#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
CPTP	80772	broad.mit.edu	37	1	1263084	1263084	+	Missense_Mutation	SNP	C	C	A	rs145750452		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:1263084C>A	ENST00000343938.4	+	3	997	c.586C>A	c.(586-588)Cgt>Agt	p.R196S	GLTPD1_ENST00000464957.1_3'UTR	NM_001029885.1	NP_001025056.1	Q5TA50	CPTP_HUMAN		196					ceramide 1-phosphate transport (GO:1902389)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ceramide 1-phosphate binding (GO:1902387)|ceramide 1-phosphate transporter activity (GO:1902388)|glycolipid binding (GO:0051861)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)			lung(1)	1	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;4.95e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		CTTCATCCAGCGTGTCTACAA	0.672																																						uc001aeo.2		NA																	0					0						c.(586-588)CGT>AGT		glycolipid transfer protein domain containing 1							54.0	63.0	60.0					1																	1263084		2198	4290	6488	SO:0001583	missense	80772					cytoplasm	glycolipid binding|glycolipid transporter activity	g.chr1:1263084C>A																												ENST00000343938.4:c.586C>A	1.37:g.1263084C>A	ENSP00000343890:p.Arg196Ser		Somatic					p.R196S	NM_001029885	NP_001025056	WXS	Illumina HiSeq	Unspecified	Q5TA50	GLTD1_HUMAN		Epithelial(90;4.95e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)	3	1001	+	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)	196					Q4G0E6|Q7L5A4	Missense_Mutation	SNP	ENST00000343938.4	37	c.586C>A	CCDS30555.1	.	.	.	.	.	.	.	.	.	.	C	2.982	-0.210119	0.06140	.	.	ENSG00000224051	ENST00000343938	.	.	.	4.85	4.85	0.62838	Glycolipid transfer protein domain (2);	0.953087	0.08689	U	0.908262	T	0.34919	0.0914	L	0.54323	1.7	0.09310	N	1	B	0.28350	0.208	B	0.20577	0.03	T	0.28808	-1.0032	9	0.13108	T	0.6	-0.0761	8.1185	0.30957	0.265:0.5162:0.2188:0.0	.	196	Q5TA50	GLTD1_HUMAN	S	196	.	ENSP00000343890:R196S	R	+	1	0	GLTPD1	1252947	0.000000	0.05858	0.010000	0.14722	0.163000	0.22366	0.682000	0.25335	2.252000	0.74401	0.555000	0.69702	CGT		0.672	GLTPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008742.1			21	64	1	0	1.64e-05	1.95e-05	21	64				
SPSB1	80176	broad.mit.edu	37	1	9416393	9416393	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:9416393G>T	ENST00000328089.6	+	2	784	c.443G>T	c.(442-444)cGg>cTg	p.R148L	SPSB1_ENST00000377399.2_Missense_Mutation_p.R148L|SPSB1_ENST00000357898.3_Missense_Mutation_p.R148L	NM_025106.3	NP_079382.2	Q96BD6	SPSB1_HUMAN	splA/ryanodine receptor domain and SOCS box containing 1	148	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				breast(1)|endometrium(3)|kidney(2)|lung(5)|prostate(2)	13	all_lung(157;0.194)	all_epithelial(116;4.38e-15)|all_lung(118;0.000156)|Lung NSC(185;0.000446)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.72e-07)|COAD - Colon adenocarcinoma(227;9.12e-05)|Kidney(185;0.000296)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00193)|BRCA - Breast invasive adenocarcinoma(304;0.00202)|READ - Rectum adenocarcinoma(331;0.0419)		GGGCGCAACCGGCTCTACCAC	0.602																																						uc010oae.1		NA																	0					0						c.(442-444)CGG>CTG		splA/ryanodine receptor domain and SOCS box							77.0	65.0	69.0					1																	9416393		2203	4300	6503	SO:0001583	missense	80176				intracellular signal transduction	cytoplasm		g.chr1:9416393G>T		CCDS102.1	1p36.22	2008-02-05			ENSG00000171621	ENSG00000171621			30628	protein-coding gene	gene with protein product		611657				15713673, 12076535	Standard	NM_025106		Approved	SSB-1	uc010oae.2	Q96BD6	OTTHUMG00000001279	ENST00000328089.6:c.443G>T	1.37:g.9416393G>T	ENSP00000330221:p.Arg148Leu		Somatic				SPSB1_uc001apv.2_Missense_Mutation_p.R148L	p.R148L	NM_025106	NP_079382	WXS	Illumina HiSeq	Unspecified	Q96BD6	SPSB1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.72e-07)|COAD - Colon adenocarcinoma(227;9.12e-05)|Kidney(185;0.000296)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00193)|BRCA - Breast invasive adenocarcinoma(304;0.00202)|READ - Rectum adenocarcinoma(331;0.0419)	2	782	+	all_lung(157;0.194)	all_epithelial(116;4.38e-15)|all_lung(118;0.000156)|Lung NSC(185;0.000446)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)	148			B30.2/SPRY.		A2A275|Q59FA1|Q5TIH9|Q9BRY9|Q9H6C5	Missense_Mutation	SNP	ENST00000328089.6	37	c.443G>T	CCDS102.1	.	.	.	.	.	.	.	.	.	.	G	14.40	2.525107	0.44969	.	.	ENSG00000171621	ENST00000328089;ENST00000450402;ENST00000357898;ENST00000377399	T;T;T;T	0.68903	-0.36;-0.36;-0.36;-0.36	5.06	5.06	0.68205	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.055133	0.64402	D	0.000001	T	0.50582	0.1624	L	0.33189	0.99	0.50467	D	0.999879	B	0.12630	0.006	B	0.14578	0.011	T	0.42766	-0.9432	10	0.08599	T	0.76	-19.0179	10.9679	0.47422	0.0856:0.0:0.9144:0.0	.	148	Q96BD6	SPSB1_HUMAN	L	148	ENSP00000330221:R148L;ENSP00000409235:R148L;ENSP00000350573:R148L;ENSP00000366616:R148L	ENSP00000330221:R148L	R	+	2	0	SPSB1	9338980	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.415000	0.80131	2.345000	0.79718	0.655000	0.94253	CGG		0.602	SPSB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003727.2	NM_025106		25	47	1	0	1.85e-09	2.46e-09	25	47				
NPPB	4879	broad.mit.edu	37	1	11918861	11918861	+	Silent	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:11918861C>A	ENST00000376468.3	-	1	127	c.30G>T	c.(28-30)gcG>gcT	p.A10A		NM_002521.2	NP_002512.1	P16860	ANFB_HUMAN	natriuretic peptide B	10					body fluid secretion (GO:0007589)|cell surface receptor signaling pathway (GO:0007166)|cGMP biosynthetic process (GO:0006182)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|regulation of vascular permeability (GO:0043114)|regulation of vasodilation (GO:0042312)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|protein complex (GO:0043234)	diuretic hormone activity (GO:0008613)|hormone activity (GO:0005179)|receptor binding (GO:0005102)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	11	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	Carvedilol(DB01136)	GGAGCAGGAGCGCCCGGGAAG	0.652																																						uc001atj.2		NA																	0				ovary(2)	2						c.(28-30)GCG>GCT		natriuretic peptide precursor B preproprotein	Carvedilol(DB01136)|Nesiritide(DB04899)|Testosterone(DB00624)						75.0	90.0	85.0					1																	11918861		2203	4300	6503	SO:0001819	synonymous_variant	4879				body fluid secretion|cGMP biosynthetic process|negative regulation of angiogenesis|negative regulation of cell growth|positive regulation of renal sodium excretion|positive regulation of urine volume|receptor guanylyl cyclase signaling pathway|regulation of blood pressure|regulation of blood vessel size|regulation of vascular permeability|regulation of vasodilation	extracellular space	diuretic hormone activity	g.chr1:11918861C>A	BC025785	CCDS140.1	1p36.2	2014-01-30	2010-11-09		ENSG00000120937	ENSG00000120937		"""Endogenous ligands"""	7940	protein-coding gene	gene with protein product		600295	"""natriuretic peptide precursor B"""			2597152	Standard	NM_002521		Approved		uc001atj.3	P16860	OTTHUMG00000002389	ENST00000376468.3:c.30G>T	1.37:g.11918861C>A			Somatic					p.A10A	NM_002521	NP_002512	WXS	Illumina HiSeq	Unspecified	P16860	ANFB_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	1	132	-	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)	10					B0ZBE9|Q6FGY0|Q9P2Q7	Silent	SNP	ENST00000376468.3	37	c.30G>T	CCDS140.1																																																																																				0.652	NPPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006854.1	NM_002521		37	60	1	0	2.41e-17	3.52e-17	37	60				
PRAMEF11	440560	broad.mit.edu	37	1	12884844	12884844	+	Missense_Mutation	SNP	C	C	T	rs190003384		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:12884844C>T	ENST00000535591.1	-	4	1462	c.1267G>A	c.(1267-1269)Gac>Aac	p.D423N	RP5-845O24.8_ENST00000438401.1_lincRNA	NM_001146344.1	NP_001139816.1	O60813	PRA11_HUMAN	PRAME family member 11	423					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|lung(7)|pancreas(2)|skin(4)|urinary_tract(1)	27						AATGACCTGTCGCCATGGTCA	0.468																																						uc001auk.2		NA																	0					0						c.(1267-1269)GAC>AAC		PRAME family member 11							54.0	43.0	46.0					1																	12884844		692	1590	2282	SO:0001583	missense	440560							g.chr1:12884844C>T	AL049680	CCDS53268.1	1p36.21	2013-01-17			ENSG00000204513	ENSG00000239810		"""-"""	14086	protein-coding gene	gene with protein product							Standard	XM_006710645		Approved		uc001auk.2	O60813	OTTHUMG00000001929	ENST00000535591.1:c.1267G>A	1.37:g.12884844C>T	ENSP00000439551:p.Asp423Asn		Somatic					p.D423N	NM_001146344	NP_001139816	WXS	Illumina HiSeq	Unspecified	O60813	PRA11_HUMAN			4	1463	-			423						Missense_Mutation	SNP	ENST00000535591.1	37	c.1267G>A	CCDS53268.1	3	0.0013736263736263737	3	0.006097560975609756	0	0.0	0	0.0	0	0.0	.	0.133	-1.111398	0.01813	.	.	ENSG00000204513	ENST00000535591;ENST00000331684;ENST00000437584	T;T	0.50277	0.75;0.75	1.52	-3.04	0.05412	.	25.866400	0.00166	N	0.000001	T	0.10723	0.0262	N	0.00841	-1.15	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15549	-1.0433	10	0.07990	T	0.79	.	3.8072	0.08782	0.2051:0.4829:0.0:0.312	.	423	O60813	PRA11_HUMAN	N	423;464;423	ENSP00000439551:D423N;ENSP00000391839:D423N	ENSP00000328783:D464N	D	-	1	0	PRAMEF11	12807431	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.638000	0.00866	-1.860000	0.01154	-0.688000	0.03733	GAC		0.468	PRAMEF11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_496341		6	211	0	0	0	0	6	211				
IGSF21	84966	broad.mit.edu	37	1	18692115	18692115	+	Missense_Mutation	SNP	C	C	G	rs371464766		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:18692115C>G	ENST00000251296.1	+	6	1322	c.939C>G	c.(937-939)atC>atG	p.I313M		NM_032880.4	NP_116269.3	Q96ID5	IGS21_HUMAN	immunoglobin superfamily, member 21	313						extracellular region (GO:0005576)				endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	40		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)		ACCCACAGATCGACAACGAGG	0.642																																						uc001bau.1		NA																	0				ovary(2)|large_intestine(1)|skin(1)	4						c.(937-939)ATC>ATG		immunoglobin superfamily, member 21 precursor		C	MET/ILE	1,4405	2.1+/-5.4	0,1,2202	109.0	88.0	95.0		939	0.9	1.0	1		95	0,8600		0,0,4300	no	missense	IGSF21	NM_032880.4	10	0,1,6502	GG,GC,CC		0.0,0.0227,0.0077	benign	313/468	18692115	1,13005	2203	4300	6503	SO:0001583	missense	84966					extracellular region		g.chr1:18692115C>G	AK075316	CCDS184.1	1p36.13	2013-01-29			ENSG00000117154	ENSG00000117154		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28246	protein-coding gene	gene with protein product						12477932	Standard	NM_032880		Approved	MGC15730, RP11-121A23.1	uc001bau.2	Q96ID5	OTTHUMG00000002432	ENST00000251296.1:c.939C>G	1.37:g.18692115C>G	ENSP00000251296:p.Ile313Met		Somatic				IGSF21_uc001bav.1_Missense_Mutation_p.I134M	p.I313M	NM_032880	NP_116269	WXS	Illumina HiSeq	Unspecified	Q96ID5	IGS21_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)	6	1322	+		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)	313					Q8NBR8	Missense_Mutation	SNP	ENST00000251296.1	37	c.939C>G	CCDS184.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.55|10.55	1.381059|1.381059	0.24944|0.24944	2.27E-4|2.27E-4	0.0|0.0	ENSG00000117154|ENSG00000117154	ENST00000251296|ENST00000412684	T|.	0.29655|.	1.56|.	4.1|4.1	0.858|0.858	0.19030|0.19030	Immunoglobulin-like fold (1);|.	0.436137|.	0.25830|.	N|.	0.028031|.	T|T	0.37461|0.37461	0.1004|0.1004	N|N	0.19112|0.19112	0.55|0.55	0.39736|0.39736	D|D	0.971678|0.971678	P|.	0.34724|.	0.465|.	B|.	0.34652|.	0.187|.	T|T	0.09509|0.09509	-1.0671|-1.0671	10|5	0.38643|.	T|.	0.18|.	-16.2319|-16.2319	8.1307|8.1307	0.31024|0.31024	0.0:0.6245:0.2022:0.1733|0.0:0.6245:0.2022:0.1733	.|.	313|.	Q96ID5|.	IGS21_HUMAN|.	M|G	313|266	ENSP00000251296:I313M|.	ENSP00000251296:I313M|.	I|R	+|+	3|1	3|2	IGSF21|IGSF21	18564702|18564702	0.826000|0.826000	0.29277|0.29277	1.000000|1.000000	0.80357|0.80357	0.967000|0.967000	0.64934|0.64934	-0.148000|-0.148000	0.10219|0.10219	0.141000|0.141000	0.18875|0.18875	-1.134000|-1.134000	0.01955|0.01955	ATC|CGA		0.642	IGSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006924.1	NM_032880		23	57	0	0	0	0	23	57				
SMPDL3B	27293	broad.mit.edu	37	1	28285042	28285042	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:28285042G>T	ENST00000373894.3	+	8	1252	c.1061G>T	c.(1060-1062)cGc>cTc	p.R354L	XKR8_ENST00000373884.5_5'Flank|RP11-460I13.2_ENST00000448015.1_RNA|SMPDL3B_ENST00000549094.1_Missense_Mutation_p.R306L	NM_014474.2	NP_055289.2	Q92485	ASM3B_HUMAN	sphingomyelin phosphodiesterase, acid-like 3B	354					sphingomyelin catabolic process (GO:0006685)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	16		Colorectal(325;3.46e-05)|all_lung(284;0.000414)|Lung NSC(340;0.000431)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;5.68e-24)|Colorectal(126;1.65e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00303)|BRCA - Breast invasive adenocarcinoma(304;0.00587)|READ - Rectum adenocarcinoma(331;0.055)		GGGACGCCGCGCTGGGAGCTC	0.632																																						uc001bpg.2		NA																	0				ovary(3)	3						c.(1060-1062)CGC>CTC		acid sphingomyelinase-like phosphodiesterase 3B							50.0	53.0	52.0					1																	28285042		2203	4300	6503	SO:0001583	missense	27293				sphingomyelin catabolic process	extracellular space	hydrolase activity, acting on glycosyl bonds|sphingomyelin phosphodiesterase activity	g.chr1:28285042G>T	Y08134	CCDS30655.1, CCDS30656.1	1p35.3	2008-02-05			ENSG00000130768	ENSG00000130768			21416	protein-coding gene	gene with protein product							Standard	NM_014474		Approved	ASML3B	uc001bpg.3	Q92485	OTTHUMG00000003910	ENST00000373894.3:c.1061G>T	1.37:g.28285042G>T	ENSP00000363001:p.Arg354Leu		Somatic				SMPDL3B_uc010ofq.1_Missense_Mutation_p.R148L|SMPDL3B_uc010ofr.1_Missense_Mutation_p.R306L|XKR8_uc001bph.1_5'Flank	p.R354L	NM_014474	NP_055289	WXS	Illumina HiSeq	Unspecified	Q92485	ASM3B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;5.68e-24)|Colorectal(126;1.65e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00303)|BRCA - Breast invasive adenocarcinoma(304;0.00587)|READ - Rectum adenocarcinoma(331;0.055)	8	1252	+		Colorectal(325;3.46e-05)|all_lung(284;0.000414)|Lung NSC(340;0.000431)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)	354					B7ZB35|Q5T0Z0|Q96CB7	Missense_Mutation	SNP	ENST00000373894.3	37	c.1061G>T	CCDS30655.1	.	.	.	.	.	.	.	.	.	.	G	10.77	1.444416	0.25987	.	.	ENSG00000130768	ENST00000373894;ENST00000549094;ENST00000412515	D;D	0.89617	-2.54;-2.54	5.09	-3.88	0.04205	.	0.885835	0.09827	N	0.750775	T	0.78104	0.4231	L	0.32530	0.975	0.09310	N	1	B;B	0.18863	0.031;0.018	B;B	0.16722	0.016;0.005	T	0.61123	-0.7126	10	0.28530	T	0.3	-0.411	4.3925	0.11348	0.4915:0.0953:0.3166:0.0965	.	306;354	F8VWW8;Q92485	.;ASM3B_HUMAN	L	354;306;306	ENSP00000363001:R354L;ENSP00000449450:R306L	ENSP00000363001:R354L	R	+	2	0	SMPDL3B	28157629	0.000000	0.05858	0.005000	0.12908	0.009000	0.06853	-0.079000	0.11357	-0.708000	0.05015	-0.258000	0.10820	CGC		0.632	SMPDL3B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011170.1	NM_014474		27	43	1	0	2.09e-25	3.21e-25	27	43				
CD53	963	broad.mit.edu	37	1	111435056	111435056	+	Silent	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:111435056G>T	ENST00000271324.5	+	3	265	c.153G>T	c.(151-153)acG>acT	p.T51T	CD53_ENST00000429072.2_Silent_p.T51T	NM_000560.3|NM_001040033.1	NP_000551.1|NP_001035122.1	P19397	CD53_HUMAN	CD53 molecule	51					positive regulation of myoblast fusion (GO:1901741)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)	17		all_cancers(81;1.06e-05)|all_epithelial(167;1.95e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0264)|Colorectal(144;0.0375)|all cancers(265;0.11)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.141)|LUSC - Lung squamous cell carcinoma(189;0.144)		CCTCCCTCACGCTGGGCAATG	0.507																																						uc001dzw.2		NA																	0					0						c.(151-153)ACG>ACT		CD53 antigen							207.0	183.0	191.0					1																	111435056		2203	4300	6503	SO:0001819	synonymous_variant	963				signal transduction	integral to membrane|plasma membrane		g.chr1:111435056G>T	BC040693	CCDS829.1	1p13	2013-02-14	2006-03-28		ENSG00000143119	ENSG00000143119		"""CD molecules"", ""Tetraspanins"""	1686	protein-coding gene	gene with protein product		151525	"""CD53 antigen"""	MOX44		8319976	Standard	XM_006711053		Approved	TSPAN25	uc001dzw.3	P19397	OTTHUMG00000048020	ENST00000271324.5:c.153G>T	1.37:g.111435056G>T			Somatic				CD53_uc001dzx.2_Silent_p.T51T|CD53_uc010owa.1_Silent_p.T51T|CD53_uc001dzy.2_Silent_p.T51T	p.T51T	NM_001040033	NP_001035122	WXS	Illumina HiSeq	Unspecified	P19397	CD53_HUMAN		Lung(183;0.0264)|Colorectal(144;0.0375)|all cancers(265;0.11)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.141)|LUSC - Lung squamous cell carcinoma(189;0.144)	4	324	+		all_cancers(81;1.06e-05)|all_epithelial(167;1.95e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)	51			Extracellular (Potential).		B2R905|Q5U0D6	Silent	SNP	ENST00000271324.5	37	c.153G>T	CCDS829.1																																																																																				0.507	CD53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032931.1	NM_000560		39	105	1	0	2.76e-19	4.09e-19	39	105				
NBPF10	100132406	broad.mit.edu	37	1	145296541	145296541	+	Missense_Mutation	SNP	G	G	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:145296541G>C	ENST00000342960.5	+	3	498	c.463G>C	c.(463-465)Gca>Cca	p.A155P	RP11-458D21.5_ENST00000468030.1_3'UTR|NBPF10_ENST00000369339.3_Intron|NBPF10_ENST00000369338.1_Intron	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	155						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GTGTAGACTGGCACAGCACCT	0.577																																						uc001end.3		NA																	0					0						c.(463-465)GCA>CCA		hypothetical protein LOC100132406																																				SO:0001583	missense	100132406							g.chr1:145296541G>C	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.463G>C	1.37:g.145296541G>C	ENSP00000345684:p.Ala155Pro		Somatic				NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_Missense_Mutation_p.A155P|NBPF10_uc001emq.1_Intron	p.A155P	NM_001039703	NP_001034792	WXS	Illumina HiSeq	Unspecified	A6NDV3	A6NDV3_HUMAN		Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)	3	498	+	all_hematologic(923;0.032)		155					Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000342960.5	37	c.463G>C	CCDS53355.1	.	.	.	.	.	.	.	.	.	.	.	11.83	1.755637	0.31046	.	.	ENSG00000163386	ENST00000369339;ENST00000448873;ENST00000342960	T	0.04049	3.72	1.15	0.165	0.14995	.	.	.	.	.	T	0.03827	0.0108	M	0.77820	2.39	0.09310	N	1	.	.	.	.	.	.	T	0.35276	-0.9795	7	0.66056	D	0.02	.	3.302	0.06987	0.2986:0.0:0.7014:0.0	.	.	.	.	P	155;80;155	ENSP00000345684:A155P	ENSP00000345684:A155P	A	+	1	0	NBPF10	144007898	0.019000	0.18553	0.006000	0.13384	0.010000	0.07245	0.047000	0.14056	0.071000	0.16664	0.121000	0.15741	GCA		0.577	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001039703		44	331	0	0	0	0	44	331				
NBPF10	100132406	broad.mit.edu	37	1	145368536	145368536	+	Missense_Mutation	SNP	C	C	G	rs587714222		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:145368536C>G	ENST00000369339.3	+	17	2121	c.1868C>G	c.(1867-1869)cCt>cGt	p.P623R	NBPF10_ENST00000369338.1_Missense_Mutation_p.P621R|NBPF10_ENST00000342960.5_Missense_Mutation_p.P3505R			Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	800	NBPF 4. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		TTTGAACTACCTGACTCATTC	0.458													.|||	1	0.000199681	0.0	0.0	5008	,	,		51751	0.0		0.0	False		,,,				2504	0.001					uc001end.3		NA																	0					0						c.(10738-10740)CCT>CGT		hypothetical protein LOC100132406																																				SO:0001583	missense	100132406							g.chr1:145368536C>G	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000369339.3:c.1868C>G	1.37:g.145368536C>G	ENSP00000358345:p.Pro623Arg		Somatic				NBPF9_uc010oye.1_Missense_Mutation_p.P864R|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Missense_Mutation_p.P433R|NBPF10_uc010oyk.1_Missense_Mutation_p.P221R|NBPF10_uc010oyl.1_Missense_Mutation_p.P221R	p.P3580R	NM_001039703	NP_001034792	WXS	Illumina HiSeq	Unspecified	A6NDV3	A6NDV3_HUMAN		Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)	86	10774	+	all_hematologic(923;0.032)		3505					Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000369339.3	37	c.10739C>G		.	.	.	.	.	.	.	.	.	.	.	3.392	-0.124065	0.06795	.	.	ENSG00000163386	ENST00000369339;ENST00000369338;ENST00000342960	T;T	0.07114	3.22;3.22	0.732	0.732	0.18283	.	.	.	.	.	T	0.03434	0.0099	L	0.43152	1.355	0.09310	N	1	.	.	.	.	.	.	T	0.42531	-0.9446	7	0.54805	T	0.06	.	4.8119	0.13347	0.0:1.0:0.0:0.0	.	.	.	.	R	625;621;3505	ENSP00000358344:P621R;ENSP00000345684:P3505R	ENSP00000345684:P3505R	P	+	2	0	NBPF10	144079893	0.010000	0.17322	0.004000	0.12327	0.007000	0.05969	0.106000	0.15354	0.689000	0.31550	0.384000	0.25694	CCT		0.458	NBPF10-001	KNOWN	not_best_in_genome_evidence|basic	protein_coding	protein_coding	OTTHUMT00000038550.3	NM_001039703		9	486	0	0	0	0	9	486				
HIST2H2BF	440689	broad.mit.edu	37	1	149783631	149783631	+	Missense_Mutation	SNP	T	T	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:149783631T>A	ENST00000369167.1	-	1	283	c.248A>T	c.(247-249)cAc>cTc	p.H83L	HIST2H2BF_ENST00000469483.1_5'UTR|RP11-196G18.21_ENST00000420462.1_RNA|HIST2H2BF_ENST00000427880.2_Missense_Mutation_p.H83L|HIST2H2BF_ENST00000545683.1_Missense_Mutation_p.H83L	NM_001024599.4	NP_001019770.1	Q5QNW6	H2B2F_HUMAN	histone cluster 2, H2bf	83					chromatin organization (GO:0006325)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Breast(34;0.0124)|all_hematologic(923;0.127)					CTTGTTGTAGTGCGCCAGGCG	0.667																																						uc001esr.2		NA																	0					0						c.(247-249)CAC>CTC		histone cluster 2, H2bf isoform a							41.0	38.0	39.0					1																	149783631		2203	4277	6480	SO:0001583	missense	440689				nucleosome assembly	nucleosome|nucleus	DNA binding	g.chr1:149783631T>A	BC110793	CCDS30846.1, CCDS53359.1	1q21.2	2013-06-03	2006-10-11		ENSG00000203814	ENSG00000203814		"""Histones / Replication-dependent"""	24700	protein-coding gene	gene with protein product			"""histone 2, H2bf"""				Standard	NM_001161334		Approved		uc010pbj.2	Q5QNW6	OTTHUMG00000183159	ENST00000369167.1:c.248A>T	1.37:g.149783631T>A	ENSP00000358164:p.His83Leu		Somatic				HIST2H2BF_uc010pbj.1_Missense_Mutation_p.H83L|HIST2H2BF_uc010pbk.1_Missense_Mutation_p.H83L	p.H83L	NM_001024599	NP_001019770	WXS	Illumina HiSeq	Unspecified	Q5QNW6	H2B2F_HUMAN			1	298	-	Breast(34;0.0124)|all_hematologic(923;0.127)		83					A8K0U9|B4DLA9	Missense_Mutation	SNP	ENST00000369167.1	37	c.248A>T	CCDS30846.1	.	.	.	.	.	.	.	.	.	.	T	14.86	2.662001	0.47572	.	.	ENSG00000203814	ENST00000545683;ENST00000427880;ENST00000369167	T;T;T	0.18810	2.19;2.19;2.19	3.56	3.56	0.40772	Histone-fold (2);Histone core (1);	0.000000	0.64402	D	0.000007	T	0.29652	0.0740	L	0.61218	1.895	0.48830	D	0.999714	D;D;D	0.76494	0.999;0.998;0.978	D;D;P	0.66351	0.943;0.943;0.864	T	0.07177	-1.0786	10	0.87932	D	0	.	11.9288	0.52835	0.0:0.0:0.0:1.0	.	83;83;83	B4DR52;B4DLA9;Q5QNW6	.;.;H2B2F_HUMAN	L	83	ENSP00000445831:H83L;ENSP00000407461:H83L;ENSP00000358164:H83L	ENSP00000358164:H83L	H	-	2	0	HIST2H2BF	148050255	1.000000	0.71417	0.998000	0.56505	0.222000	0.24845	7.173000	0.77612	1.855000	0.53841	0.164000	0.16699	CAC		0.667	HIST2H2BF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033453.2	NM_001024599		37	89	0	0	0	0	37	89				
PLEKHO1	51177	broad.mit.edu	37	1	150131289	150131289	+	Silent	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:150131289C>A	ENST00000369124.4	+	6	1079	c.801C>A	c.(799-801)ggC>ggA	p.G267G	PLEKHO1_ENST00000025469.6_Silent_p.G233G|PLEKHO1_ENST00000369126.1_Silent_p.G84G	NM_016274.4	NP_057358.2	Q53GL0	PKHO1_HUMAN	pleckstrin homology domain containing, family O member 1	267	Interaction with ATM, CKIP, IFP35 and NMI.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|skin(2)	22	Lung NSC(24;7.78e-28)|Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			CAGAGAAAGGCCGCTGCGCCT	0.647																																						uc001ett.2		NA																	0				lung(1)	1						c.(799-801)GGC>GGA		pleckstrin homology domain containing, family O							30.0	36.0	34.0					1																	150131289		2203	4300	6503	SO:0001819	synonymous_variant	51177					cytoplasm|nucleus|plasma membrane		g.chr1:150131289C>A	AF073836	CCDS945.1	1q21.2	2013-01-10			ENSG00000023902	ENSG00000023902		"""Pleckstrin homology (PH) domain containing"""	24310	protein-coding gene	gene with protein product		608335				10799509	Standard	NM_016274		Approved	CKIP-1, OC120	uc001ett.3	Q53GL0	OTTHUMG00000012510	ENST00000369124.4:c.801C>A	1.37:g.150131289C>A			Somatic				PLEKHO1_uc001etr.2_Silent_p.G95G|PLEKHO1_uc001ets.2_Silent_p.G84G|PLEKHO1_uc001etu.2_Silent_p.G95G	p.G267G	NM_016274	NP_057358	WXS	Illumina HiSeq	Unspecified	Q53GL0	PKHO1_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)		6	1079	+	Lung NSC(24;7.78e-28)|Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		267			Interaction with ATM, CKIP, IFP35 and NMI.		Q336K5|Q8IZ51|Q9NRV3|Q9UL48	Silent	SNP	ENST00000369124.4	37	c.801C>A	CCDS945.1																																																																																				0.647	PLEKHO1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034962.1	NM_016274		20	46	1	0	1.64e-05	1.95e-05	20	46				
HORMAD1	84072	broad.mit.edu	37	1	150689696	150689696	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:150689696C>A	ENST00000361824.2	-	3	201	c.96G>T	c.(94-96)agG>agT	p.R32S	HORMAD1_ENST00000476530.1_5'UTR|HORMAD1_ENST00000368995.4_5'UTR|HORMAD1_ENST00000322343.7_Missense_Mutation_p.R32S|HORMAD1_ENST00000368993.2_Missense_Mutation_p.R32S	NM_032132.4	NP_115508.2	Q86X24	HORM1_HUMAN	HORMA domain containing 1	32	HORMA. {ECO:0000255|PROSITE- ProRule:PRU00109}.				blastocyst development (GO:0001824)|meiotic DNA double-strand break formation (GO:0042138)|meiotic nuclear division (GO:0007126)|meiotic recombination checkpoint (GO:0051598)|meiotic sister chromatid cohesion (GO:0051177)|oogenesis (GO:0048477)|regulation of homologous chromosome segregation (GO:0060629)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(3)	16	all_cancers(9;3.23e-52)|all_epithelial(9;4.68e-43)|all_lung(15;5.74e-35)|Lung NSC(24;2.09e-31)|Breast(34;0.0009)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;2.32e-23)|all cancers(9;5.21e-23)|OV - Ovarian serous cystadenocarcinoma(6;6.72e-15)|BRCA - Breast invasive adenocarcinoma(12;0.000479)|LUSC - Lung squamous cell carcinoma(543;0.171)			CTGCTAGAAGCCTCTTCACTA	0.348																																						uc001evk.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(94-96)AGG>AGT		HORMA domain containing 1							98.0	98.0	98.0					1																	150689696		2203	4300	6503	SO:0001583	missense	84072				blastocyst development|cell differentiation|meiotic DNA double-strand break formation|meiotic recombination checkpoint|meiotic sister chromatid cohesion|mitosis|oogenesis|regulation of homologous chromosome segregation|spermatogenesis|synaptonemal complex assembly	chromosome|nucleus		g.chr1:150689696C>A	AL136755	CCDS967.1, CCDS55633.1	1q21.2	2009-03-09			ENSG00000143452	ENSG00000143452			25245	protein-coding gene	gene with protein product	"""cancer/testis antigen 46"""	609824				11230166, 15999985	Standard	NM_032132		Approved	DKFZP434A1315, CT46	uc001evk.2	Q86X24	OTTHUMG00000035005	ENST00000361824.2:c.96G>T	1.37:g.150689696C>A	ENSP00000355167:p.Arg32Ser		Somatic				HORMAD1_uc001evl.1_Missense_Mutation_p.R32S|HORMAD1_uc001evm.1_5'UTR	p.R32S	NM_032132	NP_115508	WXS	Illumina HiSeq	Unspecified	Q86X24	HORM1_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;2.32e-23)|all cancers(9;5.21e-23)|OV - Ovarian serous cystadenocarcinoma(6;6.72e-15)|BRCA - Breast invasive adenocarcinoma(12;0.000479)|LUSC - Lung squamous cell carcinoma(543;0.171)		3	202	-	all_cancers(9;3.23e-52)|all_epithelial(9;4.68e-43)|all_lung(15;5.74e-35)|Lung NSC(24;2.09e-31)|Breast(34;0.0009)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		32			HORMA.		A6NMK2|B3KUK1|Q4G114|Q5T5I3|Q5T5I4|Q5T5I5|Q6FIC1|Q9H0K8	Missense_Mutation	SNP	ENST00000361824.2	37	c.96G>T	CCDS967.1	.	.	.	.	.	.	.	.	.	.	C	19.80	3.895507	0.72639	.	.	ENSG00000143452	ENST00000368993;ENST00000322343;ENST00000361824	T;T;T	0.32753	1.44;1.46;1.44	5.46	2.13	0.27403	DNA-binding HORMA (4);	0.084170	0.85682	D	0.000000	T	0.33323	0.0859	M	0.68317	2.08	0.43588	D	0.995936	D;D	0.76494	0.999;0.997	D;D	0.71656	0.974;0.971	T	0.12811	-1.0533	10	0.20046	T	0.44	-15.1191	10.8243	0.46622	0.0:0.7498:0.0:0.2502	.	32;32	Q86X24-2;Q86X24	.;HORM1_HUMAN	S	32	ENSP00000357989:R32S;ENSP00000326489:R32S;ENSP00000355167:R32S	ENSP00000326489:R32S	R	-	3	2	HORMAD1	148956320	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	0.762000	0.26503	0.683000	0.31428	0.460000	0.39030	AGG		0.348	HORMAD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084722.1	NM_032132		43	146	1	0	7.71e-36	1.21e-35	43	146				
CTSS	1520	broad.mit.edu	37	1	150724474	150724474	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:150724474C>A	ENST00000368985.3	-	5	670	c.410G>T	c.(409-411)gGt>gTt	p.G137V	CTSS_ENST00000448301.2_Missense_Mutation_p.G87V|CTSS_ENST00000480760.1_5'UTR	NM_001199739.1|NM_004079.4	NP_001186668.1|NP_004070.3	P25774	CATS_HUMAN	cathepsin S	137					adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|basement membrane disassembly (GO:0034769)|cellular response to thyroid hormone stimulus (GO:0097067)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of inflammatory response (GO:0050729)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|membrane (GO:0016020)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|skin(1)|stomach(1)|urinary_tract(1)	15	all_cancers(9;6.17e-52)|all_epithelial(9;9.7e-43)|all_lung(15;5.74e-35)|Lung NSC(24;2.09e-31)|Breast(34;0.00146)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0485)|Epithelial(6;5.02e-21)|all cancers(9;1.28e-20)|OV - Ovarian serous cystadenocarcinoma(6;1.09e-14)|BRCA - Breast invasive adenocarcinoma(12;0.00501)|LUSC - Lung squamous cell carcinoma(543;0.171)			CCAGCAAGCACCACAAGAACC	0.498																																						uc001evn.2		NA																	0					0						c.(409-411)GGT>GTT		cathepsin S preproprotein							63.0	62.0	62.0					1																	150724474		2203	4300	6503	SO:0001583	missense	1520				immune response|proteolysis	extracellular region|lysosome	cysteine-type endopeptidase activity	g.chr1:150724474C>A	M90696	CCDS968.1, CCDS55634.1	1q21	2008-02-05			ENSG00000163131	ENSG00000163131	3.4.22.27	"""Cathepsins"""	2545	protein-coding gene	gene with protein product		116845				1373132	Standard	NM_001199739		Approved		uc001evn.3	P25774	OTTHUMG00000035010	ENST00000368985.3:c.410G>T	1.37:g.150724474C>A	ENSP00000357981:p.Gly137Val		Somatic				CTSS_uc010pcj.1_Missense_Mutation_p.G87V|CTSS_uc001evo.1_Missense_Mutation_p.G137V	p.G137V	NM_004079	NP_004070	WXS	Illumina HiSeq	Unspecified	P25774	CATS_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.0485)|Epithelial(6;5.02e-21)|all cancers(9;1.28e-20)|OV - Ovarian serous cystadenocarcinoma(6;1.09e-14)|BRCA - Breast invasive adenocarcinoma(12;0.00501)|LUSC - Lung squamous cell carcinoma(543;0.171)		5	543	-	all_cancers(9;6.17e-52)|all_epithelial(9;9.7e-43)|all_lung(15;5.74e-35)|Lung NSC(24;2.09e-31)|Breast(34;0.00146)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		137					B4DWC9|D3DV05|Q5T5I0|Q6FHS5|Q9BUG3	Missense_Mutation	SNP	ENST00000368985.3	37	c.410G>T	CCDS968.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.656803	0.88154	.	.	ENSG00000163131	ENST00000448301;ENST00000368985	D;D	0.99089	-5.41;-3.24	4.91	4.91	0.64330	Peptidase C1A, papain C-terminal (3);	0.152514	0.64402	D	0.000014	D	0.99739	0.9897	H	0.99794	4.785	0.80722	D	1	D;D	0.89917	1.0;0.996	D;D	0.83275	0.996;0.961	D	0.96802	0.9590	10	0.87932	D	0	.	17.1057	0.86662	0.0:1.0:0.0:0.0	.	87;137	B4DWC9;P25774	.;CATS_HUMAN	V	87;137	ENSP00000408414:G87V;ENSP00000357981:G137V	ENSP00000357981:G137V	G	-	2	0	CTSS	148991098	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	7.776000	0.85560	2.442000	0.82660	0.650000	0.86243	GGT		0.498	CTSS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084737.1	NM_004079		21	66	1	0	3.62e-10	4.88e-10	21	66				
FCRL4	83417	broad.mit.edu	37	1	157557067	157557067	+	Splice_Site	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:157557067C>A	ENST00000271532.1	-	5	981	c.846G>T	c.(844-846)caG>caT	p.Q282H	FCRL4_ENST00000448509.2_5'UTR	NM_031282.2	NP_112572.1	Q96PJ5	FCRL4_HUMAN	Fc receptor-like 4	282	Ig-like C2-type 4.				immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(20)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	40	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)				AACACTCACGCTGCACATGGA	0.532																																						uc001fqw.2		NA																	0				ovary(2)|kidney(1)|skin(1)	4						c.(844-846)CAG>CAT		Fc receptor-like 4 precursor							163.0	159.0	161.0					1																	157557067		2203	4300	6503	SO:0001630	splice_region_variant	83417					integral to membrane|plasma membrane	receptor activity	g.chr1:157557067C>A	AF343661	CCDS1166.1	1q21	2013-01-14			ENSG00000163518	ENSG00000163518		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18507	protein-coding gene	gene with protein product		605876				11290337, 11493702	Standard	NM_031282		Approved	FCRH4, IRTA1, IGFP2, CD307d	uc001fqw.3	Q96PJ5	OTTHUMG00000035488	ENST00000271532.1:c.847+1G>T	1.37:g.157557067C>A			Somatic				FCRL4_uc010phy.1_RNA	p.Q282H	NM_031282	NP_112572	WXS	Illumina HiSeq	Unspecified	Q96PJ5	FCRL4_HUMAN			5	982	-	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)	282			Ig-like C2-type 4.|Extracellular (Potential).		Q96PJ3|Q96RE0	Missense_Mutation	SNP	ENST00000271532.1	37	c.846G>T	CCDS1166.1	.	.	.	.	.	.	.	.	.	.	C	10.92	1.488402	0.26686	.	.	ENSG00000163518	ENST00000271532	T	0.12984	2.63	4.48	0.481	0.16809	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.384649	0.18862	N	0.129089	T	0.06325	0.0163	L	0.60067	1.865	0.23940	N	0.996405	P	0.46656	0.882	P	0.44946	0.465	T	0.18618	-1.0331	10	0.49607	T	0.09	.	6.9144	0.24352	0.0:0.6144:0.0:0.3856	.	282	Q96PJ5	FCRL4_HUMAN	H	282	ENSP00000271532:Q282H	ENSP00000271532:Q282H	Q	-	3	2	FCRL4	155823691	0.979000	0.34478	0.568000	0.28447	0.064000	0.16182	-0.144000	0.10280	-0.006000	0.14370	-0.670000	0.03821	CAG		0.532	FCRL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086180.1	NM_031282	Missense_Mutation	67	227	1	0	1.32e-23	2e-23	67	227				
FCRL2	79368	broad.mit.edu	37	1	157739772	157739772	+	Missense_Mutation	SNP	G	G	A	rs200209730	byFrequency	TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:157739772G>A	ENST00000361516.3	-	4	527	c.479C>T	c.(478-480)cCg>cTg	p.P160L	FCRL2_ENST00000469986.1_5'Flank|FCRL2_ENST00000368181.4_Intron|FCRL2_ENST00000392274.3_Missense_Mutation_p.P160L	NM_030764.3	NP_110391.2	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2	160	Ig-like C2-type 2.				cell-cell signaling (GO:0007267)|positive regulation of signal transduction (GO:0009967)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|skin(2)	51	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CTGGAGCTCCGGAGAGCTGCT	0.537													G|||	2	0.000399361	0.0	0.0	5008	,	,		16785	0.001		0.0	False		,,,				2504	0.001					uc001fre.2		NA																	0				ovary(1)|pancreas(1)	2						c.(478-480)CCG>CTG		Fc receptor-like 2 precursor							60.0	64.0	63.0					1																	157739772		2203	4300	6503	SO:0001583	missense	79368				cell-cell signaling	integral to membrane|plasma membrane|soluble fraction	receptor activity|SH3/SH2 adaptor activity	g.chr1:157739772G>A	AF319438	CCDS1168.1	1q23.1	2013-01-14	2002-01-14	2005-03-23	ENSG00000132704	ENSG00000132704		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14875	protein-coding gene	gene with protein product		606509	"""SH2 domain-containing phosphatase anchor protein 1"""	SPAP1		11162587	Standard	NM_030764		Approved	FCRH2, IRTA4, CD307b	uc001fre.2	Q96LA5	OTTHUMG00000019399	ENST00000361516.3:c.479C>T	1.37:g.157739772G>A	ENSP00000355157:p.Pro160Leu		Somatic				FCRL2_uc001frd.2_5'Flank|FCRL2_uc010phz.1_Missense_Mutation_p.P160L|FCRL2_uc009wsp.2_Intron|FCRL2_uc010pia.1_Missense_Mutation_p.P160L	p.P160L	NM_030764	NP_110391	WXS	Illumina HiSeq	Unspecified	Q96LA5	FCRL2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.24)		4	538	-	all_hematologic(112;0.0378)		160			Extracellular (Potential).|Ig-like C2-type 2.		A0N0M5|A1L307|A6NMS0|Q6NTA1|Q9BZI4|Q9BZI5|Q9BZI6	Missense_Mutation	SNP	ENST00000361516.3	37	c.479C>T	CCDS1168.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	14.51	2.556718	0.45487	.	.	ENSG00000132704	ENST00000361516;ENST00000392274	T;T	0.02974	4.09;4.09	4.25	1.02	0.19986	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.723684	0.11286	N	0.579767	T	0.02970	0.0088	M	0.86178	2.8	0.09310	N	1	P;B;D	0.56035	0.883;0.178;0.974	P;B;P	0.49451	0.611;0.148;0.577	T	0.34004	-0.9846	10	0.51188	T	0.08	.	4.4671	0.11694	0.1085:0.0:0.4961:0.3953	.	160;160;160	B4E0W2;B4DVJ9;Q96LA5	.;.;FCRL2_HUMAN	L	160	ENSP00000355157:P160L;ENSP00000376100:P160L	ENSP00000355157:P160L	P	-	2	0	FCRL2	156006396	0.001000	0.12720	0.001000	0.08648	0.007000	0.05969	0.815000	0.27253	0.505000	0.28104	-0.293000	0.09583	CCG		0.537	FCRL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051408.2	NM_030764		25	86	0	0	0	0	25	86				
FCRL1	115350	broad.mit.edu	37	1	157773822	157773822	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:157773822C>A	ENST00000368176.3	-	3	199	c.132G>T	c.(130-132)caG>caT	p.Q44H	FCRL1_ENST00000358292.3_Missense_Mutation_p.Q44H|FCRL1_ENST00000491942.1_Missense_Mutation_p.Q44H|FCRL1_ENST00000489998.1_5'UTR	NM_001159398.1|NM_052938.4	NP_001152870.1|NP_443170.1	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1	44	Ig-like C2-type 1.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(24)|ovary(4)|prostate(1)|skin(6)	42	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CATCTGAACTCTGTAGAAAGG	0.562																																					GBM(54;482 1003 11223 30131 35730)	uc001frg.2		NA																	0				skin(4)|ovary(3)	7						c.(130-132)CAG>CAT		Fc receptor-like 1 isoform 1 precursor							87.0	90.0	89.0					1																	157773822		2203	4300	6503	SO:0001583	missense	115350					integral to membrane|plasma membrane	receptor activity	g.chr1:157773822C>A	BC033690	CCDS1170.1, CCDS53382.1, CCDS53383.1	1q21-q22	2013-01-14			ENSG00000163534	ENSG00000163534		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18509	protein-coding gene	gene with protein product		606508				11493702, 11929751	Standard	NM_052938		Approved	FCRH1, IRTA5, IFGP1, CD307a	uc001frg.3	Q96LA6	OTTHUMG00000019398	ENST00000368176.3:c.132G>T	1.37:g.157773822C>A	ENSP00000357158:p.Gln44His		Somatic				FCRL1_uc001frf.2_5'Flank|FCRL1_uc001frh.2_Missense_Mutation_p.Q44H|FCRL1_uc001fri.2_Missense_Mutation_p.Q44H|FCRL1_uc001frj.2_RNA	p.Q44H	NM_052938	NP_443170	WXS	Illumina HiSeq	Unspecified	Q96LA6	FCRL1_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.24)		3	245	-	all_hematologic(112;0.0378)		44			Extracellular (Potential).|Ig-like C2-type 1.		B2RE05|Q8N759|Q8NDI0|Q96PJ6	Missense_Mutation	SNP	ENST00000368176.3	37	c.132G>T	CCDS1170.1	.	.	.	.	.	.	.	.	.	.	C	11.03	1.518373	0.27211	.	.	ENSG00000163534	ENST00000358292;ENST00000368176;ENST00000491942	T;T;T	0.11604	2.76;2.76;2.76	4.41	-0.746	0.11095	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.774780	0.02865	N	0.130830	T	0.02571	0.0078	L	0.42581	1.335	0.09310	N	1	B;B;B	0.32467	0.372;0.116;0.031	B;B;B	0.30179	0.112;0.112;0.021	T	0.37957	-0.9683	10	0.32370	T	0.25	.	2.555	0.04757	0.2497:0.364:0.2904:0.096	.	44;44;44	Q96LA6-3;Q96LA6-2;Q96LA6	.;.;FCRL1_HUMAN	H	44	ENSP00000351039:Q44H;ENSP00000357158:Q44H;ENSP00000418130:Q44H	ENSP00000351039:Q44H	Q	-	3	2	FCRL1	156040446	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.470000	0.22084	-0.211000	0.10124	0.655000	0.94253	CAG		0.562	FCRL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051401.1	NM_052938		38	149	1	0	2.32e-10	3.14e-10	38	149				
SPTA1	6708	broad.mit.edu	37	1	158636152	158636152	+	Missense_Mutation	SNP	C	C	A	rs375230030		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:158636152C>A	ENST00000368147.4	-	16	2354	c.2174G>T	c.(2173-2175)cGa>cTa	p.R725L		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	725					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TTTCCTGAGTCGATTCTGTAC	0.517																																						uc001fst.1		NA																	0				ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(2173-2175)CGA>CTA		spectrin, alpha, erythrocytic 1							46.0	49.0	48.0					1																	158636152		1992	4164	6156	SO:0001583	missense	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158636152C>A	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.2174G>T	1.37:g.158636152C>A	ENSP00000357129:p.Arg725Leu		Somatic					p.R725L	NM_003126	NP_003117	WXS	Illumina HiSeq	Unspecified	P02549	SPTA1_HUMAN			16	2373	-	all_hematologic(112;0.0378)		725			Spectrin 8.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	c.2174G>T	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	C	0.536	-0.855772	0.02630	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.32753	1.44;1.44	4.55	3.46	0.39613	.	0.391081	0.15080	N	0.281729	T	0.00845	0.0028	N	0.00006	-3.2	0.29264	N	0.871166	B	0.02656	0.0	B	0.04013	0.001	T	0.42716	-0.9435	10	0.02654	T	1	.	10.0225	0.42053	0.8007:0.1993:0.0:0.0	.	725	P02549	SPTA1_HUMAN	L	725	ENSP00000357130:R725L;ENSP00000357129:R725L	ENSP00000357129:R725L	R	-	2	0	SPTA1	156902776	1.000000	0.71417	0.368000	0.25939	0.246000	0.25737	6.069000	0.71209	0.829000	0.34733	0.650000	0.86243	CGA		0.517	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		10	41	1	0	2.27e-07	2.87e-07	10	41				
MNDA	4332	broad.mit.edu	37	1	158815619	158815619	+	Nonsense_Mutation	SNP	C	C	A	rs199696767		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:158815619C>A	ENST00000368141.4	+	5	1074	c.813C>A	c.(811-813)taC>taA	p.Y271*		NM_002432.1	NP_002423.1	P41218	MNDA_HUMAN	myeloid cell nuclear differentiation antigen	271	HIN-200. {ECO:0000255|PROSITE- ProRule:PRU00106}.				B cell receptor signaling pathway (GO:0050853)|cellular defense response (GO:0006968)|cellular response to DNA damage stimulus (GO:0006974)|negative regulation of B cell proliferation (GO:0030889)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(2)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(1)|lung(26)|ovary(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	all_hematologic(112;0.0378)					TATCTGATTACTCTGAATGTA	0.343																																						uc001fsz.1		NA																	0				ovary(2)|skin(2)	4						c.(811-813)TAC>TAA		myeloid cell nuclear differentiation antigen							77.0	80.0	79.0					1																	158815619		2203	4300	6503	SO:0001587	stop_gained	4332				B cell receptor signaling pathway|cellular defense response|negative regulation of B cell proliferation|positive regulation of apoptosis|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding	g.chr1:158815619C>A	BC032319	CCDS1177.1	1q22	2008-02-05			ENSG00000163563	ENSG00000163563			7183	protein-coding gene	gene with protein product		159553				1644857, 7512843	Standard	NM_002432		Approved	PYHIN3	uc001fsz.1	P41218	OTTHUMG00000022776	ENST00000368141.4:c.813C>A	1.37:g.158815619C>A	ENSP00000357123:p.Tyr271*		Somatic					p.Y271*	NM_002432	NP_002423	WXS	Illumina HiSeq	Unspecified	P41218	MNDA_HUMAN			5	1013	+	all_hematologic(112;0.0378)		271			HIN-200.			Nonsense_Mutation	SNP	ENST00000368141.4	37	c.813C>A	CCDS1177.1	.	.	.	.	.	.	.	.	.	.	C	34	5.303543	0.95601	.	.	ENSG00000163563	ENST00000368141	.	.	.	4.28	0.783	0.18572	.	0.000000	0.35179	N	0.003381	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.9138	5.6952	0.17851	0.0:0.4369:0.0:0.5631	.	.	.	.	X	271	.	ENSP00000357123:Y271X	Y	+	3	2	MNDA	157082243	0.000000	0.05858	0.005000	0.12908	0.030000	0.12068	-0.862000	0.04263	0.063000	0.16370	-0.137000	0.14449	TAC		0.343	MNDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059069.1	NM_002432		13	67	1	0	1.5e-05	1.78e-05	13	67				
DUSP27	92235	broad.mit.edu	37	1	167096649	167096649	+	Missense_Mutation	SNP	A	A	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:167096649A>G	ENST00000361200.2	+	6	2447	c.2281A>G	c.(2281-2283)Agc>Ggc	p.S761G	DUSP27_ENST00000443333.1_Missense_Mutation_p.S761G|DUSP27_ENST00000271385.5_Missense_Mutation_p.S761G|DUSP27_ENST00000485151.1_Intron			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	761					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						ACCAGCGGCTAGCTGCCTGGG	0.562																																						uc001geb.1		NA																	0				ovary(3)	3						c.(2281-2283)AGC>GGC		dual specificity phosphatase 27							78.0	65.0	70.0					1																	167096649		2203	4300	6503	SO:0001583	missense	92235				protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity	g.chr1:167096649A>G	AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.2281A>G	1.37:g.167096649A>G	ENSP00000354483:p.Ser761Gly		Somatic					p.S761G	NM_001080426	NP_001073895	WXS	Illumina HiSeq	Unspecified	Q5VZP5	DUS27_HUMAN			5	2281	+			761					A0AUM4|Q9C074	Missense_Mutation	SNP	ENST00000361200.2	37	c.2281A>G	CCDS30932.1	.	.	.	.	.	.	.	.	.	.	A	0.163	-1.079598	0.01903	.	.	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	T;T;T	0.03358	3.96;3.96;3.96	4.58	-8.52	0.00920	.	1.138180	0.06519	N	0.739385	T	0.00412	0.0013	N	0.04043	-0.29	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.49312	-0.8953	10	0.12766	T	0.61	-3.1425	5.3742	0.16156	0.5541:0.0:0.2535:0.1923	.	761	Q5VZP5	DUS27_HUMAN	G	761	ENSP00000354483:S761G;ENSP00000271385:S761G;ENSP00000404874:S761G	ENSP00000271385:S761G	S	+	1	0	DUSP27	165363273	0.022000	0.18835	0.012000	0.15200	0.312000	0.27988	0.164000	0.16542	-1.639000	0.01527	-0.304000	0.09214	AGC		0.562	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1	NM_001080426		16	73	0	0	0	0	16	73				
F5	2153	broad.mit.edu	37	1	169526028	169526028	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:169526028G>A	ENST00000367797.3	-	6	1009	c.808C>T	c.(808-810)Cat>Tat	p.H270Y	F5_ENST00000546081.1_Missense_Mutation_p.H133Y|F5_ENST00000367796.3_Missense_Mutation_p.H270Y	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	270	F5/8 type A 1.|Plastocyanin-like 2.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	CCGTTGAAATGAATGGAGAAT	0.507																																						uc001ggg.1		NA																	0				ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6						c.(808-810)CAT>TAT		coagulation factor V precursor	Drotrecogin alfa(DB00055)						123.0	100.0	108.0					1																	169526028		2203	4300	6503	SO:0001583	missense	2153				cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity	g.chr1:169526028G>A	M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.808C>T	1.37:g.169526028G>A	ENSP00000356771:p.His270Tyr		Somatic				F5_uc010plr.1_RNA	p.H270Y	NM_000130	NP_000121	WXS	Illumina HiSeq	Unspecified	P12259	FA5_HUMAN			6	953	-	all_hematologic(923;0.208)		270			F5/8 type A 1.|Plastocyanin-like 2.		A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	ENST00000367797.3	37	c.808C>T	CCDS1281.1	.	.	.	.	.	.	.	.	.	.	G	32	5.134160	0.94517	.	.	ENSG00000198734	ENST00000367797;ENST00000367796;ENST00000546081	D;D;D	0.99846	-7.13;-7.13;-7.13	6.07	6.07	0.98685	Cupredoxin (2);	0.043642	0.85682	D	0.000000	D	0.99677	0.9879	L	0.43646	1.37	0.41293	D	0.986992	D	0.89917	1.0	D	0.85130	0.997	D	0.98312	1.0524	9	0.37606	T	0.19	-27.2625	20.6439	0.99570	0.0:0.0:1.0:0.0	.	270	P12259	FA5_HUMAN	Y	270;270;133	ENSP00000356771:H270Y;ENSP00000356770:H270Y;ENSP00000439664:H133Y	ENSP00000356770:H270Y	H	-	1	0	F5	167792652	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.434000	0.97515	2.890000	0.99128	0.650000	0.86243	CAT		0.507	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083712.1	NM_000130		16	64	0	0	0	0	16	64				
MROH9	80133	broad.mit.edu	37	1	170927641	170927641	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:170927641C>A	ENST00000367758.3	+	4	211	c.112C>A	c.(112-114)Ctg>Atg	p.L38M	MROH9_ENST00000367759.4_Missense_Mutation_p.L38M	NM_025063.2	NP_079339.2	Q5TGP6	MROH9_HUMAN	maestro heat-like repeat family member 9	38																	ATACTCAGGCCTGTTAAGTAA	0.333																																						uc001ghg.2		NA																	0				pancreas(1)	1						c.(112-114)CTG>ATG		hypothetical protein LOC80133 isoform 2							140.0	139.0	139.0					1																	170927641		1838	4092	5930	SO:0001583	missense	80133						binding	g.chr1:170927641C>A	AK027203	CCDS41436.1, CCDS53429.1	1q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000117501	ENSG00000117501		"""maestro heat-like repeat containing"""	26287	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 129"""	C1orf129			Standard	NM_025063		Approved	FLJ23550, ARMC11	uc010plz.2	Q5TGP6	OTTHUMG00000041456	ENST00000367758.3:c.112C>A	1.37:g.170927641C>A	ENSP00000356732:p.Leu38Met		Somatic				C1orf129_uc009wvy.2_Translation_Start_Site|C1orf129_uc010plz.1_Missense_Mutation_p.L38M	p.L38M	NM_025063	NP_079339	WXS	Illumina HiSeq	Unspecified	Q5TGP6	CA129_HUMAN			4	242	+	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)		38					A0PJM0|A0PJM2|F5GWX6|Q9H5D7	Missense_Mutation	SNP	ENST00000367758.3	37	c.112C>A	CCDS41436.1	.	.	.	.	.	.	.	.	.	.	C	13.09	2.133810	0.37630	.	.	ENSG00000117501	ENST00000367759;ENST00000367758	T;T	0.16457	3.95;2.34	4.94	1.97	0.26223	.	0.392206	0.18879	N	0.128638	T	0.12433	0.0302	L	0.47716	1.5	0.09310	N	1	D;D	0.76494	0.999;0.999	D;D	0.68192	0.956;0.956	T	0.06972	-1.0797	10	0.33141	T	0.24	-2.4888	4.1395	0.10186	0.164:0.5892:0.1585:0.0884	.	38;38	F5GWX6;Q5TGP6	.;CA129_HUMAN	M	38	ENSP00000356733:L38M;ENSP00000356732:L38M	ENSP00000356732:L38M	L	+	1	2	C1orf129	169194265	0.000000	0.05858	0.002000	0.10522	0.022000	0.10575	-0.405000	0.07196	0.322000	0.23283	0.644000	0.83932	CTG		0.333	MROH9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000099327.1	NM_025063		30	142	1	0	7.65e-34	1.2e-33	30	142				
TNR	7143	broad.mit.edu	37	1	175348704	175348704	+	Silent	SNP	G	G	A	rs140708810		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:175348704G>A	ENST00000367674.2	-	9	2655	c.1947C>T	c.(1945-1947)acC>acT	p.T649T	TNR_ENST00000263525.2_Silent_p.T649T			Q92752	TENR_HUMAN	tenascin R	649	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					GGGTGGCCCTGGTGGTTGGAC	0.532																																						uc001gkp.1		NA																	0				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11						c.(1945-1947)ACC>ACT		tenascin R precursor							88.0	77.0	81.0					1																	175348704		2203	4300	6503	SO:0001819	synonymous_variant	7143				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix		g.chr1:175348704G>A	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.1947C>T	1.37:g.175348704G>A			Somatic				TNR_uc009wwu.1_Silent_p.T649T	p.T649T	NM_003285	NP_003276	WXS	Illumina HiSeq	Unspecified	Q92752	TENR_HUMAN			7	2028	-	Renal(580;0.146)		649			Fibronectin type-III 4.		C9J563|Q15568|Q5R3G0	Silent	SNP	ENST00000367674.2	37	c.1947C>T	CCDS1318.1																																																																																				0.532	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285		19	68	0	0	0	0	19	68				
PAPPA2	60676	broad.mit.edu	37	1	176526124	176526124	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:176526124G>T	ENST00000367662.3	+	2	1830	c.666G>T	c.(664-666)tgG>tgT	p.W222C	PAPPA2_ENST00000367661.3_Missense_Mutation_p.W222C	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	222					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						TCCAACCTTGGCCCAAGCATT	0.562																																						uc001gkz.2		NA																	0				ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						c.(664-666)TGG>TGT		pappalysin 2 isoform 1							90.0	93.0	92.0					1																	176526124		1965	4150	6115	SO:0001583	missense	60676				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding	g.chr1:176526124G>T	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.666G>T	1.37:g.176526124G>T	ENSP00000356634:p.Trp222Cys		Somatic				PAPPA2_uc001gky.1_Missense_Mutation_p.W222C|PAPPA2_uc009www.2_RNA	p.W222C	NM_020318	NP_064714	WXS	Illumina HiSeq	Unspecified	Q9BXP8	PAPP2_HUMAN			2	1830	+			222					A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	c.666G>T	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	G	12.64	1.997189	0.35226	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	T;T	0.32023	4.72;1.47	3.28	2.3	0.28687	Concanavalin A-like lectin/glucanase (1);	0.481226	0.15990	U	0.234878	T	0.31638	0.0803	M	0.65975	2.015	0.09310	N	0.999995	P;D	0.54047	0.875;0.964	B;B	0.43783	0.253;0.431	T	0.14839	-1.0458	10	0.51188	T	0.08	.	7.9237	0.29861	0.0:0.0:0.7532:0.2468	.	222;222	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	C	222	ENSP00000356634:W222C;ENSP00000356633:W222C	ENSP00000356633:W222C	W	+	3	0	PAPPA2	174792747	0.297000	0.24408	0.002000	0.10522	0.555000	0.35460	1.887000	0.39698	0.626000	0.30322	0.313000	0.20887	TGG		0.562	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1			35	110	1	0	2e-19	2.97e-19	35	110				
ASTN1	460	broad.mit.edu	37	1	176927497	176927497	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:176927497C>T	ENST00000367654.3	-	10	1955	c.1744G>A	c.(1744-1746)Gat>Aat	p.D582N	ASTN1_ENST00000281881.3_5'UTR|ASTN1_ENST00000424564.2_Missense_Mutation_p.D574N|ASTN1_ENST00000361833.2_Missense_Mutation_p.D574N|ASTN1_ENST00000367657.3_Missense_Mutation_p.D574N	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	582					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.D574H(2)		NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						TCCACAGCATCCTCCATCACA	0.532																																						uc001glc.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						c.(1720-1722)GAT>AAT		astrotactin isoform 1							125.0	94.0	105.0					1																	176927497		2203	4300	6503	SO:0001583	missense	460				cell migration|neuron cell-cell adhesion	integral to membrane		g.chr1:176927497C>T	AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.1744G>A	1.37:g.176927497C>T	ENSP00000356626:p.Asp582Asn		Somatic				ASTN1_uc001glb.1_Missense_Mutation_p.D574N|ASTN1_uc001gld.1_Missense_Mutation_p.D574N|ASTN1_uc009wwx.1_Missense_Mutation_p.D574N	p.D574N	NM_004319	NP_004310	WXS	Illumina HiSeq	Unspecified	O14525	ASTN1_HUMAN			10	1932	-			582					A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	ENST00000367654.3	37	c.1720G>A		.	.	.	.	.	.	.	.	.	.	C	35	5.481394	0.96307	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.19250	2.16;2.57;2.57;2.16	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.36826	0.0981	L	0.29908	0.895	0.80722	D	1	D;D;D	0.76494	0.999;0.994;0.994	D;D;D	0.71414	0.973;0.915;0.915	T	0.12889	-1.0530	10	0.72032	D	0.01	-25.5837	18.9852	0.92766	0.0:1.0:0.0:0.0	.	582;574;574	O14525;O14525-2;B1AJS1	ASTN1_HUMAN;.;.	N	574;574;582;574;574	ENSP00000356629:D574N;ENSP00000354536:D574N;ENSP00000356626:D582N;ENSP00000395041:D574N	ENSP00000354536:D574N	D	-	1	0	ASTN1	175194120	1.000000	0.71417	0.981000	0.43875	0.954000	0.61252	7.711000	0.84669	2.572000	0.86782	0.655000	0.94253	GAT		0.532	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319		13	49	0	0	0	0	13	49				
TDRD5	163589	broad.mit.edu	37	1	179587802	179587802	+	Silent	SNP	A	A	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:179587802A>G	ENST00000367614.1	+	5	1259	c.900A>G	c.(898-900)aaA>aaG	p.K300K	TDRD5_ENST00000444136.1_Silent_p.K300K|TDRD5_ENST00000294848.8_Silent_p.K300K	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	300	HTH OST-type 3. {ECO:0000255|PROSITE- ProRule:PRU00975}.				DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)				NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						CAGAACTAAAACATAAGATAA	0.294																																						uc001gnf.1		NA																	0				ovary(2)|skin(2)|central_nervous_system(1)	5						c.(898-900)AAA>AAG		tudor domain containing 5							60.0	65.0	63.0					1																	179587802		2202	4298	6500	SO:0001819	synonymous_variant	163589				DNA methylation involved in gamete generation|P granule organization|spermatid development	chromatoid body|pi-body	nucleic acid binding	g.chr1:179587802A>G	AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.900A>G	1.37:g.179587802A>G			Somatic				TDRD5_uc010pnp.1_Silent_p.K300K|TDRD5_uc001gnh.1_5'UTR	p.K300K	NM_173533	NP_775804	WXS	Illumina HiSeq	Unspecified	Q8NAT2	TDRD5_HUMAN			5	1150	+			300			Lotus/OST-HTH 3.		A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Silent	SNP	ENST00000367614.1	37	c.900A>G	CCDS1332.1																																																																																				0.294	TDRD5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000085295.1	NM_173533		31	89	0	0	0	0	31	89				
CACNA1E	777	broad.mit.edu	37	1	181690998	181690998	+	Silent	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:181690998C>A	ENST00000367573.2	+	16	2061	c.2061C>A	c.(2059-2061)acC>acA	p.T687T	CACNA1E_ENST00000357570.5_Silent_p.T638T|CACNA1E_ENST00000367567.4_Silent_p.T294T|CACNA1E_ENST00000526775.1_Silent_p.T687T|CACNA1E_ENST00000358338.5_Silent_p.T638T|CACNA1E_ENST00000367570.1_Silent_p.T687T|CACNA1E_ENST00000360108.3_Silent_p.T687T	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	687					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						TTGTGCTCACCTTGTTTGGCA	0.537																																						uc001gow.2		NA																	0				ovary(3)|central_nervous_system(2)|pancreas(1)	6						c.(2059-2061)ACC>ACA		calcium channel, voltage-dependent, R type,							192.0	194.0	193.0					1																	181690998		2095	4231	6326	SO:0001819	synonymous_variant	777				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr1:181690998C>A	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.2061C>A	1.37:g.181690998C>A			Somatic				CACNA1E_uc009wxs.2_Silent_p.T594T	p.T687T	NM_000721	NP_000712	WXS	Illumina HiSeq	Unspecified	Q15878	CAC1E_HUMAN			16	2226	+			687			Helical; Name=S6 of repeat II.|II.		B1AM12|B1AM13|B1AM14|Q14580|Q14581	Silent	SNP	ENST00000367573.2	37	c.2061C>A	CCDS55664.1																																																																																				0.537	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721		41	139	1	0	2.27e-22	3.42e-22	41	139				
CACNA1E	777	broad.mit.edu	37	1	181731752	181731752	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:181731752G>A	ENST00000367573.2	+	33	4648	c.4648G>A	c.(4648-4650)Gtg>Atg	p.V1550M	CACNA1E_ENST00000357570.5_Missense_Mutation_p.V1501M|CACNA1E_ENST00000367567.4_Missense_Mutation_p.V1157M|CACNA1E_ENST00000526775.1_Missense_Mutation_p.V1531M|CACNA1E_ENST00000358338.5_Missense_Mutation_p.V1482M|CACNA1E_ENST00000367570.1_Missense_Mutation_p.V1550M|CACNA1E_ENST00000360108.3_Missense_Mutation_p.V1531M	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1550					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						CTTCATCACCGTGATTGGCAG	0.388																																						uc001gow.2		NA																	0				ovary(3)|central_nervous_system(2)|pancreas(1)	6						c.(4648-4650)GTG>ATG		calcium channel, voltage-dependent, R type,							95.0	85.0	88.0					1																	181731752		1885	4123	6008	SO:0001583	missense	777				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr1:181731752G>A	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.4648G>A	1.37:g.181731752G>A	ENSP00000356545:p.Val1550Met		Somatic				CACNA1E_uc009wxs.2_Missense_Mutation_p.V1438M|CACNA1E_uc001gox.1_Missense_Mutation_p.V776M|CACNA1E_uc009wxt.2_Missense_Mutation_p.V776M	p.V1550M	NM_000721	NP_000712	WXS	Illumina HiSeq	Unspecified	Q15878	CAC1E_HUMAN			33	4813	+			1550			Helical; Name=S3 of repeat IV.|IV.		B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	37	c.4648G>A	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.025705	0.93518	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.99070	-5.39;-5.39;-5.39;-5.39;-5.39;-5.39;-5.39	5.6	5.6	0.85130	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99591	0.9852	H	0.96833	3.89	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.996	D	0.97917	1.0312	10	0.87932	D	0	.	19.2125	0.93763	0.0:0.0:1.0:0.0	.	1531;1550;1550	Q15878-2;Q15878;Q15878-3	.;CAC1E_HUMAN;.	M	1550;1531;1501;1482;1157;1531;1550	ENSP00000356542:V1550M;ENSP00000434814:V1531M;ENSP00000350183:V1501M;ENSP00000351101:V1482M;ENSP00000356539:V1157M;ENSP00000353222:V1531M;ENSP00000356545:V1550M	ENSP00000350183:V1501M	V	+	1	0	CACNA1E	179998375	1.000000	0.71417	0.959000	0.39883	0.964000	0.63967	9.675000	0.98638	2.649000	0.89929	0.591000	0.81541	GTG		0.388	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721		10	26	0	0	0	0	10	26				
CFHR2	3080	broad.mit.edu	37	1	196871597	196871597	+	Intron	SNP	T	T	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:196871597T>C	ENST00000367421.3	+	2	135				CFHR4_ENST00000251424.4_Silent_p.Y36Y|CFHR4_ENST00000367418.2_Silent_p.Y36Y|CFHR4_ENST00000608469.1_Intron|CFHR4_ENST00000367416.2_Silent_p.Y35Y			P36980	FHR2_HUMAN	complement factor H-related 2							extracellular region (GO:0005576)				large_intestine(2)|ovary(1)|skin(3)	6						GTCTATATTATAAGAGTTTGC	0.318																																						uc001gto.2		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(106-108)TAT>TAC		complement factor H-related 4 precursor							114.0	116.0	116.0					1																	196871597		1901	4176	6077	SO:0001627	intron_variant	10877					extracellular region	lipid transporter activity	g.chr1:196871597T>C	X64877	CCDS30959.1	1q31.3	2008-02-05	2004-08-09	2006-02-28	ENSG00000080910	ENSG00000080910		"""Complement system"""	4890	protein-coding gene	gene with protein product		600889	"""H factor (complement)-like 3"""	HFL3, CFHL2		1533657, 7672821	Standard	NM_005666		Approved	FHR2	uc001gtq.1	P36980	OTTHUMG00000036518	ENST00000367421.3:c.59-46988T>C	1.37:g.196871597T>C			Somatic				CFHR4_uc009wyy.2_Silent_p.Y35Y|CFHR4_uc001gtp.2_Silent_p.Y36Y	p.Y36Y	NM_006684	NP_006675	WXS	Illumina HiSeq	Unspecified	Q92496	FHR4_HUMAN			2	177	+			36			Sushi 1.		Q14310|Q5T9T1	Silent	SNP	ENST00000367421.3	37	c.108T>C																																																																																					0.318	CFHR2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_005666		71	176	0	0	0	0	71	176				
PTPRC	5788	broad.mit.edu	37	1	198701448	198701448	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:198701448G>T	ENST00000367376.2	+	19	2159	c.1988G>T	c.(1987-1989)aGc>aTc	p.S663I	PTPRC_ENST00000594404.1_Missense_Mutation_p.S502I|PTPRC_ENST00000352140.3_Missense_Mutation_p.S615I|PTPRC_ENST00000348564.6_Missense_Mutation_p.S504I|PTPRC_ENST00000442510.2_Missense_Mutation_p.S665I	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	663	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						CGGGTGTTCAGCAAGTTTCCT	0.398																																						uc001gur.1		NA																	0				breast(4)|skin(3)|ovary(2)|lung(1)|kidney(1)|pancreas(1)	12						c.(1987-1989)AGC>ATC		protein tyrosine phosphatase, receptor type, C							77.0	78.0	77.0					1																	198701448		2203	4300	6503	SO:0001583	missense	5788				axon guidance|B cell proliferation|B cell receptor signaling pathway|defense response to virus|immunoglobulin biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of T cell mediated cytotoxicity|positive regulation of antigen receptor-mediated signaling pathway|positive regulation of B cell proliferation|positive regulation of protein kinase activity|positive regulation of T cell proliferation|regulation of S phase|release of sequestered calcium ion into cytosol|T cell differentiation|T cell receptor signaling pathway	focal adhesion|integral to plasma membrane|membrane raft	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr1:198701448G>T	Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.1988G>T	1.37:g.198701448G>T	ENSP00000356346:p.Ser663Ile		Somatic				PTPRC_uc001gus.1_Missense_Mutation_p.S615I|PTPRC_uc001gut.1_Missense_Mutation_p.S502I|PTPRC_uc009wzf.1_Missense_Mutation_p.S551I|PTPRC_uc010ppg.1_Missense_Mutation_p.S599I	p.S663I	NM_002838	NP_002829	WXS	Illumina HiSeq	Unspecified	P08575	PTPRC_HUMAN			19	2168	+			663			Cytoplasmic (Potential).|Tyrosine-protein phosphatase 1.		A8K7W6|Q16614|Q9H0Y6	Missense_Mutation	SNP	ENST00000367376.2	37	c.1988G>T		.	.	.	.	.	.	.	.	.	.	G	16.02	3.003830	0.54254	.	.	ENSG00000081237	ENST00000367376;ENST00000367366;ENST00000352140;ENST00000535566;ENST00000530727;ENST00000442510;ENST00000367367;ENST00000348564	T	0.10763	2.84	5.93	4.97	0.65823	Protein-tyrosine phosphatase, receptor/non-receptor type (2);	0.000000	0.64402	D	0.000015	T	0.24624	0.0597	L	0.37630	1.12	0.41426	D	0.987833	D;D;D;D;D	0.76494	0.987;0.999;0.997;0.997;0.999	P;D;D;D;D	0.77004	0.883;0.989;0.973;0.973;0.973	T	0.00487	-1.1710	10	0.87932	D	0	.	16.5204	0.84312	0.0:0.2322:0.7678:0.0	.	599;599;504;615;663	F5GXZ3;B4DSZ5;B1ALS3;E9PC28;P08575	.;.;.;.;PTPRC_HUMAN	I	665;599;615;615;549;663;597;502	ENSP00000193532:S615I	ENSP00000306782:S502I	S	+	2	0	PTPRC	196968071	1.000000	0.71417	1.000000	0.80357	0.793000	0.44817	1.522000	0.35921	2.798000	0.96311	0.655000	0.94253	AGC		0.398	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding				19	83	1	0	3.6e-14	5.11e-14	19	83				
NR5A2	2494	broad.mit.edu	37	1	200017865	200017865	+	Silent	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:200017865G>T	ENST00000367362.3	+	5	1275	c.1029G>T	c.(1027-1029)ggG>ggT	p.G343G	NR5A2_ENST00000236914.3_Silent_p.G297G|NR5A2_ENST00000544748.1_Silent_p.G271G	NM_001276464.1|NM_205860.1	NP_001263393.1|NP_995582.1	O00482	NR5A2_HUMAN	nuclear receptor subfamily 5, group A, member 2	343	Ligand-binding.				bile acid metabolic process (GO:0008206)|cholesterol homeostasis (GO:0042632)|embryo development (GO:0009790)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|homeostatic process (GO:0042592)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral genome replication (GO:0045070)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|phospholipid binding (GO:0005543)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(15)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	31	Prostate(682;0.19)					GCACCTTTGGGCTTATGTGCA	0.478																																					Melanoma(179;1138 2773 15678 26136)	uc001gvb.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(1027-1029)GGG>GGT		nuclear receptor subfamily 5, group A, member 2							149.0	144.0	145.0					1																	200017865		2203	4300	6503	SO:0001819	synonymous_variant	2494				embryo development|positive regulation of viral genome replication|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	lipid binding|protein binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr1:200017865G>T	U93553	CCDS1400.1, CCDS1401.1, CCDS60383.1	1q32.11	2013-01-16			ENSG00000116833	ENSG00000116833		"""Nuclear hormone receptors"""	7984	protein-coding gene	gene with protein product	"""liver receptor homolog-1"""	604453		FTF		9858833, 7680097	Standard	NM_205860		Approved	FTZ-F1beta, hB1F, LRH-1, FTZ-F1, hB1F-2, B1F2	uc001gvb.4	O00482	OTTHUMG00000035635	ENST00000367362.3:c.1029G>T	1.37:g.200017865G>T			Somatic				NR5A2_uc001gvc.2_Silent_p.G297G|NR5A2_uc009wzh.2_Silent_p.G303G|NR5A2_uc010pph.1_Silent_p.G271G	p.G343G	NM_205860	NP_995582	WXS	Illumina HiSeq	Unspecified	O00482	NR5A2_HUMAN			5	1235	+	Prostate(682;0.19)		343			Ligand-binding.		B4E2P3|O95642|Q147U3	Silent	SNP	ENST00000367362.3	37	c.1029G>T	CCDS1401.1	.	.	.	.	.	.	.	.	.	.	G	8.332	0.826818	0.16749	.	.	ENSG00000116833	ENST00000367357	T	0.51574	0.7	5.33	1.08	0.20341	.	0.000000	0.85682	D	0.000000	T	0.41650	0.1168	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.11743	-1.0575	6	.	.	.	.	4.6972	0.12809	0.0675:0.2636:0.4183:0.2506	.	.	.	.	V	264	ENSP00000356326:G264V	.	G	+	2	0	NR5A2	198284488	1.000000	0.71417	0.801000	0.32222	0.993000	0.82548	1.406000	0.34646	0.013000	0.14918	-0.175000	0.13238	GGC		0.478	NR5A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086497.2			42	137	1	0	4.14e-30	6.43e-30	42	137				
MYOG	4656	broad.mit.edu	37	1	203054660	203054660	+	Missense_Mutation	SNP	G	G	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:203054660G>C	ENST00000241651.4	-	1	504	c.430C>G	c.(430-432)Cgt>Ggt	p.R144G		NM_002479.5	NP_002470.2	P15173	MYOG_HUMAN	myogenin (myogenic factor 4)	144					cell cycle (GO:0007049)|cellular response to estradiol stimulus (GO:0071392)|cellular response to growth factor stimulus (GO:0071363)|cellular response to lithium ion (GO:0071285)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|negative regulation of cell proliferation (GO:0008285)|ossification (GO:0001503)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of muscle atrophy (GO:0014737)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of skeletal muscle fiber development (GO:0048743)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of myoblast fusion (GO:1901739)|regulation of satellite cell proliferation (GO:0014842)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to electrical stimulus involved in regulation of muscle adaptation (GO:0014878)|response to muscle activity involved in regulation of muscle adaptation (GO:0014873)|skeletal muscle fiber development (GO:0048741)|skeletal muscle tissue development (GO:0007519)|striated muscle atrophy (GO:0014891)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|E-box binding (GO:0070888)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|skin(2)|urinary_tract(1)	12						CGGAGGTCACGCTCCTCCTGG	0.701																																						uc001gzd.2		NA																	0				skin(2)	2						c.(430-432)CGT>GGT		myogenin							29.0	32.0	31.0					1																	203054660		2203	4300	6503	SO:0001583	missense	4656				muscle cell fate commitment|positive regulation of muscle cell differentiation|positive regulation of transcription from RNA polymerase II promoter	transcription factor complex	E-box binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity	g.chr1:203054660G>C	BC053899	CCDS1433.1	1q31-q41	2013-05-21			ENSG00000122180	ENSG00000122180		"""Basic helix-loop-helix proteins"""	7612	protein-coding gene	gene with protein product		159980		MYF4		10329008	Standard	NM_002479		Approved	bHLHc3	uc001gzd.4	P15173	OTTHUMG00000042127	ENST00000241651.4:c.430C>G	1.37:g.203054660G>C	ENSP00000241651:p.Arg144Gly		Somatic					p.R144G	NM_002479	NP_002470	WXS	Illumina HiSeq	Unspecified	P15173	MYOG_HUMAN			1	718	-			144					Q53XW6	Missense_Mutation	SNP	ENST00000241651.4	37	c.430C>G	CCDS1433.1	.	.	.	.	.	.	.	.	.	.	G	16.93	3.259282	0.59321	.	.	ENSG00000122180	ENST00000241651	D	0.98313	-4.86	5.32	5.32	0.75619	Helix-loop-helix DNA-binding (1);	0.280313	0.39687	N	0.001286	D	0.93792	0.8015	N	0.05158	-0.105	0.44736	D	0.997738	B	0.06786	0.001	B	0.08055	0.003	D	0.90539	0.4501	10	0.59425	D	0.04	-35.456	13.926	0.63964	0.0:0.0:0.848:0.152	.	144	P15173	MYOG_HUMAN	G	144	ENSP00000241651:R144G	ENSP00000241651:R144G	R	-	1	0	MYOG	201321283	1.000000	0.71417	0.982000	0.44146	0.877000	0.50540	2.665000	0.46791	2.486000	0.83907	0.563000	0.77884	CGT		0.701	MYOG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100279.1	NM_002479		15	41	0	0	0	0	15	41				
PLXNA2	5362	broad.mit.edu	37	1	208390886	208390886	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:208390886C>T	ENST00000367033.3	-	2	1139	c.382G>A	c.(382-384)Gcc>Acc	p.A128T		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	128	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		CTCCCACAGGCCAGCAGGCGG	0.587																																						uc001hgz.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(382-384)GCC>ACC		plexin A2 precursor							93.0	99.0	97.0					1																	208390886		2203	4300	6503	SO:0001583	missense	5362				axon guidance	integral to membrane|intracellular|plasma membrane		g.chr1:208390886C>T	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.382G>A	1.37:g.208390886C>T	ENSP00000356000:p.Ala128Thr		Somatic				PLXNA2_uc001hha.3_Missense_Mutation_p.A182T	p.A128T	NM_025179	NP_079455	WXS	Illumina HiSeq	Unspecified	O75051	PLXA2_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.199)	2	1140	-			128			Extracellular (Potential).|Sema.		A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	ENST00000367033.3	37	c.382G>A	CCDS31013.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.887275	0.91814	.	.	ENSG00000076356	ENST00000367033	T	0.11821	2.74	5.64	5.64	0.86602	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.42381	0.1200	M	0.77616	2.38	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.996;1.0	T	0.24977	-1.0145	10	0.62326	D	0.03	.	19.7016	0.96057	0.0:1.0:0.0:0.0	.	182;128	O75051-2;O75051	.;PLXA2_HUMAN	T	128	ENSP00000356000:A128T	ENSP00000356000:A128T	A	-	1	0	PLXNA2	206457509	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.525000	0.81892	2.662000	0.90505	0.514000	0.50259	GCC		0.587	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6	NM_025179		34	133	0	0	0	0	34	133				
USH2A	7399	broad.mit.edu	37	1	216373030	216373030	+	Silent	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:216373030C>T	ENST00000307340.3	-	17	4136	c.3750G>A	c.(3748-3750)aaG>aaA	p.K1250K	USH2A_ENST00000366942.3_Silent_p.K1250K|USH2A_ENST00000366943.2_Silent_p.K1250K|RP5-1099E6.3_ENST00000420867.1_RNA	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1250	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TTTTCTGCATCTTAGGTGGAC	0.478										HNSCC(13;0.011)																												uc001hku.1		NA																	0				ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(3748-3750)AAG>AAA		usherin isoform B							98.0	92.0	94.0					1																	216373030		2203	4300	6503	SO:0001819	synonymous_variant	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:216373030C>T	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.3750G>A	1.37:g.216373030C>T		HNSCC(13;0.011)	Somatic				USH2A_uc001hkv.2_Silent_p.K1250K	p.K1250K	NM_206933	NP_996816	WXS	Illumina HiSeq	Unspecified	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	17	4137	-			1250			Fibronectin type-III 3.|Extracellular (Potential).		Q5VVM9|Q6S362|Q9NS27	Silent	SNP	ENST00000307340.3	37	c.3750G>A	CCDS31025.1																																																																																				0.478	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		21	80	0	0	0	0	21	80				
KCNK1	3775	broad.mit.edu	37	1	233802661	233802661	+	Missense_Mutation	SNP	A	A	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:233802661A>G	ENST00000366621.3	+	2	844	c.676A>G	c.(676-678)Att>Gtt	p.I226V	KCNK1_ENST00000472190.1_3'UTR|KCNK1_ENST00000366620.1_Missense_Mutation_p.I110V	NM_002245.3	NP_002236.1	O00180	KCNK1_HUMAN	potassium channel, subfamily K, member 1	226					potassium ion transport (GO:0006813)|response to nicotine (GO:0035094)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endosome (GO:0005768)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(4)|skin(1)	11		all_cancers(173;0.00217)|all_epithelial(177;0.121)|Prostate(94;0.122)|Acute lymphoblastic leukemia(190;0.175)			Ibutilide(DB00308)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)	CCTGAGCACCATTGGCCTGGG	0.483																																						uc010pxo.1		NA																	0				central_nervous_system(1)	1						c.(676-678)ATT>GTT		potassium channel, subfamily K, member 1	Ibutilide(DB00308)|Quinidine(DB00908)						72.0	77.0	76.0					1																	233802661		2203	4300	6503	SO:0001583	missense	3775					voltage-gated potassium channel complex	inward rectifier potassium channel activity	g.chr1:233802661A>G	U33632	CCDS1599.1	1q42-q43	2012-03-07			ENSG00000135750	ENSG00000135750		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6272	protein-coding gene	gene with protein product		601745				8661042, 16382106	Standard	NM_002245		Approved	K2p1.1, DPK, TWIK-1	uc010pxo.1	O00180	OTTHUMG00000037923	ENST00000366621.3:c.676A>G	1.37:g.233802661A>G	ENSP00000355580:p.Ile226Val		Somatic				KCNK1_uc001hvw.2_RNA|KCNK1_uc001hvx.2_RNA	p.I226V	NM_002245	NP_002236	WXS	Illumina HiSeq	Unspecified	O00180	KCNK1_HUMAN			2	844	+		all_cancers(173;0.00217)|all_epithelial(177;0.121)|Prostate(94;0.122)|Acute lymphoblastic leukemia(190;0.175)	226					Q13307|Q5T5E8	Missense_Mutation	SNP	ENST00000366621.3	37	c.676A>G	CCDS1599.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.555874	0.86231	.	.	ENSG00000135750	ENST00000366621;ENST00000366620;ENST00000446915	T;T;T	0.32988	1.43;1.43;1.43	5.7	5.7	0.88788	Ion transport 2 (1);	0.000000	0.85682	D	0.000000	T	0.43612	0.1255	L	0.28608	0.87	0.80722	D	1	D	0.69078	0.997	D	0.80764	0.994	T	0.22034	-1.0228	10	0.33141	T	0.24	.	15.9745	0.80049	1.0:0.0:0.0:0.0	.	226	O00180	KCNK1_HUMAN	V	226;110;144	ENSP00000355580:I226V;ENSP00000355579:I110V;ENSP00000409626:I144V	ENSP00000355579:I110V	I	+	1	0	KCNK1	231869284	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.345000	0.79337	2.168000	0.68352	0.533000	0.62120	ATT		0.483	KCNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092565.1	NM_002245		35	115	0	0	0	0	35	115				
RGS7	6000	broad.mit.edu	37	1	241094032	241094032	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:241094032C>A	ENST00000407727.1	-	5	369	c.370G>T	c.(370-372)Gaa>Taa	p.E124*	RGS7_ENST00000348120.2_Intron|RGS7_ENST00000366565.1_Nonsense_Mutation_p.E124*|RGS7_ENST00000401882.1_Intron|RGS7_ENST00000446183.2_Nonsense_Mutation_p.E40*|RGS7_ENST00000366563.1_Nonsense_Mutation_p.E124*|RGS7_ENST00000366562.4_Nonsense_Mutation_p.E124*|RGS7_ENST00000366564.1_Nonsense_Mutation_p.E124*|RGS7_ENST00000331110.7_Nonsense_Mutation_p.E98*			P49802	RGS7_HUMAN	regulator of G-protein signaling 7	124					G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(51)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			TCTGTGTTTTCCGGCTCCCAA	0.383																																						uc001hyv.2		NA																	0				ovary(4)|skin(2)|kidney(1)	7						c.(370-372)GAA>TAA		regulator of G-protein signaling 7							128.0	142.0	137.0					1																	241094032		2203	4300	6503	SO:0001587	stop_gained	6000				G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity	g.chr1:241094032C>A	BC022009	CCDS31071.1, CCDS60457.1, CCDS60458.1, CCDS60459.1	1q43	2008-02-05	2007-08-14		ENSG00000182901	ENSG00000182901		"""Regulators of G-protein signaling"""	10003	protein-coding gene	gene with protein product		602517	"""regulator of G-protein signalling 7"""			8548815	Standard	XM_005273218		Approved		uc001hyv.2	P49802	OTTHUMG00000040107	ENST00000407727.1:c.370G>T	1.37:g.241094032C>A	ENSP00000384428:p.Glu124*		Somatic				RGS7_uc010pyh.1_Nonsense_Mutation_p.E98*|RGS7_uc010pyj.1_Nonsense_Mutation_p.E40*|RGS7_uc001hyu.2_Nonsense_Mutation_p.E124*|RGS7_uc009xgn.1_Intron|RGS7_uc001hyw.2_Nonsense_Mutation_p.E124*	p.E124*	NM_002924	NP_002915	WXS	Illumina HiSeq	Unspecified	P49802	RGS7_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.027)		6	700	-		all_cancers(173;0.0131)	124					Q5T3H4|Q8TD66|Q8TD67|Q8WW09|Q9UNU7|Q9Y6B9	Nonsense_Mutation	SNP	ENST00000407727.1	37	c.370G>T		.	.	.	.	.	.	.	.	.	.	C	42	9.436241	0.99171	.	.	ENSG00000182901	ENST00000331110;ENST00000366565;ENST00000366564;ENST00000366563;ENST00000446183;ENST00000366562;ENST00000407727	.	.	.	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-20.0026	17.2744	0.87111	0.0:1.0:0.0:0.0	.	.	.	.	X	98;124;124;124;40;124;124	.	ENSP00000331485:E98X	E	-	1	0	RGS7	239160655	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	7.126000	0.77201	2.769000	0.95229	0.655000	0.94253	GAA		0.383	RGS7-204	KNOWN	basic	protein_coding	protein_coding		NM_002924		72	222	1	0	4.5e-31	7.02e-31	72	222				
MAP1LC3C	440738	broad.mit.edu	37	1	242159636	242159636	+	Silent	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:242159636G>A	ENST00000357246.3	-	4	337	c.273C>T	c.(271-273)aaC>aaT	p.N91N		NM_001004343.2	NP_001004343.1	Q9BXW4	MLP3C_HUMAN	microtubule-associated protein 1 light chain 3 gamma	91					autophagy (GO:0006914)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|microtubule (GO:0005874)|organelle membrane (GO:0031090)				endometrium(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	13			OV - Ovarian serous cystadenocarcinoma(106;0.0188)			CCAGGCTCTTGTTGTTCACCA	0.572																																						uc001hzk.2		NA																	0				ovary(1)	1						c.(271-273)AAC>AAT		microtubule-associated protein 1 light chain 3							184.0	159.0	168.0					1																	242159636		2203	4300	6503	SO:0001819	synonymous_variant	440738				autophagy	autophagic vacuole membrane|cytoplasmic vesicle|endomembrane system|microtubule	protein binding	g.chr1:242159636G>A	AF276659	CCDS31074.1	1q43	2014-02-12			ENSG00000197769	ENSG00000197769			13353	protein-coding gene	gene with protein product		609605				12740394	Standard	NM_001004343		Approved	ATG8J	uc001hzk.2	Q9BXW4	OTTHUMG00000039865	ENST00000357246.3:c.273C>T	1.37:g.242159636G>A			Somatic					p.N91N	NM_001004343	NP_001004343	WXS	Illumina HiSeq	Unspecified	Q9BXW4	MLP3C_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0188)		4	348	-			91					A0PJY8|A2RUP0	Silent	SNP	ENST00000357246.3	37	c.273C>T	CCDS31074.1																																																																																				0.572	MAP1LC3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096185.1	NM_001004343		41	127	0	0	0	0	41	127				
PLD5	200150	broad.mit.edu	37	1	242511469	242511469	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:242511469C>A	ENST00000536534.2	-	2	506	c.265G>T	c.(265-267)Gtg>Ttg	p.V89L	PLD5_ENST00000427495.1_Missense_Mutation_p.V27L|PLD5_ENST00000442594.2_5'UTR			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	89						integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			ATGATGTCCACGGCTGAAAAG	0.448																																						uc001hzn.1		NA																	0				ovary(6)	6						c.(265-267)GTG>TTG		RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;							95.0	90.0	92.0					1																	242511469		2203	4297	6500	SO:0001583	missense	200150					integral to membrane	catalytic activity	g.chr1:242511469C>A	AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.265G>T	1.37:g.242511469C>A	ENSP00000440896:p.Val89Leu		Somatic				PLD5_uc001hzl.3_Missense_Mutation_p.V27L|PLD5_uc001hzm.3_5'UTR|PLD5_uc001hzo.1_5'UTR	p.V89L			WXS	Illumina HiSeq	Unspecified	Q8N7P1	PLD5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0329)		2	392	-	Melanoma(84;0.242)		89			Helical; (Potential).		A1KXV0|B7Z324|Q494U9|Q8NB22	Missense_Mutation	SNP	ENST00000536534.2	37	c.265G>T	CCDS1621.2	.	.	.	.	.	.	.	.	.	.	C	23.4	4.415589	0.83449	.	.	ENSG00000180287	ENST00000427495;ENST00000536534;ENST00000459864	T;T;T	0.30714	1.52;1.52;1.52	5.24	5.24	0.73138	.	.	.	.	.	T	0.43478	0.1249	L	0.27053	0.805	0.80722	D	1	D;D	0.69078	0.997;0.996	D;D	0.77004	0.984;0.989	T	0.40327	-0.9569	9	0.87932	D	0	.	15.9157	0.79517	0.0:1.0:0.0:0.0	.	89;27	Q8N7P1;Q8N7P1-4	PLD5_HUMAN;.	L	27;89;27	ENSP00000401285:V27L;ENSP00000440896:V89L;ENSP00000438191:V27L	ENSP00000314748:V27L	V	-	1	0	PLD5	240578092	1.000000	0.71417	0.957000	0.39632	0.765000	0.43378	7.133000	0.77259	2.609000	0.88269	0.655000	0.94253	GTG		0.448	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397213.2	NM_152666		35	128	1	0	6.97e-18	1.02e-17	35	128				
CEP170	9859	broad.mit.edu	37	1	243349671	243349671	+	Missense_Mutation	SNP	T	T	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:243349671T>A	ENST00000366542.1	-	9	1213	c.1162A>T	c.(1162-1164)Agg>Tgg	p.R388W	CEP170_ENST00000366543.1_Missense_Mutation_p.R388W|CEP170_ENST00000366544.1_Missense_Mutation_p.R388W	NM_014812.2	NP_055627.2	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa	388						centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear membrane (GO:0031965)				NS(1)|breast(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	62	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			CTACAGCGCCTGTGAGCCCCA	0.438																																						uc001hzs.2		NA																	0				ovary(1)|haematopoietic_and_lymphoid_tissue(1)	2						c.(1162-1164)AGG>TGG		centrosomal protein 170kDa isoform alpha							133.0	125.0	127.0					1																	243349671		1930	4133	6063	SO:0001583	missense	9859					centriole|microtubule|spindle		g.chr1:243349671T>A	AB022657	CCDS44337.1, CCDS44338.1, CCDS44339.1	1q44	2014-02-20	2006-01-12	2006-01-12	ENSG00000143702	ENSG00000143702			28920	protein-coding gene	gene with protein product	"""KARP 1 binding protein"", ""XRCC5 binding protein"""	613023	"""KIAA0470"""	KIAA0470		15616186	Standard	NM_014812		Approved	KAB, FAM68A	uc021plo.1	Q5SW79	OTTHUMG00000039862	ENST00000366542.1:c.1162A>T	1.37:g.243349671T>A	ENSP00000355500:p.Arg388Trp		Somatic				CEP170_uc001hzt.2_Missense_Mutation_p.R388W|CEP170_uc001hzu.2_Missense_Mutation_p.R388W	p.R388W	NM_014812	NP_055627	WXS	Illumina HiSeq	Unspecified	Q5SW79	CE170_HUMAN	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)		9	1570	-	all_neural(11;0.101)	all_cancers(173;0.003)	388					O75058|Q5SW77|Q5SW78|Q7LGA9|Q86W31|Q9UQ08|Q9UQ09	Missense_Mutation	SNP	ENST00000366542.1	37	c.1162A>T	CCDS44339.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.87|17.87	3.495321|3.495321	0.64186|0.64186	.|.	.|.	ENSG00000143702|ENSG00000143702	ENST00000522895|ENST00000366542;ENST00000366544;ENST00000366543;ENST00000424081	.|T;T;T	.|0.49720	.|0.77;0.81;0.81	5.3|5.3	4.1|4.1	0.47936|0.47936	.|.	.|0.108147	.|0.64402	.|D	.|0.000009	T|T	0.55497|0.55497	0.1924|0.1924	L|L	0.36672|0.36672	1.1|1.1	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.71674	.|0.998;0.995;0.996	.|D;D;P	.|0.66979	.|0.948;0.948;0.888	T|T	0.59445|0.59445	-0.7453|-0.7453	5|10	.|0.87932	.|D	.|0	-13.294|-13.294	12.0939|12.0939	0.53744|0.53744	0.0:0.0:0.2319:0.7681|0.0:0.0:0.2319:0.7681	.|.	.|388;388;388	.|Q5SW79-3;Q5SW79-2;Q5SW79	.|.;.;CE170_HUMAN	L|W	14|388;388;388;286	.|ENSP00000355500:R388W;ENSP00000355502:R388W;ENSP00000355501:R388W	.|ENSP00000355500:R388W	Q|R	-|-	2|1	0|2	CEP170|CEP170	241416294|241416294	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.638000|1.638000	0.37165|0.37165	1.998000|1.998000	0.58463|0.58463	0.477000|0.477000	0.44152|0.44152	CAG|AGG		0.438	CEP170-003	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096178.2	NM_014812		59	177	0	0	0	0	59	177				
KIF26B	55083	broad.mit.edu	37	1	245850938	245850938	+	Missense_Mutation	SNP	C	C	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:245850938C>G	ENST00000407071.2	+	12	5093	c.4653C>G	c.(4651-4653)gaC>gaG	p.D1551E	KIF26B_ENST00000366518.4_Missense_Mutation_p.D1170E	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	1551					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			AGGAGCCGGACAGCCTCTCCT	0.662																																						uc001ibf.1		NA																	0				ovary(3)	3						c.(4651-4653)GAC>GAG		kinesin family member 26B							10.0	13.0	12.0					1																	245850938		1934	4111	6045	SO:0001583	missense	55083				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr1:245850938C>G	AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.4653C>G	1.37:g.245850938C>G	ENSP00000385545:p.Asp1551Glu		Somatic				KIF26B_uc001ibg.1_Missense_Mutation_p.D1169E|KIF26B_uc001ibh.1_Missense_Mutation_p.D793E	p.D1551E	NM_018012	NP_060482	WXS	Illumina HiSeq	Unspecified	Q2KJY2	KI26B_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.022)		12	5093	+	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		1551					Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	ENST00000407071.2	37	c.4653C>G	CCDS44342.1	.	.	.	.	.	.	.	.	.	.	C	8.411	0.844210	0.16963	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	T;T	0.77489	-1.1;-1.09	5.68	4.77	0.60923	.	.	.	.	.	T	0.64789	0.2630	L	0.31294	0.92	0.28848	N	0.896232	B;B	0.21905	0.062;0.007	B;B	0.18263	0.021;0.008	T	0.52373	-0.8584	9	0.19590	T	0.45	.	10.1136	0.42576	0.0:0.8494:0.0:0.1506	.	1170;1551	B7WPD9;Q2KJY2	.;KI26B_HUMAN	E	1551;1170;1167	ENSP00000385545:D1551E;ENSP00000355475:D1170E	ENSP00000355475:D1170E	D	+	3	2	KIF26B	243917561	0.988000	0.35896	0.965000	0.40720	0.159000	0.22180	1.018000	0.30002	2.695000	0.91970	0.555000	0.69702	GAC		0.662	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381037.1	XM_371354		3	7	0	0	0	0	3	7				
OR2C3	81472	broad.mit.edu	37	1	247695329	247695329	+	Missense_Mutation	SNP	G	G	T	rs562326145	byFrequency	TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:247695329G>T	ENST00000366487.3	-	2	846	c.485C>A	c.(484-486)aCg>aAg	p.T162K	GCSAML_ENST00000366489.1_Intron|GCSAML_ENST00000527084.1_Intron|GCSAML_ENST00000531662.1_Intron|GCSAML_ENST00000527541.1_Intron|GCSAML_ENST00000366490.3_Intron|GCSAML_ENST00000463359.1_Intron|GCSAML_ENST00000366491.2_Intron	NM_198074.4	NP_932340	Q8N628	OR2C3_HUMAN	olfactory receptor, family 2, subfamily C, member 3	162						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|large_intestine(2)|lung(31)|ovary(1)|prostate(1)|skin(2)	43	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0242)	OV - Ovarian serous cystadenocarcinoma(106;0.0241)			CATGGTGAGCGTGGAGCCCAC	0.557																																						uc009xgy.2		NA																	0				ovary(1)|skin(1)	2						c.(484-486)ACG>AAG		olfactory receptor, family 2, subfamily C,							57.0	54.0	55.0					1																	247695329		2203	4300	6503	SO:0001583	missense	81472				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247695329G>T	BC030717	CCDS1634.2	1q44	2014-02-19	2002-02-28		ENSG00000196242	ENSG00000196242		"""GPCR / Class A : Olfactory receptors"""	15005	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily C, member 4"""	OR2C4, OR2C5P			Standard	NM_198074		Approved	OST742	uc009xgy.3	Q8N628	OTTHUMG00000040579	ENST00000366487.3:c.485C>A	1.37:g.247695329G>T	ENSP00000355443:p.Thr162Lys		Somatic				C1orf150_uc009xgw.2_Intron|C1orf150_uc001ida.3_Intron|C1orf150_uc001idb.3_Intron|C1orf150_uc009xgx.2_Intron|LOC148824_uc001idd.2_5'Flank	p.T162K	NM_198074	NP_932340	WXS	Illumina HiSeq	Unspecified	Q8N628	OR2C3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0241)		2	847	-	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0242)	162			Extracellular (Potential).		Q5JQS4|Q6IEZ1|Q8NGW7	Missense_Mutation	SNP	ENST00000366487.3	37	c.485C>A	CCDS1634.2	.	.	.	.	.	.	.	.	.	.	G	14.86	2.660002	0.47572	.	.	ENSG00000196242	ENST00000366487	T	0.37235	1.21	3.89	2.97	0.34412	GPCR, rhodopsin-like superfamily (1);	0.193330	0.25146	U	0.032788	T	0.43634	0.1256	M	0.72353	2.195	0.09310	N	1	P	0.43169	0.8	P	0.47603	0.551	T	0.31081	-0.9956	10	0.54805	T	0.06	.	9.709	0.40233	0.1052:0.0:0.8948:0.0	.	162	Q8N628	OR2C3_HUMAN	K	162	ENSP00000355443:T162K	ENSP00000355443:T162K	T	-	2	0	OR2C3	245761952	0.000000	0.05858	0.664000	0.29753	0.861000	0.49209	-0.037000	0.12164	0.959000	0.37980	0.650000	0.86243	ACG		0.557	OR2C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097626.2	NM_198074		4	24	1	0	1.02e-07	1.31e-07	4	24				
OR2M5	127059	broad.mit.edu	37	1	248308673	248308673	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr1:248308673G>T	ENST00000366476.1	+	1	224	c.224G>T	c.(223-225)tGc>tTc	p.C75F		NM_001004690.1	NP_001004690.1	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M, member 5	75						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	49	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			ATGCTCATCTGCTCTACCGTA	0.488																																						uc010pze.1		NA																	0				ovary(2)|kidney(1)	3						c.(223-225)TGC>TTC		olfactory receptor, family 2, subfamily M,							364.0	341.0	349.0					1																	248308673		2203	4300	6503	SO:0001583	missense	127059				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248308673G>T		CCDS31105.1	1q44	2012-08-09		2004-03-10	ENSG00000162727	ENSG00000162727		"""GPCR / Class A : Olfactory receptors"""	19576	protein-coding gene	gene with protein product				OR2M5P			Standard	NM_001004690		Approved		uc010pze.2	A3KFT3	OTTHUMG00000040447	ENST00000366476.1:c.224G>T	1.37:g.248308673G>T	ENSP00000355432:p.Cys75Phe		Somatic					p.C75F	NM_001004690	NP_001004690	WXS	Illumina HiSeq	Unspecified	A3KFT3	OR2M5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0388)		1	224	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		75			Helical; Name=2; (Potential).			Missense_Mutation	SNP	ENST00000366476.1	37	c.224G>T	CCDS31105.1	.	.	.	.	.	.	.	.	.	.	g	2.686	-0.274189	0.05679	.	.	ENSG00000162727	ENST00000366476	T	0.00477	7.14	3.28	-3.88	0.04205	GPCR, rhodopsin-like superfamily (1);	0.241563	0.21363	U	0.075766	T	0.00300	0.0009	L	0.31476	0.935	0.09310	N	1	B	0.21309	0.054	B	0.23018	0.043	T	0.46148	-0.9212	10	0.72032	D	0.01	.	8.7597	0.34667	0.2132:0.6133:0.1735:0.0	.	75	A3KFT3	OR2M5_HUMAN	F	75	ENSP00000355432:C75F	ENSP00000355432:C75F	C	+	2	0	OR2M5	246375296	0.000000	0.05858	0.013000	0.15412	0.174000	0.22865	0.597000	0.24059	-0.328000	0.08539	0.492000	0.49549	TGC		0.488	OR2M5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097343.1	NM_001004690		289	472	1	0	4.04e-157	6.46e-157	289	472				
ITGA8	8516	broad.mit.edu	37	10	15649735	15649735	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr10:15649735G>T	ENST00000378076.3	-	17	2058	c.1705C>A	c.(1705-1707)Cct>Act	p.P569T		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	569					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)			NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						ATCACAAGAGGGAAGACGCGA	0.448																																						uc001ioc.1		NA																	0				ovary(3)|lung(3)	6						c.(1705-1707)CCT>ACT		integrin, alpha 8 precursor							182.0	182.0	182.0					10																	15649735		2203	4300	6503	SO:0001583	missense	8516				cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity	g.chr10:15649735G>T	L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.1705C>A	10.37:g.15649735G>T	ENSP00000367316:p.Pro569Thr		Somatic				ITGA8_uc010qcb.1_Missense_Mutation_p.P554T	p.P569T	NM_003638	NP_003629	WXS	Illumina HiSeq	Unspecified	P53708	ITA8_HUMAN			17	1705	-			569			Extracellular (Potential).		B0YJ31|Q5VX94	Missense_Mutation	SNP	ENST00000378076.3	37	c.1705C>A	CCDS31155.1	.	.	.	.	.	.	.	.	.	.	G	0.007	-1.956220	0.00470	.	.	ENSG00000077943	ENST00000378076;ENST00000538044	T	0.38560	1.13	5.84	-0.705	0.11252	Integrin alpha-2 (1);	0.667158	0.17102	N	0.186965	T	0.18130	0.0435	N	0.12182	0.205	0.23950	N	0.996378	B;B	0.29481	0.206;0.245	B;B	0.31101	0.076;0.124	T	0.32295	-0.9912	10	0.05959	T	0.93	.	8.1189	0.30959	0.2016:0.4339:0.3646:0.0	.	554;569	F5H818;P53708	.;ITA8_HUMAN	T	569;554	ENSP00000367316:P569T	ENSP00000367316:P569T	P	-	1	0	ITGA8	15689741	0.886000	0.30341	0.837000	0.33122	0.018000	0.09664	0.063000	0.14410	0.066000	0.16515	-0.282000	0.10007	CCT		0.448	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046987.1	NM_003638		64	135	1	0	2.68e-24	4.09e-24	64	135				
SLC39A12	221074	broad.mit.edu	37	10	18242223	18242223	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr10:18242223G>T	ENST00000377369.2	+	2	291	c.18G>T	c.(16-18)aaG>aaT	p.K6N	SLC39A12_ENST00000377371.3_Missense_Mutation_p.K6N|SLC39A12_ENST00000539911.1_Intron|SLC39A12_ENST00000377374.4_Missense_Mutation_p.K6N	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter), member 12	6					regulation of microtubule polymerization (GO:0031113)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)|zinc ion transmembrane import (GO:0071578)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	zinc ion transmembrane transporter activity (GO:0005385)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(5)|lung(38)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	60						TCCGGACAAAGCTCTCAGTAT	0.493																																						uc001ipo.2		NA																	0				ovary(1)|breast(1)	2						c.(16-18)AAG>AAT		solute carrier family 39 (zinc transporter),							120.0	120.0	120.0					10																	18242223		2203	4300	6503	SO:0001583	missense	221074				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity	g.chr10:18242223G>T		CCDS7124.1, CCDS44362.1, CCDS60493.1, CCDS60494.1	10p12.33	2013-05-22			ENSG00000148482	ENSG00000148482		"""Solute carriers"""	20860	protein-coding gene	gene with protein product		608734	"""solute carrier family 39 (metal ion transporter), member 12"""			12659941	Standard	NM_152725		Approved	FLJ30499	uc001ipo.2	Q504Y0	OTTHUMG00000017759	ENST00000377369.2:c.18G>T	10.37:g.18242223G>T	ENSP00000366586:p.Lys6Asn		Somatic				SLC39A12_uc001ipn.2_Missense_Mutation_p.K6N|SLC39A12_uc001ipp.2_Missense_Mutation_p.K6N|SLC39A12_uc010qck.1_Intron	p.K6N	NM_001145195	NP_001138667	WXS	Illumina HiSeq	Unspecified	Q504Y0	S39AC_HUMAN			2	291	+			6			Extracellular (Potential).		B7ZL35|C9JJL4|Q49AN8|Q4G0L3|Q5VWV8|Q5VWV9|Q6NZY5|Q96NN4	Missense_Mutation	SNP	ENST00000377369.2	37	c.18G>T	CCDS44362.1	.	.	.	.	.	.	.	.	.	.	G	11.77	1.738787	0.30774	.	.	ENSG00000148482	ENST00000377369;ENST00000377374;ENST00000377371	T;T;T	0.23147	1.92;1.92;1.92	5.72	-2.21	0.06973	.	0.852042	0.10608	N	0.654759	T	0.18759	0.0450	L	0.55103	1.725	0.09310	N	0.999999	B;B;B	0.13145	0.007;0.004;0.007	B;B;B	0.14578	0.011;0.003;0.011	T	0.30060	-0.9991	10	0.35671	T	0.21	-5.4121	2.9271	0.05787	0.3675:0.1025:0.4247:0.1052	.	6;6;6	Q504Y0-4;Q504Y0;Q504Y0-3	.;S39AC_HUMAN;.	N	6	ENSP00000366586:K6N;ENSP00000366591:K6N;ENSP00000366588:K6N	ENSP00000366586:K6N	K	+	3	2	SLC39A12	18282229	0.000000	0.05858	0.004000	0.12327	0.078000	0.17371	-0.288000	0.08377	-0.373000	0.07979	-0.783000	0.03347	AAG		0.493	SLC39A12-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_152725		22	67	1	0	2.89e-11	3.97e-11	22	67				
ARHGAP12	94134	broad.mit.edu	37	10	32141445	32141445	+	Splice_Site	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr10:32141445C>A	ENST00000344936.2	-	6	1404	c.1170G>T	c.(1168-1170)aaG>aaT	p.K390N	ARHGAP12_ENST00000311380.4_Splice_Site_p.K343N|ARHGAP12_ENST00000375245.4_Splice_Site_p.K343N|ARHGAP12_ENST00000396144.4_Splice_Site_p.K390N|ARHGAP12_ENST00000375250.5_Splice_Site_p.K390N	NM_001270697.1|NM_018287.6	NP_001257626.1|NP_060757.4	Q8IWW6	RHG12_HUMAN	Rho GTPase activating protein 12	390	WW 2. {ECO:0000255|PROSITE- ProRule:PRU00224}.				morphogenesis of an epithelial sheet (GO:0002011)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(11)|lung(10)|skin(1)|urinary_tract(2)	31		Prostate(175;0.0199)				GGTTTATTACCTTTGGCAATT	0.348																																						uc001ivz.1		NA																	0					0						c.(1168-1170)AAG>AAT		Rho GTPase activating protein 12							93.0	93.0	93.0					10																	32141445		2203	4300	6503	SO:0001630	splice_region_variant	94134				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	g.chr10:32141445C>A	AY033594	CCDS7170.1, CCDS59214.1, CCDS59215.1, CCDS59216.1, CCDS73082.1	10p11.22	2013-01-10			ENSG00000165322	ENSG00000165322		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	16348	protein-coding gene	gene with protein product		610577				11854031	Standard	NM_001270695		Approved	FLJ20737, FLJ10971, FLJ21785	uc001ivz.2	Q8IWW6	OTTHUMG00000017911	ENST00000344936.2:c.1170+1G>T	10.37:g.32141445C>A			Somatic				ARHGAP12_uc001ivy.1_Missense_Mutation_p.K341N|ARHGAP12_uc009xls.2_Missense_Mutation_p.K341N|ARHGAP12_uc001iwb.1_Missense_Mutation_p.K388N|ARHGAP12_uc001iwc.1_Missense_Mutation_p.K388N|ARHGAP12_uc009xlq.1_Missense_Mutation_p.K341N|ARHGAP12_uc001iwd.1_Missense_Mutation_p.K388N|ARHGAP12_uc009xlr.1_Missense_Mutation_p.K388N	p.K390N	NM_018287	NP_060757	WXS	Illumina HiSeq	Unspecified	Q8IWW6	RHG12_HUMAN			6	1440	-		Prostate(175;0.0199)	390			WW 2.		B1ANY0|B1ANY1|B1ANY2|Q504X1|Q86UB3|Q8IWW7|Q8N3L1|Q9NT76	Missense_Mutation	SNP	ENST00000344936.2	37	c.1170G>T	CCDS7170.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.0|25.0	4.589118|4.589118	0.86851|0.86851	.|.	.|.	ENSG00000165322|ENSG00000165322	ENST00000311380;ENST00000375250;ENST00000344936;ENST00000396144;ENST00000375245|ENST00000454919	T;T;T;T;T|.	0.38560|.	1.13;3.03;1.13;1.13;1.13|.	5.85|5.85	5.85|5.85	0.93711|0.93711	WW/Rsp5/WWP (4);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.73674|0.73674	0.3617|0.3617	L|L	0.57536|0.57536	1.79|1.79	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D|.	0.76494|.	0.998;0.995;0.997;0.998;0.998;0.999|.	D;P;D;P;P;D|.	0.70487|.	0.931;0.884;0.946;0.884;0.884;0.969|.	T|T	0.68973|0.68973	-0.5268|-0.5268	9|5	.|.	.|.	.|.	.|.	20.1736|20.1736	0.98170|0.98170	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	343;390;390;390;390;343|.	Q1RLN5;B3KR88;Q8IWW6-2;Q504X1;Q8IWW6;Q8IWW6-3|.	.;.;.;.;RHG12_HUMAN;.|.	N|L	343;390;390;390;343|66	ENSP00000310984:K343N;ENSP00000364399:K390N;ENSP00000345808:K390N;ENSP00000379448:K390N;ENSP00000364394:K343N|.	.|.	K|V	-|-	3|1	2|0	ARHGAP12|ARHGAP12	32181451|32181451	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.978000|0.978000	0.69477|0.69477	4.415000|4.415000	0.59809|0.59809	2.767000|2.767000	0.95098|0.95098	0.557000|0.557000	0.71058|0.71058	AAG|GTA		0.348	ARHGAP12-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047465.1		Missense_Mutation	44	80	1	0	5.24e-18	7.7e-18	44	80				
ZNF37A	7587	broad.mit.edu	37	10	38406775	38406775	+	Silent	SNP	A	A	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr10:38406775A>G	ENST00000361085.5	+	7	1041	c.696A>G	c.(694-696)ccA>ccG	p.P232P	ZNF37A_ENST00000351773.3_Silent_p.P232P	NM_001178101.1|NM_003421.2	NP_001171572.1|NP_003412.1	P17032	ZN37A_HUMAN	zinc finger protein 37A	232					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|prostate(1)	28						ATCTCACTCCAATTCAGAGAA	0.338																																						uc001izk.2		NA																	0				breast(1)	1						c.(694-696)CCA>CCG		zinc finger protein 37a							46.0	48.0	47.0					10																	38406775		2203	4300	6503	SO:0001819	synonymous_variant	7587					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr10:38406775A>G	X69115	CCDS31183.1	10p11.2	2013-01-08	2006-05-11		ENSG00000075407	ENSG00000075407		"""Zinc fingers, C2H2-type"", ""-"""	13102	protein-coding gene	gene with protein product			"""zinc finger protein 37a (KOX 21)"""			2014798, 8464732	Standard	NM_001178101		Approved	KOX21, ZNF37	uc001izl.3	P17032	OTTHUMG00000017990	ENST00000361085.5:c.696A>G	10.37:g.38406775A>G			Somatic				ZNF37A_uc001izl.2_Silent_p.P232P|ZNF37A_uc001izm.2_Silent_p.P232P	p.P232P	NM_001007094	NP_001007095	WXS	Illumina HiSeq	Unspecified	P17032	ZN37A_HUMAN			8	1515	+			232					B3KRQ3|D3DRZ3|Q96B88	Silent	SNP	ENST00000361085.5	37	c.696A>G	CCDS31183.1																																																																																				0.338	ZNF37A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047624.2	NM_003421		10	45	0	0	0	0	10	45				
OGDHL	55753	broad.mit.edu	37	10	50954889	50954889	+	Missense_Mutation	SNP	A	A	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr10:50954889A>C	ENST00000374103.4	-	10	1288	c.1203T>G	c.(1201-1203)ttT>ttG	p.F401L	OGDHL_ENST00000419399.1_Missense_Mutation_p.F344L|OGDHL_ENST00000432695.1_Missense_Mutation_p.F192L	NM_018245.2	NP_060715.2	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like	401					glycolytic process (GO:0006096)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	61						CCTGGCCAGCAAAGGCGGCGT	0.637																																						uc001jie.2		NA																	0				pancreas(1)	1						c.(1201-1203)TTT>TTG		oxoglutarate dehydrogenase-like isoform a							115.0	84.0	95.0					10																	50954889		2203	4300	6503	SO:0001583	missense	55753				glycolysis	mitochondrial matrix	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding	g.chr10:50954889A>C	AK001713	CCDS7234.1, CCDS44390.1, CCDS44391.1	10q11.23	2013-09-20			ENSG00000197444	ENSG00000197444			25590	protein-coding gene	gene with protein product						10574462	Standard	NM_018245		Approved	FLJ10851	uc001jie.3	Q9ULD0	OTTHUMG00000018200	ENST00000374103.4:c.1203T>G	10.37:g.50954889A>C	ENSP00000363216:p.Phe401Leu		Somatic				OGDHL_uc009xog.2_Missense_Mutation_p.F428L|OGDHL_uc010qgt.1_Missense_Mutation_p.F344L|OGDHL_uc010qgu.1_Missense_Mutation_p.F192L|OGDHL_uc009xoh.2_Missense_Mutation_p.F192L	p.F401L	NM_018245	NP_060715	WXS	Illumina HiSeq	Unspecified	Q9ULD0	OGDHL_HUMAN			10	1345	-			401					A8K2G1|B4DKG2|B4E193|Q8TAN9|Q9NVA0	Missense_Mutation	SNP	ENST00000374103.4	37	c.1203T>G	CCDS7234.1	.	.	.	.	.	.	.	.	.	.	A	26.3	4.726870	0.89390	.	.	ENSG00000197444	ENST00000374103;ENST00000419399;ENST00000432695	T;T;T	0.08193	3.12;3.13;3.18	5.76	-4.33	0.03677	Dehydrogenase, E1 component (1);	0.000000	0.85682	D	0.000000	T	0.21347	0.0514	M	0.80982	2.52	0.58432	D	0.999995	P;P;P	0.50819	0.925;0.859;0.939	P;P;P	0.59546	0.779;0.654;0.859	T	0.01081	-1.1458	10	0.72032	D	0.01	.	12.8308	0.57744	0.6202:0.0:0.3798:0.0	.	344;192;401	Q9ULD0-2;Q9ULD0-3;Q9ULD0	.;.;OGDHL_HUMAN	L	401;344;192	ENSP00000363216:F401L;ENSP00000401356:F344L;ENSP00000390240:F192L	ENSP00000363216:F401L	F	-	3	2	OGDHL	50624895	0.545000	0.26449	0.817000	0.32601	0.786000	0.44442	0.004000	0.13106	-1.133000	0.02903	-0.290000	0.09829	TTT		0.637	OGDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048007.1	NM_018245		10	34	0	0	0	0	10	34				
RBP4	5950	broad.mit.edu	37	10	95360467	95360467	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr10:95360467C>A	ENST00000371467.1	-	3	524	c.205G>T	c.(205-207)Ggc>Tgc	p.G69C	RBP4_ENST00000371469.2_Missense_Mutation_p.G67C|FFAR4_ENST00000604414.1_Intron|RBP4_ENST00000371464.3_Missense_Mutation_p.G69C			P02753	RET4_HUMAN	retinol binding protein 4, plasma	69					cardiac muscle tissue development (GO:0048738)|detection of light stimulus involved in visual perception (GO:0050908)|embryonic organ morphogenesis (GO:0048562)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|embryonic skeletal system development (GO:0048706)|eye development (GO:0001654)|female genitalia morphogenesis (GO:0048807)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|lung development (GO:0030324)|maintenance of gastrointestinal epithelium (GO:0030277)|male gonad development (GO:0008584)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|phototransduction, visible light (GO:0007603)|positive regulation of immunoglobulin secretion (GO:0051024)|positive regulation of insulin secretion (GO:0032024)|response to ethanol (GO:0045471)|response to insulin (GO:0032868)|response to retinoic acid (GO:0032526)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|retinol transport (GO:0034633)|spermatogenesis (GO:0007283)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vagina development (GO:0060068)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	retinal binding (GO:0016918)|retinol binding (GO:0019841)|retinol transporter activity (GO:0034632)			large_intestine(1)|lung(3)|skin(1)	5		Colorectal(252;0.122)			Vitamin A(DB00162)	CTCATCTGGCCGGTCTCGTCC	0.647																																					Pancreas(5;160 256 1117 46697 50185)	uc001kit.2		NA																	0					0						c.(205-207)GGC>TGC		retinol-binding protein 4, plasma precursor	Vitamin A(DB00162)						27.0	30.0	29.0					10																	95360467		2202	4299	6501	SO:0001583	missense	5950				cardiac muscle tissue development|embryonic organ morphogenesis|embryonic retina morphogenesis in camera-type eye|embryonic skeletal system development|female genitalia morphogenesis|gluconeogenesis|glucose homeostasis|heart trabecula formation|lung development|maintenance of gastrointestinal epithelium|negative regulation of cardiac muscle cell proliferation|positive regulation of immunoglobulin secretion|positive regulation of insulin secretion|response to retinoic acid|retinol metabolic process|urinary bladder development|uterus development|vagina development	extracellular space	protein binding|retinal binding|retinol binding	g.chr10:95360467C>A	BC020633	CCDS31249.1	10q23.33	2014-01-22	2001-11-28		ENSG00000138207	ENSG00000138207		"""Lipocalins"""	9922	protein-coding gene	gene with protein product		180250	"""retinol-binding protein 4, plasma"""				Standard	XM_005270023		Approved		uc001kit.3	P02753	OTTHUMG00000018773	ENST00000371467.1:c.205G>T	10.37:g.95360467C>A	ENSP00000360522:p.Gly69Cys		Somatic					p.G69C	NM_006744	NP_006735	WXS	Illumina HiSeq	Unspecified	P02753	RET4_HUMAN			3	289	-		Colorectal(252;0.122)	69					D3DR38|O43478|O43479|Q5VY24|Q8WWA3|Q9P178	Missense_Mutation	SNP	ENST00000371467.1	37	c.205G>T	CCDS31249.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.832999	0.91036	.	.	ENSG00000138207	ENST00000371464;ENST00000371469;ENST00000371467;ENST00000371463	D;D	0.89270	-2.49;-2.49	5.25	5.25	0.73442	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.101689	0.64402	D	0.000002	D	0.94814	0.8325	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95292	0.8396	10	0.87932	D	0	-37.5377	18.9151	0.92503	0.0:1.0:0.0:0.0	.	69	P02753	RET4_HUMAN	C	69;67;69;67	ENSP00000360519:G69C;ENSP00000360522:G69C	ENSP00000360518:G67C	G	-	1	0	RBP4	95350457	1.000000	0.71417	0.988000	0.46212	0.890000	0.51754	7.437000	0.80417	2.467000	0.83353	0.306000	0.20318	GGC		0.647	RBP4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049431.1	NM_006744		9	10	1	0	5.49e-09	7.2e-09	9	10				
PNLIPRP2	5408	broad.mit.edu	37	10	118383495	118383495	+	RNA	SNP	A	A	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr10:118383495A>T	ENST00000298771.7	+	0	114				PNLIPRP2_ENST00000537242.1_RNA|PNLIPRP2_ENST00000433618.4_RNA	NR_103727.1		P54317	LIPR2_HUMAN	pancreatic lipase-related protein 2						galactolipid catabolic process (GO:0019376)|lipid digestion (GO:0044241)|phospholipid catabolic process (GO:0009395)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	acylglycerol lipase activity (GO:0047372)|calcium ion binding (GO:0005509)|galactolipase activity (GO:0047714)|phospholipase activity (GO:0004620)|triglyceride lipase activity (GO:0004806)			endometrium(1)|large_intestine(1)|lung(11)|prostate(3)	16				all cancers(201;0.015)		TGCTTTTCTGATGAAAAACCA	0.463																																						uc001lcq.2		NA																	0				large_intestine(1)	1						c.(91-93)GAT>GTT		pancreatic lipase-related protein 2							96.0	96.0	96.0					10																	118383495		1905	4129	6034			5408				galactolipid catabolic process|lipid digestion|phospholipid catabolic process|triglyceride metabolic process	extracellular space	acylglycerol lipase activity|calcium ion binding|galactolipase activity|phospholipase activity|triglyceride lipase activity	g.chr10:118383495A>T	M93284		10q26.12	2014-03-14				ENSG00000266200	3.1.1.3		9157	protein-coding gene	gene with protein product		604423				1379598	Standard	NM_005396		Approved	PLRP2	uc001lcq.3	P54317			10.37:g.118383495A>T			Somatic				PNLIPRP2_uc009xyu.1_RNA|PNLIPRP2_uc009xyv.1_RNA	p.D31V	NM_005396	NP_005387	WXS	Illumina HiSeq	Unspecified	P54317	LIPR2_HUMAN		all cancers(201;0.015)	5	115	+			30					A8K627|Q6IB55	Missense_Mutation	SNP	ENST00000298771.7	37	c.92A>T		.	.	.	.	.	.	.	.	.	.	A	17.51	3.407455	0.62399	.	.	ENSG00000165862	ENST00000537242	D	0.91180	-2.8	5.65	4.49	0.54785	Lipase, N-terminal (1);	0.409623	0.21351	N	0.075976	D	0.91570	0.7337	.	.	.	0.38965	D	0.95862	B	0.29805	0.257	B	0.44085	0.44	D	0.90062	0.4157	9	0.52906	T	0.07	.	11.0658	0.47974	0.8608:0.0:0.0:0.1392	.	30	P54317	LIPR2_HUMAN	V	30	ENSP00000446346:D30V	ENSP00000446346:D30V	D	+	2	0	PNLIPRP2	118373485	1.000000	0.71417	0.052000	0.19188	0.865000	0.49528	6.966000	0.76073	0.932000	0.37266	0.454000	0.30748	GAT		0.463	PNLIPRP2-004	KNOWN	basic	processed_transcript	polymorphic_pseudogene	OTTHUMT00000050546.6	NM_005396		23	39	0	0	0	0	23	39				
FAM196A	642938	broad.mit.edu	37	10	128974171	128974171	+	Silent	SNP	G	G	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr10:128974171G>C	ENST00000522781.1	-	4	1044	c.489C>G	c.(487-489)ggC>ggG	p.G163G	FAM196A_ENST00000424811.2_Silent_p.G163G|DOCK1_ENST00000280333.6_Intron	NM_001039762.2	NP_001034851.1	Q6ZSG2	F196A_HUMAN	family with sequence similarity 196, member A	163										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						CCCGCCCCGCGCCACATGGCC	0.552																																						uc001lju.1		NA																	0				ovary(2)	2						c.(487-489)GGC>GGG		hypothetical protein LOC642938							76.0	75.0	75.0					10																	128974171		2203	4300	6503	SO:0001819	synonymous_variant	642938							g.chr10:128974171G>C		CCDS31312.1	10q26.2	2009-09-11	2009-09-11	2009-09-11		ENSG00000188916			33859	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 141"""	C10orf141			Standard	NM_001039762		Approved	FLJ45557	uc001ljv.1	Q6ZSG2		ENST00000522781.1:c.489C>G	10.37:g.128974171G>C			Somatic				DOCK1_uc001ljt.2_Intron|DOCK1_uc010qun.1_Intron|FAM196A_uc010quo.1_Silent_p.G163G|FAM196A_uc001ljv.1_Silent_p.G163G|FAM196A_uc009yap.1_Silent_p.G163G	p.G163G	NM_001039762	NP_001034851	WXS	Illumina HiSeq	Unspecified	Q6ZSG2	F196A_HUMAN			1	530	-			163					B2RNT4|B7ZME7	Silent	SNP	ENST00000522781.1	37	c.489C>G	CCDS31312.1																																																																																				0.552	FAM196A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050978.2	NM_001039762		22	53	0	0	0	0	22	53				
FRG2B	441581	broad.mit.edu	37	10	135438781	135438781	+	Missense_Mutation	SNP	T	T	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr10:135438781T>C	ENST00000425520.1	-	4	711	c.659A>G	c.(658-660)cAg>cGg	p.Q220R	FRG2B_ENST00000443774.1_Missense_Mutation_p.Q221R	NM_001080998.1	NP_001074467.1	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	220						nucleus (GO:0005634)				endometrium(2)|kidney(2)|lung(14)|ovary(1)|prostate(1)	20		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		GGTCTGCACCTGGGCACACAG	0.597																																						uc010qvg.1		NA																	0					0						c.(658-660)CAG>CGG		FSHD region gene 2 family, member B							5.0	6.0	6.0					10																	135438781		1585	3556	5141	SO:0001583	missense	441581					nucleus		g.chr10:135438781T>C	AY744466	CCDS44502.1	10q26.3	2012-10-02			ENSG00000225899	ENSG00000225899			33518	protein-coding gene	gene with protein product						15520407	Standard	NM_001080998		Approved		uc010qvg.2	Q96QU4	OTTHUMG00000019328	ENST00000425520.1:c.659A>G	10.37:g.135438781T>C	ENSP00000401310:p.Gln220Arg		Somatic					p.Q220R	NM_001080998	NP_001074467	WXS	Illumina HiSeq	Unspecified	Q96QU4	FRG2B_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)	4	712	-		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)	220					Q5VSQ1	Missense_Mutation	SNP	ENST00000425520.1	37	c.659A>G	CCDS44502.1	.	.	.	.	.	.	.	.	.	.	.	8.497	0.863384	0.17250	.	.	ENSG00000225899	ENST00000443774;ENST00000425520	T;T	0.42900	0.96;0.96	.	.	.	.	2.568370	0.01797	N	0.032679	T	0.24044	0.0582	N	0.08118	0	0.09310	N	0.999997	B	0.26445	0.149	B	0.24848	0.056	T	0.23154	-1.0196	8	0.49607	T	0.09	0.8038	.	.	.	.	220	Q96QU4	FRG2B_HUMAN	R	221;220	ENSP00000408343:Q221R;ENSP00000401310:Q220R	ENSP00000401310:Q220R	Q	-	2	0	FRG2B	135288771	0.015000	0.18098	0.676000	0.29932	0.681000	0.39784	0.264000	0.18497	0.103000	0.17682	0.102000	0.15555	CAG		0.597	FRG2B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000467780.1	NM_001080998		10	21	0	0	0	0	10	21				
SIGIRR	59307	broad.mit.edu	37	11	408879	408879	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:408879C>T	ENST00000431843.2	-	3	328	c.22G>A	c.(22-24)Gcc>Acc	p.A8T	SIGIRR_ENST00000382520.2_Missense_Mutation_p.A8T|SIGIRR_ENST00000397632.3_Missense_Mutation_p.A8T|SIGIRR_ENST00000332725.3_Missense_Mutation_p.A8T|SIGIRR_ENST00000531205.1_Missense_Mutation_p.A8T|SIGIRR_ENST00000529486.1_Intron	NM_001135054.1	NP_001128526.1	Q6IA17	SIGIR_HUMAN	single immunoglobulin and toll-interleukin 1 receptor (TIR) domain	8					acute-phase response (GO:0006953)|negative regulation of chemokine biosynthetic process (GO:0045079)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				cervix(2)|endometrium(1)|liver(1)|lung(5)|prostate(2)|skin(1)|urinary_tract(1)	13		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AAGTCAGGGGCCCTATCACAG	0.617																																						uc001lpd.2		NA																	0					0						c.(22-24)GCC>ACC		single Ig IL-1R-related molecule							45.0	47.0	46.0					11																	408879		2199	4295	6494	SO:0001583	missense	59307				acute-phase response|innate immune response|negative regulation of chemokine biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of lipopolysaccharide-mediated signaling pathway|negative regulation of sequence-specific DNA binding transcription factor activity	integral to membrane	protein binding|transmembrane receptor activity	g.chr11:408879C>T		CCDS31325.1	11p15.5	2013-01-11	2005-10-10					"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30575	protein-coding gene	gene with protein product	"""single immunoglobulin domain IL1R1 related"""	605478				10346978	Standard	NM_021805		Approved	TIR8	uc001lpe.1	Q6IA17		ENST00000431843.2:c.22G>A	11.37:g.408879C>T	ENSP00000403104:p.Ala8Thr		Somatic				SIGIRR_uc001lpf.2_Missense_Mutation_p.A8T|SIGIRR_uc001lpe.1_Missense_Mutation_p.A8T|SIGIRR_uc001lpg.2_Missense_Mutation_p.A8T	p.A8T	NM_001135054	NP_001128526	WXS	Illumina HiSeq	Unspecified	Q6IA17	SIGIR_HUMAN		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)	3	352	-		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)	8			Extracellular (Potential).		Q3KQY2|Q6UXI3|Q9H733	Missense_Mutation	SNP	ENST00000431843.2	37	c.22G>A	CCDS31325.1	.	.	.	.	.	.	.	.	.	.	c	10.56	1.383318	0.25031	.	.	ENSG00000185187	ENST00000431843;ENST00000397632;ENST00000332725;ENST00000531205;ENST00000382520;ENST00000530494;ENST00000528058	T;T;T;T;T;T	0.71461	-0.57;-0.57;-0.57;-0.57;-0.57;-0.57	2.47	1.55	0.23275	Immunoglobulin-like fold (1);	0.962172	0.08553	N	0.928669	T	0.62865	0.2463	M	0.64997	1.995	0.23581	N	0.997366	P;P	0.49090	0.919;0.682	P;B	0.45343	0.477;0.154	T	0.51301	-0.8723	10	0.12103	T	0.63	.	1.262	0.02003	0.2223:0.4191:0.2179:0.1407	.	8;8	C9JFX4;Q6IA17	.;SIGIR_HUMAN	T	8;8;8;8;8;8;19	ENSP00000403104:A8T;ENSP00000380756:A8T;ENSP00000333656:A8T;ENSP00000433022:A8T;ENSP00000371960:A8T;ENSP00000434030:A8T	ENSP00000333656:A8T	A	-	1	0	SIGIRR	398879	0.209000	0.23505	0.561000	0.28357	0.040000	0.13550	0.149000	0.16243	0.606000	0.29965	0.305000	0.20034	GCC		0.617	SIGIRR-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383884.3	NM_021805		14	48	0	0	0	0	14	48				
MUC5B	727897	broad.mit.edu	37	11	1255445	1255445	+	Silent	SNP	C	C	A	rs374766645		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:1255445C>A	ENST00000529681.1	+	20	2446	c.2388C>A	c.(2386-2388)gcC>gcA	p.A796A	MUC5B_ENST00000447027.1_Silent_p.A799A	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	796					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GGTGTGCAGCCCCCATGGTGT	0.682																																						uc009ycr.1		NA																	0					0						c.(4363-4365)GCC>GCA		SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;							15.0	17.0	16.0					11																	1255445		1975	4130	6105	SO:0001819	synonymous_variant	727897				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding	g.chr11:1255445C>A	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.2388C>A	11.37:g.1255445C>A			Somatic				MUC5B_uc009yct.1_Silent_p.A796A|MUC5B_uc001ltb.2_Silent_p.A799A|MUC5B_uc001lta.2_Silent_p.A464A	p.A1455A	NM_017511	NP_059981	WXS	Illumina HiSeq	Unspecified	Q9HC84	MUC5B_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)	36	4491	+		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	796					O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	c.4365C>A	CCDS44515.2																																																																																				0.682	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093		3	6	1	0	0.00024832	0.00028114	3	6				
MUC5B	727897	broad.mit.edu	37	11	1268010	1268010	+	Silent	SNP	A	A	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:1268010A>C	ENST00000529681.1	+	31	9958	c.9900A>C	c.(9898-9900)ccA>ccC	p.P3300P	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Silent_p.P3303P	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	3300	17 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCTCCACCCCAGGAACAGCTC	0.637																																						uc009ycr.1		NA																	0					0						c.(11647-11649)CCA>CCC		SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;							53.0	73.0	67.0					11																	1268010		1907	4109	6016	SO:0001819	synonymous_variant	727897				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding	g.chr11:1268010A>C	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.9900A>C	11.37:g.1268010A>C			Somatic				MUC5B_uc001ltb.2_Silent_p.P3303P	p.P3883P	NM_017511	NP_059981	WXS	Illumina HiSeq	Unspecified	Q9HC84	MUC5B_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)	49	11775	+		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	3300	Missing (in Ref. 6; AAB61398).		7 X Cys-rich subdomain repeats.|Thr-rich.|17 X approximate tandem repeats, Ser/Thr- rich.		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	c.11649A>C	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	A	4.116	0.019668	0.08006	.	.	ENSG00000117983	ENST00000538459	.	.	.	1.64	1.64	0.23874	.	.	.	.	.	T	0.51822	0.1697	.	.	.	0.53688	D	0.999971	.	.	.	.	.	.	T	0.44832	-0.9302	4	.	.	.	.	5.0609	0.14557	0.7353:0.0:0.0:0.2647	.	.	.	.	P	184	.	.	Q	+	2	0	MUC5B	1224586	0.000000	0.05858	0.005000	0.12908	0.077000	0.17291	-0.639000	0.05446	1.011000	0.39340	0.164000	0.16699	CAG		0.637	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093		3	64	0	0	0	0	3	64				
MUC5B	727897	broad.mit.edu	37	11	1269681	1269681	+	Silent	SNP	A	A	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:1269681A>C	ENST00000529681.1	+	31	11629	c.11571A>C	c.(11569-11571)ccA>ccC	p.P3857P	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Silent_p.P3860P	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	3857	11 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CTTCCACCCCAGGAACAGCTC	0.647																																						uc009ycr.1		NA																	0					0						c.(13153-13155)CCA>CCC		SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;							105.0	120.0	115.0					11																	1269681		2045	4175	6220	SO:0001819	synonymous_variant	727897				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding	g.chr11:1269681A>C	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.11571A>C	11.37:g.1269681A>C			Somatic				MUC5B_uc001ltb.2_Silent_p.P3860P	p.P4385P	NM_017511	NP_059981	WXS	Illumina HiSeq	Unspecified	Q9HC84	MUC5B_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)	50	13281	+		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	3857			7 X Cys-rich subdomain repeats.|11 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	c.13155A>C	CCDS44515.2																																																																																				0.647	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093		11	27	0	0	0	0	11	27				
ZNF195	7748	broad.mit.edu	37	11	3381036	3381036	+	Missense_Mutation	SNP	T	T	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:3381036T>C	ENST00000399602.4	-	6	1328	c.1202A>G	c.(1201-1203)cAg>cGg	p.Q401R	ZNF195_ENST00000528796.1_Intron|ZNF195_ENST00000005082.9_Missense_Mutation_p.Q378R|ZNF195_ENST00000343338.7_Missense_Mutation_p.Q333R|ZNF195_ENST00000429541.2_Missense_Mutation_p.Q333R|ZNF195_ENST00000526601.1_Missense_Mutation_p.Q382R|ZNF195_ENST00000354599.6_Missense_Mutation_p.Q329R	NM_001130520.2	NP_001123992.1	O14628	ZN195_HUMAN	zinc finger protein 195	401				Missing (in Ref. 2; BAD18466). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)	17		Medulloblastoma(188;0.00106)|Breast(177;0.00328)|all_neural(188;0.00681)|Ovarian(85;0.00965)		BRCA - Breast invasive adenocarcinoma(625;0.0361)|LUSC - Lung squamous cell carcinoma(625;0.2)		CTCATTTCTCTGGTGTTTGGA	0.408																																						uc001lxt.2		NA																	0					0						c.(1201-1203)CAG>CGG		zinc finger protein 195 isoform 1							135.0	130.0	132.0					11																	3381036		1982	4183	6165	SO:0001583	missense	7748				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr11:3381036T>C		CCDS41604.1, CCDS44521.1, CCDS44522.1, CCDS55736.1, CCDS55737.1, CCDS58111.1	11p15.5	2013-01-08			ENSG00000005801	ENSG00000005801		"""Zinc fingers, C2H2-type"", ""-"""	12986	protein-coding gene	gene with protein product		602187				9344677	Standard	NM_001130520		Approved		uc001lxt.3	O14628	OTTHUMG00000011694	ENST00000399602.4:c.1202A>G	11.37:g.3381036T>C	ENSP00000382511:p.Gln401Arg		Somatic				uc001lxr.2_5'Flank|ZNF195_uc001lxv.2_Missense_Mutation_p.Q378R|ZNF195_uc001lxs.2_Missense_Mutation_p.Q329R|ZNF195_uc010qxr.1_Missense_Mutation_p.Q382R|ZNF195_uc009ydz.2_Missense_Mutation_p.Q356R|ZNF195_uc001lxu.2_Missense_Mutation_p.Q333R	p.Q401R	NM_001130520	NP_001123992	WXS	Illumina HiSeq	Unspecified	O14628	ZN195_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.0361)|LUSC - Lung squamous cell carcinoma(625;0.2)	6	1380	-		Medulloblastoma(188;0.00106)|Breast(177;0.00328)|all_neural(188;0.00681)|Ovarian(85;0.00965)	401	Missing (in Ref. 2; BAD18466).				A8K234|B3KTK2|B4DEL0|C9JLY9|L7MNK2|Q0VAJ6|Q658N8|Q6ZNA9	Missense_Mutation	SNP	ENST00000399602.4	37	c.1202A>G	CCDS44522.1	.	.	.	.	.	.	.	.	.	.	t	9.076	0.998143	0.19043	.	.	ENSG00000005801	ENST00000354599;ENST00000399602;ENST00000343338;ENST00000429541;ENST00000005082;ENST00000526601	T;T;T;T;T;T	0.16196	2.36;2.36;2.36;2.36;2.36;2.36	1.27	1.27	0.21489	.	.	.	.	.	T	0.19287	0.0463	L	0.33624	1.015	0.21184	N	0.999769	B;P;P;P;P;P	0.50819	0.061;0.939;0.695;0.925;0.492;0.925	B;B;P;B;P;B	0.54401	0.161;0.396;0.636;0.204;0.751;0.204	T	0.12167	-1.0558	9	0.38643	T	0.18	.	6.268	0.20939	0.0:0.0:0.0:1.0	.	382;260;378;333;401;329	O14628-6;Q59EZ7;O14628-5;O14628-7;O14628;O14628-4	.;.;.;.;ZN195_HUMAN;.	R	329;401;333;333;378;382	ENSP00000346613:Q329R;ENSP00000382511:Q401R;ENSP00000344483:Q333R;ENSP00000387998:Q333R;ENSP00000005082:Q378R;ENSP00000435828:Q382R	ENSP00000005082:Q378R	Q	-	2	0	ZNF195	3337612	0.002000	0.14202	0.015000	0.15790	0.242000	0.25591	0.007000	0.13174	0.535000	0.28714	0.254000	0.18369	CAG		0.408	ZNF195-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000032321.2			81	239	0	0	0	0	81	239				
HBE1	3046	broad.mit.edu	37	11	5290723	5290723	+	Silent	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:5290723C>A	ENST00000380237.1	-	4	620	c.276G>T	c.(274-276)ctG>ctT	p.L92L	HBE1_ENST00000292896.2_Silent_p.L92L|HBG2_ENST00000380259.2_Intron|HBG2_ENST00000380252.1_Intron			P02100	HBE_HUMAN	hemoglobin, epsilon 1	92					blood coagulation (GO:0007596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein heterooligomerization (GO:0051291)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|hemoglobin complex (GO:0005833)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|skin(1)	20		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.34e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGTCACAGTGCAGCTCACTCA	0.458																																						uc001mal.1		NA																	0					0						c.(274-276)CTG>CTT		epsilon globin							140.0	129.0	133.0					11																	5290723		2201	4298	6499	SO:0001819	synonymous_variant	3046				blood coagulation	hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity	g.chr11:5290723C>A	BC015537	CCDS7756.1	11p15.5	2012-10-02			ENSG00000213931	ENSG00000213931			4830	protein-coding gene	gene with protein product		142100				2649166	Standard	NM_005330		Approved	HBE	uc001mal.1	P02100	OTTHUMG00000066675	ENST00000380237.1:c.276G>T	11.37:g.5290723C>A			Somatic				HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Silent_p.L92L	p.L92L	NM_005330	NP_005321	WXS	Illumina HiSeq	Unspecified	P02100	HBE_HUMAN		Epithelial(150;1.34e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	2	529	-		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)	92					Q6FH44	Silent	SNP	ENST00000380237.1	37	c.276G>T	CCDS7756.1																																																																																				0.458	HBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142973.2	NM_005330		33	135	1	0	6.53e-20	9.76e-20	33	135				
OR51M1	390059	broad.mit.edu	37	11	5411012	5411012	+	Silent	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:5411012C>T	ENST00000328611.3	+	1	406	c.384C>T	c.(382-384)ctC>ctT	p.L128L	HBG2_ENST00000380259.2_Intron|AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380252.1_Intron|HBE1_ENST00000380237.1_Intron	NM_001004756.2	NP_001004756.2	Q9H341	O51M1_HUMAN	olfactory receptor, family 51, subfamily M, member 1	128					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(16)|upper_aerodigestive_tract(1)	30		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.98e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CAGTGCTCCTCATGATGTCCT	0.488																																						uc010qzc.1		NA																	0					0						c.(382-384)CTC>CTT		olfactory receptor, family 51, subfamily M,							230.0	220.0	223.0					11																	5411012		2057	4243	6300	SO:0001819	synonymous_variant	390059					integral to membrane	olfactory receptor activity	g.chr11:5411012C>T	BK004382	CCDS53596.1	11p15.4	2012-08-09			ENSG00000184698	ENSG00000184698		"""GPCR / Class A : Olfactory receptors"""	14847	protein-coding gene	gene with protein product							Standard	NM_001004756		Approved		uc010qzc.2	Q9H341	OTTHUMG00000066680	ENST00000328611.3:c.384C>T	11.37:g.5411012C>T			Somatic				HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	p.L128L	NM_001004756	NP_001004756	WXS	Illumina HiSeq	Unspecified	B2RNI9	B2RNI9_HUMAN		Epithelial(150;1.98e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	384	+		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)	128					Q6IF80	Silent	SNP	ENST00000328611.3	37	c.384C>T	CCDS53596.1																																																																																				0.488	OR51M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142981.1	NM_001004756		82	307	0	0	0	0	82	307				
OR56A4	120793	broad.mit.edu	37	11	6024019	6024019	+	Silent	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:6024019G>A	ENST00000330728.4	-	1	405	c.360C>T	c.(358-360)ctC>ctT	p.L120L		NM_001005179.2	NP_001005179.2	Q8NGH8	O56A4_HUMAN	olfactory receptor, family 56, subfamily A, member 4	68						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(4)|large_intestine(5)|lung(17)|ovary(1)|skin(1)|urinary_tract(1)	32		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GCAGGGAGAGGAGGCTGAGCA	0.607																																						uc010qzv.1		NA																	0				central_nervous_system(1)|skin(1)	2						c.(358-360)CTC>CTT		olfactory receptor, family 56, subfamily A,							71.0	70.0	70.0					11																	6024019		2201	4292	6493	SO:0001819	synonymous_variant	120793				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6024019G>A	BK004255	CCDS31404.1	11p15.4	2012-08-09			ENSG00000183389	ENSG00000183389		"""GPCR / Class A : Olfactory receptors"""	14791	protein-coding gene	gene with protein product							Standard	NM_001005179		Approved		uc010qzv.2	Q8NGH8	OTTHUMG00000165376	ENST00000330728.4:c.360C>T	11.37:g.6024019G>A			Somatic					p.L120L	NM_001005179	NP_001005179	WXS	Illumina HiSeq	Unspecified	Q8NGH8	O56A4_HUMAN		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	360	-		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)	68			Helical; Name=2; (Potential).		B9EH17	Silent	SNP	ENST00000330728.4	37	c.360C>T	CCDS31404.1																																																																																				0.607	OR56A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383756.2	NM_001005179		25	85	0	0	0	0	25	85				
OR2AG2	338755	broad.mit.edu	37	11	6789565	6789565	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:6789565C>A	ENST00000338569.2	-	1	721	c.624G>T	c.(622-624)ttG>ttT	p.L208F		NM_001004490.1	NP_001004490.1	A6NM03	O2AG2_HUMAN	olfactory receptor, family 2, subfamily AG, member 2	208						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(13)|ovary(1)|skin(5)|stomach(1)|urinary_tract(1)	28		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		AAATGGGGAGCAAGAGGAAAG	0.502																																						uc001meq.1		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(622-624)TTG>TTT		olfactory receptor, family 2, subfamily AG,							90.0	81.0	84.0					11																	6789565		2201	4296	6497	SO:0001583	missense	338755				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6789565C>A	AB065539	CCDS31413.1	11p15.4	2012-08-09		2004-03-10	ENSG00000188124	ENSG00000188124		"""GPCR / Class A : Olfactory receptors"""	15143	protein-coding gene	gene with protein product				OR2AG2P			Standard	NM_001004490		Approved		uc001meq.1	A6NM03	OTTHUMG00000165868	ENST00000338569.2:c.624G>T	11.37:g.6789565C>A	ENSP00000342697:p.Leu208Phe		Somatic					p.L208F	NM_001004490	NP_001004490	WXS	Illumina HiSeq	Unspecified	A6NM03	O2AG2_HUMAN		Epithelial(150;2.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)	1	624	-		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)	208			Helical; Name=5; (Potential).			Missense_Mutation	SNP	ENST00000338569.2	37	c.624G>T	CCDS31413.1	.	.	.	.	.	.	.	.	.	.	C	10.37	1.331499	0.24167	.	.	ENSG00000188124	ENST00000338569	T	0.39056	1.1	4.47	0.0505	0.14293	GPCR, rhodopsin-like superfamily (1);	0.540328	0.15170	N	0.276706	T	0.26593	0.0650	L	0.28458	0.855	0.09310	N	1	B	0.18610	0.029	B	0.22880	0.042	T	0.21827	-1.0234	10	0.72032	D	0.01	.	4.2165	0.10537	0.2086:0.5193:0.0:0.2721	.	208	A6NM03	O2AG2_HUMAN	F	208	ENSP00000342697:L208F	ENSP00000342697:L208F	L	-	3	2	OR2AG2	6746141	0.000000	0.05858	0.003000	0.11579	0.980000	0.70556	-2.102000	0.01343	0.015000	0.14971	0.655000	0.94253	TTG		0.502	OR2AG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386775.1	NM_001004490		10	34	1	0	0.00829132	0.00880817	10	34				
ANO5	203859	broad.mit.edu	37	11	22294481	22294481	+	Silent	SNP	A	A	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:22294481A>T	ENST00000324559.8	+	19	2498	c.2181A>T	c.(2179-2181)atA>atT	p.I727I	ANO5_ENST00000532043.1_3'UTR	NM_001142649.1|NM_213599.2	NP_001136121.1|NP_998764.1	Q75V66	ANO5_HUMAN	anoctamin 5	727					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	intracellular calcium activated chloride channel activity (GO:0005229)			breast(2)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(12)|lung(36)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CTCATAGCATAGGTGTTTGGC	0.403																																						uc001mqi.2		NA																	0				central_nervous_system(3)|ovary(1)	4						c.(2179-2181)ATA>ATT		anoctamin 5 isoform a							160.0	153.0	155.0					11																	22294481		2203	4300	6503	SO:0001819	synonymous_variant	203859					chloride channel complex|endoplasmic reticulum membrane	chloride channel activity	g.chr11:22294481A>T	AL833271	CCDS31444.1	11p15.1	2014-09-17	2008-08-28	2008-08-28	ENSG00000171714	ENSG00000171714		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	27337	protein-coding gene	gene with protein product		608662	"""transmembrane protein 16E"", ""limb girdle muscular dystrophy 2L (autosomal recessive)"""	TMEM16E, LGMD2L		15067359, 20096397, 24692353	Standard	NM_213599		Approved	GDD1	uc001mqi.2	Q75V66	OTTHUMG00000166051	ENST00000324559.8:c.2181A>T	11.37:g.22294481A>T			Somatic				ANO5_uc001mqj.2_Silent_p.I726I	p.I727I	NM_213599	NP_998764	WXS	Illumina HiSeq	Unspecified	Q75V66	ANO5_HUMAN			19	2498	+			727			Cytoplasmic (Potential).			Silent	SNP	ENST00000324559.8	37	c.2181A>T	CCDS31444.1																																																																																				0.403	ANO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387615.1	NM_213599		42	144	0	0	0	0	42	144				
KCNA4	3739	broad.mit.edu	37	11	30033431	30033431	+	Silent	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:30033431G>T	ENST00000328224.6	-	2	2028	c.795C>A	c.(793-795)gcC>gcA	p.A265A	KCNA4_ENST00000526518.1_5'Flank	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4	265					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	ACTTCAACAGGGCCTCCTCCC	0.488																																						uc001msk.2		NA																	0				ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(793-795)GCC>GCA		potassium voltage-gated channel, shaker-related							73.0	67.0	69.0					11																	30033431		1871	4130	6001	SO:0001819	synonymous_variant	3739					voltage-gated potassium channel complex	potassium ion binding|protein binding|voltage-gated potassium channel activity	g.chr11:30033431G>T	M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.795C>A	11.37:g.30033431G>T			Somatic					p.A265A	NM_002233	NP_002224	WXS	Illumina HiSeq	Unspecified	P22459	KCNA4_HUMAN			2	1947	-			265						Silent	SNP	ENST00000328224.6	37	c.795C>A	CCDS41629.1																																																																																				0.488	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388074.2	NM_002233		40	103	1	0	1.05e-18	1.54e-18	40	103				
LRRC4C	57689	broad.mit.edu	37	11	40136727	40136727	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:40136727C>A	ENST00000278198.2	-	2	3079	c.1116G>T	c.(1114-1116)gaG>gaT	p.E372D	LRRC4C_ENST00000530763.1_Missense_Mutation_p.E372D|LRRC4C_ENST00000528697.1_Missense_Mutation_p.E372D|LRRC4C_ENST00000527150.1_Missense_Mutation_p.E372D			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	372	Ig-like C2-type.				regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)				NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				GACATTTCAGCTCAGCTGCCA	0.517																																						uc001mxa.1		NA																	0				ovary(4)|skin(3)|central_nervous_system(1)	8						c.(1114-1116)GAG>GAT		netrin-G1 ligand precursor							88.0	80.0	83.0					11																	40136727		2203	4300	6503	SO:0001583	missense	57689				regulation of axonogenesis	integral to membrane	protein binding	g.chr11:40136727C>A	AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.1116G>T	11.37:g.40136727C>A	ENSP00000278198:p.Glu372Asp		Somatic				LRRC4C_uc001mxc.1_Missense_Mutation_p.E368D|LRRC4C_uc001mxd.1_Missense_Mutation_p.E368D|LRRC4C_uc001mxb.1_Missense_Mutation_p.E368D	p.E372D	NM_020929	NP_065980	WXS	Illumina HiSeq	Unspecified	Q9HCJ2	LRC4C_HUMAN			2	3080	-		all_lung(304;0.0575)|Lung NSC(402;0.138)	372			Ig-like C2-type.		A8K0T1|Q7L0N3	Missense_Mutation	SNP	ENST00000278198.2	37	c.1116G>T	CCDS31464.1	.	.	.	.	.	.	.	.	.	.	C	11.98	1.800198	0.31869	.	.	ENSG00000148948	ENST00000278198;ENST00000527150;ENST00000528697;ENST00000530763	T;T;T;T	0.28255	1.62;1.62;1.62;1.62	5.87	5.87	0.94306	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.34135	0.0887	L	0.46947	1.48	0.58432	D	0.999998	B	0.21905	0.062	B	0.28139	0.086	T	0.03887	-1.0995	10	0.37606	T	0.19	.	19.2669	0.93990	0.0:1.0:0.0:0.0	.	372	Q9HCJ2	LRC4C_HUMAN	D	372	ENSP00000278198:E372D;ENSP00000436976:E372D;ENSP00000437132:E372D;ENSP00000434761:E372D	ENSP00000278198:E372D	E	-	3	2	LRRC4C	40093303	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	2.627000	0.46469	2.798000	0.96311	0.650000	0.86243	GAG		0.517	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389499.1	NM_020929		28	60	1	0	2.82e-10	3.8e-10	28	60				
ALX4	60529	broad.mit.edu	37	11	44296974	44296974	+	Missense_Mutation	SNP	T	T	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:44296974T>A	ENST00000329255.3	-	2	804	c.701A>T	c.(700-702)cAg>cTg	p.Q234L		NM_021926.3	NP_068745.2	Q9H161	ALX4_HUMAN	ALX homeobox 4	234					anterior/posterior pattern specification (GO:0009952)|digestive tract development (GO:0048565)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal system morphogenesis (GO:0048704)|hair follicle development (GO:0001942)|muscle organ development (GO:0007517)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of apoptotic process (GO:0042981)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	16						GTGGGTCTTCTGGAAGACCTT	0.617																																						uc001myb.2		NA																	0					0						c.(700-702)CAG>CTG		aristaless-like homeobox 4							123.0	125.0	124.0					11																	44296974		2203	4299	6502	SO:0001583	missense	60529				hair follicle development			g.chr11:44296974T>A	AF294629	CCDS31468.1	11p11.2	2011-06-20	2008-11-04		ENSG00000052850	ENSG00000052850		"""Homeoboxes / PRD class"""	450	protein-coding gene	gene with protein product		605420	"""parietal foramina 2"", ""aristaless-like homeobox 4"""	PFM2		11017806, 8644736	Standard	NM_021926		Approved	FPP, PFM, KIAA1788	uc001myb.3	Q9H161	OTTHUMG00000166557	ENST00000329255.3:c.701A>T	11.37:g.44296974T>A	ENSP00000332744:p.Gln234Leu		Somatic					p.Q234L	NM_021926	NP_068745	WXS	Illumina HiSeq	Unspecified	Q9H161	ALX4_HUMAN			2	805	-			234			Homeobox.		Q96JN7|Q9H198|Q9HAY9	Missense_Mutation	SNP	ENST00000329255.3	37	c.701A>T	CCDS31468.1	.	.	.	.	.	.	.	.	.	.	T	19.25	3.792293	0.70452	.	.	ENSG00000052850	ENST00000329255	D	0.96300	-3.97	3.74	3.74	0.42951	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.220326	0.40469	N	0.001085	D	0.93406	0.7897	L	0.47016	1.485	0.80722	D	1	B	0.31705	0.336	B	0.29440	0.102	D	0.93101	0.6508	10	0.87932	D	0	.	12.6143	0.56567	0.0:0.0:0.0:1.0	.	234	Q9H161	ALX4_HUMAN	L	234	ENSP00000332744:Q234L	ENSP00000332744:Q234L	Q	-	2	0	ALX4	44253550	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.839000	0.86812	1.572000	0.49736	0.374000	0.22700	CAG		0.617	ALX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390399.1			89	220	0	0	0	0	89	220				
OR4A5	81318	broad.mit.edu	37	11	51411677	51411678	+	Missense_Mutation	DNP	CC	CC	AA	rs5011055	byFrequency	TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:51411677_51411678CC>AA	ENST00000319760.6	-	1	770_771	c.718_719GG>TT	c.(718-720)GGc>TTc	p.G240F		NM_001005272.3	NP_001005272.3	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A, member 5	240						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(28)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	49		all_lung(304;0.236)				AACGGTACTGCCGGAGCTGCAG	0.401																																						uc001nhi.1		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(718-720)GGC>TTC		olfactory receptor, family 4, subfamily A,																																				SO:0001583	missense	81318				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:51411677_51411678CC>AA	AB065506	CCDS73289.1	11p11.12	2012-08-09			ENSG00000221840	ENSG00000221840		"""GPCR / Class A : Olfactory receptors"""	15162	protein-coding gene	gene with protein product							Standard	NM_001005272		Approved		uc001nhi.2	Q8NH83	OTTHUMG00000166764	ENST00000319760.6:c.718_719delinsAA	11.37:g.51411677_51411678delinsAA	ENSP00000367664:p.Gly240Phe		Somatic					p.G240F	NM_001005272	NP_001005272	WXS	Illumina HiSeq	Unspecified	Q8NH83	OR4A5_HUMAN			1	718_719	-		all_lung(304;0.236)	240			Helical; Name=6; (Potential).		Q6IF84	Missense_Mutation	DNP	ENST00000319760.6	37	c.718_719GG>TT	CCDS31497.1																																																																																				0.401	OR4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391399.1	NM_001005272		5	65	0	0	0	0	5	65				
OR5L1	219437	broad.mit.edu	37	11	55579236	55579237	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:55579236_55579237GG>TT	ENST00000333973.2	+	1	383_384	c.294_295GG>TT	c.(292-297)atGGtg>atTTtg	p.98_99MV>IL		NM_001004738.1	NP_001004738.1	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L, member 1	98						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M98_V99>IM(1)		NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(4)|liver(4)|lung(36)|ovary(2)|pancreas(1)|prostate(5)|skin(9)|stomach(4)|upper_aerodigestive_tract(3)	78		all_epithelial(135;0.208)				TAGGGTGCATGGTGCAATTCTA	0.45																																						uc001nhw.1		NA																	1	Complex - compound substitution(1)		lung(1)	skin(3)|ovary(2)	5						c.(292-297)ATGGTG>ATTTTG		olfactory receptor, family 5, subfamily L,																																				SO:0001583	missense	219437				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55579236_55579237GG>TT	AB065780	CCDS31509.1	11q11	2012-08-09			ENSG00000186117	ENSG00000186117		"""GPCR / Class A : Olfactory receptors"""	8350	protein-coding gene	gene with protein product							Standard	NM_001004738		Approved	OST262	uc001nhw.1	Q8NGL2	OTTHUMG00000166810	Exception_encountered	11.37:g.55579236_55579237delinsTT	ENSP00000335529:p.M98_V99delinsIL		Somatic					p.98_99MV>IL	NM_001004738	NP_001004738	WXS	Illumina HiSeq	Unspecified	Q8NGL2	OR5L1_HUMAN			1	294_295	+		all_epithelial(135;0.208)	98_99			Extracellular (Potential).		B2RNK6|Q6IFD0	Missense_Mutation	DNP	ENST00000333973.2	37	c.294_295GG>TT	CCDS31509.1																																																																																				0.450	OR5L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391514.1	NM_001004738		29	251	0	0	0	0	29	251				
OR5D18	219438	broad.mit.edu	37	11	55587970	55587970	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:55587970C>A	ENST00000333976.4	+	1	885	c.865C>A	c.(865-867)Ctg>Atg	p.L289M		NM_001001952.1	NP_001001952.1	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D, member 18	289						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(3)|large_intestine(6)|lung(33)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		all_epithelial(135;0.208)				GTTGAATCCCCTGATCTACAG	0.458																																						uc010rin.1		NA																	0				skin(2)|ovary(1)	3						c.(865-867)CTG>ATG		olfactory receptor, family 5, subfamily D,							78.0	80.0	79.0					11																	55587970		2200	4296	6496	SO:0001583	missense	219438				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55587970C>A	AB065781	CCDS31510.1	11q11	2012-08-09			ENSG00000186119	ENSG00000186119		"""GPCR / Class A : Olfactory receptors"""	15285	protein-coding gene	gene with protein product							Standard	NM_001001952		Approved		uc010rin.2	Q8NGL1	OTTHUMG00000166811	ENST00000333976.4:c.865C>A	11.37:g.55587970C>A	ENSP00000335025:p.Leu289Met		Somatic					p.L289M	NM_001001952	NP_001001952	WXS	Illumina HiSeq	Unspecified	Q8NGL1	OR5DI_HUMAN			1	865	+		all_epithelial(135;0.208)	289			Helical; Name=7; (Potential).		Q6IF67|Q6IFD3|Q96RB3	Missense_Mutation	SNP	ENST00000333976.4	37	c.865C>A	CCDS31510.1	.	.	.	.	.	.	.	.	.	.	.	10.69	1.420568	0.25639	.	.	ENSG00000186119	ENST00000333976	T	0.45668	0.89	5.14	0.846	0.18955	GPCR, rhodopsin-like superfamily (1);	0.000000	0.31061	N	0.008331	T	0.41396	0.1157	M	0.66439	2.03	0.09310	N	0.999996	P	0.50819	0.939	P	0.48304	0.573	T	0.33650	-0.9860	10	0.62326	D	0.03	-15.2649	4.1975	0.10450	0.2676:0.5052:0.0:0.2272	.	289	Q8NGL1	OR5DI_HUMAN	M	289	ENSP00000335025:L289M	ENSP00000335025:L289M	L	+	1	2	OR5D18	55344546	0.000000	0.05858	0.315000	0.25238	0.075000	0.17131	-4.136000	0.00288	-0.013000	0.14199	0.573000	0.79308	CTG		0.458	OR5D18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391515.1	NM_001001952		7	70	1	0	8.13e-05	9.38e-05	7	70				
OR5L2	26338	broad.mit.edu	37	11	55594988	55594989	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:55594988_55594989GG>TT	ENST00000378397.1	+	1	294_295	c.294_295GG>TT	c.(292-297)atGGtg>atTTtg	p.98_99MV>IL		NM_001004739.1	NP_001004739.1	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L, member 2	98						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|large_intestine(1)|lung(42)|ovary(1)|prostate(3)|skin(1)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	59		all_epithelial(135;0.208)				TAGGGTGCATGGTGCAATTCTA	0.465										HNSCC(27;0.073)																												uc001nhy.1		NA																	0				ovary(1)	1						c.(292-297)ATGGTG>ATTTTG		olfactory receptor, family 5, subfamily L,																																				SO:0001583	missense	26338				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55594988_55594989GG>TT	AB065782	CCDS31511.1	11q11	2012-08-09			ENSG00000205030	ENSG00000205030		"""GPCR / Class A : Olfactory receptors"""	8351	protein-coding gene	gene with protein product						1370859	Standard	NM_001004739		Approved	HTPCRX16, HSHTPCRX16	uc001nhy.1	Q8NGL0	OTTHUMG00000166812	Exception_encountered	11.37:g.55594988_55594989delinsTT	ENSP00000367650:p.M98_V99delinsIL	HNSCC(27;0.073)	Somatic					p.98_99MV>IL	NM_001004739	NP_001004739	WXS	Illumina HiSeq	Unspecified	Q8NGL0	OR5L2_HUMAN			1	294_295	+		all_epithelial(135;0.208)	98_99			Extracellular (Potential).		Q6IF66|Q96RB2	Missense_Mutation	DNP	ENST00000378397.1	37	c.294_295GG>TT	CCDS31511.1																																																																																				0.465	OR5L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391516.1	NM_001004739		21	129	0	0	0	0	21	129				
OR10AG1	282770	broad.mit.edu	37	11	55735898	55735898	+	Silent	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:55735898G>A	ENST00000312345.2	-	1	92	c.42C>T	c.(40-42)ctC>ctT	p.L14L		NM_001005491.1	NP_001005491.1	Q8NH19	O10AG_HUMAN	olfactory receptor, family 10, subfamily AG, member 1	14						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(24)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	40	Esophageal squamous(21;0.0137)					GCATCCAGTGGAGATTGGGAA	0.338																																						uc010rit.1		NA																	0				skin(2)	2						c.(40-42)CTC>CTT		olfactory receptor, family 10, subfamily AG,							35.0	39.0	38.0					11																	55735898		2193	4284	6477	SO:0001819	synonymous_variant	282770				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55735898G>A	AB065594	CCDS31514.1	11q11	2012-08-09			ENSG00000174970	ENSG00000174970		"""GPCR / Class A : Olfactory receptors"""	19607	protein-coding gene	gene with protein product							Standard	NM_001005491		Approved		uc010rit.2	Q8NH19	OTTHUMG00000166824	ENST00000312345.2:c.42C>T	11.37:g.55735898G>A			Somatic					p.L14L	NM_001005491	NP_001005491	WXS	Illumina HiSeq	Unspecified	Q8NH19	O10AG_HUMAN			1	42	-	Esophageal squamous(21;0.0137)		14			Extracellular (Potential).		B2RNH4|Q6IEU3	Silent	SNP	ENST00000312345.2	37	c.42C>T	CCDS31514.1																																																																																				0.338	OR10AG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391531.1	NM_001005491		4	75	0	0	0	0	4	75				
OR8K3	219473	broad.mit.edu	37	11	56085893	56085893	+	Silent	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:56085893C>A	ENST00000312711.1	+	1	111	c.111C>A	c.(109-111)atC>atA	p.I37I		NM_001005202.1	NP_001005202.1	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K, member 3	37						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|ovary(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	40	Esophageal squamous(21;0.00448)					TCTATGTGATCTCAGTGATGG	0.433																																						uc010rjf.1		NA																	0				ovary(2)|large_intestine(1)|central_nervous_system(1)	4						c.(109-111)ATC>ATA		olfactory receptor, family 8, subfamily K,							212.0	194.0	200.0					11																	56085893		2201	4296	6497	SO:0001819	synonymous_variant	219473				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56085893C>A	AB065541	CCDS31527.1	11q11	2012-08-09			ENSG00000181689	ENSG00000181689		"""GPCR / Class A : Olfactory receptors"""	15313	protein-coding gene	gene with protein product							Standard	NM_001005202		Approved		uc010rjf.2	Q8NH51	OTTHUMG00000166855	ENST00000312711.1:c.111C>A	11.37:g.56085893C>A			Somatic					p.I37I	NM_001005202	NP_001005202	WXS	Illumina HiSeq	Unspecified	Q8NH51	OR8K3_HUMAN			1	111	+	Esophageal squamous(21;0.00448)		37			Helical; Name=1; (Potential).		Q6IFC4	Silent	SNP	ENST00000312711.1	37	c.111C>A	CCDS31527.1																																																																																				0.433	OR8K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391602.1	NM_001005202		65	119	1	0	5.09e-23	7.73e-23	65	119				
OR5M3	219482	broad.mit.edu	37	11	56237592	56237592	+	Missense_Mutation	SNP	G	G	T	rs571938065	byFrequency	TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:56237592G>T	ENST00000312240.2	-	1	422	c.382C>A	c.(382-384)Ctg>Atg	p.L128M		NM_001004742.2	NP_001004742.2	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M, member 3	128						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(15)|ovary(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	37	Esophageal squamous(21;0.00448)					CCATAAAGCAGAGGATTCCCA	0.393																																						uc010rjk.1		NA																	0				ovary(2)	2						c.(382-384)CTG>ATG		olfactory receptor, family 5, subfamily M,							96.0	90.0	92.0					11																	56237592		2201	4269	6470	SO:0001583	missense	219482				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56237592G>T	AB065746	CCDS31532.1	11q11	2012-08-09			ENSG00000174937	ENSG00000174937		"""GPCR / Class A : Olfactory receptors"""	14806	protein-coding gene	gene with protein product							Standard	NM_001004742		Approved		uc010rjk.2	Q8NGP4	OTTHUMG00000166875	ENST00000312240.2:c.382C>A	11.37:g.56237592G>T	ENSP00000312208:p.Leu128Met		Somatic					p.L128M	NM_001004742	NP_001004742	WXS	Illumina HiSeq	Unspecified	Q8NGP4	OR5M3_HUMAN			1	382	-	Esophageal squamous(21;0.00448)		128			Cytoplasmic (Potential).		B2RNM7|Q6IEW4|Q96RC0	Missense_Mutation	SNP	ENST00000312240.2	37	c.382C>A	CCDS31532.1	.	.	.	.	.	.	.	.	.	.	G	10.89	1.478700	0.26511	.	.	ENSG00000174937	ENST00000312240	T	0.01359	4.98	5.13	1.18	0.20946	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36234	N	0.002717	T	0.10337	0.0253	H	0.94582	3.555	0.27239	N	0.95919	D	0.89917	1.0	D	0.91635	0.999	T	0.02567	-1.1140	10	0.87932	D	0	-9.0034	8.8807	0.35374	0.3158:0.0:0.6842:0.0	.	128	Q8NGP4	OR5M3_HUMAN	M	128	ENSP00000312208:L128M	ENSP00000312208:L128M	L	-	1	2	OR5M3	55994168	0.000000	0.05858	0.958000	0.39756	0.006000	0.05464	-0.422000	0.07043	0.201000	0.20466	-1.506000	0.00953	CTG		0.393	OR5M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391639.1	NM_001004742		35	114	1	0	6.34e-27	9.76e-27	35	114				
OR5M8	219484	broad.mit.edu	37	11	56258070	56258070	+	Silent	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:56258070G>A	ENST00000327216.2	-	1	801	c.777C>T	c.(775-777)ctC>ctT	p.L259L		NM_001005282.1	NP_001005282.1	Q8NGP6	OR5M8_HUMAN	olfactory receptor, family 5, subfamily M, member 8	259						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(22)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	Esophageal squamous(21;0.00352)					AGGGGGGTCTGAGATACATGA	0.413																																						uc001nix.1		NA																	0				central_nervous_system(1)	1						c.(775-777)CTC>CTT		olfactory receptor, family 5, subfamily M,							39.0	44.0	42.0					11																	56258070		2201	4296	6497	SO:0001819	synonymous_variant	219484				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56258070G>A	AB065744	CCDS31533.1	11q11	2012-08-09			ENSG00000181371	ENSG00000181371		"""GPCR / Class A : Olfactory receptors"""	14846	protein-coding gene	gene with protein product							Standard	NM_001005282		Approved		uc001nix.1	Q8NGP6	OTTHUMG00000166877	ENST00000327216.2:c.777C>T	11.37:g.56258070G>A			Somatic					p.L259L	NM_001005282	NP_001005282	WXS	Illumina HiSeq	Unspecified	Q8NGP6	OR5M8_HUMAN			1	777	-	Esophageal squamous(21;0.00352)		259			Extracellular (Potential).		B2RNM5|Q6IEW3|Q96RB8	Silent	SNP	ENST00000327216.2	37	c.777C>T	CCDS31533.1																																																																																				0.413	OR5M8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391641.1	NM_001005282		34	59	0	0	0	0	34	59				
OR5AR1	219493	broad.mit.edu	37	11	56431893	56431893	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:56431893C>A	ENST00000302969.2	+	1	756	c.732C>A	c.(730-732)caC>caA	p.H244Q		NM_001004730.1	NP_001004730.1	Q8NGP9	O5AR1_HUMAN	olfactory receptor, family 5, subfamily AR, member 1 (gene/pseudogene)	244						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(12)|prostate(1)|skin(3)|stomach(1)	26						GCGGGTCTCACCTTACTGGCA	0.498																																						uc010rjm.1		NA																	0					0						c.(730-732)CAC>CAA		olfactory receptor, family 5, subfamily AR,							150.0	129.0	136.0					11																	56431893		2201	4296	6497	SO:0001583	missense	219493				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56431893C>A	AB065740	CCDS31535.1	11q11	2013-10-10	2013-10-10		ENSG00000172459	ENSG00000172459		"""GPCR / Class A : Olfactory receptors"""	15260	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily AR, member 1"""				Standard	NM_001004730		Approved		uc010rjm.2	Q8NGP9	OTTHUMG00000154213	ENST00000302969.2:c.732C>A	11.37:g.56431893C>A	ENSP00000302639:p.His244Gln		Somatic					p.H244Q	NM_001004730	NP_001004730	WXS	Illumina HiSeq	Unspecified	Q8NGP9	O5AR1_HUMAN			1	732	+			244			Helical; Name=6; (Potential).		Q6IF61	Missense_Mutation	SNP	ENST00000302969.2	37	c.732C>A	CCDS31535.1	.	.	.	.	.	.	.	.	.	.	C	16.67	3.186973	0.57909	.	.	ENSG00000172459	ENST00000302969	T	0.00307	8.17	5.06	1.72	0.24424	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49916	D	0.000128	T	0.00580	0.0019	H	0.95884	3.735	0.33185	D	0.550055	P	0.47604	0.898	P	0.49192	0.602	T	0.21690	-1.0238	10	0.87932	D	0	.	8.6356	0.33945	0.0:0.7077:0.0:0.2923	.	244	Q8NGP9	O5AR1_HUMAN	Q	244	ENSP00000302639:H244Q	ENSP00000302639:H244Q	H	+	3	2	OR5AR1	56188469	0.947000	0.32204	1.000000	0.80357	0.906000	0.53458	0.111000	0.15458	0.543000	0.28864	0.573000	0.79308	CAC		0.498	OR5AR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334434.1	NM_001004730		40	92	1	0	1.3e-30	2.02e-30	40	92				
OR9G4	283189	broad.mit.edu	37	11	56510975	56510975	+	Missense_Mutation	SNP	T	T	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:56510975T>C	ENST00000302957.3	-	1	312	c.313A>G	c.(313-315)Aag>Gag	p.K105E		NM_001005284.1	NP_001005284.1	Q8NGQ1	OR9G4_HUMAN	olfactory receptor, family 9, subfamily G, member 4	105						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	34						GAAATGCGCTTATCTTCTGAG	0.458																																						uc010rjo.1		NA																	0				ovary(2)|skin(1)	3						c.(313-315)AAG>GAG		olfactory receptor, family 9, subfamily G,							97.0	100.0	99.0					11																	56510975		2201	4296	6497	SO:0001583	missense	283189				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56510975T>C	BK004400	CCDS31537.1	11q11	2012-08-09			ENSG00000172457	ENSG00000172457		"""GPCR / Class A : Olfactory receptors"""	15322	protein-coding gene	gene with protein product							Standard	NM_001005284		Approved		uc010rjo.2	Q8NGQ1	OTTHUMG00000166932	ENST00000302957.3:c.313A>G	11.37:g.56510975T>C	ENSP00000307515:p.Lys105Glu		Somatic					p.K105E	NM_001005284	NP_001005284	WXS	Illumina HiSeq	Unspecified	Q8NGQ1	OR9G4_HUMAN			1	313	-			105			Extracellular (Potential).		Q6IF62|Q96RA9	Missense_Mutation	SNP	ENST00000302957.3	37	c.313A>G	CCDS31537.1	.	.	.	.	.	.	.	.	.	.	T	14.21	2.468761	0.43839	.	.	ENSG00000172457	ENST00000302957	T	0.38560	1.13	5.07	5.07	0.68467	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41500	D	0.000867	T	0.51381	0.1671	M	0.91459	3.21	0.09310	N	1	P	0.46395	0.877	B	0.38106	0.265	T	0.62742	-0.6790	10	0.72032	D	0.01	-17.2511	13.8217	0.63325	0.0:0.0:0.0:1.0	.	105	Q8NGQ1	OR9G4_HUMAN	E	105	ENSP00000307515:K105E	ENSP00000307515:K105E	K	-	1	0	OR9G4	56267551	0.102000	0.21896	0.440000	0.26846	0.968000	0.65278	2.430000	0.44766	2.131000	0.65755	0.523000	0.50628	AAG		0.458	OR9G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391945.1	NM_001005284		6	125	0	0	0	0	6	125				
