#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
UBR4	23352	broad.mit.edu	37	1	19524242	19524242	+	Missense_Mutation	SNP	C	C	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr1:19524242C>T	ENST00000375254.3	-	7	842	c.815G>A	c.(814-816)cGg>cAg	p.R272Q	UBR4_ENST00000375226.2_Missense_Mutation_p.R272Q|UBR4_ENST00000375267.2_Missense_Mutation_p.R272Q|UBR4_ENST00000375217.2_Missense_Mutation_p.R272Q	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	272					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		ATCTTGGAACCGATTGATATA	0.443																																						uc001bbi.2		NA																	0				kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25						c.(814-816)CGG>CAG		retinoblastoma-associated factor 600							181.0	173.0	176.0					1																	19524242		2203	4300	6503	SO:0001583	missense	23352				interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr1:19524242C>T	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.815G>A	1.37:g.19524242C>T	ENSP00000364403:p.Arg272Gln		Somatic					p.R272Q	NM_020765	NP_065816	WXS	Illumina HiSeq	Unspecified	Q5T4S7	UBR4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)	7	819	-		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)	272					A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	ENST00000375254.3	37	c.815G>A	CCDS189.1	.	.	.	.	.	.	.	.	.	.	C	33	5.254587	0.95336	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226	T;T;T;T	0.24350	1.87;1.87;1.86;1.86	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.36826	0.0981	N	0.22421	0.69	0.80722	D	1	D	0.64830	0.994	P	0.61201	0.885	T	0.11817	-1.0572	10	0.66056	D	0.02	.	18.6148	0.91299	0.0:1.0:0.0:0.0	.	272	Q5T4S7	UBR4_HUMAN	Q	272	ENSP00000364403:R272Q;ENSP00000364416:R272Q;ENSP00000364365:R272Q;ENSP00000364374:R272Q	ENSP00000364365:R272Q	R	-	2	0	UBR4	19396829	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.734000	0.68580	2.740000	0.93945	0.650000	0.86243	CGG		0.443	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765		47	22	0	0	0	0	47	22				
AKR7A2	8574	broad.mit.edu	37	1	19633547	19633547	+	Missense_Mutation	SNP	T	T	C			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr1:19633547T>C	ENST00000235835.3	-	5	758	c.737A>G	c.(736-738)cAg>cGg	p.Q246R	RNU6-1099P_ENST00000363533.1_RNA	NM_003689.3	NP_003680.2	O43488	ARK72_HUMAN	aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase)	246					carbohydrate metabolic process (GO:0005975)|cellular aldehyde metabolic process (GO:0006081)|daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|electron carrier activity (GO:0009055)|phenanthrene-9,10-epoxide hydrolase activity (GO:0019119)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00461)|BRCA - Breast invasive adenocarcinoma(304;1.83e-05)|Kidney(64;0.000167)|GBM - Glioblastoma multiforme(114;0.00115)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		GCCCACAGGCTGTTTCCCGTC	0.622																																						uc001bbw.2		NA																	0				central_nervous_system(1)	1						c.(736-738)CAG>CGG		aldo-keto reductase family 7, member A2							100.0	107.0	105.0					1																	19633547		2203	4300	6503	SO:0001583	missense	8574				carbohydrate metabolic process|cellular aldehyde metabolic process	Golgi apparatus	alditol:NADP+ 1-oxidoreductase activity|electron carrier activity	g.chr1:19633547T>C	AF026947	CCDS194.1	1p36.13	2010-09-30			ENSG00000053371	ENSG00000053371		"""Aldo-keto reductases"""	389	protein-coding gene	gene with protein product		603418				9576847	Standard	NM_003689		Approved	AFAR	uc001bbw.3	O43488	OTTHUMG00000002522	ENST00000235835.3:c.737A>G	1.37:g.19633547T>C	ENSP00000235835:p.Gln246Arg		Somatic				AKR7A2_uc001bbx.2_Missense_Mutation_p.Q211R	p.Q246R	NM_003689	NP_003680	WXS	Illumina HiSeq	Unspecified	O43488	ARK72_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00461)|BRCA - Breast invasive adenocarcinoma(304;1.83e-05)|Kidney(64;0.000167)|GBM - Glioblastoma multiforme(114;0.00115)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	5	759	-		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)	246					O75749|Q5TG63	Missense_Mutation	SNP	ENST00000235835.3	37	c.737A>G	CCDS194.1	.	.	.	.	.	.	.	.	.	.	T	16.36	3.102280	0.56183	.	.	ENSG00000053371	ENST00000235835;ENST00000330072	T;T	0.03920	3.76;3.76	5.17	5.17	0.71159	NADP-dependent oxidoreductase domain (3);	0.056128	0.64402	D	0.000001	T	0.03263	0.0095	N	0.04636	-0.2	0.50632	D	0.999882	B	0.23540	0.087	B	0.31191	0.125	T	0.56798	-0.7919	10	0.21014	T	0.42	.	14.1287	0.65238	0.0:0.0:0.0:1.0	.	246	O43488	ARK72_HUMAN	R	246;201	ENSP00000235835:Q246R;ENSP00000339084:Q201R	ENSP00000235835:Q246R	Q	-	2	0	AKR7A2	19506134	1.000000	0.71417	0.018000	0.16275	0.808000	0.45660	7.622000	0.83099	2.064000	0.61679	0.533000	0.62120	CAG		0.622	AKR7A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007165.2	NM_003689		3	70	0	0	0	0	3	70				
INADL	10207	broad.mit.edu	37	1	62234980	62234980	+	Missense_Mutation	SNP	T	T	C			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr1:62234980T>C	ENST00000371158.2	+	5	524	c.410T>C	c.(409-411)aTa>aCa	p.I137T	INADL_ENST00000316485.6_Missense_Mutation_p.I137T	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	137	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						TATATAGATATAGAACGGCCT	0.428																																						uc001dab.2		NA																	0				ovary(3)|skin(1)	4						c.(409-411)ATA>ACA		InaD-like							65.0	68.0	67.0					1																	62234980		2203	4300	6503	SO:0001583	missense	10207				intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding	g.chr1:62234980T>C	AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.410T>C	1.37:g.62234980T>C	ENSP00000360200:p.Ile137Thr		Somatic				INADL_uc009waf.1_Missense_Mutation_p.I137T|INADL_uc001daa.2_Missense_Mutation_p.I137T|INADL_uc001dad.3_5'Flank	p.I137T	NM_176877	NP_795352	WXS	Illumina HiSeq	Unspecified	Q8NI35	INADL_HUMAN			5	524	+			137			PDZ 1.		O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Missense_Mutation	SNP	ENST00000371158.2	37	c.410T>C	CCDS617.2	.	.	.	.	.	.	.	.	.	.	T	19.86	3.906033	0.72868	.	.	ENSG00000132849	ENST00000371158;ENST00000316485;ENST00000371156;ENST00000395513;ENST00000255202	T;T	0.42513	0.97;0.97	5.64	5.64	0.86602	PDZ/DHR/GLGF (3);	0.081738	0.51477	D	0.000095	T	0.67297	0.2878	M	0.80422	2.495	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.97110	0.999;1.0;1.0	T	0.72411	-0.4302	10	0.87932	D	0	.	15.8441	0.78874	0.0:0.0:0.0:1.0	.	137;137;137	F8W8T2;Q8NI35;Q8NI35-4	.;INADL_HUMAN;.	T	137	ENSP00000360200:I137T;ENSP00000326199:I137T	ENSP00000255202:I137T	I	+	2	0	INADL	62007568	1.000000	0.71417	0.894000	0.35097	0.729000	0.41735	7.197000	0.77814	2.142000	0.66516	0.482000	0.46254	ATA		0.428	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023639.2	NM_170605		9	32	0	0	0	0	9	32				
MCOLN2	255231	broad.mit.edu	37	1	85403472	85403472	+	Missense_Mutation	SNP	C	C	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr1:85403472C>T	ENST00000370608.3	-	11	1368	c.1301G>A	c.(1300-1302)tGt>tAt	p.C434Y	MCOLN2_ENST00000284027.5_Missense_Mutation_p.C406Y|MCOLN2_ENST00000531325.1_5'UTR	NM_153259.2	NP_694991.2	Q8IZK6	MCLN2_HUMAN	mucolipin 2	434					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	18				all cancers(265;0.0111)|Epithelial(280;0.0263)|OV - Ovarian serous cystadenocarcinoma(397;0.217)		AATCCAGCCACAGAATGTGTA	0.463																																						uc001dkm.2		NA																	0				ovary(3)|upper_aerodigestive_tract(1)	4						c.(1300-1302)TGT>TAT		mucolipin 2							102.0	88.0	93.0					1																	85403472		2203	4300	6503	SO:0001583	missense	255231					integral to membrane	ion channel activity	g.chr1:85403472C>T	AK094010	CCDS30762.1	1p22	2011-12-16			ENSG00000153898	ENSG00000153898		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13357	protein-coding gene	gene with protein product		607399				16382100	Standard	XM_005270719		Approved	TRPML2, FLJ36691, TRP-ML2	uc001dkm.3	Q8IZK6	OTTHUMG00000009954	ENST00000370608.3:c.1301G>A	1.37:g.85403472C>T	ENSP00000359640:p.Cys434Tyr		Somatic				MCOLN2_uc001dkn.2_RNA	p.C434Y	NM_153259	NP_694991	WXS	Illumina HiSeq	Unspecified	Q8IZK6	MCLN2_HUMAN		all cancers(265;0.0111)|Epithelial(280;0.0263)|OV - Ovarian serous cystadenocarcinoma(397;0.217)	11	1542	-			434			Helical; (Potential).		A6NI99|Q2M3I6|Q5TAG5|Q8N9R3	Missense_Mutation	SNP	ENST00000370608.3	37	c.1301G>A	CCDS30762.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.934837	0.92458	.	.	ENSG00000153898	ENST00000370608;ENST00000284027	T;T	0.69435	-0.4;-0.4	6.07	6.07	0.98685	Polycystin cation channel, PKD1/PKD2 (1);	0.000000	0.85682	D	0.000000	D	0.84329	0.5448	M	0.88450	2.955	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85549	0.1220	10	0.87932	D	0	-35.0524	20.6439	0.99570	0.0:1.0:0.0:0.0	.	434	Q8IZK6	MCLN2_HUMAN	Y	434;406	ENSP00000359640:C434Y;ENSP00000284027:C406Y	ENSP00000284027:C406Y	C	-	2	0	MCOLN2	85176060	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.487000	0.81328	2.890000	0.99128	0.650000	0.86243	TGT		0.463	MCOLN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027567.2	NM_153259		16	7	0	0	0	0	16	7				
CELSR2	1952	broad.mit.edu	37	1	109801082	109801082	+	Silent	SNP	C	C	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr1:109801082C>T	ENST00000271332.3	+	2	3400	c.3339C>T	c.(3337-3339)tgC>tgT	p.C1113C		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	1113	Cadherin 9. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CCGCCCAGTGCGCGCTGCGTG	0.622																																					NSCLC(158;1285 2011 34800 34852 42084)	uc001dxa.3		NA																	0				ovary(4)|lung(3)|skin(1)	8						c.(3337-3339)TGC>TGT		cadherin EGF LAG seven-pass G-type receptor 2							34.0	26.0	29.0					1																	109801082		2202	4300	6502	SO:0001819	synonymous_variant	1952				dendrite morphogenesis|homophilic cell adhesion|neural plate anterior/posterior regionalization|neuropeptide signaling pathway|regulation of cell-cell adhesion|regulation of transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding	g.chr1:109801082C>T	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.3339C>T	1.37:g.109801082C>T			Somatic					p.C1113C	NM_001408	NP_001399	WXS	Illumina HiSeq	Unspecified	Q9HCU4	CELR2_HUMAN		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)	2	3400	+		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)	1113			Cadherin 9.|Extracellular (Potential).		Q5T2Y7|Q92566	Silent	SNP	ENST00000271332.3	37	c.3339C>T	CCDS796.1																																																																																				0.622	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408		3	5	0	0	0	0	3	5				
RBM15	64783	broad.mit.edu	37	1	110884036	110884036	+	Missense_Mutation	SNP	C	C	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr1:110884036C>T	ENST00000369784.3	+	1	2909	c.2009C>T	c.(2008-2010)tCt>tTt	p.S670F	RBM15_ENST00000487146.2_Missense_Mutation_p.S670F|RP5-1074L1.1_ENST00000449169.1_RNA|RBM15_ENST00000602849.1_Missense_Mutation_p.S670F	NM_022768.4	NP_073605.4	Q96T37	RBM15_HUMAN	RNA binding motif protein 15	670	Arg-rich.				negative regulation of myeloid cell differentiation (GO:0045638)|patterning of blood vessels (GO:0001569)|placenta blood vessel development (GO:0060674)|positive regulation of transcription of Notch receptor target (GO:0007221)|spleen development (GO:0048536)|ventricular septum morphogenesis (GO:0060412)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			ovary(3)	3		all_cancers(81;2.89e-06)|all_epithelial(167;2.96e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Breast(1374;0.0634)		BRCA - Breast invasive adenocarcinoma(282;0.000224)|Epithelial(280;0.000476)|Kidney(133;0.000539)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|all cancers(265;0.00144)|Lung(183;0.0238)|Colorectal(144;0.103)|LUSC - Lung squamous cell carcinoma(189;0.135)		TGCGCTCCTTCTCCTGACCGC	0.557			T	MKL1	acute megakaryocytic leukemia																																	uc001dzl.1		NA		Dom	yes		1	1p13	64783	T	RNA binding motif protein 15			L	MKL1		acute megakaryocytic leukemia		0				ovary(3)	3						c.(2008-2010)TCT>TTT		RNA binding motif protein 15							61.0	55.0	57.0					1																	110884036		2203	4300	6503	SO:0001583	missense	64783				interspecies interaction between organisms	nucleus	nucleotide binding|protein binding|RNA binding	g.chr1:110884036C>T	AF368063	CCDS822.1, CCDS59198.1	1p13	2013-02-12			ENSG00000162775	ENSG00000162775		"""RNA binding motif (RRM) containing"""	14959	protein-coding gene	gene with protein product	"""one twenty-two"""	606077				11431691, 11344311	Standard	NM_001201545		Approved	OTT, OTT1	uc001dzl.1	Q96T37	OTTHUMG00000011284	ENST00000369784.3:c.2009C>T	1.37:g.110884036C>T	ENSP00000358799:p.Ser670Phe		Somatic				RBM15_uc001dzm.1_Missense_Mutation_p.S670F|uc001dzj.2_5'Flank	p.S670F	NM_022768	NP_073605	WXS	Illumina HiSeq	Unspecified	Q96T37	RBM15_HUMAN		BRCA - Breast invasive adenocarcinoma(282;0.000224)|Epithelial(280;0.000476)|Kidney(133;0.000539)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|all cancers(265;0.00144)|Lung(183;0.0238)|Colorectal(144;0.103)|LUSC - Lung squamous cell carcinoma(189;0.135)	1	2092	+		all_cancers(81;2.89e-06)|all_epithelial(167;2.96e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Breast(1374;0.0634)	670			Arg-rich.		A1A693|Q3ZB86|Q4V760|Q5D058|Q5T613|Q86VW9|Q96PE4|Q96SC5|Q96SC6|Q96SC9|Q96SD0|Q96T38|Q9BRA5|Q9H6R8|Q9H9Y0	Missense_Mutation	SNP	ENST00000369784.3	37	c.2009C>T	CCDS822.1	.	.	.	.	.	.	.	.	.	.	C	13.17	2.156028	0.38021	.	.	ENSG00000162775	ENST00000369784	T	0.20738	2.05	4.87	4.87	0.63330	.	0.171732	0.28209	N	0.016186	T	0.07279	0.0184	N	0.19112	0.55	0.39662	D	0.970623	B;P	0.37864	0.343;0.61	B;B	0.35607	0.206;0.102	T	0.09487	-1.0672	10	0.59425	D	0.04	-10.0583	11.8614	0.52467	0.0:0.9162:0.0:0.0838	.	670;670	Q96T37-3;Q96T37	.;RBM15_HUMAN	F	670	ENSP00000358799:S670F	ENSP00000358799:S670F	S	+	2	0	RBM15	110685559	0.996000	0.38824	1.000000	0.80357	0.994000	0.84299	4.241000	0.58707	2.538000	0.85594	0.655000	0.94253	TCT		0.557	RBM15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000031114.2	NM_022768		19	29	0	0	0	0	19	29				
HRNR	388697	broad.mit.edu	37	1	152188022	152188022	+	Missense_Mutation	SNP	C	C	G			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr1:152188022C>G	ENST00000368801.2	-	3	6158	c.6083G>C	c.(6082-6084)aGc>aCc	p.S2028T	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	2028					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTGGCCACAGCTCGATGACTG	0.562																																						uc001ezt.1		NA																	0				skin(2)|ovary(1)	3						c.(6082-6084)AGC>ACC		hornerin							333.0	473.0	425.0					1																	152188022		2157	4164	6321	SO:0001583	missense	388697				keratinization		calcium ion binding|protein binding	g.chr1:152188022C>G	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.6083G>C	1.37:g.152188022C>G	ENSP00000357791:p.Ser2028Thr		Somatic					p.S2028T	NM_001009931	NP_001009931	WXS	Illumina HiSeq	Unspecified	Q86YZ3	HORN_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	6159	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		2028			22		Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	37	c.6083G>C	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	C	4.800	0.148785	0.09185	.	.	ENSG00000197915	ENST00000368801	T	0.01629	4.72	3.41	2.47	0.30058	.	.	.	.	.	T	0.00608	0.0020	L	0.38175	1.15	0.09310	N	1	D	0.53885	0.963	P	0.44359	0.447	T	0.43988	-0.9357	9	0.15952	T	0.53	.	4.1756	0.10349	0.2325:0.645:0.0:0.1224	.	2028	Q86YZ3	HORN_HUMAN	T	2028	ENSP00000357791:S2028T	ENSP00000357791:S2028T	S	-	2	0	HRNR	150454646	0.000000	0.05858	0.003000	0.11579	0.039000	0.13416	-0.048000	0.11944	0.742000	0.32697	0.505000	0.49811	AGC		0.562	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868		64	859	0	0	0	0	64	859				
UBAP2L	9898	broad.mit.edu	37	1	154223543	154223543	+	Missense_Mutation	SNP	G	G	A			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr1:154223543G>A	ENST00000361546.2	+	12	1282	c.1240G>A	c.(1240-1242)Gtg>Atg	p.V414M	UBAP2L_ENST00000271877.7_Missense_Mutation_p.V425M|UBAP2L_ENST00000343815.6_Missense_Mutation_p.V414M|UBAP2L_ENST00000428931.1_Missense_Mutation_p.V414M			Q14157	UBP2L_HUMAN	ubiquitin associated protein 2-like	414					binding of sperm to zona pellucida (GO:0007339)		poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(20)|ovary(1)|prostate(1)|urinary_tract(2)	50	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			TGATTCAGCAGTGCACAGCCC	0.483																																						uc001fep.3		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1240-1242)GTG>ATG		ubiquitin associated protein 2-like isoform a							77.0	80.0	79.0					1																	154223543		2203	4300	6503	SO:0001583	missense	9898				binding of sperm to zona pellucida		protein binding	g.chr1:154223543G>A	BC003170	CCDS1063.1, CCDS44229.1, CCDS72925.1	1q21.3	2008-02-05			ENSG00000143569	ENSG00000143569			29877	protein-coding gene	gene with protein product						8590280, 11230159	Standard	NM_014847		Approved	NICE-4, KIAA0144	uc001fep.4	Q14157	OTTHUMG00000035983	ENST00000361546.2:c.1240G>A	1.37:g.154223543G>A	ENSP00000355343:p.Val414Met		Somatic				UBAP2L_uc009wot.2_Missense_Mutation_p.V414M|UBAP2L_uc010pek.1_Missense_Mutation_p.V406M|UBAP2L_uc010pel.1_Missense_Mutation_p.V424M|UBAP2L_uc010pen.1_Missense_Mutation_p.V328M	p.V414M	NM_014847	NP_055662	WXS	Illumina HiSeq	Unspecified	Q14157	UBP2L_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.185)		13	1407	+	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		414					B4E0U8|Q5VU75|Q5VU76|Q9BTU3|Q9UGL2|Q9UGL3|Q9UGL4|Q9UGL5	Missense_Mutation	SNP	ENST00000361546.2	37	c.1240G>A	CCDS1063.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.207941	0.79240	.	.	ENSG00000143569	ENST00000343815;ENST00000428931;ENST00000271877;ENST00000361546	T;T;T;T	0.19394	2.29;2.3;2.15;2.3	5.52	5.52	0.82312	.	0.120882	0.56097	D	0.000031	T	0.25717	0.0626	N	0.24115	0.695	0.45390	D	0.998379	D;D;P;P;P	0.89917	0.985;1.0;0.514;0.514;0.61	P;D;P;P;B	0.83275	0.767;0.996;0.452;0.452;0.372	T	0.03728	-1.1009	10	0.87932	D	0	-1.3352	16.7488	0.85480	0.0:0.0:1.0:0.0	.	328;425;407;414;414	B4DZJ6;F8W726;Q14157-4;Q14157-1;Q14157	.;.;.;.;UBP2L_HUMAN	M	414;414;425;414	ENSP00000345308:V414M;ENSP00000389445:V414M;ENSP00000271877:V425M;ENSP00000355343:V414M	ENSP00000271877:V425M	V	+	1	0	UBAP2L	152490167	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.580000	0.60942	2.873000	0.98535	0.563000	0.77884	GTG		0.483	UBAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087673.1	NM_014847		32	54	0	0	0	0	32	54				
IQGAP3	128239	broad.mit.edu	37	1	156510539	156510539	+	Silent	SNP	G	G	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr1:156510539G>T	ENST00000361170.2	-	23	2710	c.2700C>A	c.(2698-2700)atC>atA	p.I900I	IQGAP3_ENST00000498755.1_5'Flank	NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	900					activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGCCAATCTTGATGTCCATGA	0.562																																						uc001fpf.2		NA																	0				ovary(5)|skin(1)	6						c.(2698-2700)ATC>ATA		IQ motif containing GTPase activating protein 3							171.0	123.0	139.0					1																	156510539		2203	4300	6503	SO:0001819	synonymous_variant	128239				small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity	g.chr1:156510539G>T	AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.2700C>A	1.37:g.156510539G>T			Somatic					p.I900I	NM_178229	NP_839943	WXS	Illumina HiSeq	Unspecified	Q86VI3	IQGA3_HUMAN			23	2775	-	all_hematologic(923;0.088)|Hepatocellular(266;0.158)		900					Q5T3H8	Silent	SNP	ENST00000361170.2	37	c.2700C>A	CCDS1144.1																																																																																				0.562	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080657.1	NM_178229		30	31	1	0	3.73e-12	6.19e-12	30	31				
FCRL4	83417	broad.mit.edu	37	1	157559108	157559108	+	Missense_Mutation	SNP	C	C	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr1:157559108C>T	ENST00000271532.1	-	3	328	c.193G>A	c.(193-195)Gaa>Aaa	p.E65K	FCRL4_ENST00000448509.2_5'Flank	NM_031282.2	NP_112572.1	Q96PJ5	FCRL4_HUMAN	Fc receptor-like 4	65	Ig-like C2-type 1.				immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(20)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	40	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)				GTCAACTTTTCTCCCCAGTAG	0.517																																						uc001fqw.2		NA																	0				ovary(2)|kidney(1)|skin(1)	4						c.(193-195)GAA>AAA		Fc receptor-like 4 precursor							107.0	93.0	97.0					1																	157559108		2203	4300	6503	SO:0001583	missense	83417					integral to membrane|plasma membrane	receptor activity	g.chr1:157559108C>T	AF343661	CCDS1166.1	1q21	2013-01-14			ENSG00000163518	ENSG00000163518		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18507	protein-coding gene	gene with protein product		605876				11290337, 11493702	Standard	NM_031282		Approved	FCRH4, IRTA1, IGFP2, CD307d	uc001fqw.3	Q96PJ5	OTTHUMG00000035488	ENST00000271532.1:c.193G>A	1.37:g.157559108C>T	ENSP00000271532:p.Glu65Lys		Somatic				FCRL4_uc010phy.1_RNA	p.E65K	NM_031282	NP_112572	WXS	Illumina HiSeq	Unspecified	Q96PJ5	FCRL4_HUMAN			3	329	-	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)	65			Extracellular (Potential).|Ig-like C2-type 1.		Q96PJ3|Q96RE0	Missense_Mutation	SNP	ENST00000271532.1	37	c.193G>A	CCDS1166.1	.	.	.	.	.	.	.	.	.	.	C	7.210	0.595208	0.13875	.	.	ENSG00000163518	ENST00000271532	T	0.12465	2.68	4.2	-8.41	0.00961	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.073720	0.07433	N	0.896042	T	0.02119	0.0066	L	0.31845	0.965	0.09310	N	1	B	0.29341	0.242	B	0.29353	0.101	T	0.24440	-1.0160	10	0.13108	T	0.6	.	10.6185	0.45465	0.0:0.1347:0.1903:0.675	.	65	Q96PJ5	FCRL4_HUMAN	K	65	ENSP00000271532:E65K	ENSP00000271532:E65K	E	-	1	0	FCRL4	155825732	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.399000	0.00484	-2.872000	0.00322	-0.262000	0.10625	GAA		0.517	FCRL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086180.1	NM_031282		8	53	0	0	0	0	8	53				