OR4D10	390197	broad.mit.edu	37	11	59245402	59245402	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:59245402C>A	ENST00000530162.1	+	1	557	c.500C>A	c.(499-501)cCt>cAt	p.P167H		NM_001004705.1	NP_001004705.1	Q8NGI6	OR4DA_HUMAN	olfactory receptor, family 4, subfamily D, member 10	167						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CTCCCACTCCCTTTCTGCGGA	0.493																																						uc001nnz.1		NA																	0				ovary(2)|skin(1)	3						c.(499-501)CCT>CAT		olfactory receptor, family 4, subfamily D,							113.0	112.0	113.0					11																	59245402		2201	4295	6496	SO:0001583	missense	390197				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:59245402C>A	AB065808	CCDS53636.1	11q12.1	2012-10-03		2004-03-10	ENSG00000254466	ENSG00000254466		"""GPCR / Class A : Olfactory receptors"""	15173	protein-coding gene	gene with protein product				OR4D10P			Standard	NM_001004705		Approved	OST711	uc001nnz.1	Q8NGI6	OTTHUMG00000167341	ENST00000530162.1:c.500C>A	11.37:g.59245402C>A	ENSP00000436424:p.Pro167His		Somatic					p.P167H	NM_001004705	NP_001004705	WXS	Illumina HiSeq	Unspecified	Q8NGI6	OR4DA_HUMAN			1	500	+			167			Extracellular (Potential).		B2RNH6	Missense_Mutation	SNP	ENST00000530162.1	37	c.500C>A	CCDS53636.1	.	.	.	.	.	.	.	.	.	.	C	14.33	2.502470	0.44455	.	.	ENSG00000254466	ENST00000530162	T	0.00207	8.55	4.71	4.71	0.59529	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00580	0.0019	M	0.77616	2.38	0.31303	N	0.688054	P	0.45768	0.866	P	0.62649	0.905	T	0.48833	-0.9000	9	0.87932	D	0	.	16.5977	0.84801	0.0:1.0:0.0:0.0	.	167	Q8NGI6	OR4DA_HUMAN	H	167	ENSP00000436424:P167H	ENSP00000436424:P167H	P	+	2	0	OR4D10	59001978	0.004000	0.15560	0.613000	0.29037	0.061000	0.15899	2.107000	0.41844	2.311000	0.77944	0.655000	0.94253	CCT		0.493	OR4D10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394235.1	NM_001004705		7	145	1	0	5.18e-06	6.28e-06	7	145				
TCN1	6947	broad.mit.edu	37	11	59622211	59622211	+	Silent	SNP	T	T	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:59622211T>C	ENST00000257264.3	-	7	1139	c.1035A>G	c.(1033-1035)acA>acG	p.T345T	TCN1_ENST00000532419.1_5'UTR	NM_001062.3	NP_001053.2	P20061	TCO1_HUMAN	transcobalamin I (vitamin B12 binding protein, R binder family)	345	Globular C-terminal beta domain.				cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|cobalt ion transport (GO:0006824)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cobalamin binding (GO:0031419)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29		all_epithelial(135;0.198)			Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TGGTGAAATATGTTTCATTGA	0.408																																						uc001noj.2		NA																	0				ovary(2)	2						c.(1033-1035)ACA>ACG		transcobalamin I precursor	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)						156.0	144.0	148.0					11																	59622211		2201	4295	6496	SO:0001819	synonymous_variant	6947				cobalamin metabolic process|cobalamin transport|cobalt ion transport	extracellular region	cobalamin binding	g.chr11:59622211T>C	J05068	CCDS7978.1	11q11-q12	2008-07-21			ENSG00000134827	ENSG00000134827			11652	protein-coding gene	gene with protein product	"""haptocorin"", ""haptocorrin"""	189905					Standard	NM_001062		Approved	TCI, TC1	uc001noj.2	P20061	OTTHUMG00000167400	ENST00000257264.3:c.1035A>G	11.37:g.59622211T>C			Somatic					p.T345T	NM_001062	NP_001053	WXS	Illumina HiSeq	Unspecified	P20061	TCO1_HUMAN			7	1133	-		all_epithelial(135;0.198)	345					A8KAC5|Q8WV77	Silent	SNP	ENST00000257264.3	37	c.1035A>G	CCDS7978.1																																																																																				0.408	TCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394503.1	NM_001062		9	145	0	0	0	0	9	145				
TPCN2	219931	broad.mit.edu	37	11	68830381	68830381	+	Silent	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:68830381C>A	ENST00000294309.3	+	6	677	c.576C>A	c.(574-576)ccC>ccA	p.P192P	TPCN2_ENST00000542467.1_Silent_p.P192P|TPCN2_ENST00000442692.2_3'UTR	NM_139075.3	NP_620714.2	Q8NHX9	TPC2_HUMAN	two pore segment channel 2	192					calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|release of sequestered calcium ion into cytosol (GO:0051209)|smooth muscle contraction (GO:0006939)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|protein kinase binding (GO:0019901)|voltage-gated calcium channel activity (GO:0005245)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	32			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			TTCTCCGTCCCTTCTTCCTGC	0.582																																						uc001oos.2		NA																	0					0						c.(574-576)CCC>CCA		two pore segment channel 2							156.0	152.0	154.0					11																	68830381		2200	4294	6494	SO:0001819	synonymous_variant	219931				cellular calcium ion homeostasis|smooth muscle contraction	endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated calcium channel activity	g.chr11:68830381C>A	AK023366	CCDS8189.1	11q13.1	2011-07-05			ENSG00000162341	ENSG00000162341		"""Voltage-gated ion channels / Two-pore channels"""	20820	protein-coding gene	gene with protein product		612163				16382101	Standard	NM_139075		Approved	TPC2	uc001oos.2	Q8NHX9	OTTHUMG00000167898	ENST00000294309.3:c.576C>A	11.37:g.68830381C>A			Somatic				TPCN2_uc009ysk.1_RNA|TPCN2_uc001oor.2_Silent_p.P107P|TPCN2_uc010rqg.1_Silent_p.P192P	p.P192P	NM_139075	NP_620714	WXS	Illumina HiSeq	Unspecified	Q8NHX9	TPC2_HUMAN	STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)		6	692	+			192			Helical; Name=S4 of repeat I; (Potential).		Q9NT82	Silent	SNP	ENST00000294309.3	37	c.576C>A	CCDS8189.1																																																																																				0.582	TPCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396878.2	NM_139075		56	162	1	0	6.75e-32	1.06e-31	56	162				
PHOX2A	401	broad.mit.edu	37	11	71950813	71950813	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:71950813G>T	ENST00000298231.5	-	3	1006	c.835C>A	c.(835-837)Ctg>Atg	p.L279M	PHOX2A_ENST00000544057.1_5'Flank	NM_005169.3	NP_005160.2	O14813	PHX2A_HUMAN	paired-like homeobox 2a	279					dopaminergic neuron differentiation (GO:0071542)|locus ceruleus development (GO:0021703)|midbrain development (GO:0030901)|noradrenergic neuron differentiation (GO:0003357)|oculomotor nerve formation (GO:0021623)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of respiratory gaseous exchange (GO:0043576)|somatic motor neuron differentiation (GO:0021523)|sympathetic nervous system development (GO:0048485)|transcription, DNA-templated (GO:0006351)|trochlear nerve formation (GO:0021642)	nuclear chromatin (GO:0000790)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(2)	5						TTGGTCTTCAGGGCGGGGCCG	0.692																																						uc001osh.3		NA																	0					0						c.(835-837)CTG>ATG		paired-like homeobox 2a							5.0	7.0	6.0					11																	71950813		2017	3967	5984	SO:0001583	missense	401				noradrenergic neuron differentiation|positive regulation of transcription from RNA polymerase II promoter	nuclear chromatin	RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr11:71950813G>T	AF022722	CCDS8214.1	11q13.4	2014-09-04	2007-07-12	2003-02-14	ENSG00000165462	ENSG00000165462		"""Homeoboxes / PRD class"""	691	protein-coding gene	gene with protein product		602753	"""aristaless (Drosophila) homeobox, aristaless homeobox (Drosophila), fibrosis of extraocular muscles, congenital, 2, autosomal recessive"", ""paired-like (aristaless) homeobox 2a"""	ARIX, FEOM2		8661014, 11600883	Standard	NM_005169		Approved	PMX2A, CFEOM2	uc001osh.4	O14813	OTTHUMG00000167899	ENST00000298231.5:c.835C>A	11.37:g.71950813G>T	ENSP00000298231:p.Leu279Met		Somatic					p.L279M	NM_005169	NP_005160	WXS	Illumina HiSeq	Unspecified	O14813	PHX2A_HUMAN			3	1007	-			279					A8K3N0|Q8IVZ2	Missense_Mutation	SNP	ENST00000298231.5	37	c.835C>A	CCDS8214.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	12.87|12.87	2.067643|2.067643	0.36470|0.36470	.|.	.|.	ENSG00000165462|ENSG00000165462	ENST00000298231|ENST00000546310	D|.	0.90788|.	-2.73|.	4.29|4.29	3.38|3.38	0.38709|0.38709	.|.	0.000000|.	0.31167|.	N|.	0.008121|.	T|T	0.35307|0.35307	0.0927|0.0927	N|N	0.14661|0.14661	0.345|0.345	0.37910|0.37910	D|D	0.931327|0.931327	P|.	0.48911|.	0.917|.	B|.	0.43478|.	0.421|.	T|T	0.18681|0.18681	-1.0329|-1.0329	10|5	0.72032|.	D|.	0.01|.	.|.	7.2334|7.2334	0.26055|0.26055	0.0926:0.0:0.7398:0.1676|0.0926:0.0:0.7398:0.1676	.|.	279|.	O14813|.	PHX2A_HUMAN|.	M|H	279|79	ENSP00000298231:L279M|.	ENSP00000298231:L279M|.	L|P	-|-	1|2	2|0	PHOX2A|PHOX2A	71628461|71628461	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.602000|0.602000	0.36980|0.36980	2.292000|2.292000	0.43549|0.43549	1.012000|1.012000	0.39366|0.39366	-0.448000|-0.448000	0.05591|0.05591	CTG|CCT		0.692	PHOX2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396885.1	NM_005169		4	4	1	0	0.000602214	0.000669173	4	4				
C2CD3	26005	broad.mit.edu	37	11	73753213	73753213	+	Missense_Mutation	SNP	T	T	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:73753213T>A	ENST00000334126.7	-	29	5772	c.5546A>T	c.(5545-5547)aAc>aTc	p.N1849I	C2CD3_ENST00000313663.7_Missense_Mutation_p.N1849I			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	1849					brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)				NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					CCGGCGAATGTTCTGCACATG	0.433																																						uc001ouu.2		NA																	0				ovary(4)|pancreas(2)|skin(1)	7						c.(5545-5547)AAC>ATC		C2 calcium-dependent domain containing 3							227.0	187.0	201.0					11																	73753213		2200	4293	6493	SO:0001583	missense	26005					centrosome		g.chr11:73753213T>A	BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.5546A>T	11.37:g.73753213T>A	ENSP00000334379:p.Asn1849Ile		Somatic				C2CD3_uc001out.2_RNA	p.N1849I	NM_015531	NP_056346	WXS	Illumina HiSeq	Unspecified	Q4AC94	C2CD3_HUMAN			29	5773	-	Breast(11;4.16e-06)		1849					C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Missense_Mutation	SNP	ENST00000334126.7	37	c.5546A>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.9|22.9	4.348945|4.348945	0.82132|0.82132	.|.	.|.	ENSG00000168014|ENSG00000168014	ENST00000538361|ENST00000334126;ENST00000313663;ENST00000313681;ENST00000414160	.|T;T;T	.|0.17528	.|2.59;2.67;2.27	5.82|5.82	5.82|5.82	0.92795|0.92795	.|.	.|0.187390	.|0.56097	.|D	.|0.000038	T|T	0.44891|0.44891	0.1315|0.1315	M|M	0.78049|0.78049	2.395|2.395	0.41389|0.41389	D|D	0.987608|0.987608	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	T|T	0.46190|0.46190	-0.9209|-0.9209	5|10	.|0.72032	.|D	.|0.01	-16.2482|-16.2482	15.8373|15.8373	0.78808|0.78808	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|1849	.|Q4AC94-1	.|.	D|I	82|1849;1849;1830;657	.|ENSP00000334379:N1849I;ENSP00000323339:N1849I;ENSP00000388750:N657I	.|ENSP00000323339:N1849I	E|N	-|-	3|2	2|0	C2CD3|C2CD3	73430861|73430861	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	5.702000|5.702000	0.68332|0.68332	2.225000|2.225000	0.72522|0.72522	0.477000|0.477000	0.44152|0.44152	GAA|AAC		0.433	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015531		39	56	0	0	0	0	39	56				
TMEM135	65084	broad.mit.edu	37	11	87013387	87013387	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:87013387G>A	ENST00000305494.5	+	8	640	c.601G>A	c.(601-603)Gca>Aca	p.A201T	TMEM135_ENST00000340353.7_Missense_Mutation_p.A179T|TMEM135_ENST00000532959.1_Missense_Mutation_p.A72T|TMEM135_ENST00000535167.1_Missense_Mutation_p.A62T	NM_022918.3	NP_075069.3	Q86UB9	TM135_HUMAN	transmembrane protein 135	201					peroxisome organization (GO:0007031)	integral component of membrane (GO:0016021)|peroxisome (GO:0005777)				NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	17		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				TTCACCAGAGGCAGCATATGC	0.378																																						uc001pch.2		NA																	0					0						c.(601-603)GCA>ACA		transmembrane protein 135							119.0	126.0	124.0					11																	87013387		2201	4299	6500	SO:0001583	missense	65084					integral to membrane		g.chr11:87013387G>A	BX648678	CCDS8280.1, CCDS53692.1	11q14.2	2006-03-09			ENSG00000166575	ENSG00000166575			26167	protein-coding gene	gene with protein product						12477932	Standard	NM_022918		Approved	FLJ22104	uc001pch.3	Q86UB9	OTTHUMG00000167248	ENST00000305494.5:c.601G>A	11.37:g.87013387G>A	ENSP00000306344:p.Ala201Thr		Somatic				TMEM135_uc010rtt.1_Missense_Mutation_p.A62T|TMEM135_uc001pci.2_Missense_Mutation_p.A179T	p.A201T	NM_022918	NP_075069	WXS	Illumina HiSeq	Unspecified	Q86UB9	TM135_HUMAN			8	624	+		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)	201					Q6AW91|Q8ND01|Q9H6M3	Missense_Mutation	SNP	ENST00000305494.5	37	c.601G>A	CCDS8280.1	.	.	.	.	.	.	.	.	.	.	G	12.71	2.018971	0.35606	.	.	ENSG00000166575	ENST00000340353;ENST00000544294;ENST00000532959;ENST00000305494;ENST00000535167	T;T;T;T	0.44482	0.92;0.94;0.93;0.98	5.55	1.81	0.25067	.	0.654660	0.17295	N	0.179495	T	0.23727	0.0574	N	0.19112	0.55	0.24709	N	0.993219	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.19647	-1.0299	9	.	.	.	-10.7581	7.849	0.29442	0.4472:0.0:0.5528:0.0	.	179;201	Q86UB9-2;Q86UB9	.;TM135_HUMAN	T	179;38;72;201;62	ENSP00000345513:A179T;ENSP00000436179:A72T;ENSP00000306344:A201T;ENSP00000439525:A62T	.	A	+	1	0	TMEM135	86691035	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	0.909000	0.28558	0.102000	0.17638	-0.136000	0.14681	GCA		0.378	TMEM135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393875.1	NM_022918		25	57	0	0	0	0	25	57				
CNTN5	53942	broad.mit.edu	37	11	99827584	99827584	+	Silent	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:99827584G>T	ENST00000524871.1	+	8	1010	c.720G>T	c.(718-720)gcG>gcT	p.A240A	CNTN5_ENST00000418526.2_Silent_p.A166A|CNTN5_ENST00000279463.3_Silent_p.A240A|CNTN5_ENST00000528682.1_Silent_p.A240A|CNTN5_ENST00000527185.1_Silent_p.A240A	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	240	Ig-like C2-type 2.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		CCTTTGTGGCGGAAGACAGCC	0.393																																						uc001pga.2		NA																	0				skin(3)|ovary(2)|pancreas(2)|breast(1)	8						c.(718-720)GCG>GCT		contactin 5 isoform long							96.0	89.0	91.0					11																	99827584		1842	4088	5930	SO:0001819	synonymous_variant	53942				cell adhesion	anchored to membrane|plasma membrane	protein binding	g.chr11:99827584G>T	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.720G>T	11.37:g.99827584G>T			Somatic				CNTN5_uc009ywv.1_Silent_p.A240A|CNTN5_uc001pfz.2_Silent_p.A240A|CNTN5_uc001pgb.2_Silent_p.A166A	p.A240A	NM_014361	NP_055176	WXS	Illumina HiSeq	Unspecified	O94779	CNTN5_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)	8	1059	+		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)	240			Ig-like C2-type 2.		A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Silent	SNP	ENST00000524871.1	37	c.720G>T	CCDS53696.1																																																																																				0.393	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361		17	50	1	0	4.97e-08	6.38e-08	17	50				
MMP10	4319	broad.mit.edu	37	11	102646043	102646043	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:102646043C>T	ENST00000279441.4	-	7	978	c.942G>A	c.(940-942)tgG>tgA	p.W314*		NM_002425.2	NP_002416.1	P09238	MMP10_HUMAN	matrix metallopeptidase 10 (stromelysin 2)	314					collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)|regulation of cell migration (GO:0030334)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|liver(2)|lung(6)	22	all_epithelial(12;0.00961)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0303)|Lung(13;0.0828)|all cancers(10;0.116)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0145)	Marimastat(DB00786)	GGGATCTTCGCCAAAAATATC	0.328																																						uc001phg.1		NA																	0				kidney(1)|lung(1)|breast(1)|central_nervous_system(1)	4						c.(940-942)TGG>TGA		matrix metalloproteinase 10 preproprotein							62.0	64.0	63.0					11																	102646043		2203	4299	6502	SO:0001587	stop_gained	4319				collagen catabolic process|proteolysis	extracellular space|proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding	g.chr11:102646043C>T	X07820	CCDS8321.1	11q22.3	2008-02-05	2005-08-08		ENSG00000166670	ENSG00000166670	3.4.24.22		7156	protein-coding gene	gene with protein product		185260	"""matrix metalloproteinase 10 (stromelysin 2)"""	STMY2			Standard	NM_002425		Approved		uc001phg.2	P09238	OTTHUMG00000168083	ENST00000279441.4:c.942G>A	11.37:g.102646043C>T	ENSP00000279441:p.Trp314*		Somatic					p.W314*	NM_002425	NP_002416	WXS	Illumina HiSeq	Unspecified	P09238	MMP10_HUMAN	Epithelial(9;0.0303)|Lung(13;0.0828)|all cancers(10;0.116)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0145)	7	964	-	all_epithelial(12;0.00961)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	314			Hemopexin-like 1.		B2R9X9|Q53HH9	Nonsense_Mutation	SNP	ENST00000279441.4	37	c.942G>A	CCDS8321.1	.	.	.	.	.	.	.	.	.	.	C	19.24	3.788776	0.70337	.	.	ENSG00000166670	ENST00000279441	.	.	.	4.2	3.28	0.37604	.	0.531799	0.15507	N	0.258703	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.227	0.54465	0.0:0.9167:0.0:0.0833	.	.	.	.	X	314	.	ENSP00000279441:W314X	W	-	3	0	MMP10	102151253	1.000000	0.71417	0.987000	0.45799	0.306000	0.27790	3.065000	0.49994	1.114000	0.41781	0.644000	0.83932	TGG		0.328	MMP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398014.1			4	57	0	0	0	0	4	57				
CASP5	838	broad.mit.edu	37	11	104869720	104869720	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:104869720C>T	ENST00000260315.3	-	7	987	c.988G>A	c.(988-990)Gca>Aca	p.A330T	CASP5_ENST00000526056.1_Missense_Mutation_p.A343T|CASP5_ENST00000531367.1_Missense_Mutation_p.A188T|CASP5_ENST00000393139.2_3'UTR|CASP5_ENST00000418434.1_Missense_Mutation_p.A188T|CASP5_ENST00000444749.2_Missense_Mutation_p.A272T|CASP5_ENST00000393141.2_Missense_Mutation_p.A343T			P51878	CASP5_HUMAN	caspase 5, apoptosis-related cysteine peptidase	330					apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|NLRP1 inflammasome complex (GO:0072558)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|ovary(3)|skin(1)|urinary_tract(1)	35		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)		GCCAAGGATGCTGGAGAGTCT	0.418																																						uc010rva.1		NA																	0				ovary(2)|lung(1)	3						c.(988-990)GCA>ACA		caspase 5 isoform a precursor							111.0	96.0	101.0					11																	104869720		2202	4299	6501	SO:0001583	missense	838				apoptosis|cellular response to mechanical stimulus|proteolysis|regulation of apoptosis	intracellular	cysteine-type endopeptidase activity|protein binding	g.chr11:104869720C>T		CCDS8328.2, CCDS44718.1, CCDS44719.1, CCDS44720.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000137757	ENSG00000137757		"""Caspases"""	1506	protein-coding gene	gene with protein product		602665	"""caspase 5, apoptosis-related cysteine protease"""			7797592, 9250871	Standard	NM_004347		Approved	ICE(rel)III	uc010ruz.1	P51878	OTTHUMG00000048073	ENST00000260315.3:c.988G>A	11.37:g.104869720C>T	ENSP00000260315:p.Ala330Thr		Somatic				CASP5_uc010ruz.1_Missense_Mutation_p.A343T|CASP5_uc010rvb.1_Missense_Mutation_p.A272T|CASP5_uc010rvc.1_Missense_Mutation_p.A188T|CASP5_uc009yxh.2_Missense_Mutation_p.A112T|CASP5_uc010rvd.1_Missense_Mutation_p.A112T	p.A330T	NM_004347	NP_004338	WXS	Illumina HiSeq	Unspecified	P51878	CASP5_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)	7	1020	-		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)	330					B4DKP5|Q0QVY7|Q0QVY8|Q0QVZ0|Q0QVZ1|Q0QVZ2|Q14DD6|Q1HBJ3|Q6DJV7	Missense_Mutation	SNP	ENST00000260315.3	37	c.988G>A	CCDS8328.2	.	.	.	.	.	.	.	.	.	.	C	12.27	1.888544	0.33348	.	.	ENSG00000137757	ENST00000393141;ENST00000418434;ENST00000260315;ENST00000444749;ENST00000526056;ENST00000531367	T;T;T;T;T;T	0.20598	2.06;2.06;2.06;2.06;2.06;2.06	4.19	-1.64	0.08318	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase precursor p45, core (1);	2.968610	0.01232	N	0.008378	T	0.35595	0.0937	M	0.71581	2.175	0.09310	N	1	P;P;P;P	0.52316	0.696;0.823;0.952;0.93	P;P;P;P	0.57846	0.541;0.535;0.828;0.649	T	0.20571	-1.0271	10	0.34782	T	0.22	.	1.9417	0.03348	0.1372:0.4759:0.1339:0.253	.	188;272;330;343	P51878-3;P51878-2;P51878;P51878-5	.;.;CASP5_HUMAN;.	T	343;188;330;272;343;188	ENSP00000376849:A343T;ENSP00000398130:A188T;ENSP00000260315:A330T;ENSP00000388365:A272T;ENSP00000436877:A343T;ENSP00000434471:A188T	ENSP00000260315:A330T	A	-	1	0	CASP5	104374930	0.000000	0.05858	0.000000	0.03702	0.051000	0.14879	0.118000	0.15605	-0.610000	0.05716	0.563000	0.77884	GCA		0.418	CASP5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109397.2	NM_004347		26	59	0	0	0	0	26	59				
AASDHPPT	60496	broad.mit.edu	37	11	105967590	105967590	+	Missense_Mutation	SNP	T	T	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:105967590T>C	ENST00000278618.4	+	6	1108	c.886T>C	c.(886-888)Tgc>Cgc	p.C296R	RP11-677I18.3_ENST00000532422.1_RNA|RP11-677I18.3_ENST00000527594.1_RNA	NM_015423.2	NP_056238.2	Q9NRN7	ADPPT_HUMAN	aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase	296					macromolecule biosynthetic process (GO:0009059)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	holo-[acyl-carrier-protein] synthase activity (GO:0008897)|magnesium ion binding (GO:0000287)			endometrium(3)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)	17		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.78e-05)|Epithelial(105;0.00622)|all cancers(92;0.041)		GGACTGTTTTTGCTTCACAGA	0.378																																						uc001pjc.1		NA																	0					0						c.(886-888)TGC>CGC		aminoadipate-semialdehyde							86.0	76.0	79.0					11																	105967590		2201	4298	6499	SO:0001583	missense	60496				macromolecule biosynthetic process|pantothenate metabolic process	cytosol	holo-[acyl-carrier-protein] synthase activity|magnesium ion binding|protein binding	g.chr11:105967590T>C	AF302110	CCDS31664.1	11q22	2010-12-09			ENSG00000149313	ENSG00000149313	1.2.1.31		14235	protein-coding gene	gene with protein product		607756				12815048, 11286508	Standard	NM_015423		Approved	LYS5, CGI-80, AASD-PPT	uc001pjc.1	Q9NRN7	OTTHUMG00000166253	ENST00000278618.4:c.886T>C	11.37:g.105967590T>C	ENSP00000278618:p.Cys296Arg		Somatic				AASDHPPT_uc010rvn.1_RNA|AASDHPPT_uc001pjd.1_Missense_Mutation_p.C149R	p.C296R	NM_015423	NP_056238	WXS	Illumina HiSeq	Unspecified	Q9NRN7	ADPPT_HUMAN		BRCA - Breast invasive adenocarcinoma(274;5.78e-05)|Epithelial(105;0.00622)|all cancers(92;0.041)	6	1032	+		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)	296					B2R6D1|B4DDW7|Q9C068|Q9P0Q3|Q9UG80|Q9Y389	Missense_Mutation	SNP	ENST00000278618.4	37	c.886T>C	CCDS31664.1	.	.	.	.	.	.	.	.	.	.	T	10.38	1.334655	0.24253	.	.	ENSG00000149313	ENST00000278618	.	.	.	5.5	4.36	0.52297	.	0.276044	0.45867	D	0.000336	T	0.40570	0.1122	L	0.27053	0.805	0.50813	D	0.999895	B	0.18166	0.026	B	0.14578	0.011	T	0.14671	-1.0464	9	0.16420	T	0.52	.	10.2625	0.43436	0.1476:0.0:0.0:0.8524	.	296	Q9NRN7	ADPPT_HUMAN	R	296	.	ENSP00000278618:C296R	C	+	1	0	AASDHPPT	105472800	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.523000	0.45580	0.897000	0.36392	0.528000	0.53228	TGC		0.378	AASDHPPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388734.1	NM_015423		11	48	0	0	0	0	11	48				
OR10G8	219869	broad.mit.edu	37	11	123900787	123900787	+	Missense_Mutation	SNP	T	T	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:123900787T>A	ENST00000431524.1	+	1	491	c.458T>A	c.(457-459)cTg>cAg	p.L153Q		NM_001004464.1	NP_001004464.1	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G, member 8	153						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|large_intestine(2)|lung(21)|ovary(1)|prostate(5)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	44		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		AGTGGCTCTCTGCACTCTGCT	0.552																																						uc001pzp.1		NA																	0				ovary(1)|skin(1)	2						c.(457-459)CTG>CAG		olfactory receptor, family 10, subfamily G,							170.0	154.0	159.0					11																	123900787		2201	4299	6500	SO:0001583	missense	219869				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123900787T>A	AB065755	CCDS31704.1	11q24.1	2012-08-09			ENSG00000234560	ENSG00000234560		"""GPCR / Class A : Olfactory receptors"""	14845	protein-coding gene	gene with protein product							Standard	NM_001004464		Approved		uc001pzp.1	Q8NGN5	OTTHUMG00000165968	ENST00000431524.1:c.458T>A	11.37:g.123900787T>A	ENSP00000389072:p.Leu153Gln		Somatic					p.L153Q	NM_001004464	NP_001004464	WXS	Illumina HiSeq	Unspecified	Q8NGN5	O10G8_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)	1	458	+		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	153			Helical; Name=4; (Potential).		B2RNJ3|Q6IEV2	Missense_Mutation	SNP	ENST00000431524.1	37	c.458T>A	CCDS31704.1	.	.	.	.	.	.	.	.	.	.	T	14.07	2.426403	0.43020	.	.	ENSG00000234560	ENST00000431524	T	0.49432	0.78	3.04	3.04	0.35103	GPCR, rhodopsin-like superfamily (1);	0.682649	0.12018	N	0.507286	T	0.74261	0.3693	M	0.93241	3.395	0.36724	D	0.881336	D	0.67145	0.996	D	0.73708	0.981	T	0.79955	-0.1585	10	0.87932	D	0	.	10.5975	0.45347	0.0:0.0:0.0:1.0	.	153	Q8NGN5	O10G8_HUMAN	Q	153	ENSP00000389072:L153Q	ENSP00000389072:L153Q	L	+	2	0	OR10G8	123405997	0.003000	0.15002	0.993000	0.49108	0.465000	0.32709	0.903000	0.28475	1.377000	0.46286	0.528000	0.53228	CTG		0.552	OR10G8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387270.1	NM_001004464		51	115	0	0	0	0	51	115				
VSIG2	23584	broad.mit.edu	37	11	124617497	124617497	+	Silent	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:124617497G>A	ENST00000326621.5	-	7	1018	c.918C>T	c.(916-918)ttC>ttT	p.F306F	RP11-677M14.2_ENST00000531241.1_RNA	NM_014312.3	NP_055127.2	Q96IQ7	VSIG2_HUMAN	V-set and immunoglobulin domain containing 2	306						integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(5)	19	all_hematologic(175;0.215)	Breast(109;0.00663)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0215)		GTCTTTCCAGGAACCCCTTGC	0.562																																						uc001qas.2		NA																	0				ovary(3)|central_nervous_system(1)	4						c.(916-918)TTC>TTT		V-set and immunoglobulin domain containing 2							102.0	89.0	94.0					11																	124617497		2201	4299	6500	SO:0001819	synonymous_variant	23584					integral to plasma membrane|membrane fraction		g.chr11:124617497G>A	AF061022	CCDS8452.1	11q24	2013-01-11			ENSG00000019102	ENSG00000019102		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	17149	protein-coding gene	gene with protein product		606011				9862345	Standard	NM_014312		Approved	CTXL, CTH	uc001qas.3	Q96IQ7	OTTHUMG00000150357	ENST00000326621.5:c.918C>T	11.37:g.124617497G>A			Somatic					p.F306F	NM_014312	NP_055127	WXS	Illumina HiSeq	Unspecified	Q96IQ7	VSIG2_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0215)	7	994	-	all_hematologic(175;0.215)	Breast(109;0.00663)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)	306			Cytoplasmic (Potential).		O95791|Q9NX42	Silent	SNP	ENST00000326621.5	37	c.918C>T	CCDS8452.1																																																																																				0.562	VSIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317785.1	NM_014312		6	66	0	0	0	0	6	66				
ROBO4	54538	broad.mit.edu	37	11	124761626	124761626	+	Missense_Mutation	SNP	G	G	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr11:124761626G>C	ENST00000306534.3	-	11	2105	c.1620C>G	c.(1618-1620)agC>agG	p.S540R	ROBO4_ENST00000533054.1_Missense_Mutation_p.S395R|RP11-664I21.6_ENST00000524433.1_Intron	NM_019055.5	NP_061928.4	Q8WZ75	ROBO4_HUMAN	roundabout, axon guidance receptor, homolog 4 (Drosophila)	540					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of cell migration (GO:0030336)|regulation of cell migration (GO:0030334)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(2)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(42)|ovary(1)|prostate(4)|skin(5)|urinary_tract(3)	76	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		GGCTGCTGCTGCTGCTCAGGT	0.662																																						uc001qbg.2		NA																	0				ovary(1)|skin(1)	2						c.(1618-1620)AGC>AGG		roundabout homolog 4, magic roundabout							38.0	42.0	41.0					11																	124761626		2201	4299	6500	SO:0001583	missense	54538				angiogenesis|cell differentiation	integral to membrane	receptor activity	g.chr11:124761626G>C	AF361473	CCDS8455.1, CCDS73409.1	11q24.2	2013-02-11	2011-12-09		ENSG00000154133	ENSG00000154133		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17985	protein-coding gene	gene with protein product	"""magic roundabout"""	607528	"""roundabout homolog 4 (Drosophila)"""			11076864	Standard	NM_019055		Approved	FLJ20798, MRB, ECSM4	uc001qbg.3	Q8WZ75	OTTHUMG00000165936	ENST00000306534.3:c.1620C>G	11.37:g.124761626G>C	ENSP00000304945:p.Ser540Arg		Somatic				ROBO4_uc010sas.1_Missense_Mutation_p.S395R|ROBO4_uc001qbh.2_Missense_Mutation_p.S430R|ROBO4_uc001qbi.2_Missense_Mutation_p.S98R|ROBO4_uc010sat.1_Missense_Mutation_p.S98R	p.S540R	NM_019055	NP_061928	WXS	Illumina HiSeq	Unspecified	Q8WZ75	ROBO4_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)	11	1760	-	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)	540					A8K154|Q14DU7|Q8TEG1|Q96JV6|Q9H718|Q9NWJ8	Missense_Mutation	SNP	ENST00000306534.3	37	c.1620C>G	CCDS8455.1	.	.	.	.	.	.	.	.	.	.	G	19.26	3.793077	0.70452	.	.	ENSG00000154133	ENST00000306534;ENST00000374963;ENST00000533054	T;T	0.65916	-0.18;0.2	5.99	3.16	0.36331	.	0.000000	0.46758	D	0.000275	T	0.74191	0.3684	M	0.69823	2.125	0.35826	D	0.824947	D;D;D	0.89917	1.0;0.999;0.998	D;D;D	0.85130	0.997;0.994;0.986	T	0.78038	-0.2360	10	0.72032	D	0.01	.	8.1085	0.30900	0.2469:0.0:0.7531:0.0	.	540;430;540	Q8WZ75-2;Q8WZ75-3;Q8WZ75	.;.;ROBO4_HUMAN	R	540;430;395	ENSP00000304945:S540R;ENSP00000437129:S395R	ENSP00000304945:S540R	S	-	3	2	ROBO4	124266836	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	1.771000	0.38542	0.448000	0.26722	-0.140000	0.14226	AGC		0.662	ROBO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387111.1	NM_019055		12	20	0	0	0	0	12	20				
FGF23	8074	broad.mit.edu	37	12	4479648	4479648	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr12:4479648C>A	ENST00000237837.1	-	3	762	c.617G>T	c.(616-618)tGt>tTt	p.C206F		NM_020638.2	NP_065689.1	Q9GZV9	FGF23_HUMAN	fibroblast growth factor 23	206					cell differentiation (GO:0030154)|cellular phosphate ion homeostasis (GO:0030643)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of bone mineralization (GO:0030502)|negative regulation of hormone secretion (GO:0046888)|negative regulation of osteoblast differentiation (GO:0045668)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphate ion homeostasis (GO:0055062)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vitamin D 24-hydroxylase activity (GO:0010980)|regulation of phosphate transport (GO:0010966)|vitamin D catabolic process (GO:0042369)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	22			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)|STAD - Stomach adenocarcinoma(119;0.206)			CTCCTGTGAACAGGAGGCCGG	0.706																																						uc001qmq.1		NA																	0				ovary(2)|breast(1)|skin(1)	4						c.(616-618)TGT>TTT		fibroblast growth factor 23 precursor							18.0	23.0	21.0					12																	4479648		2203	4300	6503	SO:0001583	missense	8074				cell differentiation|insulin receptor signaling pathway|negative regulation of bone mineralization|negative regulation of hormone secretion|negative regulation of osteoblast differentiation|positive regulation of vitamin D 24-hydroxylase activity|regulation of phosphate transport|vitamin D catabolic process	extracellular space	growth factor activity	g.chr12:4479648C>A	AF263537	CCDS8526.1	12p13	2008-07-04			ENSG00000118972	ENSG00000118972			3680	protein-coding gene	gene with protein product		605380				11032749, 18310961	Standard	NM_020638		Approved		uc001qmq.1	Q9GZV9	OTTHUMG00000168241	ENST00000237837.1:c.617G>T	12.37:g.4479648C>A	ENSP00000237837:p.Cys206Phe		Somatic					p.C206F	NM_020638	NP_065689	WXS	Illumina HiSeq	Unspecified	Q9GZV9	FGF23_HUMAN	Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)|STAD - Stomach adenocarcinoma(119;0.206)		3	763	-			206					Q4V758	Missense_Mutation	SNP	ENST00000237837.1	37	c.617G>T	CCDS8526.1	.	.	.	.	.	.	.	.	.	.	C	10.73	1.433841	0.25813	.	.	ENSG00000118972	ENST00000237837	T	0.81330	-1.48	4.84	4.84	0.62591	.	0.250904	0.39909	N	0.001229	D	0.82416	0.5032	L	0.32530	0.975	0.37643	D	0.922123	D	0.65815	0.995	P	0.60886	0.88	D	0.84506	0.0619	10	0.45353	T	0.12	-15.1737	15.2508	0.73545	0.0:1.0:0.0:0.0	.	206	Q9GZV9	FGF23_HUMAN	F	206	ENSP00000237837:C206F	ENSP00000237837:C206F	C	-	2	0	FGF23	4349909	1.000000	0.71417	1.000000	0.80357	0.055000	0.15305	3.209000	0.51122	2.505000	0.84491	0.549000	0.68633	TGT		0.706	FGF23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398936.1			14	33	1	0	0.000308642	0.000347249	14	33				
TAS2R50	259296	broad.mit.edu	37	12	11139067	11139067	+	Silent	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr12:11139067C>T	ENST00000506868.1	-	1	444	c.393G>A	c.(391-393)gtG>gtA	p.V131V	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176890.2	NP_795371.2	P59544	T2R50_HUMAN	taste receptor, type 2, member 50	131					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(4)|ovary(2)|pancreas(1)	17						CCAACAGTATCACCAGAATGA	0.388																																						uc001qzl.2		NA																	0				ovary(2)	2						c.(391-393)GTG>GTA		taste receptor, type 2, member 50							142.0	155.0	151.0					12																	11139067		2203	4299	6502	SO:0001819	synonymous_variant	259296				sensory perception of taste	integral to membrane	G-protein coupled receptor activity	g.chr12:11139067C>T	AF494235	CCDS8638.1	12p13.2	2012-08-22			ENSG00000212126	ENSG00000212126		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18882	protein-coding gene	gene with protein product		609627				12379855, 12584440, 16175505	Standard	NM_176890		Approved	T2R51	uc001qzl.2	P59544	OTTHUMG00000162719	ENST00000506868.1:c.393G>A	12.37:g.11139067C>T			Somatic				PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron|PRH1_uc001qzj.2_Intron	p.V131V	NM_176890	NP_795371	WXS	Illumina HiSeq	Unspecified	P59544	T2R50_HUMAN			1	445	-			131			Helical; Name=4; (Potential).		P59545|Q2M255|Q645Y0	Silent	SNP	ENST00000506868.1	37	c.393G>A	CCDS8638.1																																																																																				0.388	TAS2R50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370192.2	NM_176890		80	256	0	0	0	0	80	256				
GRIN2B	2904	broad.mit.edu	37	12	13717318	13717318	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr12:13717318G>T	ENST00000609686.1	-	13	3063	c.2854C>A	c.(2854-2856)Ccg>Acg	p.P952T		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	952					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TCACAGGGCGGGTTGTTGTAG	0.542																																						uc001rbt.2		NA																	0				central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12						c.(2854-2856)CCG>ACG		N-methyl-D-aspartate receptor subunit 2B	Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)						190.0	170.0	177.0					12																	13717318		2203	4300	6503	SO:0001583	missense	2904				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	g.chr12:13717318G>T		CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.2854C>A	12.37:g.13717318G>T	ENSP00000477455:p.Pro952Thr		Somatic					p.P952T	NM_000834	NP_000825	WXS	Illumina HiSeq	Unspecified	Q13224	NMDE2_HUMAN			13	3033	-			952			Cytoplasmic (Potential).		Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Missense_Mutation	SNP	ENST00000609686.1	37	c.2854C>A	CCDS8662.1	.	.	.	.	.	.	.	.	.	.	G	15.43	2.829828	0.50845	.	.	ENSG00000150086	ENST00000279593	T	0.11277	2.79	5.58	5.58	0.84498	Glutamate [NMDA] receptor, epsilon subunit, C-terminal (1);	0.057946	0.64402	D	0.000001	T	0.12008	0.0292	L	0.44542	1.39	0.80722	D	1	P	0.41748	0.761	B	0.37015	0.239	T	0.03630	-1.1018	10	0.38643	T	0.18	.	17.7552	0.88446	0.0:0.0:1.0:0.0	.	952	Q13224	NMDE2_HUMAN	T	952	ENSP00000279593:P952T	ENSP00000279593:P952T	P	-	1	0	GRIN2B	13608585	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.628000	0.83189	2.638000	0.89438	0.655000	0.94253	CCG		0.542	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268014.2			40	94	1	0	8.17e-11	1.11e-10	40	94				
PTPRO	5800	broad.mit.edu	37	12	15475702	15475702	+	Silent	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr12:15475702C>A	ENST00000281171.4	+	1	372	c.42C>A	c.(40-42)ctC>ctA	p.L14L	PTPRO_ENST00000543886.1_Silent_p.L14L|PTPRO_ENST00000348962.2_Silent_p.L14L	NM_030667.2	NP_109592.1	Q16827	PTPRO_HUMAN	protein tyrosine phosphatase, receptor type, O	14					axon guidance (GO:0007411)|cell morphogenesis (GO:0000902)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|lamellipodium assembly (GO:0030032)|monocyte chemotaxis (GO:0002548)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron projection development (GO:0010977)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of glomerular filtration (GO:0003093)|slit diaphragm assembly (GO:0036060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)|Wnt-protein binding (GO:0017147)			NS(2)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(11)|lung(30)|ovary(2)|prostate(1)|skin(17)|upper_aerodigestive_tract(1)	74		Hepatocellular(102;0.244)				CCCGCCGCCTCCTGCCTCTGC	0.741																																						uc001rcv.1		NA																	0				skin(5)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	9						c.(40-42)CTC>CTA		receptor-type protein tyrosine phosphatase O							27.0	26.0	26.0					12																	15475702		2202	4300	6502	SO:0001819	synonymous_variant	5800					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr12:15475702C>A	U20489	CCDS8674.1, CCDS8675.1, CCDS44837.1, CCDS53754.1	12p13-p12	2013-02-11			ENSG00000151490	ENSG00000151490		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9678	protein-coding gene	gene with protein product	"""osteoclastic transmembrane protein-tyrosine phosphatase"""	600579				7519601, 7665166, 21722858	Standard	NM_030667		Approved	PTPU2, GLEPP1, PTP-U2, PTP-oc, NPHS6	uc001rcv.2	Q16827	OTTHUMG00000168786	ENST00000281171.4:c.42C>A	12.37:g.15475702C>A			Somatic				PTPRO_uc001rcw.1_Silent_p.L14L|PTPRO_uc001rcu.1_Silent_p.L14L	p.L14L	NM_030667	NP_109592	WXS	Illumina HiSeq	Unspecified	Q16827	PTPRO_HUMAN			1	216	+		Hepatocellular(102;0.244)	14					A0AV39|Q13101|Q8IYG3|Q9UBF0|Q9UBT5	Silent	SNP	ENST00000281171.4	37	c.42C>A	CCDS8675.1																																																																																				0.741	PTPRO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401079.1			10	21	1	0	1.15e-07	1.46e-07	10	21				
GYS2	2998	broad.mit.edu	37	12	21721901	21721901	+	Missense_Mutation	SNP	G	G	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr12:21721901G>C	ENST00000261195.2	-	5	975	c.721C>G	c.(721-723)Cgg>Ggg	p.R241G		NM_021957.3	NP_068776.2	P54840	GYS2_HUMAN	glycogen synthase 2 (liver)	241					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|ectoplasm (GO:0043265)	glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein homodimerization activity (GO:0042803)			NS(1)|breast(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(14)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						ATGCAGTACCGGTGGTAAATC	0.433																																					Colon(149;9 1820 3690 10544 50424)	uc001rfb.2		NA																	0				lung(1)|skin(1)	2						c.(721-723)CGG>GGG		glycogen synthase 2							142.0	137.0	139.0					12																	21721901		2203	4300	6503	SO:0001583	missense	2998				glucose metabolic process|glycogen biosynthetic process|response to glucose stimulus	cortical actin cytoskeleton|cytosol|ectoplasm|insoluble fraction|soluble fraction	glycogen (starch) synthase activity|protein homodimerization activity	g.chr12:21721901G>C		CCDS8690.1	12p12.2-p11.2	2013-02-22			ENSG00000111713	ENSG00000111713	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4707	protein-coding gene	gene with protein product		138571					Standard	NM_021957		Approved		uc001rfb.3	P54840	OTTHUMG00000169135	ENST00000261195.2:c.721C>G	12.37:g.21721901G>C	ENSP00000261195:p.Arg241Gly		Somatic					p.R241G	NM_021957	NP_068776	WXS	Illumina HiSeq	Unspecified	P54840	GYS2_HUMAN			5	976	-			241					A0AVD8	Missense_Mutation	SNP	ENST00000261195.2	37	c.721C>G	CCDS8690.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.386269	0.82902	.	.	ENSG00000111713	ENST00000261195	T	0.69435	-0.4	5.16	4.26	0.50523	.	0.062472	0.64402	D	0.000003	D	0.85470	0.5704	M	0.92507	3.315	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89472	0.3744	10	0.87932	D	0	-13.3348	15.3088	0.74014	0.0:0.0:0.8595:0.1405	.	241	P54840	GYS2_HUMAN	G	241	ENSP00000261195:R241G	ENSP00000261195:R241G	R	-	1	2	GYS2	21613168	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.747000	0.85070	1.375000	0.46248	0.655000	0.94253	CGG		0.433	GYS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402396.1	NM_021957		24	112	0	0	0	0	24	112				
ABCC9	10060	broad.mit.edu	37	12	22013989	22013989	+	Splice_Site	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr12:22013989C>T	ENST00000261201.4	-	19	2339	c.2340G>A	c.(2338-2340)agG>agA	p.R780R	RP11-729I10.2_ENST00000539874.1_RNA|ABCC9_ENST00000261200.4_Splice_Site_p.R780R|ABCC9_ENST00000345162.2_Splice_Site_p.R744R	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	780	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	CAGCTTTGTACCTTTGGGAGA	0.333																																						uc001rfi.1		NA																	0				ovary(4)|skin(2)	6						c.(2338-2340)AGG>AGA		ATP-binding cassette, sub-family C, member 9	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)						109.0	106.0	107.0					12																	22013989		2203	4300	6503	SO:0001630	splice_region_variant	10060				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity	g.chr12:22013989C>T	AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.2340-1G>A	12.37:g.22013989C>T			Somatic				ABCC9_uc001rfh.2_Silent_p.R780R|ABCC9_uc001rfj.1_Silent_p.R744R	p.R780R	NM_005691	NP_005682	WXS	Illumina HiSeq	Unspecified	O60706	ABCC9_HUMAN			19	2360	-			780			Cytoplasmic (Potential).|ABC transporter 1.		O60707	Silent	SNP	ENST00000261201.4	37	c.2340G>A	CCDS8694.1																																																																																				0.333	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402230.1	NM_005691	Silent	23	99	0	0	0	0	23	99				
C2CD5	9847	broad.mit.edu	37	12	22676469	22676469	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr12:22676469C>A	ENST00000333957.4	-	7	946	c.691G>T	c.(691-693)Gag>Tag	p.E231*	C2CD5_ENST00000446597.1_Nonsense_Mutation_p.E231*|C2CD5_ENST00000540703.1_5'UTR|C2CD5_ENST00000544930.1_Nonsense_Mutation_p.E33*|C2CD5_ENST00000536386.1_Nonsense_Mutation_p.E231*|C2CD5_ENST00000396028.2_Nonsense_Mutation_p.E231*|C2CD5_ENST00000542676.1_Nonsense_Mutation_p.E231*|C2CD5_ENST00000545552.1_Nonsense_Mutation_p.E231*	NM_014802.1	NP_055617.1	Q86YS7	C2CD5_HUMAN	C2 calcium-dependent domain containing 5	231					cellular response to insulin stimulus (GO:0032869)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|intracellular protein transmembrane transport (GO:0065002)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)	p.E231*(1)|p.E33*(1)									AACCCAGACTCGCCCTCCAGA	0.473																																						uc001rfq.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(1)|large_intestine(1)|breast(1)|central_nervous_system(1)	4						c.(691-693)GAG>TAG		hypothetical protein LOC9847							146.0	131.0	136.0					12																	22676469		2203	4300	6503	SO:0001587	stop_gained	9847						protein binding	g.chr12:22676469C>A	AB011100	CCDS31758.1, CCDS66337.1, CCDS66338.1, CCDS66339.1, CCDS66340.1	12p12.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000111731	ENSG00000111731			29062	protein-coding gene	gene with protein product	"""138 kDa C2 domain-containing phosphoprotein"""		"""KIAA0528"""	KIAA0528		21907143	Standard	XM_005253538		Approved	CDP138	uc001rfq.3	Q86YS7	OTTHUMG00000169100	ENST00000333957.4:c.691G>T	12.37:g.22676469C>A	ENSP00000334229:p.Glu231*		Somatic				KIAA0528_uc010sir.1_Nonsense_Mutation_p.E33*|KIAA0528_uc010sis.1_Nonsense_Mutation_p.E231*|KIAA0528_uc010sit.1_Nonsense_Mutation_p.E231*|KIAA0528_uc010siu.1_Nonsense_Mutation_p.E231*|KIAA0528_uc001rfr.2_Nonsense_Mutation_p.E231*|KIAA0528_uc009ziy.1_Nonsense_Mutation_p.E231*	p.E231*	NM_014802	NP_055617	WXS	Illumina HiSeq	Unspecified	Q86YS7	K0528_HUMAN			7	919	-			231					B4DJ03|B4DRN7|B7ZLL0|F5H2A1|F5H5R1|O60280|Q17RY7|Q7Z619|Q86SU3	Nonsense_Mutation	SNP	ENST00000333957.4	37	c.691G>T	CCDS31758.1	.	.	.	.	.	.	.	.	.	.	C	37	6.055121	0.97241	.	.	ENSG00000111731	ENST00000333957;ENST00000446597;ENST00000536386;ENST00000396028;ENST00000542676;ENST00000545552;ENST00000544930;ENST00000544281	.	.	.	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-17.4728	18.8083	0.92047	0.0:1.0:0.0:0.0	.	.	.	.	X	231;231;231;231;231;231;33;30	.	ENSP00000334229:E231X	E	-	1	0	KIAA0528	22567736	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.801000	0.85960	2.426000	0.82243	0.591000	0.81541	GAG		0.473	C2CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402257.1	NM_014802		16	49	1	0	2.32e-05	2.73e-05	16	49				
BICD1	636	broad.mit.edu	37	12	32480467	32480467	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr12:32480467G>T	ENST00000281474.5	+	5	1181	c.1078G>T	c.(1078-1080)Gca>Tca	p.A360S	BICD1_ENST00000548411.1_Missense_Mutation_p.A360S	NM_001714.2	NP_001705.2	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 (Drosophila)	360					anatomical structure morphogenesis (GO:0009653)|intracellular mRNA localization (GO:0008298)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900737)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein localization to organelle (GO:0033365)|regulation of proteinase activated receptor activity (GO:1900276)|RNA processing (GO:0006396)|stress granule assembly (GO:0034063)|viral process (GO:0016032)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|host cell viral assembly compartment (GO:0072517)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	cytoskeletal adaptor activity (GO:0008093)|dynactin binding (GO:0034452)|dynein binding (GO:0045502)|proteinase activated receptor binding (GO:0031871)|Rab GTPase binding (GO:0017137)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			CACCAAGGGGGCACTGACGGA	0.562																																						uc001rku.2		NA																	0				large_intestine(1)|central_nervous_system(1)	2						c.(1078-1080)GCA>TCA		bicaudal D homolog 1 isoform 1							64.0	61.0	62.0					12																	32480467		2203	4300	6503	SO:0001583	missense	636				anatomical structure morphogenesis|intracellular mRNA localization|microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule|positive regulation of receptor-mediated endocytosis|protein localization to organelle|RNA processing|stress granule assembly|viral reproduction	cytoplasmic vesicle|cytoskeleton|cytosol|host cell viral assembly compartment|membrane|perinuclear region of cytoplasm|trans-Golgi network	cytoskeletal adaptor activity|dynactin binding|dynein binding|proteinase activated receptor binding|Rab GTPase binding|structural constituent of cytoskeleton	g.chr12:32480467G>T	U90028	CCDS8726.1, CCDS44859.1	12p11.2-p11.1	2005-01-13	2001-11-28			ENSG00000151746			1049	protein-coding gene	gene with protein product		602204	"""Bicaudal D (Drosophila) homolog 1"""			9367685	Standard	NM_001714		Approved		uc001rku.3	Q96G01	OTTHUMG00000169307	ENST00000281474.5:c.1078G>T	12.37:g.32480467G>T	ENSP00000281474:p.Ala360Ser		Somatic				BICD1_uc001rkv.2_Missense_Mutation_p.A360S|BICD1_uc010skd.1_RNA	p.A360S	NM_001714	NP_001705	WXS	Illumina HiSeq	Unspecified	Q96G01	BICD1_HUMAN	OV - Ovarian serous cystadenocarcinoma(6;0.0201)		5	1159	+	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		360			Potential.		A8K2C3|F8W113|O43892|O43893	Missense_Mutation	SNP	ENST00000281474.5	37	c.1078G>T	CCDS8726.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.271906	0.80469	.	.	ENSG00000151746	ENST00000548411;ENST00000281474	T;T	0.47528	0.84;0.84	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.66287	0.2774	M	0.63428	1.95	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.60100	-0.7329	10	0.23891	T	0.37	.	19.1424	0.93450	0.0:0.0:1.0:0.0	.	360;360	F8W113;Q96G01	.;BICD1_HUMAN	S	360	ENSP00000446793:A360S;ENSP00000281474:A360S	ENSP00000281474:A360S	A	+	1	0	BICD1	32371734	1.000000	0.71417	0.983000	0.44433	0.914000	0.54420	9.556000	0.98127	2.597000	0.87782	0.655000	0.94253	GCA		0.562	BICD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403380.1	NM_001714		28	58	1	0	1.16e-09	1.55e-09	28	58				
MFSD5	84975	broad.mit.edu	37	12	53647566	53647566	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr12:53647566C>T	ENST00000329548.4	+	2	1138	c.947C>T	c.(946-948)tCc>tTc	p.S316F	MFSD5_ENST00000534842.1_Missense_Mutation_p.S423F	NM_032889.4	NP_116278.3	Q6N075	MFSD5_HUMAN	major facilitator superfamily domain containing 5	316					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|skin(3)|urinary_tract(1)	16						CACCTGCTGTCCCTTGCTGTG	0.542																																						uc001sci.1		NA																	0				skin(2)|ovary(1)	3						c.(946-948)TCC>TTC		major facilitator superfamily domain containing							136.0	112.0	120.0					12																	53647566		2203	4300	6503	SO:0001583	missense	84975				transport	integral to membrane		g.chr12:53647566C>T	AK097576	CCDS8851.1, CCDS53796.1	12q13.13	2012-03-09			ENSG00000182544	ENSG00000182544			28156	protein-coding gene	gene with protein product							Standard	NM_032889		Approved	MGC11308	uc001sch.2	Q6N075	OTTHUMG00000170028	ENST00000329548.4:c.947C>T	12.37:g.53647566C>T	ENSP00000332624:p.Ser316Phe		Somatic				MFSD5_uc001sch.1_Missense_Mutation_p.S423F	p.S316F	NM_032889	NP_116278	WXS	Illumina HiSeq	Unspecified	Q6N075	MFSD5_HUMAN			2	1138	+			316			Helical; (Potential).		G3V1N7|Q6NW04|Q8N7W8|Q8NCK0|Q96IA5	Missense_Mutation	SNP	ENST00000329548.4	37	c.947C>T	CCDS8851.1	.	.	.	.	.	.	.	.	.	.	C	2.949	-0.217178	0.06101	.	.	ENSG00000182544	ENST00000534842;ENST00000329548	D;D	0.81659	-1.52;-1.52	5.19	5.19	0.71726	Major facilitator superfamily domain, general substrate transporter (1);	0.121965	0.53938	D	0.000044	D	0.84857	0.5565	L	0.47716	1.5	0.42919	D	0.994284	B;D	0.76494	0.002;0.999	B;D	0.68943	0.003;0.961	D	0.84158	0.0427	9	.	.	.	-9.8946	13.256	0.60079	0.0:0.8402:0.1598:0.0	.	316;423	Q6N075;G3V1N7	MFSD5_HUMAN;.	F	423;316	ENSP00000442688:S423F;ENSP00000332624:S316F	.	S	+	2	0	MFSD5	51933833	0.996000	0.38824	0.998000	0.56505	0.876000	0.50452	3.332000	0.52083	2.418000	0.82041	0.561000	0.74099	TCC		0.542	MFSD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406896.1	NM_032889		42	105	0	0	0	0	42	105				
OR9K2	441639	broad.mit.edu	37	12	55523823	55523823	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr12:55523823C>A	ENST00000305377.5	+	1	359	c.271C>A	c.(271-273)Ctc>Atc	p.L91I		NM_001005243.1	NP_001005243.1	Q8NGE7	OR9K2_HUMAN	olfactory receptor, family 9, subfamily K, member 2	91						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(3)|central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(2)	31						CCTAGGCAATCTCTCCTTCAT	0.408																																						uc010spe.1		NA																	0				central_nervous_system(1)|pancreas(1)	2						c.(271-273)CTC>ATC		olfactory receptor, family 9, subfamily K,							197.0	193.0	194.0					12																	55523823		2203	4300	6503	SO:0001583	missense	441639				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr12:55523823C>A	BK004326	CCDS31814.1	12q13.2	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	15339	protein-coding gene	gene with protein product							Standard	NM_001005243		Approved		uc010spe.2	Q8NGE7	OTTHUMG00000169827	ENST00000305377.5:c.271C>A	12.37:g.55523823C>A	ENSP00000307598:p.Leu91Ile		Somatic					p.L91I	NM_001005243	NP_001005243	WXS	Illumina HiSeq	Unspecified	Q8NGE7	OR9K2_HUMAN			1	271	+			91			Helical; Name=2; (Potential).		B9EH19|Q6IFD6	Missense_Mutation	SNP	ENST00000305377.5	37	c.271C>A	CCDS31814.1	.	.	.	.	.	.	.	.	.	.	C	19.56	3.850774	0.71719	.	.	ENSG00000170605	ENST00000305377	T	0.00502	6.95	4.98	4.98	0.66077	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44902	D	0.000420	T	0.03305	0.0096	H	0.94698	3.57	0.38769	D	0.954508	D	0.89917	1.0	D	0.87578	0.998	T	0.10823	-1.0613	10	0.87932	D	0	-28.7911	18.4253	0.90607	0.0:1.0:0.0:0.0	.	91	Q8NGE7	OR9K2_HUMAN	I	91	ENSP00000307598:L91I	ENSP00000307598:L91I	L	+	1	0	OR9K2	53810090	0.019000	0.18553	1.000000	0.80357	0.988000	0.76386	0.310000	0.19356	2.753000	0.94483	0.650000	0.86243	CTC		0.408	OR9K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406105.1			68	278	1	0	2.7e-31	4.21e-31	68	278				
OR6C76	390326	broad.mit.edu	37	12	55820376	55820376	+	Silent	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr12:55820376C>T	ENST00000328314.3	+	1	339	c.339C>T	c.(337-339)gcC>gcT	p.A113A		NM_001005183.1	NP_001005183.1	A6NM76	O6C76_HUMAN	olfactory receptor, family 6, subfamily C, member 76	113						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						TCCTCCTGGCCTCTATGTCCT	0.413																																						uc010spm.1		NA																	0					0						c.(337-339)GCC>GCT		olfactory receptor, family 6, subfamily C,							107.0	118.0	114.0					12																	55820376		2203	4297	6500	SO:0001819	synonymous_variant	390326				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr12:55820376C>T		CCDS31823.1	12q13.2	2013-09-23			ENSG00000185821	ENSG00000185821		"""GPCR / Class A : Olfactory receptors"""	31305	protein-coding gene	gene with protein product							Standard	NM_001005183		Approved		uc010spm.2	A6NM76	OTTHUMG00000169956	ENST00000328314.3:c.339C>T	12.37:g.55820376C>T			Somatic					p.A113A	NM_001005183	NP_001005183	WXS	Illumina HiSeq	Unspecified	A6NM76	O6C76_HUMAN			1	339	+			113			Helical; Name=3; (Potential).			Silent	SNP	ENST00000328314.3	37	c.339C>T	CCDS31823.1																																																																																				0.413	OR6C76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406675.1	NM_001005183		86	263	0	0	0	0	86	263				
LRP1	4035	broad.mit.edu	37	12	57572180	57572180	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr12:57572180G>A	ENST00000243077.3	+	27	4866	c.4400G>A	c.(4399-4401)gGc>gAc	p.G1467D		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	1467					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GACGGCTCTGGCCACATGGAG	0.582																																						uc001snd.2		NA																	0				ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22						c.(4399-4401)GGC>GAC		low density lipoprotein-related protein 1	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)						94.0	74.0	81.0					12																	57572180		2203	4300	6503	SO:0001583	missense	4035				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity	g.chr12:57572180G>A	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.4400G>A	12.37:g.57572180G>A	ENSP00000243077:p.Gly1467Asp		Somatic					p.G1467D	NM_002332	NP_002323	WXS	Illumina HiSeq	Unspecified	Q07954	LRP1_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.0103)	27	4866	+			1467			Extracellular (Potential).|LDL-receptor class B 11.		Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	37	c.4400G>A	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	G	14.42	2.530944	0.45073	.	.	ENSG00000123384	ENST00000243077	D	0.91068	-2.78	4.8	4.8	0.61643	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.64402	D	0.000001	D	0.90359	0.6983	N	0.20445	0.575	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86569	0.1846	10	0.11485	T	0.65	.	16.7965	0.85603	0.0:0.0:1.0:0.0	.	1467	Q07954	LRP1_HUMAN	D	1467	ENSP00000243077:G1467D	ENSP00000243077:G1467D	G	+	2	0	LRP1	55858447	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.637000	0.74304	2.503000	0.84419	0.561000	0.74099	GGC		0.582	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332		16	54	0	0	0	0	16	54				
AGAP2	116986	broad.mit.edu	37	12	58125675	58125676	+	Silent	DNP	GG	GG	TT			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr12:58125675_58125676GG>TT	ENST00000547588.1	-	8	1868_1869	c.1869_1870CC>AA	c.(1867-1872)ctCCga>ctAAga	p.623_624LR>LR	AGAP2_ENST00000257897.3_Silent_p.287_288LR>LR	NM_001122772.2	NP_001116244.1	Q99490	AGAP2_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 2	623					axon guidance (GO:0007411)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|large_intestine(7)|lung(20)|prostate(3)|skin(1)|stomach(1)	48						GCCTCGGCTCGGAGCTCCCGGT	0.609																																						uc001spq.2		NA																	0				central_nervous_system(3)|breast(2)	5						c.(1867-1872)CTCCGA>CTAAGA		centaurin, gamma 1 isoform PIKE-L																																				SO:0001819	synonymous_variant	116986				axon guidance|negative regulation of neuron apoptosis|negative regulation of protein catabolic process|protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	mitochondrion|nucleolus	ARF GTPase activator activity|GTP binding|zinc ion binding	g.chr12:58125675_58125676GG>TT	AF413077	CCDS8951.1, CCDS44932.1	12q13.2	2013-05-30	2008-09-22	2008-09-22	ENSG00000135439	ENSG00000135439		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16921	protein-coding gene	gene with protein product		605476	"""centaurin, gamma 1"""	CENTG1			Standard	NM_001122772		Approved		uc001spq.3	Q99490	OTTHUMG00000170285	ENST00000547588.1:c.1869_1870delinsTT	12.37:g.58125675_58125676delinsTT			Somatic				AGAP2_uc001spp.2_Silent_p.623_624LR>LR|AGAP2_uc001spr.2_Silent_p.287_288LR>LR	p.623_624LR>LR	NM_001122772	NP_001116244	WXS	Illumina HiSeq	Unspecified	Q99490	AGAP2_HUMAN			8	1869_1870	-			623_624					A8K9F7|O00578|Q548E0|Q8IWU3	Silent	DNP	ENST00000547588.1	37	c.1869_1870CC>AA	CCDS44932.1																																																																																				0.609	AGAP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408367.1	NM_014770		4	14	0	0	0	0	4	14				
BEST3	144453	broad.mit.edu	37	12	70049538	70049538	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr12:70049538C>A	ENST00000330891.5	-	10	1382	c.1156G>T	c.(1156-1158)Ggc>Tgc	p.G386C	BEST3_ENST00000331471.4_Intron|BEST3_ENST00000553096.1_Missense_Mutation_p.G280C|BEST3_ENST00000488961.1_Missense_Mutation_p.G173C	NM_001282613.1|NM_032735.2	NP_001269542.1|NP_116124.2	Q8N1M1	BEST3_HUMAN	bestrophin 3	386					negative regulation of ion transport (GO:0043271)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			cervix(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(2)	12	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)			TGCCGATGGCCATGCTTCTCA	0.547																																						uc001svg.2		NA																	0					0						c.(1156-1158)GGC>TGC		vitelliform macular dystrophy 2-like 3 isoform							93.0	97.0	96.0					12																	70049538		2087	4225	6312	SO:0001583	missense	144453					chloride channel complex|plasma membrane	chloride channel activity	g.chr12:70049538C>A	AF440758	CCDS8992.2, CCDS41810.1, CCDS61192.1, CCDS61193.1, CCDS73496.1	12q14.2-q15	2012-09-26	2006-10-18	2006-10-18	ENSG00000127325	ENSG00000127325		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17105	protein-coding gene	gene with protein product		607337	"""vitelliform macular dystrophy 2-like 3"""	VMD2L3		12032738	Standard	NM_032735		Approved	MGC40411, MGC13168	uc001svg.3	Q8N1M1	OTTHUMG00000149919	ENST00000330891.5:c.1156G>T	12.37:g.70049538C>A	ENSP00000332413:p.Gly386Cys		Somatic				BEST3_uc001svd.1_Intron|BEST3_uc001sve.1_Intron|BEST3_uc001svf.2_Missense_Mutation_p.G173C|BEST3_uc010stm.1_Missense_Mutation_p.G280C	p.G386C	NM_032735	NP_116124	WXS	Illumina HiSeq	Unspecified	Q8N1M1	BEST3_HUMAN	Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)		10	1383	-	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		386			Cytoplasmic (Potential).		B5MDI8|F8VVZ2|Q53YQ7|Q8N356|Q8NFT9|Q9BR80	Missense_Mutation	SNP	ENST00000330891.5	37	c.1156G>T	CCDS8992.2	.	.	.	.	.	.	.	.	.	.	C	12.40	1.927145	0.34002	.	.	ENSG00000127325	ENST00000488961;ENST00000330891;ENST00000553096	D;D;D	0.98028	-4.34;-4.67;-4.64	5.63	5.63	0.86233	.	0.492743	0.21841	N	0.068326	D	0.98055	0.9359	M	0.74881	2.28	0.21652	N	0.999602	D;D	0.76494	0.999;0.999	P;D	0.66979	0.862;0.948	D	0.94358	0.7585	10	0.54805	T	0.06	-15.8527	8.2779	0.31883	0.0:0.7594:0.1582:0.0824	.	386;173	Q8N1M1;B5MDI8	BEST3_HUMAN;.	C	173;386;280	ENSP00000433213:G173C;ENSP00000332413:G386C;ENSP00000449548:G280C	ENSP00000332413:G386C	G	-	1	0	BEST3	68335805	0.022000	0.18835	0.061000	0.19648	0.005000	0.04900	1.574000	0.36482	2.636000	0.89361	0.655000	0.94253	GGC		0.547	BEST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313908.2	NM_152439		35	117	1	0	2.76e-19	4.09e-19	35	117				
TRHDE	29953	broad.mit.edu	37	12	72866900	72866900	+	Missense_Mutation	SNP	A	A	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr12:72866900A>T	ENST00000261180.4	+	5	1485	c.1389A>T	c.(1387-1389)gaA>gaT	p.E463D		NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	463					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						GGCTGAAGGAAGGGTTTGCTC	0.408																																						uc001sxa.2		NA																	0				ovary(2)|skin(1)	3						c.(1387-1389)GAA>GAT		thyrotropin-releasing hormone degrading enzyme							352.0	318.0	330.0					12																	72866900		2203	4300	6503	SO:0001583	missense	29953				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding	g.chr12:72866900A>T	AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.1389A>T	12.37:g.72866900A>T	ENSP00000261180:p.Glu463Asp		Somatic					p.E463D	NM_013381	NP_037513	WXS	Illumina HiSeq	Unspecified	Q9UKU6	TRHDE_HUMAN			5	1419	+			463			Extracellular (Potential).	Zinc; catalytic (By similarity).	A5PL19|Q6UWJ4	Missense_Mutation	SNP	ENST00000261180.4	37	c.1389A>T	CCDS9004.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.414685	0.83449	.	.	ENSG00000072657	ENST00000261180	T	0.24538	1.85	5.15	2.8	0.32819	Peptidase M1, membrane alanine aminopeptidase, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.62588	0.2440	H	0.97758	4.07	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.69584	-0.5106	9	.	.	.	.	10.3144	0.43727	0.8347:0.0:0.1653:0.0	.	463	Q9UKU6	TRHDE_HUMAN	D	463	ENSP00000261180:E463D	.	E	+	3	2	TRHDE	71153167	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.857000	0.48349	0.307000	0.22880	0.528000	0.53228	GAA		0.408	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405380.1	NM_013381		41	151	0	0	0	0	41	151				
TRHDE	29953	broad.mit.edu	37	12	72956721	72956721	+	Missense_Mutation	SNP	T	T	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr12:72956721T>C	ENST00000261180.4	+	9	1904	c.1808T>C	c.(1807-1809)tTg>tCg	p.L603S	TRHDE_ENST00000549138.1_3'UTR	NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	603					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						ATCACCATCTTGGGAAACACA	0.338																																						uc001sxa.2		NA																	0				ovary(2)|skin(1)	3						c.(1807-1809)TTG>TCG		thyrotropin-releasing hormone degrading enzyme							94.0	97.0	96.0					12																	72956721		2203	4296	6499	SO:0001583	missense	29953				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding	g.chr12:72956721T>C	AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.1808T>C	12.37:g.72956721T>C	ENSP00000261180:p.Leu603Ser		Somatic					p.L603S	NM_013381	NP_037513	WXS	Illumina HiSeq	Unspecified	Q9UKU6	TRHDE_HUMAN			9	1838	+			603			Extracellular (Potential).		A5PL19|Q6UWJ4	Missense_Mutation	SNP	ENST00000261180.4	37	c.1808T>C	CCDS9004.1	.	.	.	.	.	.	.	.	.	.	T	5.597	0.294907	0.10622	.	.	ENSG00000072657	ENST00000261180	T	0.01192	5.2	6.17	6.17	0.99709	.	0.265926	0.35970	N	0.002868	T	0.00580	0.0019	N	0.01048	-1.04	0.42403	D	0.99257	B	0.06786	0.001	B	0.04013	0.001	T	0.63409	-0.6644	10	0.11794	T	0.64	.	12.5553	0.56250	0.0:0.0657:0.0:0.9342	.	603	Q9UKU6	TRHDE_HUMAN	S	603	ENSP00000261180:L603S	ENSP00000261180:L603S	L	+	2	0	TRHDE	71242988	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.472000	0.53114	2.371000	0.80710	0.533000	0.62120	TTG		0.338	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405380.1	NM_013381		60	168	0	0	0	0	60	168				
NAV3	89795	broad.mit.edu	37	12	78444555	78444555	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr12:78444555C>A	ENST00000397909.2	+	11	2317	c.2144C>A	c.(2143-2145)aCa>aAa	p.T715K	RP11-136F16.1_ENST00000549103.1_RNA|NAV3_ENST00000266692.7_Missense_Mutation_p.T715K|NAV3_ENST00000536525.2_Missense_Mutation_p.T715K|NAV3_ENST00000228327.6_Missense_Mutation_p.T715K			Q8IVL0	NAV3_HUMAN	neuron navigator 3	715						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						ACCCTGGAGACAACATTTGAC	0.463										HNSCC(70;0.22)																												uc001syp.2		NA																	0				large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						c.(2143-2145)ACA>AAA		neuron navigator 3							127.0	119.0	122.0					12																	78444555		1959	4157	6116	SO:0001583	missense	89795					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity	g.chr12:78444555C>A	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.2144C>A	12.37:g.78444555C>A	ENSP00000381007:p.Thr715Lys	HNSCC(70;0.22)	Somatic				NAV3_uc001syo.2_Missense_Mutation_p.T715K|NAV3_uc010sub.1_Missense_Mutation_p.T215K	p.T715K	NM_014903	NP_055718	WXS	Illumina HiSeq	Unspecified	Q8IVL0	NAV3_HUMAN			11	2317	+			715					Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37	c.2144C>A		.	.	.	.	.	.	.	.	.	.	C	29.9	5.041300	0.93685	.	.	ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692	T;T;T;T	0.15256	2.44;2.44;2.44;2.44	5.9	5.9	0.94986	.	0.000000	0.41294	U	0.000918	T	0.44561	0.1299	M	0.68593	2.085	0.80722	D	1	D;D;D	0.89917	1.0;0.996;1.0	D;D;D	0.91635	0.999;0.977;0.997	T	0.20874	-1.0262	10	0.87932	D	0	-18.8498	20.2822	0.98520	0.0:1.0:0.0:0.0	.	715;715;715	E7EUC6;Q8IVL0;Q8IVL0-2	.;NAV3_HUMAN;.	K	715	ENSP00000446132:T715K;ENSP00000381007:T715K;ENSP00000228327:T715K;ENSP00000266692:T715K	ENSP00000228327:T715K	T	+	2	0	NAV3	76968686	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.474000	0.81024	2.806000	0.96561	0.655000	0.94253	ACA		0.463	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		23	96	1	0	4.78e-09	6.27e-09	23	96				
NAV3	89795	broad.mit.edu	37	12	78444857	78444857	+	Missense_Mutation	SNP	G	G	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr12:78444857G>C	ENST00000397909.2	+	11	2619	c.2446G>C	c.(2446-2448)Gat>Cat	p.D816H	RP11-136F16.1_ENST00000549103.1_RNA|NAV3_ENST00000266692.7_Missense_Mutation_p.D816H|NAV3_ENST00000536525.2_Missense_Mutation_p.D816H|NAV3_ENST00000228327.6_Missense_Mutation_p.D816H			Q8IVL0	NAV3_HUMAN	neuron navigator 3	816						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						TTCTGAGGTCGATGTGGGTGG	0.493										HNSCC(70;0.22)																												uc001syp.2		NA																	0				large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						c.(2446-2448)GAT>CAT		neuron navigator 3							69.0	69.0	69.0					12																	78444857		2092	4224	6316	SO:0001583	missense	89795					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity	g.chr12:78444857G>C	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.2446G>C	12.37:g.78444857G>C	ENSP00000381007:p.Asp816His	HNSCC(70;0.22)	Somatic				NAV3_uc001syo.2_Missense_Mutation_p.D816H|NAV3_uc010sub.1_Missense_Mutation_p.D316H	p.D816H	NM_014903	NP_055718	WXS	Illumina HiSeq	Unspecified	Q8IVL0	NAV3_HUMAN			11	2619	+			816					Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37	c.2446G>C		.	.	.	.	.	.	.	.	.	.	G	25.1	4.599371	0.87055	.	.	ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692	T;T;T;T	0.33216	1.53;1.53;1.53;1.42	5.79	5.79	0.91817	.	0.000000	0.41605	U	0.000858	T	0.55449	0.1921	M	0.61703	1.905	0.80722	D	1	D;D;D	0.89917	0.998;0.999;1.0	D;P;D	0.76575	0.942;0.893;0.988	T	0.47923	-0.9079	10	0.42905	T	0.14	-22.6856	20.031	0.97536	0.0:0.0:1.0:0.0	.	816;816;816	E7EUC6;Q8IVL0;Q8IVL0-2	.;NAV3_HUMAN;.	H	816	ENSP00000446132:D816H;ENSP00000381007:D816H;ENSP00000228327:D816H;ENSP00000266692:D816H	ENSP00000228327:D816H	D	+	1	0	NAV3	76968988	1.000000	0.71417	0.979000	0.43373	0.955000	0.61496	9.365000	0.97139	2.735000	0.93741	0.655000	0.94253	GAT		0.493	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		12	56	0	0	0	0	12	56				
NAV3	89795	broad.mit.edu	37	12	78511909	78511909	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr12:78511909G>T	ENST00000397909.2	+	14	3045	c.2872G>T	c.(2872-2874)Ggt>Tgt	p.G958C	NAV3_ENST00000266692.7_Missense_Mutation_p.G958C|NAV3_ENST00000536525.2_Missense_Mutation_p.G958C|NAV3_ENST00000228327.6_Missense_Mutation_p.G958C			Q8IVL0	NAV3_HUMAN	neuron navigator 3	958						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						TGGGGATGCTGGTGGCAAGTG	0.522										HNSCC(70;0.22)																												uc001syp.2		NA																	0				large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						c.(2872-2874)GGT>TGT		neuron navigator 3							132.0	141.0	138.0					12																	78511909		1968	4154	6122	SO:0001583	missense	89795					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity	g.chr12:78511909G>T	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.2872G>T	12.37:g.78511909G>T	ENSP00000381007:p.Gly958Cys	HNSCC(70;0.22)	Somatic				NAV3_uc001syo.2_Missense_Mutation_p.G958C|NAV3_uc010sub.1_Missense_Mutation_p.G458C|NAV3_uc009zsf.2_5'UTR	p.G958C	NM_014903	NP_055718	WXS	Illumina HiSeq	Unspecified	Q8IVL0	NAV3_HUMAN			14	3045	+			958					Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37	c.2872G>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.23|12.23	1.876836|1.876836	0.33162|0.33162	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692|ENST00000552895	T;T;T;T|.	0.30182|.	1.54;1.54;1.54;1.54|.	5.85|5.85	2.61|2.61	0.31194|0.31194	.|.	0.374376|.	0.18735|.	U|.	0.132633|.	T|T	0.40347|0.40347	0.1113|0.1113	L|L	0.49778|0.49778	1.585|1.585	0.21445|0.21445	N|N	0.999688|0.999688	P;P;P|.	0.41131|.	0.539;0.677;0.739|.	B;B;B|.	0.44163|.	0.443;0.299;0.412|.	T|T	0.24870|0.24870	-1.0148|-1.0148	10|5	0.72032|.	D|.	0.01|.	-4.759|-4.759	7.093|7.093	0.25295|0.25295	0.4425:0.0:0.5574:0.0|0.4425:0.0:0.5574:0.0	.|.	958;958;958|.	E7EUC6;Q8IVL0;Q8IVL0-2|.	.;NAV3_HUMAN;.|.	C|L	958|29	ENSP00000446132:G958C;ENSP00000381007:G958C;ENSP00000228327:G958C;ENSP00000266692:G958C|.	ENSP00000228327:G958C|.	G|W	+|+	1|2	0|0	NAV3|NAV3	77036040|77036040	0.026000|0.026000	0.19158|0.19158	0.019000|0.019000	0.16419|0.16419	0.967000|0.967000	0.64934|0.64934	1.174000|1.174000	0.31932|0.31932	0.819000|0.819000	0.34492|0.34492	-0.253000|-0.253000	0.11424|0.11424	GGT|TGG		0.522	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		35	138	1	0	2.41e-17	3.52e-17	35	138				
NAV3	89795	broad.mit.edu	37	12	78562633	78562633	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr12:78562633C>A	ENST00000397909.2	+	24	5141	c.4968C>A	c.(4966-4968)gaC>gaA	p.D1656E	NAV3_ENST00000266692.7_Missense_Mutation_p.D1479E|NAV3_ENST00000536525.2_Missense_Mutation_p.D1656E|NAV3_ENST00000228327.6_Missense_Mutation_p.D1656E			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1656						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						ATGGTCCAGACCATCCTCCCA	0.378										HNSCC(70;0.22)																												uc001syp.2		NA																	0				large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						c.(4966-4968)GAC>GAA		neuron navigator 3							71.0	72.0	72.0					12																	78562633		1834	4070	5904	SO:0001583	missense	89795					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity	g.chr12:78562633C>A	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.4968C>A	12.37:g.78562633C>A	ENSP00000381007:p.Asp1656Glu	HNSCC(70;0.22)	Somatic				NAV3_uc001syo.2_Missense_Mutation_p.D1656E|NAV3_uc010sub.1_Missense_Mutation_p.D1142E|NAV3_uc009zsf.2_Missense_Mutation_p.D487E	p.D1656E	NM_014903	NP_055718	WXS	Illumina HiSeq	Unspecified	Q8IVL0	NAV3_HUMAN			24	5141	+			1656					Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37	c.4968C>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.076|8.076	0.771287|0.771287	0.16051|0.16051	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692;ENST00000378640;ENST00000550788|ENST00000552895	D;D;D;D;D|.	0.92348|.	-3.02;-3.02;-3.02;-3.02;-3.02|.	5.41|5.41	-1.7|-1.7	0.08159|0.08159	.|.	0.000000|.	0.41712|.	U|.	0.000828|.	T|T	0.46889|0.46889	0.1416|0.1416	L|L	0.28649|0.28649	0.875|0.875	0.80722|0.80722	D|D	1|1	B;B;P;P|.	0.41393|.	0.009;0.071;0.536;0.748|.	B;B;B;B|.	0.36134|.	0.007;0.048;0.205;0.218|.	T|T	0.30446|0.30446	-0.9978|-0.9978	10|5	0.02654|.	T|.	1|.	-21.4397|-21.4397	10.6284|10.6284	0.45521|0.45521	0.0:0.3672:0.0:0.6328|0.0:0.3672:0.0:0.6328	.|.	1656;1479;1656;1656|.	E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2|.	.;.;NAV3_HUMAN;.|.	E|T	1656;1656;1656;1479;277;285|551	ENSP00000446132:D1656E;ENSP00000381007:D1656E;ENSP00000228327:D1656E;ENSP00000266692:D1479E;ENSP00000448303:D285E|.	ENSP00000228327:D1656E|.	D|P	+|+	3|1	2|0	NAV3|NAV3	77086764|77086764	0.972000|0.972000	0.33761|0.33761	0.995000|0.995000	0.50966|0.50966	0.959000|0.959000	0.62525|0.62525	0.239000|0.239000	0.18023|0.18023	-0.150000|-0.150000	0.11195|0.11195	-0.145000|-0.145000	0.13849|0.13849	GAC|CCA		0.378	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		27	109	1	0	6.33e-13	8.87e-13	27	109				
GAS2L3	283431	broad.mit.edu	37	12	101012273	101012273	+	Missense_Mutation	SNP	G	G	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr12:101012273G>C	ENST00000539410.1	+	7	942	c.556G>C	c.(556-558)Gag>Cag	p.E186Q	GAS2L3_ENST00000266754.5_Missense_Mutation_p.E186Q|GAS2L3_ENST00000537247.1_Missense_Mutation_p.E82Q|GAS2L3_ENST00000547754.1_Missense_Mutation_p.E186Q			Q86XJ1	GA2L3_HUMAN	growth arrest-specific 2 like 3	186					actin cytoskeleton organization (GO:0030036)|cell cycle arrest (GO:0007050)|microtubule cytoskeleton organization (GO:0000226)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	actin binding (GO:0003779)|microtubule binding (GO:0008017)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(15)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35						GAAAGAAATTGAGTTAGAAGA	0.423																																						uc001thu.2		NA																	0				skin(1)	1						c.(556-558)GAG>CAG		growth arrest-specific 2 like 3							147.0	153.0	151.0					12																	101012273		2203	4300	6503	SO:0001583	missense	283431				cell cycle arrest			g.chr12:101012273G>C	AK095594	CCDS9079.1	12q23.1	2014-09-11			ENSG00000139354	ENSG00000139354			27475	protein-coding gene	gene with protein product							Standard	NM_174942		Approved		uc001thu.3	Q86XJ1	OTTHUMG00000170439	ENST00000539410.1:c.556G>C	12.37:g.101012273G>C	ENSP00000439672:p.Glu186Gln		Somatic				GAS2L3_uc009zty.2_Missense_Mutation_p.E186Q|GAS2L3_uc001thv.2_Missense_Mutation_p.E82Q	p.E186Q	NM_174942	NP_777602	WXS	Illumina HiSeq	Unspecified	Q86XJ1	GA2L3_HUMAN			8	782	+			186					B2RCN2	Missense_Mutation	SNP	ENST00000539410.1	37	c.556G>C	CCDS9079.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.892311	0.91889	.	.	ENSG00000139354	ENST00000266754;ENST00000547754;ENST00000537247;ENST00000539410	T;T;T;T	0.46819	0.86;0.86;0.86;0.86	5.27	5.27	0.74061	Calponin homology domain (2);	0.000000	0.85682	D	0.000000	T	0.62563	0.2438	M	0.77103	2.36	0.51012	D	0.999908	P	0.50710	0.938	P	0.50270	0.636	T	0.67480	-0.5660	10	0.59425	D	0.04	-24.3224	19.2547	0.93941	0.0:0.0:1.0:0.0	.	186	Q86XJ1	GA2L3_HUMAN	Q	186;186;82;186	ENSP00000266754:E186Q;ENSP00000448955:E186Q;ENSP00000442406:E82Q;ENSP00000439672:E186Q	ENSP00000266754:E186Q	E	+	1	0	GAS2L3	99536404	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	8.862000	0.92283	2.616000	0.88540	0.484000	0.47621	GAG		0.423	GAS2L3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409143.1	NM_174942		26	74	0	0	0	0	26	74				
STAB2	55576	broad.mit.edu	37	12	104044339	104044339	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr12:104044339G>T	ENST00000388887.2	+	11	1444	c.1240G>T	c.(1240-1242)Gga>Tga	p.G414*		NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						TACAGACAAGGGACTGAAAGG	0.423																																						uc001tjw.2		NA																	0				ovary(9)|skin(5)	14						c.(1240-1242)GGA>TGA		stabilin 2 precursor							99.0	90.0	93.0					12																	104044339		2203	4300	6503	SO:0001587	stop_gained	55576				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity	g.chr12:104044339G>T	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.1240G>T	12.37:g.104044339G>T	ENSP00000373539:p.Gly414*		Somatic					p.G414*	NM_017564	NP_060034	WXS	Illumina HiSeq	Unspecified	Q8WWQ8	STAB2_HUMAN			11	1426	+			414			Extracellular (Potential).|FAS1 1.			Nonsense_Mutation	SNP	ENST00000388887.2	37	c.1240G>T	CCDS31888.1	.	.	.	.	.	.	.	.	.	.	G	36	5.867311	0.97043	.	.	ENSG00000136011	ENST00000388887	.	.	.	5.03	4.14	0.48551	.	0.067357	0.56097	D	0.000027	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	13.076	0.59087	0.0788:0.0:0.9212:0.0	.	.	.	.	X	414	.	ENSP00000373539:G414X	G	+	1	0	STAB2	102568469	1.000000	0.71417	0.187000	0.23214	0.041000	0.13682	7.255000	0.78338	1.127000	0.42034	0.650000	0.86243	GGA		0.423	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1			9	31	1	0	2.74e-10	3.7e-10	9	31				
POLR3B	55703	broad.mit.edu	37	12	106786921	106786921	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr12:106786921C>T	ENST00000228347.4	+	10	1058	c.836C>T	c.(835-837)aCa>aTa	p.T279I	POLR3B_ENST00000539066.1_Missense_Mutation_p.T221I	NM_018082.5	NP_060552.4	Q9NW08	RPC2_HUMAN	polymerase (RNA) III (DNA directed) polypeptide B	279					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(22)|ovary(1)|prostate(3)|skin(3)|urinary_tract(2)	57						CAGATTTTCACACAGATGCAG	0.458																																						uc001tlp.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(835-837)ACA>ATA		DNA-directed RNA polymerase III B isoform 1							215.0	203.0	207.0					12																	106786921		2203	4300	6503	SO:0001583	missense	55703				innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|ribonucleoside binding	g.chr12:106786921C>T	AY092084	CCDS9105.1, CCDS53824.1	12q23.3	2014-08-12			ENSG00000013503	ENSG00000013503		"""RNA polymerase subunits"""	30348	protein-coding gene	gene with protein product		614366				12391170	Standard	NM_018082		Approved	RPC2, FLJ10388	uc001tlp.3	Q9NW08	OTTHUMG00000170077	ENST00000228347.4:c.836C>T	12.37:g.106786921C>T	ENSP00000228347:p.Thr279Ile		Somatic				POLR3B_uc001tlq.2_Missense_Mutation_p.T221I	p.T279I	NM_018082	NP_060552	WXS	Illumina HiSeq	Unspecified	Q9NW08	RPC2_HUMAN			10	1058	+			279					A8K6H0|B3KV73|F5H1E6|Q9NW59	Missense_Mutation	SNP	ENST00000228347.4	37	c.836C>T	CCDS9105.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.661755	0.88154	.	.	ENSG00000013503	ENST00000228347;ENST00000551370;ENST00000539066;ENST00000549569	T;T;T	0.70164	-0.46;-0.46;-0.46	5.74	5.74	0.90152	RNA polymerase, beta subunit, protrusion (1);RNA polymerase Rpb2, domain 2 (1);	0.000000	0.85682	D	0.000000	D	0.86201	0.5876	M	0.92833	3.35	0.80722	D	1	P	0.50066	0.931	D	0.67548	0.952	D	0.88735	0.3239	10	0.87932	D	0	-20.4205	18.1163	0.89556	0.0:1.0:0.0:0.0	.	279	Q9NW08	RPC2_HUMAN	I	279;279;221;37	ENSP00000228347:T279I;ENSP00000445721:T221I;ENSP00000448398:T37I	ENSP00000228347:T279I	T	+	2	0	POLR3B	105311051	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.395000	0.79876	2.715000	0.92844	0.655000	0.94253	ACA		0.458	POLR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407166.1	NM_018082		73	188	0	0	0	0	73	188				
NAA25	80018	broad.mit.edu	37	12	112491432	112491432	+	Missense_Mutation	SNP	A	A	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr12:112491432A>G	ENST00000261745.4	-	15	1906	c.1658T>C	c.(1657-1659)cTa>cCa	p.L553P		NM_024953.3	NP_079229.2	Q14CX7	NAA25_HUMAN	N(alpha)-acetyltransferase 25, NatB auxiliary subunit	553						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(1)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	46						ATACTGACCTAGAGATTCAGC	0.358																																						uc001ttm.2		NA																	0				ovary(1)|breast(1)|pancreas(1)	3						c.(1657-1659)CTA>CCA		mitochondrial distribution and morphology 20							60.0	55.0	57.0					12																	112491432		2203	4300	6503	SO:0001583	missense	80018					cytoplasm	protein binding	g.chr12:112491432A>G	AB054990	CCDS9159.1	12q24.13	2013-10-11	2010-01-14	2010-01-14		ENSG00000111300		"""N(alpha)-acetyltransferase subunits"""	25783	protein-coding gene	gene with protein product		612755	"""chromosome 12 open reading frame 30"""	C12orf30		19660095	Standard	NM_024953		Approved	FLJ13089	uc001ttm.3	Q14CX7	OTTHUMG00000169638	ENST00000261745.4:c.1658T>C	12.37:g.112491432A>G	ENSP00000261745:p.Leu553Pro		Somatic				NAA25_uc001ttn.3_RNA|NAA25_uc009zvz.1_Missense_Mutation_p.L525P|NAA25_uc009zwa.1_Missense_Mutation_p.L553P	p.L553P	NM_024953	NP_079229	WXS	Illumina HiSeq	Unspecified	Q14CX7	NAA25_HUMAN			15	1678	-			553					A0JLU7|Q6MZH1|Q7Z4N6|Q9H911	Missense_Mutation	SNP	ENST00000261745.4	37	c.1658T>C	CCDS9159.1	.	.	.	.	.	.	.	.	.	.	A	24.3	4.513601	0.85389	.	.	ENSG00000111300	ENST00000261745	T	0.21031	2.03	5.99	5.99	0.97316	Tetratricopeptide-like helical (1);	0.000000	0.64402	D	0.000001	T	0.47820	0.1466	M	0.77103	2.36	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.70016	0.967;0.967	T	0.40572	-0.9556	10	0.37606	T	0.19	-6.6441	16.4943	0.84223	1.0:0.0:0.0:0.0	.	553;553	A8K8X0;Q14CX7	.;NAA25_HUMAN	P	553	ENSP00000261745:L553P	ENSP00000261745:L553P	L	-	2	0	NAA25	110975815	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.904000	0.92590	2.291000	0.77112	0.533000	0.62120	CTA		0.358	NAA25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405205.1	NM_024953		9	32	0	0	0	0	9	32				
TBX5	6910	broad.mit.edu	37	12	114793739	114793739	+	Silent	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr12:114793739G>T	ENST00000310346.4	-	9	1821	c.1155C>A	c.(1153-1155)ccC>ccA	p.P385P	TBX5_ENST00000405440.2_Silent_p.P385P|TBX5_ENST00000349716.5_Silent_p.P335P	NM_000192.3	NP_000183.2	Q99593	TBX5_HUMAN	T-box 5	385					apoptotic nuclear changes (GO:0030262)|atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His development (GO:0003166)|cardiac left ventricle formation (GO:0003218)|cardiac muscle cell differentiation (GO:0055007)|cell migration involved in coronary vasculogenesis (GO:0060980)|cell-cell signaling (GO:0007267)|embryonic forelimb morphogenesis (GO:0035115)|embryonic limb morphogenesis (GO:0030326)|endocardial cushion development (GO:0003197)|forelimb morphogenesis (GO:0035136)|gene expression (GO:0010467)|heart development (GO:0007507)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pattern specification process (GO:0007389)|pericardium development (GO:0060039)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of execution phase of apoptosis (GO:1900117)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle tissue development (GO:0003229)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(29)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		GCTCGCTGGGGGGCGCAGAGC	0.632																																					NSCLC(152;1358 1980 4050 23898 40356)	uc001tvo.2		NA																	0				ovary(6)|pancreas(1)|skin(1)	8						c.(1153-1155)CCC>CCA		T-box 5 isoform 1							72.0	63.0	66.0					12																	114793739		2203	4300	6503	SO:0001819	synonymous_variant	6910				cardiac left ventricle formation|cell migration involved in coronary vasculogenesis|cell-cell signaling|embryonic arm morphogenesis|induction of apoptosis|negative regulation of cardiac muscle cell proliferation|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|pericardium development|positive regulation of cardioblast differentiation|positive regulation of transcription from RNA polymerase II promoter|ventricular septum development	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding	g.chr12:114793739G>T	U89353	CCDS9173.1, CCDS9174.1	12q24.1	2014-09-17			ENSG00000089225	ENSG00000089225		"""T-boxes"""	11604	protein-coding gene	gene with protein product		601620		HOS		8988165, 8054982	Standard	NM_000192		Approved		uc001tvo.4	Q99593	OTTHUMG00000166191	ENST00000310346.4:c.1155C>A	12.37:g.114793739G>T			Somatic				TBX5_uc001tvp.2_Silent_p.P385P|TBX5_uc001tvq.2_Silent_p.P335P	p.P385P	NM_181486	NP_852259	WXS	Illumina HiSeq	Unspecified	Q99593	TBX5_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.0893)	9	1650	-	Medulloblastoma(191;0.163)|all_neural(191;0.178)		385					A6ND77|O15301|Q96TB0|Q9Y4I2	Silent	SNP	ENST00000310346.4	37	c.1155C>A	CCDS9173.1																																																																																				0.632	TBX5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388297.1	NM_080717		10	86	1	0	7.48e-07	9.26e-07	10	86				
DHX37	57647	broad.mit.edu	37	12	125470763	125470763	+	Missense_Mutation	SNP	G	G	A	rs529499939		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr12:125470763G>A	ENST00000308736.2	-	2	253	c.155C>T	c.(154-156)cCg>cTg	p.P52L		NM_032656.3	NP_116045.2	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	52							ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(5)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|liver(1)|lung(27)|ovary(1)|prostate(2)|skin(3)	65	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		CTTCTTCCCCGGTAGAACGAG	0.493													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18528	0.0		0.0	False		,,,				2504	0.0					uc001ugy.2		NA																	0				skin(1)	1						c.(154-156)CCG>CTG		DEAH (Asp-Glu-Ala-His) box polypeptide 37							149.0	138.0	142.0					12																	125470763		2203	4300	6503	SO:0001583	missense	57647						ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding	g.chr12:125470763G>A	AB040950	CCDS9261.1	12q24.31	2004-03-25	2003-06-13	2003-06-20		ENSG00000150990		"""DEAH-boxes"""	17210	protein-coding gene	gene with protein product			"""DEAD/DEAH box helicase DDX37"""	DDX37		10819331	Standard	NM_032656		Approved	KIAA1517, MGC4322, MGC2695	uc001ugy.3	Q8IY37		ENST00000308736.2:c.155C>T	12.37:g.125470763G>A	ENSP00000311135:p.Pro52Leu		Somatic					p.P52L	NM_032656	NP_116045	WXS	Illumina HiSeq	Unspecified	Q8IY37	DHX37_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)	2	254	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)		52					Q9BUI7|Q9P211	Missense_Mutation	SNP	ENST00000308736.2	37	c.155C>T	CCDS9261.1	.	.	.	.	.	.	.	.	.	.	G	11.04	1.521314	0.27211	.	.	ENSG00000150990	ENST00000308736	T	0.08807	3.05	4.04	2.16	0.27623	.	0.000000	0.85682	D	0.000000	T	0.13329	0.0323	M	0.82716	2.605	0.80722	D	1	B	0.14438	0.01	B	0.10450	0.005	T	0.03051	-1.1078	10	0.87932	D	0	-0.6562	9.6565	0.39930	0.1821:0.0:0.8179:0.0	.	52	Q8IY37	DHX37_HUMAN	L	52	ENSP00000311135:P52L	ENSP00000311135:P52L	P	-	2	0	DHX37	124036716	1.000000	0.71417	0.131000	0.22000	0.460000	0.32559	3.045000	0.49838	0.277000	0.22141	-0.424000	0.05967	CCG		0.493	DHX37-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_032656		50	129	0	0	0	0	50	129				
GPR133	283383	broad.mit.edu	37	12	131620641	131620641	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr12:131620641G>A	ENST00000261654.5	+	22	2886	c.2327G>A	c.(2326-2328)gGc>gAc	p.G776D	GPR133_ENST00000540207.1_3'UTR|GPR133_ENST00000535015.1_Missense_Mutation_p.G808D|GPR133_ENST00000376682.4_Missense_Mutation_p.G462D|GPR133_ENST00000543617.1_Missense_Mutation_p.G295D	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	776					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		TGGGTCTTTGGCGTGCTTGCT	0.617																																						uc001uit.3		NA																	0				pancreas(5)|ovary(3)|skin(2)	10						c.(2326-2328)GGC>GAC		G protein-coupled receptor 133 precursor							278.0	177.0	211.0					12																	131620641		2203	4300	6503	SO:0001583	missense	283383				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr12:131620641G>A	AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.2327G>A	12.37:g.131620641G>A	ENSP00000261654:p.Gly776Asp		Somatic				GPR133_uc010tbm.1_Missense_Mutation_p.G808D|GPR133_uc009zyo.2_Missense_Mutation_p.G58D|GPR133_uc009zyp.2_RNA	p.G776D	NM_198827	NP_942122	WXS	Illumina HiSeq	Unspecified	Q6QNK2	GP133_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)	22	2886	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)		776			Helical; Name=6; (Potential).		B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Missense_Mutation	SNP	ENST00000261654.5	37	c.2327G>A	CCDS9272.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.63|17.63	3.438428|3.438428	0.62955|0.62955	.|.	.|.	ENSG00000111452|ENSG00000111452	ENST00000335486|ENST00000261654;ENST00000535015;ENST00000376682;ENST00000543617	.|T;T;T;T	.|0.61158	.|0.13;0.13;0.13;0.13	4.6|4.6	4.6|4.6	0.57074|0.57074	.|GPCR, family 2-like (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.79930|0.79930	0.4531|0.4531	M|M	0.89658|0.89658	3.05|3.05	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.97110	.|1.0;1.0;1.0	D|D	0.84871|0.84871	0.0825|0.0825	5|10	.|0.87932	.|D	.|0	.|.	14.915|14.915	0.70789|0.70789	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|808;129;776	.|B7ZLF7;Q9NSM3;Q6QNK2	.|.;.;GP133_HUMAN	T|D	130|776;808;462;295	.|ENSP00000261654:G776D;ENSP00000444425:G808D;ENSP00000365872:G462D;ENSP00000438021:G295D	.|ENSP00000261654:G776D	A|G	+|+	1|2	0|0	GPR133|GPR133	130186594|130186594	1.000000|1.000000	0.71417|0.71417	0.201000|0.201000	0.23476|0.23476	0.318000|0.318000	0.28184|0.28184	8.045000|8.045000	0.89436|0.89436	2.081000|2.081000	0.62600|0.62600	0.491000|0.491000	0.48974|0.48974	GCG|GGC		0.617	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399356.1	NM_198827		10	48	0	0	0	0	10	48				
GPR133	283383	broad.mit.edu	37	12	131621519	131621519	+	Splice_Site	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr12:131621519G>T	ENST00000261654.5	+	23	2955	c.2396G>T	c.(2395-2397)gGa>gTa	p.G799V	GPR133_ENST00000540207.1_3'UTR|GPR133_ENST00000535015.1_Splice_Site_p.G831V|GPR133_ENST00000376682.4_Splice_Site_p.G485V|GPR133_ENST00000543617.1_Splice_Site_p.G318V	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	799					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		TCTTCCCAGGGACTGTTCATA	0.532																																						uc001uit.3		NA																	0				pancreas(5)|ovary(3)|skin(2)	10						c.(2395-2397)GGA>GTA		G protein-coupled receptor 133 precursor							270.0	217.0	235.0					12																	131621519		2203	4300	6503	SO:0001630	splice_region_variant	283383				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr12:131621519G>T	AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.2395-1G>T	12.37:g.131621519G>T			Somatic				GPR133_uc010tbm.1_Missense_Mutation_p.G831V|GPR133_uc009zyo.2_Missense_Mutation_p.G81V|GPR133_uc009zyp.2_RNA	p.G799V	NM_198827	NP_942122	WXS	Illumina HiSeq	Unspecified	Q6QNK2	GP133_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)	23	2955	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)		799			Helical; Name=7; (Potential).		B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Missense_Mutation	SNP	ENST00000261654.5	37	c.2396G>T	CCDS9272.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.01|18.01	3.528189|3.528189	0.64860|0.64860	.|.	.|.	ENSG00000111452|ENSG00000111452	ENST00000335486|ENST00000261654;ENST00000535015;ENST00000376682;ENST00000543617	.|D;D;D;D	.|0.84660	.|-1.88;-1.88;-1.88;-1.88	4.23|4.23	4.23|4.23	0.50019|0.50019	.|GPCR, family 2-like (1);GPCR, family 2, secretin-like, conserved site (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.93471|0.93471	0.7917|0.7917	M|M	0.91249|0.91249	3.19|3.19	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|0.999;1.0;0.999	.|D;D;D	.|0.97110	.|0.999;1.0;0.999	D|D	0.94887|0.94887	0.8044|0.8044	5|10	.|0.87932	.|D	.|0	.|.	14.4411|14.4411	0.67318|0.67318	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|831;152;799	.|B7ZLF7;Q9NSM3;Q6QNK2	.|.;.;GP133_HUMAN	Y|V	153|799;831;485;318	.|ENSP00000261654:G799V;ENSP00000444425:G831V;ENSP00000365872:G485V;ENSP00000438021:G318V	.|ENSP00000261654:G799V	D|G	+|+	1|2	0|0	GPR133|GPR133	130187472|130187472	1.000000|1.000000	0.71417|0.71417	0.919000|0.919000	0.36401|0.36401	0.852000|0.852000	0.48524|0.48524	5.786000|5.786000	0.69006|0.69006	2.069000|2.069000	0.61940|0.61940	0.561000|0.561000	0.74099|0.74099	GAC|GGA		0.532	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399356.1	NM_198827	Missense_Mutation	19	85	1	0	1.85e-09	2.46e-09	19	85				
POLE	5426	broad.mit.edu	37	12	133241050	133241050	+	Splice_Site	SNP	T	T	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr12:133241050T>A	ENST00000320574.5	-	22	2512		c.e22-2		POLE_ENST00000535270.1_Splice_Site	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit						base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	CAGCGAGCCCTGAGAGGACAC	0.602								DNA polymerases (catalytic subunits)																														uc001uks.1		NA																	0				ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8						c.e22-1	DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage	DNA-directed DNA polymerase epsilon							58.0	49.0	52.0					12																	133241050		2203	4300	6503	SO:0001630	splice_region_variant	5426				base-excision repair, gap-filling|DNA synthesis involved in DNA repair|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	chromatin binding|DNA binding|DNA-directed DNA polymerase activity|nucleotide binding|protein binding|zinc ion binding	g.chr12:133241050T>A		CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.2469-2A>T	12.37:g.133241050T>A			Somatic				POLE_uc010tbq.1_Splice_Site|POLE_uc009zyu.1_Splice_Site_p.G796_splice	p.G823_splice	NM_006231	NP_006222	WXS	Illumina HiSeq	Unspecified	Q07864	DPOE1_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	22	2513	-	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)						Q13533|Q86VH9	Splice_Site	SNP	ENST00000320574.5	37	c.2469_splice	CCDS9278.1	.	.	.	.	.	.	.	.	.	.	T	17.91	3.503965	0.64410	.	.	ENSG00000177084	ENST00000320574;ENST00000455752;ENST00000535270;ENST00000539006;ENST00000376577	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5776	0.76404	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	POLE	131751123	1.000000	0.71417	0.996000	0.52242	0.526000	0.34562	7.658000	0.83755	2.092000	0.63282	0.519000	0.50382	.		0.602	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397689.2	NM_006231	Intron	16	37	0	0	0	0	16	37				
RB1	5925	broad.mit.edu	37	13	49033970	49033970	+	Splice_Site	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr13:49033970G>T	ENST00000267163.4	+	20	2244		c.e20+1			NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(13)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TTTGGACCAAGTAAGAAAATC	0.393		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																												uc001vcb.2		6	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	D|Mis|N|F|S	retinoblastoma gene			"""L, E, M, O"""		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung		28	Whole gene deletion(15)|Unknown(13)	p.?(6)	bone(10)|breast(5)|haematopoietic_and_lymphoid_tissue(4)|lung(3)|adrenal_gland(1)|eye(1)|soft_tissue(1)|endometrium(1)|urinary_tract(1)|liver(1)	lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358						c.e20+1		retinoblastoma 1	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)						70.0	62.0	65.0					13																	49033970		2203	4300	6503	SO:0001630	splice_region_variant	5925	Hereditary_Retinoblastoma	Familial Cancer Database		androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	g.chr13:49033970G>T	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.2106+1G>T	13.37:g.49033970G>T		TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)	Somatic					p.Q702_splice	NM_000321	NP_000312	WXS	Illumina HiSeq	Unspecified	P06400	RB_HUMAN		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	20	2272	+		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)						A8K5E3|P78499|Q5VW46|Q8IZL4	Splice_Site	SNP	ENST00000267163.4	37	c.2106_splice	CCDS31973.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.771837	0.90108	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	5.48	5.48	0.80851	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3477	0.94372	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RB1	47931971	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.476000	0.97823	2.581000	0.87130	0.585000	0.79938	.		0.393	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044884.1		Intron	9	27	1	0	7.48e-07	9.26e-07	9	27				
MYCBP2	23077	broad.mit.edu	37	13	77633756	77633756	+	Missense_Mutation	SNP	G	G	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr13:77633756G>C	ENST00000544440.2	-	77	12945	c.12928C>G	c.(12928-12930)Ccc>Gcc	p.P4310A	MYCBP2_ENST00000357337.6_Missense_Mutation_p.P4310A|MYCBP2_ENST00000407578.2_Missense_Mutation_p.P4348A					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		CTCGTGGTGGGTTTGCCTAGG	0.393																																						uc001vkf.2		NA																	0				ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14						c.(12928-12930)CCC>GCC		MYC binding protein 2							109.0	95.0	100.0					13																	77633756		2203	4300	6503	SO:0001583	missense	23077				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding	g.chr13:77633756G>C	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.12928C>G	13.37:g.77633756G>C	ENSP00000444596:p.Pro4310Ala		Somatic				MYCBP2_uc010aev.2_Missense_Mutation_p.P3714A|MYCBP2_uc001vke.2_Missense_Mutation_p.P927A	p.P4310A	NM_015057	NP_055872	WXS	Illumina HiSeq	Unspecified	O75592	MYCB2_HUMAN		GBM - Glioblastoma multiforme(99;0.109)	78	13019	-		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)	4310						Missense_Mutation	SNP	ENST00000544440.2	37	c.12928C>G		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.50|15.50	2.852530|2.852530	0.51270|0.51270	.|.	.|.	ENSG00000005810|ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440|ENST00000429715	T;T;T|.	0.28666|.	1.6;1.6;1.6|.	5.54|5.54	5.54|5.54	0.83059|0.83059	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.51483|0.51483	0.1677|0.1677	N|N	0.17082|0.17082	0.46|0.46	0.80722|0.80722	D|D	1|1	B|.	0.25521|.	0.128|.	B|.	0.20955|.	0.032|.	T|T	0.46456|0.46456	-0.9190|-0.9190	10|5	0.15066|.	T|.	0.55|.	.|.	17.252|17.252	0.87045|0.87045	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	4310|.	O75592|.	MYCB2_HUMAN|.	A|S	4310;4348;4310|730	ENSP00000349892:P4310A;ENSP00000384288:P4348A;ENSP00000444596:P4310A|.	ENSP00000349892:P4310A|.	P|T	-|-	1|2	0|0	MYCBP2|MYCBP2	76531757|76531757	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.979000|0.979000	0.70002|0.70002	9.221000|9.221000	0.95188|0.95188	2.589000|2.589000	0.87451|0.87451	0.591000|0.591000	0.81541|0.81541	CCC|ACC		0.393	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057		27	69	0	0	0	0	27	69				
GPC5	2262	broad.mit.edu	37	13	92345593	92345593	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr13:92345593G>A	ENST00000377067.3	+	3	850	c.478G>A	c.(478-480)Gaa>Aaa	p.E160K		NM_004466.4	NP_004457.1	P78333	GPC5_HUMAN	glypican 5	160					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(4)|endometrium(6)|kidney(4)|large_intestine(7)|lung(34)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				TGTTAATCCTGAAGAATTTGT	0.448																																						uc010tif.1		NA																	0				ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5						c.(478-480)GAA>AAA		glypican 5 precursor							150.0	154.0	153.0					13																	92345593		2203	4300	6503	SO:0001583	missense	2262					anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding	g.chr13:92345593G>A	AF001462	CCDS9468.1	13q32	2011-08-01			ENSG00000179399	ENSG00000179399		"""Proteoglycans / Cell Surface : Glypicans"""	4453	protein-coding gene	gene with protein product	"""glypican proteoglycan 5"""	602446				9070915, 20304703, 19556317, 15057823	Standard	NM_004466		Approved		uc010tif.2	P78333	OTTHUMG00000017200	ENST00000377067.3:c.478G>A	13.37:g.92345593G>A	ENSP00000366267:p.Glu160Lys		Somatic					p.E160K	NM_004466	NP_004457	WXS	Illumina HiSeq	Unspecified	P78333	GPC5_HUMAN			3	844	+	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)	160					B2R726|O60436|Q9BX27	Missense_Mutation	SNP	ENST00000377067.3	37	c.478G>A	CCDS9468.1	.	.	.	.	.	.	.	.	.	.	G	16.95	3.262574	0.59431	.	.	ENSG00000179399	ENST00000377067	T	0.56776	0.44	5.07	5.07	0.68467	.	0.265056	0.42420	D	0.000701	T	0.69691	0.3139	M	0.80422	2.495	0.43381	D	0.995481	D	0.53151	0.958	P	0.62740	0.906	T	0.73216	-0.4053	10	0.62326	D	0.03	.	11.0004	0.47602	0.0857:0.0:0.9143:0.0	.	160	P78333	GPC5_HUMAN	K	160	ENSP00000366267:E160K	ENSP00000366267:E160K	E	+	1	0	GPC5	91143594	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	6.696000	0.74598	2.351000	0.79841	0.467000	0.42956	GAA		0.448	GPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045454.1	NM_004466		45	99	0	0	0	0	45	99				
MYO16	23026	broad.mit.edu	37	13	109472729	109472729	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr13:109472729C>A	ENST00000357550.2	+	7	887	c.846C>A	c.(844-846)caC>caA	p.H282Q	MYO16_ENST00000356711.2_Missense_Mutation_p.H282Q|MYO16_ENST00000251041.5_Missense_Mutation_p.H282Q	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			CAAACCCACACCTCGTGAACT	0.438																																						uc001vqt.1		NA																	0				ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10						c.(844-846)CAC>CAA		myosin heavy chain Myr 8							119.0	96.0	104.0					13																	109472729		2203	4300	6503	SO:0001583	missense	23026				cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity	g.chr13:109472729C>A		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.846C>A	13.37:g.109472729C>A	ENSP00000350160:p.His282Gln		Somatic				MYO16_uc010agk.1_Missense_Mutation_p.H304Q|MYO16_uc001vqu.1_Missense_Mutation_p.H82Q	p.H282Q	NM_015011	NP_055826	WXS	Illumina HiSeq	Unspecified	Q9Y6X6	MYO16_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)		8	972	+	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		282			ANK 7.			Missense_Mutation	SNP	ENST00000357550.2	37	c.846C>A	CCDS32008.1	.	.	.	.	.	.	.	.	.	.	C	10.64	1.406889	0.25378	.	.	ENSG00000041515	ENST00000356711;ENST00000397258;ENST00000357550;ENST00000251041;ENST00000375857	T;T;T	0.52754	0.65;0.65;0.65	5.7	1.28	0.21552	Ankyrin repeat-containing domain (4);	0.848527	0.09635	U	0.775734	T	0.22859	0.0552	N	0.11698	0.16	0.44295	D	0.997168	B;B	0.13145	0.005;0.007	B;B	0.19148	0.007;0.024	T	0.29088	-1.0023	9	.	.	.	.	0.376	0.00387	0.2071:0.3253:0.2038:0.2637	.	282;282	Q9Y6X6-2;Q9Y6X6	.;MYO16_HUMAN	Q	282;282;282;282;70	ENSP00000349145:H282Q;ENSP00000350160:H282Q;ENSP00000251041:H282Q	.	H	+	3	2	MYO16	108270730	0.995000	0.38212	0.031000	0.17742	0.871000	0.50021	0.732000	0.26072	0.294000	0.22547	0.650000	0.86243	CAC		0.438	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011		4	18	1	0	0.000602214	0.000669173	4	18				
OR5AU1	390445	broad.mit.edu	37	14	21623117	21623117	+	Missense_Mutation	SNP	C	C	A	rs562622063	byFrequency	TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr14:21623117C>A	ENST00000304418.3	-	1	1105	c.1068G>T	c.(1066-1068)tgG>tgT	p.W356C		NM_001004731.1	NP_001004731.1	Q8NGC0	O5AU1_HUMAN	olfactory receptor, family 5, subfamily AU, member 1	356						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(12)|pancreas(1)	21	all_cancers(95;0.00238)		Epithelial(56;6.88e-07)|all cancers(55;6.02e-06)	GBM - Glioblastoma multiforme(265;0.0192)		TTTTCCTACCCCAAACCTTTA	0.428																																						uc010tlp.1		NA																	0				central_nervous_system(1)	1						c.(1066-1068)TGG>TGT		olfactory receptor, family 5, subfamily AU,							86.0	84.0	84.0					14																	21623117		2203	4300	6503	SO:0001583	missense	390445				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:21623117C>A	AL157687	CCDS32042.1	14q11.2	2013-09-23			ENSG00000169327	ENSG00000169327		"""GPCR / Class A : Olfactory receptors"""	15362	protein-coding gene	gene with protein product							Standard	NM_001004731		Approved		uc010tlp.2	Q8NGC0	OTTHUMG00000170753	ENST00000304418.3:c.1068G>T	14.37:g.21623117C>A	ENSP00000302057:p.Trp356Cys		Somatic					p.W356C	NM_001004731	NP_001004731	WXS	Illumina HiSeq	Unspecified	Q8NGC0	O5AU1_HUMAN	Epithelial(56;6.88e-07)|all cancers(55;6.02e-06)	GBM - Glioblastoma multiforme(265;0.0192)	1	1068	-	all_cancers(95;0.00238)		356			Cytoplasmic (Potential).		B2RP78|Q6IEU2|Q96R10	Missense_Mutation	SNP	ENST00000304418.3	37	c.1068G>T	CCDS32042.1	.	.	.	.	.	.	.	.	.	.	C	9.062	0.994831	0.19043	.	.	ENSG00000169327	ENST00000304418	T	0.36878	1.23	3.85	3.85	0.44370	.	.	.	.	.	T	0.16599	0.0399	N	0.11789	0.175	0.35590	D	0.807031	P	0.43519	0.809	B	0.28849	0.095	T	0.26189	-1.0110	9	0.87932	D	0	.	9.6816	0.40074	0.0:0.7872:0.2128:0.0	.	356	Q8NGC0	O5AU1_HUMAN	C	356	ENSP00000302057:W356C	ENSP00000302057:W356C	W	-	3	0	OR5AU1	20692957	0.000000	0.05858	0.774000	0.31636	0.330000	0.28571	0.062000	0.14389	2.138000	0.66242	0.491000	0.48974	TGG		0.428	OR5AU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410213.1			15	95	1	0	4.75e-09	6.24e-09	15	95				
CHD8	57680	broad.mit.edu	37	14	21859702	21859702	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr14:21859702C>T	ENST00000557364.1	-	36	7248	c.6985G>A	c.(6985-6987)Gag>Aag	p.E2329K	CHD8_ENST00000399982.2_Missense_Mutation_p.E2329K|CHD8_ENST00000430710.3_Missense_Mutation_p.E2050K|SNORD9_ENST00000362566.1_RNA			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	2329					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		GGGGCATCCTCACCCACCAGC	0.557																																						uc001was.1		NA																	0				ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)|skin(1)	10						c.(6148-6150)GAG>AAG		chromodomain helicase DNA binding protein 8							46.0	48.0	47.0					14																	21859702		2039	4181	6220	SO:0001583	missense	57680				ATP-dependent chromatin remodeling|canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	MLL1 complex	ATP binding|beta-catenin binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity|methylated histone residue binding|p53 binding	g.chr14:21859702C>T	AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.6985G>A	14.37:g.21859702C>T	ENSP00000451601:p.Glu2329Lys		Somatic				CHD8_uc001war.1_Missense_Mutation_p.E1946K	p.E2050K	NM_020920	NP_065971	WXS	Illumina HiSeq	Unspecified	Q9HCK8	CHD8_HUMAN	Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)	36	6242	-	all_cancers(95;0.00121)		2329					Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Missense_Mutation	SNP	ENST00000557364.1	37	c.6148G>A	CCDS53885.1	.	.	.	.	.	.	.	.	.	.	C	19.09	3.759602	0.69763	.	.	ENSG00000100888	ENST00000430710;ENST00000399982;ENST00000262707;ENST00000557364	T;T;T	0.44083	0.93;0.93;0.93	5.42	5.42	0.78866	.	0.050806	0.85682	D	0.000000	T	0.36413	0.0966	L	0.42245	1.32	0.49389	D	0.999785	P	0.40731	0.728	B	0.32980	0.156	T	0.34875	-0.9811	10	0.62326	D	0.03	-10.6446	18.1527	0.89679	0.0:1.0:0.0:0.0	.	2050	Q9HCK8-2	.	K	2050;2329;2049;2329	ENSP00000406288:E2050K;ENSP00000382863:E2329K;ENSP00000451601:E2329K	ENSP00000262707:E2049K	E	-	1	0	CHD8	20929542	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.976000	0.76135	2.819000	0.97034	0.655000	0.94253	GAG		0.557	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410436.1	NM_020920		13	35	0	0	0	0	13	35				
PNN	5411	broad.mit.edu	37	14	39644596	39644596	+	Splice_Site	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr14:39644596G>T	ENST00000216832.4	+	1	180	c.113G>T	c.(112-114)aGg>aTg	p.R38M	PNN_ENST00000553331.1_Splice_Site_p.R38M|RP11-407N17.4_ENST00000556537.1_lincRNA|PNN_ENST00000556530.1_Splice_Site_p.R38M	NM_002687.3	NP_002678	Q9H307	PININ_HUMAN	pinin, desmosome associated protein	38	Necessary for interaction with RNPS1.|Necessary for interactions with KRT8, KRT18 and KRT19.|Necessary for mediating alternative 5' splicing.				cell adhesion (GO:0007155)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			breast(2)|endometrium(5)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(2)|stomach(1)	27	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0119)		AATGACGTGAGGTAAGGGCCT	0.582																																						uc001wuw.3		NA																	0				ovary(1)	1						c.(112-114)AGG>ATG		pinin, desmosome associated protein							49.0	43.0	45.0					14																	39644596		2203	4300	6503	SO:0001630	splice_region_variant	5411				cell adhesion|regulation of transcription, DNA-dependent|transcription, DNA-dependent	catalytic step 2 spliceosome|desmosome|intermediate filament|nuclear speck	DNA binding|protein binding|structural molecule activity	g.chr14:39644596G>T	U77718	CCDS9671.1	14q21.1	2010-07-02			ENSG00000100941	ENSG00000100941			9162	protein-coding gene	gene with protein product		603154				8922384	Standard	NM_002687		Approved	memA	uc001wuw.4	Q9H307	OTTHUMG00000028821	ENST00000216832.4:c.113+1G>T	14.37:g.39644596G>T			Somatic					p.R38M	NM_002687	NP_002678	WXS	Illumina HiSeq	Unspecified	Q9H307	PININ_HUMAN	LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0119)	1	210	+	Hepatocellular(127;0.213)		38			Necessary for interaction with RNPS1.|Necessary for mediating alternative 5' splicing.|Necessary for interactions with KRT8, KRT18 and KRT19.		B4DZX8|O60899|Q53EM7|Q6P5X4|Q7KYL1|Q99738|Q9UHZ9|Q9UQR9	Missense_Mutation	SNP	ENST00000216832.4	37	c.113G>T	CCDS9671.1	.	.	.	.	.	.	.	.	.	.	G	36	5.769135	0.96914	.	.	ENSG00000100941	ENST00000553331;ENST00000216832;ENST00000556530	T	0.37411	1.2	5.63	5.63	0.86233	Pinin/SDK (2);	0.000000	0.85682	D	0.000000	T	0.60728	0.2291	M	0.63843	1.955	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.61811	-0.6986	10	0.87932	D	0	-8.4602	19.6672	0.95896	0.0:0.0:1.0:0.0	.	38	Q9H307	PININ_HUMAN	M	38	ENSP00000216832:R38M	ENSP00000216832:R38M	R	+	2	0	PNN	38714347	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	9.474000	0.97718	2.662000	0.90505	0.585000	0.79938	AGG		0.582	PNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276776.2	NM_002687	Missense_Mutation	6	19	1	0	3.6e-05	4.22e-05	6	19				
LRFN5	145581	broad.mit.edu	37	14	42356187	42356187	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr14:42356187G>A	ENST00000298119.4	+	3	1548	c.359G>A	c.(358-360)aGt>aAt	p.S120N	LRFN5_ENST00000554120.1_Missense_Mutation_p.S120N|LRFN5_ENST00000554171.1_Missense_Mutation_p.S120N	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	120						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		GATATGTTCAGTGGTCTTTCC	0.373										HNSCC(30;0.082)																												uc001wvm.2		NA																	0				ovary(5)|pancreas(2)|central_nervous_system(1)	8						c.(358-360)AGT>AAT		leucine rich repeat and fibronectin type III							77.0	75.0	76.0					14																	42356187		2203	4300	6503	SO:0001583	missense	145581					integral to membrane		g.chr14:42356187G>A	AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.359G>A	14.37:g.42356187G>A	ENSP00000298119:p.Ser120Asn	HNSCC(30;0.082)	Somatic				LRFN5_uc010ana.2_Missense_Mutation_p.S120N	p.S120N	NM_152447	NP_689660	WXS	Illumina HiSeq	Unspecified	Q96NI6	LRFN5_HUMAN	LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)	3	1557	+			120			Extracellular (Potential).|LRR 3.		B3KU78|Q86XL2	Missense_Mutation	SNP	ENST00000298119.4	37	c.359G>A	CCDS9678.1	.	.	.	.	.	.	.	.	.	.	G	13.62	2.291277	0.40494	.	.	ENSG00000165379	ENST00000298119;ENST00000554120;ENST00000554171	D;D;D	0.91894	-2.93;-2.93;-2.93	5.56	5.56	0.83823	.	0.000000	0.64402	D	0.000002	D	0.90403	0.6996	L	0.41356	1.27	0.54753	D	0.999982	B;B	0.24043	0.009;0.096	B;B	0.34301	0.008;0.179	D	0.87662	0.2535	10	0.52906	T	0.07	.	17.0193	0.86429	0.0:0.0:1.0:0.0	.	120;120	G3V364;Q96NI6	.;LRFN5_HUMAN	N	120	ENSP00000298119:S120N;ENSP00000451897:S120N;ENSP00000451067:S120N	ENSP00000298119:S120N	S	+	2	0	LRFN5	41425937	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.815000	0.75242	2.595000	0.87683	0.650000	0.86243	AGT		0.373	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447		27	106	0	0	0	0	27	106				
GNG2	54331	broad.mit.edu	37	14	52433376	52433376	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr14:52433376G>T	ENST00000335281.4	+	3	593	c.187G>T	c.(187-189)Gag>Tag	p.E63*	GNG2_ENST00000556752.1_Nonsense_Mutation_p.E63*|GNG2_ENST00000555472.1_Nonsense_Mutation_p.E63*|GNG2_ENST00000553299.1_3'UTR|GNG2_ENST00000556766.1_Nonsense_Mutation_p.E63*|GNG2_ENST00000557376.1_Nonsense_Mutation_p.E102*|RP11-463J10.3_ENST00000553603.1_RNA|GNG2_ENST00000554736.1_Nonsense_Mutation_p.E63*|GNG2_ENST00000553432.1_Nonsense_Mutation_p.E94*	NM_001243774.1	NP_001230703.1	P59768	GBG2_HUMAN	guanine nucleotide binding protein (G protein), gamma 2	63					adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|energy reserve metabolic process (GO:0006112)|platelet activation (GO:0030168)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|signal transducer activity (GO:0004871)			lung(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	5	all_epithelial(31;0.0659)|Breast(41;0.0684)				Halothane(DB01159)	CCCGTTTAGGGAGAAGAAGTT	0.522																																						uc001wzi.2		NA																	0					0						c.(187-189)GAG>TAG		guanine nucleotide binding protein (G protein),	Halothane(DB01159)						83.0	91.0	88.0					14																	52433376		2203	4300	6503	SO:0001587	stop_gained	54331				cellular response to glucagon stimulus|energy reserve metabolic process|platelet activation|synaptic transmission	heterotrimeric G-protein complex	protein binding|signal transducer activity	g.chr14:52433376G>T	AK001024	CCDS32082.1	14q21	2008-07-28				ENSG00000186469			4404	protein-coding gene	gene with protein product		606981				10833460	Standard	NM_053064		Approved		uc001wzj.3	P59768		ENST00000335281.4:c.187G>T	14.37:g.52433376G>T	ENSP00000334448:p.Glu63*		Somatic				GNG2_uc001wzh.2_RNA|GNG2_uc010aoc.1_RNA|GNG2_uc001wzj.2_RNA|GNG2_uc001wzk.2_Nonsense_Mutation_p.E63*	p.E63*	NM_053064	NP_444292	WXS	Illumina HiSeq	Unspecified	P59768	GBG2_HUMAN			4	716	+	all_epithelial(31;0.0659)|Breast(41;0.0684)		63					Q5JPE2|Q6P9A9	Nonsense_Mutation	SNP	ENST00000335281.4	37	c.187G>T	CCDS32082.1	.	.	.	.	.	.	.	.	.	.	G	34	5.353954	0.95830	.	.	ENSG00000186469	ENST00000553432;ENST00000557376;ENST00000335281;ENST00000555472;ENST00000556766;ENST00000554736;ENST00000556752	.	.	.	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-14.5805	19.2197	0.93791	0.0:0.0:1.0:0.0	.	.	.	.	X	94;102;63;63;63;63;63	.	ENSP00000334448:E63X	E	+	1	0	GNG2	51503126	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.809000	0.99208	2.700000	0.92200	0.591000	0.81541	GAG		0.522	GNG2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411585.1			56	178	1	0	6.61e-23	1e-22	56	178				
NID2	22795	broad.mit.edu	37	14	52520339	52520339	+	Missense_Mutation	SNP	A	A	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr14:52520339A>G	ENST00000216286.5	-	5	1386	c.1387T>C	c.(1387-1389)Tat>Cat	p.Y463H	NID2_ENST00000541773.1_Missense_Mutation_p.Y410H	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)	463					basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)			NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					CCCACCTCATACGTCCCTCGA	0.478																																						uc001wzo.2		NA																	0				pancreas(2)|breast(2)|ovary(1)|liver(1)|skin(1)	7						c.(1387-1389)TAT>CAT		nidogen 2 precursor							161.0	163.0	162.0					14																	52520339		2203	4300	6503	SO:0001583	missense	22795					basement membrane	calcium ion binding|collagen binding	g.chr14:52520339A>G	AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.1387T>C	14.37:g.52520339A>G	ENSP00000216286:p.Tyr463His		Somatic				NID2_uc010tqs.1_Missense_Mutation_p.Y463H|NID2_uc010tqt.1_Missense_Mutation_p.Y463H|NID2_uc001wzp.2_Missense_Mutation_p.Y463H	p.Y463H	NM_007361	NP_031387	WXS	Illumina HiSeq	Unspecified	Q14112	NID2_HUMAN			5	1621	-	Breast(41;0.0639)|all_epithelial(31;0.123)		463					A8K6I7|B4DU19|O43710	Missense_Mutation	SNP	ENST00000216286.5	37	c.1387T>C	CCDS9706.1	.	.	.	.	.	.	.	.	.	.	A	9.715	1.158058	0.21454	.	.	ENSG00000087303	ENST00000216286;ENST00000541773;ENST00000395707	D;D	0.83250	-1.7;-1.58	5.61	2.18	0.27775	.	1.833690	0.02150	N	0.057894	T	0.72961	0.3526	N	0.24115	0.695	0.09310	N	1	B;B;B	0.10296	0.0;0.003;0.002	B;B;B	0.06405	0.002;0.002;0.002	T	0.54536	-0.8279	10	0.15499	T	0.54	.	7.7827	0.29074	0.5594:0.0:0.4406:0.0	.	410;465;463	Q14112-2;Q5CZI2;Q14112	.;.;NID2_HUMAN	H	463;410;465	ENSP00000216286:Y463H;ENSP00000443730:Y410H	ENSP00000216286:Y463H	Y	-	1	0	NID2	51590089	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	0.925000	0.28791	0.148000	0.19059	0.533000	0.62120	TAT		0.478	NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276888.1			51	155	0	0	0	0	51	155				
DDHD1	80821	broad.mit.edu	37	14	53518577	53518577	+	Missense_Mutation	SNP	T	T	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr14:53518577T>C	ENST00000323669.5	-	12	2505	c.2506A>G	c.(2506-2508)Aaa>Gaa	p.K836E	DDHD1_ENST00000357758.3_Intron|DDHD1_ENST00000555621.1_Intron|DDHD1_ENST00000395606.1_Intron	NM_001160148.1	NP_001153620.1	Q8NEL9	DDHD1_HUMAN	DDHD domain containing 1	836	DDHD. {ECO:0000255|PROSITE- ProRule:PRU00378}.				cell death (GO:0008219)|lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)	25	Breast(41;0.037)					GCATTATCTTTATTCTGCATT	0.333																																						uc001xai.2		NA																	0				ovary(2)	2						c.(2506-2508)AAA>GAA		DDHD domain containing 1 isoform c							73.0	63.0	66.0					14																	53518577		1566	3580	5146	SO:0001583	missense	80821				lipid catabolic process	cytoplasm	hydrolase activity|metal ion binding	g.chr14:53518577T>C	AB051492	CCDS9714.1, CCDS53895.1, CCDS53896.1	14q21	2012-11-23			ENSG00000100523	ENSG00000100523			19714	protein-coding gene	gene with protein product	"""phosphatidic acid-preferring phospholipase A1"""	614603	"""spastic paraplegia 28 (autosomal recessive)"""	SPG28		11214970, 20359546	Standard	NM_030637		Approved	KIAA1705, PA-PLA1	uc001xai.3	Q8NEL9	OTTHUMG00000140305	ENST00000323669.5:c.2506A>G	14.37:g.53518577T>C	ENSP00000327104:p.Lys836Glu		Somatic				DDHD1_uc001xaj.2_Intron|DDHD1_uc001xah.2_Intron|DDHD1_uc001xag.2_Intron	p.K836E	NM_001160148	NP_001153620	WXS	Illumina HiSeq	Unspecified	Q8NEL9	DDHD1_HUMAN			12	2736	-	Breast(41;0.037)		836			DDHD.		G5E9D1|Q8WVH3|Q96LL2|Q9C0F8	Missense_Mutation	SNP	ENST00000323669.5	37	c.2506A>G	CCDS53895.1	.	.	.	.	.	.	.	.	.	.	T	13.57	2.275920	0.40294	.	.	ENSG00000100523	ENST00000323669;ENST00000395610	.	.	.	6.07	6.07	0.98685	DDHD (2);	0.320093	0.30277	N	0.009982	T	0.36441	0.0967	N	0.14661	0.345	0.80722	D	1	P	0.38440	0.631	B	0.42995	0.404	T	0.31752	-0.9932	9	0.02654	T	1	-17.6282	13.0325	0.58851	0.0:0.0:0.0:1.0	.	836	Q8NEL9	DDHD1_HUMAN	E	836;707	.	ENSP00000327104:K836E	K	-	1	0	DDHD1	52588327	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.578000	0.53892	2.326000	0.78906	0.533000	0.62120	AAA		0.333	DDHD1-003	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276901.1			2	14	0	0	0	0	2	14				
KIAA0586	9786	broad.mit.edu	37	14	58927843	58927843	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr14:58927843G>T	ENST00000556134.1	+	15	2253	c.1979G>T	c.(1978-1980)aGa>aTa	p.R660I	KIAA0586_ENST00000354386.6_Missense_Mutation_p.R728I|KIAA0586_ENST00000423743.3_Missense_Mutation_p.R631I|KIAA0586_ENST00000538571.2_3'UTR|KIAA0586_ENST00000261244.5_Missense_Mutation_p.R599I	NM_001244190.1|NM_001244193.1	NP_001231119.1|NP_001231122.1	Q9BVV6	TALD3_HUMAN	KIAA0586	660					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|regulation of establishment of protein localization (GO:0070201)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				endometrium(4)|kidney(6)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CCTAAGTCCAGACCACAGAGA	0.328																																						uc001xdv.3		NA																	0				ovary(1)	1						c.(1795-1797)AGA>ATA		talpid3 protein							83.0	74.0	77.0					14																	58927843		1846	4097	5943	SO:0001583	missense	9786							g.chr14:58927843G>T	AB011158	CCDS45115.1, CCDS58320.1, CCDS58321.1, CCDS58322.1, CCDS73639.1	14q23.1	2012-12-06			ENSG00000100578	ENSG00000100578			19960	protein-coding gene	gene with protein product		610178				16702409	Standard	NM_014749		Approved	Talpid3	uc010trr.2	Q9BVV6	OTTHUMG00000171141	ENST00000556134.1:c.1979G>T	14.37:g.58927843G>T	ENSP00000452351:p.Arg660Ile		Somatic				KIAA0586_uc010trr.1_Missense_Mutation_p.R716I|KIAA0586_uc001xdt.3_Missense_Mutation_p.R631I|KIAA0586_uc001xdu.3_Missense_Mutation_p.R660I|KIAA0586_uc010trs.1_Missense_Mutation_p.R590I|KIAA0586_uc010trt.1_Missense_Mutation_p.R535I|KIAA0586_uc010tru.1_Missense_Mutation_p.R535I	p.R599I	NM_014749	NP_055564	WXS	Illumina HiSeq	Unspecified	E9PGW8	E9PGW8_HUMAN			13	2069	+			599					B4DZB6|E7EWM8|J3KQH9|O60328|Q6NYC6|Q6UV20	Missense_Mutation	SNP	ENST00000556134.1	37	c.1796G>T	CCDS58321.1	.	.	.	.	.	.	.	.	.	.	G	15.35	2.806555	0.50421	.	.	ENSG00000100578	ENST00000354386;ENST00000556134;ENST00000423743;ENST00000261244;ENST00000546216	T;T;T;T	0.48201	0.82;0.82;0.82;0.82	5.8	-0.667	0.11395	.	0.412504	0.25219	N	0.032244	T	0.31606	0.0802	N	0.19112	0.55	0.33749	D	0.620359	P;P;P;B;P;P	0.41569	0.731;0.731;0.755;0.429;0.731;0.731	B;B;B;B;B;B	0.41764	0.256;0.256;0.277;0.106;0.366;0.366	T	0.46005	-0.9222	10	0.72032	D	0.01	.	10.1633	0.42864	0.6549:0.0:0.3451:0.0	.	535;535;728;599;660;631	F5GWA3;B7Z7W7;E7EWM8;E9PGW8;Q9BVV6;Q6UV20	.;.;.;.;K0586_HUMAN;.	I	728;660;631;599;535	ENSP00000346359:R728I;ENSP00000452351:R660I;ENSP00000399427:R631I;ENSP00000261244:R599I	ENSP00000261244:R599I	R	+	2	0	KIAA0586	57997596	1.000000	0.71417	0.989000	0.46669	0.971000	0.66376	1.671000	0.37513	-0.077000	0.12752	-0.966000	0.02617	AGA		0.328	KIAA0586-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000411887.1	NM_014749		5	16	1	0	1.24e-05	1.48e-05	5	16				
DACT1	51339	broad.mit.edu	37	14	59112685	59112685	+	Missense_Mutation	SNP	G	G	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr14:59112685G>C	ENST00000335867.4	+	4	1368	c.1344G>C	c.(1342-1344)caG>caC	p.Q448H	DACT1_ENST00000556859.1_Missense_Mutation_p.Q167H|DACT1_ENST00000541264.2_Missense_Mutation_p.Q167H|DACT1_ENST00000395153.3_Missense_Mutation_p.Q411H			Q9NYF0	DACT1_HUMAN	dishevelled-binding antagonist of beta-catenin 1	448					dendrite morphogenesis (GO:0048813)|embryonic hindgut morphogenesis (GO:0048619)|gastrulation with mouth forming second (GO:0001702)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of catenin import into nucleus (GO:0035412)|regulation of protein stability (GO:0031647)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|synapse organization (GO:0050808)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|protein kinase A binding (GO:0051018)|protein kinase C binding (GO:0005080)			endometrium(7)|kidney(3)|large_intestine(11)|lung(27)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	53						CCGACCTTCAGAGTAAGCACC	0.602																																						uc001xdw.2		NA																	0				large_intestine(2)|lung(2)|ovary(1)	5						c.(1342-1344)CAG>CAC		dapper 1 isoform 1							40.0	46.0	44.0					14																	59112685		2203	4300	6503	SO:0001583	missense	51339				multicellular organismal development|Wnt receptor signaling pathway	cytoplasm|nucleus		g.chr14:59112685G>C	AF251079	CCDS9736.1, CCDS41961.1	14q22.3	2013-05-15	2013-05-15		ENSG00000165617	ENSG00000165617			17748	protein-coding gene	gene with protein product		607861	"""dapper homolog 1, antagonist of beta-catenin (xenopus)"", ""dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis)"""			11970895	Standard	NM_001079520		Approved	DAPPER1, THYEX3, HDPR1, DAPPER, FRODO	uc001xdw.3	Q9NYF0	OTTHUMG00000140324	ENST00000335867.4:c.1344G>C	14.37:g.59112685G>C	ENSP00000337439:p.Gln448His		Somatic				DACT1_uc010trv.1_Missense_Mutation_p.Q167H|DACT1_uc001xdx.2_Missense_Mutation_p.Q411H|DACT1_uc010trw.1_Missense_Mutation_p.Q167H	p.Q448H	NM_016651	NP_057735	WXS	Illumina HiSeq	Unspecified	Q9NYF0	DACT1_HUMAN			4	1508	+			448					A8MYJ2|Q86TY0	Missense_Mutation	SNP	ENST00000335867.4	37	c.1344G>C	CCDS9736.1	.	.	.	.	.	.	.	.	.	.	G	11.86	1.763359	0.31228	.	.	ENSG00000165617	ENST00000556859;ENST00000395151;ENST00000395153;ENST00000335867;ENST00000541264	T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91	4.82	-1.61	0.08399	.	0.269442	0.31673	N	0.007256	T	0.45034	0.1322	L	0.43152	1.355	0.34524	D	0.708468	P;D	0.54047	0.955;0.964	P;P	0.56514	0.8;0.787	T	0.55854	-0.8075	10	0.62326	D	0.03	-0.2253	11.4728	0.50280	0.5139:0.0:0.4861:0.0	.	411;448	A8MYJ2;Q9NYF0	.;DACT1_HUMAN	H	167;167;411;448;167	ENSP00000451598:Q167H;ENSP00000378581:Q167H;ENSP00000378582:Q411H;ENSP00000337439:Q448H;ENSP00000442850:Q167H	ENSP00000337439:Q448H	Q	+	3	2	DACT1	58182438	0.804000	0.28969	0.186000	0.23195	0.331000	0.28603	0.246000	0.18160	-0.461000	0.06993	-0.471000	0.05019	CAG		0.602	DACT1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325515.1	NM_016651		15	43	0	0	0	0	15	43				
RGS6	9628	broad.mit.edu	37	14	72961932	72961932	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr14:72961932G>T	ENST00000553530.1	+	13	1134	c.927G>T	c.(925-927)tgG>tgT	p.W309C	RGS6_ENST00000355512.6_Missense_Mutation_p.W309C|RGS6_ENST00000343854.6_Intron|RGS6_ENST00000556437.1_Missense_Mutation_p.W309C|RGS6_ENST00000402788.2_Missense_Mutation_p.W309C|RGS6_ENST00000555571.1_Missense_Mutation_p.W309C|RGS6_ENST00000406236.4_Missense_Mutation_p.W309C|RGS6_ENST00000553525.1_Missense_Mutation_p.W309C|RGS6_ENST00000434263.2_Missense_Mutation_p.W240C|RGS6_ENST00000407322.4_Missense_Mutation_p.W309C|RGS6_ENST00000554782.1_Missense_Mutation_p.W170C|RGS6_ENST00000404301.2_Missense_Mutation_p.W309C	NM_001204417.1|NM_001204418.1|NM_001204420.1|NM_001204421.1|NM_001204422.1|NM_004296.5	NP_001191346.1|NP_001191347.1|NP_001191349.1|NP_001191350.1|NP_001191351.1|NP_004287.3	P49758	RGS6_HUMAN	regulator of G-protein signaling 6	309	G protein gamma.				G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neuron differentiation (GO:0045666)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		CCAACCCTTGGATCAGCGATG	0.433																																					Ovarian(143;1926 2468 21071 48641)	uc001xna.3		NA																	0				upper_aerodigestive_tract(1)|lung(1)|skin(1)	3						c.(925-927)TGG>TGT		regulator of G-protein signalling 6							236.0	207.0	217.0					14																	72961932		2203	4300	6503	SO:0001583	missense	9628				G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity	g.chr14:72961932G>T	AF073920	CCDS9808.1, CCDS55924.1, CCDS73655.1	14q24.3	2008-07-28	2007-08-14			ENSG00000182732		"""Regulators of G-protein signaling"""	10002	protein-coding gene	gene with protein product		603894	"""regulator of G-protein signalling 6"""			10083744, 14734556	Standard	NM_004296		Approved		uc010ttn.2	P49758		ENST00000553530.1:c.927G>T	14.37:g.72961932G>T	ENSP00000452331:p.Trp309Cys		Somatic				RGS6_uc010ttn.1_Missense_Mutation_p.W309C|RGS6_uc001xmx.3_Missense_Mutation_p.W309C|RGS6_uc010tto.1_RNA|RGS6_uc001xmy.3_Missense_Mutation_p.W309C|RGS6_uc010ttp.1_Missense_Mutation_p.W240C|RGS6_uc001xmz.1_Missense_Mutation_p.W170C	p.W309C	NM_004296	NP_004287	WXS	Illumina HiSeq	Unspecified	P49758	RGS6_HUMAN		all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)	13	1450	+			309	W->F: Diminishes interaction with Gbeta5.		G protein gamma.		C9JE95|F8W7W5|O75576|O75577|Q7Z4K3|Q7Z4K4|Q7Z4K5|Q7Z4K6|Q8TE13|Q8TE14|Q8TE15|Q8TE16|Q8TE17|Q8TE18|Q8TE19|Q8TE20|Q8TE21|Q8TE22|Q9UDS8|Q9UDT0|Q9Y245|Q9Y647	Missense_Mutation	SNP	ENST00000553530.1	37	c.927G>T	CCDS9808.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.246431	0.80024	.	.	ENSG00000182732	ENST00000553525;ENST00000555571;ENST00000553530;ENST00000556437;ENST00000355512;ENST00000404301;ENST00000406236;ENST00000407322;ENST00000402788;ENST00000453330;ENST00000434263;ENST00000554782;ENST00000535521	T;T;T;T;T;T;T;T;T;T;T	0.39229	1.09;1.09;1.09;1.09;1.09;1.09;1.09;1.09;1.09;1.09;1.09	5.81	5.81	0.92471	G-protein gamma domain (4);	0.000000	0.85682	D	0.000000	T	0.72724	0.3496	M	0.90595	3.13	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.77861	-0.2430	10	0.87932	D	0	-16.5666	18.854	0.92244	0.0:0.0:1.0:0.0	.	240;309;314;309	B7Z7N5;P49758-2;Q59FJ8;P49758	.;.;.;RGS6_HUMAN	C	309;309;309;309;309;309;309;309;309;281;240;170;170	ENSP00000451030:W309C;ENSP00000450936:W309C;ENSP00000452331:W309C;ENSP00000451855:W309C;ENSP00000347699:W309C;ENSP00000385243:W309C;ENSP00000384218:W309C;ENSP00000384612:W309C;ENSP00000383953:W309C;ENSP00000412144:W240C;ENSP00000451912:W170C	ENSP00000347699:W309C	W	+	3	0	RGS6	72031685	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	8.586000	0.90806	2.746000	0.94184	0.655000	0.94253	TGG		0.433	RGS6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413033.2			81	201	1	0	2.62e-37	4.13e-37	81	201				
NRXN3	9369	broad.mit.edu	37	14	79175791	79175791	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr14:79175791C>A	ENST00000554719.1	+	4	825	c.334C>A	c.(334-336)Ctc>Atc	p.L112I	NRXN3_ENST00000335750.5_Missense_Mutation_p.L112I|RP11-232C2.2_ENST00000555680.1_RNA	NM_004796.4	NP_004787.2	Q9HDB5	NRX3B_HUMAN	neurexin 3	0	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		TGGCCTGATCCTCTTCACTCA	0.517																																						uc001xun.2		NA																	0				ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10						c.(334-336)CTC>ATC		neurexin 3 isoform 1 precursor							121.0	113.0	116.0					14																	79175791		2203	4300	6503	SO:0001583	missense	9369				axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity	g.chr14:79175791C>A	AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000554719.1:c.334C>A	14.37:g.79175791C>A	ENSP00000451648:p.Leu112Ile		Somatic				NRXN3_uc001xum.1_RNA|NRXN3_uc010asv.1_Missense_Mutation_p.L246I	p.L112I	NM_004796	NP_004787	WXS	Illumina HiSeq	Unspecified	Q9Y4C0	NRX3A_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)	4	825	+		Renal(4;0.00876)	485			Extracellular (Potential).|Laminin G-like 3.		A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	ENST00000554719.1	37	c.334C>A	CCDS9870.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.471112	0.84533	.	.	ENSG00000021645	ENST00000330071;ENST00000332068;ENST00000553631;ENST00000554719;ENST00000335750;ENST00000557081	D;D;D;D	0.86956	-2.19;-2.05;-2.05;-2.19	5.38	5.38	0.77491	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.85682	D	0.000000	D	0.93612	0.7960	M	0.77820	2.39	0.58432	D	0.999999	D;P	0.61697	0.99;0.91	D;P	0.85130	0.997;0.896	D	0.93235	0.6621	9	.	.	.	.	19.1251	0.93380	0.0:1.0:0.0:0.0	.	485;112	Q9Y4C0;Q9Y4C0-3	NRX3A_HUMAN;.	I	485;483;56;112;112;56	ENSP00000451947:L56I;ENSP00000451648:L112I;ENSP00000338349:L112I;ENSP00000450462:L56I	.	L	+	1	0	NRXN3	78245544	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.920000	0.70017	2.518000	0.84900	0.563000	0.77884	CTC		0.517	NRXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413787.1	NM_001105250		54	127	1	0	1.88e-15	2.7e-15	54	127				
RCOR1	23186	broad.mit.edu	37	14	103188649	103188649	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr14:103188649G>A	ENST00000570597.1	+	11	1306	c.1306G>A	c.(1306-1308)Gaa>Aaa	p.E436K	RCOR1_ENST00000262241.6_Missense_Mutation_p.E439K			Q9UKL0	RCOR1_HUMAN	REST corepressor 1	436					blood coagulation (GO:0007596)|histone H4 deacetylation (GO:0070933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	12						AGTTTTACAAGAATGGGAGGC	0.428																																						uc001ymb.2		NA																	0				ovary(1)	1						c.(1306-1308)GAA>AAA		REST corepressor 1							126.0	134.0	131.0					14																	103188649		2203	4300	6503	SO:0001583	missense	23186				blood coagulation|histone H4 deacetylation|interspecies interaction between organisms	transcriptional repressor complex	protein binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|transcription regulatory region DNA binding	g.chr14:103188649G>A	AF155595	CCDS9974.1, CCDS9974.2	14q32.33	2004-04-16	2004-04-16	2004-04-16		ENSG00000089902			17441	protein-coding gene	gene with protein product		607675	"""REST corepressor"""	RCOR		10449787	Standard	NM_015156		Approved	COREST, KIAA0071	uc001ymb.4	Q9UKL0		ENST00000570597.1:c.1306G>A	14.37:g.103188649G>A	ENSP00000459789:p.Glu436Lys		Somatic					p.E436K	NM_015156	NP_055971	WXS	Illumina HiSeq	Unspecified	Q9UKL0	RCOR1_HUMAN			11	1306	+			436					Q15044|Q6P2I9|Q86VG5	Missense_Mutation	SNP	ENST00000570597.1	37	c.1306G>A		.	.	.	.	.	.	.	.	.	.	G	36	5.781540	0.96929	.	.	ENSG00000089902	ENST00000262241	.	.	.	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.77778	0.4181	M	0.66939	2.045	0.80722	D	1	D	0.65815	0.995	D	0.63488	0.915	T	0.77694	-0.2492	9	0.56958	D	0.05	-30.5031	19.9357	0.97140	0.0:0.0:1.0:0.0	.	436	Q9UKL0	RCOR1_HUMAN	K	436	.	ENSP00000262241:E436K	E	+	1	0	RCOR1	102258402	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	9.869000	0.99810	2.715000	0.92844	0.655000	0.94253	GAA		0.428	RCOR1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015156		47	135	0	0	0	0	47	135				
CDC42BPB	9578	broad.mit.edu	37	14	103418843	103418843	+	Missense_Mutation	SNP	G	G	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr14:103418843G>C	ENST00000361246.2	-	24	3452	c.3164C>G	c.(3163-3165)gCc>gGc	p.A1055G		NM_006035.3	NP_006026.3			CDC42 binding protein kinase beta (DMPK-like)											NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(11)|liver(1)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	49		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		ACCCTCGCAGGCGTAGCCCTG	0.637																																						uc001ymi.1		NA																	0				large_intestine(3)|skin(3)|lung(2)|stomach(1)|breast(1)|ovary(1)	11						c.(3163-3165)GCC>GGC		CDC42-binding protein kinase beta							87.0	76.0	80.0					14																	103418843		2203	4299	6502	SO:0001583	missense	9578				actin cytoskeleton reorganization|establishment or maintenance of cell polarity|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm|cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity	g.chr14:103418843G>C	AF128625	CCDS9978.1	14q32.32	2010-05-12	2001-11-28		ENSG00000198752	ENSG00000198752			1738	protein-coding gene	gene with protein product		614062	"""CDC42-binding protein kinase beta (DMPK-like)"""			10198171	Standard	NM_006035		Approved	MRCKB, KIAA1124	uc001ymi.1	Q9Y5S2		ENST00000361246.2:c.3164C>G	14.37:g.103418843G>C	ENSP00000355237:p.Ala1055Gly		Somatic				CDC42BPB_uc001ymj.1_Missense_Mutation_p.A157G	p.A1055G	NM_006035	NP_006026	WXS	Illumina HiSeq	Unspecified	Q9Y5S2	MRCKB_HUMAN		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)	24	3396	-		Melanoma(154;0.155)	1055			Phorbol-ester/DAG-type.			Missense_Mutation	SNP	ENST00000361246.2	37	c.3164C>G	CCDS9978.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.294909	0.81025	.	.	ENSG00000198752	ENST00000361246;ENST00000541396	D	0.93076	-3.16	5.66	5.66	0.87406	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);Diacylglycerol/phorbol-ester binding (1);	0.048775	0.85682	D	0.000000	D	0.91835	0.7416	N	0.24115	0.695	0.80722	D	1	P;B	0.47604	0.898;0.012	P;B	0.50537	0.643;0.058	D	0.90380	0.4387	10	0.31617	T	0.26	.	20.108	0.97899	0.0:0.0:1.0:0.0	.	1055;1055	A9JR72;Q9Y5S2	.;MRCKB_HUMAN	G	1055;166	ENSP00000355237:A1055G	ENSP00000355237:A1055G	A	-	2	0	CDC42BPB	102488596	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.688000	0.98670	2.828000	0.97474	0.655000	0.94253	GCC		0.637	CDC42BPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415711.1	NM_006035		3	27	0	0	0	0	3	27				
NPAP1	23742	broad.mit.edu	37	15	24921750	24921750	+	Missense_Mutation	SNP	G	G	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr15:24921750G>C	ENST00000329468.2	+	1	1210	c.736G>C	c.(736-738)Gcc>Ccc	p.A246P		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	246					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											ACACAGCCAGGCCGGATGTGC	0.622																																						uc001ywo.2		NA																	0				ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8						c.(736-738)GCC>CCC		hypothetical protein LOC23742							32.0	35.0	34.0					15																	24921750		2203	4299	6502	SO:0001583	missense	23742				cell differentiation|multicellular organismal development|spermatogenesis			g.chr15:24921750G>C	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.736G>C	15.37:g.24921750G>C	ENSP00000333735:p.Ala246Pro		Somatic					p.A246P	NM_018958	NP_061831	WXS	Illumina HiSeq	Unspecified	Q9NZP6	CO002_HUMAN		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)	1	1210	+		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)	246						Missense_Mutation	SNP	ENST00000329468.2	37	c.736G>C	CCDS10015.1	.	.	.	.	.	.	.	.	.	.	.	13.03	2.116495	0.37339	.	.	ENSG00000185823	ENST00000329468	T	0.12984	2.63	2.07	-0.238	0.13055	.	2.608710	0.02105	N	0.054286	T	0.27866	0.0686	L	0.43923	1.385	0.09310	N	1	D	0.76494	0.999	D	0.78314	0.991	T	0.15492	-1.0435	10	0.41790	T	0.15	.	6.0616	0.19841	0.0:0.0:0.4654:0.5346	.	246	Q9NZP6	CO002_HUMAN	P	246	ENSP00000333735:A246P	ENSP00000333735:A246P	A	+	1	0	C15orf2	22472843	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.037000	0.13840	-0.037000	0.13646	-0.694000	0.03704	GCC		0.622	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958		16	45	0	0	0	0	16	45				
NPAP1	23742	broad.mit.edu	37	15	24922585	24922585	+	Missense_Mutation	SNP	C	C	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr15:24922585C>G	ENST00000329468.2	+	1	2045	c.1571C>G	c.(1570-1572)cCt>cGt	p.P524R		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	524	Pro-rich.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											GTGGATTCCCCTCCTCCTCTT	0.547																																						uc001ywo.2		NA																	0				ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8						c.(1570-1572)CCT>CGT		hypothetical protein LOC23742							203.0	207.0	206.0					15																	24922585		2203	4300	6503	SO:0001583	missense	23742				cell differentiation|multicellular organismal development|spermatogenesis			g.chr15:24922585C>G	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.1571C>G	15.37:g.24922585C>G	ENSP00000333735:p.Pro524Arg		Somatic					p.P524R	NM_018958	NP_061831	WXS	Illumina HiSeq	Unspecified	Q9NZP6	CO002_HUMAN		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)	1	2045	+		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)	524			Pro-rich.			Missense_Mutation	SNP	ENST00000329468.2	37	c.1571C>G	CCDS10015.1	.	.	.	.	.	.	.	.	.	.	.	13.40	2.224649	0.39300	.	.	ENSG00000185823	ENST00000329468	T	0.10288	2.89	1.87	-0.262	0.12958	.	1.129940	0.06843	N	0.796056	T	0.15609	0.0376	L	0.39898	1.24	0.09310	N	1	D	0.71674	0.998	P	0.61328	0.887	T	0.24440	-1.0160	10	0.25106	T	0.35	.	2.1405	0.03774	0.3097:0.4899:0.0:0.2004	.	524	Q9NZP6	CO002_HUMAN	R	524	ENSP00000333735:P524R	ENSP00000333735:P524R	P	+	2	0	C15orf2	22473678	0.035000	0.19736	0.000000	0.03702	0.533000	0.34776	1.017000	0.29989	-0.047000	0.13423	0.205000	0.17691	CCT		0.547	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958		71	281	0	0	0	0	71	281				
GABRB3	2562	broad.mit.edu	37	15	26793136	26793136	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr15:26793136C>A	ENST00000311550.5	-	9	1337	c.1226G>T	c.(1225-1227)cGa>cTa	p.R409L	GABRB3_ENST00000400188.3_Missense_Mutation_p.R338L|GABRB3_ENST00000299267.4_Missense_Mutation_p.R409L|GABRB3_ENST00000545868.1_Missense_Mutation_p.R324L|GABRB3_ENST00000541819.2_Missense_Mutation_p.R465L	NM_000814.5|NM_001278631.1	NP_000805.1|NP_001265560.1	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 3	409					cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|cochlea development (GO:0090102)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|GABA-gated chloride ion channel activity (GO:0022851)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(41)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	68		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ivermectin(DB00602)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Piperazine(DB00592)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	ATGCCCTTCTCGAGGCATGCT	0.488																																						uc001zaz.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5						c.(1225-1227)CGA>CTA		gamma-aminobutyric acid (GABA) A receptor, beta	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)						85.0	76.0	79.0					15																	26793136		2203	4300	6503	SO:0001583	missense	2562				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr15:26793136C>A		CCDS10018.1, CCDS10019.1, CCDS53920.1, CCDS53921.1	15q12	2012-06-22			ENSG00000166206	ENSG00000166206		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4083	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 3"""	137192					Standard	NM_000814		Approved		uc001zaz.3	P28472	OTTHUMG00000129231	ENST00000311550.5:c.1226G>T	15.37:g.26793136C>A	ENSP00000308725:p.Arg409Leu		Somatic				GABRB3_uc010uae.1_Missense_Mutation_p.R324L|GABRB3_uc001zba.2_Missense_Mutation_p.R409L|GABRB3_uc001zbb.2_Missense_Mutation_p.R465L	p.R409L	NM_000814	NP_000805	WXS	Illumina HiSeq	Unspecified	P28472	GBRB3_HUMAN		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	9	1368	-		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)	409			Cytoplasmic (Probable).		B7Z2W1|B7Z825|F5H3D2|H7BYV8|Q14352|Q96FM5	Missense_Mutation	SNP	ENST00000311550.5	37	c.1226G>T	CCDS10019.1	.	.	.	.	.	.	.	.	.	.	C	12.21	1.870266	0.33069	.	.	ENSG00000166206	ENST00000311550;ENST00000541819;ENST00000299267;ENST00000400188;ENST00000545868	D;D;D;D;D	0.85955	-2.05;-2.05;-2.05;-2.05;-2.05	5.72	3.82	0.43975	Neurotransmitter-gated ion-channel transmembrane domain (2);	1.067980	0.07114	N	0.842655	D	0.86694	0.5994	M	0.86178	2.8	0.33062	D	0.534268	B;B;B	0.09022	0.002;0.0;0.001	B;B;B	0.19666	0.022;0.009;0.026	T	0.77973	-0.2386	10	0.30078	T	0.28	.	9.3323	0.38030	0.1452:0.7791:0.0:0.0756	.	465;409;409	F5H7N0;P28472-2;P28472	.;.;GBRB3_HUMAN	L	409;465;409;338;324	ENSP00000308725:R409L;ENSP00000442408:R465L;ENSP00000299267:R409L;ENSP00000383049:R338L;ENSP00000439169:R324L	ENSP00000299267:R409L	R	-	2	0	GABRB3	24344229	0.174000	0.23070	0.220000	0.23810	0.905000	0.53344	3.737000	0.55060	0.741000	0.32674	0.591000	0.81541	CGA		0.488	GABRB3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251352.2			33	93	1	0	5.92e-21	8.89e-21	33	93				
HERC2	8924	broad.mit.edu	37	15	28388011	28388011	+	Missense_Mutation	SNP	T	T	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr15:28388011T>A	ENST00000261609.7	-	75	11614	c.11506A>T	c.(11506-11508)Agg>Tgg	p.R3836W		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TTGCCACCCCTCACAATAGGA	0.408																																						uc001zbj.2		NA																	0				ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13						c.(11506-11508)AGG>TGG		hect domain and RLD 2							24.0	24.0	24.0					15																	28388011		2197	4279	6476	SO:0001583	missense	8924				DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr15:28388011T>A	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.11506A>T	15.37:g.28388011T>A	ENSP00000261609:p.Arg3836Trp		Somatic					p.R3836W	NM_004667	NP_004658	WXS	Illumina HiSeq	Unspecified	O95714	HERC2_HUMAN		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)	75	11612	-		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)	3836						Missense_Mutation	SNP	ENST00000261609.7	37	c.11506A>T	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	T	18.09	3.546618	0.65198	.	.	ENSG00000128731	ENST00000261609	T	0.46063	0.88	5.93	3.57	0.40892	.	0.000000	0.85682	D	0.000000	T	0.58119	0.2100	L	0.60455	1.87	0.80722	D	1	D	0.76494	0.999	D	0.69142	0.962	T	0.59236	-0.7492	10	0.87932	D	0	.	13.0137	0.58745	0.0:0.0:0.2544:0.7456	.	3836	O95714	HERC2_HUMAN	W	3836	ENSP00000261609:R3836W	ENSP00000261609:R3836W	R	-	1	2	HERC2	26061606	1.000000	0.71417	1.000000	0.80357	0.521000	0.34408	3.862000	0.56009	0.463000	0.27118	0.454000	0.30748	AGG		0.408	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667		5	17	0	0	0	0	5	17				
FBN1	2200	broad.mit.edu	37	15	48714173	48714173	+	Missense_Mutation	SNP	T	T	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr15:48714173T>A	ENST00000316623.5	-	61	8001	c.7546A>T	c.(7546-7548)Acc>Tcc	p.T2516S		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	2516	EGF-like 43; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		TGGTGTTGGGTAAATCCGGGA	0.433																																						uc001zwx.1		NA																	0				ovary(2)|large_intestine(1)	3						c.(7546-7548)ACC>TCC		fibrillin 1 precursor							110.0	93.0	99.0					15																	48714173		2198	4296	6494	SO:0001583	missense	2200				heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding	g.chr15:48714173T>A	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.7546A>T	15.37:g.48714173T>A	ENSP00000325527:p.Thr2516Ser		Somatic				FBN1_uc010beo.1_RNA	p.T2516S	NM_000138	NP_000129	WXS	Illumina HiSeq	Unspecified	P35555	FBN1_HUMAN		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)	61	7874	-		all_lung(180;0.00279)	2516			EGF-like 43; calcium-binding.		B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	ENST00000316623.5	37	c.7546A>T	CCDS32232.1	.	.	.	.	.	.	.	.	.	.	T	19.16	3.774258	0.69992	.	.	ENSG00000166147	ENST00000316623	D	0.87729	-2.29	6.08	6.08	0.98989	Growth factor, receptor (1);EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.044625	0.85682	D	0.000000	D	0.82549	0.5061	L	0.33137	0.985	0.80722	D	1	B	0.22746	0.074	B	0.23574	0.047	T	0.77970	-0.2387	10	0.40728	T	0.16	.	16.3053	0.82846	0.0:0.0:0.0:1.0	.	2516	P35555	FBN1_HUMAN	S	2516	ENSP00000325527:T2516S	ENSP00000325527:T2516S	T	-	1	0	FBN1	46501465	1.000000	0.71417	0.998000	0.56505	0.945000	0.59286	6.236000	0.72339	2.333000	0.79357	0.533000	0.62120	ACC		0.433	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1			14	47	0	0	0	0	14	47				
CCPG1	9236	broad.mit.edu	37	15	55669217	55669217	+	Silent	SNP	T	T	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr15:55669217T>C	ENST00000310958.6	-	5	682	c.384A>G	c.(382-384)gcA>gcG	p.A128A	DYX1C1-CCPG1_ENST00000565113.1_RNA|CCPG1_ENST00000425574.3_Silent_p.A128A|CCPG1_ENST00000569205.1_Silent_p.A128A|CCPG1_ENST00000442196.3_Silent_p.A128A	NM_001204450.1|NM_001204451.1|NM_004748.4|NM_020739.3	NP_001191379.1|NP_001191380.1|NP_004739.3|NP_065790.2	Q9ULG6	CCPG1_HUMAN	cell cycle progression 1	128	Interaction with MCF2L and SRC. {ECO:0000250}.				cell cycle (GO:0007049)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001106)	integral component of membrane (GO:0016021)				autonomic_ganglia(1)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|stomach(3)	30				all cancers(107;0.0354)		CTGAACTCTGTGCTTCTTCAA	0.388																																						uc002acv.1		NA																	0				ovary(1)	1						c.(382-384)GCA>GCG		cell cycle progression 1 isoform 2							126.0	118.0	121.0					15																	55669217		1841	4081	5922	SO:0001819	synonymous_variant	9236				cell cycle	integral to membrane		g.chr15:55669217T>C	AF212228	CCDS42039.1, CCDS55966.1, CCDS55967.1	15q21.1	2011-04-20				ENSG00000260916			24227	protein-coding gene	gene with protein product		611326				9383053, 10574462	Standard	NM_004748		Approved	KIAA1254, CPR8	uc010bfk.2	Q9ULG6		ENST00000310958.6:c.384A>G	15.37:g.55669217T>C			Somatic				CCPG1_uc002acy.2_Silent_p.A128A|DYX1C1_uc010ugh.1_RNA|CCPG1_uc002acw.1_5'UTR|CCPG1_uc002acx.2_Silent_p.A128A|CCPG1_uc010bfk.1_Silent_p.A128A|CCPG1_uc002acz.1_Silent_p.A128A	p.A128A	NM_020739	NP_065790	WXS	Illumina HiSeq	Unspecified	Q9ULG6	CCPG1_HUMAN		all cancers(107;0.0354)	5	549	-			128			Cytoplasmic (Potential).|Interaction with MCF2L and SRC (By similarity).		A0PJH3|A8K9T0|O14712|Q05DG4|Q5U5S7|Q8IYV8|Q9BY53|Q9HA17	Silent	SNP	ENST00000310958.6	37	c.384A>G	CCDS42039.1																																																																																				0.388	CCPG1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419850.1	NM_004748		43	108	0	0	0	0	43	108				
ALDH1A2	8854	broad.mit.edu	37	15	58287338	58287338	+	Splice_Site	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr15:58287338C>A	ENST00000249750.4	-	5	1261		c.e5-1		ALDH1A2_ENST00000559517.1_Splice_Site|ALDH1A2_ENST00000347587.3_Splice_Site|ALDH1A2_ENST00000537372.1_Splice_Site|ALDH1A2_ENST00000558231.1_Splice_Site	NM_003888.3	NP_003879.2	O94788	AL1A2_HUMAN	aldehyde dehydrogenase 1 family, member A2						9-cis-retinoic acid biosynthetic process (GO:0042904)|anterior/posterior pattern specification (GO:0009952)|blood vessel development (GO:0001568)|cardiac muscle tissue development (GO:0048738)|cellular response to retinoic acid (GO:0071300)|determination of bilateral symmetry (GO:0009855)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract development (GO:0048566)|embryonic forelimb morphogenesis (GO:0035115)|face development (GO:0060324)|heart morphogenesis (GO:0003007)|hindbrain development (GO:0030902)|kidney development (GO:0001822)|liver development (GO:0001889)|lung development (GO:0030324)|midgut development (GO:0007494)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of cell proliferation (GO:0008285)|neural crest cell development (GO:0014032)|neural tube development (GO:0021915)|neuron differentiation (GO:0030182)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|proximal/distal pattern formation (GO:0009954)|regulation of endothelial cell proliferation (GO:0001936)|response to cytokine (GO:0034097)|response to estradiol (GO:0032355)|response to vitamin A (GO:0033189)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)|retinoic acid receptor signaling pathway (GO:0048384)|retinol metabolic process (GO:0042572)|ureter maturation (GO:0035799)|vitamin A metabolic process (GO:0006776)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)	3-chloroallyl aldehyde dehydrogenase activity (GO:0004028)|retinal binding (GO:0016918)|retinal dehydrogenase activity (GO:0001758)			NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(15)|prostate(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(80;0.152)|all cancers(107;0.18)	Tretinoin(DB00755)|Vitamin A(DB00162)	TAGTCTCCATCTGAAAGAAAA	0.358																																						uc002aex.2		NA																	0				central_nervous_system(1)	1						c.e5-1		aldehyde dehydrogenase 1A2 isoform 1	NADH(DB00157)|Tretinoin(DB00755)|Vitamin A(DB00162)						110.0	106.0	107.0					15																	58287338		2192	4292	6484	SO:0001630	splice_region_variant	8854				negative regulation of cell proliferation|neural tube development|response to cytokine stimulus	nucleus	3-chloroallyl aldehyde dehydrogenase activity|retinal binding|retinal dehydrogenase activity	g.chr15:58287338C>A	AB015228	CCDS10163.1, CCDS10164.1, CCDS45266.1, CCDS55968.1	15q21.2	2011-02-18			ENSG00000128918	ENSG00000128918		"""Aldehyde dehydrogenases"""	15472	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 2"""	603687				9819382	Standard	NM_003888		Approved	RALDH2	uc002aex.3	O94788	OTTHUMG00000132624	ENST00000249750.4:c.494-1G>T	15.37:g.58287338C>A			Somatic				ALDH1A2_uc002aey.2_Splice_Site_p.D165_splice|ALDH1A2_uc010ugv.1_Splice_Site_p.D144_splice|ALDH1A2_uc010ugw.1_Splice_Site_p.D136_splice|ALDH1A2_uc002aew.2_Splice_Site_p.D69_splice	p.D165_splice	NM_003888	NP_003879	WXS	Illumina HiSeq	Unspecified	O94788	AL1A2_HUMAN		GBM - Glioblastoma multiforme(80;0.152)|all cancers(107;0.18)	5	552	-								B3KY52|B4DZR2|F5H2Y9|H0YM00|Q2PJS6|Q8NHQ4|Q9UBR8|Q9UFY0	Splice_Site	SNP	ENST00000249750.4	37	c.494_splice	CCDS10163.1	.	.	.	.	.	.	.	.	.	.	C	16.68	3.191333	0.58017	.	.	ENSG00000128918	ENST00000249750;ENST00000430119;ENST00000543386;ENST00000347587;ENST00000537372	.	.	.	5.65	5.65	0.86999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9142	0.97043	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ALDH1A2	56074630	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.273000	0.78527	2.941000	0.99782	0.655000	0.94253	.		0.358	ALDH1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255869.1		Intron	37	108	1	0	8.74e-17	1.27e-16	37	108				
SLTM	79811	broad.mit.edu	37	15	59182658	59182658	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr15:59182658C>T	ENST00000380516.2	-	15	1988	c.1901G>A	c.(1900-1902)cGa>cAa	p.R634Q	AC025918.2_ENST00000452467.1_RNA|SLTM_ENST00000536328.1_Missense_Mutation_p.R203Q	NM_001013843.1|NM_024755.2	NP_001013865.1|NP_079031.2	Q9NWH9	SLTM_HUMAN	SAFB-like, transcription modulator	634	Arg/Glu-rich.				apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						AATCTCTCTTCGTCTACCAAA	0.403																																						uc002afp.2		NA																	0				ovary(1)	1						c.(1900-1902)CGA>CAA		modulator of estrogen induced transcription							74.0	72.0	73.0					15																	59182658		2192	4291	6483	SO:0001583	missense	79811				apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleotide binding|RNA binding	g.chr15:59182658C>T	BC046119	CCDS10168.2	15q21.3	2013-02-12			ENSG00000137776	ENSG00000137776		"""RNA binding motif (RRM) containing"""	20709	protein-coding gene	gene with protein product							Standard	XR_243128		Approved	Met, FLJ13213	uc002afp.3	Q9NWH9	OTTHUMG00000074033	ENST00000380516.2:c.1901G>A	15.37:g.59182658C>T	ENSP00000369887:p.Arg634Gln		Somatic				SLTM_uc002afn.2_Missense_Mutation_p.R176Q|SLTM_uc002afo.2_Missense_Mutation_p.R616Q|SLTM_uc002afq.2_Missense_Mutation_p.R203Q|SLTM_uc010bgd.2_Missense_Mutation_p.R203Q	p.R634Q	NM_024755	NP_079031	WXS	Illumina HiSeq	Unspecified	Q9NWH9	SLTM_HUMAN			15	1989	-			634			Arg/Glu-rich.|Potential.		A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000380516.2	37	c.1901G>A	CCDS10168.2	.	.	.	.	.	.	.	.	.	.	C	18.06	3.539927	0.65085	.	.	ENSG00000137776	ENST00000380516;ENST00000432750;ENST00000536328	T	0.14022	2.54	5.86	5.86	0.93980	.	0.000000	0.45606	D	0.000349	T	0.21022	0.0506	L	0.27053	0.805	0.58432	D	0.99999	D;D	0.71674	0.998;0.997	P;P	0.55391	0.689;0.775	T	0.01301	-1.1391	10	0.23891	T	0.37	.	20.1802	0.98196	0.0:1.0:0.0:0.0	.	634;203	Q9NWH9;A8K5V8	SLTM_HUMAN;.	Q	634;200;203	ENSP00000369887:R634Q	ENSP00000369887:R634Q	R	-	2	0	SLTM	56969950	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.384000	0.66225	2.777000	0.95525	0.655000	0.94253	CGA		0.403	SLTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157124.1	NM_024755		34	128	0	0	0	0	34	128				
ZNF609	23060	broad.mit.edu	37	15	64967929	64967929	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr15:64967929C>T	ENST00000326648.3	+	4	3004	c.2876C>T	c.(2875-2877)tCg>tTg	p.S959L		NM_015042.1	NP_055857.1	O15014	ZN609_HUMAN	zinc finger protein 609	959						nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CAGCAGCCCTCGGTCATCCAG	0.507																																						uc002ann.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						c.(2875-2877)TCG>TTG		zinc finger protein 609							162.0	162.0	162.0					15																	64967929		2203	4299	6502	SO:0001583	missense	23060					nucleus	zinc ion binding	g.chr15:64967929C>T	BC014251	CCDS32270.1	15q22.1	2008-05-02				ENSG00000180357		"""Zinc fingers, C2H2-type"""	29003	protein-coding gene	gene with protein product						9205841	Standard	NM_015042		Approved	KIAA0295	uc002ann.3	O15014		ENST00000326648.3:c.2876C>T	15.37:g.64967929C>T	ENSP00000316527:p.Ser959Leu		Somatic					p.S959L	NM_015042	NP_055857	WXS	Illumina HiSeq	Unspecified	O15014	ZN609_HUMAN			4	2876	+			959					Q0D2I2	Missense_Mutation	SNP	ENST00000326648.3	37	c.2876C>T	CCDS32270.1	.	.	.	.	.	.	.	.	.	.	C	19.78	3.890697	0.72524	.	.	ENSG00000180357	ENST00000326648	T	0.50001	0.76	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.65344	0.2682	L	0.52126	1.63	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.60037	-0.7341	10	0.39692	T	0.17	-12.6278	20.1008	0.97874	0.0:1.0:0.0:0.0	.	959	O15014	ZN609_HUMAN	L	959	ENSP00000316527:S959L	ENSP00000316527:S959L	S	+	2	0	ZNF609	62754982	1.000000	0.71417	0.934000	0.37439	0.786000	0.44442	6.072000	0.71238	2.756000	0.94617	0.563000	0.77884	TCG		0.507	ZNF609-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418130.1	XM_042833		53	146	0	0	0	0	53	146				
MAP2K5	5607	broad.mit.edu	37	15	67873100	67873100	+	Silent	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr15:67873100C>T	ENST00000178640.5	+	4	888	c.261C>T	c.(259-261)tcC>tcT	p.S87S	MAP2K5_ENST00000354498.5_Silent_p.S51S|MAP2K5_ENST00000395476.2_Silent_p.S87S|MAP2K5_ENST00000560591.1_3'UTR	NM_145160.2	NP_660143.1	Q13163	MP2K5_HUMAN	mitogen-activated protein kinase kinase 5	87	OPR.				activation of MAPK activity (GO:0000187)|cellular response to growth factor stimulus (GO:0071363)|cellular response to laminar fluid shear stress (GO:0071499)|ERK5 cascade (GO:0070375)|heart development (GO:0007507)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000342)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of interleukin-8 biosynthetic process (GO:0045415)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of response to cytokine stimulus (GO:0060761)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|skin(1)	16						AGTATTATTCCACAGTAATGG	0.328																																						uc002aqu.2		NA																	0				lung(2)	2						c.(259-261)TCC>TCT		mitogen-activated protein kinase kinase 5							133.0	135.0	134.0					15																	67873100		2201	4296	6497	SO:0001819	synonymous_variant	5607				nerve growth factor receptor signaling pathway		ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr15:67873100C>T	U25265	CCDS10224.1, CCDS42051.1, CCDS55970.1	15q22.31	2011-06-09			ENSG00000137764	ENSG00000137764		"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6845	protein-coding gene	gene with protein product		602520		PRKMK5		7759517	Standard	NM_002757		Approved	MEK5, MAPKK5, HsT17454	uc002aqu.3	Q13163	OTTHUMG00000133264	ENST00000178640.5:c.261C>T	15.37:g.67873100C>T			Somatic				MAP2K5_uc002aqt.1_Silent_p.S87S|MAP2K5_uc002aqv.2_Silent_p.S87S|MAP2K5_uc010ujw.1_Silent_p.S51S	p.S87S	NM_145160	NP_660143	WXS	Illumina HiSeq	Unspecified	Q13163	MP2K5_HUMAN			4	914	+			87			OPR.		B4DE43|Q92961|Q92962	Silent	SNP	ENST00000178640.5	37	c.261C>T	CCDS10224.1																																																																																				0.328	MAP2K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257041.1	NM_145162		41	136	0	0	0	0	41	136				