CD5L	922	broad.mit.edu	37	1	157805833	157805833	+	Missense_Mutation	SNP	C	C	A			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr1:157805833C>A	ENST00000368174.4	-	3	264	c.168G>T	c.(166-168)aaG>aaT	p.K56N	CD5L_ENST00000484609.1_5'UTR	NM_005894.2	NP_005885.1	O43866	CD5L_HUMAN	CD5 molecule-like	56	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	scavenger receptor activity (GO:0005044)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	52	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CAGCCACGTCCTTAATGTCCC	0.612																																						uc001frk.3		NA																	0				ovary(1)	1						c.(166-168)AAG>AAT		CD5 molecule-like precursor							120.0	121.0	121.0					1																	157805833		2203	4300	6503	SO:0001583	missense	922				apoptosis|cellular defense response	extracellular space|membrane	scavenger receptor activity	g.chr1:157805833C>A	U82812	CCDS1171.1	1q21-q23	2008-02-05	2006-03-28		ENSG00000073754	ENSG00000073754			1690	protein-coding gene	gene with protein product		602592	"""apoptosis inhibitor 6"", ""CD5 antigen-like (scavenger receptor cysteine rich family)"""	API6		9045627	Standard	NM_005894		Approved	Spalpha	uc001frk.4	O43866	OTTHUMG00000022440	ENST00000368174.4:c.168G>T	1.37:g.157805833C>A	ENSP00000357156:p.Lys56Asn		Somatic					p.K56N	NM_005894	NP_005885	WXS	Illumina HiSeq	Unspecified	O43866	CD5L_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.24)		3	311	-	all_hematologic(112;0.0378)		56			SRCR 1.		A8K7M5|Q6UX63	Missense_Mutation	SNP	ENST00000368174.4	37	c.168G>T	CCDS1171.1	.	.	.	.	.	.	.	.	.	.	C	0.013	-1.643230	0.00792	.	.	ENSG00000073754	ENST00000368174	T	0.35789	1.29	4.85	-9.7	0.00521	Speract/scavenger receptor (3);Speract/scavenger receptor-related (2);	1.423940	0.04569	N	0.392927	T	0.04497	0.0123	N	0.17631	0.505	0.09310	N	1	B	0.14805	0.011	B	0.19666	0.026	T	0.14117	-1.0484	10	0.10377	T	0.69	.	4.0939	0.09982	0.2052:0.1042:0.4908:0.1998	.	56	O43866	CD5L_HUMAN	N	56	ENSP00000357156:K56N	ENSP00000357156:K56N	K	-	3	2	CD5L	156072457	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-5.396000	0.00125	-1.829000	0.01201	-1.253000	0.01494	AAG		0.612	CD5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058346.1	NM_005894		6	167	1	0	0.00116845	0.0017736	6	167				
ADAMTS4	9507	broad.mit.edu	37	1	161163765	161163765	+	Missense_Mutation	SNP	C	C	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr1:161163765C>T	ENST00000367996.5	-	5	1936	c.1508G>A	c.(1507-1509)gGt>gAt	p.G503D	ADAMTS4_ENST00000478394.1_5'Flank	NM_005099.4	NP_005090.3	O75173	ATS4_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 4	503	Disintegrin.				defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|protease binding (GO:0002020)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(20)|ovary(4)|prostate(3)|skin(1)|urinary_tract(1)	43	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)		Tinzaparin(DB06822)	GCAGCGACCACCCATGCAGGC	0.652																																						uc001fyt.3		NA																	0				ovary(4)|central_nervous_system(1)	5						c.(1507-1509)GGT>GAT		ADAM metallopeptidase with thrombospondin type 1							29.0	33.0	31.0					1																	161163765		2202	4300	6502	SO:0001583	missense	9507				proteolysis|skeletal system development	extracellular space|proteinaceous extracellular matrix	metalloendopeptidase activity|protease binding|zinc ion binding	g.chr1:161163765C>T	AB014588	CCDS1223.1	1q31-q32	2008-02-05	2005-08-19		ENSG00000158859	ENSG00000158859		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	220	protein-coding gene	gene with protein product		603876	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 4"""			10094461	Standard	NM_005099		Approved	KIAA0688, ADAMTS-2, ADMP-1	uc001fyt.4	O75173	OTTHUMG00000034349	ENST00000367996.5:c.1508G>A	1.37:g.161163765C>T	ENSP00000356975:p.Gly503Asp		Somatic					p.G503D	NM_005099	NP_005090	WXS	Illumina HiSeq	Unspecified	O75173	ATS4_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00275)		5	1936	-	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		503			Disintegrin.		Q5VTW2|Q6P4Q8|Q6UWA8|Q9UN83	Missense_Mutation	SNP	ENST00000367996.5	37	c.1508G>A	CCDS1223.1	.	.	.	.	.	.	.	.	.	.	C	8.305	0.820811	0.16678	.	.	ENSG00000158859	ENST00000367996	T	0.62788	-0.0	5.41	4.49	0.54785	.	0.177583	0.38778	N	0.001577	T	0.18676	0.0448	N	0.11364	0.135	0.80722	D	1	B	0.06786	0.001	B	0.08055	0.003	T	0.14392	-1.0474	10	0.11485	T	0.65	.	8.1653	0.31222	0.1591:0.7617:0.0:0.0792	.	503	O75173	ATS4_HUMAN	D	503	ENSP00000356975:G503D	ENSP00000356975:G503D	G	-	2	0	ADAMTS4	159430389	0.972000	0.33761	0.997000	0.53966	0.994000	0.84299	1.929000	0.40114	1.502000	0.48669	0.561000	0.74099	GGT		0.652	ADAMTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083066.2	NM_005099		20	21	0	0	0	0	20	21				
RC3H1	149041	broad.mit.edu	37	1	173915954	173915954	+	Missense_Mutation	SNP	G	G	A			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr1:173915954G>A	ENST00000367696.2	-	16	3109	c.2758C>T	c.(2758-2760)Cac>Tac	p.H920Y	RC3H1_ENST00000258349.4_Missense_Mutation_p.H920Y|RC3H1_ENST00000367694.2_Missense_Mutation_p.H920Y			Q5TC82	RC3H1_HUMAN	ring finger and CCCH-type domains 1	920					B cell homeostasis (GO:0001782)|cytoplasmic mRNA processing body assembly (GO:0033962)|lymph node development (GO:0048535)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of germinal center formation (GO:0002635)|negative regulation of T-helper cell differentiation (GO:0045623)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|posttranscriptional regulation of gene expression (GO:0010608)|protein ubiquitination (GO:0016567)|regulation of germinal center formation (GO:0002634)|regulation of mRNA stability (GO:0043488)|regulation of T cell receptor signaling pathway (GO:0050856)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	50						CAGCCACCGTGGGTTCCATAT	0.368																																						uc001gju.3		NA																	0				ovary(2)	2						c.(2758-2760)CAC>TAC		roquin							68.0	71.0	70.0					1																	173915954		2203	4300	6503	SO:0001583	missense	149041				cytoplasmic mRNA processing body assembly|negative regulation of activated T cell proliferation|negative regulation of B cell proliferation|negative regulation of germinal center formation|negative regulation of T-helper cell differentiation|nuclear-transcribed mRNA catabolic process|regulation of mRNA stability|regulation of T cell receptor signaling pathway	cytoplasmic mRNA processing body|stress granule	mRNA 3'-UTR binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr1:173915954G>A	AK093501	CCDS30940.1, CCDS72987.1	1q25.1	2013-01-18	2010-09-15		ENSG00000135870	ENSG00000135870		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	29434	protein-coding gene	gene with protein product	"""KIAA2025 protein"""	609424	"""ring finger and CCCH-type zinc finger domains 1"""			15917799	Standard	XM_005244918		Approved	KIAA2025, roquin, RP5-1198E17.5, RNF198	uc001gju.4	Q5TC82	OTTHUMG00000037275	ENST00000367696.2:c.2758C>T	1.37:g.173915954G>A	ENSP00000356669:p.His920Tyr		Somatic				RC3H1_uc010pms.1_Missense_Mutation_p.H920Y|RC3H1_uc001gjv.2_Missense_Mutation_p.H920Y|RC3H1_uc010pmt.1_Missense_Mutation_p.H920Y	p.H920Y	NM_172071	NP_742068	WXS	Illumina HiSeq	Unspecified	Q5TC82	RC3H1_HUMAN			15	2845	-			920					B3KVK1|Q5W180|Q5W181|Q8IVE6|Q8N9V1	Missense_Mutation	SNP	ENST00000367696.2	37	c.2758C>T	CCDS30940.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.189879	0.78789	.	.	ENSG00000135870	ENST00000367696;ENST00000258349;ENST00000367694	T;T;T	0.52526	0.67;0.67;0.66	5.45	5.45	0.79879	.	0.046562	0.85682	D	0.000000	T	0.61198	0.2328	L	0.59436	1.845	0.80722	D	1	D;D;D;D	0.67145	0.993;0.993;0.996;0.993	D;D;D;D	0.75484	0.968;0.968;0.986;0.968	T	0.63310	-0.6666	10	0.66056	D	0.02	-17.4399	19.2973	0.94128	0.0:0.0:1.0:0.0	.	920;920;920;920	B9EGU6;B7ZMB3;Q5TC82-2;Q5TC82	.;.;.;RC3H1_HUMAN	Y	920	ENSP00000356669:H920Y;ENSP00000258349:H920Y;ENSP00000356667:H920Y	ENSP00000258349:H920Y	H	-	1	0	RC3H1	172182577	1.000000	0.71417	0.266000	0.24541	0.683000	0.39861	9.358000	0.97109	2.552000	0.86080	0.650000	0.86243	CAC		0.368	RC3H1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090733.2	NM_172071		16	35	0	0	0	0	16	35				
PLEKHA6	22874	broad.mit.edu	37	1	204226792	204226792	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr1:204226792G>A	ENST00000272203.3	-	9	1529	c.1213C>T	c.(1213-1215)Cag>Tag	p.Q405*	PLEKHA6_ENST00000414478.1_Nonsense_Mutation_p.Q425*	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	405										breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			TCTCGCAGCTGGTAGGCAGGG	0.652																																						uc001hau.2		NA																	0				ovary(3)|pancreas(1)	4						c.(1213-1215)CAG>TAG		phosphoinositol 3-phosphate-binding protein-3							13.0	14.0	14.0					1																	204226792		2199	4295	6494	SO:0001587	stop_gained	22874							g.chr1:204226792G>A	AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.1213C>T	1.37:g.204226792G>A	ENSP00000272203:p.Gln405*		Somatic				PLEKHA6_uc009xaw.1_Nonsense_Mutation_p.Q29*|PLEKHA6_uc009xax.1_Nonsense_Mutation_p.Q29*|PLEKHA6_uc009xay.1_Nonsense_Mutation_p.Q29*|PLEKHA6_uc009xaz.1_Nonsense_Mutation_p.Q29*|PLEKHA6_uc009xba.1_Nonsense_Mutation_p.Q29*|PLEKHA6_uc009xbb.1_Nonsense_Mutation_p.Q29*|PLEKHA6_uc009xbc.1_Nonsense_Mutation_p.Q29*	p.Q405*	NM_014935	NP_055750	WXS	Illumina HiSeq	Unspecified	Q9Y2H5	PKHA6_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)		9	1530	-	all_cancers(21;0.0222)|Breast(84;0.179)		405					A7MD51|Q5VTI6	Nonsense_Mutation	SNP	ENST00000272203.3	37	c.1213C>T	CCDS1444.1	.	.	.	.	.	.	.	.	.	.	G	39	7.473303	0.98306	.	.	ENSG00000143850	ENST00000272203;ENST00000414478	.	.	.	5.38	5.38	0.77491	.	0.208120	0.42053	D	0.000771	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-20.4814	12.4792	0.55831	0.0779:0.0:0.9221:0.0	.	.	.	.	X	405;425	.	ENSP00000272203:Q405X	Q	-	1	0	PLEKHA6	202493415	1.000000	0.71417	1.000000	0.80357	0.685000	0.39939	5.077000	0.64419	2.659000	0.90383	0.655000	0.94253	CAG		0.652	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087889.3	NM_014935		8	11	0	0	0	0	8	11				
SLC41A1	254428	broad.mit.edu	37	1	205779508	205779508	+	Missense_Mutation	SNP	G	G	A			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr1:205779508G>A	ENST00000367137.3	-	2	1076	c.62C>T	c.(61-63)tCt>tTt	p.S21F		NM_173854.4	NP_776253.3	Q8IVJ1	S41A1_HUMAN	solute carrier family 41 (magnesium transporter), member 1	21					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	17	Breast(84;0.0799)		BRCA - Breast invasive adenocarcinoma(75;0.0252)			AGAGCAGGGAGAGGCAGAAGG	0.612											OREG0014163	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										uc001hdh.1		NA																	0				skin(2)	2						c.(61-63)TCT>TTT		solute carrier family 41 member 1							72.0	76.0	75.0					1																	205779508		2203	4300	6503	SO:0001583	missense	254428					integral to membrane|plasma membrane	magnesium ion transmembrane transporter activity	g.chr1:205779508G>A	AJ514402	CCDS30988.1	1q32.1	2013-07-17	2013-07-17		ENSG00000133065	ENSG00000133065		"""Solute carriers"""	19429	protein-coding gene	gene with protein product		610801				12810078, 18367447	Standard	NM_173854		Approved	MgtE	uc001hdh.1	Q8IVJ1	OTTHUMG00000036000	ENST00000367137.3:c.62C>T	1.37:g.205779508G>A	ENSP00000356105:p.Ser21Phe		Somatic	OREG0014163	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2154		p.S21F	NM_173854	NP_776253	WXS	Illumina HiSeq	Unspecified	Q8IVJ1	S41A1_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.0252)		2	934	-	Breast(84;0.0799)		21					Q63HJ4|Q658Z5|Q659A4|Q6MZK2	Missense_Mutation	SNP	ENST00000367137.3	37	c.62C>T	CCDS30988.1	.	.	.	.	.	.	.	.	.	.	G	13.15	2.151668	0.38021	.	.	ENSG00000133065	ENST00000367137	T	0.32988	1.43	5.64	4.54	0.55810	.	0.699999	0.13659	N	0.371740	T	0.19685	0.0473	N	0.19112	0.55	0.09310	N	1	B	0.14438	0.01	B	0.12156	0.007	T	0.04440	-1.0951	10	0.48119	T	0.1	-28.4764	7.9543	0.30033	0.17:0.0:0.83:0.0	.	21	Q8IVJ1	S41A1_HUMAN	F	21	ENSP00000356105:S21F	ENSP00000356105:S21F	S	-	2	0	SLC41A1	204046131	0.892000	0.30473	0.995000	0.50966	0.982000	0.71751	2.591000	0.46163	2.662000	0.90505	0.555000	0.69702	TCT		0.612	SLC41A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087731.1			25	39	0	0	0	0	25	39				
OR2AK2	391191	broad.mit.edu	37	1	248128809	248128809	+	Missense_Mutation	SNP	T	T	C	rs187908111	byFrequency	TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr1:248128809T>C	ENST00000366480.3	+	1	275	c.176T>C	c.(175-177)aTg>aCg	p.M59T	OR2L13_ENST00000366478.2_Intron	NM_001004491.1	NP_001004491.1	Q8NG84	O2AK2_HUMAN	olfactory receptor, family 2, subfamily AK, member 2	59						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	36	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			GGAAATATCATGCTGATCCAC	0.448													.|||	5	0.000998403	0.0	0.0	5008	,	,		19908	0.005		0.0	False		,,,				2504	0.0				Melanoma(45;390 1181 23848 28461 41504)	uc010pzd.1		NA																	0				ovary(1)|breast(1)	2						c.(175-177)ATG>ACG		olfactory receptor, family 2, subfamily AK,							216.0	202.0	207.0					1																	248128809		2203	4300	6503	SO:0001583	missense	391191				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248128809T>C	BK004457	CCDS31102.1	1q44	2012-08-09			ENSG00000187080	ENSG00000187080		"""GPCR / Class A : Olfactory receptors"""	19569	protein-coding gene	gene with protein product				OR2AK1P			Standard	NM_001004491		Approved		uc010pzd.2	Q8NG84	OTTHUMG00000040201	ENST00000366480.3:c.176T>C	1.37:g.248128809T>C	ENSP00000355436:p.Met59Thr		Somatic				OR2L13_uc001ids.2_Intron	p.M59T	NM_001004491	NP_001004491	WXS	Illumina HiSeq	Unspecified	Q8NG84	O2AK2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0152)		1	176	+	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		59			Helical; Name=1; (Potential).		B2RND1|Q6IF05	Missense_Mutation	SNP	ENST00000366480.3	37	c.176T>C	CCDS31102.1	5	0.0022893772893772895	0	0.0	0	0.0	5	0.008741258741258742	0	0.0	.	2.872	-0.233716	0.05983	.	.	ENSG00000187080	ENST00000366480	T	0.00421	7.46	3.0	-6.0	0.02206	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00109	0.0003	N	0.01668	-0.77	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.33701	-0.9858	9	0.45353	T	0.12	.	6.2915	0.21063	0.0:0.4024:0.2377:0.3599	.	59	Q8NG84	O2AK2_HUMAN	T	59	ENSP00000355436:M59T	ENSP00000355436:M59T	M	+	2	0	OR2AK2	246195432	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	-0.853000	0.04303	-1.544000	0.01721	0.374000	0.22700	ATG		0.448	OR2AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096858.2	NM_001004491		18	221	0	0	0	0	18	221				
UPF2	26019	broad.mit.edu	37	10	12001352	12001352	+	Missense_Mutation	SNP	G	G	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr10:12001352G>T	ENST00000356352.2	-	11	2661	c.2188C>A	c.(2188-2190)Caa>Aaa	p.Q730K	UPF2_ENST00000397053.2_Missense_Mutation_p.Q730K|UPF2_ENST00000357604.5_Missense_Mutation_p.Q730K			Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog (yeast)	730	MIF4G 2.|Sufficient for interaction with UPF3A and UPF3B.				gene expression (GO:0010467)|liver development (GO:0001889)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(14)|lung(17)|ovary(2)|skin(3)|urinary_tract(2)	56		Renal(717;0.228)				CTCATCATTTGCTCCTGAAAT	0.363																																						uc001ila.2		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(2188-2190)CAA>AAA		UPF2 regulator of nonsense transcripts homolog							140.0	113.0	122.0					10																	12001352		2203	4300	6503	SO:0001583	missense	26019				mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	exon-exon junction complex|perinuclear region of cytoplasm	identical protein binding|RNA binding	g.chr10:12001352G>T	AB037829	CCDS7086.1	10p14-p13	2011-06-21			ENSG00000151461	ENSG00000151461			17854	protein-coding gene	gene with protein product	"""smg-3 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	605529				11073994, 11113196	Standard	NM_080599		Approved	RENT2, DKFZP434D222, KIAA1408, smg-3	uc001ilb.3	Q9HAU5	OTTHUMG00000017678	ENST00000356352.2:c.2188C>A	10.37:g.12001352G>T	ENSP00000348708:p.Gln730Lys		Somatic				UPF2_uc001ilb.2_Missense_Mutation_p.Q730K|UPF2_uc001ilc.2_Missense_Mutation_p.Q730K|UPF2_uc009xiz.1_Missense_Mutation_p.Q730K	p.Q730K	NM_080599	NP_542166	WXS	Illumina HiSeq	Unspecified	Q9HAU5	RENT2_HUMAN			11	2662	-		Renal(717;0.228)	730			MIF4G 2.|Sufficient for interaction with UPF3A and UPF3B.		A6NLJ5|D3DRS0|Q14BM1|Q5W0J4|Q8N8U1|Q9H1J2|Q9NWL1|Q9P2D9|Q9Y4M9	Missense_Mutation	SNP	ENST00000356352.2	37	c.2188C>A	CCDS7086.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.494889	0.85069	.	.	ENSG00000151461	ENST00000356352;ENST00000357604;ENST00000397053	T;T;T	0.21543	2.0;2.0;2.0	5.12	5.12	0.69794	MIF4G-like, type 3 (2);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.000000	0.85682	D	0.000000	T	0.26666	0.0652	M	0.64404	1.975	0.80722	D	1	P	0.45902	0.868	P	0.45753	0.492	T	0.10042	-1.0647	10	0.02654	T	1	.	18.5419	0.91031	0.0:0.0:1.0:0.0	.	730	Q9HAU5	RENT2_HUMAN	K	730	ENSP00000348708:Q730K;ENSP00000350221:Q730K;ENSP00000380244:Q730K	ENSP00000348708:Q730K	Q	-	1	0	UPF2	12041358	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.431000	0.97494	2.391000	0.81399	0.585000	0.79938	CAA		0.363	UPF2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046783.1			9	27	1	0	3.1e-07	4.95e-07	9	27				
DHTKD1	55526	broad.mit.edu	37	10	12126710	12126710	+	Missense_Mutation	SNP	A	A	C			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr10:12126710A>C	ENST00000263035.4	+	3	544	c.482A>C	c.(481-483)gAa>gCa	p.E161A	DHTKD1_ENST00000465617.1_Intron	NM_018706.5	NP_061176	Q96HY7	DHTK1_HUMAN	dehydrogenase E1 and transketolase domain containing 1	161					cell death (GO:0008219)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hematopoietic progenitor cell differentiation (GO:0002244)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(1)	44		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)			TTTACCACAGAAGAGCGAAAA	0.493																																						uc001ild.3		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(481-483)GAA>GCA		dehydrogenase E1 and transketolase domain							141.0	144.0	143.0					10																	12126710		2203	4300	6503	SO:0001583	missense	55526				glycolysis	mitochondrion	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding	g.chr10:12126710A>C	BC002477	CCDS7087.1	10p14	2003-11-24			ENSG00000181192	ENSG00000181192			23537	protein-coding gene	gene with protein product		614984				10997877	Standard	NM_018706		Approved	KIAA1630, MGC3090, DKFZP762M115	uc001ild.5	Q96HY7	OTTHUMG00000017677	ENST00000263035.4:c.482A>C	10.37:g.12126710A>C	ENSP00000263035:p.Glu161Ala		Somatic					p.E161A	NM_018706	NP_061176	WXS	Illumina HiSeq	Unspecified	Q96HY7	DHTK1_HUMAN	BRCA - Breast invasive adenocarcinoma(52;0.188)		3	581	+		Renal(717;0.228)	161					Q68CU5|Q9BUM8|Q9HCE2	Missense_Mutation	SNP	ENST00000263035.4	37	c.482A>C	CCDS7087.1	.	.	.	.	.	.	.	.	.	.	A	14.18	2.458186	0.43634	.	.	ENSG00000181192	ENST00000263035;ENST00000437298	T;T	0.17213	2.29;2.29	5.16	5.16	0.70880	.	0.092179	0.85682	D	0.000000	T	0.19525	0.0469	L	0.39566	1.225	0.80722	D	1	B	0.31968	0.349	B	0.36885	0.235	T	0.03315	-1.1049	10	0.72032	D	0.01	-12.6241	15.3045	0.73982	1.0:0.0:0.0:0.0	.	161	Q96HY7	DHTK1_HUMAN	A	161	ENSP00000263035:E161A;ENSP00000388163:E161A	ENSP00000263035:E161A	E	+	2	0	DHTKD1	12166716	1.000000	0.71417	1.000000	0.80357	0.528000	0.34623	8.813000	0.91963	2.084000	0.62774	0.496000	0.49642	GAA		0.493	DHTKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046777.1	NM_018706		45	92	0	0	0	0	45	92				