HCN4	10021	broad.mit.edu	37	15	73659940	73659940	+	Silent	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr15:73659940G>A	ENST00000261917.3	-	1	1665	c.672C>T	c.(670-672)ccC>ccT	p.P224P		NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	224	Involved in subunit assembly. {ECO:0000250}.				blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		TGTTGACCCCGGGTTGGAGCA	0.652																																						uc002avp.2		NA																	0				ovary(5)|liver(1)	6						c.(670-672)CCC>CCT		hyperpolarization activated cyclic							48.0	50.0	50.0					15																	73659940		2198	4297	6495	SO:0001819	synonymous_variant	10021				blood circulation|muscle contraction	integral to membrane	cAMP binding|protein binding|sodium channel activity|voltage-gated potassium channel activity	g.chr15:73659940G>A	AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.672C>T	15.37:g.73659940G>A			Somatic					p.P224P	NM_005477	NP_005468	WXS	Illumina HiSeq	Unspecified	Q9Y3Q4	HCN4_HUMAN		COAD - Colon adenocarcinoma(1;0.142)	1	1666	-			224			Involved in subunit assembly (By similarity).|Cytoplasmic (Potential).		Q9UMQ7	Silent	SNP	ENST00000261917.3	37	c.672C>T	CCDS10248.1																																																																																				0.652	HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268900.2	NM_005477		15	53	0	0	0	0	15	53				
ACSBG1	23205	broad.mit.edu	37	15	78466037	78466037	+	Missense_Mutation	SNP	C	C	G	rs137988972	byFrequency	TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr15:78466037C>G	ENST00000258873.4	-	13	2192	c.1987G>C	c.(1987-1989)Gag>Cag	p.E663Q	ACSBG1_ENST00000541759.1_Missense_Mutation_p.E421Q|ACSBG1_ENST00000560817.1_Missense_Mutation_p.E421Q	NM_001199377.1|NM_015162.4	NP_001186306.1|NP_055977.3	Q96GR2	ACBG1_HUMAN	acyl-CoA synthetase bubblegum family member 1	663					long-chain fatty acid metabolic process (GO:0001676)|myelination (GO:0042552)|ovarian follicle atresia (GO:0001552)|response to glucocorticoid (GO:0051384)|very long-chain fatty acid metabolic process (GO:0000038)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			endometrium(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	37						CGGATCCCCTCTTCGATGGCC	0.577													C|||	11	0.00219649	0.0008	0.0029	5008	,	,		19743	0.0		0.003	False		,,,				2504	0.0051					uc002bdh.2		NA																	0				ovary(1)	1						c.(1987-1989)GAG>CAG		lipidosin		C	GLN/GLU,GLN/GLU	5,4387	11.4+/-27.6	0,5,2191	112.0	90.0	97.0		1975,1987	4.4	0.9	15	dbSNP_134	97	50,8536	31.2+/-83.2	0,50,4243	yes	missense,missense	ACSBG1	NM_001199377.1,NM_015162.4	29,29	0,55,6434	GG,GC,CC		0.5823,0.1138,0.4238	benign,benign	659/721,663/725	78466037	55,12923	2196	4293	6489	SO:0001583	missense	23205				long-chain fatty acid metabolic process|myelination|very long-chain fatty acid metabolic process	cytoplasmic membrane-bounded vesicle|endoplasmic reticulum|microsome	ATP binding|long-chain fatty acid-CoA ligase activity|very long-chain fatty acid-CoA ligase activity	g.chr15:78466037C>G	AB014531	CCDS10298.1	15q23-q24	2006-02-09			ENSG00000103740	ENSG00000103740		"""Acyl-CoA synthetase family"""	29567	protein-coding gene	gene with protein product	"""bubblegum"", ""very long-chain acyl-CoA synthetase"", ""lipidosin"""	614362				9734811, 10954726	Standard	NM_015162		Approved	BGM, FLJ30320, MGC14352, BG1, KIAA0631, hBG1, hsBG	uc002bdh.3	Q96GR2	OTTHUMG00000143734	ENST00000258873.4:c.1987G>C	15.37:g.78466037C>G	ENSP00000258873:p.Glu663Gln		Somatic				ACSBG1_uc010umw.1_Missense_Mutation_p.E659Q|ACSBG1_uc010umx.1_Missense_Mutation_p.E421Q	p.E663Q	NM_015162	NP_055977	WXS	Illumina HiSeq	Unspecified	Q96GR2	ACBG1_HUMAN			13	2043	-			663					B2RB61|O75126|Q76N27|Q9HC26	Missense_Mutation	SNP	ENST00000258873.4	37	c.1987G>C	CCDS10298.1	4	0.0018315018315018315	1	0.0020325203252032522	0	0.0	0	0.0	3	0.00395778364116095	C	13.79	2.341281	0.41498	0.001138	0.005823	ENSG00000103740	ENST00000258873;ENST00000541759	T;T	0.11169	2.8;2.8	5.35	4.42	0.53409	.	0.213852	0.38326	N	0.001726	T	0.07369	0.0186	L	0.46157	1.445	0.45035	D	0.998052	B;B	0.10296	0.002;0.003	B;B	0.11329	0.006;0.006	T	0.07673	-1.0760	10	0.08381	T	0.77	-23.1554	15.3473	0.74350	0.0:0.8602:0.1398:0.0	.	659;663	B7Z2Y6;Q96GR2	.;ACBG1_HUMAN	Q	663;421	ENSP00000258873:E663Q;ENSP00000439955:E421Q	ENSP00000258873:E663Q	E	-	1	0	ACSBG1	76253092	1.000000	0.71417	0.874000	0.34290	0.964000	0.63967	4.783000	0.62403	1.476000	0.48215	0.591000	0.81541	GAG		0.577	ACSBG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289802.2	NM_015162		3	77	0	0	0	0	3	77				
IREB2	3658	broad.mit.edu	37	15	78780136	78780136	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr15:78780136G>T	ENST00000258886.8	+	14	1920	c.1771G>T	c.(1771-1773)Gca>Tca	p.A591S		NM_004136.2	NP_004127	P48200	IREB2_HUMAN	iron-responsive element binding protein 2	591					aging (GO:0007568)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|erythrocyte homeostasis (GO:0034101)|intestinal absorption (GO:0050892)|iron ion transport (GO:0006826)|osteoclast differentiation (GO:0030316)|post-embryonic development (GO:0009791)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to iron(II) ion (GO:0010040)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|translation repressor activity (GO:0030371)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	41				UCEC - Uterine corpus endometrioid carcinoma (272;0.232)		CTTATCAGACGCAGTTTTAAA	0.313																																					NSCLC(200;764 2208 35157 49871 50830)	uc002bdr.2		NA																	0					0						c.(1771-1773)GCA>TCA		iron-responsive element binding protein 2							114.0	106.0	109.0					15																	78780136		2196	4293	6489	SO:0001583	missense	3658						4 iron, 4 sulfur cluster binding|metal ion binding|protein binding	g.chr15:78780136G>T	M58511	CCDS10302.1	15q25.1	2013-09-20			ENSG00000136381	ENSG00000136381			6115	protein-coding gene	gene with protein product		147582				2172968	Standard	NM_004136		Approved	IRP2	uc002bdr.2	P48200	OTTHUMG00000143861	ENST00000258886.8:c.1771G>T	15.37:g.78780136G>T	ENSP00000258886:p.Ala591Ser		Somatic				IREB2_uc010unb.1_Missense_Mutation_p.A341S	p.A591S	NM_004136	NP_004127	WXS	Illumina HiSeq	Unspecified	P48200	IREB2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (272;0.232)	14	1933	+			591					A8KAC7|E1CJT9|H0YKU0|Q13095|Q1HE21|Q59FQ7|Q8WVK6|Q9UF17	Missense_Mutation	SNP	ENST00000258886.8	37	c.1771G>T	CCDS10302.1	.	.	.	.	.	.	.	.	.	.	G	10.14	1.268337	0.23136	.	.	ENSG00000136381	ENST00000258886	T	0.16897	2.31	4.93	4.0	0.46444	Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomain 1/3 (1);Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha (2);	0.298346	0.36932	N	0.002340	T	0.10637	0.0260	N	0.17872	0.535	0.80722	D	1	B	0.24721	0.11	B	0.26310	0.068	T	0.12837	-1.0532	10	0.33940	T	0.23	-14.3608	8.7026	0.34334	0.2303:0.0:0.7697:0.0	.	591	P48200	IREB2_HUMAN	S	591	ENSP00000258886:A591S	ENSP00000258886:A591S	A	+	1	0	IREB2	76567191	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.549000	0.45803	2.280000	0.76307	0.650000	0.86243	GCA		0.313	IREB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290109.3	NM_004136		16	86	1	0	4.97e-08	6.38e-08	16	86				
AGBL1	123624	broad.mit.edu	37	15	87089303	87089303	+	Missense_Mutation	SNP	C	C	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr15:87089303C>G	ENST00000441037.2	+	19	2713	c.2618C>G	c.(2617-2619)aCc>aGc	p.T873S	AGBL1_ENST00000421325.2_Missense_Mutation_p.T873S|AGBL1_ENST00000389298.3_Missense_Mutation_p.T604S	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	873					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						ATCAAGGAAACCTTGTGGCAA	0.463																																						uc002blz.1		NA																	0					0						c.(2617-2619)ACC>AGC		ATP/GTP binding protein-like 1							111.0	102.0	105.0					15																	87089303		1970	4184	6154	SO:0001583	missense	123624				C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding	g.chr15:87089303C>G	AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.2618C>G	15.37:g.87089303C>G	ENSP00000413001:p.Thr873Ser		Somatic					p.T873S	NM_152336	NP_689549	WXS	Illumina HiSeq	Unspecified	Q96MI9	CBPC4_HUMAN			19	2698	+			873					A1A4X5|A6NJH6|C9JHL5	Missense_Mutation	SNP	ENST00000441037.2	37	c.2618C>G	CCDS58398.1	.	.	.	.	.	.	.	.	.	.	C	15.23	2.772111	0.49680	.	.	ENSG00000166748	ENST00000441037;ENST00000421325;ENST00000389298	T;T	0.09723	2.96;2.95	5.53	5.53	0.82687	Peptidase M14, carboxypeptidase A (1);	0.000000	0.39759	U	0.001276	T	0.23688	0.0573	L	0.33093	0.98	0.41839	D	0.990115	D	0.89917	1.0	D	0.87578	0.998	T	0.00948	-1.1504	10	0.25751	T	0.34	-15.2901	18.6325	0.91364	0.0:1.0:0.0:0.0	.	873	Q96MI9	CBPC4_HUMAN	S	908;873;604	ENSP00000397173:T873S;ENSP00000373949:T604S	ENSP00000373949:T604S	T	+	2	0	AGBL1	84890307	1.000000	0.71417	0.969000	0.41365	0.991000	0.79684	7.211000	0.77933	2.882000	0.98803	0.655000	0.94253	ACC		0.463	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000314929.5	NM_152336		7	32	0	0	0	0	7	32				
IGF1R	3480	broad.mit.edu	37	15	99456390	99456391	+	Missense_Mutation	DNP	TG	TG	AT			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr15:99456390_99456391TG>AT	ENST00000268035.6	+	8	2318_2319	c.1707_1708TG>AT	c.(1705-1710)caTGgg>caATgg	p.569_570HG>QW	IGF1R_ENST00000558762.1_Missense_Mutation_p.569_570HG>QW	NM_000875.3	NP_000866.1	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor	569	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|epidermis development (GO:0008544)|establishment of cell polarity (GO:0030010)|exocrine pancreas development (GO:0031017)|immune response (GO:0006955)|inactivation of MAPKK activity (GO:0051389)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|male sex determination (GO:0030238)|mammary gland development (GO:0030879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|peptidyl-tyrosine autophosphorylation (GO:0038083)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of DNA replication (GO:0045740)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|prostate gland epithelium morphogenesis (GO:0060740)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein tetramerization (GO:0051262)|regulation of JNK cascade (GO:0046328)|response to vitamin E (GO:0033197)|signal transduction (GO:0007165)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor-activated receptor activity (GO:0005010)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(13)|lung(20)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		"""""""Insulin(DB00071)|Insulin Glargine(DB00047)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	TCTTACTACATGGGCTGAAGCC	0.579																																						uc002bul.2		NA																	0				lung(3)|kidney(3)|ovary(1)|central_nervous_system(1)	8						c.(1705-1710)CATGGG>CAATGG		insulin-like growth factor 1 receptor precursor	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Mecasermin(DB01277)																																			SO:0001583	missense	3480				anti-apoptosis|immune response|insulin receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of DNA replication|protein autophosphorylation|protein tetramerization	microsome	ATP binding|identical protein binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor receptor activity|metal ion binding|phosphatidylinositol 3-kinase binding	g.chr15:99456390_99456391TG>AT	M69229	CCDS10378.1, CCDS73785.1	15q26.3	2013-02-11			ENSG00000140443	ENSG00000140443		"""CD molecules"", ""Fibronectin type III domain containing"""	5465	protein-coding gene	gene with protein product		147370				1316909	Standard	XM_006720486		Approved	JTK13, CD221, IGFIR, MGC18216, IGFR	uc002bul.3	P08069	OTTHUMG00000149851	Exception_encountered	15.37:g.99456390_99456391delinsAT	ENSP00000268035:p.H569_G570delinsQW		Somatic				IGF1R_uc010urq.1_Missense_Mutation_p.569_570HG>QW|IGF1R_uc010bon.2_Missense_Mutation_p.569_570HG>QW|IGF1R_uc010urr.1_Missense_Mutation_p.19_20HG>QW	p.569_570HG>QW	NM_000875	NP_000866	WXS	Illumina HiSeq	Unspecified	P08069	IGF1R_HUMAN	Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		8	1757_1758	+	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		569_570			Fibronectin type-III 1.		B1B5Y2|Q14CV2|Q9UCC0	Missense_Mutation	DNP	ENST00000268035.6	37	c.1707_1708TG>AT	CCDS10378.1																																																																																				0.579	IGF1R-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313537.2	NM_000875		28	65	0	0	0	0	28	65				
LYSMD4	145748	broad.mit.edu	37	15	100269708	100269708	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr15:100269708T>A	ENST00000409796.1	-	3	573	c.511A>T	c.(511-513)Aag>Tag	p.K171*	LYSMD4_ENST00000344791.2_Nonsense_Mutation_p.K172*|LYSMD4_ENST00000545021.1_Nonsense_Mutation_p.K45*|LYSMD4_ENST00000604213.1_Intron|LYSMD4_ENST00000332728.4_Nonsense_Mutation_p.K171*	NM_001284417.1|NM_001284418.1|NM_001284420.1	NP_001271346.1|NP_001271347.1|NP_001271349.1	Q5XG99	LYSM4_HUMAN	LysM, putative peptidoglycan-binding, domain containing 4	171						integral component of membrane (GO:0016021)				breast(1)|cervix(1)|kidney(2)|large_intestine(2)|lung(3)|stomach(1)	10	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00162)|LUSC - Lung squamous cell carcinoma(107;0.17)|Lung(145;0.208)			TCAATCCCCTTAAAGAAGCCC	0.582																																						uc002bvk.2		NA																	0					0						c.(511-513)AAG>TAG		SubName: Full=cDNA FLJ77040, highly similar to Homo sapiens LysM, putative peptidoglycan-binding, domain containing 4, mRNA; SubName: Full=LysM, putative peptidoglycan-binding, domain containing 4, isoform CRA_c;							76.0	75.0	76.0					15																	100269708		2203	4300	6503	SO:0001587	stop_gained	145748				cell wall macromolecule catabolic process	integral to membrane		g.chr15:100269708T>A	BC041097	CCDS10381.1, CCDS66876.1, CCDS66877.1, CCDS73788.1	15q26.3	2005-10-24			ENSG00000183060	ENSG00000183060			26571	protein-coding gene	gene with protein product						12477932	Standard	NM_001284418		Approved	FLJ33008	uc002bvl.3	Q5XG99	OTTHUMG00000149853	ENST00000409796.1:c.511A>T	15.37:g.100269708T>A	ENSP00000386283:p.Lys171*		Somatic				LYSMD4_uc002bvj.1_Intron|LYSMD4_uc010bou.1_Intron|LYSMD4_uc002bvl.2_Nonsense_Mutation_p.K172*|LYSMD4_uc002bvm.2_3'UTR|LYSMD4_uc010bov.2_Nonsense_Mutation_p.K171*	p.K171*			WXS	Illumina HiSeq	Unspecified	Q5XG99	LYSM4_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.00162)|LUSC - Lung squamous cell carcinoma(107;0.17)|Lung(145;0.208)		3	574	-	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		171			Extracellular (Potential).		A6NII6|A8K2N1|Q96LY7	Nonsense_Mutation	SNP	ENST00000409796.1	37	c.511A>T		.	.	.	.	.	.	.	.	.	.	T	16.23	3.063747	0.55432	.	.	ENSG00000183060	ENST00000409796;ENST00000344791;ENST00000332728;ENST00000545021	.	.	.	4.83	2.36	0.29203	.	0.146245	0.64402	D	0.000015	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-31.7992	11.7132	0.51637	0.0:0.0:0.2796:0.7204	.	.	.	.	X	171;172;171;45	.	ENSP00000333008:K171X	K	-	1	0	LYSMD4	98087231	1.000000	0.71417	0.991000	0.47740	0.541000	0.35023	2.447000	0.44917	0.237000	0.21200	0.533000	0.62120	AAG		0.582	LYSMD4-005	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000335634.1	NM_152449		40	103	0	0	0	0	40	103				
RHOT2	89941	broad.mit.edu	37	16	720765	720765	+	Missense_Mutation	SNP	G	G	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr16:720765G>C	ENST00000315082.4	+	9	745	c.631G>C	c.(631-633)Gct>Cct	p.A211P	RHOT2_ENST00000569943.2_Intron	NM_138769.2	NP_620124.1	Q8IXI1	MIRO2_HUMAN	ras homolog family member T2	211	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cellular homeostasis (GO:0019725)|mitochondrial outer membrane permeabilization (GO:0097345)|mitochondrion transport along microtubule (GO:0047497)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(2)|kidney(3)|lung(4)|ovary(1)|pancreas(2)|prostate(1)	13		Hepatocellular(780;0.0218)				AGAGCTCAACGCTTTCCAGGT	0.662																																						uc002cip.2		NA																	0				pancreas(1)	1						c.(631-633)GCT>CCT		ras homolog gene family, member T2							48.0	55.0	53.0					16																	720765		2197	4294	6491	SO:0001583	missense	89941				apoptosis|cellular homeostasis|mitochondrion transport along microtubule|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to mitochondrial outer membrane|plasma membrane	calcium ion binding|GTP binding|GTPase activity|protein binding	g.chr16:720765G>C	BC014942	CCDS10417.1	16p13.3	2013-01-10	2012-02-27	2004-03-24	ENSG00000140983	ENSG00000140983		"""EF-hand domain containing"""	21169	protein-coding gene	gene with protein product	"""mitochondrial Rho (MIRO) GTPase 2"""	613889	"""chromosome 16 open reading frame 39"", ""ras homolog gene family, member T2"""	C16orf39, ARHT2		12482879	Standard	NM_138769		Approved	MIRO-2	uc002cip.3	Q8IXI1	OTTHUMG00000121139	ENST00000315082.4:c.631G>C	16.37:g.720765G>C	ENSP00000321971:p.Ala211Pro		Somatic				RHOT2_uc002ciq.2_Missense_Mutation_p.A104P|RHOT2_uc010bqy.2_5'Flank	p.A211P	NM_138769	NP_620124	WXS	Illumina HiSeq	Unspecified	Q8IXI1	MIRO2_HUMAN			9	698	+		Hepatocellular(780;0.0218)	211			EF-hand 1.|Mitochondrial intermembrane (Potential).		A2IDC2|Q8NF53|Q96C13|Q96S17|Q9BT60|Q9H7M8	Missense_Mutation	SNP	ENST00000315082.4	37	c.631G>C	CCDS10417.1	.	.	.	.	.	.	.	.	.	.	G	11.26	1.587062	0.28268	.	.	ENSG00000140983	ENST00000315082	T	0.11169	2.8	5.11	-0.137	0.13469	EF-hand-like domain (1);	0.521986	0.23571	N	0.046759	T	0.18173	0.0436	L	0.52905	1.665	0.24484	N	0.994334	D;P	0.69078	0.997;0.674	D;B	0.68192	0.956;0.334	T	0.07424	-1.0773	10	0.34782	T	0.22	-0.0172	4.0114	0.09624	0.3238:0.0:0.3784:0.2977	.	84;211	Q8IXI1-2;Q8IXI1	.;MIRO2_HUMAN	P	211	ENSP00000321971:A211P	ENSP00000321971:A211P	A	+	1	0	RHOT2	660766	0.000000	0.05858	0.842000	0.33263	0.493000	0.33554	0.244000	0.18124	0.096000	0.17463	0.561000	0.74099	GCT		0.662	RHOT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241617.1	NM_138769		19	39	0	0	0	0	19	39				
NLRC3	197358	broad.mit.edu	37	16	3614575	3614575	+	RNA	SNP	G	G	T	rs199475934		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr16:3614575G>T	ENST00000301749.7	-	0	768				NLRC3_ENST00000448023.2_RNA|NLRC3_ENST00000419350.2_RNA|NLRC3_ENST00000359128.5_RNA|NLRC3_ENST00000603507.1_RNA|NLRC3_ENST00000324659.8_RNA	NM_178844.2	NP_849172.2	Q7RTR2	NLRC3_HUMAN	NLR family, CARD domain containing 3						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of protein ubiquitination (GO:0031396)|response to lipopolysaccharide (GO:0032496)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(16)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CCAGGGCGACGGTCCTGGCGG	0.706																																						uc010btn.2		NA																	0				ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						c.(361-363)ACC>ACA		NOD3 protein							18.0	23.0	22.0					16																	3614575		1899	4067	5966			197358				I-kappaB kinase/NF-kappaB cascade|negative regulation of NF-kappaB transcription factor activity|T cell activation	cytoplasm	ATP binding	g.chr16:3614575G>T	BK001112	CCDS73817.1	16p13.3	2014-03-25			ENSG00000167984	ENSG00000167984		"""Nucleotide-binding domain and leucine rich repeat containing"""	29889	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 3"", ""NOD-like receptor C3"""	615648				15705585, 12766759	Standard	NM_178844		Approved	CLR16.2, FLJ00348, NOD3	uc010btn.3	Q7RTR2	OTTHUMG00000177561		16.37:g.3614575G>T			Somatic					p.T121T	NM_178844	NP_849172	WXS	Illumina HiSeq	Unspecified	Q7RTR2	NLRC3_HUMAN			5	774	-			121					Q5EY36|Q8NF48|Q8NI01|Q8NI02|Q8TEL3	Silent	SNP	ENST00000301749.7	37	c.363C>A																																																																																					0.706	NLRC3-201	KNOWN	basic|appris_principal	protein_coding	polymorphic_pseudogene		NM_178844		12	25	1	0	1.05e-09	1.41e-09	12	25				
LITAF	9516	broad.mit.edu	37	16	11650502	11650502	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr16:11650502C>A	ENST00000571688.1	-	2	315	c.85G>T	c.(85-87)Gtt>Ttt	p.V29F	LITAF_ENST00000381810.3_Missense_Mutation_p.V29F|LITAF_ENST00000571459.1_Missense_Mutation_p.V29F|LITAF_ENST00000570904.1_Missense_Mutation_p.V29F|LITAF_ENST00000576036.1_Missense_Mutation_p.V29F|LITAF_ENST00000571976.1_Missense_Mutation_p.V29F|LITAF_ENST00000572255.1_Intron|LITAF_ENST00000413364.2_Missense_Mutation_p.V29F|LITAF_ENST00000574763.1_Missense_Mutation_p.V29F|LITAF_ENST00000339430.5_Missense_Mutation_p.V29F|LITAF_ENST00000574703.1_Missense_Mutation_p.V29F	NM_001136472.1	NP_001129944.1	Q99732	LITAF_HUMAN	lipopolysaccharide-induced TNF factor	29					aging (GO:0007568)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of cytokine production (GO:0001817)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			endometrium(1)|large_intestine(1)|liver(1)|lung(3)|skin(1)	7						TAACTGTTAACAGCCACTGTC	0.547																																						uc002daz.2		NA																	0				liver(1)	1						c.(85-87)GTT>TTT		lipopolysaccharide-induced TNF-alpha factor							99.0	89.0	92.0					16																	11650502		2197	4300	6497	SO:0001583	missense	9516				apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|lysosomal membrane	signal transducer activity|WW domain binding	g.chr16:11650502C>A	AB034747	CCDS32386.1, CCDS45411.1	16p13.3-p12	2014-09-17							16841	protein-coding gene	gene with protein product		603795				9305847, 10200294	Standard	NM_004862		Approved	PIG7, SIMPLE, FLJ38636, TP53I7	uc002dbb.3	Q99732		ENST00000571688.1:c.85G>T	16.37:g.11650502C>A	ENSP00000459533:p.Val29Phe		Somatic				LITAF_uc002dba.2_Missense_Mutation_p.V29F|LITAF_uc002dbb.2_Missense_Mutation_p.V29F|LITAF_uc002dbc.2_Missense_Mutation_p.V29F|LITAF_uc002dbd.2_Missense_Mutation_p.V29F|LITAF_uc002dbe.3_Missense_Mutation_p.V29F	p.V29F	NM_004862	NP_004853	WXS	Illumina HiSeq	Unspecified	Q99732	LITAF_HUMAN			2	318	-			29					D3DUG1|G5E9K0|Q05DW0|Q9C0L6	Missense_Mutation	SNP	ENST00000571688.1	37	c.85G>T	CCDS32386.1	.	.	.	.	.	.	.	.	.	.	C	9.924	1.213060	0.22289	.	.	ENSG00000189067	ENST00000339430;ENST00000413364;ENST00000381810	D;D;D	0.88046	-2.23;-1.8;-2.33	5.04	-1.74	0.08056	.	0.749563	0.12164	N	0.493641	T	0.71879	0.3392	N	0.22421	0.69	0.09310	N	1	B;B;B	0.22909	0.077;0.017;0.001	B;B;B	0.27715	0.082;0.007;0.001	T	0.56902	-0.7902	10	0.10111	T	0.7	-4.0858	4.0084	0.09611	0.1674:0.3528:0.0:0.4798	.	29;29;29	Q99732-2;G5E9K0;Q99732	.;.;LITAF_HUMAN	F	29	ENSP00000340118:V29F;ENSP00000397958:V29F;ENSP00000371231:V29F	ENSP00000340118:V29F	V	-	1	0	LITAF	11558003	0.011000	0.17503	0.000000	0.03702	0.416000	0.31233	0.500000	0.22562	-0.064000	0.13043	0.561000	0.74099	GTT		0.547	LITAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436794.2	NM_004862		27	56	1	0	3.8e-20	5.69e-20	27	56				
CCP110	9738	broad.mit.edu	37	16	19557743	19557743	+	Missense_Mutation	SNP	A	A	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr16:19557743A>C	ENST00000381396.5	+	12	3034	c.2787A>C	c.(2785-2787)gaA>gaC	p.E929D	CCP110_ENST00000396208.2_Missense_Mutation_p.E929D|CCP110_ENST00000396212.2_Missense_Mutation_p.E929D	NM_001199022.1	NP_001185951	O43303	CP110_HUMAN	centriolar coiled coil protein 110kDa	929					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cytokinesis (GO:0032465)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|protein complex (GO:0043234)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|stomach(3)|urinary_tract(1)	21						GAGCTGCTGAAATGGGAATGC	0.303																																						uc002dgl.3		NA																	0					0						c.(2785-2787)GAA>GAC		RecName: Full=Centrosomal protein of 110 kDa;          Short=Cep110;							81.0	83.0	82.0					16																	19557743		2197	4300	6497	SO:0001583	missense	9738				centriole replication|G2/M transition of mitotic cell cycle|regulation of cytokinesis	centriole|cytosol	protein binding	g.chr16:19557743A>C	AB007879	CCDS10579.1, CCDS55992.1	16p12.3	2014-02-20	2011-05-27		ENSG00000103540	ENSG00000103540			24342	protein-coding gene	gene with protein product		609544				9455477, 12361598, 16760425	Standard	NM_014711		Approved	KIAA0419, CP110	uc002dgl.4	O43303	OTTHUMG00000131459	ENST00000381396.5:c.2787A>C	16.37:g.19557743A>C	ENSP00000370803:p.Glu929Asp		Somatic				CP110_uc002dgk.3_Missense_Mutation_p.E929D	p.E929D			WXS	Illumina HiSeq	Unspecified	O43303	CP110_HUMAN			12	3034	+			929					B7WP23|O43335|Q68DV9|Q8NE13	Missense_Mutation	SNP	ENST00000381396.5	37	c.2787A>C	CCDS55992.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.949727	0.73787	.	.	ENSG00000103540	ENST00000396212;ENST00000381396;ENST00000396208	T;T;T	0.18810	2.19;2.22;2.19	6.07	3.79	0.43588	.	0.285453	0.34932	N	0.003577	T	0.32102	0.0818	L	0.47716	1.5	0.38993	D	0.959191	D;D	0.71674	0.998;0.998	D;D	0.66196	0.942;0.937	T	0.10019	-1.0648	10	0.66056	D	0.02	-25.4887	5.779	0.18295	0.7424:0.0:0.1335:0.1242	.	929;929	O43303;O43303-2	CP110_HUMAN;.	D	929	ENSP00000379515:E929D;ENSP00000370803:E929D;ENSP00000379511:E929D	ENSP00000370803:E929D	E	+	3	2	CCP110	19465244	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.085000	0.30840	0.509000	0.28195	0.477000	0.44152	GAA		0.303	CCP110-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254284.2	NM_014711		18	44	0	0	0	0	18	44				
PDILT	204474	broad.mit.edu	37	16	20410587	20410587	+	Silent	SNP	G	G	T	rs376540863		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr16:20410587G>T	ENST00000302451.4	-	2	284	c.36C>A	c.(34-36)gcC>gcA	p.A12A		NM_174924.1	NP_777584.1	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis expressed	12					cell migration (GO:0016477)|cell redox homeostasis (GO:0045454)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|spermatid development (GO:0007286)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(33)|prostate(3)|skin(1)|urinary_tract(1)	61						AGACACAAGCGGCCACCAGCA	0.592																																						uc002dhc.1		NA																	0				large_intestine(1)	1						c.(34-36)GCC>GCA		protein disulfide isomerase-like, testis							100.0	94.0	96.0					16																	20410587		2203	4300	6503	SO:0001819	synonymous_variant	204474				cell differentiation|cell redox homeostasis|multicellular organismal development|spermatogenesis	endoplasmic reticulum	isomerase activity	g.chr16:20410587G>T		CCDS10584.1	16p12.3	2011-11-10	2009-02-23		ENSG00000169340	ENSG00000169340		"""Protein disulfide isomerases"""	27338	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 7"", ""protein disulfide isomerase-like protein of the testis"""					15475357	Standard	NM_174924		Approved	PDIA7	uc002dhc.1	Q8N807	OTTHUMG00000131487	ENST00000302451.4:c.36C>A	16.37:g.20410587G>T			Somatic					p.A12A	NM_174924	NP_777584	WXS	Illumina HiSeq	Unspecified	Q8N807	PDILT_HUMAN			2	259	-			12					Q8IVQ5	Silent	SNP	ENST00000302451.4	37	c.36C>A	CCDS10584.1																																																																																				0.592	PDILT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254332.1	NM_174924		15	103	1	0	5.01e-05	5.85e-05	15	103				
ACSM2B	348158	broad.mit.edu	37	16	20570737	20570737	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr16:20570737C>A	ENST00000329697.6	-	3	378	c.210G>T	c.(208-210)tgG>tgT	p.W70C	ACSM2B_ENST00000565322.1_5'UTR|ACSM2B_ENST00000414188.2_Missense_Mutation_p.W70C|ACSM2B_ENST00000567001.1_Missense_Mutation_p.W70C|ACSM2B_ENST00000565232.1_Missense_Mutation_p.W70C	NM_001105069.1	NP_001098539.1	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member 2B	70					fatty acid metabolic process (GO:0006631)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(4)|lung(33)|ovary(1)|prostate(1)|skin(5)	57						CATTCACCCACCACAGGGCTG	0.532																																						uc002dhj.3		NA																	0				skin(3)|ovary(1)|central_nervous_system(1)	5						c.(208-210)TGG>TGT		acyl-CoA synthetase medium-chain family member							34.0	33.0	33.0					16																	20570737		2201	4298	6499	SO:0001583	missense	348158				fatty acid metabolic process|xenobiotic metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|CoA-ligase activity|metal ion binding	g.chr16:20570737C>A	AY160217	CCDS10586.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000066813	ENSG00000066813		"""Acyl-CoA synthetase family"""	30931	protein-coding gene	gene with protein product	"""xenobiotic/medium chain fatty acid:CoA ligase"""	614359	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2		12616642	Standard	NM_182617		Approved	HXMA, HYST1046	uc002dhk.4	Q68CK6	OTTHUMG00000131555	ENST00000329697.6:c.210G>T	16.37:g.20570737C>A	ENSP00000327453:p.Trp70Cys		Somatic				ACSM2B_uc002dhk.3_Missense_Mutation_p.W70C|ACSM2B_uc010bwf.1_Missense_Mutation_p.W70C	p.W70C	NM_182617	NP_872423	WXS	Illumina HiSeq	Unspecified	Q68CK6	ACS2B_HUMAN			4	420	-			70					Q86YT1	Missense_Mutation	SNP	ENST00000329697.6	37	c.210G>T	CCDS10586.1	.	.	.	.	.	.	.	.	.	.	C	17.61	3.433051	0.62844	.	.	ENSG00000066813	ENST00000329697;ENST00000414188	T;T	0.40225	1.04;1.04	3.51	3.51	0.40186	.	0.000000	0.41605	D	0.000844	T	0.58722	0.2142	L	0.60067	1.865	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.988	T	0.62329	-0.6877	10	0.54805	T	0.06	-9.9549	13.969	0.64228	0.0:1.0:0.0:0.0	.	70;70	A8K051;Q68CK6	.;ACS2B_HUMAN	C	70	ENSP00000327453:W70C;ENSP00000390378:W70C	ENSP00000327453:W70C	W	-	3	0	ACSM2B	20478238	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	5.725000	0.68507	1.794000	0.52575	0.609000	0.83330	TGG		0.532	ACSM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254417.2	NM_182617		8	27	1	0	3.86e-05	4.51e-05	8	27				
LOC81691	81691	broad.mit.edu	37	16	20824541	20824541	+	Silent	SNP	T	T	C	rs547741435		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr16:20824541T>C	ENST00000261377.6	+	3	377	c.168T>C	c.(166-168)acT>acC	p.T56T	ERI2_ENST00000564349.1_Intron|AC004381.6_ENST00000567297.1_3'UTR|AC004381.6_ENST00000564274.1_Silent_p.T56T|AC004381.6_ENST00000348433.6_Silent_p.T56T	NM_001199053.1|NM_030941.2	NP_001185982.1|NP_112203.2																					TTTTATTTACTGACAACTGTG	0.383																																						uc002dhv.2		NA																	0				ovary(1)|kidney(1)	2						c.(166-168)ACT>ACC		exonuclease NEF-sp isoform 1							78.0	74.0	75.0					16																	20824541		2201	4300	6501	SO:0001819	synonymous_variant	81691					nucleolus	exonuclease activity|nucleotide binding|RNA binding	g.chr16:20824541T>C																												ENST00000261377.6:c.168T>C	16.37:g.20824541T>C			Somatic				ERI2_uc002dht.3_Intron|LOC81691_uc002dhx.2_Silent_p.T56T|LOC81691_uc002dhw.2_5'UTR|LOC81691_uc002dhy.3_Silent_p.T56T	p.T56T	NM_030941	NP_112203	WXS	Illumina HiSeq	Unspecified	Q96IC2	REXON_HUMAN			3	431	+			56						Silent	SNP	ENST00000261377.6	37	c.168T>C	CCDS10591.1																																																																																				0.383	AC004381.6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254418.2			23	58	0	0	0	0	23	58				
DNAH3	55567	broad.mit.edu	37	16	21038393	21038393	+	Silent	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr16:21038393G>A	ENST00000261383.3	-	38	5495	c.5496C>T	c.(5494-5496)ttC>ttT	p.F1832F	DNAH3_ENST00000415178.1_Silent_p.F1832F	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1832	AAA 2. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		CGGCGGGCTCGAAGATCAGGC	0.572																																						uc010vbe.1		NA																	0				ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18						c.(5494-5496)TTC>TTT		dynein, axonemal, heavy chain 3							75.0	68.0	70.0					16																	21038393		2201	4300	6501	SO:0001819	synonymous_variant	55567				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr16:21038393G>A	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.5496C>T	16.37:g.21038393G>A			Somatic					p.F1832F	NM_017539	NP_060009	WXS	Illumina HiSeq	Unspecified	Q8TD57	DYH3_HUMAN		GBM - Glioblastoma multiforme(48;0.207)	38	5496	-			1832			AAA 2 (By similarity).		O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Silent	SNP	ENST00000261383.3	37	c.5496C>T	CCDS10594.1																																																																																				0.572	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539		10	40	0	0	0	0	10	40				
DNAH3	55567	broad.mit.edu	37	16	21117970	21117970	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr16:21117970C>T	ENST00000261383.3	-	15	2124	c.2125G>A	c.(2125-2127)Gca>Aca	p.A709T	DNAH3_ENST00000415178.1_Missense_Mutation_p.A709T	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	709	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		ACTTTGTCTGCGATGTGGCTG	0.413																																						uc010vbe.1		NA																	0				ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18						c.(2125-2127)GCA>ACA		dynein, axonemal, heavy chain 3							95.0	85.0	88.0					16																	21117970		2201	4300	6501	SO:0001583	missense	55567				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr16:21117970C>T	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.2125G>A	16.37:g.21117970C>T	ENSP00000261383:p.Ala709Thr		Somatic				DNAH3_uc002die.2_Missense_Mutation_p.A649T	p.A709T	NM_017539	NP_060009	WXS	Illumina HiSeq	Unspecified	Q8TD57	DYH3_HUMAN		GBM - Glioblastoma multiforme(48;0.207)	15	2125	-			709			Stem (By similarity).		O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	c.2125G>A	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	C	16.78	3.216404	0.58452	.	.	ENSG00000158486	ENST00000261383;ENST00000415178;ENST00000396036	T;T	0.22539	1.95;2.09	5.42	5.42	0.78866	.	0.665988	0.14813	N	0.296907	T	0.25606	0.0623	L	0.33245	0.995	0.43988	D	0.996684	P;D	0.59357	0.705;0.985	B;P	0.49887	0.028;0.625	T	0.02238	-1.1190	10	0.18710	T	0.47	.	17.972	0.89116	0.0:1.0:0.0:0.0	.	709;649	Q8TD57;Q8TD57-2	DYH3_HUMAN;.	T	709;709;649	ENSP00000261383:A709T;ENSP00000394245:A709T	ENSP00000261383:A709T	A	-	1	0	DNAH3	21025471	0.996000	0.38824	0.956000	0.39512	0.898000	0.52572	3.515000	0.53429	2.542000	0.85734	0.650000	0.86243	GCA		0.413	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539		17	75	0	0	0	0	17	75				
RBBP6	5930	broad.mit.edu	37	16	24581745	24581745	+	Missense_Mutation	SNP	A	A	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr16:24581745A>C	ENST00000319715.4	+	17	4166	c.3734A>C	c.(3733-3735)gAa>gCa	p.E1245A	RBBP6_ENST00000381039.3_Intron|RBBP6_ENST00000348022.2_Missense_Mutation_p.E1211A	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	1245					embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		GTTAAACAAGAAAAAGTCAAA	0.408																																						uc002dmh.2		NA																	0				ovary(3)|pancreas(1)	4						c.(3733-3735)GAA>GCA		retinoblastoma-binding protein 6 isoform 1							79.0	82.0	81.0					16																	24581745		2197	4300	6497	SO:0001583	missense	5930				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	chromosome|nucleolus|ubiquitin ligase complex	nucleic acid binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr16:24581745A>C		CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.3734A>C	16.37:g.24581745A>C	ENSP00000317872:p.Glu1245Ala		Somatic				RBBP6_uc010vcb.1_Missense_Mutation_p.E1112A|RBBP6_uc002dmi.2_Missense_Mutation_p.E1211A|RBBP6_uc010bxr.2_Intron|RBBP6_uc002dmk.2_Missense_Mutation_p.E1078A	p.E1245A	NM_006910	NP_008841	WXS	Illumina HiSeq	Unspecified	Q7Z6E9	RBBP6_HUMAN		GBM - Glioblastoma multiforme(48;0.0518)	17	4774	+			1245					Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Missense_Mutation	SNP	ENST00000319715.4	37	c.3734A>C	CCDS10621.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.981891	0.74474	.	.	ENSG00000122257	ENST00000319715;ENST00000348022	T;T	0.21031	2.05;2.03	5.97	5.97	0.96955	.	0.095669	0.45361	D	0.000363	T	0.24353	0.0590	N	0.19112	0.55	0.42767	D	0.993829	D;P	0.54207	0.965;0.941	P;P	0.50970	0.655;0.453	T	0.02519	-1.1147	10	0.72032	D	0.01	-28.9787	16.4504	0.83984	1.0:0.0:0.0:0.0	.	1211;1245	Q7Z6E9-2;Q7Z6E9	.;RBBP6_HUMAN	A	1245;1211	ENSP00000317872:E1245A;ENSP00000316291:E1211A	ENSP00000317872:E1245A	E	+	2	0	RBBP6	24489246	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.425000	0.80255	2.288000	0.76882	0.533000	0.62120	GAA		0.408	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214067.2	NM_006910		16	56	0	0	0	0	16	56				
GTF3C1	2975	broad.mit.edu	37	16	27556684	27556684	+	Missense_Mutation	SNP	T	T	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr16:27556684T>C	ENST00000356183.4	-	2	397	c.382A>G	c.(382-384)Aga>Gga	p.R128G	GTF3C1_ENST00000561623.1_Missense_Mutation_p.R128G	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	128					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						GACTTGGTTCTGATGTCATTG	0.473																																						uc002dov.1		NA																	0				ovary(2)|pancreas(1)|breast(1)|skin(1)	5						c.(382-384)AGA>GGA		general transcription factor IIIC, polypeptide							195.0	164.0	174.0					16																	27556684		2197	4300	6497	SO:0001583	missense	2975					transcription factor TFIIIC complex	DNA binding|protein binding	g.chr16:27556684T>C	U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.382A>G	16.37:g.27556684T>C	ENSP00000348510:p.Arg128Gly		Somatic				GTF3C1_uc002dou.2_Missense_Mutation_p.R128G	p.R128G	NM_001520	NP_001511	WXS	Illumina HiSeq	Unspecified	Q12789	TF3C1_HUMAN			2	422	-			128					B2RP21|Q12838|Q6DKN9|Q9Y4W9	Missense_Mutation	SNP	ENST00000356183.4	37	c.382A>G	CCDS32414.1	.	.	.	.	.	.	.	.	.	.	T	11.75	1.730327	0.30684	.	.	ENSG00000077235	ENST00000356183;ENST00000388971	T	0.29142	1.58	4.33	4.33	0.51752	.	0.000000	0.64402	D	0.000001	T	0.40522	0.1120	M	0.76574	2.34	0.38686	D	0.952657	D;P	0.53312	0.959;0.767	P;B	0.48552	0.581;0.359	T	0.50659	-0.8802	10	0.66056	D	0.02	-7.4446	10.3339	0.43839	0.0:0.0:0.1651:0.8349	.	128;128	Q12789;Q12789-3	TF3C1_HUMAN;.	G	128	ENSP00000348510:R128G	ENSP00000348510:R128G	R	-	1	2	GTF3C1	27464185	1.000000	0.71417	1.000000	0.80357	0.333000	0.28666	1.724000	0.38064	1.716000	0.51395	0.402000	0.26972	AGA		0.473	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433856.1	NM_001520		66	179	0	0	0	0	66	179				
ZNF668	79759	broad.mit.edu	37	16	31072937	31072937	+	Missense_Mutation	SNP	C	C	A	rs200991255		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr16:31072937C>A	ENST00000538906.1	-	3	2096	c.1312G>T	c.(1312-1314)Gtg>Ttg	p.V438L	ZNF668_ENST00000394983.2_Missense_Mutation_p.V438L|ZNF668_ENST00000300849.4_Missense_Mutation_p.V438L|ZNF668_ENST00000539836.3_Missense_Mutation_p.V461L|ZNF668_ENST00000417110.2_Missense_Mutation_p.T42K|ZNF668_ENST00000535577.1_Missense_Mutation_p.V438L|ZNF668_ENST00000426488.2_Missense_Mutation_p.V461L	NM_001172668.1	NP_001166139	Q96K58	ZN668_HUMAN	zinc finger protein 668	438					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V438M(1)|p.V461M(1)		breast(6)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	27						TCACCTGCCACGCCCACAGGC	0.716																																					Colon(181;1111 1980 5060 10512 25785)	uc010caf.2		NA																	2	Substitution - Missense(2)		endometrium(2)	breast(4)	4						c.(1312-1314)GTG>TTG		zinc finger protein 668							38.0	45.0	43.0					16																	31072937		2196	4298	6494	SO:0001583	missense	79759				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr16:31072937C>A		CCDS10701.1, CCDS54003.1	16p11.2	2013-01-08			ENSG00000167394	ENSG00000167394		"""Zinc fingers, C2H2-type"""	25821	protein-coding gene	gene with protein product						12477932	Standard	NM_024706		Approved	FLJ13479	uc021tgt.1	Q96K58	OTTHUMG00000047357	ENST00000538906.1:c.1312G>T	16.37:g.31072937C>A	ENSP00000440149:p.Val438Leu		Somatic				ZNF668_uc002eao.2_Missense_Mutation_p.V438L	p.V438L	NM_024706	NP_078982	WXS	Illumina HiSeq	Unspecified	Q96K58	ZN668_HUMAN			3	1669	-			438					C9JHH8|F5H7E7|Q59EV1|Q8N669|Q9H8L4	Missense_Mutation	SNP	ENST00000538906.1	37	c.1312G>T	CCDS10701.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	2.618|2.618	-0.289316|-0.289316	0.05605|0.05605	.|.	.|.	ENSG00000232748|ENSG00000167394	ENST00000417110|ENST00000539836;ENST00000535577;ENST00000538906;ENST00000394983;ENST00000300849	.|T;T;T;T;T	.|0.06687	.|3.27;3.28;3.28;3.28;3.28	4.84|4.84	1.72|1.72	0.24424|0.24424	.|.	.|0.653207	.|0.12964	.|N	.|0.424712	T|T	0.03178|0.03178	0.0093|0.0093	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|B	.|0.13145	.|0.007	.|B	.|0.08055	.|0.003	T|T	0.46317|0.46317	-0.9200|-0.9200	6|10	0.87932|0.11794	D|T	0|0.64	-17.5978|-17.5978	3.6902|3.6902	0.08343|0.08343	0.1956:0.6019:0.0:0.2026|0.1956:0.6019:0.0:0.2026	.|.	.|438	.|Q96K58	.|ZN668_HUMAN	K|L	42|461;438;438;438;438	.|ENSP00000442573:V461L;ENSP00000441349:V438L;ENSP00000440149:V438L;ENSP00000378434:V438L;ENSP00000300849:V438L	ENSP00000391989:T42K|ENSP00000300849:V438L	T|V	+|-	2|1	0|0	AC135050.1|ZNF668	30980438|30980438	0.000000|0.000000	0.05858|0.05858	0.421000|0.421000	0.26609|0.26609	0.188000|0.188000	0.23474|0.23474	-0.127000|-0.127000	0.10547|0.10547	1.285000|1.285000	0.44548|0.44548	0.462000|0.462000	0.41574|0.41574	ACG|GTG		0.716	ZNF668-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000108516.2	NM_024706		26	88	1	0	4.03e-09	5.31e-09	26	88				
IRX5	10265	broad.mit.edu	37	16	54965210	54965210	+	Missense_Mutation	SNP	G	G	A	rs377035980		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr16:54965210G>A	ENST00000394636.4	+	1	437	c.100G>A	c.(100-102)Gat>Aat	p.D34N	IRX5_ENST00000558597.1_5'Flank|IRX5_ENST00000560154.1_Missense_Mutation_p.D34N|CRNDE_ENST00000560208.1_lincRNA|IRX5_ENST00000320990.5_Missense_Mutation_p.D34N			P78411	IRX5_HUMAN	iroquois homeobox 5	34					embryonic cranial skeleton morphogenesis (GO:0048701)|gonad development (GO:0008406)|neuron maturation (GO:0042551)|regulation of heart rate (GO:0002027)|regulation of transcription, DNA-templated (GO:0006355)|response to stimulus (GO:0050896)|retinal bipolar neuron differentiation (GO:0060040)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|vitamin D binding (GO:0005499)			kidney(3)|large_intestine(6)|lung(4)|prostate(1)	14						GCCCCGCACGGATGAGCTCGG	0.672																																						uc002ehv.2		NA																	0					0						c.(100-102)GAT>AAT		iroquois homeobox protein 5		G	ASN/ASP	0,4394		0,0,2197	24.0	25.0	24.0		100	3.2	1.0	16		24	1,8591		0,1,4295	no	missense	IRX5	NM_005853.5	23	0,1,6492	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	34/484	54965210	1,12985	2197	4296	6493	SO:0001583	missense	10265				response to stimulus|visual perception	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|vitamin D binding	g.chr16:54965210G>A	U90309	CCDS10751.1, CCDS58462.1	16q12.2	2011-06-20	2007-07-13		ENSG00000176842	ENSG00000176842		"""Homeoboxes / TALE class"""	14361	protein-coding gene	gene with protein product		606195					Standard	NM_005853		Approved	IRX-2a	uc002ehv.3	P78411	OTTHUMG00000133201	ENST00000394636.4:c.100G>A	16.37:g.54965210G>A	ENSP00000378132:p.Asp34Asn		Somatic				uc010vhb.1_5'Flank|uc010vhc.1_5'Flank|uc002ehu.1_5'Flank|IRX5_uc010cca.1_Missense_Mutation_p.D34N|IRX5_uc002ehw.2_5'Flank	p.D34N	NM_005853	NP_005844	WXS	Illumina HiSeq	Unspecified	P78411	IRX5_HUMAN			1	100	+			34					H0YMS7|P78416|Q7Z2E1	Missense_Mutation	SNP	ENST00000394636.4	37	c.100G>A	CCDS10751.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.259779	0.80246	0.0	1.16E-4	ENSG00000176842	ENST00000394636;ENST00000320990;ENST00000447390	T;T	0.57907	0.37;0.37	5.17	3.2	0.36748	.	0.102804	0.64402	D	0.000003	T	0.46639	0.1403	N	0.22421	0.69	0.80722	D	1	B;D	0.55605	0.021;0.972	B;P	0.53360	0.027;0.724	T	0.35943	-0.9768	10	0.36615	T	0.2	-6.9681	10.0939	0.42464	0.1629:0.0:0.8371:0.0	.	34;34	A2RRB5;P78411	.;IRX5_HUMAN	N	34	ENSP00000378132:D34N;ENSP00000316250:D34N	ENSP00000316250:D34N	D	+	1	0	IRX5	53522711	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.124000	0.77185	1.166000	0.42689	0.561000	0.74099	GAT		0.672	IRX5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256911.2			11	22	0	0	0	0	11	22				
CIRH1A	84916	broad.mit.edu	37	16	69184450	69184450	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr16:69184450G>T	ENST00000314423.7	+	7	926	c.749G>T	c.(748-750)aGt>aTt	p.S250I	CIRH1A_ENST00000563094.1_Missense_Mutation_p.S250I|CIRH1A_ENST00000352319.4_Missense_Mutation_p.S250I|CIRH1A_ENST00000569615.2_3'UTR			Q969X6	CIR1A_HUMAN	cirrhosis, autosomal recessive 1A (cirhin)	250					maturation of SSU-rRNA (GO:0030490)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|t-UTP complex (GO:0034455)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(4)|prostate(1)|urinary_tract(1)	16				OV - Ovarian serous cystadenocarcinoma(108;0.125)		CAAGAAGACAGTTTCGTGGTG	0.488											OREG0023906	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Melanoma(69;1156 1278 4951 8715 52012)	uc002ews.3		NA																	0					0						c.(748-750)AGT>ATT		cirhin							163.0	161.0	162.0					16																	69184450		2198	4300	6498	SO:0001583	missense	84916					nucleolus	protein binding	g.chr16:69184450G>T	AB075868	CCDS10872.1	16q22	2014-04-07			ENSG00000141076	ENSG00000141076		"""WD repeat domain containing"""	1983	protein-coding gene	gene with protein product	"""UTP4, small subunit (SSU) processome component, homolog (yeast)"""	607456				10820129, 20385600	Standard	NM_032830		Approved	NAIC, FLJ14728, KIAA1988, TEX292, CIRHIN, UTP4	uc002ews.4	Q969X6	OTTHUMG00000137570	ENST00000314423.7:c.749G>T	16.37:g.69184450G>T	ENSP00000327179:p.Ser250Ile		Somatic	OREG0023906	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1112	CIRH1A_uc002ewr.2_Missense_Mutation_p.S250I|CIRH1A_uc002ewt.3_Missense_Mutation_p.S167I|CIRH1A_uc010cfi.2_Missense_Mutation_p.S167I|CIRH1A_uc010cfj.1_Missense_Mutation_p.S69I	p.S250I	NM_032830	NP_116219	WXS	Illumina HiSeq	Unspecified	Q969X6	CIR1A_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.125)	7	845	+			250			WD 6.		Q8NCD9|Q8TF14|Q96SP0|Q96SR9|Q96SZ9|Q96T13|Q9BWK6	Missense_Mutation	SNP	ENST00000314423.7	37	c.749G>T	CCDS10872.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.298395	0.81025	.	.	ENSG00000141076	ENST00000314423;ENST00000352319	T;T	0.33865	1.61;1.39	5.86	4.89	0.63831	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.036479	0.85682	N	0.000000	T	0.57666	0.2069	M	0.70842	2.15	0.58432	D	0.999995	D;P;D	0.89917	1.0;0.915;0.999	D;P;D	0.79108	0.992;0.519;0.974	T	0.55811	-0.8082	10	0.22706	T	0.39	.	15.906	0.79430	0.0:0.0:0.8635:0.1365	.	250;250;250	Q969X6-2;Q969X6;Q969X6-3	.;CIR1A_HUMAN;.	I	250	ENSP00000327179:S250I;ENSP00000339164:S250I	ENSP00000327179:S250I	S	+	2	0	CIRH1A	67741951	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	8.872000	0.92352	1.442000	0.47568	0.508000	0.49915	AGT		0.488	CIRH1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268950.2	NM_032830		4	152	1	0	0.00909568	0.00953133	4	152				
NFAT5	10725	broad.mit.edu	37	16	69726060	69726060	+	Missense_Mutation	SNP	A	A	G	rs202102702		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr16:69726060A>G	ENST00000354436.2	+	12	2596	c.2278A>G	c.(2278-2280)Aat>Gat	p.N760D	NFAT5_ENST00000349945.1_Missense_Mutation_p.N684D|NFAT5_ENST00000567239.1_Missense_Mutation_p.N777D|NFAT5_ENST00000393742.2_Missense_Mutation_p.N684D|NFAT5_ENST00000432919.1_Missense_Mutation_p.N778D|NFAT5_ENST00000566899.1_Missense_Mutation_p.N684D	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	760					cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						GATTTCATCAAATATTTTTCC	0.443																																						uc002exm.1		NA																	0					0						c.(2278-2280)AAT>GAT		nuclear factor of activated T-cells 5 isoform c		A	ASP/ASN,ASP/ASN,ASP/ASN,ASP/ASN,ASP/ASN	0,4396		0,0,2198	177.0	157.0	163.0		2329,2278,2332,2050,2050	6.1	1.0	16		163	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense,missense,missense,missense	NFAT5	NM_001113178.2,NM_006599.3,NM_138713.3,NM_138714.3,NM_173214.2	23,23,23,23,23	0,2,6496	GG,GA,AA		0.0233,0.0,0.0154	benign,benign,benign,benign,benign	777/1549,760/1532,778/1550,684/1456,684/1456	69726060	2,12994	2198	4300	6498	SO:0001583	missense	10725				excretion|signal transduction|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr16:69726060A>G	AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.2278A>G	16.37:g.69726060A>G	ENSP00000346420:p.Asn760Asp		Somatic				NFAT5_uc002exi.2_Missense_Mutation_p.N684D|NFAT5_uc002exj.1_Missense_Mutation_p.N684D|NFAT5_uc002exk.1_Missense_Mutation_p.N684D|NFAT5_uc002exl.1_Missense_Mutation_p.N778D|NFAT5_uc002exn.1_Missense_Mutation_p.N777D|NFAT5_uc002exo.1_5'Flank	p.N760D	NM_006599	NP_006590	WXS	Illumina HiSeq	Unspecified	O94916	NFAT5_HUMAN			12	3486	+			760					A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	Missense_Mutation	SNP	ENST00000354436.2	37	c.2278A>G	CCDS10881.1	.	.	.	.	.	.	.	.	.	.	A	12.32	1.901400	0.33535	0.0	2.33E-4	ENSG00000102908	ENST00000432919;ENST00000426654;ENST00000349945;ENST00000354436;ENST00000393742	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	6.08	6.08	0.98989	.	0.522573	0.22962	N	0.053540	T	0.30262	0.0759	L	0.36672	1.1	0.30027	N	0.813778	B;B;B	0.30741	0.293;0.189;0.293	B;B;B	0.22386	0.039;0.039;0.039	T	0.25187	-1.0139	10	0.23891	T	0.37	-3.7626	10.9027	0.47062	0.9305:0.0:0.0695:0.0	.	777;760;778	A2RRB4;O94916;E9PHR7	.;NFAT5_HUMAN;.	D	778;777;684;760;684	ENSP00000396538:N778D;ENSP00000338806:N684D;ENSP00000346420:N760D;ENSP00000377343:N684D	ENSP00000338806:N684D	N	+	1	0	NFAT5	68283561	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.810000	0.62598	2.333000	0.79357	0.533000	0.62120	AAT		0.443	NFAT5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268952.2	NM_138714		4	65	0	0	0	0	4	65				
HSD17B2	3294	broad.mit.edu	37	16	82131825	82131825	+	Silent	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr16:82131825G>A	ENST00000199936.4	+	5	1141	c.948G>A	c.(946-948)aaG>aaA	p.K316K	RP11-510J16.5_ENST00000567021.1_RNA	NM_002153.2	NP_002144.1	P37059	DHB2_HUMAN	hydroxysteroid (17-beta) dehydrogenase 2	316					in utero embryonic development (GO:0001701)|placenta development (GO:0001890)|response to retinoic acid (GO:0032526)|steroid biosynthetic process (GO:0006694)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity (GO:0047006)|estradiol 17-beta-dehydrogenase activity (GO:0004303)|testosterone dehydrogenase (NAD+) activity (GO:0047035)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	10						TAGCCAGCAAGGACTTCTCTC	0.542																																						uc002fgv.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(946-948)AAG>AAA		hydroxysteroid (17-beta) dehydrogenase 2	NADH(DB00157)						171.0	132.0	145.0					16																	82131825		2201	4300	6501	SO:0001819	synonymous_variant	3294				response to retinoic acid|steroid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity|binding|estradiol 17-beta-dehydrogenase activity|testosterone 17-beta-dehydrogenase (NAD+) activity	g.chr16:82131825G>A		CCDS10936.1	16q24.1-q24.2	2011-09-14			ENSG00000086696	ENSG00000086696	1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5211	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 9C, member 2"""	109685				7759109, 19027726	Standard	NM_002153		Approved	HSD17, SDR9C2	uc002fgv.3	P37059	OTTHUMG00000137631	ENST00000199936.4:c.948G>A	16.37:g.82131825G>A			Somatic					p.K316K	NM_002153	NP_002144	WXS	Illumina HiSeq	Unspecified	P37059	DHB2_HUMAN			5	1120	+			316					B2R7T4	Silent	SNP	ENST00000199936.4	37	c.948G>A	CCDS10936.1																																																																																				0.542	HSD17B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269057.2	NM_002153		39	73	0	0	0	0	39	73				
TEKT1	83659	broad.mit.edu	37	17	6718618	6718618	+	Missense_Mutation	SNP	G	G	T	rs375527200		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr17:6718618G>T	ENST00000338694.2	-	5	622	c.493C>A	c.(493-495)Cgc>Agc	p.R165S	TEKT1_ENST00000535086.1_Missense_Mutation_p.R19S	NM_053285.1	NP_444515.1	Q969V4	TEKT1_HUMAN	tektin 1	165						cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)				NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)	20		Myeloproliferative disorder(207;0.0255)				TTGGCAGAGCGGTTCATCCTG	0.498																																						uc002gdt.2		NA																	0				ovary(1)|skin(1)	2						c.(493-495)CGC>AGC		tektin 1							150.0	141.0	144.0					17																	6718618		2203	4300	6503	SO:0001583	missense	83659				microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule		g.chr17:6718618G>T		CCDS11083.1	17p13.2	2011-05-23			ENSG00000167858	ENSG00000167858			15534	protein-coding gene	gene with protein product		609002				11606253	Standard	NM_053285		Approved		uc002gdt.3	Q969V4	OTTHUMG00000102063	ENST00000338694.2:c.493C>A	17.37:g.6718618G>T	ENSP00000341346:p.Arg165Ser		Somatic				TEKT1_uc010vth.1_Missense_Mutation_p.R19S	p.R165S	NM_053285	NP_444515	WXS	Illumina HiSeq	Unspecified	Q969V4	TEKT1_HUMAN			5	603	-		Myeloproliferative disorder(207;0.0255)	165			Potential.		D3DTM7	Missense_Mutation	SNP	ENST00000338694.2	37	c.493C>A	CCDS11083.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.719676	0.89205	.	.	ENSG00000167858	ENST00000338694;ENST00000535086	T;T	0.03920	3.76;3.76	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.30324	0.0761	M	0.92970	3.365	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.27673	-1.0067	10	0.87932	D	0	.	16.548	0.84454	0.0:0.0:1.0:0.0	.	165	Q969V4	TEKT1_HUMAN	S	165;19	ENSP00000341346:R165S;ENSP00000444142:R19S	ENSP00000341346:R165S	R	-	1	0	TEKT1	6659342	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.641000	0.91032	2.582000	0.87167	0.655000	0.94253	CGC		0.498	TEKT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219867.2	NM_053285		34	72	1	0	8.42e-14	1.19e-13	34	72				
SLC2A4	6517	broad.mit.edu	37	17	7188426	7188426	+	Missense_Mutation	SNP	C	C	A	rs370389410		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr17:7188426C>A	ENST00000317370.8	+	9	1308	c.1040C>A	c.(1039-1041)gCg>gAg	p.A347E	SLC2A4_ENST00000571308.1_Missense_Mutation_p.A347E|SLC2A4_ENST00000424875.2_Missense_Mutation_p.A337E|RP1-4G17.2_ENST00000576271.1_RNA	NM_001042.2	NP_001033.1	P14672	GTR4_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 4	347					amylopectin biosynthetic process (GO:0010021)|brown fat cell differentiation (GO:0050873)|carbohydrate metabolic process (GO:0005975)|cellular response to insulin stimulus (GO:0032869)|cellular response to osmotic stress (GO:0071470)|glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|membrane organization (GO:0061024)|response to ethanol (GO:0045471)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|endomembrane system (GO:0012505)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|insulin-responsive compartment (GO:0032593)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|multivesicular body (GO:0005771)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|trans-Golgi network transport vesicle (GO:0030140)|vesicle membrane (GO:0012506)	D-glucose transmembrane transporter activity (GO:0055056)|glucose transmembrane transporter activity (GO:0005355)			breast(1)|endometrium(3)|large_intestine(7)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	17						GTGGAGCGGGCGGGGCGCCGG	0.667																																						uc002gfp.2		NA																	0					0						c.(1039-1041)GCG>GAG		glucose transporter 4							26.0	29.0	28.0					17																	7188426		2201	4297	6498	SO:0001583	missense	6517				carbohydrate metabolic process|glucose homeostasis|glucose import	external side of plasma membrane|integral to plasma membrane|perinuclear region of cytoplasm	D-glucose transmembrane transporter activity|protein binding	g.chr17:7188426C>A	M20747	CCDS11097.1	17p13	2013-05-22			ENSG00000181856	ENSG00000181856		"""Solute carriers"""	11009	protein-coding gene	gene with protein product		138190		GLUT4			Standard	NM_001042		Approved		uc002gfp.3	P14672	OTTHUMG00000102181	ENST00000317370.8:c.1040C>A	17.37:g.7188426C>A	ENSP00000320935:p.Ala347Glu		Somatic				SLC2A4_uc002gfo.2_Missense_Mutation_p.A347E|SLC2A4_uc010cmd.2_RNA	p.A347E	NM_001042	NP_001033	WXS	Illumina HiSeq	Unspecified	P14672	GTR4_HUMAN			9	1240	+			347			Cytoplasmic (Potential).		Q05BQ3|Q14CX2	Missense_Mutation	SNP	ENST00000317370.8	37	c.1040C>A	CCDS11097.1	.	.	.	.	.	.	.	.	.	.	C	15.54	2.864217	0.51482	.	.	ENSG00000181856	ENST00000317370;ENST00000424875	T;T	0.75477	-0.94;-0.94	5.92	4.96	0.65561	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);Sugar transporter, conserved site (1);	0.118609	0.64402	D	0.000015	D	0.89815	0.6824	H	0.97131	3.945	0.43417	D	0.995561	D;D	0.63046	0.983;0.992	D;D	0.69479	0.964;0.919	D	0.91912	0.5540	10	0.49607	T	0.09	.	13.1252	0.59351	0.0:0.9227:0.0:0.0773	.	347;337	P14672;F5H081	GTR4_HUMAN;.	E	347;337	ENSP00000320935:A347E;ENSP00000396887:A337E	ENSP00000320935:A347E	A	+	2	0	SLC2A4	7129150	0.951000	0.32395	0.638000	0.29380	0.355000	0.29361	2.078000	0.41567	1.522000	0.49001	-0.254000	0.11334	GCG		0.667	SLC2A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220031.3			10	7	1	0	0.000442599	0.000496582	10	7				
MFSD6L	162387	broad.mit.edu	37	17	8702310	8702310	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr17:8702310C>A	ENST00000329805.4	-	1	357	c.129G>T	c.(127-129)ttG>ttT	p.L43F		NM_152599.3	NP_689812.3	Q8IWD5	MFS6L_HUMAN	major facilitator superfamily domain containing 6-like	43						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(7)|skin(4)	17						AGGGCGCGGCCAAGCCCAGCT	0.652																																						uc002glp.1		NA																	0				central_nervous_system(1)	1						c.(127-129)TTG>TTT		major facilitator superfamily domain containing							31.0	37.0	35.0					17																	8702310		2203	4298	6501	SO:0001583	missense	162387					integral to membrane		g.chr17:8702310C>A	AK093092	CCDS11146.1	17p13.1	2014-05-30			ENSG00000185156	ENSG00000185156			26656	protein-coding gene	gene with protein product							Standard	NM_152599		Approved	FLJ35773	uc002glp.2	Q8IWD5	OTTHUMG00000178584	ENST00000329805.4:c.129G>T	17.37:g.8702310C>A	ENSP00000330051:p.Leu43Phe		Somatic					p.L43F	NM_152599	NP_689812	WXS	Illumina HiSeq	Unspecified	Q8IWD5	MFS6L_HUMAN			1	277	-			43					Q6YL34|Q8NA76	Missense_Mutation	SNP	ENST00000329805.4	37	c.129G>T	CCDS11146.1	.	.	.	.	.	.	.	.	.	.	C	18.68	3.675672	0.67928	.	.	ENSG00000185156	ENST00000329805	D	0.91068	-2.78	4.47	0.812	0.18744	Major facilitator superfamily domain, general substrate transporter (1);	0.092844	0.43747	D	0.000530	D	0.91988	0.7462	M	0.68952	2.095	0.31642	N	0.647893	D	0.76494	0.999	D	0.71414	0.973	D	0.87960	0.2729	10	0.44086	T	0.13	-0.0885	5.2348	0.15441	0.1509:0.6186:0.1326:0.0979	.	43	Q8IWD5	MFS6L_HUMAN	F	43	ENSP00000330051:L43F	ENSP00000330051:L43F	L	-	3	2	MFSD6L	8643035	0.683000	0.27633	0.987000	0.45799	0.993000	0.82548	0.655000	0.24933	0.424000	0.26061	0.655000	0.94253	TTG		0.652	MFSD6L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442554.1	NM_152599		18	40	1	0	1.68e-08	2.19e-08	18	40				
GLP2R	9340	broad.mit.edu	37	17	9792733	9792733	+	Missense_Mutation	SNP	G	G	T	rs143908746	byFrequency	TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr17:9792733G>T	ENST00000262441.5	+	13	1886	c.1373G>T	c.(1372-1374)cGc>cTc	p.R458L	GLP2R_ENST00000574745.1_Missense_Mutation_p.R278L	NM_004246.1	NP_004237.1	O95838	GLP2R_HUMAN	glucagon-like peptide 2 receptor	458					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|positive regulation of cell proliferation (GO:0008284)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|glucagon receptor activity (GO:0004967)			endometrium(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	44					Glucagon recombinant(DB00040)|Teduglutide(DB08900)	TTGCTAGCCCGCCACTCAGGC	0.562																																						uc002gmd.1		NA																	0				lung(2)|ovary(1)	3						c.(1372-1374)CGC>CTC		glucagon-like peptide 2 receptor precursor	Glucagon recombinant(DB00040)						39.0	41.0	40.0					17																	9792733		2203	4299	6502	SO:0001583	missense	9340				G-protein signaling, coupled to cAMP nucleotide second messenger|positive regulation of cell proliferation	integral to membrane|plasma membrane		g.chr17:9792733G>T	AF105367	CCDS11150.1	17p13.3	2012-08-10			ENSG00000065325	ENSG00000065325		"""GPCR / Class B : Glucagon receptors"""	4325	protein-coding gene	gene with protein product		603659				9990065	Standard	NM_004246		Approved		uc002gmd.1	O95838	OTTHUMG00000130269	ENST00000262441.5:c.1373G>T	17.37:g.9792733G>T	ENSP00000262441:p.Arg458Leu		Somatic					p.R458L	NM_004246	NP_004237	WXS	Illumina HiSeq	Unspecified	O95838	GLP2R_HUMAN			13	1373	+			458			Cytoplasmic (Potential).		Q4VAT3	Missense_Mutation	SNP	ENST00000262441.5	37	c.1373G>T	CCDS11150.1	.	.	.	.	.	.	.	.	.	.	G	5.354	0.250532	0.10130	.	.	ENSG00000065325	ENST00000396206;ENST00000262441	T	0.57595	0.39	5.3	-4.95	0.03048	.	1.163360	0.06577	N	0.749633	T	0.43743	0.1261	L	0.48986	1.54	0.09310	N	1	P	0.42123	0.771	B	0.39876	0.312	T	0.50197	-0.8856	10	0.59425	D	0.04	.	8.4385	0.32801	0.7265:0.0:0.1481:0.1254	.	458	O95838	GLP2R_HUMAN	L	458	ENSP00000262441:R458L	ENSP00000262441:R458L	R	+	2	0	GLP2R	9733458	0.001000	0.12720	0.000000	0.03702	0.030000	0.12068	0.022000	0.13511	-0.960000	0.03613	-0.142000	0.14014	CGC		0.562	GLP2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252601.4			16	31	1	0	1.37e-15	1.98e-15	16	31				
MYH1	4619	broad.mit.edu	37	17	10402013	10402013	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr17:10402013C>T	ENST00000226207.5	-	30	4205	c.4111G>A	c.(4111-4113)Gag>Aag	p.E1371K	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1371					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						TGGGCAACCTCACTGTTGGCC	0.547																																						uc002gmo.2		NA																	0				ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						c.(4111-4113)GAG>AAG		myosin, heavy chain 1, skeletal muscle, adult							170.0	146.0	154.0					17																	10402013		2203	4300	6503	SO:0001583	missense	4619					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity	g.chr17:10402013C>T		CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.4111G>A	17.37:g.10402013C>T	ENSP00000226207:p.Glu1371Lys		Somatic				uc002gml.1_Intron	p.E1371K	NM_005963	NP_005954	WXS	Illumina HiSeq	Unspecified	P12882	MYH1_HUMAN			30	4205	-			1371			Potential.		Q14CA4|Q9Y622	Missense_Mutation	SNP	ENST00000226207.5	37	c.4111G>A	CCDS11155.1	.	.	.	.	.	.	.	.	.	.	C	36	5.732209	0.96856	.	.	ENSG00000109061	ENST00000226207;ENST00000379814	T	0.80480	-1.38	5.41	5.41	0.78517	Myosin tail (1);	0.000000	0.43579	U	0.000550	D	0.94052	0.8094	H	0.97852	4.09	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	D	0.95879	0.8897	10	0.87932	D	0	.	19.5475	0.95305	0.0:1.0:0.0:0.0	.	1371	P12882	MYH1_HUMAN	K	1371;460	ENSP00000226207:E1371K	ENSP00000226207:E1371K	E	-	1	0	MYH1	10342738	1.000000	0.71417	0.991000	0.47740	0.997000	0.91878	7.698000	0.84413	2.696000	0.92011	0.655000	0.94253	GAG		0.547	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963		49	109	0	0	0	0	49	109				
MYH2	4620	broad.mit.edu	37	17	10427956	10427956	+	Missense_Mutation	SNP	G	G	A	rs569489518		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr17:10427956G>A	ENST00000245503.5	-	35	5386	c.5002C>T	c.(5002-5004)Cgg>Tgg	p.R1668W	MYH2_ENST00000397183.2_Missense_Mutation_p.R1668W|RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|MYH2_ENST00000532183.2_Intron	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1668					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						TCCTGGCTCCGGAGAGCATCA	0.572													g|||	1	0.000199681	0.0	0.0	5008	,	,		19739	0.0		0.001	False		,,,				2504	0.0					uc010coi.2		NA																	0				ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						c.(5002-5004)CGG>TGG		myosin heavy chain IIa							92.0	82.0	85.0					17																	10427956		2203	4300	6503	SO:0001583	missense	4620				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr17:10427956G>A		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.5002C>T	17.37:g.10427956G>A	ENSP00000245503:p.Arg1668Trp		Somatic				uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.R1668W|MYH2_uc010coj.2_Intron	p.R1668W	NM_001100112	NP_001093582	WXS	Illumina HiSeq	Unspecified	Q9UKX2	MYH2_HUMAN			35	5130	-			1668			Potential.		A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	ENST00000245503.5	37	c.5002C>T	CCDS11156.1	.	.	.	.	.	.	.	.	.	.	G	14.23	2.472724	0.43942	.	.	ENSG00000125414	ENST00000245503;ENST00000397183	D;D	0.82526	-1.62;-1.62	5.31	5.31	0.75309	Myosin tail (1);	0.000000	0.37483	U	0.002071	D	0.93933	0.8058	H	0.97415	4	0.49483	D	0.999795	D	0.76494	0.999	D	0.76575	0.988	D	0.95210	0.8324	10	0.87932	D	0	.	13.282	0.60222	0.0:0.0:0.7467:0.2533	.	1668	Q9UKX2	MYH2_HUMAN	W	1668	ENSP00000245503:R1668W;ENSP00000380367:R1668W	ENSP00000245503:R1668W	R	-	1	2	MYH2	10368681	0.181000	0.23161	1.000000	0.80357	0.402000	0.30811	0.546000	0.23284	2.755000	0.94549	0.491000	0.48974	CGG		0.572	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534		21	50	0	0	0	0	21	50				
MYH2	4620	broad.mit.edu	37	17	10429159	10429159	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr17:10429159C>T	ENST00000245503.5	-	31	4606	c.4222G>A	c.(4222-4224)Gaa>Aaa	p.E1408K	MYH2_ENST00000397183.2_Missense_Mutation_p.E1408K|RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|MYH2_ENST00000532183.2_Intron	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1408					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						TCTACATGTTCCTCAGCTGCC	0.483																																						uc010coi.2		NA																	0				ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						c.(4222-4224)GAA>AAA		myosin heavy chain IIa							59.0	56.0	57.0					17																	10429159		2203	4300	6503	SO:0001583	missense	4620				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr17:10429159C>T		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.4222G>A	17.37:g.10429159C>T	ENSP00000245503:p.Glu1408Lys		Somatic				uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.E1408K|MYH2_uc010coj.2_Intron	p.E1408K	NM_001100112	NP_001093582	WXS	Illumina HiSeq	Unspecified	Q9UKX2	MYH2_HUMAN			31	4350	-			1408			Potential.		A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	ENST00000245503.5	37	c.4222G>A	CCDS11156.1	.	.	.	.	.	.	.	.	.	.	C	34	5.296659	0.95574	.	.	ENSG00000125414	ENST00000245503;ENST00000397183	T;T	0.80393	-1.37;-1.37	4.9	4.9	0.64082	Myosin tail (1);	0.000000	0.39687	U	0.001290	D	0.92469	0.7609	M	0.93462	3.42	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.94296	0.7533	10	0.87932	D	0	.	18.2698	0.90064	0.0:1.0:0.0:0.0	.	1408	Q9UKX2	MYH2_HUMAN	K	1408	ENSP00000245503:E1408K;ENSP00000380367:E1408K	ENSP00000245503:E1408K	E	-	1	0	MYH2	10369884	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	5.934000	0.70138	2.558000	0.86282	0.313000	0.20887	GAA		0.483	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534		21	44	0	0	0	0	21	44				
DNAH9	1770	broad.mit.edu	37	17	11833273	11833273	+	Missense_Mutation	SNP	A	A	T	rs141342607		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr17:11833273A>T	ENST00000262442.4	+	63	12036	c.11968A>T	c.(11968-11970)Atg>Ttg	p.M3990L	DNAH9_ENST00000608377.1_Missense_Mutation_p.M302L|DNAH9_ENST00000454412.2_Intron|DNAH9_ENST00000396001.2_3'UTR	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3990	AAA 6. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CAGGGTCTTCATGAGTGCAGA	0.582																																						uc002gne.2		NA																	0				skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20						c.(11968-11970)ATG>TTG		dynein, axonemal, heavy chain 9 isoform 2							85.0	64.0	71.0					17																	11833273		2203	4300	6503	SO:0001583	missense	1770				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr17:11833273A>T	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.11968A>T	17.37:g.11833273A>T	ENSP00000262442:p.Met3990Leu		Somatic				DNAH9_uc010coo.2_Intron|DNAH9_uc002gnf.2_Missense_Mutation_p.M302L	p.M3990L	NM_001372	NP_001363	WXS	Illumina HiSeq	Unspecified	Q9NYC9	DYH9_HUMAN		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)	63	12036	+		Breast(5;0.0122)|all_epithelial(5;0.131)	3990			AAA 6 (By similarity).		A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	37	c.11968A>T	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	A	3.834	-0.035174	0.07543	.	.	ENSG00000007174	ENST00000262442;ENST00000396001	T;T	0.03272	3.99;3.99	5.19	5.19	0.71726	Dynein heavy chain (1);	0.423910	0.27567	N	0.018781	T	0.01287	0.0042	N	0.00879	-1.12	0.28213	N	0.92684	B	0.02656	0.0	B	0.11329	0.006	T	0.38415	-0.9662	10	0.02654	T	1	.	12.3686	0.55242	0.8598:0.1402:0.0:0.0	.	3990	Q9NYC9	DYH9_HUMAN	L	3990;302	ENSP00000262442:M3990L;ENSP00000379323:M302L	ENSP00000262442:M3990L	M	+	1	0	DNAH9	11773998	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.369000	0.52365	2.179000	0.69175	0.460000	0.39030	ATG		0.582	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372		11	21	0	0	0	0	11	21				
MYOCD	93649	broad.mit.edu	37	17	12649298	12649298	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr17:12649298C>T	ENST00000343344.4	+	9	1034	c.1034C>T	c.(1033-1035)cCc>cTc	p.P345L	MYOCD_ENST00000395988.1_3'UTR|MYOCD_ENST00000425538.1_Missense_Mutation_p.P345L|AC005358.1_ENST00000609971.1_Missense_Mutation_p.P249L			Q8IZQ8	MYCD_HUMAN	myocardin	345					cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		AGCAATACCCCCTTGTCTCCT	0.423																																						uc002gnn.2		NA																	0				central_nervous_system(2)|skin(2)|ovary(1)	5						c.(1033-1035)CCC>CTC		myocardin isoform 2							163.0	157.0	159.0					17																	12649298		2203	4300	6503	SO:0001583	missense	93649				cardiac muscle cell differentiation|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|positive regulation of smooth muscle cell differentiation|positive regulation of smooth muscle contraction|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation|regulation of histone acetylation|smooth muscle cell differentiation	nucleus	nucleic acid binding|RNA polymerase II transcription factor binding transcription factor activity|transcription factor binding	g.chr17:12649298C>T	AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.1034C>T	17.37:g.12649298C>T	ENSP00000341835:p.Pro345Leu		Somatic				MYOCD_uc002gno.2_Missense_Mutation_p.P345L|MYOCD_uc002gnp.1_Missense_Mutation_p.P249L|MYOCD_uc002gnq.2_Missense_Mutation_p.P64L	p.P345L	NM_153604	NP_705832	WXS	Illumina HiSeq	Unspecified	Q8IZQ8	MYCD_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)	9	1333	+			345					Q5UBU5|Q8N7Q1	Missense_Mutation	SNP	ENST00000343344.4	37	c.1034C>T	CCDS11163.1	.	.	.	.	.	.	.	.	.	.	C	15.06	2.721155	0.48728	.	.	ENSG00000141052	ENST00000395982;ENST00000425538;ENST00000343344;ENST00000395988;ENST00000443061	T;T	0.55234	0.7;0.53	5.71	5.71	0.89125	.	0.420852	0.28946	N	0.013633	T	0.39036	0.1063	N	0.24115	0.695	0.50171	D	0.999852	B;B;B;B	0.26876	0.031;0.027;0.162;0.016	B;B;B;B	0.22386	0.014;0.013;0.039;0.01	T	0.17107	-1.0380	10	0.28530	T	0.3	-25.3662	14.8666	0.70422	0.0:0.8557:0.1443:0.0	.	64;249;345;345	E9PEP9;Q8IZQ8-2;Q8IZQ8-3;Q8IZQ8	.;.;.;MYCD_HUMAN	L	64;345;345;249;50	ENSP00000341835:P345L;ENSP00000400148:P50L	ENSP00000341835:P345L	P	+	2	0	MYOCD	12590023	0.653000	0.27358	1.000000	0.80357	0.996000	0.88848	3.535000	0.53575	2.704000	0.92352	0.561000	0.74099	CCC		0.423	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129950.1	NM_153604		76	146	0	0	0	0	76	146				
ZNF286B	729288	broad.mit.edu	37	17	18566461	18566461	+	Missense_Mutation	SNP	T	T	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr17:18566461T>A	ENST00000545289.1	-	5	608	c.358A>T	c.(358-360)Agc>Tgc	p.S120C	ZNF286B_ENST00000285274.5_3'UTR	NM_001145045.1	NP_001138517.1	P0CG31	Z286B_HUMAN	zinc finger protein 286B	120					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|lung(1)	2						GAATCCTTGCTCTGTGGTCTA	0.388																																						uc010vyd.1		NA																	0					0						c.(358-360)AGC>TGC		zinc finger protein 286B							118.0	92.0	100.0					17																	18566461		692	1591	2283	SO:0001583	missense	729288				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr17:18566461T>A		CCDS58523.1	17p11.2	2013-01-08			ENSG00000249459	ENSG00000249459		"""Zinc fingers, C2H2-type"""	33241	protein-coding gene	gene with protein product	"""zinc finger protein 590"""		"""zinc finger protein 286-like"", ""zinc finger 286C pseudogene"""	ZNF286L, ZNF286C			Standard	NM_001145045		Approved	ZNF590	uc010vyd.1	P0CG31	OTTHUMG00000178136	ENST00000545289.1:c.358A>T	17.37:g.18566461T>A	ENSP00000461413:p.Ser120Cys		Somatic					p.S120C	NM_001145045	NP_001138517	WXS	Illumina HiSeq	Unspecified	P0CG31	Z286B_HUMAN			5	609	-			120						Missense_Mutation	SNP	ENST00000545289.1	37	c.358A>T	CCDS58523.1																																																																																				0.388	ZNF286B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_001723047		27	45	0	0	0	0	27	45				
RAB34	83871	broad.mit.edu	37	17	27041920	27041920	+	Splice_Site	SNP	T	T	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr17:27041920T>A	ENST00000395245.3	-	9	1231		c.e9-2		RAB34_ENST00000453384.3_Intron|RAB34_ENST00000447716.1_Splice_Site|RAB34_ENST00000415040.2_Splice_Site|RAB34_ENST00000450529.1_Splice_Site|RAB34_ENST00000395243.3_Splice_Site|RAB34_ENST00000301043.6_Splice_Site|RAB34_ENST00000436730.3_Splice_Site|RAB34_ENST00000395242.2_Splice_Site	NM_001256281.1|NM_031934.5	NP_001243210.1|NP_114140.4	Q9BZG1	RAB34_HUMAN	RAB34, member RAS oncogene family						antigen processing and presentation (GO:0019882)|Golgi to plasma membrane protein transport (GO:0043001)|lysosome localization (GO:0032418)|phagosome maturation (GO:0090382)|phagosome-lysosome fusion (GO:0090385)|protein localization to plasma membrane (GO:0072659)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|Golgi stack (GO:0005795)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|vesicle (GO:0031982)	GTP binding (GO:0005525)			endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(8)|skin(2)	14	Lung NSC(42;0.00431)					CATTCTCACCTGACACAGAGA	0.587																																					Pancreas(175;216 2049 29940 32498 41589)	uc002hce.2		NA																	0					0						c.e9-1		Ras-related protein RAB34 isoform 1							53.0	47.0	49.0					17																	27041920		2203	4300	6503	SO:0001630	splice_region_variant	83871				protein transport|small GTPase mediated signal transduction	Golgi apparatus	GTP binding	g.chr17:27041920T>A	AF322067	CCDS11240.1, CCDS45636.1, CCDS54101.1, CCDS58536.1	17q11.2	2008-07-18			ENSG00000109113	ENSG00000109113		"""RAB, member RAS oncogene"""	16519	protein-coding gene	gene with protein product		610917				12446704	Standard	NM_031934		Approved	RAB39, RAH	uc010was.1	P0DI83	OTTHUMG00000132680	ENST00000395245.3:c.605-2A>T	17.37:g.27041920T>A			Somatic				RAB34_uc002hcg.2_Splice_Site_p.G194_splice|RAB34_uc002hcf.2_Splice_Site_p.G203_splice|RAB34_uc010was.1_Splice_Site_p.G259_splice|RAB34_uc010wat.1_Splice_Site_p.G251_splice|RAB34_uc002hch.2_Splice_Site_p.G202_splice|RAB34_uc010wau.1_Splice_Site_p.G180_splice|RAB34_uc010wav.1_Intron	p.G202_splice	NM_031934	NP_114140	WXS	Illumina HiSeq	Unspecified	Q9BZG1	RAB34_HUMAN			9	1229	-	Lung NSC(42;0.00431)							B4E3A0|E9PEJ9|Q5BJE6|Q8NCJ8|Q96AR4	Splice_Site	SNP	ENST00000395245.3	37	c.605_splice	CCDS11240.1	.	.	.	.	.	.	.	.	.	.	T	18.24	3.579788	0.65992	.	.	ENSG00000109113	ENST00000447716;ENST00000301043;ENST00000395243;ENST00000415040;ENST00000450529;ENST00000395242;ENST00000395245;ENST00000436730;ENST00000430132;ENST00000412625;ENST00000353676	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.437	0.67287	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	RAB34	24066047	1.000000	0.71417	0.999000	0.59377	0.816000	0.46133	7.710000	0.84655	2.087000	0.62958	0.460000	0.39030	.		0.587	RAB34-018	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000345906.1	NM_031934	Intron	12	54	0	0	0	0	12	54				
KRT12	3859	broad.mit.edu	37	17	39022952	39022952	+	Missense_Mutation	SNP	T	T	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr17:39022952T>A	ENST00000251643.4	-	1	510	c.487A>T	c.(487-489)Aca>Tca	p.T163S		NM_000223.3	NP_000214.1	Q99456	K1C12_HUMAN	keratin 12	163	Rod.				visual perception (GO:0007601)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	15		Breast(137;0.000301)			Griseofulvin(DB00400)	GTTCCTCGTGTTTCATACCAT	0.408																																						uc002hvk.2		NA																	0				ovary(1)	1						c.(487-489)ACA>TCA		keratin 12							126.0	127.0	127.0					17																	39022952		2203	4300	6503	SO:0001583	missense	3859				visual perception	intermediate filament	structural molecule activity	g.chr17:39022952T>A		CCDS11378.1	17q21.2	2013-06-20	2008-08-01		ENSG00000187242	ENSG00000187242		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6414	protein-coding gene	gene with protein product	"""Meesmann corneal dystrophy"""	601687				9171831, 16831889	Standard	NM_000223		Approved	K12	uc002hvk.2	Q99456	OTTHUMG00000133369	ENST00000251643.4:c.487A>T	17.37:g.39022952T>A	ENSP00000251643:p.Thr163Ser		Somatic					p.T163S	NM_000223	NP_000214	WXS	Illumina HiSeq	Unspecified	Q99456	K1C12_HUMAN			1	511	-		Breast(137;0.000301)	163			Rod.		B2R9E0	Missense_Mutation	SNP	ENST00000251643.4	37	c.487A>T	CCDS11378.1	.	.	.	.	.	.	.	.	.	.	T	13.95	2.388677	0.42308	.	.	ENSG00000187242	ENST00000251643	D	0.88509	-2.39	5.91	1.29	0.21616	Filament (1);	0.254036	0.28182	N	0.016296	T	0.76877	0.4049	N	0.14661	0.345	0.21878	N	0.999498	B	0.17268	0.021	B	0.16289	0.015	T	0.64433	-0.6409	10	0.40728	T	0.16	.	8.8259	0.35054	0.0:0.2985:0.0:0.7015	.	163	Q99456	K1C12_HUMAN	S	163	ENSP00000251643:T163S	ENSP00000251643:T163S	T	-	1	0	KRT12	36276478	0.020000	0.18652	0.501000	0.27601	0.868000	0.49771	0.679000	0.25291	0.156000	0.19299	0.533000	0.62120	ACA		0.408	KRT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257214.2	NM_000223		54	208	0	0	0	0	54	208				
HAP1	9001	broad.mit.edu	37	17	39881020	39881020	+	Missense_Mutation	SNP	T	T	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr17:39881020T>C	ENST00000310778.5	-	12	1958	c.1949A>G	c.(1948-1950)aAa>aGa	p.K650R	HAP1_ENST00000393939.2_Missense_Mutation_p.K573R|HAP1_ENST00000347901.4_Missense_Mutation_p.K598R|HAP1_ENST00000341193.5_Missense_Mutation_p.K581R|JUP_ENST00000540235.1_Intron			P54257	HAP1_HUMAN	huntingtin-associated protein 1	650					anterograde axon cargo transport (GO:0008089)|autophagy (GO:0006914)|brain development (GO:0007420)|cell projection organization (GO:0030030)|exocytosis (GO:0006887)|negative regulation of beta-amyloid formation (GO:1902430)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|positive regulation of neurotrophin production (GO:0032901)|positive regulation of nonmotile primary cilium assembly (GO:1902857)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|protein localization (GO:0008104)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|regulation of organelle transport along microtubule (GO:1902513)|retrograde axon cargo transport (GO:0008090)|synaptic transmission (GO:0007268)|vesicle transport along microtubule (GO:0047496)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|inclusion body (GO:0016234)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synapse (GO:0045202)	brain-derived neurotrophic factor binding (GO:0048403)|ion channel binding (GO:0044325)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(4)|skin(1)	21		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			GCACTCACCTTTCTGGAGCAT	0.602																																						uc002hxm.1		NA																	0				ovary(2)	2						c.(1948-1950)AAA>AGA		huntingtin-associated protein 1 isoform 2							87.0	95.0	92.0					17																	39881020		2203	4300	6503	SO:0001583	missense	9001				brain development|protein localization|synaptic transmission	actin cytoskeleton	protein binding	g.chr17:39881020T>C	AF040723	CCDS11406.1, CCDS42338.1, CCDS42339.1	17q21.2-q21.3	2008-04-23	2008-04-23		ENSG00000173805	ENSG00000173805			4812	protein-coding gene	gene with protein product	"""neuroan 1"""	600947		HAP2		7477378, 9668110	Standard	NM_177977		Approved	HLP, hHLP1, HIP5	uc002hxn.1	P54257	OTTHUMG00000133498	ENST00000310778.5:c.1949A>G	17.37:g.39881020T>C	ENSP00000309392:p.Lys650Arg		Somatic				JUP_uc010wfs.1_Intron|HAP1_uc002hxn.1_Missense_Mutation_p.K598R|HAP1_uc002hxo.1_Missense_Mutation_p.K581R|HAP1_uc002hxp.1_Missense_Mutation_p.K573R	p.K650R	NM_177977	NP_817084	WXS	Illumina HiSeq	Unspecified	P54257	HAP1_HUMAN	BRCA - Breast invasive adenocarcinoma(4;0.0677)		12	1961	-		Breast(137;0.000162)	650					A8MQB5|O75358|Q59GK4|Q9H4G3|Q9HA98|Q9NY90	Missense_Mutation	SNP	ENST00000310778.5	37	c.1949A>G		.	.	.	.	.	.	.	.	.	.	T	11.90	1.775477	0.31411	.	.	ENSG00000173805	ENST00000458656;ENST00000442364;ENST00000393939;ENST00000310778;ENST00000347901;ENST00000341193	T;T;T;T;T;T	0.42131	1.08;0.98;2.75;3.15;2.84;2.77	3.97	1.78	0.24846	.	0.498837	0.17039	N	0.189381	T	0.34774	0.0909	L	0.27053	0.805	0.09310	N	1	P;P;P;P	0.50156	0.932;0.932;0.932;0.888	P;P;P;P	0.50970	0.655;0.655;0.655;0.453	T	0.11299	-1.0593	10	0.87932	D	0	-7.077	4.9318	0.13921	0.0:0.2483:0.0:0.7517	.	573;581;598;650	P54257-3;P54257-4;P54257-2;P54257	.;.;.;HAP1_HUMAN	R	105;67;573;650;598;581	ENSP00000404640:K105R;ENSP00000388981:K67R;ENSP00000377513:K573R;ENSP00000309392:K650R;ENSP00000334002:K598R;ENSP00000343170:K581R	ENSP00000309392:K650R	K	-	2	0	HAP1	37134546	0.993000	0.37304	0.602000	0.28890	0.115000	0.19883	0.759000	0.26461	0.702000	0.31825	0.418000	0.28097	AAA		0.602	HAP1-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000389619.1	NM_003949		57	188	0	0	0	0	57	188				
LPO	4025	broad.mit.edu	37	17	56344747	56344747	+	Silent	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr17:56344747G>A	ENST00000262290.4	+	12	2047	c.1731G>A	c.(1729-1731)caG>caA	p.Q577Q	LPO_ENST00000543544.1_Silent_p.Q518Q|LPO_ENST00000582328.1_Silent_p.Q494Q|LPO_ENST00000421678.2_Silent_p.Q494Q	NM_006151.2	NP_006142.1	P22079	PERL_HUMAN	lactoperoxidase	577					defense response to bacterium (GO:0042742)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|hydrogen peroxide catabolic process (GO:0042744)|response to oxidative stress (GO:0006979)|thiocyanate metabolic process (GO:0018969)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|thiocyanate peroxidase activity (GO:0036393)			breast(5)|cervix(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30						ACCTCTCACAGCCGCAGACAC	0.552																																						uc002ivt.2		NA																	0				ovary(1)|breast(1)	2						c.(1729-1731)CAG>CAA		lactoperoxidase isoform 1 preproprotein							65.0	60.0	62.0					17																	56344747		2203	4300	6503	SO:0001819	synonymous_variant	4025				hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity	g.chr17:56344747G>A	M58151	CCDS32689.1, CCDS54149.1	17q23.1	2008-02-05				ENSG00000167419	1.11.1.7		6678	protein-coding gene	gene with protein product		150205				2222811, 8964511	Standard	NM_006151		Approved	SPO	uc002ivt.3	P22079		ENST00000262290.4:c.1731G>A	17.37:g.56344747G>A			Somatic				LPO_uc010wns.1_Silent_p.Q518Q|LPO_uc010dcp.2_Silent_p.Q494Q|LPO_uc010dcq.2_Silent_p.Q248Q|LPO_uc010dcr.2_Silent_p.Q140Q	p.Q577Q	NM_006151	NP_006142	WXS	Illumina HiSeq	Unspecified	P22079	PERL_HUMAN			12	2047	+			577					A5JUY4|E7EMJ3|Q13408|Q3KNQ2	Silent	SNP	ENST00000262290.4	37	c.1731G>A	CCDS32689.1																																																																																				0.552	LPO-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443961.1			16	60	0	0	0	0	16	60				
BZRAP1	9256	broad.mit.edu	37	17	56386506	56386506	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr17:56386506C>T	ENST00000343736.4	-	22	4290	c.4127G>A	c.(4126-4128)aGa>aAa	p.R1376K	BZRAP1_ENST00000268893.6_Missense_Mutation_p.R1316K|BZRAP1_ENST00000355701.3_Missense_Mutation_p.R1376K			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	1376						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CTGGCCAGGTCTTCGGGGCTG	0.632																																						uc002ivx.3		NA																	0				upper_aerodigestive_tract(2)|skin(1)	3						c.(4126-4128)AGA>AAA		peripheral benzodiazepine receptor-associated							81.0	87.0	85.0					17																	56386506		2203	4300	6503	SO:0001583	missense	9256					mitochondrion	benzodiazepine receptor binding	g.chr17:56386506C>T	AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.4127G>A	17.37:g.56386506C>T	ENSP00000345824:p.Arg1376Lys		Somatic				BZRAP1_uc002ivw.2_5'Flank|BZRAP1_uc010dcs.2_Missense_Mutation_p.R1316K|BZRAP1_uc010wnt.1_Missense_Mutation_p.R1376K	p.R1376K	NM_004758	NP_004749	WXS	Illumina HiSeq	Unspecified	O95153	RIMB1_HUMAN			22	4998	-	Medulloblastoma(34;0.127)|all_neural(34;0.237)		1376					O75111|Q8N5W3	Missense_Mutation	SNP	ENST00000343736.4	37	c.4127G>A	CCDS11605.1	.	.	.	.	.	.	.	.	.	.	C	4.208	0.037289	0.08148	.	.	ENSG00000005379	ENST00000355701;ENST00000343736;ENST00000268893	T;T;T	0.04083	3.71;3.71;3.71	5.31	4.25	0.50352	.	0.965480	0.08634	N	0.916556	T	0.02304	0.0071	N	0.08118	0	0.09310	N	1	B;B;B	0.18741	0.002;0.03;0.017	B;B;B	0.19946	0.003;0.027;0.012	T	0.48670	-0.9015	10	0.05959	T	0.93	.	3.8085	0.08788	0.2634:0.5926:0.0:0.144	.	1376;1316;1376	B7ZVZ7;O95153-2;O95153	.;.;RIMB1_HUMAN	K	1376;1376;1316	ENSP00000347929:R1376K;ENSP00000345824:R1376K;ENSP00000268893:R1316K	ENSP00000268893:R1316K	R	-	2	0	BZRAP1	53741505	0.074000	0.21230	0.984000	0.44739	0.968000	0.65278	1.219000	0.32479	2.487000	0.83934	0.563000	0.77884	AGA		0.632	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443980.1	NM_004758		47	121	0	0	0	0	47	121				
PRR11	55771	broad.mit.edu	37	17	57270975	57270975	+	Silent	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr17:57270975C>A	ENST00000262293.4	+	5	837	c.525C>A	c.(523-525)ccC>ccA	p.P175P		NM_018304.3	NP_060774.2	Q96HE9	PRR11_HUMAN	proline rich 11	175	Pro-rich.					cytoplasm (GO:0005737)|membrane (GO:0016020)				breast(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|pancreas(1)	16	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					TGCTTCCTCCCACACTGCCAC	0.552																																						uc002ixf.1		NA																	0				ovary(2)	2						c.(523-525)CCC>CCA		proline rich 11							134.0	99.0	111.0					17																	57270975		2203	4300	6503	SO:0001819	synonymous_variant	55771							g.chr17:57270975C>A		CCDS11614.1	17q23.2	2005-12-13				ENSG00000068489			25619	protein-coding gene	gene with protein product		615920				11799066	Standard	NM_018304		Approved	FLJ11029	uc002ixf.2	Q96HE9		ENST00000262293.4:c.525C>A	17.37:g.57270975C>A			Somatic				PRR11_uc002ixg.1_RNA	p.P175P	NM_018304	NP_060774	WXS	Illumina HiSeq	Unspecified	Q96HE9	PRR11_HUMAN			5	604	+	Medulloblastoma(34;0.0922)|all_neural(34;0.101)		175			Pro-rich.		Q9NUZ7|Q9NXE9	Silent	SNP	ENST00000262293.4	37	c.525C>A	CCDS11614.1																																																																																				0.552	PRR11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445949.1	NM_018304		17	32	1	0	2.23e-06	2.72e-06	17	32				
MED13	9969	broad.mit.edu	37	17	60130054	60130054	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr17:60130054C>T	ENST00000397786.2	-	3	390	c.314G>A	c.(313-315)gGa>gAa	p.G105E		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	105					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.G105A(1)		breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						CTCCCACACTCCATCTTCTTC	0.338																																						uc002izo.2		NA																	1	Substitution - Missense(1)		endometrium(1)	large_intestine(1)|ovary(1)	2						c.(313-315)GGA>GAA		mediator complex subunit 13							120.0	115.0	117.0					17																	60130054		1817	4076	5893	SO:0001583	missense	9969				androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	g.chr17:60130054C>T	AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.314G>A	17.37:g.60130054C>T	ENSP00000380888:p.Gly105Glu		Somatic					p.G105E	NM_005121	NP_005112	WXS	Illumina HiSeq	Unspecified	Q9UHV7	MED13_HUMAN			3	391	-			105					B2RU05|O60334	Missense_Mutation	SNP	ENST00000397786.2	37	c.314G>A	CCDS42366.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.8|25.8	4.676734|4.676734	0.88445|0.88445	.|.	.|.	ENSG00000108510|ENSG00000108510	ENST00000262436|ENST00000397786	.|T	.|0.79653	.|-1.29	5.22|5.22	5.22|5.22	0.72569|0.72569	.|Mediator complex, subunit Med13, N-terminal, metazoa/fungi (1);	.|1.225140	.|0.05079	.|N	.|0.483160	D|D	0.91150|0.91150	0.7213|0.7213	M|M	0.84326|0.84326	2.69|2.69	0.80722|0.80722	D|D	1|1	.|D	.|0.64830	.|0.994	.|P	.|0.59115	.|0.852	D|D	0.84168|0.84168	0.0432|0.0432	6|10	0.20046|0.66056	T|D	0.44|0.02	-20.4715|-20.4715	19.1433|19.1433	0.93455|0.93455	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|105	.|Q9UHV7	.|MED13_HUMAN	K|E	105|105	.|ENSP00000380888:G105E	ENSP00000262436:E105K|ENSP00000380888:G105E	E|G	-|-	1|2	0|0	MED13|MED13	57484836|57484836	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	5.723000|5.723000	0.68492|0.68492	2.605000|2.605000	0.88082|0.88082	0.591000|0.591000	0.81541|0.81541	GAG|GGA		0.338	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445461.1	NM_005121		44	181	0	0	0	0	44	181				
KCNH6	81033	broad.mit.edu	37	17	61623183	61623183	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr17:61623183C>A	ENST00000583023.1	+	14	2916	c.2905C>A	c.(2905-2907)Cac>Aac	p.H969N	KCNH6_ENST00000456941.2_Missense_Mutation_p.H880N|KCNH6_ENST00000314672.5_Missense_Mutation_p.H933N|KCNH6_ENST00000581784.1_Missense_Mutation_p.H880N	NM_030779.2	NP_110406.1	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 6	969					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)	p.H969N(2)		breast(2)|central_nervous_system(2)|endometrium(9)|kidney(4)|large_intestine(6)|lung(20)|ovary(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	54					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	CCTCCCTGAACACCTTGGCTC	0.567																																						uc002jay.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(2905-2907)CAC>AAC		potassium voltage-gated channel, subfamily H,	Ibutilide(DB00308)						114.0	106.0	108.0					17																	61623183		2203	4300	6503	SO:0001583	missense	81033				regulation of transcription, DNA-dependent|signal transduction			g.chr17:61623183C>A	AF311913	CCDS11638.1, CCDS11639.1, CCDS62290.1	17q23.3	2012-07-05				ENSG00000173826		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18862	protein-coding gene	gene with protein product		608168				16382104	Standard	NM_030779		Approved	Kv11.2, erg2, HERG2	uc002jay.3	Q9H252		ENST00000583023.1:c.2905C>A	17.37:g.61623183C>A	ENSP00000463533:p.His969Asn		Somatic				KCNH6_uc010wpl.1_Missense_Mutation_p.H810N|KCNH6_uc010wpm.1_Missense_Mutation_p.H933N|KCNH6_uc002jaz.1_Missense_Mutation_p.H880N	p.H969N	NM_030779	NP_110406	WXS	Illumina HiSeq	Unspecified	Q9H252	KCNH6_HUMAN			14	2985	+			969			Cytoplasmic (Potential).		Q9BRD7	Missense_Mutation	SNP	ENST00000583023.1	37	c.2905C>A	CCDS11638.1	.	.	.	.	.	.	.	.	.	.	C	12.43	1.936643	0.34189	.	.	ENSG00000173826	ENST00000314672;ENST00000456941	D	0.99376	-5.79	4.57	1.2	0.21068	.	0.189959	0.31010	U	0.008440	D	0.96667	0.8912	L	0.36672	1.1	0.27836	N	0.941296	B;B;B;B	0.18013	0.001;0.02;0.02;0.025	B;B;B;B	0.18871	0.001;0.016;0.023;0.013	D	0.92734	0.6202	10	0.27082	T	0.32	.	7.9331	0.29914	0.0:0.7123:0.1327:0.155	.	810;933;880;969	B4DPJ3;B4DKC0;Q9H252-2;Q9H252	.;.;.;KCNH6_HUMAN	N	969;880	ENSP00000396900:H880N	ENSP00000318212:H969N	H	+	1	0	KCNH6	58976915	1.000000	0.71417	0.614000	0.29051	0.960000	0.62799	0.803000	0.27083	0.385000	0.24970	0.563000	0.77884	CAC		0.567	KCNH6-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443853.1	NM_030779		38	130	1	0	7e-10	9.4e-10	38	130				
APOH	350	broad.mit.edu	37	17	64225441	64225441	+	Silent	SNP	T	T	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr17:64225441T>A	ENST00000205948.6	-	1	94	c.57A>T	c.(55-57)gcA>gcT	p.A19A		NM_000042.2	NP_000033.2	P02749	APOH_HUMAN	apolipoprotein H (beta-2-glycoprotein I)	19					blood coagulation, intrinsic pathway (GO:0007597)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood coagulation (GO:0030195)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of myeloid cell apoptotic process (GO:0033033)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|plasminogen activation (GO:0031639)|positive regulation of blood coagulation (GO:0030194)|positive regulation of lipoprotein lipase activity (GO:0051006)|regulation of fibrinolysis (GO:0051917)|triglyceride metabolic process (GO:0006641)|triglyceride transport (GO:0034197)	cell surface (GO:0009986)|chylomicron (GO:0042627)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|very-low-density lipoprotein particle (GO:0034361)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipid binding (GO:0005543)			central_nervous_system(1)|kidney(3)|large_intestine(5)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17			BRCA - Breast invasive adenocarcinoma(6;9.74e-08)			TACTCCGTCCTGCAATAGCAA	0.418																																					Melanoma(155;624 1882 16869 48804 51309)	uc002jfn.3		NA																	0					0						c.(55-57)GCA>GCT		apolipoprotein H precursor							61.0	57.0	58.0					17																	64225441		2203	4300	6503	SO:0001819	synonymous_variant	350				blood coagulation, intrinsic pathway|negative regulation of angiogenesis|negative regulation of blood coagulation|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|negative regulation of fibrinolysis|negative regulation of myeloid cell apoptosis|negative regulation of smooth muscle cell apoptosis|plasminogen activation|positive regulation of lipoprotein lipase activity|triglyceride metabolic process|triglyceride transport	cell surface|chylomicron|high-density lipoprotein particle|very-low-density lipoprotein particle	eukaryotic cell surface binding|glycoprotein binding|heparin binding|lipoprotein lipase activator activity|phospholipid binding	g.chr17:64225441T>A		CCDS11663.1	17q24.2	2013-01-24				ENSG00000091583		"""Apolipoproteins"""	616	protein-coding gene	gene with protein product	"""beta-2-glycoprotein I"""	138700		B2G1		1582254	Standard	NM_000042		Approved	BG	uc002jfn.4	P02749		ENST00000205948.6:c.57A>T	17.37:g.64225441T>A			Somatic					p.A19A	NM_000042	NP_000033	WXS	Illumina HiSeq	Unspecified	P02749	APOH_HUMAN	BRCA - Breast invasive adenocarcinoma(6;9.74e-08)		1	116	-			19					B2R9M3|Q9UCN7	Silent	SNP	ENST00000205948.6	37	c.57A>T	CCDS11663.1																																																																																				0.418	APOH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446926.1	NM_000042		6	14	0	0	0	0	6	14				
MAP2K6	5608	broad.mit.edu	37	17	67516411	67516411	+	Splice_Site	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr17:67516411G>T	ENST00000590474.1	+	6	654	c.367G>T	c.(367-369)Ggt>Tgt	p.G123C	MAP2K6_ENST00000589647.1_Splice_Site_p.G67C	NM_002758.3	NP_002749.2	P52564	MP2K6_HUMAN	mitogen-activated protein kinase kinase 6	123	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|apoptotic process (GO:0006915)|cardiac muscle contraction (GO:0060048)|cell cycle arrest (GO:0007050)|cellular response to sorbitol (GO:0072709)|DNA damage induced protein phosphorylation (GO:0006975)|innate immune response (GO:0045087)|muscle cell differentiation (GO:0042692)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to ischemia (GO:0002931)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)	20	Breast(10;6.05e-10)					TGGTCTCCAGGGTGATGTGTG	0.343																																						uc002jij.2		NA																	0				lung(2)|stomach(1)|ovary(1)|pancreas(1)	5						c.(367-369)GGT>TGT		mitogen-activated protein kinase kinase 6							62.0	60.0	60.0					17																	67516411		2203	4300	6503	SO:0001630	splice_region_variant	5608				activation of MAPK activity|cell cycle arrest|DNA damage induced protein phosphorylation|innate immune response|muscle cell differentiation|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of muscle cell differentiation|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr17:67516411G>T	U39064	CCDS11686.1	17q	2011-06-09						"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6846	protein-coding gene	gene with protein product	"""protein kinase, mitogen-activated, kinase 6 (MAP kinase kinase 6)"""	601254		PRKMK6		8621675	Standard	XM_005257515		Approved	MEK6, MKK6, SAPKK3, MAPKK6	uc002jij.3	P52564		ENST00000590474.1:c.367-1G>T	17.37:g.67516411G>T			Somatic				MAP2K6_uc002jii.2_Missense_Mutation_p.G123C|MAP2K6_uc002jik.2_3'UTR	p.G123C	NM_002758	NP_002749	WXS	Illumina HiSeq	Unspecified	P52564	MP2K6_HUMAN			6	655	+	Breast(10;6.05e-10)		123			Protein kinase.			Missense_Mutation	SNP	ENST00000590474.1	37	c.367G>T	CCDS11686.1	.	.	.	.	.	.	.	.	.	.	G	16.58	3.162419	0.57368	.	.	ENSG00000108984	ENST00000359094	.	.	.	5.49	5.49	0.81192	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.055024	0.64402	D	0.000001	T	0.75012	0.3792	L	0.55017	1.72	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.72625	0.978;0.978	T	0.72789	-0.4187	8	.	.	.	-11.8258	17.2159	0.86944	0.0:0.0:1.0:0.0	.	123;123	P52564;A8K3Y2	MP2K6_HUMAN;.	C	123	.	.	G	+	1	0	MAP2K6	65028006	1.000000	0.71417	0.998000	0.56505	0.111000	0.19643	9.679000	0.98649	2.727000	0.93392	0.563000	0.77884	GGT		0.343	MAP2K6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450689.1	NM_002758	Missense_Mutation	26	53	1	0	1.55e-18	2.29e-18	26	53				
RHBDF2	79651	broad.mit.edu	37	17	74473293	74473293	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr17:74473293G>A	ENST00000313080.4	-	8	1249	c.976C>T	c.(976-978)Cct>Tct	p.P326S	RHBDF2_ENST00000592378.1_5'Flank|RHBDF2_ENST00000591885.1_Missense_Mutation_p.P297S|RHBDF2_ENST00000389760.4_Missense_Mutation_p.P297S	NM_024599.5	NP_078875.4	Q6PJF5	RHDF2_HUMAN	rhomboid 5 homolog 2 (Drosophila)	326					negative regulation of protein secretion (GO:0050709)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(4)|skin(1)	27						GGGGAGACAGGGGAGGCTGAG	0.632																																						uc002jrq.1		NA																	0					0						c.(976-978)CCT>TCT		rhomboid, veinlet-like 6 isoform 1							24.0	27.0	26.0					17																	74473293		2203	4300	6503	SO:0001583	missense	79651				negative regulation of protein secretion|protein transport|proteolysis	endoplasmic reticulum membrane|integral to membrane	growth factor binding|serine-type endopeptidase activity	g.chr17:74473293G>A	BC016034	CCDS32743.1, CCDS32744.1	17q25.3	2014-09-17	2006-02-22	2006-02-22		ENSG00000129667			20788	protein-coding gene	gene with protein product		614404	"""rhomboid, veinlet-like 6 (Drosophila)"", ""tylosis with oesophageal cancer"""	RHBDL6, TOC		12838346, 22265016	Standard	NM_024599		Approved	FLJ22341, RHBDL5, TOCG	uc002jrq.2	Q6PJF5		ENST00000313080.4:c.976C>T	17.37:g.74473293G>A	ENSP00000322775:p.Pro326Ser		Somatic				RHBDF2_uc002jrp.1_Missense_Mutation_p.P297S|RHBDF2_uc002jrr.1_Missense_Mutation_p.P178S|RHBDF2_uc010wtf.1_Missense_Mutation_p.P297S|RHBDF2_uc002jrs.1_Missense_Mutation_p.P321S	p.P326S	NM_024599	NP_078875	WXS	Illumina HiSeq	Unspecified	Q6PJF5	RHDF2_HUMAN			8	1269	-			326			Cytoplasmic (Potential).		A6NEM3|A8K801|Q5U607|Q5YGQ8|Q9H6E9	Missense_Mutation	SNP	ENST00000313080.4	37	c.976C>T	CCDS32743.1	.	.	.	.	.	.	.	.	.	.	G	8.164	0.790266	0.16258	.	.	ENSG00000129667	ENST00000313080;ENST00000389760;ENST00000389762	T;T	0.62364	0.03;0.03	5.3	5.3	0.74995	.	0.630111	0.15718	N	0.248053	T	0.52141	0.1716	L	0.40543	1.245	0.36687	D	0.879394	B;B;B;B	0.19445	0.036;0.009;0.003;0.0	B;B;B;B	0.23018	0.043;0.021;0.009;0.002	T	0.51442	-0.8705	10	0.14656	T	0.56	-25.2465	12.9394	0.58333	0.0:0.2139:0.7861:0.0	.	297;272;326;297	B7Z8H4;Q6ZWP8;Q6PJF5;Q6PJF5-2	.;.;RHDF2_HUMAN;.	S	326;297;272	ENSP00000322775:P326S;ENSP00000374410:P297S	ENSP00000322775:P326S	P	-	1	0	RHBDF2	71984888	0.999000	0.42202	0.992000	0.48379	0.653000	0.38743	2.654000	0.46699	2.479000	0.83701	0.655000	0.94253	CCT		0.632	RHBDF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450134.1	NM_024599		5	11	0	0	0	0	5	11				
ENPP7	339221	broad.mit.edu	37	17	77709217	77709217	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr17:77709217C>A	ENST00000328313.5	+	3	996	c.775C>A	c.(775-777)Ctg>Atg	p.L259M		NM_178543.3	NP_848638.3			ectonucleotide pyrophosphatase/phosphodiesterase 7											breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(6)|skin(3)	34			OV - Ovarian serous cystadenocarcinoma(97;0.016)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			GGCTGGCGACCTGGTTGAATT	0.587																																						uc002jxa.2		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(775-777)CTG>ATG		ectonucleotide pyrophosphatase/phosphodiesterase							134.0	102.0	113.0					17																	77709217		2203	4300	6503	SO:0001583	missense	339221				negative regulation of cell proliferation|negative regulation of DNA replication|sphingomyelin metabolic process	Golgi apparatus|integral to membrane|microvillus	sphingomyelin phosphodiesterase activity	g.chr17:77709217C>A	AY230663	CCDS11763.1	17q25.3	2014-04-09			ENSG00000182156	ENSG00000182156			23764	protein-coding gene	gene with protein product	"""alkaline sphingomyelinase"""					12885774	Standard	NM_178543		Approved	alk-SMase, NPP7	uc002jxa.3	Q6UWV6	OTTHUMG00000177462	ENST00000328313.5:c.775C>A	17.37:g.77709217C>A	ENSP00000332656:p.Leu259Met		Somatic					p.L259M	NM_178543	NP_848638	WXS	Illumina HiSeq	Unspecified	Q6UWV6	ENPP7_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.016)|BRCA - Breast invasive adenocarcinoma(99;0.0224)		3	795	+			259						Missense_Mutation	SNP	ENST00000328313.5	37	c.775C>A	CCDS11763.1	.	.	.	.	.	.	.	.	.	.	C	13.14	2.147013	0.37923	.	.	ENSG00000182156	ENST00000328313	T	0.79033	-1.23	5.39	1.87	0.25490	Alkaline-phosphatase-like, core domain (1);	0.105907	0.36167	N	0.002744	D	0.83658	0.5302	M	0.82323	2.585	0.23704	N	0.997067	D	0.58268	0.982	D	0.63033	0.91	T	0.71748	-0.4499	10	0.36615	T	0.2	-25.7743	5.8637	0.18762	0.0:0.5341:0.1877:0.2782	.	259	Q6UWV6	ENPP7_HUMAN	M	259	ENSP00000332656:L259M	ENSP00000332656:L259M	L	+	1	2	ENPP7	75323812	0.604000	0.26932	0.998000	0.56505	0.420000	0.31355	0.960000	0.29253	0.655000	0.30866	0.655000	0.94253	CTG		0.587	ENPP7-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437038.1	NM_178543		16	86	1	0	1.57e-10	2.14e-10	16	86				
B3GNTL1	146712	broad.mit.edu	37	17	80972342	80972342	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr17:80972342C>A	ENST00000320865.3	-	5	409	c.396G>T	c.(394-396)caG>caT	p.Q132H	B3GNTL1_ENST00000571954.1_5'UTR|B3GNTL1_ENST00000576599.1_5'UTR	NM_001009905.1	NP_001009905.1	Q67FW5	B3GNL_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1	132							transferase activity, transferring glycosyl groups (GO:0016757)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	8	Breast(20;0.000443)|all_neural(118;0.0779)	all_cancers(8;0.0396)|all_epithelial(8;0.0556)	BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)			TCGACGGGTGCTGAACGGCAG	0.468																																						uc002kgg.1		NA																	0				ovary(1)|pancreas(1)	2						c.(394-396)CAG>CAT		UDP-GlcNAc:betaGal							120.0	94.0	103.0					17																	80972342		2203	4300	6503	SO:0001583	missense	146712						transferase activity, transferring glycosyl groups	g.chr17:80972342C>A	AY634364	CCDS32778.1	17q25.3	2013-02-22	2004-01-13	2004-01-14	ENSG00000175711	ENSG00000175711		"""Glycosyltransferase family 2 domain containing"""	21727	protein-coding gene	gene with protein product		615337					Standard	NM_001009905		Approved	B3GNT8	uc002kgg.1	Q67FW5	OTTHUMG00000177788	ENST00000320865.3:c.396G>T	17.37:g.80972342C>A	ENSP00000319979:p.Gln132His		Somatic				B3GNTL1_uc002kgf.1_5'UTR	p.Q132H	NM_001009905	NP_001009905	WXS	Illumina HiSeq	Unspecified	Q67FW5	B3GNL_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)		5	410	-	Breast(20;0.000443)|all_neural(118;0.0779)	all_cancers(8;0.0396)|all_epithelial(8;0.0556)	132					Q6GV30|Q8WUT3	Missense_Mutation	SNP	ENST00000320865.3	37	c.396G>T	CCDS32778.1	.	.	.	.	.	.	.	.	.	.	c	14.25	2.479918	0.44044	.	.	ENSG00000175711	ENST00000320865	T	0.61392	0.11	4.15	0.993	0.19825	Glycosyl transferase, family 2 (1);	0.600536	0.16433	U	0.214639	T	0.59418	0.2192	L	0.52011	1.625	0.22354	N	0.99918	P	0.39071	0.658	P	0.53450	0.726	T	0.49153	-0.8969	9	.	.	.	-9.9789	5.4459	0.16535	0.0:0.6106:0.0:0.3894	.	132	Q67FW5	B3GNL_HUMAN	H	132	ENSP00000319979:Q132H	.	Q	-	3	2	B3GNTL1	78565631	0.118000	0.22208	0.529000	0.27951	0.009000	0.06853	-0.065000	0.11617	0.497000	0.27926	0.441000	0.28932	CAG		0.468	B3GNTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438949.1	NM_001009905		10	56	1	0	1.59e-06	1.95e-06	10	56				
TMEM200C	645369	broad.mit.edu	37	18	5891898	5891898	+	Silent	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr18:5891898G>A	ENST00000581347.2	-	3	810	c.165C>T	c.(163-165)atC>atT	p.I55I	TMEM200C_ENST00000383490.2_Silent_p.I55I|RP11-945C19.4_ENST00000577694.1_RNA|RP11-945C19.4_ENST00000580845.1_RNA|RP11-945C19.4_ENST00000582939.1_RNA			A6NKL6	T200C_HUMAN	transmembrane protein 200C	55						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|endometrium(1)|large_intestine(4)|lung(5)|stomach(1)	12						CACAGAGGGCGATGAGCCCTG	0.627																																						uc002kmx.1		NA																	0					0						c.(163-165)ATC>ATT		transmembrane protein 200C							73.0	83.0	80.0					18																	5891898		2185	4272	6457	SO:0001819	synonymous_variant	645369					integral to membrane		g.chr18:5891898G>A		CCDS45825.1	18p11.31	2009-09-08			ENSG00000206432	ENSG00000206432			37208	protein-coding gene	gene with protein product						15722956	Standard	NM_001080209		Approved	TTMA	uc002kmx.1	A6NKL6		ENST00000581347.2:c.165C>T	18.37:g.5891898G>A			Somatic					p.I55I	NM_001080209	NP_001073678	WXS	Illumina HiSeq	Unspecified	A6NKL6	T200C_HUMAN			1	206	-			55			Helical; (Potential).			Silent	SNP	ENST00000581347.2	37	c.165C>T	CCDS45825.1																																																																																				0.627	TMEM200C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441917.4	NM_001080209		13	36	0	0	0	0	13	36				
LAMA1	284217	broad.mit.edu	37	18	7079977	7079977	+	Missense_Mutation	SNP	T	T	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr18:7079977T>A	ENST00000389658.3	-	3	435	c.342A>T	c.(340-342)agA>agT	p.R114S	RP11-76K13.3_ENST00000581502.1_RNA	NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	114	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				CACCTACCTGTCTTAAGTCCA	0.468																																						uc002knm.2		NA																	0				ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21						c.(340-342)AGA>AGT		laminin, alpha 1 precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						174.0	130.0	145.0					18																	7079977		2203	4300	6503	SO:0001583	missense	284217				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding	g.chr18:7079977T>A	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.342A>T	18.37:g.7079977T>A	ENSP00000374309:p.Arg114Ser		Somatic				LAMA1_uc010wzj.1_5'UTR	p.R114S	NM_005559	NP_005550	WXS	Illumina HiSeq	Unspecified	P25391	LAMA1_HUMAN			3	436	-		Colorectal(10;0.172)	114			Laminin N-terminal.			Missense_Mutation	SNP	ENST00000389658.3	37	c.342A>T	CCDS32787.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.241793	0.79912	.	.	ENSG00000101680	ENST00000389658	T	0.75821	-0.97	5.61	1.87	0.25490	Laminin, N-terminal (3);	0.109425	0.64402	D	0.000013	T	0.75744	0.3891	L	0.50333	1.59	0.47949	D	0.999558	D	0.59767	0.986	P	0.58928	0.848	T	0.69401	-0.5155	10	0.28530	T	0.3	.	9.2566	0.37586	0.0:0.3101:0.0:0.6899	.	114	P25391	LAMA1_HUMAN	S	114	ENSP00000374309:R114S	ENSP00000374309:R114S	R	-	3	2	LAMA1	7069977	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	0.639000	0.24690	0.088000	0.17205	0.533000	0.62120	AGA		0.468	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559		13	49	0	0	0	0	13	49				
MPPE1	65258	broad.mit.edu	37	18	11888679	11888679	+	Nonsense_Mutation	SNP	C	C	T	rs527986273		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr18:11888679C>T	ENST00000588072.1	-	6	1779	c.558G>A	c.(556-558)tgG>tgA	p.W186*	MPPE1_ENST00000344987.7_Nonsense_Mutation_p.W186*|MPPE1_ENST00000399978.2_Nonsense_Mutation_p.W186*|MPPE1_ENST00000317235.7_Nonsense_Mutation_p.W186*|MPPE1_ENST00000309976.9_Nonsense_Mutation_p.W186*	NM_023075.5	NP_075563.3	Q53F39	MPPE1_HUMAN	metallophosphoesterase 1	186					ER to Golgi vesicle-mediated transport (GO:0006888)|GPI anchor biosynthetic process (GO:0006506)	cis-Golgi network (GO:0005801)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	GPI anchor binding (GO:0034235)|manganese ion binding (GO:0030145)|phosphoric diester hydrolase activity (GO:0008081)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	5						TAATGCCTTTCCAAGAAAACA	0.353																																						uc002kqf.2		NA																	0					0						c.(556-558)TGG>TGA		metallophosphoesterase 1 precursor							58.0	62.0	61.0					18																	11888679		2203	4298	6501	SO:0001587	stop_gained	65258				ER to Golgi vesicle-mediated transport|GPI anchor biosynthetic process	cis-Golgi network|endoplasmic reticulum exit site|ER-Golgi intermediate compartment membrane|integral to membrane	GPI anchor binding|manganese ion binding|phosphoric diester hydrolase activity	g.chr18:11888679C>T	BC002877	CCDS11853.1, CCDS56054.1	18p11.21	2004-04-30			ENSG00000154889	ENSG00000154889			15988	protein-coding gene	gene with protein product		611900				11978971	Standard	NM_001242904		Approved		uc002kqf.3	Q53F39	OTTHUMG00000131661	ENST00000588072.1:c.558G>A	18.37:g.11888679C>T	ENSP00000465894:p.Trp186*		Somatic				MPPE1_uc002kqn.2_Nonsense_Mutation_p.W186*|MPPE1_uc002kqg.2_RNA|MPPE1_uc002kqh.2_RNA|MPPE1_uc002kqi.2_RNA|MPPE1_uc002kqj.2_Nonsense_Mutation_p.W186*|MPPE1_uc002kqk.2_Nonsense_Mutation_p.W186*|MPPE1_uc002kql.2_Nonsense_Mutation_p.W186*|MPPE1_uc002kqm.2_Nonsense_Mutation_p.W186*|MPPE1_uc010dla.1_Nonsense_Mutation_p.W186*	p.W186*	NM_023075	NP_075563	WXS	Illumina HiSeq	Unspecified	Q53F39	MPPE1_HUMAN			6	1199	-			186					B0YJ39|B0YJ40|B0YJ41|B5ME53|B7WNJ3|D3DUI5|D3DUI7|Q6GMP1|Q8TAD6|Q8TE26|Q8WZ32|Q9BU58|Q9H958|Q9HAI4	Nonsense_Mutation	SNP	ENST00000588072.1	37	c.558G>A	CCDS11853.1	.	.	.	.	.	.	.	.	.	.	C	37	6.408938	0.97542	.	.	ENSG00000154889	ENST00000317235;ENST00000309976;ENST00000317251;ENST00000344987;ENST00000399978	.	.	.	4.83	2.99	0.34606	.	0.901259	0.09684	N	0.769387	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	-21.98	6.0779	0.19925	0.0:0.6177:0.1465:0.2358	.	.	.	.	X	186;186;89;186;186	.	ENSP00000311200:W186X	W	-	3	0	MPPE1	11878679	0.995000	0.38212	1.000000	0.80357	0.873000	0.50193	0.347000	0.20014	1.172000	0.42781	0.462000	0.41574	TGG		0.353	MPPE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254562.2	NM_023075		9	31	0	0	0	0	9	31				
POTEC	388468	broad.mit.edu	37	18	14537970	14537970	+	Missense_Mutation	SNP	C	C	T	rs148283099	byFrequency	TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr18:14537970C>T	ENST00000358970.5	-	3	639	c.640G>A	c.(640-642)Gta>Ata	p.V214I	POTEC_ENST00000389891.4_5'UTR	NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	214										NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						TGGCATTGTACGGCCTGTCAG	0.358													.|||	272	0.0543131	0.0968	0.0317	5008	,	,		17535	0.0		0.0676	False		,,,				2504	0.0552					uc010dln.2		NA																	0				skin(3)	3						c.(640-642)GTA>ATA		ANKRD26-like family B, member 2		C	ILE/VAL	127,1257		5,117,570	223.0	181.0	194.0		640	-0.2	0.1	18	dbSNP_134	194	227,2955		5,217,1369	yes	missense	POTEC	NM_001137671.1	29	10,334,1939	TT,TC,CC		7.1339,9.1763,7.753	possibly-damaging	214/543	14537970	354,4212	692	1591	2283	SO:0001583	missense	388468							g.chr18:14537970C>T	BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.640G>A	18.37:g.14537970C>T	ENSP00000351856:p.Val214Ile		Somatic				POTEC_uc010xaj.1_RNA	p.V214I	NM_001137671	NP_001131143	WXS	Illumina HiSeq	Unspecified	B2RU33	POTEC_HUMAN			3	1094	-			214			ANK 3.			Missense_Mutation	SNP	ENST00000358970.5	37	c.640G>A	CCDS45835.1	131	0.059981684981684984	61	0.12398373983739837	12	0.03314917127071823	3	0.005244755244755245	55	0.07255936675461741	C	8.316	0.823305	0.16678	0.091763	0.071339	ENSG00000183206	ENST00000358970;ENST00000389891	T	0.66638	-0.22	1.4	-0.219	0.13135	Ankyrin repeat-containing domain (4);	.	.	.	.	T	0.00936	0.0031	L	0.38649	1.16	0.40531	P	0.019066000000000027	B	0.14012	0.009	B	0.15052	0.012	T	0.06954	-1.0798	8	0.44086	T	0.13	.	4.0054	0.09598	0.0:0.6525:0.0:0.3475	.	214	B2RU33	POTEC_HUMAN	I	214	ENSP00000351856:V214I	ENSP00000351856:V214I	V	-	1	0	POTEC	14527970	0.005000	0.15991	0.120000	0.21714	0.083000	0.17756	-0.145000	0.10265	-0.081000	0.12662	0.194000	0.17425	GTA		0.358	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371179.1	XM_496269		6	159	0	0	0	0	6	159				
GAREM	64762	broad.mit.edu	37	18	29848468	29848468	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr18:29848468G>A	ENST00000269209.6	-	6	2000	c.1997C>T	c.(1996-1998)cCa>cTa	p.P666L	GAREM_ENST00000399218.4_Missense_Mutation_p.P665L			Q9H706	GAREM_HUMAN	GRB2 associated, regulator of MAPK1	666					cellular response to epidermal growth factor stimulus (GO:0071364)|epidermal growth factor receptor signaling pathway (GO:0007173)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)										AAAAGGTGCTGGGCAGTTTCT	0.532																																						uc002kxl.2		NA																	0				ovary(1)|skin(1)	2						c.(1996-1998)CCA>CTA		family with sequence similarity 59, member A							82.0	81.0	82.0					18																	29848468		2203	4300	6503	SO:0001583	missense	64762							g.chr18:29848468G>A	AK025263	CCDS11905.1, CCDS56057.1	18q12.1	2012-11-30	2012-11-30	2012-11-30	ENSG00000141441	ENSG00000141441			26136	protein-coding gene	gene with protein product	"""Grb2-associated and regulator of Erk/MAPK"""		"""chromosome 18 open reading frame 11"", ""family with sequence similarity 59, member A"""	C18orf11, FAM59A		19509291	Standard	NM_001242409		Approved	FLJ21610	uc002kxl.3	Q9H706	OTTHUMG00000132273	ENST00000269209.6:c.1997C>T	18.37:g.29848468G>A	ENSP00000269209:p.Pro666Leu		Somatic				FAM59A_uc002kxk.1_Missense_Mutation_p.P665L	p.P666L	NM_022751	NP_073588	WXS	Illumina HiSeq	Unspecified	Q9H706	FA59A_HUMAN			6	2053	-			666					Q0VAG3|Q0VAG4|Q8ND03|Q9BSF5	Missense_Mutation	SNP	ENST00000269209.6	37	c.1997C>T	CCDS56057.1	.	.	.	.	.	.	.	.	.	.	G	18.18	3.566217	0.65651	.	.	ENSG00000141441	ENST00000399218;ENST00000269209	T;T	0.14266	2.52;2.52	5.73	5.73	0.89815	.	0.109884	0.64402	D	0.000005	T	0.15262	0.0368	N	0.08118	0	0.80722	D	1	P;D	0.59767	0.919;0.986	B;P	0.52159	0.253;0.691	T	0.11348	-1.0591	10	0.87932	D	0	-8.5105	19.5409	0.95273	0.0:0.0:1.0:0.0	.	666;665	Q9H706;Q9H706-3	FA59A_HUMAN;.	L	665;666	ENSP00000382165:P665L;ENSP00000269209:P666L	ENSP00000269209:P666L	P	-	2	0	FAM59A	28102466	1.000000	0.71417	0.990000	0.47175	0.998000	0.95712	8.936000	0.92931	2.721000	0.93114	0.650000	0.86243	CCA		0.532	GAREM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255365.1	NM_022751		28	76	0	0	0	0	28	76				
SLC14A1	6563	broad.mit.edu	37	18	43329784	43329784	+	Silent	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr18:43329784G>A	ENST00000321925.4	+	10	1270	c.1038G>A	c.(1036-1038)acG>acA	p.T346T	SLC14A1_ENST00000436407.3_Silent_p.T402T|SLC14A1_ENST00000535474.1_Silent_p.T214T|SLC14A1_ENST00000589700.1_Missense_Mutation_p.R297H|SLC14A1_ENST00000586142.1_Silent_p.T346T|SLC14A1_ENST00000415427.3_Silent_p.T402T|SLC14A1_ENST00000591541.1_Silent_p.T50T|RP11-116O18.3_ENST00000586213.1_RNA|SLC14A1_ENST00000502059.2_Silent_p.T238T|SLC14A1_ENST00000402943.2_Silent_p.T241T	NM_001128588.3|NM_001146036.2|NM_015865.6	NP_001122060.3|NP_001139508.2|NP_056949.4	Q13336	UT1_HUMAN	solute carrier family 14 (urea transporter), member 1 (Kidd blood group)	346					transmembrane transport (GO:0055085)|urea transmembrane transport (GO:0071918)|urea transport (GO:0015840)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	urea channel activity (GO:0015265)|urea transmembrane transporter activity (GO:0015204)|water transmembrane transporter activity (GO:0005372)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(11)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	21						GTTTGGCCACGCTATTGTTCC	0.478																																						uc010xcn.1		NA																	0				central_nervous_system(1)|pancreas(1)	2						c.(1036-1038)ACG>ACA		solute carrier family 14 (urea transporter),							156.0	136.0	143.0					18																	43329784		2203	4300	6503	SO:0001819	synonymous_variant	6563					integral to plasma membrane	urea transmembrane transporter activity	g.chr18:43329784G>A	BC040128	CCDS11925.1, CCDS45860.1	18q11-q12	2014-07-19	2014-01-02		ENSG00000141469	ENSG00000141469		"""Blood group antigens"", ""Solute carriers"""	10918	protein-coding gene	gene with protein product		613868	"""Kidd blood group"", ""solute carrier family 14 (urea transporter), member 1"""	JK		7797558	Standard	NM_001146037		Approved	HsT1341, RACH1, RACH2	uc010dnk.3	Q13336	OTTHUMG00000132617	ENST00000321925.4:c.1038G>A	18.37:g.43329784G>A			Somatic				SLC14A1_uc010dnk.2_Silent_p.T402T|SLC14A1_uc002lbf.3_Silent_p.T346T|SLC14A1_uc002lbg.3_RNA|SLC14A1_uc010xco.1_Silent_p.T241T|SLC14A1_uc002lbh.3_Silent_p.T238T|SLC14A1_uc002lbi.3_Silent_p.T214T|SLC14A1_uc002lbj.3_Silent_p.T402T|SLC14A1_uc002lbk.3_Silent_p.T346T	p.T346T	NM_001146036	NP_001139508	WXS	Illumina HiSeq	Unspecified	Q13336	UT1_HUMAN			11	1357	+			346			Helical; (Potential).		A8K0P3|B3KR62|B3KVX3|C9EHF2|Q86VM5	Silent	SNP	ENST00000321925.4	37	c.1038G>A	CCDS11925.1																																																																																				0.478	SLC14A1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255860.2	NM_015865		48	132	0	0	0	0	48	132				
TXNL1	9352	broad.mit.edu	37	18	54293689	54293689	+	Splice_Site	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr18:54293689C>A	ENST00000217515.6	-	2	303		c.e2-1		TXNL1_ENST00000540155.1_Splice_Site|TXNL1_ENST00000590954.1_Splice_Site	NM_004786.2	NP_004777.1	O43396	TXNL1_HUMAN	thioredoxin-like 1						cell redox homeostasis (GO:0045454)|glycerol ether metabolic process (GO:0006662)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	disulfide oxidoreductase activity (GO:0015036)|protein disulfide oxidoreductase activity (GO:0015035)			endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4				READ - Rectum adenocarcinoma(59;0.193)|Colorectal(16;0.211)		TGGCCCACACCTGTTAGAAAA	0.363																																						uc002lgg.2		NA																	0					0						c.e2-1		thioredoxin-like 1							91.0	94.0	93.0					18																	54293689		2203	4300	6503	SO:0001630	splice_region_variant	9352				cell redox homeostasis|electron transport chain|glycerol ether metabolic process|transport	cytoplasm	electron carrier activity|protein disulfide oxidoreductase activity	g.chr18:54293689C>A	AF003938	CCDS11961.1	18q21.31	2011-01-17	2004-05-06	2004-05-07	ENSG00000091164	ENSG00000091164			12436	protein-coding gene	gene with protein product	"""thioredoxin-like, 32kD"""	603049	"""thioredoxin-like, 32kDa"""	TXNL		9473519, 9668102	Standard	NM_004786		Approved	Txl, TRP32	uc002lgg.3	O43396	OTTHUMG00000132722	ENST00000217515.6:c.99-1G>T	18.37:g.54293689C>A			Somatic				TXNL1_uc010xdz.1_Splice_Site|TXNL1_uc002lgh.2_Splice_Site|TXNL1_uc002lgi.2_Splice_Site_p.G33_splice|TXNL1_uc002lgj.1_Splice_Site_p.G33_splice	p.G33_splice	NM_004786	NP_004777	WXS	Illumina HiSeq	Unspecified	O43396	TXNL1_HUMAN		READ - Rectum adenocarcinoma(59;0.193)|Colorectal(16;0.211)	2	348	-									Splice_Site	SNP	ENST00000217515.6	37	c.99_splice	CCDS11961.1	.	.	.	.	.	.	.	.	.	.	C	12.86	2.063522	0.36373	.	.	ENSG00000091164	ENST00000217515	.	.	.	5.56	5.56	0.83823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1139	0.93330	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TXNL1	52444687	1.000000	0.71417	0.985000	0.45067	0.077000	0.17291	7.208000	0.77907	2.621000	0.88768	0.655000	0.94253	.		0.363	TXNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256064.2		Intron	40	120	1	0	1.6e-16	2.32e-16	40	120				
CPLX4	339302	broad.mit.edu	37	18	56985537	56985537	+	Missense_Mutation	SNP	A	A	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr18:56985537A>G	ENST00000299721.3	-	1	344	c.158T>C	c.(157-159)aTt>aCt	p.I53T	CPLX4_ENST00000587244.1_Missense_Mutation_p.I53T	NM_181654.3	NP_857637.1	Q7Z7G2	CPLX4_HUMAN	complexin 4	53					exocytosis (GO:0006887)|neurotransmitter transport (GO:0006836)|regulation of neurotransmitter secretion (GO:0046928)	cell junction (GO:0030054)|membrane (GO:0016020)|synapse (GO:0045202)				autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	16		Colorectal(73;0.175)				CTTCTCCTCAATCATTTGCTT	0.408																																						uc002lhy.2		NA																	0				ovary(1)	1						c.(157-159)ATT>ACT		complexin 4 precursor							225.0	204.0	211.0					18																	56985537		2203	4300	6503	SO:0001583	missense	339302				exocytosis|neurotransmitter transport	cell junction|synapse	syntaxin binding	g.chr18:56985537A>G	AY286502	CCDS11973.1	18q21.32	2005-08-02			ENSG00000166569	ENSG00000166569			24330	protein-coding gene	gene with protein product		609586				15911881	Standard	NM_181654		Approved	CPX-IV	uc002lhy.3	Q7Z7G2	OTTHUMG00000132756	ENST00000299721.3:c.158T>C	18.37:g.56985537A>G	ENSP00000299721:p.Ile53Thr		Somatic					p.I53T	NM_181654	NP_857637	WXS	Illumina HiSeq	Unspecified	Q7Z7G2	CPLX4_HUMAN			1	345	-		Colorectal(73;0.175)	53					F1T0L6	Missense_Mutation	SNP	ENST00000299721.3	37	c.158T>C	CCDS11973.1	.	.	.	.	.	.	.	.	.	.	A	15.22	2.769393	0.49680	.	.	ENSG00000166569	ENST00000299721	.	.	.	5.25	5.25	0.73442	.	0.054223	0.64402	D	0.000001	T	0.42562	0.1208	N	0.14661	0.345	0.46458	D	0.999053	B	0.26708	0.157	B	0.28638	0.092	T	0.34254	-0.9836	9	0.34782	T	0.22	-2.3627	15.1144	0.72388	1.0:0.0:0.0:0.0	.	53	Q7Z7G2	CPLX4_HUMAN	T	53	.	ENSP00000299721:I53T	I	-	2	0	CPLX4	55136517	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	8.634000	0.91002	2.097000	0.63578	0.533000	0.62120	ATT		0.408	CPLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256127.1	NM_181654		56	148	0	0	0	0	56	148				
VPS4B	9525	broad.mit.edu	37	18	61066522	61066522	+	Silent	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr18:61066522C>T	ENST00000238497.5	-	8	1028	c.825G>A	c.(823-825)ctG>ctA	p.L275L	VPS4B_ENST00000591383.1_5'UTR	NM_004869.3	NP_004860.2	O75351	VPS4B_HUMAN	vacuolar protein sorting 4 homolog B (S. cerevisiae)	275					ATP catabolic process (GO:0006200)|cell cycle (GO:0007049)|cell division (GO:0051301)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|intracellular cholesterol transport (GO:0032367)|membrane organization (GO:0061024)|positive regulation of viral release from host cell (GO:1902188)|potassium ion transport (GO:0006813)|protein transport (GO:0015031)|regulation of viral process (GO:0050792)|response to lipid (GO:0033993)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|nucleus (GO:0005634)|vacuolar membrane (GO:0005774)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)			breast(1)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	13						TTGTAGCTCCCAGAACCAAAA	0.348																																						uc002lix.2		NA																	0				ovary(1)	1						c.(823-825)CTG>CTA		vacuolar protein sorting factor 4B							108.0	105.0	106.0					18																	61066522		2203	4300	6503	SO:0001819	synonymous_variant	9525				cell cycle|cell division|cellular membrane organization|endosome to lysosome transport via multivesicular body sorting pathway|intracellular cholesterol transport|protein transport|response to lipid	cytosol|early endosome|late endosome membrane|lysosome|nucleus|vacuolar membrane	ATP binding|ATPase activity, coupled|protein C-terminus binding	g.chr18:61066522C>T	AF038960	CCDS11983.1	18q21.33	2010-04-21	2006-04-04	2002-06-14	ENSG00000119541	ENSG00000119541		"""ATPases / AAA-type"""	10895	protein-coding gene	gene with protein product		609983	"""suppressor of K+ transport defect 1"", ""vacuolar protein sorting 4B (yeast)"""	SKD1		11563910	Standard	XM_006722582		Approved	VPS4-2, SKD1B	uc002lix.3	O75351	OTTHUMG00000132790	ENST00000238497.5:c.825G>A	18.37:g.61066522C>T			Somatic				VPS4B_uc010dpx.2_Silent_p.L275L|VPS4B_uc010dpy.2_Silent_p.L157L|VPS4B_uc010dpz.1_Silent_p.L157L	p.L275L	NM_004869	NP_004860	WXS	Illumina HiSeq	Unspecified	O75351	VPS4B_HUMAN			8	1085	-			275					Q69HW4|Q9GZS7	Silent	SNP	ENST00000238497.5	37	c.825G>A	CCDS11983.1																																																																																				0.348	VPS4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256198.2	NM_004869		43	100	0	0	0	0	43	100				
RTTN	25914	broad.mit.edu	37	18	67860629	67860629	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr18:67860629G>A	ENST00000255674.6	-	8	1188	c.902C>T	c.(901-903)tCc>tTc	p.S301F	RTTN_ENST00000454359.1_Missense_Mutation_p.S301F|RTTN_ENST00000437017.1_Missense_Mutation_p.S301F	NM_173630.3	NP_775901.3	Q86VV8	RTTN_HUMAN	rotatin	301					determination of left/right symmetry (GO:0007368)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(35)|ovary(4)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Esophageal squamous(42;0.129)				AGGATTCTGGGAATGATGAGT	0.488																																						uc002lkp.2		NA																	0				ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8						c.(901-903)TCC>TTC		rotatin							81.0	82.0	81.0					18																	67860629		1903	4122	6025	SO:0001583	missense	25914						binding	g.chr18:67860629G>A	AL117635	CCDS42443.1	18q22.1	2008-08-01				ENSG00000176225			18654	protein-coding gene	gene with protein product		610436				11900971	Standard	NM_173630		Approved	DKFZP434G145	uc002lkp.2	Q86VV8		ENST00000255674.6:c.902C>T	18.37:g.67860629G>A	ENSP00000255674:p.Ser301Phe		Somatic				RTTN_uc002lko.2_RNA|RTTN_uc010xfb.1_5'UTR|RTTN_uc002lkq.1_Missense_Mutation_p.S301F	p.S301F	NM_173630	NP_775901	WXS	Illumina HiSeq	Unspecified	Q86VV8	RTTN_HUMAN			8	970	-		Esophageal squamous(42;0.129)	301					Q68CS9|Q6ZRL8|Q6ZTK3|Q86TG4|Q8N8N8|Q8TBQ4|Q96IN9|Q9UFJ4	Missense_Mutation	SNP	ENST00000255674.6	37	c.902C>T	CCDS42443.1	.	.	.	.	.	.	.	.	.	.	G	14.90	2.674487	0.47781	.	.	ENSG00000176225	ENST00000255674;ENST00000454359;ENST00000437017	T;T;T	0.67523	0.46;0.33;-0.27	5.34	5.34	0.76211	Armadillo-type fold (1);	0.161164	0.41605	D	0.000859	T	0.81004	0.4733	M	0.64997	1.995	0.58432	D	0.999993	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.82617	-0.0369	10	0.87932	D	0	.	19.0662	0.93113	0.0:0.0:1.0:0.0	.	301;301	Q86VV8-2;Q86VV8	.;RTTN_HUMAN	F	301	ENSP00000255674:S301F;ENSP00000402352:S301F;ENSP00000399520:S301F	ENSP00000255674:S301F	S	-	2	0	RTTN	66011609	1.000000	0.71417	0.546000	0.28166	0.969000	0.65631	9.159000	0.94728	2.501000	0.84356	0.591000	0.81541	TCC		0.488	RTTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442988.1	NM_173630		21	69	0	0	0	0	21	69				
SMIM21	284274	broad.mit.edu	37	18	73130849	73130849	+	Missense_Mutation	SNP	C	C	T	rs375362339		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr18:73130849C>T	ENST00000579022.1	-	2	291	c.152G>A	c.(151-153)cGt>cAt	p.R51H	RP11-321M21.3_ENST00000578340.1_3'UTR|RP11-321M21.3_ENST00000579386.1_3'UTR|SMIM21_ENST00000382638.3_Intron|SMIM21_ENST00000584508.1_Missense_Mutation_p.R51H	NM_001037331.2	NP_001032408.1	Q3B7S5	SMI21_HUMAN	small integral membrane protein 21	51						integral component of membrane (GO:0016021)		p.R51P(1)									TGTGAAGAAACGAATATGGTG	0.383																																						uc002lma.1		NA																	1	Substitution - Missense(1)		upper_aerodigestive_tract(1)		0						c.(151-153)CGT>CAT		hypothetical protein LOC284274		C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	100.0	94.0	96.0		152	-1.2	0.0	18		96	0,8600		0,0,4300	no	missense	C18orf62	NM_001037331.2	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	51/102	73130849	1,13005	2203	4300	6503	SO:0001583	missense	284274					integral to membrane		g.chr18:73130849C>T		CCDS32845.1	18q23	2013-03-11	2013-03-11	2013-03-11	ENSG00000206026	ENSG00000206026			27598	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 62"""	C18orf62			Standard	NM_001037331		Approved		uc002lma.1	Q3B7S5	OTTHUMG00000179126	ENST00000579022.1:c.152G>A	18.37:g.73130849C>T	ENSP00000462106:p.Arg51His		Somatic				C18orf62_uc010dqw.1_Intron|C18orf62_uc002lmb.1_RNA	p.R51H	NM_001037331	NP_001032408	WXS	Illumina HiSeq	Unspecified	Q3B7S5	CR062_HUMAN		OV - Ovarian serous cystadenocarcinoma(15;6.21e-06)	2	223	-		Esophageal squamous(42;0.131)|Prostate(75;0.155)	51			Helical; (Potential).			Missense_Mutation	SNP	ENST00000579022.1	37	c.152G>A	CCDS32845.1	.	.	.	.	.	.	.	.	.	.	C	3.216	-0.160615	0.06502	2.27E-4	0.0	ENSG00000206026	ENST00000382638	.	.	.	1.74	-1.21	0.09524	.	.	.	.	.	T	0.16085	0.0387	N	0.08118	0	0.09310	N	1	B	0.22604	0.072	B	0.08055	0.003	T	0.18935	-1.0321	8	0.87932	D	0	.	5.0101	0.14308	0.0:0.4418:0.0:0.5582	.	51	Q3B7S5	CR062_HUMAN	H	51	.	ENSP00000372083:R51H	R	-	2	0	C18orf62	71259837	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.664000	0.05292	-0.097000	0.12307	0.591000	0.81541	CGT		0.383	SMIM21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000444917.1	NM_001037331		32	87	0	0	0	0	32	87				
GALR1	2587	broad.mit.edu	37	18	74962794	74962794	+	Missense_Mutation	SNP	C	C	A	rs140216881	byFrequency	TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr18:74962794C>A	ENST00000299727.3	+	1	290	c.290C>A	c.(289-291)gCg>gAg	p.A97E		NM_001480.3	NP_001471.2	P47211	GALR1_HUMAN	galanin receptor 1	97					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|digestion (GO:0007586)|negative regulation of adenylate cyclase activity (GO:0007194)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galanin receptor activity (GO:0004966)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.03e-06)|BRCA - Breast invasive adenocarcinoma(31;0.104)		ACCGTGTACGCGCTGCCCACC	0.617																																						uc002lms.3		NA																	0				lung(1)	1						c.(289-291)GCG>GAG		galanin receptor 1							129.0	114.0	119.0					18																	74962794		2203	4300	6503	SO:0001583	missense	2587				digestion|negative regulation of adenylate cyclase activity	integral to membrane|plasma membrane	galanin receptor activity	g.chr18:74962794C>A	U90658	CCDS12012.1	18q23	2012-08-08			ENSG00000166573	ENSG00000166573		"""GPCR / Class A : Galanin receptors"""	4132	protein-coding gene	gene with protein product		600377		GALNR1, GALNR		7524088	Standard	NM_001480		Approved		uc002lms.4	P47211	OTTHUMG00000132875	ENST00000299727.3:c.290C>A	18.37:g.74962794C>A	ENSP00000299727:p.Ala97Glu		Somatic					p.A97E	NM_001480	NP_001471	WXS	Illumina HiSeq	Unspecified	P47211	GALR1_HUMAN		OV - Ovarian serous cystadenocarcinoma(15;1.03e-06)|BRCA - Breast invasive adenocarcinoma(31;0.104)	1	787	+		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)	97			Extracellular (Potential).		Q4VBL7	Missense_Mutation	SNP	ENST00000299727.3	37	c.290C>A	CCDS12012.1	.	.	.	.	.	.	.	.	.	.	C	18.68	3.676882	0.67928	.	.	ENSG00000166573	ENST00000299727	T	0.72942	-0.7	4.46	3.59	0.41128	GPCR, rhodopsin-like superfamily (1);	0.219066	0.45867	D	0.000326	T	0.66268	0.2772	L	0.41356	1.27	0.38524	D	0.948798	P	0.39535	0.677	P	0.47786	0.557	T	0.67538	-0.5645	10	0.62326	D	0.03	.	6.0676	0.19871	0.0:0.6515:0.0:0.3485	.	97	P47211	GALR1_HUMAN	E	97	ENSP00000299727:A97E	ENSP00000299727:A97E	A	+	2	0	GALR1	73091782	1.000000	0.71417	0.994000	0.49952	0.998000	0.95712	1.564000	0.36375	0.879000	0.35944	0.585000	0.79938	GCG		0.617	GALR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256362.1			28	128	1	0	1.4e-14	1.99e-14	28	128				
NCLN	56926	broad.mit.edu	37	19	3207205	3207205	+	Silent	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:3207205G>A	ENST00000246117.4	+	13	1940	c.1509G>A	c.(1507-1509)gaG>gaA	p.E503E	NCLN_ENST00000590671.1_Silent_p.E429E	NM_020170.3	NP_064555.2	Q969V3	NCLN_HUMAN	nicalin	503					regulation of signal transduction (GO:0009966)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				kidney(1)|lung(3)|skin(1)	5		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.83e-113)|Epithelial(107;1.65e-111)|all cancers(105;1.53e-103)|BRCA - Breast invasive adenocarcinoma(158;0.00139)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGACCCAGAGTTTGTCTTCT	0.567																																						uc002lxi.2		NA																	0					0						c.(1507-1509)GAG>GAA		nicalin precursor							114.0	110.0	111.0					19																	3207205		2203	4300	6503	SO:0001819	synonymous_variant	56926				proteolysis|regulation of signal transduction	endoplasmic reticulum membrane|integral to membrane|nucleus	peptidase activity|protein binding	g.chr19:3207205G>A	BC025926	CCDS32869.1	19p13.3	2010-08-13	2010-08-13			ENSG00000125912			26923	protein-coding gene	gene with protein product	"""nicastrin-like protein"""	609156	"""nicalin homolog (zebrafish)"""			11230166	Standard	NM_020170		Approved	NICALIN, NET59	uc002lxi.3	Q969V3		ENST00000246117.4:c.1509G>A	19.37:g.3207205G>A			Somatic				NCLN_uc002lxh.1_RNA|NCLN_uc002lxj.1_RNA|NCLN_uc002lxk.2_Silent_p.E147E	p.E503E	NM_020170	NP_064555	WXS	Illumina HiSeq	Unspecified	Q969V3	NCLN_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.83e-113)|Epithelial(107;1.65e-111)|all cancers(105;1.53e-103)|BRCA - Breast invasive adenocarcinoma(158;0.00139)|STAD - Stomach adenocarcinoma(1328;0.18)	13	1663	+		Hepatocellular(1079;0.137)	503			Lumenal (Potential).		D6W613|O75252|Q6FI60|Q6ZMB7|Q8TAT7|Q96H48|Q96IS7|Q9BQH9|Q9BTX4|Q9NPP2	Silent	SNP	ENST00000246117.4	37	c.1509G>A	CCDS32869.1																																																																																				0.567	NCLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452545.1	NM_020170		38	114	0	0	0	0	38	114				
GPR108	56927	broad.mit.edu	37	19	6734313	6734313	+	Missense_Mutation	SNP	T	T	C	rs550205099		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:6734313T>C	ENST00000264080.7	-	5	406	c.380A>G	c.(379-381)cAg>cGg	p.Q127R	GPR108_ENST00000430424.4_5'UTR|GPR108_ENST00000598626.1_5'Flank	NM_001080452.1	NP_001073921.1	Q9NPR9	GP108_HUMAN	G protein-coupled receptor 108	127						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|large_intestine(4)|lung(4)|skin(1)|urinary_tract(1)	13						CTTCCGCACCTGGACCCTGGG	0.637											OREG0025092	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	T|||	1	0.000199681	0.0	0.0	5008	,	,		14444	0.0		0.0	False		,,,				2504	0.001					uc002mfp.2		NA																	0					0						c.(379-381)CAG>CGG		G protein-coupled receptor 108 isoform 1							25.0	29.0	28.0					19																	6734313		1911	4120	6031	SO:0001583	missense	56927					integral to membrane		g.chr19:6734313T>C		CCDS42479.1	19p13.3	2014-01-30				ENSG00000125734		"""GPCR / Unclassified : 7TM orphan receptors"""	17829	protein-coding gene	gene with protein product							Standard	NM_001080452		Approved	LUSTR2	uc002mfp.3	Q9NPR9	OTTHUMG00000170129	ENST00000264080.7:c.380A>G	19.37:g.6734313T>C	ENSP00000264080:p.Gln127Arg		Somatic	OREG0025092	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	636	GPR108_uc010duv.2_5'Flank|GPR108_uc002mfn.2_5'UTR|GPR108_uc002mfo.3_5'UTR|GPR108_uc010duw.2_RNA	p.Q127R	NM_001080452	NP_001073921	WXS	Illumina HiSeq	Unspecified	Q9NPR9	GP108_HUMAN			5	426	-			127					B9EJD7	Missense_Mutation	SNP	ENST00000264080.7	37	c.380A>G	CCDS42479.1	.	.	.	.	.	.	.	.	.	.	T	4.946	0.175698	0.09391	.	.	ENSG00000125734	ENST00000264080	T	0.22134	1.97	3.93	2.87	0.33458	.	1.514960	0.04830	U	0.438604	T	0.15609	0.0376	L	0.38531	1.155	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.34129	-0.9841	10	0.06625	T	0.88	.	6.2748	0.20975	0.2217:0.0:0.0:0.7783	.	127	Q9NPR9	GP108_HUMAN	R	127	ENSP00000264080:Q127R	ENSP00000264080:Q127R	Q	-	2	0	GPR108	6685313	1.000000	0.71417	0.999000	0.59377	0.122000	0.20287	1.350000	0.34010	0.527000	0.28560	0.459000	0.35465	CAG		0.637	GPR108-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407508.2			13	38	0	0	0	0	13	38				
INSR	3643	broad.mit.edu	37	19	7120658	7120658	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:7120658C>A	ENST00000302850.5	-	20	3774	c.3632G>T	c.(3631-3633)gGg>gTg	p.G1211V	INSR_ENST00000341500.5_Missense_Mutation_p.G1199V	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor	1211	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	GGTGAAGACCCCATCCTTCAG	0.552																																						uc002mgd.1		NA																	0				ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12						c.(3631-3633)GGG>GTG		insulin receptor isoform Long precursor	Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)						132.0	108.0	116.0					19																	7120658		2203	4300	6503	SO:0001583	missense	3643				activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding	g.chr19:7120658C>A	M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.3632G>T	19.37:g.7120658C>A	ENSP00000303830:p.Gly1211Val		Somatic				INSR_uc002mge.1_Missense_Mutation_p.G1199V	p.G1211V	NM_000208	NP_000199	WXS	Illumina HiSeq	Unspecified	P06213	INSR_HUMAN			20	3741	-			1211			Protein kinase.|Cytoplasmic (Potential).		Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Missense_Mutation	SNP	ENST00000302850.5	37	c.3632G>T	CCDS12176.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.131219	0.77549	.	.	ENSG00000171105	ENST00000302850;ENST00000341500	D;D	0.82984	-1.67;-1.67	4.41	4.41	0.53225	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.43260	U	0.000592	D	0.91981	0.7460	M	0.88377	2.95	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.99;0.999	D	0.93575	0.6907	10	0.87932	D	0	.	14.8438	0.70246	0.0:1.0:0.0:0.0	.	1199;1211	P06213-2;P06213	.;INSR_HUMAN	V	1211;1199	ENSP00000303830:G1211V;ENSP00000342838:G1199V	ENSP00000303830:G1211V	G	-	2	0	INSR	7071658	1.000000	0.71417	0.974000	0.42286	0.726000	0.41606	7.446000	0.80609	2.166000	0.68216	0.455000	0.32223	GGG		0.552	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458544.1			14	51	1	0	0.00244969	0.00265821	14	51				
ARHGEF18	23370	broad.mit.edu	37	19	7529551	7529551	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:7529551G>A	ENST00000359920.6	+	13	2568	c.2315G>A	c.(2314-2316)gGg>gAg	p.G772E	CTD-2207O23.3_ENST00000593531.1_Missense_Mutation_p.G730R|ARHGEF18_ENST00000319670.9_Missense_Mutation_p.G614E	NM_001130955.1	NP_001124427.1	Q6ZSZ5	ARHGI_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 18	772					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transforming growth factor beta receptor signaling pathway (GO:0007179)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(2)|stomach(1)|urinary_tract(1)	23		Renal(5;0.0902)				GACATTCCTGGGAGCTCTGAG	0.557																																						uc002mgi.2		NA																	0				ovary(1)	1						c.(2314-2316)GGG>GAG		Rho/Rac guanine nucleotide exchange factor 18							88.0	76.0	80.0					19																	7529551		2203	4300	6503	SO:0001583	missense	23370				actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of cell shape|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity	g.chr19:7529551G>A	AK074372	CCDS12177.1, CCDS45946.1	19p13.3	2013-01-10	2009-06-12			ENSG00000104880		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	17090	protein-coding gene	gene with protein product	"""Rho-specific guanine nucleotide exchange factor p114"""		"""rho/rac guanine nucleotide exchange factor (GEF) 18"""			9628581, 11318610	Standard	NM_015318		Approved	P114-RhoGEF, KIAA0521, MGC15913	uc002mgi.3	Q6ZSZ5		ENST00000359920.6:c.2315G>A	19.37:g.7529551G>A	ENSP00000352995:p.Gly772Glu		Somatic				ARHGEF18_uc010xjm.1_Missense_Mutation_p.G614E|ARHGEF18_uc002mgh.2_Missense_Mutation_p.G614E|ARHGEF18_uc002mgj.1_Missense_Mutation_p.G415E	p.G772E	NM_001130955	NP_001124427	WXS	Illumina HiSeq	Unspecified	Q6ZSZ5	ARHGI_HUMAN			13	2568	+		Renal(5;0.0902)	772					A8MV62|B5ME81|O60274|Q6DD92	Missense_Mutation	SNP	ENST00000359920.6	37	c.2315G>A	CCDS45946.1	.	.	.	.	.	.	.	.	.	.	G	6.626	0.484022	0.12581	.	.	ENSG00000104880	ENST00000319670;ENST00000359920	T;T	0.23950	1.88;1.88	4.97	2.82	0.32997	.	0.230379	0.30168	N	0.010243	T	0.21841	0.0526	L	0.56769	1.78	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.001	T	0.17561	-1.0365	10	0.33141	T	0.24	-41.1444	6.4226	0.21752	0.0944:0.0:0.7251:0.1804	.	614;772	Q6ZSZ5-2;Q6ZSZ5	.;ARHGI_HUMAN	E	614;772	ENSP00000319200:G614E;ENSP00000352995:G772E	ENSP00000319200:G614E	G	+	2	0	ARHGEF18	7435551	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	0.288000	0.18939	0.605000	0.29947	-0.268000	0.10319	GGG		0.557	ARHGEF18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000436340.1	NM_015318		16	32	0	0	0	0	16	32				
MUC16	94025	broad.mit.edu	37	19	9085606	9085606	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:9085606G>A	ENST00000397910.4	-	1	6412	c.6209C>T	c.(6208-6210)tCt>tTt	p.S2070F		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2070	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CAGTGCCTCAGATAAACTAGT	0.473																																						uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(6208-6210)TCT>TTT		mucin 16							159.0	152.0	154.0					19																	9085606		1934	4132	6066	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9085606G>A	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.6209C>T	19.37:g.9085606G>A	ENSP00000381008:p.Ser2070Phe		Somatic					p.S2070F	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			1	6413	-			2070			Ser-rich.|Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.6209C>T	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	0.565	-0.843719	0.02671	.	.	ENSG00000181143	ENST00000397910	T	0.02737	4.18	0.235	0.235	0.15431	.	.	.	.	.	T	0.04048	0.0113	N	0.08118	0	.	.	.	D	0.58970	0.984	D	0.63877	0.919	T	0.45293	-0.9271	7	0.87932	D	0	.	.	.	.	.	2070	B5ME49	.	F	2070	ENSP00000381008:S2070F	ENSP00000381008:S2070F	S	-	2	0	MUC16	8946606	0.004000	0.15560	0.032000	0.17829	0.032000	0.12392	0.840000	0.27600	0.308000	0.22923	0.313000	0.20887	TCT		0.473	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		67	167	0	0	0	0	67	167				
MUC16	94025	broad.mit.edu	37	19	9088915	9088915	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:9088915C>T	ENST00000397910.4	-	1	3103	c.2900G>A	c.(2899-2901)tGg>tAg	p.W967*		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	967	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGTCTCTGGCCAAGTTGTGCT	0.468																																						uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(2899-2901)TGG>TAG		mucin 16							236.0	230.0	232.0					19																	9088915		2011	4178	6189	SO:0001587	stop_gained	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9088915C>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.2900G>A	19.37:g.9088915C>T	ENSP00000381008:p.Trp967*		Somatic					p.W967*	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			1	3104	-			967			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Nonsense_Mutation	SNP	ENST00000397910.4	37	c.2900G>A	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	41	8.546638	0.98857	.	.	ENSG00000181143	ENST00000397910	.	.	.	1.27	-1.93	0.07594	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	3.0586	0.06193	0.3034:0.3957:0.3009:0.0	.	.	.	.	X	967	.	ENSP00000381008:W967X	W	-	2	0	MUC16	8949915	0.000000	0.05858	0.000000	0.03702	0.474000	0.32979	-0.582000	0.05814	-0.442000	0.07190	0.205000	0.17691	TGG		0.468	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		61	235	0	0	0	0	61	235				
RDH8	50700	broad.mit.edu	37	19	10129427	10129427	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:10129427C>A	ENST00000171214.1	+	3	532	c.283C>A	c.(283-285)Ctg>Atg	p.L95M	RDH8_ENST00000591589.1_Missense_Mutation_p.L115M	NM_015725.2	NP_056540.2	Q9NYR8	RDH8_HUMAN	retinol dehydrogenase 8 (all-trans)	95					estrogen biosynthetic process (GO:0006703)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|steroid biosynthetic process (GO:0006694)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|NADP-retinol dehydrogenase activity (GO:0052650)|retinol dehydrogenase activity (GO:0004745)			endometrium(3)|large_intestine(3)|lung(10)|ovary(3)|pancreas(1)|prostate(1)	21			Epithelial(33;4.24e-05)		Vitamin A(DB00162)	TGGAATGGGCCTGGTGGGGCC	0.517																																						uc002mmr.2		NA																	0				ovary(3)|pancreas(1)	4						c.(283-285)CTG>ATG		retinol dehydrogenase 8 (all-trans)	Vitamin A(DB00162)						96.0	101.0	99.0					19																	10129427		2203	4300	6503	SO:0001583	missense	50700				estrogen biosynthetic process|response to stimulus|visual perception	cytoplasm|integral to plasma membrane	binding|estradiol 17-beta-dehydrogenase activity|NADP-retinol dehydrogenase activity|retinol dehydrogenase activity	g.chr19:10129427C>A	AF229845	CCDS12223.1, CCDS12223.2	19p13.2	2011-09-14				ENSG00000080511	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	14423	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 28C, member 2"""	608575				10753906, 19027726	Standard	NM_015725		Approved	PRRDH, SDR28C2	uc002mmr.4	Q9NYR8		ENST00000171214.1:c.283C>A	19.37:g.10129427C>A	ENSP00000171214:p.Leu95Met		Somatic					p.L95M	NM_015725	NP_056540	WXS	Illumina HiSeq	Unspecified	Q9NYR8	RDH8_HUMAN	Epithelial(33;4.24e-05)		3	532	+			95			Helical; (Potential).		Q9H838	Missense_Mutation	SNP	ENST00000171214.1	37	c.283C>A		.	.	.	.	.	.	.	.	.	.	C	16.64	3.178843	0.57692	.	.	ENSG00000080511	ENST00000171214	D	0.87412	-2.25	5.34	3.18	0.36537	NAD(P)-binding domain (1);	0.156351	0.43919	N	0.000517	D	0.86851	0.6032	L	0.41632	1.29	0.39103	D	0.961318	P	0.47962	0.903	P	0.57502	0.822	D	0.84676	0.0714	10	0.42905	T	0.14	.	8.3224	0.32136	0.1553:0.762:0.0:0.0827	.	95	Q9NYR8	RDH8_HUMAN	M	95	ENSP00000171214:L95M	ENSP00000171214:L95M	L	+	1	2	RDH8	9990427	0.001000	0.12720	0.999000	0.59377	0.763000	0.43281	-0.035000	0.12205	0.614000	0.30107	-0.500000	0.04577	CTG		0.517	RDH8-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				42	245	1	0	6.43e-24	9.8e-24	42	245				
TYK2	7297	broad.mit.edu	37	19	10464800	10464800	+	Silent	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:10464800C>A	ENST00000525621.1	-	20	3307	c.2826G>T	c.(2824-2826)tcG>tcT	p.S942S	TYK2_ENST00000529422.1_5'Flank|TYK2_ENST00000524462.1_Silent_p.S757S|TYK2_ENST00000264818.6_Silent_p.S942S	NM_003331.4	NP_003322.3	P29597	TYK2_HUMAN	tyrosine kinase 2	942	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine-mediated signaling pathway (GO:0019221)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(11)|kidney(6)|large_intestine(3)|lung(19)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			GCTTCCAGCCCGAGCGGTGCT	0.627																																						uc002moc.3		NA																	0				lung(5)|large_intestine(2)|ovary(1)|breast(1)	9						c.(2824-2826)TCG>TCT		tyrosine kinase 2							119.0	105.0	110.0					19																	10464800		2203	4300	6503	SO:0001819	synonymous_variant	7297				intracellular protein kinase cascade|regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity	g.chr19:10464800C>A		CCDS12236.1	19p13.2	2014-09-17			ENSG00000105397	ENSG00000105397	2.7.10.1		12440	protein-coding gene	gene with protein product		176941				2156206	Standard	NM_003331		Approved	JTK1	uc002moc.4	P29597	OTTHUMG00000166373	ENST00000525621.1:c.2826G>T	19.37:g.10464800C>A			Somatic				TYK2_uc010dxe.2_Silent_p.S757S	p.S942S	NM_003331	NP_003322	WXS	Illumina HiSeq	Unspecified	P29597	TYK2_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)		20	3204	-			942			Protein kinase 2.		Q6QB10|Q96CH0	Silent	SNP	ENST00000525621.1	37	c.2826G>T	CCDS12236.1																																																																																				0.627	TYK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389443.1			34	128	1	0	1.22e-17	1.79e-17	34	128				
ZNF440	126070	broad.mit.edu	37	19	11942379	11942380	+	Missense_Mutation	DNP	GG	GG	TC			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:11942379_11942380GG>TC	ENST00000304060.5	+	4	552_553	c.388_389GG>TC	c.(388-390)GGa>TCa	p.G130S		NM_152357.2	NP_689570.2	Q8IYI8	ZN440_HUMAN	zinc finger protein 440	130					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(9)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						AGGTGACATTGGACACAAGGCA	0.406																																						uc002msp.1		NA																	0					0						c.(388-390)GGA>TCA		zinc finger protein 440																																				SO:0001583	missense	126070				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:11942379_11942380GG>TC	AK095252	CCDS42503.1	19p13.13	2013-01-08	2006-08-14	2006-08-14	ENSG00000171295	ENSG00000171295		"""Zinc fingers, C2H2-type"", ""-"""	20874	protein-coding gene	gene with protein product							Standard	NM_152357		Approved	FLJ37933	uc002msp.1	Q8IYI8	OTTHUMG00000156403	Exception_encountered	19.37:g.11942379_11942380delinsTC	ENSP00000305373:p.Gly130Ser		Somatic					p.G130S	NM_152357	NP_689570	WXS	Illumina HiSeq	Unspecified	Q8IYI8	ZN440_HUMAN			4	544_545	+			130					Q8N1R9	Missense_Mutation	DNP	ENST00000304060.5	37	c.388_389GG>TC	CCDS42503.1																																																																																				0.406	ZNF440-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344508.1	NM_152357		21	221	0	0	0	0	21	221				
ZNF443	10224	broad.mit.edu	37	19	12542085	12542085	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:12542085T>A	ENST00000301547.5	-	4	1098	c.901A>T	c.(901-903)Aga>Tga	p.R301*	CTD-3105H18.16_ENST00000595562.1_Intron	NM_005815.4	NP_005806	Q9Y2A4	ZN443_HUMAN	zinc finger protein 443	301					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(1)|kidney(1)|large_intestine(11)|lung(10)|pancreas(1)|prostate(1)	28						GTGTGAGTTCTTTCATGTATT	0.408																																						uc002mtu.2		NA																	0				pancreas(1)	1						c.(901-903)AGA>TGA		zinc finger protein 443							115.0	116.0	116.0					19																	12542085		2203	4298	6501	SO:0001587	stop_gained	10224				induction of apoptosis|regulation of transcription, DNA-dependent|response to stress|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:12542085T>A	AB011414	CCDS32918.1	19p13.13	2013-01-08			ENSG00000180855	ENSG00000180855		"""Zinc fingers, C2H2-type"", ""-"""	20878	protein-coding gene	gene with protein product		606697				9731181	Standard	NM_005815		Approved	ZK1	uc002mtu.3	Q9Y2A4	OTTHUMG00000156404	ENST00000301547.5:c.901A>T	19.37:g.12542085T>A	ENSP00000301547:p.Arg301*		Somatic					p.R301*	NM_005815	NP_005806	WXS	Illumina HiSeq	Unspecified	Q9Y2A4	ZN443_HUMAN			4	1099	-			301			C2H2-type 6.			Nonsense_Mutation	SNP	ENST00000301547.5	37	c.901A>T	CCDS32918.1	.	.	.	.	.	.	.	.	.	.	T	37	6.030042	0.97216	.	.	ENSG00000180855	ENST00000301547;ENST00000411622	.	.	.	1.26	1.26	0.21427	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.9923	0.30248	0.0:0.0:0.0:1.0	.	.	.	.	X	301	.	ENSP00000301547:R301X	R	-	1	2	ZNF443	12403085	0.000000	0.05858	0.034000	0.17996	0.834000	0.47266	-0.944000	0.03913	0.841000	0.35020	0.378000	0.23410	AGA		0.408	ZNF443-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344084.1	NM_005815		68	220	0	0	0	0	68	220				
CYP4F8	11283	broad.mit.edu	37	19	15739139	15739139	+	RNA	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:15739139G>T	ENST00000441682.2	+	0	1204							P98187	CP4F8_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 8						icosanoid metabolic process (GO:0006690)|prostaglandin metabolic process (GO:0006693)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alkane 1-monooxygenase activity (GO:0018685)|aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|skin(1)	26						TGCCCTTCCTGACCATGTGCC	0.617																																						uc002nbi.2		NA																	0				large_intestine(1)	1						c.(1141-1143)CTG>CTT		cytochrome P450, family 4, subfamily F,							89.0	97.0	94.0					19																	15739139		2203	4300	6503			11283				prostaglandin metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	alkane 1-monooxygenase activity|aromatase activity|electron carrier activity|heme binding|oxygen binding|protein binding	g.chr19:15739139G>T	AF133298	CCDS74303.1	19p13.12	2013-11-11	2003-01-14		ENSG00000186526	ENSG00000186526		"""Cytochrome P450s"""	2648	protein-coding gene	gene with protein product		611545	"""cytochrome P450, subfamily IVF, polypeptide 8"""			10405341	Standard	NM_007253		Approved		uc002nbi.3	P98187	OTTHUMG00000182386		19.37:g.15739139G>T			Somatic				CYP4F8_uc010xoj.1_Silent_p.L193L	p.L381L	NM_007253	NP_009184	WXS	Illumina HiSeq	Unspecified	P98187	CP4F8_HUMAN			12	1207	+			381						Silent	SNP	ENST00000441682.2	37	c.1143G>T																																																																																					0.617	CYP4F8-201	KNOWN	basic	processed_transcript	processed_transcript		NM_007253		33	120	1	0	6.06e-23	9.2e-23	33	120				
CPAMD8	27151	broad.mit.edu	37	19	17015051	17015051	+	Silent	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:17015051G>T	ENST00000443236.1	-	32	4408	c.4377C>A	c.(4375-4377)ggC>ggA	p.G1459G		NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	1412						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						TGGAGGAGAAGCCCCCAAGTG	0.652																																						uc002nfb.2		NA																	0				ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13						c.(4375-4377)GGC>GGA		C3 and PZP-like, alpha-2-macroglobulin domain							28.0	30.0	30.0					19																	17015051		1963	4125	6088	SO:0001819	synonymous_variant	27151					extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity	g.chr19:17015051G>T	AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.4377C>A	19.37:g.17015051G>T			Somatic				CPAMD8_uc002nfd.1_5'Flank	p.G1459G	NM_015692	NP_056507	WXS	Illumina HiSeq	Unspecified	Q8IZJ3	CPMD8_HUMAN			32	4409	-			1412					Q8NC09|Q9ULD7	Silent	SNP	ENST00000443236.1	37	c.4377C>A	CCDS42519.1	.	.	.	.	.	.	.	.	.	.	G	4.408	0.075318	0.08485	.	.	ENSG00000160111	ENST00000443236	.	.	.	2.72	-5.23	0.02798	.	.	.	.	.	T	0.35480	0.0933	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42616	-0.9441	4	.	.	.	.	0.841	0.01150	0.2034:0.1492:0.3235:0.324	.	.	.	.	D	1470	.	.	A	-	2	0	CPAMD8	16876051	0.990000	0.36364	0.303000	0.25071	0.156000	0.22039	-0.017000	0.12590	-0.471000	0.06891	-2.482000	0.00198	GCT		0.652	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257531.2	NM_015692		6	18	1	0	5.94e-07	7.37e-07	6	18				
ANKLE1	126549	broad.mit.edu	37	19	17394535	17394535	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:17394535G>A	ENST00000394458.3	+	5	1238	c.962G>A	c.(961-963)tGg>tAg	p.W321*	ANKLE1_ENST00000598347.1_Nonsense_Mutation_p.W321*|ANKLE1_ENST00000594072.1_Nonsense_Mutation_p.W310*|ANKLE1_ENST00000433424.2_Nonsense_Mutation_p.W375*|ANKLE1_ENST00000404085.1_Nonsense_Mutation_p.W343*	NM_152363.4	NP_689576	Q8NAG6	ANKL1_HUMAN	ankyrin repeat and LEM domain containing 1	321										large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	7						CACTGCCTGTGGGAGCACCAG	0.612																																						uc002nga.2		NA																	0					0						c.(961-963)TGG>TAG		ankyrin repeat domain 41							92.0	85.0	87.0					19																	17394535		2203	4300	6503	SO:0001587	stop_gained	126549					nuclear envelope		g.chr19:17394535G>A	AK096688	CCDS12354.2, CCDS12354.3	19p13.11	2013-01-10	2008-03-25	2008-03-25	ENSG00000160117	ENSG00000160117		"""Ankyrin repeat domain containing"""	26812	protein-coding gene	gene with protein product	"""LEM domain containing 6"""		"""ankyrin repeat domain 41"""	ANKRD41			Standard	NM_152363		Approved	FLJ39369, LEMD6	uc002nga.2	Q8NAG6	OTTHUMG00000150839	ENST00000394458.3:c.962G>A	19.37:g.17394535G>A	ENSP00000377971:p.Trp321*		Somatic				ANKLE1_uc010xpm.1_RNA|ANKLE1_uc010eao.1_Nonsense_Mutation_p.W343*|ANKLE1_uc010xpn.1_Nonsense_Mutation_p.W375*|ANKLE1_uc002nfy.2_Nonsense_Mutation_p.W310*|ANKLE1_uc002nfz.2_Nonsense_Mutation_p.W27*	p.W321*	NM_152363	NP_689576	WXS	Illumina HiSeq	Unspecified	Q8NAG6	ANKL1_HUMAN			5	1238	+			321					A8VU82|Q8N8J8	Nonsense_Mutation	SNP	ENST00000394458.3	37	c.962G>A	CCDS12354.2	.	.	.	.	.	.	.	.	.	.	G	13.83	2.354898	0.41700	.	.	ENSG00000160117	ENST00000404261;ENST00000433424;ENST00000404085;ENST00000394458;ENST00000438921	.	.	.	3.51	-7.02	0.01589	.	6.674290	0.01361	U	0.012254	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	7.8889	0.29667	0.5018:0.1547:0.3436:0.0	.	.	.	.	X	321;375;343;310;321	.	ENSP00000377971:W310X	W	+	2	0	ANKLE1	17255535	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-3.017000	0.00644	-1.383000	0.02106	0.313000	0.20887	TGG		0.612	ANKLE1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325392.2	NM_152363		30	123	0	0	0	0	30	123				
UNC13A	23025	broad.mit.edu	37	19	17756536	17756536	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:17756536G>A	ENST00000519716.2	-	19	2302	c.2303C>T	c.(2302-2304)aCg>aTg	p.T768M	UNC13A_ENST00000550896.1_Missense_Mutation_p.T766M|UNC13A_ENST00000252773.7_Missense_Mutation_p.T768M|UNC13A_ENST00000551649.1_Missense_Mutation_p.T768M|UNC13A_ENST00000428389.2_Missense_Mutation_p.T856M|UNC13A_ENST00000552293.1_Missense_Mutation_p.T768M	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	768	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						CTCAATGATCGTCTGCCCCAG	0.592																																						uc002nhd.2		NA																	0				ovary(3)	3						c.(2566-2568)ACG>ATG		unc-13 homolog A							90.0	93.0	92.0					19																	17756536		2157	4274	6431	SO:0001583	missense	23025				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding	g.chr19:17756536G>A	AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.2303C>T	19.37:g.17756536G>A	ENSP00000429562:p.Thr768Met		Somatic					p.T856M	NM_001080421	NP_001073890	WXS	Illumina HiSeq	Unspecified	Q9UPW8	UN13A_HUMAN			19	2567	-			768			C2 2.		E5RHY9	Missense_Mutation	SNP	ENST00000519716.2	37	c.2567C>T	CCDS46013.2	.	.	.	.	.	.	.	.	.	.	G	20.9	4.069067	0.76301	.	.	ENSG00000130477	ENST00000519716;ENST00000428389;ENST00000252773;ENST00000551649;ENST00000552293;ENST00000550896	T;T;T;T;T;T	0.69926	-0.44;-0.44;-0.44;-0.44;-0.44;-0.44	4.04	4.04	0.47022	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	U	0.000000	T	0.70561	0.3238	N	0.25245	0.725	0.58432	D	0.999997	D	0.89917	1.0	D	0.87578	0.998	T	0.75431	-0.3320	10	0.87932	D	0	-18.2632	14.0431	0.64689	0.0:0.0:1.0:0.0	.	768	Q9UPW8	UN13A_HUMAN	M	768;856;768;768;768;766	ENSP00000429562:T768M;ENSP00000400409:T856M;ENSP00000252773:T768M;ENSP00000447236:T768M;ENSP00000447572:T768M;ENSP00000446831:T766M	ENSP00000252773:T768M	T	-	2	0	UNC13A	17617536	1.000000	0.71417	0.885000	0.34714	0.815000	0.46073	9.501000	0.97979	1.957000	0.56846	0.491000	0.48974	ACG		0.592	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376169.2	XM_038604		4	36	0	0	0	0	4	36				