RET	5979	broad.mit.edu	37	10	43604571	43604571	+	Missense_Mutation	SNP	G	G	A			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr10:43604571G>A	ENST00000355710.3	+	6	1388	c.1156G>A	c.(1156-1158)Gcg>Acg	p.A386T	RET_ENST00000340058.5_Missense_Mutation_p.A386T	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	386					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	GGGCCCAGGAGCGGGCGTCCT	0.632		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma																												Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)	uc001jal.2		1	yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	5979	T|Mis|N|F	ret proto-oncogene	yes	Hirschsprung disease	"""E, O"""	H4|PRKAR1A|NCOA4|PCM1|GOLGA5|TRIM33|KTN1|TRIM27|HOOK3	medullary thyroid| papillary thyroid|pheochromocytoma	medullary thyroid| papillary thyroid|pheochromocytoma		0				thyroid(404)|adrenal_gland(20)|lung(9)|large_intestine(5)|breast(4)|ovary(4)|central_nervous_system(3)|urinary_tract(1)|NS(1)	451						c.(1156-1158)GCG>ACG		ret proto-oncogene isoform a	Sunitinib(DB01268)						74.0	70.0	72.0					10																	43604571		2203	4300	6503	SO:0001583	missense	5979	Multiple_Endocrine_Neoplasia_type_2B|Multiple_Endocrine_Neoplasia_type_2A|Familial_Medullary_Thyroid_Carcinoma	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	homophilic cell adhesion|positive regulation of metanephric glomerulus development|positive regulation of transcription, DNA-dependent|posterior midgut development	integral to membrane	ATP binding|calcium ion binding|transmembrane receptor protein tyrosine kinase activity	g.chr10:43604571G>A	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.1156G>A	10.37:g.43604571G>A	ENSP00000347942:p.Ala386Thr		Somatic				RET_uc001jak.1_Missense_Mutation_p.A386T|RET_uc010qez.1_Missense_Mutation_p.A132T	p.A386T	NM_020975	NP_066124	WXS	Illumina HiSeq	Unspecified	P07949	RET_HUMAN			6	1346	+		Ovarian(717;0.0423)	386			Extracellular (Potential).		A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Missense_Mutation	SNP	ENST00000355710.3	37	c.1156G>A	CCDS7200.1	.	.	.	.	.	.	.	.	.	.	G	5.621	0.299291	0.10622	.	.	ENSG00000165731	ENST00000355710;ENST00000340058;ENST00000535749	T;T	0.79247	-1.13;-1.25	3.74	-3.24	0.05094	.	0.735082	0.13546	N	0.379831	T	0.55481	0.1923	L	0.36672	1.1	0.09310	N	1	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.09377	0.0;0.0;0.004	T	0.39482	-0.9612	10	0.14252	T	0.57	.	0.3698	0.00378	0.2543:0.1526:0.3292:0.2639	.	132;386;386	B4DGX8;P07949;P07949-2	.;RET_HUMAN;.	T	386	ENSP00000347942:A386T;ENSP00000344798:A386T	ENSP00000344798:A386T	A	+	1	0	RET	42924577	0.140000	0.22579	0.001000	0.08648	0.608000	0.37181	0.001000	0.13038	-0.710000	0.05001	-0.311000	0.09066	GCG		0.632	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047694.2	NM_020975		20	23	0	0	0	0	20	23				
PCDH15	65217	broad.mit.edu	37	10	55849763	55849763	+	Missense_Mutation	SNP	C	C	A	rs373482210		TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr10:55849763C>A	ENST00000320301.6	-	16	2372	c.1978G>T	c.(1978-1980)Gtt>Ttt	p.V660F	PCDH15_ENST00000373955.1_Missense_Mutation_p.V660F|PCDH15_ENST00000395445.1_Missense_Mutation_p.V667F|PCDH15_ENST00000409834.1_Missense_Mutation_p.V271F|PCDH15_ENST00000395438.1_Missense_Mutation_p.V660F|PCDH15_ENST00000395430.1_Missense_Mutation_p.V660F|PCDH15_ENST00000395432.2_Missense_Mutation_p.V623F|PCDH15_ENST00000437009.1_Intron|PCDH15_ENST00000373965.2_Missense_Mutation_p.V667F|PCDH15_ENST00000395446.1_Missense_Mutation_p.V660F|PCDH15_ENST00000395433.1_Missense_Mutation_p.V638F|PCDH15_ENST00000373957.3_Missense_Mutation_p.V638F|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000414778.1_Missense_Mutation_p.V665F|PCDH15_ENST00000361849.3_Missense_Mutation_p.V660F	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	660	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				AGATTAAAAACTCTCTGAGGA	0.338										HNSCC(58;0.16)																												uc001jju.1		NA																	0				pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13						c.(1978-1980)GTT>TTT		protocadherin 15 isoform CD1-4 precursor							63.0	65.0	65.0					10																	55849763		2203	4298	6501	SO:0001583	missense	65217				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding	g.chr10:55849763C>A	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.1978G>T	10.37:g.55849763C>A	ENSP00000322604:p.Val660Phe	HNSCC(58;0.16)	Somatic				PCDH15_uc010qhq.1_Missense_Mutation_p.V665F|PCDH15_uc010qhr.1_Missense_Mutation_p.V660F|PCDH15_uc010qhs.1_Missense_Mutation_p.V672F|PCDH15_uc010qht.1_Missense_Mutation_p.V667F|PCDH15_uc010qhu.1_Missense_Mutation_p.V660F|PCDH15_uc001jjv.1_Missense_Mutation_p.V638F|PCDH15_uc010qhv.1_Missense_Mutation_p.V660F|PCDH15_uc010qhw.1_Missense_Mutation_p.V623F|PCDH15_uc010qhx.1_Intron|PCDH15_uc010qhy.1_Missense_Mutation_p.V665F|PCDH15_uc010qhz.1_Missense_Mutation_p.V660F|PCDH15_uc010qia.1_Missense_Mutation_p.V638F|PCDH15_uc010qib.1_Missense_Mutation_p.V638F|PCDH15_uc001jjw.2_Missense_Mutation_p.V660F	p.V660F	NM_033056	NP_149045	WXS	Illumina HiSeq	Unspecified	Q96QU1	PCD15_HUMAN			16	2373	-		Melanoma(3;0.117)|Lung SC(717;0.238)	660			Cadherin 6.|Extracellular (Potential).		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	37	c.1978G>T	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.036645	0.75617	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395446;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000373957;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000373955	T;T;T;T;T;T;T;T;T;T;T;T;T	0.51817	0.69;0.69;0.69;0.69;0.69;0.69;0.69;0.69;0.69;0.69;0.69;0.69;0.69	6.16	6.16	0.99307	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.60932	0.2307	L	0.35487	1.065	0.80722	D	1	D;D;D;B;D;D;P;D;D;B;D;D;D;D	0.76494	0.999;0.999;0.999;0.392;0.999;0.999;0.47;0.999;0.999;0.444;0.996;0.991;0.992;0.999	D;D;D;B;D;D;B;D;D;P;D;P;D;D	0.87578	0.998;0.979;0.979;0.374;0.99;0.998;0.42;0.969;0.954;0.574;0.979;0.865;0.972;0.979	T	0.58668	-0.7596	9	0.54805	T	0.06	.	18.6329	0.91366	0.0:1.0:0.0:0.0	.	638;660;660;665;623;660;660;667;667;660;665;660;638;660	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;A2A3D8;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	F	667;665;660;660;271;667;660;623;660;638;638;660;660;665;660	ENSP00000363076:V667F;ENSP00000410304:V665F;ENSP00000378826:V660F;ENSP00000386693:V271F;ENSP00000378832:V667F;ENSP00000378833:V660F;ENSP00000378820:V623F;ENSP00000354950:V660F;ENSP00000378821:V638F;ENSP00000363068:V638F;ENSP00000322604:V660F;ENSP00000378818:V660F;ENSP00000363066:V660F	ENSP00000322604:V660F	V	-	1	0	PCDH15	55519769	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	5.099000	0.64554	2.937000	0.99478	0.650000	0.86243	GTT		0.338	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056		29	94	1	0	8.89e-20	1.52e-19	29	94				
NUTM2D	728130	broad.mit.edu	37	10	89118157	89118157	+	Silent	SNP	T	T	C			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr10:89118157T>C	ENST00000381697.2	+	1	733	c.135T>C	c.(133-135)agT>agC	p.S45S	LINC00863_ENST00000439559.2_lincRNA|NUTM2D_ENST00000412718.1_Silent_p.S45S			Q5VT03	NTM2D_HUMAN	NUT family member 2D	45																	CGGTAGTCAGTGCCCAGCCTG	0.512																																						uc001kes.2		NA																	0					0						c.(133-135)AGT>AGC		hypothetical protein LOC728130							221.0	244.0	237.0					10																	89118157		1993	4190	6183	SO:0001819	synonymous_variant	728130							g.chr10:89118157T>C			10q23.31	2013-03-14	2013-03-14	2013-03-14	ENSG00000214562	ENSG00000214562			23447	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member D"""	FAM22D			Standard	NR_075100		Approved		uc001kes.3	Q5VT03	OTTHUMG00000018672	ENST00000381697.2:c.135T>C	10.37:g.89118157T>C			Somatic				FAM22D_uc009xte.1_Silent_p.S45S	p.S45S	NM_001009610	NP_001009610	WXS	Illumina HiSeq	Unspecified	Q5VT03	FA22D_HUMAN			1	681	+			45					A6NGV9	Silent	SNP	ENST00000381697.2	37	c.135T>C																																																																																					0.512	NUTM2D-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000470142.1	NR_075100		17	443	0	0	0	0	17	443				
DRD4	1815	broad.mit.edu	37	11	639780	639780	+	Silent	SNP	G	G	A			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr11:639780G>A	ENST00000176183.5	+	3	543	c.531G>A	c.(529-531)gtG>gtA	p.V177V	DRD4_ENST00000528733.1_3'UTR	NM_000797.3	NP_000788.2	P21917	DRD4_HUMAN	dopamine receptor D4	177					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adult locomotory behavior (GO:0008344)|arachidonic acid secretion (GO:0050482)|behavioral fear response (GO:0001662)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|cellular calcium ion homeostasis (GO:0006874)|circadian rhythm (GO:0007623)|dopamine metabolic process (GO:0042417)|dopamine receptor signaling pathway (GO:0007212)|fear response (GO:0042596)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of protein secretion (GO:0050709)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|olfactory learning (GO:0008355)|photoperiodism (GO:0009648)|positive regulation of dopamine uptake involved in synaptic transmission (GO:0051586)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of kinase activity (GO:0033674)|positive regulation of penile erection (GO:0060406)|positive regulation of sodium:proton antiporter activity (GO:0032417)|regulation of calcium-mediated signaling (GO:0050848)|regulation of circadian rhythm (GO:0042752)|regulation of dopamine metabolic process (GO:0042053)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of neurotransmitter secretion (GO:0046928)|response to amphetamine (GO:0001975)|response to histamine (GO:0034776)|response to steroid hormone (GO:0048545)|retina development in camera-type eye (GO:0060041)|short-term memory (GO:0007614)|social behavior (GO:0035176)|synaptic transmission, dopaminergic (GO:0001963)	cell cortex (GO:0005938)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)|vesicle membrane (GO:0012506)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)|identical protein binding (GO:0042802)|potassium channel regulator activity (GO:0015459)|SH3 domain binding (GO:0017124)			NS(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	4		all_cancers(49;1.69e-08)|all_epithelial(84;1.65e-05)|Breast(177;0.000231)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;4.36e-28)|Epithelial(43;2.59e-27)|OV - Ovarian serous cystadenocarcinoma(40;3.53e-21)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0234)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Dopamine(DB00988)|Iloperidone(DB04946)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Ziprasidone(DB00246)	TCAACGACGTGCGCGGCCGCG	0.726																																						uc001lqp.1		NA																	0					0						c.(529-531)GTG>GTA		dopamine receptor D4	Apomorphine(DB00714)|Clozapine(DB00363)|Olanzapine(DB00334)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Ropinirole(DB00268)|Thiethylperazine(DB00372)|Ziprasidone(DB00246)						31.0	23.0	26.0					11																	639780		2180	4292	6472	SO:0001819	synonymous_variant	1815				activation of MAPK activity|adult locomotory behavior|arachidonic acid secretion|behavioral fear response|behavioral response to cocaine|behavioral response to ethanol|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of cAMP biosynthetic process|negative regulation of protein secretion|positive regulation of sodium:hydrogen antiporter activity|regulation of dopamine metabolic process|regulation of inhibitory postsynaptic membrane potential|response to amphetamine|response to histamine|social behavior	integral to plasma membrane	dopamine D4 receptor activity|drug binding|potassium channel regulator activity|SH3 domain binding	g.chr11:639780G>A	L12398	CCDS7710.1	11p15.5	2012-08-08			ENSG00000069696	ENSG00000069696		"""GPCR / Class A : Dopamine receptors"""	3025	protein-coding gene	gene with protein product		126452					Standard	NM_000797		Approved		uc001lqp.2	P21917	OTTHUMG00000133312	ENST00000176183.5:c.531G>A	11.37:g.639780G>A			Somatic					p.V177V	NM_000797	NP_000788	WXS	Illumina HiSeq	Unspecified	P21917	DRD4_HUMAN		all cancers(45;4.36e-28)|Epithelial(43;2.59e-27)|OV - Ovarian serous cystadenocarcinoma(40;3.53e-21)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0234)|LUSC - Lung squamous cell carcinoma(625;0.0703)	3	531	+		all_cancers(49;1.69e-08)|all_epithelial(84;1.65e-05)|Breast(177;0.000231)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)	177			Extracellular (Potential).		B0M0J7|Q7Z7Q5|Q8NGM5	Silent	SNP	ENST00000176183.5	37	c.531G>A	CCDS7710.1																																																																																				0.726	DRD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257109.1	NM_000797		7	7	0	0	0	0	7	7				
OR51E2	81285	broad.mit.edu	37	11	4703785	4703785	+	Missense_Mutation	SNP	T	T	C			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr11:4703785T>C	ENST00000396950.3	-	2	396	c.157A>G	c.(157-159)Agc>Ggc	p.S53G		NM_030774.3	NP_110401.1	Q9H255	O51E2_HUMAN	olfactory receptor, family 51, subfamily E, member 2	53					cellular response to fatty acid (GO:0071398)|detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|positive regulation of blood pressure (GO:0045777)|positive regulation of renin secretion into blood stream (GO:1900135)|steroid hormone mediated signaling pathway (GO:0043401)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|signaling receptor activity (GO:0038023)|steroid hormone receptor activity (GO:0003707)			NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(3)	23		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;3e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00476)|LUSC - Lung squamous cell carcinoma(625;0.2)		GCGTGCAGGCTGCGTTCCGTC	0.512																																						uc001lzk.2		NA																	0				lung(3)|ovary(2)	5						c.(157-159)AGC>GGC		olfactory receptor, family 51, subfamily E,							117.0	98.0	105.0					11																	4703785		2201	4298	6499	SO:0001583	missense	81285				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4703785T>C	AY033942	CCDS7751.1	11p15	2012-08-09			ENSG00000167332	ENSG00000167332		"""GPCR / Class A : Olfactory receptors"""	15195	protein-coding gene	gene with protein product		611268				11118034	Standard	NM_030774		Approved	PSGR	uc001lzk.2	Q9H255	OTTHUMG00000133362	ENST00000396950.3:c.157A>G	11.37:g.4703785T>C	ENSP00000380153:p.Ser53Gly		Somatic					p.S53G	NM_030774	NP_110401	WXS	Illumina HiSeq	Unspecified	Q9H255	O51E2_HUMAN		Epithelial(150;3e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00476)|LUSC - Lung squamous cell carcinoma(625;0.2)	2	401	-		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)	53			Cytoplasmic (Potential).		B2RA63|Q6IF94	Missense_Mutation	SNP	ENST00000396950.3	37	c.157A>G	CCDS7751.1	.	.	.	.	.	.	.	.	.	.	T	8.258	0.810505	0.16537	.	.	ENSG00000167332	ENST00000396950;ENST00000532598	T;T	0.00441	7.41;7.41	5.0	5.0	0.66597	GPCR, rhodopsin-like superfamily (1);	0.347793	0.24766	N	0.035766	T	0.00580	0.0019	M	0.82056	2.57	0.09310	N	1	B	0.12630	0.006	B	0.14023	0.01	T	0.36114	-0.9761	10	0.87932	D	0	.	13.681	0.62484	0.0:0.0:0.0:1.0	.	53	Q9H255	O51E2_HUMAN	G	53	ENSP00000380153:S53G;ENSP00000432644:S53G	ENSP00000380153:S53G	S	-	1	0	OR51E2	4660361	0.967000	0.33354	0.988000	0.46212	0.107000	0.19398	2.386000	0.44380	2.112000	0.64535	0.533000	0.62120	AGC		0.512	OR51E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257198.1	NM_030774		3	77	0	0	0	0	3	77				
PTPRJ	5795	broad.mit.edu	37	11	48158579	48158579	+	Missense_Mutation	SNP	A	A	C			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr11:48158579A>C	ENST00000418331.2	+	10	2250	c.1898A>C	c.(1897-1899)gAt>gCt	p.D633A		NM_002843.3	NP_002834.3	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	633	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				contact inhibition (GO:0060242)|heart development (GO:0007507)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of vascular permeability (GO:0043116)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of cell adhesion (GO:0045785)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion (GO:0030155)|vasculogenesis (GO:0001570)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|mitogen-activated protein kinase binding (GO:0051019)|phosphatase activity (GO:0016791)|platelet-derived growth factor receptor binding (GO:0005161)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|endometrium(7)|kidney(7)|large_intestine(5)|lung(15)|ovary(1)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						TCCAACATTGATGTAAGTACC	0.398																																						uc001ngp.3		NA																	0				breast(3)|kidney(3)|ovary(1)|skin(1)	8						c.(1897-1899)GAT>GCT		protein tyrosine phosphatase, receptor type, J							129.0	118.0	121.0					11																	48158579		2201	4298	6499	SO:0001583	missense	5795				contact inhibition|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of T cell receptor signaling pathway|negative regulation of vascular permeability|platelet-derived growth factor receptor signaling pathway|positive chemotaxis|positive regulation of focal adhesion assembly|positive regulation of protein kinase B signaling cascade|positive regulation of survival gene product expression	cell surface|cell-cell junction|immunological synapse|integral to plasma membrane|ruffle membrane	beta-catenin binding|delta-catenin binding|gamma-catenin binding|mitogen-activated protein kinase binding|platelet-derived growth factor receptor binding|protein tyrosine phosphatase activity	g.chr11:48158579A>C	U10886	CCDS7945.1, CCDS44596.1	11p11.2	2013-02-11			ENSG00000149177	ENSG00000149177		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9673	protein-coding gene	gene with protein product		600925				7937872, 7994032	Standard	NM_001098503		Approved	DEP1, HPTPeta, CD148	uc001ngp.4	Q12913	OTTHUMG00000166573	ENST00000418331.2:c.1898A>C	11.37:g.48158579A>C	ENSP00000400010:p.Asp633Ala		Somatic				PTPRJ_uc010rhr.1_Missense_Mutation_p.D78A	p.D633A	NM_002843	NP_002834	WXS	Illumina HiSeq	Unspecified	Q12913	PTPRJ_HUMAN			10	2253	+			633			Extracellular (Potential).|Fibronectin type-III 7.		Q15255|Q6P4H4|Q8NHM2|Q9UDA9	Missense_Mutation	SNP	ENST00000418331.2	37	c.1898A>C	CCDS7945.1	.	.	.	.	.	.	.	.	.	.	A	7.811	0.715733	0.15306	.	.	ENSG00000149177	ENST00000418331	T	0.57107	0.42	6.06	-1.17	0.09648	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	T	0.29321	0.0730	N	0.22421	0.69	0.09310	N	1	B	0.14012	0.009	B	0.22152	0.038	T	0.20773	-1.0265	9	0.19590	T	0.45	.	0.6777	0.00869	0.4449:0.133:0.1633:0.2588	.	633	Q12913	PTPRJ_HUMAN	A	633	ENSP00000400010:D633A	ENSP00000400010:D633A	D	+	2	0	PTPRJ	48115155	0.007000	0.16637	0.000000	0.03702	0.013000	0.08279	0.650000	0.24858	-0.093000	0.12396	-0.250000	0.11733	GAT		0.398	PTPRJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390525.1			12	87	0	0	0	0	12	87				
MED17	9440	broad.mit.edu	37	11	93527025	93527025	+	Missense_Mutation	SNP	A	A	G			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr11:93527025A>G	ENST00000251871.3	+	4	1056	c.769A>G	c.(769-771)Atc>Gtc	p.I257V		NM_004268.4	NP_004259.3	Q9NVC6	MED17_HUMAN	mediator complex subunit 17	257					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			large_intestine(2)|lung(11)|ovary(1)	14		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				GTCTGCATATATCAAGGTATT	0.299																																						uc001pem.3		NA																	0				ovary(1)	1						c.(769-771)ATC>GTC		mediator complex subunit 17							71.0	71.0	71.0					11																	93527025		2201	4298	6499	SO:0001583	missense	9440				androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex|transcription factor complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	g.chr11:93527025A>G	AF104254	CCDS8295.1	11q21	2007-07-30	2007-07-30	2007-07-30	ENSG00000042429	ENSG00000042429			2375	protein-coding gene	gene with protein product		603810	"""cofactor required for Sp1 transcriptional activation, subunit 6 (77kD)"", ""cofactor required for Sp1 transcriptional activation, subunit 6, 77kDa"""	CRSP6		9989412, 10198638	Standard	NM_004268		Approved	CRSP77, TRAP80, DRIP80	uc001pem.4	Q9NVC6	OTTHUMG00000167497	ENST00000251871.3:c.769A>G	11.37:g.93527025A>G	ENSP00000251871:p.Ile257Val		Somatic					p.I257V	NM_004268	NP_004259	WXS	Illumina HiSeq	Unspecified	Q9NVC6	MED17_HUMAN			4	1044	+		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)	257					B3KN07|Q9HA81|Q9UNP7|Q9Y2W0|Q9Y660	Missense_Mutation	SNP	ENST00000251871.3	37	c.769A>G	CCDS8295.1	.	.	.	.	.	.	.	.	.	.	A	16.12	3.032250	0.54790	.	.	ENSG00000042429	ENST00000251871;ENST00000427225	T	0.54866	0.55	5.64	5.64	0.86602	.	0.044778	0.85682	D	0.000000	T	0.47358	0.1441	L	0.52126	1.63	0.80722	D	1	B	0.23854	0.092	B	0.23574	0.047	T	0.43310	-0.9399	10	0.42905	T	0.14	-14.5124	11.8008	0.52126	0.8535:0.1465:0.0:0.0	.	257	Q9NVC6	MED17_HUMAN	V	257;227	ENSP00000251871:I257V	ENSP00000251871:I257V	I	+	1	0	MED17	93166673	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	5.880000	0.69698	2.160000	0.67779	0.533000	0.62120	ATC		0.299	MED17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394800.2	NM_004268		14	407	0	0	0	0	14	407				
TMPRSS13	84000	broad.mit.edu	37	11	117789522	117789522	+	Missense_Mutation	SNP	C	C	G			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr11:117789522C>G	ENST00000430170.2	-	2	140	c.53G>C	c.(52-54)gGa>gCa	p.G18A	TMPRSS13_ENST00000445164.2_Missense_Mutation_p.G18A|TMPRSS13_ENST00000528626.1_Missense_Mutation_p.G18A|TMPRSS13_ENST00000526090.1_Missense_Mutation_p.G18A|TMPRSS13_ENST00000524993.1_Missense_Mutation_p.G18A	NM_001244995.1	NP_001231924.1	Q9BYE2	TMPSD_HUMAN	transmembrane protease, serine 13	18	13 X 5 AA repeats of A-S-P-A-[GLQR].|4 X 5 AA repeats of T-P-P-G-R.|Ala-rich.					blood microparticle (GO:0072562)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|pancreas(1)|prostate(1)|urinary_tract(1)	20	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)		TGGAGATGCTCCAGCTGAAGG	0.617																																						uc001prs.1		NA																	0				pancreas(1)	1						c.(52-54)GGA>GCA		transmembrane protease, serine 13							44.0	49.0	47.0					11																	117789522		1971	4161	6132	SO:0001583	missense	84000				proteolysis	integral to membrane	scavenger receptor activity|serine-type endopeptidase activity	g.chr11:117789522C>G	AB048796	CCDS41721.1, CCDS55788.1, CCDS55789.1, CCDS58185.1	11q23	2010-04-13	2005-03-11	2005-03-12	ENSG00000137747	ENSG00000137747		"""Serine peptidases / Transmembrane"""	29808	protein-coding gene	gene with protein product		610050	"""transmembrane protease, serine 11"""	TMPRSS11		11267681	Standard	NM_001077263		Approved	MSPL	uc001prs.2	Q9BYE2	OTTHUMG00000166992	ENST00000430170.2:c.53G>C	11.37:g.117789522C>G	ENSP00000387702:p.Gly18Ala		Somatic				TMPRSS13_uc009yzr.1_5'UTR|TMPRSS13_uc001prt.1_5'UTR|TMPRSS13_uc001pru.1_Missense_Mutation_p.G18A	p.G18A	NM_001077263	NP_001070731	WXS	Illumina HiSeq	Unspecified	Q9BYE2	TMPSD_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)	2	146	-	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)	18			4 X 5 AA repeats of T-P-P-G-R.|2-1; approximate.|12 X 5 AA repeats of A-S-P-A-[GLQR].|Cytoplasmic (Potential).|Ala-rich.		B4DTM9|E9PIJ5|F8WAJ3|Q86YM4|Q96JY8|Q9BYE1	Missense_Mutation	SNP	ENST00000430170.2	37	c.53G>C	CCDS58185.1	.	.	.	.	.	.	.	.	.	.	C	9.971	1.225450	0.22457	.	.	ENSG00000137747	ENST00000528626;ENST00000336500;ENST00000524993;ENST00000430170;ENST00000445164;ENST00000526090	D;D;D;D;D	0.87334	-2.24;-2.24;-2.24;-2.23;-2.13	0.648	0.648	0.17801	.	.	.	.	.	T	0.67449	0.2894	N	0.08118	0	0.09310	N	1	B;B	0.17667	0.023;0.02	B;B	0.10450	0.005;0.005	T	0.55309	-0.8161	9	0.02654	T	1	.	7.1027	0.25346	0.0:0.9999:0.0:1.0E-4	.	18;18	Q9BYE2-4;E9PRA0	.;.	A	18	ENSP00000435813:G18A;ENSP00000434279:G18A;ENSP00000387702:G18A;ENSP00000394114:G18A;ENSP00000436502:G18A	ENSP00000337113:G18A	G	-	2	0	TMPRSS13	117294732	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	0.283000	0.18846	0.625000	0.30304	0.478000	0.44815	GGA		0.617	TMPRSS13-006	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000392318.1	NM_032046		13	24	0	0	0	0	13	24				