JAK3	3718	broad.mit.edu	37	19	17949121	17949121	+	Missense_Mutation	SNP	T	T	A	rs140690573		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:17949121T>A	ENST00000527670.1	-	10	1549	c.1520A>T	c.(1519-1521)cAg>cTg	p.Q507L	JAK3_ENST00000534444.1_Missense_Mutation_p.Q507L|JAK3_ENST00000526008.1_5'UTR|JAK3_ENST00000458235.1_Missense_Mutation_p.Q507L			P52333	JAK3_HUMAN	Janus kinase 3	507					B cell differentiation (GO:0030183)|enzyme linked receptor protein signaling pathway (GO:0007167)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of dendritic cell cytokine production (GO:0002731)|negative regulation of FasL biosynthetic process (GO:0045221)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of thymocyte apoptotic process (GO:0070244)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of T cell apoptotic process (GO:0070232)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to interleukin-9 (GO:0071104)|STAT protein import into nucleus (GO:0007262)|T cell homeostasis (GO:0043029)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)	p.Q507R(2)		breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(85)|kidney(4)|large_intestine(11)|lung(22)|ovary(3)|prostate(5)|skin(1)|stomach(2)|upper_aerodigestive_tract(5)	147					Tofacitinib(DB08895)	CTGACTCAGCTGGTATTGGGA	0.547		2	Mis		"""acute megakaryocytic leukemia, ETP ALL"""																																	uc002nhn.3		2		Dom	yes		19	19p13.1	3718	Mis	Janus kinase 3			L			acute megakaryocytic leukemia|		2	Substitution - Missense(2)		lung(2)	haematopoietic_and_lymphoid_tissue(40)|lung(5)|breast(5)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	56						c.(1519-1521)CAG>CTG		Janus kinase 3							235.0	218.0	223.0					19																	17949121		2203	4300	6503	SO:0001583	missense	3718				B cell differentiation|cytokine-mediated signaling pathway|enzyme linked receptor protein signaling pathway|intracellular protein kinase cascade|negative regulation of dendritic cell cytokine production|negative regulation of FasL biosynthetic process|negative regulation of interleukin-10 production|negative regulation of interleukin-12 production|negative regulation of T-helper 1 cell differentiation|negative regulation of thymocyte apoptosis|peptidyl-tyrosine phosphorylation|positive regulation of anti-apoptosis|response to interleukin-15|response to interleukin-2|response to interleukin-4|response to interleukin-9|T cell homeostasis	cytoskeleton|cytosol|endomembrane system|membrane	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding	g.chr19:17949121T>A	U31601	CCDS12366.1	19p13-p12	2014-09-17	2009-04-23		ENSG00000105639	ENSG00000105639	2.7.10.1		6193	protein-coding gene	gene with protein product	"""tyrosine-protein kinase JAK3"", ""leukocyte Janus kinase"""	600173				8921370, 9226382	Standard	NM_000215		Approved	L-JAK, JAKL, LJAK, JAK3_HUMAN, JAK-3	uc002nhn.4	P52333	OTTHUMG00000165648	ENST00000527670.1:c.1520A>T	19.37:g.17949121T>A	ENSP00000432511:p.Gln507Leu		Somatic				JAK3_uc010ebh.2_RNA|JAK3_uc002nho.2_Missense_Mutation_p.Q507L|JAK3_uc010xpx.1_3'UTR	p.Q507L	NM_000215	NP_000206	WXS	Illumina HiSeq	Unspecified	P52333	JAK3_HUMAN			11	1620	-			507					Q13259|Q13260|Q13611|Q8N1E8|Q99699|Q9Y6S2	Missense_Mutation	SNP	ENST00000527670.1	37	c.1520A>T	CCDS12366.1	.	.	.	.	.	.	.	.	.	.	T	13.66	2.302595	0.40795	.	.	ENSG00000105639	ENST00000458235;ENST00000428406;ENST00000527670;ENST00000534444	T;T;T	0.75821	-0.97;-0.97;-0.97	4.65	3.6	0.41247	Protein kinase-like domain (1);	0.282057	0.33753	N	0.004590	T	0.64940	0.2644	L	0.40543	1.245	0.31528	N	0.661514	B;B	0.25667	0.13;0.131	B;B	0.29077	0.098;0.035	T	0.64888	-0.6301	10	0.46703	T	0.11	-8.7049	9.332	0.38027	0.0:0.0:0.1898:0.8102	.	507;507	P52333-2;P52333	.;JAK3_HUMAN	L	507	ENSP00000391676:Q507L;ENSP00000432511:Q507L;ENSP00000436421:Q507L	ENSP00000413248:Q507L	Q	-	2	0	JAK3	17810121	0.828000	0.29307	0.858000	0.33744	0.662000	0.39071	1.663000	0.37429	0.623000	0.30267	0.260000	0.18958	CAG		0.547	JAK3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385549.1	NM_000215		94	205	0	0	0	0	94	205				
SLC5A5	6528	broad.mit.edu	37	19	17994720	17994720	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:17994720C>T	ENST00000222248.3	+	12	1738	c.1391C>T	c.(1390-1392)aCg>aTg	p.T464M		NM_000453.2	NP_000444.1	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium/iodide cotransporter), member 5	464					cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|iodide transport (GO:0015705)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	iodide transmembrane transporter activity (GO:0015111)|sodium:iodide symporter activity (GO:0008507)			NS(2)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						TTGGGCGCCACGCTGTACCCA	0.721																																					Melanoma(65;1008 1708 7910 46650)	uc002nhr.3		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(1390-1392)ACG>ATG		solute carrier family 5 (sodium iodide							9.0	8.0	8.0					19																	17994720		2158	4229	6387	SO:0001583	missense	6528				cellular nitrogen compound metabolic process|cellular response to cAMP|cellular response to gonadotropin stimulus|hormone biosynthetic process	integral to membrane|nucleus|plasma membrane	iodide transmembrane transporter activity|sodium:iodide symporter activity	g.chr19:17994720C>T		CCDS12368.1	19p13.11	2013-07-19	2013-07-19		ENSG00000105641	ENSG00000105641		"""Solute carriers"""	11040	protein-coding gene	gene with protein product		601843	"""solute carrier family 5 (sodium iodide symporter), member 5"""			9231811	Standard	NM_000453		Approved	NIS	uc002nhr.4	Q92911		ENST00000222248.3:c.1391C>T	19.37:g.17994720C>T	ENSP00000222248:p.Thr464Met		Somatic					p.T464M	NM_000453	NP_000444	WXS	Illumina HiSeq	Unspecified	Q92911	SC5A5_HUMAN			12	1738	+			464			Helical; (Potential).		O43702|Q2M335|Q9NYB6	Missense_Mutation	SNP	ENST00000222248.3	37	c.1391C>T	CCDS12368.1	.	.	.	.	.	.	.	.	.	.	C	15.02	2.709031	0.48517	.	.	ENSG00000105641	ENST00000222248	D	0.85629	-2.01	4.43	3.39	0.38822	.	0.170192	0.49916	D	0.000125	T	0.80105	0.4562	L	0.43152	1.355	0.43485	D	0.995711	P	0.46859	0.885	P	0.47044	0.535	T	0.75105	-0.3435	10	0.32370	T	0.25	.	5.7314	0.18042	0.1923:0.7053:0.0:0.1024	.	464	Q92911	SC5A5_HUMAN	M	464	ENSP00000222248:T464M	ENSP00000222248:T464M	T	+	2	0	SLC5A5	17855720	0.956000	0.32656	0.740000	0.30986	0.428000	0.31595	2.171000	0.42453	0.992000	0.38840	0.555000	0.69702	ACG		0.721	SLC5A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466690.1			5	2	0	0	0	0	5	2				
IL12RB1	3594	broad.mit.edu	37	19	18182953	18182953	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:18182953C>A	ENST00000600835.2	-	10	1288	c.990G>T	c.(988-990)caG>caT	p.Q330H	IL12RB1_ENST00000593993.2_Missense_Mutation_p.Q330H|IL12RB1_ENST00000322153.7_Missense_Mutation_p.Q330H			P42701	I12R1_HUMAN	interleukin 12 receptor, beta 1	330	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cellular response to interferon-gamma (GO:0071346)|cytokine-mediated signaling pathway (GO:0019221)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-23-mediated signaling pathway (GO:0038155)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|interleukin-12 receptor complex (GO:0042022)|interleukin-23 receptor complex (GO:0072536)	cytokine receptor activity (GO:0004896)			endometrium(1)|kidney(1)|lung(3)|pancreas(1)|skin(2)	8						TGTGCCACGTCTGGTTCAGGC	0.622																																						uc002nhw.1		NA																	0				pancreas(1)	1						c.(988-990)CAG>CAT		interleukin 12 receptor, beta 1 isoform 1							84.0	61.0	69.0					19																	18182953		2203	4300	6503	SO:0001583	missense	3594				cellular response to interferon-gamma|interleukin-12-mediated signaling pathway|positive regulation of activated T cell proliferation|positive regulation of defense response to virus by host|positive regulation of interferon-gamma production|positive regulation of memory T cell differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response	interleukin-12 receptor complex|interleukin-23 receptor complex	cytokine receptor activity	g.chr19:18182953C>A	U03187	CCDS32957.1, CCDS54232.1	19p13.1	2014-09-17						"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	5971	protein-coding gene	gene with protein product		601604		IL12RB		9284929	Standard	XM_005259893		Approved	CD212	uc002nhw.1	P42701		ENST00000600835.2:c.990G>T	19.37:g.18182953C>A	ENSP00000470788:p.Gln330His		Somatic				IL12RB1_uc010xqb.1_Missense_Mutation_p.Q330H|IL12RB1_uc002nhx.1_Missense_Mutation_p.Q370H|IL12RB1_uc002nhy.2_Missense_Mutation_p.Q330H	p.Q330H	NM_005535	NP_005526	WXS	Illumina HiSeq	Unspecified	P42701	I12R1_HUMAN			9	1054	-			330			Extracellular (Potential).|Fibronectin type-III 3.		A8K308|B2RPF1|B7ZKK3|Q8N6Q7	Missense_Mutation	SNP	ENST00000600835.2	37	c.990G>T	CCDS54232.1	.	.	.	.	.	.	.	.	.	.	C	15.45	2.837856	0.50951	.	.	ENSG00000096996	ENST00000430026;ENST00000322153	T;T	0.58652	0.32;2.33	4.51	2.24	0.28232	Long hematopoietin receptor, Gp130 family 2, conserved site (1);	0.558550	0.15347	N	0.267155	T	0.66317	0.2777	L	0.46157	1.445	0.09310	N	1	D;P;D	0.76494	0.999;0.582;0.998	D;B;D	0.69479	0.964;0.329;0.921	T	0.56631	-0.7947	10	0.56958	D	0.05	-10.8574	10.9986	0.47591	0.0:0.6332:0.3668:0.0	.	330;330;330	P42701-2;P42701-3;P42701	.;.;I12R1_HUMAN	H	330	ENSP00000403103:Q330H;ENSP00000314425:Q330H	ENSP00000314425:Q330H	Q	-	3	2	IL12RB1	18043953	0.336000	0.24757	0.014000	0.15608	0.212000	0.24457	1.151000	0.31651	0.409000	0.25649	0.491000	0.48974	CAG		0.622	IL12RB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466525.3			6	32	1	0	0.00116845	0.00128078	6	32				
ZNF208	7757	broad.mit.edu	37	19	22155424	22155424	+	Silent	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:22155424G>T	ENST00000397126.4	-	4	2560	c.2412C>A	c.(2410-2412)ccC>ccA	p.P804P	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	804					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				CACATTTGTAGGGTTTCTCAT	0.363																																						uc002nqp.2		NA																	0				ovary(5)|skin(2)	7						c.(2110-2112)CCC>CCA		zinc finger protein 208							54.0	64.0	60.0					19																	22155424		2095	4244	6339	SO:0001819	synonymous_variant	7757							g.chr19:22155424G>T	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.2412C>A	19.37:g.22155424G>T			Somatic				ZNF208_uc002nqo.1_Intron	p.P704P	NM_007153	NP_009084	WXS	Illumina HiSeq	Unspecified					5	2261	-		all_lung(12;0.0961)|Lung NSC(12;0.103)							Silent	SNP	ENST00000397126.4	37	c.2112C>A	CCDS54240.1																																																																																				0.363	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153		29	89	1	0	9.81e-20	1.46e-19	29	89				
ZNF676	163223	broad.mit.edu	37	19	22363057	22363057	+	Missense_Mutation	SNP	T	T	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:22363057T>C	ENST00000397121.2	-	3	1779	c.1462A>G	c.(1462-1464)Acg>Gcg	p.T488A		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	488					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				ATTGAGAACGTACTAAAGCCT	0.413																																						uc002nqs.1		NA																	0					0						c.(1462-1464)ACG>GCG		zinc finger protein 676							83.0	88.0	86.0					19																	22363057		2165	4275	6440	SO:0001583	missense	163223				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:22363057T>C	AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.1462A>G	19.37:g.22363057T>C	ENSP00000380310:p.Thr488Ala		Somatic					p.T488A	NM_001001411	NP_001001411	WXS	Illumina HiSeq	Unspecified	Q8N7Q3	ZN676_HUMAN			3	1780	-		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)	488			C2H2-type 12.		A8MVX5	Missense_Mutation	SNP	ENST00000397121.2	37	c.1462A>G	CCDS42539.1	.	.	.	.	.	.	.	.	.	.	.	6.034	0.374582	0.11409	.	.	ENSG00000196109	ENST00000397121	T	0.22539	1.95	0.81	-1.62	0.08372	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13586	0.0329	L	0.41632	1.29	0.09310	N	1	B	0.24258	0.1	B	0.24394	0.053	T	0.26780	-1.0093	9	0.40728	T	0.16	.	2.2122	0.03951	0.4317:0.198:0.0:0.3702	.	488	Q8N7Q3	ZN676_HUMAN	A	488	ENSP00000380310:T488A	ENSP00000380310:T488A	T	-	1	0	ZNF676	22154897	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-9.229000	0.00013	-1.417000	0.02017	-1.496000	0.00964	ACG		0.413	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464392.1	NM_001001411		39	128	0	0	0	0	39	128				
ZNF676	163223	broad.mit.edu	37	19	22363257	22363257	+	Missense_Mutation	SNP	T	T	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:22363257T>G	ENST00000397121.2	-	3	1579	c.1262A>C	c.(1261-1263)tAc>tCc	p.Y421S		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	421					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				TTCACACTTGTAGGGTTTCTC	0.433																																						uc002nqs.1		NA																	0					0						c.(1261-1263)TAC>TCC		zinc finger protein 676							65.0	66.0	65.0					19																	22363257		2088	4226	6314	SO:0001583	missense	163223				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:22363257T>G	AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.1262A>C	19.37:g.22363257T>G	ENSP00000380310:p.Tyr421Ser		Somatic					p.Y421S	NM_001001411	NP_001001411	WXS	Illumina HiSeq	Unspecified	Q8N7Q3	ZN676_HUMAN			3	1580	-		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)	421			C2H2-type 10.		A8MVX5	Missense_Mutation	SNP	ENST00000397121.2	37	c.1262A>C	CCDS42539.1	.	.	.	.	.	.	.	.	.	.	.	11.17	1.559619	0.27827	.	.	ENSG00000196109	ENST00000397121	T	0.25579	1.79	0.81	-1.62	0.08372	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.41696	0.1170	M	0.74881	2.28	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	T	0.28586	-1.0039	9	0.87932	D	0	.	2.1872	0.03890	0.2523:0.0:0.2502:0.4975	.	421	Q8N7Q3	ZN676_HUMAN	S	421	ENSP00000380310:Y421S	ENSP00000380310:Y421S	Y	-	2	0	ZNF676	22155097	0.000000	0.05858	0.059000	0.19551	0.059000	0.15707	-0.726000	0.04936	0.156000	0.19299	0.155000	0.16302	TAC		0.433	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464392.1	NM_001001411		41	141	0	0	0	0	41	141				
DPY19L3	147991	broad.mit.edu	37	19	32899172	32899172	+	Missense_Mutation	SNP	C	C	T	rs143875213		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:32899172C>T	ENST00000342179.5	+	2	228	c.13C>T	c.(13-15)Cgg>Tgg	p.R5W	AC007773.2_ENST00000595727.1_RNA|DPY19L3_ENST00000587077.2_Missense_Mutation_p.R5W|DPY19L3_ENST00000392250.2_Missense_Mutation_p.R5W|DPY19L3_ENST00000586987.1_Missense_Mutation_p.R5W|AC007773.2_ENST00000592680.2_RNA	NM_207325.2	NP_997208.2	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3 (C. elegans)	5						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(4)|pancreas(1)	32	Esophageal squamous(110;0.162)					GATGTCCATCCGGCAAAGAAG	0.423																																						uc002ntg.2		NA																	0				ovary(4)	4						c.(13-15)CGG>TGG		dpy-19-like 3		C	TRP/ARG,TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	78.0	77.0	78.0		13,13	3.1	1.0	19	dbSNP_134	78	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	DPY19L3	NM_001172774.1,NM_207325.2	101,101	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging,probably-damaging	5/717,5/717	32899172	2,13004	2203	4300	6503	SO:0001583	missense	147991					integral to membrane		g.chr19:32899172C>T		CCDS12422.1	19q13.11	2008-02-05				ENSG00000178904			27120	protein-coding gene	gene with protein product		613894					Standard	NM_207325		Approved		uc002ntg.3	Q6ZPD9		ENST00000342179.5:c.13C>T	19.37:g.32899172C>T	ENSP00000344937:p.Arg5Trp		Somatic				DPY19L3_uc002ntf.2_Missense_Mutation_p.R5W|DPY19L3_uc002nth.1_Missense_Mutation_p.R5W	p.R5W	NM_207325	NP_997208	WXS	Illumina HiSeq	Unspecified	Q6ZPD9	D19L3_HUMAN			2	189	+	Esophageal squamous(110;0.162)		5					Q68DC7|Q6ZTB7|Q6ZTS2	Missense_Mutation	SNP	ENST00000342179.5	37	c.13C>T	CCDS12422.1	.	.	.	.	.	.	.	.	.	.	C	19.06	3.753432	0.69648	2.27E-4	1.16E-4	ENSG00000178904	ENST00000392250;ENST00000319326;ENST00000342179;ENST00000392248	T;T	0.63417	-0.04;-0.04	5.42	3.08	0.35506	.	0.000000	0.64402	D	0.000001	T	0.66848	0.2831	L	0.32530	0.975	0.38991	D	0.959155	D;D	0.89917	1.0;1.0	D;D	0.91635	0.993;0.999	T	0.70260	-0.4921	10	0.72032	D	0.01	-15.7073	9.9077	0.41386	0.6151:0.3849:0.0:0.0	.	5;5	Q6ZPD9;Q8N6Q4	D19L3_HUMAN;.	W	5	ENSP00000376081:R5W;ENSP00000344937:R5W	ENSP00000315672:R5W	R	+	1	2	DPY19L3	37591012	0.995000	0.38212	1.000000	0.80357	0.881000	0.50899	0.801000	0.27055	1.267000	0.44247	0.650000	0.86243	CGG		0.423	DPY19L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450311.1	NM_207325		15	56	0	0	0	0	15	56				
KMT2B	9757	broad.mit.edu	37	19	36217232	36217232	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:36217232G>T	ENST00000222270.7	+	14	3981	c.3981G>T	c.(3979-3981)agG>agT	p.R1327S	KMT2B_ENST00000420124.1_Missense_Mutation_p.R1327S|KMT2B_ENST00000607650.1_RNA	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	1327					chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										TCTGCCCCAGGTGCACCCAGC	0.592																																						uc010eei.2		NA																	0				central_nervous_system(6)|breast(2)|ovary(1)|kidney(1)|skin(1)	11						c.(3979-3981)AGG>AGT		myeloid/lymphoid or mixed-lineage leukemia 4							57.0	59.0	58.0					19																	36217232		1919	4117	6036	SO:0001583	missense	9757				chromatin-mediated maintenance of transcription		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:36217232G>T	AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.3981G>T	19.37:g.36217232G>T	ENSP00000222270:p.Arg1327Ser		Somatic					p.R1327S	NM_014727	NP_055542	WXS	Illumina HiSeq	Unspecified	Q9UMN6	MLL4_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0515)		15	3981	+	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		1327					O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Missense_Mutation	SNP	ENST00000222270.7	37	c.3981G>T	CCDS46055.1	.	.	.	.	.	.	.	.	.	.	G	13.16	2.154773	0.38021	.	.	ENSG00000105663	ENST00000222270;ENST00000420124	D;D	0.82711	-1.64;-1.64	5.14	2.92	0.33932	Zinc finger, FYVE/PHD-type (1);	0.167461	0.29424	N	0.012195	T	0.60483	0.2272	N	0.08118	0	0.38546	D	0.949332	B	0.25609	0.13	B	0.16289	0.015	T	0.56288	-0.8004	10	0.09590	T	0.72	.	9.2361	0.37466	0.0883:0.1939:0.7178:0.0	.	1327	Q9UMN6	MLL4_HUMAN	S	1327	ENSP00000222270:R1327S;ENSP00000398837:R1327S	ENSP00000222270:R1327S	R	+	3	2	AD000671.1	40909072	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.950000	0.40323	1.410000	0.46936	0.655000	0.94253	AGG		0.592	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014727		13	45	1	0	1.58e-08	2.07e-08	13	45				
ZNF382	84911	broad.mit.edu	37	19	37118348	37118348	+	Nonsense_Mutation	SNP	G	G	T	rs370850208		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:37118348G>T	ENST00000292928.2	+	5	1662	c.1549G>T	c.(1549-1551)Gag>Tag	p.E517*	CTD-3234P18.2_ENST00000585467.1_lincRNA|ZNF382_ENST00000439428.1_Nonsense_Mutation_p.E516*|ZNF382_ENST00000423582.1_Nonsense_Mutation_p.E468*|ZNF382_ENST00000435416.1_Nonsense_Mutation_p.E516*	NM_001256838.1|NM_032825.4	NP_001243767.1|NP_116214.2	Q96SR6	ZN382_HUMAN	zinc finger protein 382	517	Required for transcriptional repression activity; probably mediates sequence- specific DNA-binding. {ECO:0000250}.				negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	34	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			TCACACAGGCGAGAAACCATA	0.423																																						uc002oek.2		NA																	0					0						c.(1549-1551)GAG>TAG		zinc finger protein 382							77.0	79.0	78.0					19																	37118348		2203	4300	6503	SO:0001587	stop_gained	84911				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:37118348G>T	AF513816	CCDS33004.1, CCDS58659.1	19q13.13	2013-01-08			ENSG00000161298	ENSG00000161298		"""Zinc fingers, C2H2-type"", ""-"""	17409	protein-coding gene	gene with protein product		609516					Standard	NM_032825		Approved	FLJ14686, KS1	uc010efb.4	Q96SR6	OTTHUMG00000048153	ENST00000292928.2:c.1549G>T	19.37:g.37118348G>T	ENSP00000292928:p.Glu517*		Somatic				ZNF382_uc010efa.2_Nonsense_Mutation_p.E468*|ZNF382_uc010efb.2_Nonsense_Mutation_p.E516*|ZNF382_uc002oel.2_Nonsense_Mutation_p.E516*	p.E517*	NM_032825	NP_116214	WXS	Illumina HiSeq	Unspecified	Q96SR6	ZN382_HUMAN	COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)		5	1662	+	Esophageal squamous(110;0.198)		517			Required for transcriptional repression activity; probably mediates sequence- specific DNA-binding (By similarity).		A3KMP6|A8MT55|C9K0V5|Q53ZY8|Q5JPJ2	Nonsense_Mutation	SNP	ENST00000292928.2	37	c.1549G>T	CCDS33004.1	.	.	.	.	.	.	.	.	.	.	G	49	15.266827	0.99828	.	.	ENSG00000161298	ENST00000423582;ENST00000292928;ENST00000439428;ENST00000435416	.	.	.	4.18	3.14	0.36123	.	0.000000	0.43747	D	0.000527	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	10.0423	0.42166	0.1019:0.0:0.8981:0.0	.	.	.	.	X	468;517;516;516	.	ENSP00000292928:E517X	E	+	1	0	ZNF382	41810188	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.276000	0.58933	1.112000	0.41740	0.591000	0.81541	GAG		0.423	ZNF382-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109562.2	NM_032825		19	52	1	0	1.02e-10	1.39e-10	19	52				
LRFN1	57622	broad.mit.edu	37	19	39798856	39798856	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:39798856C>A	ENST00000248668.4	-	2	1732	c.1733G>T	c.(1732-1734)cGg>cTg	p.R578L		NM_020862.1	NP_065913.1	Q9P244	LRFN1_HUMAN	leucine rich repeat and fibronectin type III domain containing 1	578						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(60;1.85e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;1.96e-27)|all cancers(26;2.05e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			GTGGCTGACCCGCGGGAGCGA	0.697																																						uc002okw.2		NA																	0				ovary(2)	2						c.(1732-1734)CGG>CTG		leucine rich repeat and fibronectin type III							18.0	22.0	21.0					19																	39798856		2120	4230	6350	SO:0001583	missense	57622					cell junction|integral to membrane|postsynaptic density|postsynaptic membrane		g.chr19:39798856C>A	BC014678	CCDS46071.1	19q13.2	2013-02-11				ENSG00000128011		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29290	protein-coding gene	gene with protein product		612807				10819331, 16828986	Standard	NM_020862		Approved	KIAA1484, SALM2	uc002okw.2	Q9P244		ENST00000248668.4:c.1733G>T	19.37:g.39798856C>A	ENSP00000248668:p.Arg578Leu		Somatic					p.R578L	NM_020862	NP_065913	WXS	Illumina HiSeq	Unspecified	Q9P244	LRFN1_HUMAN	Epithelial(26;1.96e-27)|all cancers(26;2.05e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)		2	1733	-	all_cancers(60;1.85e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		578			Cytoplasmic (Potential).		Q8TBS9	Missense_Mutation	SNP	ENST00000248668.4	37	c.1733G>T	CCDS46071.1	.	.	.	.	.	.	.	.	.	.	C	14.70	2.613193	0.46631	.	.	ENSG00000128011	ENST00000248668	T	0.61859	0.07	4.17	4.17	0.49024	.	0.000000	0.33916	N	0.004422	T	0.42653	0.1212	N	0.19112	0.55	0.39833	D	0.973004	B	0.20887	0.049	B	0.12156	0.007	T	0.43637	-0.9379	10	0.49607	T	0.09	.	14.0383	0.64658	0.0:1.0:0.0:0.0	.	578	Q9P244	LRFN1_HUMAN	L	578	ENSP00000248668:R578L	ENSP00000248668:R578L	R	-	2	0	LRFN1	44490696	0.991000	0.36638	1.000000	0.80357	0.794000	0.44872	3.138000	0.50570	2.176000	0.68965	0.462000	0.41574	CGG		0.697	LRFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463835.1	NM_020862		6	18	1	0	0.00116845	0.00128078	6	18				
TIMM50	92609	broad.mit.edu	37	19	39972552	39972552	+	Silent	SNP	T	T	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:39972552T>C	ENST00000607714.1	+	2	160	c.138T>C	c.(136-138)acT>acC	p.T46T	TIMM50_ENST00000544017.1_5'UTR|TIMM50_ENST00000599794.1_Intron|TIMM50_ENST00000314349.4_Silent_p.T149T			Q3ZCQ8	TIM50_HUMAN	translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae)	46					cellular protein metabolic process (GO:0044267)|mitochondrial membrane organization (GO:0007006)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein targeting to mitochondrion (GO:0006626)|release of cytochrome c from mitochondria (GO:0001836)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial inner membrane presequence translocase complex (GO:0005744)|mitochondrion (GO:0005739)|nuclear speck (GO:0016607)	interleukin-2 receptor binding (GO:0005134)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|ribonucleoprotein complex binding (GO:0043021)|RNA binding (GO:0003723)			NS(1)|endometrium(3)|large_intestine(5)|lung(3)|ovary(1)|prostate(1)	14	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;5.89e-26)|all cancers(26;1.96e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			GCGGGAGCACTAAGGCGCAAG	0.632																																						uc002olu.1		NA																	0				ovary(1)	1						c.(445-447)ACT>ACC		translocase of inner mitochondrial membrane 50							75.0	85.0	82.0					19																	39972552		2203	4300	6503	SO:0001819	synonymous_variant	92609				mitochondrial membrane organization|protein transport|release of cytochrome c from mitochondria|transmembrane transport	integral to membrane|mitochondrial inner membrane presequence translocase complex|nuclear speck	interleukin-2 receptor binding|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|ribonucleoprotein binding|RNA binding	g.chr19:39972552T>C	BC009072	CCDS33023.1	19q13.2	2010-06-21	2006-04-04		ENSG00000105197	ENSG00000105197		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	23656	protein-coding gene	gene with protein product		607381	"""translocase of inner mitochondrial membrane 50 homolog (yeast)"""			12437925	Standard	NM_001001563		Approved	TIM50L	uc002olu.1	Q3ZCQ8		ENST00000607714.1:c.138T>C	19.37:g.39972552T>C			Somatic				TIMM50_uc002olt.1_RNA	p.T149T	NM_001001563	NP_001001563	WXS	Illumina HiSeq	Unspecified	Q3ZCQ8	TIM50_HUMAN	Epithelial(26;5.89e-26)|all cancers(26;1.96e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)		2	580	+	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		46			Mitochondrial matrix (Potential).		Q330K1|Q6QA00|Q96FJ5|Q96GY2|Q9H370	Silent	SNP	ENST00000607714.1	37	c.447T>C																																																																																					0.632	TIMM50-021	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470728.1	NM_001001563		25	123	0	0	0	0	25	123				
CEACAM5	1048	broad.mit.edu	37	19	42213713	42213713	+	Missense_Mutation	SNP	A	A	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:42213713A>T	ENST00000221992.6	+	2	293	c.179A>T	c.(178-180)cAg>cTg	p.Q60L	CEA_ENST00000598976.1_Missense_Mutation_p.Q60L|CEACAM5_ENST00000398599.4_Missense_Mutation_p.Q60L|CEACAM5_ENST00000405816.1_Missense_Mutation_p.Q60L|CEACAM7_ENST00000599715.1_5'Flank	NM_004363.2	NP_004354.2	P06731	CEAM5_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 5	60	Ig-like 1.				homotypic cell-cell adhesion (GO:0034109)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myotube differentiation (GO:0010832)	anchored component of membrane (GO:0031225)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of external side of plasma membrane (GO:0071575)|integral component of plasma membrane (GO:0005887)	GPI anchor binding (GO:0034235)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(3)|kidney(5)|large_intestine(4)|lung(10)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	34				OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)		AATCTGCCCCAGCATCTTTTT	0.507																																						uc002ork.2		NA																	0				skin(2)	2						c.(178-180)CAG>CTG		carcinoembryonic antigen-related cell adhesion							166.0	152.0	157.0					19																	42213713		2203	4300	6503	SO:0001583	missense	1048					anchored to membrane|basolateral plasma membrane|integral to plasma membrane		g.chr19:42213713A>T	M17303	CCDS12584.1	19q13.1-q13.2	2013-01-29			ENSG00000105388	ENSG00000105388		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1817	protein-coding gene	gene with protein product		114890		CEA			Standard	XM_005258413		Approved	CD66e	uc002orl.3	P06731	OTTHUMG00000151061	ENST00000221992.6:c.179A>T	19.37:g.42213713A>T	ENSP00000221992:p.Gln60Leu		Somatic				CEACAM5_uc010ehz.1_Missense_Mutation_p.Q60L|CEACAM5_uc002orj.1_Missense_Mutation_p.Q60L|CEACAM5_uc002orl.2_Missense_Mutation_p.Q60L	p.Q60L	NM_004363	NP_004354	WXS	Illumina HiSeq	Unspecified	P06731	CEAM5_HUMAN		OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)	2	300	+			60			Ig-like 1.		H9KVA7	Missense_Mutation	SNP	ENST00000221992.6	37	c.179A>T	CCDS12584.1	.	.	.	.	.	.	.	.	.	.	-	13.24	2.177541	0.38413	.	.	ENSG00000105388	ENST00000221992;ENST00000405816;ENST00000378181	T;T	0.64991	-0.13;-0.13	3.09	-6.19	0.02078	Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.69833	0.3155	M	0.83852	2.665	0.09310	N	1	P;P;P	0.51653	0.585;0.947;0.707	P;D;P	0.63957	0.694;0.92;0.786	T	0.62431	-0.6856	9	0.56958	D	0.05	.	1.4101	0.02289	0.2372:0.3001:0.3152:0.1475	.	60;60;60	Q8N4D0;P06731;Q53G30	.;CEAM5_HUMAN;.	L	60	ENSP00000221992:Q60L;ENSP00000385072:Q60L	ENSP00000221992:Q60L	Q	+	2	0	CEACAM5	46905553	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-3.299000	0.00521	-2.083000	0.00867	0.254000	0.18369	CAG		0.507	CEACAM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321132.2	NM_004363		53	142	0	0	0	0	53	142				
PSG7	5676	broad.mit.edu	37	19	43430641	43430641	+	RNA	SNP	G	G	C	rs376480204		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:43430641G>C	ENST00000406070.2	-	0	1033				PSG7_ENST00000446844.3_RNA	NM_002783.2	NP_002774.2	Q13046	PSG7_HUMAN	pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene)						female pregnancy (GO:0007565)	extracellular region (GO:0005576)							Prostate(69;0.00682)				TATCGGTCCCGTATTTCACAT	0.522																																						uc002ovl.3		NA																	0					0						c.(937-939)CGG>GGG		pregnancy specific beta-1-glycoprotein 7							128.0	118.0	121.0					19																	43430641		2201	4296	6497			5676				female pregnancy	extracellular region		g.chr19:43430641G>C			19q13.2	2013-01-29	2010-02-26		ENSG00000221878	ENSG00000221878		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9524	protein-coding gene	gene with protein product		176396	"""pregnancy specific beta-1-glycoprotein 7"""				Standard	NM_002783		Approved		uc010xwl.2	Q13046	OTTHUMG00000151125		19.37:g.43430641G>C			Somatic				PSG3_uc002ouf.2_Intron|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_RNA|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Intron|PSG7_uc010xwl.1_Missense_Mutation_p.R191G	p.R313G	NM_002783	NP_002774	WXS	Illumina HiSeq	Unspecified	Q13046	PSG7_HUMAN			5	1039	-		Prostate(69;0.00682)	313			Ig-like C2-type 2.		Q15232	Missense_Mutation	SNP	ENST00000406070.2	37	c.937C>G																																																																																					0.522	PSG7-001	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000321431.2	NM_001206650		6	242	0	0	0	0	6	242				
CABP5	56344	broad.mit.edu	37	19	48543892	48543892	+	Missense_Mutation	SNP	T	T	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:48543892T>C	ENST00000293255.2	-	3	338	c.208A>G	c.(208-210)Att>Gtt	p.I70V		NM_019855.4	NP_062829.1	Q9NP86	CABP5_HUMAN	calcium binding protein 5	70	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				signal transduction (GO:0007165)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(3)|lung(3)|prostate(2)|skin(2)	11		all_cancers(25;1.86e-08)|all_lung(116;1.14e-06)|all_epithelial(76;1.16e-06)|Lung NSC(112;2.54e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;4.09e-05)|all cancers(93;0.000322)|Epithelial(262;0.01)|GBM - Glioblastoma multiforme(486;0.058)		CCGAGCTCAATCAGTTCCATC	0.527																																						uc002phu.1		NA																	0				skin(1)	1						c.(208-210)ATT>GTT		calcium binding protein 5							113.0	85.0	95.0					19																	48543892		2203	4300	6503	SO:0001583	missense	56344				signal transduction	cytoplasm	calcium ion binding	g.chr19:48543892T>C	AF169159	CCDS12709.1	19q13.33	2014-08-12			ENSG00000105507	ENSG00000105507		"""EF-hand domain containing"""	13714	protein-coding gene	gene with protein product		607315	"""calcium binding protein 3"""	CABP3		10625670	Standard	NM_019855		Approved	CaBP3	uc002phu.2	Q9NP86	OTTHUMG00000183139	ENST00000293255.2:c.208A>G	19.37:g.48543892T>C	ENSP00000293255:p.Ile70Val		Somatic					p.I70V	NM_019855	NP_062829	WXS	Illumina HiSeq	Unspecified	Q9NP86	CABP5_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;4.09e-05)|all cancers(93;0.000322)|Epithelial(262;0.01)|GBM - Glioblastoma multiforme(486;0.058)	3	333	-		all_cancers(25;1.86e-08)|all_lung(116;1.14e-06)|all_epithelial(76;1.16e-06)|Lung NSC(112;2.54e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)	70			EF-hand 2.		A0AUY4	Missense_Mutation	SNP	ENST00000293255.2	37	c.208A>G	CCDS12709.1	.	.	.	.	.	.	.	.	.	.	T	13.36	2.213725	0.39102	.	.	ENSG00000105507	ENST00000293255	T	0.09255	3.0	4.4	4.4	0.53042	EF-hand-like domain (1);	0.254115	0.38436	N	0.001681	T	0.13713	0.0332	L	0.60455	1.87	0.35126	D	0.767549	B	0.12013	0.005	B	0.20577	0.03	T	0.07578	-1.0765	10	0.72032	D	0.01	-0.9774	12.2186	0.54420	0.0:0.0:0.0:1.0	.	70	Q9NP86	CABP5_HUMAN	V	70	ENSP00000293255:I70V	ENSP00000293255:I70V	I	-	1	0	CABP5	53235704	1.000000	0.71417	0.980000	0.43619	0.942000	0.58702	3.416000	0.52707	1.946000	0.56461	0.448000	0.29417	ATT		0.527	CABP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465212.1	NM_019855		18	91	0	0	0	0	18	91				
NOSIP	51070	broad.mit.edu	37	19	50063282	50063282	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:50063282C>A	ENST00000596358.1	-	3	143	c.85G>T	c.(85-87)Ggg>Tgg	p.G29W	NOSIP_ENST00000391853.3_Missense_Mutation_p.G29W|NOSIP_ENST00000339093.3_Missense_Mutation_p.G29W	NM_001270960.1	NP_001257889.1	Q9Y314	NOSIP_HUMAN	nitric oxide synthase interacting protein	29					negative regulation of catalytic activity (GO:0043086)|negative regulation of nitric-oxide synthase activity (GO:0051001)|nitric oxide metabolic process (GO:0046209)|regulation of nitric-oxide synthase activity (GO:0050999)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|ovary(1)|skin(2)|urinary_tract(1)	11		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00321)|GBM - Glioblastoma multiforme(134;0.0133)		TTCTGGGTCCCATAGCCCGAG	0.607																																						uc002pok.2		NA																	0				skin(1)	1						c.(85-87)GGG>TGG		nitric oxide synthase interacting protein							91.0	69.0	76.0					19																	50063282		2203	4300	6503	SO:0001583	missense	51070				negative regulation of nitric-oxide synthase activity|nitric oxide metabolic process	cytosol|nucleus	protein binding	g.chr19:50063282C>A	AF132959	CCDS12772.1	19q13.3	2008-02-05				ENSG00000142546			17946	protein-coding gene	gene with protein product						11149895, 10810093	Standard	NM_015953		Approved	CGI-25	uc002pol.4	Q9Y314		ENST00000596358.1:c.85G>T	19.37:g.50063282C>A	ENSP00000470034:p.Gly29Trp		Somatic				NOSIP_uc002pol.2_Missense_Mutation_p.G29W|NOSIP_uc010yay.1_RNA	p.G29W	NM_015953	NP_057037	WXS	Illumina HiSeq	Unspecified	Q9Y314	NOSIP_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00321)|GBM - Glioblastoma multiforme(134;0.0133)	4	237	-		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)	29					Q96FD2	Missense_Mutation	SNP	ENST00000596358.1	37	c.85G>T	CCDS12772.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.986496	0.93044	.	.	ENSG00000142546	ENST00000339093;ENST00000391853	T;T	0.77489	-1.1;-1.1	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.82015	0.4945	M	0.81614	2.55	0.80722	D	1	P	0.39404	0.672	B	0.41202	0.35	D	0.84855	0.0816	10	0.87932	D	0	-31.3487	18.1743	0.89757	0.0:1.0:0.0:0.0	.	29	Q9Y314	NOSIP_HUMAN	W	29	ENSP00000343497:G29W;ENSP00000375726:G29W	ENSP00000343497:G29W	G	-	1	0	NOSIP	54755094	1.000000	0.71417	0.986000	0.45419	0.991000	0.79684	6.534000	0.73833	2.592000	0.87571	0.585000	0.79938	GGG		0.607	NOSIP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465423.1			8	26	1	0	0.000442599	0.000496582	8	26				
SIGLEC10	89790	broad.mit.edu	37	19	51919978	51919978	+	Silent	SNP	A	A	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:51919978A>G	ENST00000339313.5	-	3	764	c.648T>C	c.(646-648)caT>caC	p.H216H	CTD-2616J11.2_ENST00000526996.1_RNA|SIGLEC10_ENST00000356298.5_Silent_p.H216H|SIGLEC10_ENST00000432469.2_Intron|SIGLEC10_ENST00000436984.2_Silent_p.H168H|CTD-2616J11.2_ENST00000532688.1_RNA|SIGLEC10_ENST00000439889.2_Silent_p.H158H|SIGLEC10_ENST00000353836.5_Silent_p.H216H|SIGLEC10_ENST00000441969.3_Silent_p.H158H|SIGLEC10_ENST00000525998.1_Silent_p.H216H|CTD-2616J11.3_ENST00000532473.1_RNA|SIGLEC10_ENST00000442846.3_Silent_p.H158H			Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10	216	Ig-like C2-type 1.				cell adhesion (GO:0007155)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(27)|ovary(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		AGAAGTCCACATGGCAGGTGA	0.632																																						uc002pwo.2		NA																	0				skin(1)	1						c.(646-648)CAT>CAC		sialic acid binding Ig-like lectin 10 precursor							127.0	100.0	109.0					19																	51919978		2203	4300	6503	SO:0001819	synonymous_variant	89790				cell adhesion	extracellular region|integral to membrane|plasma membrane	sugar binding	g.chr19:51919978A>G	AF310233	CCDS12832.1, CCDS54301.1, CCDS54302.1, CCDS54303.1, CCDS54304.1, CCDS54305.1	19q13.3	2013-01-29			ENSG00000142512	ENSG00000142512		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15620	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 10 Ig-like lectin 7"", ""siglec-like gene 2"""	606091				11284738	Standard	NM_033130		Approved	SIGLEC-10, SLG2, PRO940, MGC126774	uc002pwo.3	Q96LC7	OTTHUMG00000165521	ENST00000339313.5:c.648T>C	19.37:g.51919978A>G			Somatic				SIGLEC10_uc002pwp.2_Silent_p.H158H|SIGLEC10_uc002pwq.2_Silent_p.H158H|SIGLEC10_uc002pwr.2_Silent_p.H216H|SIGLEC10_uc010ycy.1_Silent_p.H216H|SIGLEC10_uc010ycz.1_Silent_p.H168H|SIGLEC10_uc010eow.2_5'UTR|SIGLEC10_uc002pws.1_Silent_p.H142H	p.H216H	NM_033130	NP_149121	WXS	Illumina HiSeq	Unspecified	Q96LC7	SIG10_HUMAN		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)	3	1264	-		all_neural(266;0.0199)	216			Extracellular (Potential).|Ig-like C2-type 1.		A8K1I5|A8K3C7|C9JJ33|C9JM10|F8W917|Q3MIR5|Q6UXI8|Q96G54|Q96LC8	Silent	SNP	ENST00000339313.5	37	c.648T>C	CCDS12832.1																																																																																				0.632	SIGLEC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384620.2	NM_033130		12	41	0	0	0	0	12	41				
CEACAM18	729767	broad.mit.edu	37	19	51986470	51986470	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:51986470G>A	ENST00000396477.4	+	4	894	c.873G>A	c.(871-873)atG>atA	p.M291I	CEACAM18_ENST00000451626.1_Missense_Mutation_p.M352I	NM_001278392.1	NP_001265321.1	A8MTB9	CEA18_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 18	291	Ig-like C2-type.									breast(1)|endometrium(4)|large_intestine(3)|lung(8)|skin(1)	17		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		GGGAGCAGATGGGCCGTTACC	0.557																																						uc002pwv.1		NA																	0				skin(1)	1						c.(1054-1056)ATG>ATA		carcinoembryonic antigen-related cell adhesion							120.0	120.0	120.0					19																	51986470		2088	4219	6307	SO:0001583	missense	729767					integral to membrane		g.chr19:51986470G>A			19q13.41	2013-01-29				ENSG00000213822		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31949	protein-coding gene	gene with protein product							Standard	NM_001278392		Approved		uc002pwv.1	A8MTB9		ENST00000396477.4:c.873G>A	19.37:g.51986470G>A	ENSP00000379738:p.Met291Ile		Somatic					p.M352I	NM_001080405	NP_001073874	WXS	Illumina HiSeq	Unspecified	A8MTB9	CEA18_HUMAN		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)	5	1056	+		all_neural(266;0.0529)	352			Ig-like C2-type.		C9JN24	Missense_Mutation	SNP	ENST00000396477.4	37	c.1056G>A		.	.	.	.	.	.	.	.	.	.	.	10.07	1.248546	0.22880	.	.	ENSG00000213822	ENST00000451626;ENST00000451086;ENST00000396477	T	0.12147	2.71	2.76	1.72	0.24424	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.13841	0.0335	L	0.60455	1.87	0.26300	N	0.977992	B	0.11235	0.004	B	0.10450	0.005	T	0.19321	-1.0309	9	0.51188	T	0.08	-15.8356	6.4714	0.22009	0.1418:0.0:0.8582:0.0	.	352	A8MTB9	CEA18_HUMAN	I	352;291;291	ENSP00000402203:M352I	ENSP00000379738:M291I	M	+	3	0	CEACAM18	56678282	0.969000	0.33509	0.994000	0.49952	0.008000	0.06430	0.445000	0.21677	0.744000	0.32741	-0.680000	0.03767	ATG		0.557	CEACAM18-001	PUTATIVE	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000323114.2			35	93	0	0	0	0	35	93				
ZNF610	162963	broad.mit.edu	37	19	52869373	52869373	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:52869373G>T	ENST00000403906.3	+	6	1198	c.742G>T	c.(742-744)Gta>Tta	p.V248L	ZNF610_ENST00000601151.1_Missense_Mutation_p.V205L|ZNF610_ENST00000327920.8_Missense_Mutation_p.V248L|ZNF610_ENST00000321287.8_Missense_Mutation_p.V248L	NM_001161425.1	NP_001154897.1	Q8N9Z0	ZN610_HUMAN	zinc finger protein 610	248					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(8)|liver(2)|lung(9)|ovary(2)|stomach(2)|upper_aerodigestive_tract(2)	34				OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)		TTCACACCTTGTAGAACATTG	0.403																																						uc002pyx.3		NA																	0				ovary(2)|upper_aerodigestive_tract(1)	3						c.(742-744)GTA>TTA		zinc finger protein 610 isoform a							61.0	61.0	61.0					19																	52869373		2203	4300	6503	SO:0001583	missense	162963				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:52869373G>T	AK093359	CCDS12851.1, CCDS54309.1	19q13.41	2013-01-08			ENSG00000167554	ENSG00000167554		"""Zinc fingers, C2H2-type"", ""-"""	26687	protein-coding gene	gene with protein product						12477932	Standard	NM_001161425		Approved	FLJ36040	uc002pyx.4	Q8N9Z0		ENST00000403906.3:c.742G>T	19.37:g.52869373G>T	ENSP00000383922:p.Val248Leu		Somatic				ZNF610_uc002pyy.3_Missense_Mutation_p.V248L|ZNF610_uc002pyz.3_Missense_Mutation_p.V205L|ZNF610_uc002pza.2_Missense_Mutation_p.V248L	p.V248L	NM_001161426	NP_001154898	WXS	Illumina HiSeq	Unspecified	Q8N9Z0	ZN610_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)	6	1148	+			248			C2H2-type 2.		A8K4C3|Q86YH8|Q8NDS9	Missense_Mutation	SNP	ENST00000403906.3	37	c.742G>T	CCDS12851.1	.	.	.	.	.	.	.	.	.	.	G	4.356	0.065535	0.08388	.	.	ENSG00000167554	ENST00000403906;ENST00000321287;ENST00000327920	T;T	0.07216	3.21;3.21	1.82	-3.64	0.04515	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02767	0.0083	N	0.02973	-0.45	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.0;0.001	T	0.41556	-0.9502	9	0.32370	T	0.25	.	4.7701	0.13151	0.4437:0.0:0.4071:0.1493	.	205;248	Q8N9Z0-2;Q8N9Z0	.;ZN610_HUMAN	L	248;205;248	ENSP00000383922:V248L;ENSP00000327597:V248L	ENSP00000324441:V205L	V	+	1	0	ZNF610	57561185	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.752000	0.00791	-1.680000	0.01450	-1.391000	0.01154	GTA		0.403	ZNF610-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462880.1	NM_173530		24	56	1	0	9.58e-11	1.31e-10	24	56				
ZNF677	342926	broad.mit.edu	37	19	53740380	53740380	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:53740380G>A	ENST00000598513.1	-	5	1750	c.1600C>T	c.(1600-1602)Cag>Tag	p.Q534*	ZNF677_ENST00000333952.4_Nonsense_Mutation_p.Q534*	NM_182609.2	NP_872415.1	Q86XU0	ZN677_HUMAN	zinc finger protein 677	534					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(13)|lung(6)|ovary(1)|pancreas(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(134;0.00352)		TGTATTTTCTGGTGTCTAGTG	0.318																																						uc002qbf.1		NA																	0				ovary(1)	1						c.(1600-1602)CAG>TAG		zinc finger protein 677							131.0	125.0	127.0					19																	53740380		2203	4299	6502	SO:0001587	stop_gained	342926				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53740380G>A	BC050038	CCDS12861.1	19q13.42	2013-01-08				ENSG00000197928		"""Zinc fingers, C2H2-type"", ""-"""	28730	protein-coding gene	gene with protein product	"""hypothetical protein MGC48625"""					12477932	Standard	NM_182609		Approved	MGC48625	uc002qbg.1	Q86XU0		ENST00000598513.1:c.1600C>T	19.37:g.53740380G>A	ENSP00000469391:p.Gln534*		Somatic				ZNF677_uc002qbg.1_Nonsense_Mutation_p.Q534*	p.Q534*	NM_182609	NP_872415	WXS	Illumina HiSeq	Unspecified	Q86XU0	ZN677_HUMAN		GBM - Glioblastoma multiforme(134;0.00352)	5	1785	-			534			C2H2-type 10.			Nonsense_Mutation	SNP	ENST00000598513.1	37	c.1600C>T	CCDS12861.1	.	.	.	.	.	.	.	.	.	.	G	35	5.525060	0.96431	.	.	ENSG00000197928	ENST00000333952	.	.	.	2.12	1.08	0.20341	.	0.000000	0.32416	N	0.006131	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	.	6.7502	0.23483	0.1558:0.0:0.8442:0.0	.	.	.	.	X	534	.	ENSP00000334394:Q534X	Q	-	1	0	ZNF677	58432192	0.357000	0.24938	0.372000	0.25991	0.876000	0.50452	0.054000	0.14205	0.467000	0.27218	0.591000	0.81541	CAG		0.318	ZNF677-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464189.1	NM_182609		23	87	0	0	0	0	23	87				
PRKCG	5582	broad.mit.edu	37	19	54403966	54403966	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:54403966G>T	ENST00000263431.3	+	14	1820	c.1538G>T	c.(1537-1539)cGc>cTc	p.R513L	PRKCG_ENST00000540413.1_Missense_Mutation_p.R513L|PRKCG_ENST00000542049.1_Missense_Mutation_p.R400L	NM_002739.3	NP_002730.1	P05129	KPCG_HUMAN	protein kinase C, gamma	513	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cell death (GO:0008219)|chemosensory behavior (GO:0007635)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein ubiquitination (GO:0031397)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of mismatch repair (GO:0032425)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to morphine (GO:0043278)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic membrane (GO:0097060)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(4)|ovary(2)|pancreas(2)|skin(1)	10	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)	Tamoxifen(DB00675)	ACGACAACCCGCACCTTCTGC	0.567																																						uc002qcq.1		NA																	0				lung(4)|ovary(2)|pancreas(2)|large_intestine(1)	9						c.(1537-1539)CGC>CTC		protein kinase C, gamma							222.0	222.0	222.0					19																	54403966		2203	4300	6503	SO:0001583	missense	5582				activation of phospholipase C activity|cell death|intracellular signal transduction|negative regulation of protein catabolic process|negative regulation of protein ubiquitination|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of mismatch repair|synaptic transmission	cytosol	ATP binding|protein kinase C activity|zinc ion binding	g.chr19:54403966G>T	M13977	CCDS12867.1	19q13.4	2014-09-17			ENSG00000126583	ENSG00000126583	2.7.11.1		9402	protein-coding gene	gene with protein product	"""PKC-gamma"""	176980		PKCG, SCA14		8432525, 3755548	Standard	NM_002739		Approved	PKCC, MGC57564	uc002qcq.1	P05129	OTTHUMG00000064846	ENST00000263431.3:c.1538G>T	19.37:g.54403966G>T	ENSP00000263431:p.Arg513Leu		Somatic				PRKCG_uc010yeg.1_Missense_Mutation_p.R513L|PRKCG_uc010yeh.1_Missense_Mutation_p.R400L	p.R513L	NM_002739	NP_002730	WXS	Illumina HiSeq	Unspecified	P05129	KPCG_HUMAN		GBM - Glioblastoma multiforme(134;0.0521)	14	1820	+	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)		513			Protein kinase.		B7Z8Q0	Missense_Mutation	SNP	ENST00000263431.3	37	c.1538G>T	CCDS12867.1	.	.	.	.	.	.	.	.	.	.	G	19.91	3.914928	0.72983	.	.	ENSG00000126583	ENST00000540413;ENST00000263431;ENST00000542049	T;T;T	0.65916	-0.18;-0.18;-0.18	4.24	4.24	0.50183	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.57799	0.2078	L	0.53780	1.695	0.44985	D	0.998003	P;P;P	0.49090	0.919;0.673;0.716	B;B;B	0.40444	0.258;0.158;0.329	T	0.66728	-0.5850	9	0.72032	D	0.01	.	14.5204	0.67847	0.0:0.0:1.0:0.0	.	400;513;513	B7Z8Q0;F5H5C4;P05129	.;.;KPCG_HUMAN	L	513;513;400	ENSP00000443493:R513L;ENSP00000263431:R513L;ENSP00000438090:R400L	ENSP00000263431:R513L	R	+	2	0	PRKCG	59095778	0.906000	0.30813	0.994000	0.49952	0.982000	0.71751	2.183000	0.42565	2.088000	0.63022	0.462000	0.41574	CGC		0.567	PRKCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139233.3	NM_002739		83	414	1	0	6.07e-39	9.6e-39	83	414				
CACNG6	59285	broad.mit.edu	37	19	54502939	54502939	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:54502939C>T	ENST00000252729.2	+	3	1048	c.458C>T	c.(457-459)gCc>gTc	p.A153V	CACNG6_ENST00000352529.1_Intron|CACNG6_ENST00000346968.2_Intron	NM_145814.1	NP_665813.1	Q9BXT2	CCG6_HUMAN	calcium channel, voltage-dependent, gamma subunit 6	153					calcium ion transport (GO:0006816)	voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	15	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.168)		GCAGTCATGGCCTTGGGGTGC	0.562																																						uc002qct.2		NA																	0				ovary(2)	2						c.(457-459)GCC>GTC		voltage-dependent calcium channel gamma-6							257.0	234.0	242.0					19																	54502939		2203	4300	6503	SO:0001583	missense	59285					voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr19:54502939C>T	AF288386	CCDS12870.1, CCDS12871.1	19q13.4	2008-05-02			ENSG00000130433	ENSG00000130433		"""Calcium channel subunits"""	13625	protein-coding gene	gene with protein product		606898				11170751	Standard	NM_145814		Approved		uc002qct.3	Q9BXT2	OTTHUMG00000064907	ENST00000252729.2:c.458C>T	19.37:g.54502939C>T	ENSP00000252729:p.Ala153Val		Somatic				CACNG6_uc002qcu.2_Intron|CACNG6_uc002qcv.2_Intron	p.A153V	NM_145814	NP_665813	WXS	Illumina HiSeq	Unspecified	Q9BXT2	CCG6_HUMAN		GBM - Glioblastoma multiforme(134;0.168)	3	1048	+	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)		153			Helical; (Potential).			Missense_Mutation	SNP	ENST00000252729.2	37	c.458C>T	CCDS12870.1	.	.	.	.	.	.	.	.	.	.	.	5.210	0.224309	0.09863	.	.	ENSG00000130433	ENST00000252729	T	0.69175	-0.38	4.92	2.75	0.32379	.	0.152803	0.42821	D	0.000643	T	0.35335	0.0928	N	0.04043	-0.29	0.80722	D	1	B	0.12630	0.006	B	0.17722	0.019	T	0.30822	-0.9965	10	0.02654	T	1	-13.4143	8.2823	0.31908	0.0:0.8037:0.0:0.1963	.	153	Q9BXT2	CCG6_HUMAN	V	153	ENSP00000252729:A153V	ENSP00000252729:A153V	A	+	2	0	CACNG6	59194751	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.241000	0.32743	1.205000	0.43262	0.561000	0.74099	GCC		0.562	CACNG6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139359.1			118	347	0	0	0	0	118	347				
DNAAF3	352909	broad.mit.edu	37	19	55677772	55677772	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:55677772G>T	ENST00000524407.2	-	2	43	c.10C>A	c.(10-12)Cct>Act	p.P4T	DNAAF3_ENST00000527223.2_Missense_Mutation_p.P51T|CTD-2587H24.5_ENST00000591665.1_RNA|DNAAF3_ENST00000455045.1_5'Flank|DNAAF3_ENST00000391720.4_Missense_Mutation_p.P51T|snoU13_ENST00000459370.1_RNA			Q8N9W5	DAAF3_HUMAN	dynein, axonemal, assembly factor 3	4					axonemal dynein complex assembly (GO:0070286)|motile cilium assembly (GO:0044458)	cytoplasm (GO:0005737)											GAGCCGGCAGGTGTGGTCATC	0.662											OREG0025679	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										uc002qji.1		NA																	0					0						c.(10-12)CCT>ACT		RecName: Full=UPF0470 protein C19orf51;							46.0	61.0	56.0					19																	55677772		2036	4164	6200	SO:0001583	missense	352909							g.chr19:55677772G>T	AK097388	CCDS12918.2, CCDS58679.1, CCDS58680.1, CCDS59422.1	19q13.42	2012-10-05	2012-03-09	2012-03-09	ENSG00000167646	ENSG00000167646			30492	protein-coding gene	gene with protein product		614566	"""chromosome 19 open reading frame 51"", ""ciliary dyskinesia, primary 2"""	C19orf51, CILD2		22387996	Standard	NM_001256714		Approved	FLJ40069, FLJ36139, PF22, PCD	uc002qjl.2	Q8N9W5	OTTHUMG00000128547	ENST00000524407.2:c.10C>A	19.37:g.55677772G>T	ENSP00000432046:p.Pro4Thr		Somatic	OREG0025679	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1009	C19orf51_uc002qjj.1_Missense_Mutation_p.P51T|C19orf51_uc002qjk.1_5'UTR|C19orf51_uc002qjl.1_Missense_Mutation_p.P51T	p.P4T			WXS	Illumina HiSeq	Unspecified	Q8N9W5	CS051_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)	2	44	-			4					A8MUY0|E3W9A1|E9PAX5|Q6P4F6|Q8N9W0|Q96AR2	Missense_Mutation	SNP	ENST00000524407.2	37	c.10C>A	CCDS59422.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.234141	0.79688	.	.	ENSG00000167646	ENST00000301249;ENST00000391720;ENST00000528476	T	0.19105	2.17	4.68	0.911	0.19343	.	0.546735	0.18826	N	0.130115	T	0.31949	0.0813	L	0.34521	1.04	0.19775	N	0.999955	D;P;P	0.89917	1.0;0.827;0.827	D;P;P	0.87578	0.998;0.526;0.526	T	0.10543	-1.0625	10	0.72032	D	0.01	-23.42	11.8572	0.52444	0.0:0.5342:0.4658:0.0	.	51;4;4	E9PAX5;Q8N9W5-3;Q8N9W5	.;.;CS051_HUMAN	T	51	ENSP00000375600:P51T	ENSP00000301249:P51T	P	-	1	0	C19orf51	60369584	0.595000	0.26857	0.198000	0.23420	0.648000	0.38561	1.300000	0.33436	0.621000	0.30232	0.655000	0.94253	CCT		0.662	DNAAF3-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250388.5	NM_178837		21	46	1	0	2.22e-12	3.08e-12	21	46				
SBK2	646643	broad.mit.edu	37	19	56042591	56042591	+	Silent	SNP	A	A	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:56042591A>G	ENST00000413299.1	-	3	412	c.375T>C	c.(373-375)atT>atC	p.I125I	SBK2_ENST00000344158.3_Silent_p.I125I	NM_001101401.2	NP_001094871.2	P0C263	SBK2_HUMAN	SH3 domain binding kinase family, member 2	125	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	9						ACTCGATGCCAATGCCGTAGG	0.652																																						uc010ygc.1		NA																	0					0						c.(373-375)ATT>ATC		SH3-binding domain kinase family, member 2							49.0	56.0	54.0					19																	56042591		2171	4257	6428	SO:0001819	synonymous_variant	646643						ATP binding|protein serine/threonine kinase activity	g.chr19:56042591A>G		CCDS42631.1	19q13.42	2013-09-27	2013-09-27		ENSG00000187550	ENSG00000187550			34416	protein-coding gene	gene with protein product			"""SH3-binding domain kinase family, member 2"""				Standard	NM_001101401		Approved	SGK069	uc010ygc.2	P0C263	OTTHUMG00000155830	ENST00000413299.1:c.375T>C	19.37:g.56042591A>G			Somatic					p.I125I	NM_001101401	NP_001094871	WXS	Illumina HiSeq	Unspecified	P0C263	SBK2_HUMAN			2	375	-			125			Protein kinase.			Silent	SNP	ENST00000413299.1	37	c.375T>C	CCDS42631.1																																																																																				0.652	SBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341919.1	NM_001101401		10	33	0	0	0	0	10	33				
PEG3	5178	broad.mit.edu	37	19	57325540	57325540	+	Missense_Mutation	SNP	C	C	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:57325540C>G	ENST00000326441.9	-	10	4633	c.4270G>C	c.(4270-4272)Ggg>Cgg	p.G1424R	ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000391708.3_Intron|PEG3_ENST00000593695.1_Missense_Mutation_p.G1298R|PEG3_ENST00000423103.2_Missense_Mutation_p.G1424R|PEG3_ENST00000598410.1_Missense_Mutation_p.G1300R|ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000593711.1_Intron|ZIM2_ENST00000221722.5_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	1424	4 X 5 AA repeat of P-X-G-E-A.|Glu-rich.				apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		CCATCTGGCCCTTCAGCCTCT	0.607																																						uc002qnu.2		NA																	0				ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12						c.(4270-4272)GGG>CGG		paternally expressed 3 isoform 1							45.0	46.0	46.0					19																	57325540		2203	4300	6503	SO:0001583	missense	5178				apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:57325540C>G	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.4270G>C	19.37:g.57325540C>G	ENSP00000326581:p.Gly1424Arg		Somatic				ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.G1395R|PEG3_uc002qnv.2_Missense_Mutation_p.G1424R|PEG3_uc002qnw.2_Missense_Mutation_p.G1300R|PEG3_uc002qnx.2_Missense_Mutation_p.G1298R|PEG3_uc010etr.2_Missense_Mutation_p.G1424R	p.G1424R	NM_001146186	NP_001139658	WXS	Illumina HiSeq	Unspecified	Q9GZU2	PEG3_HUMAN		GBM - Glioblastoma multiforme(193;0.0269)	7	4621	-		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)	1424			Glu-rich.|4 X 5 AA repeat of P-X-G-E-A.		A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	ENST00000326441.9	37	c.4270G>C	CCDS12948.1	.	.	.	.	.	.	.	.	.	.	C	18.62	3.663784	0.67700	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.02472	4.28;4.28	4.17	3.1	0.35709	.	0.293012	0.24935	N	0.034431	T	0.04907	0.0132	L	0.27053	0.805	.	.	.	D;D;D	0.69078	0.994;0.994;0.997	P;P;P	0.62491	0.896;0.864;0.903	T	0.44757	-0.9307	9	0.11182	T	0.66	-25.7011	9.8721	0.41180	0.0:0.792:0.208:0.0	.	1300;1424;1359	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	R	1424	ENSP00000326581:G1424R;ENSP00000403051:G1424R	ENSP00000326581:G1424R	G	-	1	0	ZIM2	62017352	0.025000	0.19082	0.910000	0.35882	0.980000	0.70556	0.874000	0.28065	1.306000	0.44926	0.655000	0.94253	GGG		0.607	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2			18	72	0	0	0	0	18	72				
USP29	57663	broad.mit.edu	37	19	57641829	57641829	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:57641829G>T	ENST00000254181.4	+	4	2240	c.1786G>T	c.(1786-1788)Gaa>Taa	p.E596*	USP29_ENST00000598197.1_Nonsense_Mutation_p.E596*	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	596	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TCTACCCGTTGAACCAGACAA	0.488																																						uc002qny.2		NA																	0				lung(6)|ovary(2)|breast(2)|pancreas(1)	11						c.(1786-1788)GAA>TAA		ubiquitin specific peptidase 29							68.0	68.0	68.0					19																	57641829		2203	4300	6503	SO:0001587	stop_gained	57663				protein modification process|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity	g.chr19:57641829G>T		CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		ENST00000254181.4:c.1786G>T	19.37:g.57641829G>T	ENSP00000254181:p.Glu596*		Somatic					p.E596*	NM_020903	NP_065954	WXS	Illumina HiSeq	Unspecified	Q9HBJ7	UBP29_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)	4	2142	+		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)	596						Nonsense_Mutation	SNP	ENST00000254181.4	37	c.1786G>T	CCDS33124.1	.	.	.	.	.	.	.	.	.	.	G	37	6.491915	0.97612	.	.	ENSG00000131864	ENST00000254181	.	.	.	2.09	-0.234	0.13074	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	0.5235	3.3164	0.07035	0.1723:0.2753:0.5524:0.0	.	.	.	.	X	596	.	ENSP00000254181:E596X	E	+	1	0	USP29	62333641	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.080000	0.11339	0.007000	0.14760	0.467000	0.42956	GAA		0.488	USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465075.1			19	48	1	0	5.39e-06	6.51e-06	19	48				
DUXA	503835	broad.mit.edu	37	19	57666725	57666725	+	Silent	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:57666725G>T	ENST00000554048.2	-	5	453	c.454C>A	c.(454-456)Cga>Aga	p.R152R		NM_001012729.1	NP_001012747.1	A6NLW8	DUXA_HUMAN	double homeobox A	152					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	17		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0123)		CTAGATCTTCGATTTTGGAAC	0.383																																						uc002qoa.1		NA																	0				ovary(1)	1						c.(454-456)CGA>AGA		double homeobox A							72.0	66.0	68.0					19																	57666725		2203	4300	6503	SO:0001819	synonymous_variant	503835					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr19:57666725G>T		CCDS33126.1	19q13.43	2012-10-04			ENSG00000258873	ENSG00000258873		"""Homeoboxes / PRD class"""	32179	protein-coding gene	gene with protein product		611168					Standard	NM_001012729		Approved		uc002qoa.1	A6NLW8	OTTHUMG00000170714	ENST00000554048.2:c.454C>A	19.37:g.57666725G>T			Somatic					p.R152R	NM_001012729	NP_001012747	WXS	Illumina HiSeq	Unspecified	A6NLW8	DUXA_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0123)	5	499	-		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)	152			Homeobox 2.			Silent	SNP	ENST00000554048.2	37	c.454C>A	CCDS33126.1																																																																																				0.383	DUXA-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410075.3	NM_001012729		20	47	1	0	1.56e-12	2.18e-12	20	47				
ZNF460	10794	broad.mit.edu	37	19	57802666	57802666	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:57802666G>A	ENST00000360338.3	+	3	1079	c.757G>A	c.(757-759)Gtg>Atg	p.V253M	ZNF460_ENST00000537645.1_Missense_Mutation_p.V212M	NM_006635.3	NP_006626.3	Q14592	ZN460_HUMAN	zinc finger protein 460	253					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TAAGCCCTTTGTGTGCAGTGA	0.542																																						uc002qog.2		NA																	0					0						c.(757-759)GTG>ATG		zinc finger protein 460							88.0	77.0	81.0					19																	57802666		2203	4300	6503	SO:0001583	missense	10794				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:57802666G>A	X78931	CCDS12949.1	19q13.4	2013-01-08				ENSG00000197714		"""Zinc fingers, C2H2-type"", ""-"""	21628	protein-coding gene	gene with protein product		604755	"""zinc finger protein 272"""	ZNF272		15004467	Standard	NM_006635		Approved	HZF8	uc002qog.2	Q14592		ENST00000360338.3:c.757G>A	19.37:g.57802666G>A	ENSP00000353491:p.Val253Met		Somatic				ZNF460_uc010ygv.1_Missense_Mutation_p.V212M	p.V253M	NM_006635	NP_006626	WXS	Illumina HiSeq	Unspecified	Q14592	ZN460_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)	3	1079	+		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)	253			C2H2-type 3.		A4FU64|B4DNX9|Q2VPC7|Q6VSF8	Missense_Mutation	SNP	ENST00000360338.3	37	c.757G>A	CCDS12949.1	.	.	.	.	.	.	.	.	.	.	G	6.467	0.454243	0.12283	.	.	ENSG00000197714	ENST00000537645;ENST00000360338	T;T	0.18657	2.2;2.2	1.49	-1.1	0.09872	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12092	0.0294	N	0.20766	0.605	0.09310	N	1	B	0.12013	0.005	B	0.14023	0.01	T	0.27905	-1.0060	9	0.62326	D	0.03	.	6.3121	0.21171	0.7213:0.0:0.2787:0.0	.	253	Q14592	ZN460_HUMAN	M	212;253	ENSP00000446167:V212M;ENSP00000353491:V253M	ENSP00000353491:V253M	V	+	1	0	ZNF460	62494478	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-4.246000	0.00267	-0.299000	0.08909	0.650000	0.86243	GTG		0.542	ZNF460-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465727.1	NM_006635		30	84	0	0	0	0	30	84				
A1BG	1	broad.mit.edu	37	19	58862906	58862906	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:58862906C>T	ENST00000263100.3	-	5	822	c.761G>A	c.(760-762)aGg>aAg	p.R254K	A1BG-AS1_ENST00000594950.1_RNA|A1BG-AS1_ENST00000599728.1_RNA|A1BG-AS1_ENST00000593374.1_RNA|A1BG-AS1_ENST00000593960.1_RNA|CTD-2619J13.8_ENST00000599109.1_RNA|A1BG-AS1_ENST00000600379.1_RNA|A1BG-AS1_ENST00000600686.1_RNA|A1BG-AS1_ENST00000595302.1_RNA	NM_130786.3	NP_570602.2	P04217	A1BG_HUMAN	alpha-1-B glycoprotein	254	Ig-like V-type 3.					blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|prostate(2)	15		all_cancers(17;3.04e-16)|all_epithelial(17;7.77e-12)|Lung NSC(17;3.25e-05)|Colorectal(82;5.46e-05)|all_lung(17;0.000129)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(17;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0269)		GGTGCTGCTCCTGGGTACCAG	0.627																																						uc002qsd.3		NA																	0					0						c.(760-762)AGG>AAG		alpha 1B-glycoprotein precursor							83.0	68.0	73.0					19																	58862906		2203	4300	6503	SO:0001583	missense	1					extracellular region		g.chr19:58862906C>T		CCDS12976.1	19q13.43	2013-10-15			ENSG00000121410	ENSG00000121410		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5	protein-coding gene	gene with protein product		138670				2591067	Standard	NM_130786		Approved		uc002qsd.4	P04217	OTTHUMG00000183507	ENST00000263100.3:c.761G>A	19.37:g.58862906C>T	ENSP00000263100:p.Arg254Lys		Somatic				NCRNA00181_uc002qse.2_Intron|A1BG_uc002qsf.1_RNA|NCRNA00181_uc002qsg.2_5'Flank	p.R254K	NM_130786	NP_570602	WXS	Illumina HiSeq	Unspecified	P04217	A1BG_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0269)	5	823	-		all_cancers(17;3.04e-16)|all_epithelial(17;7.77e-12)|Lung NSC(17;3.25e-05)|Colorectal(82;5.46e-05)|all_lung(17;0.000129)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(17;0.157)	254			Ig-like V-type 3.		A8K052|Q68CK0|Q8IYJ6|Q96P39	Missense_Mutation	SNP	ENST00000263100.3	37	c.761G>A	CCDS12976.1	.	.	.	.	.	.	.	.	.	.	C	1.689	-0.504519	0.04261	.	.	ENSG00000121410	ENST00000263100;ENST00000453054	T	0.00768	5.72	4.08	-8.16	0.01061	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	2.332680	0.01710	N	0.027693	T	0.00936	0.0031	L	0.29908	0.895	0.09310	N	1	P	0.35139	0.486	B	0.43082	0.407	T	0.45366	-0.9266	10	0.05959	T	0.93	.	12.1691	0.54148	0.1218:0.7128:0.0753:0.0901	.	254	P04217	A1BG_HUMAN	K	254;132	ENSP00000263100:R254K	ENSP00000263100:R254K	R	-	2	0	A1BG	63554718	0.000000	0.05858	0.000000	0.03702	0.118000	0.20060	-2.322000	0.01118	-2.123000	0.00823	-0.502000	0.04539	AGG		0.627	A1BG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466930.1	NM_130786		11	50	0	0	0	0	11	50				
TPO	7173	broad.mit.edu	37	2	1459848	1459848	+	Splice_Site	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:1459848G>T	ENST00000345913.4	+	7	704	c.613G>T	c.(613-615)Gtc>Ttc	p.V205F	TPO_ENST00000337415.3_Splice_Site_p.V205F|TPO_ENST00000329066.4_Splice_Site_p.V205F|TPO_ENST00000349624.3_Splice_Site_p.V205F|TPO_ENST00000382201.3_Splice_Site_p.V205F|TPO_ENST00000346956.3_Splice_Site_p.V205F|TPO_ENST00000382198.1_Splice_Site_p.V205F|TPO_ENST00000497517.2_Intron	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	205					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	TCCTACCCAGGTCCGGGAGGT	0.493																																						uc002qww.2		NA																	0				ovary(7)|pancreas(6)|skin(5)|lung(1)|kidney(1)	20						c.(613-615)GTC>TTC		thyroid peroxidase isoform a	Carbimazole(DB00389)|Methimazole(DB00763)|Propylthiouracil(DB00550)						83.0	62.0	69.0					2																	1459848		2203	4300	6503	SO:0001630	splice_region_variant	7173				cellular nitrogen compound metabolic process|hormone biosynthetic process|hydrogen peroxide catabolic process	cell surface|cytoplasm|integral to plasma membrane	calcium ion binding|heme binding|iodide peroxidase activity	g.chr2:1459848G>T		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.613-1G>T	2.37:g.1459848G>T			Somatic				TPO_uc010ewj.2_Intron|TPO_uc002qwu.2_Missense_Mutation_p.V205F|TPO_uc002qwr.2_Missense_Mutation_p.V205F|TPO_uc002qwx.2_Missense_Mutation_p.V205F|TPO_uc010yio.1_Missense_Mutation_p.V205F|TPO_uc010yip.1_Missense_Mutation_p.V205F	p.V205F	NM_000547	NP_000538	WXS	Illumina HiSeq	Unspecified	P07202	PERT_HUMAN		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	7	704	+	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)	205			Extracellular (Potential).		P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	c.613G>T	CCDS1643.1	.	.	.	.	.	.	.	.	.	.	G	16.75	3.208435	0.58343	.	.	ENSG00000115705	ENST00000337415;ENST00000345913;ENST00000346956;ENST00000349624;ENST00000329066;ENST00000382201;ENST00000382198;ENST00000422464	T;T;T;T;T;T;T;T	0.70045	-0.45;-0.45;-0.45;-0.45;-0.45;-0.45;-0.45;-0.45	4.77	4.77	0.60923	.	0.294706	0.32028	N	0.006697	D	0.85270	0.5658	M	0.89904	3.07	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.994;0.999;0.991;0.997	D	0.88294	0.2945	9	.	.	.	-34.1279	18.1528	0.89679	0.0:0.0:1.0:0.0	.	205;205;205;205	P07202-4;P07202-5;P07202-2;P07202	.;.;.;PERT_HUMAN	F	205;205;205;205;205;205;205;134	ENSP00000337263:V205F;ENSP00000318820:V205F;ENSP00000263886:V205F;ENSP00000332044:V205F;ENSP00000329869:V205F;ENSP00000371636:V205F;ENSP00000371633:V205F;ENSP00000405788:V134F	.	V	+	1	0	TPO	1438855	1.000000	0.71417	0.993000	0.49108	0.238000	0.25445	8.134000	0.89606	2.335000	0.79485	0.563000	0.77884	GTC		0.493	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	Missense_Mutation	7	30	1	0	0.00198382	0.00215702	7	30				
GREB1	9687	broad.mit.edu	37	2	11718542	11718542	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:11718542G>T	ENST00000381486.2	+	6	1057	c.757G>T	c.(757-759)Gga>Tga	p.G253*	GREB1_ENST00000234142.5_Nonsense_Mutation_p.G253*|GREB1_ENST00000381483.2_Nonsense_Mutation_p.G253*|GREB1_ENST00000263834.5_Nonsense_Mutation_p.G253*|GREB1_ENST00000389825.3_Nonsense_Mutation_p.G143*	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	253						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		CATCCTGATGGGAGCTCAGCA	0.622																																					Ovarian(39;850 945 2785 23371 33093)	uc002rbk.1		NA																	0				ovary(1)	1						c.(757-759)GGA>TGA		growth regulation by estrogen in breast cancer 1							54.0	52.0	53.0					2																	11718542		2203	4300	6503	SO:0001587	stop_gained	9687					integral to membrane		g.chr2:11718542G>T		CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.757G>T	2.37:g.11718542G>T	ENSP00000370896:p.Gly253*		Somatic				GREB1_uc002rbl.2_Nonsense_Mutation_p.G253*|GREB1_uc002rbm.2_Nonsense_Mutation_p.G143*|GREB1_uc002rbn.1_Nonsense_Mutation_p.G253*	p.G253*	NM_014668	NP_055483	WXS	Illumina HiSeq	Unspecified	Q4ZG55	GREB1_HUMAN		Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)	6	1057	+	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		253					A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Nonsense_Mutation	SNP	ENST00000381486.2	37	c.757G>T	CCDS42655.1	.	.	.	.	.	.	.	.	.	.	G	37	5.981343	0.97168	.	.	ENSG00000196208	ENST00000381486;ENST00000263834;ENST00000389825;ENST00000381483;ENST00000234142	.	.	.	5.86	4.07	0.47477	.	0.339625	0.28296	N	0.015868	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-48.9858	10.5357	0.45002	0.15:0.0:0.85:0.0	.	.	.	.	X	253;253;143;253;253	.	ENSP00000234142:G253X	G	+	1	0	GREB1	11635993	1.000000	0.71417	0.184000	0.23157	0.010000	0.07245	4.487000	0.60293	0.834000	0.34852	0.655000	0.94253	GGA		0.622	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	NM_014668		24	63	1	0	1.11e-12	1.55e-12	24	63				
ATRAID	51374	broad.mit.edu	37	2	27438549	27438549	+	Missense_Mutation	SNP	A	A	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:27438549A>G	ENST00000606999.1	+	5	473	c.415A>G	c.(415-417)Act>Gct	p.T139A	ATRAID_ENST00000380171.3_Missense_Mutation_p.T194A|ATRAID_ENST00000405489.3_Missense_Mutation_p.T81A|CAD_ENST00000264705.4_5'Flank|CAD_ENST00000403525.1_5'Flank	NM_001170795.1	NP_001164266.1	Q6UW56	ARAID_HUMAN	all-trans retinoic acid-induced differentiation factor	139					cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)											TGCCTGGAATACTATCACCTC	0.423																																						uc002rjf.2		NA																	0				skin(1)	1						c.(580-582)ACT>GCT		apoptosis related protein 3 isoform b							128.0	127.0	127.0					2																	27438549		2203	4300	6503	SO:0001583	missense	51374					integral to membrane|plasma membrane		g.chr2:27438549A>G	BC021237	CCDS1741.1, CCDS46243.1, CCDS62877.1	2p23.3	2012-08-01	2012-07-30	2012-07-30	ENSG00000138085	ENSG00000138085			24090	protein-coding gene	gene with protein product	"""apoptosis-related protein 3"""		"""chromosome 2 open reading frame 28"""	C2orf28		17524364, 21723284	Standard	NM_016085		Approved	HSPC013, p18, APR3	uc002rjf.3	Q6UW56	OTTHUMG00000128405	ENST00000606999.1:c.415A>G	2.37:g.27438549A>G	ENSP00000476080:p.Thr139Ala		Somatic				C2orf28_uc002rjg.2_Missense_Mutation_p.T81A|C2orf28_uc002rjh.2_5'Flank|CAD_uc002rji.2_5'Flank|CAD_uc010eyw.2_5'Flank	p.T194A	NM_080592	NP_542159	WXS	Illumina HiSeq	Unspecified	Q6UW56	APR3_HUMAN			5	753	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		139			Extracellular (Potential).		A8C1S2|A8K779|Q96FF6|Q96RT2|Q9Y2R7|Q9Y5L7	Missense_Mutation	SNP	ENST00000606999.1	37	c.580A>G		.	.	.	.	.	.	.	.	.	.	A	8.804	0.933665	0.18206	.	.	ENSG00000138085	ENST00000380171;ENST00000405489	T;T	0.41758	1.62;0.99	5.49	3.0	0.34707	.	0.418784	0.28677	N	0.014501	T	0.35566	0.0936	L	0.51422	1.61	0.09310	N	1	B;P	0.34587	0.058;0.458	B;B	0.35039	0.059;0.194	T	0.15607	-1.0431	10	0.42905	T	0.14	-15.41	9.7141	0.40263	0.6691:0.3309:0.0:0.0	.	139;194	Q6UW56;Q6UW56-3	APR3_HUMAN;.	A	194;81	ENSP00000369518:T194A;ENSP00000384033:T81A	ENSP00000369518:T194A	T	+	1	0	C2orf28	27292053	0.000000	0.05858	0.001000	0.08648	0.689000	0.40095	0.488000	0.22371	0.336000	0.23639	0.482000	0.46254	ACT		0.423	ATRAID-007	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470709.1	NM_016085		55	137	0	0	0	0	55	137				
SLC30A3	7781	broad.mit.edu	37	2	27480193	27480193	+	Silent	SNP	C	C	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:27480193C>G	ENST00000233535.4	-	5	958	c.606G>C	c.(604-606)ggG>ggC	p.G202G	SLC30A3_ENST00000447008.2_Silent_p.G197G	NM_003459.4	NP_003450.2	Q99726	ZNT3_HUMAN	solute carrier family 30 (zinc transporter), member 3	202					positive regulation of transport (GO:0051050)|regulation of sequestering of zinc ion (GO:0061088)|transmembrane transport (GO:0055085)|transport (GO:0006810)|zinc ion transmembrane transport (GO:0071577)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	zinc transporting ATPase activity (GO:0015633)			NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(11)|pancreas(1)	20	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGTGGGGGGGCCCAGCCTGGT	0.662																																						uc002rjk.2		NA																	0					0						c.(604-606)GGG>GGC		solute carrier family 30 (zinc transporter),							16.0	18.0	18.0					2																	27480193		2203	4299	6502	SO:0001819	synonymous_variant	7781				regulation of sequestering of zinc ion	cell junction|integral to plasma membrane|late endosome|membrane fraction|synaptic vesicle membrane	zinc transporting ATPase activity	g.chr2:27480193C>G	U76010	CCDS1743.1	2p23.3	2013-05-22			ENSG00000115194	ENSG00000115194		"""Solute carriers"""	11014	protein-coding gene	gene with protein product		602878		ZNT3		8962159	Standard	NM_003459		Approved		uc002rjj.3	Q99726	OTTHUMG00000128409	ENST00000233535.4:c.606G>C	2.37:g.27480193C>G			Somatic				SLC30A3_uc002rjj.2_Missense_Mutation_p.G48A|SLC30A3_uc010ylh.1_Silent_p.G197G	p.G202G	NM_003459	NP_003450	WXS	Illumina HiSeq	Unspecified	Q99726	ZNT3_HUMAN			5	792	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		202			Cytoplasmic (Potential).		Q8TC03	Silent	SNP	ENST00000233535.4	37	c.606G>C	CCDS1743.1																																																																																				0.662	SLC30A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250189.2			8	17	0	0	0	0	8	17				
ABCG8	64241	broad.mit.edu	37	2	44079562	44079562	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:44079562C>T	ENST00000272286.2	+	5	721	c.631C>T	c.(631-633)Cgg>Tgg	p.R211W		NM_022437.2	NP_071882.1	Q9H221	ABCG8_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 8	211	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|phospholipid transport (GO:0015914)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein heterodimerization activity (GO:0046982)|sterol transporter activity (GO:0015248)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(21)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	CATGTACGTGCGGGGGTTGTC	0.667																																						uc002rtq.2		NA																	0				skin(3)|ovary(1)	4						c.(631-633)CGG>TGG		ATP-binding cassette sub-family G member 8							33.0	37.0	36.0					2																	44079562		2203	4300	6503	SO:0001583	missense	64241				cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity	g.chr2:44079562C>T	AF320294	CCDS1815.1	2p21	2012-03-14	2008-07-31		ENSG00000143921	ENSG00000143921		"""ATP binding cassette transporters / subfamily G"""	13887	protein-coding gene	gene with protein product	"""gallbladder disease 4"", ""sterolin 2"""	605460	"""ATP-binding cassette, sub-family G (WHITE), member 8 (sterolin 2)"""			11099417, 17626266	Standard	NM_022437		Approved	GBD4	uc002rtq.3	Q9H221	OTTHUMG00000128756	ENST00000272286.2:c.631C>T	2.37:g.44079562C>T	ENSP00000272286:p.Arg211Trp		Somatic				ABCG8_uc010yoa.1_Missense_Mutation_p.R211W	p.R211W	NM_022437	NP_071882	WXS	Illumina HiSeq	Unspecified	Q9H221	ABCG8_HUMAN			5	721	+		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	211			ABC transporter.|Cytoplasmic (Potential).		Q53QN8	Missense_Mutation	SNP	ENST00000272286.2	37	c.631C>T	CCDS1815.1	.	.	.	.	.	.	.	.	.	.	C	14.76	2.632816	0.47049	.	.	ENSG00000143921	ENST00000272286	T	0.31510	1.49	5.11	4.2	0.49525	ABC transporter-like (2);	0.096478	0.64402	D	0.000002	T	0.59569	0.2203	M	0.88031	2.925	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.67122	-0.5750	10	0.87932	D	0	.	12.0607	0.53561	0.3066:0.6934:0.0:0.0	.	211;211	Q9H221-2;Q9H221	.;ABCG8_HUMAN	W	211	ENSP00000272286:R211W	ENSP00000272286:R211W	R	+	1	2	ABCG8	43933066	1.000000	0.71417	0.608000	0.28969	0.008000	0.06430	1.569000	0.36428	2.371000	0.80710	0.561000	0.74099	CGG		0.667	ABCG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250671.1	NM_022437		19	44	0	0	0	0	19	44				
SPTBN1	6711	broad.mit.edu	37	2	54753686	54753686	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:54753686G>T	ENST00000356805.4	+	2	412	c.131G>T	c.(130-132)cGc>cTc	p.R44L	AC092839.3_ENST00000433475.1_RNA	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	44	Actin-binding.				actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			GAGCGGTCCCGCATCAAGGCT	0.537																																						uc002rxu.2		NA																	0				ovary(3)|breast(2)|central_nervous_system(2)|skin(1)	8						c.(130-132)CGC>CTC		spectrin, beta, non-erythrocytic 1 isoform 1							95.0	87.0	90.0					2																	54753686		2203	4300	6503	SO:0001583	missense	6711				actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton	g.chr2:54753686G>T		CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.131G>T	2.37:g.54753686G>T	ENSP00000349259:p.Arg44Leu		Somatic				SPTBN1_uc002rxv.1_Missense_Mutation_p.R44L|RPL23AP32_uc010yot.1_5'Flank	p.R44L	NM_003128	NP_003119	WXS	Illumina HiSeq	Unspecified	Q01082	SPTB2_HUMAN	Lung(47;0.24)		2	380	+			44			Actin-binding.		B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Missense_Mutation	SNP	ENST00000356805.4	37	c.131G>T	CCDS33198.1	.	.	.	.	.	.	.	.	.	.	G	36	5.653028	0.96724	.	.	ENSG00000115306	ENST00000356805;ENST00000389980	T;T	0.26067	1.76;1.76	5.77	5.77	0.91146	Calponin homology domain (1);	0.064498	0.64402	D	0.000016	T	0.63896	0.2550	M	0.92738	3.34	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.72151	-0.4377	10	0.87932	D	0	.	20.0007	0.97408	0.0:0.0:1.0:0.0	.	44	Q01082	SPTB2_HUMAN	L	44	ENSP00000349259:R44L;ENSP00000374630:R44L	ENSP00000349259:R44L	R	+	2	0	SPTBN1	54607190	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.837000	0.99465	2.726000	0.93360	0.650000	0.86243	CGC		0.537	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3			16	42	1	0	4.75e-09	6.24e-09	16	42				
CTNNA2	1496	broad.mit.edu	37	2	79971585	79971585	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:79971585G>T	ENST00000402739.4	+	2	180	c.175G>T	c.(175-177)Gta>Tta	p.V59L	CTNNA2_ENST00000361291.4_Missense_Mutation_p.V93L|CTNNA2_ENST00000466387.1_Missense_Mutation_p.V59L|CTNNA2_ENST00000496558.1_Missense_Mutation_p.V59L|CTNNA2_ENST00000540488.1_Missense_Mutation_p.V59L|CTNNA2_ENST00000541047.1_Missense_Mutation_p.V59L	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	59					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						GAAAGCCCATGTACTAGCTGC	0.433																																						uc010ysh.1		NA																	0				pancreas(4)|lung(3)|breast(1)|skin(1)	9						c.(175-177)GTA>TTA		catenin, alpha 2 isoform 1							76.0	77.0	77.0					2																	79971585		1922	4130	6052	SO:0001583	missense	1496				axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton	g.chr2:79971585G>T		CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.175G>T	2.37:g.79971585G>T	ENSP00000384638:p.Val59Leu		Somatic				CTNNA2_uc010yse.1_Missense_Mutation_p.V59L|CTNNA2_uc010ysf.1_Missense_Mutation_p.V59L|CTNNA2_uc010ysg.1_Missense_Mutation_p.V59L	p.V59L	NM_004389	NP_004380	WXS	Illumina HiSeq	Unspecified	P26232	CTNA2_HUMAN			2	180	+			59					B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	ENST00000402739.4	37	c.175G>T		.	.	.	.	.	.	.	.	.	.	G	20.2	3.947270	0.73672	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000451966;ENST00000409971;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488	T;T;T;T;T;T;T;T	0.36878	1.23;1.23;1.23;1.23;1.23;1.23;1.23;1.23	5.49	5.49	0.81192	.	0.000000	0.64402	D	0.000001	T	0.42966	0.1226	M	0.84683	2.71	0.58432	D	0.999999	B;P;B	0.36010	0.076;0.532;0.389	B;B;B	0.32928	0.155;0.14;0.08	T	0.42865	-0.9426	10	0.19590	T	0.45	.	16.8625	0.86021	0.0:0.0:1.0:0.0	.	59;59;59	P26232;P26232-3;P26232-2	CTNA2_HUMAN;.;.	L	59;59;59;59;93;59;59;59	ENSP00000418191:V59L;ENSP00000419295:V59L;ENSP00000400105:V59L;ENSP00000387073:V59L;ENSP00000355398:V93L;ENSP00000384638:V59L;ENSP00000444675:V59L;ENSP00000441705:V59L	ENSP00000355398:V93L	V	+	1	0	CTNNA2	79825093	1.000000	0.71417	0.146000	0.22360	0.960000	0.62799	9.827000	0.99397	2.582000	0.87167	0.460000	0.39030	GTA		0.433	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000328511.4	NM_004389		13	38	1	0	1.42e-15	2.04e-15	13	38				
CTNNA2	1496	broad.mit.edu	37	2	80831210	80831210	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:80831210C>A	ENST00000402739.4	+	15	2206	c.2201C>A	c.(2200-2202)cCa>cAa	p.P734Q	CTNNA2_ENST00000361291.4_Missense_Mutation_p.P768Q|AC008067.2_ENST00000599412.2_RNA|AC008067.2_ENST00000596887.1_RNA|CTNNA2_ENST00000343114.3_Missense_Mutation_p.P413Q|AC008067.2_ENST00000595478.1_RNA|CTNNA2_ENST00000466387.1_Missense_Mutation_p.P734Q|AC008067.2_ENST00000430876.1_RNA|AC008067.2_ENST00000596783.1_RNA|CTNNA2_ENST00000496558.1_Missense_Mutation_p.P734Q|AC008067.2_ENST00000609950.1_RNA|CTNNA2_ENST00000540488.1_Missense_Mutation_p.P734Q|CTNNA2_ENST00000541047.1_Missense_Mutation_p.P734Q	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	734					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						GGCAAAGGCCCATTGAAAAAT	0.408																																						uc010ysh.1		NA																	0				pancreas(4)|lung(3)|breast(1)|skin(1)	9						c.(2200-2202)CCA>CAA		catenin, alpha 2 isoform 1							83.0	77.0	79.0					2																	80831210		1874	4121	5995	SO:0001583	missense	1496				axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton	g.chr2:80831210C>A		CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.2201C>A	2.37:g.80831210C>A	ENSP00000384638:p.Pro734Gln		Somatic				CTNNA2_uc010yse.1_Missense_Mutation_p.P734Q|CTNNA2_uc010ysf.1_Missense_Mutation_p.P734Q|CTNNA2_uc010ysg.1_Missense_Mutation_p.P734Q|CTNNA2_uc010ysi.1_Missense_Mutation_p.P366Q|CTNNA2_uc010ysj.1_Missense_Mutation_p.P63Q	p.P734Q	NM_004389	NP_004380	WXS	Illumina HiSeq	Unspecified	P26232	CTNA2_HUMAN			15	2206	+			734					B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	ENST00000402739.4	37	c.2201C>A		.	.	.	.	.	.	.	.	.	.	C	32	5.176755	0.94846	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488;ENST00000343114	T;T;T;T;T;T;T	0.55760	0.5;0.5;0.5;0.5;0.5;0.5;0.5	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.79370	0.4434	M	0.90425	3.115	0.80722	D	1	P;D;D;D	0.89917	0.84;1.0;0.998;1.0	P;D;D;D	0.83275	0.69;0.996;0.988;0.993	T	0.82094	-0.0627	9	.	.	.	.	19.9392	0.97153	0.0:1.0:0.0:0.0	.	366;734;734;734	F6KRI5;P26232;P26232-3;P26232-2	.;CTNA2_HUMAN;.;.	Q	734;734;768;734;734;734;413	ENSP00000418191:P734Q;ENSP00000419295:P734Q;ENSP00000355398:P768Q;ENSP00000384638:P734Q;ENSP00000444675:P734Q;ENSP00000441705:P734Q;ENSP00000341500:P413Q	.	P	+	2	0	CTNNA2	80684721	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.764000	0.85297	2.713000	0.92767	0.655000	0.94253	CCA		0.408	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000328511.4	NM_004389		12	41	1	0	1.05e-09	1.41e-09	12	41				
ZAP70	7535	broad.mit.edu	37	2	98340653	98340653	+	Missense_Mutation	SNP	C	C	T	rs377195771		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:98340653C>T	ENST00000264972.5	+	3	369	c.154C>T	c.(154-156)Cac>Tac	p.H52Y	ZAP70_ENST00000442208.1_5'Flank	NM_001079.3	NP_001070.2	P43403	ZAP70_HUMAN	zeta-chain (TCR) associated protein kinase 70kDa	52	SH2 1. {ECO:0000255|PROSITE- ProRule:PRU00191}.				adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|beta selection (GO:0043366)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative thymic T cell selection (GO:0045060)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of T cell differentiation (GO:0045582)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell activation (GO:0042110)|T cell aggregation (GO:0070489)|T cell differentiation (GO:0030217)|T cell migration (GO:0072678)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	29						GTCGCTCGTGCACGATGTGCG	0.677																																						uc002syd.1		NA																	0				lung(4)|upper_aerodigestive_tract(1)|ovary(1)	6						c.(154-156)CAC>TAC		zeta-chain associated protein kinase 70kDa							21.0	18.0	19.0					2																	98340653		2202	4299	6501	SO:0001583	missense	7535				immune response|intracellular protein kinase cascade|positive thymic T cell selection|T cell receptor signaling pathway	cytosol|T cell receptor complex	ATP binding|non-membrane spanning protein tyrosine kinase activity	g.chr2:98340653C>T	L05148	CCDS33254.1, CCDS33255.1	2q11-q13	2014-09-17	2002-08-29		ENSG00000115085	ENSG00000115085		"""SH2 domain containing"""	12858	protein-coding gene	gene with protein product		176947	"""zeta-chain (TCR) associated protein kinase (70 kD)"""	SRK		1423621	Standard	NM_001079		Approved	ZAP-70, STD	uc002syd.1	P43403	OTTHUMG00000153060	ENST00000264972.5:c.154C>T	2.37:g.98340653C>T	ENSP00000264972:p.His52Tyr		Somatic				ZAP70_uc010yvf.1_Missense_Mutation_p.H52Y|ZAP70_uc002sye.1_5'Flank	p.H52Y	NM_001079	NP_001070	WXS	Illumina HiSeq	Unspecified	P43403	ZAP70_HUMAN			3	361	+			52			SH2 1.		A6NFP4|Q6PIA4|Q8IXD6|Q9UBS6	Missense_Mutation	SNP	ENST00000264972.5	37	c.154C>T	CCDS33254.1	.	.	.	.	.	.	.	.	.	.	C	6.392	0.440527	0.12104	.	.	ENSG00000115085	ENST00000264972	T	0.25085	1.82	4.6	3.7	0.42460	SH2 motif (4);	0.262989	0.27349	N	0.019772	T	0.09202	0.0227	N	0.04724	-0.175	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.06405	0.001;0.002	T	0.18681	-1.0329	10	0.02654	T	1	.	7.7037	0.28638	0.0:0.8046:0.0:0.1954	.	52;52	B4E0E2;P43403	.;ZAP70_HUMAN	Y	52	ENSP00000264972:H52Y	ENSP00000264972:H52Y	H	+	1	0	ZAP70	97707085	0.999000	0.42202	1.000000	0.80357	0.895000	0.52256	2.597000	0.46214	2.306000	0.77630	0.460000	0.39030	CAC		0.677	ZAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329278.1			8	8	0	0	0	0	8	8				
VWA3B	200403	broad.mit.edu	37	2	98851213	98851213	+	Missense_Mutation	SNP	C	C	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:98851213C>G	ENST00000477737.1	+	17	2615	c.2411C>G	c.(2410-2412)aCt>aGt	p.T804S		NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	804										NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						AGCCGGAGGACTGCTCTAAGT	0.532																																						uc002syo.2		NA																	0				ovary(3)|large_intestine(2)|skin(1)	6						c.(2410-2412)ACT>AGT		von Willebrand factor A domain containing 3B							56.0	58.0	57.0					2																	98851213		1991	4180	6171	SO:0001583	missense	200403							g.chr2:98851213C>G	AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.2411C>G	2.37:g.98851213C>G	ENSP00000417955:p.Thr804Ser		Somatic				VWA3B_uc002syk.1_RNA|VWA3B_uc002syl.1_Missense_Mutation_p.T323S|VWA3B_uc002sym.2_Missense_Mutation_p.T804S|VWA3B_uc002syn.1_RNA|VWA3B_uc010yvi.1_Missense_Mutation_p.T461S|VWA3B_uc002syp.1_Missense_Mutation_p.T196S|VWA3B_uc002syq.1_Missense_Mutation_p.T80S|VWA3B_uc002syr.1_Missense_Mutation_p.T121S|VWA3B_uc010fih.1_5'Flank	p.T804S	NM_144992	NP_659429	WXS	Illumina HiSeq	Unspecified	Q502W6	VWA3B_HUMAN			17	2675	+			804					B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Missense_Mutation	SNP	ENST00000477737.1	37	c.2411C>G	CCDS42718.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	2.994|2.994	-0.207531|-0.207531	0.06180|0.06180	.|.	.|.	ENSG00000168658|ENSG00000168658	ENST00000473149|ENST00000477737	.|T	.|0.06068	.|3.35	3.17|3.17	-1.34|-1.34	0.09143|0.09143	.|.	.|2.383750	.|0.01507	.|N	.|0.017772	T|T	0.07863|0.07863	0.0197|0.0197	L|L	0.54323|0.54323	1.7|1.7	0.09310|0.09310	N|N	1|1	.|B;B;B;B	.|0.17268	.|0.021;0.001;0.009;0.003	.|B;B;B;B	.|0.13407	.|0.009;0.002;0.009;0.001	T|T	0.39603|0.39603	-0.9606|-0.9606	5|10	.|0.21014	.|T	.|0.42	.|.	6.559|6.559	0.22476|0.22476	0.0:0.3678:0.0:0.6322|0.0:0.3678:0.0:0.6322	.|.	.|196;804;804;804	.|Q502W6-5;Q502W6;Q502W6-8;Q502W6-6	.|.;VWA3B_HUMAN;.;.	E|S	214|804	.|ENSP00000417955:T804S	.|ENSP00000417955:T804S	D|T	+|+	3|2	2|0	VWA3B|VWA3B	98217645|98217645	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.109000|0.109000	0.19521|0.19521	-0.188000|-0.188000	0.09642|0.09642	-0.188000|-0.188000	0.10499|0.10499	0.484000|0.484000	0.47621|0.47621	GAC|ACT		0.532	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353469.2	NM_144992		18	34	0	0	0	0	18	34				
NMS	129521	broad.mit.edu	37	2	101098739	101098739	+	Splice_Site	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:101098739C>A	ENST00000376865.1	+	9	422	c.415C>A	c.(415-417)Ccc>Acc	p.P139T		NM_001011717.1	NP_001011717.1	Q5H8A3	NMS_HUMAN	neuromedin S	139					neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				breast(1)|large_intestine(4)|lung(7)|ovary(1)|stomach(1)	14						TTTTTTTCAGCCCAGGAATGG	0.423																																						uc002tan.1		NA																	0				ovary(1)	1						c.(415-417)CCC>ACC		neuromedin S precursor							205.0	197.0	200.0					2																	101098739		2203	4300	6503	SO:0001630	splice_region_variant	129521				neuropeptide signaling pathway|regulation of smooth muscle contraction	extracellular region		g.chr2:101098739C>A	AB164464	CCDS33259.1	2q11.2	2013-02-26			ENSG00000204640	ENSG00000204640		"""Endogenous ligands"""	32203	protein-coding gene	gene with protein product	"""prepro-NMS"""					15635449	Standard	NM_001011717		Approved		uc002tan.1	Q5H8A3	OTTHUMG00000153142	ENST00000376865.1:c.415-1C>A	2.37:g.101098739C>A			Somatic					p.P139T	NM_001011717	NP_001011717	WXS	Illumina HiSeq	Unspecified	Q5H8A3	NMS_HUMAN			9	422	+			139						Missense_Mutation	SNP	ENST00000376865.1	37	c.415C>A	CCDS33259.1	.	.	.	.	.	.	.	.	.	.	C	15.55	2.866526	0.51588	.	.	ENSG00000204640	ENST00000376865	T	0.54675	0.56	4.12	3.22	0.36961	.	0.235951	0.34110	N	0.004242	T	0.60766	0.2294	M	0.64170	1.965	0.35205	D	0.774614	D	0.58620	0.983	P	0.57502	0.822	T	0.69495	-0.5130	9	.	.	.	-0.4654	9.9117	0.41411	0.0:0.7918:0.2082:0.0	.	139	Q5H8A3	NMS_HUMAN	T	139	ENSP00000366061:P139T	.	P	+	1	0	NMS	100465171	1.000000	0.71417	0.999000	0.59377	0.871000	0.50021	0.754000	0.26390	1.046000	0.40249	0.655000	0.94253	CCC		0.423	NMS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329737.1	NM_001011717	Missense_Mutation	15	90	1	0	1.36e-06	1.67e-06	15	90				
IL1RL1	9173	broad.mit.edu	37	2	102955393	102955393	+	Missense_Mutation	SNP	C	C	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:102955393C>G	ENST00000233954.1	+	3	429	c.158C>G	c.(157-159)aCa>aGa	p.T53R	IL1RL1_ENST00000311734.2_Missense_Mutation_p.T53R|IL1RL1_ENST00000393393.3_Missense_Mutation_p.T53R|IL1RL1_ENST00000404917.2_Intron|IL1RL1_ENST00000473175.1_3'UTR|IL1RL1_ENST00000409584.1_Missense_Mutation_p.T53R	NM_016232.4	NP_057316.3	Q01638	ILRL1_HUMAN	interleukin 1 receptor-like 1	53	Ig-like C2-type 1.				immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of T-helper 1 type immune response (GO:0002826)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of macrophage activation (GO:0043032)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	cytokine receptor activity (GO:0004896)|interleukin-1 receptor activity (GO:0004908)|interleukin-33 receptor activity (GO:0002114)|receptor signaling protein activity (GO:0005057)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(3)|urinary_tract(1)	16						TACTCACAAACAAACAAAAGT	0.418																																						uc002tbu.1		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(157-159)ACA>AGA		interleukin 1 receptor-like 1 isoform 1							184.0	184.0	184.0					2																	102955393		2203	4300	6503	SO:0001583	missense	9173				innate immune response	integral to membrane	interleukin-1 receptor activity|receptor signaling protein activity	g.chr2:102955393C>G	D12764	CCDS2057.1, CCDS2058.1, CCDS74548.1	2q12	2013-01-29			ENSG00000115602	ENSG00000115602		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5998	protein-coding gene	gene with protein product	"""homolog of mouse growth stimulation-expressed"""	601203				1482686, 10191101, 16286016	Standard	NM_016232		Approved	ST2, FIT-1, ST2L, ST2V, DER4, T1, IL33R	uc002tbu.1	Q01638	OTTHUMG00000130782	ENST00000233954.1:c.158C>G	2.37:g.102955393C>G	ENSP00000233954:p.Thr53Arg		Somatic				IL1RL1_uc010ywa.1_Intron|IL18R1_uc002tbw.3_Intron|IL1RL1_uc002tbv.2_Missense_Mutation_p.T53R	p.T53R	NM_016232	NP_057316	WXS	Illumina HiSeq	Unspecified	Q01638	ILRL1_HUMAN			3	429	+			53			Extracellular (Potential).|Ig-like C2-type 1.		A8K6B3|B4E0I3|Q53TU7|Q8NEJ3|Q9ULV7|Q9UQ44	Missense_Mutation	SNP	ENST00000233954.1	37	c.158C>G	CCDS2057.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.758450	0.89843	.	.	ENSG00000115602	ENST00000233954;ENST00000393393;ENST00000311734;ENST00000409584	T;T;T;T	0.76709	-1.04;-1.04;-1.04;-1.04	6.03	5.13	0.70059	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.507833	0.20712	N	0.087076	D	0.83599	0.5289	L	0.52364	1.645	0.36362	D	0.860762	D;D	0.76494	0.999;0.998	D;D	0.72982	0.964;0.979	D	0.85709	0.1318	10	0.41790	T	0.15	.	12.4371	0.55604	0.1675:0.8325:0.0:0.0	.	53;53	Q01638-2;Q01638	.;ILRL1_HUMAN	R	53	ENSP00000233954:T53R;ENSP00000377052:T53R;ENSP00000310371:T53R;ENSP00000386618:T53R	ENSP00000233954:T53R	T	+	2	0	IL1RL1	102321825	0.204000	0.23447	0.324000	0.25361	0.750000	0.42670	1.427000	0.34881	1.493000	0.48517	0.655000	0.94253	ACA		0.418	IL1RL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253296.1	NM_016232		54	231	0	0	0	0	54	231				
GPR45	11250	broad.mit.edu	37	2	105859167	105859167	+	Silent	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:105859167C>T	ENST00000258456.1	+	1	968	c.852C>T	c.(850-852)tcC>tcT	p.S284S		NM_007227.3	NP_009158.3	Q9Y5Y3	GPR45_HUMAN	G protein-coupled receptor 45	284						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.S284S(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	28						TGCCCCACTCCGTCTACAGCC	0.587																																						uc002tco.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|breast(1)|central_nervous_system(1)	3						c.(850-852)TCC>TCT		G protein-coupled receptor 45							179.0	171.0	174.0					2																	105859167		2203	4300	6503	SO:0001819	synonymous_variant	11250					integral to membrane|plasma membrane	G-protein coupled receptor activity|protein binding	g.chr2:105859167C>T	AF118266	CCDS2066.1	2q11.1-q12	2012-08-21			ENSG00000135973	ENSG00000135973		"""GPCR / Class A : Orphans"""	4503	protein-coding gene	gene with protein product		604838				10036181	Standard	NM_007227		Approved	PSP24, PSP24A	uc002tco.1	Q9Y5Y3	OTTHUMG00000130805	ENST00000258456.1:c.852C>T	2.37:g.105859167C>T			Somatic					p.S284S	NM_007227	NP_009158	WXS	Illumina HiSeq	Unspecified	Q9Y5Y3	GPR45_HUMAN			1	968	+			284			Helical; Name=6; (Potential).		Q6NWS4|Q6NXU6	Silent	SNP	ENST00000258456.1	37	c.852C>T	CCDS2066.1																																																																																				0.587	GPR45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253348.1	NM_007227		75	220	0	0	0	0	75	220				
IL36B	27177	broad.mit.edu	37	2	113788710	113788710	+	Silent	SNP	A	A	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:113788710A>G	ENST00000259213.4	-	3	143	c.36T>C	c.(34-36)taT>taC	p.Y12Y	IL36B_ENST00000327407.2_Silent_p.Y12Y	NM_014438.3	NP_055253.2	Q9NZH7	IL36B_HUMAN	interleukin 36, beta	12					immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of T cell differentiation (GO:0045582)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	interleukin-1 receptor binding (GO:0005149)			kidney(1)|ovary(1)|pancreas(1)	3						CACGAATAGCATAGGATTTGG	0.463																																						uc002tiq.1		NA																	0				ovary(1)	1						c.(34-36)TAT>TAC		interleukin 1 family, member 8 isoform 1							102.0	91.0	95.0					2																	113788710		2203	4300	6503	SO:0001819	synonymous_variant	27177				immune response	extracellular space	cytokine activity|interleukin-1 receptor binding	g.chr2:113788710A>G	AF201833	CCDS2109.1, CCDS2110.1	2q14	2011-07-14	2011-06-06	2011-06-06	ENSG00000136696	ENSG00000136696		"""Interleukins and interleukin receptors"""	15564	protein-coding gene	gene with protein product		605508	"""interleukin 1 family, member 8 (eta)"""	IL1F8		10625660, 10512743, 16646978	Standard	NM_173178		Approved	FIL1, IL-1H2, IL-1F8, FILI-(ETA), IL1-ETA, IL1H2, MGC126880, MGC126882	uc002tiq.1	Q9NZH7	OTTHUMG00000131338	ENST00000259213.4:c.36T>C	2.37:g.113788710A>G			Somatic				IL1F8_uc002tir.1_Silent_p.Y12Y	p.Y12Y	NM_014438	NP_055253	WXS	Illumina HiSeq	Unspecified	Q9NZH7	IL36B_HUMAN			3	140	-			12					Q3MIH0|Q53SR6|Q7RTZ7|Q9UHA5	Silent	SNP	ENST00000259213.4	37	c.36T>C	CCDS2109.1																																																																																				0.463	IL36B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254110.1	NM_014438		15	44	0	0	0	0	15	44				
CNTNAP5	129684	broad.mit.edu	37	2	125285021	125285021	+	Missense_Mutation	SNP	G	G	A	rs367937965		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:125285021G>A	ENST00000431078.1	+	10	1998	c.1634G>A	c.(1633-1635)aGc>aAc	p.S545N		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	545					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		GATCTGTGTAGCATCAAAGAC	0.398																																						uc002tno.2		NA																	0				ovary(10)	10						c.(1633-1635)AGC>AAC		contactin associated protein-like 5 precursor		G	ASN/SER	1,3781		0,1,1890	135.0	132.0	133.0		1634	5.6	1.0	2		133	0,8200		0,0,4100	no	missense	CNTNAP5	NM_130773.2	46	0,1,5990	AA,AG,GG		0.0,0.0264,0.0083	benign	545/1307	125285021	1,11981	1891	4100	5991	SO:0001583	missense	129684				cell adhesion|signal transduction	integral to membrane	receptor binding	g.chr2:125285021G>A	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.1634G>A	2.37:g.125285021G>A	ENSP00000399013:p.Ser545Asn		Somatic				CNTNAP5_uc010flu.2_Missense_Mutation_p.S546N	p.S545N	NM_130773	NP_570129	WXS	Illumina HiSeq	Unspecified	Q8WYK1	CNTP5_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.248)	10	1998	+			545			Extracellular (Potential).		Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	37	c.1634G>A	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	G	11.70	1.716011	0.30413	2.64E-4	0.0	ENSG00000155052	ENST00000431078	D	0.87729	-2.29	5.58	5.58	0.84498	Concanavalin A-like lectin/glucanase, subgroup (1);	0.243164	0.28996	N	0.013461	D	0.82300	0.5007	L	0.46947	1.48	0.29570	N	0.849996	P	0.36222	0.544	B	0.33339	0.162	T	0.79225	-0.1891	10	0.33940	T	0.23	.	13.8766	0.63655	0.0753:0.0:0.9247:0.0	.	545	Q8WYK1	CNTP5_HUMAN	N	545	ENSP00000399013:S545N	ENSP00000399013:S545N	S	+	2	0	CNTNAP5	125001491	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.186000	0.50942	2.629000	0.89072	0.650000	0.86243	AGC		0.398	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3			38	120	0	0	0	0	38	120				
GPR17	2840	broad.mit.edu	37	2	128408390	128408390	+	Silent	SNP	G	G	A	rs145234598		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:128408390G>A	ENST00000272644.3	+	3	239	c.165G>A	c.(163-165)acG>acA	p.T55T	LIMS2_ENST00000410011.1_Intron|GPR17_ENST00000486700.1_3'UTR|LIMS2_ENST00000409254.1_5'Flank|LIMS2_ENST00000409808.2_Intron|LIMS2_ENST00000355119.4_Intron|LIMS2_ENST00000410038.1_5'Flank|LIMS2_ENST00000545738.2_Intron|GPR17_ENST00000393018.3_Silent_p.T55T|GPR17_ENST00000544369.1_Silent_p.T55T|LIMS2_ENST00000324938.5_Intron|LIMS2_ENST00000409455.1_Intron	NM_001161416.1|NM_001161417.1|NM_005291.2	NP_001154888.1|NP_001154889.1|NP_005282.1	Q13304	GPR17_HUMAN	G protein-coupled receptor 17	55					chemokine-mediated signaling pathway (GO:0070098)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)|urinary_tract(1)	19	Colorectal(110;0.1)	Ovarian(717;0.15)		BRCA - Breast invasive adenocarcinoma(221;0.0677)		gccaggagacgccactggaga	0.547											OREG0014966	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	1	0.000199681	0.0	0.0	5008	,	,		18174	0.0		0.0	False		,,,				2504	0.001					uc010yzn.1		NA																	0					0						c.(163-165)ACG>ACA		G protein-coupled receptor 17 isoform a		G	,,,,,,,	0,4406		0,0,2203	108.0	104.0	105.0		,,,165,81,81,165,	-7.6	0.0	2	dbSNP_134	105	2,8598	2.2+/-6.3	0,2,4298	no	intron,intron,intron,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,intron	GPR17,LIMS2	NM_001136037.2,NM_001161403.1,NM_001161404.1,NM_001161415.1,NM_001161416.1,NM_001161417.1,NM_005291.2,NM_017980.4	,,,,,,,	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	,,,,,,,	,,,55/368,27/340,27/340,55/368,	128408390	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	2840					integral to plasma membrane	chemokine receptor activity|purinergic nucleotide receptor activity, G-protein coupled	g.chr2:128408390G>A		CCDS2148.1	2q21	2014-01-30			ENSG00000144230	ENSG00000144230		"""GPCR / Class A : Orphans"""	4471	protein-coding gene	gene with protein product		603071				8558062	Standard	NM_001161415		Approved		uc002tpc.3	Q13304	OTTHUMG00000131533	ENST00000272644.3:c.165G>A	2.37:g.128408390G>A			Somatic	OREG0014966	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1564	LIMS2_uc002tow.2_5'Flank|LIMS2_uc002tox.2_Intron|LIMS2_uc010fmb.2_Intron|LIMS2_uc002toy.2_Intron|LIMS2_uc010yzm.1_Intron|LIMS2_uc002tpa.2_Intron|LIMS2_uc002toz.2_Intron|LIMS2_uc002tpb.2_Intron|GPR17_uc002tpc.2_Silent_p.T55T|GPR17_uc010yzo.1_Silent_p.T27T|GPR17_uc002tpd.2_Silent_p.T27T	p.T55T	NM_001161415	NP_001154887	WXS	Illumina HiSeq	Unspecified	Q13304	GPR17_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0677)	4	776	+	Colorectal(110;0.1)	Ovarian(717;0.15)	55			Extracellular (Potential).		A8K9L0|B2R9X0|Q8N5S7|Q9UDZ6|Q9UE21	Silent	SNP	ENST00000272644.3	37	c.165G>A	CCDS2148.1																																																																																				0.547	GPR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254390.1			32	90	0	0	0	0	32	90				
UBXN4	23190	broad.mit.edu	37	2	136499519	136499519	+	Missense_Mutation	SNP	C	C	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:136499519C>G	ENST00000272638.9	+	1	331	c.20C>G	c.(19-21)gCc>gGc	p.A7G		NM_014607.3	NP_055422.1	Q92575	UBXN4_HUMAN	UBX domain protein 4	7					response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)				NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	24						TTCCAGGGCGCCATTCCGGCC	0.701																																						uc002tur.2		NA																	0				skin(2)	2						c.(19-21)GCC>GGC		UBX domain containing 2							25.0	34.0	31.0					2																	136499519		1985	4131	6116	SO:0001583	missense	23190				response to unfolded protein	endoplasmic reticulum membrane|nuclear envelope	protein binding	g.chr2:136499519C>G	D87684	CCDS42761.1	2q21.3-q22.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000144224	ENSG00000144224		"""UBX domain containing"""	14860	protein-coding gene	gene with protein product	"""erasin"""	611216	"""UBX domain-containing 2"", ""UBX domain containing 2"""	UBXDC1, UBXD2		16968747	Standard	NM_014607		Approved	KIAA0242	uc002tur.3	Q92575	OTTHUMG00000153577	ENST00000272638.9:c.20C>G	2.37:g.136499519C>G	ENSP00000272638:p.Ala7Gly		Somatic					p.A7G	NM_014607	NP_055422	WXS	Illumina HiSeq	Unspecified	Q92575	UBXN4_HUMAN			1	331	+			7			Cytoplasmic (Potential).		A8K9W4|Q4ZG56|Q8IYM5	Missense_Mutation	SNP	ENST00000272638.9	37	c.20C>G	CCDS42761.1	.	.	.	.	.	.	.	.	.	.	C	12.22	1.873760	0.33069	.	.	ENSG00000144224	ENST00000272638;ENST00000430594;ENST00000415164	T;T	0.39592	1.07;1.49	3.92	3.92	0.45320	.	0.347019	0.27039	N	0.021232	T	0.32615	0.0835	L	0.34521	1.04	0.31287	N	0.689913	B	0.02656	0.0	B	0.01281	0.0	T	0.37663	-0.9696	10	0.51188	T	0.08	.	12.9685	0.58499	0.0:1.0:0.0:0.0	.	7	Q92575	UBXN4_HUMAN	G	7	ENSP00000272638:A7G;ENSP00000401748:A7G	ENSP00000272638:A7G	A	+	2	0	UBXN4	136215989	1.000000	0.71417	1.000000	0.80357	0.039000	0.13416	4.491000	0.60326	2.022000	0.59522	0.313000	0.20887	GCC		0.701	UBXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331696.1	NM_014607		7	23	0	0	0	0	7	23				
LRP1B	53353	broad.mit.edu	37	2	141130602	141130602	+	Silent	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:141130602C>A	ENST00000389484.3	-	69	11714	c.10743G>T	c.(10741-10743)ggG>ggT	p.G3581G		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3581	LDL-receptor class A 27. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TCTCATCTTCCCCATATTTGC	0.363										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	0				lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(10741-10743)GGG>GGT		low density lipoprotein-related protein 1B							217.0	211.0	213.0					2																	141130602		2203	4300	6503	SO:0001819	synonymous_variant	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141130602C>A	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.10743G>T	2.37:g.141130602C>A		TSP Lung(27;0.18)	Somatic					p.G3581G	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	69	11715	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	3581			Extracellular (Potential).|LDL-receptor class A 27.		Q8WY29|Q8WY30|Q8WY31	Silent	SNP	ENST00000389484.3	37	c.10743G>T	CCDS2182.1																																																																																				0.363	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		45	183	1	0	1e-16	1.45e-16	45	183				
LRP1B	53353	broad.mit.edu	37	2	141460116	141460116	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:141460116C>A	ENST00000389484.3	-	38	7001	c.6030G>T	c.(6028-6030)ttG>ttT	p.L2010F		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2010					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CAGTCCAGAACAAGAGGCTGA	0.398										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	0				lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(6028-6030)TTG>TTT		low density lipoprotein-related protein 1B							80.0	75.0	77.0					2																	141460116		2203	4299	6502	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141460116C>A	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.6030G>T	2.37:g.141460116C>A	ENSP00000374135:p.Leu2010Phe	TSP Lung(27;0.18)	Somatic					p.L2010F	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	38	7002	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	2010			Extracellular (Potential).|LDL-receptor class B 21.		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.6030G>T	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	14.29	2.490900	0.44249	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.97870	-4.58	5.16	2.28	0.28536	Six-bladed beta-propeller, TolB-like (1);	0.095371	0.41712	N	0.000838	D	0.97056	0.9038	M	0.93328	3.405	0.41286	D	0.986941	B	0.21452	0.056	B	0.26202	0.067	D	0.92920	0.6354	10	0.87932	D	0	.	3.0395	0.06133	0.1222:0.5127:0.1199:0.2451	.	2010	Q9NZR2	LRP1B_HUMAN	F	2010;1948	ENSP00000374135:L2010F	ENSP00000374135:L2010F	L	-	3	2	LRP1B	141176586	0.992000	0.36948	0.996000	0.52242	0.851000	0.48451	0.275000	0.18698	0.006000	0.14734	-2.049000	0.00408	TTG		0.398	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		18	80	1	0	2.38e-13	3.34e-13	18	80				
MBD5	55777	broad.mit.edu	37	2	149226486	149226486	+	Missense_Mutation	SNP	G	G	T	rs374866920		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:149226486G>T	ENST00000407073.1	+	9	1971	c.974G>T	c.(973-975)cGa>cTa	p.R325L	MBD5_ENST00000404807.1_Missense_Mutation_p.R325L	NM_018328.4	NP_060798.2	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	325					glucose homeostasis (GO:0042593)|nervous system development (GO:0007399)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|regulation of multicellular organism growth (GO:0040014)|single-organism behavior (GO:0044708)	chromocenter (GO:0010369)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(16)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	62				BRCA - Breast invasive adenocarcinoma(221;0.0569)		GAAATACCACGAGCAATGTTC	0.433																																						uc002twm.3		NA																	0				skin(3)|ovary(2)	5						c.(973-975)CGA>CTA		methyl-CpG binding domain protein 5							70.0	61.0	64.0					2																	149226486		2203	4300	6503	SO:0001583	missense	55777					chromosome|nucleus	chromatin binding|DNA binding	g.chr2:149226486G>T	AB040894	CCDS33302.1	2q23.2	2009-04-17			ENSG00000204406	ENSG00000204406			20444	protein-coding gene	gene with protein product		611472				12529184	Standard	NM_018328		Approved	FLJ11113, KIAA1461	uc002twm.4	Q9P267	OTTHUMG00000150440	ENST00000407073.1:c.974G>T	2.37:g.149226486G>T	ENSP00000386049:p.Arg325Leu		Somatic				MBD5_uc010zbs.1_RNA|MBD5_uc010fns.2_Missense_Mutation_p.R325L|MBD5_uc002twn.1_5'Flank	p.R325L	NM_018328	NP_060798	WXS	Illumina HiSeq	Unspecified	Q9P267	MBD5_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0569)	9	1962	+			325					A5HMQ4|A7E2B1|Q53SR1|Q9NUV6	Missense_Mutation	SNP	ENST00000407073.1	37	c.974G>T	CCDS33302.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.31|18.31	3.595392|3.595392	0.66219|0.66219	.|.	.|.	ENSG00000204406|ENSG00000204406	ENST00000416015|ENST00000407073;ENST00000404807	.|T;T	.|0.55234	.|0.53;0.53	5.45|5.45	5.45|5.45	0.79879|0.79879	.|.	.|0.000000	.|0.49916	.|D	.|0.000140	.|T	.|0.61825	.|0.2378	N|N	0.19112|0.19112	0.55|0.55	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.85130	.|0.997	.|T	.|0.66416	.|-0.5929	.|10	.|0.72032	.|D	.|0.01	-4.8133|-4.8133	19.6555|19.6555	0.95837|0.95837	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|325	.|Q9P267	.|MBD5_HUMAN	X|L	65|325	.|ENSP00000386049:R325L;ENSP00000384672:R325L	.|ENSP00000384672:R325L	E|R	+|+	1|2	0|0	MBD5|MBD5	148942956|148942956	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.404000|9.404000	0.97306|0.97306	2.725000|2.725000	0.93324|0.93324	0.655000|0.655000	0.94253|0.94253	GAG|CGA		0.433	MBD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318111.2			23	59	1	0	2.89e-11	3.97e-11	23	59				
GALNT13	114805	broad.mit.edu	37	2	155102362	155102362	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:155102362G>T	ENST00000392825.3	+	7	1291	c.724G>T	c.(724-726)Gat>Tat	p.D242Y	GALNT13_ENST00000409237.1_Missense_Mutation_p.D242Y	NM_052917.2	NP_443149.2	Q8IUC8	GLT13_HUMAN	polypeptide N-acetylgalactosaminyltransferase 13	242					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|lung(37)|ovary(3)|pancreas(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	65						TGTGATTAGTGATGATACTTT	0.363																																						uc002tyr.3		NA																	0				ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						c.(724-726)GAT>TAT		UDP-N-acetyl-alpha-D-galactosamine:polypeptide							129.0	127.0	127.0					2																	155102362		2203	4300	6503	SO:0001583	missense	114805					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr2:155102362G>T	AB067505	CCDS2199.1	2q24.1	2014-03-13	2014-03-13		ENSG00000144278	ENSG00000144278	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	23242	protein-coding gene	gene with protein product	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13"", ""polypeptide GalNAc transferase 13"""	608369	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)"""			11572484, 12407114	Standard	XM_005246267		Approved	KIAA1918, GalNAc-T13	uc002tyr.4	Q8IUC8	OTTHUMG00000131917	ENST00000392825.3:c.724G>T	2.37:g.155102362G>T	ENSP00000376570:p.Asp242Tyr		Somatic				GALNT13_uc002tyt.3_Missense_Mutation_p.D242Y|GALNT13_uc010foc.1_Missense_Mutation_p.D61Y|GALNT13_uc010fod.2_5'UTR	p.D242Y	NM_052917	NP_443149	WXS	Illumina HiSeq	Unspecified	Q8IUC8	GLT13_HUMAN			7	1291	+			242			Lumenal (Potential).		Q08ER7|Q68VI8|Q6ZWG1|Q96PX0|Q9UIE5	Missense_Mutation	SNP	ENST00000392825.3	37	c.724G>T	CCDS2199.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.735700	0.89482	.	.	ENSG00000144278	ENST00000392825;ENST00000409237	T;T	0.59772	0.24;0.24	5.37	5.37	0.77165	Glycosyl transferase, family 2 (1);	0.000000	0.85682	D	0.000000	T	0.71048	0.3294	M	0.66297	2.02	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.997	T	0.65376	-0.6183	10	0.02654	T	1	.	18.5273	0.90976	0.0:0.0:1.0:0.0	.	242;242;242	B3KY85;Q08ER7;Q8IUC8	.;.;GLT13_HUMAN	Y	242	ENSP00000376570:D242Y;ENSP00000387239:D242Y	ENSP00000376570:D242Y	D	+	1	0	GALNT13	154810608	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.810000	0.99221	2.702000	0.92279	0.644000	0.83932	GAT		0.363	GALNT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254870.2	NM_052917		43	142	1	0	1.52e-22	2.3e-22	43	142				
GALNT13	114805	broad.mit.edu	37	2	155158090	155158090	+	Missense_Mutation	SNP	A	A	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:155158090A>T	ENST00000392825.3	+	9	1711	c.1144A>T	c.(1144-1146)Atc>Ttc	p.I382F	GALNT13_ENST00000409237.1_Missense_Mutation_p.I382F|GALNT13_ENST00000487047.1_3'UTR	NM_052917.2	NP_443149.2	Q8IUC8	GLT13_HUMAN	polypeptide N-acetylgalactosaminyltransferase 13	382					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|lung(37)|ovary(3)|pancreas(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	65						TTTCTTCTACATCATATCCCC	0.353																																						uc002tyr.3		NA																	0				ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						c.(1144-1146)ATC>TTC		UDP-N-acetyl-alpha-D-galactosamine:polypeptide							138.0	141.0	140.0					2																	155158090		2203	4300	6503	SO:0001583	missense	114805					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr2:155158090A>T	AB067505	CCDS2199.1	2q24.1	2014-03-13	2014-03-13		ENSG00000144278	ENSG00000144278	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	23242	protein-coding gene	gene with protein product	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13"", ""polypeptide GalNAc transferase 13"""	608369	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)"""			11572484, 12407114	Standard	XM_005246267		Approved	KIAA1918, GalNAc-T13	uc002tyr.4	Q8IUC8	OTTHUMG00000131917	ENST00000392825.3:c.1144A>T	2.37:g.155158090A>T	ENSP00000376570:p.Ile382Phe		Somatic				GALNT13_uc002tyt.3_Missense_Mutation_p.I382F|GALNT13_uc010foc.1_Missense_Mutation_p.I201F|GALNT13_uc010fod.2_Missense_Mutation_p.I135F	p.I382F	NM_052917	NP_443149	WXS	Illumina HiSeq	Unspecified	Q8IUC8	GLT13_HUMAN			9	1711	+			382			Lumenal (Potential).		Q08ER7|Q68VI8|Q6ZWG1|Q96PX0|Q9UIE5	Missense_Mutation	SNP	ENST00000392825.3	37	c.1144A>T	CCDS2199.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.041940	0.75732	.	.	ENSG00000144278	ENST00000392825;ENST00000409237	T;T	0.68479	-0.33;-0.33	5.44	5.44	0.79542	.	0.096864	0.64402	D	0.000001	T	0.65302	0.2678	M	0.64404	1.975	0.80722	D	1	B;B;B;B	0.13594	0.007;0.008;0.002;0.008	B;B;B;B	0.15870	0.014;0.004;0.003;0.004	T	0.63681	-0.6582	10	0.54805	T	0.06	.	14.9846	0.71336	1.0:0.0:0.0:0.0	.	382;382;382;382	Q8IUC8-2;B3KY85;Q08ER7;Q8IUC8	.;.;.;GLT13_HUMAN	F	382	ENSP00000376570:I382F;ENSP00000387239:I382F	ENSP00000376570:I382F	I	+	1	0	GALNT13	154866336	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	7.470000	0.80973	2.193000	0.70182	0.533000	0.62120	ATC		0.353	GALNT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254870.2	NM_052917		40	136	0	0	0	0	40	136				
RBMS1	5937	broad.mit.edu	37	2	161223858	161223858	+	Silent	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:161223858G>A	ENST00000348849.3	-	2	550	c.120C>T	c.(118-120)agC>agT	p.S40S	RBMS1_ENST00000392753.3_Silent_p.S40S|RBMS1_ENST00000409972.1_Silent_p.S7S|RBMS1_ENST00000409075.1_Silent_p.S7S|RBMS1_ENST00000409289.2_Silent_p.S7S|RBMS1_ENST00000474820.1_5'UTR	NM_002897.4|NM_016836.3	NP_002888.1|NP_058520.1	P29558	RBMS1_HUMAN	RNA binding motif, single stranded interacting protein 1	40					DNA replication (GO:0006260)|RNA processing (GO:0006396)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)		PLA2R1/RBMS1(2)								tgctggtggtgctgGGACTGG	0.537																																						uc002ubo.2		NA																	0					0						c.(118-120)AGC>AGT		RNA binding motif, single stranded interacting							80.0	76.0	78.0					2																	161223858		2203	4300	6503	SO:0001819	synonymous_variant	5937				DNA replication|RNA processing	nucleus	double-stranded DNA binding|nucleotide binding|protein binding|RNA binding|single-stranded DNA binding	g.chr2:161223858G>A	D28482	CCDS2213.1	2q24.2	2013-02-12			ENSG00000153250	ENSG00000153250		"""RNA binding motif (RRM) containing"""	9907	protein-coding gene	gene with protein product	"""suppressor of cdc 2 (cdc13) with RNA binding motif 2"", ""c-myc gene single strand binding protein 2"""	602310	"""chromosome 2 open reading frame 12"""	C2orf12		8041632, 8134115, 7838710	Standard	NM_016836		Approved	SCR2, MSSP-1, MSSP-2, MSSP-3, YC1, HCC-4, DKFZp564H0764	uc002ubo.3	P29558	OTTHUMG00000132031	ENST00000348849.3:c.120C>T	2.37:g.161223858G>A			Somatic				RBMS1_uc002ubj.2_Silent_p.S7S|RBMS1_uc002ubk.2_Silent_p.S7S|RBMS1_uc002ubl.2_Silent_p.S38S|RBMS1_uc002ubn.2_Silent_p.S40S|RBMS1_uc002ubi.3_Silent_p.S40S|RBMS1_uc002ubm.2_Silent_p.S7S|RBMS1_uc002ubp.2_Silent_p.S40S|RBMS1_uc010fox.2_Silent_p.S40S	p.S40S	NM_016836	NP_058520	WXS	Illumina HiSeq	Unspecified	P29558	RBMS1_HUMAN			2	564	-			40					Q14869|Q15433|Q53P46|Q53QX8|Q53RG6|Q8WV20	Silent	SNP	ENST00000348849.3	37	c.120C>T	CCDS2213.1																																																																																				0.537	RBMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255043.4	NM_016836		31	74	0	0	0	0	31	74				
SCN3A	6328	broad.mit.edu	37	2	166019249	166019249	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:166019249C>T	ENST00000360093.3	-	8	1275	c.784G>A	c.(784-786)Gct>Act	p.A262T	SCN3A_ENST00000283254.7_Missense_Mutation_p.A262T|SCN3A_ENST00000409101.3_Missense_Mutation_p.A262T	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	262					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CCAATGAGAGCAAACACGCTC	0.483																																						uc002ucx.2		NA																	0				ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10						c.(784-786)GCT>ACT		sodium channel, voltage-gated, type III, alpha	Lamotrigine(DB00555)						123.0	119.0	120.0					2																	166019249		2203	4300	6503	SO:0001583	missense	6328					voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:166019249C>T	AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.784G>A	2.37:g.166019249C>T	ENSP00000353206:p.Ala262Thr		Somatic				SCN3A_uc002ucy.2_Missense_Mutation_p.A262T|SCN3A_uc002ucz.2_Missense_Mutation_p.A262T|SCN3A_uc002uda.1_Missense_Mutation_p.A131T|SCN3A_uc002udb.1_Missense_Mutation_p.A131T	p.A262T	NM_006922	NP_008853	WXS	Illumina HiSeq	Unspecified	Q9NY46	SCN3A_HUMAN			8	1276	-			262			Helical; Name=S5 of repeat I; (Potential).		Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	ENST00000360093.3	37	c.784G>A		.	.	.	.	.	.	.	.	.	.	C	32	5.147990	0.94603	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000440431	D;D;D;D	0.98400	-4.91;-4.91;-4.91;-4.91	5.82	5.82	0.92795	Ion transport (1);	0.000000	0.64402	D	0.000014	D	0.99233	0.9733	M	0.91717	3.235	0.80722	D	1	D;D;D;P;D	0.71674	0.997;0.995;0.96;0.863;0.998	D;D;D;P;D	0.83275	0.996;0.983;0.911;0.798;0.995	D	0.99274	1.0894	10	0.87932	D	0	.	20.0991	0.97865	0.0:1.0:0.0:0.0	.	262;262;262;262;262	Q9NY46;E7EUE6;Q9NY46-2;Q9NY46-4;Q9NY46-3	SCN3A_HUMAN;.;.;.;.	T	262	ENSP00000353206:A262T;ENSP00000283254:A262T;ENSP00000386726:A262T;ENSP00000403348:A262T	ENSP00000283254:A262T	A	-	1	0	SCN3A	165727495	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.818000	0.86416	2.752000	0.94435	0.655000	0.94253	GCT		0.483	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922		34	98	0	0	0	0	34	98				
SCN2A	6326	broad.mit.edu	37	2	166187857	166187857	+	Missense_Mutation	SNP	C	C	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:166187857C>G	ENST00000375437.2	+	14	2457	c.2167C>G	c.(2167-2169)Cag>Gag	p.Q723E	SCN2A_ENST00000283256.6_Missense_Mutation_p.Q723E|SCN2A_ENST00000357398.3_Missense_Mutation_p.Q723E|SCN2A_ENST00000375427.2_Missense_Mutation_p.Q723E	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	723					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AGAATCCAGACAGAAATGCCC	0.338																																						uc002udc.2		NA																	0				ovary(6)|breast(1)|pancreas(1)	8						c.(2167-2169)CAG>GAG		sodium channel, voltage-gated, type II, alpha	Lamotrigine(DB00555)						103.0	98.0	100.0					2																	166187857		2203	4300	6503	SO:0001583	missense	6326				myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:166187857C>G	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.2167C>G	2.37:g.166187857C>G	ENSP00000364586:p.Gln723Glu		Somatic				SCN2A_uc002udd.2_Missense_Mutation_p.Q723E|SCN2A_uc002ude.2_Missense_Mutation_p.Q723E	p.Q723E	NM_001040142	NP_001035232	WXS	Illumina HiSeq	Unspecified	Q99250	SCN2A_HUMAN			14	2457	+			723					A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	ENST00000375437.2	37	c.2167C>G	CCDS33314.1	.	.	.	.	.	.	.	.	.	.	C	14.61	2.586800	0.46110	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.96104	-3.91;-3.9;-3.91;-3.9	5.55	5.55	0.83447	.	0.000000	0.64402	D	0.000003	D	0.92753	0.7696	N	0.25380	0.74	0.48762	D	0.999705	B;B	0.23854	0.092;0.004	B;B	0.30646	0.118;0.016	D	0.89003	0.3423	10	0.38643	T	0.18	.	19.505	0.95111	0.0:1.0:0.0:0.0	.	723;723	Q99250-2;Q99250	.;SCN2A_HUMAN	E	723	ENSP00000364586:Q723E;ENSP00000349973:Q723E;ENSP00000283256:Q723E;ENSP00000364576:Q723E	ENSP00000283256:Q723E	Q	+	1	0	SCN2A	165896103	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.913000	0.56394	2.616000	0.88540	0.585000	0.79938	CAG		0.338	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007		25	92	0	0	0	0	25	92				
GALNT3	2591	broad.mit.edu	37	2	166606398	166606398	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:166606398C>T	ENST00000392701.3	-	10	2408	c.1633G>A	c.(1633-1635)Gaa>Aaa	p.E545K	GALNT3_ENST00000409882.1_Missense_Mutation_p.E283K	NM_004482.3	NP_004473.2	Q14435	GALT3_HUMAN	polypeptide N-acetylgalactosaminyltransferase 3	545	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.E545K(1)		NS(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|skin(1)	20						GCAGAGTATTCAAAGTACTAT	0.383																																						uc010fph.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|ovary(1)	3						c.(1633-1635)GAA>AAA		polypeptide N-acetylgalactosaminyltransferase 3							139.0	121.0	127.0					2																	166606398		2203	4299	6502	SO:0001583	missense	2591				protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	Golgi cisterna membrane|integral to membrane|membrane fraction|nucleus|perinuclear region of cytoplasm	calcium ion binding|manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr2:166606398C>T		CCDS2226.1	2q24-q31	2014-03-13	2014-03-13		ENSG00000115339	ENSG00000115339	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4125	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 3"""	601756	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3)"""			9592121, 15133511	Standard	NM_004482		Approved	GalNAc-T3, HHS, HFTC	uc010fph.1	Q14435	OTTHUMG00000132157	ENST00000392701.3:c.1633G>A	2.37:g.166606398C>T	ENSP00000376465:p.Glu545Lys		Somatic					p.E545K	NM_004482	NP_004473	WXS	Illumina HiSeq	Unspecified	Q14435	GALT3_HUMAN			10	2020	-			545			Ricin B-type lectin.|Lumenal (Potential).		Q53TG9|Q7Z476	Missense_Mutation	SNP	ENST00000392701.3	37	c.1633G>A	CCDS2226.1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.768422	0.90020	.	.	ENSG00000115339	ENST00000392701;ENST00000409882	T;T	0.26957	1.7;1.7	5.43	5.43	0.79202	Ricin B-related lectin (1);Ricin B lectin (3);	0.054208	0.64402	D	0.000001	T	0.44159	0.1280	M	0.84585	2.705	0.80722	D	1	B	0.27380	0.177	B	0.39935	0.314	T	0.40270	-0.9572	10	0.17832	T	0.49	.	19.2459	0.93902	0.0:1.0:0.0:0.0	.	545	Q14435	GALT3_HUMAN	K	545;283	ENSP00000376465:E545K;ENSP00000386955:E283K	ENSP00000376465:E545K	E	-	1	0	GALNT3	166314644	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	7.814000	0.86154	2.551000	0.86045	0.655000	0.94253	GAA		0.383	GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255205.2	NM_004482		33	130	0	0	0	0	33	130				
LRP2	4036	broad.mit.edu	37	2	170136935	170136935	+	Silent	SNP	A	A	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:170136935A>G	ENST00000263816.3	-	11	1551	c.1266T>C	c.(1264-1266)aaT>aaC	p.N422N	LRP2_ENST00000443831.1_Silent_p.N422N	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	422					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CCACTCCACGATTCTGAGACT	0.448																																						uc002ues.2		NA																	0				ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29						c.(1264-1266)AAT>AAC		low density lipoprotein-related protein 2	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)						72.0	74.0	73.0					2																	170136935		2203	4300	6503	SO:0001819	synonymous_variant	4036				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding	g.chr2:170136935A>G		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.1266T>C	2.37:g.170136935A>G			Somatic				LRP2_uc010zdf.1_Silent_p.N422N	p.N422N	NM_004525	NP_004516	WXS	Illumina HiSeq	Unspecified	P98164	LRP2_HUMAN		STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	11	1479	-			422			Extracellular (Potential).		O00711|Q16215	Silent	SNP	ENST00000263816.3	37	c.1266T>C	CCDS2232.1																																																																																				0.448	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525		17	75	0	0	0	0	17	75				
GPR155	151556	broad.mit.edu	37	2	175326175	175326175	+	Silent	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:175326175G>A	ENST00000392552.2	-	9	1753	c.1515C>T	c.(1513-1515)caC>caT	p.H505H	GPR155_ENST00000392551.2_Silent_p.H505H|GPR155_ENST00000295500.4_Silent_p.H505H	NM_001267051.1|NM_152529.6	NP_001253980.1|NP_689742.4	Q7Z3F1	GP155_HUMAN	G protein-coupled receptor 155	505					cognition (GO:0050890)|intracellular signal transduction (GO:0035556)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	26						TATCTCCATTGTGTTTTCCAG	0.383																																						uc002uit.2		NA																	0				ovary(1)	1						c.(1513-1515)CAC>CAT		G protein-coupled receptor 155 isoform 9							128.0	132.0	130.0					2																	175326175		2203	4300	6503	SO:0001819	synonymous_variant	151556				intracellular signal transduction|transmembrane transport	integral to membrane		g.chr2:175326175G>A	AY255528	CCDS2259.1, CCDS74605.1	2q31.1	2012-04-10			ENSG00000163328	ENSG00000163328			22951	protein-coding gene	gene with protein product						12679517	Standard	NM_001033045		Approved	DEPDC3, DEP.7, FLJ31819, PGR22	uc002uiu.4	Q7Z3F1	OTTHUMG00000132336	ENST00000392552.2:c.1515C>T	2.37:g.175326175G>A			Somatic				GPR155_uc002uiu.2_Silent_p.H505H|GPR155_uc002uiv.2_Silent_p.H505H|GPR155_uc010fqs.2_Silent_p.H477H	p.H505H	NM_001033045	NP_001028217	WXS	Illumina HiSeq	Unspecified	Q7Z3F1	GP155_HUMAN			10	1906	-			505					B2RCI2|D3DPE2|Q4G0Y6|Q53SJ3|Q53TA8|Q69YG8|Q86SP9|Q8N261|Q8N639|Q8N8K3|Q96MV6	Silent	SNP	ENST00000392552.2	37	c.1515C>T	CCDS2259.1																																																																																				0.383	GPR155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255455.1	NM_152529		43	137	0	0	0	0	43	137				
TTN	7273	broad.mit.edu	37	2	179437412	179437412	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:179437412G>T	ENST00000591111.1	-	276	68748	c.68524C>A	c.(68524-68526)Ctg>Atg	p.L22842M	TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.L15543M|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.L24483M|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.L15418M|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.L21915M|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.L15610M			Q8WZ42	TITIN_HUMAN	titin	22842	Ig-like 117.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACAATAAGCAGGGTGTAAGAG	0.428																																						uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(65743-65745)CTG>ATG		titin isoform N2-A							83.0	86.0	85.0					2																	179437412		1891	4105	5996	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179437412G>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.68524C>A	2.37:g.179437412G>T	ENSP00000465570:p.Leu22842Met		Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.L15610M|TTN_uc010zfi.1_Missense_Mutation_p.L15543M|TTN_uc010zfj.1_Missense_Mutation_p.L15418M	p.L21915M	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		275	65967	-			22842					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.65743C>A		.	.	.	.	.	.	.	.	.	.	G	5.569	0.289886	0.10567	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26	5.9	1.54	0.23209	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.50735	0.1633	N	0.17800	0.525	0.20563	N	0.999886	B;B;B;B	0.30068	0.267;0.267;0.267;0.164	B;B;B;B	0.28465	0.079;0.079;0.079;0.09	T	0.46176	-0.9210	9	0.87932	D	0	.	11.4263	0.50012	0.3999:0.0:0.6001:0.0	.	15418;15543;15610;22842	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	M	21915;15418;15610;15543;15416	ENSP00000343764:L21915M;ENSP00000434586:L15418M;ENSP00000340554:L15610M;ENSP00000352154:L15543M	ENSP00000340554:L15610M	L	-	1	2	TTN	179145658	0.035000	0.19736	0.446000	0.26920	0.976000	0.68499	0.318000	0.19504	0.396000	0.25283	0.650000	0.86243	CTG		0.428	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		38	97	1	0	4.33e-17	6.31e-17	38	97				
TTN	7273	broad.mit.edu	37	2	179476296	179476296	+	Missense_Mutation	SNP	T	T	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:179476296T>A	ENST00000591111.1	-	219	45961	c.45737A>T	c.(45736-45738)tAc>tTc	p.Y15246F	TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.Y7947F|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.Y16887F|TTN_ENST00000460472.2_Missense_Mutation_p.Y7822F|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.Y14319F|TTN_ENST00000342175.6_Missense_Mutation_p.Y8014F			Q8WZ42	TITIN_HUMAN	titin	15246	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCAACATGGTATCCTATGAT	0.438																																						uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(42955-42957)TAC>TTC		titin isoform N2-A							108.0	103.0	105.0					2																	179476296		1895	4120	6015	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179476296T>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.45737A>T	2.37:g.179476296T>A	ENSP00000465570:p.Tyr15246Phe		Somatic				uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.Y8014F|TTN_uc010zfi.1_Missense_Mutation_p.Y7947F|TTN_uc010zfj.1_Missense_Mutation_p.Y7822F	p.Y14319F	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		218	43180	-			15246					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.42956A>T		.	.	.	.	.	.	.	.	.	.	T	14.37	2.514265	0.44763	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.79845	-1.31;-1.31;-1.31;-1.31	5.95	5.95	0.96441	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.90154	0.6923	M	0.80422	2.495	0.58432	D	0.999999	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.83275	0.996;0.996;0.996;0.996	D	0.91325	0.5085	9	0.87932	D	0	.	16.4237	0.83790	0.0:0.0:0.0:1.0	.	7822;7947;8014;15246	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	F	14319;7822;8014;7947;7822	ENSP00000343764:Y14319F;ENSP00000434586:Y7822F;ENSP00000340554:Y8014F;ENSP00000352154:Y7947F	ENSP00000340554:Y8014F	Y	-	2	0	TTN	179184541	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.991000	0.88244	2.279000	0.76181	0.533000	0.62120	TAC		0.438	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		41	135	0	0	0	0	41	135				
TTN	7273	broad.mit.edu	37	2	179537416	179537416	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:179537416G>T	ENST00000591111.1	-	149	33903	c.33679C>A	c.(33679-33681)Cct>Act	p.P11227T	TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P11601T|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P10300T|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin	11227	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTTCCTCAGGAATTTTCTTT	0.373																																						uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(30898-30900)CCT>ACT		titin isoform N2-A							88.0	84.0	85.0					2																	179537416		1819	4066	5885	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179537416G>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.33679C>A	2.37:g.179537416G>T	ENSP00000465570:p.Pro11227Thr		Somatic				TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.P6961T|TTN_uc010fre.1_Intron|TTN_uc010zfk.1_5'Flank|TTN_uc002una.1_RNA|TTN_uc010frf.1_Intron	p.P10300T	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		148	31122	-			11227					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.30898C>A		.	.	.	.	.	.	.	.	.	.	G	11.60	1.687636	0.29962	.	.	ENSG00000155657	ENST00000342992	T	0.80738	-1.41	5.25	5.25	0.73442	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.76083	0.3938	L	0.56199	1.76	0.80722	D	1	P	0.37781	0.608	B	0.35413	0.202	T	0.79291	-0.1864	9	0.87932	D	0	.	12.9173	0.58213	0.0:0.0:0.8379:0.1621	.	11227	Q8WZ42	TITIN_HUMAN	T	10300	ENSP00000343764:P10300T	ENSP00000343764:P10300T	P	-	1	0	TTN	179245661	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	3.286000	0.51724	2.611000	0.88343	0.585000	0.79938	CCT		0.373	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		6	24	1	0	1.07e-07	1.36e-07	6	24				
TTN	7273	broad.mit.edu	37	2	179588378	179588378	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:179588378G>T	ENST00000591111.1	-	72	20722	c.20498C>A	c.(20497-20499)cCa>cAa	p.P6833Q	TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P7150Q|TTN_ENST00000460472.2_Intron|RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P5906Q|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin	12426	Ig-like 50.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATTTTTGCCTGGTAGTACTTC	0.433																																						uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(17716-17718)CCA>CAA		titin isoform N2-A							46.0	42.0	43.0					2																	179588378		1839	4089	5928	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179588378G>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.20498C>A	2.37:g.179588378G>T	ENSP00000465570:p.Pro6833Gln		Somatic				TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.P2567Q	p.P5906Q	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		71	17941	-			6833					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.17717C>A		.	.	.	.	.	.	.	.	.	.	G	9.646	1.140287	0.21205	.	.	ENSG00000155657	ENST00000342992	T	0.40756	1.02	6.16	5.29	0.74685	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.57036	0.2026	L	0.53780	1.695	0.80722	D	1	D	0.54772	0.968	P	0.59889	0.865	T	0.60979	-0.7155	9	0.87932	D	0	.	15.7724	0.78180	0.065:0.0:0.935:0.0	.	6833	Q8WZ42	TITIN_HUMAN	Q	5906	ENSP00000343764:P5906Q	ENSP00000343764:P5906Q	P	-	2	0	TTN	179296623	1.000000	0.71417	0.998000	0.56505	0.849000	0.48306	3.668000	0.54554	1.623000	0.50342	0.650000	0.86243	CCA		0.433	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		11	27	1	0	0.00829132	0.00880817	11	27				
TTN	7273	broad.mit.edu	37	2	179603084	179603084	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:179603084G>A	ENST00000591111.1	-	47	13369	c.13145C>T	c.(13144-13146)gCc>gTc	p.A4382V	TTN_ENST00000359218.5_Missense_Mutation_p.A4461V|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.A4699V|TTN_ENST00000460472.2_Missense_Mutation_p.A4336V|TTN-AS1_ENST00000582847.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.A3455V|TTN_ENST00000342175.6_Missense_Mutation_p.A4528V			Q8WZ42	TITIN_HUMAN	titin	12139					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GATCACTGGGGCAGCTGCAAA	0.453																																						uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(10363-10365)GCC>GTC		titin isoform N2-A							53.0	48.0	50.0					2																	179603084		1883	4118	6001	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179603084G>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.13145C>T	2.37:g.179603084G>A	ENSP00000465570:p.Ala4382Val		Somatic				TTN_uc010zfh.1_Missense_Mutation_p.A4528V|TTN_uc010zfi.1_Missense_Mutation_p.A4461V|TTN_uc010zfj.1_Missense_Mutation_p.A4336V|TTN_uc002umz.1_Missense_Mutation_p.A116V	p.A3455V	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		46	10588	-			4382					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.10364C>T		.	.	.	.	.	.	.	.	.	.	G	16.04	3.009874	0.54361	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.66460	-0.21;0.04;0.03;-0.0	5.37	5.37	0.77165	Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.66036	0.2749	M	0.61703	1.905	0.34378	D	0.692808	P;P;P;P	0.47106	0.89;0.89;0.89;0.791	B;B;B;B	0.40782	0.34;0.34;0.34;0.34	T	0.79412	-0.1814	9	0.87932	D	0	.	15.7988	0.78436	0.0:0.1361:0.8639:0.0	.	4336;4461;4528;4382	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	V	3455;4336;4528;4461;4336	ENSP00000343764:A3455V;ENSP00000434586:A4336V;ENSP00000340554:A4528V;ENSP00000352154:A4461V	ENSP00000340554:A4528V	A	-	2	0	TTN	179311329	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.550000	0.73905	2.689000	0.91719	0.462000	0.41574	GCC		0.453	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		11	43	0	0	0	0	11	43				
TTN	7273	broad.mit.edu	37	2	179605479	179605479	+	Missense_Mutation	SNP	A	A	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:179605479A>T	ENST00000591111.1	-	46	11754	c.11530T>A	c.(11530-11532)Ttc>Atc	p.F3844I	TTN_ENST00000359218.5_Missense_Mutation_p.F3923I|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.F4161I|TTN_ENST00000460472.2_Missense_Mutation_p.F3798I|TTN-AS1_ENST00000582847.1_RNA|TTN_ENST00000342992.6_Intron|TTN_ENST00000342175.6_Missense_Mutation_p.F3990I			Q8WZ42	TITIN_HUMAN	titin	0					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTTTGGAGAAGGTTTTCTGG	0.448																																						uc010zfh.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(11968-11970)TTC>ATC		titin isoform novex-2							107.0	105.0	106.0					2																	179605479		1890	4113	6003	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179605479A>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.11530T>A	2.37:g.179605479A>T	ENSP00000465570:p.Phe3844Ile		Somatic				TTN_uc010zfg.1_Intron|TTN_uc010zfi.1_Missense_Mutation_p.F3923I|TTN_uc010zfj.1_Missense_Mutation_p.F3798I|TTN_uc002umz.1_Intron	p.F3990I	NM_133437	NP_597681	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		46	12192	-			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.11968T>A		.	.	.	.	.	.	.	.	.	.	A	9.053	0.992587	0.18966	.	.	ENSG00000155657	ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T	0.58940	0.35;0.31;0.3	5.06	3.21	0.36854	.	.	.	.	.	T	0.39253	0.1071	N	0.14661	0.345	0.21290	N	0.99974	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.33675	-0.9859	9	0.87932	D	0	.	8.5265	0.33309	0.3153:0.0:0.6847:0.0	.	3798;3923;3990	D3DPF9;E7EQE6;E7ET18	.;.;.	I	3798;3990;3923;3798	ENSP00000434586:F3798I;ENSP00000340554:F3990I;ENSP00000352154:F3923I	ENSP00000340554:F3990I	F	-	1	0	TTN	179313724	0.751000	0.28327	0.996000	0.52242	0.558000	0.35554	1.104000	0.31074	1.231000	0.43661	-0.242000	0.12053	TTC		0.448	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		50	158	0	0	0	0	50	158				
TTN	7273	broad.mit.edu	37	2	179611115	179611115	+	Intron	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:179611115G>T	ENST00000591111.1	-	46	10585				TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.P5338T|TTN-AS1_ENST00000578746.1_RNA|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000589042.1_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000342992.6_Intron|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTATGGTCAGGAGTAAATTCG	0.348																																						uc002unb.2		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(16012-16014)CCT>ACT		titin isoform novex-3							59.0	53.0	55.0					2																	179611115		2203	4299	6502	SO:0001627	intron_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179611115G>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10361-4467C>A	2.37:g.179611115G>T			Somatic				TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	p.P5338T	NM_133379	NP_596870	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		46	16236	-			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.16012C>A		.	.	.	.	.	.	.	.	.	.	G	12.69	2.013959	0.35511	.	.	ENSG00000155657	ENST00000360870;ENST00000306136	T	0.58060	0.36	5.88	3.75	0.43078	.	.	.	.	.	T	0.60301	0.2258	L	0.47716	1.5	0.80722	D	1	P	0.46512	0.879	D	0.69824	0.966	T	0.54549	-0.8277	9	0.13108	T	0.6	.	10.5134	0.44874	0.1181:0.1267:0.7552:0.0	.	5338	Q8WZ42-6	.	T	5338;619	ENSP00000354117:P5338T	ENSP00000304714:P619T	P	-	1	0	TTN	179319360	0.983000	0.35010	1.000000	0.80357	0.889000	0.51656	1.583000	0.36579	1.468000	0.48064	0.655000	0.94253	CCT		0.348	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		21	89	1	0	1.02e-10	1.39e-10	21	89				
TTN	7273	broad.mit.edu	37	2	179611834	179611834	+	Intron	SNP	G	G	T	rs397517814		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:179611834G>T	ENST00000591111.1	-	46	10585				TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.P5098H|TTN-AS1_ENST00000578746.1_RNA|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000589042.1_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000342992.6_Intron|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTCTCCTGGGGGTGTGGAGTA	0.522																																						uc002unb.2		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(15292-15294)CCC>CAC		titin isoform novex-3							62.0	73.0	69.0					2																	179611834		2203	4299	6502	SO:0001627	intron_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179611834G>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10361-5186C>A	2.37:g.179611834G>T			Somatic				TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	p.P5098H	NM_133379	NP_596870	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		46	15517	-			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.15293C>A		.	.	.	.	.	.	.	.	.	.	G	15.32	2.799369	0.50208	.	.	ENSG00000155657	ENST00000360870	T	0.71579	-0.58	5.49	5.49	0.81192	.	.	.	.	.	T	0.75583	0.3869	M	0.66939	2.045	0.80722	D	1	P	0.44380	0.834	P	0.46320	0.512	T	0.78894	-0.2024	9	0.87932	D	0	.	17.5209	0.87787	0.0:0.0:1.0:0.0	.	5098	Q8WZ42-6	.	H	5098	ENSP00000354117:P5098H	ENSP00000354117:P5098H	P	-	2	0	TTN	179320079	0.993000	0.37304	1.000000	0.80357	0.895000	0.52256	3.526000	0.53509	2.748000	0.94277	0.655000	0.94253	CCC		0.522	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		41	147	1	0	6.24e-21	9.36e-21	41	147				
TTN	7273	broad.mit.edu	37	2	179635394	179635394	+	Missense_Mutation	SNP	T	T	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:179635394T>C	ENST00000591111.1	-	35	8349	c.8125A>G	c.(8125-8127)Att>Gtt	p.I2709V	TTN_ENST00000359218.5_Missense_Mutation_p.I2663V|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.I2709V|TTN-AS1_ENST00000584485.1_RNA|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.I2709V|TTN_ENST00000460472.2_Missense_Mutation_p.I2663V|TTN_ENST00000342992.6_Missense_Mutation_p.I2709V|TTN_ENST00000342175.6_Missense_Mutation_p.I2663V			Q8WZ42	TITIN_HUMAN	titin	13036					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTCTTCTTAATTTTGACAGCT	0.393																																						uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(8125-8127)ATT>GTT		titin isoform N2-A							92.0	97.0	96.0					2																	179635394		2203	4300	6503	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179635394T>C	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.8125A>G	2.37:g.179635394T>C	ENSP00000465570:p.Ile2709Val		Somatic				TTN_uc010zfh.1_Missense_Mutation_p.I2663V|TTN_uc010zfi.1_Missense_Mutation_p.I2663V|TTN_uc010zfj.1_Missense_Mutation_p.I2663V|TTN_uc002unb.2_Missense_Mutation_p.I2709V	p.I2709V	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		35	8349	-			2709					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.8125A>G		.	.	.	.	.	.	.	.	.	.	T	12.21	1.869911	0.33069	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38;-0.38	5.66	4.51	0.55191	Immunoglobulin I-set (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.57725	0.2073	L	0.37897	1.145	0.28012	N	0.934881	B;B;B;B;B	0.24043	0.02;0.02;0.02;0.02;0.096	B;B;B;B;B	0.23018	0.04;0.04;0.04;0.04;0.043	T	0.56038	-0.8045	9	0.87932	D	0	.	11.6825	0.51466	0.0:0.0693:0.0:0.9307	.	2663;2663;2663;2709;2709	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	V	2709;2663;2663;2663;2663;2709	ENSP00000343764:I2709V;ENSP00000434586:I2663V;ENSP00000340554:I2663V;ENSP00000352154:I2663V;ENSP00000354117:I2709V	ENSP00000340554:I2663V	I	-	1	0	TTN	179343639	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.150000	0.58098	1.089000	0.41292	0.533000	0.62120	ATT		0.393	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		49	129	0	0	0	0	49	129				
SESTD1	91404	broad.mit.edu	37	2	180014079	180014079	+	Missense_Mutation	SNP	C	C	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:180014079C>G	ENST00000428443.3	-	7	842	c.526G>C	c.(526-528)Gaa>Caa	p.E176Q		NM_178123.4	NP_835224.3	Q86VW0	SESD1_HUMAN	SEC14 and spectrin domains 1	176							phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)	p.E176K(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(3)	30			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)			AAAGCAAGTTCATCTAATAAT	0.289																																						uc002uni.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(526-528)GAA>CAA		SEC14 and spectrin domains 1							88.0	78.0	81.0					2																	180014079		2201	4297	6498	SO:0001583	missense	91404				regulation of calcium ion transport via voltage-gated calcium channel activity		phosphatidic acid binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylinositol-4-phosphate binding|phosphatidylinositol-5-phosphate binding|protein binding	g.chr2:180014079C>G	AK096232	CCDS33338.1	2q31.3	2014-01-28			ENSG00000187231	ENSG00000187231			18379	protein-coding gene	gene with protein product						12837271	Standard	NM_178123		Approved	DKFZp434O0515, Solo	uc002uni.4	Q86VW0	OTTHUMG00000154554	ENST00000428443.3:c.526G>C	2.37:g.180014079C>G	ENSP00000415332:p.Glu176Gln		Somatic					p.E176Q	NM_178123	NP_835224	WXS	Illumina HiSeq	Unspecified	Q86VW0	SESD1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)		7	676	-			176					Q53R38|Q53SP3|Q5GM69|Q8N6M1|Q96LQ2	Missense_Mutation	SNP	ENST00000428443.3	37	c.526G>C	CCDS33338.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.083563	0.76642	.	.	ENSG00000187231	ENST00000428443	T	0.05649	3.41	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.14141	0.0342	N	0.19112	0.55	0.80722	D	1	D	0.63880	0.993	D	0.72982	0.979	T	0.25984	-1.0116	9	.	.	.	-24.3432	18.8932	0.92413	0.0:1.0:0.0:0.0	.	176	Q86VW0	SESD1_HUMAN	Q	176	ENSP00000415332:E176Q	.	E	-	1	0	SESTD1	179722324	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.791000	0.85805	2.546000	0.85860	0.655000	0.94253	GAA		0.289	SESTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335916.2	NM_178123		13	34	0	0	0	0	13	34				
ZNF385B	151126	broad.mit.edu	37	2	180634252	180634252	+	Missense_Mutation	SNP	G	G	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:180634252G>C	ENST00000410066.1	-	3	834	c.231C>G	c.(229-231)agC>agG	p.S77R		NM_152520.4	NP_689733.3	Q569K4	Z385B_HUMAN	zinc finger protein 385B	77	Required for induction of apoptosis.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|p53 binding (GO:0002039)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	26			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)			TGCTGCTGGGGCTGGCCTGGG	0.607																																					Colon(155;204 2491 32774 51842)	uc002unn.3		NA																	0				ovary(1)	1						c.(229-231)AGC>AGG		zinc finger protein 385B isoform 1							41.0	41.0	41.0					2																	180634252		2203	4300	6503	SO:0001583	missense	151126					nucleus	nucleic acid binding|zinc ion binding	g.chr2:180634252G>C	AK057999	CCDS33339.1, CCDS46463.1, CCDS46464.1	2q31.3-q32.1	2012-10-05	2007-12-06	2007-12-06	ENSG00000144331	ENSG00000144331			26332	protein-coding gene	gene with protein product		612344	"""zinc finger protein 533"""	ZNF533		12477932	Standard	NM_152520		Approved	FLJ25270	uc002unn.4	Q569K4	OTTHUMG00000154559	ENST00000410066.1:c.231C>G	2.37:g.180634252G>C	ENSP00000386845:p.Ser77Arg		Somatic					p.S77R	NM_152520	NP_689733	WXS	Illumina HiSeq	Unspecified	Q569K4	Z385B_HUMAN	Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)		3	835	-			77					Q49A04|Q6ZMZ7|Q8IY01|Q8N8H2|Q96DK4	Missense_Mutation	SNP	ENST00000410066.1	37	c.231C>G	CCDS33339.1	.	.	.	.	.	.	.	.	.	.	G	15.47	2.842492	0.51057	.	.	ENSG00000144331	ENST00000410066	T	0.32272	1.46	6.06	2.91	0.33838	.	0.673300	0.14040	N	0.345461	T	0.26122	0.0637	L	0.43152	1.355	0.48288	D	0.999629	B	0.14438	0.01	B	0.15484	0.013	T	0.04427	-1.0952	10	0.35671	T	0.21	-14.4722	10.8257	0.46631	0.2161:0.0:0.7839:0.0	.	77	Q569K4	Z385B_HUMAN	R	77	ENSP00000386845:S77R	ENSP00000386845:S77R	S	-	3	2	ZNF385B	180342497	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	2.129000	0.42055	0.909000	0.36697	0.655000	0.94253	AGC		0.607	ZNF385B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335972.1	NM_152520		9	61	0	0	0	0	9	61				
NEUROD1	4760	broad.mit.edu	37	2	182543323	182543323	+	Missense_Mutation	SNP	T	T	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:182543323T>G	ENST00000295108.3	-	2	722	c.265A>C	c.(265-267)Aag>Cag	p.K89Q	NEUROD1_ENST00000496876.1_Intron|CERKL_ENST00000479558.1_Intron	NM_002500.4	NP_002491.2	Q13562	NDF1_HUMAN	neuronal differentiation 1	89	Poly-Lys.				amacrine cell differentiation (GO:0035881)|anterior/posterior pattern specification (GO:0009952)|cellular response to glucose stimulus (GO:0071333)|cerebellum development (GO:0021549)|dentate gyrus development (GO:0021542)|embryonic organ morphogenesis (GO:0048562)|endocrine pancreas development (GO:0031018)|enteroendocrine cell differentiation (GO:0035883)|glucose homeostasis (GO:0042593)|inner ear development (GO:0048839)|insulin secretion (GO:0030073)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurogenesis (GO:0022008)|nitric oxide mediated signal transduction (GO:0007263)|nucleocytoplasmic transport (GO:0006913)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle arrest (GO:0071156)|regulation of insulin secretion (GO:0050796)|regulation of intestinal epithelial structure maintenance (GO:0060730)|response to drug (GO:0042493)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|protein heterodimerization activity (GO:0046982)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25			OV - Ovarian serous cystadenocarcinoma(117;0.088)			GTCATCTTCTTCTTTTTGGGG	0.567																																						uc002uof.2		NA																	0				ovary(1)	1						c.(265-267)AAG>CAG		neurogenic differentiation 1							136.0	115.0	122.0					2																	182543323		2203	4300	6503	SO:0001583	missense	4760				amacrine cell differentiation|cerebellum development|dentate gyrus development|embryonic organ morphogenesis|enteroendocrine cell differentiation|glucose homeostasis|inner ear development|insulin secretion|negative regulation of apoptosis|nitric oxide mediated signal transduction|positive regulation of apoptosis|positive regulation of neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of cell cycle arrest|regulation of intestinal epithelial structure maintenance|response to glucose stimulus	cytoplasm|nucleus	chromatin binding|E-box binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding	g.chr2:182543323T>G	U50823	CCDS2283.1	2q32	2013-05-21	2012-02-22		ENSG00000162992	ENSG00000162992		"""Basic helix-loop-helix proteins"""	7762	protein-coding gene	gene with protein product	"""beta-cell E-box transactivator 2"", ""neurogenic helix-loop-helix protein NEUROD"""	601724	"""neurogenic differentiation 1"""	NEUROD		7754368, 8786144	Standard	NM_002500		Approved	BETA2, BHF-1, NeuroD, bHLHa3, MODY6	uc002uof.4	Q13562	OTTHUMG00000132583	ENST00000295108.3:c.265A>C	2.37:g.182543323T>G	ENSP00000295108:p.Lys89Gln		Somatic				CERKL_uc002uod.1_Intron	p.K89Q	NM_002500	NP_002491	WXS	Illumina HiSeq	Unspecified	Q13562	NDF1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.088)		2	501	-			89			Poly-Lys.|Nuclear localization signal (Potential).		B2R9I8|F1T0E1|O00343|Q13340|Q5U095|Q96TH0|Q99455|Q9UEC8	Missense_Mutation	SNP	ENST00000295108.3	37	c.265A>C	CCDS2283.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.179896	0.78564	.	.	ENSG00000162992	ENST00000295108	D	0.95980	-3.87	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	D	0.95146	0.8427	M	0.76838	2.35	0.53688	D	0.999974	P	0.44690	0.841	B	0.40741	0.339	D	0.95406	0.8494	10	0.72032	D	0.01	-21.6922	15.6301	0.76899	0.0:0.0:0.0:1.0	.	89	Q13562	NDF1_HUMAN	Q	89	ENSP00000295108:K89Q	ENSP00000295108:K89Q	K	-	1	0	NEUROD1	182251568	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.508000	0.53378	2.367000	0.80283	0.528000	0.53228	AAG		0.567	NEUROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255792.2	NM_002500		10	37	0	0	0	0	10	37				
DNAJC10	54431	broad.mit.edu	37	2	183594599	183594600	+	Missense_Mutation	DNP	AG	AG	CT			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:183594599_183594600AG>CT	ENST00000264065.7	+	8	1073_1074	c.658_659AG>CT	c.(658-660)AGa>CTa	p.R220L	DNAJC10_ENST00000537515.1_Missense_Mutation_p.R220L	NM_018981.1	NP_061854.1	Q8IXB1	DJC10_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 10	220	Thioredoxin 1. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of ATPase activity (GO:0032781)|protein folding in endoplasmic reticulum (GO:0034975)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|chaperone binding (GO:0051087)|disulfide oxidoreductase activity (GO:0015036)|Hsp70 protein binding (GO:0030544)|misfolded protein binding (GO:0051787)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide oxidoreductase activity (GO:0015035)			breast(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(15)|ovary(1)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			TCATGGAGACAGATCAAAGGAG	0.312																																					Pancreas(56;860 1183 25669 35822 48585)	uc002uow.1		NA																	0				ovary(1)|large_intestine(1)|breast(1)|skin(1)	4						c.(658-660)AGA>CTA		DnaJ (Hsp40) homolog, subfamily C, member 10																																				SO:0001583	missense	54431				apoptosis in response to endoplasmic reticulum stress|cell redox homeostasis|ER-associated protein catabolic process|glycerol ether metabolic process|negative regulation of protein phosphorylation|protein folding|response to endoplasmic reticulum stress	endoplasmic reticulum chaperone complex|endoplasmic reticulum lumen|extracellular region	ATPase activator activity|ATPase binding|chaperone binding|electron carrier activity|heat shock protein binding|misfolded protein binding|protein disulfide oxidoreductase activity|unfolded protein binding	g.chr2:183594599_183594600AG>CT		CCDS33345.1, CCDS74613.1	2q32.1	2011-11-23			ENSG00000077232	ENSG00000077232		"""Heat shock proteins / DNAJ (HSP40)"", ""Protein disulfide isomerases"""	24637	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 19"""	607987				12411443, 12446677	Standard	NM_018981		Approved	ERdj5, PDIA19	uc002uow.2	Q8IXB1	OTTHUMG00000154209	Exception_encountered	2.37:g.183594599_183594600delinsCT	ENSP00000264065:p.Arg220Leu		Somatic				DNAJC10_uc002uox.1_RNA|DNAJC10_uc002uoy.1_RNA|DNAJC10_uc002uoz.1_Missense_Mutation_p.R220L|DNAJC10_uc010fro.1_RNA	p.R220L	NM_018981	NP_061854	WXS	Illumina HiSeq	Unspecified	Q8IXB1	DJC10_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)		8	1073_1074	+			220			Thioredoxin 1.		Q17RJ6|Q3B7W8|Q4ZG06|Q53QT7|Q6UWZ6|Q86T61|Q8NC82|Q8TD87|Q96K38|Q96K44|Q96K54|Q9NSY6	Missense_Mutation	DNP	ENST00000264065.7	37	c.658_659AG>CT	CCDS33345.1																																																																																				0.312	DNAJC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334418.2	NM_018981		26	106	0	0	0	0	26	106				
CALCRL	10203	broad.mit.edu	37	2	188245205	188245205	+	Missense_Mutation	SNP	C	C	T	rs369171869		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:188245205C>T	ENST00000409998.1	-	8	1178	c.397G>A	c.(397-399)Gag>Aag	p.E133K	AC007319.1_ENST00000453517.1_RNA|AC007319.1_ENST00000412276.1_RNA|CALCRL_ENST00000410068.1_Missense_Mutation_p.E133K|CALCRL_ENST00000392370.3_Missense_Mutation_p.E133K			Q16602	CALRL_HUMAN	calcitonin receptor-like	133					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|angiogenesis (GO:0001525)|calcium ion transport (GO:0006816)|cAMP biosynthetic process (GO:0006171)|cellular response to sucrose stimulus (GO:0071329)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|heart development (GO:0007507)|negative regulation of inflammatory response (GO:0050728)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|regulation of muscle contraction (GO:0006937)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	adrenomedullin receptor activity (GO:0001605)|calcitonin gene-related polypeptide receptor activity (GO:0001635)|calcitonin receptor activity (GO:0004948)|G-protein coupled receptor activity (GO:0004930)|protein transporter activity (GO:0008565)			endometrium(1)|large_intestine(7)|lung(21)|ovary(1)|prostate(1)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(96;0.227)			TTCACTTTCTCGTGGGTGTTA	0.338																																						uc002upv.3		NA																	0				lung(3)|ovary(1)	4						c.(397-399)GAG>AAG		calcitonin receptor-like precursor		C	LYS/GLU	0,4406		0,0,2203	185.0	190.0	188.0		397	3.1	0.5	2		188	1,8599	1.2+/-3.3	0,1,4299	no	missense	CALCRL	NM_005795.4	56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	133/462	188245205	1,13005	2203	4300	6503	SO:0001583	missense	10203					integral to plasma membrane		g.chr2:188245205C>T	U17473	CCDS2293.1	2q21.1-q21.3	2012-08-10			ENSG00000064989	ENSG00000064989		"""GPCR / Class B : Calcitonin receptors"""	16709	protein-coding gene	gene with protein product		114190				7818539, 8626685	Standard	NM_005795		Approved	CGRPR, CRLR	uc010frt.4	Q16602	OTTHUMG00000132636	ENST00000409998.1:c.397G>A	2.37:g.188245205C>T	ENSP00000386972:p.Glu133Lys		Somatic				CALCRL_uc010frt.2_Missense_Mutation_p.E133K	p.E133K	NM_005795	NP_005786	WXS	Illumina HiSeq	Unspecified	Q16602	CALRL_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(96;0.227)		7	945	-			133			Extracellular (Potential).		A8K6G5|A8KAD3|Q53S02|Q53TS5	Missense_Mutation	SNP	ENST00000409998.1	37	c.397G>A	CCDS2293.1	.	.	.	.	.	.	.	.	.	.	C	10.96	1.498091	0.26861	0.0	1.16E-4	ENSG00000064989	ENST00000392370;ENST00000409998;ENST00000410068	T;T;T	0.38401	1.14;1.14;1.14	5.0	3.08	0.35506	GPCR, family 2, extracellular hormone receptor domain (1);	0.386827	0.23038	N	0.052647	T	0.31295	0.0792	M	0.72894	2.215	0.40749	D	0.982904	B	0.30664	0.289	B	0.23716	0.048	T	0.11012	-1.0605	10	0.24483	T	0.36	.	7.8834	0.29635	0.161:0.7505:0.0:0.0885	.	133	Q16602	CALRL_HUMAN	K	133	ENSP00000376177:E133K;ENSP00000386972:E133K;ENSP00000387190:E133K	ENSP00000376177:E133K	E	-	1	0	CALCRL	187953450	0.221000	0.23642	0.531000	0.27976	0.080000	0.17528	2.091000	0.41691	1.474000	0.48178	0.563000	0.77884	GAG		0.338	CALCRL-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334648.1	NM_005795		10	253	0	0	0	0	10	253				