ZNF384	171017	broad.mit.edu	37	12	6788350	6788350	+	Splice_Site	SNP	C	C	G			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr12:6788350C>G	ENST00000396801.3	-	4	274		c.e4-1		ZNF384_ENST00000361959.3_Splice_Site|ZNF384_ENST00000355772.4_Splice_Site|ZNF384_ENST00000396799.2_Splice_Site|ZNF384_ENST00000396795.1_Splice_Site|ZNF384_ENST00000319770.3_Splice_Site	NM_001135734.2	NP_001129206.1	Q8TF68	ZN384_HUMAN	zinc finger protein 384						nucleocytoplasmic transport (GO:0006913)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	focal adhesion (GO:0005925)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)		EWSR1/ZNF384(4)	breast(3)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(1)	18						TGTTCTCGATCTAAGAGAAAA	0.532			T	"""EWSR1, TAF15 """	ALL																																	uc010sfh.1		NA		Dom	yes		12	12p13	171017	T	zinc finger protein 384 (CIZ/NMP4)			L	EWSR1|TAF15 		ALL	EWSR1/ZNF384(4)	0				haematopoietic_and_lymphoid_tissue(4)|central_nervous_system(3)|kidney(1)	8						c.e4-1		nuclear matrix transcription factor 4 isoform d							70.0	71.0	71.0					12																	6788350		2203	4300	6503	SO:0001630	splice_region_variant	171017				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr12:6788350C>G	U80738	CCDS8557.1, CCDS31732.1, CCDS44817.1	12p12	2013-01-08	2002-05-23	2002-05-24		ENSG00000126746		"""Zinc fingers, C2H2-type"""	11955	protein-coding gene	gene with protein product		609951	"""trinucleotide repeat containing 1"""	TNRC1		9225980, 11149472	Standard	NM_001135734		Approved	CAGH1A, CIZ, NMP4, NP	uc010sfh.2	Q8TF68		ENST00000396801.3:c.67-1G>C	12.37:g.6788350C>G			Somatic				ZNF384_uc001qpz.2_Splice_Site_p.I23_splice|ZNF384_uc001qqa.2_Splice_Site_p.I23_splice|ZNF384_uc001qqb.2_Splice_Site_p.I23_splice|ZNF384_uc001qqc.2_Splice_Site_p.I23_splice|ZNF384_uc001qqd.2_Splice_Site_p.I23_splice|ZNF384_uc001qqe.2_Splice_Site_p.I23_splice|ZNF384_uc009zew.1_5'Flank	p.I23_splice	NM_001135734	NP_001129206	WXS	Illumina HiSeq	Unspecified	Q8TF68	ZN384_HUMAN			4	275	-								O15407|Q7Z722|Q8N938	Splice_Site	SNP	ENST00000396801.3	37	c.67_splice	CCDS44817.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.069183	0.76301	.	.	ENSG00000126746	ENST00000319770;ENST00000396795;ENST00000396801;ENST00000361959;ENST00000355772;ENST00000396799;ENST00000417772;ENST00000436774;ENST00000542796;ENST00000540915;ENST00000535485;ENST00000538829;ENST00000542351;ENST00000544482;ENST00000537248	.	.	.	4.94	4.94	0.65067	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7331	0.91742	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ZNF384	6658611	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	7.320000	0.79064	2.724000	0.93272	0.561000	0.74099	.		0.532	ZNF384-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400712.1		Intron	26	47	0	0	0	0	26	47				
ALG10B	144245	broad.mit.edu	37	12	38712166	38712166	+	Missense_Mutation	SNP	C	C	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr12:38712166C>T	ENST00000308742.4	+	2	591	c.275C>T	c.(274-276)tCc>tTc	p.S92F	ALG10B_ENST00000551464.1_Missense_Mutation_p.S92F	NM_001013620.3	NP_001013642.1	Q5I7T1	AG10B_HUMAN	ALG10B, alpha-1,2-glucosyltransferase	92					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transferase activity, transferring hexosyl groups (GO:0016758)			breast(2)|kidney(3)|large_intestine(7)|lung(8)|ovary(4)|skin(1)	25	Esophageal squamous(101;0.187)	Lung NSC(34;0.204)|all_lung(34;0.235)				GTTGTCTGCTCCATTGGGATG	0.418																																						uc001rln.3		NA																	0				ovary(2)|skin(1)	3						c.(274-276)TCC>TTC		asparagine-linked glycosylation 10 homolog B							223.0	204.0	210.0					12																	38712166		2203	4297	6500	SO:0001583	missense	144245				dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane|plasma membrane	dolichyl-phosphate-glucose-glycolipid alpha-glucosyltransferase activity	g.chr12:38712166C>T	AY845858	CCDS31772.1	12q12	2013-03-04	2013-03-04		ENSG00000175548	ENSG00000175548	2.4.1.256		31088	protein-coding gene	gene with protein product	"""potassium channel regulator 1"", ""dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase"""		"""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog B (yeast)"""				Standard	NM_001013620		Approved	KCR1	uc001rln.4	Q5I7T1	OTTHUMG00000169298	ENST00000308742.4:c.275C>T	12.37:g.38712166C>T	ENSP00000310120:p.Ser92Phe		Somatic				ALG10B_uc001rlo.3_Missense_Mutation_p.S62F|ALG10B_uc010skk.1_Missense_Mutation_p.S32F	p.S92F	NM_001013620	NP_001013642	WXS	Illumina HiSeq	Unspecified	Q5I7T1	AG10B_HUMAN			2	414	+	Esophageal squamous(101;0.187)	Lung NSC(34;0.204)|all_lung(34;0.235)	92			Cytoplasmic (Potential).		B2RPF4	Missense_Mutation	SNP	ENST00000308742.4	37	c.275C>T	CCDS31772.1	.	.	.	.	.	.	.	.	.	.	c	21.3	4.135269	0.77662	.	.	ENSG00000175548	ENST00000308742;ENST00000551464	T;T	0.51071	1.34;0.72	3.74	3.74	0.42951	.	0.000000	0.85682	D	0.000000	T	0.67599	0.2910	M	0.77486	2.375	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.73043	-0.4107	10	0.87932	D	0	.	13.8574	0.63537	0.0:1.0:0.0:0.0	.	92	Q5I7T1	AG10B_HUMAN	F	92	ENSP00000310120:S92F;ENSP00000448819:S92F	ENSP00000310120:S92F	S	+	2	0	ALG10B	36998433	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.304000	0.78882	2.355000	0.79922	0.655000	0.94253	TCC		0.418	ALG10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403349.1	NM_001013620		7	98	0	0	0	0	7	98				
ALG10B	144245	broad.mit.edu	37	12	38714315	38714315	+	Missense_Mutation	SNP	C	C	G			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr12:38714315C>G	ENST00000308742.4	+	3	1038	c.722C>G	c.(721-723)tCc>tGc	p.S241C	AC117372.1_ENST00000401168.2_RNA|ALG10B_ENST00000551464.1_Intron	NM_001013620.3	NP_001013642.1	Q5I7T1	AG10B_HUMAN	ALG10B, alpha-1,2-glucosyltransferase	241					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transferase activity, transferring hexosyl groups (GO:0016758)			breast(2)|kidney(3)|large_intestine(7)|lung(8)|ovary(4)|skin(1)	25	Esophageal squamous(101;0.187)	Lung NSC(34;0.204)|all_lung(34;0.235)				TTGGCTTATTCCATGTCCTTT	0.368																																						uc001rln.3		NA																	0				ovary(2)|skin(1)	3						c.(721-723)TCC>TGC		asparagine-linked glycosylation 10 homolog B							165.0	170.0	168.0					12																	38714315		2203	4300	6503	SO:0001583	missense	144245				dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane|plasma membrane	dolichyl-phosphate-glucose-glycolipid alpha-glucosyltransferase activity	g.chr12:38714315C>G	AY845858	CCDS31772.1	12q12	2013-03-04	2013-03-04		ENSG00000175548	ENSG00000175548	2.4.1.256		31088	protein-coding gene	gene with protein product	"""potassium channel regulator 1"", ""dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase"""		"""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog B (yeast)"""				Standard	NM_001013620		Approved	KCR1	uc001rln.4	Q5I7T1	OTTHUMG00000169298	ENST00000308742.4:c.722C>G	12.37:g.38714315C>G	ENSP00000310120:p.Ser241Cys		Somatic				ALG10B_uc001rlo.3_Missense_Mutation_p.S211C|ALG10B_uc010skk.1_Missense_Mutation_p.S181C	p.S241C	NM_001013620	NP_001013642	WXS	Illumina HiSeq	Unspecified	Q5I7T1	AG10B_HUMAN			3	861	+	Esophageal squamous(101;0.187)	Lung NSC(34;0.204)|all_lung(34;0.235)	241			Cytoplasmic (Potential).		B2RPF4	Missense_Mutation	SNP	ENST00000308742.4	37	c.722C>G	CCDS31772.1	.	.	.	.	.	.	.	.	.	.	N	2.854	-0.237599	0.05944	.	.	ENSG00000175548	ENST00000308742	T	0.56275	0.47	3.23	1.26	0.21427	.	0.860216	0.10479	N	0.669875	T	0.25606	0.0623	N	0.03324	-0.35	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.17167	-1.0378	10	0.35671	T	0.21	.	5.4951	0.16797	0.0:0.4862:0.3961:0.1177	.	241	Q5I7T1	AG10B_HUMAN	C	241	ENSP00000310120:S241C	ENSP00000310120:S241C	S	+	2	0	ALG10B	37000582	0.010000	0.17322	0.001000	0.08648	0.693000	0.40251	1.944000	0.40263	0.333000	0.23563	0.643000	0.83706	TCC		0.368	ALG10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403349.1	NM_001013620		9	114	0	0	0	0	9	114				
ALG10B	144245	broad.mit.edu	37	12	38714762	38714762	+	Nonsense_Mutation	SNP	C	C	G			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr12:38714762C>G	ENST00000308742.4	+	3	1485	c.1169C>G	c.(1168-1170)tCa>tGa	p.S390*	AC117372.1_ENST00000401168.2_RNA|ALG10B_ENST00000551464.1_Intron	NM_001013620.3	NP_001013642.1	Q5I7T1	AG10B_HUMAN	ALG10B, alpha-1,2-glucosyltransferase	390					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transferase activity, transferring hexosyl groups (GO:0016758)			breast(2)|kidney(3)|large_intestine(7)|lung(8)|ovary(4)|skin(1)	25	Esophageal squamous(101;0.187)	Lung NSC(34;0.204)|all_lung(34;0.235)				TCATTGAAATCAAAGCCAATT	0.313																																						uc001rln.3		NA																	0				ovary(2)|skin(1)	3						c.(1168-1170)TCA>TGA		asparagine-linked glycosylation 10 homolog B							102.0	104.0	104.0					12																	38714762		2203	4299	6502	SO:0001587	stop_gained	144245				dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane|plasma membrane	dolichyl-phosphate-glucose-glycolipid alpha-glucosyltransferase activity	g.chr12:38714762C>G	AY845858	CCDS31772.1	12q12	2013-03-04	2013-03-04		ENSG00000175548	ENSG00000175548	2.4.1.256		31088	protein-coding gene	gene with protein product	"""potassium channel regulator 1"", ""dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase"""		"""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog B (yeast)"""				Standard	NM_001013620		Approved	KCR1	uc001rln.4	Q5I7T1	OTTHUMG00000169298	ENST00000308742.4:c.1169C>G	12.37:g.38714762C>G	ENSP00000310120:p.Ser390*		Somatic				ALG10B_uc001rlo.3_Nonsense_Mutation_p.S360*|ALG10B_uc010skk.1_Nonsense_Mutation_p.S330*	p.S390*	NM_001013620	NP_001013642	WXS	Illumina HiSeq	Unspecified	Q5I7T1	AG10B_HUMAN			3	1308	+	Esophageal squamous(101;0.187)	Lung NSC(34;0.204)|all_lung(34;0.235)	390			Cytoplasmic (Potential).		B2RPF4	Nonsense_Mutation	SNP	ENST00000308742.4	37	c.1169C>G	CCDS31772.1	.	.	.	.	.	.	.	.	.	.	c	27.5	4.835460	0.91117	.	.	ENSG00000175548	ENST00000308742	.	.	.	3.34	3.34	0.38264	.	0.496837	0.22575	N	0.058289	.	.	.	.	.	.	0.36006	D	0.837724	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	.	8.8334	0.35098	0.0:0.769:0.231:0.0	.	.	.	.	X	390	.	ENSP00000310120:S390X	S	+	2	0	ALG10B	37001029	1.000000	0.71417	0.009000	0.14445	0.370000	0.29829	3.504000	0.53347	2.171000	0.68590	0.655000	0.94253	TCA		0.313	ALG10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403349.1	NM_001013620		6	59	0	0	0	0	6	59				