COL3A1	1281	broad.mit.edu	37	2	189870076	189870076	+	Splice_Site	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:189870076G>T	ENST00000304636.3	+	41	3102	c.2932G>T	c.(2932-2934)Ggt>Tgt	p.G978C	COL3A1_ENST00000317840.5_Intron	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	978	Triple-helical region.				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	TTGTATACAGGGTGAAAGTGG	0.413																																						uc002uqj.1		NA																	0				central_nervous_system(7)|ovary(4)|large_intestine(2)	13	GRCh37	CM066013	COL3A1	M		c.(2932-2934)GGT>TGT		collagen type III alpha 1 preproprotein	Collagenase(DB00048)|Palifermin(DB00039)						103.0	108.0	106.0					2																	189870076		2203	4300	6503	SO:0001630	splice_region_variant	1281				axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding	g.chr2:189870076G>T	X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.2932-1G>T	2.37:g.189870076G>T			Somatic					p.G978C	NM_000090	NP_000081	WXS	Illumina HiSeq	Unspecified	P02461	CO3A1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		41	3049	+			978			Triple-helical region.		D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	ENST00000304636.3	37	c.2932G>T	CCDS2297.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.820149	0.90873	.	.	ENSG00000168542	ENST00000304636	D	0.99637	-6.29	5.5	5.5	0.81552	.	0.000000	0.52532	D	0.000071	D	0.99859	0.9934	H	0.99498	4.595	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96364	0.9268	9	.	.	.	.	19.4039	0.94641	0.0:0.0:1.0:0.0	.	978	P02461	CO3A1_HUMAN	C	978	ENSP00000304408:G978C	.	G	+	1	0	COL3A1	189578321	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	9.869000	0.99810	2.586000	0.87340	0.650000	0.86243	GGT		0.413	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3	NM_000090	Missense_Mutation	32	150	1	0	1.46e-13	2.06e-13	32	150				
SLC40A1	30061	broad.mit.edu	37	2	190430079	190430079	+	Splice_Site	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:190430079C>A	ENST00000261024.2	-	6	1187		c.e6+1			NM_014585.5	NP_055400.1	Q9NP59	S40A1_HUMAN	solute carrier family 40 (iron-regulated transporter), member 1						anatomical structure morphogenesis (GO:0009653)|cellular iron ion homeostasis (GO:0006879)|endothelium development (GO:0003158)|iron ion transmembrane transport (GO:0034755)|lymphocyte homeostasis (GO:0002260)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of apoptotic process (GO:0043066)|regulation of transcription from RNA polymerase II promoter in response to iron (GO:0034395)|spleen trabecula formation (GO:0060345)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	iron ion transmembrane transporter activity (GO:0005381)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(117;0.000917)|Epithelial(96;0.014)|all cancers(119;0.0491)			GTTCAGTTTACCTTTGTGTAA	0.368																																						uc002uqp.3		NA																	0				ovary(1)	1						c.e6+1		solute carrier family 40 (iron-regulated							71.0	67.0	69.0					2																	190430079		2203	4300	6503	SO:0001630	splice_region_variant	30061				anatomical structure morphogenesis|cellular iron ion homeostasis	cytoplasm|integral to plasma membrane	iron ion transmembrane transporter activity|protein binding	g.chr2:190430079C>A	AF215636	CCDS2299.1	2q32	2014-09-17	2003-06-04	2003-06-05	ENSG00000138449	ENSG00000138449		"""Solute carriers"""	10909	protein-coding gene	gene with protein product	"""ferroportin 1"""	604653	"""solute carrier family 11 (proton-coupled divalent metal ion transporters), member 3"""	SLC11A3		10828623	Standard	NM_014585		Approved	MTP1, IREG1, FPN1, HFE4	uc002uqp.4	Q9NP59	OTTHUMG00000132662	ENST00000261024.2:c.760+1G>T	2.37:g.190430079C>A			Somatic					p.D254_splice	NM_014585	NP_055400	WXS	Illumina HiSeq	Unspecified	Q9NP59	S40A1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.000917)|Epithelial(96;0.014)|all cancers(119;0.0491)		6	1111	-								Q6FI62|Q7Z4F8|Q8IVB2|Q9NRL0	Splice_Site	SNP	ENST00000261024.2	37	c.760_splice	CCDS2299.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.969240	0.74246	.	.	ENSG00000138449	ENST00000261024	.	.	.	5.72	4.84	0.62591	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8065	0.69959	0.0:0.931:0.0:0.069	.	.	.	.	.	-1	.	.	.	-	.	.	SLC40A1	190138324	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.220000	0.78008	1.562000	0.49601	0.655000	0.94253	.		0.368	SLC40A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255916.2		Intron	23	49	1	0	1.85e-09	2.46e-09	23	49				
ANKRD44	91526	broad.mit.edu	37	2	197943433	197943433	+	Silent	SNP	C	C	A	rs146996314		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:197943433C>A	ENST00000328737.2	-	16	1645	c.1569G>T	c.(1567-1569)ctG>ctT	p.L523L	ANKRD44_ENST00000450567.1_Silent_p.L523L|ANKRD44_ENST00000477852.1_5'Flank|ANKRD44_ENST00000337207.5_Silent_p.L523L|ANKRD44_ENST00000282272.8_Silent_p.L540L|ANKRD44_ENST00000409153.1_Silent_p.L548L|ANKRD44_ENST00000539527.1_Silent_p.L476L			Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44	548										NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(20)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.246)			TCACCAATTCCAGACACTGCC	0.418																																						uc002uua.1		NA																	0				ovary(4)|skin(1)	5						c.(1567-1569)CTG>CTT		ankyrin repeat domain 44							94.0	78.0	83.0					2																	197943433		2203	4300	6503	SO:0001819	synonymous_variant	91526						protein binding	g.chr2:197943433C>A	AK097086	CCDS33355.1, CCDS33355.2, CCDS74619.1	2q33.1	2013-01-10			ENSG00000065413	ENSG00000065413		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	25259	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit B"""						Standard	NM_153697		Approved	PP6-ARS-B	uc021vuj.1	Q8N8A2	OTTHUMG00000154411	ENST00000328737.2:c.1569G>T	2.37:g.197943433C>A			Somatic				ANKRD44_uc002utz.3_Silent_p.L255L|ANKRD44_uc002uub.2_Silent_p.L548L|ANKRD44_uc010zgw.1_Silent_p.L476L	p.L523L	NM_153697	NP_710181	WXS	Illumina HiSeq	Unspecified	Q8N8A2	ANR44_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.246)		16	1646	-			548			ANK 16.		Q53SL9|Q6P480|Q86VL5|Q8IZ72|Q9UFA4	Silent	SNP	ENST00000328737.2	37	c.1569G>T																																																																																					0.418	ANKRD44-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000335113.1	NM_153697		11	20	1	0	0.000219431	0.000251067	11	20				
KLF7	8609	broad.mit.edu	37	2	207989096	207989096	+	Silent	SNP	C	C	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:207989096C>G	ENST00000309446.6	-	2	511	c.135G>C	c.(133-135)acG>acC	p.T45T	KLF7_ENST00000421199.1_Silent_p.T12T|KLF7_ENST00000423015.1_Silent_p.T45T|KLF7-IT1_ENST00000428777.1_RNA|KLF7_ENST00000412414.2_Silent_p.T17T|KLF7_ENST00000458272.1_Silent_p.T45T|KLF7_ENST00000467833.1_5'UTR	NM_003709.3	NP_003700.1	O75840	KLF7_HUMAN	Kruppel-like factor 7 (ubiquitous)	45					axon guidance (GO:0007411)|dendrite morphogenesis (GO:0048813)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|large_intestine(3)|liver(1)|lung(4)|skin(1)	11				LUSC - Lung squamous cell carcinoma(261;0.0856)|Lung(261;0.166)|Epithelial(149;0.173)		TCCGGGGCTCCGTCTGTAGGT	0.557																																						uc002vbz.1		NA																	0				central_nervous_system(1)|skin(1)	2						c.(133-135)ACG>ACC		Kruppel-like factor 7 (ubiquitous)							55.0	59.0	57.0					2																	207989096		2203	4300	6503	SO:0001819	synonymous_variant	8609				regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|zinc ion binding	g.chr2:207989096C>G	AB015132	CCDS2373.1, CCDS59438.1, CCDS59439.1, CCDS59440.1	2q32	2013-01-08			ENSG00000118263	ENSG00000118263		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6350	protein-coding gene	gene with protein product		604865				9774444	Standard	NM_003709		Approved	UKLF	uc010zix.2	O75840	OTTHUMG00000132935	ENST00000309446.6:c.135G>C	2.37:g.207989096C>G			Somatic				KLF7_uc002vca.1_Silent_p.T45T|KLF7_uc010zix.1_Silent_p.T17T	p.T45T	NM_003709	NP_003700	WXS	Illumina HiSeq	Unspecified	O75840	KLF7_HUMAN		LUSC - Lung squamous cell carcinoma(261;0.0856)|Lung(261;0.166)|Epithelial(149;0.173)	2	457	-			45					B2RB03|B7Z4F7|C9JF04|E7EWH1|L0R4P2|Q7Z3H8|Q96E51	Silent	SNP	ENST00000309446.6	37	c.135G>C	CCDS2373.1																																																																																				0.557	KLF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256466.2	NM_003709		9	24	0	0	0	0	9	24				
FN1	2335	broad.mit.edu	37	2	216251534	216251534	+	Missense_Mutation	SNP	A	A	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:216251534A>C	ENST00000359671.1	-	27	4482	c.4217T>G	c.(4216-4218)gTg>gGg	p.V1406G	FN1_ENST00000336916.4_Missense_Mutation_p.V1406G|FN1_ENST00000432072.2_Missense_Mutation_p.V1497G|FN1_ENST00000357009.2_Missense_Mutation_p.V1406G|FN1_ENST00000421182.1_Missense_Mutation_p.V1406G|FN1_ENST00000345488.5_Missense_Mutation_p.V1406G|FN1_ENST00000357867.4_Missense_Mutation_p.V1406G|FN1_ENST00000446046.1_Missense_Mutation_p.V1406G|FN1_ENST00000443816.1_Missense_Mutation_p.V1406G|FN1_ENST00000356005.4_Missense_Mutation_p.V1406G|FN1_ENST00000346544.3_Missense_Mutation_p.V1406G|FN1_ENST00000323926.6_Missense_Mutation_p.V1497G|FN1_ENST00000354785.4_Missense_Mutation_p.V1497G			P02751	FINC_HUMAN	fibronectin 1	1406	Cell-attachment.|Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316, ECO:0000255|PROSITE-ProRule:PRU00478, ECO:0000255|PROSITE-ProRule:PRU00479}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	AGAGTGGGGCACCCGATCTTC	0.542																																						uc002vfa.2		NA																	0				central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13						c.(4489-4491)GTG>GGG		fibronectin 1 isoform 1 preproprotein	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						108.0	98.0	101.0					2																	216251534		2203	4300	6503	SO:0001583	missense	2335				acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding	g.chr2:216251534A>C		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.4217T>G	2.37:g.216251534A>C	ENSP00000352696:p.Val1406Gly		Somatic				FN1_uc002vfb.2_Missense_Mutation_p.V1406G|FN1_uc002vfc.2_Missense_Mutation_p.V1406G|FN1_uc002vfd.2_Missense_Mutation_p.V1497G|FN1_uc002vfe.2_Missense_Mutation_p.V1406G|FN1_uc002vff.2_Missense_Mutation_p.V1406G|FN1_uc002vfg.2_Missense_Mutation_p.V1406G|FN1_uc002vfh.2_Missense_Mutation_p.V1406G|FN1_uc002vfi.2_Missense_Mutation_p.V1497G|FN1_uc002vfj.2_Missense_Mutation_p.V1497G|FN1_uc002vez.2_5'UTR|FN1_uc010zjp.1_Missense_Mutation_p.V124G	p.V1497G	NM_212482	NP_997647	WXS	Illumina HiSeq	Unspecified	P02751	FINC_HUMAN		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	28	4756	-		Renal(323;0.127)	1496			Fibronectin type-III 10.|Cell-attachment.		B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	ENST00000359671.1	37	c.4490T>G		.	.	.	.	.	.	.	.	.	.	A	19.07	3.755643	0.69648	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005;ENST00000456923	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.61274	0.12;0.12;0.12;0.12;0.12;0.12;0.12;0.12;0.12;0.12;0.12;0.12;0.12;0.12	6.17	6.17	0.99709	.	0.000000	0.64402	D	0.000006	D	0.82674	0.5088	M	0.93854	3.465	0.58432	D	0.999991	D;D;D;D;D;D;D;D;D;D	0.89917	0.999;0.999;1.0;1.0;1.0;0.999;1.0;0.999;0.999;0.999	D;D;D;D;D;D;D;D;D;D	0.97110	0.999;0.972;0.992;0.995;1.0;0.977;0.997;0.999;0.999;0.985	D	0.87069	0.2158	10	0.87932	D	0	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	1497;1497;1406;1406;1406;1406;1407;1406;1406;1497	P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15	.;.;.;.;.;.;.;.;.;.	G	1406;1497;1406;1406;1497;1407;1406;1406;1406;1406;1406;1406;1497;1406;213	ENSP00000394423:V1406G;ENSP00000323534:V1497G;ENSP00000338200:V1406G;ENSP00000350534:V1406G;ENSP00000346839:V1497G;ENSP00000352696:V1406G;ENSP00000265312:V1406G;ENSP00000273049:V1406G;ENSP00000349509:V1406G;ENSP00000410422:V1406G;ENSP00000415018:V1406G;ENSP00000399538:V1497G;ENSP00000348285:V1406G;ENSP00000416139:V213G	ENSP00000265313:V1407G	V	-	2	0	FN1	215959779	0.992000	0.36948	1.000000	0.80357	0.208000	0.24298	8.962000	0.93254	2.371000	0.80710	0.533000	0.62120	GTG		0.542	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476		12	40	0	0	0	0	12	40				
CUL3	8452	broad.mit.edu	37	2	225400280	225400280	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:225400280C>T	ENST00000264414.4	-	3	681	c.343G>A	c.(343-345)Gct>Act	p.A115T	CUL3_ENST00000344951.4_Missense_Mutation_p.A49T|CUL3_ENST00000432260.2_5'UTR|CUL3_ENST00000409777.1_Missense_Mutation_p.A91T|CUL3_ENST00000409096.1_Missense_Mutation_p.A91T	NM_003590.4	NP_003581.1	Q13618	CUL3_HUMAN	cullin 3	115					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|COPII vesicle coating (GO:0048208)|cyclin catabolic process (GO:0008054)|embryonic cleavage (GO:0040016)|ER to Golgi vesicle-mediated transport (GO:0006888)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|integrin-mediated signaling pathway (GO:0007229)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic metaphase plate congression (GO:0007080)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|stem cell division (GO:0017145)|stress fiber assembly (GO:0043149)|trophectodermal cellular morphogenesis (GO:0001831)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|nucleus (GO:0005634)|polar microtubule (GO:0005827)	POZ domain binding (GO:0031208)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	46		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		ATCACCATAGCTGTTTGATGA	0.343																																						uc002vny.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|liver(1)|kidney(1)	4						c.(343-345)GCT>ACT		cullin 3							185.0	165.0	172.0					2																	225400280		2203	4298	6501	SO:0001583	missense	8452				cell cycle arrest|cell migration|cyclin catabolic process|cytokinesis|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|mitotic anaphase|negative regulation of Rho protein signal transduction|positive regulation of cell proliferation|protein ubiquitination|stress fiber assembly	Cul3-RING ubiquitin ligase complex|Golgi apparatus|nucleus|polar microtubule	ubiquitin protein ligase binding	g.chr2:225400280C>T	U58089	CCDS2462.1, CCDS58751.1	2q36.2	2011-05-24			ENSG00000036257	ENSG00000036257			2553	protein-coding gene	gene with protein product		603136				8681378, 17192413	Standard	NM_003590		Approved		uc002vny.3	Q13618	OTTHUMG00000133167	ENST00000264414.4:c.343G>A	2.37:g.225400280C>T	ENSP00000264414:p.Ala115Thr		Somatic				CUL3_uc010zls.1_Missense_Mutation_p.A49T|CUL3_uc010fwy.1_Missense_Mutation_p.A121T	p.A115T	NM_003590	NP_003581	WXS	Illumina HiSeq	Unspecified	Q13618	CUL3_HUMAN		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)	3	727	-		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)	115					A8K536|B8ZZC3|O75415|Q569L3|Q9UBI8|Q9UET7	Missense_Mutation	SNP	ENST00000264414.4	37	c.343G>A	CCDS2462.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.89|17.89	3.500606|3.500606	0.64298|0.64298	.|.	.|.	ENSG00000036257|ENSG00000036257	ENST00000264414;ENST00000344951;ENST00000409096;ENST00000409777|ENST00000436172	T;T;T;T|.	0.31510|.	1.49;1.49;1.49;1.49|.	5.99|5.99	5.11|5.11	0.69529|0.69529	Cullin, N-terminal (1);Cullin repeat-like-containing domain (1);|.	0.102911|.	0.64402|.	D|.	0.000003|.	T|T	0.71651|0.71651	0.3365|0.3365	M|M	0.63208|0.63208	1.945|1.945	0.80722|0.80722	D|D	1|1	P;P;P|.	0.48089|.	0.905;0.866;0.866|.	B;P;P|.	0.46796|.	0.392;0.527;0.527|.	T|T	0.71066|0.71066	-0.4700|-0.4700	10|5	0.41790|.	T|.	0.15|.	.|.	16.2777|16.2777	0.82654|0.82654	0.1337:0.8663:0.0:0.0|0.1337:0.8663:0.0:0.0	.|.	49;93;115|.	Q13618-3;Q53S54;Q13618|.	.;.;CUL3_HUMAN|.	T|N	115;49;91;91|135	ENSP00000264414:A115T;ENSP00000343601:A49T;ENSP00000387200:A91T;ENSP00000386525:A91T|.	ENSP00000264414:A115T|.	A|S	-|-	1|2	0|0	CUL3|CUL3	225108524|225108524	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.653000|0.653000	0.38743|0.38743	4.453000|4.453000	0.60061|0.60061	1.519000|1.519000	0.48950|0.48950	-0.182000|-0.182000	0.12963|0.12963	GCT|AGC		0.343	CUL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256871.2			13	35	0	0	0	0	13	35				
SPHKAP	80309	broad.mit.edu	37	2	228882377	228882377	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:228882377G>T	ENST00000392056.3	-	7	3239	c.3193C>A	c.(3193-3195)Ccc>Acc	p.P1065T	SPHKAP_ENST00000344657.5_Missense_Mutation_p.P1065T	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1065						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)	p.P1065T(2)		NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		CGATTCCGGGGATAGCCCTGC	0.562																																						uc002vpq.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(5)|ovary(4)|lung(1)	10						c.(3193-3195)CCC>ACC		sphingosine kinase type 1-interacting protein							53.0	54.0	54.0					2																	228882377		2203	4300	6503	SO:0001583	missense	80309					cytoplasm	protein binding	g.chr2:228882377G>T		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.3193C>A	2.37:g.228882377G>T	ENSP00000375909:p.Pro1065Thr		Somatic				SPHKAP_uc002vpp.2_Missense_Mutation_p.P1065T|SPHKAP_uc010zlx.1_Missense_Mutation_p.P1065T	p.P1065T	NM_001142644	NP_001136116	WXS	Illumina HiSeq	Unspecified	Q2M3C7	SPKAP_HUMAN		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)	7	3240	-		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)	1065					Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	37	c.3193C>A	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	G	8.897	0.955366	0.18507	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.12147	2.72;2.71	6.08	-0.261	0.12963	.	0.377737	0.33253	N	0.005117	T	0.06280	0.0162	N	0.19112	0.55	0.20489	N	0.999896	B;B;B	0.26547	0.002;0.003;0.152	B;B;B	0.23716	0.004;0.007;0.048	T	0.37842	-0.9688	10	0.19147	T	0.46	.	5.2879	0.15712	0.5027:0.0:0.3589:0.1385	.	96;1065;1065	B3KR30;Q2M3C7;Q2M3C7-2	.;SPKAP_HUMAN;.	T	1065	ENSP00000375909:P1065T;ENSP00000339886:P1065T	ENSP00000339886:P1065T	P	-	1	0	SPHKAP	228590621	0.666000	0.27475	0.033000	0.17914	0.715000	0.41141	0.663000	0.25053	-0.103000	0.12175	-0.137000	0.14449	CCC		0.562	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623		25	45	1	0	3.74e-20	5.59e-20	25	45				
SP140L	93349	broad.mit.edu	37	2	231249970	231249970	+	Silent	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:231249970G>A	ENST00000415673.2	+	9	821	c.735G>A	c.(733-735)tcG>tcA	p.S245S	SP140L_ENST00000444636.1_Silent_p.S245S|SP140L_ENST00000243810.6_Silent_p.S245S|SP140L_ENST00000396563.4_Silent_p.S245S	NM_138402.4	NP_612411.4	Q9H930	SP14L_HUMAN	SP140 nuclear body protein-like	245						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(7)|prostate(1)|skin(1)	20						AGCTGGTCTCGAGTGAAAAGA	0.458																																						uc010fxm.1		NA																	0				central_nervous_system(1)	1						c.(733-735)TCG>TCA		SP140 nuclear body protein-like							111.0	111.0	111.0					2																	231249970		1885	4112	5997	SO:0001819	synonymous_variant	93349					nucleus	DNA binding|metal ion binding	g.chr2:231249970G>A	BC004921	CCDS46538.1	2q37.1	2013-01-28			ENSG00000185404	ENSG00000185404		"""Zinc fingers, PHD-type"""	25105	protein-coding gene	gene with protein product						12477932	Standard	NM_138402		Approved		uc010fxm.1	Q9H930	OTTHUMG00000153730	ENST00000415673.2:c.735G>A	2.37:g.231249970G>A			Somatic				SP140L_uc010fxo.1_Silent_p.S52S	p.S245S	NM_138402	NP_612411	WXS	Illumina HiSeq	Unspecified	Q9H930	LY10L_HUMAN			9	826	+			245					Q2M375|Q4ZG65|Q9BSP3	Silent	SNP	ENST00000415673.2	37	c.735G>A	CCDS46538.1																																																																																				0.458	SP140L-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374538.1	NM_138402		3	55	0	0	0	0	3	55				
COL6A3	1293	broad.mit.edu	37	2	238296331	238296331	+	Silent	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:238296331G>T	ENST00000295550.4	-	4	1658	c.1206C>A	c.(1204-1206)gtC>gtA	p.V402V	COL6A3_ENST00000472056.1_Intron|COL6A3_ENST00000392004.3_Silent_p.V196V|COL6A3_ENST00000409809.1_Silent_p.V196V|COL6A3_ENST00000353578.4_Silent_p.V196V|COL6A3_ENST00000392003.2_Intron|COL6A3_ENST00000347401.3_Intron|COL6A3_ENST00000346358.4_Silent_p.V402V	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	402	Nonhelical region.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GGAATTCCGGGACAGTAAACA	0.542																																						uc002vwl.2		NA																	0				ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18						c.(1204-1206)GTC>GTA		alpha 3 type VI collagen isoform 1 precursor							63.0	58.0	60.0					2																	238296331		2203	4300	6503	SO:0001819	synonymous_variant	1293				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity	g.chr2:238296331G>T	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.1206C>A	2.37:g.238296331G>T			Somatic				COL6A3_uc002vwo.2_Silent_p.V196V|COL6A3_uc010znj.1_Intron|COL6A3_uc002vwq.2_Silent_p.V196V|COL6A3_uc002vwr.2_Intron|COL6A3_uc010znk.1_Silent_p.V402V	p.V402V	NM_004369	NP_004360	WXS	Illumina HiSeq	Unspecified	P12111	CO6A3_HUMAN		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)	4	1491	-		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)	402			VWFA 2.|Nonhelical region.		A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Silent	SNP	ENST00000295550.4	37	c.1206C>A	CCDS33412.1																																																																																				0.542	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369		4	21	1	0	0.00909568	0.00953133	4	21				
SNPH	9751	broad.mit.edu	37	20	1286353	1286353	+	Silent	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr20:1286353C>A	ENST00000381873.3	+	6	1376	c.1140C>A	c.(1138-1140)acC>acA	p.T380T	SNPH_ENST00000381867.1_Silent_p.T424T	NM_014723.2	NP_055538.2	O15079	SNPH_HUMAN	syntaphilin	380					brain development (GO:0007420)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|synaptic vesicle docking involved in exocytosis (GO:0016081)	cell junction (GO:0030054)|cytoplasmic microtubule (GO:0005881)|integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)	syntaxin-1 binding (GO:0017075)			endometrium(2)|large_intestine(4)|lung(10)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						AGCCCATCACCCGTGGACCCA	0.672																																						uc002wes.2		NA																	0				ovary(2)	2						c.(1138-1140)ACC>ACA		syntaphilin							32.0	33.0	33.0					20																	1286353		2202	4298	6500	SO:0001819	synonymous_variant	9751				synaptic vesicle docking involved in exocytosis	cell junction|integral to membrane|synapse|synaptosome	syntaxin-1 binding	g.chr20:1286353C>A		CCDS13012.1	20p13	2008-07-02			ENSG00000101298	ENSG00000101298			15931	protein-coding gene	gene with protein product		604942				10707983	Standard	NM_014723		Approved	bA314N13.5	uc002wes.3	O15079	OTTHUMG00000031662	ENST00000381873.3:c.1140C>A	20.37:g.1286353C>A			Somatic				SNPH_uc002wet.2_Silent_p.T424T	p.T380T	NM_014723	NP_055538	WXS	Illumina HiSeq	Unspecified	O15079	SNPH_HUMAN			6	1376	+			380					Q8IYI3	Silent	SNP	ENST00000381873.3	37	c.1140C>A	CCDS13012.1																																																																																				0.672	SNPH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145240.2	NM_014723		13	52	1	0	0.00136819	0.00149669	13	52				
STK35	140901	broad.mit.edu	37	20	2097588	2097588	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr20:2097588G>T	ENST00000381482.3	+	3	1440	c.1169G>T	c.(1168-1170)gGg>gTg	p.G390V	STK35_ENST00000400064.3_Intron|STK35_ENST00000246032.3_Missense_Mutation_p.G257V			Q8TDR2	STK35_HUMAN	serine/threonine kinase 35	390	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(2)|liver(2)|lung(6)|ovary(1)|prostate(2)	13						GTCTGTGCTGGGCTGGCACCC	0.542																																						uc010gak.2		NA																	0				ovary(1)	1						c.(1168-1170)GGG>GTG		serine/threonine kinase 35							57.0	49.0	52.0					20																	2097588		2203	4300	6503	SO:0001583	missense	140901					cytoplasm|nucleolus	ATP binding|protein serine/threonine kinase activity	g.chr20:2097588G>T	AL359916	CCDS13024.1, CCDS13024.2	20p13	2008-07-02			ENSG00000125834	ENSG00000125834			16254	protein-coding gene	gene with protein product	"""CLP-36 interacting kinase"""	609370				11973348	Standard	NM_080836		Approved	bA550O8.2, CLIK1	uc002wfw.4	Q8TDR2	OTTHUMG00000031688	ENST00000381482.3:c.1169G>T	20.37:g.2097588G>T	ENSP00000370891:p.Gly390Val		Somatic				STK35_uc010zpu.1_Intron|STK35_uc002wfw.3_Missense_Mutation_p.G257V	p.G390V	NM_080836	NP_543026	WXS	Illumina HiSeq	Unspecified	Q8TDR2	STK35_HUMAN			3	1169	+			390			Protein kinase.		B2RBM3|C7ENV8|Q2NKW6|Q5T3R1|Q5T3R2|Q96AB4|Q9BZ06	Missense_Mutation	SNP	ENST00000381482.3	37	c.1169G>T	CCDS13024.2	.	.	.	.	.	.	.	.	.	.	G	23.5	4.418174	0.83449	.	.	ENSG00000125834	ENST00000381482;ENST00000246032	D;D	0.93189	-3.18;-3.18	5.5	5.5	0.81552	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.92309	0.7560	L	0.35341	1.055	0.80722	D	1	P	0.51240	0.943	P	0.50270	0.636	D	0.92767	0.6229	10	0.62326	D	0.03	-17.4029	16.94	0.86215	0.0:0.0:1.0:0.0	.	390	Q8TDR2	STK35_HUMAN	V	390;257	ENSP00000370891:G390V;ENSP00000246032:G257V	ENSP00000246032:G257V	G	+	2	0	STK35	2045588	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.657000	0.98554	2.861000	0.98227	0.655000	0.94253	GGG		0.542	STK35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077574.3	NM_080836		13	78	1	0	2.32e-09	3.07e-09	13	78				
SEL1L2	80343	broad.mit.edu	37	20	13868594	13868594	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr20:13868594C>A	ENST00000284951.5	-	7	731	c.657G>T	c.(655-657)atG>atT	p.M219I	SEL1L2_ENST00000378072.5_Missense_Mutation_p.M219I|SEL1L2_ENST00000486903.1_5'UTR			Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 (C. elegans)	219						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	51						AAACCAAAATCATCTGGGACA	0.368																																						uc010gcf.2		NA																	0				ovary(2)	2						c.(655-657)ATG>ATT		sel-1 suppressor of lin-12-like 2 precursor							80.0	75.0	76.0					20																	13868594		1818	4085	5903	SO:0001583	missense	80343					integral to membrane	binding	g.chr20:13868594C>A	AL137678	CCDS59443.1	20p12.1	2011-03-31	2006-11-24	2006-11-24	ENSG00000101251	ENSG00000101251			15897	protein-coding gene	gene with protein product		614289	"""chromosome 20 open reading frame 50"""	C20orf50			Standard	NM_001271539		Approved	DKFZp434C1826	uc010zrl.3	Q5TEA6	OTTHUMG00000031910	ENST00000284951.5:c.657G>T	20.37:g.13868594C>A	ENSP00000284951:p.Met219Ile		Somatic				SEL1L2_uc002woq.3_Missense_Mutation_p.M80I|SEL1L2_uc010zrl.1_Missense_Mutation_p.M219I|SEL1L2_uc002wor.2_RNA	p.M219I	NM_025229	NP_079505	WXS	Illumina HiSeq	Unspecified	Q5TEA6	SE1L2_HUMAN			7	739	-			219			Sel1-like 4.|Extracellular (Potential).		B4DXX5	Missense_Mutation	SNP	ENST00000284951.5	37	c.657G>T		.	.	.	.	.	.	.	.	.	.	C	20.6	4.009856	0.75046	.	.	ENSG00000101251	ENST00000378072;ENST00000284951	T;T	0.50277	0.75;0.75	5.58	5.58	0.84498	Tetratricopeptide-like helical (1);	0.000000	0.64402	D	0.000001	T	0.74245	0.3691	M	0.90977	3.165	0.45477	D	0.998443	D;D	0.65815	0.995;0.969	D;D	0.75020	0.985;0.968	T	0.78550	-0.2161	10	0.51188	T	0.08	-13.7922	15.065	0.71986	0.0:1.0:0.0:0.0	.	219;219	B4DXX5;Q5TEA6	.;SE1L2_HUMAN	I	219	ENSP00000367312:M219I;ENSP00000284951:M219I	ENSP00000284951:M219I	M	-	3	0	SEL1L2	13816594	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.317000	0.59184	2.615000	0.88500	0.650000	0.86243	ATG		0.368	SEL1L2-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078067.3	NM_025229		17	119	1	0	2.94e-08	3.82e-08	17	119				
DZANK1	55184	broad.mit.edu	37	20	18377178	18377178	+	Missense_Mutation	SNP	T	T	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr20:18377178T>A	ENST00000358866.6	-	14	1571	c.1549A>T	c.(1549-1551)Act>Tct	p.T517S	DZANK1_ENST00000487128.1_5'UTR|DZANK1_ENST00000262547.5_Missense_Mutation_p.T517S|DZANK1_ENST00000329494.5_Missense_Mutation_p.T519S|DZANK1_ENST00000357236.4_Missense_Mutation_p.T403S			Q9NVP4	DZAN1_HUMAN	double zinc ribbon and ankyrin repeat domains 1	517							zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(10)	19						TCGTGGACAGTAGCAGAGATA	0.383																																						uc010zsa.1		NA																	0				ovary(1)	1						c.(1606-1608)ACT>TCT		hypothetical protein LOC55184							134.0	128.0	130.0					20																	18377178		1888	4112	6000	SO:0001583	missense	55184					intracellular	zinc ion binding	g.chr20:18377178T>A	AK001462	CCDS46582.1	20p11.23	2013-01-11	2011-10-03	2011-10-03	ENSG00000089091	ENSG00000089091		"""Ankyrin repeat domain containing"""	15858	protein-coding gene	gene with protein product	"""ankyrin repeat domain 64"""		"""chromosome 20 open reading frame 12"""	C20orf84, C20orf12			Standard	NM_001099407		Approved	FLJ10600, dJ568F9.2, FLJ30892, bA189K21.8, ANKRD64	uc002wqq.4	Q9NVP4	OTTHUMG00000031968	ENST00000358866.6:c.1549A>T	20.37:g.18377178T>A	ENSP00000351734:p.Thr517Ser		Somatic				C20orf12_uc010zrz.1_Missense_Mutation_p.T55S|C20orf12_uc002wqp.3_Missense_Mutation_p.T227S|C20orf12_uc002wqr.3_RNA|C20orf12_uc002wqs.3_Missense_Mutation_p.T403S|C20orf12_uc002wqq.3_Missense_Mutation_p.T517S	p.T536S	NM_001099407	NP_001092877	WXS	Illumina HiSeq	Unspecified	Q9NVP4	CT012_HUMAN			15	1815	-		Myeloproliferative disorder(85;0.0122)	344					B7ZLZ4|Q4F7X1|Q5QPD9|Q5QPE0|Q68DN8|Q6ZMX9|Q96NF0|Q9H1E0|Q9H442	Missense_Mutation	SNP	ENST00000358866.6	37	c.1606A>T	CCDS46582.1	.	.	.	.	.	.	.	.	.	.	T	15.56	2.869433	0.51588	.	.	ENSG00000089091	ENST00000377630;ENST00000262547;ENST00000329494;ENST00000414623;ENST00000377637;ENST00000357236	T;T;T;T	0.62364	0.2;0.03;0.66;0.18	4.99	4.99	0.66335	.	0.286751	0.39834	N	0.001247	T	0.70996	0.3288	L	0.56396	1.775	0.27598	N	0.949067	D;D;P;P	0.65815	0.983;0.995;0.619;0.601	P;P;B;B	0.61592	0.656;0.891;0.359;0.174	T	0.66436	-0.5924	10	0.72032	D	0.01	-24.5295	10.2718	0.43487	0.0:0.0806:0.0:0.9194	.	536;403;517;302	B7Z631;Q9NVP4-4;Q9NVP4;A6NKD0	.;.;DZAN1_HUMAN;.	S	350;517;519;349;302;403	ENSP00000366857:T350S;ENSP00000262547:T517S;ENSP00000328866:T519S;ENSP00000349774:T403S	ENSP00000262547:T517S	T	-	1	0	C20orf12	18325178	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.844000	0.48246	2.009000	0.58944	0.533000	0.62120	ACT		0.383	DZANK1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471926.1	NM_001099407		58	90	0	0	0	0	58	90				
VSX1	30813	broad.mit.edu	37	20	25060074	25060074	+	Silent	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr20:25060074G>A	ENST00000376709.4	-	2	764	c.501C>T	c.(499-501)caC>caT	p.H167H	VSX1_ENST00000429762.3_Silent_p.H167H|VSX1_ENST00000424574.1_Silent_p.H167H|VSX1_ENST00000376707.3_Silent_p.H167H|VSX1_ENST00000451258.1_Silent_p.H167H|VSX1_ENST00000444511.2_Silent_p.H167H	NM_014588.5	NP_055403.2	Q9NZR4	VSX1_HUMAN	visual system homeobox 1	167					neuron maturation (GO:0042551)|response to stimulus (GO:0050896)|retinal bipolar neuron differentiation (GO:0060040)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(3)|lung(2)	6						CCCTATACCTGTGCCGCCGCT	0.557																																						uc002wuf.2		NA																	0					0						c.(499-501)CAC>CAT		visual system homeobox 1 isoform a							60.0	45.0	50.0					20																	25060074		2203	4300	6503	SO:0001819	synonymous_variant	30813				response to stimulus|visual perception	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr20:25060074G>A	AF176797	CCDS13168.1, CCDS13169.1, CCDS58766.1, CCDS58767.1	20p11.21	2014-02-14	2007-07-12		ENSG00000100987	ENSG00000100987		"""Homeoboxes / PRD class"""	12723	protein-coding gene	gene with protein product		605020	"""posterior polymorphous corneal dystrophy"", ""visual system homeobox 1 homolog, CHX10-like (zebrafish)"""	PPCD		10673340	Standard	NM_001256272		Approved	PPD, PPCD1	uc002wuf.4	Q9NZR4	OTTHUMG00000032111	ENST00000376709.4:c.501C>T	20.37:g.25060074G>A			Somatic				VSX1_uc002wue.2_RNA|VSX1_uc010gdd.1_Silent_p.H167H|VSX1_uc010gde.1_RNA|VSX1_uc010gdf.1_Silent_p.H167H|VSX1_uc002wug.1_Silent_p.H167H	p.H167H	NM_014588	NP_055403	WXS	Illumina HiSeq	Unspecified	Q9NZR4	VSX1_HUMAN			2	536	-			167			Homeobox.		B9EGJ4|D1MF28|Q0GM60|Q0GM61|Q0GM62|Q0GM63|Q0GM64|Q0GM65|Q5TF40|Q5TF41|Q9HCU3|Q9NU27	Silent	SNP	ENST00000376709.4	37	c.501C>T	CCDS13168.1																																																																																				0.557	VSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078384.3			13	29	0	0	0	0	13	29				
DLGAP4	22839	broad.mit.edu	37	20	35154397	35154397	+	Silent	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr20:35154397C>A	ENST00000373907.2	+	11	2947	c.2748C>A	c.(2746-2748)ccC>ccA	p.P916P	DLGAP4_ENST00000340491.4_Silent_p.P377P|DLGAP4_ENST00000475894.1_3'UTR|RP5-977B1.7_ENST00000439595.1_RNA|DLGAP4_ENST00000339266.5_Silent_p.P916P|DLGAP4_ENST00000373913.3_Silent_p.P913P|DLGAP4_ENST00000401952.2_Silent_p.P913P|RP5-977B1.7_ENST00000425233.1_RNA|RP5-977B1.7_ENST00000433238.1_RNA			Q9Y2H0	DLGP4_HUMAN	discs, large (Drosophila) homolog-associated protein 4	916					cell-cell signaling (GO:0007267)	membrane (GO:0016020)|synapse (GO:0045202)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(20)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				TGGAGACCCCCGAGAAGAGGA	0.572																																						uc002xff.2		NA																	0				skin(2)|ovary(1)	3						c.(2737-2739)CCC>CCA		disks large-associated protein 4 isoform a							95.0	95.0	95.0					20																	35154397		2203	4300	6503	SO:0001819	synonymous_variant	22839				cell-cell signaling	membrane	protein binding	g.chr20:35154397C>A	AF088030	CCDS13274.1, CCDS13275.1	20q11.23	2010-02-05			ENSG00000080845	ENSG00000080845			24476	protein-coding gene	gene with protein product						9115257	Standard	XM_005260329		Approved	DAP4, KIAA0964, SAPAP4	uc010zvp.2	Q9Y2H0	OTTHUMG00000032390	ENST00000373907.2:c.2748C>A	20.37:g.35154397C>A			Somatic				DLGAP4_uc010zvp.1_Silent_p.P913P|DLGAP4_uc002xfg.2_Silent_p.P209P|DLGAP4_uc002xfh.2_Silent_p.P377P|DLGAP4_uc002xfi.2_Silent_p.P222P|DLGAP4_uc002xfj.2_Silent_p.P209P|uc002xfk.3_Intron	p.P913P	NM_014902	NP_055717	WXS	Illumina HiSeq	Unspecified	Q9Y2H0	DLGP4_HUMAN			12	3174	+	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)	916					E1P5T5|Q5QPG4|Q5T2Y4|Q5T2Y5|Q9H137|Q9H138|Q9H1L7	Silent	SNP	ENST00000373907.2	37	c.2739C>A																																																																																					0.572	DLGAP4-007	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000079025.2	NM_014902		27	85	1	0	3.58e-08	4.61e-08	27	85				
RBPJL	11317	broad.mit.edu	37	20	43942234	43942234	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr20:43942234C>A	ENST00000343694.3	+	7	818	c.746C>A	c.(745-747)aCg>aAg	p.T249K	RBPJL_ENST00000372741.3_Missense_Mutation_p.T249K|RBPJL_ENST00000372743.1_Missense_Mutation_p.T249K	NM_001281448.1|NM_001281449.1|NM_014276.2	NP_001268377.1|NP_001268378.1|NP_055091.2	Q9UBG7	RBPJL_HUMAN	recombination signal binding protein for immunoglobulin kappa J region-like	249					positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Myeloproliferative disorder(115;0.0122)				GCTGCCTTCACGCTCCACCTG	0.562																																						uc002xns.2		NA																	0				ovary(1)	1						c.(745-747)ACG>AAG		recombining binding protein L							66.0	54.0	58.0					20																	43942234		2203	4300	6503	SO:0001583	missense	11317				signal transduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr20:43942234C>A	AB024964	CCDS13349.1, CCDS63283.1, CCDS63284.1	20q13.12	2013-10-18	2007-02-26	2007-02-26	ENSG00000124232	ENSG00000124232			13761	protein-coding gene	gene with protein product			"""recombining binding protein suppressor of hairless (Drosophila)-like"""	RBPSUHL		9929984	Standard	NM_014276		Approved	RBP-L, SUH, SUHL	uc002xns.3	Q9UBG7	OTTHUMG00000033055	ENST00000343694.3:c.746C>A	20.37:g.43942234C>A	ENSP00000341243:p.Thr249Lys		Somatic				RBPJL_uc002xnt.2_Missense_Mutation_p.T249K	p.T249K	NM_014276	NP_055091	WXS	Illumina HiSeq	Unspecified	Q9UBG7	RBPJL_HUMAN			7	818	+		Myeloproliferative disorder(115;0.0122)	249					O95723|Q5QPU9|Q5QPV0|Q9ULV9	Missense_Mutation	SNP	ENST00000343694.3	37	c.746C>A	CCDS13349.1	.	.	.	.	.	.	.	.	.	.	C	15.95	2.983826	0.53827	.	.	ENSG00000124232	ENST00000372743;ENST00000372741;ENST00000343694	T;T;T	0.31247	1.5;1.5;1.5	4.85	3.9	0.45041	Beta-trefoil (2);	0.000000	0.85682	D	0.000000	T	0.45935	0.1367	L	0.58101	1.795	0.54753	D	0.999986	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.32402	-0.9908	10	0.36615	T	0.2	-17.9253	7.6811	0.28513	0.161:0.7562:0.0:0.0827	.	249;249	Q5QPV1;Q9UBG7	.;RBPJL_HUMAN	K	249	ENSP00000361828:T249K;ENSP00000361826:T249K;ENSP00000341243:T249K	ENSP00000341243:T249K	T	+	2	0	RBPJL	43375648	0.955000	0.32602	0.843000	0.33291	0.639000	0.38242	2.173000	0.42472	1.258000	0.44101	0.557000	0.71058	ACG		0.562	RBPJL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080391.1	NM_014276		11	19	1	0	2.81e-09	3.7e-09	11	19				
POTEH	23784	broad.mit.edu	37	22	16287846	16287846	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr22:16287846C>T	ENST00000343518.6	-	1	91	c.40G>A	c.(40-42)Gtg>Atg	p.V14M		NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	14										NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						GGCTTCTTCACAGAGGAGGCA	0.587																																						uc010gqp.2		NA																	0				skin(1)	1						c.(40-42)GTG>ATG		ANKRD26-like family C, member 3							50.0	66.0	61.0					22																	16287846		1419	2872	4291	SO:0001583	missense	23784							g.chr22:16287846C>T	AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.40G>A	22.37:g.16287846C>T	ENSP00000340610:p.Val14Met		Somatic				POTEH_uc002zlg.1_5'Flank|POTEH_uc002zlh.1_5'Flank|POTEH_uc002zlj.1_Translation_Start_Site	p.V14M	NM_001136213	NP_001129685	WXS	Illumina HiSeq	Unspecified	Q6S545	POTEH_HUMAN			1	92	-			14					A2CEK4|A6NCI1|A9Z1W0	Missense_Mutation	SNP	ENST00000343518.6	37	c.40G>A	CCDS46658.1	.	.	.	.	.	.	.	.	.	.	.	0.345	-0.948202	0.02304	.	.	ENSG00000198062	ENST00000359587;ENST00000343518;ENST00000355872	T	0.37584	1.19	0.462	-0.925	0.10458	.	.	.	.	.	T	0.15825	0.0381	N	0.14661	0.345	0.09310	N	1	P	0.36438	0.553	B	0.32393	0.145	T	0.11767	-1.0574	8	0.87932	D	0	.	.	.	.	.	14	Q6S545	POTEH_HUMAN	M	14	ENSP00000340610:V14M	ENSP00000340610:V14M	V	-	1	0	POTEH	14667846	0.016000	0.18221	0.002000	0.10522	0.009000	0.06853	-0.603000	0.05674	-1.445000	0.01948	-1.064000	0.02280	GTG		0.587	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276918.4	NM_001136213		34	70	0	0	0	0	34	70				
C22orf29	79680	broad.mit.edu	37	22	19839663	19839663	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr22:19839663G>A	ENST00000405640.1	-	2	790	c.122C>T	c.(121-123)cCc>cTc	p.P41L	GNB1L_ENST00000405009.1_Intron|C22orf29_ENST00000407472.1_Missense_Mutation_p.P41L|GNB1L_ENST00000460402.1_Intron|C22orf29_ENST00000484072.1_Intron|C22orf29_ENST00000328554.4_Missense_Mutation_p.P41L|GNB1L_ENST00000403325.1_Intron|GNB1L_ENST00000329517.6_Intron			Q7L3V2	BOP_HUMAN	chromosome 22 open reading frame 29	41					mitochondrial outer membrane permeabilization (GO:0097345)|regulation of mitochondrial membrane potential (GO:0051881)	mitochondrion (GO:0005739)				NS(1)|large_intestine(1)|lung(3)|prostate(1)|urinary_tract(1)	7	Colorectal(54;0.0993)					ATCCACAAGGGGGGTGTATGC	0.617																																						uc002zqg.2		NA																	0					0						c.(121-123)CCC>CTC		hypothetical protein LOC79680							93.0	83.0	87.0					22																	19839663		2203	4300	6503	SO:0001583	missense	79680							g.chr22:19839663G>A	BX640998	CCDS13769.1	22q11.21	2006-07-05			ENSG00000215012	ENSG00000215012			26112	protein-coding gene	gene with protein product						12477932	Standard	NM_024627		Approved	FLJ21125	uc002zqh.3	Q7L3V2	OTTHUMG00000030314	ENST00000405640.1:c.122C>T	22.37:g.19839663G>A	ENSP00000384924:p.Pro41Leu		Somatic				GNB1L_uc002zqd.1_Intron|GNB1L_uc002zqe.1_Intron|GNB1L_uc002zqf.1_Intron|C22orf29_uc002zqh.2_Missense_Mutation_p.P41L|C22orf29_uc002zqi.2_Missense_Mutation_p.P41L|C22orf29_uc010grt.1_Intron	p.P41L	NM_024627	NP_078903	WXS	Illumina HiSeq	Unspecified	Q7L3V2	CV029_HUMAN			2	721	-	Colorectal(54;0.0993)		41					A8K5E7|D3DX21|Q6MZM8|Q6N000|Q9H7A0	Missense_Mutation	SNP	ENST00000405640.1	37	c.122C>T	CCDS13769.1	.	.	.	.	.	.	.	.	.	.	G	10.52	1.373985	0.24857	.	.	ENSG00000215012	ENST00000407472;ENST00000328554;ENST00000405640;ENST00000416337	T;T;T;T	0.28069	1.63;1.63;1.63;1.63	3.17	-1.51	0.08664	.	.	.	.	.	T	0.12305	0.0299	N	0.08118	0	0.09310	N	1	B	0.17667	0.023	B	0.12156	0.007	T	0.25572	-1.0128	9	0.87932	D	0	.	0.6896	0.00889	0.2355:0.1875:0.3852:0.1918	.	41	Q7L3V2	CV029_HUMAN	L	41	ENSP00000386111:P41L;ENSP00000330596:P41L;ENSP00000384924:P41L;ENSP00000392994:P41L	ENSP00000330596:P41L	P	-	2	0	C22orf29	18219663	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.199000	0.09491	-0.193000	0.10415	-0.140000	0.14226	CCC		0.617	C22orf29-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317290.2	NM_024627		48	125	0	0	0	0	48	125				
MYO18B	84700	broad.mit.edu	37	22	26159210	26159210	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr22:26159210G>A	ENST00000407587.2	+	3	221	c.52G>A	c.(52-54)Gac>Aac	p.D18N	MYO18B_ENST00000335473.7_Missense_Mutation_p.D18N|MYO18B_ENST00000536101.1_Missense_Mutation_p.D18N			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	18						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						TCGGGAAGAGGACAAGAGCCC	0.542																																						uc003abz.1		NA																	0				ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						c.(52-54)GAC>AAC		myosin XVIIIB							38.0	41.0	40.0					22																	26159210		1925	4113	6038	SO:0001583	missense	84700					nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity	g.chr22:26159210G>A	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.52G>A	22.37:g.26159210G>A	ENSP00000386096:p.Asp18Asn		Somatic				MYO18B_uc003aca.1_5'UTR|MYO18B_uc010guy.1_5'UTR|MYO18B_uc010guz.1_5'UTR|MYO18B_uc011aka.1_5'UTR	p.D18N	NM_032608	NP_115997	WXS	Illumina HiSeq	Unspecified	Q8IUG5	MY18B_HUMAN			3	302	+			18					B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	37	c.52G>A		.	.	.	.	.	.	.	.	.	.	G	23.9	4.466875	0.84425	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.88354	-2.35;-2.35;-2.37	5.09	5.09	0.68999	.	0.169277	0.28470	N	0.015229	D	0.92861	0.7729	M	0.67953	2.075	0.34989	D	0.754828	D	0.57257	0.979	P	0.62560	0.904	D	0.95829	0.8856	10	0.87932	D	0	.	15.5718	0.76345	0.0:0.0:1.0:0.0	.	18	F5GYU7	.	N	18	ENSP00000441229:D18N;ENSP00000334563:D18N;ENSP00000386096:D18N	ENSP00000334563:D18N	D	+	1	0	MYO18B	24489210	1.000000	0.71417	1.000000	0.80357	0.804000	0.45430	3.874000	0.56101	2.531000	0.85337	0.467000	0.42956	GAC		0.542	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608		8	34	0	0	0	0	8	34				
NCF4	4689	broad.mit.edu	37	22	37273817	37273817	+	Silent	SNP	G	G	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr22:37273817G>C	ENST00000248899.6	+	10	1156	c.972G>C	c.(970-972)ctG>ctC	p.L324L	NCF4_ENST00000397147.4_3'UTR	NM_000631.4	NP_000622.2	Q15080	NCF4_HUMAN	neutrophil cytosolic factor 4, 40kDa	324	OPR.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|interaction with host (GO:0051701)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|positive regulation of catalytic activity (GO:0043085)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|membrane (GO:0016020)|NADPH oxidase complex (GO:0043020)|phagolysosome (GO:0032010)	phosphatidylinositol-3-phosphate binding (GO:0032266)|protein dimerization activity (GO:0046983)|superoxide-generating NADPH oxidase activator activity (GO:0016176)			cervix(1)|endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	16					Dextromethorphan(DB00514)	CCTGGAAGCTGCACATCACGC	0.607																																						uc003apy.3		NA																	0				ovary(1)	1						c.(970-972)CTG>CTC		neutrophil cytosolic factor 4 isoform 1							51.0	42.0	45.0					22																	37273817		2203	4300	6503	SO:0001819	synonymous_variant	4689				cell communication|immune response|oxidation-reduction process	cytosol|NADPH oxidase complex	phosphatidylinositol binding|protein dimerization activity	g.chr22:37273817G>C	X77094	CCDS13934.1, CCDS13935.1	22q13.1	2014-09-17	2002-08-29		ENSG00000100365	ENSG00000100365			7662	protein-coding gene	gene with protein product	"""neutrophil NADPH oxidase factor 4"""	601488	"""neutrophil cytosolic factor 4 (40kD)"""			8839867	Standard	NM_013416		Approved	p40phox, SH3PXD4	uc003apy.4	Q15080	OTTHUMG00000150548	ENST00000248899.6:c.972G>C	22.37:g.37273817G>C			Somatic				NCF4_uc003apz.3_3'UTR	p.L324L	NM_000631	NP_000622	WXS	Illumina HiSeq	Unspecified	Q15080	NCF4_HUMAN			10	1156	+			324					A8K4F9|O60808|Q86U56|Q9BU98|Q9NP45	Silent	SNP	ENST00000248899.6	37	c.972G>C	CCDS13934.1																																																																																				0.607	NCF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318863.1	NM_000631		7	17	0	0	0	0	7	17				
ENTHD1	150350	broad.mit.edu	37	22	40283742	40283742	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr22:40283742C>T	ENST00000325157.6	-	2	261	c.11G>A	c.(10-12)aGg>aAg	p.R4K		NM_152512.3	NP_689725.2	Q8IYW4	ENTD1_HUMAN	ENTH domain containing 1	4								p.R4K(1)		breast(2)|endometrium(1)|kidney(6)|large_intestine(6)|lung(11)|ovary(3)|skin(3)	32	Melanoma(58;0.0749)					CACTTGTCTCCTGAACGCCAT	0.393																																						uc003ayg.2		NA																	1	Substitution - Missense(1)	p.R4K(1)	ovary(1)	ovary(2)|skin(1)	3						c.(10-12)AGG>AAG		ENTH domain containing 1							56.0	55.0	55.0					22																	40283742		2203	4300	6503	SO:0001583	missense	150350							g.chr22:40283742C>T	AK093154	CCDS13998.1	22q13.1	2006-06-26			ENSG00000176177	ENSG00000176177			26352	protein-coding gene	gene with protein product						12477932	Standard	NM_152512		Approved	FLJ25421	uc003ayg.3	Q8IYW4	OTTHUMG00000151098	ENST00000325157.6:c.11G>A	22.37:g.40283742C>T	ENSP00000317431:p.Arg4Lys		Somatic					p.R4K	NM_152512	NP_689725	WXS	Illumina HiSeq	Unspecified	Q8IYW4	ENTD1_HUMAN			2	262	-	Melanoma(58;0.0749)		4					B0QYD5|Q5H9F7|Q96LK3	Missense_Mutation	SNP	ENST00000325157.6	37	c.11G>A	CCDS13998.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.018050	0.75275	.	.	ENSG00000176177	ENST00000325157	T	0.43688	0.94	5.82	3.75	0.43078	ENTH/VHS (1);	0.140299	0.47852	N	0.000219	T	0.38268	0.1034	L	0.60067	1.865	0.43734	D	0.996226	P	0.35226	0.491	B	0.34418	0.182	T	0.31752	-0.9932	10	0.42905	T	0.14	-13.3498	11.513	0.50504	0.0:0.855:0.0:0.145	.	4	Q8IYW4	ENTD1_HUMAN	K	4	ENSP00000317431:R4K	ENSP00000317431:R4K	R	-	2	0	ENTHD1	38613688	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	0.878000	0.28126	1.472000	0.48140	0.655000	0.94253	AGG		0.393	ENTHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321302.1	NM_152512		19	62	0	0	0	0	19	62				
PKDREJ	10343	broad.mit.edu	37	22	46656831	46656831	+	Missense_Mutation	SNP	G	G	T	rs140368137	byFrequency	TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr22:46656831G>T	ENST00000253255.5	-	1	2388	c.2389C>A	c.(2389-2391)Cgc>Agc	p.R797S		NM_006071.1	NP_006062.1	Q9NTG1	PKDRE_HUMAN	polycystin (PKD) family receptor for egg jelly	797	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				acrosome reaction (GO:0007340)|calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|neuropeptide signaling pathway (GO:0007218)|regulation of acrosome reaction (GO:0060046)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			NS(2)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(4)|kidney(5)|large_intestine(21)|lung(16)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	73		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		GATCGAAAGCGTTTATCTTTT	0.398																																						uc003bhh.2		NA																	0				breast(3)|ovary(2)	5						c.(2389-2391)CGC>AGC		receptor for egg jelly-like protein precursor							74.0	79.0	77.0					22																	46656831		2203	4300	6503	SO:0001583	missense	10343				acrosome reaction|neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity	g.chr22:46656831G>T	AF116458	CCDS14073.1	22q13.31	2013-07-31	2013-07-31		ENSG00000130943	ENSG00000130943			9015	protein-coding gene	gene with protein product		604670	"""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like"", ""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like"", ""polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin)"""			9949214, 10591208	Standard	NM_006071		Approved		uc003bhh.3	Q9NTG1	OTTHUMG00000150493	ENST00000253255.5:c.2389C>A	22.37:g.46656831G>T	ENSP00000253255:p.Arg797Ser		Somatic					p.R797S	NM_006071	NP_006062	WXS	Illumina HiSeq	Unspecified	Q9NTG1	PKDRE_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)	1	2389	-		Ovarian(80;0.00965)|all_neural(38;0.0416)	797			Extracellular (Potential).|REJ.		B1AJY3|O95850	Missense_Mutation	SNP	ENST00000253255.5	37	c.2389C>A	CCDS14073.1	.	.	.	.	.	.	.	.	.	.	G	2.861	-0.236140	0.05944	.	.	ENSG00000130943	ENST00000253255	T	0.35973	1.28	5.31	-7.5	0.01351	Egg jelly receptor, REJ-like (1);	2.845440	0.00799	N	0.001403	T	0.14527	0.0351	N	0.04508	-0.205	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.28202	-1.0051	10	0.09084	T	0.74	-1.2666	9.4094	0.38482	0.1399:0.0:0.1684:0.6917	.	797	Q9NTG1	PKDRE_HUMAN	S	797	ENSP00000253255:R797S	ENSP00000253255:R797S	R	-	1	0	PKDREJ	45035495	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.640000	0.05440	-0.843000	0.04189	-0.126000	0.14955	CGC		0.398	PKDREJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318466.1	NM_006071		32	112	1	0	1.08e-15	1.56e-15	32	112				
SCO2	9997	broad.mit.edu	37	22	50962505	50962505	+	Silent	SNP	C	C	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr22:50962505C>G	ENST00000543927.1	-	2	542	c.336G>C	c.(334-336)cgG>cgC	p.R112R	SCO2_ENST00000535425.1_Silent_p.R112R|CTA-384D8.36_ENST00000608319.1_RNA|SCO2_ENST00000252785.3_Silent_p.R112R|SCO2_ENST00000395693.3_Silent_p.R112R	NM_001169109.1	NP_001162580.1	O43819	SCO2_HUMAN	SCO2 cytochrome c oxidase assembly protein	112	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cellular copper ion homeostasis (GO:0006878)|copper ion transport (GO:0006825)|eye development (GO:0001654)|in utero embryonic development (GO:0001701)|muscle system process (GO:0003012)|oxidation-reduction process (GO:0055114)|respiratory chain complex IV assembly (GO:0008535)|respiratory electron transport chain (GO:0022904)|response to activity (GO:0014823)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|myofibril (GO:0030016)|nucleus (GO:0005634)	copper ion binding (GO:0005507)			endometrium(1)|lung(1)	2		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		TGCAGCGAGCCCGGCCTCTGT	0.632																																						uc003bma.2		NA																	0					0						c.(334-336)CGG>CGC		cytochrome oxidase deficient homolog 2							31.0	33.0	32.0					22																	50962505		2203	4300	6503	SO:0001819	synonymous_variant	9997				cell redox homeostasis|cellular copper ion homeostasis|copper ion transport|oxidation-reduction process|respiratory chain complex IV assembly	mitochondrial inner membrane	copper ion binding	g.chr22:50962505C>G	AL021683	CCDS14095.1	22q13.33	2014-01-30	2012-10-15		ENSG00000130489	ENSG00000130489		"""Mitochondrial respiratory chain complex assembly factors"""	10604	protein-coding gene	gene with protein product		604272	"""SCO (cytochrome oxidase deficient, yeast) homolog 2"", ""SCO cytochrome oxidase deficient homolog 2 (yeast)"", ""myopia 6"""	MYP6		10218584, 16091356, 23643385	Standard	NM_005138		Approved	SCO1L	uc003bma.3	O43819	OTTHUMG00000150251	ENST00000543927.1:c.336G>C	22.37:g.50962505C>G			Somatic				SCO2_uc003blz.3_Silent_p.R112R	p.R112R	NM_005138	NP_005129	WXS	Illumina HiSeq	Unspecified	O43819	SCO2_HUMAN		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)	2	512	-		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)	112			Thioredoxin.		Q3T1B5|Q9UK87	Silent	SNP	ENST00000543927.1	37	c.336G>C	CCDS14095.1																																																																																				0.632	SCO2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317091.1	NM_005138		10	38	0	0	0	0	10	38				
CPT1B	1375	broad.mit.edu	37	22	51009711	51009711	+	Missense_Mutation	SNP	T	T	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr22:51009711T>G	ENST00000360719.2	-	15	1888	c.1751A>C	c.(1750-1752)aAg>aCg	p.K584T	CPT1B_ENST00000312108.7_Missense_Mutation_p.K584T|CPT1B_ENST00000457250.1_Missense_Mutation_p.K550T|CPT1B_ENST00000440709.1_Missense_Mutation_p.K503T|CPT1B_ENST00000434492.2_Missense_Mutation_p.K379T|CHKB-CPT1B_ENST00000453634.1_3'UTR|CPT1B_ENST00000405237.3_Missense_Mutation_p.K584T|CPT1B_ENST00000395650.2_Missense_Mutation_p.K584T	NM_001145135.1|NM_152245.2	NP_001138607.1|NP_689451.1	Q92523	CPT1B_HUMAN	carnitine palmitoyltransferase 1B (muscle)	584					carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;3.56e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.39e-74)|Epithelial(4;5.58e-70)|GBM - Glioblastoma multiforme(4;5.59e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.207)		CAGGCAGAACTTACCCCTGTC	0.602																																					Esophageal Squamous(170;988 1933 25577 30295 48163)	uc003bmk.3		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1750-1752)AAG>ACG		carnitine palmitoyltransferase 1B isoform a							86.0	78.0	81.0					22																	51009711		2203	4300	6503	SO:0001583	missense	1375				carnitine shuttle|fatty acid beta-oxidation|regulation of fatty acid oxidation	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity	g.chr22:51009711T>G	U62733	CCDS14098.1, CCDS46734.1	22q13.33	2007-07-26			ENSG00000205560	ENSG00000205560			2329	protein-coding gene	gene with protein product		601987				9070950	Standard	NM_152245		Approved	M-CPT1, CPT1-M	uc003bmm.3	Q92523	OTTHUMG00000137390	ENST00000360719.2:c.1751A>C	22.37:g.51009711T>G	ENSP00000353945:p.Lys584Thr		Somatic				CPT1B_uc003bml.2_Missense_Mutation_p.K584T|CPT1B_uc003bmm.2_Missense_Mutation_p.K584T|CPT1B_uc003bmo.2_Missense_Mutation_p.K584T|CPT1B_uc011asa.1_Missense_Mutation_p.K550T|CPT1B_uc003bmn.2_Missense_Mutation_p.K584T|CPT1B_uc011asb.1_Missense_Mutation_p.K503T|CHKB-CPT1B_uc003bmp.2_Missense_Mutation_p.K379T|uc003bmr.1_RNA	p.K584T	NM_001145137	NP_001138609	WXS	Illumina HiSeq	Unspecified	Q92523	CPT1B_HUMAN		all cancers(3;3.56e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.39e-74)|Epithelial(4;5.58e-70)|GBM - Glioblastoma multiforme(4;5.59e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.207)	14	1913	-		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)	584			Cytoplasmic (Potential).		B7Z4U4|B7Z5T8|E9PCP2|Q13389|Q99655|Q9BY90	Missense_Mutation	SNP	ENST00000360719.2	37	c.1751A>C	CCDS14098.1	.	.	.	.	.	.	.	.	.	.	T	14.49	2.552124	0.45487	.	.	ENSG00000205560	ENST00000405237;ENST00000312108;ENST00000360719;ENST00000457250;ENST00000440709;ENST00000434492;ENST00000395650	D;D;D;D;D;D;D	0.90788	-2.73;-2.73;-2.73;-2.73;-2.73;-2.73;-2.73	5.82	3.72	0.42706	.	0.371433	0.29964	N	0.010750	D	0.86410	0.5926	L	0.49126	1.545	0.36431	D	0.864886	B;B;B;B	0.27316	0.175;0.011;0.023;0.01	B;B;B;B	0.27887	0.084;0.084;0.063;0.063	T	0.83101	-0.0128	10	0.49607	T	0.09	-25.2978	8.6703	0.34145	0.0:0.1562:0.0:0.8438	.	503;550;379;584	E9PCP2;B7Z4U4;A2RRE8;Q92523	.;.;.;CPT1B_HUMAN	T	584;584;584;550;503;379;584	ENSP00000385486:K584T;ENSP00000312189:K584T;ENSP00000353945:K584T;ENSP00000409342:K550T;ENSP00000414713:K503T;ENSP00000410966:K379T;ENSP00000379011:K584T	ENSP00000312189:K584T	K	-	2	0	CPT1B	49356577	0.000000	0.05858	1.000000	0.80357	0.990000	0.78478	0.355000	0.20163	0.481000	0.27557	0.459000	0.35465	AAG		0.602	CPT1B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317264.5	NM_152246		10	41	0	0	0	0	10	41				
OXTR	5021	broad.mit.edu	37	3	8809254	8809254	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:8809254G>A	ENST00000316793.3	-	3	1244	c.620C>T	c.(619-621)gCt>gTt	p.A207V	CAV3_ENST00000472766.1_Intron	NM_000916.3	NP_000907.2	P30559	OXYR_HUMAN	oxytocin receptor	207					cell surface receptor signaling pathway (GO:0007166)|digestive tract development (GO:0048565)|eating behavior (GO:0042755)|ERK1 and ERK2 cascade (GO:0070371)|estrous cycle phase (GO:0060206)|female pregnancy (GO:0007565)|heart development (GO:0007507)|lactation (GO:0007595)|maternal behavior (GO:0042711)|maternal process involved in parturition (GO:0060137)|memory (GO:0007613)|muscle contraction (GO:0006936)|negative regulation of gastric acid secretion (GO:0060455)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of norepinephrine secretion (GO:0010701)|positive regulation of penile erection (GO:0060406)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of uterine smooth muscle contraction (GO:0070474)|response to amphetamine (GO:0001975)|response to anoxia (GO:0034059)|response to cocaine (GO:0042220)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to peptide hormone (GO:0043434)|response to progesterone (GO:0032570)|sleep (GO:0030431)|social behavior (GO:0035176)|sperm ejaculation (GO:0042713)|suckling behavior (GO:0001967)|telencephalon development (GO:0021537)	apical plasma membrane (GO:0016324)|cell-cell adherens junction (GO:0005913)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	oxytocin receptor activity (GO:0004990)|peptide hormone binding (GO:0017046)|vasopressin receptor activity (GO:0005000)			NS(1)|endometrium(2)|large_intestine(4)|lung(5)|urinary_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(96;0.15)	Carbetocin(DB01282)|Oxytocin(DB00107)	GATGTAGACAGCTAGCGTGAT	0.612																																						uc003brc.2		NA																	0					0						c.(619-621)GCT>GTT		oxytocin receptor	Carbetocin(DB01282)						48.0	48.0	48.0					3																	8809254		2203	4300	6503	SO:0001583	missense	5021				female pregnancy|lactation|muscle contraction	integral to plasma membrane	oxytocin receptor activity|vasopressin receptor activity	g.chr3:8809254G>A		CCDS2570.1	3p25	2012-08-08			ENSG00000180914	ENSG00000180914		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	8529	protein-coding gene	gene with protein product		167055				1313946	Standard	NM_000916		Approved		uc003brc.3	P30559	OTTHUMG00000090537	ENST00000316793.3:c.620C>T	3.37:g.8809254G>A	ENSP00000324270:p.Ala207Val		Somatic					p.A207V	NM_000916	NP_000907	WXS	Illumina HiSeq	Unspecified	P30559	OXYR_HUMAN		OV - Ovarian serous cystadenocarcinoma(96;0.15)	3	1242	-			207			Helical; Name=5; (Potential).		Q15071	Missense_Mutation	SNP	ENST00000316793.3	37	c.620C>T	CCDS2570.1	.	.	.	.	.	.	.	.	.	.	G	15.98	2.993768	0.54041	.	.	ENSG00000180914	ENST00000316793	T	0.34859	1.34	5.27	4.4	0.53042	GPCR, rhodopsin-like superfamily (1);	0.331668	0.34700	N	0.003749	T	0.21062	0.0507	N	0.20845	0.615	0.35621	D	0.809393	B	0.14438	0.01	B	0.18561	0.022	T	0.16988	-1.0384	10	0.10902	T	0.67	-11.4489	10.0555	0.42241	0.1642:0.0:0.8358:0.0	.	207	P30559	OXYR_HUMAN	V	207	ENSP00000324270:A207V	ENSP00000324270:A207V	A	-	2	0	OXTR	8784254	0.723000	0.28027	0.881000	0.34555	0.979000	0.70002	4.086000	0.57664	1.222000	0.43521	0.561000	0.74099	GCT		0.612	OXTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207061.2			17	28	0	0	0	0	17	28				
SLC6A11	6538	broad.mit.edu	37	3	10861414	10861414	+	Missense_Mutation	SNP	C	C	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:10861414C>G	ENST00000254488.2	+	3	475	c.409C>G	c.(409-411)Cag>Gag	p.Q137E	SLC6A11_ENST00000454147.1_Missense_Mutation_p.Q137E	NM_014229.1	NP_055044.1	P48066	S6A11_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 11	137					brain development (GO:0007420)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter binding (GO:0042165)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(13)|ovary(1)|skin(4)	35				OV - Ovarian serous cystadenocarcinoma(96;0.229)	Clobazam(DB00349)	CTATGCAACACAGGTGATTGA	0.448																																						uc003bvz.2		NA																	0				skin(3)|ovary(1)	4						c.(409-411)CAG>GAG		solute carrier family 6 (neurotransmitter							184.0	167.0	173.0					3																	10861414		2203	4300	6503	SO:0001583	missense	6538				neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity	g.chr3:10861414C>G	S75989	CCDS2602.1	3p25.3	2013-07-19	2013-07-19		ENSG00000132164	ENSG00000132164		"""Solute carriers"""	11044	protein-coding gene	gene with protein product	"""GABA transporter 3"""	607952	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 11"""			7874447	Standard	NM_014229		Approved	GAT3	uc003bvz.3	P48066	OTTHUMG00000129718	ENST00000254488.2:c.409C>G	3.37:g.10861414C>G	ENSP00000254488:p.Gln137Glu		Somatic				SLC6A11_uc003bvy.1_Missense_Mutation_p.Q137E	p.Q137E	NM_014229	NP_055044	WXS	Illumina HiSeq	Unspecified	P48066	S6A11_HUMAN		OV - Ovarian serous cystadenocarcinoma(96;0.229)	3	443	+			137			Helical; Name=3; (Potential).		B2R6U6|Q8IYC9	Missense_Mutation	SNP	ENST00000254488.2	37	c.409C>G	CCDS2602.1	.	.	.	.	.	.	.	.	.	.	C	15.65	2.894839	0.52121	.	.	ENSG00000132164	ENST00000254488;ENST00000454147	T;T	0.74106	-0.81;-0.81	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	D	0.84800	0.5552	M	0.86573	2.825	0.53688	D	0.999976	P	0.40144	0.704	P	0.49085	0.6	D	0.86131	0.1575	10	0.52906	T	0.07	.	19.197	0.93693	0.0:1.0:0.0:0.0	.	137	P48066	S6A11_HUMAN	E	137	ENSP00000254488:Q137E;ENSP00000404120:Q137E	ENSP00000254488:Q137E	Q	+	1	0	SLC6A11	10836414	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.885000	0.69736	2.605000	0.88082	0.655000	0.94253	CAG		0.448	SLC6A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251927.1	NM_014229		48	112	0	0	0	0	48	112				
C3orf20	84077	broad.mit.edu	37	3	14755664	14755664	+	Silent	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:14755664C>A	ENST00000253697.3	+	8	1763	c.1311C>A	c.(1309-1311)acC>acA	p.T437T	C3orf20_ENST00000412910.1_Silent_p.T315T|C3orf20_ENST00000495387.1_3'UTR|C3orf20_ENST00000435614.1_Silent_p.T315T	NM_032137.4	NP_115513.4	Q8ND61	CC020_HUMAN	chromosome 3 open reading frame 20	437						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(13)|lung(11)|ovary(4)|skin(2)	40						ACCTAAAAACCAGGTAAGTGG	0.498																																						uc003byy.2		NA																	0				ovary(3)|skin(1)	4						c.(1309-1311)ACC>ACA		hypothetical protein LOC84077							71.0	63.0	66.0					3																	14755664		2203	4300	6503	SO:0001819	synonymous_variant	84077					cytoplasm|integral to membrane		g.chr3:14755664C>A	AL136781	CCDS33706.1, CCDS54555.1	3p25.1	2011-01-25			ENSG00000131379	ENSG00000131379			25320	protein-coding gene	gene with protein product						11230166	Standard	NM_032137		Approved	DKFZP434N1817	uc003byy.3	Q8ND61	OTTHUMG00000155545	ENST00000253697.3:c.1311C>A	3.37:g.14755664C>A			Somatic				C3orf20_uc003byz.2_Silent_p.T315T|C3orf20_uc003bza.2_Silent_p.T315T|C3orf20_uc003bzb.1_5'UTR	p.T437T	NM_032137	NP_115513	WXS	Illumina HiSeq	Unspecified	Q8ND61	CC020_HUMAN			8	1715	+			437					Q7L0U6|Q8NCP2|Q9H0I7	Silent	SNP	ENST00000253697.3	37	c.1311C>A	CCDS33706.1																																																																																				0.498	C3orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340586.1	NM_032137		18	33	1	0	9.17e-09	1.2e-08	18	33				
SH3BP5	9467	broad.mit.edu	37	3	15300345	15300345	+	Silent	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:15300345G>A	ENST00000383791.3	-	7	1102	c.882C>T	c.(880-882)gcC>gcT	p.A294A	SH3BP5_ENST00000426925.1_Silent_p.A137A|SH3BP5_ENST00000408919.3_Silent_p.A137A|SH3BP5-AS1_ENST00000420195.1_RNA|SH3BP5-AS1_ENST00000413977.1_RNA|SH3BP5_ENST00000253688.5_Silent_p.A137A|SH3BP5-AS1_ENST00000436602.1_RNA	NM_004844.4	NP_004835.2	O60239	3BP5_HUMAN	SH3-domain binding protein 5 (BTK-associated)	294	Ser-rich.				intracellular signal transduction (GO:0035556)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	protein kinase inhibitor activity (GO:0004860)			NS(1)|endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	12						TACCAGAAATGGCATCAGGCT	0.572																																						uc003bzp.1		NA																	0					0						c.(880-882)GCC>GCT		SH3-domain binding protein 5 (BTK-associated)							63.0	55.0	58.0					3																	15300345		2203	4300	6503	SO:0001819	synonymous_variant	9467				intracellular signal transduction	mitochondrion	protein kinase inhibitor activity|SH3 domain binding	g.chr3:15300345G>A	AB005047	CCDS2625.2, CCDS43055.1	3p24.3	2008-07-10			ENSG00000131370	ENSG00000131370			10827	protein-coding gene	gene with protein product	"""SH3 binding protein"""	605612				9571151, 10339589	Standard	NM_004844		Approved	Sab	uc003bzp.2	O60239	OTTHUMG00000129859	ENST00000383791.3:c.882C>T	3.37:g.15300345G>A			Somatic				SH3BP5_uc010hem.1_RNA|SH3BP5_uc003bzq.1_Silent_p.A137A|SH3BP5_uc003bzr.1_Silent_p.A137A|uc003bzo.1_RNA	p.A294A	NM_004844	NP_004835	WXS	Illumina HiSeq	Unspecified	O60239	3BP5_HUMAN			7	1071	-			294			Ser-rich.		B3KQW6|Q5JWV9	Silent	SNP	ENST00000383791.3	37	c.882C>T	CCDS2625.2																																																																																				0.572	SH3BP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340740.2	NM_004844		18	37	0	0	0	0	18	37				
ZNF385D	79750	broad.mit.edu	37	3	21478684	21478684	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:21478684C>A	ENST00000281523.2	-	5	969	c.451G>T	c.(451-453)Ggg>Tgg	p.G151W	ZNF385D_ENST00000494118.1_5'UTR	NM_024697.2	NP_078973.1	Q9H6B1	Z385D_HUMAN	zinc finger protein 385D	151	Thr-rich.					nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(1)|prostate(1)|skin(4)	46						GCTGGTGTCCCTGCAGTACCG	0.408																																						uc003cce.2		NA																	0				large_intestine(2)|skin(2)|ovary(1)	5						c.(451-453)GGG>TGG		zinc finger protein 385D							108.0	102.0	104.0					3																	21478684		2203	4300	6503	SO:0001583	missense	79750					nucleus	nucleic acid binding|zinc ion binding	g.chr3:21478684C>A	BC007212	CCDS2636.1	3p24.3	2012-10-05	2007-12-06	2007-12-06	ENSG00000151789	ENSG00000151789			26191	protein-coding gene	gene with protein product			"""zinc finger protein 659"""	ZNF659		12477932	Standard	NM_024697		Approved	FLJ22419	uc003cce.3	Q9H6B1	OTTHUMG00000130484	ENST00000281523.2:c.451G>T	3.37:g.21478684C>A	ENSP00000281523:p.Gly151Trp		Somatic				ZNF385D_uc010hfb.1_RNA	p.G151W	NM_024697	NP_078973	WXS	Illumina HiSeq	Unspecified	Q9H6B1	Z385D_HUMAN			5	859	-			151			Thr-rich.			Missense_Mutation	SNP	ENST00000281523.2	37	c.451G>T	CCDS2636.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.337722	0.81911	.	.	ENSG00000151789	ENST00000281523	T	0.33654	1.4	6.09	5.21	0.72293	.	0.574671	0.18186	N	0.148985	T	0.33644	0.0870	N	0.14661	0.345	0.40809	D	0.983408	P	0.51653	0.947	P	0.50136	0.632	T	0.22800	-1.0206	10	0.72032	D	0.01	-6.9288	15.827	0.78718	0.0:0.934:0.0:0.066	.	151	Q9H6B1	Z385D_HUMAN	W	151	ENSP00000281523:G151W	ENSP00000281523:G151W	G	-	1	0	ZNF385D	21453688	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	4.711000	0.61881	2.891000	0.99171	0.655000	0.94253	GGG		0.408	ZNF385D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252884.1	NM_024697		35	58	1	0	3.09e-21	4.65e-21	35	58				
NEK10	152110	broad.mit.edu	37	3	27216146	27216146	+	Missense_Mutation	SNP	T	T	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:27216146T>C	ENST00000429845.2	-	28	3046	c.2684A>G	c.(2683-2685)gAg>gGg	p.E895G	NEK10_ENST00000383771.4_Missense_Mutation_p.E207G|NEK10_ENST00000383770.3_Missense_Mutation_p.E207G|NEK10_ENST00000498182.1_5'UTR|NEK10_ENST00000357467.2_Missense_Mutation_p.E292G|NEK10_ENST00000295720.6_Missense_Mutation_p.E207G			Q6ZWH5	NEK10_HUMAN	NIMA-related kinase 10	895					positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein autophosphorylation (GO:0031954)|protein phosphorylation (GO:0006468)|regulation of cell cycle G2/M phase transition (GO:1902749)|regulation of ERK1 and ERK2 cascade (GO:0070372)	protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.E895V(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						AGTACCTTTCTCAGCATTTTC	0.483																																						uc010hfk.2		NA																	1	Substitution - Missense(1)		haematopoietic_and_lymphoid_tissue(1)	ovary(5)|stomach(2)|central_nervous_system(2)|lung(2)|skin(1)|pancreas(1)	13						c.(619-621)GAG>GGG		RecName: Full=Serine/threonine-protein kinase Nek10;          EC=2.7.11.1; AltName: Full=NimA-related protein kinase 10;							129.0	118.0	122.0					3																	27216146		2203	4300	6503	SO:0001583	missense	152110						ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr3:27216146T>C	AK123061, AK057247	CCDS46781.1	3p24.1	2012-11-15	2012-11-15		ENSG00000163491	ENSG00000163491			18592	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)- related kinase 10"""			15289607	Standard	NM_199347		Approved	FLJ32685	uc003cdt.2	Q6ZWH5	OTTHUMG00000130571	ENST00000429845.2:c.2684A>G	3.37:g.27216146T>C	ENSP00000395849:p.Glu895Gly		Somatic				NEK10_uc003cds.1_Missense_Mutation_p.E292G|NEK10_uc010hfj.2_Missense_Mutation_p.E207G	p.E207G			WXS	Illumina HiSeq	Unspecified	Q6ZWH5	NEK10_HUMAN			6	849	-			895					A8MWG1|B9ZVR0|Q45VJ4|Q6ZR11|Q7Z671|Q86XB1|Q96MB3	Missense_Mutation	SNP	ENST00000429845.2	37	c.620A>G		.	.	.	.	.	.	.	.	.	.	T	14.31	2.497491	0.44455	.	.	ENSG00000163491	ENST00000295720;ENST00000383771;ENST00000383770;ENST00000357467	T;T;T;T	0.74002	2.7;2.76;2.96;-0.8	5.91	5.91	0.95273	.	.	.	.	.	T	0.69124	0.3076	.	.	.	0.29126	N	0.879965	P;P;B	0.43662	0.814;0.57;0.061	B;B;B	0.42214	0.38;0.294;0.024	T	0.65565	-0.6137	8	0.29301	T	0.29	.	14.9212	0.70838	0.0:0.0:0.0:1.0	.	207;207;292	Q6ZWH5-5;Q6ZWH5-7;Q8N774	.;.;.	G	207;207;207;292	ENSP00000295720:E207G;ENSP00000373281:E207G;ENSP00000373280:E207G;ENSP00000350059:E292G	ENSP00000295720:E207G	E	-	2	0	NEK10	27191150	0.992000	0.36948	0.901000	0.35422	0.263000	0.26337	4.379000	0.59575	2.265000	0.75225	0.455000	0.32223	GAG		0.483	NEK10-016	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000438156.1	NM_152534		41	103	0	0	0	0	41	103				
NEK10	152110	broad.mit.edu	37	3	27233635	27233635	+	Missense_Mutation	SNP	G	G	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:27233635G>C	ENST00000429845.2	-	27	2752	c.2390C>G	c.(2389-2391)tCc>tGc	p.S797C	NEK10_ENST00000383771.4_Missense_Mutation_p.S109C|NEK10_ENST00000383770.3_Missense_Mutation_p.S109C|NEK10_ENST00000498182.1_5'UTR|NEK10_ENST00000357467.2_Missense_Mutation_p.S194C|NEK10_ENST00000295720.6_Missense_Mutation_p.S109C			Q6ZWH5	NEK10_HUMAN	NIMA-related kinase 10	797					positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein autophosphorylation (GO:0031954)|protein phosphorylation (GO:0006468)|regulation of cell cycle G2/M phase transition (GO:1902749)|regulation of ERK1 and ERK2 cascade (GO:0070372)	protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						GGACAACTGGGATGTAGATAA	0.448																																						uc010hfk.2		NA																	0				ovary(5)|stomach(2)|central_nervous_system(2)|lung(2)|skin(1)|pancreas(1)	13						c.(325-327)TCC>TGC		RecName: Full=Serine/threonine-protein kinase Nek10;          EC=2.7.11.1; AltName: Full=NimA-related protein kinase 10;							218.0	190.0	199.0					3																	27233635		2203	4300	6503	SO:0001583	missense	152110						ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr3:27233635G>C	AK123061, AK057247	CCDS46781.1	3p24.1	2012-11-15	2012-11-15		ENSG00000163491	ENSG00000163491			18592	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)- related kinase 10"""			15289607	Standard	NM_199347		Approved	FLJ32685	uc003cdt.2	Q6ZWH5	OTTHUMG00000130571	ENST00000429845.2:c.2390C>G	3.37:g.27233635G>C	ENSP00000395849:p.Ser797Cys		Somatic				NEK10_uc003cds.1_Missense_Mutation_p.S194C|NEK10_uc010hfj.2_Missense_Mutation_p.S109C	p.S109C			WXS	Illumina HiSeq	Unspecified	Q6ZWH5	NEK10_HUMAN			5	555	-			797					A8MWG1|B9ZVR0|Q45VJ4|Q6ZR11|Q7Z671|Q86XB1|Q96MB3	Missense_Mutation	SNP	ENST00000429845.2	37	c.326C>G		.	.	.	.	.	.	.	.	.	.	G	11.73	1.725266	0.30593	.	.	ENSG00000163491	ENST00000295720;ENST00000383771;ENST00000383770;ENST00000357467	T;T;T;T	0.51817	0.69;0.69;0.69;1.01	5.91	5.91	0.95273	.	.	.	.	.	T	0.40670	0.1126	.	.	.	0.31029	N	0.717638	B;B;B	0.22851	0.044;0.076;0.016	B;B;B	0.21917	0.023;0.037;0.01	T	0.39014	-0.9634	8	0.40728	T	0.16	.	15.3878	0.74714	0.0:0.1388:0.8612:0.0	.	109;109;194	Q6ZWH5-5;Q6ZWH5-7;Q8N774	.;.;.	C	109;109;109;194	ENSP00000295720:S109C;ENSP00000373281:S109C;ENSP00000373280:S109C;ENSP00000350059:S194C	ENSP00000295720:S109C	S	-	2	0	NEK10	27208639	1.000000	0.71417	1.000000	0.80357	0.431000	0.31685	5.564000	0.67359	2.793000	0.96121	0.655000	0.94253	TCC		0.448	NEK10-016	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000438156.1	NM_152534		32	73	0	0	0	0	32	73				
SCN11A	11280	broad.mit.edu	37	3	38921582	38921582	+	Silent	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:38921582G>T	ENST00000302328.3	-	19	3450	c.3252C>A	c.(3250-3252)ccC>ccA	p.P1084P	SCN11A_ENST00000456224.3_Silent_p.P1046P|SCN11A_ENST00000444237.2_Silent_p.P1084P|SCN11A_ENST00000450244.1_Silent_p.P1084P	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	1084					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.P1084P(1)		NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CTTGGATTTTGGGTTGGTTCT	0.338																																						uc011ays.1		NA																	1	Substitution - coding silent(1)	p.P1084P(1)	ovary(1)	skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9						c.(3250-3252)CCC>CCA		sodium channel, voltage-gated, type XI, alpha	Cocaine(DB00907)						53.0	55.0	54.0					3																	38921582		2203	4300	6503	SO:0001819	synonymous_variant	11280				response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr3:38921582G>T	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.3252C>A	3.37:g.38921582G>T			Somatic				SCN11A_uc010hhn.1_Silent_p.P162P	p.P1084P	NM_014139	NP_054858	WXS	Illumina HiSeq	Unspecified	Q9UI33	SCNBA_HUMAN		Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	19	3451	-			1084			III.		A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Silent	SNP	ENST00000302328.3	37	c.3252C>A	CCDS33737.1																																																																																				0.338	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139		13	32	1	0	1.36e-13	1.93e-13	13	32				
TRAK1	22906	broad.mit.edu	37	3	42132991	42132991	+	Silent	SNP	C	C	G	rs200587226	byFrequency	TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:42132991C>G	ENST00000327628.5	+	1	430	c.30C>G	c.(28-30)ccC>ccG	p.P10P	TRAK1_ENST00000487159.1_Intron	NM_001042646.2	NP_001036111.1	Q9UPV9	TRAK1_HUMAN	trafficking protein, kinesin binding 1	10					endosome to lysosome transport (GO:0008333)|protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	22						TCGGGCAGCCCGTCAGGGCTC	0.537																																					GBM(44;195 884 22595 31865 41850)	uc003cky.2		NA																	0				ovary(1)	1						c.(28-30)CCC>CCG		OGT(O-Glc-NAc transferase)-interacting protein							83.0	80.0	81.0					3																	42132991		1914	4117	6031	SO:0001819	synonymous_variant	22906				endosome to lysosome transport|protein O-linked glycosylation|protein targeting|regulation of transcription from RNA polymerase II promoter	early endosome|mitochondrion|nucleus		g.chr3:42132991C>G		CCDS2695.1, CCDS43072.1, CCDS58826.1, CCDS74922.1	3p22.1	2012-03-05			ENSG00000182606	ENSG00000182606			29947	protein-coding gene	gene with protein product	"""OGT(O Glc NAc transferase) interacting protein 106 KDa"", ""O-linked N-acetylglucosamine transferase interacting protein 106"", ""milton homolog 1 (Drosophila)"""	608112				10470851, 12435728, 16380713, 20230862	Standard	NM_014965		Approved	OIP106, KIAA1042, MILT1	uc003cky.4	Q9UPV9	OTTHUMG00000131795	ENST00000327628.5:c.30C>G	3.37:g.42132991C>G			Somatic				TRAK1_uc011azh.1_Silent_p.P10P|TRAK1_uc011azi.1_Silent_p.P10P	p.P10P	NM_001042646	NP_001036111	WXS	Illumina HiSeq	Unspecified	Q9UPV9	TRAK1_HUMAN			1	246	+			10					E9PDS2|J3KNT7|Q63HR0|Q659B5|Q96B69	Silent	SNP	ENST00000327628.5	37	c.30C>G	CCDS43072.1																																																																																				0.537	TRAK1-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343413.1	NM_014965		8	40	0	0	0	0	8	40				
DOCK3	1795	broad.mit.edu	37	3	51263131	51263131	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:51263131G>T	ENST00000266037.9	+	15	1327	c.1304G>T	c.(1303-1305)aGa>aTa	p.R435I		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	435	DHR-1.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		GATTTCGAGAGAGGAGGAAAG	0.463																																						uc011bds.1		NA																	0					0						c.(1303-1305)AGA>ATA		dedicator of cytokinesis 3							151.0	148.0	149.0					3																	51263131		1884	4124	6008	SO:0001583	missense	1795					cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding	g.chr3:51263131G>T	AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.1304G>T	3.37:g.51263131G>T	ENSP00000266037:p.Arg435Ile		Somatic					p.R435I	NM_004947	NP_004938	WXS	Illumina HiSeq	Unspecified	Q8IZD9	DOCK3_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)	15	1327	+			435			DHR-1.		O15017	Missense_Mutation	SNP	ENST00000266037.9	37	c.1304G>T	CCDS46835.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.793410	0.90453	.	.	ENSG00000088538	ENST00000266037	T	0.15139	2.45	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.45216	0.1331	M	0.73598	2.24	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.37641	-0.9697	10	0.72032	D	0.01	.	19.7077	0.96081	0.0:0.0:1.0:0.0	.	435	Q8IZD9	DOCK3_HUMAN	I	435	ENSP00000266037:R435I	ENSP00000266037:R435I	R	+	2	0	DOCK3	51238171	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.733000	0.93635	0.655000	0.94253	AGA		0.463	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5	NM_004947		44	74	1	0	7.53e-24	1.15e-23	44	74				
GLT8D1	55830	broad.mit.edu	37	3	52734476	52734476	+	Start_Codon_SNP	SNP	T	T	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:52734476T>A	ENST00000407584.3	-	3	851	c.1A>T	c.(1-3)Atg>Ttg	p.M1L	GLT8D1_ENST00000266014.5_Start_Codon_SNP_p.M1L|GLT8D1_ENST00000394783.3_Start_Codon_SNP_p.M1L|GLT8D1_ENST00000491606.1_Start_Codon_SNP_p.M1L|GLT8D1_ENST00000463827.1_5'Flank|GLT8D1_ENST00000478968.2_Start_Codon_SNP_p.M1L	NM_001010983.1|NM_001278280.1	NP_001010983.1|NP_001265209.1	Q68CQ7	GL8D1_HUMAN	glycosyltransferase 8 domain containing 1	1						integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|endometrium(1)|kidney(3)|large_intestine(3)	8				BRCA - Breast invasive adenocarcinoma(193;6.78e-05)|Kidney(197;0.000618)|KIRC - Kidney renal clear cell carcinoma(197;0.000779)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		CGGAATGACATCTTTTTCTTC	0.338																																						uc003dfi.3		NA																	0					0						c.(1-3)ATG>TTG		glycosyltransferase 8 domain containing 1							84.0	88.0	87.0					3																	52734476		2203	4300	6503	SO:0001582	initiator_codon_variant	55830					integral to membrane|mitochondrion	transferase activity, transferring glycosyl groups	g.chr3:52734476T>A	AY358579	CCDS2862.1	3p21.1	2013-02-22			ENSG00000016864	ENSG00000016864		"""Glycosyltransferase family 8 domain containing"""	24870	protein-coding gene	gene with protein product						12975309	Standard	NM_152932		Approved	AD-017, FLJ14611	uc003dfi.4	Q68CQ7	OTTHUMG00000158759	ENST00000407584.3:c.1A>T	3.37:g.52734476T>A	ENSP00000385730:p.Met1Leu		Somatic				GLT8D1_uc003dfj.2_Missense_Mutation_p.M1L|GLT8D1_uc003dfk.2_Missense_Mutation_p.M1L|GLT8D1_uc003dfl.2_Missense_Mutation_p.M1L|GLT8D1_uc003dfm.2_Missense_Mutation_p.M1L|GLT8D1_uc003dfn.2_Missense_Mutation_p.M1L|GLT8D1_uc003dfo.1_Missense_Mutation_p.M1L|GLT8D1_uc010hmm.1_RNA	p.M1L	NM_152932	NP_690909	WXS	Illumina HiSeq	Unspecified	Q68CQ7	GL8D1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;6.78e-05)|Kidney(197;0.000618)|KIRC - Kidney renal clear cell carcinoma(197;0.000779)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)	2	140	-			1			Cytoplasmic (Potential).		Q7Z4D1|Q8N2J6|Q9P0I5	Missense_Mutation	SNP	ENST00000407584.3	37	c.1A>T	CCDS2862.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.355487	0.82243	.	.	ENSG00000016864	ENST00000478968;ENST00000394783;ENST00000407584;ENST00000266014;ENST00000491606;ENST00000479553;ENST00000489119;ENST00000497436;ENST00000497953;ENST00000487642;ENST00000464705	T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02	5.75	5.75	0.90469	.	0.284098	0.42964	D	0.000626	T	0.60287	0.2257	.	.	.	0.80722	D	1	P;P	0.38863	0.65;0.518	P;P	0.54140	0.743;0.558	T	0.63139	-0.6704	9	0.87932	D	0	-6.6605	14.3051	0.66380	0.0:0.0:0.0:1.0	.	1;1	Q68CQ7-2;Q68CQ7	.;GL8D1_HUMAN	L	1	ENSP00000419612:M1L;ENSP00000378263:M1L;ENSP00000385730:M1L;ENSP00000266014:M1L;ENSP00000418853:M1L	ENSP00000266014:M1L	M	-	1	0	GLT8D1	52709516	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.593000	0.54001	2.202000	0.70862	0.528000	0.53228	ATG		0.338	GLT8D1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352065.3	NM_152932	Missense_Mutation	5	115	0	0	0	0	5	115				
SFMBT1	51460	broad.mit.edu	37	3	52977588	52977588	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:52977588C>A	ENST00000394752.3	-	4	527	c.145G>T	c.(145-147)Gga>Tga	p.G49*	SFMBT1_ENST00000296295.6_Nonsense_Mutation_p.G49*|SFMBT1_ENST00000394750.1_Nonsense_Mutation_p.G49*|SFMBT1_ENST00000358080.2_Nonsense_Mutation_p.G49*	NM_016329.3	NP_057413.2	Q9UHJ3	SMBT1_HUMAN	Scm-like with four mbt domains 1	49					cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|negative regulation of muscle organ development (GO:0048635)|negative regulation of transcription, DNA-templated (GO:0045892)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	24				BRCA - Breast invasive adenocarcinoma(193;9.91e-05)|Kidney(197;0.000644)|KIRC - Kidney renal clear cell carcinoma(197;0.000792)|OV - Ovarian serous cystadenocarcinoma(275;0.113)		GGAGCAAATCCATTTTGCAAA	0.433																																						uc003dgf.2		NA																	0				ovary(1)	1						c.(145-147)GGA>TGA		Scm-like with four mbt domains 1							115.0	103.0	107.0					3																	52977588		2203	4300	6503	SO:0001587	stop_gained	51460				regulation of transcription, DNA-dependent	nucleus		g.chr3:52977588C>A	AF168132	CCDS2867.1	3p21.31	2013-01-10			ENSG00000163935	ENSG00000163935		"""Sterile alpha motif (SAM) domain containing"""	20255	protein-coding gene	gene with protein product		607319				10661410	Standard	NM_016329		Approved	RU1, DKFZp434L243, SFMBT	uc003dgh.3	Q9UHJ3	OTTHUMG00000159052	ENST00000394752.3:c.145G>T	3.37:g.52977588C>A	ENSP00000378235:p.Gly49*		Somatic				SFMBT1_uc010hmr.2_5'UTR|SFMBT1_uc003dgg.2_Nonsense_Mutation_p.G49*|SFMBT1_uc003dgh.2_Nonsense_Mutation_p.G49*	p.G49*	NM_001005159	NP_001005159	WXS	Illumina HiSeq	Unspecified	Q9UHJ3	SMBT1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;9.91e-05)|Kidney(197;0.000644)|KIRC - Kidney renal clear cell carcinoma(197;0.000792)|OV - Ovarian serous cystadenocarcinoma(275;0.113)	5	714	-			49			MBT 1.		Q402F7|Q96C73|Q9Y4Q9	Nonsense_Mutation	SNP	ENST00000394752.3	37	c.145G>T	CCDS2867.1	.	.	.	.	.	.	.	.	.	.	C	32	5.161570	0.94727	.	.	ENSG00000163935	ENST00000394752;ENST00000358080;ENST00000296295;ENST00000394750;ENST00000482396;ENST00000483069;ENST00000497586	.	.	.	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	.	19.7023	0.96060	0.0:1.0:0.0:0.0	.	.	.	.	X	49	.	ENSP00000296295:G49X	G	-	1	0	SFMBT1	52952628	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.712000	0.68407	2.644000	0.89710	0.650000	0.86243	GGA		0.433	SFMBT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353040.3	NM_016329		33	85	1	0	1.22e-17	1.79e-17	33	85				
OR5H14	403273	broad.mit.edu	37	3	97868307	97868307	+	Silent	SNP	C	C	A	rs146669592		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:97868307C>A	ENST00000437310.1	+	1	138	c.78C>A	c.(76-78)ccC>ccA	p.P26P	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005514.1	NP_001005514.1	A6NHG9	O5H14_HUMAN	olfactory receptor, family 5, subfamily H, member 14	26						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.(=)(1)		breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						GGAAAATACCCCTGTTCCTGG	0.418																																						uc003dsg.1		NA																	1	Unknown(1)		lung(1)	skin(1)	1						c.(76-78)CCC>CCA		olfactory receptor, family 5, subfamily H,							78.0	82.0	81.0					3																	97868307		2202	4279	6481	SO:0001819	synonymous_variant	403273				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr3:97868307C>A		CCDS33798.1	3q11.2	2013-09-23			ENSG00000236032	ENSG00000236032		"""GPCR / Class A : Olfactory receptors"""	31286	protein-coding gene	gene with protein product							Standard	NM_001005514		Approved		uc003dsg.1	A6NHG9	OTTHUMG00000160079	ENST00000437310.1:c.78C>A	3.37:g.97868307C>A			Somatic					p.P26P	NM_001005514	NP_001005514	WXS	Illumina HiSeq	Unspecified	A6NHG9	O5H14_HUMAN			1	78	+			26			Extracellular (Potential).		B9EH15	Silent	SNP	ENST00000437310.1	37	c.78C>A	CCDS33798.1																																																																																				0.418	OR5H14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359112.1			162	224	1	0	1.82e-84	2.91e-84	162	224				
OR5H15	403274	broad.mit.edu	37	3	97887742	97887742	+	Missense_Mutation	SNP	G	G	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:97887742G>C	ENST00000356526.2	+	1	199	c.199G>C	c.(199-201)Gct>Cct	p.A67P		NM_001005515.1	NP_001005515.1	A6NDH6	O5H15_HUMAN	olfactory receptor, family 5, subfamily H, member 15	67						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(2)|stomach(1)	35						TGGGAATTTAGCTTTTGTGGA	0.403																																						uc011bgu.1		NA																	0				ovary(1)|skin(1)	2						c.(199-201)GCT>CCT		olfactory receptor, family 5, subfamily H,							76.0	76.0	76.0					3																	97887742		2201	4278	6479	SO:0001583	missense	403274				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr3:97887742G>C		CCDS33799.1	3q11.2	2013-09-23			ENSG00000233412	ENSG00000233412		"""GPCR / Class A : Olfactory receptors"""	31287	protein-coding gene	gene with protein product							Standard	NM_001005515		Approved		uc011bgu.2	A6NDH6	OTTHUMG00000160076	ENST00000356526.2:c.199G>C	3.37:g.97887742G>C	ENSP00000373195:p.Ala67Pro		Somatic					p.A67P	NM_001005515	NP_001005515	WXS	Illumina HiSeq	Unspecified	A6NDH6	O5H15_HUMAN			1	199	+			67			Helical; Name=2; (Potential).			Missense_Mutation	SNP	ENST00000356526.2	37	c.199G>C	CCDS33799.1	.	.	.	.	.	.	.	.	.	.	-	9.762	1.170243	0.21621	.	.	ENSG00000233412	ENST00000356526;ENST00000454529	T	0.03181	4.02	2.48	2.48	0.30137	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44688	D	0.000424	T	0.13628	0.0330	M	0.83223	2.63	0.09310	N	1	D	0.59357	0.985	D	0.63192	0.912	T	0.01587	-1.1318	10	0.87932	D	0	.	6.6024	0.22707	0.0:0.0:0.7153:0.2847	.	67	A6NDH6	O5H15_HUMAN	P	67	ENSP00000373195:A67P	ENSP00000373195:A67P	A	+	1	0	OR5H15	99370432	0.000000	0.05858	0.095000	0.20976	0.224000	0.24922	0.287000	0.18920	1.386000	0.46466	0.184000	0.17185	GCT		0.403	OR5H15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359109.1			64	247	0	0	0	0	64	247				
COL8A1	1295	broad.mit.edu	37	3	99509677	99509677	+	Missense_Mutation	SNP	T	T	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:99509677T>C	ENST00000261037.3	+	4	531	c.151T>C	c.(151-153)Tac>Cac	p.Y51H	COL8A1_ENST00000273342.4_Missense_Mutation_p.Y51H	NM_001850.4	NP_001841.2	P27658	CO8A1_HUMAN	collagen, type VIII, alpha 1	51	Nonhelical region (NC2).				angiogenesis (GO:0001525)|camera-type eye morphogenesis (GO:0048593)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen type VIII trimer (GO:0005591)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)				breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(15)|skin(5)|upper_aerodigestive_tract(1)	27						AATTCCACAATACCAGCCCCT	0.537																																						uc003dtg.1		NA																	0					0						c.(151-153)TAC>CAC		alpha 1 type VIII collagen precursor							92.0	82.0	86.0					3																	99509677		2203	4300	6503	SO:0001583	missense	1295				angiogenesis|cell adhesion	basement membrane|collagen type VIII		g.chr3:99509677T>C	AF170702	CCDS2934.1	3q11.1-q13.2	2013-01-16			ENSG00000144810	ENSG00000144810		"""Collagens"""	2215	protein-coding gene	gene with protein product		120251	"""chromosome 3 open reading frame 7"""	C3orf7		2029894	Standard	NM_001850		Approved	MGC9568	uc003dth.2	P27658	OTTHUMG00000148669	ENST00000261037.3:c.151T>C	3.37:g.99509677T>C	ENSP00000261037:p.Tyr51His		Somatic				COL8A1_uc003dth.1_Missense_Mutation_p.Y51H|COL8A1_uc003dti.1_Missense_Mutation_p.Y51H	p.Y51H	NM_001850	NP_001841	WXS	Illumina HiSeq	Unspecified	P27658	CO8A1_HUMAN			4	396	+			51			Nonhelical region (NC2).		D3DN42|Q53XI6|Q96D07	Missense_Mutation	SNP	ENST00000261037.3	37	c.151T>C	CCDS2934.1	.	.	.	.	.	.	.	.	.	.	T	18.83	3.707947	0.68615	.	.	ENSG00000144810	ENST00000261037;ENST00000452013;ENST00000273342	D;D	0.91521	-2.86;-2.86	5.86	5.86	0.93980	.	0.390517	0.26995	N	0.021456	D	0.87861	0.6284	L	0.48642	1.525	0.43824	D	0.99639	B;B	0.12630	0.006;0.006	B;B	0.10450	0.005;0.005	D	0.84415	0.0568	10	0.66056	D	0.02	.	14.1973	0.65679	0.0:0.0:0.0:1.0	.	51;51	E7EPK9;P27658	.;CO8A1_HUMAN	H	51	ENSP00000261037:Y51H;ENSP00000273342:Y51H	ENSP00000261037:Y51H	Y	+	1	0	COL8A1	100992367	0.998000	0.40836	0.999000	0.59377	0.954000	0.61252	3.022000	0.49659	2.241000	0.73720	0.533000	0.62120	TAC		0.537	COL8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309001.1	NM_001850		19	74	0	0	0	0	19	74				
TRAT1	50852	broad.mit.edu	37	3	108557809	108557809	+	Missense_Mutation	SNP	C	C	A	rs150919761		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:108557809C>A	ENST00000295756.6	+	3	377	c.147C>A	c.(145-147)caC>caA	p.H49Q	TRAT1_ENST00000426646.1_Missense_Mutation_p.H12Q|TRAT1_ENST00000493604.1_3'UTR	NM_016388.2	NP_057472.2	Q6PIZ9	TRAT1_HUMAN	T cell receptor associated transmembrane adaptor 1	49					cellular defense response (GO:0006968)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of receptor recycling (GO:0001920)|negative regulation of transport (GO:0051051)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of T cell receptor signaling pathway (GO:0050862)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			endometrium(2)|kidney(2)|large_intestine(2)|lung(18)|prostate(1)|skin(3)	28						CCAGTGACCACACCAGGTATG	0.318																																						uc003dxi.1		NA																	0				skin(1)	1						c.(145-147)CAC>CAA		T-cell receptor interacting molecule							101.0	98.0	99.0					3																	108557809		2203	4300	6503	SO:0001583	missense	50852				cellular defense response|negative regulation of receptor recycling|negative regulation of transport|positive regulation of calcium-mediated signaling|positive regulation of T cell receptor signaling pathway|T cell receptor signaling pathway	integral to plasma membrane|T cell receptor complex	phosphatidylinositol-4,5-bisphosphate 3-kinase activity|transmembrane receptor protein tyrosine kinase adaptor activity	g.chr3:108557809C>A	AJ240084	CCDS33813.1	3q13	2005-05-04	2005-05-04	2005-05-04	ENSG00000163519	ENSG00000163519			30698	protein-coding gene	gene with protein product		604962	"""T cell receptor interacting molecule"""	TCRIM		10663578, 9687533	Standard	NM_016388		Approved	HSPC062, TRIM	uc003dxi.1	Q6PIZ9	OTTHUMG00000159198	ENST00000295756.6:c.147C>A	3.37:g.108557809C>A	ENSP00000295756:p.His49Gln		Somatic				TRAT1_uc010hpx.1_Missense_Mutation_p.H12Q	p.H49Q	NM_016388	NP_057472	WXS	Illumina HiSeq	Unspecified	Q6PIZ9	TRAT1_HUMAN			3	291	+			49			Cytoplasmic (Potential).		Q9NZX5	Missense_Mutation	SNP	ENST00000295756.6	37	c.147C>A	CCDS33813.1	.	.	.	.	.	.	.	.	.	.	C	9.598	1.127929	0.20959	.	.	ENSG00000163519	ENST00000295756;ENST00000426646	T;T	0.33654	1.4;1.59	4.16	3.29	0.37713	.	0.816356	0.10810	N	0.631751	T	0.19046	0.0457	N	0.08118	0	0.24291	N	0.995166	B;B	0.15930	0.015;0.015	B;B	0.19148	0.024;0.024	T	0.17623	-1.0363	10	0.29301	T	0.29	-26.3448	7.9495	0.30006	0.0:0.89:0.0:0.11	.	12;49	C9JF66;Q6PIZ9	.;TRAT1_HUMAN	Q	49;12	ENSP00000295756:H49Q;ENSP00000410097:H12Q	ENSP00000295756:H49Q	H	+	3	2	TRAT1	110040499	1.000000	0.71417	0.991000	0.47740	0.854000	0.48673	1.711000	0.37930	1.357000	0.45904	0.591000	0.81541	CAC		0.318	TRAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353794.1	NM_016388		18	119	1	0	6.33e-15	9.05e-15	18	119				
MORC1	27136	broad.mit.edu	37	3	108822766	108822766	+	Splice_Site	SNP	T	T	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:108822766T>A	ENST00000483760.1	-	4	198		c.e4-2		MORC1_ENST00000232603.5_Splice_Site|MORC1-AS1_ENST00000480826.1_RNA					MORC family CW-type zinc finger 1											breast(7)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(47)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	105						CATTATCCACTGTAAGAGAAA	0.398																																						uc003dxl.2		NA																	0				ovary(3)|skin(3)|breast(2)	8						c.e4-1		MORC family CW-type zinc finger 1							93.0	94.0	94.0					3																	108822766		2203	4300	6503	SO:0001630	splice_region_variant	27136				cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding	g.chr3:108822766T>A	AF084946	CCDS2955.1	3q13	2011-10-26	2005-06-15	2005-06-15	ENSG00000114487	ENSG00000114487			7198	protein-coding gene	gene with protein product	"""cancer/testis antigen 33"""	603205	"""microrchidia (mouse) homolog"", ""microrchidia homolog (mouse)"""	MORC		10369865	Standard	NM_014429		Approved	ZCW6, CT33	uc003dxl.3	Q86VD1	OTTHUMG00000159209	ENST00000483760.1:c.155-2A>T	3.37:g.108822766T>A			Somatic				MORC1_uc011bhn.1_Splice_Site_p.V52_splice	p.V52_splice	NM_014429	NP_055244	WXS	Illumina HiSeq	Unspecified	Q86VD1	MORC1_HUMAN			4	242	-									Splice_Site	SNP	ENST00000483760.1	37	c.155_splice		.	.	.	.	.	.	.	.	.	.	T	15.68	2.906360	0.52333	.	.	ENSG00000114487	ENST00000232603;ENST00000483760	.	.	.	5.41	5.41	0.78517	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.7167	0.34416	0.1688:0.0:0.0:0.8312	.	.	.	.	.	-1	.	.	.	-	.	.	MORC1	110305456	1.000000	0.71417	1.000000	0.80357	0.779000	0.44077	5.152000	0.64882	2.276000	0.75962	0.397000	0.26171	.		0.398	MORC1-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000353844.1		Intron	45	133	0	0	0	0	45	133				
DPPA4	55211	broad.mit.edu	37	3	109050622	109050622	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:109050622C>T	ENST00000335658.6	-	4	403	c.349G>A	c.(349-351)Gca>Aca	p.A117T	DPPA4_ENST00000478791.1_5'UTR	NM_018189.3	NP_060659.3	Q7L190	DPPA4_HUMAN	developmental pluripotency associated 4	117					lung-associated mesenchyme development (GO:0060484)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(17)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25						CGCTTATATGCATCCAATTTC	0.448																																						uc003dxq.3		NA																	0				upper_aerodigestive_tract(1)	1						c.(349-351)GCA>ACA		developmental pluripotency associated 4							109.0	104.0	106.0					3																	109050622		2203	4300	6503	SO:0001583	missense	55211					nucleus	protein binding	g.chr3:109050622C>T	AK001575	CCDS33814.1	3q13.13	2014-01-28			ENSG00000121570	ENSG00000121570			19200	protein-coding gene	gene with protein product		614125					Standard	NM_018189		Approved	FLJ10713	uc003dxq.4	Q7L190	OTTHUMG00000159222	ENST00000335658.6:c.349G>A	3.37:g.109050622C>T	ENSP00000335306:p.Ala117Thr		Somatic				DPPA4_uc011bho.1_Missense_Mutation_p.A117T|DPPA4_uc011bhp.1_Missense_Mutation_p.A117T	p.A117T	NM_018189	NP_060659	WXS	Illumina HiSeq	Unspecified	Q7L190	DPPA4_HUMAN			4	404	-			117					A8K4M7|Q9H9N5|Q9NVI6	Missense_Mutation	SNP	ENST00000335658.6	37	c.349G>A	CCDS33814.1	.	.	.	.	.	.	.	.	.	.	C	10.51	1.369022	0.24771	.	.	ENSG00000121570	ENST00000335658	T	0.41758	0.99	4.32	-0.63	0.11530	.	1.992070	0.02028	N	0.048352	T	0.32466	0.0830	L	0.48642	1.525	0.09310	N	1	B;B;B	0.30824	0.296;0.02;0.172	B;B;B	0.19946	0.027;0.023;0.015	T	0.08411	-1.0723	9	.	.	.	-0.8223	4.2845	0.10848	0.0:0.4131:0.1877:0.3992	.	107;117;117	B7Z5Q7;B7Z595;Q7L190	.;.;DPPA4_HUMAN	T	117	ENSP00000335306:A117T	.	A	-	1	0	DPPA4	110533312	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.546000	0.06062	-0.126000	0.11682	0.650000	0.86243	GCA		0.448	DPPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353897.1	NM_018189		30	158	0	0	0	0	30	158				
SLC9C1	285335	broad.mit.edu	37	3	111870716	111870716	+	Missense_Mutation	SNP	A	A	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:111870716A>T	ENST00000305815.5	-	28	3764	c.3512T>A	c.(3511-3513)cTa>cAa	p.L1171Q	SLC9C1_ENST00000487372.1_Missense_Mutation_p.L1123Q	NM_183061.1	NP_898884.1	Q4G0N8	SL9C1_HUMAN	solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1	1171					cell differentiation (GO:0030154)|ion transmembrane transport (GO:0034220)|multicellular organismal development (GO:0007275)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)										GACTTTCCTTAGGTTTATTCT	0.522																																						uc003dyu.2		NA																	0				ovary(3)|breast(2)	5						c.(3511-3513)CTA>CAA		sperm-specific sodium proton exchanger							119.0	122.0	121.0					3																	111870716		2203	4300	6503	SO:0001583	missense	285335				cell differentiation|multicellular organismal development|sodium ion transport|spermatogenesis	cilium|flagellar membrane|integral to membrane	solute:hydrogen antiporter activity	g.chr3:111870716A>T	AK128084	CCDS33817.1	3q13	2013-05-22	2012-03-22	2012-03-22	ENSG00000172139	ENSG00000172139		"""Solute carriers"""	31401	protein-coding gene	gene with protein product	"""sperm-NHE"""	612738	"""solute carrier family 9, isoform 10"", ""solute carrier family 9, member 10"""	SLC9A10		12783626	Standard	NM_183061		Approved	NHE	uc003dyu.3	Q4G0N8	OTTHUMG00000159245	ENST00000305815.5:c.3512T>A	3.37:g.111870716A>T	ENSP00000306627:p.Leu1171Gln		Somatic				SLC9A10_uc011bhu.1_Missense_Mutation_p.L434Q|SLC9A10_uc010hqc.2_Missense_Mutation_p.L1123Q	p.L1171Q	NM_183061	NP_898884	WXS	Illumina HiSeq	Unspecified	Q4G0N8	S9A10_HUMAN			28	3734	-			1171					Q6ZRP4|Q7RTP2	Missense_Mutation	SNP	ENST00000305815.5	37	c.3512T>A	CCDS33817.1	.	.	.	.	.	.	.	.	.	.	A	11.68	1.711859	0.30322	.	.	ENSG00000172139	ENST00000305815;ENST00000487372	T;T	0.80304	-1.34;-1.36	2.61	-1.69	0.08186	.	.	.	.	.	T	0.68155	0.2970	N	0.22421	0.69	0.09310	N	1	P;P	0.52061	0.95;0.917	P;B	0.48227	0.571;0.367	T	0.59958	-0.7356	9	0.87932	D	0	1.5637	2.3256	0.04222	0.405:0.0:0.1452:0.4498	.	1123;1171	Q4G0N8-2;Q4G0N8	.;S9A10_HUMAN	Q	1171;1123	ENSP00000306627:L1171Q;ENSP00000420688:L1123Q	ENSP00000306627:L1171Q	L	-	2	0	SLC9A10	113353406	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-1.295000	0.02764	-0.368000	0.08040	0.533000	0.62120	CTA		0.522	SLC9C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354066.1	NM_183061		51	109	0	0	0	0	51	109				
SLC35A5	55032	broad.mit.edu	37	3	112299779	112299779	+	Missense_Mutation	SNP	A	A	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:112299779A>G	ENST00000492406.1	+	6	1098	c.815A>G	c.(814-816)tAt>tGt	p.Y272C	SLC35A5_ENST00000460713.1_3'UTR	NM_017945.2	NP_060415.1	Q9BS91	S35A5_HUMAN	solute carrier family 35, member A5	272					nucleotide-sugar transport (GO:0015780)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	nucleotide-sugar transmembrane transporter activity (GO:0005338)|sugar:proton symporter activity (GO:0005351)			endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(4)|ovary(1)|skin(1)	11						AGCAAACTCTATTTCTTTGGC	0.388																																						uc003dze.2		NA																	0				ovary(1)	1						c.(814-816)TAT>TGT		solute carrier family 35, member A5							94.0	100.0	98.0					3																	112299779		2203	4300	6503	SO:0001583	missense	55032					Golgi membrane|integral to membrane	nucleotide-sugar transmembrane transporter activity|sugar:hydrogen symporter activity	g.chr3:112299779A>G	AK000737	CCDS2967.1	3q13.13	2013-05-22			ENSG00000138459	ENSG00000138459		"""Solute carriers"""	20792	protein-coding gene	gene with protein product							Standard	NM_017945		Approved	FLJ20730	uc003dze.4	Q9BS91	OTTHUMG00000159263	ENST00000492406.1:c.815A>G	3.37:g.112299779A>G	ENSP00000417654:p.Tyr272Cys		Somatic					p.Y272C	NM_017945	NP_060415	WXS	Illumina HiSeq	Unspecified	Q9BS91	S35A5_HUMAN			6	1060	+			272			Helical; (Potential).		D3DN66|Q69YY6|Q6ZMD6|Q9NWM9	Missense_Mutation	SNP	ENST00000492406.1	37	c.815A>G	CCDS2967.1	.	.	.	.	.	.	.	.	.	.	A	17.58	3.423945	0.62733	.	.	ENSG00000138459	ENST00000492406	T	0.46819	0.86	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.75206	0.3818	M	0.90922	3.16	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81437	-0.0933	9	.	.	.	-17.1794	15.7112	0.77629	1.0:0.0:0.0:0.0	.	272	Q9BS91	S35A5_HUMAN	C	272	ENSP00000417654:Y272C	.	Y	+	2	0	SLC35A5	113782469	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.802000	0.75175	2.172000	0.68678	0.438000	0.28831	TAT		0.388	SLC35A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354184.1	NM_017945		24	93	0	0	0	0	24	93				
KIAA2018	205717	broad.mit.edu	37	3	113375785	113375785	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:113375785G>A	ENST00000478658.1	-	5	4761	c.4744C>T	c.(4744-4746)Cct>Tct	p.P1582S	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Missense_Mutation_p.P1582S			Q68DE3	K2018_HUMAN	KIAA2018	1582	Gln-rich.					membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						CTAGTTGAAGGGTTTTCACAG	0.498																																						uc003eam.2		NA																	0				skin(2)|ovary(1)	3						c.(4744-4746)CCT>TCT		hypothetical protein LOC205717							145.0	136.0	139.0					3																	113375785		2021	4182	6203	SO:0001583	missense	205717				regulation of transcription, DNA-dependent	membrane|nucleus	calcium ion binding|DNA binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity	g.chr3:113375785G>A	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.4744C>T	3.37:g.113375785G>A	ENSP00000420721:p.Pro1582Ser		Somatic				KIAA2018_uc003eal.2_Missense_Mutation_p.P1526S	p.P1582S	NM_001009899	NP_001009899	WXS	Illumina HiSeq	Unspecified	Q68DE3	K2018_HUMAN			7	5155	-			1582			Gln-rich.		Q7Z3L9|Q8IVF3|Q9H8T4	Missense_Mutation	SNP	ENST00000478658.1	37	c.4744C>T	CCDS43133.1	.	.	.	.	.	.	.	.	.	.	G	13.58	2.278724	0.40294	.	.	ENSG00000176542	ENST00000316407;ENST00000478658	T;T	0.31247	1.5;1.5	5.32	4.43	0.53597	.	0.238486	0.36815	N	0.002396	T	0.22627	0.0546	N	0.24115	0.695	0.42388	D	0.992519	B	0.22346	0.068	B	0.19391	0.025	T	0.03695	-1.1012	10	0.39692	T	0.17	-11.6955	14.4856	0.67614	0.0:0.279:0.721:0.0	.	1582	Q68DE3	K2018_HUMAN	S	1582	ENSP00000320794:P1582S;ENSP00000420721:P1582S	ENSP00000320794:P1582S	P	-	1	0	KIAA2018	114858475	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	2.496000	0.45346	1.431000	0.47355	0.655000	0.94253	CCT		0.498	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899		43	73	0	0	0	0	43	73				
ZNF80	7634	broad.mit.edu	37	3	113955434	113955434	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:113955434C>A	ENST00000482457.2	-	1	991	c.488G>T	c.(487-489)tGc>tTc	p.C163F	RP11-553L6.2_ENST00000481773.1_RNA|RP11-553L6.2_ENST00000493033.1_RNA	NM_007136.3	NP_009067.2	P51504	ZNF80_HUMAN	zinc finger protein 80	163					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|urinary_tract(2)	32		Lung NSC(201;0.0233)|all_neural(597;0.0837)				ACATTCTTTGCACCCAAAGAG	0.488																																					GBM(23;986 1114 21716)	uc010hqo.2		NA																	0					0						c.(487-489)TGC>TTC		zinc finger protein 80							100.0	105.0	103.0					3																	113955434		2203	4300	6503	SO:0001583	missense	7634					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr3:113955434C>A	X65233	CCDS2979.1	3q13.31	2013-01-08	2006-05-12		ENSG00000174255	ENSG00000174255		"""Zinc fingers, C2H2-type"""	13155	protein-coding gene	gene with protein product		194553	"""zinc finger protein 80 (pT17)"""			8478004	Standard	NM_007136		Approved	pT17	uc010hqo.3	P51504	OTTHUMG00000159332	ENST00000482457.2:c.488G>T	3.37:g.113955434C>A	ENSP00000417192:p.Cys163Phe		Somatic				ZNF80_uc003ebf.2_RNA	p.C163F	NM_007136	NP_009067	WXS	Illumina HiSeq	Unspecified	P51504	ZNF80_HUMAN			1	992	-		Lung NSC(201;0.0233)|all_neural(597;0.0837)	163			C2H2-type 5.		Q6NSW4|Q6NT14	Missense_Mutation	SNP	ENST00000482457.2	37	c.488G>T	CCDS2979.1	.	.	.	.	.	.	.	.	.	.	C	16.66	3.184468	0.57800	.	.	ENSG00000174255	ENST00000482457	D	0.85088	-1.94	3.09	2.18	0.27775	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.93504	0.7927	H	0.94345	3.525	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	D	0.84349	0.0531	9	0.87932	D	0	.	9.5344	0.39213	0.2117:0.7883:0.0:0.0	.	163	P51504	ZNF80_HUMAN	F	163	ENSP00000417192:C163F	ENSP00000309812:C163F	C	-	2	0	ZNF80	115438124	0.603000	0.26924	0.001000	0.08648	0.353000	0.29299	2.482000	0.45224	0.826000	0.34661	0.561000	0.74099	TGC		0.488	ZNF80-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354696.2	NM_007136		32	190	1	0	4.66e-17	6.77e-17	32	190				
ADPRH	141	broad.mit.edu	37	3	119305452	119305452	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:119305452G>T	ENST00000478399.1	+	3	2024	c.619G>T	c.(619-621)Gtc>Ttc	p.V207F	ADPRH_ENST00000465513.1_Missense_Mutation_p.V207F|ADPRH_ENST00000471850.1_3'UTR|ADPRH_ENST00000478927.1_Missense_Mutation_p.V207F|ADPRH_ENST00000357003.3_Missense_Mutation_p.V207F			P54922	ADPRH_HUMAN	ADP-ribosylarginine hydrolase	207					cellular protein modification process (GO:0006464)|protein de-ADP-ribosylation (GO:0051725)		ADP-ribosylarginine hydrolase activity (GO:0003875)|magnesium ion binding (GO:0000287)			breast(1)|kidney(1)|lung(10)|ovary(1)	13		Lung NSC(201;0.0977)		GBM - Glioblastoma multiforme(114;0.23)		AAAGTACATTGTCCAATCAGG	0.483																																					GBM(133;579 1804 5989 9967 40052)	uc003ecs.2		NA																	0				ovary(1)	1						c.(619-621)GTC>TTC		ADP-ribosylarginine hydrolase							79.0	81.0	80.0					3																	119305452		2203	4300	6503	SO:0001583	missense	141				protein de-ADP-ribosylation		ADP-ribosylarginine hydrolase activity|magnesium ion binding	g.chr3:119305452G>T	L13291	CCDS2990.1	3q13.31-q13.33	2004-02-27			ENSG00000144843	ENSG00000144843			269	protein-coding gene	gene with protein product		603081				8349667, 12070318	Standard	NM_001125		Approved	ARH1	uc003ecs.3	P54922	OTTHUMG00000159420	ENST00000478399.1:c.619G>T	3.37:g.119305452G>T	ENSP00000420200:p.Val207Phe		Somatic				ADPRH_uc010hqv.2_Missense_Mutation_p.V207F|ADPRH_uc011bjb.1_Missense_Mutation_p.V100F|ADPRH_uc003ect.2_Missense_Mutation_p.V207F	p.V207F	NM_001125	NP_001116	WXS	Illumina HiSeq	Unspecified	P54922	ADPRH_HUMAN		GBM - Glioblastoma multiforme(114;0.23)	4	917	+		Lung NSC(201;0.0977)	207					B2R8H1|D3DN83	Missense_Mutation	SNP	ENST00000478399.1	37	c.619G>T	CCDS2990.1	.	.	.	.	.	.	.	.	.	.	G	10.43	1.347106	0.24426	.	.	ENSG00000144843	ENST00000478399;ENST00000478927;ENST00000357003;ENST00000465513	T;T;T;T	0.30714	1.52;1.52;1.52;1.52	5.54	1.27	0.21489	.	1.016190	0.07847	N	0.963978	T	0.21841	0.0526	N	0.22421	0.69	0.09310	N	1	B	0.31383	0.321	B	0.31390	0.129	T	0.29366	-1.0014	10	0.54805	T	0.06	-4.6558	8.4065	0.32619	0.3875:0.0:0.6125:0.0	.	207	P54922	ADPRH_HUMAN	F	207	ENSP00000420200:V207F;ENSP00000417528:V207F;ENSP00000349496:V207F;ENSP00000417430:V207F	ENSP00000349496:V207F	V	+	1	0	ADPRH	120788142	0.002000	0.14202	0.004000	0.12327	0.383000	0.30230	0.646000	0.24797	0.025000	0.15241	-0.136000	0.14681	GTC		0.483	ADPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355199.1	NM_001125		36	121	1	0	6.03e-25	9.23e-25	36	121				
GOLGB1	2804	broad.mit.edu	37	3	121413755	121413755	+	Missense_Mutation	SNP	T	T	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:121413755T>G	ENST00000340645.5	-	13	5725	c.5600A>C	c.(5599-5601)gAa>gCa	p.E1867A	GOLGB1_ENST00000393667.3_Missense_Mutation_p.E1872A	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	1867					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		TTTCTCATTTTCTAAAGTCTG	0.353																																						uc003eei.3		NA																	0				ovary(6)|breast(2)|skin(2)	10						c.(5599-5601)GAA>GCA		golgi autoantigen, golgin subfamily b,							114.0	130.0	125.0					3																	121413755		2199	4298	6497	SO:0001583	missense	2804				Golgi organization	ER-Golgi intermediate compartment|Golgi membrane|Golgi stack|integral to membrane	protein binding	g.chr3:121413755T>G	X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.5600A>C	3.37:g.121413755T>G	ENSP00000341848:p.Glu1867Ala		Somatic				GOLGB1_uc010hrc.2_Missense_Mutation_p.E1872A|GOLGB1_uc003eej.3_Missense_Mutation_p.E1833A|GOLGB1_uc011bjm.1_Missense_Mutation_p.E1753A|GOLGB1_uc010hrd.1_Missense_Mutation_p.E1831A	p.E1867A	NM_004487	NP_004478	WXS	Illumina HiSeq	Unspecified	Q14789	GOGB1_HUMAN		GBM - Glioblastoma multiforme(114;0.0989)	13	5726	-			1867			Cytoplasmic (Potential).|Potential.		B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	ENST00000340645.5	37	c.5600A>C	CCDS3004.1	.	.	.	.	.	.	.	.	.	.	T	10.91	1.483059	0.26598	.	.	ENSG00000173230	ENST00000340645;ENST00000393667	T;T	0.17370	2.28;2.28	5.92	5.92	0.95590	.	0.117176	0.38778	N	0.001580	T	0.22781	0.0550	M	0.67953	2.075	0.35698	D	0.815405	P;P;B;P	0.42692	0.787;0.787;0.033;0.726	B;B;B;B	0.44163	0.443;0.443;0.046;0.371	T	0.27123	-1.0083	10	0.34782	T	0.22	.	9.5914	0.39548	0.1561:0.0:0.0:0.8439	.	1792;1872;1872;1867	F1T0J2;E7EP74;B2ZZ91;Q14789	.;.;.;GOGB1_HUMAN	A	1867;1872	ENSP00000341848:E1867A;ENSP00000377275:E1872A	ENSP00000341848:E1867A	E	-	2	0	GOLGB1	122896445	0.303000	0.24463	1.000000	0.80357	0.987000	0.75469	0.732000	0.26072	2.254000	0.74563	0.528000	0.53228	GAA		0.353	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355159.1	NM_004487		87	340	0	0	0	0	87	340				
PARP9	83666	broad.mit.edu	37	3	122247277	122247277	+	Silent	SNP	T	T	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:122247277T>C	ENST00000360356.2	-	11	2726	c.2499A>G	c.(2497-2499)tcA>tcG	p.S833S	PARP9_ENST00000471785.1_Silent_p.S798S|PARP9_ENST00000477522.2_Silent_p.S798S|PARP9_ENST00000492382.1_Silent_p.S378S	NM_001146102.1|NM_031458.2	NP_001139574.1|NP_113646.2	Q8IXQ6	PARP9_HUMAN	poly (ADP-ribose) polymerase family, member 9	833	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				cell migration (GO:0016477)|double-strand break repair (GO:0006302)|regulation of response to interferon-gamma (GO:0060330)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	34				GBM - Glioblastoma multiforme(114;0.0519)		TCATTGGTCCTGATGAGTAAT	0.453																																						uc010hri.2		NA																	0				ovary(1)|pancreas(1)|prostate(1)|skin(1)	4						c.(2497-2499)TCA>TCG		poly (ADP-ribose) polymerase family, member 9							142.0	123.0	130.0					3																	122247277		2203	4300	6503	SO:0001819	synonymous_variant	83666				cell migration	cytosol|nucleus	NAD+ ADP-ribosyltransferase activity|protein binding	g.chr3:122247277T>C	AF307339	CCDS3014.1, CCDS54633.1, CCDS54634.1	3q13-q21	2010-02-16			ENSG00000138496	ENSG00000138496		"""Poly (ADP-ribose) polymerases"""	24118	protein-coding gene	gene with protein product		612065				11110709	Standard	NM_031458		Approved	BAL, BAL1	uc003efi.3	Q8IXQ6	OTTHUMG00000159522	ENST00000360356.2:c.2499A>G	3.37:g.122247277T>C			Somatic				PARP9_uc003eff.3_Silent_p.S798S|PARP9_uc011bjs.1_Silent_p.S798S|PARP9_uc003efg.2_Silent_p.S378S|PARP9_uc003efi.2_Silent_p.S798S|PARP9_uc003efh.2_Silent_p.S833S	p.S833S	NM_001146102	NP_001139574	WXS	Illumina HiSeq	Unspecified	Q8IXQ6	PARP9_HUMAN		GBM - Glioblastoma multiforme(114;0.0519)	11	2644	-			833			PARP catalytic.		A8KA94|B2R8S9|E9PFM7|Q8TCP3|Q9BZL8|Q9BZL9	Silent	SNP	ENST00000360356.2	37	c.2499A>G	CCDS3014.1																																																																																				0.453	PARP9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355957.1	NM_031458		35	136	0	0	0	0	35	136				
SLC12A8	84561	broad.mit.edu	37	3	124802771	124802771	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:124802771G>T	ENST00000393469.4	-	13	2157	c.2108C>A	c.(2107-2109)tCc>tAc	p.S703Y	SLC12A8_ENST00000469902.1_Missense_Mutation_p.S703Y|SLC12A8_ENST00000430155.2_Missense_Mutation_p.S504Y|SLC12A8_ENST00000314584.7_Missense_Mutation_p.S364Y|SLC12A8_ENST00000465475.1_5'UTR|SLC12A8_ENST00000423114.2_Missense_Mutation_p.S732Y	NM_001195483.1	NP_001182412	A0AV02	S12A8_HUMAN	solute carrier family 12, member 8	703					potassium ion transport (GO:0006813)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			endometrium(2)|kidney(2)|lung(12)	16						GTTCACGAGGGAGGAGTGGTG	0.572																																						uc003ehv.3		NA																	0					0						c.(2107-2109)TCC>TAC		solute carrier family 12, member 8							52.0	58.0	56.0					3																	124802771		2136	4235	6371	SO:0001583	missense	84561				potassium ion transport	integral to membrane	symporter activity	g.chr3:124802771G>T		CCDS43143.1	3q21.2	2013-07-18	2013-07-18		ENSG00000221955	ENSG00000221955		"""Solute carriers"""	15595	protein-coding gene	gene with protein product	"""solute carrier family 12 (sodium/potassium/chloride transporters), member 8"", ""cation-chloride cotransporter 9"""	611316				11863360	Standard	NM_024628		Approved	CCC9	uc003ehv.4	A0AV02	OTTHUMG00000159483	ENST00000393469.4:c.2108C>A	3.37:g.124802771G>T	ENSP00000377112:p.Ser703Tyr		Somatic				SLC12A8_uc003ehw.3_Missense_Mutation_p.S732Y|SLC12A8_uc003eht.3_Missense_Mutation_p.S504Y|SLC12A8_uc003ehu.3_Missense_Mutation_p.S456Y|SLC12A8_uc010hry.2_3'UTR	p.S703Y	NM_024628	NP_078904	WXS	Illumina HiSeq	Unspecified	A0AV02	S12A8_HUMAN			14	2219	-			703					C9JJJ2|Q68D04|Q6I9Z2|Q6P4C0|Q7Z3A6|Q86WK0|Q8NFX9|Q8WUI3|Q96RF9|Q9H5P9	Missense_Mutation	SNP	ENST00000393469.4	37	c.2108C>A	CCDS43143.1	.	.	.	.	.	.	.	.	.	.	G	15.63	2.891581	0.52014	.	.	ENSG00000221955	ENST00000430155;ENST00000393469;ENST00000423114;ENST00000469902;ENST00000314584	D;D;D;D;D	0.89343	-2.05;-2.48;-2.5;-2.48;-1.74	5.05	4.18	0.49190	.	.	.	.	.	D	0.93077	0.7796	M	0.76002	2.32	0.26537	N	0.974158	D;D;D	0.76494	0.999;0.998;0.98	D;P;P	0.69824	0.966;0.898;0.902	D	0.85871	0.1416	9	0.87932	D	0	.	9.6722	0.40019	0.1676:0.0:0.8324:0.0	.	732;703;504	A0AV02-2;A0AV02;A0AV02-3	.;S12A8_HUMAN;.	Y	504;703;732;703;364	ENSP00000415713:S504Y;ENSP00000377112:S703Y;ENSP00000404243:S732Y;ENSP00000418783:S703Y;ENSP00000323632:S364Y	ENSP00000323632:S364Y	S	-	2	0	SLC12A8	126285461	0.996000	0.38824	0.988000	0.46212	0.465000	0.32709	2.392000	0.44433	1.351000	0.45789	-0.244000	0.11960	TCC		0.572	SLC12A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355711.4	NM_024628		4	32	1	0	0.00909568	0.00953133	4	32				
CHST13	166012	broad.mit.edu	37	3	126255138	126255138	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:126255138C>A	ENST00000319340.2	+	2	172	c.122C>A	c.(121-123)tCc>tAc	p.S41Y		NM_152889.2	NP_690849.1	Q8NET6	CHSTD_HUMAN	carbohydrate (chondroitin 4) sulfotransferase 13	41					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin 4-sulfotransferase activity (GO:0047756)|N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)			central_nervous_system(1)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(114;0.151)		GCCCTGGGCTCCAGCTGGCTT	0.592																																						uc003eja.2		NA																	0				central_nervous_system(1)	1						c.(121-123)TCC>TAC		carbohydrate sulfotransferase 13							107.0	109.0	108.0					3																	126255138		2203	4300	6503	SO:0001583	missense	166012				chondroitin sulfate biosynthetic process	Golgi membrane|integral to membrane	chondroitin 4-sulfotransferase activity|N-acetylgalactosamine 4-O-sulfotransferase activity	g.chr3:126255138C>A	AY120869	CCDS3039.1	3q21.3	2008-02-05			ENSG00000180767	ENSG00000180767	2.8.2.5	"""Sulfotransferases, membrane-bound"""	21755	protein-coding gene	gene with protein product		610124				12080076	Standard	NM_152889		Approved	C4ST3	uc003eja.3	Q8NET6	OTTHUMG00000162721	ENST00000319340.2:c.122C>A	3.37:g.126255138C>A	ENSP00000317404:p.Ser41Tyr		Somatic					p.S41Y	NM_152889	NP_690849	WXS	Illumina HiSeq	Unspecified	Q8NET6	CHSTD_HUMAN		GBM - Glioblastoma multiforme(114;0.151)	2	122	+			41			Lumenal (Potential).		Q3SYA3|Q3SYA5	Missense_Mutation	SNP	ENST00000319340.2	37	c.122C>A	CCDS3039.1	.	.	.	.	.	.	.	.	.	.	C	7.705	0.693941	0.15039	.	.	ENSG00000180767	ENST00000319340;ENST00000383575	T	0.68903	-0.36	3.18	3.18	0.36537	.	4.707150	0.00760	N	0.001126	T	0.58921	0.2156	L	0.51422	1.61	0.31899	N	0.616233	P	0.44578	0.838	B	0.39185	0.293	T	0.57700	-0.7766	10	0.02654	T	1	-26.42	10.1162	0.42591	0.0:1.0:0.0:0.0	.	41	Q8NET6	CHSTD_HUMAN	Y	41	ENSP00000317404:S41Y	ENSP00000317404:S41Y	S	+	2	0	CHST13	127737828	0.228000	0.23718	0.065000	0.19835	0.300000	0.27592	1.068000	0.30629	2.063000	0.61619	0.467000	0.42956	TCC		0.592	CHST13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370201.2	NM_152889		21	122	1	0	2.28e-19	3.39e-19	21	122				
EPHB1	2047	broad.mit.edu	37	3	134825427	134825427	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:134825427C>A	ENST00000398015.3	+	4	1313	c.943C>A	c.(943-945)Cca>Aca	p.P315T	EPHB1_ENST00000493838.1_5'UTR|EPHB1_ENST00000488154.1_3'UTR	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	315	Cys-rich.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						CTTTGACCCTCCAGAAGTGGC	0.587																																						uc003eqt.2		NA																	0				lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30						c.(943-945)CCA>ACA		ephrin receptor EphB1 precursor							50.0	50.0	50.0					3																	134825427		1936	4145	6081	SO:0001583	missense	2047					integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding	g.chr3:134825427C>A	L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.943C>A	3.37:g.134825427C>A	ENSP00000381097:p.Pro315Thr		Somatic				EPHB1_uc010htz.1_RNA|EPHB1_uc011bly.1_Silent_p.L203L|EPHB1_uc003equ.2_5'UTR	p.P315T	NM_004441	NP_004432	WXS	Illumina HiSeq	Unspecified	P54762	EPHB1_HUMAN			4	1163	+			315			Extracellular (Potential).|Cys-rich.		A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Missense_Mutation	SNP	ENST00000398015.3	37	c.943C>A	CCDS46921.1	.	.	.	.	.	.	.	.	.	.	C	16.18	3.050207	0.55218	.	.	ENSG00000154928	ENST00000398015	D	0.97620	-4.46	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	D	0.97219	0.9091	M	0.88512	2.96	0.80722	D	1	B	0.31968	0.349	B	0.36418	0.224	D	0.96360	0.9265	10	0.62326	D	0.03	.	14.5539	0.68086	0.0:0.9307:0.0:0.0693	.	315	P54762	EPHB1_HUMAN	T	315	ENSP00000381097:P315T	ENSP00000381097:P315T	P	+	1	0	EPHB1	136308117	1.000000	0.71417	0.786000	0.31890	0.997000	0.91878	4.834000	0.62774	2.832000	0.97577	0.655000	0.94253	CCA		0.587	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357671.1	NM_004441		17	57	1	0	5.39e-06	6.51e-06	17	57				
STAG1	10274	broad.mit.edu	37	3	136192475	136192475	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:136192475C>A	ENST00000383202.2	-	11	1287	c.1031G>T	c.(1030-1032)gGg>gTg	p.G344V	STAG1_ENST00000434713.2_Missense_Mutation_p.G118V|STAG1_ENST00000236698.5_Missense_Mutation_p.G344V|STAG1_ENST00000536929.1_5'Flank	NM_005862.2	NP_005853.2	Q8WVM7	STAG1_HUMAN	stromal antigen 1	344	SCD. {ECO:0000255|PROSITE- ProRule:PRU00750}.				chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58						CCTGACTTCCCCTTGCTTCAG	0.348																																						uc003era.1		NA																	0				ovary(2)	2						c.(1030-1032)GGG>GTG		stromal antigen 1							71.0	72.0	72.0					3																	136192475		2203	4300	6503	SO:0001583	missense	10274				cell division|chromosome segregation|mitotic metaphase/anaphase transition|mitotic prometaphase	cell junction|chromatin|chromosome, centromeric region|nucleoplasm	protein binding	g.chr3:136192475C>A	Z75330	CCDS3090.1	3q22.2-q22.3	2011-08-12			ENSG00000118007	ENSG00000118007			11354	protein-coding gene	gene with protein product		604358				9305759	Standard	XM_006713471		Approved	SA-1, SCC3A	uc003era.1	Q8WVM7	OTTHUMG00000159798	ENST00000383202.2:c.1031G>T	3.37:g.136192475C>A	ENSP00000372689:p.Gly344Val		Somatic				STAG1_uc003erb.1_Missense_Mutation_p.G344V|STAG1_uc003erc.1_Missense_Mutation_p.G118V|STAG1_uc010hua.1_Missense_Mutation_p.G207V	p.G344V	NM_005862	NP_005853	WXS	Illumina HiSeq	Unspecified	Q8WVM7	STAG1_HUMAN			11	1323	-			344			SCD.		O00539|Q6P275	Missense_Mutation	SNP	ENST00000383202.2	37	c.1031G>T	CCDS3090.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.908458	0.92107	.	.	ENSG00000118007	ENST00000383202;ENST00000236698;ENST00000434713	T;T;T	0.29655	1.56;1.56;1.56	5.7	5.7	0.88788	Stromalin conservative domain (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.55386	0.1917	M	0.64260	1.97	0.80722	D	1	D;D;D	0.89917	0.984;1.0;0.984	D;D;D	0.97110	0.938;1.0;0.938	T	0.47407	-0.9120	10	0.39692	T	0.17	.	19.8218	0.96599	0.0:1.0:0.0:0.0	.	361;344;344	Q4LE48;Q6P275;Q8WVM7	.;.;STAG1_HUMAN	V	344;344;118	ENSP00000372689:G344V;ENSP00000236698:G344V;ENSP00000404396:G118V	ENSP00000236698:G344V	G	-	2	0	STAG1	137675165	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.678000	0.91216	0.655000	0.94253	GGG		0.348	STAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357366.1	NM_005862		10	88	1	0	2.81e-09	3.7e-09	10	88				
CLSTN2	64084	broad.mit.edu	37	3	140281733	140281733	+	Silent	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:140281733C>A	ENST00000458420.3	+	14	2483	c.2293C>A	c.(2293-2295)Cgg>Agg	p.R765R		NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	765			R -> Q (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						CCTTGAGGCCCGGCGTTTCCG	0.572										HNSCC(16;0.037)																											GBM(45;858 913 3709 36904 37282)	uc003etn.2		NA																	0		p.R765Q(1)		skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						c.(2293-2295)CGG>AGG		calsyntenin 2 precursor							53.0	52.0	52.0					3																	140281733		2203	4300	6503	SO:0001819	synonymous_variant	64084				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding	g.chr3:140281733C>A	AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.2293C>A	3.37:g.140281733C>A		HNSCC(16;0.037)	Somatic					p.R765R	NM_022131	NP_071414	WXS	Illumina HiSeq	Unspecified	Q9H4D0	CSTN2_HUMAN			14	2483	+			765		R -> Q (in a colorectal cancer sample; somatic mutation).	Extracellular (Potential).		B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Silent	SNP	ENST00000458420.3	37	c.2293C>A	CCDS3112.1																																																																																				0.572	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359393.3	NM_022131		11	72	1	0	3.86e-05	4.51e-05	11	72				
TRPC1	7220	broad.mit.edu	37	3	142522827	142522827	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:142522827G>T	ENST00000476941.1	+	11	2252	c.1766G>T	c.(1765-1767)gGc>gTc	p.G589V	TRPC1_ENST00000273482.6_Missense_Mutation_p.G555V|RNU7-47P_ENST00000515978.1_RNA	NM_001251845.1	NP_001238774.1	P48995	TRPC1_HUMAN	transient receptor potential cation channel, subfamily C, member 1	589					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|response to calcium ion (GO:0051592)|saliva secretion (GO:0046541)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|sarcomere (GO:0030017)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|inositol 1,4,5 trisphosphate binding (GO:0070679)|ion channel binding (GO:0044325)|store-operated calcium channel activity (GO:0015279)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(2)|stomach(3)|urinary_tract(1)	37						AGGTTCATTGGCACCTGCTTT	0.328																																						uc003evc.2		NA																	0				ovary(2)	2						c.(1765-1767)GGC>GTC		transient receptor potential cation channel,							91.0	83.0	86.0					3																	142522827		2203	4300	6503	SO:0001583	missense	7220				axon guidance|cytosolic calcium ion homeostasis|positive regulation of release of sequestered calcium ion into cytosol|response to calcium ion	cytosol|integral to plasma membrane	protein binding|store-operated calcium channel activity	g.chr3:142522827G>T	X89066	CCDS3126.1, CCDS58856.1	3q23	2011-12-14			ENSG00000144935	ENSG00000144935		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12333	protein-coding gene	gene with protein product		602343				7568191, 16382100	Standard	NM_001251845		Approved	HTRP-1	uc003evc.3	P48995	OTTHUMG00000159301	ENST00000476941.1:c.1766G>T	3.37:g.142522827G>T	ENSP00000419313:p.Gly589Val		Somatic				TRPC1_uc003evb.2_Missense_Mutation_p.G555V|TRPC1_uc011bni.1_Missense_Mutation_p.G108V	p.G589V	NM_003304	NP_003295	WXS	Illumina HiSeq	Unspecified	P48995	TRPC1_HUMAN			11	1902	+			589			Helical; (Potential).		Q14CE4	Missense_Mutation	SNP	ENST00000476941.1	37	c.1766G>T	CCDS58856.1	.	.	.	.	.	.	.	.	.	.	G	18.51	3.638651	0.67130	.	.	ENSG00000144935	ENST00000476941;ENST00000273482;ENST00000416210	D;D	0.98419	-4.92;-4.92	5.33	5.33	0.75918	Ion transport (1);	0.097252	0.64402	D	0.000001	D	0.96318	0.8799	L	0.34521	1.04	0.80722	D	1	B;B;B	0.23128	0.033;0.08;0.013	B;B;B	0.23419	0.031;0.046;0.013	D	0.93626	0.6952	10	0.72032	D	0.01	-6.1973	19.3994	0.94621	0.0:0.0:1.0:0.0	.	555;589;555	A7VJS2;P48995;P48995-2	.;TRPC1_HUMAN;.	V	589;555;108	ENSP00000419313:G589V;ENSP00000273482:G555V	ENSP00000273482:G555V	G	+	2	0	TRPC1	144005517	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.546000	0.98097	2.654000	0.90174	0.650000	0.86243	GGC		0.328	TRPC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354520.1	NM_003304		22	108	1	0	1.11e-09	1.48e-09	22	108				
PLOD2	5352	broad.mit.edu	37	3	145799596	145799596	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:145799596C>A	ENST00000360060.3	-	12	1464	c.1287G>T	c.(1285-1287)tgG>tgT	p.W429C	PLOD2_ENST00000282903.5_Missense_Mutation_p.W429C|PLOD2_ENST00000494950.1_Missense_Mutation_p.W374C|PLOD2_ENST00000461497.1_Missense_Mutation_p.W89C|RP11-274H2.2_ENST00000480247.1_RNA	NM_000935.2	NP_000926.2	O00469	PLOD2_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2	429					cellular protein modification process (GO:0006464)|extracellular matrix organization (GO:0030198)|response to hypoxia (GO:0001666)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29					Vitamin C(DB00126)	TCAATGCTCCCCAGAAATTGG	0.378																																						uc003evs.1		NA																	0				ovary(1)|skin(1)	2						c.(1285-1287)TGG>TGT		procollagen-lysine, 2-oxoglutarate 5-dioxygenase	Vitamin C(DB00126)						81.0	76.0	78.0					3																	145799596		2203	4300	6503	SO:0001583	missense	5352				protein modification process|response to hypoxia	rough endoplasmic reticulum membrane	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-lysine 5-dioxygenase activity|protein binding	g.chr3:145799596C>A	U84573	CCDS3131.1, CCDS3132.1	3q24	2011-08-24	2005-01-04		ENSG00000152952	ENSG00000152952			9082	protein-coding gene	gene with protein product	"""lysyl hydroxlase 2"""	601865	"""procollagen-lysine, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase) 2"""			9054364	Standard	XM_005247535		Approved	LH2	uc003evr.1	O00469	OTTHUMG00000159417	ENST00000360060.3:c.1287G>T	3.37:g.145799596C>A	ENSP00000353170:p.Trp429Cys		Somatic				PLOD2_uc003evq.1_Missense_Mutation_p.W89C|PLOD2_uc011bnm.1_Missense_Mutation_p.W374C|PLOD2_uc003evr.1_Missense_Mutation_p.W429C	p.W429C	NM_000935	NP_000926	WXS	Illumina HiSeq	Unspecified	O00469	PLOD2_HUMAN			12	1793	-			429					B3KWS3|Q59ED2|Q8N170	Missense_Mutation	SNP	ENST00000360060.3	37	c.1287G>T	CCDS3131.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.671119	0.88348	.	.	ENSG00000152952	ENST00000461497;ENST00000282903;ENST00000360060;ENST00000494950	D;D;D;D	0.84873	-1.91;-1.91;-1.91;-1.91	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	D	0.94331	0.8178	M	0.91459	3.21	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.997;0.996;0.993	D	0.95136	0.8259	10	0.87932	D	0	-24.304	19.4559	0.94889	0.0:1.0:0.0:0.0	.	374;429;429;89	E7ETU9;O00469;O00469-2;B3KWS3	.;PLOD2_HUMAN;.;.	C	89;429;429;374	ENSP00000419354:W89C;ENSP00000282903:W429C;ENSP00000353170:W429C;ENSP00000420094:W374C	ENSP00000282903:W429C	W	-	3	0	PLOD2	147282286	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.744000	0.85034	2.578000	0.87016	0.591000	0.81541	TGG		0.378	PLOD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355185.1	NM_000935		15	106	1	0	2.32e-09	3.07e-09	15	106				
ZIC4	84107	broad.mit.edu	37	3	147114163	147114163	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:147114163G>T	ENST00000383075.3	-	3	676	c.164C>A	c.(163-165)cCc>cAc	p.P55H	ZIC4_ENST00000425731.3_Missense_Mutation_p.P93H|ZIC4_ENST00000525172.2_Missense_Mutation_p.P105H|ZIC4_ENST00000473123.1_Missense_Mutation_p.P55H|ZIC4_ENST00000491672.1_Intron|ZIC4_ENST00000484399.1_Missense_Mutation_p.P55H	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4	55						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						AGGACGGCTGGGGGAGGCCTG	0.716																																						uc003ewd.1		NA																	0				upper_aerodigestive_tract(1)|central_nervous_system(1)	2						c.(163-165)CCC>CAC		zinc finger protein of the cerebellum 4							13.0	17.0	16.0					3																	147114163		1869	4081	5950	SO:0001583	missense	84107					nucleus	DNA binding|zinc ion binding	g.chr3:147114163G>T	AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.164C>A	3.37:g.147114163G>T	ENSP00000372553:p.Pro55His		Somatic				ZIC4_uc003ewc.1_5'UTR|ZIC4_uc011bno.1_Missense_Mutation_p.P105H	p.P55H	NM_032153	NP_115529	WXS	Illumina HiSeq	Unspecified	Q8N9L1	ZIC4_HUMAN			3	437	-			55					A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	Missense_Mutation	SNP	ENST00000383075.3	37	c.164C>A	CCDS43160.1	.	.	.	.	.	.	.	.	.	.	G	12.53	1.964644	0.34659	.	.	ENSG00000174963	ENST00000383075;ENST00000425731;ENST00000525172;ENST00000484399;ENST00000473123;ENST00000462748;ENST00000484586;ENST00000463250	T;T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88;0.88	5.01	3.04	0.35103	.	0.503265	0.16365	N	0.217586	T	0.26195	0.0639	N	0.12746	0.255	0.80722	D	1	B;B	0.09022	0.002;0.001	B;B	0.08055	0.003;0.002	T	0.02683	-1.1124	10	0.33141	T	0.24	.	13.4769	0.61314	0.0:0.0:0.653:0.347	.	105;55	B7Z2L2;Q8N9L1	.;ZIC4_HUMAN	H	55;93;105;55;55;55;55;55	ENSP00000372553:P55H;ENSP00000397695:P93H;ENSP00000435509:P105H;ENSP00000417855:P55H;ENSP00000420775:P55H;ENSP00000420627:P55H	ENSP00000372553:P55H	P	-	2	0	ZIC4	148596853	1.000000	0.71417	0.957000	0.39632	0.729000	0.41735	6.290000	0.72712	0.375000	0.24679	-0.219000	0.12488	CCC		0.716	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355504.1			10	38	1	0	1.59e-06	1.95e-06	10	38				
ZIC1	7545	broad.mit.edu	37	3	147130344	147130344	+	Missense_Mutation	SNP	G	G	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:147130344G>C	ENST00000282928.4	+	2	1751	c.1022G>C	c.(1021-1023)cGg>cCg	p.R341P		NM_003412.3	NP_003403.2	Q15915	ZIC1_HUMAN	Zic family member 1	341					adult walking behavior (GO:0007628)|brain development (GO:0007420)|cell differentiation (GO:0030154)|inner ear morphogenesis (GO:0042472)|pattern specification process (GO:0007389)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord development (GO:0021510)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(4)|cervix(1)|endometrium(2)|large_intestine(8)|lung(38)|ovary(1)|prostate(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	63						GGCTGTGACCGGCGCTTCGCT	0.532																																						uc003ewe.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1021-1023)CGG>CCG		zinc finger protein of the cerebellum 1							97.0	85.0	89.0					3																	147130344		2203	4300	6503	SO:0001583	missense	7545				behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr3:147130344G>C	D76435	CCDS3136.1	3q24	2013-01-08	2011-05-19		ENSG00000152977	ENSG00000152977		"""Zinc fingers, C2H2-type"""	12872	protein-coding gene	gene with protein product		600470	"""Zic family member 1 (odd-paired Drosophila homolog)"", ""Zic family member 1 (odd-paired homolog, Drosophila)"""			8542595	Standard	NM_003412		Approved	ZIC, ZNF201	uc003ewe.3	Q15915	OTTHUMG00000159456	ENST00000282928.4:c.1022G>C	3.37:g.147130344G>C	ENSP00000282928:p.Arg341Pro		Somatic					p.R341P	NM_003412	NP_003403	WXS	Illumina HiSeq	Unspecified	Q15915	ZIC1_HUMAN			2	1741	+			341			C2H2-type 4.		Q2M3N1	Missense_Mutation	SNP	ENST00000282928.4	37	c.1022G>C	CCDS3136.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.8|24.8	4.569368|4.569368	0.86439|0.86439	.|.	.|.	ENSG00000152977|ENSG00000152977	ENST00000488404|ENST00000282928	.|T	.|0.07908	.|3.15	3.48|3.48	3.48|3.48	0.39840|0.39840	.|Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.|0.000000	.|0.85682	.|U	.|0.000000	T|T	0.27349|0.27349	0.0671|0.0671	M|M	0.74647|0.74647	2.275|2.275	0.80722|0.80722	D|D	1|1	.|D	.|0.57899	.|0.981	.|D	.|0.67231	.|0.95	T|T	0.10405|0.10405	-1.0631|-1.0631	5|10	.|0.87932	.|D	.|0	.|.	15.1592|15.1592	0.72767|0.72767	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|341	.|Q15915	.|ZIC1_HUMAN	R|P	30|341	.|ENSP00000282928:R341P	.|ENSP00000282928:R341P	G|R	+|+	1|2	0|0	ZIC1|ZIC1	148613034|148613034	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	9.515000|9.515000	0.98015|0.98015	1.772000|1.772000	0.52199|0.52199	0.462000|0.462000	0.41574|0.41574	GGC|CGG		0.532	ZIC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355497.1	NM_003412		29	117	0	0	0	0	29	117				
ZIC1	7545	broad.mit.edu	37	3	147131168	147131168	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:147131168C>T	ENST00000282928.4	+	3	1903	c.1174C>T	c.(1174-1176)Cag>Tag	p.Q392*		NM_003412.3	NP_003403.2	Q15915	ZIC1_HUMAN	Zic family member 1	392	Ser-rich.				adult walking behavior (GO:0007628)|brain development (GO:0007420)|cell differentiation (GO:0030154)|inner ear morphogenesis (GO:0042472)|pattern specification process (GO:0007389)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord development (GO:0021510)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(4)|cervix(1)|endometrium(2)|large_intestine(8)|lung(38)|ovary(1)|prostate(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	63						GCAGGGCTCGCAGCCTTCGCC	0.622																																						uc003ewe.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1174-1176)CAG>TAG		zinc finger protein of the cerebellum 1							88.0	83.0	85.0					3																	147131168		2203	4300	6503	SO:0001587	stop_gained	7545				behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr3:147131168C>T	D76435	CCDS3136.1	3q24	2013-01-08	2011-05-19		ENSG00000152977	ENSG00000152977		"""Zinc fingers, C2H2-type"""	12872	protein-coding gene	gene with protein product		600470	"""Zic family member 1 (odd-paired Drosophila homolog)"", ""Zic family member 1 (odd-paired homolog, Drosophila)"""			8542595	Standard	NM_003412		Approved	ZIC, ZNF201	uc003ewe.3	Q15915	OTTHUMG00000159456	ENST00000282928.4:c.1174C>T	3.37:g.147131168C>T	ENSP00000282928:p.Gln392*		Somatic					p.Q392*	NM_003412	NP_003403	WXS	Illumina HiSeq	Unspecified	Q15915	ZIC1_HUMAN			3	1893	+			392			Ser-rich.		Q2M3N1	Nonsense_Mutation	SNP	ENST00000282928.4	37	c.1174C>T	CCDS3136.1	.	.	.	.	.	.	.	.	.	.	C	18.89	3.720198	0.68844	.	.	ENSG00000152977	ENST00000282928	.	.	.	3.37	3.37	0.38596	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09084	T	0.74	.	14.7459	0.69490	0.0:1.0:0.0:0.0	.	.	.	.	X	392	.	ENSP00000282928:Q392X	Q	+	1	0	ZIC1	148613858	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	4.345000	0.59360	1.431000	0.47355	0.462000	0.41574	CAG		0.622	ZIC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355497.1	NM_003412		21	147	0	0	0	0	21	147				
ZIC1	7545	broad.mit.edu	37	3	147131266	147131266	+	Silent	SNP	C	C	A	rs368298985		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:147131266C>A	ENST00000282928.4	+	3	2001	c.1272C>A	c.(1270-1272)ccC>ccA	p.P424P		NM_003412.3	NP_003403.2	Q15915	ZIC1_HUMAN	Zic family member 1	424	Ser-rich.				adult walking behavior (GO:0007628)|brain development (GO:0007420)|cell differentiation (GO:0030154)|inner ear morphogenesis (GO:0042472)|pattern specification process (GO:0007389)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord development (GO:0021510)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(4)|cervix(1)|endometrium(2)|large_intestine(8)|lung(38)|ovary(1)|prostate(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	63						CCTTATCGCCCTCCTCCTCCG	0.562																																						uc003ewe.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1270-1272)CCC>CCA		zinc finger protein of the cerebellum 1							145.0	123.0	130.0					3																	147131266		2203	4300	6503	SO:0001819	synonymous_variant	7545				behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr3:147131266C>A	D76435	CCDS3136.1	3q24	2013-01-08	2011-05-19		ENSG00000152977	ENSG00000152977		"""Zinc fingers, C2H2-type"""	12872	protein-coding gene	gene with protein product		600470	"""Zic family member 1 (odd-paired Drosophila homolog)"", ""Zic family member 1 (odd-paired homolog, Drosophila)"""			8542595	Standard	NM_003412		Approved	ZIC, ZNF201	uc003ewe.3	Q15915	OTTHUMG00000159456	ENST00000282928.4:c.1272C>A	3.37:g.147131266C>A			Somatic					p.P424P	NM_003412	NP_003403	WXS	Illumina HiSeq	Unspecified	Q15915	ZIC1_HUMAN			3	1991	+			424			Ser-rich.		Q2M3N1	Silent	SNP	ENST00000282928.4	37	c.1272C>A	CCDS3136.1	.	.	.	.	.	.	.	.	.	.	C	6.326	0.428265	0.11987	.	.	ENSG00000152977	ENST00000488404	T	0.09630	2.96	3.37	-0.0962	0.13637	.	0.000000	0.85682	U	0.000000	T	0.10809	0.0264	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.17623	-1.0363	7	0.42905	T	0.14	.	1.859	0.03185	0.1776:0.3643:0.3085:0.1496	.	.	.	.	H	113	ENSP00000419664:P113H	ENSP00000419664:P113H	P	+	2	0	ZIC1	148613956	0.993000	0.37304	1.000000	0.80357	0.670000	0.39368	0.319000	0.19522	0.386000	0.24997	-0.502000	0.04539	CCT		0.562	ZIC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355497.1	NM_003412		25	163	1	0	4.72e-08	6.08e-08	25	163				
TSC22D2	9819	broad.mit.edu	37	3	150128674	150128674	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:150128674G>T	ENST00000361875.3	+	1	2553	c.1537G>T	c.(1537-1539)Gtg>Ttg	p.V513L	TSC22D2_ENST00000361136.2_Missense_Mutation_p.V513L	NM_014779.2	NP_055594.1	O75157	T22D2_HUMAN	TSC22 domain family, member 2	513					response to osmotic stress (GO:0006970)		sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	18			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			GCCTGCAGCCGTGCCCGCTCC	0.647																																						uc003exv.2		NA																	0				ovary(1)	1						c.(1537-1539)GTG>TTG		TSC22 domain family, member 2							52.0	54.0	53.0					3																	150128674		2203	4300	6503	SO:0001583	missense	9819						sequence-specific DNA binding transcription factor activity	g.chr3:150128674G>T	AB014569	CCDS3149.1	3q25.1	2005-03-01			ENSG00000196428	ENSG00000196428			29095	protein-coding gene	gene with protein product						9734811	Standard	NM_014779		Approved	KIAA0669, TILZ4a, TILZ4b, TILZ4c	uc003exv.3	O75157	OTTHUMG00000159744	ENST00000361875.3:c.1537G>T	3.37:g.150128674G>T	ENSP00000354543:p.Val513Leu		Somatic				TSC22D2_uc003exw.2_RNA|TSC22D2_uc003exx.2_Missense_Mutation_p.V513L	p.V513L	NM_014779	NP_055594	WXS	Illumina HiSeq	Unspecified	O75157	T22D2_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)		1	1887	+			513					D3DNI5|Q6PI50|Q9H2Z6|Q9H2Z7|Q9H2Z8	Missense_Mutation	SNP	ENST00000361875.3	37	c.1537G>T	CCDS3149.1	.	.	.	.	.	.	.	.	.	.	G	14.12	2.439353	0.43326	.	.	ENSG00000196428	ENST00000361875;ENST00000361136	T;T	0.33438	1.45;1.41	4.56	2.58	0.30949	.	0.282776	0.23167	N	0.051161	T	0.18383	0.0441	N	0.19112	0.55	0.27378	N	0.955485	B;B	0.23591	0.088;0.053	B;B	0.16289	0.015;0.007	T	0.14337	-1.0476	10	0.45353	T	0.12	.	10.1186	0.42607	0.0:0.149:0.6967:0.1543	.	513;513	O75157-2;O75157	.;T22D2_HUMAN	L	513	ENSP00000354543:V513L;ENSP00000354893:V513L	ENSP00000354893:V513L	V	+	1	0	TSC22D2	151611364	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	4.847000	0.62867	0.888000	0.36160	0.563000	0.77884	GTG		0.647	TSC22D2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357123.2	NM_014779		8	55	1	0	2.18e-05	2.57e-05	8	55				
MED12L	116931	broad.mit.edu	37	3	151067863	151067863	+	Missense_Mutation	SNP	A	A	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:151067863A>T	ENST00000474524.1	+	15	2200	c.2162A>T	c.(2161-2163)cAt>cTt	p.H721L	P2RY12_ENST00000302632.3_Intron|MED12L_ENST00000491549.1_3'UTR|MED12L_ENST00000273432.4_Missense_Mutation_p.H581L	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	721						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TCTTCAAGTCATGAATGTAAC	0.433																																						uc003eyp.2		NA																	0				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7						c.(2161-2163)CAT>CTT		mediator of RNA polymerase II transcription,							239.0	246.0	243.0					3																	151067863		2203	4300	6503	SO:0001583	missense	116931				regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex		g.chr3:151067863A>T	AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.2162A>T	3.37:g.151067863A>T	ENSP00000417235:p.His721Leu		Somatic				MED12L_uc011bnz.1_Missense_Mutation_p.H581L|P2RY12_uc011boa.1_Intron|P2RY12_uc003eyx.1_Intron	p.H721L	NM_053002	NP_443728	WXS	Illumina HiSeq	Unspecified	Q86YW9	MD12L_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)		15	2200	+			721					Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	ENST00000474524.1	37	c.2162A>T	CCDS33876.1	.	.	.	.	.	.	.	.	.	.	A	28.6	4.935314	0.92458	.	.	ENSG00000144893	ENST00000474524;ENST00000273432	T;T	0.34275	1.37;1.37	5.81	5.81	0.92471	Mediator complex, subunit Med12, LCEWAV-domain (1);	0.104244	0.64402	D	0.000003	T	0.64768	0.2628	M	0.84433	2.695	0.80722	D	1	D;P	0.76494	0.999;0.458	D;B	0.74023	0.982;0.328	T	0.71017	-0.4714	10	0.87932	D	0	-28.2664	15.8353	0.78793	1.0:0.0:0.0:0.0	.	581;721	F8WAE6;Q86YW9	.;MD12L_HUMAN	L	721;581	ENSP00000417235:H721L;ENSP00000273432:H581L	ENSP00000273432:H581L	H	+	2	0	MED12L	152550553	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.474000	0.90413	2.221000	0.72209	0.455000	0.32223	CAT		0.433	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357707.2	NM_053002		100	592	0	0	0	0	100	592				
MME	4311	broad.mit.edu	37	3	154861232	154861232	+	Splice_Site	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:154861232G>T	ENST00000460393.1	+	13	1309	c.1189G>T	c.(1189-1191)Gcc>Tcc	p.A397S	MME_ENST00000492661.1_Splice_Site_p.A397S|MME_ENST00000493237.1_Splice_Site_p.A397S|MME_ENST00000360490.2_Splice_Site_p.A397S|MME_ENST00000462745.1_Splice_Site_p.A397S	NM_000902.3|NM_007287.2	NP_000893.2|NP_009218.2	P08473	NEP_HUMAN	membrane metallo-endopeptidase	397					angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cellular protein metabolic process (GO:0044267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to UV-A (GO:0071492)|cellular response to UV-B (GO:0071493)|creatinine metabolic process (GO:0046449)|kidney development (GO:0001822)|peptide metabolic process (GO:0006518)|proteolysis (GO:0006508)|replicative senescence (GO:0090399)|sensory perception of pain (GO:0019233)	axon (GO:0030424)|brush border (GO:0005903)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(31)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)|Liraglutide(DB06655)	TTTTCCGTAGGCCCTTTATGG	0.418																																						uc010hvr.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(1189-1191)GCC>TCC		membrane metallo-endopeptidase	Candoxatril(DB00616)						151.0	147.0	148.0					3																	154861232		2203	4300	6503	SO:0001630	splice_region_variant	4311				cell-cell signaling|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding	g.chr3:154861232G>T		CCDS3172.1	3q25.2	2012-01-31	2007-02-21		ENSG00000196549	ENSG00000196549	3.4.24.11	"""CD molecules"""	7154	protein-coding gene	gene with protein product	"""neutral endopeptidase"", ""enkephalinase"", ""neprilysin"""	120520					Standard	NM_007287		Approved	CALLA, CD10, NEP	uc003fad.1	P08473	OTTHUMG00000158455	ENST00000460393.1:c.1189-1G>T	3.37:g.154861232G>T			Somatic				MME_uc003fab.1_Missense_Mutation_p.A397S|MME_uc003fac.1_Missense_Mutation_p.A397S|MME_uc003fad.1_Missense_Mutation_p.A397S|MME_uc003fae.1_Missense_Mutation_p.A397S	p.A397S	NM_007289	NP_009220	WXS	Illumina HiSeq	Unspecified	P08473	NEP_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		13	1400	+		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	397			Extracellular (Potential).		A8K6U6|D3DNJ9|Q3MIX4	Missense_Mutation	SNP	ENST00000460393.1	37	c.1189G>T	CCDS3172.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.604983	0.87157	.	.	ENSG00000196549	ENST00000492661;ENST00000460393;ENST00000462745;ENST00000493237;ENST00000360490	T;T;T;T;T	0.74737	-0.87;-0.87;-0.87;-0.87;-0.87	5.91	5.91	0.95273	Peptidase M13 (1);Metallopeptidase, catalytic domain (1);	0.052570	0.85682	D	0.000000	D	0.82930	0.5144	L	0.49455	1.56	0.80722	D	1	P	0.50156	0.932	D	0.63381	0.914	T	0.79507	-0.1775	9	.	.	.	-17.7342	20.2985	0.98592	0.0:0.0:1.0:0.0	.	397	P08473	NEP_HUMAN	S	397	ENSP00000420389:A397S;ENSP00000418525:A397S;ENSP00000419653:A397S;ENSP00000417079:A397S;ENSP00000353679:A397S	.	A	+	1	0	MME	156343926	1.000000	0.71417	0.998000	0.56505	0.672000	0.39443	8.666000	0.91149	2.793000	0.96121	0.655000	0.94253	GCC		0.418	MME-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351076.1	NM_000902	Missense_Mutation	29	219	1	0	1.75e-13	2.47e-13	29	219				
IL12A	3592	broad.mit.edu	37	3	159711264	159711264	+	Silent	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:159711264G>A	ENST00000305579.2	+	4	712	c.405G>A	c.(403-405)gaG>gaA	p.E135E	IL12A_ENST00000480787.1_Silent_p.E97E|IL12A_ENST00000466512.1_Intron|IL12A-AS1_ENST00000497452.1_RNA	NM_000882.3	NP_000873.2	P29459	IL12A_HUMAN	interleukin 12A	101					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|defense response to Gram-positive bacterium (GO:0050830)|defense response to protozoan (GO:0042832)|extrinsic apoptotic signaling pathway (GO:0097191)|immune response (GO:0006955)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cell adhesion (GO:0045785)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of mononuclear cell proliferation (GO:0032946)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|positive regulation of NK T cell activation (GO:0051135)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat4 protein (GO:0042520)|response to lipopolysaccharide (GO:0032496)|response to UV-B (GO:0010224)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|interleukin-12 complex (GO:0043514)	interleukin-12 beta subunit binding (GO:0042163)|interleukin-12 receptor binding (GO:0005143)|interleukin-27 binding (GO:0045513)|protein heterodimerization activity (GO:0046982)			endometrium(3)|kidney(1)|large_intestine(1)|lung(4)	9			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			ATTCCAGAGAGACCTCTTTCA	0.313																																						uc003fcx.2		NA																	0					0						c.(403-405)GAG>GAA		interleukin 12A precursor							64.0	65.0	65.0					3																	159711264		2203	4300	6503	SO:0001819	synonymous_variant	3592				cell cycle arrest|cell migration|defense response to Gram-positive bacterium|immune response|negative regulation of interleukin-17 production|negative regulation of smooth muscle cell proliferation|positive regulation of cell adhesion|positive regulation of interferon-gamma production|positive regulation of natural killer cell activation|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target|positive regulation of NK T cell activation|positive regulation of smooth muscle cell apoptosis|positive regulation of T cell mediated cytotoxicity|positive regulation of tyrosine phosphorylation of Stat4 protein|response to lipopolysaccharide|response to UV-B|response to virus	interleukin-12 complex	cytokine activity|growth factor activity|interleukin-12 receptor binding|interleukin-27 binding|protein heterodimerization activity	g.chr3:159711264G>A	M65271	CCDS3187.1	3q25.33	2014-04-04	2014-04-04		ENSG00000168811	ENSG00000168811		"""Interleukins and interleukin receptors"""	5969	protein-coding gene	gene with protein product	"""natural killer cell stimulatory factor 1, 35 kD subunit"", ""cytotoxic lymphocyte maturation factor 1, p35"", ""interleukin 12, p35"", ""IL-12, subunit p35"", ""NF cell stimulatory factor chain 1"", ""interleukin-12 alpha chain"", ""IL35 subunit"""	161560	"""interleukin 12A (natural killer cell stimulatory factor 1, cytotoxic lymphocyte maturation factor 1, p35)"""	NKSF1		1673147	Standard	NM_000882		Approved	CLMF, IL-12A, p35, NFSK	uc003fcx.3	P29459	OTTHUMG00000158942	ENST00000305579.2:c.405G>A	3.37:g.159711264G>A			Somatic				uc003fcw.1_Intron	p.E135E	NM_000882	NP_000873	WXS	Illumina HiSeq	Unspecified	P29459	IL12A_HUMAN	Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)		4	620	+			101					Q96QZ1	Silent	SNP	ENST00000305579.2	37	c.405G>A	CCDS3187.1																																																																																				0.313	IL12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352602.2	NM_000882		10	100	0	0	0	0	10	100				
IFT80	57560	broad.mit.edu	37	3	160037641	160037641	+	Silent	SNP	A	A	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:160037641A>G	ENST00000326448.7	-	9	1296	c.864T>C	c.(862-864)tgT>tgC	p.C288C	IFT80_ENST00000483465.1_Silent_p.C151C|IFT80_ENST00000496589.1_Silent_p.C151C|RP11-432B6.3_ENST00000483754.1_Silent_p.C459C	NM_020800.2	NP_065851.1	Q9P2H3	IFT80_HUMAN	intraflagellar transport 80	288					bone morphogenesis (GO:0060349)|chondrocyte differentiation (GO:0002062)|cilium assembly (GO:0042384)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|osteoblast differentiation (GO:0001649)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)				NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(12)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	36			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			GTCCATTTCCACAGGCTCCAG	0.408																																						uc011boy.1		NA																	0				ovary(1)	1						c.(862-864)TGT>TGC		WD repeat domain 56							117.0	114.0	115.0					3																	160037641		2203	4300	6503	SO:0001819	synonymous_variant	57560					cilium axoneme|microtubule basal body		g.chr3:160037641A>G	AB037795	CCDS3188.1, CCDS54668.1	3q25.33	2014-07-03	2014-07-03	2005-11-02	ENSG00000068885	ENSG00000068885		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29262	protein-coding gene	gene with protein product		611177	"""WD repeat domain 56"", ""intraflagellar transport 80 homolog (Chlamydomonas)"""	WDR56		10718198	Standard	NM_020800		Approved	KIAA1374	uc021xgq.1	Q9P2H3	OTTHUMG00000158953	ENST00000326448.7:c.864T>C	3.37:g.160037641A>G			Somatic				IFT80_uc003fda.2_RNA|IFT80_uc003fdb.1_Silent_p.C151C|IFT80_uc003fdd.1_5'UTR|IFT80_uc003fde.1_Silent_p.C151C	p.C288C	NM_020800	NP_065851	WXS	Illumina HiSeq	Unspecified	Q9P2H3	IFT80_HUMAN	Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)		9	1297	-			288			WD 6.		B4E0K1|C9J8I0|Q3MJC4|Q86YF4|Q9UIX1	Silent	SNP	ENST00000326448.7	37	c.864T>C	CCDS3188.1																																																																																				0.408	IFT80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352651.2	NM_020800		45	145	0	0	0	0	45	145				
SLITRK3	22865	broad.mit.edu	37	3	164906635	164906635	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:164906635C>A	ENST00000475390.1	-	2	2427	c.1984G>T	c.(1984-1986)Gtt>Ttt	p.V662F	SLITRK3_ENST00000241274.3_Missense_Mutation_p.V662F			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	662					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						AAAAACAGAACCAGCAGGCTG	0.527										HNSCC(40;0.11)																												uc003fej.3		NA																	0				ovary(6)|skin(3)|pancreas(1)	10						c.(1984-1986)GTT>TTT		slit and trk like 3 protein precursor							44.0	46.0	45.0					3																	164906635		2203	4300	6503	SO:0001583	missense	22865					integral to membrane		g.chr3:164906635C>A	AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.1984G>T	3.37:g.164906635C>A	ENSP00000420091:p.Val662Phe	HNSCC(40;0.11)	Somatic				SLITRK3_uc003fek.2_Missense_Mutation_p.V662F	p.V662F	NM_014926	NP_055741	WXS	Illumina HiSeq	Unspecified	O94933	SLIK3_HUMAN			2	2428	-			662			Helical; (Potential).		Q1RMY6	Missense_Mutation	SNP	ENST00000475390.1	37	c.1984G>T	CCDS3197.1	.	.	.	.	.	.	.	.	.	.	C	17.24	3.338474	0.60963	.	.	ENSG00000121871	ENST00000475390;ENST00000241274	T;T	0.60672	0.17;0.17	4.85	4.85	0.62838	.	0.000000	0.34268	N	0.004103	T	0.56963	0.2021	L	0.55990	1.75	0.45194	D	0.998205	P	0.48162	0.906	P	0.46585	0.521	T	0.61898	-0.6968	10	0.87932	D	0	-15.5087	10.7983	0.46474	0.0:0.9118:0.0:0.0882	.	662	O94933	SLIK3_HUMAN	F	662	ENSP00000420091:V662F;ENSP00000241274:V662F	ENSP00000241274:V662F	V	-	1	0	SLITRK3	166389329	0.439000	0.25610	1.000000	0.80357	0.609000	0.37215	0.723000	0.25939	2.654000	0.90174	0.655000	0.94253	GTT		0.527	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350126.1	NM_014926		15	52	1	0	1.36e-06	1.67e-06	15	52				
WDR49	151790	broad.mit.edu	37	3	167272580	167272580	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:167272580C>T	ENST00000308378.3	-	6	963	c.658G>A	c.(658-660)Gac>Aac	p.D220N	WDR49_ENST00000476376.1_Missense_Mutation_p.D45N|WDR49_ENST00000479765.1_Intron|WDR49_ENST00000453925.2_Missense_Mutation_p.D273N	NM_178824.3	NP_849146.1	Q8IV35	WDR49_HUMAN	WD repeat domain 49	220										breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	50						CCATTGAAGTCCCATATCTTT	0.323																																						uc003fev.1		NA																	0				large_intestine(1)|ovary(1)|skin(1)	3						c.(658-660)GAC>AAC		WD repeat domain 49							106.0	102.0	103.0					3																	167272580		2203	4299	6502	SO:0001583	missense	151790							g.chr3:167272580C>T	AK097556	CCDS3201.1	3q26.1	2013-01-11			ENSG00000174776	ENSG00000174776		"""WD repeat domain containing"""	26587	protein-coding gene	gene with protein product						12477932	Standard	NM_178824		Approved	FLJ33620	uc003fev.1	Q8IV35	OTTHUMG00000158290	ENST00000308378.3:c.658G>A	3.37:g.167272580C>T	ENSP00000311343:p.Asp220Asn		Somatic				WDR49_uc003feu.1_Missense_Mutation_p.D45N|WDR49_uc011bpd.1_Missense_Mutation_p.D273N|WDR49_uc003few.1_Intron	p.D220N	NM_178824	NP_849146	WXS	Illumina HiSeq	Unspecified	Q8IV35	WDR49_HUMAN			6	964	-			220			WD 4.		Q8N297	Missense_Mutation	SNP	ENST00000308378.3	37	c.658G>A	CCDS3201.1	.	.	.	.	.	.	.	.	.	.	C	10.06	1.246560	0.22796	.	.	ENSG00000174776	ENST00000308378;ENST00000476376;ENST00000453925;ENST00000466760	T;T;T;T	0.78003	1.01;-0.3;1.61;-1.14	5.36	4.48	0.54585	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.202889	0.50627	N	0.000115	T	0.78648	0.4316	L	0.39898	1.24	0.26530	N	0.974273	D;D	0.59767	0.981;0.986	P;P	0.56514	0.8;0.664	T	0.70425	-0.4875	10	0.23891	T	0.37	.	14.3324	0.66566	0.1499:0.8501:0.0:0.0	.	273;220	E7EQK3;Q8IV35	.;WDR49_HUMAN	N	220;45;273;113	ENSP00000311343:D220N;ENSP00000420508:D45N;ENSP00000410863:D273N;ENSP00000418718:D113N	ENSP00000311343:D220N	D	-	1	0	WDR49	168755274	1.000000	0.71417	1.000000	0.80357	0.692000	0.40212	5.453000	0.66645	1.253000	0.44018	-0.291000	0.09656	GAC		0.323	WDR49-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000350592.3	NM_178824		56	219	0	0	0	0	56	219				
SAMD7	344658	broad.mit.edu	37	3	169639112	169639112	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:169639112G>A	ENST00000428432.2	+	4	586	c.197G>A	c.(196-198)aGt>aAt	p.S66N	SAMD7_ENST00000335556.3_Missense_Mutation_p.S66N	NM_182610.2	NP_872416.1	Q7Z3H4	SAMD7_HUMAN	sterile alpha motif domain containing 7	66										NS(1)|biliary_tract(1)|breast(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	31	all_cancers(22;1.55e-22)|all_epithelial(15;2.41e-27)|all_lung(20;3.52e-17)|Lung NSC(18;1.44e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0106)			GTGTTGTCCAGTCGGATCTAC	0.438																																						uc003fgd.2		NA																	0				skin(1)	1						c.(196-198)AGT>AAT		sterile alpha motif domain containing 7							130.0	109.0	116.0					3																	169639112		2203	4300	6503	SO:0001583	missense	344658							g.chr3:169639112G>A	BX537903	CCDS3209.1	3q26.31	2013-01-10			ENSG00000187033	ENSG00000187033		"""Sterile alpha motif (SAM) domain containing"""	25394	protein-coding gene	gene with protein product							Standard	NM_182610		Approved	DKFZp686E1583	uc003fgd.3	Q7Z3H4	OTTHUMG00000158730	ENST00000428432.2:c.197G>A	3.37:g.169639112G>A	ENSP00000391299:p.Ser66Asn		Somatic				SAMD7_uc003fge.2_Missense_Mutation_p.S66N|SAMD7_uc011bpo.1_5'UTR	p.S66N	NM_182610	NP_872416	WXS	Illumina HiSeq	Unspecified	Q7Z3H4	SAMD7_HUMAN	Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0106)		4	464	+	all_cancers(22;1.55e-22)|all_epithelial(15;2.41e-27)|all_lung(20;3.52e-17)|Lung NSC(18;1.44e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		66						Missense_Mutation	SNP	ENST00000428432.2	37	c.197G>A	CCDS3209.1	.	.	.	.	.	.	.	.	.	.	g	0.023	-1.403503	0.01165	.	.	ENSG00000187033	ENST00000428432;ENST00000335556	T;T	0.37235	1.21;1.21	5.42	-8.55	0.00908	.	0.523741	0.21804	N	0.068861	T	0.08714	0.0216	N	0.01048	-1.04	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.07849	-1.0751	10	0.02654	T	1	-5.4032	16.4261	0.83815	0.4633:0.0:0.5367:0.0	.	66	Q7Z3H4	SAMD7_HUMAN	N	66	ENSP00000391299:S66N;ENSP00000334668:S66N	ENSP00000334668:S66N	S	+	2	0	SAMD7	171121806	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.442000	0.06871	-2.509000	0.00505	-3.205000	0.00054	AGT		0.438	SAMD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351959.1	NM_182610		35	185	0	0	0	0	35	185				
FNDC3B	64778	broad.mit.edu	37	3	172046816	172046816	+	Silent	SNP	G	G	T	rs372880783		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:172046816G>T	ENST00000336824.4	+	12	1428	c.1329G>T	c.(1327-1329)ccG>ccT	p.P443P	FNDC3B_ENST00000415807.2_Silent_p.P443P|FNDC3B_ENST00000416957.1_Silent_p.P443P	NM_001135095.1	NP_001128567.1	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	443	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell migration (GO:0016477)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast proliferation (GO:0048146)|substrate adhesion-dependent cell spreading (GO:0034446)|Type II pneumocyte differentiation (GO:0060510)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(26)|ovary(3)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	69	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		AGCTTTGTCCGGCAATGGGGT	0.473																																						uc003fhy.2		NA																	0				ovary(2)|breast(1)	3						c.(1327-1329)CCG>CCT		fibronectin type III domain containing 3B							140.0	133.0	135.0					3																	172046816		2203	4300	6503	SO:0001819	synonymous_variant	64778					endoplasmic reticulum|integral to membrane		g.chr3:172046816G>T	AF543840	CCDS3217.1	3q26.31	2013-11-06			ENSG00000075420	ENSG00000075420		"""Fibronectin type III domain containing"""	24670	protein-coding gene	gene with protein product		611909				15527760	Standard	NM_022763		Approved	FAD104, DKFZp762K137, FLJ23399, PRO4979, YVTM2421	uc003fhy.3	Q53EP0	OTTHUMG00000156761	ENST00000336824.4:c.1329G>T	3.37:g.172046816G>T			Somatic				FNDC3B_uc003fhz.3_Silent_p.P443P|FNDC3B_uc003fia.2_Silent_p.P374P	p.P443P	NM_022763	NP_073600	WXS	Illumina HiSeq	Unspecified	Q53EP0	FND3B_HUMAN	LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)	12	1501	+	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		443			Fibronectin type-III 2.		B2RB36|B3KXR8|D3DNQ7|Q5U5T8|Q6PIJ3|Q6UXG1|Q6UXZ5|Q8IXB2|Q8NBU7|Q96D78|Q9H5I7|Q9NSQ8	Silent	SNP	ENST00000336824.4	37	c.1329G>T	CCDS3217.1																																																																																				0.473	FNDC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345618.2	NM_022763		29	164	1	0	2.48e-08	3.22e-08	29	164				
PIK3CA	5290	broad.mit.edu	37	3	178948139	178948139	+	Missense_Mutation	SNP	T	T	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:178948139T>C	ENST00000263967.3	+	20	3068	c.2911T>C	c.(2911-2913)Tgc>Cgc	p.C971R		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	971	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)			NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AGCCCAAGAATGCACAAAGAC	0.343		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	uc003fjk.2		57		Dom	yes		3	3q26.3	5290	Mis	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			"""E, O"""			colorectal|gastric|gliobastoma|breast		0				breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553						c.(2911-2913)TGC>CGC		phosphoinositide-3-kinase, catalytic, alpha							74.0	73.0	73.0					3																	178948139		1812	4076	5888	SO:0001583	missense	5290				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	g.chr3:178948139T>C		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.2911T>C	3.37:g.178948139T>C	ENSP00000263967:p.Cys971Arg	HNSCC(19;0.045)|TSP Lung(28;0.18)	Somatic					p.C971R	NM_006218	NP_006209	WXS	Illumina HiSeq	Unspecified	P42336	PK3CA_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		20	3068	+	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		971			PI3K/PI4K.		Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	c.2911T>C	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	T	15.94	2.982396	0.53827	.	.	ENSG00000121879	ENST00000263967	T	0.75367	-0.93	4.99	4.99	0.66335	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.659654	0.14990	N	0.286740	T	0.56746	0.2006	N	0.08118	0	0.80722	D	1	B	0.28971	0.229	B	0.27887	0.084	T	0.55250	-0.8170	10	0.30854	T	0.27	-2.599	14.9656	0.71188	0.0:0.0:0.0:1.0	.	971	P42336	PK3CA_HUMAN	R	971	ENSP00000263967:C971R	ENSP00000263967:C971R	C	+	1	0	PIK3CA	180430833	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.568000	0.82369	1.990000	0.58119	0.477000	0.44152	TGC		0.343	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2			21	124	0	0	0	0	21	124				
TTC14	151613	broad.mit.edu	37	3	180321002	180321002	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:180321002G>T	ENST00000296015.4	+	3	509	c.377G>T	c.(376-378)gGt>gTt	p.G126V	TTC14_ENST00000412756.2_Missense_Mutation_p.G126V|TTC14_ENST00000382584.4_Missense_Mutation_p.G126V|RP11-496B10.3_ENST00000472596.1_lincRNA	NM_133462.3	NP_597719.1	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14	126	S1 motif. {ECO:0000255|PROSITE- ProRule:PRU00180}.						RNA binding (GO:0003723)			endometrium(3)|kidney(5)|large_intestine(9)|lung(24)|ovary(2)|pancreas(1)|skin(1)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			ATTGAGCGTGGTGATATAGTG	0.378																																						uc003fkk.2		NA																	0				ovary(1)	1						c.(376-378)GGT>GTT		tetratricopeptide repeat domain 14 isoform a							255.0	240.0	245.0					3																	180321002		2203	4300	6503	SO:0001583	missense	151613						RNA binding	g.chr3:180321002G>T	AB075860	CCDS3237.1, CCDS46963.1, CCDS75055.1	3q27.2	2013-01-10			ENSG00000163728	ENSG00000163728		"""Tetratricopeptide (TTC) repeat domain containing"""	24697	protein-coding gene	gene with protein product						11853319	Standard	NM_001042601		Approved	FLJ00166, KIAA1980	uc003fkk.3	Q96N46	OTTHUMG00000157859	ENST00000296015.4:c.377G>T	3.37:g.180321002G>T	ENSP00000296015:p.Gly126Val		Somatic				TTC14_uc003fkl.2_Missense_Mutation_p.G126V|TTC14_uc003fkm.2_Missense_Mutation_p.G126V	p.G126V	NM_133462	NP_597719	WXS	Illumina HiSeq	Unspecified	Q96N46	TTC14_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)		3	509	+	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		126			S1 motif.		G5E9X0|Q6UWJ7|Q8TF22	Missense_Mutation	SNP	ENST00000296015.4	37	c.377G>T	CCDS3237.1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.012347	0.93346	.	.	ENSG00000163728	ENST00000296015;ENST00000491380;ENST00000412756;ENST00000382584;ENST00000492617;ENST00000495660	T;T	0.71934	-0.6;-0.61	5.71	5.71	0.89125	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);RNA-binding domain, S1 (1);Ribosomal protein S1, RNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.87924	0.6300	M	0.90425	3.115	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.996;0.999	D	0.89641	0.3862	10	0.87932	D	0	-16.1152	19.8449	0.96704	0.0:0.0:1.0:0.0	.	126;126;126	Q96N46-2;G5E9X0;Q96N46	.;.;TTC14_HUMAN	V	126;126;126;126;26;26	ENSP00000296015:G126V;ENSP00000372027:G126V	ENSP00000296015:G126V	G	+	2	0	TTC14	181803696	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.213000	0.95133	2.680000	0.91292	0.655000	0.94253	GGT		0.378	TTC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349786.1	NM_133462		43	245	1	0	4.67e-22	7.03e-22	43	245				
B3GNT5	84002	broad.mit.edu	37	3	182987805	182987805	+	Silent	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:182987805C>T	ENST00000326505.3	+	2	749	c.219C>T	c.(217-219)taC>taT	p.Y73Y	B3GNT5_ENST00000460419.1_Silent_p.Y73Y|MCF2L2_ENST00000473233.1_Intron|MCF2L2_ENST00000328913.3_Intron|MCF2L2_ENST00000447025.2_Intron|B3GNT5_ENST00000465010.1_Silent_p.Y73Y	NM_032047.4	NP_114436.1	Q9BYG0	B3GN5_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5	73					cellular protein metabolic process (GO:0044267)|central nervous system development (GO:0007417)|glycolipid biosynthetic process (GO:0009247)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)	beta-galactosyl-N-acetylglucosaminylgalactosylglucosyl-ceramide beta-1,3-acetylglucosaminyltransferase activity (GO:0008457)|galactosyltransferase activity (GO:0008378)|lactosylceramide 1,3-N-acetyl-beta-D-glucosaminyltransferase activity (GO:0047256)|lipopolysaccharide N-acetylglucosaminyltransferase activity (GO:0008917)			endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	8	all_cancers(143;8.52e-13)|Ovarian(172;0.0355)		all cancers(12;4.52e-44)|Epithelial(37;8.82e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			GGCCTCGCTACCAATACTTGA	0.418																																						uc003flk.2		NA																	0				ovary(1)	1						c.(217-219)TAC>TAT		UDP-GlcNAc:betaGal							108.0	106.0	107.0					3																	182987805		2203	4300	6503	SO:0001819	synonymous_variant	84002				central nervous system development|glycolipid biosynthetic process|protein glycosylation	Golgi membrane|integral to membrane	beta-galactosyl-N-acetylglucosaminylgalactosylglucosyl-ceramide beta-1,3-acetylglucosaminyltransferase activity|galactosyltransferase activity	g.chr3:182987805C>T	AB045278	CCDS3244.1	3q28	2013-02-21			ENSG00000176597	ENSG00000176597	2.4.1.206	"""Beta 3-glycosyltransferases"""	15684	protein-coding gene	gene with protein product	"""lactosylceramide 1,3-N-acetyl-beta-D-glucosaminyltransferase"""	615333				11283017	Standard	XM_005247824		Approved	B3GN-T5, beta3Gn-T5	uc003flk.3	Q9BYG0	OTTHUMG00000158436	ENST00000326505.3:c.219C>T	3.37:g.182987805C>T			Somatic				MCF2L2_uc003fli.1_Intron|MCF2L2_uc003flj.1_Intron|MCF2L2_uc011bqr.1_Intron|B3GNT5_uc003fll.2_Silent_p.Y73Y|B3GNT5_uc003flm.2_Silent_p.Y73Y	p.Y73Y	NM_032047	NP_114436	WXS	Illumina HiSeq	Unspecified	Q9BYG0	B3GN5_HUMAN	all cancers(12;4.52e-44)|Epithelial(37;8.82e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)		2	749	+	all_cancers(143;8.52e-13)|Ovarian(172;0.0355)		73			Lumenal (Potential).		D3DNS5|Q59FE3|Q7L9Z5|Q8WWP9	Silent	SNP	ENST00000326505.3	37	c.219C>T	CCDS3244.1																																																																																				0.418	B3GNT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351009.1	NM_032047		39	159	0	0	0	0	39	159				
HTR3E	285242	broad.mit.edu	37	3	183824076	183824076	+	Silent	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:183824076C>A	ENST00000415389.2	+	8	1552	c.1086C>A	c.(1084-1086)ccC>ccA	p.P362P	HTR3E_ENST00000436361.2_Silent_p.P362P|HTR3E_ENST00000425359.2_Silent_p.P347P|HTR3E_ENST00000440596.2_Silent_p.P388P|HTR3E-AS1_ENST00000431427.1_RNA|HTR3E_ENST00000335304.2_Silent_p.P377P	NM_001256613.1|NM_198313.2	NP_001243542.1|NP_938055.1	A5X5Y0	5HT3E_HUMAN	5-hydroxytryptamine (serotonin) receptor 3E, ionotropic	362					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(20)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	40	all_cancers(143;1.46e-10)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)		Ergoloid mesylate(DB01049)	GATGCTGTCCCACTGCGCCCC	0.662																																					Melanoma(7;227 727 6634 44770)	uc010hxq.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(1084-1086)CCC>CCA		5-hydroxytryptamine receptor 3 subunit E							34.0	37.0	36.0					3																	183824076		2203	4300	6503	SO:0001819	synonymous_variant	285242					integral to membrane|plasma membrane|postsynaptic membrane	extracellular ligand-gated ion channel activity|receptor activity	g.chr3:183824076C>A	AY159813	CCDS3251.1, CCDS58868.1, CCDS58869.1, CCDS58870.1, CCDS58871.1	3q27	2012-05-22	2012-02-03		ENSG00000186038	ENSG00000186038		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	24005	protein-coding gene	gene with protein product		610123	"""5-hydroxytryptamine (serotonin) receptor 3, family member E"""			12801637, 15157181	Standard	NM_001256613		Approved		uc010hxr.3	A5X5Y0	OTTHUMG00000156857	ENST00000415389.2:c.1086C>A	3.37:g.183824076C>A			Somatic				HTR3E_uc003fml.3_Silent_p.P347P|HTR3E_uc003fmm.2_Silent_p.P377P|HTR3E_uc010hxr.2_Silent_p.P388P|HTR3E_uc003fmn.2_Silent_p.P362P	p.P362P	NM_182589	NP_872395	WXS	Illumina HiSeq	Unspecified	A5X5Y0	5HT3E_HUMAN	Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)		8	1552	+	all_cancers(143;1.46e-10)|Ovarian(172;0.0303)		362			Cytoplasmic (Potential).		A8IKD7|E9PGF1|Q495G1|Q495G3|Q6V706|Q6V707|Q7Z6B2	Silent	SNP	ENST00000415389.2	37	c.1086C>A	CCDS58868.1																																																																																				0.662	HTR3E-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346284.1	NM_182589		12	60	1	0	0.000978159	0.00108025	12	60				
TBCCD1	55171	broad.mit.edu	37	3	186272075	186272075	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:186272075C>A	ENST00000424280.1	-	6	1991	c.1512G>T	c.(1510-1512)tgG>tgT	p.W504C	TBCCD1_ENST00000479590.1_5'UTR|TBCCD1_ENST00000446782.1_Missense_Mutation_p.W408C|TBCCD1_ENST00000338733.5_Missense_Mutation_p.W504C	NM_001134415.1	NP_001127887.1	Q9NVR7	TBCC1_HUMAN	TBCC domain containing 1	504					cell morphogenesis (GO:0000902)|cytoskeleton organization (GO:0007010)|maintenance of centrosome location (GO:0051661)|maintenance of Golgi location (GO:0051684)|regulation of cell migration (GO:0030334)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|spindle pole centrosome (GO:0031616)				breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|skin(1)	17	all_cancers(143;3.75e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.3e-21)	GBM - Glioblastoma multiforme(93;0.0474)		CAGTTTTCTGCCAGATCTGTA	0.408																																						uc003fqg.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(1510-1512)TGG>TGT		TBCC domain containing 1							79.0	87.0	84.0					3																	186272075		2203	4300	6503	SO:0001583	missense	55171				cell morphogenesis|maintenance of centrosome location|maintenance of Golgi location|regulation of cell migration|regulation of cell shape	spindle pole centrosome	binding	g.chr3:186272075C>A	BC025748	CCDS3276.1, CCDS75061.1	3q27.3	2006-03-09			ENSG00000113838	ENSG00000113838			25546	protein-coding gene	gene with protein product						12477932	Standard	NM_001134415		Approved	FLJ10560	uc003fqg.3	Q9NVR7	OTTHUMG00000156613	ENST00000424280.1:c.1512G>T	3.37:g.186272075C>A	ENSP00000411253:p.Trp504Cys		Somatic				TBCCD1_uc011bry.1_Missense_Mutation_p.W504C|TBCCD1_uc003fqh.2_Missense_Mutation_p.W408C	p.W504C	NM_018138	NP_060608	WXS	Illumina HiSeq	Unspecified	Q9NVR7	TBCC1_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;4.3e-21)	GBM - Glioblastoma multiforme(93;0.0474)	6	1641	-	all_cancers(143;3.75e-12)|Ovarian(172;0.0339)		504					B3KW69|D3DNU6|G5E9J4	Missense_Mutation	SNP	ENST00000424280.1	37	c.1512G>T	CCDS3276.1	.	.	.	.	.	.	.	.	.	.	C	19.28	3.797599	0.70567	.	.	ENSG00000113838	ENST00000424280;ENST00000338733;ENST00000446782	D;D;D	0.84660	-1.87;-1.87;-1.88	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	D	0.92685	0.7675	M	0.80183	2.485	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.93243	0.6628	10	0.87932	D	0	-6.9065	17.3092	0.87204	0.0:1.0:0.0:0.0	.	408;504	G5E9J4;Q9NVR7	.;TBCC1_HUMAN	C	504;504;408	ENSP00000411253:W504C;ENSP00000341652:W504C;ENSP00000397091:W408C	ENSP00000341652:W504C	W	-	3	0	TBCCD1	187754769	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.484000	0.81180	2.686000	0.91538	0.552000	0.68991	TGG		0.408	TBCCD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344774.1	NM_018138		45	246	1	0	1.42e-22	2.14e-22	45	246				
ATP13A3	79572	broad.mit.edu	37	3	194149640	194149640	+	Missense_Mutation	SNP	T	T	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:194149640T>G	ENST00000439040.1	-	28	3672	c.2881A>C	c.(2881-2883)Agt>Cgt	p.S961R	ATP13A3_ENST00000256031.4_Missense_Mutation_p.S961R			Q9H7F0	AT133_HUMAN	ATPase type 13A3	961						integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	24	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)		CCTAGGTTACTTAAGATCTAC	0.294																																						uc003fty.3		NA																	0				ovary(1)	1						c.(2881-2883)AGT>CGT		ATPase type 13A3							52.0	48.0	49.0					3																	194149640		1802	4062	5864	SO:0001583	missense	79572				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding	g.chr3:194149640T>G	AJ306929	CCDS43187.1	3q29	2010-04-20			ENSG00000133657	ENSG00000133657		"""ATPases / P-type"""	24113	protein-coding gene	gene with protein product	"""ATPase family homolog up regulated in senescence cells"""	610232				11867234	Standard	NM_024524		Approved	AFURS1	uc003fty.4	Q9H7F0	OTTHUMG00000156034	ENST00000439040.1:c.2881A>C	3.37:g.194149640T>G	ENSP00000416508:p.Ser961Arg		Somatic					p.S961R	NM_024524	NP_078800	WXS	Illumina HiSeq	Unspecified	Q9H7F0	AT133_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)	27	3283	-	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	961			Helical; (Potential).		Q8NC11|Q96KS1	Missense_Mutation	SNP	ENST00000439040.1	37	c.2881A>C	CCDS43187.1	.	.	.	.	.	.	.	.	.	.	T	17.56	3.420804	0.62622	.	.	ENSG00000133657	ENST00000439040;ENST00000256031	D;D	0.90133	-2.62;-2.62	5.63	5.63	0.86233	.	0.092832	0.85682	D	0.000000	D	0.93625	0.7964	M	0.90650	3.135	0.58432	D	0.999998	B	0.33512	0.415	B	0.41723	0.365	D	0.93297	0.6673	10	0.46703	T	0.11	0.2858	15.3339	0.74234	0.0:0.0:0.0:1.0	.	961	Q9H7F0	AT133_HUMAN	R	961	ENSP00000416508:S961R;ENSP00000256031:S961R	ENSP00000256031:S961R	S	-	1	0	ATP13A3	195630929	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	4.778000	0.62368	2.279000	0.76181	0.533000	0.62120	AGT		0.294	ATP13A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342799.2	NM_024524		16	66	0	0	0	0	16	66				
TMEM44	93109	broad.mit.edu	37	3	194336360	194336360	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:194336360T>A	ENST00000392432.2	-	8	1196	c.991A>T	c.(991-993)Aga>Tga	p.R331*	TMEM44_ENST00000347147.4_Nonsense_Mutation_p.R284*|TMEM44_ENST00000273580.7_Nonsense_Mutation_p.R284*|TMEM44_ENST00000473092.1_Nonsense_Mutation_p.R284*|TMEM44_ENST00000381975.3_Nonsense_Mutation_p.R284*	NM_001166305.1	NP_001159777.1	Q2T9K0	TMM44_HUMAN	transmembrane protein 44	331						integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|urinary_tract(1)	8	all_cancers(143;1.41e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;9.06e-06)		GGGCTCTCTCTGGCTTCCTTG	0.478																																						uc010hzn.2		NA																	0					0						c.(991-993)AGA>TGA		transmembrane protein 44 isoform b							238.0	223.0	228.0					3																	194336360		2203	4300	6503	SO:0001587	stop_gained	93109					integral to membrane		g.chr3:194336360T>A	AL833026	CCDS3308.1, CCDS33921.1, CCDS3308.2, CCDS54698.1, CCDS54699.1	3q29	2005-08-16			ENSG00000145014	ENSG00000145014			25120	protein-coding gene	gene with protein product							Standard	NM_138399		Approved	DKFZp686O18124	uc010hzn.3	Q2T9K0	OTTHUMG00000156023	ENST00000392432.2:c.991A>T	3.37:g.194336360T>A	ENSP00000376227:p.Arg331*		Somatic				TMEM44_uc010hzm.2_Nonsense_Mutation_p.R16*|TMEM44_uc003fuc.2_Nonsense_Mutation_p.R16*|TMEM44_uc003fue.2_Nonsense_Mutation_p.R284*|TMEM44_uc003fud.2_Nonsense_Mutation_p.R284*|TMEM44_uc003fuf.2_Nonsense_Mutation_p.R284*|TMEM44_uc011bsv.1_Nonsense_Mutation_p.R284*|TMEM44_uc003fuh.1_RNA	p.R331*	NM_001011655	NP_001011655	WXS	Illumina HiSeq	Unspecified	Q2T9K0	TMM44_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;9.06e-06)	8	1160	-	all_cancers(143;1.41e-08)|Ovarian(172;0.0634)		331			Cytoplasmic (Potential).		A1L3V7|B7ZLZ5|B7ZLZ6|C9JJ62|E9PGA9|Q0P6F7|Q6ZT47|Q8IXR1|Q8N4G3	Nonsense_Mutation	SNP	ENST00000392432.2	37	c.991A>T	CCDS54699.1	.	.	.	.	.	.	.	.	.	.	T	36	5.949426	0.97134	.	.	ENSG00000145014	ENST00000392432;ENST00000273580;ENST00000432352;ENST00000347147;ENST00000381975;ENST00000473092;ENST00000452358;ENST00000429560	.	.	.	5.05	3.89	0.44902	.	0.397703	0.21441	N	0.074492	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.0077	7.7918	0.29125	0.0:0.0961:0.0:0.9039	.	.	.	.	X	331;284;42;284;284;284;117;16	.	ENSP00000273580:R284X	R	-	1	2	TMEM44	195817649	0.032000	0.19561	0.976000	0.42696	0.872000	0.50106	0.364000	0.20325	0.879000	0.35944	0.402000	0.26972	AGA		0.478	TMEM44-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000342750.1	NM_138399		104	390	0	0	0	0	104	390				
UBXN7	26043	broad.mit.edu	37	3	196129879	196129879	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:196129879C>T	ENST00000296328.4	-	3	307	c.233G>A	c.(232-234)cGt>cAt	p.R78H	RN7SL738P_ENST00000470264.2_RNA|UBXN7_ENST00000428095.1_Intron|UBXN7_ENST00000535858.1_De_novo_Start_OutOfFrame	NM_015562.1	NP_056377.1	O94888	UBXN7_HUMAN	UBX domain protein 7	78						Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|nucleus (GO:0005634)	transcription factor binding (GO:0008134)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)			NS(1)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	18						AATTGGGGCACGAACTTCTTC	0.318																																						uc003fwm.3		NA																	0				ovary(2)|pancreas(1)	3						c.(232-234)CGT>CAT		UBX domain containing 7							153.0	149.0	150.0					3																	196129879		1813	4068	5881	SO:0001583	missense	26043						protein binding	g.chr3:196129879C>T	AB018337	CCDS43191.1	3q29	2012-07-06	2008-07-25	2008-07-25	ENSG00000163960	ENSG00000163960		"""UBX domain containing"""	29119	protein-coding gene	gene with protein product			"""UBX domain containing 7"""	UBXD7		9872452, 22537386	Standard	NM_015562		Approved	KIAA0794	uc003fwm.4	O94888	OTTHUMG00000155639	ENST00000296328.4:c.233G>A	3.37:g.196129879C>T	ENSP00000296328:p.Arg78His		Somatic				UBXN7_uc003fwn.3_Translation_Start_Site|UBXN7_uc010iae.2_Intron|UBXN7_uc010iaf.2_Missense_Mutation_p.R78H	p.R78H	NM_015562	NP_056377	WXS	Illumina HiSeq	Unspecified	O94888	UBXN7_HUMAN			3	308	-			78					D3DXB3|Q6ZP77|Q86X20|Q8N327	Missense_Mutation	SNP	ENST00000296328.4	37	c.233G>A	CCDS43191.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.846443	0.91277	.	.	ENSG00000163960	ENST00000296328;ENST00000413584	.	.	.	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.80270	0.4592	M	0.80508	2.5	0.80722	D	1	D;D	0.89917	1.0;0.999	D;P	0.79784	0.993;0.664	T	0.80535	-0.1339	9	0.48119	T	0.1	-9.7749	17.4702	0.87643	0.0:1.0:0.0:0.0	.	45;78	C9JD50;O94888	.;UBXN7_HUMAN	H	78;45	.	ENSP00000296328:R78H	R	-	2	0	UBXN7	197614276	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.452000	0.73485	2.720000	0.93068	0.557000	0.71058	CGT		0.318	UBXN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340938.2	XM_087353		56	373	0	0	0	0	56	373				
IQCG	84223	broad.mit.edu	37	3	197665493	197665493	+	Silent	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:197665493C>T	ENST00000265239.6	-	5	865	c.441G>A	c.(439-441)caG>caA	p.Q147Q	IQCG_ENST00000480302.1_5'Flank|IQCG_ENST00000453254.1_Silent_p.Q147Q|IQCG_ENST00000455191.1_Silent_p.Q147Q	NM_032263.3	NP_115639.1	Q9H095	IQCG_HUMAN	IQ motif containing G	147						extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(3)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)		AGACAAGATCCTGCATTTTGT	0.433																																						uc003fyo.2		NA																	0					0						c.(439-441)CAG>CAA		IQ motif containing G							290.0	281.0	284.0					3																	197665493		2203	4300	6503	SO:0001819	synonymous_variant	84223							g.chr3:197665493C>T	AL136889	CCDS3331.1	3q29	2014-07-18			ENSG00000114473	ENSG00000114473			25251	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 9"""	612477				11230166, 23427265, 24362311	Standard	NM_032263		Approved	DKFZp434B227, DRC9, CFAP122	uc003fyo.3	Q9H095	OTTHUMG00000155408	ENST00000265239.6:c.441G>A	3.37:g.197665493C>T			Somatic				IQCG_uc003fyn.2_Silent_p.Q49Q|IQCG_uc003fyp.2_Silent_p.Q147Q|IQCG_uc003fyq.3_Silent_p.Q147Q	p.Q147Q	NM_001134435	NP_001127907	WXS	Illumina HiSeq	Unspecified	Q9H095	IQCG_HUMAN	Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)	4	587	-	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		147					Q9BST2|Q9HAG8	Silent	SNP	ENST00000265239.6	37	c.441G>A	CCDS3331.1																																																																																				0.433	IQCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339730.1	NM_032263		120	654	0	0	0	0	120	654				
ZNF595	152687	broad.mit.edu	37	4	59410	59410	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr4:59410G>T	ENST00000509152.2	+	2	276	c.91G>T	c.(91-93)Gat>Tat	p.D31Y	ZNF595_ENST00000339368.6_3'UTR|ZNF595_ENST00000526473.2_Missense_Mutation_p.D31Y			Q8IYB9	ZN595_HUMAN	zinc finger protein 595	31	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)	20		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		TTTGTATAGAGATGTGATGTT	0.423																																						uc003fzv.1		NA																	0					0						c.(91-93)GAT>TAT		zinc finger protein 595							381.0	414.0	403.0					4																	59410		2203	4300	6503	SO:0001583	missense	152687				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding	g.chr4:59410G>T	BX537887	CCDS75075.1, CCDS75076.1, CCDS75077.1	4p16.3	2013-01-08				ENSG00000272602		"""Zinc fingers, C2H2-type"", ""-"""	27196	protein-coding gene	gene with protein product						12477932	Standard	NM_182524		Approved	FLJ31740		Q8IYB9		ENST00000509152.2:c.91G>T	4.37:g.59410G>T	ENSP00000434858:p.Asp31Tyr		Somatic				ZNF595_uc003fzu.1_RNA|ZNF718_uc003fzt.3_Missense_Mutation_p.D31Y|ZNF595_uc010iay.1_RNA|ZNF595_uc011bus.1_5'UTR|ZNF595_uc011but.1_Intron	p.D31Y	NM_182524	NP_872330	WXS	Illumina HiSeq	Unspecified	Q7Z3I0	Q7Z3I0_HUMAN		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)	2	247	+		all_cancers(4;0.0738)|all_epithelial(65;0.139)	31						Missense_Mutation	SNP	ENST00000509152.2	37	c.91G>T		.	.	.	.	.	.	.	.	.	.	G	13.27	2.188305	0.38609	.	.	ENSG00000197701	ENST00000509152;ENST00000526473	T;T	0.02863	4.13;4.13	1.26	1.26	0.21427	Krueppel-associated box (8);	.	.	.	.	T	0.10937	0.0267	.	.	.	0.29179	N	0.87663	D;D	0.89917	1.0;1.0	D;D	0.97110	0.987;1.0	T	0.04065	-1.0980	8	0.87932	D	0	.	7.9738	0.30143	0.0:0.0:1.0:0.0	.	31;31	Q8IYB9;Q3SXZ3	ZN595_HUMAN;ZN718_HUMAN	Y	31	ENSP00000434858:D31Y;ENSP00000437878:D31Y	ENSP00000434858:D31Y	D	+	1	0	ZNF595	49410	0.848000	0.29623	0.118000	0.21660	0.063000	0.16089	1.590000	0.36654	0.655000	0.30866	0.484000	0.47621	GAT		0.423	ZNF595-004	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000357817.2	NM_182524		37	831	1	0	5.72e-15	8.18e-15	37	831				
ZFYVE28	57732	broad.mit.edu	37	4	2306180	2306180	+	Silent	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr4:2306180G>T	ENST00000290974.2	-	8	2226	c.1887C>A	c.(1885-1887)ccC>ccA	p.P629P	RP11-478C1.7_ENST00000510632.1_RNA|ZFYVE28_ENST00000511071.1_Silent_p.P599P|ZFYVE28_ENST00000515312.1_Silent_p.P559P	NM_020972.2	NP_066023.2	Q9HCC9	LST2_HUMAN	zinc finger, FYVE domain containing 28	629					negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	31						TGTCGGAAGTGGGGGCTTTGG	0.667																																						uc003gex.1		NA																	0				skin(2)|ovary(1)	3						c.(1885-1887)CCC>CCA		zinc finger, FYVE domain containing 28							65.0	72.0	69.0					4																	2306180		2203	4300	6503	SO:0001819	synonymous_variant	57732				negative regulation of epidermal growth factor receptor activity	cytosol|early endosome membrane	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding	g.chr4:2306180G>T	AK126692	CCDS33942.1, CCDS54708.1, CCDS54709.1, CCDS54710.1, CCDS54711.1, CCDS54712.1	4p16.3	2008-05-02			ENSG00000159733	ENSG00000159733		"""Zinc fingers, FYVE domain containing"""	29334	protein-coding gene	gene with protein product		614176				10997877	Standard	NM_020972		Approved	KIAA1643	uc003gex.2	Q9HCC9	OTTHUMG00000160292	ENST00000290974.2:c.1887C>A	4.37:g.2306180G>T			Somatic				ZFYVE28_uc011bvk.1_Silent_p.P559P|ZFYVE28_uc011bvl.1_Silent_p.P599P|ZFYVE28_uc003gew.1_Silent_p.P515P	p.P629P	NM_020972	NP_066023	WXS	Illumina HiSeq	Unspecified	Q9HCC9	LST2_HUMAN			8	2206	-			629					B2RP83|B3KX50|B7Z1Q7|B7Z2G9|B7Z2M2|B7ZB19|E9PB54|E9PB64|E9PG77|Q7Z6J3	Silent	SNP	ENST00000290974.2	37	c.1887C>A	CCDS33942.1																																																																																				0.667	ZFYVE28-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360078.1	XM_035371		36	71	1	0	6.05e-29	9.37e-29	36	71				
YIPF7	285525	broad.mit.edu	37	4	44626780	44626780	+	Missense_Mutation	SNP	C	C	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr4:44626780C>G	ENST00000332990.5	-	5	534	c.518G>C	c.(517-519)gGt>gCt	p.G173A	YIPF7_ENST00000415895.4_Missense_Mutation_p.G149A	NM_182592.2	NP_872398.2	Q8N8F6	YIPF7_HUMAN	Yip1 domain family, member 7	173						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(1)|large_intestine(1)|lung(9)|upper_aerodigestive_tract(1)	12						ATACACATAACCAAACTGAAC	0.478																																						uc010ifx.1		NA																	0					0						c.(517-519)GGT>GCT		Yip1 domain family, member 7							70.0	71.0	71.0					4																	44626780		2028	4192	6220	SO:0001583	missense	285525					endoplasmic reticulum membrane|integral to membrane		g.chr4:44626780C>G	AK096895	CCDS54766.1	4p13	2008-08-07			ENSG00000177752	ENSG00000177752		"""Yip1 domain family"""	26825	protein-coding gene	gene with protein product							Standard	NM_182592		Approved	FLJ39576, FinGER9	uc021xnx.1	Q8N8F6	OTTHUMG00000160467	ENST00000332990.5:c.518G>C	4.37:g.44626780C>G	ENSP00000332772:p.Gly173Ala		Somatic					p.G173A	NM_182592	NP_872398	WXS	Illumina HiSeq	Unspecified	Q8N8F6	YIPF7_HUMAN			5	535	-			173			Helical; (Potential).		Q3SY21|Q3SY22	Missense_Mutation	SNP	ENST00000332990.5	37	c.518G>C	CCDS54766.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.9|24.9	4.580617|4.580617	0.86645|0.86645	.|.	.|.	ENSG00000177752|ENSG00000177752	ENST00000332990|ENST00000415895	T|.	0.41758|.	0.99|.	5.1|5.1	5.1|5.1	0.69264|0.69264	Yip1 domain (1);|.	.|.	.|.	.|.	.|.	D|D	0.86611|0.86611	0.5974|0.5974	M|M	0.93462|0.93462	3.42|3.42	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.78314|.	0.991|.	D|D	0.89944|0.89944	0.4075|0.4075	9|5	0.40728|.	T|.	0.16|.	-20.6805|-20.6805	17.6932|17.6932	0.88275|0.88275	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	173|.	Q8N8F6|.	YIPF7_HUMAN|.	A|C	173|149	ENSP00000332772:G173A|.	ENSP00000332772:G173A|.	G|W	-|-	2|3	0|0	YIPF7|YIPF7	44321537|44321537	1.000000|1.000000	0.71417|0.71417	0.988000|0.988000	0.46212|0.46212	0.953000|0.953000	0.61014|0.61014	7.576000|7.576000	0.82467|0.82467	2.654000|2.654000	0.90174|0.90174	0.655000|0.655000	0.94253|0.94253	GGT|TGG		0.478	YIPF7-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_182592		4	3	0	0	0	0	4	3				
NFXL1	152518	broad.mit.edu	37	4	47877297	47877297	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr4:47877297C>T	ENST00000507489.1	-	18	2269	c.2093G>A	c.(2092-2094)tGc>tAc	p.C698Y	NFXL1_ENST00000381538.3_Missense_Mutation_p.C698Y	NM_001278624.1	NP_001265553.1	Q6ZNB6	NFXL1_HUMAN	nuclear transcription factor, X-box binding-like 1	698						integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(4)	27						ACAATGAAGGCATTCTGGGCC	0.428																																						uc010igh.2		NA																	0				ovary(1)|lung(1)|skin(1)	3						c.(2092-2094)TGC>TAC		nuclear transcription factor, X-box binding-like							74.0	60.0	65.0					4																	47877297		2203	4300	6503	SO:0001583	missense	152518					integral to membrane|nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr4:47877297C>T	AY134856	CCDS3478.2	4p12	2008-02-05			ENSG00000170448	ENSG00000170448			18726	protein-coding gene	gene with protein product	"""ovarian zinc finger protein"""						Standard	NM_152995		Approved	HOZFP	uc003gxp.3	Q6ZNB6	OTTHUMG00000128621	ENST00000507489.1:c.2093G>A	4.37:g.47877297C>T	ENSP00000422037:p.Cys698Tyr		Somatic				NFXL1_uc003gxo.2_Missense_Mutation_p.C23Y|NFXL1_uc003gxp.2_Missense_Mutation_p.C698Y|NFXL1_uc003gxq.3_RNA|NFXL1_uc010igi.2_Missense_Mutation_p.C698Y	p.C698Y	NM_152995	NP_694540	WXS	Illumina HiSeq	Unspecified	Q6ZNB6	NFXL1_HUMAN			18	2270	-			698			NF-X1-type 8.		B1Q2K1|Q86VG1|Q8WVH1	Missense_Mutation	SNP	ENST00000507489.1	37	c.2093G>A	CCDS3478.2	.	.	.	.	.	.	.	.	.	.	C	18.94	3.729900	0.69074	.	.	ENSG00000170448	ENST00000381538;ENST00000507489	T;T	0.57107	0.42;0.42	5.62	4.78	0.61160	.	0.000000	0.85682	D	0.000000	T	0.78304	0.4262	M	0.92970	3.365	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.83291	-0.0033	10	0.54805	T	0.06	-0.5572	14.6209	0.68584	0.0:0.9297:0.0:0.0703	.	698	Q6ZNB6	NFXL1_HUMAN	Y	698	ENSP00000370949:C698Y;ENSP00000422037:C698Y	ENSP00000370949:C698Y	C	-	2	0	NFXL1	47572054	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.223000	0.72257	1.378000	0.46305	0.484000	0.47621	TGC		0.428	NFXL1-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361636.1	NM_152995		12	75	0	0	0	0	12	75				
SPATA18	132671	broad.mit.edu	37	4	52917908	52917908	+	Missense_Mutation	SNP	C	C	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr4:52917908C>G	ENST00000295213.4	+	1	412	c.38C>G	c.(37-39)aCt>aGt	p.T13S	SPATA18_ENST00000419395.2_Missense_Mutation_p.T13S|SPATA18_ENST00000506829.1_3'UTR	NM_145263.2	NP_660306.1	Q8TC71	MIEAP_HUMAN	spermatogenesis associated 18	13					cellular response to DNA damage stimulus (GO:0006974)|mitochondrial protein catabolic process (GO:0035694)|mitochondrion degradation by induced vacuole formation (GO:0035695)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial outer membrane (GO:0005741)				breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(4;1.77e-13)|LUSC - Lung squamous cell carcinoma(32;0.00204)			TCAAACGAAACTTTACGAACG	0.567																																						uc003gzl.2		NA																	0				ovary(2)|skin(2)	4						c.(37-39)ACT>AGT		spermatogenesis associated 18 homolog							131.0	127.0	128.0					4																	52917908		2203	4300	6503	SO:0001583	missense	132671				mitochondrial protein catabolic process|mitochondrion degradation by induced vacuole formation|response to DNA damage stimulus	mitochondrial outer membrane	protein binding	g.chr4:52917908C>G	BC025396	CCDS3489.1, CCDS75124.1	4q11	2012-01-23	2012-01-23		ENSG00000163071	ENSG00000163071			29579	protein-coding gene	gene with protein product		612814	"""spermatogenesis associated 18 homolog (rat)"""			21300779	Standard	XR_245253		Approved	FLJ32906	uc003gzl.3	Q8TC71	OTTHUMG00000128698	ENST00000295213.4:c.38C>G	4.37:g.52917908C>G	ENSP00000295213:p.Thr13Ser		Somatic				SPATA18_uc010igl.1_RNA|SPATA18_uc011bzq.1_Missense_Mutation_p.T13S|SPATA18_uc003gzk.1_Missense_Mutation_p.T13S	p.T13S	NM_145263	NP_660306	WXS	Illumina HiSeq	Unspecified	Q8TC71	MIEAP_HUMAN	GBM - Glioblastoma multiforme(4;1.77e-13)|LUSC - Lung squamous cell carcinoma(32;0.00204)		1	316	+			13					B4E2R0|E5RLK1|Q8IY48|Q8N7D7	Missense_Mutation	SNP	ENST00000295213.4	37	c.38C>G	CCDS3489.1	.	.	.	.	.	.	.	.	.	.	C	0.831	-0.745132	0.03065	.	.	ENSG00000163071	ENST00000295213;ENST00000419395	T;T	0.26810	1.72;1.71	4.12	1.07	0.20283	.	1.372500	0.04541	N	0.388217	T	0.07098	0.0180	N	0.01297	-0.9	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.001	T	0.35895	-0.9770	10	0.02654	T	1	-0.0039	2.1724	0.03853	0.2024:0.4877:0.1968:0.1131	.	13;13;13	Q8TC71-2;Q8TC71;Q96M13	.;MIEAP_HUMAN;.	S	13	ENSP00000295213:T13S;ENSP00000415309:T13S	ENSP00000295213:T13S	T	+	2	0	SPATA18	52612665	0.006000	0.16342	0.001000	0.08648	0.117000	0.20001	0.150000	0.16263	0.450000	0.26774	0.491000	0.48974	ACT		0.567	SPATA18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250597.2	NM_145263		40	236	0	0	0	0	40	236				
KDR	3791	broad.mit.edu	37	4	55968085	55968085	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr4:55968085C>T	ENST00000263923.4	-	15	2540	c.2245G>A	c.(2245-2247)Gag>Aag	p.E749K		NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	749	Ig-like C2-type 7.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	AAAAATGCCTCCACTTTTGCA	0.468			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																												uc003has.2		NA		Dom	yes		4	4q11-q12	3791	Mis	vascular endothelial growth factor receptor 2			E			NSCLC|angiosarcoma		0				lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33						c.(2245-2247)GAG>AAG		kinase insert domain receptor precursor	Sorafenib(DB00398)|Sunitinib(DB01268)						92.0	90.0	91.0					4																	55968085		2203	4300	6503	SO:0001583	missense	3791	Familial_Infantile_Hemangioma			angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity	g.chr4:55968085C>T	AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.2245G>A	4.37:g.55968085C>T	ENSP00000263923:p.Glu749Lys	TSP Lung(20;0.16)	Somatic				KDR_uc003hat.1_Missense_Mutation_p.E749K	p.E749K	NM_002253	NP_002244	WXS	Illumina HiSeq	Unspecified	P35968	VGFR2_HUMAN	Epithelial(7;0.189)		15	2547	-	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		749			Ig-like C2-type 7.|Extracellular (Potential).		A2RRS0|B5A925|C5IFA0|O60723|Q14178	Missense_Mutation	SNP	ENST00000263923.4	37	c.2245G>A	CCDS3497.1	.	.	.	.	.	.	.	.	.	.	C	14.90	2.673849	0.47781	.	.	ENSG00000128052	ENST00000263923	T	0.65732	-0.17	5.76	4.91	0.64330	Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	0.107851	0.64402	D	0.000006	T	0.53238	0.1784	N	0.22421	0.69	0.51767	D	0.999938	P	0.45044	0.849	B	0.43990	0.438	T	0.53330	-0.8454	10	0.35671	T	0.21	.	16.1676	0.81782	0.1345:0.8655:0.0:0.0	.	749	P35968	VGFR2_HUMAN	K	749	ENSP00000263923:E749K	ENSP00000263923:E749K	E	-	1	0	KDR	55662842	0.955000	0.32602	0.741000	0.31004	0.104000	0.19210	1.986000	0.40677	1.414000	0.47017	-0.188000	0.12872	GAG		0.468	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250645.1			77	80	0	0	0	0	77	80				
PROL1	58503	broad.mit.edu	37	4	71275727	71275727	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr4:71275727C>T	ENST00000399575.2	+	3	856	c.682C>T	c.(682-684)Caa>Taa	p.Q228*		NM_021225.4	NP_067048.4	Q99935	PROL1_HUMAN	proline rich, lacrimal 1	228	Thr-rich.				negative regulation of endopeptidase activity (GO:0010951)|regulation of sensory perception of pain (GO:0051930)|retina homeostasis (GO:0001895)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	endopeptidase inhibitor activity (GO:0004866)|peptidase inhibitor activity (GO:0030414)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(3)	15		all_hematologic(202;0.196)				GACTTCCAACCAAACTATATT	0.408																																						uc003hfi.2		NA																	0				large_intestine(1)	1						c.(682-684)CAA>TAA		proline rich, lacrimal 1							77.0	77.0	77.0					4																	71275727		1909	4123	6032	SO:0001587	stop_gained	58503				regulation of sensory perception of pain	extracellular region	endopeptidase inhibitor activity	g.chr4:71275727C>T	S83198	CCDS43235.1	4q13.3	2011-10-28	2005-02-07		ENSG00000171199	ENSG00000171199			17279	protein-coding gene	gene with protein product		608936	"""proline rich 1"""			8670737	Standard	NM_021225		Approved	BPLP, PRL1, opiorphin	uc003hfi.3	Q99935	OTTHUMG00000160845	ENST00000399575.2:c.682C>T	4.37:g.71275727C>T	ENSP00000382485:p.Gln228*		Somatic					p.Q228*	NM_021225	NP_067048	WXS	Illumina HiSeq	Unspecified	Q99935	PROL1_HUMAN			3	856	+		all_hematologic(202;0.196)	228			Thr-rich.		A8MZ07|P85047	Nonsense_Mutation	SNP	ENST00000399575.2	37	c.682C>T	CCDS43235.1	.	.	.	.	.	.	.	.	.	.	C	11.59	1.684085	0.29872	.	.	ENSG00000171199	ENST00000399575	.	.	.	2.65	0.224	0.15297	.	.	.	.	.	.	.	.	.	.	.	0.30737	N	0.746581	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	7.4809	0.27404	0.5974:0.4026:0.0:0.0	.	.	.	.	X	228	.	ENSP00000382485:Q228X	Q	+	1	0	PROL1	71310316	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.370000	0.20433	0.009000	0.14813	0.585000	0.79938	CAA		0.408	PROL1-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000362639.1	NM_021225		26	68	0	0	0	0	26	68				
ANKRD17	26057	broad.mit.edu	37	4	73968234	73968234	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr4:73968234C>T	ENST00000358602.4	-	25	4548	c.4432G>A	c.(4432-4434)Gct>Act	p.A1478T	ANKRD17_ENST00000509867.2_Missense_Mutation_p.A1365T|ANKRD17_ENST00000330838.6_Missense_Mutation_p.A1227T	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	1478					blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			cttttcGCAGCCAAAGCCAGC	0.348																																						uc003hgp.2		NA																	0				ovary(5)|skin(3)|upper_aerodigestive_tract(1)|lung(1)	10						c.(4432-4434)GCT>ACT		ankyrin repeat domain protein 17 isoform a							83.0	81.0	81.0					4																	73968234		2203	4300	6503	SO:0001583	missense	26057				interspecies interaction between organisms	cytoplasm|nucleus	RNA binding	g.chr4:73968234C>T	AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.4432G>A	4.37:g.73968234C>T	ENSP00000351416:p.Ala1478Thr		Somatic				ANKRD17_uc003hgo.2_Missense_Mutation_p.A1365T|ANKRD17_uc003hgq.2_Missense_Mutation_p.A1227T|ANKRD17_uc003hgr.2_Missense_Mutation_p.A1477T	p.A1478T	NM_032217	NP_115593	WXS	Illumina HiSeq	Unspecified	O75179	ANR17_HUMAN	Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)		25	4549	-	Breast(15;0.000295)		1478			Potential.		E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Missense_Mutation	SNP	ENST00000358602.4	37	c.4432G>A	CCDS34004.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.476136	0.84640	.	.	ENSG00000132466	ENST00000358602;ENST00000330838;ENST00000509867	T;T;T	0.70516	1.6;-0.46;-0.49	5.69	5.69	0.88448	.	0.401133	0.22301	N	0.061875	T	0.65302	0.2678	L	0.41492	1.28	0.51767	D	0.99993	P;P;P;P	0.44139	0.72;0.827;0.598;0.455	B;B;B;B	0.38500	0.275;0.275;0.142;0.099	T	0.69967	-0.5001	10	0.62326	D	0.03	.	18.7984	0.92005	0.0:1.0:0.0:0.0	.	1477;1227;1478;1365	O75179-2;G5E964;O75179;E7EUV3	.;.;ANR17_HUMAN;.	T	1478;1227;1365	ENSP00000351416:A1478T;ENSP00000332265:A1227T;ENSP00000427151:A1365T	ENSP00000332265:A1227T	A	-	1	0	ANKRD17	74187098	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.999000	0.70665	2.682000	0.91365	0.585000	0.79938	GCT		0.348	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362475.1	NM_032217		11	41	0	0	0	0	11	41				
NUP54	53371	broad.mit.edu	37	4	77053715	77053715	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr4:77053715G>T	ENST00000264883.3	-	6	1008	c.868C>A	c.(868-870)Cct>Act	p.P290T	NUP54_ENST00000458189.2_Missense_Mutation_p.P110T|NUP54_ENST00000342467.6_Missense_Mutation_p.P110T|NUP54_ENST00000514987.1_Missense_Mutation_p.P242T|NUP54_ENST00000515460.1_5'Flank	NM_017426.2	NP_059122.2	Q7Z3B4	NUP54_HUMAN	nucleoporin 54kDa	290	9 X 2 AA repeats of F-G.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein targeting (GO:0006605)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)	nucleocytoplasmic transporter activity (GO:0005487)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(3)|skin(1)|stomach(1)	19						ATCTGTGCAGGAGAAAGTTCT	0.383																																						uc003hjs.2		NA																	0				ovary(1)|lung(1)	2						c.(868-870)CCT>ACT		nucleoporin 54kDa							213.0	211.0	212.0					4																	77053715		2203	4300	6503	SO:0001583	missense	53371				carbohydrate metabolic process|glucose transport|mRNA transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleoplasm		g.chr4:77053715G>T	AF157322	CCDS3576.1, CCDS63998.1	4q21.1	2008-07-03	2002-08-29		ENSG00000138750	ENSG00000138750			17359	protein-coding gene	gene with protein product		607607	"""nucleoporin 54kD"""			8707840	Standard	NM_017426		Approved		uc003hjs.3	Q7Z3B4	OTTHUMG00000130098	ENST00000264883.3:c.868C>A	4.37:g.77053715G>T	ENSP00000264883:p.Pro290Thr		Somatic				NUP54_uc010ije.2_Missense_Mutation_p.P8T|NUP54_uc011cbs.1_Missense_Mutation_p.P110T|NUP54_uc011cbt.1_Missense_Mutation_p.P242T|NUP54_uc003hjt.2_Missense_Mutation_p.P110T	p.P290T	NM_017426	NP_059122	WXS	Illumina HiSeq	Unspecified	Q7Z3B4	NUP54_HUMAN			6	996	-			290			9 X 2 AA repeats of F-G.		B2RCK7|B4DT35|Q96EA7|Q9NVL5|Q9P0I1	Missense_Mutation	SNP	ENST00000264883.3	37	c.868C>A	CCDS3576.1	.	.	.	.	.	.	.	.	.	.	G	18.52	3.641112	0.67244	.	.	ENSG00000138750	ENST00000264883;ENST00000342467;ENST00000514987;ENST00000458189	.	.	.	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.64951	0.2645	M	0.76002	2.32	0.80722	D	1	P;P;P	0.38767	0.514;0.646;0.47	B;B;B	0.35353	0.14;0.201;0.096	T	0.70475	-0.4861	9	0.59425	D	0.04	-4.7982	19.3123	0.94195	0.0:0.0:1.0:0.0	.	242;110;290	B4DT35;Q7Z3B4-2;Q7Z3B4	.;.;NUP54_HUMAN	T	290;110;242;110	.	ENSP00000264883:P290T	P	-	1	0	NUP54	77272739	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.336000	0.96533	2.581000	0.87130	0.650000	0.86243	CCT		0.383	NUP54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252402.3			9	224	1	0	1.62e-10	2.19e-10	9	224				
CCDC158	339965	broad.mit.edu	37	4	77283402	77283402	+	Nonsense_Mutation	SNP	C	C	A	rs368420803		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr4:77283402C>A	ENST00000388914.3	-	12	2049	c.1897G>T	c.(1897-1899)Gaa>Taa	p.E633*		NM_001042784.1	NP_001036249.1	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	633										breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(1)	56						TTCACCTTTTCCAGCTCCAAG	0.408																																						uc003hkb.3		NA																	0				skin(3)|ovary(2)|pancreas(1)	6						c.(1897-1899)GAA>TAA		coiled-coil domain containing 158							168.0	166.0	166.0					4																	77283402		1962	4145	6107	SO:0001587	stop_gained	339965							g.chr4:77283402C>A	BC035224	CCDS43242.1	4q21.1	2009-04-06			ENSG00000163749	ENSG00000163749			26374	protein-coding gene	gene with protein product						12477932	Standard	NM_001042784		Approved	FLJ25770	uc003hkb.4	Q5M9N0	OTTHUMG00000160916	ENST00000388914.3:c.1897G>T	4.37:g.77283402C>A	ENSP00000373566:p.Glu633*		Somatic					p.E633*	NM_001042784	NP_001036249	WXS	Illumina HiSeq	Unspecified	Q5M9N0	CD158_HUMAN			12	2050	-			633			Potential.		Q8IYQ1|Q8N7D4|Q8N7E3	Nonsense_Mutation	SNP	ENST00000388914.3	37	c.1897G>T	CCDS43242.1	.	.	.	.	.	.	.	.	.	.	C	41	8.911860	0.99000	.	.	ENSG00000163749	ENST00000388914	.	.	.	5.74	5.74	0.90152	.	0.074313	0.51477	D	0.000083	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	17.7097	0.88318	0.0:1.0:0.0:0.0	.	.	.	.	X	633	.	ENSP00000373566:E633X	E	-	1	0	CCDC158	77502426	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.813000	0.62620	2.716000	0.92895	0.563000	0.77884	GAA		0.408	CCDC158-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362694.2	NM_001042784		7	239	1	0	0.00448238	0.00482833	7	239				
ANXA3	306	broad.mit.edu	37	4	79500196	79500196	+	Missense_Mutation	SNP	T	T	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr4:79500196T>C	ENST00000264908.6	+	4	498	c.119T>C	c.(118-120)aTg>aCg	p.M40T	ANXA3_ENST00000512884.1_Start_Codon_SNP_p.M1T|ANXA3_ENST00000503570.2_Start_Codon_SNP_p.M1T	NM_005139.2	NP_005130.1	P12429	ANXA3_HUMAN	annexin A3	40					defense response to bacterium (GO:0042742)|neutrophil degranulation (GO:0043312)|phagocytosis (GO:0006909)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|phospholipase A2 inhibitor activity (GO:0019834)			NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15						GATGAGAAAATGCTCATCAGC	0.368																																					GBM(2;126 157 27790 28920 42492)	uc003hld.2		NA																	0					0						c.(118-120)ATG>ACG		annexin A3							82.0	77.0	78.0					4																	79500196		2203	4300	6503	SO:0001583	missense	306				defense response to bacterium|neutrophil degranulation|phagocytosis|positive regulation of angiogenesis|positive regulation of endothelial cell migration|positive regulation of sequence-specific DNA binding transcription factor activity	phagocytic vesicle membrane|plasma membrane|specific granule	calcium ion binding|calcium-dependent phospholipid binding|phospholipase A2 inhibitor activity	g.chr4:79500196T>C	M63310	CCDS3584.1	4q21.21	2009-07-10			ENSG00000138772	ENSG00000138772	3.1.4.43	"""Annexins"""	541	protein-coding gene	gene with protein product		106490		ANX3		1830024	Standard	XM_005262973		Approved		uc003hld.3	P12429	OTTHUMG00000130198	ENST00000264908.6:c.119T>C	4.37:g.79500196T>C	ENSP00000264908:p.Met40Thr		Somatic				ANXA3_uc003hle.2_Missense_Mutation_p.M1T|ANXA3_uc010ijk.2_Missense_Mutation_p.M1T	p.M40T	NM_005139	NP_005130	WXS	Illumina HiSeq	Unspecified	P12429	ANXA3_HUMAN			4	429	+			40			Annexin 1.		B2R9W6|Q6LET2	Missense_Mutation	SNP	ENST00000264908.6	37	c.119T>C	CCDS3584.1	.	.	.	.	.	.	.	.	.	.	T	6.097	0.386086	0.11524	.	.	ENSG00000138772	ENST00000264908;ENST00000512884;ENST00000503570;ENST00000512373;ENST00000514171;ENST00000508214	T;T;T;T;T;T	0.09911	4.2;2.93;2.93;4.2;4.2;4.2	4.99	1.19	0.21007	Annexin repeat, conserved site (1);	0.494394	0.20898	N	0.083693	T	0.02304	0.0071	N	0.00403	-1.54	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44590	-0.9318	10	0.29301	T	0.29	.	5.4803	0.16719	0.1389:0.6212:0.0:0.24	.	40	P12429	ANXA3_HUMAN	T	40;1;1;40;40;40	ENSP00000264908:M40T;ENSP00000423068:M1T;ENSP00000421015:M1T;ENSP00000424584:M40T;ENSP00000421512:M40T;ENSP00000422281:M40T	ENSP00000264908:M40T	M	+	2	0	ANXA3	79719220	0.000000	0.05858	0.001000	0.08648	0.493000	0.33554	-0.154000	0.10130	0.003000	0.14656	-0.462000	0.05337	ATG		0.368	ANXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252516.3	NM_005139		17	30	0	0	0	0	17	30				
WDFY3	23001	broad.mit.edu	37	4	85600085	85600085	+	Silent	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr4:85600085G>A	ENST00000295888.4	-	65	10541	c.10134C>T	c.(10132-10134)agC>agT	p.S3378S	WDFY3_ENST00000322366.6_Silent_p.S3361S	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	3378	Interaction with ATG5.|Interaction with SQSTM1.				aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		GTTTCAATCTGCTGTAATTCC	0.517																																						uc003hpd.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(10132-10134)AGC>AGT		WD repeat and FYVE domain containing 3 isoform							68.0	76.0	73.0					4																	85600085		2203	4300	6503	SO:0001819	synonymous_variant	23001					cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding	g.chr4:85600085G>A	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.10134C>T	4.37:g.85600085G>A			Somatic				WDFY3_uc003hpc.2_Silent_p.S133S	p.S3378S	NM_014991	NP_055806	WXS	Illumina HiSeq	Unspecified	Q8IZQ1	WDFY3_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000808)	65	10542	-		Hepatocellular(203;0.114)	3378					Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Silent	SNP	ENST00000295888.4	37	c.10134C>T	CCDS3609.1																																																																																				0.517	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991		40	89	0	0	0	0	40	89				
DMP1	1758	broad.mit.edu	37	4	88583240	88583240	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr4:88583240G>A	ENST00000339673.6	+	6	409	c.310G>A	c.(310-312)Gac>Aac	p.D104N	RP11-742B18.1_ENST00000506814.1_RNA|RP11-742B18.1_ENST00000506480.1_RNA|RP11-742B18.1_ENST00000507894.1_RNA|DMP1_ENST00000282479.7_Missense_Mutation_p.D88N	NM_004407.3	NP_004398.1	Q13316	DMP1_HUMAN	dentin matrix acidic phosphoprotein 1	104					biomineral tissue development (GO:0031214)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|positive regulation of cell-substrate adhesion (GO:0010811)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|integrin binding (GO:0005178)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(1)|stomach(1)	32		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.227)		OV - Ovarian serous cystadenocarcinoma(123;0.000516)		TGATAAAGATGACGATGAAGA	0.502																																						uc003hqv.2		NA																	0				pancreas(1)|skin(1)	2						c.(310-312)GAC>AAC		dentin matrix acidic phosphoprotein 1 isoform 1							86.0	83.0	84.0					4																	88583240		2203	4300	6503	SO:0001583	missense	1758				biomineral tissue development|ossification	cytoplasm|nucleus|proteinaceous extracellular matrix	calcium ion binding|integrin binding	g.chr4:88583240G>A	U34037	CCDS3623.1, CCDS43249.1	4q21	2008-08-29	2008-08-29		ENSG00000152592	ENSG00000152592			2932	protein-coding gene	gene with protein product		600980	"""dentin matrix acidic phosphoprotein"""			8586437, 9177774	Standard	NM_001079911		Approved		uc003hqv.3	Q13316	OTTHUMG00000130598	ENST00000339673.6:c.310G>A	4.37:g.88583240G>A	ENSP00000340935:p.Asp104Asn		Somatic				DMP1_uc003hqw.2_Missense_Mutation_p.D88N	p.D104N	NM_004407	NP_004398	WXS	Illumina HiSeq	Unspecified	Q13316	DMP1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000516)	6	414	+		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.227)	104					A1L4L3|O43265	Missense_Mutation	SNP	ENST00000339673.6	37	c.310G>A	CCDS3623.1	.	.	.	.	.	.	.	.	.	.	G	13.80	2.345571	0.41498	.	.	ENSG00000152592	ENST00000339673;ENST00000282479	T;T	0.59364	0.27;0.27	5.24	4.4	0.53042	.	0.326222	0.26224	N	0.025616	T	0.68485	0.3006	L	0.54323	1.7	0.35088	D	0.764047	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.76512	-0.2932	10	0.72032	D	0.01	-8.3425	8.898	0.35476	0.172:0.0:0.828:0.0	.	88;104	Q13316-2;Q13316	.;DMP1_HUMAN	N	104;88	ENSP00000340935:D104N;ENSP00000282479:D88N	ENSP00000282479:D88N	D	+	1	0	DMP1	88802264	1.000000	0.71417	0.766000	0.31476	0.074000	0.17049	2.205000	0.42770	1.219000	0.43474	0.455000	0.32223	GAC		0.502	DMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253047.1			8	27	0	0	0	0	8	27				
CENPE	1062	broad.mit.edu	37	4	104062227	104062227	+	Missense_Mutation	SNP	A	A	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr4:104062227A>G	ENST00000265148.3	-	36	5587	c.5498T>C	c.(5497-5499)aTt>aCt	p.I1833T	CENPE_ENST00000380026.3_Missense_Mutation_p.I1808T	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	1833					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		TTTTAACGTAATAAGTTGATG	0.279																																						uc003hxb.1		NA																	0				ovary(5)|breast(4)	9						c.(5497-5499)ATT>ACT		centromere protein E							62.0	63.0	63.0					4																	104062227		2201	4294	6495	SO:0001583	missense	1062				blood coagulation|cell division|kinetochore assembly|microtubule-based movement|mitotic chromosome movement towards spindle pole|mitotic metaphase|mitotic metaphase plate congression|mitotic prometaphase|multicellular organismal development|positive regulation of protein kinase activity	condensed chromosome kinetochore|cytosol|microtubule|nucleus|spindle	ATP binding|kinetochore binding|microtubule motor activity	g.chr4:104062227A>G	Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.5498T>C	4.37:g.104062227A>G	ENSP00000265148:p.Ile1833Thr		Somatic				CENPE_uc003hxc.1_Missense_Mutation_p.I1808T|CENPE_uc003hxd.1_5'Flank	p.I1833T	NM_001813	NP_001804	WXS	Illumina HiSeq	Unspecified	Q02224	CENPE_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)	36	5588	-			1833			Potential.		A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	ENST00000265148.3	37	c.5498T>C	CCDS34042.1	.	.	.	.	.	.	.	.	.	.	A	6.225	0.409689	0.11812	.	.	ENSG00000138778	ENST00000265148;ENST00000394771;ENST00000380026	T;T	0.70749	-0.51;-0.51	4.74	2.17	0.27698	.	.	.	.	.	T	0.53334	0.1790	N	0.22421	0.69	0.09310	N	1	B;B	0.19583	0.037;0.009	B;B	0.17098	0.013;0.017	T	0.42103	-0.9471	9	0.44086	T	0.13	.	6.5419	0.22385	0.5458:0.3067:0.0:0.1475	.	1808;1833	Q02224-3;Q02224	.;CENPE_HUMAN	T	1833;1833;1808	ENSP00000265148:I1833T;ENSP00000369365:I1808T	ENSP00000265148:I1833T	I	-	2	0	CENPE	104281676	0.003000	0.15002	0.511000	0.27724	0.780000	0.44128	-0.053000	0.11846	0.240000	0.21263	-0.307000	0.09154	ATT		0.279	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				9	31	0	0	0	0	9	31				
ENPEP	2028	broad.mit.edu	37	4	111397696	111397696	+	Silent	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr4:111397696G>A	ENST00000265162.5	+	1	468	c.126G>A	c.(124-126)tcG>tcA	p.S42S		NM_001977.3	NP_001968.3	Q07075	AMPE_HUMAN	glutamyl aminopeptidase (aminopeptidase A)	42					angiogenesis (GO:0001525)|angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|glomerulus development (GO:0032835)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloaminopeptidase activity (GO:0070006)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(1)	54		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)		TGACCAGATCGTGTGACTCCA	0.612																																						uc003iab.3		NA																	0				skin(3)|ovary(1)|breast(1)	5						c.(124-126)TCG>TCA		glutamyl aminopeptidase	L-Glutamic Acid(DB00142)						181.0	170.0	174.0					4																	111397696		2203	4300	6503	SO:0001819	synonymous_variant	2028				cell migration|cell proliferation|cell-cell signaling|proteolysis	integral to plasma membrane	aminopeptidase activity|metalloexopeptidase activity|zinc ion binding	g.chr4:111397696G>A	L12468	CCDS3691.1	4q25	2008-02-05			ENSG00000138792	ENSG00000138792	3.4.11.7	"""CD molecules"""	3355	protein-coding gene	gene with protein product		138297				9268642	Standard	NM_001977		Approved	gp160, CD249	uc003iab.4	Q07075	OTTHUMG00000132546	ENST00000265162.5:c.126G>A	4.37:g.111397696G>A			Somatic					p.S42S	NM_001977	NP_001968	WXS	Illumina HiSeq	Unspecified	Q07075	AMPE_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.0031)	1	468	+		Hepatocellular(203;0.217)	42			Extracellular (Potential).		Q504U2	Silent	SNP	ENST00000265162.5	37	c.126G>A	CCDS3691.1																																																																																				0.612	ENPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255747.2			9	156	0	0	0	0	9	156				
PRDM5	11107	broad.mit.edu	37	4	121828688	121828688	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr4:121828688C>A	ENST00000264808.3	-	2	358	c.118G>T	c.(118-120)Gga>Tga	p.G40*	PRDM5_ENST00000394435.2_Nonsense_Mutation_p.G40*|PRDM5_ENST00000428209.2_Nonsense_Mutation_p.G40*|PRDM5_ENST00000515109.1_Nonsense_Mutation_p.G40*	NM_018699.2	NP_061169.2	Q9NQX1	PRDM5_HUMAN	PR domain containing 5	40	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|mitotic cell cycle (GO:0000278)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(17)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						CTCTTCTCTCCAGCAAAGGGT	0.328																																						uc003idn.2		NA																	0				central_nervous_system(1)|pancreas(1)	2						c.(118-120)GGA>TGA		PR domain containing 5							136.0	135.0	136.0					4																	121828688		2203	4300	6503	SO:0001587	stop_gained	11107				histone deacetylation|histone H3-K9 methylation|mitotic cell cycle|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	repressing transcription factor binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding	g.chr4:121828688C>A	AF272897	CCDS3716.1, CCDS75187.1, CCDS75188.1	4q25-q26	2013-01-08			ENSG00000138738	ENSG00000138738		"""Zinc fingers, C2H2-type"""	9349	protein-coding gene	gene with protein product		614161					Standard	XM_005262706		Approved	PFM2	uc003idn.3	Q9NQX1	OTTHUMG00000132970	ENST00000264808.3:c.118G>T	4.37:g.121828688C>A	ENSP00000264808:p.Gly40*		Somatic				PRDM5_uc003ido.2_Nonsense_Mutation_p.G40*|PRDM5_uc010ine.2_Nonsense_Mutation_p.G40*|PRDM5_uc010inf.2_Nonsense_Mutation_p.G40*|PRDM5_uc003idp.1_Nonsense_Mutation_p.G40*	p.G40*	NM_018699	NP_061169	WXS	Illumina HiSeq	Unspecified	Q9NQX1	PRDM5_HUMAN			2	368	-			40			SET.		Q0VAI9|Q0VAJ0|Q6NXQ7	Nonsense_Mutation	SNP	ENST00000264808.3	37	c.118G>T	CCDS3716.1	.	.	.	.	.	.	.	.	.	.	C	39	7.566154	0.98361	.	.	ENSG00000138738	ENST00000264808;ENST00000515109;ENST00000428209;ENST00000394435	.	.	.	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-16.5869	18.8497	0.92222	0.0:1.0:0.0:0.0	.	.	.	.	X	40	.	ENSP00000264808:G40X	G	-	1	0	PRDM5	122048138	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.734000	0.68580	2.746000	0.94184	0.655000	0.94253	GGA		0.328	PRDM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256528.2			45	114	1	0	3.51e-19	5.2e-19	45	114				
DCHS2	54798	broad.mit.edu	37	4	155226280	155226280	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr4:155226280G>T	ENST00000357232.4	-	16	3998	c.3999C>A	c.(3997-3999)gaC>gaA	p.D1333E		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1333	Cadherin 11. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		GAATTTCTCTGTCAAGTATGG	0.338																																						uc003inw.2		NA																	0				ovary(3)|pancreas(1)	4						c.(3997-3999)GAC>GAA		dachsous 2 isoform 1							43.0	43.0	43.0					4																	155226280		2203	4300	6503	SO:0001583	missense	54798				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:155226280G>T	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.3999C>A	4.37:g.155226280G>T	ENSP00000349768:p.Asp1333Glu		Somatic					p.D1333E	NM_017639	NP_060109	WXS	Illumina HiSeq	Unspecified	Q6V1P9	PCD23_HUMAN		LUSC - Lung squamous cell carcinoma(193;0.107)	16	3999	-	all_hematologic(180;0.208)	Renal(120;0.0854)	1333			Cadherin 11.		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	37	c.3999C>A	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.978489	0.74360	.	.	ENSG00000197410	ENST00000357232	T	0.63255	-0.03	6.03	4.32	0.51571	Cadherin (4);Cadherin-like (1);	0.000000	0.64402	D	0.000001	T	0.81384	0.4811	M	0.91561	3.22	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.83099	-0.0129	10	0.72032	D	0.01	.	10.1099	0.42557	0.2035:0.0:0.7965:0.0	.	1333	Q6V1P9	PCD23_HUMAN	E	1333	ENSP00000349768:D1333E	ENSP00000349768:D1333E	D	-	3	2	DCHS2	155445730	1.000000	0.71417	1.000000	0.80357	0.710000	0.40934	3.271000	0.51608	0.878000	0.35920	-0.150000	0.13652	GAC		0.338	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552		8	50	1	0	2.18e-05	2.57e-05	8	50				
TLL1	7092	broad.mit.edu	37	4	166910618	166910618	+	Silent	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr4:166910618C>A	ENST00000061240.2	+	2	902	c.255C>A	c.(253-255)ccC>ccA	p.P85P	TLL1_ENST00000507499.1_Silent_p.P85P|TLL1_ENST00000513213.1_Silent_p.P85P	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	85					cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		CGCAGAACCCCTTTGGAAACC	0.328																																						uc003irh.1		NA																	0				skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7						c.(253-255)CCC>CCA		tolloid-like 1 precursor							113.0	118.0	117.0					4																	166910618		2203	4300	6503	SO:0001819	synonymous_variant	7092				cell differentiation|proteolysis|skeletal system development	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding	g.chr4:166910618C>A	AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.255C>A	4.37:g.166910618C>A			Somatic				TLL1_uc011cjn.1_Silent_p.P85P|TLL1_uc011cjo.1_5'UTR	p.P85P	NM_012464	NP_036596	WXS	Illumina HiSeq	Unspecified	O43897	TLL1_HUMAN		GBM - Glioblastoma multiforme(119;0.103)	2	902	+	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)	85					B2RMU2|Q96AN3|Q9NQS4	Silent	SNP	ENST00000061240.2	37	c.255C>A	CCDS3811.1																																																																																				0.328	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363821.1			46	131	1	0	1.07e-20	1.61e-20	46	131				
GALNTL6	442117	broad.mit.edu	37	4	173269706	173269706	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr4:173269706C>A	ENST00000506823.1	+	5	1076	c.419C>A	c.(418-420)cCa>cAa	p.P140Q	GALNTL6_ENST00000457021.1_3'UTR|GALNTL6_ENST00000508122.1_Missense_Mutation_p.P123Q	NM_001034845.2	NP_001030017.2	Q49A17	GLTL6_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 6	140	Catalytic subdomain A.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(2)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	45						GAAAGGCTGCCAAACACCAGC	0.403																																						uc003isv.2		NA																	0				breast(2)|ovary(1)|skin(1)	4						c.(418-420)CCA>CAA		N-acetylgalactosaminyltransferase-like 6							139.0	131.0	134.0					4																	173269706		2203	4300	6503	SO:0001583	missense	442117					Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr4:173269706C>A		CCDS34104.1	4q34.1	2014-03-13	2014-03-13		ENSG00000174473	ENSG00000174473		"""Glycosyltransferase family 2 domain containing"""	33844	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 6"""	615138	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6"""				Standard	NM_001034845		Approved	GALNT17, GalNAc-T6L	uc003isv.3	Q49A17	OTTHUMG00000160807	ENST00000506823.1:c.419C>A	4.37:g.173269706C>A	ENSP00000423313:p.Pro140Gln		Somatic					p.P140Q	NM_001034845	NP_001030017	WXS	Illumina HiSeq	Unspecified	Q49A17	GLTL6_HUMAN			5	1155	+			140			Catalytic subdomain A.|Lumenal (Potential).		Q2L4S6	Missense_Mutation	SNP	ENST00000506823.1	37	c.419C>A	CCDS34104.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.658210	0.88154	.	.	ENSG00000174473	ENST00000506823;ENST00000404275;ENST00000508122	T;T	0.68479	-0.33;-0.33	5.23	5.23	0.72850	.	0.000000	0.33854	N	0.004484	D	0.85699	0.5757	M	0.90759	3.145	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88730	0.3236	10	0.87932	D	0	.	18.8064	0.92038	0.0:1.0:0.0:0.0	.	140	Q49A17	GLTL6_HUMAN	Q	140;140;123	ENSP00000423313:P140Q;ENSP00000423827:P123Q	ENSP00000385382:P140Q	P	+	2	0	GALNTL6	173506281	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.818000	0.86416	2.451000	0.82905	0.467000	0.42956	CCA		0.403	GALNTL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362395.1	NM_001034845		40	105	1	0	9.15e-12	1.26e-11	40	105				
LRP2BP	55805	broad.mit.edu	37	4	186295607	186295607	+	Silent	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr4:186295607C>T	ENST00000328559.7	-	4	1150	c.339G>A	c.(337-339)ggG>ggA	p.G113G	LRP2BP_ENST00000362004.3_Silent_p.G115G|LRP2BP_ENST00000505916.1_Silent_p.G113G|RP11-714G18.1_ENST00000514884.1_RNA|LRP2BP_ENST00000510776.1_Silent_p.G87G	NM_018409.3	NP_060879.2	Q9P2M1	LR2BP_HUMAN	LRP2 binding protein	113						cytoplasm (GO:0005737)				breast(1)|endometrium(2)|large_intestine(6)|lung(3)|prostate(1)|skin(2)	15		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;0.00109)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;2.14e-25)|Epithelial(43;1.55e-22)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-11)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.000132)|STAD - Stomach adenocarcinoma(60;0.000766)|Colorectal(24;0.00116)|LUSC - Lung squamous cell carcinoma(40;0.00904)|COAD - Colon adenocarcinoma(29;0.0101)|READ - Rectum adenocarcinoma(43;0.161)		TATAGTCCACCCCTTTCTCCT	0.393																																						uc003ixj.1		NA																	0					0						c.(337-339)GGG>GGA		LRP2 binding protein							101.0	101.0	101.0					4																	186295607		2203	4300	6503	SO:0001819	synonymous_variant	55805					cytoplasm	protein binding	g.chr4:186295607C>T	AB037746	CCDS3840.1	4q35.1	2011-05-03			ENSG00000109771	ENSG00000109771			25434	protein-coding gene	gene with protein product						10718198, 12508107	Standard	NM_018409		Approved	DKFZp761O0113	uc003ixj.2	Q9P2M1	OTTHUMG00000160460	ENST00000328559.7:c.339G>A	4.37:g.186295607C>T			Somatic				LRP2BP_uc003ixk.1_Silent_p.G87G|LRP2BP_uc011ckr.1_Silent_p.G113G	p.G113G	NM_018409	NP_060879	WXS	Illumina HiSeq	Unspecified	Q9P2M1	LR2BP_HUMAN		all cancers(43;2.14e-25)|Epithelial(43;1.55e-22)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-11)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.000132)|STAD - Stomach adenocarcinoma(60;0.000766)|Colorectal(24;0.00116)|LUSC - Lung squamous cell carcinoma(40;0.00904)|COAD - Colon adenocarcinoma(29;0.0101)|READ - Rectum adenocarcinoma(43;0.161)	4	1151	-		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;0.00109)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)	113			Sel1-like 1.		A6NJR7|A7E219|B3KX83|Q9NSN6	Silent	SNP	ENST00000328559.7	37	c.339G>A	CCDS3840.1																																																																																				0.393	LRP2BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360679.2	NM_018409		34	77	0	0	0	0	34	77				
IRX1	79192	broad.mit.edu	37	5	3600253	3600253	+	Silent	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr5:3600253C>T	ENST00000302006.3	+	2	1243	c.1191C>T	c.(1189-1191)ccC>ccT	p.P397P	CTD-2012M11.3_ENST00000559410.1_RNA	NM_024337.3	NP_077313.3	P78414	IRX1_HUMAN	iroquois homeobox 1	397					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			biliary_tract(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|pancreas(1)|prostate(5)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						TTGGCGCTCCCCACGCCGCGC	0.667																																						uc003jde.2		NA																	0				ovary(1)|pancreas(1)	2						c.(1189-1191)CCC>CCT		iroquois homeobox protein 1							47.0	46.0	47.0					5																	3600253		2202	4300	6502	SO:0001819	synonymous_variant	79192					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr5:3600253C>T	U90307	CCDS34132.1	5p15.33	2011-12-16	2007-07-13		ENSG00000170549	ENSG00000170549		"""Homeoboxes / TALE class"""	14358	protein-coding gene	gene with protein product		606197					Standard	NM_024337		Approved	IRX-5	uc003jde.3	P78414	OTTHUMG00000161632	ENST00000302006.3:c.1191C>T	5.37:g.3600253C>T			Somatic					p.P397P	NM_024337	NP_077313	WXS	Illumina HiSeq	Unspecified	P78414	IRX1_HUMAN			2	1243	+			397					Q7Z2F8|Q8N312	Silent	SNP	ENST00000302006.3	37	c.1191C>T	CCDS34132.1																																																																																				0.667	IRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365546.1	NM_024337		11	42	0	0	0	0	11	42				
ADCY2	108	broad.mit.edu	37	5	7709444	7709444	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr5:7709444G>T	ENST00000338316.4	+	10	1611	c.1522G>T	c.(1522-1524)Gca>Tca	p.A508S	RP11-711G10.1_ENST00000514105.2_RNA|ADCY2_ENST00000537121.1_Missense_Mutation_p.A328S	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	508					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						CAAGCCCTTTGCACACCTACA	0.602																																						uc003jdz.1		NA																	0				ovary(5)|pancreas(1)|skin(1)	7						c.(1522-1524)GCA>TCA		adenylate cyclase 2							97.0	73.0	81.0					5																	7709444		2203	4300	6503	SO:0001583	missense	108				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding	g.chr5:7709444G>T	AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.1522G>T	5.37:g.7709444G>T	ENSP00000342952:p.Ala508Ser		Somatic				ADCY2_uc011cmo.1_Missense_Mutation_p.A328S	p.A508S	NM_020546	NP_065433	WXS	Illumina HiSeq	Unspecified	Q08462	ADCY2_HUMAN			10	1589	+			508			Cytoplasmic (Potential).		B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	ENST00000338316.4	37	c.1522G>T	CCDS3872.2	.	.	.	.	.	.	.	.	.	.	g	24.7	4.561444	0.86335	.	.	ENSG00000078295	ENST00000338316;ENST00000541993;ENST00000537121	T;T	0.76448	-1.02;-1.02	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.82458	0.5041	L	0.55213	1.73	0.80722	D	1	P;B	0.35894	0.526;0.422	P;B	0.48921	0.595;0.394	T	0.77742	-0.2474	10	0.26408	T	0.33	.	19.6604	0.95864	0.0:0.0:1.0:0.0	.	328;508	B7Z2C1;Q08462	.;ADCY2_HUMAN	S	508;341;328	ENSP00000342952:A508S;ENSP00000444803:A328S	ENSP00000342952:A508S	A	+	1	0	ADCY2	7762444	1.000000	0.71417	0.937000	0.37676	0.998000	0.95712	9.554000	0.98121	2.644000	0.89710	0.558000	0.71614	GCA		0.602	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546		8	40	1	0	5.18e-06	6.28e-06	8	40				
ADCY2	108	broad.mit.edu	37	5	7826861	7826861	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr5:7826861G>T	ENST00000338316.4	+	25	3242	c.3153G>T	c.(3151-3153)caG>caT	p.Q1051H	ADCY2_ENST00000537121.1_Missense_Mutation_p.Q871H	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	1051					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						TCGTCCTGCAGACCCTCGGAT	0.493																																						uc003jdz.1		NA																	0				ovary(5)|pancreas(1)|skin(1)	7						c.(3151-3153)CAG>CAT		adenylate cyclase 2							107.0	95.0	99.0					5																	7826861		2203	4300	6503	SO:0001583	missense	108				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding	g.chr5:7826861G>T	AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.3153G>T	5.37:g.7826861G>T	ENSP00000342952:p.Gln1051His		Somatic				ADCY2_uc011cmo.1_Missense_Mutation_p.Q871H|ADCY2_uc010itm.1_Missense_Mutation_p.Q247H	p.Q1051H	NM_020546	NP_065433	WXS	Illumina HiSeq	Unspecified	Q08462	ADCY2_HUMAN			25	3220	+			1051			Cytoplasmic (Potential).		B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	ENST00000338316.4	37	c.3153G>T	CCDS3872.2	.	.	.	.	.	.	.	.	.	.	G	15.61	2.883463	0.51908	.	.	ENSG00000078295	ENST00000338316;ENST00000382532;ENST00000541993;ENST00000537121	T;T	0.81415	-1.49;-1.49	5.43	5.43	0.79202	Adenylyl cyclase class-3/4/guanylyl cyclase (4);	0.381500	0.27193	N	0.020489	T	0.82208	0.4987	L	0.52573	1.65	0.42968	D	0.994427	D;D	0.57571	0.98;0.98	P;P	0.57911	0.829;0.767	T	0.82963	-0.0196	10	0.62326	D	0.03	.	7.0757	0.25203	0.2074:0.0:0.7926:0.0	.	871;1051	B7Z2C1;Q08462	.;ADCY2_HUMAN	H	1051;163;884;871	ENSP00000342952:Q1051H;ENSP00000444803:Q871H	ENSP00000342952:Q1051H	Q	+	3	2	ADCY2	7879861	1.000000	0.71417	1.000000	0.80357	0.595000	0.36748	0.949000	0.29109	2.547000	0.85894	0.591000	0.81541	CAG		0.493	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546		23	105	1	0	4.54e-19	6.72e-19	23	105				
DNAH5	1767	broad.mit.edu	37	5	13692194	13692194	+	Silent	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr5:13692194G>T	ENST00000265104.4	-	79	13878	c.13774C>A	c.(13774-13776)Cga>Aga	p.R4592R		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	4592					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R4592*(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					AAGTCCGTTCGAACTGGCTTC	0.468									Kartagener syndrome																													uc003jfd.2		NA																	1	Substitution - Nonsense(1)		large_intestine(1)	ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31						c.(13774-13776)CGA>AGA		dynein, axonemal, heavy chain 5							108.0	99.0	102.0					5																	13692194		2203	4300	6503	SO:0001819	synonymous_variant	1767	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr5:13692194G>T	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.13774C>A	5.37:g.13692194G>T			Somatic				DNAH5_uc003jfc.2_Silent_p.R760R	p.R4592R	NM_001369	NP_001360	WXS	Illumina HiSeq	Unspecified	Q8TE73	DYH5_HUMAN			79	13816	-	Lung NSC(4;0.00476)		4592					Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	ENST00000265104.4	37	c.13774C>A	CCDS3882.1																																																																																				0.468	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		15	89	1	0	6.32e-08	8.1e-08	15	89				
DNAH5	1767	broad.mit.edu	37	5	13876810	13876810	+	Missense_Mutation	SNP	T	T	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr5:13876810T>A	ENST00000265104.4	-	22	3483	c.3379A>T	c.(3379-3381)Atc>Ttc	p.I1127F	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1127	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GTGGAGTTGATAATTGTGCTA	0.378									Kartagener syndrome																													uc003jfd.2		NA																	0				ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31						c.(3379-3381)ATC>TTC		dynein, axonemal, heavy chain 5							127.0	129.0	128.0					5																	13876810		2203	4300	6503	SO:0001583	missense	1767	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr5:13876810T>A	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.3379A>T	5.37:g.13876810T>A	ENSP00000265104:p.Ile1127Phe		Somatic					p.I1127F	NM_001369	NP_001360	WXS	Illumina HiSeq	Unspecified	Q8TE73	DYH5_HUMAN			22	3421	-	Lung NSC(4;0.00476)		1127			Stem (By similarity).		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	c.3379A>T	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	T	14.77	2.635840	0.47049	.	.	ENSG00000039139	ENST00000265104	T	0.26223	1.75	5.6	4.45	0.53987	.	0.000000	0.85682	D	0.000000	T	0.36880	0.0983	M	0.87269	2.87	0.80722	D	1	B	0.17667	0.023	B	0.25614	0.062	T	0.26395	-1.0104	10	0.54805	T	0.06	.	11.6725	0.51411	0.0:0.0694:0.0:0.9306	.	1127	Q8TE73	DYH5_HUMAN	F	1127	ENSP00000265104:I1127F	ENSP00000265104:I1127F	I	-	1	0	DNAH5	13929810	1.000000	0.71417	0.998000	0.56505	0.916000	0.54674	4.640000	0.61368	1.073000	0.40885	-0.250000	0.11733	ATC		0.378	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		17	82	0	0	0	0	17	82				
PRDM9	56979	broad.mit.edu	37	5	23524604	23524604	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr5:23524604G>T	ENST00000296682.3	+	10	1294	c.1112G>T	c.(1111-1113)aGc>aTc	p.S371I		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	371					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						AAGTGGGGCAGCAAGTGGAAG	0.468										HNSCC(3;0.000094)																												uc003jgo.2		NA																	0				ovary(3)|large_intestine(2)|pancreas(1)	6						c.(1111-1113)AGC>ATC		PR domain containing 9							94.0	98.0	97.0					5																	23524604		1892	4106	5998	SO:0001583	missense	56979				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding	g.chr5:23524604G>T	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.1112G>T	5.37:g.23524604G>T	ENSP00000296682:p.Ser371Ile	HNSCC(3;0.000094)	Somatic					p.S371I	NM_020227	NP_064612	WXS	Illumina HiSeq	Unspecified	Q9NQV7	PRDM9_HUMAN			10	1294	+			371					B4DX22|Q27Q50	Missense_Mutation	SNP	ENST00000296682.3	37	c.1112G>T	CCDS43307.1	.	.	.	.	.	.	.	.	.	.	G	12.70	2.016262	0.35606	.	.	ENSG00000164256	ENST00000296682;ENST00000253473	T	0.50277	0.75	3.7	3.7	0.42460	.	.	.	.	.	T	0.41050	0.1142	L	0.54323	1.7	0.28490	N	0.914517	P	0.50617	0.937	B	0.39706	0.307	T	0.34650	-0.9820	9	0.34782	T	0.22	-4.3976	11.1763	0.48601	0.0:0.0:1.0:0.0	.	371	Q9NQV7	PRDM9_HUMAN	I	371;165	ENSP00000296682:S371I	ENSP00000253473:S165I	S	+	2	0	PRDM9	23560361	0.004000	0.15560	1.000000	0.80357	0.218000	0.24690	1.042000	0.30303	2.080000	0.62538	0.597000	0.82753	AGC		0.468	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227		26	87	1	0	1.79e-09	2.38e-09	26	87				
PDZD2	23037	broad.mit.edu	37	5	32090710	32090710	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr5:32090710G>A	ENST00000438447.1	+	20	7544	c.7156G>A	c.(7156-7158)Ggt>Agt	p.G2386S	PDZD2_ENST00000282493.3_Missense_Mutation_p.G2386S			O15018	PDZD2_HUMAN	PDZ domain containing 2	2386					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						GGGCCACCCAGGTGACGCAGC	0.617																																						uc003jhl.2		NA																	0				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						c.(7156-7158)GGT>AGT		PDZ domain containing 2							46.0	48.0	48.0					5																	32090710		2203	4300	6503	SO:0001583	missense	23037				cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus		g.chr5:32090710G>A	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.7156G>A	5.37:g.32090710G>A	ENSP00000402033:p.Gly2386Ser		Somatic				PDZD2_uc003jhm.2_Missense_Mutation_p.G2386S	p.G2386S	NM_178140	NP_835260	WXS	Illumina HiSeq	Unspecified	O15018	PDZD2_HUMAN			20	7544	+			2386					Q9BXD4	Missense_Mutation	SNP	ENST00000438447.1	37	c.7156G>A	CCDS34137.1	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.743474	0.00675	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.04862	3.54;3.54	5.15	-3.15	0.05233	.	0.891913	0.09671	N	0.771047	T	0.01558	0.0050	N	0.00926	-1.1	0.09310	N	1	B	0.14438	0.01	B	0.06405	0.002	T	0.46076	-0.9217	10	0.02654	T	1	.	7.6833	0.28526	0.5412:0.1129:0.3459:0.0	.	2386	O15018	PDZD2_HUMAN	S	2386;2187;2386	ENSP00000402033:G2386S;ENSP00000282493:G2386S	ENSP00000282493:G2386S	G	+	1	0	PDZD2	32126467	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.033000	0.12246	-0.461000	0.06993	0.561000	0.74099	GGT		0.617	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1			14	52	0	0	0	0	14	52				
ADAMTS12	81792	broad.mit.edu	37	5	33534996	33534996	+	Missense_Mutation	SNP	G	G	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr5:33534996G>C	ENST00000504830.1	-	23	4883	c.4548C>G	c.(4546-4548)caC>caG	p.H1516Q	ADAMTS12_ENST00000352040.3_Missense_Mutation_p.H1431Q	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	1516	TSP type-1 8. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						GTCTGGGTTTGTGATCACATA	0.493										HNSCC(64;0.19)																												uc003jia.1		NA																	0				ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						c.(4546-4548)CAC>CAG		ADAM metallopeptidase with thrombospondin type 1							161.0	150.0	153.0					5																	33534996		2203	4300	6503	SO:0001583	missense	81792				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:33534996G>C	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.4548C>G	5.37:g.33534996G>C	ENSP00000422554:p.His1516Gln	HNSCC(64;0.19)	Somatic				ADAMTS12_uc010iuq.1_Missense_Mutation_p.H1431Q	p.H1516Q	NM_030955	NP_112217	WXS	Illumina HiSeq	Unspecified	P58397	ATS12_HUMAN			23	4711	-			1516			TSP type-1 8.		A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	37	c.4548C>G	CCDS34140.1	.	.	.	.	.	.	.	.	.	.	G	14.93	2.683698	0.47991	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.60424	0.19;0.19	5.13	-0.742	0.11108	.	0.379656	0.29362	N	0.012369	T	0.59088	0.2168	L	0.52823	1.66	0.53005	D	0.999967	D;D	0.59767	0.983;0.986	P;P	0.59288	0.773;0.855	T	0.54443	-0.8293	10	0.24483	T	0.36	.	8.1044	0.30877	0.5991:0.0:0.4009:0.0	.	1431;1516	P58397-3;P58397	.;ATS12_HUMAN	Q	1516;1431	ENSP00000422554:H1516Q;ENSP00000344847:H1431Q	ENSP00000344847:H1431Q	H	-	3	2	ADAMTS12	33570753	0.143000	0.22626	0.847000	0.33407	0.794000	0.44872	-0.198000	0.09505	-0.224000	0.09928	-0.440000	0.05779	CAC		0.493	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955		35	112	0	0	0	0	35	112				
ADAMTS12	81792	broad.mit.edu	37	5	33577237	33577237	+	Missense_Mutation	SNP	C	C	G	rs563669246		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr5:33577237C>G	ENST00000504830.1	-	19	3229	c.2894G>C	c.(2893-2895)cGg>cCg	p.R965P	ADAMTS12_ENST00000504582.1_5'UTR|ADAMTS12_ENST00000352040.3_Missense_Mutation_p.R880P	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	965	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R965Q(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						ACTGCGAATCCGCACTCCACC	0.493										HNSCC(64;0.19)																												uc003jia.1		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						c.(2893-2895)CGG>CCG		ADAM metallopeptidase with thrombospondin type 1							94.0	90.0	91.0					5																	33577237		2203	4300	6503	SO:0001583	missense	81792				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:33577237C>G	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.2894G>C	5.37:g.33577237C>G	ENSP00000422554:p.Arg965Pro	HNSCC(64;0.19)	Somatic				ADAMTS12_uc010iuq.1_Missense_Mutation_p.R880P	p.R965P	NM_030955	NP_112217	WXS	Illumina HiSeq	Unspecified	P58397	ATS12_HUMAN			19	3057	-			965			TSP type-1 4.		A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	37	c.2894G>C	CCDS34140.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.545153	0.86022	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.58060	0.36;0.36	5.28	5.28	0.74379	.	0.051693	0.64402	D	0.000001	T	0.79924	0.4530	M	0.92555	3.32	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.80764	0.994;0.992	D	0.84173	0.0435	10	0.66056	D	0.02	.	19.1111	0.93317	0.0:1.0:0.0:0.0	.	880;965	P58397-3;P58397	.;ATS12_HUMAN	P	965;880	ENSP00000422554:R965P;ENSP00000344847:R880P	ENSP00000344847:R880P	R	-	2	0	ADAMTS12	33612994	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.634000	0.61325	2.756000	0.94617	0.655000	0.94253	CGG		0.493	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955		30	118	0	0	0	0	30	118				
IL7R	3575	broad.mit.edu	37	5	35876247	35876247	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr5:35876247C>T	ENST00000303115.3	+	8	1168	c.1039C>T	c.(1039-1041)Ccc>Tcc	p.P347S	IL7R_ENST00000343305.4_3'UTR	NM_002185.3	NP_002176.2	P16871	IL7RA_HUMAN	interleukin 7 receptor	347					B cell proliferation (GO:0042100)|cell growth (GO:0016049)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|homeostasis of number of cells (GO:0048872)|immune response (GO:0006955)|immunoglobulin production (GO:0002377)|interleukin-7-mediated signaling pathway (GO:0038111)|lymph node development (GO:0048535)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|positive regulation of gene expression (GO:0010628)|positive regulation of T cell differentiation in thymus (GO:0033089)|regulation of cell size (GO:0008361)|regulation of DNA recombination (GO:0000018)|signal transduction (GO:0007165)|T cell differentiation (GO:0030217)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|interleukin-7 receptor activity (GO:0004917)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(78)|kidney(2)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|skin(5)|stomach(3)	126	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			TGTGCAGAGCCCCAACTGCCC	0.502			"""Mis, O"""		"""ALL, ETP ALL"""		Severe combined immune deficiency																															uc003jjs.2		NA		Dom	yes		5	5p13	146661		interleukin 7 receptor	yes		L					0				ovary(3)|breast(1)|skin(1)	5						c.(1039-1041)CCC>TCC		interleukin 7 receptor precursor							79.0	76.0	77.0					5																	35876247		2203	4300	6503	SO:0001583	missense	3575				immune response|regulation of DNA recombination	extracellular region|integral to membrane	antigen binding|interleukin-7 receptor activity	g.chr5:35876247C>T	M29696	CCDS3911.1	5p13	2014-09-17			ENSG00000168685	ENSG00000168685		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6024	protein-coding gene	gene with protein product		146661				2317865	Standard	NM_002185		Approved	CD127	uc003jjs.4	P16871	OTTHUMG00000090791	ENST00000303115.3:c.1039C>T	5.37:g.35876247C>T	ENSP00000306157:p.Pro347Ser		Somatic				IL7R_uc011cop.1_RNA	p.P347S	NM_002185	NP_002176	WXS	Illumina HiSeq	Unspecified	P16871	IL7RA_HUMAN	Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)		8	1128	+	all_lung(31;0.00015)		347			Cytoplasmic (Potential).		B2RCS6|B4DVT1|Q05CU8|Q6NSP4|Q6NWM0|Q6NWM1|Q6NWM2|Q6NWM3|Q6SV45|Q9UPC1	Missense_Mutation	SNP	ENST00000303115.3	37	c.1039C>T	CCDS3911.1	.	.	.	.	.	.	.	.	.	.	C	4.381	0.070324	0.08436	.	.	ENSG00000168685	ENST00000303115;ENST00000505875	T;T	0.30448	1.84;1.53	5.79	1.95	0.26073	.	1.181870	0.05897	N	0.629258	T	0.30070	0.0753	L	0.56769	1.78	0.09310	N	0.999999	B	0.24721	0.11	B	0.17098	0.017	T	0.27938	-1.0059	10	0.51188	T	0.08	-22.9052	5.7038	0.17897	0.0:0.6168:0.1441:0.2391	.	347	P16871	IL7RA_HUMAN	S	347;113	ENSP00000306157:P347S;ENSP00000420923:P113S	ENSP00000306157:P347S	P	+	1	0	IL7R	35912004	0.000000	0.05858	0.000000	0.03702	0.063000	0.16089	-0.190000	0.09615	0.060000	0.16281	0.655000	0.94253	CCC		0.502	IL7R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207577.2			17	52	0	0	0	0	17	52				
C9	735	broad.mit.edu	37	5	39308356	39308356	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr5:39308356C>T	ENST00000263408.4	-	8	1311	c.1216G>A	c.(1216-1218)Gta>Ata	p.V406I		NM_001737.3	NP_001728.1	P02748	CO9_HUMAN	complement component 9	406	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|hemolysis by symbiont of host erythrocytes (GO:0019836)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane attack complex (GO:0005579)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32	all_lung(31;0.000197)	all_neural(839;7.57e-10)|Lung NSC(810;2.62e-08)|Ovarian(839;0.00384)|Breast(839;0.0184)|Myeloproliferative disorder(839;0.0511)	Epithelial(62;0.158)			CCCCTCTTTACACAATCATCT	0.418																																						uc003jlv.3		NA																	0					0						c.(1216-1218)GTA>ATA		complement component 9 precursor							143.0	136.0	139.0					5																	39308356		2203	4300	6503	SO:0001583	missense	735				complement activation, alternative pathway|complement activation, classical pathway|cytolysis|hemolysis by symbiont of host erythrocytes	extracellular region|membrane attack complex		g.chr5:39308356C>T		CCDS3929.1	5p14-p12	2014-09-17			ENSG00000113600	ENSG00000113600		"""Complement system"""	1358	protein-coding gene	gene with protein product		120940					Standard	NM_001737		Approved		uc003jlv.4	P02748	OTTHUMG00000094767	ENST00000263408.4:c.1216G>A	5.37:g.39308356C>T	ENSP00000263408:p.Val406Ile		Somatic					p.V406I	NM_001737	NP_001728	WXS	Illumina HiSeq	Unspecified	P02748	CO9_HUMAN	Epithelial(62;0.158)		8	1305	-	all_lung(31;0.000197)	all_neural(839;7.57e-10)|Lung NSC(810;2.62e-08)|Ovarian(839;0.00384)|Breast(839;0.0184)|Myeloproliferative disorder(839;0.0511)	406			MACPF.			Missense_Mutation	SNP	ENST00000263408.4	37	c.1216G>A	CCDS3929.1	.	.	.	.	.	.	.	.	.	.	C	8.845	0.943293	0.18281	.	.	ENSG00000113600	ENST00000263408	D	0.84730	-1.89	4.73	-7.09	0.01553	Membrane attack complex component/perforin (MACPF) domain (3);	1.647450	0.03104	N	0.161560	T	0.60766	0.2294	N	0.01705	-0.755	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.54860	-0.8230	10	0.36615	T	0.2	-0.1049	4.7888	0.13238	0.2301:0.5013:0.071:0.1975	.	406	P02748	CO9_HUMAN	I	406	ENSP00000263408:V406I	ENSP00000263408:V406I	V	-	1	0	C9	39344113	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-0.197000	0.09518	-1.402000	0.02056	-1.522000	0.00932	GTA		0.418	C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211576.3			24	94	0	0	0	0	24	94				
C7	730	broad.mit.edu	37	5	40979897	40979897	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr5:40979897C>T	ENST00000313164.9	+	17	2595	c.2236C>T	c.(2236-2238)Cat>Tat	p.H746Y	C7_ENST00000494960.1_3'UTR	NM_000587.2	NP_000578.2	P10643	CO7_HUMAN	complement component 7	746	Factor I module (FIM) 1.				cellular sodium ion homeostasis (GO:0006883)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)		p.H746N(1)					Ovarian(839;0.0112)				TTGCAAGATGCATGTTCTCCA	0.453																																						uc003jmh.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2236-2238)CAT>TAT		complement component 7 precursor							82.0	83.0	83.0					5																	40979897		1977	4157	6134	SO:0001583	missense	730				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex		g.chr5:40979897C>T	J03507	CCDS47201.1	5p13.1	2014-09-17			ENSG00000112936	ENSG00000112936		"""Complement system"""	1346	protein-coding gene	gene with protein product		217070					Standard	NM_000587		Approved		uc003jmh.3	P10643	OTTHUMG00000150340	ENST00000313164.9:c.2236C>T	5.37:g.40979897C>T	ENSP00000322061:p.His746Tyr		Somatic				C7_uc011cpn.1_RNA	p.H746Y	NM_000587	NP_000578	WXS	Illumina HiSeq	Unspecified	P10643	CO7_HUMAN			17	2350	+		Ovarian(839;0.0112)	746			Complement control factor I module 1.		Q6P3T5|Q92489	Missense_Mutation	SNP	ENST00000313164.9	37	c.2236C>T	CCDS47201.1	.	.	.	.	.	.	.	.	.	.	C	18.75	3.690116	0.68271	.	.	ENSG00000112936	ENST00000313164	T	0.64260	-0.09	5.8	5.8	0.92144	Factor I / membrane attack complex (1);	0.476929	0.24081	N	0.041737	T	0.54902	0.1887	L	0.46885	1.475	0.36489	D	0.868319	B	0.34372	0.451	B	0.34138	0.176	T	0.58289	-0.7662	10	0.21540	T	0.41	-15.2479	14.2473	0.65997	0.0:0.9267:0.0:0.0733	.	746	P10643	CO7_HUMAN	Y	746	ENSP00000322061:H746Y	ENSP00000322061:H746Y	H	+	1	0	C7	41015654	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	0.946000	0.29069	2.745000	0.94114	0.563000	0.77884	CAT		0.453	C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317680.1			14	53	0	0	0	0	14	53				
MROH2B	133558	broad.mit.edu	37	5	41000408	41000408	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr5:41000408G>A	ENST00000399564.4	-	39	4846	c.4396C>T	c.(4396-4398)Cag>Tag	p.Q1466*	MROH2B_ENST00000506092.2_Nonsense_Mutation_p.Q1021*	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	1466																	TAGAGCTCCTGGAGGCCCAAA	0.488																																						uc003jmj.3		NA																	0				ovary(6)|central_nervous_system(2)	8						c.(4396-4398)CAG>TAG		HEAT repeat family member 7B2							61.0	60.0	60.0					5																	41000408		1885	4110	5995	SO:0001587	stop_gained	133558						binding	g.chr5:41000408G>A		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.4396C>T	5.37:g.41000408G>A	ENSP00000382476:p.Gln1466*		Somatic				HEATR7B2_uc003jmi.3_Nonsense_Mutation_p.Q1021*	p.Q1466*	NM_173489	NP_775760	WXS	Illumina HiSeq	Unspecified	Q7Z745	HTRB2_HUMAN			39	4886	-			1466					Q68DM1|Q7Z4U4|Q8N7X3	Nonsense_Mutation	SNP	ENST00000399564.4	37	c.4396C>T	CCDS47202.1	.	.	.	.	.	.	.	.	.	.	G	42	9.608849	0.99219	.	.	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	.	.	.	5.99	5.07	0.68467	.	0.105627	0.42548	D	0.000691	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	.	11.7069	0.51601	0.0:0.0:0.8241:0.1759	.	.	.	.	X	1021;1171;1466	.	ENSP00000296803:Q1171X	Q	-	1	0	HEATR7B2	41036165	1.000000	0.71417	0.992000	0.48379	0.529000	0.34654	2.883000	0.48554	2.840000	0.97914	0.655000	0.94253	CAG		0.488	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489		13	56	0	0	0	0	13	56				
GFM2	84340	broad.mit.edu	37	5	74017519	74017519	+	Silent	SNP	A	A	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr5:74017519A>G	ENST00000296805.3	-	21	2758	c.2301T>C	c.(2299-2301)gaT>gaC	p.D767D	GFM2_ENST00000509430.1_Silent_p.D767D|GFM2_ENST00000345239.2_Silent_p.D720D|GFM2_ENST00000515125.1_5'UTR	NM_032380.3	NP_115756.2			G elongation factor, mitochondrial 2											breast(2)|endometrium(2)|large_intestine(4)|lung(5)|prostate(1)	14		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Breast(144;0.231)		OV - Ovarian serous cystadenocarcinoma(47;1.86e-56)		GTGTATTTTGATCTTGAGGAT	0.383																																						uc003kdh.1		NA																	0					0						c.(2299-2301)GAT>GAC		mitochondrial elongation factor G2 isoform 1							91.0	92.0	92.0					5																	74017519		2203	4300	6503	SO:0001819	synonymous_variant	84340				mitochondrial translation|ribosome disassembly	mitochondrion	GTP binding|GTPase activity	g.chr5:74017519A>G	AF111808	CCDS4023.1, CCDS4024.1, CCDS47232.1	5q13	2008-02-05			ENSG00000164347	ENSG00000164347			29682	protein-coding gene	gene with protein product		606544				11735030	Standard	NM_001281302		Approved	EFG2, FLJ21661	uc003kdh.1	Q969S9	OTTHUMG00000102058	ENST00000296805.3:c.2301T>C	5.37:g.74017519A>G			Somatic				GFM2_uc003kdi.1_Silent_p.D720D|GFM2_uc010izj.1_Silent_p.D799D|GFM2_uc010izk.1_RNA	p.D767D	NM_032380	NP_115756	WXS	Illumina HiSeq	Unspecified	Q969S9	RRF2M_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;1.86e-56)	21	2605	-		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Breast(144;0.231)	767						Silent	SNP	ENST00000296805.3	37	c.2301T>C	CCDS4023.1																																																																																				0.383	GFM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219860.2	NM_032380		25	72	0	0	0	0	25	72				
IQGAP2	10788	broad.mit.edu	37	5	75906917	75906917	+	Missense_Mutation	SNP	T	T	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr5:75906917T>C	ENST00000274364.6	+	13	1727	c.1430T>C	c.(1429-1431)cTc>cCc	p.L477P	IQGAP2_ENST00000502745.1_Missense_Mutation_p.L30P|IQGAP2_ENST00000396234.3_Missense_Mutation_p.L30P|CTD-2236F14.1_ENST00000511327.1_RNA|IQGAP2_ENST00000379730.3_Missense_Mutation_p.L36P	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	477					negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		GAAACTTTGCTCCTACCTACT	0.408																																						uc003kek.2		NA																	0				ovary(6)|central_nervous_system(1)	7						c.(1429-1431)CTC>CCC		IQ motif containing GTPase activating protein 2							137.0	132.0	133.0					5																	75906917		2203	4300	6503	SO:0001583	missense	10788				small GTPase mediated signal transduction	actin cytoskeleton	actin binding|calmodulin binding|GTPase inhibitor activity|Ras GTPase activator activity	g.chr5:75906917T>C	U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.1430T>C	5.37:g.75906917T>C	ENSP00000274364:p.Leu477Pro		Somatic				IQGAP2_uc010izv.2_Missense_Mutation_p.L30P|IQGAP2_uc011csv.1_Missense_Mutation_p.L30P|IQGAP2_uc003kel.2_Missense_Mutation_p.L30P	p.L477P	NM_006633	NP_006624	WXS	Illumina HiSeq	Unspecified	Q13576	IQGA2_HUMAN		all cancers(79;1.38e-36)	13	1652	+		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)	477					A8K4V1|B7Z8A4|J3KR91	Missense_Mutation	SNP	ENST00000274364.6	37	c.1430T>C	CCDS34188.1	.	.	.	.	.	.	.	.	.	.	T	13.14	2.149555	0.37923	.	.	ENSG00000145703	ENST00000274364;ENST00000379730;ENST00000514350;ENST00000505766;ENST00000514001;ENST00000396234;ENST00000545384;ENST00000509074;ENST00000502745	T;T;T;T;T;T;T;T	0.06849	3.25;3.25;3.25;3.25;3.25;3.25;3.25;3.25	5.8	3.28	0.37604	.	0.298356	0.32819	N	0.005611	T	0.24509	0.0594	M	0.78637	2.42	0.80722	D	1	P;P;D;P	0.62365	0.919;0.956;0.991;0.956	P;P;D;P	0.67382	0.857;0.836;0.951;0.836	T	0.01666	-1.1300	10	0.30854	T	0.27	-2.5993	11.196	0.48713	0.2444:0.0:0.0:0.7556	.	36;427;30;477	F5H7S7;E7EWC2;Q13576-2;Q13576	.;.;.;IQGA2_HUMAN	P	477;36;450;427;30;30;30;30;30	ENSP00000274364:L477P;ENSP00000442313:L36P;ENSP00000423672:L450P;ENSP00000421097:L427P;ENSP00000422661:L30P;ENSP00000379535:L30P;ENSP00000425351:L30P;ENSP00000426027:L30P	ENSP00000274364:L477P	L	+	2	0	IQGAP2	75942673	0.976000	0.34144	0.037000	0.18230	0.043000	0.13939	4.442000	0.59988	0.991000	0.38814	0.477000	0.44152	CTC		0.408	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368877.1	NM_006633		41	86	0	0	0	0	41	86				
GPR98	84059	broad.mit.edu	37	5	89933675	89933675	+	Missense_Mutation	SNP	T	T	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr5:89933675T>C	ENST00000405460.2	+	11	2246	c.2150T>C	c.(2149-2151)tTa>tCa	p.L717S		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	717	Calx-beta 5. {ECO:0000305|PubMed:11606593}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GTTTTGTTTTTATCTGGGCAA	0.423																																						uc003kju.2		NA																	0				ovary(11)|central_nervous_system(3)|pancreas(2)	16						c.(2149-2151)TTA>TCA		G protein-coupled receptor 98 precursor							92.0	84.0	87.0					5																	89933675		1838	4088	5926	SO:0001583	missense	84059				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity	g.chr5:89933675T>C	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.2150T>C	5.37:g.89933675T>C	ENSP00000384582:p.Leu717Ser		Somatic				GPR98_uc003kjt.2_5'UTR	p.L717S	NM_032119	NP_115495	WXS	Illumina HiSeq	Unspecified	Q8WXG9	GPR98_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)	11	2246	+		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)	717			Calx-beta 5.|Extracellular (Potential).		O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	c.2150T>C	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.189426	0.78789	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043	T	0.27402	1.67	5.46	5.46	0.80206	.	0.066837	0.56097	D	0.000026	T	0.52191	0.1719	M	0.69823	2.125	0.80722	D	1	D	0.67145	0.996	P	0.61397	0.888	T	0.55604	-0.8115	10	0.59425	D	0.04	.	15.5338	0.75986	0.0:0.0:0.0:1.0	.	717	Q8WXG9	GPR98_HUMAN	S	717	ENSP00000384582:L717S	ENSP00000296619:L717S	L	+	2	0	GPR98	89969431	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.102000	0.71486	2.058000	0.61347	0.528000	0.53228	TTA		0.423	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119		29	52	0	0	0	0	29	52				
PAM	5066	broad.mit.edu	37	5	102286460	102286460	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr5:102286460G>T	ENST00000438793.3	+	11	1311	c.841G>T	c.(841-843)Ggt>Tgt	p.G281C	PAM_ENST00000379787.4_5'UTR|PAM_ENST00000346918.2_Missense_Mutation_p.G281C|PAM_ENST00000274392.9_Missense_Mutation_p.G184C|PAM_ENST00000348126.2_Missense_Mutation_p.G281C|PAM_ENST00000304400.7_Missense_Mutation_p.G281C|PAM_ENST00000455264.2_Missense_Mutation_p.G281C	NM_000919.3|NM_001177306.1|NM_138766.2	NP_000910.2|NP_001170777.1|NP_620121.1	P19021	AMD_HUMAN	peptidylglycine alpha-amidating monooxygenase	281	Peptidylglycine alpha-hydroxylating monooxygenase. {ECO:0000250}.				central nervous system development (GO:0007417)|heart development (GO:0007507)|lactation (GO:0007595)|limb development (GO:0060173)|long-chain fatty acid metabolic process (GO:0001676)|maternal process involved in female pregnancy (GO:0060135)|odontogenesis (GO:0042476)|ovulation cycle process (GO:0022602)|peptide amidation (GO:0001519)|protein amidation (GO:0018032)|protein homooligomerization (GO:0051260)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of protein secretion (GO:0050708)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to pH (GO:0009268)|toxin metabolic process (GO:0009404)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network (GO:0005802)	calcium ion binding (GO:0005509)|copper ion binding (GO:0005507)|L-ascorbic acid binding (GO:0031418)|peptidylamidoglycolate lyase activity (GO:0004598)|peptidylglycine monooxygenase activity (GO:0004504)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	25		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)	TGTAAGTTTTGGTGACCTACT	0.378																																						uc003knw.2		NA																	0					0						c.(841-843)GGT>TGT		peptidylglycine alpha-amidating monooxygenase	Vitamin C(DB00126)						152.0	149.0	150.0					5																	102286460		2203	4300	6503	SO:0001583	missense	5066				peptide metabolic process|protein modification process	extracellular region|integral to membrane|stored secretory granule	L-ascorbic acid binding|peptidylamidoglycolate lyase activity|peptidylglycine monooxygenase activity|protein binding	g.chr5:102286460G>T	AB095007	CCDS4092.1, CCDS4093.1, CCDS4094.1, CCDS43348.1, CCDS54885.1	5q	2008-02-05			ENSG00000145730	ENSG00000145730	1.14.17.3		8596	protein-coding gene	gene with protein product	"""peptidyl-alpha-hydroxyglycine alpha-amidating lyase"", ""peptidylglycine alpha-hydroxylating monooxygenase"""	170270				2357221	Standard	NM_000919		Approved	PAL, PHM	uc003knt.3	P19021	OTTHUMG00000128729	ENST00000438793.3:c.841G>T	5.37:g.102286460G>T	ENSP00000396493:p.Gly281Cys		Somatic				PAM_uc003kns.2_Missense_Mutation_p.G281C|PAM_uc003knt.2_Missense_Mutation_p.G281C|PAM_uc003knu.2_Missense_Mutation_p.G281C|PAM_uc003knv.2_Missense_Mutation_p.G281C|PAM_uc011cuz.1_Missense_Mutation_p.G184C	p.G281C	NM_000919	NP_000910	WXS	Illumina HiSeq	Unspecified	P19021	AMD_HUMAN		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	11	1214	+		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)	281			Peptidylglycine alpha-hydroxylating monooxygenase (By similarity).|Intragranular (Potential).		A6NMR0|A8K293|O43211|O95080|Q16252|Q16253|Q54A45|Q86U53|Q8WVC7|Q9UCG0	Missense_Mutation	SNP	ENST00000438793.3	37	c.841G>T	CCDS54885.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.5|24.5	4.541244|4.541244	0.85917|0.85917	.|.	.|.	ENSG00000145730|ENSG00000145730	ENST00000438793;ENST00000346918;ENST00000348126;ENST00000304400;ENST00000274392;ENST00000455264|ENST00000379799	D;D;D;D;D;D|.	0.90788|.	-2.73;-2.73;-2.73;-2.73;-2.73;-2.73|.	5.48|5.48	5.48|5.48	0.80851|0.80851	PHM/PNGase F domain (1);Copper type II, ascorbate-dependent monooxygenase-like, C-terminal (1);|.	0.047420|.	0.85682|.	D|.	0.000000|.	D|D	0.84804|0.84804	0.5553|0.5553	M|M	0.89214|0.89214	3.015|3.015	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D|.	0.87578|.	0.997;0.998;0.997;0.997;0.997;0.996|.	D|D	0.86854|0.86854	0.2025|0.2025	10|5	0.87932|.	D|.	0|.	.|.	19.3533|19.3533	0.94401|0.94401	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	184;281;281;281;281;281|.	F8WE90;P19021;P19021-4;P19021-3;P19021-5;P19021-2|.	.;AMD_HUMAN;.;.;.;.|.	C|L	281;281;281;281;184;281|53	ENSP00000396493:G281C;ENSP00000282992:G281C;ENSP00000314638:G281C;ENSP00000306100:G281C;ENSP00000274392:G184C;ENSP00000403461:G281C|.	ENSP00000274392:G184C|.	G|W	+|+	1|2	0|0	PAM|PAM	102314359|102314359	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.866000|0.866000	0.49608|0.49608	7.508000|7.508000	0.81686|0.81686	2.583000|2.583000	0.87209|0.87209	0.484000|0.484000	0.47621|0.47621	GGT|TGG		0.378	PAM-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250640.2	NM_000919		28	56	1	0	3.67e-24	5.61e-24	28	56				
PPIP5K2	23262	broad.mit.edu	37	5	102474116	102474116	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr5:102474116G>A	ENST00000358359.3	+	5	939	c.430G>A	c.(430-432)Gaa>Aaa	p.E144K	PPIP5K2_ENST00000321521.9_Missense_Mutation_p.E144K|PPIP5K2_ENST00000414217.1_Missense_Mutation_p.E144K|PPIP5K2_ENST00000513500.1_3'UTR	NM_001276277.1	NP_001263206.1	O43314	VIP2_HUMAN	diphosphoinositol pentakisphosphate kinase 2	144					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						TCTTCAAGCTGAAGGTATTTT	0.338																																						uc003kod.3		NA																	0				ovary(1)|skin(1)	2						c.(430-432)GAA>AAA		Histidine acid phosphatase domain containing 1							92.0	91.0	92.0					5																	102474116		2203	4299	6502	SO:0001583	missense	23262				inositol metabolic process	cytosol	acid phosphatase activity|ATP binding|diphosphoinositol-pentakisphosphate kinase activity|inositol 1,3,4,5,6-pentakisphosphate kinase activity|inositol hexakisphosphate 5-kinase activity	g.chr5:102474116G>A	AB007893	CCDS34207.1, CCDS64212.1, CCDS75283.1	5q21.1	2014-05-06	2010-01-26	2010-01-26	ENSG00000145725	ENSG00000145725	2.7.4.24		29035	protein-coding gene	gene with protein product		611648	"""histidine acid phosphatase domain containing 1"""	HISPPD1		9455477, 17690096, 18981179	Standard	NM_001276277		Approved	KIAA0433, VIP2	uc003koe.4	O43314	OTTHUMG00000181461	ENST00000358359.3:c.430G>A	5.37:g.102474116G>A	ENSP00000351126:p.Glu144Lys		Somatic				PPIP5K2_uc011cva.1_RNA|PPIP5K2_uc003koe.2_Missense_Mutation_p.E144K|PPIP5K2_uc010jbo.1_Missense_Mutation_p.E66K	p.E144K	NM_015216	NP_056031	WXS	Illumina HiSeq	Unspecified	O43314	VIP2_HUMAN			5	949	+			144					A1NI53|A6NGS8|Q8TB50	Missense_Mutation	SNP	ENST00000358359.3	37	c.430G>A		.	.	.	.	.	.	.	.	.	.	G	17.62	3.433997	0.62955	.	.	ENSG00000145725	ENST00000321521;ENST00000507921;ENST00000358359;ENST00000451606;ENST00000414217;ENST00000507310	T;T;T;T	0.14266	2.53;3.17;2.52;2.53	4.88	4.88	0.63580	.	0.252181	0.33553	N	0.004793	T	0.18593	0.0446	M	0.78285	2.405	0.80722	D	1	B;P;B	0.37864	0.209;0.61;0.12	B;B;B	0.29267	0.043;0.1;0.046	T	0.06338	-1.0832	10	0.54805	T	0.06	.	16.5739	0.84632	0.0:0.0:1.0:0.0	.	66;144;144	D6RBU4;O43314-2;O43314	.;.;VIP2_HUMAN	K	144;66;144;144;144;74	ENSP00000313070:E144K;ENSP00000422525:E66K;ENSP00000351126:E144K;ENSP00000416016:E144K	ENSP00000313070:E144K	E	+	1	0	PPIP5K2	102502015	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.199000	0.95003	2.413000	0.81919	0.585000	0.79938	GAA		0.338	PPIP5K2-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370487.1	NM_015216		16	47	0	0	0	0	16	47				
MCC	4163	broad.mit.edu	37	5	112384928	112384928	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr5:112384928C>A	ENST00000302475.4	-	14	2510	c.1947G>T	c.(1945-1947)aaG>aaT	p.K649N	MCC_ENST00000514701.3_5'UTR|MCC_ENST00000515367.2_Missense_Mutation_p.K586N|MCC_ENST00000408903.3_Missense_Mutation_p.K839N	NM_002387.2	NP_002378	P23508	CRCM_HUMAN	mutated in colorectal cancers	649					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		GCGTGCTCAGCTTCAGCTCCA	0.597																																						uc003kqj.3		NA																	0				ovary(1)	1						c.(1945-1947)AAG>AAT		mutated in colorectal cancers isoform 2							47.0	36.0	40.0					5																	112384928		2202	4300	6502	SO:0001583	missense	4163				negative regulation of canonical Wnt receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane	protein binding|receptor activity	g.chr5:112384928C>A		CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000302475.4:c.1947G>T	5.37:g.112384928C>A	ENSP00000305617:p.Lys649Asn		Somatic				MCC_uc003kqk.3_RNA|MCC_uc003kql.3_Missense_Mutation_p.K839N|MCC_uc011cwb.1_Missense_Mutation_p.K649N	p.K649N	NM_002387	NP_002378	WXS	Illumina HiSeq	Unspecified	P23508	CRCM_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)	14	2477	-		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)	649					D3DT05|Q6ZR04	Missense_Mutation	SNP	ENST00000302475.4	37	c.1947G>T	CCDS4111.1	.	.	.	.	.	.	.	.	.	.	C	18.87	3.715612	0.68844	.	.	ENSG00000171444	ENST00000302475;ENST00000515367;ENST00000408903	T;T;T	0.37411	2.37;2.38;1.2	4.87	4.0	0.46444	.	0.000000	0.85682	D	0.000000	T	0.44180	0.1281	L	0.27053	0.805	0.58432	D	0.999999	D;D;D	0.61080	0.981;0.989;0.981	D;D;D	0.75020	0.95;0.985;0.95	T	0.24154	-1.0168	10	0.34782	T	0.22	-38.5978	12.8321	0.57752	0.0:0.9206:0.0:0.0794	.	649;839;649	B7Z6G0;P23508-2;P23508	.;.;CRCM_HUMAN	N	649;586;839	ENSP00000305617:K649N;ENSP00000421615:K586N;ENSP00000386227:K839N	ENSP00000305617:K649N	K	-	3	2	MCC	112412827	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.081000	0.30791	1.038000	0.40049	0.462000	0.41574	AAG		0.597	MCC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250736.3	NM_001085377		14	29	1	0	4.93e-13	6.92e-13	14	29				
PCDHA2	56146	broad.mit.edu	37	5	140176058	140176058	+	Silent	SNP	G	G	T	rs527553477		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr5:140176058G>T	ENST00000526136.1	+	1	1509	c.1509G>T	c.(1507-1509)gcG>gcT	p.A503A	PCDHA2_ENST00000520672.2_Silent_p.A503A|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000378132.1_Silent_p.A503A	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	503	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A503A(2)		NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGAGCGCGCGTTGTCGAGCT	0.677													.|||	1	0.000199681	0.0	0.0	5008	,	,		13832	0.001		0.0	False		,,,				2504	0.0					uc003lhd.2		NA																	2	Substitution - coding silent(2)		endometrium(2)	ovary(4)	4						c.(1507-1509)GCG>GCT		protocadherin alpha 2 isoform 1 precursor							58.0	60.0	60.0					5																	140176058		2203	4299	6502	SO:0001819	synonymous_variant	56146				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140176058G>T	AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.1509G>T	5.37:g.140176058G>T			Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhc.1_Silent_p.A503A|PCDHA2_uc011czy.1_Silent_p.A503A	p.A503A	NM_018905	NP_061728	WXS	Illumina HiSeq	Unspecified	Q9Y5H9	PCDA2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1615	+			503			Cadherin 5.|Extracellular (Potential).		O75287|Q9BTV3	Silent	SNP	ENST00000526136.1	37	c.1509G>T	CCDS54914.1																																																																																				0.677	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372877.3	NM_018905		17	33	1	0	5.35e-07	6.66e-07	17	33				
PCDHA3	56145	broad.mit.edu	37	5	140181115	140181115	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr5:140181115C>A	ENST00000522353.2	+	1	333	c.333C>A	c.(331-333)gaC>gaA	p.D111E	PCDHA2_ENST00000520672.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000532566.2_Missense_Mutation_p.D111E	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	111	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.D111E(2)		NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGATCGTGGACAGGCCGCTGC	0.507																																						uc003lhf.2		NA																	2	Substitution - Missense(2)		large_intestine(2)	ovary(6)|skin(2)	8						c.(331-333)GAC>GAA		protocadherin alpha 3 isoform 1 precursor							123.0	137.0	132.0					5																	140181115		2203	4300	6503	SO:0001583	missense	56145				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140181115C>A	AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.333C>A	5.37:g.140181115C>A	ENSP00000429808:p.Asp111Glu		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA2_uc011czy.1_Intron|PCDHA3_uc011czz.1_Missense_Mutation_p.D111E	p.D111E	NM_018906	NP_061729	WXS	Illumina HiSeq	Unspecified	Q9Y5H8	PCDA3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	333	+			111			Cadherin 1.|Extracellular (Potential).		O75286	Missense_Mutation	SNP	ENST00000522353.2	37	c.333C>A	CCDS54915.1	.	.	.	.	.	.	.	.	.	.	c	5.482	0.274049	0.10403	.	.	ENSG00000255408	ENST00000522353;ENST00000532566	T;T	0.21031	2.03;2.03	4.35	2.49	0.30216	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.152498	0.29551	N	0.011832	T	0.08537	0.0212	N	0.05330	-0.07	0.18873	N	0.999989	B;B	0.18863	0.031;0.008	B;B	0.15484	0.013;0.007	T	0.38520	-0.9657	10	0.11794	T	0.64	.	7.728	0.28771	0.0:0.3715:0.4749:0.1536	.	111;111	Q9Y5H8-2;Q9Y5H8	.;PCDA3_HUMAN	E	111	ENSP00000429808:D111E;ENSP00000434086:D111E	ENSP00000429808:D111E	D	+	3	2	PCDHA3	140161299	0.000000	0.05858	0.660000	0.29694	0.948000	0.59901	-1.274000	0.02820	0.347000	0.23924	0.467000	0.42956	GAC		0.507	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372848.2	NM_018906		55	115	1	0	1.11e-26	1.71e-26	55	115				
PCDHA7	56141	broad.mit.edu	37	5	140215406	140215406	+	Missense_Mutation	SNP	G	G	T	rs375168399		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr5:140215406G>T	ENST00000525929.1	+	1	1438	c.1438G>T	c.(1438-1440)Ggg>Tgg	p.G480W	PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.G480W|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	480	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGTGTCGGCGGGGGACGCGGA	0.672																																					NSCLC(160;258 2013 5070 22440 28951)	uc003lhq.2		NA																	0				ovary(2)|skin(2)	4						c.(1438-1440)GGG>TGG		protocadherin alpha 7 isoform 1 precursor							45.0	50.0	49.0					5																	140215406		2202	4298	6500	SO:0001583	missense	56141				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140215406G>T	AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.1438G>T	5.37:g.140215406G>T	ENSP00000436426:p.Gly480Trp		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc011dac.1_Missense_Mutation_p.G480W	p.G480W	NM_018910	NP_061733	WXS	Illumina HiSeq	Unspecified	Q9UN72	PCDA7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1438	+			480			Cadherin 5.|Extracellular (Potential).		O75282	Missense_Mutation	SNP	ENST00000525929.1	37	c.1438G>T	CCDS54918.1	.	.	.	.	.	.	.	.	.	.	G	0.133	-1.111504	0.01813	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.01821	4.62;4.62	4.0	-2.82	0.05787	Cadherin (4);Cadherin-like (1);	0.833607	0.09224	U	0.831572	T	0.00608	0.0020	N	0.00729	-1.24	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.45659	-0.9246	10	0.34782	T	0.22	.	2.3451	0.04270	0.1032:0.2208:0.3381:0.3378	.	480;480	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	W	480	ENSP00000436426:G480W;ENSP00000367365:G480W	ENSP00000367365:G480W	G	+	1	0	PCDHA7	140195590	0.000000	0.05858	0.002000	0.10522	0.027000	0.11550	-2.548000	0.00930	-0.632000	0.05553	-0.789000	0.03336	GGG		0.672	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372887.2	NM_018910		22	26	1	0	7.93e-12	1.1e-11	22	26				
PCDHA9	9752	broad.mit.edu	37	5	140229949	140229949	+	Silent	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr5:140229949C>T	ENST00000532602.1	+	1	2902	c.1869C>T	c.(1867-1869)cgC>cgT	p.R623R	PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA9_ENST00000378122.3_Silent_p.R623R|PCDHA4_ENST00000512229.2_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	623	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCCGTTCCGCGTGGGGCTGT	0.667																																					Melanoma(55;1800 1972 14909)	uc003lhu.2		NA																	0				large_intestine(2)|ovary(2)|skin(1)	5						c.(1867-1869)CGC>CGT		protocadherin alpha 9 isoform 1 precursor							67.0	72.0	70.0					5																	140229949		2197	4273	6470	SO:0001819	synonymous_variant	9752				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding	g.chr5:140229949C>T	AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.1869C>T	5.37:g.140229949C>T			Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lht.1_Silent_p.R623R	p.R623R	NM_031857	NP_114063	WXS	Illumina HiSeq	Unspecified	Q9Y5H5	PCDA9_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2593	+			623			Cadherin 6.|Extracellular (Potential).		O15053|Q2M3S5	Silent	SNP	ENST00000532602.1	37	c.1869C>T	CCDS54920.1																																																																																				0.667	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372896.2	NM_031857		18	50	0	0	0	0	18	50				
PCDHA10	56139	broad.mit.edu	37	5	140236300	140236300	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr5:140236300G>T	ENST00000307360.5	+	1	667	c.667G>T	c.(667-669)Gga>Tga	p.G223*	PCDHA9_ENST00000532602.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000506939.2_Nonsense_Mutation_p.G223*|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018901.2	NP_061724.1	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10	223	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(11)|cervix(1)|endometrium(11)|kidney(5)|large_intestine(13)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	79			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGAATTTACCGGATCTGTTTC	0.433																																						uc003lhx.2		NA																	0				ovary(2)|skin(2)|breast(1)	5						c.(667-669)GGA>TGA		protocadherin alpha 10 isoform 1 precursor							108.0	102.0	104.0					5																	140236300		2196	4273	6469	SO:0001587	stop_gained	56139				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140236300G>T	AF152475	CCDS34255.1, CCDS54921.1, CCDS75325.1	5q31	2010-11-26			ENSG00000250120	ENSG00000250120		"""Cadherins / Protocadherins : Clustered"""	8664	other	complex locus constituent	"""KIAA0345-like 4"", ""ortholog to mouse CNR8"""	606316		CNRS8		10380929	Standard	NM_018901		Approved	CNR8, CRNR8, CNRN8, PCDH-ALPHA10		Q9Y5I2	OTTHUMG00000163372	ENST00000307360.5:c.667G>T	5.37:g.140236300G>T	ENSP00000304234:p.Gly223*		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Nonsense_Mutation_p.G223*|PCDHA10_uc011dad.1_Nonsense_Mutation_p.G223*	p.G223*	NM_018901	NP_061724	WXS	Illumina HiSeq	Unspecified	Q9Y5I2	PCDAA_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	667	+			223			Extracellular (Potential).|Cadherin 2.		A1L493|O75280|Q9NRU2	Nonsense_Mutation	SNP	ENST00000307360.5	37	c.667G>T	CCDS54921.1	.	.	.	.	.	.	.	.	.	.	G	36	5.751860	0.96890	.	.	ENSG00000250120	ENST00000506939;ENST00000307360	.	.	.	4.29	4.29	0.51040	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.2947	0.87167	0.0:0.0:1.0:0.0	.	.	.	.	X	223	.	ENSP00000304234:G223X	G	+	1	0	PCDHA10	140216484	0.988000	0.35896	0.097000	0.21041	0.980000	0.70556	2.723000	0.47277	2.383000	0.81215	0.561000	0.74099	GGA		0.433	PCDHA10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372895.2	NM_018901		60	113	1	0	6.2e-27	9.56e-27	60	113				
PCDHA11	56138	broad.mit.edu	37	5	140250827	140250827	+	Silent	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr5:140250827G>T	ENST00000398640.2	+	1	2139	c.2139G>T	c.(2137-2139)acG>acT	p.T713T	PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA10_ENST00000506939.2_Intron	NM_018902.3	NP_061725.1	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11	713					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(1)|lung(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGTACTCACGCTGCTGCTGT	0.687																																						uc003lia.2		NA																	0				breast(1)	1						c.(2137-2139)ACG>ACT		protocadherin alpha 11 isoform 1 precursor							40.0	41.0	40.0					5																	140250827		2203	4300	6503	SO:0001819	synonymous_variant	56138				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140250827G>T	AF152476	CCDS47284.1, CCDS75326.1	5q31	2010-11-26			ENSG00000249158	ENSG00000249158		"""Cadherins / Protocadherins : Clustered"""	8665	other	complex locus constituent	"""KIAA0345-like 3"", ""ortholog of mouse CNR7"""	606317		CNRS7		10380929, 10662547	Standard	NM_018902		Approved	CNR7, CRNR7, CNRN7, PCDH-ALPHA11		Q9Y5I1	OTTHUMG00000163369	ENST00000398640.2:c.2139G>T	5.37:g.140250827G>T			Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc011dae.1_Silent_p.T713T	p.T713T	NM_018902	NP_061725	WXS	Illumina HiSeq	Unspecified	Q9Y5I1	PCDAB_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2997	+			713			Helical; (Potential).		B2RN58|O75279	Silent	SNP	ENST00000398640.2	37	c.2139G>T	CCDS47284.1																																																																																				0.687	PCDHA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372885.2	NM_018902		12	30	1	0	1.09e-07	1.38e-07	12	30				
PCDHB7	56129	broad.mit.edu	37	5	140553967	140553967	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr5:140553967G>T	ENST00000231137.3	+	1	1725	c.1551G>T	c.(1549-1551)agG>agT	p.R517S		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	517	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTGCCCTCAGGTCCCTGGACT	0.706																																						uc003lit.2		NA																	0				ovary(4)|central_nervous_system(1)|skin(1)	6						c.(1549-1551)AGG>AGT		protocadherin beta 7 precursor							81.0	85.0	84.0					5																	140553967		2202	4300	6502	SO:0001583	missense	56129				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140553967G>T	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.1551G>T	5.37:g.140553967G>T	ENSP00000231137:p.Arg517Ser		Somatic					p.R517S	NM_018940	NP_061763	WXS	Illumina HiSeq	Unspecified	Q9Y5E2	PCDB7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1725	+			517			Extracellular (Potential).|Cadherin 5.		A1L3Y8	Missense_Mutation	SNP	ENST00000231137.3	37	c.1551G>T	CCDS4249.1	.	.	.	.	.	.	.	.	.	.	g	10.71	1.425800	0.25639	.	.	ENSG00000113212	ENST00000231137;ENST00000543636	T	0.01584	4.75	4.34	-2.18	0.07037	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.02970	0.0088	M	0.64404	1.975	0.26355	N	0.97715	B	0.24092	0.097	B	0.35353	0.201	T	0.41840	-0.9486	9	0.66056	D	0.02	.	5.6397	0.17557	0.3045:0.4123:0.2831:0.0	.	517	Q9Y5E2	PCDB7_HUMAN	S	517;300	ENSP00000231137:R517S	ENSP00000231137:R517S	R	+	3	2	PCDHB7	140534151	0.000000	0.05858	0.011000	0.14972	0.074000	0.17049	-1.470000	0.02346	-0.250000	0.09555	-0.321000	0.08615	AGG		0.706	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940		28	60	1	0	2.44e-19	3.62e-19	28	60				
PCDHB10	56126	broad.mit.edu	37	5	140573129	140573129	+	Missense_Mutation	SNP	T	T	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr5:140573129T>A	ENST00000239446.4	+	1	1188	c.1004T>A	c.(1003-1005)gTg>gAg	p.V335E		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	335	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGGGTTTTAGTGGAAGTATTG	0.408																																						uc003lix.2		NA																	0				ovary(1)|skin(1)	2						c.(1003-1005)GTG>GAG		protocadherin beta 10 precursor							97.0	98.0	98.0					5																	140573129		2203	4300	6503	SO:0001583	missense	56126				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140573129T>A	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.1004T>A	5.37:g.140573129T>A	ENSP00000239446:p.Val335Glu		Somatic					p.V335E	NM_018930	NP_061753	WXS	Illumina HiSeq	Unspecified	Q9UN67	PCDBA_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1178	+			335			Extracellular (Potential).|Cadherin 3.		Q96T99	Missense_Mutation	SNP	ENST00000239446.4	37	c.1004T>A	CCDS4252.1	.	.	.	.	.	.	.	.	.	.	T	13.86	2.362740	0.41902	.	.	ENSG00000120324	ENST00000239446	T	0.62364	0.03	3.41	3.41	0.39046	Cadherin (5);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	D	0.85465	0.5703	H	0.98295	4.195	0.09310	N	0.999999	P	0.52577	0.954	D	0.63793	0.918	T	0.77797	-0.2453	9	0.87932	D	0	.	12.0382	0.53438	0.0:0.0:0.0:1.0	.	335	Q9UN67	PCDBA_HUMAN	E	335	ENSP00000239446:V335E	ENSP00000239446:V335E	V	+	2	0	PCDHB10	140553313	0.995000	0.38212	0.005000	0.12908	0.314000	0.28054	7.790000	0.85794	1.572000	0.49736	0.454000	0.30748	GTG		0.408	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930		41	80	0	0	0	0	41	80				
SLC36A2	153201	broad.mit.edu	37	5	150712872	150712872	+	Silent	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr5:150712872G>A	ENST00000335244.4	-	7	885	c.756C>T	c.(754-756)gaC>gaT	p.D252D	SLC36A2_ENST00000521967.1_Silent_p.D252D|SLC36A2_ENST00000450886.1_5'Flank	NM_181776.2	NP_861441.2	Q495M3	S36A2_HUMAN	solute carrier family 36 (proton/amino acid symporter), member 2	252					amino acid transport (GO:0006865)|ion transport (GO:0006811)|proline transmembrane transport (GO:0035524)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine transmembrane transporter activity (GO:0015187)|hydrogen:amino acid symporter activity (GO:0005280)|L-alanine transmembrane transporter activity (GO:0015180)|L-proline transmembrane transporter activity (GO:0015193)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(14)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	33		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Cycloserine(DB00260)	ACCGGCTGGGGTCTGGGATTT	0.438																																						uc003lty.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(754-756)GAC>GAT		solute carrier family 36, member 2							76.0	79.0	78.0					5																	150712872		2203	4300	6503	SO:0001819	synonymous_variant	153201				cellular nitrogen compound metabolic process	cytoplasm|integral to membrane|plasma membrane	glycine transmembrane transporter activity	g.chr5:150712872G>A	AY162214	CCDS4315.1	5q33.1	2013-05-22			ENSG00000186335	ENSG00000186335		"""Solute carriers"""	18762	protein-coding gene	gene with protein product		608331				11959859	Standard	NM_181776		Approved	PAT2, tramdorin, TRAMD1	uc003lty.3	Q495M3	OTTHUMG00000130129	ENST00000335244.4:c.756C>T	5.37:g.150712872G>A			Somatic				GM2A_uc011dcs.1_Intron|SLC36A2_uc003ltz.2_RNA|SLC36A2_uc003lua.2_Silent_p.D54D|SLC36A2_uc010jhv.2_Silent_p.D252D	p.D252D	NM_181776	NP_861441	WXS	Illumina HiSeq	Unspecified	Q495M3	S36A2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		7	886	-		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	252			Extracellular (Potential).		Q495M4|Q495M6|Q6ZWK5|Q7Z6B5	Silent	SNP	ENST00000335244.4	37	c.756C>T	CCDS4315.1	.	.	.	.	.	.	.	.	.	.	G	6.601	0.479356	0.12581	.	.	ENSG00000186335	ENST00000523044	.	.	.	4.71	1.38	0.22167	.	.	.	.	.	T	0.54919	0.1888	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46816	-0.9164	4	.	.	.	-32.8882	7.4234	0.27085	0.47:0.0:0.53:0.0	.	.	.	.	I	5	.	.	T	-	2	0	SLC36A2	150693065	1.000000	0.71417	0.991000	0.47740	0.788000	0.44548	2.152000	0.42272	0.472000	0.27344	0.585000	0.79938	ACC		0.438	SLC36A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252437.1			25	56	0	0	0	0	25	56				
FOXI1	2299	broad.mit.edu	37	5	169535593	169535593	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr5:169535593C>A	ENST00000306268.6	+	2	1176	c.1115C>A	c.(1114-1116)cCc>cAc	p.P372H	FOXI1_ENST00000449804.2_Missense_Mutation_p.P277H			Q12951	FOXI1_HUMAN	forkhead box I1	372					embryo development (GO:0009790)|inner ear morphogenesis (GO:0042472)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Renal(175;0.000159)|Lung NSC(126;0.0267)|all_lung(126;0.04)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GTCCTCTACCCCAGGGAGGGC	0.572									Pendred syndrome																													uc003mai.3		NA																	0				breast(3)|central_nervous_system(1)	4						c.(1114-1116)CCC>CAC		forkhead box I1 isoform a							94.0	79.0	84.0					5																	169535593		2198	4293	6491	SO:0001583	missense	2299	Pendred_syndrome	Familial Cancer Database	Goiter-Deafness syndrome	epidermal cell fate specification|otic placode formation|pattern specification process|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|transcription regulatory region DNA binding	g.chr5:169535593C>A	BC029778	CCDS4372.1, CCDS47337.1	5q34	2008-02-05			ENSG00000168269	ENSG00000168269		"""Forkhead boxes"""	3815	protein-coding gene	gene with protein product		601093		FKHL10		7957066, 8825632	Standard	NM_144769		Approved	FREAC6	uc003mai.4	Q12951	OTTHUMG00000130436	ENST00000306268.6:c.1115C>A	5.37:g.169535593C>A	ENSP00000304286:p.Pro372His		Somatic				FOXI1_uc003maj.3_Missense_Mutation_p.P277H	p.P372H	NM_012188	NP_036320	WXS	Illumina HiSeq	Unspecified	Q12951	FOXI1_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		2	1160	+	Renal(175;0.000159)|Lung NSC(126;0.0267)|all_lung(126;0.04)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	372					Q14518|Q66SR7|Q8N6L8	Missense_Mutation	SNP	ENST00000306268.6	37	c.1115C>A	CCDS4372.1	.	.	.	.	.	.	.	.	.	.	C	12.94	2.088321	0.36855	.	.	ENSG00000168269	ENST00000306268;ENST00000449804	D;D	0.94828	-3.41;-3.53	5.52	5.52	0.82312	.	0.267375	0.36740	N	0.002431	D	0.96457	0.8844	M	0.71296	2.17	0.22552	N	0.99899	D;P	0.89917	1.0;0.93	D;P	0.72982	0.979;0.635	D	0.91620	0.5310	10	0.36615	T	0.2	.	14.3017	0.66357	0.1485:0.8515:0.0:0.0	.	277;372	Q12951-2;Q12951	.;FOXI1_HUMAN	H	372;277	ENSP00000304286:P372H;ENSP00000415483:P277H	ENSP00000304286:P372H	P	+	2	0	FOXI1	169468171	0.991000	0.36638	1.000000	0.80357	0.131000	0.20780	1.943000	0.40253	2.598000	0.87819	0.655000	0.94253	CCC		0.572	FOXI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252827.2	NM_144769, NM_012188		24	75	1	0	7.38e-10	9.91e-10	24	75				
RANBP17	64901	broad.mit.edu	37	5	170720913	170720913	+	Silent	SNP	T	T	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr5:170720913T>A	ENST00000523189.1	+	26	3134	c.2970T>A	c.(2968-2970)atT>atA	p.I990I	RANBP17_ENST00000521759.1_3'UTR	NM_022897.3	NP_075048.1	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	990					mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)	GTP binding (GO:0005525)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	50	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TGAACACCATTGTCTTTGAAG	0.488			T	TRD@	ALL																																	uc003mba.2		NA		Dom	yes		5	5q34	64901	T	RAN binding protein 17			L	TRD@		ALL		0				ovary(2)|central_nervous_system(1)	3						c.(2968-2970)ATT>ATA		RAN binding protein 17							223.0	211.0	215.0					5																	170720913		2203	4300	6503	SO:0001819	synonymous_variant	64901				mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity	g.chr5:170720913T>A	AF222747	CCDS34287.1	5q34	2009-01-12			ENSG00000204764	ENSG00000204764			14428	protein-coding gene	gene with protein product		606141				11024021	Standard	NM_022897		Approved		uc003mba.3	Q9H2T7	OTTHUMG00000163203	ENST00000523189.1:c.2970T>A	5.37:g.170720913T>A			Somatic				RANBP17_uc003mbb.2_Silent_p.I315I|RANBP17_uc010jjs.2_RNA	p.I990I	NM_022897	NP_075048	WXS	Illumina HiSeq	Unspecified	Q9H2T7	RBP17_HUMAN	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)		26	2986	+	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	990					Q8IU74	Silent	SNP	ENST00000523189.1	37	c.2970T>A	CCDS34287.1																																																																																				0.488	RANBP17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000372036.1	NM_022897		61	137	0	0	0	0	61	137				
HK3	3101	broad.mit.edu	37	5	176309035	176309035	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr5:176309035C>T	ENST00000292432.5	-	16	2238	c.2147G>A	c.(2146-2148)gGc>gAc	p.G716D		NM_002115.2	NP_002106.2	P52790	HXK3_HUMAN	hexokinase 3 (white cell)	716	Catalytic.|Hexokinase type-2 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|hormone binding (GO:0042562)|mannokinase activity (GO:0019158)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCCAAAGGCGCCCCACTCCAT	0.632																																						uc003mfa.2		NA																	0				ovary(3)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)|skin(1)	7						c.(2146-2148)GGC>GAC		hexokinase 3							79.0	77.0	78.0					5																	176309035		2203	4300	6503	SO:0001583	missense	3101				glucose transport|glycolysis|transmembrane transport	cytosol|membrane	ATP binding|glucokinase activity	g.chr5:176309035C>T		CCDS4407.1	5q35.2	2008-02-05			ENSG00000160883	ENSG00000160883	2.7.1.1		4925	protein-coding gene	gene with protein product		142570				8812439	Standard	NM_002115		Approved		uc003mfa.3	P52790	OTTHUMG00000130855	ENST00000292432.5:c.2147G>A	5.37:g.176309035C>T	ENSP00000292432:p.Gly716Asp		Somatic				HK3_uc003mez.2_Missense_Mutation_p.G272D	p.G716D	NM_002115	NP_002106	WXS	Illumina HiSeq	Unspecified	P52790	HXK3_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		16	2239	-	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	716			Catalytic.		Q8N1E7	Missense_Mutation	SNP	ENST00000292432.5	37	c.2147G>A	CCDS4407.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.942910	0.92526	.	.	ENSG00000160883	ENST00000292432;ENST00000514058	D;D	0.98567	-5.0;-5.0	5.06	5.06	0.68205	Hexokinase, C-terminal (1);	0.000000	0.53938	D	0.000044	D	0.99468	0.9811	H	0.98965	4.385	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.98023	1.0372	10	0.87932	D	0	-21.154	18.5845	0.91183	0.0:1.0:0.0:0.0	.	716	P52790	HXK3_HUMAN	D	716;106	ENSP00000292432:G716D;ENSP00000424632:G106D	ENSP00000292432:G716D	G	-	2	0	HK3	176241641	1.000000	0.71417	0.974000	0.42286	0.823000	0.46562	7.651000	0.83577	2.782000	0.95742	0.655000	0.94253	GGC		0.632	HK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253428.1			23	56	0	0	0	0	23	56				
NSD1	64324	broad.mit.edu	37	5	176637631	176637631	+	Nonsense_Mutation	SNP	C	C	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr5:176637631C>G	ENST00000439151.2	+	5	2276	c.2231C>G	c.(2230-2232)tCa>tGa	p.S744*	NSD1_ENST00000347982.4_Nonsense_Mutation_p.S475*|NSD1_ENST00000354179.4_Nonsense_Mutation_p.S475*|NSD1_ENST00000361032.4_Nonsense_Mutation_p.S641*	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	744					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		AAACCCCAGTCAGATTTTACA	0.438			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																												uc003mfr.3		NA		Dom	yes		5	5q35	64324	T	nuclear receptor binding SET domain protein 1	yes	Sotos Syndrome	L	NUP98		AML		0				ovary(2)|kidney(1)	3						c.(2230-2232)TCA>TGA		nuclear receptor binding SET domain protein 1							81.0	83.0	82.0					5																	176637631		2203	4300	6503	SO:0001587	stop_gained	64324	Beckwith-Wiedemann_syndrome|Sotos_syndrome|Weaver_syndrome	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	androgen receptor binding|chromatin binding|estrogen receptor binding|histone methyltransferase activity (H3-K36 specific)|histone methyltransferase activity (H4-K20 specific)|ligand-dependent nuclear receptor binding|retinoid X receptor binding|thyroid hormone receptor binding|transcription corepressor activity|zinc ion binding	g.chr5:176637631C>G	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.2231C>G	5.37:g.176637631C>G	ENSP00000395929:p.Ser744*	HNSCC(47;0.14)	Somatic				NSD1_uc003mft.3_Nonsense_Mutation_p.S475*|NSD1_uc003mfs.1_Nonsense_Mutation_p.S641*|NSD1_uc011dfx.1_Nonsense_Mutation_p.S392*	p.S744*	NM_022455	NP_071900	WXS	Illumina HiSeq	Unspecified	Q96L73	NSD1_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)	5	2369	+	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	744					Q96PD8|Q96RN7	Nonsense_Mutation	SNP	ENST00000439151.2	37	c.2231C>G	CCDS4412.1	.	.	.	.	.	.	.	.	.	.	C	9.589	1.125545	0.20959	.	.	ENSG00000165671	ENST00000354179;ENST00000355783;ENST00000439151;ENST00000347982;ENST00000361032	.	.	.	4.45	1.74	0.24563	.	1.301350	0.05191	N	0.503100	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.8748	0.29586	0.0:0.6555:0.0:0.3445	.	.	.	.	X	475;475;744;475;641	.	.	S	+	2	0	NSD1	176570237	0.005000	0.15991	0.002000	0.10522	0.020000	0.10135	1.553000	0.36255	0.398000	0.25338	0.655000	0.94253	TCA		0.438	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253412.2	NM_172349		25	56	0	0	0	0	25	56				
CAP2	10486	broad.mit.edu	37	6	17539517	17539517	+	Silent	SNP	A	A	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:17539517A>G	ENST00000229922.2	+	8	1186	c.654A>G	c.(652-654)acA>acG	p.T218T	CAP2_ENST00000465994.1_Silent_p.T154T|CAP2_ENST00000489374.1_Silent_p.T106T|CAP2_ENST00000493172.1_Intron|CAP2_ENST00000378990.2_Silent_p.T192T	NM_006366.2	NP_006357.1	P40123	CAP2_HUMAN	CAP, adenylate cyclase-associated protein, 2 (yeast)	218					activation of adenylate cyclase activity (GO:0007190)|axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|establishment or maintenance of cell polarity (GO:0007163)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(4)|urinary_tract(1)	27	Breast(50;0.0333)|Ovarian(93;0.0386)	all_hematologic(90;0.0466)	all cancers(50;0.194)|Epithelial(50;0.227)			TAGCATCCACAGTATCAGCGT	0.567																																						uc003ncb.2		NA																	0				ovary(1)	1						c.(652-654)ACA>ACG		adenylyl cyclase-associated protein 2							252.0	218.0	230.0					6																	17539517		2203	4300	6503	SO:0001819	synonymous_variant	10486				activation of adenylate cyclase activity|axon guidance|cytoskeleton organization|establishment or maintenance of cell polarity|signal transduction	plasma membrane	actin binding	g.chr6:17539517A>G	BC008481	CCDS4539.1	6p22.3	2008-02-05			ENSG00000112186	ENSG00000112186			20039	protein-coding gene	gene with protein product						7962207, 8761950	Standard	NM_006366		Approved		uc003ncb.3	P40123	OTTHUMG00000014311	ENST00000229922.2:c.654A>G	6.37:g.17539517A>G			Somatic				CAP2_uc010jpk.1_RNA|CAP2_uc011dja.1_Silent_p.T192T|CAP2_uc011djb.1_Silent_p.T154T|CAP2_uc011djc.1_Silent_p.T106T|CAP2_uc011djd.1_Intron	p.T218T	NM_006366	NP_006357	WXS	Illumina HiSeq	Unspecified	P40123	CAP2_HUMAN	all cancers(50;0.194)|Epithelial(50;0.227)		8	897	+	Breast(50;0.0333)|Ovarian(93;0.0386)	all_hematologic(90;0.0466)	218					B2R5Y3|B7Z1C4|B7Z214|Q6IAY2	Silent	SNP	ENST00000229922.2	37	c.654A>G	CCDS4539.1																																																																																				0.567	CAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039952.2			59	195	0	0	0	0	59	195				
SOX4	6659	broad.mit.edu	37	6	21596066	21596066	+	Missense_Mutation	SNP	T	T	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:21596066T>G	ENST00000244745.1	+	1	2095	c.1301T>G	c.(1300-1302)tTt>tGt	p.F434C	SOX4_ENST00000543472.1_Missense_Mutation_p.F434C	NM_003107.2	NP_003098.1	Q06945	SOX4_HUMAN	SRY (sex determining region Y)-box 4	434					ascending aorta morphogenesis (GO:0035910)|atrial septum primum morphogenesis (GO:0003289)|canonical Wnt signaling pathway (GO:0060070)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac ventricle formation (GO:0003211)|cellular response to glucose stimulus (GO:0071333)|DNA damage response, detection of DNA damage (GO:0042769)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|endocrine pancreas development (GO:0031018)|glial cell development (GO:0021782)|glial cell proliferation (GO:0014009)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|kidney morphogenesis (GO:0060993)|limb bud formation (GO:0060174)|mitral valve morphogenesis (GO:0003183)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of protein ubiquitination (GO:0031397)|neural tube formation (GO:0001841)|neuroepithelial cell differentiation (GO:0060563)|noradrenergic neuron differentiation (GO:0003357)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin secretion (GO:0032024)|positive regulation of N-terminal peptidyl-lysine acetylation (GO:2000761)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|positive regulation of Wnt signaling pathway (GO:0030177)|pro-B cell differentiation (GO:0002328)|protein stabilization (GO:0050821)|regulation of protein stability (GO:0031647)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|spinal cord development (GO:0021510)|spinal cord motor neuron differentiation (GO:0021522)|sympathetic nervous system development (GO:0048485)|T cell differentiation (GO:0030217)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			kidney(2)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)	6	Ovarian(93;0.163)		all cancers(50;0.0751)|Epithelial(50;0.155)			GACCTGGATTTTAACTTCGAG	0.607																																						uc003ndi.2		NA																	0					0						c.(1300-1302)TTT>TGT		SRY (sex determining region Y)-box 4							22.0	22.0	22.0					6																	21596066		2203	4300	6503	SO:0001583	missense	6659				canonical Wnt receptor signaling pathway|cardiac ventricle formation|cellular response to glucose stimulus|DNA damage response, detection of DNA damage|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|glial cell development|glial cell proliferation|limb bud formation|negative regulation of apoptosis|negative regulation of cell proliferation|negative regulation of protein export from nucleus|negative regulation of protein ubiquitination|neural tube formation|neuroepithelial cell differentiation|noradrenergic neuron differentiation|positive regulation of apoptosis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell proliferation|positive regulation of insulin secretion|positive regulation of N-terminal peptidyl-lysine acetylation|positive regulation of translation|pro-B cell differentiation|protein stabilization|skeletal system development|spinal cord motor neuron differentiation|sympathetic nervous system development|T cell differentiation	mitochondrion|nucleus	core promoter sequence-specific DNA binding|protein binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|RNA polymerase II transcription coactivator activity	g.chr6:21596066T>G	AF070669	CCDS4547.1	6p22.3	2008-02-05			ENSG00000124766	ENSG00000124766		"""SRY (sex determining region Y)-boxes"""	11200	protein-coding gene	gene with protein product		184430				8268656, 9730625	Standard	NM_003107		Approved		uc003ndi.3	Q06945	OTTHUMG00000016101	ENST00000244745.1:c.1301T>G	6.37:g.21596066T>G	ENSP00000244745:p.Phe434Cys		Somatic					p.F434C	NM_003107	NP_003098	WXS	Illumina HiSeq	Unspecified	Q06945	SOX4_HUMAN	all cancers(50;0.0751)|Epithelial(50;0.155)		1	2095	+	Ovarian(93;0.163)		434						Missense_Mutation	SNP	ENST00000244745.1	37	c.1301T>G	CCDS4547.1	.	.	.	.	.	.	.	.	.	.	T	19.58	3.853615	0.71719	.	.	ENSG00000124766	ENST00000244745;ENST00000543472	D;D	0.97888	-4.59;-4.59	4.19	4.19	0.49359	.	0.302563	0.27686	U	0.018269	D	0.97002	0.9021	L	0.48642	1.525	0.44024	D	0.996746	D	0.76494	0.999	P	0.61328	0.887	D	0.97370	0.9975	10	0.62326	D	0.03	.	13.1908	0.59709	0.0:0.0:0.0:1.0	.	434	Q06945	SOX4_HUMAN	C	434	ENSP00000244745:F434C;ENSP00000438412:F434C	ENSP00000244745:F434C	F	+	2	0	SOX4	21704045	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.566000	0.60843	1.657000	0.50732	0.477000	0.44152	TTT		0.607	SOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043301.1	NM_003107		10	26	0	0	0	0	10	26				
FAM65B	9750	broad.mit.edu	37	6	24873954	24873954	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:24873954C>A	ENST00000259698.4	-	3	350	c.175G>T	c.(175-177)Ggc>Tgc	p.G59C	FAM65B_ENST00000378023.4_Missense_Mutation_p.G59C|FAM65B_ENST00000540914.1_Missense_Mutation_p.G59C|FAM65B_ENST00000538035.1_Missense_Mutation_p.G88C|FAM65B_ENST00000510784.2_Missense_Mutation_p.G93C	NM_014722.2	NP_055537.2	Q9Y4F9	FA65B_HUMAN	family with sequence similarity 65, member B	59	Involved in cell filopodia formation.				cell differentiation (GO:0030154)|muscle organ development (GO:0007517)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)				breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	25						TTTTTGTGGCCTAAATTGTGC	0.428																																						uc003neo.1		NA																	0				ovary(1)	1						c.(175-177)GGC>TGC		hypothetical protein LOC9750 isoform 1							136.0	120.0	125.0					6																	24873954		1834	4091	5925	SO:0001583	missense	9750				cell differentiation|muscle organ development	cytoskeleton|filopodium|mitochondrion	binding	g.chr6:24873954C>A	U49187	CCDS47383.1, CCDS47384.1, CCDS69057.1, CCDS69058.1, CCDS75410.1	6p22.3-p21.32	2012-11-30	2008-06-13	2008-06-13	ENSG00000111913	ENSG00000111913			13872	protein-coding gene	gene with protein product	"""myogenesis-related and NCAM-associated protein homolog (chicken)"""	611410	"""chromosome 6 open reading frame 32"""	C6orf32		9205841, 17150207, 17825087	Standard	NM_001286447		Approved	KIAA0386, DIFF48, MYONAP	uc003neo.1	Q9Y4F9	OTTHUMG00000014375	ENST00000259698.4:c.175G>T	6.37:g.24873954C>A	ENSP00000259698:p.Gly59Cys		Somatic				FAM65B_uc011djs.1_Missense_Mutation_p.G88C|FAM65B_uc011dju.1_Missense_Mutation_p.G93C|FAM65B_uc003nep.2_Missense_Mutation_p.G59C|FAM65B_uc011djt.1_Missense_Mutation_p.G59C	p.G59C	NM_014722	NP_055537	WXS	Illumina HiSeq	Unspecified	Q9Y4F9	FA65B_HUMAN			3	351	-			59			Involved in cell filopodia formation.		A6NHP2|Q13529|Q5VV37|Q5VV38|Q9BQ28	Missense_Mutation	SNP	ENST00000259698.4	37	c.175G>T	CCDS47383.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.471012	0.84533	.	.	ENSG00000111913	ENST00000259698;ENST00000538035;ENST00000378023;ENST00000540914;ENST00000510784	T;T;T;T;T	0.02197	4.4;4.4;4.4;4.4;4.4	5.63	5.63	0.86233	.	0.104602	0.64402	D	0.000004	T	0.05227	0.0139	L	0.36672	1.1	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.77004	0.989;0.983;0.982;0.982	T	0.53258	-0.8464	10	0.54805	T	0.06	-25.6574	19.7096	0.96089	0.0:1.0:0.0:0.0	.	93;88;59;59	B7Z6U4;F5GX51;Q9Y4F9-2;Q9Y4F9	.;.;.;FA65B_HUMAN	C	59;88;59;59;93	ENSP00000259698:G59C;ENSP00000441138:G88C;ENSP00000367262:G59C;ENSP00000438425:G59C;ENSP00000441305:G93C	ENSP00000259698:G59C	G	-	1	0	FAM65B	24981933	1.000000	0.71417	0.746000	0.31095	0.961000	0.63080	5.635000	0.67841	2.652000	0.90054	0.655000	0.94253	GGC		0.428	FAM65B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040024.2			26	107	1	0	4.27e-12	5.91e-12	26	107				
SCGN	10590	broad.mit.edu	37	6	25665232	25665232	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:25665232C>A	ENST00000377961.2	+	4	476	c.308C>A	c.(307-309)cCa>cAa	p.P103Q	SCGN_ENST00000334979.6_3'UTR	NM_006998.3	NP_008929.2	O76038	SEGN_HUMAN	secretagogin, EF-hand calcium binding protein	103						cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	24						CGGGAAAACCCACTGGACAGC	0.493																																						uc003nfb.2		NA																	0				ovary(2)|pancreas(1)	3						c.(307-309)CCA>CAA		secretagogin precursor							137.0	123.0	128.0					6																	25665232		2203	4300	6503	SO:0001583	missense	10590					extracellular region|transport vesicle membrane	calcium ion binding	g.chr6:25665232C>A	BC000336	CCDS4561.1	6p22.3-p22.1	2013-01-10			ENSG00000079689	ENSG00000079689		"""EF-hand domain containing"""	16941	protein-coding gene	gene with protein product	"""calbindin-like"""	609202				10811645	Standard	NM_006998		Approved	SECRET, DJ501N12.8, SEGN, CALBL	uc003nfb.3	O76038	OTTHUMG00000014409	ENST00000377961.2:c.308C>A	6.37:g.25665232C>A	ENSP00000367197:p.Pro103Gln		Somatic				SCGN_uc010jpz.2_Missense_Mutation_p.H13N	p.P103Q	NM_006998	NP_008929	WXS	Illumina HiSeq	Unspecified	O76038	SEGN_HUMAN			4	511	+			103					A8K0B2|Q5VV44|Q96QV7|Q9UJF6	Missense_Mutation	SNP	ENST00000377961.2	37	c.308C>A	CCDS4561.1	.	.	.	.	.	.	.	.	.	.	C	11.14	1.551772	0.27739	.	.	ENSG00000079689	ENST00000377961	T	0.09073	3.02	5.09	5.09	0.68999	EF-hand-like domain (1);	0.051114	0.85682	D	0.000000	T	0.05456	0.0144	M	0.64567	1.98	0.80722	D	1	D	0.60160	0.987	B	0.38842	0.283	T	0.43327	-0.9398	10	0.28530	T	0.3	.	17.2839	0.87136	0.0:1.0:0.0:0.0	.	103	O76038	SEGN_HUMAN	Q	103	ENSP00000367197:P103Q	ENSP00000367197:P103Q	P	+	2	0	SCGN	25773211	0.993000	0.37304	0.787000	0.31911	0.010000	0.07245	4.071000	0.57556	2.343000	0.79666	0.585000	0.79938	CCA		0.493	SCGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040067.1			17	70	1	0	4.97e-08	6.38e-08	17	70				
HIST1H2AH	85235	broad.mit.edu	37	6	27115070	27115070	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:27115070G>A	ENST00000377459.1	+	1	210	c.163G>A	c.(163-165)Gtg>Atg	p.V55M	HIST1H2BK_ENST00000396891.4_5'Flank|MIR3143_ENST00000584253.1_RNA|HIST1H2BK_ENST00000356950.1_5'Flank	NM_080596.1	NP_542163.1	Q96KK5	H2A1H_HUMAN	histone cluster 1, H2ah	55						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)|prostate(1)|skin(1)	12						CCTGGCTGCGGTGCTGGAGTA	0.652																																						uc003niz.2		NA																	0					0						c.(163-165)GTG>ATG		histone cluster 1, H2ah							52.0	54.0	53.0					6																	27115070		2203	4300	6503	SO:0001583	missense	85235				nucleosome assembly	nucleosome|nucleus	DNA binding	g.chr6:27115070G>A	AY131988	CCDS4622.1	6p22.1	2011-01-27	2006-10-11			ENSG00000274997		"""Histones / Replication-dependent"""	13671	protein-coding gene	gene with protein product		615013	"""histone 1, H2ah"""			12408966	Standard	NM_080596		Approved	H2AFALii, dJ86C11.1, H2A/S	uc003niz.4	Q96KK5		ENST00000377459.1:c.163G>A	6.37:g.27115070G>A	ENSP00000366679:p.Val55Met		Somatic				HIST1H2BK_uc003nix.1_5'Flank|hsa-mir-3143|MI0014167_5'Flank	p.V55M	NM_080596	NP_542163	WXS	Illumina HiSeq	Unspecified	Q96KK5	H2A1H_HUMAN			1	163	+			55						Missense_Mutation	SNP	ENST00000377459.1	37	c.163G>A	CCDS4622.1	.	.	.	.	.	.	.	.	.	.	G	18.65	3.669564	0.67814	.	.	ENSG00000184825	ENST00000377459	T	0.72051	-0.62	3.95	3.95	0.45737	Histone-fold (2);Histone core (1);Histone H2A (2);	0.000000	0.37012	N	0.002290	D	0.86364	0.5915	H	0.95982	3.75	0.39138	D	0.961983	D	0.67145	0.996	D	0.69824	0.966	D	0.90708	0.4625	10	0.87932	D	0	.	14.3093	0.66405	0.0:0.0:1.0:0.0	.	55	Q96KK5	H2A1H_HUMAN	M	55	ENSP00000366679:V55M	ENSP00000366679:V55M	V	+	1	0	HIST1H2AH	27223049	1.000000	0.71417	1.000000	0.80357	0.631000	0.37964	8.711000	0.91396	2.142000	0.66516	0.655000	0.94253	GTG		0.652	HIST1H2AH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040136.1	NM_080596		26	59	0	0	0	0	26	59				
OR2W1	26692	broad.mit.edu	37	6	29012793	29012793	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:29012793G>T	ENST00000377175.1	-	1	224	c.160C>A	c.(160-162)Cag>Aag	p.Q54K		NM_030903.3	NP_112165.1	Q9Y3N9	OR2W1_HUMAN	olfactory receptor, family 2, subfamily W, member 1	54						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|skin(1)	23						GTATGAAGCTGGGAATCCAGG	0.428																																						uc003nlw.2		NA																	0				ovary(2)|skin(1)	3						c.(160-162)CAG>AAG		olfactory receptor, family 2, subfamily W,							103.0	109.0	107.0					6																	29012793		1508	2709	4217	SO:0001583	missense	26692				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:29012793G>T	AL035402	CCDS4656.1	6p22.1	2012-08-09			ENSG00000204704	ENSG00000204704		"""GPCR / Class A : Olfactory receptors"""	8281	protein-coding gene	gene with protein product							Standard	NM_030903		Approved	hs6M1-15	uc003nlw.2	Q9Y3N9	OTTHUMG00000031048	ENST00000377175.1:c.160C>A	6.37:g.29012793G>T	ENSP00000366380:p.Gln54Lys		Somatic					p.Q54K	NM_030903	NP_112165	WXS	Illumina HiSeq	Unspecified	Q9Y3N9	OR2W1_HUMAN			1	160	-			54			Cytoplasmic (Potential).		B0S7Y5|Q5JNZ1|Q6IEU0|Q96R17|Q9GZL0|Q9GZL1	Missense_Mutation	SNP	ENST00000377175.1	37	c.160C>A	CCDS4656.1	.	.	.	.	.	.	.	.	.	.	G	0.151	-1.091908	0.01858	.	.	ENSG00000204704	ENST00000377175	T	0.00575	6.46	4.78	3.91	0.45181	GPCR, rhodopsin-like superfamily (1);	0.804563	0.11105	N	0.599240	T	0.00109	0.0003	N	0.04132	-0.27	0.09310	N	1	B	0.19445	0.036	B	0.12837	0.008	T	0.10636	-1.0621	10	0.18276	T	0.48	.	7.1464	0.25585	0.0893:0.0:0.7424:0.1683	.	54	Q9Y3N9	OR2W1_HUMAN	K	54	ENSP00000366380:Q54K	ENSP00000366380:Q54K	Q	-	1	0	OR2W1	29120772	0.000000	0.05858	0.698000	0.30274	0.236000	0.25371	-2.308000	0.01131	0.978000	0.38470	0.585000	0.79938	CAG		0.428	OR2W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076053.2			38	106	1	0	1.84e-18	2.7e-18	38	106				
PPP1R11	6992	broad.mit.edu	37	6	30035206	30035206	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:30035206G>A	ENST00000376772.3	+	1	342	c.19G>A	c.(19-21)Ggg>Agg	p.G7R	PPP1R11_ENST00000376765.2_5'Flank|PPP1R11_ENST00000376763.1_5'Flank|PPP1R11_ENST00000376769.2_5'UTR|PPP1R11_ENST00000376758.1_5'Flank|PPP1R11_ENST00000376773.1_Intron	NM_021959.2	NP_068778.1	O60927	PP1RB_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 11	7						cytoplasm (GO:0005737)	protein phosphatase inhibitor activity (GO:0004864)			lung(2)|ovary(1)|prostate(1)|skin(2)	6						GGCAGGGGCTGGGCTGAGCGA	0.612																																					Pancreas(185;1767 3918 43793)	uc003npb.2		NA																	0				ovary(1)|lung(1)|skin(1)	3						c.(19-21)GGG>AGG		protein phosphatase 1, regulatory (inhibitor)							57.0	55.0	56.0					6																	30035206		2203	4300	6503	SO:0001583	missense	6992					soluble fraction	protein binding|protein phosphatase inhibitor activity	g.chr6:30035206G>A	X81003	CCDS4671.1	6p21.3	2012-04-17			ENSG00000204619	ENSG00000204619		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9285	protein-coding gene	gene with protein product		606670		TCTE5		9843442, 8781118	Standard	NM_021959		Approved	HCGV, Tctex5, HCG-V	uc003npb.3	O60927	OTTHUMG00000031260	ENST00000376772.3:c.19G>A	6.37:g.30035206G>A	ENSP00000365963:p.Gly7Arg		Somatic				PPP1R11_uc010jrw.2_RNA|PPP1R11_uc003npc.2_RNA	p.G7R	NM_021959	NP_068778	WXS	Illumina HiSeq	Unspecified	O60927	PP1RB_HUMAN			1	275	+			7						Missense_Mutation	SNP	ENST00000376772.3	37	c.19G>A	CCDS4671.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.107276	0.77096	.	.	ENSG00000204619	ENST00000376772	.	.	.	5.15	3.39	0.38822	.	0.189098	0.45361	N	0.000364	T	0.15696	0.0378	N	0.24115	0.695	0.80722	D	1	P	0.50943	0.94	B	0.41088	0.347	T	0.02226	-1.1192	9	0.31617	T	0.26	-0.3005	7.7114	0.28679	0.1873:0.0:0.8127:0.0	.	7	O60927	PP1RB_HUMAN	R	7	.	ENSP00000365963:G7R	G	+	1	0	PPP1R11	30143185	1.000000	0.71417	0.994000	0.49952	0.979000	0.70002	3.474000	0.53129	0.773000	0.33404	0.643000	0.83706	GGG		0.612	PPP1R11-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076557.3	NM_021959		27	100	0	0	0	0	27	100				
TRIM39	56658	broad.mit.edu	37	6	30309588	30309588	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:30309588C>T	ENST00000396547.1	+	8	1269	c.1109C>T	c.(1108-1110)cCt>cTt	p.P370L	TRIM39_ENST00000540416.1_Missense_Mutation_p.P340L|TRIM39_ENST00000376656.4_Missense_Mutation_p.P370L|TRIM39_ENST00000396548.1_Missense_Mutation_p.P340L|TRIM39_ENST00000396551.3_Missense_Mutation_p.P340L|TRIM39_ENST00000376659.5_Missense_Mutation_p.P340L|TRIM39-RPP21_ENST00000513556.1_Missense_Mutation_p.P252L			Q9HCM9	TRI39_HUMAN	tripartite motif containing 39	370	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				apoptotic process (GO:0006915)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|positive regulation of apoptotic signaling pathway (GO:2001235)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			ovary(3)	3						CGGGATCTCCCTGACACACCA	0.572																																						uc010jrz.2		NA																	0				ovary(3)	3						c.(1108-1110)CCT>CTT		tripartite motif-containing 39 isoform 1							126.0	80.0	97.0					6																	30309588		1511	2709	4220	SO:0001583	missense	56658				apoptosis	cytosol|mitochondrion	identical protein binding|zinc ion binding	g.chr6:30309588C>T	BC034985	CCDS34377.1, CCDS34378.1	6p22.1	2013-01-09	2011-01-25	2002-06-07	ENSG00000204599	ENSG00000204599		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10065	protein-coding gene	gene with protein product		605700	"""ring finger protein 23"", ""tripartite motif-containing 39"""	RNF23		11006080	Standard	NM_021253		Approved			Q9HCM9	OTTHUMG00000031066	ENST00000396547.1:c.1109C>T	6.37:g.30309588C>T	ENSP00000379796:p.Pro370Leu		Somatic				TRIM39_uc003npz.2_Missense_Mutation_p.P340L|TRIM39_uc003nqb.2_Missense_Mutation_p.P340L|TRIM39_uc003nqc.2_Missense_Mutation_p.P340L|TRIM39_uc010jsa.1_Missense_Mutation_p.P340L	p.P370L	NM_021253	NP_067076	WXS	Illumina HiSeq	Unspecified	Q9HCM9	TRI39_HUMAN			9	1421	+			370			B30.2/SPRY.		Q5STG3|Q5STG4|Q76BL3|Q8IYT9|Q96IB6	Missense_Mutation	SNP	ENST00000396547.1	37	c.1109C>T	CCDS34377.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.291659	0.80914	.	.	ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000248167	ENST00000396551;ENST00000376656;ENST00000545104;ENST00000540416;ENST00000449040;ENST00000412529;ENST00000396548;ENST00000376659;ENST00000396547;ENST00000513556	T;T;T;T;T;T;T	0.20200	2.09;2.09;2.09;2.09;2.09;2.09;2.09	5.78	4.91	0.64330	Concanavalin A-like lectin/glucanase (1);SPRY-associated (1);B30.2/SPRY domain (1);	0.000000	0.64402	D	0.000001	T	0.27629	0.0679	M	0.88310	2.945	0.80722	D	1	B;P;P	0.45957	0.049;0.869;0.525	B;P;B	0.47645	0.058;0.553;0.213	T	0.21143	-1.0254	10	0.56958	D	0.05	.	12.6087	0.56538	0.0:0.9202:0.0:0.0798	.	254;370;340	F5H2V3;Q9HCM9;Q9HCM9-2	.;TRI39_HUMAN;.	L	340;370;370;340;340;254;340;340;370;252	ENSP00000379800:P340L;ENSP00000365844:P370L;ENSP00000439400:P340L;ENSP00000379797:P340L;ENSP00000365847:P340L;ENSP00000379796:P370L;ENSP00000424048:P252L	ENSP00000365844:P370L	P	+	2	0	TRIM39-RPP21;TRIM39	30417567	0.192000	0.23301	0.997000	0.53966	0.989000	0.77384	2.666000	0.46799	1.452000	0.47756	0.655000	0.94253	CCT		0.572	TRIM39-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076086.2	NM_172016		15	40	0	0	0	0	15	40				
DNAH8	1769	broad.mit.edu	37	6	38754683	38754683	+	Silent	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:38754683G>A	ENST00000359357.3	+	16	2141	c.1887G>A	c.(1885-1887)ttG>ttA	p.L629L	DNAH8_ENST00000441566.1_Silent_p.L629L|DNAH8_ENST00000449981.2_Silent_p.L846L			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	629					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						CAAAGAGATTGCTAAAATTGG	0.308																																						uc003ooe.1		NA																	0				skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						c.(1885-1887)TTG>TTA		dynein, axonemal, heavy polypeptide 8							79.0	82.0	81.0					6																	38754683		2203	4300	6503	SO:0001819	synonymous_variant	1769							g.chr6:38754683G>A	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.1887G>A	6.37:g.38754683G>A			Somatic					p.L629L	NM_001371	NP_001362	WXS	Illumina HiSeq	Unspecified					16	2487	+								O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Silent	SNP	ENST00000359357.3	37	c.1887G>A																																																																																					0.308	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927		13	52	0	0	0	0	13	52				
KIF6	221458	broad.mit.edu	37	6	39353414	39353414	+	Missense_Mutation	SNP	T	T	C	rs375315494		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:39353414T>C	ENST00000287152.7	-	16	1939	c.1845A>G	c.(1843-1845)atA>atG	p.I615M	KIF6_ENST00000373213.4_Missense_Mutation_p.I454M|KIF6_ENST00000538893.1_Missense_Mutation_p.I559M|KIF6_ENST00000373215.3_Intron|KIF6_ENST00000373216.3_Missense_Mutation_p.I615M|KIF6_ENST00000229913.5_Missense_Mutation_p.I66M|KIF6_ENST00000541946.1_Missense_Mutation_p.I66M|KIF6_ENST00000394362.1_Missense_Mutation_p.I66M	NM_145027.4	NP_659464.3	Q6ZMV9	KIF6_HUMAN	kinesin family member 6	615					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|male germ cell nucleus (GO:0001673)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(16)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						CTACTTGCTGTATATGCCGCT	0.448																																						uc003oot.2		NA																	0				breast(2)|central_nervous_system(1)	3						c.(1843-1845)ATA>ATG		kinesin family member 6		T	MET/ILE	1,4405	2.1+/-5.4	0,1,2202	132.0	124.0	127.0		1845	-1.0	0.5	6		127	0,8600		0,0,4300	no	missense	KIF6	NM_145027.4	10	0,1,6502	CC,CT,TT		0.0,0.0227,0.0077	benign	615/815	39353414	1,13005	2203	4300	6503	SO:0001583	missense	221458				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding	g.chr6:39353414T>C	AL832634	CCDS4844.1, CCDS75449.1	6p21.2	2010-03-30			ENSG00000164627	ENSG00000164627		"""Kinesins"""	21202	protein-coding gene	gene with protein product		613919	"""chromosome 6 open reading frame 102"""	C6orf102			Standard	NM_145027		Approved	dJ1043E3.1, MGC33317, dJ137F1.4, dJ188D3.1, DKFZp451I2418	uc003oot.2	Q6ZMV9	OTTHUMG00000014648	ENST00000287152.7:c.1845A>G	6.37:g.39353414T>C	ENSP00000287152:p.Ile615Met		Somatic				KIF6_uc003oos.2_Missense_Mutation_p.I66M|KIF6_uc010jwz.1_Translation_Start_Site|KIF6_uc010jxa.1_Missense_Mutation_p.I406M|KIF6_uc011dua.1_Intron|KIF6_uc010jxb.1_Missense_Mutation_p.I559M	p.I615M	NM_145027	NP_659464	WXS	Illumina HiSeq	Unspecified	Q6ZMV9	KIF6_HUMAN			16	1940	-			615			Potential.		Q2MDE3|Q2MDE4|Q5T8J6|Q6ZWE3|Q86T87|Q8WTV4	Missense_Mutation	SNP	ENST00000287152.7	37	c.1845A>G	CCDS4844.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	6.873|6.873	0.530509|0.530509	0.13127|0.13127	2.27E-4|2.27E-4	0.0|0.0	ENSG00000164627|ENSG00000164627	ENST00000287152;ENST00000394362;ENST00000373216;ENST00000373213;ENST00000229913;ENST00000538893;ENST00000541946;ENST00000540362|ENST00000458470	T;T;T;T;T;T;T|.	0.42131|.	0.98;0.98;0.98;0.98;0.98;0.98;0.98|.	5.73|5.73	-0.982|-0.982	0.10266|0.10266	.|.	.|.	.|.	.|.	.|.	T|T	0.02688|0.02688	0.0081|0.0081	N|N	0.04508|0.04508	-0.205|-0.205	0.25985|0.25985	N|N	0.982328|0.982328	B;B;B|.	0.10296|.	0.001;0.003;0.001|.	B;B;B|.	0.08055|.	0.002;0.003;0.001|.	T|T	0.41910|0.41910	-0.9482|-0.9482	9|5	0.32370|.	T|.	0.25|.	.|.	2.5079|2.5079	0.04649|0.04649	0.2238:0.4316:0.2459:0.0987|0.2238:0.4316:0.2459:0.0987	.|.	559;615;615|.	F6VGH2;Q6ZMV9-3;Q6ZMV9|.	.;.;KIF6_HUMAN|.	M|C	615;66;615;454;66;559;66;66|507	ENSP00000287152:I615M;ENSP00000377889:I66M;ENSP00000362312:I615M;ENSP00000362309:I454M;ENSP00000229913:I66M;ENSP00000441435:I559M;ENSP00000439064:I66M|.	ENSP00000229913:I66M|.	I|Y	-|-	3|2	3|0	KIF6|KIF6	39461392|39461392	0.987000|0.987000	0.35691|0.35691	0.516000|0.516000	0.27786|0.27786	0.521000|0.521000	0.34408|0.34408	-0.018000|-0.018000	0.12568|0.12568	-0.416000|-0.416000	0.07473|0.07473	-0.327000|-0.327000	0.08410|0.08410	ATA|TAC		0.448	KIF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040455.2	NM_145027		15	74	0	0	0	0	15	74				
UBR2	23304	broad.mit.edu	37	6	42613293	42613293	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:42613293G>A	ENST00000372899.1	+	21	2632	c.2374G>A	c.(2374-2376)Gct>Act	p.A792T	UBR2_ENST00000372883.3_Missense_Mutation_p.A296T|UBR2_ENST00000372901.1_Missense_Mutation_p.A792T	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2	792					cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			CAAGCCTATGGCTCATAGTGA	0.373																																						uc011dur.1		NA																	0				ovary(3)|pancreas(1)	4						c.(2374-2376)GCT>ACT		ubiquitin protein ligase E3 component n-recognin							116.0	110.0	112.0					6																	42613293		2203	4300	6503	SO:0001583	missense	23304				cellular response to leucine|chromatin silencing|histone H2A ubiquitination|negative regulation of TOR signaling cascade	nucleus|plasma membrane	leucine binding|zinc ion binding	g.chr6:42613293G>A	BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.2374G>A	6.37:g.42613293G>A	ENSP00000361990:p.Ala792Thr		Somatic				UBR2_uc011dus.1_Missense_Mutation_p.A437T|UBR2_uc003osh.2_RNA	p.A792T	NM_015255	NP_056070	WXS	Illumina HiSeq	Unspecified	Q8IWV8	UBR2_HUMAN	Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)		21	2374	+	Colorectal(47;0.196)		792					O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Missense_Mutation	SNP	ENST00000372899.1	37	c.2374G>A	CCDS4870.1	.	.	.	.	.	.	.	.	.	.	G	35	5.413453	0.96072	.	.	ENSG00000024048	ENST00000372899;ENST00000372901;ENST00000372883	T;T;T	0.50813	0.73;0.73;0.73	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.41719	0.1171	L	0.28344	0.845	0.80722	D	1	D;B	0.89917	1.0;0.391	D;B	0.91635	0.999;0.227	T	0.15954	-1.0419	10	0.02654	T	1	-20.5081	19.9659	0.97266	0.0:0.0:1.0:0.0	.	792;792	Q8IWV8-4;Q8IWV8	.;UBR2_HUMAN	T	792;792;296	ENSP00000361990:A792T;ENSP00000361992:A792T;ENSP00000361974:A296T	ENSP00000361974:A296T	A	+	1	0	UBR2	42721271	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.301000	0.96167	2.802000	0.96397	0.650000	0.86243	GCT		0.373	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040558.2	NM_015255		28	82	0	0	0	0	28	82				
PTCHD4	442213	broad.mit.edu	37	6	47846286	47846286	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:47846286G>T	ENST00000339488.4	-	3	2327	c.2294C>A	c.(2293-2295)tCt>tAt	p.S765Y		NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	765						integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)										AATAAGAAAAGAAGTAACATT	0.443																																						uc011dwm.1		NA																	0				central_nervous_system(1)	1						c.(2242-2244)TCT>TAT		hypothetical protein LOC442213							77.0	74.0	75.0					6																	47846286		2203	4300	6503	SO:0001583	missense	442213					integral to membrane	hedgehog receptor activity	g.chr6:47846286G>T		CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.2294C>A	6.37:g.47846286G>T	ENSP00000341914:p.Ser765Tyr		Somatic				C6orf138_uc011dwn.1_Missense_Mutation_p.S512Y	p.S748Y	NM_001013732	NP_001013754	WXS	Illumina HiSeq	Unspecified	Q6ZW05	CF138_HUMAN			3	2328	-			765			Helical; (Potential).		B0QZ29|B4DRK3|Q5T884	Missense_Mutation	SNP	ENST00000339488.4	37	c.2243C>A	CCDS34473.2	.	.	.	.	.	.	.	.	.	.	G	15.75	2.926747	0.52759	.	.	ENSG00000244694	ENST00000339488	D	0.94330	-3.4	6.01	6.01	0.97437	.	0.112927	0.64402	D	0.000008	D	0.90810	0.7114	L	0.50333	1.59	0.80722	D	1	B	0.30937	0.301	B	0.34590	0.186	D	0.89351	0.3661	10	0.87932	D	0	.	20.5211	0.99222	0.0:0.0:1.0:0.0	.	765	Q6ZW05	CF138_HUMAN	Y	765	ENSP00000341914:S765Y	ENSP00000341914:S765Y	S	-	2	0	C6orf138	47954245	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.651000	0.67951	2.861000	0.98227	0.650000	0.86243	TCT		0.443	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317987.2	NM_001013732		12	36	1	0	0.000978159	0.00108025	12	36				
PGK2	5232	broad.mit.edu	37	6	49754394	49754394	+	Silent	SNP	T	T	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:49754394T>C	ENST00000304801.3	-	1	659	c.507A>G	c.(505-507)gcA>gcG	p.A169A		NM_138733.4	NP_620061.2	P07205	PGK2_HUMAN	phosphoglycerate kinase 2	169					glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)			autonomic_ganglia(1)|endometrium(3)|large_intestine(12)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	47	Lung NSC(77;0.0402)					GAGCGCGGTGTGCAGTGCCAA	0.453																																						uc003ozu.2		NA																	0				ovary(1)	1						c.(505-507)GCA>GCG		phosphoglycerate kinase 2							96.0	94.0	95.0					6																	49754394		2203	4300	6503	SO:0001819	synonymous_variant	5232				glycolysis	cytosol	ATP binding|phosphoglycerate kinase activity	g.chr6:49754394T>C	K03019	CCDS4930.1	6p12.3	2012-09-20		2002-04-19	ENSG00000170950	ENSG00000170950			8898	protein-coding gene	gene with protein product		172270				3839763, 3453121	Standard	NM_138733		Approved	PGKPS, PGK-2	uc003ozu.3	P07205	OTTHUMG00000014824	ENST00000304801.3:c.507A>G	6.37:g.49754394T>C			Somatic					p.A169A	NM_138733	NP_620061	WXS	Illumina HiSeq	Unspecified	P07205	PGK2_HUMAN			1	614	-	Lung NSC(77;0.0402)		169					B2R6Y8|Q9H107	Silent	SNP	ENST00000304801.3	37	c.507A>G	CCDS4930.1																																																																																				0.453	PGK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040872.1			28	73	0	0	0	0	28	73				
PKHD1	5314	broad.mit.edu	37	6	51927386	51927386	+	Missense_Mutation	SNP	T	T	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:51927386T>A	ENST00000371117.3	-	14	1324	c.1049A>T	c.(1048-1050)tAc>tTc	p.Y350F	AL590391.1_ENST00000408630.2_RNA|PKHD1_ENST00000340994.4_Missense_Mutation_p.Y350F	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	350					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					CTGCCACCTGTACCCTGGGGT	0.483																																						uc003pah.1		NA																	0				lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44						c.(1048-1050)TAC>TTC		fibrocystin isoform 1							171.0	158.0	162.0					6																	51927386		2203	4300	6503	SO:0001583	missense	5314				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity	g.chr6:51927386T>A	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.1049A>T	6.37:g.51927386T>A	ENSP00000360158:p.Tyr350Phe		Somatic				PKHD1_uc003pai.2_Missense_Mutation_p.Y350F	p.Y350F	NM_138694	NP_619639	WXS	Illumina HiSeq	Unspecified	P08F94	PKHD1_HUMAN			14	1325	-	Lung NSC(77;0.0605)		350			Extracellular (Potential).		Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	c.1049A>T	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	T	27.0	4.791131	0.90367	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	T;T	0.73047	-0.71;-0.71	5.65	5.65	0.86999	Cell surface receptor IPT/TIG (1);	0.000000	0.64402	D	0.000005	T	0.79021	0.4376	M	0.81802	2.56	0.30450	N	0.775352	D;D	0.89917	0.999;1.0	D;D	0.80764	0.994;0.989	T	0.76553	-0.2917	10	0.34782	T	0.22	.	15.05	0.71862	0.0:0.0:0.0:1.0	.	350;350	P08F94-2;P08F94	.;PKHD1_HUMAN	F	350	ENSP00000360158:Y350F;ENSP00000341097:Y350F	ENSP00000341097:Y350F	Y	-	2	0	PKHD1	52035345	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	5.282000	0.65615	2.150000	0.67090	0.533000	0.62120	TAC		0.483	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694		49	118	0	0	0	0	49	118				
ZNF451	26036	broad.mit.edu	37	6	57012801	57012801	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:57012801C>T	ENST00000370706.4	+	10	2162	c.1918C>T	c.(1918-1920)Cac>Tac	p.H640Y	RP11-203B9.4_ENST00000591553.1_RNA|RP11-203B9.4_ENST00000586432.1_RNA|ZNF451_ENST00000357489.3_Missense_Mutation_p.H640Y|RP11-203B9.4_ENST00000587815.1_RNA|RP11-203B9.4_ENST00000586053.1_RNA|RP11-203B9.4_ENST00000589549.1_RNA|RP11-203B9.4_ENST00000586668.1_RNA|RP11-203B9.4_ENST00000416069.2_RNA|RP11-203B9.4_ENST00000586466.1_RNA|RP11-203B9.4_ENST00000588811.1_RNA|RP11-203B9.4_ENST00000592500.1_RNA|ZNF451_ENST00000491832.2_Missense_Mutation_p.H640Y|RP11-203B9.4_ENST00000585792.1_RNA|RP11-203B9.4_ENST00000589263.1_RNA|RP11-203B9.4_ENST00000592038.1_RNA	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451	640					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			CAGCTGTGCTCACTGCAGAAA	0.398																																						uc003pdm.1		NA																	0				ovary(1)|pancreas(1)	2						c.(1918-1920)CAC>TAC		zinc finger protein 451 isoform 1							86.0	87.0	87.0					6																	57012801		2202	4299	6501	SO:0001583	missense	26036				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr6:57012801C>T	AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.1918C>T	6.37:g.57012801C>T	ENSP00000359740:p.His640Tyr		Somatic				ZNF451_uc003pdl.2_Missense_Mutation_p.H640Y|ZNF451_uc003pdn.1_Missense_Mutation_p.H640Y|uc003pdq.1_Intron|ZNF451_uc003pdk.1_Missense_Mutation_p.H640Y	p.H640Y	NM_001031623	NP_001026794	WXS	Illumina HiSeq	Unspecified	Q9Y4E5	ZN451_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)		10	2142	+	Lung NSC(77;0.145)		640			C2H2-type 8.		Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	Missense_Mutation	SNP	ENST00000370706.4	37	c.1918C>T	CCDS43477.1	.	.	.	.	.	.	.	.	.	.	C	11.44	1.639118	0.29157	.	.	ENSG00000112200	ENST00000370706;ENST00000357489;ENST00000491832	T;T;T	0.19532	2.14;2.15;2.15	5.13	5.13	0.70059	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.193800	0.41938	D	0.000792	T	0.07458	0.0188	M	0.67953	2.075	0.58432	D	0.999997	P;P;P;P	0.46621	0.672;0.602;0.881;0.602	B;B;B;B	0.40285	0.137;0.088;0.325;0.088	T	0.23976	-1.0173	10	0.02654	T	1	-15.0383	5.4159	0.16374	0.3256:0.5564:0.0:0.118	.	640;640;640;640	Q9Y4E5-2;Q9Y4E5;E9PH99;Q4KMR5	.;ZN451_HUMAN;.;.	Y	640	ENSP00000359740:H640Y;ENSP00000350083:H640Y;ENSP00000421645:H640Y	ENSP00000350083:H640Y	H	+	1	0	ZNF451	57120760	0.992000	0.36948	0.991000	0.47740	0.927000	0.56198	2.059000	0.41384	2.541000	0.85698	0.557000	0.71058	CAC		0.398	ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041035.2	NM_015555		31	105	0	0	0	0	31	105				
BAI3	577	broad.mit.edu	37	6	69653751	69653751	+	Missense_Mutation	SNP	T	T	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:69653751T>C	ENST00000370598.1	+	6	1881	c.1060T>C	c.(1060-1062)Tgg>Cgg	p.W354R		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	354	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				ATGGTCACCATGGAGTTTATG	0.413																																						uc003pev.3		NA																	0				lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50						c.(1060-1062)TGG>CGG		brain-specific angiogenesis inhibitor 3							236.0	190.0	206.0					6																	69653751		2203	4300	6503	SO:0001583	missense	577				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr6:69653751T>C	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.1060T>C	6.37:g.69653751T>C	ENSP00000359630:p.Trp354Arg		Somatic				BAI3_uc010kak.2_Missense_Mutation_p.W354R	p.W354R	NM_001704	NP_001695	WXS	Illumina HiSeq	Unspecified	O60242	BAI3_HUMAN			6	1508	+		all_lung(197;0.212)	354			Extracellular (Potential).|TSP type-1 2.		B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	ENST00000370598.1	37	c.1060T>C	CCDS4968.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.333455	0.81801	.	.	ENSG00000135298	ENST00000370598	T	0.77489	-1.1	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	D	0.92625	0.7657	H	0.99619	4.66	0.80722	D	1	D	0.69078	0.997	D	0.68621	0.959	D	0.95541	0.8612	10	0.66056	D	0.02	.	15.1528	0.72713	0.0:0.0:0.0:1.0	.	354	O60242	BAI3_HUMAN	R	354	ENSP00000359630:W354R	ENSP00000359630:W354R	W	+	1	0	BAI3	69710472	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.868000	0.87116	2.159000	0.67721	0.528000	0.53228	TGG		0.413	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1			51	148	0	0	0	0	51	148				
BAI3	577	broad.mit.edu	37	6	69703837	69703837	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:69703837G>T	ENST00000370598.1	+	11	2733	c.1912G>T	c.(1912-1914)Gca>Tca	p.A638S		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	638					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				TTACATCCCTGCATCTGATGG	0.453																																						uc003pev.3		NA																	0				lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50						c.(1912-1914)GCA>TCA		brain-specific angiogenesis inhibitor 3							88.0	87.0	87.0					6																	69703837		2203	4300	6503	SO:0001583	missense	577				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr6:69703837G>T	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.1912G>T	6.37:g.69703837G>T	ENSP00000359630:p.Ala638Ser		Somatic				BAI3_uc010kak.2_Missense_Mutation_p.A638S	p.A638S	NM_001704	NP_001695	WXS	Illumina HiSeq	Unspecified	O60242	BAI3_HUMAN			11	2360	+		all_lung(197;0.212)	638			Extracellular (Potential).		B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	ENST00000370598.1	37	c.1912G>T	CCDS4968.1	.	.	.	.	.	.	.	.	.	.	G	4.436	0.080687	0.08533	.	.	ENSG00000135298	ENST00000370598	T	0.10288	2.89	6.05	4.21	0.49690	Domain of unknown function DUF3497 (1);	0.197396	0.44285	D	0.000467	T	0.01661	0.0053	N	0.04959	-0.14	0.80722	D	1	B	0.18013	0.025	B	0.15052	0.012	T	0.33979	-0.9847	10	0.05959	T	0.93	.	16.7148	0.85395	0.0:0.2442:0.7558:0.0	.	638	O60242	BAI3_HUMAN	S	638	ENSP00000359630:A638S	ENSP00000359630:A638S	A	+	1	0	BAI3	69760558	1.000000	0.71417	0.983000	0.44433	0.947000	0.59692	4.854000	0.62918	0.831000	0.34780	-0.182000	0.12963	GCA		0.453	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1			24	68	1	0	4.4e-07	5.48e-07	24	68				
MYO6	4646	broad.mit.edu	37	6	76624544	76624544	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:76624544G>T	ENST00000369977.3	+	35	3812	c.3673G>T	c.(3673-3675)Gag>Tag	p.E1225*	MYO6_ENST00000369975.1_Nonsense_Mutation_p.E1193*|MYO6_ENST00000369981.3_Nonsense_Mutation_p.E1226*|MYO6_ENST00000369985.4_Nonsense_Mutation_p.E1202*	NM_004999.3	NP_004990.3	Q9UM54	MYO6_HUMAN	myosin VI	1234					actin filament-based movement (GO:0030048)|auditory receptor cell differentiation (GO:0042491)|cellular response to electrical stimulus (GO:0071257)|dendrite development (GO:0016358)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|endocytosis (GO:0006897)|glutamate secretion (GO:0014047)|inner ear morphogenesis (GO:0042472)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein targeting (GO:0006605)|regulation of secretion (GO:0051046)|regulation of synaptic plasticity (GO:0048167)|response to drug (GO:0042493)|sensory perception of sound (GO:0007605)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell cortex (GO:0005938)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microvillus (GO:0005902)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|unconventional myosin complex (GO:0016461)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|minus-end directed microfilament motor activity (GO:0060001)|motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(16)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	58		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		GGACGACATGGAGATGTGTGA	0.448																																						uc003pih.1		NA																	0				kidney(1)|pancreas(1)	2						c.(3673-3675)GAG>TAG		myosin VI							112.0	96.0	102.0					6																	76624544		2203	4300	6503	SO:0001587	stop_gained	4646				actin filament-based movement|DNA damage response, signal transduction by p53 class mediator|endocytosis|intracellular protein transport|positive regulation of transcription from RNA polymerase II promoter|regulation of secretion|sensory perception of sound|synaptic transmission	cell cortex|clathrin coated vesicle membrane|coated pit|cytosol|DNA-directed RNA polymerase II, holoenzyme|filamentous actin|Golgi apparatus|nuclear membrane|perinuclear region of cytoplasm|ruffle membrane|unconventional myosin complex	actin filament binding|ADP binding|ATP binding|calmodulin binding|minus-end directed microfilament motor activity|protein binding	g.chr6:76624544G>T	U90236, AB002387	CCDS34487.1, CCDS75481.1	6q14.1	2014-09-17	2004-05-19		ENSG00000196586	ENSG00000196586		"""Myosins / Myosin superfamily : Class VI"""	7605	protein-coding gene	gene with protein product		600970	"""deafness, autosomal recessive 37"""	DFNA22, DFNB37		9259267, 11468689	Standard	XM_005248719		Approved	KIAA0389	uc003pih.1	Q9UM54	OTTHUMG00000015061	ENST00000369977.3:c.3673G>T	6.37:g.76624544G>T	ENSP00000358994:p.Glu1225*		Somatic				MYO6_uc003pii.1_Nonsense_Mutation_p.E1202*|MYO6_uc003pij.1_Nonsense_Mutation_p.E173*	p.E1225*	NM_004999	NP_004990	WXS	Illumina HiSeq	Unspecified	Q9UM54	MYO6_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.223)	35	3952	+		all_hematologic(105;0.189)	1234					A6H8V4|E1P540|Q5TEM5|Q5TEM6|Q5TEM7|Q9BZZ7|Q9UEG2	Nonsense_Mutation	SNP	ENST00000369977.3	37	c.3673G>T	CCDS34487.1	.	.	.	.	.	.	.	.	.	.	G	44	10.991807	0.99499	.	.	ENSG00000196586	ENST00000428345;ENST00000369981;ENST00000369985;ENST00000369977;ENST00000369975	.	.	.	6.07	6.07	0.98685	.	0.054218	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	20.6439	0.99570	0.0:0.0:1.0:0.0	.	.	.	.	X	1235;1226;1202;1225;1193	.	ENSP00000358992:E1193X	E	+	1	0	MYO6	76681264	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.447000	0.97595	2.884000	0.98904	0.655000	0.94253	GAG		0.448	MYO6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041279.2	NM_004999		11	60	1	0	2.81e-09	3.7e-09	11	60				
IMPG1	3617	broad.mit.edu	37	6	76715168	76715168	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:76715168G>T	ENST00000369950.3	-	10	1160	c.971C>A	c.(970-972)tCt>tAt	p.S324Y	IMPG1_ENST00000369963.3_3'UTR	NM_001282368.1|NM_001563.2	NP_001269297.1|NP_001554.2			interphotoreceptor matrix proteoglycan 1											breast(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(8)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	63		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				GGAATCAAAAGACAGGAGGTC	0.453																																					Pancreas(37;839 1141 2599 26037)	uc003pik.1		NA																	0				ovary(2)|skin(1)	3						c.(970-972)TCT>TAT		interphotoreceptor matrix proteoglycan 1							149.0	136.0	140.0					6																	76715168		2203	4300	6503	SO:0001583	missense	3617				visual perception	proteinaceous extracellular matrix	extracellular matrix structural constituent|receptor activity	g.chr6:76715168G>T	AF017776	CCDS4985.1, CCDS75483.1	6q14.2-q15	2008-02-05	2004-05-25		ENSG00000112706	ENSG00000112706			6055	protein-coding gene	gene with protein product		602870	"""sialoprotein associated with cones and rods"""	SPACR			Standard	NM_001282368		Approved	IPM150, GP147	uc003pik.1	Q17R60	OTTHUMG00000015063	ENST00000369950.3:c.971C>A	6.37:g.76715168G>T	ENSP00000358966:p.Ser324Tyr		Somatic					p.S324Y	NM_001563	NP_001554	WXS	Illumina HiSeq	Unspecified	Q17R60	IMPG1_HUMAN			10	1101	-		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)	324			SEA 1.			Missense_Mutation	SNP	ENST00000369950.3	37	c.971C>A	CCDS4985.1	.	.	.	.	.	.	.	.	.	.	G	18.50	3.636826	0.67130	.	.	ENSG00000112706	ENST00000369950	T	0.35789	1.29	5.82	5.82	0.92795	SEA (2);	0.551000	0.17852	N	0.159840	T	0.53514	0.1801	M	0.66939	2.045	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.53041	-0.8494	10	0.72032	D	0.01	.	17.8861	0.88855	0.0:0.0:1.0:0.0	.	324	Q17R60	IMPG1_HUMAN	Y	324	ENSP00000358966:S324Y	ENSP00000358966:S324Y	S	-	2	0	IMPG1	76771888	0.998000	0.40836	0.204000	0.23530	0.728000	0.41692	4.359000	0.59449	2.767000	0.95098	0.585000	0.79938	TCT		0.453	IMPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041288.1	NM_001563		26	108	1	0	1.18e-14	1.68e-14	26	108				
HTR1E	3354	broad.mit.edu	37	6	87725859	87725859	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:87725859C>A	ENST00000305344.5	+	2	1510	c.807C>A	c.(805-807)gaC>gaA	p.D269E		NM_000865.2	NP_000856.1	P28566	5HT1E_HUMAN	5-hydroxytryptamine (serotonin) receptor 1E, G protein-coupled	269					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(3)|endometrium(2)|kidney(3)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(3)	41		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)		BRCA - Breast invasive adenocarcinoma(108;0.055)	Aripiprazole(DB01238)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ketamine(DB01221)|Loxapine(DB00408)|Methysergide(DB00247)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	CCCCCTTCGACAATGATCTAG	0.502																																						uc003pli.2		NA																	0				ovary(2)|skin(1)	3						c.(805-807)GAC>GAA		5-hydroxytryptamine (serotonin) receptor 1E	Eletriptan(DB00216)						167.0	161.0	163.0					6																	87725859		2203	4300	6503	SO:0001583	missense	3354				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane	protein binding|serotonin binding|serotonin receptor activity	g.chr6:87725859C>A		CCDS5006.1	6q14-q15	2013-06-19	2012-02-03		ENSG00000168830	ENSG00000168830		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5291	protein-coding gene	gene with protein product		182132	"""5-hydroxytryptamine (serotonin) receptor 1E"""			1608964	Standard	NM_000865		Approved	5-HT1E	uc003pli.3	P28566	OTTHUMG00000015154	ENST00000305344.5:c.807C>A	6.37:g.87725859C>A	ENSP00000307766:p.Asp269Glu		Somatic					p.D269E	NM_000865	NP_000856	WXS	Illumina HiSeq	Unspecified	P28566	5HT1E_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.055)	2	1510	+		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)	269			Cytoplasmic (By similarity).		E1P503|Q9P1Y1	Missense_Mutation	SNP	ENST00000305344.5	37	c.807C>A	CCDS5006.1	.	.	.	.	.	.	.	.	.	.	C	0.024	-1.386493	0.01194	.	.	ENSG00000168830	ENST00000305344;ENST00000369584	T;T	0.64803	-0.12;-0.12	4.24	3.35	0.38373	GPCR, rhodopsin-like superfamily (1);	0.173864	0.36303	U	0.002679	T	0.07143	0.0181	N	0.00652	-1.29	0.27434	N	0.953904	B	0.06786	0.001	B	0.09377	0.004	T	0.41822	-0.9487	10	0.02654	T	1	.	5.4603	0.16614	0.0:0.6223:0.1898:0.188	.	269	P28566	5HT1E_HUMAN	E	269	ENSP00000307766:D269E;ENSP00000358597:D269E	ENSP00000307766:D269E	D	+	3	2	HTR1E	87782578	1.000000	0.71417	1.000000	0.80357	0.443000	0.32047	1.303000	0.33470	1.932000	0.55993	0.205000	0.17691	GAC		0.502	HTR1E-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472488.2	NM_000865		67	218	1	0	4.67e-28	7.24e-28	67	218				
GABRR1	2569	broad.mit.edu	37	6	89888653	89888653	+	Missense_Mutation	SNP	G	G	T	rs549063825		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:89888653G>T	ENST00000454853.2	-	10	1386	c.1276C>A	c.(1276-1278)Cag>Aag	p.Q426K	GABRR1_ENST00000369451.3_Missense_Mutation_p.Q339K|GABRR1_ENST00000435811.1_Missense_Mutation_p.Q409K	NM_001256704.1|NM_002042.4	NP_001243633.1|NP_002033.2	P24046	GBRR1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, rho 1	426					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(7)|lung(16)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	35		all_cancers(76;9.49e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.46e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00917)	Adinazolam(DB00546)|Bromazepam(DB01558)|Cinolazepam(DB01594)|Clotiazepam(DB01559)|Diazepam(DB00829)|Estazolam(DB01215)|Fludiazepam(DB01567)|Flurazepam(DB00690)|Halazepam(DB00801)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Prazepam(DB01588)|Quazepam(DB01589)|Temazepam(DB00231)|Triazolam(DB00897)	AGGGTCAGCTGCACCATCATC	0.542																																						uc003pna.2		NA																	0				pancreas(1)	1						c.(1276-1278)CAG>AAG		gamma-aminobutyric acid (GABA) receptor, rho 1	Picrotoxin(DB00466)						193.0	175.0	181.0					6																	89888653		2203	4300	6503	SO:0001583	missense	2569				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr6:89888653G>T		CCDS5019.2, CCDS59028.1, CCDS59029.1	6q15	2012-06-22	2012-02-03		ENSG00000146276	ENSG00000146276		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4090	protein-coding gene	gene with protein product	"""GABA(A) receptor, rho 1"""	137161	"""gamma-aminobutyric acid (GABA) receptor, rho 1"""			1849271, 1315307	Standard	NM_002042		Approved		uc003pna.2	P24046	OTTHUMG00000015195	ENST00000454853.2:c.1276C>A	6.37:g.89888653G>T	ENSP00000412673:p.Gln426Lys		Somatic				GABRR1_uc011dzv.1_Missense_Mutation_p.Q403K	p.Q426K	NM_002042	NP_002033	WXS	Illumina HiSeq	Unspecified	P24046	GBRR1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.00917)	10	1731	-		all_cancers(76;9.49e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.46e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)	426			Cytoplasmic (Probable).		A1L401|B4DJK8|B4DQT5|B7ZBQ7|Q9BX06	Missense_Mutation	SNP	ENST00000454853.2	37	c.1276C>A	CCDS5019.2	.	.	.	.	.	.	.	.	.	.	G	15.38	2.817504	0.50633	.	.	ENSG00000146276	ENST00000454853;ENST00000435811;ENST00000369451;ENST00000436331	D;D;D	0.83506	-1.73;-1.73;-1.73	5.65	5.65	0.86999	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.000000	0.85682	D	0.000000	T	0.76271	0.3964	L	0.52573	1.65	0.80722	D	1	B;B	0.29805	0.108;0.257	B;B	0.36030	0.089;0.216	T	0.73319	-0.4020	9	.	.	.	-24.9921	19.7272	0.96168	0.0:0.0:1.0:0.0	.	409;426	P24046-2;P24046	.;GBRR1_HUMAN	K	426;409;339;339	ENSP00000412673:Q426K;ENSP00000394687:Q409K;ENSP00000358463:Q339K	.	Q	-	1	0	GABRR1	89945372	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.646000	0.89796	0.655000	0.94253	CAG		0.542	GABRR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041479.2			29	155	1	0	8.17e-17	1.19e-16	29	155				
MDN1	23195	broad.mit.edu	37	6	90383950	90383950	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:90383950G>A	ENST00000369393.3	-	79	13235	c.13120C>T	c.(13120-13122)Cgg>Tgg	p.R4374W	RP1-122O8.7_ENST00000438877.1_RNA|MDN1_ENST00000468568.1_5'Flank|MDN1_ENST00000428876.1_Missense_Mutation_p.R4374W			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	4374					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TCCTGTTTCCGCATCCGGCAA	0.463																																						uc003pnn.1		NA																	0				ovary(8)|skin(2)	10						c.(13120-13122)CGG>TGG		MDN1, midasin homolog							117.0	104.0	109.0					6																	90383950		2203	4300	6503	SO:0001583	missense	23195				protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding	g.chr6:90383950G>A	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.13120C>T	6.37:g.90383950G>A	ENSP00000358400:p.Arg4374Trp		Somatic					p.R4374W	NM_014611	NP_055426	WXS	Illumina HiSeq	Unspecified	Q9NU22	MDN1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0193)	79	13236	-		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)	4374					O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	37	c.13120C>T	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	G	17.63	3.437955	0.62955	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.03801	3.8;3.8	5.96	5.07	0.68467	.	0.069202	0.56097	D	0.000027	T	0.10165	0.0249	M	0.62723	1.935	0.47065	D	0.999302	D	0.89917	1.0	P	0.60609	0.877	T	0.01460	-1.1349	10	0.72032	D	0.01	.	16.0917	0.81094	0.0:0.0:0.8613:0.1387	.	4374	Q9NU22	MDN1_HUMAN	W	4374	ENSP00000358400:R4374W;ENSP00000413970:R4374W	ENSP00000358400:R4374W	R	-	1	2	MDN1	90440671	0.999000	0.42202	1.000000	0.80357	0.863000	0.49368	1.293000	0.33353	1.466000	0.48025	0.655000	0.94253	CGG		0.463	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2			21	72	0	0	0	0	21	72				
MDN1	23195	broad.mit.edu	37	6	90402372	90402372	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:90402372C>A	ENST00000369393.3	-	63	10492	c.10377G>T	c.(10375-10377)ttG>ttT	p.L3459F	MDN1_ENST00000428876.1_Missense_Mutation_p.L3459F			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	3459					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TCACCGAGCACAAAGTGTCTG	0.587																																						uc003pnn.1		NA																	0				ovary(8)|skin(2)	10						c.(10375-10377)TTG>TTT		MDN1, midasin homolog							97.0	98.0	98.0					6																	90402372		2203	4300	6503	SO:0001583	missense	23195				protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding	g.chr6:90402372C>A	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.10377G>T	6.37:g.90402372C>A	ENSP00000358400:p.Leu3459Phe		Somatic					p.L3459F	NM_014611	NP_055426	WXS	Illumina HiSeq	Unspecified	Q9NU22	MDN1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0193)	63	10493	-		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)	3459					O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	37	c.10377G>T	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	C	12.64	1.998406	0.35226	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.04406	3.63;3.63	5.34	2.42	0.29668	.	0.000000	0.64402	D	0.000005	T	0.09598	0.0236	M	0.77103	2.36	0.46260	D	0.99895	D	0.89917	1.0	D	0.85130	0.997	T	0.11567	-1.0582	10	0.25751	T	0.34	.	10.7512	0.46211	0.0:0.6949:0.0:0.3051	.	3459	Q9NU22	MDN1_HUMAN	F	3459	ENSP00000358400:L3459F;ENSP00000413970:L3459F	ENSP00000358400:L3459F	L	-	3	2	MDN1	90459093	0.999000	0.42202	0.987000	0.45799	0.784000	0.44337	0.654000	0.24918	0.667000	0.31107	0.462000	0.41574	TTG		0.587	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2			39	156	1	0	1.05e-18	1.54e-18	39	156				
MDN1	23195	broad.mit.edu	37	6	90402456	90402456	+	Silent	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:90402456C>T	ENST00000369393.3	-	63	10408	c.10293G>A	c.(10291-10293)agG>agA	p.R3431R	MDN1_ENST00000428876.1_Silent_p.R3431R			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	3431					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		GGGTCCCCAGCCTGTCTGCAC	0.582																																						uc003pnn.1		NA																	0				ovary(8)|skin(2)	10						c.(10291-10293)AGG>AGA		MDN1, midasin homolog							60.0	65.0	63.0					6																	90402456		2203	4300	6503	SO:0001819	synonymous_variant	23195				protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding	g.chr6:90402456C>T	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.10293G>A	6.37:g.90402456C>T			Somatic					p.R3431R	NM_014611	NP_055426	WXS	Illumina HiSeq	Unspecified	Q9NU22	MDN1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0193)	63	10409	-		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)	3431					O15019|Q5T794	Silent	SNP	ENST00000369393.3	37	c.10293G>A	CCDS5024.1																																																																																				0.582	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2			29	71	0	0	0	0	29	71				
RFX6	222546	broad.mit.edu	37	6	117215197	117215197	+	Missense_Mutation	SNP	A	A	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:117215197A>T	ENST00000332958.2	+	5	630	c.614A>T	c.(613-615)cAc>cTc	p.H205L	RFX6_ENST00000471966.1_3'UTR	NM_173560.3	NP_775831.2	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	205					endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|pancreatic A cell differentiation (GO:0003310)|pancreatic D cell differentiation (GO:0003311)|pancreatic epsilon cell differentiation (GO:0090104)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin secretion (GO:0050796)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell differentiation (GO:0003309)	nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(29)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	59						GCATATTACCACTCCGTTTAT	0.393																																						uc003pxm.2		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(613-615)CAC>CTC		regulatory factor X, 6							182.0	162.0	169.0					6																	117215197		2203	4300	6503	SO:0001583	missense	222546				glucose homeostasis|pancreatic A cell differentiation|pancreatic D cell differentiation|pancreatic E cell differentiation|positive regulation of transcription, DNA-dependent|regulation of insulin secretion|transcription, DNA-dependent|type B pancreatic cell differentiation	nucleus	protein binding|transcription regulatory region DNA binding	g.chr6:117215197A>T	BC039248	CCDS5113.1	6q22.31	2008-08-04	2008-08-04	2008-08-04	ENSG00000185002	ENSG00000185002			21478	protein-coding gene	gene with protein product		612659	"""regulatory factor X domain containing 1"""	RFXDC1			Standard	NM_173560		Approved	MGC33442, dJ955L16.1	uc003pxm.3	Q8HWS3	OTTHUMG00000015449	ENST00000332958.2:c.614A>T	6.37:g.117215197A>T	ENSP00000332208:p.His205Leu		Somatic					p.H205L	NM_173560	NP_775831	WXS	Illumina HiSeq	Unspecified	Q8HWS3	RFX6_HUMAN			5	677	+			205					Q5T6B3	Missense_Mutation	SNP	ENST00000332958.2	37	c.614A>T	CCDS5113.1	.	.	.	.	.	.	.	.	.	.	A	17.12	3.309356	0.60414	.	.	ENSG00000185002	ENST00000332958	T	0.58060	0.36	5.67	4.49	0.54785	.	0.095396	0.64402	D	0.000001	T	0.32102	0.0818	L	0.50333	1.59	0.58432	D	0.999998	B	0.28552	0.215	B	0.25759	0.063	T	0.28996	-1.0026	10	0.62326	D	0.03	-7.7105	13.2826	0.60224	0.8678:0.1321:0.0:0.0	.	205	Q8HWS3	RFX6_HUMAN	L	205	ENSP00000332208:H205L	ENSP00000332208:H205L	H	+	2	0	RFX6	117321890	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.866000	0.75506	1.063000	0.40649	0.533000	0.62120	CAC		0.393	RFX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041970.2	NM_173560		38	140	0	0	0	0	38	140				
RSPO3	84870	broad.mit.edu	37	6	127471641	127471641	+	Silent	SNP	A	A	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:127471641A>G	ENST00000356698.4	+	3	949	c.360A>G	c.(358-360)ttA>ttG	p.L120L	RSPO3_ENST00000485757.1_3'UTR|RSPO3_ENST00000368317.3_Silent_p.L120L	NM_032784.3	NP_116173.2	Q9BXY4	RSPO3_HUMAN	R-spondin 3	120					branching involved in labyrinthine layer morphogenesis (GO:0060670)|canonical Wnt signaling pathway (GO:0060070)	extracellular region (GO:0005576)	heparin binding (GO:0008201)|receptor binding (GO:0005102)		PTPRK/RSPO3(10)	breast(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(8)|skin(1)	17				GBM - Glioblastoma multiforme(226;0.0555)		GATTTTACTTACACCTTGGAA	0.368																																						uc003qar.2		NA																	0					0						c.(358-360)TTA>TTG		R-spondin 3 precursor							114.0	110.0	111.0					6																	127471641		2203	4299	6502	SO:0001819	synonymous_variant	84870					extracellular region	heparin binding	g.chr6:127471641A>G	BC022367	CCDS5135.1	6q22.33	2013-02-28	2011-06-29	2005-08-08	ENSG00000146374	ENSG00000146374		"""Endogenous ligands"""	20866	protein-coding gene	gene with protein product		610574	"""thrombospondin, type I, domain containing 2"", ""R-spondin 3 homolog (Xenopus laevis)"""	THSD2		10842357, 15469841	Standard	NM_032784		Approved	FLJ14440	uc003qar.3	Q9BXY4	OTTHUMG00000015521	ENST00000356698.4:c.360A>G	6.37:g.127471641A>G			Somatic				RSPO3_uc003qas.1_Silent_p.L120L	p.L120L	NM_032784	NP_116173	WXS	Illumina HiSeq	Unspecified	Q9BXY4	RSPO3_HUMAN		GBM - Glioblastoma multiforme(226;0.0555)	3	650	+			120			FU 2.		B2RC27|Q5VTV4|Q96K87	Silent	SNP	ENST00000356698.4	37	c.360A>G	CCDS5135.1																																																																																				0.368	RSPO3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042111.1	NM_032784		17	112	0	0	0	0	17	112				
SOGA3	387104	broad.mit.edu	37	6	127796902	127796902	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:127796902C>T	ENST00000525778.1	-	6	3014	c.2269G>A	c.(2269-2271)Gcg>Acg	p.A757T	SOGA3_ENST00000556132.1_Missense_Mutation_p.A757T|SOGA3_ENST00000481848.2_Missense_Mutation_p.A757T|SOGA3_ENST00000474293.2_5'Flank|SOGA3_ENST00000465909.2_Missense_Mutation_p.A757T|SOGA3_ENST00000368268.2_Missense_Mutation_p.A757T			Q5TF21	SOGA3_HUMAN	SOGA family member 3	757					regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											TTCTTGCCCGCGTCGCTCTCG	0.697																																						uc003qbd.2		NA																	0				breast(3)|ovary(2)|skin(1)	6						c.(2269-2271)GCG>ACG		hypothetical protein LOC387104 precursor							39.0	46.0	44.0					6																	127796902		2129	4230	6359	SO:0001583	missense	387104					integral to membrane		g.chr6:127796902C>T	AK096490	CCDS43505.1	6q22.33	2013-03-28	2012-02-27	2012-02-27	ENSG00000214338	ENSG00000214338			21494	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 174"""	C6orf174			Standard	NM_001012279		Approved	dJ403A15.3	uc003qbd.3	Q5TF21	OTTHUMG00000166438	ENST00000525778.1:c.2269G>A	6.37:g.127796902C>T	ENSP00000434570:p.Ala757Thr		Somatic				C6orf174_uc003qbc.2_5'Flank	p.A757T	NM_001012279	NP_001012279	WXS	Illumina HiSeq	Unspecified	Q5TF21	CF174_HUMAN		GBM - Glioblastoma multiforme(226;0.026)|all cancers(137;0.161)	6	3134	-			757						Missense_Mutation	SNP	ENST00000525778.1	37	c.2269G>A	CCDS43505.1	.	.	.	.	.	.	.	.	.	.	C	16.24	3.066637	0.55539	.	.	ENSG00000214338	ENST00000556132;ENST00000368268;ENST00000525778;ENST00000465909	T;T;T;T	0.32515	1.45;1.45;1.45;1.45	5.27	4.41	0.53225	.	0.285709	0.38005	N	0.001858	T	0.12390	0.0301	L	0.33245	0.995	0.48762	D	0.999704	B	0.30236	0.274	B	0.28232	0.087	T	0.03795	-1.1003	10	0.41790	T	0.15	-8.9632	13.665	0.62389	0.0:0.9257:0.0:0.0743	.	757	Q5TF21	CF174_HUMAN	T	757	ENSP00000451768:A757T;ENSP00000357251:A757T;ENSP00000434570:A757T;ENSP00000435559:A757T	ENSP00000435559:A757T	A	-	1	0	C6orf174	127838595	1.000000	0.71417	0.999000	0.59377	0.868000	0.49771	3.092000	0.50207	1.234000	0.43709	0.462000	0.41574	GCG		0.697	SOGA3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388246.1	NM_001012279		28	90	0	0	0	0	28	90				
THEMIS	387357	broad.mit.edu	37	6	128134032	128134032	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:128134032G>A	ENST00000368248.2	-	4	1902	c.1754C>T	c.(1753-1755)cCc>cTc	p.P585L	THEMIS_ENST00000368250.1_Missense_Mutation_p.P506L|THEMIS_ENST00000537166.1_Missense_Mutation_p.P550L|THEMIS_ENST00000543064.1_Missense_Mutation_p.P585L	NM_001010923.2	NP_001010923.1	Q8N1K5	THMS1_HUMAN	thymocyte selection associated	585					negative T cell selection (GO:0043383)|positive T cell selection (GO:0043368)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(3)	60						CCTTACCTTGGGAGACTTGGG	0.463																																						uc003qbi.2		NA																	0				ovary(2)|skin(2)	4						c.(1753-1755)CCC>CTC		thymocyte selection pathway associated isoform							158.0	159.0	159.0					6																	128134032		2203	4300	6503	SO:0001583	missense	387357				negative T cell selection|positive T cell selection|T cell receptor signaling pathway	cytoplasm|nucleus		g.chr6:128134032G>A	AK094863	CCDS34534.1, CCDS55055.1	6q22.33	2012-02-08	2009-06-25	2009-06-25	ENSG00000172673	ENSG00000172673			21569	protein-coding gene	gene with protein product	"""thymocyte expressed molecule involved in selection"""	613607	"""chromosome 6 open reading frame 207"", ""chromosome 6 open reading frame 190"", ""thymocyte selection pathway associated"""	C6orf207, C6orf190, TSEPA		19597499, 19597498, 19597497	Standard	NM_001010923		Approved	bA325O24.4, FLJ40584, bA325O24.3	uc011ebt.2	Q8N1K5	OTTHUMG00000015534	ENST00000368248.2:c.1754C>T	6.37:g.128134032G>A	ENSP00000357231:p.Pro585Leu		Somatic				THEMIS_uc010kfa.2_Missense_Mutation_p.P488L|THEMIS_uc011ebt.1_Missense_Mutation_p.P585L|THEMIS_uc010kfb.2_Missense_Mutation_p.P550L	p.P585L	NM_001010923	NP_001010923	WXS	Illumina HiSeq	Unspecified	Q8N1K5	THMS1_HUMAN			5	2073	-			585					A1L4F0|A8K7N1|B3KT31|B3KW32|B3KY07|F5H1J9|Q5T3C4|Q5T3C5|Q6MZT7	Missense_Mutation	SNP	ENST00000368248.2	37	c.1754C>T	CCDS34534.1	.	.	.	.	.	.	.	.	.	.	G	10.18	1.280450	0.23392	.	.	ENSG00000172673	ENST00000368250;ENST00000543064;ENST00000368248;ENST00000537166	T;T;T;T	0.16196	2.36;2.36;2.37;2.36	5.96	4.15	0.48705	.	0.427346	0.24238	N	0.040293	T	0.03695	0.0105	N	0.17082	0.46	0.45046	D	0.998067	B;B	0.14805	0.011;0.004	B;B	0.14578	0.011;0.003	T	0.23940	-1.0174	10	0.31617	T	0.26	-3.3256	7.4381	0.27166	0.1445:0.0:0.7224:0.1331	.	585;585	F5H1J9;Q8N1K5	.;THMS1_HUMAN	L	506;585;585;550	ENSP00000357233:P506L;ENSP00000439594:P585L;ENSP00000357231:P585L;ENSP00000439863:P550L	ENSP00000357231:P585L	P	-	2	0	THEMIS	128175725	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	1.385000	0.34408	1.497000	0.48584	0.655000	0.94253	CCC		0.463	THEMIS-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_001010923		82	276	0	0	0	0	82	276				
LAMA2	3908	broad.mit.edu	37	6	129371138	129371138	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:129371138C>A	ENST00000421865.2	+	2	237	c.188C>A	c.(187-189)cCt>cAt	p.P63H		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	63	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		GAAAAAGGACCTGAAATGTAC	0.448																																						uc003qbn.2		NA																	0				ovary(8)|breast(1)|skin(1)	10						c.(187-189)CCT>CAT		laminin alpha 2 subunit isoform a precursor							193.0	171.0	178.0					6																	129371138		2203	4300	6503	SO:0001583	missense	3908				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity	g.chr6:129371138C>A	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.188C>A	6.37:g.129371138C>A	ENSP00000400365:p.Pro63His		Somatic				LAMA2_uc003qbo.2_Missense_Mutation_p.P63H	p.P63H	NM_000426	NP_000417	WXS	Illumina HiSeq	Unspecified	P24043	LAMA2_HUMAN		OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)	2	293	+			63			Laminin N-terminal.		Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	ENST00000421865.2	37	c.188C>A	CCDS5138.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.006162	0.74932	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	T	0.80304	-1.36	5.44	5.44	0.79542	Laminin, N-terminal (3);	0.071038	0.56097	D	0.000029	D	0.89979	0.6872	M	0.94142	3.5	0.47094	D	0.999314	D;D	0.71674	0.996;0.998	P;D	0.66847	0.905;0.947	D	0.91929	0.5553	10	0.87932	D	0	.	10.9162	0.47137	0.1351:0.717:0.1479:0.0	.	63;63	A6NF00;P24043	.;LAMA2_HUMAN	H	63	ENSP00000400365:P63H	ENSP00000346769:P63H	P	+	2	0	LAMA2	129412831	0.999000	0.42202	0.989000	0.46669	0.880000	0.50808	5.873000	0.69644	2.552000	0.86080	0.561000	0.74099	CCT		0.448	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1			28	82	1	0	1.13e-08	1.47e-08	28	82				
L3MBTL3	84456	broad.mit.edu	37	6	130381238	130381238	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:130381238G>T	ENST00000529410.1	+	12	1296	c.817G>T	c.(817-819)Gtg>Ttg	p.V273L	L3MBTL3_ENST00000526019.1_Missense_Mutation_p.V248L|L3MBTL3_ENST00000533560.1_Missense_Mutation_p.V248L|L3MBTL3_ENST00000368139.2_Missense_Mutation_p.V248L|L3MBTL3_ENST00000368136.2_Missense_Mutation_p.V273L|L3MBTL3_ENST00000361794.2_Missense_Mutation_p.V273L			Q96JM7	LMBL3_HUMAN	l(3)mbt-like 3 (Drosophila)	273					chromatin modification (GO:0016568)|erythrocyte maturation (GO:0043249)|granulocyte differentiation (GO:0030851)|macrophage differentiation (GO:0030225)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				cervix(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|skin(4)|stomach(1)|urinary_tract(1)	43				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)		ATTAGAAGGCGTGGATCCTGA	0.398																																						uc003qbt.2		NA																	0				ovary(5)|skin(1)	6						c.(817-819)GTG>TTG		l(3)mbt-like 3 isoform a							133.0	118.0	123.0					6																	130381238		2203	4300	6503	SO:0001583	missense	84456				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		g.chr6:130381238G>T	AB058701	CCDS34537.1, CCDS34538.1	6q23	2013-01-10			ENSG00000198945	ENSG00000198945		"""Sterile alpha motif (SAM) domain containing"""	23035	protein-coding gene	gene with protein product							Standard	NM_032438		Approved	KIAA1798	uc003qbt.3	Q96JM7	OTTHUMG00000015554	ENST00000529410.1:c.817G>T	6.37:g.130381238G>T	ENSP00000431962:p.Val273Leu		Somatic				L3MBTL3_uc003qbu.2_Missense_Mutation_p.V248L	p.V273L	NM_032438	NP_115814	WXS	Illumina HiSeq	Unspecified	Q96JM7	LMBL3_HUMAN		GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)	10	987	+			273			MBT 1.		Q4VXE1|Q5VUM9|Q6P9B5	Missense_Mutation	SNP	ENST00000529410.1	37	c.817G>T	CCDS34537.1	.	.	.	.	.	.	.	.	.	.	G	11.32	1.604275	0.28534	.	.	ENSG00000198945	ENST00000529410;ENST00000533560;ENST00000361794;ENST00000368139;ENST00000526019;ENST00000368136	D;D;D;D;D;D	0.84730	-1.89;-1.89;-1.89;-1.89;-1.89;-1.89	5.27	5.27	0.74061	.	0.196971	0.45361	D	0.000374	T	0.73590	0.3606	L	0.31420	0.93	0.46478	D	0.999066	D;B	0.58970	0.984;0.297	P;B	0.48304	0.573;0.181	T	0.72883	-0.4157	10	0.26408	T	0.33	.	12.6001	0.56492	0.0764:0.0:0.9236:0.0	.	248;273	Q96JM7-2;Q96JM7	.;LMBL3_HUMAN	L	273;248;273;248;248;273	ENSP00000431962:V273L;ENSP00000437185:V248L;ENSP00000354526:V273L;ENSP00000357121:V248L;ENSP00000436706:V248L;ENSP00000357118:V273L	ENSP00000354526:V273L	V	+	1	0	L3MBTL3	130422931	0.968000	0.33430	0.995000	0.50966	0.483000	0.33249	1.711000	0.37930	2.625000	0.88918	0.455000	0.32223	GTG		0.398	L3MBTL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042195.2	XM_027074		18	64	1	0	5.35e-11	7.32e-11	18	64				
L3MBTL3	84456	broad.mit.edu	37	6	130392248	130392248	+	Missense_Mutation	SNP	A	A	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:130392248A>G	ENST00000529410.1	+	15	1699	c.1220A>G	c.(1219-1221)aAc>aGc	p.N407S	L3MBTL3_ENST00000526019.1_Missense_Mutation_p.N382S|L3MBTL3_ENST00000533560.1_Missense_Mutation_p.N382S|L3MBTL3_ENST00000368139.2_Missense_Mutation_p.N382S|L3MBTL3_ENST00000368136.2_Missense_Mutation_p.N407S|L3MBTL3_ENST00000361794.2_Missense_Mutation_p.N407S			Q96JM7	LMBL3_HUMAN	l(3)mbt-like 3 (Drosophila)	407					chromatin modification (GO:0016568)|erythrocyte maturation (GO:0043249)|granulocyte differentiation (GO:0030851)|macrophage differentiation (GO:0030225)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				cervix(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|skin(4)|stomach(1)|urinary_tract(1)	43				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)		CATTTTGACAACTGGGATGAG	0.368																																						uc003qbt.2		NA																	0				ovary(5)|skin(1)	6						c.(1219-1221)AAC>AGC		l(3)mbt-like 3 isoform a							251.0	241.0	244.0					6																	130392248		2203	4300	6503	SO:0001583	missense	84456				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		g.chr6:130392248A>G	AB058701	CCDS34537.1, CCDS34538.1	6q23	2013-01-10			ENSG00000198945	ENSG00000198945		"""Sterile alpha motif (SAM) domain containing"""	23035	protein-coding gene	gene with protein product							Standard	NM_032438		Approved	KIAA1798	uc003qbt.3	Q96JM7	OTTHUMG00000015554	ENST00000529410.1:c.1220A>G	6.37:g.130392248A>G	ENSP00000431962:p.Asn407Ser		Somatic				L3MBTL3_uc003qbu.2_Missense_Mutation_p.N382S	p.N407S	NM_032438	NP_115814	WXS	Illumina HiSeq	Unspecified	Q96JM7	LMBL3_HUMAN		GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)	13	1390	+			407			MBT 2.		Q4VXE1|Q5VUM9|Q6P9B5	Missense_Mutation	SNP	ENST00000529410.1	37	c.1220A>G	CCDS34537.1	.	.	.	.	.	.	.	.	.	.	A	18.93	3.727599	0.69074	.	.	ENSG00000198945	ENST00000529410;ENST00000533560;ENST00000361794;ENST00000368139;ENST00000526019;ENST00000368136	T;T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0;1.0	6.17	6.17	0.99709	.	0.080602	0.85682	D	0.000000	T	0.18509	0.0444	N	0.25426	0.745	0.47308	D	0.999382	D;B	0.55172	0.97;0.211	B;B	0.42771	0.397;0.059	T	0.03651	-1.1016	10	0.33141	T	0.24	.	11.0511	0.47889	0.9315:0.0:0.0685:0.0	.	382;407	Q96JM7-2;Q96JM7	.;LMBL3_HUMAN	S	407;382;407;382;382;407	ENSP00000431962:N407S;ENSP00000437185:N382S;ENSP00000354526:N407S;ENSP00000357121:N382S;ENSP00000436706:N382S;ENSP00000357118:N407S	ENSP00000354526:N407S	N	+	2	0	L3MBTL3	130433941	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.408000	0.59761	2.371000	0.80710	0.533000	0.62120	AAC		0.368	L3MBTL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042195.2	XM_027074		64	223	0	0	0	0	64	223				
SAMD3	154075	broad.mit.edu	37	6	130535556	130535556	+	Missense_Mutation	SNP	C	C	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:130535556C>G	ENST00000368134.2	-	6	803	c.195G>C	c.(193-195)caG>caC	p.Q65H	SAMD3_ENST00000532763.1_Missense_Mutation_p.Q65H|SAMD3_ENST00000457563.2_Missense_Mutation_p.Q89H|SAMD3_ENST00000437477.2_Missense_Mutation_p.Q65H|SAMD3_ENST00000439090.2_Missense_Mutation_p.Q65H|SAMD3_ENST00000324172.6_Missense_Mutation_p.Q65H|SAMD3_ENST00000533296.1_5'UTR	NM_001258275.1	NP_001245204.1	Q8N6K7	SAMD3_HUMAN	sterile alpha motif domain containing 3	65	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.									breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(3)|lung(15)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	29				GBM - Glioblastoma multiforme(226;0.00594)|OV - Ovarian serous cystadenocarcinoma(155;0.128)		CTTGAGTGTTCTGCTTGTATT	0.448																																						uc003qbv.2		NA																	0				ovary(1)	1						c.(193-195)CAG>CAC		sterile alpha motif domain containing 3 isoform							99.0	100.0	100.0					6																	130535556		2203	4300	6503	SO:0001583	missense	154075							g.chr6:130535556C>G	AK091351	CCDS34539.1, CCDS64525.1	6q23.1	2013-01-10			ENSG00000164483	ENSG00000164483		"""Sterile alpha motif (SAM) domain containing"""	21574	protein-coding gene	gene with protein product							Standard	NM_001017373		Approved	bA73O6.2, FLJ34032	uc031spp.1	Q8N6K7	OTTHUMG00000015556	ENST00000368134.2:c.195G>C	6.37:g.130535556C>G	ENSP00000357116:p.Gln65His		Somatic				SAMD3_uc003qbx.2_Missense_Mutation_p.Q65H|SAMD3_uc003qbw.2_Missense_Mutation_p.Q65H|SAMD3_uc010kfg.1_Missense_Mutation_p.Q65H|SAMD3_uc003qby.2_Missense_Mutation_p.Q65H|SAMD3_uc003qbz.1_Missense_Mutation_p.Q24H	p.Q65H	NM_001017373	NP_001017373	WXS	Illumina HiSeq	Unspecified	Q8N6K7	SAMD3_HUMAN		GBM - Glioblastoma multiforme(226;0.00594)|OV - Ovarian serous cystadenocarcinoma(155;0.128)	5	521	-			65			SAM.		B4DY20|E1P576|J3KQK4|Q4VXD8|Q8NAY1|Q8NB96	Missense_Mutation	SNP	ENST00000368134.2	37	c.195G>C	CCDS34539.1	.	.	.	.	.	.	.	.	.	.	C	14.53	2.563508	0.45694	.	.	ENSG00000164483	ENST00000368134;ENST00000457563;ENST00000439090;ENST00000437477;ENST00000532763;ENST00000324172;ENST00000532309;ENST00000531544;ENST00000529723	T;T;T;T;T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95;2.31	5.64	4.58	0.56647	Sterile alpha motif domain (1);Sterile alpha motif/pointed domain (2);	0.000000	0.56097	D	0.000032	T	0.35451	0.0932	L	0.29908	0.895	0.36489	D	0.868343	P;P;D;D	0.69078	0.481;0.895;0.997;0.992	B;P;D;P	0.63192	0.425;0.671;0.912;0.754	T	0.32693	-0.9897	10	0.72032	D	0.01	.	8.4805	0.33040	0.0:0.8527:0.0:0.1473	.	89;65;65;65	B4DY20;Q4VXD9;Q8N6K7-2;Q8N6K7	.;.;.;SAMD3_HUMAN	H	65;89;65;65;65;65;65;65;63	ENSP00000357116:Q65H;ENSP00000402092:Q89H;ENSP00000403565:Q65H;ENSP00000391163:Q65H;ENSP00000436088:Q65H;ENSP00000324874:Q65H;ENSP00000436115:Q65H;ENSP00000435875:Q65H;ENSP00000434139:Q63H	ENSP00000324874:Q65H	Q	-	3	2	SAMD3	130577249	0.997000	0.39634	0.970000	0.41538	0.520000	0.34377	1.052000	0.30429	2.651000	0.90000	0.643000	0.83706	CAG		0.448	SAMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042197.3	NM_152552		65	202	0	0	0	0	65	202				
CTGF	1490	broad.mit.edu	37	6	132271472	132271472	+	Silent	SNP	G	G	A	rs139453995		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:132271472G>A	ENST00000367976.3	-	3	701	c.501C>T	c.(499-501)gaC>gaT	p.D167D	RP11-69I8.3_ENST00000435287.1_RNA	NM_001901.2	NP_001892	P29279	CTGF_HUMAN	connective tissue growth factor	167	VWFC. {ECO:0000255|PROSITE- ProRule:PRU00220}.				angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|chondrocyte proliferation (GO:0035988)|cytosolic calcium ion transport (GO:0060401)|DNA replication (GO:0006260)|epidermis development (GO:0008544)|extracellular matrix constituent secretion (GO:0070278)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|organ senescence (GO:0010260)|ossification (GO:0001503)|positive regulation of cardiac muscle contraction (GO:0060452)|positive regulation of cell activation (GO:0050867)|positive regulation of cell death (GO:0010942)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G0 to G1 transition (GO:0070318)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|regulation of cell growth (GO:0001558)|regulation of chondrocyte differentiation (GO:0032330)|response to amino acid (GO:0043200)|response to anoxia (GO:0034059)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to glucose (GO:0009749)|response to mineralocorticoid (GO:0051385)|response to peptide hormone (GO:0043434)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell cortex (GO:0005938)|cis-Golgi network (GO:0005801)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|insulin-like growth factor binding (GO:0005520)			breast(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	13	Breast(56;0.0602)			GBM - Glioblastoma multiforme(226;0.015)|OV - Ovarian serous cystadenocarcinoma(155;0.0169)		CCTTGGGCTCGTCACACACCC	0.632											OREG0017666	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Esophageal Squamous(127;510 1660 12817 24400 38449)	uc003qcz.2		NA																	0					0						c.(499-501)GAC>GAT		connective tissue growth factor precursor		G		1,4405	2.1+/-5.4	0,1,2202	105.0	106.0	105.0		501	-4.9	0.9	6	dbSNP_134	105	0,8600		0,0,4300	no	coding-synonymous	CTGF	NM_001901.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		167/350	132271472	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	1490				cellular lipid metabolic process|DNA replication|epidermis development|regulation of cell growth|response to wounding	plasma membrane|proteinaceous extracellular matrix	heparin binding|insulin-like growth factor binding	g.chr6:132271472G>A	X78947	CCDS5151.1	6q23.2	2008-02-05			ENSG00000118523	ENSG00000118523			2500	protein-coding gene	gene with protein product		121009				1654338	Standard	NM_001901		Approved	IGFBP8, CCN2	uc003qcz.3	P29279	OTTHUMG00000015573	ENST00000367976.3:c.501C>T	6.37:g.132271472G>A			Somatic	OREG0017666	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1594		p.D167D	NM_001901	NP_001892	WXS	Illumina HiSeq	Unspecified	P29279	CTGF_HUMAN		GBM - Glioblastoma multiforme(226;0.015)|OV - Ovarian serous cystadenocarcinoma(155;0.0169)	3	707	-	Breast(56;0.0602)		167			VWFC.		E1P578|Q6LCY0|Q96A79|Q96QX2|Q9UDL6	Silent	SNP	ENST00000367976.3	37	c.501C>T	CCDS5151.1																																																																																				0.632	CTGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042239.2	NM_001901		51	160	0	0	0	0	51	160				
TAAR1	134864	broad.mit.edu	37	6	132966320	132966320	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:132966320G>T	ENST00000275216.1	-	1	822	c.823C>A	c.(823-825)Cct>Act	p.P275T		NM_138327.1	NP_612200.1	Q96RJ0	TAAR1_HUMAN	trace amine associated receptor 1	275					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)	18	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00616)|GBM - Glioblastoma multiforme(226;0.0154)	Amphetamine(DB00182)|Dextroamphetamine(DB01576)|Methamphetamine(DB01577)|Propylhexedrine(DB06714)	TGAAGAAAAGGGTCCATGACT	0.368																																						uc003qdm.1		NA																	0					0						c.(823-825)CCT>ACT		trace amine associated receptor 1	Amphetamine(DB00182)						83.0	75.0	78.0					6																	132966320		2203	4299	6502	SO:0001583	missense	134864					plasma membrane		g.chr6:132966320G>T	AY180374	CCDS5158.1	6q23.1	2012-08-08	2005-02-23	2005-02-24	ENSG00000146399	ENSG00000146399		"""GPCR / Class A : Trace amine associated receptors"""	17734	protein-coding gene	gene with protein product		609333	"""trace amine receptor 1"""	TRAR1		11459929, 15718104	Standard	NM_138327		Approved	TAR1, TA1	uc003qdm.1	Q96RJ0	OTTHUMG00000015583	ENST00000275216.1:c.823C>A	6.37:g.132966320G>T	ENSP00000275216:p.Pro275Thr		Somatic					p.P275T	NM_138327	NP_612200	WXS	Illumina HiSeq	Unspecified	Q96RJ0	TAAR1_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;0.00616)|GBM - Glioblastoma multiforme(226;0.0154)	1	823	-	Breast(56;0.135)		275			Extracellular (Potential).		Q2M1W5|Q3MIH8|Q5VUQ1	Missense_Mutation	SNP	ENST00000275216.1	37	c.823C>A	CCDS5158.1	.	.	.	.	.	.	.	.	.	.	G	11.14	1.552450	0.27739	.	.	ENSG00000146399	ENST00000275216	T	0.35789	1.29	5.8	4.93	0.64822	GPCR, rhodopsin-like superfamily (1);	0.115257	0.64402	D	0.000012	T	0.40595	0.1123	M	0.72624	2.21	0.39507	D	0.968293	D	0.56287	0.975	P	0.57620	0.824	T	0.45527	-0.9255	10	0.59425	D	0.04	-11.3848	10.3546	0.43956	0.0706:0.1347:0.7948:0.0	.	275	Q96RJ0	TAAR1_HUMAN	T	275	ENSP00000275216:P275T	ENSP00000275216:P275T	P	-	1	0	TAAR1	133008013	1.000000	0.71417	0.970000	0.41538	0.011000	0.07611	3.301000	0.51842	1.451000	0.47736	0.455000	0.32223	CCT		0.368	TAAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042259.1	NM_138327		21	95	1	0	1.5e-11	2.07e-11	21	95				
STXBP5	134957	broad.mit.edu	37	6	147655334	147655334	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:147655334G>A	ENST00000321680.6	+	19	2122	c.2122G>A	c.(2122-2124)Gat>Aat	p.D708N	STXBP5_ENST00000367480.3_Missense_Mutation_p.D708N|STXBP5_ENST00000179882.6_Missense_Mutation_p.D379N|STXBP5_ENST00000367481.3_Missense_Mutation_p.D708N	NM_001127715.2	NP_001121187.1	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn)	708					exocytosis (GO:0006887)|negative regulation of exocytosis (GO:0045920)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|synapse (GO:0045202)	syntaxin-1 binding (GO:0017075)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	42		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		TGTTCCAGAGGATCGCTGCAA	0.328																																						uc003qlz.2		NA																	0					0						c.(2122-2124)GAT>AAT		syntaxin binding protein 5 (tomosyn) isoform b							175.0	169.0	171.0					6																	147655334		2203	4300	6503	SO:0001583	missense	134957				exocytosis|positive regulation of exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|nicotinic acetylcholine-gated receptor-channel complex|synaptic vesicle	syntaxin-1 binding	g.chr6:147655334G>A	AK055484	CCDS5211.1, CCDS47499.1	6q24.3	2013-01-10			ENSG00000164506	ENSG00000164506		"""WD repeat domain containing"""	19665	protein-coding gene	gene with protein product		604586				9620695, 14767561	Standard	NM_139244		Approved	tomosyn, LLGL3	uc010khz.2	Q5T5C0	OTTHUMG00000015766	ENST00000321680.6:c.2122G>A	6.37:g.147655334G>A	ENSP00000321826:p.Asp708Asn		Somatic				STXBP5_uc010khz.1_Missense_Mutation_p.D708N|STXBP5_uc003qlx.2_RNA|STXBP5_uc003qly.2_Missense_Mutation_p.D379N|STXBP5_uc003qma.2_Missense_Mutation_p.D55N	p.D708N	NM_001127715	NP_001121187	WXS	Illumina HiSeq	Unspecified	Q5T5C0	STXB5_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)	19	2283	+		Ovarian(120;0.0164)	708					Q14DF3|Q5T5C1|Q5T5C2|Q8NBG8|Q96NG9	Missense_Mutation	SNP	ENST00000321680.6	37	c.2122G>A	CCDS47499.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.9|23.9	4.469611|4.469611	0.84533|0.84533	.|.	.|.	ENSG00000164506|ENSG00000164506	ENST00000367479;ENST00000367481;ENST00000321680;ENST00000367480;ENST00000179882;ENST00000392291|ENST00000367475	T;T;T;T;T|.	0.27402|.	1.67;1.67;1.67;1.67;1.67|.	5.1|5.1	5.1|5.1	0.69264|0.69264	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.62756|0.62756	0.2454|0.2454	L|L	0.52759|0.52759	1.655|1.655	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	0.971;1.0;0.982;0.962|.	P;D;P;P|.	0.76575|.	0.783;0.988;0.772;0.686|.	T|T	0.59752|0.59752	-0.7395|-0.7395	10|5	0.40728|.	T|.	0.16|.	.|.	18.8679|18.8679	0.92300|0.92300	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	708;49;708;379|.	Q5T5C0-2;Q5JRH1;Q5T5C0;B3KXX0|.	.;.;STXB5_HUMAN;.|.	N|E	83;708;708;708;379;68|49	ENSP00000356451:D708N;ENSP00000321826:D708N;ENSP00000356450:D708N;ENSP00000179882:D379N;ENSP00000376112:D68N|.	ENSP00000179882:D379N|.	D|G	+|+	1|2	0|0	STXBP5|STXBP5	147697027|147697027	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.929000|0.929000	0.56500|0.56500	8.938000|8.938000	0.92943|0.92943	2.516000|2.516000	0.84829|0.84829	0.467000|0.467000	0.42956|0.42956	GAT|GGA		0.328	STXBP5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042606.1			26	76	0	0	0	0	26	76				
RAET1G	353091	broad.mit.edu	37	6	150240901	150240901	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:150240901C>T	ENST00000367360.2	-	2	204	c.137G>A	c.(136-138)gGa>gAa	p.G46E	RAET1G_ENST00000479265.1_Missense_Mutation_p.G46E|RP11-244K5.8_ENST00000606915.1_RNA|RAET1E-AS1_ENST00000446954.2_RNA|RAET1E-AS1_ENST00000605899.1_RNA	NM_001001788.2	NP_001001788.2			retinoic acid early transcript 1G											NS(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(4)|urinary_tract(1)	13		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.73e-12)		CCACCGTGGTCCAGGTCTGAA	0.552																																						uc010kii.1		NA																	0					0						c.(136-138)GGA>GAA		retinoic acid early transcript 1G precursor							82.0	83.0	82.0					6																	150240901		2203	4297	6500	SO:0001583	missense	353091				antigen processing and presentation|immune response	integral to membrane|MHC class I protein complex	protein binding	g.chr6:150240901C>T	AY172579	CCDS43514.1	6q24.1-25.1	2009-04-29	2004-11-22		ENSG00000203722	ENSG00000203722			16795	protein-coding gene	gene with protein product		609244	"""retinoic acid early transcript 1G pseudogene"""			11827464, 15240696	Standard	NM_001001788		Approved	ULBP5	uc010kii.1	Q6H3X3	OTTHUMG00000015802	ENST00000367360.2:c.137G>A	6.37:g.150240901C>T	ENSP00000356329:p.Gly46Glu		Somatic				RAET1G_uc003qnm.2_RNA	p.G46E	NM_001001788	NP_001001788	WXS	Illumina HiSeq	Unspecified	Q6H3X3	RET1G_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.73e-12)	2	205	-		Ovarian(120;0.0907)	46			MHC class I alpha-1 like.|Extracellular (Potential).			Missense_Mutation	SNP	ENST00000367360.2	37	c.137G>A	CCDS43514.1	.	.	.	.	.	.	.	.	.	.	C	11.70	1.717642	0.30413	.	.	ENSG00000203722	ENST00000367360;ENST00000479265	T;T	0.00932	5.53;5.53	2.4	0.511	0.16989	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	.	.	.	.	T	0.00637	0.0021	N	0.22421	0.69	0.09310	N	1	D	0.67145	0.996	D	0.64506	0.926	T	0.53940	-0.8367	9	0.66056	D	0.02	.	3.4744	0.07579	0.0:0.5659:0.2708:0.1632	.	46	Q6H3X3	RET1G_HUMAN	E	46	ENSP00000356329:G46E;ENSP00000417503:G46E	ENSP00000356329:G46E	G	-	2	0	RAET1G	150282594	0.187000	0.23238	0.082000	0.20525	0.010000	0.07245	0.982000	0.29539	0.118000	0.18165	-0.458000	0.05436	GGA		0.552	RAET1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042668.2			7	202	0	0	0	0	7	202				
SYNE1	23345	broad.mit.edu	37	6	152708424	152708424	+	Missense_Mutation	SNP	T	T	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:152708424T>A	ENST00000367255.5	-	54	8871	c.8270A>T	c.(8269-8271)gAa>gTa	p.E2757V	SYNE1_ENST00000448038.1_Missense_Mutation_p.E2764V|SYNE1_ENST00000423061.1_Missense_Mutation_p.E2764V|SYNE1_ENST00000265368.4_Missense_Mutation_p.E2757V|SYNE1_ENST00000341594.5_Missense_Mutation_p.E2796V	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	2757					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TAAGGGATGTTCTATTTTTTG	0.458										HNSCC(10;0.0054)																												uc010kiw.2		NA																	0				central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45						c.(8269-8271)GAA>GTA		spectrin repeat containing, nuclear envelope 1							255.0	222.0	234.0					6																	152708424		2203	4300	6503	SO:0001583	missense	23345				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding	g.chr6:152708424T>A	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.8270A>T	6.37:g.152708424T>A	ENSP00000356224:p.Glu2757Val	HNSCC(10;0.0054)	Somatic				SYNE1_uc003qot.3_Missense_Mutation_p.E2764V|SYNE1_uc003qou.3_Missense_Mutation_p.E2757V|SYNE1_uc010kjb.1_Missense_Mutation_p.E2740V	p.E2757V	NM_182961	NP_892006	WXS	Illumina HiSeq	Unspecified	Q8NF91	SYNE1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)	54	8872	-		Ovarian(120;0.0955)	2757			Cytoplasmic (Potential).		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	c.8270A>T	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	T	4.811	0.150832	0.09185	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.35605	1.3;1.3;1.3;1.3;1.3	5.7	3.11	0.35812	.	0.201656	0.34067	N	0.004282	T	0.19366	0.0465	M	0.63428	1.95	0.80722	D	1	B;B;B;P	0.39282	0.068;0.394;0.394;0.666	B;B;B;B	0.36666	0.022;0.115;0.115;0.23	T	0.02933	-1.1092	10	0.30078	T	0.28	.	12.2234	0.54447	0.0:0.0:0.2686:0.7314	.	2740;2757;2757;2764	B3W695;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	V	2757;2764;2757;2764;2796	ENSP00000356224:E2757V;ENSP00000396024:E2764V;ENSP00000265368:E2757V;ENSP00000390975:E2764V;ENSP00000341887:E2796V	ENSP00000265368:E2757V	E	-	2	0	SYNE1	152750117	0.974000	0.33945	0.070000	0.20053	0.021000	0.10359	2.191000	0.42640	0.950000	0.37743	0.533000	0.62120	GAA		0.458	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961		41	145	0	0	0	0	41	145				
TIAM2	26230	broad.mit.edu	37	6	155450864	155450864	+	Silent	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:155450864G>T	ENST00000461783.3	+	6	1780	c.507G>T	c.(505-507)ctG>ctT	p.L169L	TIAM2_ENST00000529824.2_Silent_p.L169L|TIAM2_ENST00000360366.4_Silent_p.L169L|TIAM2_ENST00000318981.5_Silent_p.L169L|TIAM2_ENST00000456144.1_Silent_p.L169L|TIAM2_ENST00000367174.2_5'UTR			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	169					apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		TGGGGAAGCTGGATGGGTGTT	0.587																																						uc003qqb.2		NA																	0				ovary(3)|breast(1)	4						c.(505-507)CTG>CTT		T-cell lymphoma invasion and metastasis 2							41.0	42.0	41.0					6																	155450864		2203	4300	6503	SO:0001819	synonymous_variant	26230				apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity	g.chr6:155450864G>T		CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.507G>T	6.37:g.155450864G>T			Somatic				TIAM2_uc003qqe.2_Silent_p.L169L	p.L169L	NM_012454	NP_036586	WXS	Illumina HiSeq	Unspecified	Q8IVF5	TIAM2_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)	6	1780	+		Ovarian(120;0.196)	169					B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Silent	SNP	ENST00000461783.3	37	c.507G>T	CCDS34558.1																																																																																				0.587	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000387980.2	NM_012454		17	68	1	0	2.39e-15	3.43e-15	17	68				
FNDC1	84624	broad.mit.edu	37	6	159660563	159660563	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:159660563C>A	ENST00000297267.9	+	14	4395	c.4195C>A	c.(4195-4197)Ccc>Acc	p.P1399T	FNDC1-IT1_ENST00000419703.1_RNA|FNDC1_ENST00000340366.6_Missense_Mutation_p.P1336T	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	1399					cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		GGAAGGGACCCCCGTGGTGAG	0.483																																						uc010kjv.2		NA																	0				large_intestine(4)|ovary(3)|central_nervous_system(1)	8						c.(4195-4197)CCC>ACC		fibronectin type III domain containing 1							18.0	21.0	20.0					6																	159660563		1862	4102	5964	SO:0001583	missense	84624					extracellular region		g.chr6:159660563C>A	AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.4195C>A	6.37:g.159660563C>A	ENSP00000297267:p.Pro1399Thr		Somatic				FNDC1_uc010kjw.1_Missense_Mutation_p.P1284T	p.P1399T	NM_032532	NP_115921	WXS	Illumina HiSeq	Unspecified	Q4ZHG4	FNDC1_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)	14	4395	+		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)	1399					A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Missense_Mutation	SNP	ENST00000297267.9	37	c.4195C>A	CCDS47512.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.79|16.79	3.219268|3.219268	0.58560|0.58560	.|.	.|.	ENSG00000164694|ENSG00000164694	ENST00000329629|ENST00000297267;ENST00000340366	.|T;T	.|0.53206	.|0.63;1.49	5.11|5.11	5.11|5.11	0.69529|0.69529	.|.	0.122496|0.122496	0.56097|0.56097	D|D	0.000032|0.000032	T|T	0.64438|0.64438	0.2598|0.2598	M|M	0.69823|0.69823	2.125|2.125	0.58432|0.58432	D|D	0.999997|0.999997	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|1.0;0.999	T|T	0.68394|0.68394	-0.5420|-0.5420	6|10	.|0.87932	.|D	.|0	-21.9523|-21.9523	18.9097|18.9097	0.92477|0.92477	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1336;1399	.|Q4ZHG4-2;Q4ZHG4	.|.;FNDC1_HUMAN	H|T	1294|1399;1336	.|ENSP00000297267:P1399T;ENSP00000342460:P1336T	.|ENSP00000297267:P1399T	P|P	+|+	2|1	0|0	FNDC1|FNDC1	159580553|159580553	1.000000|1.000000	0.71417|0.71417	0.975000|0.975000	0.42487|0.42487	0.930000|0.930000	0.56654|0.56654	6.406000|6.406000	0.73276|0.73276	2.523000|2.523000	0.85059|0.85059	0.655000|0.655000	0.94253|0.94253	CCC|CCC		0.483	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042897.3	NM_032532		3	11	1	0	0.004672	0.00498285	3	11				
SMOC2	64094	broad.mit.edu	37	6	169064781	169064781	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:169064781C>T	ENST00000356284.2	+	12	1533	c.1313C>T	c.(1312-1314)tCt>tTt	p.S438F	SMOC2_ENST00000477998.1_3'UTR|SMOC2_ENST00000354536.5_Missense_Mutation_p.S449F	NM_001166412.1	NP_001159884.1	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2	438					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)|signal transduction (GO:0007165)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	32		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		GAAAGTACGTCTAATAGACAG	0.294																																						uc003qws.1		NA																	0				ovary(1)	1						c.(1312-1314)TCT>TTT		SPARC related modular calcium binding 2							54.0	55.0	54.0					6																	169064781		2203	4300	6503	SO:0001583	missense	64094				signal transduction	basement membrane	calcium ion binding	g.chr6:169064781C>T	AB014730	CCDS5307.1, CCDS55076.1	6q27	2013-01-10			ENSG00000112562	ENSG00000112562		"""EF-hand domain containing"""	20323	protein-coding gene	gene with protein product		607223				12031507	Standard	NM_022138		Approved	SMAP2	uc003qwr.2	Q9H3U7	OTTHUMG00000016050	ENST00000356284.2:c.1313C>T	6.37:g.169064781C>T	ENSP00000348630:p.Ser438Phe		Somatic				SMOC2_uc003qwr.1_Missense_Mutation_p.S449F|SMOC2_uc011egu.1_Missense_Mutation_p.S115F	p.S438F	NM_022138	NP_071421	WXS	Illumina HiSeq	Unspecified	Q9H3U7	SMOC2_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)	12	1333	+		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)	438					B3KPS7|Q4G169|Q5TAT7|Q5TAT8|Q86VV9|Q96SF3|Q9H1L3|Q9H1L4|Q9H3U0|Q9H4F7|Q9HCV2	Missense_Mutation	SNP	ENST00000356284.2	37	c.1313C>T	CCDS55076.1	.	.	.	.	.	.	.	.	.	.	C	10.34	1.322872	0.23994	.	.	ENSG00000112562	ENST00000356284;ENST00000354536;ENST00000366793;ENST00000392101;ENST00000538593;ENST00000417208	T;T	0.38560	1.14;1.13	3.56	3.56	0.40772	.	0.882556	0.09596	N	0.780794	T	0.20861	0.0502	L	0.29908	0.895	0.09310	N	0.999999	B;P	0.46220	0.38;0.874	B;B	0.44224	0.191;0.444	T	0.06075	-1.0847	10	0.54805	T	0.06	0.3277	10.8319	0.46665	0.0:1.0:0.0:0.0	.	438;449	Q9H3U7;Q9H3U7-2	SMOC2_HUMAN;.	F	438;449;438;115;115;58	ENSP00000348630:S438F;ENSP00000346537:S449F	ENSP00000346537:S449F	S	+	2	0	SMOC2	168806706	0.003000	0.15002	0.155000	0.22561	0.671000	0.39405	1.844000	0.39269	1.977000	0.57605	0.655000	0.94253	TCT		0.294	SMOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043201.1			18	55	0	0	0	0	18	55				
RSPH10B2	728194	broad.mit.edu	37	7	6838029	6838029	+	Missense_Mutation	SNP	A	A	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:6838029A>G	ENST00000403107.1	+	20	2855	c.2468A>G	c.(2467-2469)aAg>aGg	p.K823R	RSPH10B2_ENST00000359718.3_3'UTR|RSPH10B2_ENST00000297186.3_Missense_Mutation_p.K823R|CCZ1B_ENST00000316731.8_3'UTR|RSPH10B2_ENST00000433859.2_Missense_Mutation_p.K823R|RSPH10B2_ENST00000404077.1_Missense_Mutation_p.K823R|CCZ1B_ENST00000597208.1_5'Flank			B2RC85	R10B2_HUMAN	radial spoke head 10 homolog B2 (Chlamydomonas)	823										breast(3)|endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|skin(2)	15						GAAGAGGCCAAGAGACATGAC	0.483																																						uc003sqw.1		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(2467-2469)AAG>AGG		radial spoke head 10 homolog B							62.0	71.0	69.0					7																	6838029		1560	3688	5248	SO:0001583	missense	728194							g.chr7:6838029A>G		CCDS43552.1	7p22.1	2008-07-04			ENSG00000169402	ENSG00000169402			34385	protein-coding gene	gene with protein product							Standard	NM_001099697		Approved		uc003sqw.1	B2RC85	OTTHUMG00000151856	ENST00000403107.1:c.2468A>G	7.37:g.6838029A>G	ENSP00000384766:p.Lys823Arg		Somatic				RSPH10B2_uc010ktk.1_Missense_Mutation_p.K823R|RSPH10B2_uc010ktl.1_RNA	p.K823R	NM_173565	NP_775836	WXS	Illumina HiSeq	Unspecified	B2RC85	R10B2_HUMAN			21	2739	+			823					A6NMW7|B2RXI4|B2RXJ0|Q86ST9|Q8NE68	Missense_Mutation	SNP	ENST00000403107.1	37	c.2468A>G	CCDS43552.1	.	.	.	.	.	.	.	.	.	.	A	4.725	0.134724	0.09032	.	.	ENSG00000169402	ENST00000403107;ENST00000404077;ENST00000297186;ENST00000433859	T;T;T;T	0.54866	0.55;0.55;0.55;0.55	2.72	-1.38	0.09027	.	2.468790	0.02231	U	0.064863	T	0.42653	0.1212	L	0.43923	1.385	0.22989	N	0.998468	B	0.12013	0.005	B	0.10450	0.005	T	0.07849	-1.0751	10	0.20519	T	0.43	.	5.9044	0.18984	0.5067:0.0:0.4933:0.0	.	823	B2RC85	R10B2_HUMAN	R	823	ENSP00000384766:K823R;ENSP00000386102:K823R;ENSP00000297186:K823R;ENSP00000416710:K823R	ENSP00000297186:K823R	K	+	2	0	RSPH10B2	6804554	0.992000	0.36948	0.046000	0.18839	0.048000	0.14542	0.731000	0.26058	-0.422000	0.07405	0.149000	0.16113	AAG		0.483	RSPH10B2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324184.4	NM_001099697		18	125	0	0	0	0	18	125				
THSD7A	221981	broad.mit.edu	37	7	11416278	11416278	+	Missense_Mutation	SNP	C	C	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:11416278C>G	ENST00000423059.4	-	27	5059	c.4808G>C	c.(4807-4809)aGa>aCa	p.R1603T	AC004538.3_ENST00000595972.1_RNA|AC004538.3_ENST00000421121.1_RNA|AC004538.3_ENST00000428967.1_RNA|AC004538.3_ENST00000445839.1_RNA|AC004538.3_ENST00000599875.1_RNA	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	1603					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		GGTCTTTAGTCTCCCATCTAA	0.353										HNSCC(18;0.044)																												uc003ssf.3		NA																	0				ovary(3)	3						c.(4807-4809)AGA>ACA		thrombospondin, type I, domain containing 7A							51.0	54.0	53.0					7																	11416278		1860	4089	5949	SO:0001583	missense	221981					integral to membrane		g.chr7:11416278C>G		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.4808G>C	7.37:g.11416278C>G	ENSP00000406482:p.Arg1603Thr	HNSCC(18;0.044)	Somatic				uc003ssb.2_Intron|THSD7A_uc003ssd.3_Missense_Mutation_p.R107T	p.R1603T	NM_015204	NP_056019	WXS	Illumina HiSeq	Unspecified	Q9UPZ6	THS7A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.163)	26	5060	-			1603			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000423059.4	37	c.4808G>C	CCDS47543.1	.	.	.	.	.	.	.	.	.	.	C	14.44	2.534999	0.45073	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	T	0.59224	0.28	5.07	4.19	0.49359	.	0.044558	0.85682	D	0.000000	T	0.58366	0.2117	L	0.59436	1.845	0.39240	D	0.963847	B;P	0.44044	0.135;0.825	B;P	0.45794	0.156;0.493	T	0.64984	-0.6278	10	0.72032	D	0.01	.	11.2738	0.49155	0.0:0.8515:0.0:0.1485	.	1603;1603	Q9UPZ6;C9JL67	THS7A_HUMAN;.	T	1603	ENSP00000406482:R1603T	ENSP00000262042:R1603T	R	-	2	0	THSD7A	11382803	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.948000	0.29096	1.261000	0.44149	0.650000	0.86243	AGA		0.353	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2		4	8	0	0	0	0	4	8				
AGMO	392636	broad.mit.edu	37	7	15430298	15430298	+	Missense_Mutation	SNP	G	G	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:15430298G>C	ENST00000342526.3	-	8	989	c.820C>G	c.(820-822)Cag>Gag	p.Q274E		NM_001004320.1	NP_001004320.1	Q6ZNB7	ALKMO_HUMAN	alkylglycerol monooxygenase	274					ether lipid metabolic process (GO:0046485)|fatty acid biosynthetic process (GO:0006633)|membrane lipid metabolic process (GO:0006643)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glyceryl-ether monooxygenase activity (GO:0050479)|iron ion binding (GO:0005506)			breast(1)|kidney(1)|large_intestine(6)|liver(1)|lung(30)|prostate(1)|skin(2)	42						TATGTTACCTGCACTTTGATT	0.269																																						uc003stb.1		NA																	0					0						c.(820-822)CAG>GAG		transmembrane protein 195							117.0	127.0	123.0					7																	15430298		2203	4295	6498	SO:0001583	missense	392636				ether lipid metabolic process|fatty acid biosynthetic process|membrane lipid metabolic process	endoplasmic reticulum membrane|integral to membrane	glyceryl-ether monooxygenase activity|iron ion binding	g.chr7:15430298G>C		CCDS34604.1	7p21.1	2013-03-04	2011-01-31	2011-01-31	ENSG00000187546	ENSG00000187546	1.14.16.5	"""Fatty acid hydroxylase domain containing"""	33784	protein-coding gene	gene with protein product		613738	"""transmembrane protein 195"""	TMEM195		20643956	Standard	NM_001004320		Approved	FLJ16237	uc003stb.1	Q6ZNB7	OTTHUMG00000152387	ENST00000342526.3:c.820C>G	7.37:g.15430298G>C	ENSP00000341662:p.Gln274Glu		Somatic					p.Q274E	NM_001004320	NP_001004320	WXS	Illumina HiSeq	Unspecified	Q6ZNB7	ALKMO_HUMAN			8	990	-			274					A4D114|A6NCH5	Missense_Mutation	SNP	ENST00000342526.3	37	c.820C>G	CCDS34604.1	.	.	.	.	.	.	.	.	.	.	G	10.30	1.312933	0.23908	.	.	ENSG00000187546	ENST00000342526	T	0.34667	1.35	5.32	4.43	0.53597	.	0.057020	0.64402	D	0.000001	T	0.40932	0.1137	L	0.55213	1.73	0.44234	D	0.997075	P	0.51351	0.944	P	0.48770	0.589	T	0.17349	-1.0372	10	0.23302	T	0.38	-24.0247	14.1042	0.65078	0.0729:0.0:0.9271:0.0	.	274	Q6ZNB7	ALKMO_HUMAN	E	274	ENSP00000341662:Q274E	ENSP00000341662:Q274E	Q	-	1	0	AGMO	15396823	1.000000	0.71417	0.976000	0.42696	0.191000	0.23601	4.956000	0.63645	1.369000	0.46134	0.585000	0.79938	CAG		0.269	AGMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326049.2	NM_001004320		30	136	0	0	0	0	30	136				
AGMO	392636	broad.mit.edu	37	7	15430330	15430330	+	Missense_Mutation	SNP	T	T	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:15430330T>C	ENST00000342526.3	-	8	957	c.788A>G	c.(787-789)cAt>cGt	p.H263R		NM_001004320.1	NP_001004320.1	Q6ZNB7	ALKMO_HUMAN	alkylglycerol monooxygenase	263					ether lipid metabolic process (GO:0046485)|fatty acid biosynthetic process (GO:0006633)|membrane lipid metabolic process (GO:0006643)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glyceryl-ether monooxygenase activity (GO:0050479)|iron ion binding (GO:0005506)			breast(1)|kidney(1)|large_intestine(6)|liver(1)|lung(30)|prostate(1)|skin(2)	42						ATTAATGGGATGTGTTAAGCC	0.294																																						uc003stb.1		NA																	0					0						c.(787-789)CAT>CGT		transmembrane protein 195							134.0	145.0	141.0					7																	15430330		2202	4298	6500	SO:0001583	missense	392636				ether lipid metabolic process|fatty acid biosynthetic process|membrane lipid metabolic process	endoplasmic reticulum membrane|integral to membrane	glyceryl-ether monooxygenase activity|iron ion binding	g.chr7:15430330T>C		CCDS34604.1	7p21.1	2013-03-04	2011-01-31	2011-01-31	ENSG00000187546	ENSG00000187546	1.14.16.5	"""Fatty acid hydroxylase domain containing"""	33784	protein-coding gene	gene with protein product		613738	"""transmembrane protein 195"""	TMEM195		20643956	Standard	NM_001004320		Approved	FLJ16237	uc003stb.1	Q6ZNB7	OTTHUMG00000152387	ENST00000342526.3:c.788A>G	7.37:g.15430330T>C	ENSP00000341662:p.His263Arg		Somatic					p.H263R	NM_001004320	NP_001004320	WXS	Illumina HiSeq	Unspecified	Q6ZNB7	ALKMO_HUMAN			8	958	-			263					A4D114|A6NCH5	Missense_Mutation	SNP	ENST00000342526.3	37	c.788A>G	CCDS34604.1	.	.	.	.	.	.	.	.	.	.	T	13.82	2.351422	0.41700	.	.	ENSG00000187546	ENST00000342526	T	0.30182	1.54	5.33	4.18	0.49190	.	0.105434	0.64402	D	0.000005	T	0.24470	0.0593	L	0.39467	1.215	0.37115	D	0.900554	B	0.30146	0.27	B	0.30646	0.118	T	0.12578	-1.0542	10	0.22706	T	0.39	-43.6771	11.2551	0.49050	0.0:0.0721:0.0:0.9279	.	263	Q6ZNB7	ALKMO_HUMAN	R	263	ENSP00000341662:H263R	ENSP00000341662:H263R	H	-	2	0	AGMO	15396855	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.963000	0.49184	0.970000	0.38263	-0.353000	0.07706	CAT		0.294	AGMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326049.2	NM_001004320		35	153	0	0	0	0	35	153				
ABCB5	340273	broad.mit.edu	37	7	20762764	20762764	+	Silent	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:20762764C>T	ENST00000404938.2	+	21	3199	c.2547C>T	c.(2545-2547)gcC>gcT	p.A849A	ABCB5_ENST00000258738.6_Silent_p.A404A	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	849	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						CAGTACTTGCCGTGACAGGAA	0.388																																						uc003suw.3		NA																	0				skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						c.(1210-1212)GCC>GCT		ATP-binding cassette, sub-family B, member 5							156.0	144.0	148.0					7																	20762764		2203	4300	6503	SO:0001819	synonymous_variant	340273				regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity	g.chr7:20762764C>T	U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.2547C>T	7.37:g.20762764C>T			Somatic				ABCB5_uc010kuh.2_Silent_p.A849A|ABCB5_uc003sux.1_Silent_p.A27A	p.A404A	NM_178559	NP_848654	WXS	Illumina HiSeq	Unspecified	Q2M3G0	ABCB5_HUMAN			12	1758	+			404			Cytoplasmic (Potential).|ABC transmembrane type-1.		A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Silent	SNP	ENST00000404938.2	37	c.1212C>T	CCDS55090.1																																																																																				0.388	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000326736.2	NM_178559		33	94	0	0	0	0	33	94				
CHN2	1124	broad.mit.edu	37	7	29539573	29539573	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:29539573G>T	ENST00000222792.6	+	9	1360	c.830G>T	c.(829-831)tGt>tTt	p.C277F	CHN2_ENST00000539389.1_Missense_Mutation_p.C133F|CHN2_ENST00000546235.1_Missense_Mutation_p.C262F|CHN2_ENST00000424025.2_Missense_Mutation_p.C96F|CHN2_ENST00000539406.1_Missense_Mutation_p.C352F|CHN2_ENST00000410098.1_3'UTR|CHN2_ENST00000495789.2_Missense_Mutation_p.C290F|CHN2_ENST00000435288.2_Intron|CHN2_ENST00000409041.4_Missense_Mutation_p.C141F|CHN2_ENST00000421775.2_Intron|CHN2_ENST00000439711.2_Missense_Mutation_p.C141F	NM_004067.2	NP_004058.1	P52757	CHIO_HUMAN	chimerin 2	277	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				positive regulation of GTPase activity (GO:0043547)|positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(3)|large_intestine(2)|lung(12)|ovary(2)|urinary_tract(2)	23						GTGTACTGTTGTGACCTCACA	0.443																																					Ovarian(1;44 48 13232 18918 31480)	uc003szz.2		NA																	0				ovary(2)	2						c.(829-831)TGT>TTT		beta chimerin isoform 2							115.0	98.0	104.0					7																	29539573		2203	4300	6503	SO:0001583	missense	1124				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|membrane	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity	g.chr7:29539573G>T	L29126	CCDS5420.1	7p15.3	2013-02-14	2012-10-17		ENSG00000106069	ENSG00000106069		"""Rho GTPase activating proteins"", ""SH2 domain containing"""	1944	protein-coding gene	gene with protein product	"""beta chimerin"", ""chimaerin 2"""	602857	"""chimerin (chimaerin) 2"""			8175705	Standard	XM_005249602		Approved	ARHGAP3, RhoGAP3	uc003szz.3	P52757	OTTHUMG00000023063	ENST00000222792.6:c.830G>T	7.37:g.29539573G>T	ENSP00000222792:p.Cys277Phe		Somatic				CHN2_uc011jzs.1_Missense_Mutation_p.C352F|CHN2_uc010kva.2_Missense_Mutation_p.C47F|CHN2_uc010kvb.2_Intron|CHN2_uc010kvc.2_Missense_Mutation_p.C242F|CHN2_uc011jzt.1_Missense_Mutation_p.C290F|CHN2_uc010kvd.2_Missense_Mutation_p.C133F|CHN2_uc011jzu.1_Missense_Mutation_p.C262F|CHN2_uc010kvg.2_Missense_Mutation_p.C141F|CHN2_uc010kvh.2_Intron|CHN2_uc010kvi.2_Missense_Mutation_p.C141F|CHN2_uc010kve.2_Missense_Mutation_p.C141F|CHN2_uc003taa.2_Missense_Mutation_p.C141F|CHN2_uc010kvf.2_Intron|CHN2_uc010kvj.2_Missense_Mutation_p.C96F|CHN2_uc010kvk.2_Intron|CHN2_uc010kvl.2_RNA|CHN2_uc010kvm.2_Missense_Mutation_p.C96F|CHN2_uc011jzv.1_Missense_Mutation_p.C70F	p.C277F	NM_004067	NP_004058	WXS	Illumina HiSeq	Unspecified	P52757	CHIO_HUMAN			9	1267	+			277			Rho-GAP.		A4D1A2|B3VCF1|B3VCF2|B3VCF3|B3VCF7|B3VCG1|C9J7B0|E9PGE0|F8QPL9|Q2M203|Q75MM2	Missense_Mutation	SNP	ENST00000222792.6	37	c.830G>T	CCDS5420.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.282639	0.80692	.	.	ENSG00000106069	ENST00000539406;ENST00000222792;ENST00000495789;ENST00000539389;ENST00000546235;ENST00000446446;ENST00000409041;ENST00000424025;ENST00000439711	T;T;T;T;T;T;T;T;T	0.10960	2.82;2.82;2.82;2.82;2.82;2.82;2.82;2.82;2.82	5.61	5.61	0.85477	Rho GTPase-activating protein domain (2);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.42899	0.1223	M	0.89478	3.035	0.80722	D	1	B;B;D;D;P;B;D;B;D;P;D;P;P;D	0.89917	0.28;0.309;1.0;1.0;0.813;0.402;0.998;0.288;1.0;0.817;0.999;0.93;0.91;0.999	B;B;D;D;B;B;D;B;D;B;D;P;B;D	0.87578	0.041;0.023;0.993;0.998;0.151;0.119;0.991;0.085;0.913;0.105;0.987;0.573;0.288;0.987	T	0.45425	-0.9262	10	0.72032	D	0.01	.	19.5929	0.95523	0.0:0.0:1.0:0.0	.	70;262;290;352;96;96;141;141;141;133;277;47;141;277	B7Z215;B7Z1W9;B7Z1V0;F5H003;B3VCF1;B3VCF2;B3VCF5;B3VCF7;B3VCF6;B3VCG1;A4D1A2;B3VCF8;E9PGE0;P52757	.;.;.;.;.;.;.;.;.;.;.;.;.;CHIO_HUMAN	F	352;277;290;133;262;102;141;96;141	ENSP00000444063:C352F;ENSP00000222792:C277F;ENSP00000438587:C290F;ENSP00000440526:C133F;ENSP00000442812:C262F;ENSP00000396867:C102F;ENSP00000386849:C141F;ENSP00000406337:C96F;ENSP00000387425:C141F	ENSP00000222792:C277F	C	+	2	0	CHN2	29506098	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.775000	0.98995	2.804000	0.96469	0.462000	0.41574	TGT		0.443	CHN2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214228.2	NM_004067		13	46	1	0	2.27e-07	2.87e-07	13	46				
NEUROD6	63974	broad.mit.edu	37	7	31378419	31378419	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:31378419C>T	ENST00000297142.3	-	2	786	c.464G>A	c.(463-465)aGa>aAa	p.R155K		NM_022728.2	NP_073565.2	Q96NK8	NDF6_HUMAN	neuronal differentiation 6	155					cell differentiation (GO:0030154)|dentate gyrus development (GO:0021542)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	32						CAGATCTGGTCTCTTGCCGAT	0.458																																						uc003tch.2		NA																	0				ovary(2)	2						c.(463-465)AGA>AAA		neurogenic differentiation 6							75.0	76.0	76.0					7																	31378419		2203	4300	6503	SO:0001583	missense	63974				cell differentiation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr7:31378419C>T	AF248954	CCDS5434.1	7p15.1	2013-05-21	2012-02-22		ENSG00000164600	ENSG00000164600		"""Basic helix-loop-helix proteins"""	13804	protein-coding gene	gene with protein product		611513	"""neurogenic differentiation 6"""			12357074	Standard	NM_022728		Approved	Atoh2, NEX1M, Math-2, bHLHa2, Nex1	uc003tch.4	Q96NK8	OTTHUMG00000022865	ENST00000297142.3:c.464G>A	7.37:g.31378419C>T	ENSP00000297142:p.Arg155Lys		Somatic					p.R155K	NM_022728	NP_073565	WXS	Illumina HiSeq	Unspecified	Q96NK8	NDF6_HUMAN			2	817	-			155					Q548T9|Q9H3H6	Missense_Mutation	SNP	ENST00000297142.3	37	c.464G>A	CCDS5434.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.043842	0.75732	.	.	ENSG00000164600	ENST00000297142	T	0.63255	-0.03	5.46	5.46	0.80206	Neurogenic differentiation factor, domain of unknown function (1);	0.000000	0.85682	D	0.000000	T	0.71005	0.3289	M	0.63428	1.95	0.80722	D	1	P	0.51147	0.942	P	0.54210	0.745	T	0.65417	-0.6173	10	0.17832	T	0.49	-10.9934	19.3174	0.94220	0.0:1.0:0.0:0.0	.	155	Q96NK8	NDF6_HUMAN	K	155	ENSP00000297142:R155K	ENSP00000297142:R155K	R	-	2	0	NEUROD6	31344944	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.770000	0.85390	2.569000	0.86673	0.650000	0.86243	AGA		0.458	NEUROD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215050.1	NM_022728		19	88	0	0	0	0	19	88				
PSMA2	5683	broad.mit.edu	37	7	42966149	42966149	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:42966149C>A	ENST00000223321.4	-	3	301	c.237G>T	c.(235-237)atG>atT	p.M79I	PSMA2_ENST00000442788.1_Missense_Mutation_p.M79I|PSMA2_ENST00000538645.1_Start_Codon_SNP_p.M1I|PSMA2_ENST00000445517.1_Intron	NM_002787.4	NP_002778.1	P25787	PSA2_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 2	79					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to virus (GO:0009615)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	threonine-type endopeptidase activity (GO:0004298)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(2)	10						AATCGGGGCCCATGCCACTGT	0.368																																						uc003thy.2		NA																	0				large_intestine(2)|ovary(1)	3						c.(235-237)ATG>ATT		proteasome subunit alpha type 2							161.0	141.0	148.0					7																	42966149		2203	4300	6503	SO:0001583	missense	5683				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|response to virus|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex, alpha-subunit complex	protein binding|threonine-type endopeptidase activity	g.chr7:42966149C>A	D00760	CCDS5467.1	7p13	2005-10-11			ENSG00000106588	ENSG00000106588		"""Proteasome (prosome, macropain) subunits"""	9531	protein-coding gene	gene with protein product		176842				2025653, 1888762	Standard	NM_002787		Approved	MU, HC3, PMSA2	uc003thy.3	P25787	OTTHUMG00000023916	ENST00000223321.4:c.237G>T	7.37:g.42966149C>A	ENSP00000223321:p.Met79Ile		Somatic				C7orf25_uc010kxr.2_Intron|PSMA2_uc010kxt.2_Missense_Mutation_p.M1I|PSMA2_uc003thz.1_Missense_Mutation_p.M1I	p.M79I	NM_002787	NP_002778	WXS	Illumina HiSeq	Unspecified	P25787	PSA2_HUMAN			3	285	-			79					Q6ICS6|Q9BU45	Missense_Mutation	SNP	ENST00000223321.4	37	c.237G>T	CCDS5467.1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.959458	0.92726	.	.	ENSG00000106588	ENST00000223321;ENST00000538645	T	0.39787	1.06	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.56455	0.1986	L	0.47190	1.495	0.80722	D	1	P	0.48230	0.907	P	0.57620	0.824	T	0.50389	-0.8834	10	0.46703	T	0.11	.	20.0203	0.97492	0.0:1.0:0.0:0.0	.	79	P25787	PSA2_HUMAN	I	79;1	ENSP00000223321:M79I	ENSP00000223321:M79I	M	-	3	0	PSMA2	42932674	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.729000	0.84864	2.730000	0.93505	0.655000	0.94253	ATG		0.368	PSMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250816.1	NM_002787		26	71	1	0	2.49e-11	3.42e-11	26	71				
MYO1G	64005	broad.mit.edu	37	7	45004594	45004594	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:45004594G>A	ENST00000258787.7	-	18	2612	c.2476C>T	c.(2476-2478)Cgt>Tgt	p.R826C		NM_033054.2	NP_149043.2	B0I1T2	MYO1G_HUMAN	myosin IG	826	Myosin tail. {ECO:0000255}.					extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|pancreas(1)|skin(4)	28						CAGTCCTGACGAAGCCCTTGC	0.677																																						uc003tmh.2		NA																	0				breast(2)|ovary(1)|pancreas(1)	4						c.(2476-2478)CGT>TGT		myosin IG							43.0	51.0	48.0					7																	45004594		2203	4299	6502	SO:0001583	missense	64005					myosin complex|plasma membrane	actin binding|ATP binding|calmodulin binding|motor activity	g.chr7:45004594G>A	AF380932	CCDS34629.1	7p13-p11.2	2011-09-27			ENSG00000136286	ENSG00000136286		"""Myosins / Myosin superfamily : Class I"""	13880	protein-coding gene	gene with protein product	"""minor histocompatibility antigen HA-2"""	600642					Standard	NM_033054		Approved	HA-2	uc003tmh.2	B0I1T2	OTTHUMG00000155821	ENST00000258787.7:c.2476C>T	7.37:g.45004594G>A	ENSP00000258787:p.Arg826Cys		Somatic				MYO1G_uc003tmf.2_Missense_Mutation_p.R269C|MYO1G_uc003tmg.2_Missense_Mutation_p.R588C|MYO1G_uc010kym.2_Missense_Mutation_p.R711C	p.R826C	NM_033054	NP_149043	WXS	Illumina HiSeq	Unspecified	B0I1T2	MYO1G_HUMAN			18	2620	-			826	R->A: Reduced membrane association.				Q8TEI9|Q8TES2|Q96BE2|Q96RI5|Q96RI6	Missense_Mutation	SNP	ENST00000258787.7	37	c.2476C>T	CCDS34629.1	.	.	.	.	.	.	.	.	.	.	G	17.09	3.300692	0.60195	.	.	ENSG00000136286	ENST00000258787	T	0.40476	1.03	4.29	2.43	0.29744	Myosin tail 2 (1);	0.000000	0.36268	N	0.002690	T	0.62196	0.2408	M	0.84585	2.705	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.60939	-0.7163	10	0.87932	D	0	.	6.2818	0.21011	0.0891:0.0:0.5893:0.3216	.	826	B0I1T2	MYO1G_HUMAN	C	826	ENSP00000258787:R826C	ENSP00000258787:R826C	R	-	1	0	MYO1G	44971119	1.000000	0.71417	0.017000	0.16124	0.905000	0.53344	3.147000	0.50639	0.358000	0.24211	0.561000	0.74099	CGT		0.677	MYO1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341832.2			31	98	0	0	0	0	31	98				
UPP1	7378	broad.mit.edu	37	7	48141563	48141563	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:48141563C>T	ENST00000331803.4	+	6	928	c.305C>T	c.(304-306)cCg>cTg	p.P102L	UPP1_ENST00000341253.4_Missense_Mutation_p.P102L|UPP1_ENST00000395564.4_Missense_Mutation_p.P102L|UPP1_ENST00000429491.2_Intron|UPP1_ENST00000482015.1_Intron			Q16831	UPP1_HUMAN	uridine phosphorylase 1	102					cellular response to glucose starvation (GO:0042149)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide catabolic process (GO:0009166)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside salvage (GO:0043097)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)|uridine metabolic process (GO:0046108)	cytosol (GO:0005829)	uridine phosphorylase activity (GO:0004850)			breast(1)|endometrium(2)|large_intestine(1)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	18					Fluorouracil(DB00544)	AAAGTAGGACCGGTGCTGTCT	0.572																																						uc003toj.2		NA																	0					0						c.(304-306)CCG>CTG		uridine phosphorylase 1							215.0	161.0	179.0					7																	48141563		2203	4300	6503	SO:0001583	missense	7378				nucleotide catabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process|pyrimidine nucleoside salvage	cytosol	uridine phosphorylase activity	g.chr7:48141563C>T	AK096167	CCDS5507.1	7p12.3	2012-10-02	2003-08-28	2003-08-29	ENSG00000183696	ENSG00000183696	2.4.2.3		12576	protein-coding gene	gene with protein product		191730	"""uridine phosphorylase"""	UP		752472, 11807789	Standard	NM_003364		Approved	UPASE, UPP, UDRPASE	uc003toj.3	Q16831	OTTHUMG00000129253	ENST00000331803.4:c.305C>T	7.37:g.48141563C>T	ENSP00000330032:p.Pro102Leu		Somatic				UPP1_uc003tok.2_Missense_Mutation_p.P102L|UPP1_uc003tol.2_Missense_Mutation_p.P102L|UPP1_uc011kcg.1_Missense_Mutation_p.P102L|UPP1_uc011kch.1_Intron|UPP1_uc003ton.2_Intron|UPP1_uc003too.2_Intron	p.P102L	NM_181597	NP_853628	WXS	Illumina HiSeq	Unspecified	Q16831	UPP1_HUMAN			6	834	+			102					D3DVM4|Q15362	Missense_Mutation	SNP	ENST00000331803.4	37	c.305C>T	CCDS5507.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.990092	0.93106	.	.	ENSG00000183696	ENST00000416681;ENST00000331803;ENST00000341253;ENST00000395564;ENST00000436673	D;D;D;D;D	0.88124	-2.34;-2.34;-2.34;-2.34;-2.34	5.77	5.77	0.91146	Nucleoside phosphorylase domain (1);	0.000000	0.85682	D	0.000000	D	0.95506	0.8540	M	0.93678	3.445	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.96146	0.9104	10	0.87932	D	0	-34.4206	18.9737	0.92725	0.0:1.0:0.0:0.0	.	102;102	B4DND0;Q16831	.;UPP1_HUMAN	L	102	ENSP00000405209:P102L;ENSP00000330032:P102L;ENSP00000342878:P102L;ENSP00000378931:P102L;ENSP00000390118:P102L	ENSP00000330032:P102L	P	+	2	0	UPP1	48108088	1.000000	0.71417	0.366000	0.25914	0.994000	0.84299	7.549000	0.82163	2.715000	0.92844	0.655000	0.94253	CCG		0.572	UPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251360.1	NM_003364		28	64	0	0	0	0	28	64				
WBSCR17	64409	broad.mit.edu	37	7	70881051	70881051	+	Splice_Site	SNP	T	T	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:70881051T>C	ENST00000333538.5	+	4	1398		c.e4+2		WBSCR17_ENST00000498380.2_Splice_Site	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17						protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				CGCTGGCTGGTAGGTCATGAG	0.582																																						uc003tvy.2		NA																	0				skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7						c.e4+2		UDP-GalNAc:polypeptide							57.0	49.0	52.0					7																	70881051		2203	4300	6503	SO:0001630	splice_region_variant	64409					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr7:70881051T>C	AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.764+2T>C	7.37:g.70881051T>C			Somatic				WBSCR17_uc003tvz.2_Splice_Site	p.W255_splice	NM_022479	NP_071924	WXS	Illumina HiSeq	Unspecified	Q6IS24	GLTL3_HUMAN			4	764	+		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)						Q8NFV9|Q9NTA8	Splice_Site	SNP	ENST00000333538.5	37	c.764_splice	CCDS5540.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.966734	0.74131	.	.	ENSG00000185274	ENST00000333538	.	.	.	5.04	5.04	0.67666	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.9676	0.64218	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	WBSCR17	70518987	1.000000	0.71417	1.000000	0.80357	0.787000	0.44495	7.621000	0.83083	1.906000	0.55180	0.379000	0.24179	.		0.582	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252006.1	NM_022479	Intron	8	78	0	0	0	0	8	78				
PCLO	27445	broad.mit.edu	37	7	82579581	82579581	+	Silent	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:82579581C>A	ENST00000333891.9	-	6	10660	c.10323G>T	c.(10321-10323)gtG>gtT	p.V3441V	PCLO_ENST00000423517.2_Silent_p.V3441V|PCLO_ENST00000437081.1_Silent_p.V161V	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CACCACTGTCCACTATCTTTT	0.433																																						uc003uhx.2		NA																	0				ovary(7)	7						c.(10321-10323)GTG>GTT		piccolo isoform 1							123.0	114.0	117.0					7																	82579581		1921	4133	6054	SO:0001819	synonymous_variant	27445				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity	g.chr7:82579581C>A	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.10323G>T	7.37:g.82579581C>A			Somatic				PCLO_uc003uhv.2_Silent_p.V3441V|PCLO_uc010lec.2_Silent_p.V406V	p.V3441V	NM_033026	NP_149015	WXS	Illumina HiSeq	Unspecified	Q9Y6V0	PCLO_HUMAN			6	10612	-			3372						Silent	SNP	ENST00000333891.9	37	c.10323G>T	CCDS47630.1																																																																																				0.433	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510		65	81	1	0	9.41e-28	1.45e-27	65	81				
ZNF804B	219578	broad.mit.edu	37	7	88963725	88963725	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:88963725C>A	ENST00000333190.4	+	4	2038	c.1429C>A	c.(1429-1431)Cca>Aca	p.P477T		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	477							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			TGGCTGCAACCCACTGTATTT	0.428										HNSCC(36;0.09)																												uc011khi.1		NA																	0				ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11						c.(1429-1431)CCA>ACA		zinc finger protein 804B							56.0	54.0	55.0					7																	88963725		2202	4298	6500	SO:0001583	missense	219578					intracellular	zinc ion binding	g.chr7:88963725C>A	AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.1429C>A	7.37:g.88963725C>A	ENSP00000329638:p.Pro477Thr	HNSCC(36;0.09)	Somatic					p.P477T	NM_181646	NP_857597	WXS	Illumina HiSeq	Unspecified	A4D1E1	Z804B_HUMAN	STAD - Stomach adenocarcinoma(171;0.0513)		4	1967	+	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		477					B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	ENST00000333190.4	37	c.1429C>A	CCDS5613.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.345056	0.82022	.	.	ENSG00000182348	ENST00000333190	T	0.60299	0.2	5.49	5.49	0.81192	.	0.000000	0.64402	D	0.000003	T	0.78880	0.4353	M	0.81942	2.565	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80540	-0.1337	10	0.87932	D	0	-16.6668	19.5755	0.95441	0.0:1.0:0.0:0.0	.	477	A4D1E1	Z804B_HUMAN	T	477	ENSP00000329638:P477T	ENSP00000329638:P477T	P	+	1	0	ZNF804B	88801661	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.320000	0.79064	2.865000	0.98341	0.655000	0.94253	CCA		0.428	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646		56	43	1	0	4.33e-22	6.54e-22	56	43				
AKAP9	10142	broad.mit.edu	37	7	91730192	91730192	+	Missense_Mutation	SNP	G	G	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:91730192G>C	ENST00000359028.2	+	45	11156	c.10931G>C	c.(10930-10932)gGt>gCt	p.G3644A	AKAP9_ENST00000356239.3_Missense_Mutation_p.G3640A|AKAP9_ENST00000358100.2_Missense_Mutation_p.G3590A			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	3644					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TCATTGAATGGTGGTGCCAAC	0.393			T	BRAF	papillary thyroid																																	uc003ulg.2		NA		Dom	yes		7	7q21-q22	10142	T	A kinase (PRKA) anchor protein (yotiao) 9			E	BRAF		papillary thyroid		0				breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26						c.(10918-10920)GGT>GCT		A-kinase anchor protein 9 isoform 2							114.0	115.0	114.0					7																	91730192		2203	4300	6503	SO:0001583	missense	10142				G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding	g.chr7:91730192G>C	AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.10931G>C	7.37:g.91730192G>C	ENSP00000351922:p.Gly3644Ala		Somatic				AKAP9_uc003ulf.2_Missense_Mutation_p.G3632A|AKAP9_uc003uli.2_Missense_Mutation_p.G3263A|AKAP9_uc003ulj.2_Missense_Mutation_p.G1410A|AKAP9_uc003ull.2_Missense_Mutation_p.G536A	p.G3640A	NM_005751	NP_005742	WXS	Illumina HiSeq	Unspecified	Q99996	AKAP9_HUMAN	STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)		45	11144	+	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		3644			Potential.		A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	ENST00000359028.2	37	c.10919G>C		.	.	.	.	.	.	.	.	.	.	G	12.06	1.825146	0.32237	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394534	T;T;T;T	0.03212	4.1;4.1;4.11;4.01	5.52	3.67	0.42095	.	0.199710	0.24960	N	0.034221	T	0.03220	0.0094	L	0.43152	1.355	0.09310	N	1	B;B;B;B;B	0.31026	0.304;0.167;0.104;0.167;0.167	B;B;B;B;B	0.28011	0.057;0.085;0.023;0.052;0.052	T	0.39702	-0.9601	10	0.30854	T	0.27	.	4.0024	0.09585	0.307:0.0:0.5201:0.1729	.	915;3644;3644;3640;3632	B3KQF9;Q99996-6;Q99996;Q99996-2;Q99996-3	.;.;AKAP9_HUMAN;.;.	A	3640;3644;3590;3644;1486	ENSP00000348573:G3640A;ENSP00000351922:G3644A;ENSP00000350813:G3590A;ENSP00000378042:G1486A	ENSP00000348573:G3640A	G	+	2	0	AKAP9	91568128	0.084000	0.21492	0.015000	0.15790	0.799000	0.45148	0.121000	0.15667	1.533000	0.49186	0.650000	0.86243	GGT		0.393	AKAP9-202	KNOWN	basic	protein_coding	protein_coding		NM_005751		109	128	0	0	0	0	109	128				
COL1A2	1278	broad.mit.edu	37	7	94049949	94049949	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:94049949G>T	ENST00000297268.6	+	37	2755	c.2284G>T	c.(2284-2286)Gct>Tct	p.A762S		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	762			Missing (in OI2). {ECO:0000269|PubMed:1339453}.		blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)		COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	CGTTGGAGCTGCTGGCCCAGC	0.512										HNSCC(75;0.22)																												uc003ung.1		NA																COL1A2/PLAG1(3)	0				soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9						c.(2284-2286)GCT>TCT		alpha 2 type I collagen precursor	Collagenase(DB00048)						37.0	34.0	35.0					7																	94049949		2203	4300	6503	SO:0001583	missense	1278				axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging	g.chr7:94049949G>T	Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.2284G>T	7.37:g.94049949G>T	ENSP00000297268:p.Ala762Ser	HNSCC(75;0.22)	Somatic				COL1A2_uc011kib.1_Intron|COL1A2_uc010lfi.1_Intron	p.A762S	NM_000089	NP_000080	WXS	Illumina HiSeq	Unspecified	P08123	CO1A2_HUMAN	STAD - Stomach adenocarcinoma(171;0.0031)		37	2755	+	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		762		Missing (in OI2A).			P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Missense_Mutation	SNP	ENST00000297268.6	37	c.2284G>T	CCDS34682.1	.	.	.	.	.	.	.	.	.	.	G	13.86	2.362944	0.41902	.	.	ENSG00000164692	ENST00000297268;ENST00000545487	D	0.93307	-3.2	5.85	4.96	0.65561	.	0.121733	0.56097	D	0.000022	D	0.86272	0.5893	N	0.20483	0.58	0.28215	N	0.926754	B	0.02656	0.0	B	0.06405	0.002	T	0.75365	-0.3343	10	0.25106	T	0.35	.	10.923	0.47176	0.0:0.1181:0.6121:0.2698	.	762	P08123	CO1A2_HUMAN	S	762;763	ENSP00000297268:A762S	ENSP00000297268:A762S	A	+	1	0	COL1A2	93887885	0.575000	0.26692	1.000000	0.80357	0.724000	0.41520	0.821000	0.27338	1.602000	0.50124	0.655000	0.94253	GCT		0.512	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2	NM_000089		4	8	1	0	0.00909568	0.00953133	4	8				
PON1	5444	broad.mit.edu	37	7	94931576	94931576	+	Missense_Mutation	SNP	A	A	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:94931576A>T	ENST00000222381.3	-	8	1081	c.850T>A	c.(850-852)Tgc>Agc	p.C284S	PON1_ENST00000542556.1_Missense_Mutation_p.C284S	NM_000446.5	NP_000437.3	P27169	PON1_HUMAN	paraoxonase 1	284					aromatic compound catabolic process (GO:0019439)|carboxylic acid catabolic process (GO:0046395)|dephosphorylation (GO:0016311)|organophosphate catabolic process (GO:0046434)|phosphatidylcholine metabolic process (GO:0046470)|positive regulation of binding (GO:0051099)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of transporter activity (GO:0032411)|response to external stimulus (GO:0009605)|response to toxic substance (GO:0009636)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|intracellular membrane-bounded organelle (GO:0043231)|spherical high-density lipoprotein particle (GO:0034366)	aryldialkylphosphatase activity (GO:0004063)|arylesterase activity (GO:0004064)|calcium ion binding (GO:0005509)|phospholipid binding (GO:0005543)|protein homodimerization activity (GO:0042803)			autonomic_ganglia(1)|endometrium(2)|large_intestine(6)|lung(11)|pancreas(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	27	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0031)		Cefazolin(DB01327)	TTGGGATGGCATCCAACCCAA	0.388																																					GBM(119;715 1622 17358 22490 33240)	uc003uns.2		NA																	0				pancreas(1)	1						c.(850-852)TGC>AGC		paraoxonase 1 precursor	Atorvastatin(DB01076)|Cefazolin(DB01327)						85.0	86.0	85.0					7																	94931576		2203	4300	6503	SO:0001583	missense	5444				aromatic compound catabolic process|carboxylic acid catabolic process|organophosphate catabolic process|phosphatidylcholine metabolic process|positive regulation of binding|positive regulation of cholesterol efflux|positive regulation of transporter activity|response to external stimulus	spherical high-density lipoprotein particle	aryldialkylphosphatase activity|arylesterase activity|calcium ion binding|phospholipid binding|protein homodimerization activity	g.chr7:94931576A>T	AF539592	CCDS5638.1	7q21.3	2014-03-14			ENSG00000005421	ENSG00000005421	3.1.1.2	"""Paraoxonases"""	9204	protein-coding gene	gene with protein product	"""esterase A"", ""arylesterase 1"""	168820		PON		8661009, 15450851	Standard	NM_000446		Approved	ESA	uc003uns.3	P27169	OTTHUMG00000153894	ENST00000222381.3:c.850T>A	7.37:g.94931576A>T	ENSP00000222381:p.Cys284Ser		Somatic				PON1_uc011kih.1_Missense_Mutation_p.C284S	p.C284S	NM_000446	NP_000437	WXS	Illumina HiSeq	Unspecified	P27169	PON1_HUMAN	STAD - Stomach adenocarcinoma(171;0.0031)		8	947	-	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		284	C->A,S: No loss of activity.				B2RA40|Q16052|Q6B0J6|Q9UCB1	Missense_Mutation	SNP	ENST00000222381.3	37	c.850T>A	CCDS5638.1	.	.	.	.	.	.	.	.	.	.	A	19.92	3.917223	0.73098	.	.	ENSG00000005421	ENST00000222381;ENST00000542556	T;T	0.39592	1.07;1.07	4.67	3.5	0.40072	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	T	0.55955	0.1953	M	0.75447	2.3	0.58432	D	0.999999	D;D	0.62365	0.991;0.985	P;P	0.60173	0.87;0.746	T	0.58370	-0.7648	10	0.72032	D	0.01	-9.8773	7.8821	0.29629	0.7887:0.1374:0.0739:0.0	.	284;284	F5H4W9;P27169	.;PON1_HUMAN	S	284	ENSP00000222381:C284S;ENSP00000444854:C284S	ENSP00000222381:C284S	C	-	1	0	PON1	94769512	1.000000	0.71417	0.975000	0.42487	0.943000	0.58893	4.863000	0.62983	1.090000	0.41315	0.528000	0.53228	TGC		0.388	PON1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000332865.2	NM_000446		58	59	0	0	0	0	58	59				
DLX5	1749	broad.mit.edu	37	7	96650323	96650324	+	Missense_Mutation	DNP	CG	CG	AA			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:96650323_96650324CG>AA	ENST00000222598.4	-	3	1067_1068	c.594_595CG>TT	c.(592-597)aaCGgg>aaTTgg	p.G199W	DLX5_ENST00000493764.1_5'UTR	NM_005221.5	NP_005212.1	P56178	DLX5_HUMAN	distal-less homeobox 5	199					anatomical structure formation involved in morphogenesis (GO:0048646)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell proliferation (GO:0008283)|cellular response to BMP stimulus (GO:0071773)|embryonic limb morphogenesis (GO:0030326)|endochondral ossification (GO:0001958)|epithelial cell differentiation (GO:0030855)|face morphogenesis (GO:0060325)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|olfactory pit development (GO:0060166)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)	20	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					GGCATCTCCCCGTTTTTCATGA	0.574																																						uc003uon.2		NA																	0				ovary(1)	1						c.(592-597)AACGGG>AATTGG		distal-less homeobox 5																																				SO:0001583	missense	1749				cell proliferation|endochondral ossification|osteoblast differentiation|positive regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding	g.chr7:96650323_96650324CG>AA		CCDS5647.1	7q21.3	2011-06-20	2005-12-22		ENSG00000105880	ENSG00000105880		"""Homeoboxes / ANTP class : NKL subclass"""	2918	protein-coding gene	gene with protein product		600028	"""distal-less homeo box 5"""			7907794	Standard	XM_005250185		Approved		uc003uon.3	P56178	OTTHUMG00000154200	ENST00000222598.4:c.594_595delinsAA	7.37:g.96650323_96650324delinsAA	ENSP00000222598:p.Gly199Trp		Somatic					p.G199W	NM_005221	NP_005212	WXS	Illumina HiSeq	Unspecified	P56178	DLX5_HUMAN			3	802_803	-	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)		199					B7Z4P3|Q9UPL1	Missense_Mutation	DNP	ENST00000222598.4	37	c.594_595CG>TT	CCDS5647.1																																																																																				0.574	DLX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334371.2			16	96	0	0	0	0	16	96				
LMTK2	22853	broad.mit.edu	37	7	97822447	97822447	+	Silent	SNP	T	T	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:97822447T>C	ENST00000297293.5	+	11	2963	c.2670T>C	c.(2668-2670)agT>agC	p.S890S		NM_014916.3	NP_055731.2	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2	890					early endosome to late endosome transport (GO:0045022)|endocytic recycling (GO:0032456)|negative regulation of catalytic activity (GO:0043086)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|myosin VI binding (GO:0070853)|protein phosphatase inhibitor activity (GO:0004864)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|pancreas(2)|skin(2)|stomach(3)	59	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					CTGGCGAGAGTGAGGAGACCC	0.557																																						uc003upd.1		NA																	0				lung(9)|stomach(3)|pancreas(2)|large_intestine(1)|breast(1)	16						c.(2668-2670)AGT>AGC		lemur tyrosine kinase 2 precursor							46.0	45.0	45.0					7																	97822447		2203	4300	6503	SO:0001819	synonymous_variant	22853				early endosome to late endosome transport|endocytic recycling|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|protein autophosphorylation|receptor recycling|transferrin transport	early endosome|Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|recycling endosome	ATP binding|myosin VI binding|protein phosphatase inhibitor activity|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr7:97822447T>C	AB029002	CCDS5654.1	7q22.1	2014-06-12			ENSG00000164715	ENSG00000164715			17880	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 100"""	610989				15005709	Standard	NM_014916		Approved	KIAA1079, KPI2, KPI-2, cprk, LMR2, BREK, AATYK2, PPP1R100	uc003upd.2	Q8IWU2	OTTHUMG00000154256	ENST00000297293.5:c.2670T>C	7.37:g.97822447T>C			Somatic					p.S890S	NM_014916	NP_055731	WXS	Illumina HiSeq	Unspecified	Q8IWU2	LMTK2_HUMAN			11	2963	+	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)		890					A4D272|Q75MG7|Q9UPS3	Silent	SNP	ENST00000297293.5	37	c.2670T>C	CCDS5654.1																																																																																				0.557	LMTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334560.1	NM_014916		51	50	0	0	0	0	51	50				
MUC17	140453	broad.mit.edu	37	7	100675651	100675651	+	Silent	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:100675651G>T	ENST00000306151.4	+	3	1018	c.954G>T	c.(952-954)acG>acT	p.T318T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	318	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.T318T(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CTCCTACAACGGCTGAAGGCA	0.502																																						uc003uxp.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(952-954)ACG>ACT		mucin 17 precursor							184.0	194.0	191.0					7																	100675651		2203	4300	6503	SO:0001819	synonymous_variant	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100675651G>T	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.954G>T	7.37:g.100675651G>T			Somatic				MUC17_uc010lho.1_RNA	p.T318T	NM_001040105	NP_001035194	WXS	Illumina HiSeq	Unspecified	Q685J3	MUC17_HUMAN			3	1007	+	Lung NSC(181;0.136)|all_lung(186;0.182)		318			Extracellular (Potential).|Ser-rich.|3.|59 X approximate tandem repeats.		O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	c.954G>T	CCDS34711.1																																																																																				0.502	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		73	354	1	0	9.56e-25	1.46e-24	73	354				
CUX1	1523	broad.mit.edu	37	7	101892287	101892287	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:101892287G>A	ENST00000292535.7	+	24	4521	c.4483G>A	c.(4483-4485)Gcc>Acc	p.A1495T	CUX1_ENST00000547394.2_Intron|CUX1_ENST00000560541.1_Intron|CUX1_ENST00000425244.2_Intron|CUX1_ENST00000556210.1_Missense_Mutation_p.A1337T|CUX1_ENST00000546411.2_Missense_Mutation_p.A1393T|CUX1_ENST00000292538.4_Intron|CUX1_ENST00000393824.3_Intron|CUX1_ENST00000437600.4_Intron|CUX1_ENST00000360264.3_Missense_Mutation_p.A1506T|CUX1_ENST00000549414.2_Missense_Mutation_p.A1473T|CUX1_ENST00000550008.2_Missense_Mutation_p.A1439T	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	1495					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						GGAGAAGGCCGCCAGCCGGGA	0.726																																						uc003uyx.3		NA																	0				ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						c.(4483-4485)GCC>ACC		cut-like homeobox 1 isoform a							8.0	8.0	8.0					7																	101892287		1832	3727	5559	SO:0001583	missense	1523				negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:101892287G>A	M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.4483G>A	7.37:g.101892287G>A	ENSP00000292535:p.Ala1495Thr		Somatic				CUX1_uc003uys.3_Missense_Mutation_p.A1506T|CUX1_uc003uyt.2_Intron|CUX1_uc011kkn.1_Intron|CUX1_uc003uyw.2_Intron|CUX1_uc003uyv.2_Intron|CUX1_uc003uyu.2_Intron	p.A1495T	NM_181552	NP_853530	WXS	Illumina HiSeq	Unspecified	P39880	CUX1_HUMAN			24	4521	+			1495					B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Missense_Mutation	SNP	ENST00000292535.7	37	c.4483G>A	CCDS5721.1	.	.	.	.	.	.	.	.	.	.	G	16.84	3.232729	0.58777	.	.	ENSG00000257923	ENST00000360264;ENST00000292535;ENST00000549414;ENST00000550008;ENST00000546411;ENST00000556210	D;D;D;D;D;D	0.83673	-1.58;-1.66;-1.63;-1.72;-1.63;-1.75	4.12	4.12	0.48240	.	0.072432	0.53938	D	0.000054	D	0.88923	0.6569	M	0.65975	2.015	0.80722	D	1	D;D	0.76494	0.998;0.999	P;P	0.61874	0.788;0.895	D	0.90744	0.4652	10	0.87932	D	0	-4.3039	16.5658	0.84599	0.0:0.0:1.0:0.0	.	1495;1506	P39880;P39880-3	CUX1_HUMAN;.	T	1506;1495;1473;1439;1393;1337	ENSP00000353401:A1506T;ENSP00000292535:A1495T;ENSP00000446630:A1473T;ENSP00000447373:A1439T;ENSP00000450125:A1393T;ENSP00000451558:A1337T	ENSP00000292535:A1495T	A	+	1	0	CUX1	101679007	1.000000	0.71417	0.984000	0.44739	0.025000	0.11179	8.682000	0.91232	2.109000	0.64355	0.655000	0.94253	GCC		0.726	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347535.1	NM_001913		6	9	0	0	0	0	6	9				
RINT1	60561	broad.mit.edu	37	7	105190713	105190713	+	Silent	SNP	A	A	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:105190713A>G	ENST00000257700.2	+	9	1344	c.1113A>G	c.(1111-1113)gaA>gaG	p.E371E		NM_021930.4	NP_068749.3	Q6NUQ1	RINT1_HUMAN	RAD50 interactor 1	371	RINT1/TIP20. {ECO:0000255|PROSITE- ProRule:PRU00717}.				G2 DNA damage checkpoint (GO:0031572)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						TTTAGCTTGAATTTTCTCGGG	0.363																																						uc003vda.1		NA																	0				ovary(3)|central_nervous_system(1)	4						c.(1111-1113)GAA>GAG		RAD50 interactor 1							186.0	177.0	180.0					7																	105190713		2203	4300	6503	SO:0001819	synonymous_variant	60561				cell cycle|G2/M transition DNA damage checkpoint|protein transport|vesicle-mediated transport	endoplasmic reticulum membrane	protein binding	g.chr7:105190713A>G	AF317622	CCDS34726.1	7q22.2	2007-05-03			ENSG00000135249	ENSG00000135249			21876	protein-coding gene	gene with protein product		610089				11096100, 15029241	Standard	NM_021930		Approved	FLJ11785, RINT-1	uc003vda.1	Q6NUQ1	OTTHUMG00000157400	ENST00000257700.2:c.1113A>G	7.37:g.105190713A>G			Somatic				RINT1_uc010ljj.1_Intron	p.E371E	NM_021930	NP_068749	WXS	Illumina HiSeq	Unspecified	Q6NUQ1	RINT1_HUMAN			9	1344	+			371			RINT1/TIP20.		Q75MG9|Q75MH0|Q96IW8|Q9H229|Q9HAD9	Silent	SNP	ENST00000257700.2	37	c.1113A>G	CCDS34726.1																																																																																				0.363	RINT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348686.1	NM_021930		166	188	0	0	0	0	166	188				
NAMPT	10135	broad.mit.edu	37	7	105909600	105909600	+	Splice_Site	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:105909600C>A	ENST00000222553.3	-	5	913	c.606G>T	c.(604-606)gaG>gaT	p.E202D	NAMPT_ENST00000354289.4_Splice_Site_p.E202D|NAMPT_ENST00000484527.1_Intron	NM_005746.2	NP_005737.1	P43490	NAMPT_HUMAN	nicotinamide phosphoribosyltransferase	202					cell-cell signaling (GO:0007267)|circadian regulation of gene expression (GO:0032922)|NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|nicotinamide metabolic process (GO:0006769)|positive regulation of cell proliferation (GO:0008284)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|nicotinamide phosphoribosyltransferase activity (GO:0047280)|nicotinate-nucleotide diphosphorylase (carboxylating) activity (GO:0004514)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	14						AGTTACTTACCTCTTGGGAAG	0.358																																						uc003vdq.2		NA																	0				large_intestine(1)	1						c.(604-606)GAG>GAT		nicotinamide phosphoribosyltransferase							59.0	57.0	58.0					7																	105909600		2203	4300	6503	SO:0001630	splice_region_variant	10135				cell-cell signaling|NAD biosynthetic process|nicotinamide metabolic process|positive regulation of cell proliferation|positive regulation of nitric-oxide synthase biosynthetic process|signal transduction|water-soluble vitamin metabolic process	cytosol	cytokine activity|nicotinamide phosphoribosyltransferase activity|nicotinate phosphoribosyltransferase activity|nicotinate-nucleotide diphosphorylase (carboxylating) activity	g.chr7:105909600C>A	U02020	CCDS5737.1	7q22.3	2012-10-02	2008-03-27	2008-03-27	ENSG00000105835	ENSG00000105835			30092	protein-coding gene	gene with protein product	"""visfatin"""	608764	"""pre-B-cell colony enhancing factor 1"""	PBEF1		8289818	Standard	NM_005746		Approved	PBEF	uc003vdq.3	P43490	OTTHUMG00000140388	ENST00000222553.3:c.606+1G>T	7.37:g.105909600C>A			Somatic				NAMPT_uc003vdr.1_Missense_Mutation_p.E202D|NAMPT_uc011klu.1_Missense_Mutation_p.E115D	p.E202D	NM_005746	NP_005737	WXS	Illumina HiSeq	Unspecified	P43490	NAMPT_HUMAN			5	914	-			202					A4D0Q9|A4D0R0|Q3KQV0|Q8WW95	Missense_Mutation	SNP	ENST00000222553.3	37	c.606G>T	CCDS5737.1	.	.	.	.	.	.	.	.	.	.	C	33	5.202058	0.94997	.	.	ENSG00000105835	ENST00000222553;ENST00000354289	.	.	.	5.06	5.06	0.68205	Quinolinate phosphoribosyl transferase, C-terminal (1);	0.048060	0.85682	D	0.000000	D	0.86883	0.6040	M	0.93241	3.395	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.97110	0.998;1.0;0.987	D	0.90262	0.4301	8	.	.	.	-12.6212	18.7808	0.91932	0.0:1.0:0.0:0.0	.	115;183;202	B7Z8W6;Q5SYT8;P43490	.;.;NAMPT_HUMAN	D	202	.	.	E	-	3	2	NAMPT	105696836	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.722000	0.84778	2.490000	0.84030	0.650000	0.86243	GAG		0.358	NAMPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277146.1	NM_182790	Missense_Mutation	55	67	1	0	3.94e-18	5.78e-18	55	67				
HBP1	26959	broad.mit.edu	37	7	106822945	106822945	+	Silent	SNP	A	A	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:106822945A>G	ENST00000222574.4	+	3	483	c.297A>G	c.(295-297)ccA>ccG	p.P99P	HBP1_ENST00000485846.1_Silent_p.P99P|HBP1_ENST00000468410.1_Silent_p.P99P	NM_012257.3	NP_036389.2	O60381	HBP1_HUMAN	HMG-box transcription factor 1	99					cell cycle arrest (GO:0007050)|positive regulation of potassium ion transport (GO:0043268)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			large_intestine(4)|lung(3)|prostate(1)|skin(2)	10						CAGACATACCAGAAACTACTT	0.423																																						uc003vdy.2		NA																	0				skin(1)	1						c.(295-297)CCA>CCG		HMG-box transcription factor 1							80.0	72.0	74.0					7																	106822945		2203	4300	6503	SO:0001819	synonymous_variant	26959				cell cycle arrest|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	DNA binding	g.chr7:106822945A>G	BC017069	CCDS5741.1	7q22-q31	2003-10-08			ENSG00000105856	ENSG00000105856			23200	protein-coding gene	gene with protein product						9030690, 11500377	Standard	NM_001244262		Approved		uc011klv.2	O60381	OTTHUMG00000157642	ENST00000222574.4:c.297A>G	7.37:g.106822945A>G			Somatic				HBP1_uc011klv.1_Silent_p.P109P|HBP1_uc003vdz.2_Silent_p.P99P|HBP1_uc003vea.2_Silent_p.P99P|HBP1_uc003veb.1_Silent_p.P99P	p.P99P	NM_012257	NP_036389	WXS	Illumina HiSeq	Unspecified	O60381	HBP1_HUMAN			3	483	+			99					B3KVB7|Q8TBM1|Q8TE93|Q96AJ2	Silent	SNP	ENST00000222574.4	37	c.297A>G	CCDS5741.1																																																																																				0.423	HBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349297.1	NM_012257		49	71	0	0	0	0	49	71				
WNT2	7472	broad.mit.edu	37	7	116955239	116955239	+	Missense_Mutation	SNP	A	A	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:116955239A>T	ENST00000265441.3	-	3	773	c.474T>A	c.(472-474)agT>agA	p.S158R	AC002465.2_ENST00000436097.1_RNA	NM_003391.2	NP_003382.1	P09544	WNT2_HUMAN	wingless-type MMTV integration site family member 2	158					atrial cardiac muscle tissue morphogenesis (GO:0055009)|canonical Wnt signaling pathway (GO:0060070)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|iris morphogenesis (GO:0061072)|labyrinthine layer blood vessel development (GO:0060716)|lens development in camera-type eye (GO:0002088)|lung development (GO:0030324)|lung induction (GO:0060492)|mammary gland epithelium development (GO:0061180)|neuron differentiation (GO:0030182)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			breast(2)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|ovary(3)|prostate(1)|skin(2)	31	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		CAATGTTATCACTGCAGCCAC	0.473																																						uc003viz.2		NA																	0				breast(2)|central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	7						c.(472-474)AGT>AGA		wingless-type MMTV integration site family							167.0	150.0	156.0					7																	116955239		2203	4300	6503	SO:0001583	missense	7472				atrial cardiac muscle tissue morphogenesis|canonical Wnt receptor signaling pathway|cardiac epithelial to mesenchymal transition|cellular response to retinoic acid|cellular response to transforming growth factor beta stimulus|dorsal/ventral axis specification|iris morphogenesis|labyrinthine layer blood vessel development|lens development in camera-type eye|lung induction|mammary gland epithelium development|neuron differentiation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of fibroblast proliferation|positive regulation of mesenchymal cell proliferation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|Wnt receptor signaling pathway, calcium modulating pathway	cytoplasm|extracellular space|proteinaceous extracellular matrix	cytokine activity|frizzled binding|frizzled-2 binding|signal transducer activity	g.chr7:116955239A>T	X07876	CCDS5771.1	7q31	2013-02-28			ENSG00000105989	ENSG00000105989		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12780	protein-coding gene	gene with protein product	"""secreted growth factor"""	147870		INT1L1		2971536	Standard	NM_003391		Approved	IRP	uc003viz.3	P09544	OTTHUMG00000023428	ENST00000265441.3:c.474T>A	7.37:g.116955239A>T	ENSP00000265441:p.Ser158Arg		Somatic				WNT2_uc003vja.2_Missense_Mutation_p.S62R	p.S158R	NM_003391	NP_003382	WXS	Illumina HiSeq	Unspecified	P09544	WNT2_HUMAN	STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)	3	774	-	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		158					A4D0V1|Q75N05|Q9UDP9	Missense_Mutation	SNP	ENST00000265441.3	37	c.474T>A	CCDS5771.1	.	.	.	.	.	.	.	.	.	.	A	17.73	3.461100	0.63513	.	.	ENSG00000105989	ENST00000265441	T	0.79940	-1.32	5.56	0.133	0.14766	.	0.000000	0.85682	D	0.000000	D	0.90342	0.6978	M	0.93808	3.46	0.48975	D	0.999733	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.89810	0.3981	10	0.72032	D	0.01	.	10.5766	0.45231	0.5478:0.0:0.4522:0.0	.	158;158	A4D0V1;P09544	.;WNT2_HUMAN	R	158	ENSP00000265441:S158R	ENSP00000265441:S158R	S	-	3	2	WNT2	116742475	0.977000	0.34250	1.000000	0.80357	0.998000	0.95712	0.321000	0.19558	0.147000	0.19030	0.533000	0.62120	AGT		0.473	WNT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059749.3	NM_003391		80	109	0	0	0	0	80	109				
IQUB	154865	broad.mit.edu	37	7	123104887	123104887	+	Splice_Site	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:123104887C>A	ENST00000466202.1	-	10	2334	c.1758G>T	c.(1756-1758)aaG>aaT	p.K586N	IQUB_ENST00000434450.1_Splice_Site_p.K586N|IQUB_ENST00000324698.6_Splice_Site_p.K586N	NM_001282855.1	NP_001269784.1	Q8NA54	IQUB_HUMAN	IQ motif and ubiquitin domain containing	586					cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	acrosomal vesicle (GO:0001669)|motile cilium (GO:0031514)				breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(18)|ovary(3)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)	45						TGTAGAATACCTTAAGGTATT	0.303																																						uc003vkn.2		NA																	0				ovary(3)|large_intestine(1)	4						c.(1756-1758)AAG>AAT		IQ motif and ubiquitin domain containing							63.0	67.0	66.0					7																	123104887		2201	4297	6498	SO:0001630	splice_region_variant	154865							g.chr7:123104887C>A	AK093153	CCDS5787.1	7q31.32	2010-03-19			ENSG00000164675	ENSG00000164675			21995	protein-coding gene	gene with protein product							Standard	NM_178827		Approved	FLJ35834	uc003vko.3	Q8NA54	OTTHUMG00000157347	ENST00000466202.1:c.1758+1G>T	7.37:g.123104887C>A			Somatic				IQUB_uc003vko.2_Missense_Mutation_p.K586N|IQUB_uc010lkt.2_RNA|IQUB_uc003vkp.1_Missense_Mutation_p.K586N	p.K586N	NM_178827	NP_849149	WXS	Illumina HiSeq	Unspecified	Q8NA54	IQUB_HUMAN			10	2335	-			586					A4D0X0|Q49AL6|Q4G189|Q5BJD9|Q6NUH6|Q8N9Y2	Missense_Mutation	SNP	ENST00000466202.1	37	c.1758G>T	CCDS5787.1	.	.	.	.	.	.	.	.	.	.	C	19.87	3.907507	0.72868	.	.	ENSG00000164675	ENST00000466202;ENST00000324698;ENST00000434450	T;T;T	0.55413	1.65;1.65;0.52	5.32	5.32	0.75619	.	0.095001	0.64402	D	0.000001	T	0.73202	0.3557	M	0.76574	2.34	0.51767	D	0.999936	D;D	0.76494	0.999;0.999	D;D	0.74674	0.984;0.964	T	0.73183	-0.4063	9	.	.	.	.	19.3499	0.94379	0.0:1.0:0.0:0.0	.	586;586	Q8NA54-2;Q8NA54	.;IQUB_HUMAN	N	586	ENSP00000417769:K586N;ENSP00000324882:K586N;ENSP00000388498:K586N	.	K	-	3	2	IQUB	122892123	1.000000	0.71417	1.000000	0.80357	0.505000	0.33919	7.091000	0.76923	2.654000	0.90174	0.579000	0.79373	AAG		0.303	IQUB-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348529.1	NM_178827	Missense_Mutation	29	140	1	0	2.13e-12	2.96e-12	29	140				
IQUB	154865	broad.mit.edu	37	7	123152340	123152340	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:123152340C>A	ENST00000466202.1	-	2	631	c.55G>T	c.(55-57)Gag>Tag	p.E19*	IQUB_ENST00000434450.1_Nonsense_Mutation_p.E19*|IQUB_ENST00000324698.6_Nonsense_Mutation_p.E19*|IQUB_ENST00000488987.1_Intron	NM_001282855.1	NP_001269784.1	Q8NA54	IQUB_HUMAN	IQ motif and ubiquitin domain containing	19					cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	acrosomal vesicle (GO:0001669)|motile cilium (GO:0031514)				breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(18)|ovary(3)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)	45						TCATCACTCTCTTCTGTTGAA	0.348																																						uc003vkn.2		NA																	0				ovary(3)|large_intestine(1)	4						c.(55-57)GAG>TAG		IQ motif and ubiquitin domain containing							110.0	105.0	107.0					7																	123152340		2203	4300	6503	SO:0001587	stop_gained	154865							g.chr7:123152340C>A	AK093153	CCDS5787.1	7q31.32	2010-03-19			ENSG00000164675	ENSG00000164675			21995	protein-coding gene	gene with protein product							Standard	NM_178827		Approved	FLJ35834	uc003vko.3	Q8NA54	OTTHUMG00000157347	ENST00000466202.1:c.55G>T	7.37:g.123152340C>A	ENSP00000417769:p.Glu19*		Somatic				IQUB_uc003vko.2_Nonsense_Mutation_p.E19*|IQUB_uc010lkt.2_RNA|IQUB_uc003vkp.1_Nonsense_Mutation_p.E19*|IQUB_uc003vkq.2_Nonsense_Mutation_p.E19*	p.E19*	NM_178827	NP_849149	WXS	Illumina HiSeq	Unspecified	Q8NA54	IQUB_HUMAN			2	632	-			19					A4D0X0|Q49AL6|Q4G189|Q5BJD9|Q6NUH6|Q8N9Y2	Nonsense_Mutation	SNP	ENST00000466202.1	37	c.55G>T	CCDS5787.1	.	.	.	.	.	.	.	.	.	.	C	15.55	2.865665	0.51588	.	.	ENSG00000164675	ENST00000466202;ENST00000324698;ENST00000434450	.	.	.	4.19	0.322	0.15888	.	1.619920	0.03471	N	0.213621	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	.	3.8236	0.08845	0.0:0.5088:0.1826:0.3086	.	.	.	.	X	19	.	ENSP00000324882:E19X	E	-	1	0	IQUB	122939576	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-0.100000	0.10990	0.048000	0.15891	0.557000	0.71058	GAG		0.348	IQUB-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348529.1	NM_178827		25	147	1	0	1.97e-08	2.56e-08	25	147				
POT1	25913	broad.mit.edu	37	7	124499083	124499083	+	Silent	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:124499083G>A	ENST00000357628.3	-	9	1228	c.630C>T	c.(628-630)atC>atT	p.I210I	POT1_ENST00000393329.1_Silent_p.I79I	NM_015450.2	NP_056265.2	Q9NUX5	POTE1_HUMAN	protection of telomeres 1	210					DNA duplex unwinding (GO:0032508)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of DNA strand elongation (GO:0060383)|positive regulation of helicase activity (GO:0051096)|positive regulation of telomerase activity (GO:0051973)|positive regulation of telomere maintenance via telomerase (GO:0032212)|telomere capping (GO:0016233)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|single-stranded telomeric DNA binding (GO:0043047)|telomerase inhibitor activity (GO:0010521)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47						GTAGCCGATGGATGTGACTTA	0.393																																					Esophageal Squamous(149;1032 1141 16047 36610 40540 42429 44687 51642)	uc003vlm.2		NA																	0				central_nervous_system(1)	1						c.(628-630)ATC>ATT		protection of telomeres 1 isoform 1							101.0	93.0	96.0					7																	124499083		2203	4300	6503	SO:0001819	synonymous_variant	25913				DNA duplex unwinding|negative regulation of telomere maintenance via telomerase|positive regulation of DNA strand elongation|positive regulation of helicase activity|positive regulation of telomerase activity|positive regulation of telomere maintenance via telomerase|telomere capping|telomere formation via telomerase|telomere maintenance via telomerase	nuclear telomere cap complex|nucleoplasm	DEAD/H-box RNA helicase binding|single-stranded telomeric DNA binding|telomerase inhibitor activity	g.chr7:124499083G>A	AK022580	CCDS5793.1	7q31.33	2013-01-21	2013-01-21		ENSG00000128513	ENSG00000128513			17284	protein-coding gene	gene with protein product		606478	"""protection of telomeres 1 homolog (S. pombe)"""			11349150, 12391173	Standard	NR_003102		Approved	hPot1, DKFZp586D211	uc003vlm.3	Q9NUX5	OTTHUMG00000157194	ENST00000357628.3:c.630C>T	7.37:g.124499083G>A			Somatic				POT1_uc011koe.1_RNA|POT1_uc003vlk.2_RNA|POT1_uc003vll.2_RNA|POT1_uc003vlo.2_Silent_p.I79I|POT1_uc003vln.2_RNA	p.I210I	NM_015450	NP_056265	WXS	Illumina HiSeq	Unspecified	Q9NUX5	POTE1_HUMAN			9	1231	-			210					O95018|Q5MJ36|Q9H662|Q9NW19|Q9UG95	Silent	SNP	ENST00000357628.3	37	c.630C>T	CCDS5793.1																																																																																				0.393	POT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347861.1			60	59	0	0	0	0	60	59				
KLF14	136259	broad.mit.edu	37	7	130418350	130418350	+	Missense_Mutation	SNP	G	G	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:130418350G>C	ENST00000310992.4	-	1	538	c.511C>G	c.(511-513)Cta>Gta	p.L171V		NM_138693.2	NP_619638.2	Q8TD94	KLF14_HUMAN	Kruppel-like factor 14	171					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(3)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6	Melanoma(18;0.0435)					CCTGCCCCTAGGGCCCCTCCA	0.741																																						uc003vqk.1		NA																	0					0						c.(511-513)CTA>GTA		Kruppel-like factor 14							4.0	5.0	4.0					7																	130418350		1910	3888	5798	SO:0001583	missense	136259				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:130418350G>C	AF490374	CCDS5825.1	7q32.3	2014-05-06			ENSG00000174595	ENSG00000266265		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	23025	protein-coding gene	gene with protein product		609393				17480121	Standard	NM_138693		Approved	BTEB5	uc003vqk.2	Q8TD94	OTTHUMG00000188298	ENST00000310992.4:c.511C>G	7.37:g.130418350G>C	ENSP00000310878:p.Leu171Val		Somatic					p.L171V	NM_138693	NP_619638	WXS	Illumina HiSeq	Unspecified	Q8TD94	KLF14_HUMAN			1	511	-	Melanoma(18;0.0435)		171					Q19A42|Q19A43	Missense_Mutation	SNP	ENST00000310992.4	37	c.511C>G	CCDS5825.1	.	.	.	.	.	.	.	.	.	.	g	9.177	1.022594	0.19433	.	.	ENSG00000174595	ENST00000310992	T	0.09255	3.0	3.33	3.33	0.38152	.	.	.	.	.	T	0.06554	0.0168	N	0.14661	0.345	0.09310	N	1	B	0.19445	0.036	B	0.15484	0.013	T	0.30794	-0.9966	9	0.29301	T	0.29	.	9.2559	0.37584	0.0:0.2235:0.7765:0.0	.	171	Q8TD94	KLF14_HUMAN	V	171	ENSP00000310878:L171V	ENSP00000310878:L171V	L	-	1	2	KLF14	130068890	0.939000	0.31865	0.191000	0.23289	0.187000	0.23431	0.794000	0.26958	1.771000	0.52183	0.556000	0.70494	CTA		0.741	KLF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338013.1	NM_138693		4	10	0	0	0	0	4	10				
PLXNA4	91584	broad.mit.edu	37	7	132193309	132193309	+	Silent	SNP	G	G	T	rs376606414		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:132193309G>T	ENST00000359827.3	-	2	1106	c.144C>A	c.(142-144)gcC>gcA	p.A48A	PLXNA4_ENST00000321063.4_Silent_p.A48A|PLXNA4_ENST00000423507.2_Silent_p.A48A|PLXNA4_ENST00000378539.5_Silent_p.A48A			Q9HCM2	PLXA4_HUMAN	plexin A4	48	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						TGAAACCCTCGGCGGGCTCTC	0.587																																						uc003vra.3		NA																	0				ovary(1)	1						c.(142-144)GCC>GCA		plexin A4 isoform 1							41.0	44.0	43.0					7																	132193309		2203	4300	6503	SO:0001819	synonymous_variant	91584					integral to membrane|intracellular|plasma membrane		g.chr7:132193309G>T	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.144C>A	7.37:g.132193309G>T			Somatic				PLXNA4_uc003vrc.2_Silent_p.A48A|PLXNA4_uc003vrb.2_Silent_p.A48A	p.A48A	NM_020911	NP_065962	WXS	Illumina HiSeq	Unspecified	Q9HCM2	PLXA4_HUMAN			2	373	-			48			Extracellular (Potential).|Sema.		A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Silent	SNP	ENST00000359827.3	37	c.144C>A	CCDS43646.1																																																																																				0.587	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775		18	90	1	0	9.17e-09	1.2e-08	18	90				
TRIM24	8805	broad.mit.edu	37	7	138261116	138261116	+	Splice_Site	SNP	A	A	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:138261116A>T	ENST00000343526.4	+	13	2229		c.e13-1		TRIM24_ENST00000415680.2_Splice_Site			O15164	TIF1A_HUMAN	tripartite motif containing 24						calcium ion homeostasis (GO:0055074)|cellular response to estrogen stimulus (GO:0071391)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of protein stability (GO:0031647)|regulation of signal transduction by p53 class mediator (GO:1901796)|regulation of vitamin D receptor signaling pathway (GO:0070562)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nuclear euchromatin (GO:0005719)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)	chromatin binding (GO:0003682)|estrogen response element binding (GO:0034056)|ligase activity (GO:0016874)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(5)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(12)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	40						CCCCCTCCTCAGGACCTGTTA	0.423																																					Pancreas(179;936 2074 16128 47811 50326)|Colon(136;168 1735 9344 12243 52014)	uc003vuc.2		NA																	0				central_nervous_system(3)|ovary(2)|stomach(1)|breast(1)|skin(1)	8						c.e13-2		transcriptional intermediary factor 1 alpha							147.0	132.0	137.0					7																	138261116		2203	4300	6503	SO:0001630	splice_region_variant	8805				cellular response to estrogen stimulus|protein catabolic process|regulation of apoptosis|regulation of protein stability|transcription from RNA polymerase II promoter	cytoplasm	chromatin binding|estrogen response element binding|histone acetyl-lysine binding|p53 binding|transcription coactivator activity|ubiquitin-protein ligase activity|zinc ion binding	g.chr7:138261116A>T	AF009353	CCDS5847.1, CCDS47720.1	7q32-q34	2013-01-28	2011-01-25	2005-06-02	ENSG00000122779	ENSG00000122779		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	11812	protein-coding gene	gene with protein product		603406	"""transcriptional intermediary factor 1"", ""tripartite motif-containing 24"""	TIF1		9115274, 9191165	Standard	NM_003852		Approved	hTIF1, Tif1a, RNF82, TIF1A	uc003vuc.3	O15164	OTTHUMG00000155820	ENST00000343526.4:c.2015-1A>T	7.37:g.138261116A>T			Somatic				TRIM24_uc003vub.2_Splice_Site_p.G638_splice	p.G672_splice	NM_015905	NP_056989	WXS	Illumina HiSeq	Unspecified	O15164	TIF1A_HUMAN			13	2230	+								A4D1R7|A4D1R8|O95854	Splice_Site	SNP	ENST00000343526.4	37	c.2015_splice	CCDS5847.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.309872	0.81247	.	.	ENSG00000122779	ENST00000343526;ENST00000536822;ENST00000415680	.	.	.	6.07	6.07	0.98685	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.6248	0.45502	0.9283:0.0:0.0717:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TRIM24	137911656	1.000000	0.71417	0.974000	0.42286	0.979000	0.70002	4.871000	0.63042	2.326000	0.78906	0.533000	0.62120	.		0.423	TRIM24-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341814.1	NM_015905	Intron	25	130	0	0	0	0	25	130				
KIAA1549	57670	broad.mit.edu	37	7	138603874	138603874	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:138603874C>A	ENST00000422774.1	-	2	546	c.498G>T	c.(496-498)tgG>tgT	p.W166C	KIAA1549_ENST00000440172.1_Missense_Mutation_p.W166C|KIAA1549_ENST00000242365.4_Missense_Mutation_p.W116C			Q9HCM3	K1549_HUMAN	KIAA1549	166						integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						GTGGAGTGGTCCAGTGAGTAT	0.498			O	BRAF	pilocytic astrocytoma																																NSCLC(119;1534 1718 44213 46230 50068)	uc011kql.1		NA		Dom	yes		7	7q34	57670	O	KIAA1549			O	BRAF		pilocytic astrocytoma	KIAA1549/BRAF(229)	0				central_nervous_system(229)|pancreas(1)	230						c.(496-498)TGG>TGT		hypothetical protein LOC57670 isoform 1							192.0	186.0	188.0					7																	138603874		1996	4167	6163	SO:0001583	missense	57670					integral to membrane		g.chr7:138603874C>A		CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.498G>T	7.37:g.138603874C>A	ENSP00000416040:p.Trp166Cys		Somatic				KIAA1549_uc003vuk.3_Missense_Mutation_p.W116C|KIAA1549_uc011kqj.1_Missense_Mutation_p.W166C	p.W166C	NM_020910	NP_065961	WXS	Illumina HiSeq	Unspecified	Q9HCM3	K1549_HUMAN			2	547	-			166					B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Missense_Mutation	SNP	ENST00000422774.1	37	c.498G>T	CCDS56513.1	.	.	.	.	.	.	.	.	.	.	C	15.80	2.940332	0.52972	.	.	ENSG00000122778	ENST00000440172;ENST00000242365;ENST00000422774	T;T;T	0.39229	1.09;1.13;1.1	4.66	4.66	0.58398	.	0.165156	0.29403	N	0.012250	T	0.50956	0.1646	L	0.29908	0.895	0.54753	D	0.999989	D;D	0.89917	0.999;1.0	D;D	0.70016	0.927;0.967	T	0.49447	-0.8939	10	0.45353	T	0.12	.	14.8678	0.70430	0.0:1.0:0.0:0.0	.	166;166	Q9HCM3;Q9HCM3-2	K1549_HUMAN;.	C	166;116;166	ENSP00000406661:W166C;ENSP00000242365:W116C;ENSP00000416040:W166C	ENSP00000242365:W116C	W	-	3	0	KIAA1549	138254414	1.000000	0.71417	0.228000	0.23943	0.003000	0.03518	4.582000	0.60957	2.439000	0.82584	0.561000	0.74099	TGG		0.498	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348092.1			156	175	1	0	7.08e-60	1.13e-59	156	175				
MGAM	8972	broad.mit.edu	37	7	141754672	141754672	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:141754672G>T	ENST00000549489.2	+	27	3373	c.3278G>T	c.(3277-3279)gGg>gTg	p.G1093V	MGAM_ENST00000475668.2_Missense_Mutation_p.G1093V	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1093	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	AATCCATTTGGGATTGAAATT	0.493																																						uc003vwy.2		NA																	0				ovary(2)	2						c.(3277-3279)GGG>GTG		maltase-glucoamylase	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)						92.0	87.0	88.0					7																	141754672		1901	4105	6006	SO:0001583	missense	8972				polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity	g.chr7:141754672G>T	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.3278G>T	7.37:g.141754672G>T	ENSP00000447378:p.Gly1093Val		Somatic					p.G1093V	NM_004668	NP_004659	WXS	Illumina HiSeq	Unspecified	O43451	MGA_HUMAN			27	3332	+	Melanoma(164;0.0272)		1093			Glucoamylase.|Lumenal (Potential).		Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000549489.2	37	c.3278G>T	CCDS47727.1	.	.	.	.	.	.	.	.	.	.	G	15.09	2.731502	0.48939	.	.	ENSG00000257335	ENST00000549489;ENST00000475668;ENST00000548812	T	0.47177	0.85	4.24	4.24	0.50183	Glycoside hydrolase-type carbohydrate-binding (1);	0.000000	0.38720	N	0.001595	T	0.77465	0.4134	H	0.95539	3.685	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85511	0.1197	10	0.87932	D	0	.	15.3761	0.74607	0.0:0.0:1.0:0.0	.	1093	O43451	MGA_HUMAN	V	1093;1093;970	ENSP00000447378:G1093V	ENSP00000316431:G970V	G	+	2	0	MGAM	141401141	1.000000	0.71417	0.735000	0.30896	0.088000	0.18126	8.923000	0.92808	1.890000	0.54733	0.460000	0.39030	GGG		0.493	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3			67	104	1	0	1.78e-30	2.76e-30	67	104				
MGAM	8972	broad.mit.edu	37	7	141796147	141796147	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:141796147G>A	ENST00000549489.2	+	42	5031	c.4936G>A	c.(4936-4938)Gtg>Atg	p.V1646M	MGAM_ENST00000475668.2_Missense_Mutation_p.V2542M	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1646	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GTCAGACCAGGTGACATGGGA	0.572																																						uc003vwy.2		NA																	0				ovary(2)	2						c.(4936-4938)GTG>ATG		maltase-glucoamylase	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)						48.0	42.0	44.0					7																	141796147		1838	4067	5905	SO:0001583	missense	8972				polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity	g.chr7:141796147G>A	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.4936G>A	7.37:g.141796147G>A	ENSP00000447378:p.Val1646Met		Somatic					p.V1646M	NM_004668	NP_004659	WXS	Illumina HiSeq	Unspecified	O43451	MGA_HUMAN			42	4990	+	Melanoma(164;0.0272)		1646			Glucoamylase.|Lumenal (Potential).		Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000549489.2	37	c.4936G>A	CCDS47727.1	.	.	.	.	.	.	.	.	.	.	G	9.554	1.116720	0.20795	.	.	ENSG00000257335	ENST00000549489;ENST00000475668	D	0.91295	-2.82	5.2	2.43	0.29744	.	.	.	.	.	D	0.84817	0.5556	L	0.38838	1.175	0.09310	N	1	B	0.29988	0.264	B	0.32393	0.145	T	0.73802	-0.3868	9	0.45353	T	0.12	.	7.3662	0.26774	0.4275:0.0:0.5725:0.0	.	1646	O43451	MGA_HUMAN	M	1646;2543	ENSP00000447378:V1646M	ENSP00000373973:V1646M	V	+	1	0	MGAM	141442616	0.000000	0.05858	0.405000	0.26409	0.724000	0.41520	0.239000	0.18023	0.304000	0.22809	-0.136000	0.14681	GTG		0.572	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3			47	40	0	0	0	0	47	40				
KEL	3792	broad.mit.edu	37	7	142636723	142636723	+	IGR	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:142636723C>T	ENST00000355265.2	-	0	2812				C7orf34_ENST00000409607.3_Missense_Mutation_p.P27L	NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase						vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					AGGTCCATGCCTCCCCTGGCC	0.662																																						uc003wca.2		NA																	0					0						c.(79-81)CCT>CTT		hypothetical protein LOC135927							48.0	50.0	49.0					7																	142636723		2203	4300	6503	SO:0001628	intergenic_variant	135927					extracellular region		g.chr7:142636723C>T	BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159		7.37:g.142636723C>T			Somatic					p.P27L	NM_178829	NP_849151	WXS	Illumina HiSeq	Unspecified	Q96L11	CG034_HUMAN			1	121	+	Melanoma(164;0.059)		2					B2RBV4|Q96RS8|Q99885	Missense_Mutation	SNP	ENST00000355265.2	37	c.80C>T	CCDS34766.1	.	.	.	.	.	.	.	.	.	.	c	7.438	0.640126	0.14386	.	.	ENSG00000165131	ENST00000409607	.	.	.	4.13	3.24	0.37175	.	0.281316	0.25469	N	0.030451	T	0.21062	0.0507	N	0.22421	0.69	0.27742	N	0.944442	B	0.33103	0.397	B	0.26202	0.067	T	0.10019	-1.0648	9	0.35671	T	0.21	.	10.0088	0.41972	0.0:0.7942:0.2058:0.0	.	2	Q96L11	CG034_HUMAN	L	27	.	ENSP00000386450:P27L	P	+	2	0	C7orf34	142346845	0.088000	0.21588	0.954000	0.39281	0.026000	0.11368	0.155000	0.16362	1.073000	0.40885	0.550000	0.68814	CCT		0.662	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347671.2	NM_000420		14	60	0	0	0	0	14	60				
KRBA1	84626	broad.mit.edu	37	7	149420905	149420905	+	Missense_Mutation	SNP	A	A	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:149420905A>T	ENST00000485033.2	+	7	853	c.853A>T	c.(853-855)Agg>Tgg	p.R285W	KRBA1_ENST00000479560.1_3'UTR|KRBA1_ENST00000255992.10_Missense_Mutation_p.R285W|KRBA1_ENST00000319551.8_Missense_Mutation_p.R285W			A5PL33	KRBA1_HUMAN	KRAB-A domain containing 1	285										breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(17)|ovary(1)|prostate(1)	27	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GGCCCAGGACAGGCATCCCAG	0.587																																						uc003wfz.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(853-855)AGG>TGG		KRAB A domain containing 1							54.0	60.0	58.0					7																	149420905		1861	4100	5961	SO:0001583	missense	84626							g.chr7:149420905A>T	AB058765	CCDS75674.1	7q36	2014-02-12	2006-08-15		ENSG00000133619	ENSG00000133619		"""-"""	22228	protein-coding gene	gene with protein product			"""KRAB A domain containing 1"""				Standard	NM_001290187		Approved	KIAA1862	uc003wfz.3	A5PL33	OTTHUMG00000157886	ENST00000485033.2:c.853A>T	7.37:g.149420905A>T	ENSP00000420112:p.Arg285Trp		Somatic				KRBA1_uc010lpj.2_RNA|KRBA1_uc003wga.2_RNA|KRBA1_uc003wgb.2_5'UTR	p.R285W	NM_032534	NP_115923	WXS	Illumina HiSeq	Unspecified	A5PL33	KRBA1_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00625)		8	1252	+	Melanoma(164;0.165)|Ovarian(565;0.177)		285					A7E2F5|E7ENE9|Q8N4X0|Q96JG5	Missense_Mutation	SNP	ENST00000485033.2	37	c.853A>T		.	.	.	.	.	.	.	.	.	.	A	18.73	3.687139	0.68157	.	.	ENSG00000133619	ENST00000255992;ENST00000319551;ENST00000485033	T;T;T	0.39997	1.07;1.05;1.05	5.0	-5.78	0.02362	.	0.675874	0.12934	N	0.427119	T	0.38081	0.1027	L	0.32530	0.975	0.09310	N	1	D	0.61697	0.99	D	0.64321	0.924	T	0.29852	-0.9998	10	0.87932	D	0	-3.1409	2.554	0.04756	0.2734:0.435:0.1745:0.1171	.	285	A5PL33	KRBA1_HUMAN	W	285	ENSP00000255992:R285W;ENSP00000317165:R285W;ENSP00000420112:R285W	ENSP00000255992:R285W	R	+	1	2	KRBA1	149051838	0.001000	0.12720	0.000000	0.03702	0.049000	0.14656	0.244000	0.18124	-0.395000	0.07715	0.533000	0.62120	AGG		0.587	KRBA1-004	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000349841.3	NM_032534		13	80	0	0	0	0	13	80				
ZNF467	168544	broad.mit.edu	37	7	149462101	149462101	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:149462101C>T	ENST00000302017.3	-	5	1903	c.1490G>A	c.(1489-1491)aGc>aAc	p.S497N	ZNF467_ENST00000484747.1_Intron	NM_207336.1	NP_997219.1	Q7Z7K2	ZN467_HUMAN	zinc finger protein 467	497					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(2)|liver(1)|lung(7)|urinary_tract(1)	13	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CGACTTGCGGCTGAAGCGGCG	0.716																																						uc003wgd.2		NA																	0					0						c.(1489-1491)AGC>AAC		zinc finger protein 467							15.0	18.0	17.0					7																	149462101		2034	3969	6003	SO:0001583	missense	168544				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:149462101C>T	BC029296	CCDS5899.1	7q36.1	2013-01-08			ENSG00000181444	ENSG00000181444		"""Zinc fingers, C2H2-type"""	23154	protein-coding gene	gene with protein product		614040				12426389	Standard	NM_207336		Approved	EZI, Zfp467	uc003wgd.2	Q7Z7K2	OTTHUMG00000157883	ENST00000302017.3:c.1490G>A	7.37:g.149462101C>T	ENSP00000304769:p.Ser497Asn		Somatic				ZNF467_uc003wgc.2_Intron	p.S497N	NM_207336	NP_997219	WXS	Illumina HiSeq	Unspecified	Q7Z7K2	ZN467_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00625)		5	1631	-	Melanoma(164;0.165)|Ovarian(565;0.177)		497			C2H2-type 10.			Missense_Mutation	SNP	ENST00000302017.3	37	c.1490G>A	CCDS5899.1	.	.	.	.	.	.	.	.	.	.	C	16.73	3.205149	0.58234	.	.	ENSG00000181444	ENST00000302017	T	0.54675	0.56	3.82	3.82	0.43975	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38837	U	0.001544	T	0.62539	0.2436	L	0.52266	1.64	0.29735	N	0.837532	D	0.58268	0.982	D	0.62955	0.909	T	0.59204	-0.7498	10	0.24483	T	0.36	-25.1049	15.504	0.75722	0.0:1.0:0.0:0.0	.	497	Q7Z7K2	ZN467_HUMAN	N	497	ENSP00000304769:S497N	ENSP00000304769:S497N	S	-	2	0	ZNF467	149093034	0.002000	0.14202	1.000000	0.80357	0.948000	0.59901	0.012000	0.13287	1.989000	0.58080	0.462000	0.41574	AGC		0.716	ZNF467-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349833.1	NM_207336		8	19	0	0	0	0	8	19				
NOS3	4846	broad.mit.edu	37	7	150696317	150696317	+	Silent	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:150696317C>A	ENST00000484524.1	+	8	996	c.996C>A	c.(994-996)gcC>gcA	p.A332A	NOS3_ENST00000297494.3_Silent_p.A332A|NOS3_ENST00000461406.1_Silent_p.A126A|NOS3_ENST00000467517.1_Silent_p.A332A	NM_001160111.1	NP_001153583.1	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	0					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCTGGTACGCCCTCCCGGCAG	0.647																																						uc003wif.2		NA																	0				central_nervous_system(5)|large_intestine(2)|skin(1)	8						c.(994-996)GCC>GCA		nitric oxide synthase 3 isoform 1	L-Arginine(DB00125)|L-Citrulline(DB00155)|Rosuvastatin(DB01098)|Tetrahydrobiopterin(DB00360)						62.0	69.0	67.0					7																	150696317		2201	4296	6497	SO:0001819	synonymous_variant	4846				anti-apoptosis|arginine catabolic process|blood vessel remodeling|endothelial cell migration|mitochondrion organization|negative regulation of muscle hyperplasia|negative regulation of platelet activation|nitric oxide biosynthetic process|platelet activation|positive regulation of angiogenesis|positive regulation of guanylate cyclase activity|positive regulation of vasodilation|regulation of blood vessel size|regulation of nitric-oxide synthase activity|regulation of systemic arterial blood pressure by endothelin|response to fluid shear stress|response to heat|smooth muscle hyperplasia	caveola|cytoskeleton|cytosol|Golgi membrane	actin monomer binding|arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding	g.chr7:150696317C>A		CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000484524.1:c.996C>A	7.37:g.150696317C>A			Somatic				NOS3_uc011kuy.1_Silent_p.A126A|NOS3_uc011kuz.1_Silent_p.A332A|NOS3_uc011kva.1_Silent_p.A332A|NOS3_uc011kvb.1_Silent_p.A332A	p.A332A	NM_000603	NP_000594	WXS	Illumina HiSeq	Unspecified	P29474	NOS3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	9	1292	+	all_neural(206;0.219)		332			Interaction with NOSIP.		Q495E5	Silent	SNP	ENST00000484524.1	37	c.996C>A	CCDS55182.1																																																																																				0.647	NOS3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351550.1	NM_000603		130	124	1	0	4.07e-59	6.49e-59	130	124				
AGAP3	116988	broad.mit.edu	37	7	150817174	150817174	+	Missense_Mutation	SNP	C	C	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:150817174C>G	ENST00000463381.1	+	8	882	c.386C>G	c.(385-387)gCc>gGc	p.A129G	AGAP3_ENST00000479901.1_Intron|AGAP3_ENST00000397238.2_Missense_Mutation_p.A357G|AGAP3_ENST00000473312.1_Missense_Mutation_p.A357G|AGAP3_ENST00000335367.3_Missense_Mutation_p.A537G	NM_001281300.1	NP_001268229.1	Q96P47	AGAP3_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 3	321	Small GTPase-like.				cellular response to reactive oxygen species (GO:0034614)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein import into nucleus, translocation (GO:0000060)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|liver(2)|lung(9)|ovary(2)|prostate(3)|urinary_tract(1)	28						ACCATCGCTGCCTCCTCCACC	0.667																																						uc003wjg.1		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(1069-1071)GCC>GGC		centaurin, gamma 3 isoform a							70.0	85.0	80.0					7																	150817174		2180	4279	6459	SO:0001583	missense	116988				regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm|membrane	ARF GTPase activator activity|GTP binding|GTPase activity|zinc ion binding	g.chr7:150817174C>G	AF413079	CCDS43681.1, CCDS55185.1, CCDS64802.1	7q36.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000133612	ENSG00000133612		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16923	protein-coding gene	gene with protein product			"""centaurin, gamma 3"""	CENTG3			Standard	NM_001042535		Approved		uc003wjg.1	Q96P47	OTTHUMG00000158724	ENST00000463381.1:c.386C>G	7.37:g.150817174C>G	ENSP00000418016:p.Ala129Gly		Somatic				AGAP3_uc003wje.1_Missense_Mutation_p.A129G|AGAP3_uc003wjf.1_Missense_Mutation_p.A357G|AGAP3_uc010lpy.1_Intron|AGAP3_uc003wjh.1_Missense_Mutation_p.A537G|AGAP3_uc003wji.1_5'Flank	p.A357G	NM_031946	NP_114152	WXS	Illumina HiSeq	Unspecified	Q96P47	AGAP3_HUMAN			8	1073	+			321			Small GTPase-like.		B3KNZ8|E9PAL8|Q59EN0|Q96RK3	Missense_Mutation	SNP	ENST00000463381.1	37	c.1070C>G		.	.	.	.	.	.	.	.	.	.	c	16.78	3.217686	0.58560	.	.	ENSG00000133612	ENST00000463381;ENST00000473312;ENST00000397238;ENST00000335355;ENST00000335367;ENST00000468796	T;T;T;T;T	0.33865	1.39;1.39;1.39;1.39;1.39	3.61	3.61	0.41365	.	0.224691	0.26525	U	0.023900	T	0.25082	0.0609	N	0.11927	0.2	0.53005	D	0.999965	B;P;B;B	0.45902	0.014;0.868;0.248;0.376	B;P;B;B	0.46026	0.023;0.501;0.206;0.114	T	0.03259	-1.1055	10	0.19147	T	0.46	.	14.0227	0.64565	0.0:1.0:0.0:0.0	.	537;357;357;129	E7ESL9;Q96P47-4;E9PAL8;B3KNZ8	.;.;.;.	G	129;357;357;321;537;122	ENSP00000418016:A129G;ENSP00000418921:A357G;ENSP00000380413:A357G;ENSP00000335589:A537G;ENSP00000418159:A122G	ENSP00000334157:A321G	A	+	2	0	AGAP3	150448107	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	4.705000	0.61838	1.853000	0.53794	0.306000	0.20318	GCC		0.667	AGAP3-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000351909.2	NM_031946		3	64	0	0	0	0	3	64				
KMT2C	58508	broad.mit.edu	37	7	151879345	151879345	+	Missense_Mutation	SNP	C	C	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:151879345C>G	ENST00000262189.6	-	36	5818	c.5600G>C	c.(5599-5601)aGt>aCt	p.S1867T	KMT2C_ENST00000355193.2_Missense_Mutation_p.S1867T	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1867	Pro-rich.				histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										CTGAGAAAGACTATCCTGGAT	0.522																																						uc003wla.2		NA								N							medulloblastoma		0				large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63						c.(5599-5601)AGT>ACT		myeloid/lymphoid or mixed-lineage leukemia 3							88.0	89.0	89.0					7																	151879345		2203	4300	6503	SO:0001583	missense	58508				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr7:151879345C>G	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.5600G>C	7.37:g.151879345C>G	ENSP00000262189:p.Ser1867Thr		Somatic				MLL3_uc003wkz.2_Missense_Mutation_p.S928T	p.S1867T	NM_170606	NP_733751	WXS	Illumina HiSeq	Unspecified	Q8NEZ4	MLL3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)	36	5819	-	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	1867			Pro-rich.		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	c.5600G>C	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	C	0.055	-1.237977	0.01493	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.83591	-1.74;-1.74	5.41	-0.714	0.11219	.	1.589820	0.04235	N	0.335896	T	0.63331	0.2502	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.54146	-0.8337	10	0.06494	T	0.89	.	7.3154	0.26498	0.0:0.1965:0.3953:0.4083	.	1867;928	Q8NEZ4;Q8NEZ4-2	MLL3_HUMAN;.	T	1867	ENSP00000262189:S1867T;ENSP00000347325:S1867T	ENSP00000262189:S1867T	S	-	2	0	MLL3	151510278	0.035000	0.19736	0.000000	0.03702	0.029000	0.11900	2.314000	0.43743	-0.099000	0.12263	-0.251000	0.11542	AGT		0.522	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			27	193	0	0	0	0	27	193				
DPP6	1804	broad.mit.edu	37	7	154681206	154681206	+	Missense_Mutation	SNP	A	A	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:154681206A>G	ENST00000377770.3	+	25	2558	c.2417A>G	c.(2416-2418)cAa>cGa	p.Q806R	DPP6_ENST00000427557.1_Missense_Mutation_p.Q699R|DPP6_ENST00000404039.1_Missense_Mutation_p.Q742R|DPP6_ENST00000332007.3_Missense_Mutation_p.Q744R			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	806					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			CTCATTACACAACTAATTAGG	0.378																																					NSCLC(125;1384 1783 2490 7422 34254)	uc003wlk.2		NA																	0				pancreas(3)|breast(1)	4						c.(2416-2418)CAA>CGA		dipeptidyl-peptidase 6 isoform 1							96.0	85.0	89.0					7																	154681206		1880	4114	5994	SO:0001583	missense	1804				cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity	g.chr7:154681206A>G	M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.2417A>G	7.37:g.154681206A>G	ENSP00000367001:p.Gln806Arg		Somatic				DPP6_uc003wli.2_Missense_Mutation_p.Q742R|DPP6_uc003wlm.2_Missense_Mutation_p.Q744R|DPP6_uc011kvq.1_Missense_Mutation_p.Q699R	p.Q806R	NM_130797	NP_570629	WXS	Illumina HiSeq	Unspecified	P42658	DPP6_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0562)		25	2546	+	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	806			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000377770.3	37	c.2417A>G		.	.	.	.	.	.	.	.	.	.	A	3.527	-0.096505	0.07010	.	.	ENSG00000130226	ENST00000404039;ENST00000377770;ENST00000332007;ENST00000427557	T;T;T;T	0.28069	1.63;1.63;1.63;1.63	4.81	4.81	0.61882	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.163222	0.53938	D	0.000049	T	0.14917	0.0360	N	0.04787	-0.16	0.35174	D	0.771835	B;P;P;P	0.46395	0.001;0.498;0.877;0.76	B;B;B;B	0.41691	0.004;0.178;0.364;0.273	T	0.11155	-1.0599	10	0.07030	T	0.85	-11.45	14.3739	0.66860	1.0:0.0:0.0:0.0	.	699;744;806;742	E9PDL2;P42658-2;P42658;E9PF59	.;.;DPP6_HUMAN;.	R	742;806;744;699	ENSP00000385578:Q742R;ENSP00000367001:Q806R;ENSP00000328226:Q744R;ENSP00000397303:Q699R	ENSP00000328226:Q744R	Q	+	2	0	DPP6	154312139	1.000000	0.71417	0.508000	0.27688	0.201000	0.24016	8.296000	0.89940	1.787000	0.52448	0.533000	0.62120	CAA		0.378	DPP6-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000322932.1	NM_130797		9	15	0	0	0	0	9	15				
DLGAP2	9228	broad.mit.edu	37	8	1513941	1513941	+	Silent	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr8:1513941C>T	ENST00000421627.2	+	3	1217	c.1083C>T	c.(1081-1083)gcC>gcT	p.A361A	RP11-666I19.2_ENST00000518063.1_RNA	NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	440					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		ACATTAAAGCCATGGGGGACG	0.572																																						uc003wpl.2		NA																	0					0						c.(1081-1083)GCC>GCT		discs large-associated protein 2							48.0	53.0	52.0					8																	1513941		2164	4289	6453	SO:0001819	synonymous_variant	9228				neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding	g.chr8:1513941C>T	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.1083C>T	8.37:g.1513941C>T			Somatic				DLGAP2_uc003wpm.2_Silent_p.A361A	p.A361A	NM_004745	NP_004736	WXS	Illumina HiSeq	Unspecified	Q9P1A6	DLGP2_HUMAN		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)	3	1180	+		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)	440					A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Silent	SNP	ENST00000421627.2	37	c.1083C>T	CCDS47760.1	.	.	.	.	.	.	.	.	.	.	C	10.82	1.457352	0.26161	.	.	ENSG00000198010	ENST00000520901	.	.	.	4.55	3.67	0.42095	.	.	.	.	.	T	0.61702	0.2368	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58864	-0.7561	4	.	.	.	-1.1852	11.0002	0.47600	0.0:0.8406:0.0:0.1594	.	.	.	.	L	378	.	.	P	+	2	0	DLGAP2	1501348	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.363000	0.44178	1.030000	0.39839	0.585000	0.79938	CCA		0.572	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745		4	19	0	0	0	0	4	19				
DEFB4A	1673	broad.mit.edu	37	8	7752250	7752250	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr8:7752250C>A	ENST00000302247.2	+	1	100	c.16C>A	c.(16-18)Ctc>Atc	p.L6I		NM_004942.2	NP_004933.1	O15263	DFB4A_HUMAN	defensin, beta 4A	6					chemotaxis (GO:0006935)|defense response to bacterium (GO:0042742)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|innate immune response (GO:0045087)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)				lung(1)	1						GGTCTTGTATCTCCTCTTCTC	0.527																																					Ovarian(105;1718 2131 4132 11552)	uc003wsd.2		NA																	0					0						c.(16-18)CTC>ATC		defensin, beta 4 precursor							221.0	184.0	196.0					8																	7752250		2200	4297	6497	SO:0001583	missense	1673				chemotaxis|defense response to bacterium|G-protein coupled receptor protein signaling pathway|immune response	extracellular region		g.chr8:7752250C>A	AJ000152	CCDS5971.1	8p23.1	2014-01-30	2010-03-01	2010-03-01	ENSG00000171711	ENSG00000171711		"""Defensins, beta"", ""Endogenous ligands"""	2767	protein-coding gene	gene with protein product		602215	"""defensin, beta 2"", ""defensin, beta 4"""	DEFB102, DEFB2, DEFB4		9202117	Standard	NM_004942		Approved	SAP1, HBD-2, DEFB-2	uc003wsd.3	O15263	OTTHUMG00000129314	ENST00000302247.2:c.16C>A	8.37:g.7752250C>A	ENSP00000303532:p.Leu6Ile		Somatic					p.L6I	NM_004942	NP_004933	WXS	Illumina HiSeq	Unspecified	O15263	DFB4A_HUMAN			1	52	+			6					Q52LC0	Missense_Mutation	SNP	ENST00000302247.2	37	c.16C>A	CCDS5971.1	.	.	.	.	.	.	.	.	.	.	C	5.236	0.228981	0.09916	.	.	ENSG00000171711	ENST00000302247	.	.	.	1.72	0.738	0.18319	.	.	.	.	.	T	0.17238	0.0414	.	.	.	0.09310	N	1	P	0.46656	0.882	B	0.34590	0.186	T	0.12066	-1.0562	7	0.49607	T	0.09	.	5.7203	0.17982	0.0:0.656:0.344:0.0	.	6	O15263	DFB4A_HUMAN	I	6	.	ENSP00000303532:L6I	L	+	1	0	DEFB4A	7789660	0.002000	0.14202	0.001000	0.08648	0.033000	0.12548	0.197000	0.17197	0.229000	0.21039	0.407000	0.27541	CTC		0.527	DEFB4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251446.1	NM_004942		7	111	1	0	0.000673444	0.000745763	7	111				
DLC1	10395	broad.mit.edu	37	8	13357323	13357323	+	Silent	SNP	G	G	A	rs146650078		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr8:13357323G>A	ENST00000276297.4	-	2	667	c.258C>T	c.(256-258)gaC>gaT	p.D86D	DLC1_ENST00000511869.1_Silent_p.D86D|DLC1_ENST00000316609.5_Silent_p.D86D	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	86					actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)	p.D86D(3)		NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						TGTCATTTTCGTCCACATCCT	0.443																																						uc003wwm.2		NA																	3	Substitution - coding silent(3)		lung(3)	ovary(3)|pancreas(2)|lung(1)|kidney(1)	7						c.(256-258)GAC>GAT		deleted in liver cancer 1 isoform 1		G	,	0,4406		0,0,2203	220.0	222.0	221.0		258,258	-1.4	0.3	8	dbSNP_134	221	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	DLC1	NM_024767.3,NM_182643.2	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	86/464,86/1529	13357323	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	10395				actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding	g.chr8:13357323G>A	AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.258C>T	8.37:g.13357323G>A			Somatic				DLC1_uc003wwn.2_Silent_p.D86D|DLC1_uc011kxy.1_Silent_p.D86D	p.D86D	NM_182643	NP_872584	WXS	Illumina HiSeq	Unspecified	Q96QB1	RHG07_HUMAN			2	702	-			86					B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Silent	SNP	ENST00000276297.4	37	c.258C>T	CCDS5989.1																																																																																				0.443	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207632.2	NM_182643, NM_006094		9	362	0	0	0	0	9	362				
KIF13B	23303	broad.mit.edu	37	8	29025078	29025078	+	Missense_Mutation	SNP	T	T	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr8:29025078T>A	ENST00000524189.1	-	11	1008	c.970A>T	c.(970-972)Acc>Tcc	p.T324S	KIF13B_ENST00000521515.1_Missense_Mutation_p.T324S	NM_015254.3	NP_056069.2	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	324	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein targeting (GO:0006605)|regulation of axonogenesis (GO:0050770)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	axon (GO:0030424)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)			endometrium(6)|kidney(1)|lung(20)|urinary_tract(1)	28		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		ACCATGGCGGTCTTGCTGTTA	0.463																																						uc003xhh.3		NA																	0					0						c.(970-972)ACC>TCC		kinesin family member 13B							108.0	105.0	106.0					8																	29025078		1964	4146	6110	SO:0001583	missense	23303				microtubule-based movement|protein targeting|signal transduction|T cell activation	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein kinase binding	g.chr8:29025078T>A	AB014539	CCDS55217.1	8p21	2008-07-30				ENSG00000197892		"""Kinesins"""	14405	protein-coding gene	gene with protein product		607350				9734811, 10859302, 16864656	Standard	NM_015254		Approved	GAKIN, KIAA0639	uc003xhh.4	Q9NQT8		ENST00000524189.1:c.970A>T	8.37:g.29025078T>A	ENSP00000427900:p.Thr324Ser		Somatic				KIF13B_uc003xhj.2_Missense_Mutation_p.T221S|KIF13B_uc010lvf.1_Missense_Mutation_p.T260S	p.T324S	NM_015254	NP_056069	WXS	Illumina HiSeq	Unspecified	Q9NQT8	KI13B_HUMAN		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)	11	1029	-		Ovarian(32;0.000536)	324					B4DGY5|B5MC45|F8VPJ2|O75134|Q9BYJ6	Missense_Mutation	SNP	ENST00000524189.1	37	c.970A>T	CCDS55217.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.574618	0.86542	.	.	ENSG00000197892	ENST00000524189;ENST00000521515	D;D	0.91011	-2.77;-2.77	4.67	4.67	0.58626	Kinesin, motor domain (4);	0.000000	0.85682	D	0.000000	D	0.96599	0.8890	H	0.95780	3.72	0.80722	D	1	D;D;D	0.89917	0.994;0.999;1.0	D;D;D	0.97110	0.985;0.998;1.0	D	0.97739	1.0207	10	0.87932	D	0	.	14.2837	0.66232	0.0:0.0:0.0:1.0	.	310;324;324	C9JK41;Q9NQT8;F8VPJ2	.;KI13B_HUMAN;.	S	324	ENSP00000427900:T324S;ENSP00000429201:T324S	ENSP00000429201:T324S	T	-	1	0	KIF13B	29080997	1.000000	0.71417	0.992000	0.48379	0.721000	0.41392	7.803000	0.85983	1.967000	0.57214	0.459000	0.35465	ACC		0.463	KIF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376878.1			50	66	0	0	0	0	50	66				
FAM150A	389658	broad.mit.edu	37	8	53451006	53451006	+	Silent	SNP	G	G	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr8:53451006G>C	ENST00000358543.4	-	4	637	c.387C>G	c.(385-387)acC>acG	p.T129T	FAM150A_ENST00000523939.1_Intron	NM_207413.3	NP_997296.1	Q6UXT8	F150A_HUMAN	family with sequence similarity 150, member A	129						extracellular region (GO:0005576)				lung(1)	1		Lung NSC(129;0.0919)|all_epithelial(80;0.125)|all_lung(136;0.17)				AGTTTTGCTAGGTCTGGGAGC	0.289																																						uc003xrd.2		NA																	0					0						c.(385-387)ACC>ACG		hypothetical protein LOC389658 precursor							71.0	72.0	72.0					8																	53451006		2203	4300	6503	SO:0001819	synonymous_variant	389658					extracellular region		g.chr8:53451006G>C		CCDS6150.1	8q11.23	2007-12-18			ENSG00000196711	ENSG00000196711			33775	protein-coding gene	gene with protein product							Standard	NM_207413		Approved	UNQ9433	uc003xrd.3	Q6UXT8	OTTHUMG00000164256	ENST00000358543.4:c.387C>G	8.37:g.53451006G>C			Somatic				FAM150A_uc011ldt.1_Intron	p.T129T	NM_207413	NP_997296	WXS	Illumina HiSeq	Unspecified	Q6UXT8	F150A_HUMAN			4	592	-		Lung NSC(129;0.0919)|all_epithelial(80;0.125)|all_lung(136;0.17)	129					B7ZMG9	Silent	SNP	ENST00000358543.4	37	c.387C>G	CCDS6150.1																																																																																				0.289	FAM150A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377959.1	NM_207413		15	25	0	0	0	0	15	25				
OPRK1	4986	broad.mit.edu	37	8	54142037	54142037	+	Silent	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr8:54142037G>T	ENST00000265572.3	-	4	1260	c.963C>A	c.(961-963)acC>acA	p.T321T	RP11-162D9.3_ENST00000524425.1_RNA|OPRK1_ENST00000520287.1_Silent_p.T321T|OPRK1_ENST00000524278.1_Silent_p.T232T	NM_000912.3	NP_000903.2	P41145	OPRK_HUMAN	opioid receptor, kappa 1	321					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-inhibiting opioid receptor signaling pathway (GO:0031635)|behavior (GO:0007610)|defense response to virus (GO:0051607)|immune response (GO:0006955)|locomotory behavior (GO:0007626)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of saliva secretion (GO:0046877)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dynorphin receptor activity (GO:0038048)|opioid receptor activity (GO:0004985)	p.T321T(1)		NS(2)|breast(3)|endometrium(3)|kidney(12)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	43		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)			Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Fentanyl(DB00813)|Heroin(DB01452)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Menthol(DB00825)|Methylnaltrexone(DB06800)|Mianserin(DB06148)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Pethidine(DB00454)|Progesterone(DB00396)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	GGCTACTGTTGGTATAGCCTA	0.517																																						uc003xrh.1		NA																	1	Substitution - coding silent(1)		endometrium(1)	ovary(1)|skin(1)	2						c.(961-963)ACC>ACA		opioid receptor, kappa 1	Buprenorphine(DB00921)|Butorphanol(DB00611)|Cocaine(DB00907)|Codeine(DB00318)|Dezocine(DB01209)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Meperidine(DB00454)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Propoxyphene(DB00647)|Tramadol(DB00193)						79.0	70.0	73.0					8																	54142037		2203	4300	6503	SO:0001819	synonymous_variant	4986				behavior|immune response|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception|synaptic transmission|viral genome replication	integral to plasma membrane	kappa-opioid receptor activity|protein binding	g.chr8:54142037G>T		CCDS6152.1, CCDS64895.1	8q11.2	2014-05-21			ENSG00000082556	ENSG00000082556		"""GPCR / Class A : Opioid receptors"""	8154	protein-coding gene	gene with protein product		165196				8188308	Standard	XM_005251252		Approved	KOR, OPRK	uc003xri.1	P41145	OTTHUMG00000164276	ENST00000265572.3:c.963C>A	8.37:g.54142037G>T			Somatic				OPRK1_uc003xri.1_Silent_p.T321T|OPRK1_uc010lyc.1_Silent_p.T232T	p.T321T	NM_000912	NP_000903	WXS	Illumina HiSeq	Unspecified	P41145	OPRK_HUMAN			3	1338	-		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)	321			Helical; Name=7; (Potential).		E5RHC9|Q499G4	Silent	SNP	ENST00000265572.3	37	c.963C>A	CCDS6152.1																																																																																				0.517	OPRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378048.1			14	15	1	0	7.93e-07	9.81e-07	14	15				
RP1	6101	broad.mit.edu	37	8	55542575	55542575	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr8:55542575G>T	ENST00000220676.1	+	4	6281	c.6133G>T	c.(6133-6135)Ggt>Tgt	p.G2045C		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	2045					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			GTTAGTTGTGGGTAATGTGGA	0.353																																					Colon(91;1014 1389 7634 14542 40420)	uc003xsd.1		NA																	0				skin(7)|ovary(4)|pancreas(1)	12						c.(6133-6135)GGT>TGT		retinitis pigmentosa RP1 protein							79.0	81.0	81.0					8																	55542575		2203	4300	6503	SO:0001583	missense	6101				axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding	g.chr8:55542575G>T	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.6133G>T	8.37:g.55542575G>T	ENSP00000220676:p.Gly2045Cys		Somatic				RP1_uc011ldy.1_Intron	p.G2045C	NM_006269	NP_006260	WXS	Illumina HiSeq	Unspecified	P56715	RP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)		4	6281	+		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	2045						Missense_Mutation	SNP	ENST00000220676.1	37	c.6133G>T	CCDS6160.1	.	.	.	.	.	.	.	.	.	.	G	5.785	0.329090	0.10956	.	.	ENSG00000104237	ENST00000220676	T	0.21734	1.99	5.82	3.03	0.35002	.	1.032140	0.07700	N	0.940146	T	0.19248	0.0462	L	0.44542	1.39	0.09310	N	1	P	0.38167	0.621	B	0.36186	0.219	T	0.23797	-1.0178	10	0.72032	D	0.01	.	6.3285	0.21257	0.259:0.0:0.612:0.129	.	2045	P56715	RP1_HUMAN	C	2045	ENSP00000220676:G2045C	ENSP00000220676:G2045C	G	+	1	0	RP1	55705128	0.000000	0.05858	0.001000	0.08648	0.016000	0.09150	0.417000	0.21214	0.094000	0.17404	-1.094000	0.02160	GGT		0.353	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269		25	53	1	0	2.28e-19	3.39e-19	25	53				
PLAG1	5324	broad.mit.edu	37	8	57079634	57079634	+	Missense_Mutation	SNP	C	C	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr8:57079634C>G	ENST00000316981.3	-	5	1150	c.671G>C	c.(670-672)cGa>cCa	p.R224P	PLAG1_ENST00000423799.2_Missense_Mutation_p.R142P|PLAG1_ENST00000429357.2_Missense_Mutation_p.R224P	NM_001114634.1|NM_002655.2	NP_001108106.1|NP_002646.2	Q6DJT9	PLAG1_HUMAN	pleiomorphic adenoma gene 1	224	Decreased nuclear import with localization in the nucleus but also in the cytoplasm.				gland morphogenesis (GO:0022612)|multicellular organism growth (GO:0035264)|negative regulation of gene expression (GO:0010629)|organ growth (GO:0035265)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland growth (GO:0060736)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		CTNNB1/PLAG1(60)|LIFR_ENST00000263409/PLAG1(10)|HAS2/PLAG1(10)|FGFR1_ENST00000447712/PLAG1(28)|COL1A2/PLAG1(3)|CHCHD7/PLAG1(12)|TCEA1_ENST00000521604/PLAG1(3)	breast(3)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(7)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28		all_lung(136;0.0548)|Lung NSC(129;0.0718)|all_epithelial(80;0.125)	Epithelial(17;0.00179)|all cancers(17;0.0125)			GTGATCCTTTCGCCCAAATCT	0.478			T	"""TCEA1, LIFR, CTNNB1, CHCHD7"""	salivary adenoma																																	uc003xsq.3		NA		Dom	yes		8	8q12	5324	T	pleiomorphic adenoma gene 1			E	TCEA1|LIFR|CTNNB1|CHCHD7		salivary adenoma	CTNNB1/PLAG1(60)|FGFR1_ENST00000447712/PLAG1(28)|CHCHD7/PLAG1(12)|LIFR_ENST00000263409/PLAG1(10)|HAS2/PLAG1(10)|COL1A2/PLAG1(3)|TCEA1_ENST00000521604/PLAG1(3)	0				salivary_gland(113)|soft_tissue(13)|lung(1)|central_nervous_system(1)|breast(1)	129						c.(670-672)CGA>CCA		pleiomorphic adenoma gene 1 isoform b							126.0	115.0	119.0					8																	57079634		2203	4300	6503	SO:0001583	missense	5324					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:57079634C>G	U65002	CCDS6165.1, CCDS47860.1	8q12	2010-07-30				ENSG00000181690		"""Zinc fingers, C2H2-type"""	9045	protein-coding gene	gene with protein product		603026				9268638	Standard	NM_002655		Approved	ZNF912	uc010lyi.3	Q6DJT9		ENST00000316981.3:c.671G>C	8.37:g.57079634C>G	ENSP00000325546:p.Arg224Pro		Somatic				PLAG1_uc003xsr.3_Missense_Mutation_p.R224P|PLAG1_uc010lyi.2_Missense_Mutation_p.R224P|PLAG1_uc010lyj.2_Missense_Mutation_p.R142P	p.R224P	NM_001114635	NP_001108107	WXS	Illumina HiSeq	Unspecified	Q6DJT9	PLAG1_HUMAN	Epithelial(17;0.00179)|all cancers(17;0.0125)		3	1122	-		all_lung(136;0.0548)|Lung NSC(129;0.0718)|all_epithelial(80;0.125)	224			Decreased nuclear import with localization in the nucleus but also in the cytoplasm.|C2H2-type 7.		B4DLC2|Q59GH8|Q9Y4L2	Missense_Mutation	SNP	ENST00000316981.3	37	c.671G>C	CCDS6165.1	.	.	.	.	.	.	.	.	.	.	C	16.07	3.018186	0.54576	.	.	ENSG00000181690	ENST00000316981;ENST00000423799;ENST00000429357	T;T;T	0.30448	1.53;1.53;1.53	5.66	4.79	0.61399	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.63271	0.2497	M	0.91140	3.18	0.80722	D	1	D	0.76494	0.999	D	0.74023	0.982	T	0.73385	-0.3999	10	0.87932	D	0	-14.093	14.7135	0.69251	0.0:0.9304:0.0:0.0696	.	224	Q6DJT9	PLAG1_HUMAN	P	224;142;224	ENSP00000325546:R224P;ENSP00000404067:R142P;ENSP00000416537:R224P	ENSP00000325546:R224P	R	-	2	0	PLAG1	57242188	1.000000	0.71417	0.060000	0.19600	0.954000	0.61252	7.818000	0.86416	1.385000	0.46445	0.585000	0.79938	CGA		0.478	PLAG1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378212.1	NM_002655		36	46	0	0	0	0	36	46				
TRIM55	84675	broad.mit.edu	37	8	67039550	67039550	+	Missense_Mutation	SNP	C	C	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr8:67039550C>G	ENST00000315962.4	+	1	420	c.47C>G	c.(46-48)aCc>aGc	p.T16S	TRIM55_ENST00000350034.4_Missense_Mutation_p.T16S|TRIM55_ENST00000353317.5_Missense_Mutation_p.T16S|TRIM55_ENST00000276573.7_Missense_Mutation_p.T16S	NM_184085.1	NP_908973.1	Q9BYV6	TRI55_HUMAN	tripartite motif containing 55	16					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	39		Lung NSC(129;0.138)|all_lung(136;0.221)	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)			GAGCAGCAGACCATGGATAAC	0.498																																						uc003xvv.2		NA																	0				skin(3)|ovary(1)|central_nervous_system(1)	5						c.(46-48)ACC>AGC		tripartite motif-containing 55 isoform 1							152.0	151.0	152.0					8																	67039550		2203	4300	6503	SO:0001583	missense	84675					cytoplasm|microtubule|nucleus	signal transducer activity|zinc ion binding	g.chr8:67039550C>G	AJ291712	CCDS6184.1, CCDS6185.1, CCDS6186.1, CCDS6187.1	8q13.1	2013-01-09	2011-01-25	2004-11-17	ENSG00000147573	ENSG00000147573		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	14215	protein-coding gene	gene with protein product		606469	"""ring finger protein 29"", ""tripartite motif-containing 55"""	RNF29		11243782	Standard	NM_033058		Approved	MURF-2	uc003xvv.3	Q9BYV6	OTTHUMG00000164473	ENST00000315962.4:c.47C>G	8.37:g.67039550C>G	ENSP00000323913:p.Thr16Ser		Somatic				TRIM55_uc003xvu.2_Missense_Mutation_p.T16S|TRIM55_uc003xvw.2_Missense_Mutation_p.T16S|TRIM55_uc003xvx.2_Missense_Mutation_p.T16S	p.T16S	NM_184085	NP_908973	WXS	Illumina HiSeq	Unspecified	Q9BYV6	TRI55_HUMAN	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)		1	273	+		Lung NSC(129;0.138)|all_lung(136;0.221)	16			RING-type.		B3KRC0|B3KRJ3|Q53XX3|Q8IUD9|Q8IUE4|Q96DV2|Q96DV3|Q9BYV5	Missense_Mutation	SNP	ENST00000315962.4	37	c.47C>G	CCDS6184.1	.	.	.	.	.	.	.	.	.	.	C	15.15	2.748474	0.49257	.	.	ENSG00000147573	ENST00000315962;ENST00000353317;ENST00000276573;ENST00000350034	T;T;T;T	0.38401	1.53;1.58;1.53;1.14	5.72	5.72	0.89469	Zinc finger, RING/FYVE/PHD-type (1);	0.203954	0.50627	D	0.000106	T	0.23886	0.0578	N	0.02830	-0.485	0.33688	D	0.613005	B;B;B;B	0.31548	0.077;0.178;0.22;0.328	B;B;B;B	0.36959	0.09;0.108;0.171;0.237	T	0.32375	-0.9909	10	0.35671	T	0.21	.	19.8891	0.96923	0.0:1.0:0.0:0.0	.	16;16;16;16	Q9BYV6-4;Q9BYV6-2;Q9BYV6;Q9BYV6-3	.;.;TRI55_HUMAN;.	S	16	ENSP00000323913:T16S;ENSP00000297348:T16S;ENSP00000276573:T16S;ENSP00000332302:T16S	ENSP00000276573:T16S	T	+	2	0	TRIM55	67202104	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.643000	0.67895	2.689000	0.91719	0.655000	0.94253	ACC		0.498	TRIM55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378921.1	NM_184085		41	74	0	0	0	0	41	74				
E2F5	1875	broad.mit.edu	37	8	86114380	86114380	+	Splice_Site	SNP	A	A	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr8:86114380A>T	ENST00000416274.2	+	2	268		c.e2-1		E2F5_ENST00000256117.5_Splice_Site|E2F5_ENST00000519128.1_Splice_Site|E2F5_ENST00000521429.1_Splice_Site|E2F5_ENST00000517476.1_Splice_Site|E2F5_ENST00000418930.2_Splice_Site	NM_001083588.1|NM_001951.3	NP_001077057.1|NP_001942.2	Q15329	E2F5_HUMAN	E2F transcription factor 5, p130-binding						gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)	8						TTTCCTGAACAGGCTGCTGAT	0.348																																						uc003ycz.3		NA																	0				ovary(1)	1						c.e2-2		E2F transcription factor 5 isoform 1							77.0	71.0	73.0					8																	86114380		1859	4095	5954	SO:0001630	splice_region_variant	1875				G1 phase of mitotic cell cycle	transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding	g.chr8:86114380A>T	X86097	CCDS47885.1, CCDS47886.1, CCDS55254.1	8q21.2	2004-01-29			ENSG00000133740	ENSG00000133740			3119	protein-coding gene	gene with protein product		600967				7892279	Standard	NM_001083588		Approved		uc003ycz.4	Q15329	OTTHUMG00000164785	ENST00000416274.2:c.235-1A>T	8.37:g.86114380A>T			Somatic				E2F5_uc003yda.3_Splice_Site_p.A79_splice|E2F5_uc010mab.2_Splice_Site	p.A79_splice	NM_001951	NP_001942	WXS	Illumina HiSeq	Unspecified	Q15329	E2F5_HUMAN			2	272	+								E9PBN9|Q16601|Q92756	Splice_Site	SNP	ENST00000416274.2	37	c.235_splice	CCDS47885.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.254837	0.80135	.	.	ENSG00000133740	ENST00000418930;ENST00000256117;ENST00000416274	.	.	.	5.47	5.47	0.80525	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8443	0.78876	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	E2F5	86301632	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.265000	0.95647	2.208000	0.71279	0.496000	0.49642	.		0.348	E2F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380274.1	NM_001951	Intron	5	20	0	0	0	0	5	20				
CDH17	1015	broad.mit.edu	37	8	95183180	95183180	+	Missense_Mutation	SNP	A	A	C	rs541395956		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr8:95183180A>C	ENST00000027335.3	-	8	941	c.817T>G	c.(817-819)Tta>Gta	p.L273V	CDH17_ENST00000441892.2_Intron|CDH17_ENST00000450165.2_Missense_Mutation_p.L273V	NM_004063.3	NP_004054.3	Q12864	CAD17_HUMAN	cadherin 17, LI cadherin (liver-intestine)	273	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|oligopeptide transmembrane transport (GO:0035672)|oligopeptide transport (GO:0006857)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)|transporter activity (GO:0005215)			NS(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(4)|stomach(2)	52	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			TTGTCAACTAAGGAATATTGT	0.453																																						uc003ygh.2		NA																	0				ovary(5)|skin(1)	6						c.(817-819)TTA>GTA		cadherin 17 precursor							96.0	93.0	94.0					8																	95183180		2203	4300	6503	SO:0001583	missense	1015					integral to membrane	calcium ion binding	g.chr8:95183180A>C	X83228	CCDS6260.1	8q22.1	2010-01-26			ENSG00000079112	ENSG00000079112		"""Cadherins / Major cadherins"""	1756	protein-coding gene	gene with protein product		603017				9615235, 10191097	Standard	NM_004063		Approved	HPT-1, cadherin	uc003ygh.2	Q12864	OTTHUMG00000164391	ENST00000027335.3:c.817T>G	8.37:g.95183180A>C	ENSP00000027335:p.Leu273Val		Somatic				CDH17_uc011lgo.1_Intron|CDH17_uc011lgp.1_Missense_Mutation_p.L273V	p.L273V	NM_004063	NP_004054	WXS	Illumina HiSeq	Unspecified	Q12864	CAD17_HUMAN	BRCA - Breast invasive adenocarcinoma(8;0.00691)		8	942	-	Breast(36;4.65e-06)		273			Extracellular (Potential).|Cadherin 3.		Q15336|Q2M2E0	Missense_Mutation	SNP	ENST00000027335.3	37	c.817T>G	CCDS6260.1	.	.	.	.	.	.	.	.	.	.	A	16.34	3.095791	0.56075	.	.	ENSG00000079112	ENST00000027335;ENST00000450165	T;T	0.55588	0.51;0.51	5.95	3.57	0.40892	Cadherin (4);Cadherin-like (1);	0.000000	0.42821	D	0.000652	T	0.62270	0.2414	M	0.78344	2.41	0.25998	N	0.982153	D	0.54397	0.966	P	0.55303	0.773	T	0.55309	-0.8161	10	0.38643	T	0.18	-13.0915	8.0798	0.30737	0.824:0.0:0.176:0.0	.	273	Q12864	CAD17_HUMAN	V	273	ENSP00000027335:L273V;ENSP00000401468:L273V	ENSP00000027335:L273V	L	-	1	2	CDH17	95252356	0.052000	0.20516	0.025000	0.17156	0.132000	0.20833	0.396000	0.20867	0.491000	0.27793	-0.263000	0.10527	TTA		0.453	CDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378560.1	NM_004063		19	52	0	0	0	0	19	52				
RIMS2	9699	broad.mit.edu	37	8	104897854	104897854	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr8:104897854C>T	ENST00000436393.2	+	2	602	c.361C>T	c.(361-363)Cca>Tca	p.P121S	RIMS2_ENST00000507740.1_Missense_Mutation_p.P151S|RIMS2_ENST00000406091.3_Missense_Mutation_p.P343S|RIMS2_ENST00000522174.1_3'UTR|RIMS2_ENST00000262231.10_Missense_Mutation_p.P151S			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	374	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GGCCCGTTATCCAGTAAAGCC	0.478										HNSCC(12;0.0054)																												uc003yls.2		NA																	0				ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15						c.(361-363)CCA>TCA		regulating synaptic membrane exocytosis 2							87.0	87.0	87.0					8																	104897854		2010	4176	6186	SO:0001583	missense	9699				intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding	g.chr8:104897854C>T	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.361C>T	8.37:g.104897854C>T	ENSP00000390665:p.Pro121Ser	HNSCC(12;0.0054)	Somatic				RIMS2_uc003ylp.2_Missense_Mutation_p.P343S|RIMS2_uc003ylw.2_Missense_Mutation_p.P151S|RIMS2_uc003ylq.2_Missense_Mutation_p.P151S|RIMS2_uc003ylr.2_Missense_Mutation_p.P151S	p.P121S	NM_014677	NP_055492	WXS	Illumina HiSeq	Unspecified	Q9UQ26	RIMS2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)		2	602	+			374					B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	ENST00000436393.2	37	c.361C>T		.	.	.	.	.	.	.	.	.	.	C	26.3	4.729050	0.89390	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998;ENST00000515551;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393	T;T;T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93;0.93;0.93	5.32	5.32	0.75619	.	.	.	.	.	T	0.66954	0.2842	M	0.76574	2.34	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.997;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.995;0.995;0.999;0.999;0.999	T	0.70684	-0.4804	9	0.87932	D	0	.	18.9862	0.92771	0.0:1.0:0.0:0.0	.	374;121;151;151;343	Q9UQ26;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.	S	343;374;343;374;151;151;151;151;121	ENSP00000427018:P343S;ENSP00000384892:P343S;ENSP00000425205:P151S;ENSP00000262231:P151S;ENSP00000423559:P151S;ENSP00000386228:P151S;ENSP00000390665:P121S	ENSP00000262231:P151S	P	+	1	0	RIMS2	104967030	1.000000	0.71417	0.999000	0.59377	0.980000	0.70556	7.619000	0.83057	2.479000	0.83701	0.467000	0.42956	CCA		0.478	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117		15	30	0	0	0	0	15	30				
DCSTAMP	81501	broad.mit.edu	37	8	105360964	105360964	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr8:105360964G>A	ENST00000297581.2	+	2	233	c.184G>A	c.(184-186)Gct>Act	p.A62T	DPYS_ENST00000521601.1_Intron|DCSTAMP_ENST00000517991.1_Missense_Mutation_p.A62T	NM_030788.3	NP_110415.1	Q9H295	DCSTP_HUMAN	dendrocyte expressed seven transmembrane protein	62	Poly-Ala. {ECO:0000255}.				cellular response to interleukin-4 (GO:0071353)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to tumor necrosis factor (GO:0071356)|membrane fusion (GO:0061025)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cell growth (GO:0030308)|osteoclast differentiation (GO:0030316)|osteoclast fusion (GO:0072675)|positive regulation of bone resorption (GO:0045780)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of monocyte differentiation (GO:0045657)	cell surface (GO:0009986)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)											CATAGCGGCCGCTGCCTCCTG	0.507																																						uc003ylx.1		NA																	0				pancreas(2)|large_intestine(1)|ovary(1)	4						c.(184-186)GCT>ACT		dendritic cell-specific transmembrane protein							131.0	120.0	124.0					8																	105360964		2203	4300	6503	SO:0001583	missense	81501				osteoclast differentiation	cell surface|integral to membrane|plasma membrane		g.chr8:105360964G>A	AF305068	CCDS6301.1, CCDS59111.1	8q22.3	2012-08-10	2012-03-27	2012-03-27	ENSG00000164935	ENSG00000164935			18549	protein-coding gene	gene with protein product	"""Dendritic cells (DC)-specific transmembrane protein"", ""IL-Four INDuced"""	605933	"""transmembrane 7 superfamily member 4"""	TM7SF4		11169400, 11345591	Standard	NM_030788		Approved	DC-STAMP, FIND	uc003ylx.2	Q9H295	OTTHUMG00000164890	ENST00000297581.2:c.184G>A	8.37:g.105360964G>A	ENSP00000297581:p.Ala62Thr		Somatic					p.A62T	NM_030788	NP_110415	WXS	Illumina HiSeq	Unspecified	Q9H295	TM7S4_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)		2	233	+			62			Helical; (Potential).|Poly-Ala.		B7ZVW2|E7ESG0|Q2M2D5	Missense_Mutation	SNP	ENST00000297581.2	37	c.184G>A	CCDS6301.1	.	.	.	.	.	.	.	.	.	.	G	7.740	0.701009	0.15172	.	.	ENSG00000164935	ENST00000297581;ENST00000517991	T	0.30182	1.54	5.84	-11.7	0.00046	.	1.847400	0.01832	N	0.034757	T	0.12347	0.0300	N	0.12182	0.205	0.09310	N	1	B	0.12630	0.006	B	0.06405	0.002	T	0.06338	-1.0832	9	.	.	.	2.7823	5.6546	0.17635	0.5878:0.146:0.178:0.0883	.	62	Q9H295	TM7S4_HUMAN	T	62	ENSP00000297581:A62T	.	A	+	1	0	TM7SF4	105430140	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.120000	0.03273	-2.683000	0.00407	-0.302000	0.09304	GCT		0.507	DCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380810.1	NM_030788		49	84	0	0	0	0	49	84				
CSMD3	114788	broad.mit.edu	37	8	113293570	113293570	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr8:113293570C>A	ENST00000297405.5	-	59	9585	c.9341G>T	c.(9340-9342)tGt>tTt	p.C3114F	CSMD3_ENST00000352409.3_Missense_Mutation_p.C3044F|CSMD3_ENST00000343508.3_Missense_Mutation_p.C3074F|CSMD3_ENST00000455883.2_Missense_Mutation_p.C2945F	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3114	Sushi 23. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TGGGTTACCACACTGCACAGC	0.353										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												uc003ynu.2		NA																	0				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(9340-9342)TGT>TTT		CUB and Sushi multiple domains 3 isoform 1							80.0	68.0	72.0					8																	113293570		2203	4300	6503	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113293570C>A	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.9341G>T	8.37:g.113293570C>A	ENSP00000297405:p.Cys3114Phe	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003yns.2_Missense_Mutation_p.C2316F|CSMD3_uc003ynt.2_Missense_Mutation_p.C3074F|CSMD3_uc011lhx.1_Missense_Mutation_p.C2945F	p.C3114F	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			59	9500	-			3114			Extracellular (Potential).|Sushi 23.		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.9341G>T	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.468866	0.84533	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	D;D;D;D;D	0.99784	-6.74;-6.74;-6.74;-6.74;-6.74	5.72	5.72	0.89469	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	D	0.99908	0.9956	H	0.99454	4.575	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.966	D;D;P	0.91635	0.998;0.999;0.899	D	0.96129	0.9091	10	0.87932	D	0	.	19.8765	0.96875	0.0:1.0:0.0:0.0	.	2945;3114;3074	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	F	3074;3114;2384;2945;3044	ENSP00000345799:C3074F;ENSP00000297405:C3114F;ENSP00000341558:C2384F;ENSP00000412263:C2945F;ENSP00000343124:C3044F	ENSP00000297405:C3114F	C	-	2	0	CSMD3	113362746	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.773000	0.85462	2.695000	0.91970	0.650000	0.86243	TGT		0.353	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		19	46	1	0	5.04e-11	6.9e-11	19	46				
BAI1	575	broad.mit.edu	37	8	143623649	143623649	+	Missense_Mutation	SNP	A	A	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr8:143623649A>T	ENST00000517894.1	+	28	4948	c.4054A>T	c.(4054-4056)Acg>Tcg	p.T1352S	BAI1_ENST00000323289.5_Missense_Mutation_p.T1352S			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	1352					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					GCCCACGGCCACGGCCACGCT	0.652																																						uc003ywm.2		NA																	0				lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|pancreas(1)	8						c.(4054-4056)ACG>TCG		brain-specific angiogenesis inhibitor 1							34.0	45.0	41.0					8																	143623649		2104	4215	6319	SO:0001583	missense	575				axonogenesis|cell adhesion|negative regulation of angiogenesis|negative regulation of cell proliferation|neuropeptide signaling pathway|peripheral nervous system development	cell-cell junction|integral to plasma membrane	G-protein coupled receptor activity|protein binding	g.chr8:143623649A>T	AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.4054A>T	8.37:g.143623649A>T	ENSP00000430945:p.Thr1352Ser		Somatic					p.T1352S	NM_001702	NP_001693	WXS	Illumina HiSeq	Unspecified	O14514	BAI1_HUMAN			27	4237	+	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)		1352			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000517894.1	37	c.4054A>T		.	.	.	.	.	.	.	.	.	.	A	12.85	2.060614	0.36373	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	T;T	0.29917	1.55;1.55	4.37	4.37	0.52481	.	0.067682	0.56097	U	0.000022	T	0.22044	0.0531	L	0.41573	1.285	0.28568	N	0.910757	B	0.34200	0.441	B	0.28553	0.091	T	0.10042	-1.0647	10	0.17369	T	0.5	.	12.7483	0.57293	1.0:0.0:0.0:0.0	.	1352	E9PBK0	.	S	1352	ENSP00000430945:T1352S;ENSP00000313046:T1352S	ENSP00000313046:T1352S	T	+	1	0	BAI1	143620651	0.997000	0.39634	0.247000	0.24249	0.926000	0.56050	4.014000	0.57145	1.598000	0.50083	0.533000	0.62120	ACG		0.652	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379963.3	NM_001702		20	23	0	0	0	0	20	23				
TIGD5	84948	broad.mit.edu	37	8	144681057	144681057	+	Silent	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr8:144681057G>T	ENST00000504548.2	+	1	984	c.984G>T	c.(982-984)ctG>ctT	p.L328L	RP11-661A12.14_ENST00000606452.1_lincRNA|TIGD5_ENST00000321385.3_Silent_p.L279L|EEF1D_ENST00000531770.1_5'Flank|EEF1D_ENST00000317198.6_5'Flank|EEF1D_ENST00000423316.2_5'Flank|EEF1D_ENST00000419152.2_5'Flank|EEF1D_ENST00000524624.1_5'Flank|EEF1D_ENST00000442189.2_5'Flank|EEF1D_ENST00000529272.1_5'Flank|EEF1D_ENST00000531621.1_5'Flank|EEF1D_ENST00000528610.1_5'Flank|EEF1D_ENST00000532400.1_5'Flank|EEF1D_ENST00000395119.3_5'Flank|EEF1D_ENST00000526838.1_5'Flank	NM_032862.4	NP_116251.4	Q53EQ6	TIGD5_HUMAN	tigger transposable element derived 5	328	DDE 1.					nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|lung(3)|ovary(1)|soft_tissue(1)|urinary_tract(1)	7	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			GCCCGCTGCTGCGGGGCTGGT	0.697																																						uc003yyx.1		NA																	0					0						c.(835-837)CTG>CTT		tigger transposable element derived 5							10.0	13.0	12.0					8																	144681057		2157	4245	6402	SO:0001819	synonymous_variant	84948				regulation of transcription, DNA-dependent	chromosome, centromeric region	DNA binding	g.chr8:144681057G>T	AK027832	CCDS6406.1, CCDS6406.2	8q24.3	2008-02-01				ENSG00000179886			18336	protein-coding gene	gene with protein product							Standard	NM_032862		Approved	FLJ14926	uc003yyx.2	Q53EQ6		ENST00000504548.2:c.984G>T	8.37:g.144681057G>T			Somatic				EEF1D_uc011lki.1_5'Flank|EEF1D_uc011lkj.1_5'Flank|EEF1D_uc003yyr.2_5'Flank|EEF1D_uc003yyt.2_5'Flank|EEF1D_uc011lkk.1_5'Flank|EEF1D_uc003yys.2_5'Flank|EEF1D_uc003yyv.2_5'Flank|EEF1D_uc003yyu.2_5'Flank|EEF1D_uc011lkl.1_5'Flank	p.L279L	NM_032862	NP_116251	WXS	Illumina HiSeq	Unspecified	Q53EQ6	TIGD5_HUMAN	Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)		1	837	+	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		328					E7EWS2|Q6NT83|Q8N5A1|Q96JW8	Silent	SNP	ENST00000504548.2	37	c.837G>T	CCDS6406.2																																																																																				0.697	TIGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368269.1	NM_032862		6	12	1	0	0.000157383	0.000180201	6	12				
PARP10	84875	broad.mit.edu	37	8	145049407	145049407	+	IGR	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr8:145049407C>T	ENST00000313028.7	-	0	3497				PLEC_ENST00000356346.3_5'Flank|PLEC_ENST00000436759.2_Missense_Mutation_p.G44D|PLEC_ENST00000527096.1_Missense_Mutation_p.G44D	NM_032789.3	NP_116178.2	Q53GL7	PAR10_HUMAN	poly (ADP-ribose) polymerase family, member 10						negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of gene expression (GO:0010629)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of protein K63-linked ubiquitination (GO:1900045)|negative regulation of viral genome replication (GO:0045071)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein poly-ADP-ribosylation (GO:0070212)|regulation of chromatin assembly (GO:0010847)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(2)	27	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCCAGCGCCACCCCCGCTGCG	0.657											OREG0019050	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										uc003zaj.2		NA																	0				large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						c.(130-132)GGT>GAT		plectin isoform 1c							44.0	55.0	52.0					8																	145049407		2071	4194	6265	SO:0001628	intergenic_variant	5339				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle	g.chr8:145049407C>T	AK027370	CCDS34960.1	8q24	2010-02-16				ENSG00000178685		"""Poly (ADP-ribose) polymerases"""	25895	protein-coding gene	gene with protein product		609564				15273990	Standard	NM_032789		Approved	FLJ14464	uc003zal.4	Q53GL7			8.37:g.145049407C>T			Somatic	OREG0019050	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1691	PLEC_uc003zah.2_5'Flank	p.G44D	NM_000445	NP_000436	WXS	Illumina HiSeq	Unspecified	Q15149	PLEC_HUMAN			2	180	-			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					Q8N2I0|Q8WV05|Q96CH7|Q96K72	Missense_Mutation	SNP	ENST00000313028.7	37	c.131G>A	CCDS34960.1	.	.	.	.	.	.	.	.	.	.	c	10.80	1.453689	0.26161	.	.	ENSG00000178209	ENST00000436759;ENST00000527096;ENST00000528025	T;T;D	0.90444	-1.04;-1.04;-2.67	4.09	4.09	0.47781	.	.	.	.	.	D	0.83667	0.5304	N	0.14661	0.345	0.09310	N	1	P	0.51351	0.944	P	0.47470	0.548	T	0.72520	-0.4268	9	0.12103	T	0.63	.	11.7183	0.51666	0.0:1.0:0.0:0.0	.	44	Q15149-2	.	D	44	ENSP00000388180:G44D;ENSP00000434583:G44D;ENSP00000437303:G44D	ENSP00000388180:G44D	G	-	2	0	PLEC	145121395	0.000000	0.05858	0.007000	0.13788	0.475000	0.33008	0.439000	0.21575	2.104000	0.64026	0.650000	0.86243	GGT		0.657	PARP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383866.1	NM_032789		26	50	0	0	0	0	26	50				
FREM1	158326	broad.mit.edu	37	9	14812864	14812864	+	Missense_Mutation	SNP	C	C	G	rs200811701	byFrequency	TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr9:14812864C>G	ENST00000380880.3	-	16	3622	c.2839G>C	c.(2839-2841)Gat>Cat	p.D947H	FREM1_ENST00000380881.4_Missense_Mutation_p.D948H|FREM1_ENST00000422223.2_Missense_Mutation_p.D947H			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	947					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		GAGAACTGATCCACTGTGACT	0.488																																						uc003zlm.2		NA																	0				ovary(2)|breast(2)|pancreas(1)	5						c.(2839-2841)GAT>CAT		FRAS1 related extracellular matrix 1 precursor							193.0	190.0	191.0					9																	14812864		2075	4224	6299	SO:0001583	missense	158326				cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding	g.chr9:14812864C>G	AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.2839G>C	9.37:g.14812864C>G	ENSP00000370262:p.Asp947His		Somatic				FREM1_uc010mic.2_RNA	p.D947H	NM_144966	NP_659403	WXS	Illumina HiSeq	Unspecified	Q5H8C1	FREM1_HUMAN		GBM - Glioblastoma multiforme(50;3.53e-06)	16	3429	-			947			CSPG 6.		B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	ENST00000380880.3	37	c.2839G>C	CCDS47952.1	.	.	.	.	.	.	.	.	.	.	C	13.26	2.183283	0.38511	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380880	T;T;T	0.41758	0.99;0.99;0.99	5.78	2.91	0.33838	.	0.379533	0.33534	N	0.004816	T	0.34395	0.0896	L	0.41356	1.27	0.39183	D	0.962813	B	0.13594	0.008	B	0.16722	0.016	T	0.15065	-1.0450	10	0.48119	T	0.1	-0.3419	12.3726	0.55263	0.1202:0.6252:0.2547:0.0	.	947	Q5H8C1	FREM1_HUMAN	H	948;947;947	ENSP00000370263:D948H;ENSP00000412940:D947H;ENSP00000370262:D947H	ENSP00000370257:D950H	D	-	1	0	FREM1	14802864	0.995000	0.38212	0.008000	0.14137	0.982000	0.71751	3.003000	0.49505	0.355000	0.24131	-0.150000	0.13652	GAT		0.488	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339474.2	NM_144966		70	147	0	0	0	0	70	147				
C9orf135	138255	broad.mit.edu	37	9	72459432	72459432	+	Splice_Site	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr9:72459432G>T	ENST00000377197.3	+	2	239		c.e2-1		C9orf135_ENST00000466872.2_Intron|C9orf135_ENST00000527647.1_Splice_Site	NM_001010940.1	NP_001010940.1	Q5VTT2	CI135_HUMAN	chromosome 9 open reading frame 135							integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	7						TTTTTCTTAAGGCACCGTGAC	0.328																																						uc004ahl.2		NA																	0				ovary(1)	1						c.e2-1		hypothetical protein LOC138255							75.0	84.0	81.0					9																	72459432		2203	4300	6503	SO:0001630	splice_region_variant	138255					integral to membrane		g.chr9:72459432G>T		CCDS35041.1	9q21.11	2013-06-07	2013-06-07	2013-06-07	ENSG00000204711	ENSG00000204711			31422	protein-coding gene	gene with protein product							Standard	XM_005251705		Approved		uc004ahl.3	Q5VTT2	OTTHUMG00000019985	ENST00000377197.3:c.153-1G>T	9.37:g.72459432G>T			Somatic				C9orf135_uc011lrw.1_Intron|C9orf135_uc010moq.2_Intron|C9orf135_uc011lrx.1_Intron|C9orf135_uc010mop.2_Splice_Site_p.W51_splice	p.W51_splice	NM_001010940	NP_001010940	WXS	Illumina HiSeq	Unspecified	Q5VTT2	CI135_HUMAN			2	218	+								A7E2U4|B2RN61	Splice_Site	SNP	ENST00000377197.3	37	c.153_splice	CCDS35041.1	.	.	.	.	.	.	.	.	.	.	G	16.89	3.248382	0.59103	.	.	ENSG00000204711	ENST00000377197;ENST00000527647;ENST00000480564	.	.	.	5.45	5.45	0.79879	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6523	0.68805	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C9orf135	71649252	1.000000	0.71417	0.999000	0.59377	0.833000	0.47200	4.150000	0.58098	2.836000	0.97738	0.655000	0.94253	.		0.328	C9orf135-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000052591.1	NM_001010940	Intron	23	82	1	0	3.29e-13	4.61e-13	23	82				
TMEM2	23670	broad.mit.edu	37	9	74360468	74360468	+	Missense_Mutation	SNP	T	T	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr9:74360468T>C	ENST00000377044.4	-	4	1039	c.500A>G	c.(499-501)gAt>gGt	p.D167G	TMEM2_ENST00000377066.5_Missense_Mutation_p.D167G	NM_001135820.1|NM_013390.2	NP_001129292.1|NP_037522.1	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2	167	G8. {ECO:0000255|PROSITE- ProRule:PRU00817}.				multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(15)|liver(1)|lung(19)|ovary(2)|prostate(5)|skin(1)|stomach(1)|urinary_tract(2)	56		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		TCTGGATCCATCTTTATTGTC	0.423																																						uc011lsa.1		NA																	0				ovary(2)	2						c.(499-501)GAT>GGT		transmembrane protein 2 isoform a							82.0	89.0	87.0					9																	74360468		2203	4300	6503	SO:0001583	missense	23670					integral to membrane		g.chr9:74360468T>C		CCDS6638.1, CCDS47979.1	9q21.13	2011-07-19			ENSG00000135048	ENSG00000135048			11869	protein-coding gene	gene with protein product		605835					Standard	NM_013390		Approved		uc011lsa.1	Q9UHN6	OTTHUMG00000020000	ENST00000377044.4:c.500A>G	9.37:g.74360468T>C	ENSP00000366243:p.Asp167Gly		Somatic				TMEM2_uc010mos.2_Missense_Mutation_p.D167G|TMEM2_uc011lsb.1_RNA	p.D167G	NM_013390	NP_037522	WXS	Illumina HiSeq	Unspecified	Q9UHN6	TMEM2_HUMAN		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)	4	1040	-		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)	167			G8.		A6H8W9|B2RTQ6|Q5T838|Q5T839|Q5T840|Q5T841|Q8NBP6|Q9P2D5	Missense_Mutation	SNP	ENST00000377044.4	37	c.500A>G	CCDS6638.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.143595	0.77888	.	.	ENSG00000135048	ENST00000377044;ENST00000377066	T;T	0.75154	-0.91;-0.85	5.87	5.87	0.94306	G8 domain (2);	0.087710	0.85682	D	0.000000	T	0.76011	0.3928	M	0.73962	2.25	0.80722	D	1	P;P	0.36086	0.536;0.481	B;B	0.37550	0.253;0.164	T	0.78051	-0.2355	10	0.56958	D	0.05	.	15.1469	0.72662	0.0:0.0:0.0:1.0	.	167;167	Q9UHN6;Q9UHN6-2	TMEM2_HUMAN;.	G	167	ENSP00000366243:D167G;ENSP00000366266:D167G	ENSP00000366243:D167G	D	-	2	0	TMEM2	73550288	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.479000	0.66813	2.371000	0.80710	0.533000	0.62120	GAT		0.423	TMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052618.2	NM_013390		27	98	0	0	0	0	27	98				
C9orf41	138199	broad.mit.edu	37	9	77599914	77599914	+	Missense_Mutation	SNP	T	T	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr9:77599914T>A	ENST00000376834.3	-	7	1189	c.1037A>T	c.(1036-1038)tAc>tTc	p.Y346F	RP11-197P3.4_ENST00000455609.1_RNA|C9orf41_ENST00000376837.3_3'UTR	NM_152420.1	NP_689633.1	Q8N4J0	CI041_HUMAN	chromosome 9 open reading frame 41	346										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|urinary_tract(2)	17						TTCAAAGTGGTACAGCAGAGG	0.348																																						uc004ajq.2		NA																	0				ovary(1)|skin(1)	2						c.(1036-1038)TAC>TTC		hypothetical protein LOC138199							114.0	109.0	111.0					9																	77599914		2203	4300	6503	SO:0001583	missense	138199							g.chr9:77599914T>A	AK098661	CCDS6649.1	9q21.31	2012-03-15			ENSG00000156017	ENSG00000156017			23435	protein-coding gene	gene with protein product						12477932	Standard	NM_152420		Approved	FLJ25795	uc004ajq.3	Q8N4J0	OTTHUMG00000020032	ENST00000376834.3:c.1037A>T	9.37:g.77599914T>A	ENSP00000366030:p.Tyr346Phe		Somatic				uc004ajp.2_Intron|C9orf41_uc011lsi.1_RNA	p.Y346F	NM_152420	NP_689633	WXS	Illumina HiSeq	Unspecified	Q8N4J0	CI041_HUMAN			7	1190	-			346					Q7Z383|Q8N7C5	Missense_Mutation	SNP	ENST00000376834.3	37	c.1037A>T	CCDS6649.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.350418	0.82132	.	.	ENSG00000156017	ENST00000376834	T	0.04015	3.73	6.17	5.03	0.67393	N2227-like (1);	0.117044	0.64402	D	0.000012	T	0.11410	0.0278	M	0.70903	2.155	0.80722	D	1	P	0.46064	0.872	P	0.47162	0.54	T	0.00353	-1.1795	10	0.72032	D	0.01	-11.423	12.4208	0.55520	0.0:0.0669:0.0:0.9331	.	346	Q8N4J0	CI041_HUMAN	F	346	ENSP00000366030:Y346F	ENSP00000366030:Y346F	Y	-	2	0	C9orf41	76789734	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	6.825000	0.75293	2.371000	0.80710	0.533000	0.62120	TAC		0.348	C9orf41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052703.1	NM_152420		26	69	0	0	0	0	26	69				
SPATA31D1	389763	broad.mit.edu	37	9	84608996	84608996	+	Missense_Mutation	SNP	T	T	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr9:84608996T>C	ENST00000344803.2	+	4	3658	c.3611T>C	c.(3610-3612)aTg>aCg	p.M1204T		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	1204					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											AAAAATCAGATGTTGAGCCAG	0.393																																						uc004amn.2		NA																	0					0						c.(3610-3612)ATG>ACG		hypothetical protein LOC389763							89.0	86.0	87.0					9																	84608996		1869	4102	5971	SO:0001583	missense	389763					integral to membrane		g.chr9:84608996T>C		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.3611T>C	9.37:g.84608996T>C	ENSP00000341988:p.Met1204Thr		Somatic					p.M1204T	NM_001001670	NP_001001670	WXS	Illumina HiSeq	Unspecified	Q6ZQQ2	F75D1_HUMAN			4	3658	+			1204						Missense_Mutation	SNP	ENST00000344803.2	37	c.3611T>C	CCDS47986.1	.	.	.	.	.	.	.	.	.	.	T	5.335	0.247188	0.10130	.	.	ENSG00000214929	ENST00000344803	T	0.05025	3.51	3.15	1.94	0.25998	.	.	.	.	.	T	0.03095	0.0091	N	0.08118	0	0.09310	N	1	B	0.16166	0.016	B	0.13407	0.009	T	0.46484	-0.9188	9	0.25751	T	0.34	-0.1669	5.492	0.16781	0.2473:0.0:0.0:0.7527	.	1204	Q6ZQQ2	F75D1_HUMAN	T	1204	ENSP00000341988:M1204T	ENSP00000341988:M1204T	M	+	2	0	FAM75D1	83798816	0.001000	0.12720	0.000000	0.03702	0.024000	0.10985	0.942000	0.29017	0.563000	0.29222	0.491000	0.48974	ATG		0.393	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670		25	98	0	0	0	0	25	98				
SPATA31D1	389763	broad.mit.edu	37	9	84610013	84610013	+	Missense_Mutation	SNP	C	C	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr9:84610013C>G	ENST00000344803.2	+	4	4675	c.4628C>G	c.(4627-4629)cCa>cGa	p.P1543R		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	1543					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CCAGCCGTCCCAACCAGTGCT	0.527																																						uc004amn.2		NA																	0					0						c.(4627-4629)CCA>CGA		hypothetical protein LOC389763							21.0	23.0	22.0					9																	84610013		2101	4234	6335	SO:0001583	missense	389763					integral to membrane		g.chr9:84610013C>G		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.4628C>G	9.37:g.84610013C>G	ENSP00000341988:p.Pro1543Arg		Somatic					p.P1543R	NM_001001670	NP_001001670	WXS	Illumina HiSeq	Unspecified	Q6ZQQ2	F75D1_HUMAN			4	4675	+			1543						Missense_Mutation	SNP	ENST00000344803.2	37	c.4628C>G	CCDS47986.1	.	.	.	.	.	.	.	.	.	.	C	4.650	0.120907	0.08881	.	.	ENSG00000214929	ENST00000344803	T	0.08282	3.11	1.97	-3.95	0.04118	.	.	.	.	.	T	0.06872	0.0175	N	0.08118	0	0.09310	N	1	P	0.34977	0.478	P	0.47705	0.555	T	0.46775	-0.9167	9	0.54805	T	0.06	-0.5881	7.4109	0.27017	0.0:0.3308:0.0:0.6692	.	1543	Q6ZQQ2	F75D1_HUMAN	R	1543	ENSP00000341988:P1543R	ENSP00000341988:P1543R	P	+	2	0	FAM75D1	83799833	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.235000	0.02928	-1.208000	0.02634	-0.755000	0.03482	CCA		0.527	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670		5	26	0	0	0	0	5	26				
OR13C5	138799	broad.mit.edu	37	9	107360955	107360955	+	Missense_Mutation	SNP	A	A	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr9:107360955A>C	ENST00000374779.2	-	1	833	c.740T>G	c.(739-741)gTg>gGg	p.V247G		NM_001004482.1	NP_001004482.1	Q8NGS8	O13C5_HUMAN	olfactory receptor, family 13, subfamily C, member 5	247						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|pancreas(2)|prostate(2)|skin(4)	28						TGTTATCACCACAGTCAGACG	0.423																																						uc011lvp.1		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(739-741)GTG>GGG		olfactory receptor, family 13, subfamily C,							146.0	128.0	134.0					9																	107360955		2203	4300	6503	SO:0001583	missense	138799				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:107360955A>C		CCDS35091.1	9q31.1	2012-10-03			ENSG00000255800	ENSG00000277556		"""GPCR / Class A : Olfactory receptors"""	15100	protein-coding gene	gene with protein product							Standard	NM_001004482		Approved		uc011lvp.2	Q8NGS8	OTTHUMG00000020408	ENST00000374779.2:c.740T>G	9.37:g.107360955A>C	ENSP00000363911:p.Val247Gly		Somatic					p.V247G	NM_001004482	NP_001004482	WXS	Illumina HiSeq	Unspecified	Q8NGS8	O13C5_HUMAN			1	740	-			247			Helical; Name=6; (Potential).		B2RNE5|B9EGW5|Q6IF53	Missense_Mutation	SNP	ENST00000374779.2	37	c.740T>G	CCDS35091.1	.	.	.	.	.	.	.	.	.	.	A	16.11	3.029204	0.54790	.	.	ENSG00000255800	ENST00000374779	T	0.00281	8.32	4.03	4.03	0.46877	GPCR, rhodopsin-like superfamily (1);	0.000000	0.32687	U	0.005774	T	0.00845	0.0028	M	0.93106	3.38	0.50632	D	0.99988	D	0.89917	1.0	D	0.87578	0.998	T	0.58323	-0.7656	10	0.87932	D	0	.	10.9944	0.47567	1.0:0.0:0.0:0.0	.	247	Q8NGS8	O13C5_HUMAN	G	247	ENSP00000363911:V247G	ENSP00000363911:V247G	V	-	2	0	OR13C5	106400776	0.051000	0.20477	0.976000	0.42696	0.326000	0.28443	3.218000	0.51192	1.704000	0.51252	0.347000	0.21830	GTG		0.423	OR13C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053479.2	NM_001004482		23	77	0	0	0	0	23	77				
SVEP1	79987	broad.mit.edu	37	9	113261433	113261433	+	Silent	SNP	C	C	T	rs3737156	byFrequency	TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr9:113261433C>T	ENST00000401783.2	-	7	1905	c.1569G>A	c.(1567-1569)acG>acA	p.T523T	SVEP1_ENST00000374469.1_Silent_p.T500T|SVEP1_ENST00000374461.1_Silent_p.T500T|SVEP1_ENST00000302728.8_Silent_p.T523T|SVEP1_ENST00000467821.1_5'UTR	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	523	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						CATAGCAGATCGTCCCAAATT	0.488													C|||	5	0.000998403	0.0	0.0	5008	,	,		18108	0.005		0.0	False		,,,				2504	0.0					uc010mtz.2		NA																	0				ovary(7)	7						c.(1567-1569)ACG>ACA		polydom							62.0	60.0	61.0					9																	113261433		2001	4180	6181	SO:0001819	synonymous_variant	79987				cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding	g.chr9:113261433C>T	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.1569G>A	9.37:g.113261433C>T			Somatic				SVEP1_uc010mua.1_Silent_p.T523T|SVEP1_uc004beu.2_Silent_p.T523T	p.T523T	NM_153366	NP_699197	WXS	Illumina HiSeq	Unspecified	Q4LDE5	SVEP1_HUMAN			7	1906	-			523			Sushi 3.		Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Silent	SNP	ENST00000401783.2	37	c.1569G>A	CCDS48004.1																																																																																				0.488	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				18	44	0	0	0	0	18	44				
PAPPA	5069	broad.mit.edu	37	9	118950444	118950444	+	Missense_Mutation	SNP	C	C	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr9:118950444C>G	ENST00000328252.3	+	2	1796	c.1427C>G	c.(1426-1428)cCt>cGt	p.P476R	PAPPA_ENST00000534838.1_5'Flank	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	476	Metalloprotease.				cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						TGCTGTGACCCTGAAATCACC	0.507																																						uc004bjn.2		NA																	0				ovary(4)|skin(4)|pancreas(1)	9						c.(1426-1428)CCT>CGT		pregnancy-associated plasma protein A							104.0	76.0	86.0					9																	118950444		2203	4300	6503	SO:0001583	missense	5069				cell differentiation|female pregnancy	cytoplasm|extracellular region|membrane	metalloendopeptidase activity|zinc ion binding	g.chr9:118950444C>G		CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.1427C>G	9.37:g.118950444C>G	ENSP00000330658:p.Pro476Arg		Somatic				PAPPA_uc011lxp.1_Missense_Mutation_p.P269R|PAPPA_uc011lxq.1_Missense_Mutation_p.P269R	p.P476R	NM_002581	NP_002572	WXS	Illumina HiSeq	Unspecified	Q13219	PAPP1_HUMAN			2	1808	+			476			Metalloprotease.		B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	ENST00000328252.3	37	c.1427C>G	CCDS6813.1	.	.	.	.	.	.	.	.	.	.	C	18.87	3.715107	0.68844	.	.	ENSG00000182752	ENST00000328252;ENST00000443904	T	0.02158	4.42	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.14614	0.0353	M	0.76574	2.34	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.974	T	0.00004	-1.2548	10	0.87932	D	0	-15.3978	20.6593	0.99626	0.0:1.0:0.0:0.0	.	18;476	E7EMD3;Q13219	.;PAPP1_HUMAN	R	476;18	ENSP00000330658:P476R	ENSP00000330658:P476R	P	+	2	0	PAPPA	117990265	1.000000	0.71417	0.972000	0.41901	0.669000	0.39330	7.786000	0.85741	2.885000	0.99019	0.655000	0.94253	CCT		0.507	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581		13	44	0	0	0	0	13	44				
C5	727	broad.mit.edu	37	9	123776180	123776180	+	Missense_Mutation	SNP	G	G	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr9:123776180G>C	ENST00000223642.1	-	17	2257	c.2228C>G	c.(2227-2229)tCt>tGt	p.S743C		NM_001735.2	NP_001726.2	P01031	CO5_HUMAN	complement component 5	743					activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of macrophage chemotaxis (GO:0010760)|negative regulation of norepinephrine secretion (GO:0010700)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of chemotaxis (GO:0050921)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	chemokine activity (GO:0008009)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(14)|lung(5)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)|Intravenous Immunoglobulin(DB00028)	GTCTTTATGAGAGATATTAGC	0.423																																						uc004bkv.2		NA																	0				ovary(2)	2						c.(2227-2229)TCT>TGT		complement component 5 preproprotein	Eculizumab(DB01257)						143.0	126.0	132.0					9																	123776180		2203	4300	6503	SO:0001583	missense	727				activation of MAPK activity|chemotaxis|complement activation, alternative pathway|complement activation, classical pathway|cytolysis|G-protein coupled receptor protein signaling pathway|inflammatory response|negative regulation of macrophage chemotaxis|positive regulation of chemokine secretion|positive regulation vascular endothelial growth factor production	extracellular space|membrane attack complex	chemokine activity|endopeptidase inhibitor activity	g.chr9:123776180G>C	M57729	CCDS6826.1	9q33-q34	2014-09-17			ENSG00000106804	ENSG00000106804		"""Complement system"", ""Endogenous ligands"""	1331	protein-coding gene	gene with protein product	"""prepro-C5"", ""C5a anaphylatoxin"""	120900					Standard	NM_001735		Approved	CPAMD4, C5a, C5b	uc004bkv.3	P01031	OTTHUMG00000020579	ENST00000223642.1:c.2228C>G	9.37:g.123776180G>C	ENSP00000223642:p.Ser743Cys		Somatic				C5_uc010mvm.1_Missense_Mutation_p.S743C	p.S743C	NM_001735	NP_001726	WXS	Illumina HiSeq	Unspecified	P01031	CO5_HUMAN		OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	17	2258	-			743					Q14CJ0|Q27I61	Missense_Mutation	SNP	ENST00000223642.1	37	c.2228C>G	CCDS6826.1	.	.	.	.	.	.	.	.	.	.	G	14.78	2.639042	0.47153	.	.	ENSG00000106804	ENST00000223642;ENST00000430906	T	0.31510	1.49	6.16	0.891	0.19224	Anaphylatoxin (2);	1.502520	0.03193	N	0.173656	T	0.30324	0.0761	L	0.60455	1.87	0.09310	N	1	D	0.55800	0.973	B	0.40101	0.319	T	0.34551	-0.9824	10	0.56958	D	0.05	.	6.0054	0.19542	0.0649:0.1082:0.4937:0.3331	.	743	P01031	CO5_HUMAN	C	743;814	ENSP00000223642:S743C	ENSP00000223642:S743C	S	-	2	0	C5	122816001	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.196000	0.17176	0.465000	0.27167	0.650000	0.86243	TCT		0.423	C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053844.1	NM_001735		42	125	0	0	0	0	42	125				
MRRF	92399	broad.mit.edu	37	9	125084837	125084837	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr9:125084837G>A	ENST00000344641.3	+	7	1041	c.730G>A	c.(730-732)Gac>Aac	p.D244N	RP11-498E2.7_ENST00000602625.1_lincRNA|MRRF_ENST00000394315.3_Missense_Mutation_p.M190I|MRRF_ENST00000297908.3_Missense_Mutation_p.D192N|MRRF_ENST00000373729.1_Missense_Mutation_p.D200N|MRRF_ENST00000373723.5_Missense_Mutation_p.M190I	NM_138777.3	NP_620132.1	Q96E11	RRFM_HUMAN	mitochondrial ribosome recycling factor	244					ribosome disassembly (GO:0032790)|translation (GO:0006412)	mitochondrion (GO:0005739)				breast(3)|endometrium(1)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	12						AATGGCCGATGACACAGTGGC	0.493																																						uc004bmb.2		NA																	0				ovary(2)|skin(1)	3						c.(730-732)GAC>AAC		mitochondrial ribosome recycling factor isoform							68.0	59.0	62.0					9																	125084837		2203	4300	6503	SO:0001583	missense	92399				ribosome disassembly|translation	mitochondrion	sequence-specific DNA binding transcription factor activity	g.chr9:125084837G>A	AA115320	CCDS6840.1, CCDS48013.1, CCDS55336.1	9q32-q34.1	2008-02-05			ENSG00000148187	ENSG00000148187			7234	protein-coding gene	gene with protein product		604602				9838146, 10773675	Standard	NM_001173512		Approved	RRF	uc010mwa.3	Q96E11	OTTHUMG00000020600	ENST00000344641.3:c.730G>A	9.37:g.125084837G>A	ENSP00000343867:p.Asp244Asn		Somatic				MRRF_uc004bmc.2_Missense_Mutation_p.M190I|MRRF_uc010mwa.2_Missense_Mutation_p.D244N|MRRF_uc011lyr.1_Missense_Mutation_p.D192N|MRRF_uc004bmd.2_Missense_Mutation_p.D244N|MRRF_uc004bme.2_RNA	p.D244N	NM_138777	NP_620132	WXS	Illumina HiSeq	Unspecified	Q96E11	RRFM_HUMAN			7	845	+			244					A8K6D8|A8K6Z4|B7Z4X5|B7Z6P7|Q5RKT1|Q5T7T0|Q5T7T1|Q5T7T2|Q5T7T3|Q5T7T4|Q5T7T5	Missense_Mutation	SNP	ENST00000344641.3	37	c.730G>A	CCDS6840.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.38|12.38	1.920975|1.920975	0.33908|0.33908	.|.	.|.	ENSG00000148187|ENSG00000148187	ENST00000297908;ENST00000344641;ENST00000373729|ENST00000373723;ENST00000394315	T;T;T|T;T	0.43294|0.76839	0.95;0.95;0.95|-1.05;-1.05	5.63|5.63	5.63|5.63	0.86233|0.86233	Ribosome recycling factor domain (2);|.	0.236705|.	0.49305|.	D|.	0.000147|.	T|T	0.73458|0.73458	0.3589|0.3589	.|.	.|.	.|.	0.36606|0.36606	D|D	0.874948|0.874948	B;B|B	0.26577|0.23249	0.069;0.153|0.082	B;B|B	0.25987|0.25140	0.062;0.065|0.058	T|T	0.75777|0.75777	-0.3198|-0.3198	9|8	0.40728|0.87932	T|D	0.16|0	-15.2012|-15.2012	13.975|13.975	0.64268|0.64268	0.0748:0.0:0.9252:0.0|0.0748:0.0:0.9252:0.0	.|.	192;244|190	Q96E11-8;Q96E11|Q96E11-2	.;RRFM_HUMAN|.	N|I	192;244;200|190	ENSP00000297908:D192N;ENSP00000343867:D244N;ENSP00000362834:D200N|ENSP00000362828:M190I;ENSP00000377850:M190I	ENSP00000297908:D192N|ENSP00000362828:M190I	D|M	+|+	1|3	0|0	MRRF|MRRF	124124658|124124658	0.998000|0.998000	0.40836|0.40836	0.876000|0.876000	0.34364|0.34364	0.999000|0.999000	0.98932|0.98932	3.290000|3.290000	0.51755|0.51755	2.653000|2.653000	0.90120|0.90120	0.650000|0.650000	0.86243|0.86243	GAC|ATG		0.493	MRRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053914.1	NM_138777		7	33	0	0	0	0	7	33				
GOLGA1	2800	broad.mit.edu	37	9	127670691	127670691	+	Missense_Mutation	SNP	T	T	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr9:127670691T>C	ENST00000373555.4	-	12	1363	c.1030A>G	c.(1030-1032)Agc>Ggc	p.S344G		NM_002077.3	NP_002068	Q92805	GOGA1_HUMAN	golgin A1	344					protein targeting to Golgi (GO:0000042)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)				NS(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	20						TTAGCCTGGCTGCTTCTGGCT	0.473																																						uc004bpc.2		NA																	0				ovary(1)	1						c.(1030-1032)AGC>GGC		golgin 97							140.0	123.0	128.0					9																	127670691		2203	4300	6503	SO:0001583	missense	2800					Golgi cisterna membrane		g.chr9:127670691T>C	U51587	CCDS6860.1	9q34.11	2010-02-12	2010-02-12		ENSG00000136935	ENSG00000136935			4424	protein-coding gene	gene with protein product		602502	"""golgi autoantigen, golgin subfamily a, 1"""			9324025	Standard	NM_002077		Approved	golgin-97, MGC33154	uc004bpc.3	Q92805	OTTHUMG00000020665	ENST00000373555.4:c.1030A>G	9.37:g.127670691T>C	ENSP00000362656:p.Ser344Gly		Somatic				GOLGA1_uc010mws.2_RNA	p.S344G	NM_002077	NP_002068	WXS	Illumina HiSeq	Unspecified	Q92805	GOGA1_HUMAN			12	1372	-			344			Potential.		Q5T164|Q8IYZ9	Missense_Mutation	SNP	ENST00000373555.4	37	c.1030A>G	CCDS6860.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.02|13.02	2.112271|2.112271	0.37242|0.37242	.|.	.|.	ENSG00000136935|ENSG00000136935	ENST00000373551|ENST00000373555	.|T	.|0.79749	.|-1.3	5.78|5.78	5.78|5.78	0.91487|0.91487	.|.	.|0.000000	.|0.56097	.|D	.|0.000033	T|T	0.79131|0.79131	0.4394|0.4394	M|M	0.71581|0.71581	2.175|2.175	0.34586|0.34586	D|D	0.715026|0.715026	.|P	.|0.46912	.|0.886	.|B	.|0.42738	.|0.396	D|D	0.84859|0.84859	0.0818|0.0818	5|10	.|0.38643	.|T	.|0.18	-0.814|-0.814	10.2135|10.2135	0.43156|0.43156	0.0:0.0:0.1664:0.8336|0.0:0.0:0.1664:0.8336	.|.	.|344	.|Q92805	.|GOGA1_HUMAN	R|G	27|344	.|ENSP00000362656:S344G	.|ENSP00000362656:S344G	Q|S	-|-	2|1	0|0	GOLGA1|GOLGA1	126710512|126710512	0.960000|0.960000	0.32886|0.32886	1.000000|1.000000	0.80357|0.80357	0.446000|0.446000	0.32137|0.32137	1.645000|1.645000	0.37238|0.37238	2.208000|2.208000	0.71279|0.71279	0.528000|0.528000	0.53228|0.53228	CAG|AGC		0.473	GOLGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054049.1	NM_002077		33	130	0	0	0	0	33	130				
AK8	158067	broad.mit.edu	37	9	135602855	135602855	+	Silent	SNP	T	T	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr9:135602855T>A	ENST00000298545.3	-	12	1709	c.1188A>T	c.(1186-1188)ccA>ccT	p.P396P	AK8_ENST00000477396.1_5'UTR	NM_152572.2	NP_689785.1	Q96MA6	KAD8_HUMAN	adenylate kinase 8	396	Adenylate kinase 2.|LID 2. {ECO:0000250}.				nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)			NS(1)|kidney(2)|large_intestine(4)|lung(11)|pancreas(2)|prostate(1)|urinary_tract(2)	23						CCCCAGTGACTGGATCAATTC	0.473																																						uc004cbu.1		NA																	0					0						c.(1186-1188)CCA>CCT		putative adenylate kinase-like protein C9orf98							104.0	99.0	101.0					9																	135602855		2203	4300	6503	SO:0001819	synonymous_variant	158067					cytosol	adenylate kinase activity|ATP binding|cytidylate kinase activity	g.chr9:135602855T>A	AK093446	CCDS6954.1	9q34.13	2013-04-29	2010-12-07	2010-12-07	ENSG00000165695	ENSG00000165695	2.7.4.3	"""Adenylate kinases"""	26526	protein-coding gene	gene with protein product		615365	"""chromosome 9 open reading frame 98"""	C9orf98		21080915	Standard	NM_152572		Approved	FLJ32704	uc004cbu.1	Q96MA6	OTTHUMG00000021009	ENST00000298545.3:c.1188A>T	9.37:g.135602855T>A			Somatic				C9orf98_uc010mzx.1_RNA|C9orf98_uc004cbv.1_Silent_p.P192P	p.P396P	NM_152572	NP_689785	WXS	Illumina HiSeq	Unspecified	Q96MA6	KAD8_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;4.89e-06)|Epithelial(140;0.00016)	12	1744	-			396			Adenylate kinase.		A8K821|Q8N9W9	Silent	SNP	ENST00000298545.3	37	c.1188A>T	CCDS6954.1																																																																																				0.473	AK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055413.1	NM_152572		34	113	0	0	0	0	34	113				
SARDH	1757	broad.mit.edu	37	9	136597649	136597649	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr9:136597649C>T	ENST00000371872.4	-	3	663	c.406G>A	c.(406-408)Gag>Aag	p.E136K	SARDH_ENST00000298628.5_Missense_Mutation_p.E136K|SARDH_ENST00000371867.1_Missense_Mutation_p.E47K|SARDH_ENST00000439388.1_Missense_Mutation_p.E136K|SARDH_ENST00000422262.2_5'UTR	NM_007101.3	NP_009032.2	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase	136					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|sarcosine dehydrogenase activity (GO:0008480)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(13)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	44				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		TCCTCCAGCTCCCGGCTCACC	0.672																																						uc004cep.3		NA																	0					0						c.(406-408)GAG>AAG		sarcosine dehydrogenase precursor							112.0	109.0	110.0					9																	136597649		2203	4300	6503	SO:0001583	missense	1757				glycine catabolic process	mitochondrial matrix	aminomethyltransferase activity|sarcosine dehydrogenase activity	g.chr9:136597649C>T		CCDS6978.1	9q33-q34	2008-02-05			ENSG00000123453	ENSG00000123453	1.5.99.2		10536	protein-coding gene	gene with protein product		604455		DMGDHL1		10444331	Standard	NM_007101		Approved	SDH	uc004cep.4	Q9UL12	OTTHUMG00000020879	ENST00000371872.4:c.406G>A	9.37:g.136597649C>T	ENSP00000360938:p.Glu136Lys		Somatic				SARDH_uc004ceo.2_Missense_Mutation_p.E136K|SARDH_uc011mdn.1_Missense_Mutation_p.E136K|SARDH_uc011mdo.1_5'UTR	p.E136K	NM_001134707	NP_001128179	WXS	Illumina HiSeq	Unspecified	Q9UL12	SARDH_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)	3	540	-			136					B2RMR5|B4DPI2|B7ZLT6|Q5SYV0|Q9Y280|Q9Y2Y3	Missense_Mutation	SNP	ENST00000371872.4	37	c.406G>A	CCDS6978.1	.	.	.	.	.	.	.	.	.	.	C	13.41	2.229941	0.39399	.	.	ENSG00000123453	ENST00000371872;ENST00000439388;ENST00000427237;ENST00000539227;ENST00000535281;ENST00000371867;ENST00000393050;ENST00000298628	D;D;D;D	0.82526	-1.62;-1.62;-1.62;-1.62	4.32	3.37	0.38596	FAD dependent oxidoreductase (1);	0.309004	0.34088	N	0.004266	T	0.75421	0.3847	L	0.39020	1.185	0.47308	D	0.999383	B	0.17465	0.022	B	0.29440	0.102	T	0.64960	-0.6284	10	0.12430	T	0.62	-13.5956	13.6819	0.62491	0.0:0.8435:0.1565:0.0	.	136	Q9UL12	SARDH_HUMAN	K	136;136;136;136;136;47;114;136	ENSP00000360938:E136K;ENSP00000403084:E136K;ENSP00000360933:E47K;ENSP00000298628:E136K	ENSP00000298628:E136K	E	-	1	0	SARDH	135587470	1.000000	0.71417	0.516000	0.27786	0.901000	0.52897	4.501000	0.60393	0.738000	0.32606	0.462000	0.41574	GAG		0.672	SARDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054931.1			29	139	0	0	0	0	29	139				
SARDH	1757	broad.mit.edu	37	9	136599210	136599210	+	Missense_Mutation	SNP	G	G	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr9:136599210G>C	ENST00000371872.4	-	2	343	c.86C>G	c.(85-87)tCc>tGc	p.S29C	SARDH_ENST00000298628.5_Missense_Mutation_p.S29C|SARDH_ENST00000371867.1_5'Flank|SARDH_ENST00000439388.1_Missense_Mutation_p.S29C|SARDH_ENST00000422262.2_Intron	NM_007101.3	NP_009032.2	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase	29					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|sarcosine dehydrogenase activity (GO:0008480)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(13)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	44				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		AGCTGCGCTGGACAGGTTGCA	0.697																																						uc004cep.3		NA																	0					0						c.(85-87)TCC>TGC		sarcosine dehydrogenase precursor							18.0	18.0	18.0					9																	136599210		2203	4296	6499	SO:0001583	missense	1757				glycine catabolic process	mitochondrial matrix	aminomethyltransferase activity|sarcosine dehydrogenase activity	g.chr9:136599210G>C		CCDS6978.1	9q33-q34	2008-02-05			ENSG00000123453	ENSG00000123453	1.5.99.2		10536	protein-coding gene	gene with protein product		604455		DMGDHL1		10444331	Standard	NM_007101		Approved	SDH	uc004cep.4	Q9UL12	OTTHUMG00000020879	ENST00000371872.4:c.86C>G	9.37:g.136599210G>C	ENSP00000360938:p.Ser29Cys		Somatic				SARDH_uc004ceo.2_Missense_Mutation_p.S29C|SARDH_uc011mdn.1_Missense_Mutation_p.S29C|SARDH_uc011mdo.1_Intron	p.S29C	NM_001134707	NP_001128179	WXS	Illumina HiSeq	Unspecified	Q9UL12	SARDH_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)	2	220	-			29					B2RMR5|B4DPI2|B7ZLT6|Q5SYV0|Q9Y280|Q9Y2Y3	Missense_Mutation	SNP	ENST00000371872.4	37	c.86C>G	CCDS6978.1	.	.	.	.	.	.	.	.	.	.	G	12.66	2.004583	0.35320	.	.	ENSG00000123453	ENST00000371872;ENST00000439388;ENST00000427237;ENST00000539227;ENST00000535281;ENST00000393050;ENST00000298628	T;T;T	0.74002	-0.8;-0.8;1.58	4.77	0.498	0.16908	.	0.872825	0.09922	N	0.738277	T	0.60625	0.2283	N	0.14661	0.345	0.09310	N	1	P	0.37955	0.612	B	0.40101	0.319	T	0.52465	-0.8572	10	0.52906	T	0.07	-8.8933	11.5256	0.50578	0.0916:0.6692:0.2392:0.0	.	29	Q9UL12	SARDH_HUMAN	C	29;29;29;29;29;7;29	ENSP00000360938:S29C;ENSP00000403084:S29C;ENSP00000298628:S29C	ENSP00000298628:S29C	S	-	2	0	SARDH	135589031	0.186000	0.23225	0.001000	0.08648	0.021000	0.10359	0.417000	0.21214	0.095000	0.17434	0.591000	0.81541	TCC		0.697	SARDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054931.1			8	35	0	0	0	0	8	35				
COL5A1	1289	broad.mit.edu	37	9	137653806	137653806	+	Silent	SNP	G	G	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr9:137653806G>C	ENST00000371817.3	+	19	2385	c.1971G>C	c.(1969-1971)ccG>ccC	p.P657P		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	657	Triple-helical region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		CAGGACCTCCGGGAGACGATG	0.597																																						uc004cfe.2		NA																	0				skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11						c.(1969-1971)CCG>CCC		alpha 1 type V collagen preproprotein							106.0	98.0	101.0					9																	137653806		2202	4300	6502	SO:0001819	synonymous_variant	1289				axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding	g.chr9:137653806G>C	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.1971G>C	9.37:g.137653806G>C			Somatic					p.P657P	NM_000093	NP_000084	WXS	Illumina HiSeq	Unspecified	P20908	CO5A1_HUMAN		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)	19	2353	+		Myeloproliferative disorder(178;0.0341)	657			Triple-helical region.		Q15094|Q5SUX4	Silent	SNP	ENST00000371817.3	37	c.1971G>C	CCDS6982.1																																																																																				0.597	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093		23	81	0	0	0	0	23	81				
CLIC3	9022	broad.mit.edu	37	9	139889998	139889998	+	Silent	SNP	G	G	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr9:139889998G>A	ENST00000494426.1	-	3	424	c.165C>T	c.(163-165)gaC>gaT	p.D55D	CLIC3_ENST00000480181.1_5'UTR	NM_004669.2	NP_004660.2	O95833	CLIC3_HUMAN	chloride intracellular channel 3	55	GST N-terminal.|Required for insertion into the membrane. {ECO:0000250}.				chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|signal transduction (GO:0007165)	chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			lung(1)|skin(1)	2	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		CGGGGGCGAAGTCCTTCAGCA	0.697																																						uc004ckj.1		NA																	0					0						c.(163-165)GAC>GAT		chloride intracellular channel 3							38.0	44.0	42.0					9																	139889998		2202	4298	6500	SO:0001819	synonymous_variant	9022				signal transduction	chloride channel complex|cytoplasm|nucleus	protein binding|voltage-gated chloride channel activity	g.chr9:139889998G>A	AF102166	CCDS7021.1	9q34.3	2012-09-26			ENSG00000169583	ENSG00000169583		"""Ion channels / Chloride channels : Intracellular"""	2064	protein-coding gene	gene with protein product		606533				9880541	Standard	NM_004669		Approved		uc004ckj.1	O95833	OTTHUMG00000020954	ENST00000494426.1:c.165C>T	9.37:g.139889998G>A			Somatic					p.D55D	NM_004669	NP_004660	WXS	Illumina HiSeq	Unspecified	O95833	CLIC3_HUMAN	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)	3	194	-	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	55			GST N-terminal.|Required for insertion into the membrane (By similarity).		Q5SPZ7	Silent	SNP	ENST00000494426.1	37	c.165C>T	CCDS7021.1																																																																																				0.697	CLIC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055173.2	NM_004669		13	64	0	0	0	0	13	64				
PIGA	5277	broad.mit.edu	37	X	15349561	15349561	+	Silent	SNP	C	C	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chrX:15349561C>G	ENST00000333590.4	-	2	576	c.492G>C	c.(490-492)tcG>tcC	p.S164S	PIGA_ENST00000482148.1_Intron|PIGA_ENST00000542278.1_Intron|PIGA_ENST00000428964.1_Intron	NM_002641.3	NP_002632.1	P37287	PIGA_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class A	164					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|positive regulation of metabolic process (GO:0009893)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	phosphatidylinositol N-acetylglucosaminyltransferase activity (GO:0017176)|UDP-glycosyltransferase activity (GO:0008194)			endometrium(2)|kidney(2)|large_intestine(2)|ovary(1)|prostate(2)|urinary_tract(1)	10	Hepatocellular(33;0.183)					TTGTAAGCACCGAGCTGACAT	0.443																																						uc004cwr.2		NA																	0					0						c.(490-492)TCG>TCC		phosphatidylinositol							103.0	80.0	88.0					X																	15349561		2203	4300	6503	SO:0001819	synonymous_variant	5277				C-terminal protein lipidation|positive regulation of metabolic process|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex|integral to membrane	phosphatidylinositol N-acetylglucosaminyltransferase activity|protein binding	g.chrX:15349561C>G	BC038236	CCDS14165.1, CCDS48086.1, CCDS48086.2	Xp22.1	2014-09-17	2008-07-31		ENSG00000165195	ENSG00000165195	2.4.1.198	"""Glycosyltransferase group 1 domain containing"", ""Phosphatidylinositol glycan anchor biosynthesis"""	8957	protein-coding gene	gene with protein product	"""paroxysmal nocturnal hemoglobinuria"", ""phosphatidylinositol N-acetylglucosaminyltransferase"""	311770	"""phosphatidylinositol glycan, class A (paroxysmal nocturnal hemoglobinuria)"""			8500164	Standard	NM_002641		Approved	GPI3	uc004cwr.3	P37287	OTTHUMG00000021174	ENST00000333590.4:c.492G>C	X.37:g.15349561C>G			Somatic				PIGA_uc004cwq.2_Intron|PIGA_uc010nev.2_Intron|PIGA_uc004cws.2_Intron|PIGA_uc011miq.1_Intron|PIGA_uc010new.1_Intron	p.S164S	NM_002641	NP_002632	WXS	Illumina HiSeq	Unspecified	P37287	PIGA_HUMAN			2	592	-	Hepatocellular(33;0.183)		164			Cytoplasmic (Potential).		B4E0V2|Q16025|Q16250	Silent	SNP	ENST00000333590.4	37	c.492G>C	CCDS14165.1																																																																																				0.443	PIGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055854.1	NM_002641		24	24	0	0	0	0	24	24				
IL1RAPL1	11141	broad.mit.edu	37	X	29414435	29414435	+	Silent	SNP	A	A	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chrX:29414435A>T	ENST00000378993.1	+	4	1096	c.423A>T	c.(421-423)ggA>ggT	p.G141G	IL1RAPL1_ENST00000302196.4_Silent_p.G141G	NM_014271.3	NP_055086.1	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	141					calcium ion transmembrane transport (GO:0070588)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of exocytosis (GO:0045920)|neuron differentiation (GO:0030182)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor binding (GO:0005102)|voltage-gated calcium channel activity (GO:0005245)			biliary_tract(1)|breast(1)|endometrium(5)|large_intestine(9)|lung(38)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62						ATGACACTGGACTCTGCTATA	0.388																																						uc004dby.2		NA																	0				ovary(3)|lung(1)|pancreas(1)	5						c.(421-423)GGA>GGT		interleukin 1 receptor accessory protein-like 1							89.0	80.0	83.0					X																	29414435		2202	4300	6502	SO:0001819	synonymous_variant	11141				innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity	g.chrX:29414435A>T	AJ243874	CCDS14218.1	Xp22.1-p21.3	2013-01-29	2004-02-13		ENSG00000169306	ENSG00000169306		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5996	protein-coding gene	gene with protein product		300206	"""mental retardation, X-linked 34"", ""mental retardation, X-linked 21"", ""mental retardation, X-linked 10"""	IL1RAPL, MRX34, MRX21, MRX10		10471494, 10757639	Standard	NM_014271		Approved	OPHN4, TIGIRR-2, IL1R8	uc004dby.2	Q9NZN1	OTTHUMG00000021317	ENST00000378993.1:c.423A>T	X.37:g.29414435A>T			Somatic					p.G141G	NM_014271	NP_055086	WXS	Illumina HiSeq	Unspecified	Q9NZN1	IRPL1_HUMAN			4	931	+			141			Extracellular (Potential).		A0AVG4|Q9UJ53	Silent	SNP	ENST00000378993.1	37	c.423A>T	CCDS14218.1																																																																																				0.388	IL1RAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056155.1	NM_014271		35	26	0	0	0	0	35	26				
MAGEB3	4114	broad.mit.edu	37	X	30254123	30254123	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chrX:30254123G>T	ENST00000361644.2	+	5	819	c.82G>T	c.(82-84)Gct>Tct	p.A28S		NM_002365.4	NP_002356.2	O15480	MAGB3_HUMAN	melanoma antigen family B, 3	28										NS(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|prostate(2)|skin(2)	25						TCACCAGGGTGCTCAGATCAC	0.517																																						uc004dca.1		NA																	0					0						c.(82-84)GCT>TCT		melanoma antigen family B, 3							69.0	57.0	61.0					X																	30254123		2202	4300	6502	SO:0001583	missense	4114							g.chrX:30254123G>T	AK057441	CCDS14220.1	Xp21.3	2009-03-17			ENSG00000198798	ENSG00000198798			6810	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 5"""	300152				9441743	Standard	NM_002365		Approved	CT3.5	uc004dca.2	O15480	OTTHUMG00000021320	ENST00000361644.2:c.82G>T	X.37:g.30254123G>T	ENSP00000355198:p.Ala28Ser		Somatic					p.A28S	NM_002365	NP_002356	WXS	Illumina HiSeq	Unspecified	O15480	MAGB3_HUMAN			5	819	+			28					A0AVE4|B3KQ52|O75861	Missense_Mutation	SNP	ENST00000361644.2	37	c.82G>T	CCDS14220.1	.	.	.	.	.	.	.	.	.	.	G	15.01	2.705931	0.48412	.	.	ENSG00000198798	ENST00000378986;ENST00000361644	T;T	0.06608	3.28;3.28	3.98	1.06	0.20224	Melanoma associated antigen, MAGE, N-terminal (1);	0.413845	0.18697	U	0.133683	T	0.11410	0.0278	M	0.75884	2.315	0.09310	N	1	D	0.53745	0.962	P	0.51701	0.677	T	0.15492	-1.0435	10	0.54805	T	0.06	.	1.8736	0.03214	0.1202:0.1995:0.4716:0.2086	.	28	O15480	MAGB3_HUMAN	S	28	ENSP00000368271:A28S;ENSP00000355198:A28S	ENSP00000355198:A28S	A	+	1	0	MAGEB3	30164044	0.000000	0.05858	0.002000	0.10522	0.017000	0.09413	-0.225000	0.09151	0.083000	0.17047	0.513000	0.50165	GCT		0.517	MAGEB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056158.2	NM_002365		16	23	1	0	1.15e-07	1.46e-07	16	23				
MAGEB3	4114	broad.mit.edu	37	X	30254946	30254946	+	Missense_Mutation	SNP	C	C	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chrX:30254946C>G	ENST00000361644.2	+	5	1642	c.905C>G	c.(904-906)gCg>gGg	p.A302G		NM_002365.4	NP_002356.2	O15480	MAGB3_HUMAN	melanoma antigen family B, 3	302	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									NS(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|prostate(2)|skin(2)	25						GTCCCCAGTGCGTTCCAGTTC	0.502																																						uc004dca.1		NA																	0					0						c.(904-906)GCG>GGG		melanoma antigen family B, 3							94.0	83.0	86.0					X																	30254946		2202	4300	6502	SO:0001583	missense	4114							g.chrX:30254946C>G	AK057441	CCDS14220.1	Xp21.3	2009-03-17			ENSG00000198798	ENSG00000198798			6810	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 5"""	300152				9441743	Standard	NM_002365		Approved	CT3.5	uc004dca.2	O15480	OTTHUMG00000021320	ENST00000361644.2:c.905C>G	X.37:g.30254946C>G	ENSP00000355198:p.Ala302Gly		Somatic					p.A302G	NM_002365	NP_002356	WXS	Illumina HiSeq	Unspecified	O15480	MAGB3_HUMAN			5	1642	+			302			MAGE.		A0AVE4|B3KQ52|O75861	Missense_Mutation	SNP	ENST00000361644.2	37	c.905C>G	CCDS14220.1	.	.	.	.	.	.	.	.	.	.	C	13.60	2.284335	0.40394	.	.	ENSG00000198798	ENST00000378986;ENST00000361644	T;T	0.01902	4.57;4.57	4.3	2.48	0.30137	.	0.956537	0.08458	U	0.942835	T	0.13628	0.0330	M	0.91818	3.245	0.09310	N	1	D	0.71674	0.998	D	0.69654	0.965	T	0.10474	-1.0628	10	0.62326	D	0.03	.	4.6998	0.12822	0.2114:0.6738:0.0:0.1148	.	302	O15480	MAGB3_HUMAN	G	302	ENSP00000368271:A302G;ENSP00000355198:A302G	ENSP00000355198:A302G	A	+	2	0	MAGEB3	30164867	0.048000	0.20356	0.001000	0.08648	0.000000	0.00434	1.066000	0.30604	0.518000	0.28383	-0.237000	0.12165	GCG		0.502	MAGEB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056158.2	NM_002365		22	18	0	0	0	0	22	18				
MAGEB1	4112	broad.mit.edu	37	X	30269234	30269234	+	Silent	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chrX:30269234C>A	ENST00000378981.3	+	4	945	c.624C>A	c.(622-624)atC>atA	p.I208I	MAGEB1_ENST00000397548.2_Silent_p.I208I|MAGEB1_ENST00000397550.1_Silent_p.I208I	NM_002363.4	NP_002354.2	P43366	MAGB1_HUMAN	melanoma antigen family B, 1	208	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									NS(2)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(8)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	32						TGGGTGTGATCTTCTTAAAGG	0.493																																						uc004dcc.2		NA																	0					0						c.(622-624)ATC>ATA		melanoma antigen family B, 1							79.0	60.0	66.0					X																	30269234		2202	4300	6502	SO:0001819	synonymous_variant	4112							g.chrX:30269234C>A		CCDS14222.1	Xp21.3	2009-03-17			ENSG00000214107	ENSG00000214107			6808	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 10"", ""cancer/testis antigen family 3, member 1"""	300097				7761436, 9441743	Standard	NM_002363		Approved	MAGEL1, MAGE-Xp, DAM10, MGC9322, CT3.1	uc004dce.3	P43366	OTTHUMG00000021322	ENST00000378981.3:c.624C>A	X.37:g.30269234C>A			Somatic				MAGEB1_uc004dcd.2_Silent_p.I208I|MAGEB1_uc004dce.2_Silent_p.I208I	p.I208I	NM_002363	NP_002354	WXS	Illumina HiSeq	Unspecified	P43366	MAGB1_HUMAN			4	944	+			208			MAGE.		B2RC79|O00601|O75862|Q6FHJ0|Q96CW8	Silent	SNP	ENST00000378981.3	37	c.624C>A	CCDS14222.1																																																																																				0.493	MAGEB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056160.1	NM_002363		3	7	1	0	0.004672	0.00498285	3	7				
CXorf22	170063	broad.mit.edu	37	X	35989850	35989850	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chrX:35989850G>T	ENST00000297866.5	+	12	2184	c.2118G>T	c.(2116-2118)agG>agT	p.R706S		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	706										breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						TAACCACCAGGGGTATAGCAT	0.418																																						uc004ddj.2		NA																	0				large_intestine(1)|lung(1)|ovary(1)	3						c.(2116-2118)AGG>AGT		hypothetical protein LOC170063							56.0	50.0	52.0					X																	35989850		2202	4300	6502	SO:0001583	missense	170063							g.chrX:35989850G>T	BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.2118G>T	X.37:g.35989850G>T	ENSP00000297866:p.Arg706Ser		Somatic				CXorf22_uc010ngv.2_RNA	p.R706S	NM_152632	NP_689845	WXS	Illumina HiSeq	Unspecified	Q6ZTR5	CX022_HUMAN			12	2177	+			706					Q5JRM8|Q8N6X8	Missense_Mutation	SNP	ENST00000297866.5	37	c.2118G>T	CCDS14237.2	.	.	.	.	.	.	.	.	.	.	g	10.27	1.303837	0.23736	.	.	ENSG00000165164	ENST00000297866	T	0.13778	2.56	5.84	-3.04	0.05412	.	0.684196	0.15211	N	0.274441	T	0.11067	0.0270	M	0.69823	2.125	0.09310	N	1	P	0.42296	0.775	B	0.42282	0.382	T	0.30794	-0.9966	10	0.09338	T	0.73	-2.1449	2.3168	0.04200	0.5176:0.1346:0.209:0.1388	.	706	Q6ZTR5	CX022_HUMAN	S	706	ENSP00000297866:R706S	ENSP00000297866:R706S	R	+	3	2	CXorf22	35899771	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.439000	0.06897	-0.629000	0.05575	-0.930000	0.02707	AGG		0.418	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056216.2	NM_152632		16	32	1	0	0.00316338	0.00341434	16	32				
ZNF630	57232	broad.mit.edu	37	X	47919477	47919477	+	Missense_Mutation	SNP	G	G	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chrX:47919477G>C	ENST00000409324.3	-	5	580	c.354C>G	c.(352-354)atC>atG	p.I118M	ZNF630_ENST00000276054.4_De_novo_Start_InFrame|ZNF630_ENST00000442455.3_Missense_Mutation_p.I104M|ZNF630-AS1_ENST00000436124.1_RNA	NM_001037735.2	NP_001032824.2	Q2M218	ZN630_HUMAN	zinc finger protein 630	118					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(6)|lung(11)|ovary(1)	19						CAATATGCCAGATTTTTAAAA	0.373																																						uc004div.3		NA																	0				ovary(1)|lung(1)	2						c.(352-354)ATC>ATG		zinc finger protein 630							49.0	41.0	44.0					X																	47919477		2193	4284	6477	SO:0001583	missense	57232				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chrX:47919477G>C	AK000580	CCDS35237.2, CCDS75971.1	Xp11.3-p11.1	2013-01-08			ENSG00000221994	ENSG00000221994		"""Zinc fingers, C2H2-type"", ""-"""	28855	protein-coding gene	gene with protein product		300819					Standard	NM_001037735		Approved	BC037316, dJ54B20.2, FLJ20573, MGC138344	uc004div.4	Q2M218	OTTHUMG00000021463	ENST00000409324.3:c.354C>G	X.37:g.47919477G>C	ENSP00000386393:p.Ile118Met		Somatic				ZNF630_uc010nhz.1_Intron|ZNF630_uc004diw.2_Translation_Start_Site	p.I118M	NM_001037735	NP_001032824	WXS	Illumina HiSeq	Unspecified	Q2M218	ZN630_HUMAN			5	606	-			118					F8WAG4|Q5H8Z5	Missense_Mutation	SNP	ENST00000409324.3	37	c.354C>G	CCDS35237.2	.	.	.	.	.	.	.	.	.	.	.	9.619	1.133434	0.21041	.	.	ENSG00000221994	ENST00000442455;ENST00000409324;ENST00000428686	T;T;T	0.06528	3.29;3.34;5.34	2.5	0.602	0.17535	.	.	.	.	.	T	0.04272	0.0118	L	0.32530	0.975	0.09310	N	1	P	0.39964	0.697	B	0.33042	0.157	T	0.40384	-0.9566	9	0.37606	T	0.19	.	5.8194	0.18518	0.3115:0.0:0.6885:0.0	.	118	Q2M218	ZN630_HUMAN	M	104;118;118	ENSP00000393163:I104M;ENSP00000386393:I118M;ENSP00000407278:I118M	ENSP00000386393:I118M	I	-	3	3	ZNF630	47804421	0.001000	0.12720	0.000000	0.03702	0.430000	0.31655	0.841000	0.27613	-0.076000	0.12775	0.422000	0.28245	ATC		0.373	ZNF630-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327254.1	NM_001037735		5	5	0	0	0	0	5	5				
PJA1	64219	broad.mit.edu	37	X	68382107	68382107	+	Missense_Mutation	SNP	T	T	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chrX:68382107T>A	ENST00000361478.1	-	2	1352	c.975A>T	c.(973-975)aaA>aaT	p.K325N	PJA1_ENST00000374571.4_Missense_Mutation_p.K270N|PJA1_ENST00000477231.1_5'Flank|PJA1_ENST00000374584.3_Missense_Mutation_p.K137N|PJA1_ENST00000374583.1_Missense_Mutation_p.K325N	NM_001032396.2|NM_022368.4|NM_145119.3	NP_001027568.1|NP_071763.2|NP_660095.1	Q8NG27	PJA1_HUMAN	praja ring finger 1, E3 ubiquitin protein ligase	325					protein catabolic process (GO:0030163)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(5)|lung(12)|ovary(1)	21						TCGCTTCCCGTTTGTCTTCAG	0.552																																						uc004dxh.2		NA																	0					0						c.(973-975)AAA>AAT		praja 1 isoform a							110.0	64.0	79.0					X																	68382107		2203	4300	6503	SO:0001583	missense	64219						zinc ion binding	g.chrX:68382107T>A	AK021892	CCDS14392.1, CCDS14393.1, CCDS35316.1	Xq13.1	2013-01-09	2012-02-23		ENSG00000181191	ENSG00000181191		"""RING-type (C3HC4) zinc fingers"""	16648	protein-coding gene	gene with protein product		300420	"""praja 1"", ""praja ring finger 1"""			12036302	Standard	NM_001032396		Approved	FLJ11830, RNF70	uc004dxh.3	Q8NG27	OTTHUMG00000021753	ENST00000361478.1:c.975A>T	X.37:g.68382107T>A	ENSP00000355014:p.Lys325Asn		Somatic				PJA1_uc011mpi.1_Missense_Mutation_p.K43N|PJA1_uc004dxg.2_Missense_Mutation_p.K137N|PJA1_uc004dxi.2_Missense_Mutation_p.K270N	p.K325N	NM_145119	NP_660095	WXS	Illumina HiSeq	Unspecified	Q8NG27	PJA1_HUMAN			2	1261	-			325					A2A322|Q5JUT8|Q5JUT9|Q8NG28|Q9HAC1	Missense_Mutation	SNP	ENST00000361478.1	37	c.975A>T	CCDS14393.1	.	.	.	.	.	.	.	.	.	.	t	10.18	1.278426	0.23307	.	.	ENSG00000181191	ENST00000396010;ENST00000374584;ENST00000374583;ENST00000361478;ENST00000374571	T;T;T;T	0.04917	3.53;3.53;3.53;3.53	3.41	0.619	0.17630	.	0.715653	0.12220	U	0.488500	T	0.05135	0.0137	L	0.40543	1.245	0.09310	N	1	B;P	0.36535	0.421;0.557	B;B	0.33620	0.056;0.167	T	0.35943	-0.9768	10	0.44086	T	0.13	.	5.3529	0.16045	0.0:0.5873:0.0:0.4127	.	325;137	Q8NG27;Q8NG27-2	PJA1_HUMAN;.	N	240;137;325;325;270	ENSP00000363712:K137N;ENSP00000363711:K325N;ENSP00000355014:K325N;ENSP00000363699:K270N	ENSP00000355014:K325N	K	-	3	2	PJA1	68298832	0.422000	0.25473	0.002000	0.10522	0.044000	0.14063	0.631000	0.24568	0.022000	0.15160	-0.566000	0.04163	AAA		0.552	PJA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057031.2	NM_145119		17	18	0	0	0	0	17	18				
MED12	9968	broad.mit.edu	37	X	70340889	70340889	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chrX:70340889G>T	ENST00000374080.3	+	5	654	c.622G>T	c.(622-624)Ggg>Tgg	p.G208W	MED12_ENST00000374102.1_Missense_Mutation_p.G208W|MED12_ENST00000333646.6_Missense_Mutation_p.G208W			Q93074	MED12_HUMAN	mediator complex subunit 12	208					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					CTACCGGCCAGGGCCTGCAGG	0.532			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																															uc004dyy.2		NA		Dom	yes		X	Xq13	9968		mediator complex subunit 12	Yes		M					0				ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4						c.(622-624)GGG>TGG		mediator complex subunit 12							79.0	76.0	77.0					X																	70340889		1977	4122	6099	SO:0001583	missense	9968				androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	g.chrX:70340889G>T	U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.622G>T	X.37:g.70340889G>T	ENSP00000363193:p.Gly208Trp		Somatic				MED12_uc011mpq.1_Missense_Mutation_p.G208W|MED12_uc004dyz.2_Missense_Mutation_p.G208W|MED12_uc004dza.2_Missense_Mutation_p.G55W	p.G208W	NM_005120	NP_005111	WXS	Illumina HiSeq	Unspecified	Q93074	MED12_HUMAN			5	821	+	Renal(35;0.156)		208					O15410|O75557|Q9UHV6|Q9UND7	Missense_Mutation	SNP	ENST00000374080.3	37	c.622G>T	CCDS43970.1	.	.	.	.	.	.	.	.	.	.	.	17.65	3.442089	0.63067	.	.	ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080;ENST00000430072	T;T;T;T	0.57907	0.37;0.37;0.37;0.38	5.44	5.44	0.79542	.	0.249717	0.41938	D	0.000791	T	0.57740	0.2074	L	0.42245	1.32	0.43426	D	0.995583	P;D;D;P	0.54964	0.824;0.964;0.969;0.809	P;B;P;P	0.54460	0.753;0.338;0.753;0.571	T	0.60591	-0.7233	10	0.72032	D	0.01	-15.6667	13.197	0.59745	0.0:0.0:1.0:0.0	.	208;55;208;208	F5H3Y1;Q7Z3Z5;Q93074-3;Q93074	.;.;.;MED12_HUMAN	W	208;208;208;208;176	ENSP00000333125:G208W;ENSP00000363215:G208W;ENSP00000363193:G208W;ENSP00000414203:G176W	ENSP00000333125:G208W	G	+	1	0	MED12	70257614	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.716000	0.68437	2.517000	0.84864	0.600000	0.82982	GGG		0.532	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057105.1	NM_005120		31	25	1	0	2.46e-21	3.7e-21	31	25				
KIAA2022	340533	broad.mit.edu	37	X	73963450	73963450	+	Silent	SNP	A	A	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chrX:73963450A>G	ENST00000055682.6	-	3	1553	c.942T>C	c.(940-942)taT>taC	p.Y314Y		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	314					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						GAAAGGATTCATATCGAATTT	0.418																																						uc004eby.2		NA																	0				ovary(7)|large_intestine(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15						c.(940-942)TAT>TAC		hypothetical protein LOC340533							100.0	86.0	90.0					X																	73963450		2203	4300	6503	SO:0001819	synonymous_variant	340533				base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|S phase of mitotic cell cycle	delta DNA polymerase complex	3'-5'-exodeoxyribonuclease activity|DNA-directed DNA polymerase activity	g.chrX:73963450A>G		CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.942T>C	X.37:g.73963450A>G			Somatic					p.Y314Y	NM_001008537	NP_001008537	WXS	Illumina HiSeq	Unspecified	Q5QGS0	K2022_HUMAN			3	1559	-			314					A7YY87|Q5JUX9|Q8IVE9	Silent	SNP	ENST00000055682.6	37	c.942T>C	CCDS35337.1																																																																																				0.418	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2	NM_001008537		47	50	0	0	0	0	47	50				
MAGEE2	139599	broad.mit.edu	37	X	75004401	75004401	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chrX:75004401G>T	ENST00000373359.2	-	1	678	c.486C>A	c.(484-486)ttC>ttA	p.F162L		NM_138703.4	NP_619648.1	Q8TD90	MAGE2_HUMAN	melanoma antigen family E, 2	162	MAGE 1. {ECO:0000255|PROSITE- ProRule:PRU00127}.									autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CGGTGATCTGGAAACCCCGTT	0.527																																						uc004ecj.1		NA																	0				ovary(1)|skin(1)	2						c.(484-486)TTC>TTA		melanoma antigen family E, 2							35.0	29.0	31.0					X																	75004401		2203	4300	6503	SO:0001583	missense	139599							g.chrX:75004401G>T	AF490509	CCDS14431.1	Xq13	2008-02-05			ENSG00000186675	ENSG00000186675			24935	protein-coding gene	gene with protein product		300760				11454705	Standard	NM_138703		Approved	HCA3	uc004ecj.2	Q8TD90	OTTHUMG00000021870	ENST00000373359.2:c.486C>A	X.37:g.75004401G>T	ENSP00000362457:p.Phe162Leu		Somatic					p.F162L	NM_138703	NP_619648	WXS	Illumina HiSeq	Unspecified	Q8TD90	MAGE2_HUMAN			1	671	-			162			MAGE 1.		Q5JSI5	Missense_Mutation	SNP	ENST00000373359.2	37	c.486C>A	CCDS14431.1	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.224278	0.00283	.	.	ENSG00000186675	ENST00000373359	T	0.03982	3.74	3.08	-0.775	0.10988	.	.	.	.	.	T	0.01061	0.0035	N	0.00602	-1.34	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44697	-0.9311	9	0.02654	T	1	.	2.6951	0.05132	0.4002:0.0:0.3872:0.2126	.	162	Q8TD90	MAGE2_HUMAN	L	162	ENSP00000362457:F162L	ENSP00000362457:F162L	F	-	3	2	MAGEE2	74921126	0.619000	0.27059	0.002000	0.10522	0.001000	0.01503	0.553000	0.23391	-0.354000	0.08212	-0.430000	0.05897	TTC		0.527	MAGEE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057288.1	NM_138703		10	12	1	0	5.17e-11	7.07e-11	10	12				
TBX22	50945	broad.mit.edu	37	X	79281194	79281194	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chrX:79281194G>T	ENST00000373294.5	+	4	579	c.551G>T	c.(550-552)tGc>tTc	p.C184F	TBX22_ENST00000373291.1_Missense_Mutation_p.C64F|TBX22_ENST00000442340.1_Missense_Mutation_p.C64F|TBX22_ENST00000373296.3_Missense_Mutation_p.C184F	NM_016954.2	NP_058650.1	Q9Y458	TBX22_HUMAN	T-box 22	184					multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.C184F(1)		breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(13)|lung(38)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						GACTCACCCTGCTCGGGAGAG	0.488																																						uc010nmg.1		NA																	1	Substitution - Missense(1)		stomach(1)	lung(7)|large_intestine(3)|central_nervous_system(2)|breast(1)|skin(1)|ovary(1)	15	GRCh37	CM074593	TBX22	M		c.(550-552)TGC>TTC		T-box 22 isoform 1							106.0	74.0	85.0					X																	79281194		2203	4300	6503	SO:0001583	missense	50945				multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:79281194G>T	AL031000	CCDS14445.1, CCDS43975.1	Xq21.1	2011-02-11			ENSG00000122145	ENSG00000122145		"""T-boxes"""	11600	protein-coding gene	gene with protein product		300307	"""cleft palate and/or ankyloglossia"""	CPX, CLPA		11559848, 14729838	Standard	NM_001109878		Approved		uc004edj.1	Q9Y458	OTTHUMG00000021901	ENST00000373294.5:c.551G>T	X.37:g.79281194G>T	ENSP00000362390:p.Cys184Phe		Somatic				TBX22_uc004edi.1_Missense_Mutation_p.C64F|TBX22_uc004edj.1_Missense_Mutation_p.C184F	p.C184F	NM_001109878	NP_001103348	WXS	Illumina HiSeq	Unspecified	Q9Y458	TBX22_HUMAN			5	685	+			184			T-box.		Q5JZ06|Q96LC0|Q9HBF1	Missense_Mutation	SNP	ENST00000373294.5	37	c.551G>T	CCDS14445.1	.	.	.	.	.	.	.	.	.	.	G	12.66	2.005487	0.35415	.	.	ENSG00000122145	ENST00000373296;ENST00000442340;ENST00000373294;ENST00000373291	D;D;D;D	0.87334	-2.24;-2.24;-2.24;-2.24	4.77	4.77	0.60923	Transcription factor, T-box, conserved site (1);p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.88555	0.6468	N	0.25286	0.73	0.54753	D	0.999989	D	0.89917	1.0	D	0.91635	0.999	D	0.88858	0.3324	10	0.41790	T	0.15	.	15.4757	0.75478	0.0:0.0:1.0:0.0	.	184	Q9Y458	TBX22_HUMAN	F	184;64;184;64	ENSP00000362393:C184F;ENSP00000396394:C64F;ENSP00000362390:C184F;ENSP00000362388:C64F	ENSP00000362388:C64F	C	+	2	0	TBX22	79167850	1.000000	0.71417	0.809000	0.32408	0.714000	0.41099	4.148000	0.58085	1.948000	0.56530	0.600000	0.82982	TGC		0.488	TBX22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057334.1	NM_016954		15	22	1	0	6.72e-11	9.18e-11	15	22				
PABPC5	140886	broad.mit.edu	37	X	90691137	90691137	+	Silent	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chrX:90691137G>T	ENST00000312600.3	+	2	775	c.561G>T	c.(559-561)gcG>gcT	p.A187A	PABPC5-AS1_ENST00000456187.1_RNA|PABPC5_ENST00000373105.1_Silent_p.A23A	NM_080832.2	NP_543022.1	Q96DU9	PABP5_HUMAN	poly(A) binding protein, cytoplasmic 5	187						mitochondrion (GO:0005739)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(1)|pancreas(1)	42						AAGAGCGGGCGGCTGAGGTCA	0.493																																						uc004efg.2		NA																	0				ovary(1)|lung(1)|pancreas(1)	3						c.(559-561)GCG>GCT		poly(A) binding protein, cytoplasmic 5							34.0	34.0	34.0					X																	90691137		2203	4300	6503	SO:0001819	synonymous_variant	140886					cytoplasm	nucleotide binding|RNA binding	g.chrX:90691137G>T	AJ278963	CCDS14460.1	Xq21.3	2013-02-12	2001-11-28		ENSG00000174740	ENSG00000174740		"""RNA binding motif (RRM) containing"""	13629	protein-coding gene	gene with protein product		300407	"""poly(A)-binding protein, cytoplasmic 5"""			11374897	Standard	NM_080832		Approved	PABP5	uc004efg.3	Q96DU9	OTTHUMG00000021959	ENST00000312600.3:c.561G>T	X.37:g.90691137G>T			Somatic				PABPC5_uc004eff.1_Silent_p.A23A	p.A187A	NM_080832	NP_543022	WXS	Illumina HiSeq	Unspecified	Q96DU9	PABP5_HUMAN			2	1001	+			187					A8K240|Q5JQF4|Q6P529|Q9UFE5	Silent	SNP	ENST00000312600.3	37	c.561G>T	CCDS14460.1																																																																																				0.493	PABPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057429.1	NM_080832		21	12	1	0	8.34e-07	1.03e-06	21	12				
PABPC5	140886	broad.mit.edu	37	X	90691163	90691163	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chrX:90691163C>A	ENST00000312600.3	+	2	801	c.587C>A	c.(586-588)gCa>gAa	p.A196E	PABPC5-AS1_ENST00000456187.1_RNA|PABPC5_ENST00000373105.1_Missense_Mutation_p.A32E	NM_080832.2	NP_543022.1	Q96DU9	PABP5_HUMAN	poly(A) binding protein, cytoplasmic 5	196						mitochondrion (GO:0005739)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(1)|pancreas(1)	42						AGGGATAGAGCAACTTTCACC	0.458																																						uc004efg.2		NA																	0				ovary(1)|lung(1)|pancreas(1)	3						c.(586-588)GCA>GAA		poly(A) binding protein, cytoplasmic 5							39.0	39.0	39.0					X																	90691163		2203	4300	6503	SO:0001583	missense	140886					cytoplasm	nucleotide binding|RNA binding	g.chrX:90691163C>A	AJ278963	CCDS14460.1	Xq21.3	2013-02-12	2001-11-28		ENSG00000174740	ENSG00000174740		"""RNA binding motif (RRM) containing"""	13629	protein-coding gene	gene with protein product		300407	"""poly(A)-binding protein, cytoplasmic 5"""			11374897	Standard	NM_080832		Approved	PABP5	uc004efg.3	Q96DU9	OTTHUMG00000021959	ENST00000312600.3:c.587C>A	X.37:g.90691163C>A	ENSP00000308012:p.Ala196Glu		Somatic				PABPC5_uc004eff.1_Missense_Mutation_p.A32E	p.A196E	NM_080832	NP_543022	WXS	Illumina HiSeq	Unspecified	Q96DU9	PABP5_HUMAN			2	1027	+			196					A8K240|Q5JQF4|Q6P529|Q9UFE5	Missense_Mutation	SNP	ENST00000312600.3	37	c.587C>A	CCDS14460.1	.	.	.	.	.	.	.	.	.	.	C	7.071	0.568287	0.13560	.	.	ENSG00000174740	ENST00000373105;ENST00000312600;ENST00000402906	D;D	0.85861	-2.04;-2.04	4.53	4.53	0.55603	Nucleotide-binding, alpha-beta plait (1);	0.052501	0.85682	D	0.000000	T	0.73737	0.3625	L	0.44542	1.39	0.39859	D	0.973342	P	0.45902	0.868	B	0.39590	0.304	T	0.74000	-0.3805	10	0.02654	T	1	.	9.0043	0.36102	0.2193:0.7807:0.0:0.0	.	196	Q96DU9	PABP5_HUMAN	E	32;196;164	ENSP00000362197:A32E;ENSP00000308012:A196E	ENSP00000308012:A196E	A	+	2	0	PABPC5	90577819	1.000000	0.71417	0.998000	0.56505	0.976000	0.68499	6.377000	0.73145	2.495000	0.84180	0.600000	0.82982	GCA		0.458	PABPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057429.1	NM_080832		20	22	1	0	1.56e-12	2.18e-12	20	22				
PCDH11X	27328	broad.mit.edu	37	X	91134249	91134249	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chrX:91134249C>T	ENST00000373094.1	+	2	3855	c.3010C>T	c.(3010-3012)Cct>Tct	p.P1004S	PCDH11X_ENST00000361655.2_Missense_Mutation_p.P1004S|PCDH11X_ENST00000504220.2_Missense_Mutation_p.P1004S|PCDH11X_ENST00000298274.8_Missense_Mutation_p.P1004S|PCDH11X_ENST00000361724.1_Missense_Mutation_p.P1004S|PCDH11X_ENST00000373088.1_Missense_Mutation_p.P1004S|PCDH11X_ENST00000395337.2_Missense_Mutation_p.P1004S|PCDH11X_ENST00000373097.1_Missense_Mutation_p.P1004S|PCDH11X_ENST00000406881.1_Missense_Mutation_p.P1004S	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	1004					homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						CTTCGAGGTACCTGTGTCCGT	0.423																																					NSCLC(38;925 1092 2571 38200 45895)	uc004efk.1		NA																	0				large_intestine(2)	2						c.(3010-3012)CCT>TCT		protocadherin 11 X-linked isoform c							173.0	138.0	150.0					X																	91134249		2203	4300	6503	SO:0001583	missense	27328				homophilic cell adhesion	integral to plasma membrane	calcium ion binding	g.chrX:91134249C>T	AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.3010C>T	X.37:g.91134249C>T	ENSP00000362186:p.Pro1004Ser		Somatic				PCDH11X_uc004efl.1_Missense_Mutation_p.P1004S|PCDH11X_uc004efo.1_Missense_Mutation_p.P1004S|PCDH11X_uc010nmv.1_Missense_Mutation_p.P1004S|PCDH11X_uc004efm.1_Missense_Mutation_p.P1004S|PCDH11X_uc004efn.1_Missense_Mutation_p.P1004S|PCDH11X_uc004efh.1_Missense_Mutation_p.P1004S|PCDH11X_uc004efj.1_Missense_Mutation_p.P1004S	p.P1004S	NM_032968	NP_116750	WXS	Illumina HiSeq	Unspecified	Q9BZA7	PC11X_HUMAN			2	3855	+			1004			Cytoplasmic (Potential).		A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	ENST00000373094.1	37	c.3010C>T	CCDS14461.1	.	.	.	.	.	.	.	.	.	.	C	1.706	-0.500412	0.04291	.	.	ENSG00000102290	ENST00000395337;ENST00000373094;ENST00000373097;ENST00000361724;ENST00000373088;ENST00000504220;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T;T;T;T	0.50548	0.74;0.75;0.76;0.76;0.8;0.74;0.74;0.77;0.8	5.2	2.02	0.26589	.	0.296637	0.32884	N	0.005528	T	0.39226	0.1070	L	0.40543	1.245	0.26550	N	0.973937	P;B;B;B;P;B;P;P	0.40211	0.707;0.203;0.203;0.203;0.581;0.446;0.702;0.47	B;B;B;B;B;B;B;B	0.40825	0.234;0.149;0.149;0.149;0.209;0.103;0.321;0.341	T	0.29731	-1.0002	10	0.66056	D	0.02	.	10.5549	0.45112	0.2724:0.6111:0.1165:0.0	.	1004;1004;1004;1004;1004;1004;1004;1004	Q9BZA7-6;Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7;Q9BZA7-7;Q9BZA7-2	.;.;.;.;.;PC11X_HUMAN;.;.	S	1004	ENSP00000378746:P1004S;ENSP00000362186:P1004S;ENSP00000362189:P1004S;ENSP00000355040:P1004S;ENSP00000362180:P1004S;ENSP00000423762:P1004S;ENSP00000355105:P1004S;ENSP00000384758:P1004S;ENSP00000298274:P1004S	ENSP00000298274:P1004S	P	+	1	0	PCDH11X	91020905	0.889000	0.30405	0.824000	0.32777	0.017000	0.09413	1.450000	0.35134	0.391000	0.25143	-0.205000	0.12727	CCT		0.423	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969		44	72	0	0	0	0	44	72				
USP26	83844	broad.mit.edu	37	X	132162179	132162179	+	Missense_Mutation	SNP	C	C	G			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chrX:132162179C>G	ENST00000511190.1	-	6	539	c.70G>C	c.(70-72)Gaa>Caa	p.E24Q	USP26_ENST00000406273.1_Missense_Mutation_p.E24Q|USP26_ENST00000370832.1_Missense_Mutation_p.E24Q	NM_031907.1	NP_114113.1	Q9BXU7	UBP26_HUMAN	ubiquitin specific peptidase 26	24					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	60	Acute lymphoblastic leukemia(192;0.000127)					ATGAATGCTTCTTTTGACTTA	0.358																																					NSCLC(104;342 1621 36940 47097 52632)	uc010nrm.1		NA																	0				lung(3)|central_nervous_system(3)|kidney(1)|liver(1)	8						c.(70-72)GAA>CAA		ubiquitin-specific protease 26							59.0	61.0	61.0					X																	132162179		2201	4292	6493	SO:0001583	missense	83844				protein deubiquitination|ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity	g.chrX:132162179C>G	AF285593	CCDS14635.1	Xq26.2	2012-07-13	2005-08-08		ENSG00000134588	ENSG00000134588	3.4.19.12	"""Ubiquitin-specific peptidases"""	13485	protein-coding gene	gene with protein product		300309	"""ubiquitin specific protease 26"""			12838346	Standard	NM_031907		Approved		uc011mvf.2	Q9BXU7	OTTHUMG00000022429	ENST00000511190.1:c.70G>C	X.37:g.132162179C>G	ENSP00000423390:p.Glu24Gln		Somatic				USP26_uc011mvf.1_Missense_Mutation_p.E24Q	p.E24Q	NM_031907	NP_114113	WXS	Illumina HiSeq	Unspecified	Q9BXU7	UBP26_HUMAN			6	540	-	Acute lymphoblastic leukemia(192;0.000127)		24					B9WRT6|Q5H9H4	Missense_Mutation	SNP	ENST00000511190.1	37	c.70G>C	CCDS14635.1	.	.	.	.	.	.	.	.	.	.	C	14.52	2.560621	0.45590	.	.	ENSG00000134588	ENST00000370832;ENST00000511190;ENST00000406273	T;T;T	0.66638	-0.22;-0.22;-0.22	4.15	1.37	0.22104	.	0.492406	0.15563	N	0.255840	T	0.76550	0.4003	M	0.76328	2.33	0.09310	N	1	D	0.89917	1.0	D	0.77557	0.99	T	0.63607	-0.6599	10	0.87932	D	0	-7.6202	5.4055	0.16318	0.0:0.6114:0.0:0.3886	.	24	Q9BXU7	UBP26_HUMAN	Q	24	ENSP00000359869:E24Q;ENSP00000423390:E24Q;ENSP00000384360:E24Q	ENSP00000359869:E24Q	E	-	1	0	USP26	131989845	0.002000	0.14202	0.002000	0.10522	0.159000	0.22180	0.281000	0.18810	0.151000	0.19162	0.529000	0.55759	GAA		0.358	USP26-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359441.1	NM_031907		37	37	0	0	0	0	37	37				
DDX26B	203522	broad.mit.edu	37	X	134680705	134680705	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chrX:134680705G>T	ENST00000370752.4	+	5	842	c.508G>T	c.(508-510)Gcc>Tcc	p.A170S	DDX26B_ENST00000481908.1_3'UTR	NM_182540.4	NP_872346.3	Q5JSJ4	DX26B_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B	170	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.									large_intestine(1)|lung(8)	9	Acute lymphoblastic leukemia(192;6.56e-05)					AAGGTTATTTGCCCTGGTGTT	0.468																																						uc004eyw.3		NA																	0					0						c.(508-510)GCC>TCC		DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide							150.0	122.0	131.0					X																	134680705		2203	4300	6503	SO:0001583	missense	203522							g.chrX:134680705G>T	AK096544	CCDS35401.1	Xq26	2008-02-05			ENSG00000165359	ENSG00000165359		"""DEAD-boxes"""	27334	protein-coding gene	gene with protein product							Standard	NM_182540		Approved	FLJ41215	uc004eyw.4	Q5JSJ4	OTTHUMG00000022484	ENST00000370752.4:c.508G>T	X.37:g.134680705G>T	ENSP00000359788:p.Ala170Ser		Somatic					p.A170S	NM_182540	NP_872346	WXS	Illumina HiSeq	Unspecified	Q5JSJ4	DX26B_HUMAN			5	871	+	Acute lymphoblastic leukemia(192;6.56e-05)		170			VWFA.		Q5CZA2|Q6IPS3|Q6ZTU5|Q6ZWE4	Missense_Mutation	SNP	ENST00000370752.4	37	c.508G>T	CCDS35401.1	.	.	.	.	.	.	.	.	.	.	G	12.09	1.834613	0.32421	.	.	ENSG00000165359	ENST00000370752	T	0.14766	2.48	5.27	5.27	0.74061	von Willebrand factor, type A (2);	0.000000	0.85682	D	0.000000	T	0.09862	0.0242	N	0.11255	0.115	0.80722	D	1	P	0.36048	0.534	B	0.42916	0.402	T	0.05354	-1.0890	10	0.02654	T	1	-7.868	16.9486	0.86237	0.0:0.0:1.0:0.0	.	170	Q5JSJ4	DX26B_HUMAN	S	170	ENSP00000359788:A170S	ENSP00000359788:A170S	A	+	1	0	DDX26B	134508371	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	6.449000	0.73473	2.209000	0.71365	0.523000	0.50628	GCC		0.468	DDX26B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058420.1	NM_182540		44	50	1	0	1.76e-25	2.7e-25	44	50				
CDR1	1038	broad.mit.edu	37	X	139866414	139866414	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chrX:139866414G>T	ENST00000370532.2	-	1	309	c.118C>A	c.(118-120)Ctg>Atg	p.L40M		NM_004065.2	NP_004056.2	P51861	CDR1_HUMAN	cerebellar degeneration-related protein 1, 34kDa	40	23 X 6 AA approximate repeats.									breast(1)|endometrium(3)|large_intestine(3)|lung(11)|prostate(2)|skin(4)|urinary_tract(1)	25	Acute lymphoblastic leukemia(192;7.65e-05)	Lung SC(4;0.051)				ATGTCTTCCAGCCTACTTGTG	0.438																																						uc004fbg.1		NA																	0					0						c.(118-120)CTG>ATG		cerebellar degeneration-related protein 1,							149.0	140.0	143.0					X																	139866414		2203	4300	6503	SO:0001583	missense	1038							g.chrX:139866414G>T		CCDS14670.1	Xq27.1	2013-06-13	2002-08-29		ENSG00000184258	ENSG00000184258			1798	protein-coding gene	gene with protein product	"""Cerebellar degeneration-related protein-1 (34kD)"""	302650	"""cerebellar degeneration-related protein (34kD)"""	CDR		2326268	Standard	NM_004065		Approved	CDR62A, CDR34	uc004fbg.1	P51861	OTTHUMG00000137398	ENST00000370532.2:c.118C>A	X.37:g.139866414G>T	ENSP00000359563:p.Leu40Met		Somatic				uc004fbf.1_RNA	p.L40M	NM_004065	NP_004056	WXS	Illumina HiSeq	Unspecified	P51861	CDR1_HUMAN			1	310	-	Acute lymphoblastic leukemia(192;7.65e-05)	Lung SC(4;0.051)	40			7.|23 X 6 AA approximate repeats.		Q5JXH6	Missense_Mutation	SNP	ENST00000370532.2	37	c.118C>A	CCDS14670.1	.	.	.	.	.	.	.	.	.	.	G	14.53	2.563063	0.45694	.	.	ENSG00000184258	ENST00000370532	T	0.33216	1.42	3.86	2.98	0.34508	.	.	.	.	.	T	0.32734	0.0839	N	0.12182	0.205	0.09310	N	1	D	0.89917	1.0	D	0.76071	0.987	T	0.14755	-1.0461	8	.	.	.	.	9.0022	0.36088	0.1212:0.0:0.8788:0.0	.	40	P51861	CDR1_HUMAN	M	40	ENSP00000359563:L40M	.	L	-	1	2	CDR1	139694080	0.001000	0.12720	0.126000	0.21872	0.049000	0.14656	-0.017000	0.12590	0.721000	0.32231	0.544000	0.68410	CTG		0.438	CDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058583.1	NM_004065		50	52	1	0	4.45e-29	6.9e-29	50	52				
MAGEC1	9947	broad.mit.edu	37	X	140994309	140994309	+	Silent	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chrX:140994309C>A	ENST00000285879.4	+	4	1405	c.1119C>A	c.(1117-1119)ctC>ctA	p.L373L	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	373										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					AGTCTCCTCTCCAGATTCCTG	0.478										HNSCC(15;0.026)																												uc004fbt.2		NA																	0				ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(1117-1119)CTC>CTA		melanoma antigen family C, 1							105.0	108.0	107.0					X																	140994309		2201	4291	6492	SO:0001819	synonymous_variant	9947						protein binding	g.chrX:140994309C>A	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.1119C>A	X.37:g.140994309C>A		HNSCC(15;0.026)	Somatic				MAGEC1_uc010nsl.1_Intron	p.L373L	NM_005462	NP_005453	WXS	Illumina HiSeq	Unspecified	O60732	MAGC1_HUMAN			4	1405	+	Acute lymphoblastic leukemia(192;6.56e-05)		373					A0PK03|O75451|Q8TCV4	Silent	SNP	ENST00000285879.4	37	c.1119C>A	CCDS35417.1																																																																																				0.478	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462		90	104	1	0	7.49e-41	1.19e-40	90	104				
MAGEC1	9947	broad.mit.edu	37	X	140995492	140995492	+	Missense_Mutation	SNP	G	G	C			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chrX:140995492G>C	ENST00000285879.4	+	4	2588	c.2302G>C	c.(2302-2304)Gag>Cag	p.E768Q	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	768										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					GAGTCCTCCTGAGGGGCCTGC	0.537										HNSCC(15;0.026)																												uc004fbt.2		NA																	0				ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(2302-2304)GAG>CAG		melanoma antigen family C, 1							125.0	138.0	134.0					X																	140995492		2203	4300	6503	SO:0001583	missense	9947						protein binding	g.chrX:140995492G>C	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.2302G>C	X.37:g.140995492G>C	ENSP00000285879:p.Glu768Gln	HNSCC(15;0.026)	Somatic				MAGEC1_uc010nsl.1_Intron	p.E768Q	NM_005462	NP_005453	WXS	Illumina HiSeq	Unspecified	O60732	MAGC1_HUMAN			4	2588	+	Acute lymphoblastic leukemia(192;6.56e-05)		768					A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	37	c.2302G>C	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	a	9.885	1.202567	0.22121	.	.	ENSG00000155495	ENST00000285879	T	0.02606	4.23	1.02	1.02	0.19986	.	.	.	.	.	T	0.02888	0.0086	N	0.24115	0.695	0.58432	D	0.999999	P	0.39094	0.659	B	0.42959	0.403	T	0.58440	-0.7636	9	0.56958	D	0.05	.	7.7924	0.29127	1.0E-4:0.0:0.9999:0.0	.	768	O60732	MAGC1_HUMAN	Q	768	ENSP00000285879:E768Q	ENSP00000285879:E768Q	E	+	1	0	MAGEC1	140823158	0.880000	0.30214	0.014000	0.15608	0.022000	0.10575	0.463000	0.21972	0.280000	0.22209	0.284000	0.19432	GAG		0.537	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462		98	122	0	0	0	0	98	122				
MAGEC1	9947	broad.mit.edu	37	X	140995643	140995643	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chrX:140995643C>A	ENST00000285879.4	+	4	2739	c.2453C>A	c.(2452-2454)cCc>cAc	p.P818H	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	818										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					AGCTCCTTCCCCTCCTCCACT	0.552										HNSCC(15;0.026)																												uc004fbt.2		NA																	0				ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(2452-2454)CCC>CAC		melanoma antigen family C, 1							138.0	143.0	142.0					X																	140995643		2203	4300	6503	SO:0001583	missense	9947						protein binding	g.chrX:140995643C>A	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.2453C>A	X.37:g.140995643C>A	ENSP00000285879:p.Pro818His	HNSCC(15;0.026)	Somatic				MAGEC1_uc010nsl.1_Intron	p.P818H	NM_005462	NP_005453	WXS	Illumina HiSeq	Unspecified	O60732	MAGC1_HUMAN			4	2739	+	Acute lymphoblastic leukemia(192;6.56e-05)		818					A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	37	c.2453C>A	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	-	6.715	0.500538	0.12822	.	.	ENSG00000155495	ENST00000285879	T	0.02525	4.26	2.05	-3.35	0.04928	.	.	.	.	.	T	0.02083	0.0065	N	0.08118	0	0.09310	N	1	P	0.50156	0.932	P	0.46299	0.511	T	0.44772	-0.9306	9	0.72032	D	0.01	.	7.8536	0.29470	0.0:0.2516:0.0:0.7484	.	818	O60732	MAGC1_HUMAN	H	818	ENSP00000285879:P818H	ENSP00000285879:P818H	P	+	2	0	MAGEC1	140823309	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-0.115000	0.10741	-0.936000	0.03723	-0.815000	0.03128	CCC		0.552	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462		106	124	1	0	1.52e-35	2.4e-35	106	124				
SLITRK4	139065	broad.mit.edu	37	X	142716466	142716466	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chrX:142716466C>A	ENST00000381779.4	-	2	2684	c.2459G>T	c.(2458-2460)aGt>aTt	p.S820I	SLITRK4_ENST00000356928.1_Missense_Mutation_p.S820I|SLITRK4_ENST00000338017.4_Missense_Mutation_p.S820I	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	820						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					GTCAGGGGAACTCTGCAGTTT	0.393																																						uc004fbx.2		NA																	0				upper_aerodigestive_tract(1)|large_intestine(1)	2						c.(2458-2460)AGT>ATT		slit and trk like 4 protein precursor							129.0	112.0	117.0					X																	142716466		2203	4300	6503	SO:0001583	missense	139065					integral to membrane		g.chrX:142716466C>A	BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.2459G>T	X.37:g.142716466C>A	ENSP00000371198:p.Ser820Ile		Somatic				SLITRK4_uc004fby.2_Missense_Mutation_p.S820I	p.S820I	NM_173078	NP_775101	WXS	Illumina HiSeq	Unspecified	Q8IW52	SLIK4_HUMAN			2	2835	-	Acute lymphoblastic leukemia(192;6.56e-05)		820			Cytoplasmic (Potential).		Q5JXG3|Q8TCM8|Q96DL3	Missense_Mutation	SNP	ENST00000381779.4	37	c.2459G>T	CCDS14679.1	.	.	.	.	.	.	.	.	.	.	C	11.97	1.798790	0.31777	.	.	ENSG00000179542	ENST00000381779;ENST00000356928;ENST00000338017	T;T;T	0.52526	0.66;0.66;0.66	5.26	3.49	0.39957	.	0.146293	0.46758	U	0.000266	T	0.26159	0.0638	N	0.08118	0	0.31358	N	0.681679	B	0.06786	0.001	B	0.08055	0.003	T	0.13818	-1.0495	10	0.40728	T	0.16	-3.1955	9.6289	0.39768	0.0:0.825:0.0:0.175	.	820	Q8IW52	SLIK4_HUMAN	I	820	ENSP00000371198:S820I;ENSP00000349400:S820I;ENSP00000336627:S820I	ENSP00000336627:S820I	S	-	2	0	SLITRK4	142544132	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.744000	0.47450	0.440000	0.26502	0.529000	0.55759	AGT		0.393	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058617.1	NM_173078		45	42	1	0	3.86e-14	5.48e-14	45	42				
SLITRK4	139065	broad.mit.edu	37	X	142717845	142717845	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chrX:142717845G>T	ENST00000381779.4	-	2	1305	c.1080C>A	c.(1078-1080)aaC>aaA	p.N360K	SLITRK4_ENST00000356928.1_Missense_Mutation_p.N360K|SLITRK4_ENST00000338017.4_Missense_Mutation_p.N360K	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	360	LRRNT.					integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					TCTCTTGGCAGTTCACACTTA	0.458																																						uc004fbx.2		NA																	0				upper_aerodigestive_tract(1)|large_intestine(1)	2						c.(1078-1080)AAC>AAA		slit and trk like 4 protein precursor							142.0	122.0	129.0					X																	142717845		2203	4300	6503	SO:0001583	missense	139065					integral to membrane		g.chrX:142717845G>T	BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.1080C>A	X.37:g.142717845G>T	ENSP00000371198:p.Asn360Lys		Somatic				SLITRK4_uc004fby.2_Missense_Mutation_p.N360K	p.N360K	NM_173078	NP_775101	WXS	Illumina HiSeq	Unspecified	Q8IW52	SLIK4_HUMAN			2	1456	-	Acute lymphoblastic leukemia(192;6.56e-05)		360			Extracellular (Potential).|LRRNT.		Q5JXG3|Q8TCM8|Q96DL3	Missense_Mutation	SNP	ENST00000381779.4	37	c.1080C>A	CCDS14679.1	.	.	.	.	.	.	.	.	.	.	G	11.33	1.607393	0.28623	.	.	ENSG00000179542	ENST00000381779;ENST00000356928;ENST00000338017	T;T;T	0.44881	0.91;0.91;0.91	5.57	3.75	0.43078	Leucine-rich repeat-containing N-terminal (1);	0.097746	0.64402	D	0.000002	T	0.53238	0.1784	L	0.55213	1.73	0.58432	D	0.999992	D	0.67145	0.996	D	0.65010	0.931	T	0.53725	-0.8398	10	0.59425	D	0.04	-12.6675	9.0047	0.36104	0.256:0.0:0.744:0.0	.	360	Q8IW52	SLIK4_HUMAN	K	360	ENSP00000371198:N360K;ENSP00000349400:N360K;ENSP00000336627:N360K	ENSP00000336627:N360K	N	-	3	2	SLITRK4	142545511	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.956000	0.29202	1.205000	0.43262	0.594000	0.82650	AAC		0.458	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058617.1	NM_173078		71	67	1	0	1.35e-36	2.12e-36	71	67				
SPANXN1	494118	broad.mit.edu	37	X	144337280	144337280	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chrX:144337280C>A	ENST00000370493.3	+	2	924	c.165C>A	c.(163-165)tgC>tgA	p.C55*		NM_001009614.2	NP_001009614.1	Q5VSR9	SPXN1_HUMAN	SPANX family, member N1	55								p.C55C(2)		endometrium(2)|kidney(2)|lung(8)|prostate(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(192;6.56e-05)					TAGCGTTTTGCTACAGGAAAG	0.433																																						uc004fcb.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(163-165)TGC>TGA		SPANX-N1 protein							181.0	156.0	164.0					X																	144337280		2203	4297	6500	SO:0001587	stop_gained	494118							g.chrX:144337280C>A		CCDS35421.1	Xq27.3	2009-03-25				ENSG00000203923			33174	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 6"""	300664				14973187, 17012309	Standard	NM_001009614		Approved	SPANX-N1, CT11.6	uc004fcb.2	Q5VSR9		ENST00000370493.3:c.165C>A	X.37:g.144337280C>A	ENSP00000359524:p.Cys55*		Somatic					p.C55*	NM_001009614	NP_001009614	WXS	Illumina HiSeq	Unspecified	Q5VSR9	SPXN1_HUMAN			2	165	+	Acute lymphoblastic leukemia(192;6.56e-05)		55						Nonsense_Mutation	SNP	ENST00000370493.3	37	c.165C>A	CCDS35421.1	.	.	.	.	.	.	.	.	.	.	-	34	5.409610	0.96072	.	.	ENSG00000203923	ENST00000370493	.	.	.	1.51	0.57	0.17347	.	.	.	.	.	.	.	.	.	.	.	0.33155	D	0.546167	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	3.7694	0.08636	0.0:0.7355:0.0:0.2645	.	.	.	.	X	55	.	ENSP00000359524:C55X	C	+	3	2	SPANXN1	144144972	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.214000	0.09292	0.125000	0.18397	0.151000	0.16131	TGC		0.433	SPANXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058631.2	NM_001009614		39	32	1	0	1.42e-22	2.15e-22	39	32				
L1CAM	3897	broad.mit.edu	37	X	153134316	153134316	+	Silent	SNP	C	C	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chrX:153134316C>A	ENST00000370060.1	-	12	1548	c.1359G>T	c.(1357-1359)gcG>gcT	p.A453A	L1CAM_ENST00000370057.3_Silent_p.A453A|L1CAM_ENST00000361981.3_Silent_p.A448A|L1CAM_ENST00000370055.1_Silent_p.A448A|L1CAM_ENST00000361699.4_Silent_p.A453A|L1CAM_ENST00000538883.1_Silent_p.A455A|L1CAM_ENST00000543994.1_Silent_p.A455A	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	453	Ig-like C2-type 5.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TGGGCACAGGCGCTCCGAAGG	0.632																																						uc004fjb.2		NA																	0				ovary(8)|central_nervous_system(1)	9						c.(1357-1359)GCG>GCT		L1 cell adhesion molecule isoform 1 precursor							185.0	142.0	157.0					X																	153134316		2203	4300	6503	SO:0001819	synonymous_variant	3897				axon guidance|blood coagulation|cell death|leukocyte migration	integral to membrane		g.chrX:153134316C>A	M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.1359G>T	X.37:g.153134316C>A			Somatic				L1CAM_uc004fjc.2_Silent_p.A453A|L1CAM_uc010nuo.2_Silent_p.A448A|L1CAM_uc004fjd.1_Silent_p.A267A	p.A453A	NM_000425	NP_000416	WXS	Illumina HiSeq	Unspecified	P32004	L1CAM_HUMAN			11	1467	-	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		453			Extracellular (Potential).|Ig-like C2-type 5.		A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Silent	SNP	ENST00000370060.1	37	c.1359G>T	CCDS14733.1																																																																																				0.632	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061094.2	NM_024003		46	48	1	0	2.31e-15	3.32e-15	46	48				
STAB2	55576	broad.mit.edu	37	12	104106206	104106206	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr12:104106206delG	ENST00000388887.2	+	41	4600	c.4396delG	c.(4396-4398)gggfs	p.G1466fs		NM_017564.9	NP_060034.9			stabilin 2									p.G1466R(1)		NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						CCAAGGAAACGGGACCATCTG	0.512																																						uc001tjw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|skin(5)	14						c.(4396-4398)GGGfs		stabilin 2 precursor							131.0	118.0	122.0					12																	104106206		2203	4300	6503	SO:0001589	frameshift_variant	55576				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity	g.chr12:104106206delG	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.4396delG	12.37:g.104106206delG	ENSP00000373539:p.Gly1466fs		Somatic				STAB2_uc009zug.2_RNA	p.G1466fs	NM_017564	NP_060034	WXS	Illumina HiSeq	Unspecified	Q8WWQ8	STAB2_HUMAN			41	4582	+			1466			Extracellular (Potential).|EGF-like 11.			Frame_Shift_Del	DEL	ENST00000388887.2	37	c.4396delG	CCDS31888.1																																																																																				0.512	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1			35	97	NA	NA	NA	NA	35	97	---	---	---	---
OR4K14	122740	broad.mit.edu	37	14	20482615	20482616	+	Frame_Shift_Ins	INS	-	-	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr14:20482615_20482616insA	ENST00000305045.2	-	1	736_737	c.737_738insT	c.(736-738)atgfs	p.M246fs		NM_001004712.1	NP_001004712.1	Q8NGD5	OR4KE_HUMAN	olfactory receptor, family 4, subfamily K, member 14	246						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(20)|skin(6)	37	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2e-06)	GBM - Glioblastoma multiforme(265;0.00124)		GCGTCACTACCATGATATGTGC	0.49																																						uc010tky.1		NA																	0				skin(2)|large_intestine(1)	3						c.(736-738)ATGfs		olfactory receptor, family 4, subfamily K,																																				SO:0001589	frameshift_variant	122740				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20482615_20482616insA		CCDS32027.1	14q11.2	2013-09-23			ENSG00000169484	ENSG00000169484		"""GPCR / Class A : Olfactory receptors"""	15352	protein-coding gene	gene with protein product							Standard	NM_001004712		Approved		uc010tky.2	Q8NGD5	OTTHUMG00000170780	ENST00000305045.2:c.738dupT	14.37:g.20482616_20482616dupA	ENSP00000305011:p.Met246fs		Somatic					p.M246fs	NM_001004712	NP_001004712	WXS	Illumina HiSeq	Unspecified	Q8NGD5	OR4KE_HUMAN	Epithelial(56;4.65e-07)|all cancers(55;2e-06)	GBM - Glioblastoma multiforme(265;0.00124)	1	737_738	-	all_cancers(95;0.00108)		246			Helical; Name=6; (Potential).		Q6IEU1|Q96R71	Frame_Shift_Ins	INS	ENST00000305045.2	37	c.737_738insT	CCDS32027.1																																																																																				0.490	OR4K14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410343.1			9	33	NA	NA	NA	NA	9	33	---	---	---	---
TP53	7157	broad.mit.edu	37	17	7578474	7578474	+	Frame_Shift_Del	DEL	C	C	-	rs137852790|rs137852791		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr17:7578474delC	ENST00000269305.4	-	5	645	c.456delG	c.(454-456)ccgfs	p.P153fs	TP53_ENST00000413465.2_Frame_Shift_Del_p.P153fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.P153fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.P153fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.P153fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.P153fs|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	153	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		P -> A (in sporadic cancers; somatic mutation).|P -> F (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|P -> H (in a sporadic cancer; somatic mutation).|P -> L (in sporadic cancers; somatic mutation).|P -> R (in a sporadic cancer; somatic mutation).|P -> S (in sporadic cancers; somatic mutation).|P -> T (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.P153fs*28(9)|p.0?(8)|p.T150fs*16(6)|p.P152P(5)|p.?(5)|p.P152fs*14(5)|p.P153fs*16(1)|p.P151_V173del23(1)|p.G154fs*16(1)|p.P152fs*27(1)|p.T57fs*16(1)|p.D148_T155delDSTPPPGT(1)|p.T150_P153delTPPP(1)|p.P153fs*20(1)|p.D148fs*23(1)|p.S149fs*72(1)|p.S149fs*17(1)|p.Q144_G154del11(1)|p.G154fs*27(1)|p.P152_P153insXXX(1)|p.Q144fs*16(1)|p.T18fs*16(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGGTGCCGGGCGGGGGTGTGG	0.612		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		54	Deletion - Frameshift(20)|Insertion - Frameshift(11)|Whole gene deletion(8)|Unknown(5)|Substitution - coding silent(5)|Deletion - In frame(4)|Insertion - In frame(1)	p.P152L(57)|p.P152S(21)|p.P152fs*18(17)|p.P153fs*28(8)|p.P152T(7)|p.0?(7)|p.P152fs*29(5)|p.P152P(5)|p.P152Q(4)|p.P152fs*14(4)|p.P152fs*28(3)|p.P152R(3)|p.T150fs*16(3)|p.P152A(2)|p.P153fs*16(1)|p.P151_V173del23(1)|p.P152_P153del(1)|p.G154fs*16(1)|p.D148_T155delDSTPPPGT(1)|p.T150_P153delTPPP(1)|p.P153fs*20(1)|p.D148fs*23(1)|p.P152del(1)|p.S149fs*72(1)|p.S149fs*17(1)|p.Q144_G154del11(1)|p.G154fs*27(1)|p.P152_P153insXXX(1)	ovary(9)|large_intestine(6)|skin(6)|stomach(5)|bone(5)|upper_aerodigestive_tract(4)|haematopoietic_and_lymphoid_tissue(4)|central_nervous_system(3)|breast(3)|oesophagus(3)|urinary_tract(2)|soft_tissue(1)|lung(1)|prostate(1)|liver(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245	GRCh37	CI920955	TP53	I		c.(454-456)CCGfs	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							50.0	51.0	50.0					17																	7578474		2203	4300	6503	SO:0001589	frameshift_variant	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7578474delC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.456delG	17.37:g.7578474delC	ENSP00000269305:p.Pro153fs	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)	Somatic				TP53_uc002gig.1_Frame_Shift_Del_p.P152fs|TP53_uc002gih.2_Frame_Shift_Del_p.P152fs|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Frame_Shift_Del_p.P20fs|TP53_uc010cng.1_Frame_Shift_Del_p.P20fs|TP53_uc002gii.1_Frame_Shift_Del_p.P20fs|TP53_uc010cnh.1_Frame_Shift_Del_p.P152fs|TP53_uc010cni.1_Frame_Shift_Del_p.P152fs|TP53_uc002gij.2_Frame_Shift_Del_p.P152fs|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Frame_Shift_Del_p.P59fs|TP53_uc002gio.2_Frame_Shift_Del_p.P20fs|TP53_uc010vug.1_Frame_Shift_Del_p.P113fs	p.P152fs	NM_001126112	NP_001119584	WXS	Illumina HiSeq	Unspecified	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	5	650	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	152		P -> R (in sporadic cancers; somatic mutation).|P -> T (in sporadic cancers; somatic mutation).|P -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|P -> Q (in sporadic cancers; somatic mutation).|P -> S (in sporadic cancers; somatic mutation).|P -> A (in sporadic cancers; somatic mutation).	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	37	c.456delG	CCDS11118.1																																																																																				0.612	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		13	52	NA	NA	NA	NA	13	52	---	---	---	---
IZUMO2	126123	broad.mit.edu	37	19	50666294	50666295	+	Frame_Shift_Del	DEL	GC	GC	-	rs545804811		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr19:50666294_50666295delGC	ENST00000293405.3	-	1	157_158	c.157_158delGC	c.(157-159)gccfs	p.A53fs		NM_152358.2	NP_689571.2	Q6UXV1	IZUM2_HUMAN	IZUMO family member 2	53						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	7						CACGGCCCCGGCGCGCGCCTGC	0.668																																						uc002prp.1		NA																	0					0						c.(157-159)GCCfs		hypothetical protein LOC126123 precursor																																				SO:0001589	frameshift_variant	126123					integral to membrane		g.chr19:50666294_50666295delGC	AY358196	CCDS12792.2	19q13.33	2014-02-17	2010-07-29	2010-07-29	ENSG00000161652	ENSG00000161652		"""-"""	28518	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 41"""	C19orf41		19658160, 22957301	Standard	XM_006723007		Approved	MGC33947, SCRL	uc002prp.1	Q6UXV1	OTTHUMG00000074063	ENST00000293405.3:c.157_158delGC	19.37:g.50666300_50666301delGC	ENSP00000293405:p.Ala53fs		Somatic					p.A53fs	NM_152358	NP_689571	WXS	Illumina HiSeq	Unspecified	Q6UXV1	IZUM2_HUMAN		GBM - Glioblastoma multiforme(134;0.00364)|OV - Ovarian serous cystadenocarcinoma(262;0.0052)	1	244_245	-		all_neural(266;0.0459)|Ovarian(192;0.0728)	53			Extracellular (Potential).		Q5GRG3|Q5GRG4|Q6ZNM5|Q8NHR8	Frame_Shift_Del	DEL	ENST00000293405.3	37	c.157_158delGC	CCDS12792.2																																																																																				0.668	IZUMO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157232.1	NM_152358		13	37	NA	NA	NA	NA	13	37	---	---	---	---
CCNT2	905	broad.mit.edu	37	2	135711427	135711427	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr2:135711427delG	ENST00000264157.5	+	9	1432	c.1402delG	c.(1402-1404)gggfs	p.G468fs	CCNT2_ENST00000537343.1_Frame_Shift_Del_p.G293fs|CCNT2_ENST00000295238.6_Frame_Shift_Del_p.G468fs	NM_001241.3|NM_058241.2	NP_001232.1|NP_490595.1	O60583	CCNT2_HUMAN	cyclin T2	468					cell cycle (GO:0007049)|cell division (GO:0051301)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(2)|kidney(3)|large_intestine(10)|lung(6)|ovary(2)|prostate(1)|skin(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.107)		GCACAAACAAGGGCAGTCACA	0.388																																						uc002tuc.1		NA																	0				ovary(2)|lung(1)	3						c.(1402-1404)GGGfs		cyclin T2 isoform b							49.0	51.0	50.0					2																	135711427		2203	4300	6503	SO:0001589	frameshift_variant	905				cell cycle|cell division|interspecies interaction between organisms|regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	protein kinase binding	g.chr2:135711427delG	AF048731	CCDS2174.1, CCDS2175.1	2q21.3	2010-11-15			ENSG00000082258	ENSG00000082258			1600	protein-coding gene	gene with protein product		603862				9499409, 10465067	Standard	NM_001241		Approved		uc002tuc.2	O60583	OTTHUMG00000131712	ENST00000264157.5:c.1402delG	2.37:g.135711427delG	ENSP00000264157:p.Gly468fs		Somatic				CCNT2_uc002tub.1_Frame_Shift_Del_p.G468fs|CCNT2_uc010zbf.1_Frame_Shift_Del_p.G293fs|CCNT2_uc002tud.1_Frame_Shift_Del_p.G131fs	p.G468fs	NM_058241	NP_490595	WXS	Illumina HiSeq	Unspecified	O60583	CCNT2_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.107)	9	1434	+			468					A8KA48|D3DP73|D3DP74|O60582|Q29R66|Q53SR4|Q5I1Y0	Frame_Shift_Del	DEL	ENST00000264157.5	37	c.1402delG	CCDS2174.1																																																																																				0.388	CCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254629.1	NM_058241		13	71	NA	NA	NA	NA	13	71	---	---	---	---
GZF1	64412	broad.mit.edu	37	20	23346248	23346248	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr20:23346248delG	ENST00000338121.5	+	2	1305	c.1228delG	c.(1228-1230)ggcfs	p.G410fs	GZF1_ENST00000542987.1_Intron|GZF1_ENST00000377051.2_Frame_Shift_Del_p.G410fs|GZF1_ENST00000544236.1_Intron|GZF1_ENST00000461789.1_3'UTR			Q9H116	GZF1_HUMAN	GDNF-inducible zinc finger protein 1	410					branching involved in ureteric bud morphogenesis (GO:0001658)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)|sequence-specific DNA binding (GO:0043565)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(7)|prostate(1)|urinary_tract(2)	24	Lung NSC(19;0.0605)|Colorectal(13;0.0993)|all_lung(19;0.135)					GCACCGCTGCGGCCAGTGCGG	0.682																																						uc010gdb.2		NA																	0				kidney(1)	1						c.(1228-1230)GGCfs		GDNF-inducible zinc finger protein 1							43.0	41.0	42.0					20																	23346248		2200	4291	6491	SO:0001589	frameshift_variant	64412				transcription, DNA-dependent	nucleolus|nucleoplasm	sequence-specific DNA binding|zinc ion binding	g.chr20:23346248delG	AK025447	CCDS13151.1	20p11.21	2013-01-09	2006-09-19	2006-09-19	ENSG00000125812	ENSG00000125812		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	15808	protein-coding gene	gene with protein product		613842	"""zinc finger protein 336"""	ZNF336		14522971, 16049025	Standard	NM_022482		Approved	dJ322G13.2, ZBTB23	uc002wsz.3	Q9H116	OTTHUMG00000032069	ENST00000338121.5:c.1228delG	20.37:g.23346248delG	ENSP00000338290:p.Gly410fs		Somatic				GZF1_uc002wsy.2_Frame_Shift_Del_p.G410fs|GZF1_uc010zsq.1_Intron|GZF1_uc010zsr.1_Intron|GZF1_uc002wsz.2_Frame_Shift_Del_p.G410fs	p.G410fs	NM_022482	NP_071927	WXS	Illumina HiSeq	Unspecified	Q9H116	GZF1_HUMAN			3	1402	+	Lung NSC(19;0.0605)|Colorectal(13;0.0993)|all_lung(19;0.135)		410			C2H2-type 4.		A8K199|B2RBC3|B3KPL4|B4DF58|D3DW39|Q54A22|Q96N08|Q9BQK9|Q9H117|Q9H6W6	Frame_Shift_Del	DEL	ENST00000338121.5	37	c.1228delG	CCDS13151.1																																																																																				0.682	GZF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078333.1	NM_022482		27	78	NA	NA	NA	NA	27	78	---	---	---	---
CEP70	80321	broad.mit.edu	37	3	138289944	138289944	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:138289944delC	ENST00000264982.3	-	5	482	c.216delG	c.(214-216)ttgfs	p.L73fs	CEP70_ENST00000484888.1_Frame_Shift_Del_p.L73fs|CEP70_ENST00000542237.1_Frame_Shift_Del_p.L53fs|CEP70_ENST00000489254.1_Intron|CEP70_ENST00000481834.1_Frame_Shift_Del_p.L73fs|CEP70_ENST00000464035.1_Frame_Shift_Del_p.L73fs|CEP70_ENST00000478673.1_5'UTR	NM_024491.2	NP_077817.2	Q8NHQ1	CEP70_HUMAN	centrosomal protein 70kDa	73					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(6)|skin(3)	24						CTTCCACCAACAATTTCAAAT	0.303																																						uc003esl.2		NA																	0				skin(1)	1						c.(214-216)TTGfs		centrosomal protein 70 kDa							79.0	78.0	78.0					3																	138289944		2202	4295	6497	SO:0001589	frameshift_variant	80321				G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding	g.chr3:138289944delC	AF202146	CCDS3102.1, CCDS75022.1, CCDS75023.1, CCDS75024.1	3q22.3	2014-02-20			ENSG00000114107	ENSG00000114107			29972	protein-coding gene	gene with protein product		614310				14654843	Standard	XM_005247802		Approved	BITE, FLJ13036	uc003esl.3	Q8NHQ1	OTTHUMG00000159891	ENST00000264982.3:c.216delG	3.37:g.138289944delC	ENSP00000264982:p.Leu73fs		Somatic				CEP70_uc011bmk.1_Frame_Shift_Del_p.L52fs|CEP70_uc011bml.1_Frame_Shift_Del_p.L54fs|CEP70_uc011bmm.1_Intron|CEP70_uc003esm.2_Frame_Shift_Del_p.L72fs|CEP70_uc003esn.2_Frame_Shift_Del_p.L72fs	p.L72fs	NM_024491	NP_077817	WXS	Illumina HiSeq	Unspecified	Q8NHQ1	CEP70_HUMAN			5	414	-			72					B7Z5I8|B7Z7E8|D3DNE9|F5GZX8|Q96B31|Q9H2C3|Q9H2Z1|Q9H940	Frame_Shift_Del	DEL	ENST00000264982.3	37	c.216delG	CCDS3102.1																																																																																				0.303	CEP70-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000358001.1	NM_024491		9	75	NA	NA	NA	NA	9	75	---	---	---	---
PLSCR5	389158	broad.mit.edu	37	3	146307593	146307593	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr3:146307593delG	ENST00000443512.1	-	6	1627	c.624delC	c.(622-624)accfs	p.T208fs	PLSCR5_ENST00000482567.1_Frame_Shift_Del_p.T196fs|PLSCR5-AS1_ENST00000473817.1_RNA|PLSCR5_ENST00000492200.1_Frame_Shift_Del_p.T208fs	NM_001085420.1	NP_001078889.1	A0PG75	PLS5_HUMAN	phospholipid scramblase family, member 5	208										endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|urinary_tract(1)	12						TTTCATTAATGGTTTTCACCT	0.318																																						uc003ewb.2		NA																	0					0						c.(622-624)ACCfs		phospholipid scramblase family, member 5							90.0	88.0	89.0					3																	146307593		1806	4063	5869	SO:0001589	frameshift_variant	389158							g.chr3:146307593delG	AY436642	CCDS46931.1	3q24	2004-06-28			ENSG00000231213	ENSG00000231213			19952	protein-coding gene	gene with protein product							Standard	NM_001085420		Approved		uc010hvc.3	A0PG75	OTTHUMG00000159437	ENST00000443512.1:c.624delC	3.37:g.146307593delG	ENSP00000390111:p.Thr208fs		Somatic				PLSCR5_uc010hvb.2_Frame_Shift_Del_p.T196fs|PLSCR5_uc010hvc.2_Frame_Shift_Del_p.T208fs	p.T208fs	NM_001085420	NP_001078889	WXS	Illumina HiSeq	Unspecified	A0PG75	PLS5_HUMAN			6	1628	-			208					B2RXK5	Frame_Shift_Del	DEL	ENST00000443512.1	37	c.624delC	CCDS46931.1																																																																																				0.318	PLSCR5-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355365.1	XM_371670		22	138	NA	NA	NA	NA	22	138	---	---	---	---
SLC12A2	6558	broad.mit.edu	37	5	127510346	127510348	+	In_Frame_Del	DEL	ATT	ATT	-	rs149957408		TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr5:127510346_127510348delATT	ENST00000262461.2	+	20	3106_3108	c.2917_2919delATT	c.(2917-2919)attdel	p.I973del	SLC12A2_ENST00000343225.4_In_Frame_Del_p.I973del	NM_001046.2	NP_001037.1	P55011	S12A2_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 2	973					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|branching involved in mammary gland duct morphogenesis (GO:0060444)|chloride transmembrane transport (GO:1902476)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|gamma-aminobutyric acid signaling pathway (GO:0007214)|hyperosmotic response (GO:0006972)|ion transport (GO:0006811)|mammary duct terminal end bud growth (GO:0060763)|multicellular organism growth (GO:0035264)|positive regulation of cell volume (GO:0045795)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transepithelial ammonium transport (GO:0070634)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ammonium transmembrane transporter activity (GO:0008519)|sodium:potassium:chloride symporter activity (GO:0008511)			breast(3)|endometrium(5)|kidney(5)|large_intestine(12)|lung(16)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)|Quinethazone(DB01325)	TGAAAAACCAATTACACACAAAG	0.281																																						uc003kus.2		NA																	0				ovary(3)	3						c.(2917-2919)ATTdel		solute carrier family 12	Bumetanide(DB00887)|Potassium Chloride(DB00761)																																			SO:0001651	inframe_deletion	6558				potassium ion transport|sodium ion transport|transepithelial ammonium transport|transepithelial chloride transport	integral to plasma membrane|membrane fraction	ammonia transmembrane transporter activity|sodium:potassium:chloride symporter activity	g.chr5:127510346_127510348delATT		CCDS4144.1, CCDS58965.1	5q23.3	2014-06-13	2013-07-18		ENSG00000064651	ENSG00000064651		"""Solute carriers"""	10911	protein-coding gene	gene with protein product	"""bumetanide-sensitive sodium-(potassium)-chloride cotransporter 1"", ""basolateral Na-K-Cl symporter"", ""protein phosphatase 1, regulatory subunit 141"""	600840				7629105	Standard	NM_001256461		Approved	NKCC1, BSC, BSC2, PPP1R141	uc003kus.3	P55011	OTTHUMG00000128983	ENST00000262461.2:c.2917_2919delATT	5.37:g.127510346_127510348delATT	ENSP00000262461:p.Ile973del		Somatic				SLC12A2_uc010jdf.2_RNA|SLC12A2_uc010jdg.2_In_Frame_Del_p.I973del	p.I973del	NM_001046	NP_001037	WXS	Illumina HiSeq	Unspecified	P55011	S12A2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	20	3081_3083	+		all_cancers(142;0.0972)|Prostate(80;0.151)	973			Cytoplasmic (Potential).		Q8N713|Q8WWH7	In_Frame_Del	DEL	ENST00000262461.2	37	c.2917_2919delATT	CCDS4144.1																																																																																				0.281	SLC12A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250972.1	NM_001046		16	39	NA	NA	NA	NA	16	39	---	---	---	---
ZBED9	114821	broad.mit.edu	37	6	28539885	28539886	+	Frame_Shift_Ins	INS	-	-	A			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:28539885_28539886insA	ENST00000452236.2	-	4	4397_4398	c.3780_3781insT	c.(3778-3783)cttgctfs	p.A1261fs		NM_052923.1	NP_443155.1														NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						gcaatctcagcaagctcaggat	0.366																																						uc003nlo.2		NA																	0				ovary(1)	1						c.(3778-3783)CTTGCTfs		SCAN domain containing 3																																				SO:0001589	frameshift_variant	114821				DNA integration|viral reproduction	nucleus	DNA binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity	g.chr6:28539885_28539886insA																												ENST00000452236.2:c.3781dupT	6.37:g.28539887_28539887dupA	ENSP00000395259:p.Ala1261fs		Somatic					p.L1260fs	NM_052923	NP_443155	WXS	Illumina HiSeq	Unspecified	Q6R2W3	SCND3_HUMAN			4	4398_4399	-			1260_1261						Frame_Shift_Ins	INS	ENST00000452236.2	37	c.3780_3781insT	CCDS34355.1																																																																																				0.366	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000043551.3			19	83	NA	NA	NA	NA	19	83	---	---	---	---
TULP4	56995	broad.mit.edu	37	6	158914657	158914658	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr6:158914657_158914658delCT	ENST00000367097.3	+	10	3041_3042	c.1684_1685delCT	c.(1684-1686)ctcfs	p.L562fs	TULP4_ENST00000367094.2_Frame_Shift_Del_p.L562fs	NM_020245.4	NP_064630.2	Q9NRJ4	TULP4_HUMAN	tubby like protein 4	562					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(7)|kidney(2)|large_intestine(15)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		TGCTCAGGAGCTCTCCCGGTCC	0.649																																						uc003qrf.2		NA																	0				ovary(1)	1						c.(1684-1686)CTCfs		tubby like protein 4 isoform 1																																				SO:0001589	frameshift_variant	56995				intracellular signal transduction|response to nutrient	cytoplasm	protein binding|sequence-specific DNA binding transcription factor activity	g.chr6:158914657_158914658delCT		CCDS34561.1, CCDS34562.1	6q25-q26	2013-01-10			ENSG00000130338	ENSG00000130338		"""WD repeat domain containing"""	15530	protein-coding gene	gene with protein product						11595174	Standard	NM_020245		Approved	TUSP, KIAA1397	uc003qrf.3	Q9NRJ4	OTTHUMG00000015910	ENST00000367097.3:c.1684_1685delCT	6.37:g.158914659_158914660delCT	ENSP00000356064:p.Leu562fs		Somatic				TULP4_uc003qrg.2_Frame_Shift_Del_p.L562fs	p.L562fs	NM_020245	NP_064630	WXS	Illumina HiSeq	Unspecified	Q9NRJ4	TULP4_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)	10	3041_3042	+		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)	562					Q5T3M2|Q5T3M3|Q9HD22|Q9P2F0	Frame_Shift_Del	DEL	ENST00000367097.3	37	c.1684_1685delCT	CCDS34561.1																																																																																				0.649	TULP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042869.1	NM_020245		24	63	NA	NA	NA	NA	24	63	---	---	---	---
OGDH	4967	broad.mit.edu	37	7	44736099	44736100	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr7:44736099_44736100delAC	ENST00000222673.5	+	14	1885_1886	c.1843_1844delAC	c.(1843-1845)acafs	p.T615fs	OGDH_ENST00000439616.2_Frame_Shift_Del_p.T465fs|OGDH_ENST00000449767.1_Frame_Shift_Del_p.T611fs|OGDH_ENST00000444676.1_Frame_Shift_Del_p.T630fs|OGDH_ENST00000543843.1_Frame_Shift_Del_p.T566fs|OGDH_ENST00000447398.1_Frame_Shift_Del_p.T626fs	NM_002541.3	NP_002532.2	Q02218	ODO1_HUMAN	oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)	615					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|cerebellar cortex development (GO:0021695)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hippocampus development (GO:0021766)|lysine catabolic process (GO:0006554)|NADH metabolic process (GO:0006734)|olfactory bulb mitral cell layer development (GO:0061034)|pyramidal neuron development (GO:0021860)|small molecule metabolic process (GO:0044281)|striatum development (GO:0021756)|succinyl-CoA metabolic process (GO:0006104)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)|thalamus development (GO:0021794)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)|oxoglutarate dehydrogenase complex (GO:0045252)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (NAD+) activity (GO:0034602)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	36					Valproic Acid(DB00313)	GGATATTCTGACACACATCGGG	0.545																																						uc003tln.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(1843-1845)ACAfs		oxoglutarate dehydrogenase isoform 1 precursor	NADH(DB00157)																																			SO:0001589	frameshift_variant	4967				glycolysis|lysine catabolic process|tricarboxylic acid cycle	mitochondrial matrix|mitochondrial membrane	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding	g.chr7:44736099_44736100delAC	D10523	CCDS34627.1, CCDS47580.1, CCDS55107.1	7p13-p11.2	2010-11-23			ENSG00000105953	ENSG00000105953	1.2.4.2		8124	protein-coding gene	gene with protein product		613022				8020988, 1542694	Standard	NM_002541		Approved	E1k	uc003tln.3	Q02218	OTTHUMG00000155304	ENST00000222673.5:c.1843_1844delAC	7.37:g.44736103_44736104delAC	ENSP00000222673:p.Thr615fs		Somatic				OGDH_uc011kbx.1_Frame_Shift_Del_p.T611fs|OGDH_uc011kby.1_Frame_Shift_Del_p.T465fs|OGDH_uc003tlp.2_Frame_Shift_Del_p.T626fs|OGDH_uc011kbz.1_Frame_Shift_Del_p.T410fs|OGDH_uc003tlo.1_Frame_Shift_Del_p.T448fs	p.T615fs	NM_002541	NP_002532	WXS	Illumina HiSeq	Unspecified	Q02218	ODO1_HUMAN			14	1952_1953	+			615					B4E2U9|D3DVL0|E9PBM1|Q96DD3|Q9UDX0	Frame_Shift_Del	DEL	ENST00000222673.5	37	c.1843_1844delAC	CCDS34627.1																																																																																				0.545	OGDH-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339391.1			21	60	NA	NA	NA	NA	21	60	---	---	---	---
CDKN2A	1029	broad.mit.edu	37	9	21974693	21974693	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr9:21974693delC	ENST00000304494.5	-	1	404	c.134delG	c.(133-135)ggtfs	p.G45fs	CDKN2A_ENST00000530628.2_Intron|CDKN2A_ENST00000498628.2_Intron|CDKN2A_ENST00000579755.1_Intron|CDKN2A_ENST00000579122.1_Frame_Shift_Del_p.G45fs|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000361570.3_Intron|CDKN2A_ENST00000494262.1_Intron|CDKN2A_ENST00000498124.1_Frame_Shift_Del_p.G45fs|CDKN2A_ENST00000446177.1_Frame_Shift_Del_p.G45fs	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	45					cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(25)|p.G45fs*8(3)|p.G45D(2)|p.0(1)|p.V28_V51del(1)|p.G45del(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		CGGCCTCCGACCGTAACTATT	0.687		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																												uc003zpk.2		17																	1348	Whole gene deletion(1316)|Unknown(25)|Deletion - Frameshift(3)|Substitution - Missense(2)|Deletion - In frame(2)	p.0?(1112)|p.?(25)|p.G45fs*8(3)|p.G45D(2)|p.G45S(1)|p.V28_V51del(1)|p.G45del(1)	haematopoietic_and_lymphoid_tissue(278)|skin(168)|central_nervous_system(163)|lung(150)|urinary_tract(90)|bone(73)|soft_tissue(57)|pleura(52)|oesophagus(51)|upper_aerodigestive_tract(50)|ovary(34)|kidney(31)|pancreas(30)|breast(30)|thyroid(14)|biliary_tract(13)|NS(12)|stomach(12)|autonomic_ganglia(7)|meninges(7)|large_intestine(6)|liver(6)|salivary_gland(4)|thymus(4)|vulva(2)|endometrium(2)|prostate(2)	haematopoietic_and_lymphoid_tissue(647)|skin(419)|upper_aerodigestive_tract(414)|central_nervous_system(381)|lung(325)|pancreas(244)|oesophagus(230)|urinary_tract(225)|pleura(94)|liver(91)|soft_tissue(79)|bone(77)|ovary(76)|biliary_tract(71)|stomach(46)|breast(46)|kidney(39)|NS(28)|thyroid(24)|cervix(23)|meninges(18)|genital_tract(15)|endometrium(13)|prostate(11)|autonomic_ganglia(10)|salivary_gland(10)|large_intestine(9)|adrenal_gland(6)|eye(4)|vulva(2)|small_intestine(1)	3678						c.(133-135)GGTfs		cyclin-dependent kinase inhibitor 2A isoform 1							60.0	71.0	67.0					9																	21974693		2203	4300	6503	SO:0001589	frameshift_variant	1029	Uveal_Melanoma_Familial|Familial_Malignant_Melanoma_and_Tumors_of_the_Nervous_System|Hereditary_Melanoma			cell cycle arrest|cell cycle checkpoint|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of cell-matrix adhesion|negative regulation of cyclin-dependent protein kinase activity|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage apoptosis|positive regulation of smooth muscle cell apoptosis|Ras protein signal transduction|replicative senescence	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|NF-kappaB binding|protein binding|protein binding|protein kinase binding	g.chr9:21974693delC	L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.134delG	9.37:g.21974693delC	ENSP00000307101:p.Gly45fs	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)	Somatic				MTAP_uc003zpi.1_Intron|CDKN2A_uc003zpj.2_Frame_Shift_Del_p.G45fs|CDKN2A_uc010miu.2_RNA|CDKN2A_uc003zpl.2_Intron	p.G45fs	NM_000077	NP_000068	WXS	Illumina HiSeq	Unspecified	P42771	CD2A1_HUMAN		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)	1	346	-		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)	45			ANK 2.		A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Frame_Shift_Del	DEL	ENST00000304494.5	37	c.134delG	CCDS6510.1																																																																																				0.687	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000051915.1	NM_000077		56	100	NA	NA	NA	NA	56	100	---	---	---	---
RPL12	6136	broad.mit.edu	37	9	130210254	130210255	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chr9:130210254_130210255delTC	ENST00000361436.5	-	6	480_481	c.393_394delGA	c.(391-396)gagatcfs	p.EI131fs	RPL12_ENST00000497322.1_5'UTR|RPL12_ENST00000536368.1_Frame_Shift_Del_p.EI98fs|SNORA65_ENST00000364432.1_RNA	NM_000976.3	NP_000967.1	P30050	RL12_HUMAN	ribosomal protein L12	131					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|prostate(1)	4						GTCCCCAGGATCTCTTTAATGG	0.505																																						uc004bqy.1		NA																	0					0						c.(391-396)GAGATCfs		ribosomal protein L12																																				SO:0001589	frameshift_variant	6136				endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosol|ribosome	RNA binding|structural constituent of ribosome	g.chr9:130210254_130210255delTC		CCDS6872.1	9q34	2011-04-06			ENSG00000197958	ENSG00000197958		"""L ribosomal proteins"""	10302	protein-coding gene	gene with protein product		180475				8441690	Standard	NM_000976		Approved	L12	uc004bqy.2	P30050	OTTHUMG00000020704	ENST00000361436.5:c.393_394delGA	9.37:g.130210256_130210257delTC	ENSP00000354739:p.Glu131fs		Somatic				RPL12_uc004bqx.1_RNA|RPL12_uc004bqz.1_Frame_Shift_Del_p.E98fs	p.E131fs	NM_000976	NP_000967	WXS	Illumina HiSeq	Unspecified	P30050	RL12_HUMAN			6	481_482	-			131_132					Q5VVV2|Q6PB27	Frame_Shift_Del	DEL	ENST00000361436.5	37	c.393_394delGA	CCDS6872.1																																																																																				0.505	RPL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054189.1			12	92	NA	NA	NA	NA	12	92	---	---	---	---
DACH2	117154	broad.mit.edu	37	X	86069720	86069720	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chrX:86069720delA	ENST00000373125.4	+	10	1567	c.1567delA	c.(1567-1569)aaafs	p.K524fs	DACH2_ENST00000510272.1_Frame_Shift_Del_p.K305fs|DACH2_ENST00000508860.1_Frame_Shift_Del_p.K357fs|DACH2_ENST00000373131.1_Frame_Shift_Del_p.K511fs	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2	524	DACHbox-C.				development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						GAAGAAGGAGAAAAAAACCAA	0.428																																						uc004eew.2		NA																	0				ovary(4)|pancreas(1)	5						c.(1567-1569)AAAfs		dachshund 2 isoform a							58.0	55.0	56.0					X																	86069720		2203	4300	6503	SO:0001589	frameshift_variant	117154				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|nucleotide binding	g.chrX:86069720delA	AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.1567delA	X.37:g.86069720delA	ENSP00000362217:p.Lys524fs		Somatic				DACH2_uc004eex.2_Frame_Shift_Del_p.K510fs|DACH2_uc010nmq.2_Frame_Shift_Del_p.K389fs|DACH2_uc011mra.1_Frame_Shift_Del_p.K356fs|DACH2_uc010nmr.2_Frame_Shift_Del_p.K304fs|DACH2_uc004eey.2_Frame_Shift_Del_p.K216fs|DACH2_uc004eez.2_Frame_Shift_Del_p.K206fs	p.K523fs	NM_053281	NP_444511	WXS	Illumina HiSeq	Unspecified	Q96NX9	DACH2_HUMAN			10	1737	+			523			Potential.|DACHbox-C.		B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Frame_Shift_Del	DEL	ENST00000373125.4	37	c.1567delA	CCDS14455.1																																																																																				0.428	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359266.1	NM_053281		16	18	NA	NA	NA	NA	16	18	---	---	---	---
TSPAN6	7105	broad.mit.edu	37	X	99890221	99890221	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chrX:99890221delA	ENST00000373020.4	-	3	416	c.305delT	c.(304-306)ttgfs	p.L102fs	TSPAN6_ENST00000496771.1_5'UTR	NM_001278740.1|NM_001278741.1|NM_003270.2	NP_001265669.1|NP_001265670.1|NP_003261.1	O43657	TSN6_HUMAN	tetraspanin 6	102					negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of viral-induced cytoplasmic pattern recognition receptor signaling pathway (GO:0039532)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	signal transducer activity (GO:0004871)			endometrium(2)|kidney(3)|large_intestine(6)|ovary(1)	12						CAGTTCGACCAAAAAAACGAG	0.393																																						uc004ega.1		NA																	0				ovary(1)	1						c.(304-306)TTGfs		transmembrane 4 superfamily member 6							79.0	57.0	65.0					X																	99890221		2199	4292	6491	SO:0001589	frameshift_variant	7105				positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to membrane	signal transducer activity	g.chrX:99890221delA	AF043906	CCDS14470.1, CCDS76001.1	Xq22	2013-02-14	2005-03-21	2005-03-21	ENSG00000000003	ENSG00000000003		"""Tetraspanins"""	11858	protein-coding gene	gene with protein product		300191	"""transmembrane 4 superfamily member 6"""	TM4SF6		9782095	Standard	NM_003270		Approved	T245, TSPAN-6	uc004ega.1	O43657	OTTHUMG00000022002	ENST00000373020.4:c.305delT	X.37:g.99890221delA	ENSP00000362111:p.Leu102fs		Somatic				TSPAN6_uc010nna.1_Frame_Shift_Del_p.L8fs	p.L102fs	NM_003270	NP_003261	WXS	Illumina HiSeq	Unspecified	O43657	TSN6_HUMAN			3	408	-			102			Helical; (Potential).		Q54A42|Q6IAN9	Frame_Shift_Del	DEL	ENST00000373020.4	37	c.305delT	CCDS14470.1																																																																																				0.393	TSPAN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057483.1			11	7	NA	NA	NA	NA	11	7	---	---	---	---
PLXNB3	5365	broad.mit.edu	37	X	153034499	153034499	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CN-5360-01A-01D-1434-08	TCGA-CN-5360-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	174f1ea8-abcf-44ee-b17b-9687b3ab6dae	a0cd5de0-863d-4f83-b9c5-949162c0963c	g.chrX:153034499delG	ENST00000361971.5	+	5	1477	c.1363delG	c.(1363-1365)ggcfs	p.G455fs	U52111.14_ENST00000416854.1_RNA|PLXNB3_ENST00000538966.1_Frame_Shift_Del_p.G478fs|PLXNB3_ENST00000538776.1_Frame_Shift_Del_p.G108fs|PLXNB3_ENST00000538543.1_Intron|U52111.14_ENST00000434284.1_RNA|PLXNB3_ENST00000538282.1_Intron	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3	455	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					GGACAGCAGTGGCAGTCACCT	0.642																																						uc004fii.2		NA																	0				lung(1)	1						c.(1363-1365)GGCfs		plexin B3 isoform 1							61.0	52.0	55.0					X																	153034499		2202	4300	6502	SO:0001589	frameshift_variant	5365				axon guidance	integral to membrane|intracellular|plasma membrane	protein binding|receptor activity	g.chrX:153034499delG	AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.1363delG	X.37:g.153034499delG	ENSP00000355378:p.Gly455fs		Somatic				PLXNB3_uc011mzb.1_Intron|PLXNB3_uc011mzc.1_Frame_Shift_Del_p.G137fs|PLXNB3_uc010nuk.2_Frame_Shift_Del_p.G478fs|PLXNB3_uc011mzd.1_Frame_Shift_Del_p.G94fs	p.G455fs	NM_005393	NP_005384	WXS	Illumina HiSeq	Unspecified	Q9ULL4	PLXB3_HUMAN			5	1537	+	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)		455			Extracellular (Potential).|Sema.		B7Z3E6|F5H773|Q9HDA4	Frame_Shift_Del	DEL	ENST00000361971.5	37	c.1363delG	CCDS14729.1																																																																																				0.642	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061063.1			27	22	NA	NA	NA	NA	27	22	---	---	---	---