NAV3	89795	broad.mit.edu	37	12	78513391	78513391	+	Missense_Mutation	SNP	C	C	A			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr12:78513391C>A	ENST00000397909.2	+	15	3588	c.3415C>A	c.(3415-3417)Ccc>Acc	p.P1139T	NAV3_ENST00000536525.2_Missense_Mutation_p.P1139T|NAV3_ENST00000228327.6_Missense_Mutation_p.P1139T|NAV3_ENST00000266692.7_Missense_Mutation_p.P1139T			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1139	Ser-rich.					membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						TCGCAGCTTGCCCCGCCCTTC	0.512										HNSCC(70;0.22)																												uc001syp.2		NA																	0				large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						c.(3415-3417)CCC>ACC		neuron navigator 3							69.0	72.0	71.0					12																	78513391		2010	4170	6180	SO:0001583	missense	89795					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity	g.chr12:78513391C>A	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.3415C>A	12.37:g.78513391C>A	ENSP00000381007:p.Pro1139Thr	HNSCC(70;0.22)	Somatic				NAV3_uc001syo.2_Missense_Mutation_p.P1139T|NAV3_uc010sub.1_Missense_Mutation_p.P639T|NAV3_uc009zsf.2_Missense_Mutation_p.P147T	p.P1139T	NM_014903	NP_055718	WXS	Illumina HiSeq	Unspecified	Q8IVL0	NAV3_HUMAN			15	3588	+			1139			Ser-rich.		Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37	c.3415C>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.6|23.6	4.429997|4.429997	0.83776|0.83776	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000552895|ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692	.|T;T;T;T	.|0.35421	.|1.31;1.31;1.31;1.31	5.72|5.72	5.72|5.72	0.89469|0.89469	.|.	.|0.181158	.|0.26251	.|U	.|0.025441	T|T	0.64746|0.64746	0.2626|0.2626	M|M	0.77486|0.77486	2.375|2.375	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|0.999;1.0;0.998;1.0	.|D;D;P;D	.|0.91635	.|0.979;0.994;0.907;0.999	T|T	0.67023|0.67023	-0.5775|-0.5775	5|10	.|0.87932	.|D	.|0	-12.0927|-12.0927	19.9293|19.9293	0.97114|0.97114	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1139;1139;1139;1139	.|E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2	.|.;.;NAV3_HUMAN;.	D|T	210|1139	.|ENSP00000446132:P1139T;ENSP00000381007:P1139T;ENSP00000228327:P1139T;ENSP00000266692:P1139T	.|ENSP00000228327:P1139T	A|P	+|+	2|1	0|0	NAV3|NAV3	77037522|77037522	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.950000|0.950000	0.60333|0.60333	7.594000|7.594000	0.82698|0.82698	2.701000|2.701000	0.92244|0.92244	0.650000|0.650000	0.86243|0.86243	GCC|CCC		0.512	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		23	51	1	0	3.01e-09	4.92e-09	23	51				
NR2C1	7181	broad.mit.edu	37	12	95442958	95442958	+	Silent	SNP	G	G	A			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr12:95442958G>A	ENST00000333003.5	-	9	1347	c.1017C>T	c.(1015-1017)tgC>tgT	p.C339C	NR2C1_ENST00000330677.7_Silent_p.C339C|NR2C1_ENST00000545833.1_5'UTR|NR2C1_ENST00000393101.3_Silent_p.C339C	NM_003297.3	NP_003288.2	P13056	NR2C1_HUMAN	nuclear receptor subfamily 2, group C, member 1	339					gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	DNA binding (GO:0003677)|receptor activity (GO:0004872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)	13						CTGAGCTCTGGCAGGCTGTGC	0.468																																						uc001tdm.3		NA																	0				ovary(1)	1						c.(1015-1017)TGC>TGT		nuclear receptor subfamily 2, group C, member 1							135.0	119.0	125.0					12																	95442958		2203	4300	6503	SO:0001819	synonymous_variant	7181				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	PML body	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding	g.chr12:95442958G>A	M29960	CCDS9051.1, CCDS41821.1, CCDS44953.1	12q22	2013-01-16				ENSG00000120798		"""Nuclear hormone receptors"""	7971	protein-coding gene	gene with protein product		601529		TR2		2597158	Standard	NM_001032287		Approved	TR2-11	uc001tdm.5	P13056	OTTHUMG00000170131	ENST00000333003.5:c.1017C>T	12.37:g.95442958G>A			Somatic				NR2C1_uc010suu.1_Silent_p.C339C|NR2C1_uc001tdo.3_Silent_p.C339C|NR2C1_uc001tdn.3_Silent_p.C339C	p.C339C	NM_003297	NP_003288	WXS	Illumina HiSeq	Unspecified	P13056	NR2C1_HUMAN			9	1273	-			339					A8K5K4|Q15625|Q15626	Silent	SNP	ENST00000333003.5	37	c.1017C>T	CCDS9051.1																																																																																				0.468	NR2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407565.2	NM_003297		44	78	0	0	0	0	44	78				
NEDD1	121441	broad.mit.edu	37	12	97337517	97337517	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr12:97337517G>T	ENST00000266742.4	+	12	1813	c.1474G>T	c.(1474-1476)Gaa>Taa	p.E492*	NEDD1_ENST00000557644.1_Nonsense_Mutation_p.E499*|NEDD1_ENST00000429527.2_Nonsense_Mutation_p.E492*|NEDD1_ENST00000411739.2_Nonsense_Mutation_p.E403*|NEDD1_ENST00000457368.2_Nonsense_Mutation_p.E403*	NM_152905.3	NP_690869.1	Q8NHV4	NEDD1_HUMAN	neural precursor cell expressed, developmentally down-regulated 1	492					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	apical part of cell (GO:0045177)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|pericentriolar material (GO:0000242)|spindle pole (GO:0000922)				breast(2)|endometrium(1)|kidney(2)|large_intestine(9)|lung(8)	22						GGGAAAACAGGAATCTAAAGA	0.383																																						uc001teu.3		NA																	0					0						c.(1474-1476)GAA>TAA		neural precursor cell expressed, developmentally							47.0	50.0	49.0					12																	97337517		2202	4298	6500	SO:0001587	stop_gained	121441				cell division|G2/M transition of mitotic cell cycle|mitosis	cytosol		g.chr12:97337517G>T		CCDS9063.1, CCDS44955.1, CCDS44956.1	12q23.1	2013-01-10			ENSG00000139350	ENSG00000139350		"""WD repeat domain containing"""	7723	protein-coding gene	gene with protein product		600372					Standard	NM_001135175		Approved	GCP-WD, TUBGCP7	uc001tev.4	Q8NHV4	OTTHUMG00000170604	ENST00000266742.4:c.1474G>T	12.37:g.97337517G>T	ENSP00000266742:p.Glu492*		Somatic				NEDD1_uc001tev.3_Nonsense_Mutation_p.E492*|NEDD1_uc010svc.1_Nonsense_Mutation_p.E403*|NEDD1_uc001tew.2_Nonsense_Mutation_p.E499*|NEDD1_uc001tex.2_Nonsense_Mutation_p.E403*	p.E492*	NM_152905	NP_690869	WXS	Illumina HiSeq	Unspecified	Q8NHV4	NEDD1_HUMAN			12	1813	+			492					B0AZN0|B4E145|G3V3F1|Q8NA30	Nonsense_Mutation	SNP	ENST00000266742.4	37	c.1474G>T	CCDS9063.1	.	.	.	.	.	.	.	.	.	.	G	39	7.383966	0.98252	.	.	ENSG00000139350	ENST00000266742;ENST00000429527;ENST00000411739;ENST00000557644;ENST00000457368	.	.	.	5.34	5.34	0.76211	.	0.293034	0.42294	D	0.000738	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	17.229	0.86979	0.0:0.0:1.0:0.0	.	.	.	.	X	492;492;403;499;403	.	ENSP00000266742:E492X	E	+	1	0	NEDD1	95861648	1.000000	0.71417	0.993000	0.49108	0.804000	0.45430	6.200000	0.72118	2.506000	0.84524	0.650000	0.86243	GAA		0.383	NEDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409792.1			12	22	1	0	7.04e-09	1.15e-08	12	22				
UBC	7316	broad.mit.edu	37	12	125398267	125398267	+	Silent	SNP	A	A	C			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr12:125398267A>C	ENST00000538617.1	-	3	367	c.51T>G	c.(49-51)gtT>gtG	p.V17V	MIR5188_ENST00000583467.1_RNA|UBC_ENST00000536661.1_5'UTR|UBC_ENST00000339647.5_Silent_p.V17V|UBC_ENST00000536769.1_Silent_p.V17V|UBC_ENST00000546120.1_Silent_p.V17V			P0CG48	UBC_HUMAN	ubiquitin C	397	Ubiquitin-like 1. {ECO:0000255|PROSITE- ProRule:PRU00214}.				activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protease binding (GO:0002020)			breast(3)|endometrium(4)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		CACTGGGCTCAACCTCGAGGG	0.473																																						uc001ugs.3		NA																	0				ovary(2)	2						c.(49-51)GTT>GTG		ubiquitin C							185.0	175.0	179.0					12																	125398267		2203	4300	6503	SO:0001819	synonymous_variant	7316				activation of MAPK activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|anti-apoptosis|apoptosis|cellular membrane organization|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA repair|endosome transport|epidermal growth factor receptor signaling pathway|G1/S transition of mitotic cell cycle|I-kappaB kinase/NF-kappaB cascade|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|M/G1 transition of mitotic cell cycle|mRNA metabolic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of type I interferon production|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|viral reproduction	cytosol|endocytic vesicle membrane|endosome membrane|nucleoplasm|plasma membrane	protein binding	g.chr12:125398267A>C		CCDS9260.1	12q24.3	2008-09-08			ENSG00000150991	ENSG00000150991			12468	protein-coding gene	gene with protein product	"""polyubiquitin-C"""	191340				1315303, 11872750	Standard	NM_021009		Approved		uc001ugs.4	P0CG48		ENST00000538617.1:c.51T>G	12.37:g.125398267A>C			Somatic				UBC_uc001ugr.2_5'Flank|UBC_uc001ugu.1_Silent_p.V17V|UBC_uc001ugt.2_Silent_p.V17V|UBC_uc001ugv.2_Silent_p.V17V|UBC_uc001ugw.2_5'UTR|UBC_uc009zyf.1_RNA	p.V17V	NM_021009	NP_066289	WXS	Illumina HiSeq	Unspecified	P0CG48	UBC_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)	2	499	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)		17			Ubiquitin-like 1.		P02248|P02249|P02250|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Silent	SNP	ENST00000538617.1	37	c.51T>G																																																																																					0.473	UBC-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000400179.1	NM_021009		4	217	0	0	0	0	4	217				
CATSPER2	117155	broad.mit.edu	37	15	43939610	43939610	+	Missense_Mutation	SNP	G	G	C			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr15:43939610G>C	ENST00000321596.5	-	3	400	c.201C>G	c.(199-201)ttC>ttG	p.F67L	CATSPER2_ENST00000464721.1_5'UTR|CATSPER2_ENST00000381761.1_Missense_Mutation_p.F73L|CATSPER2_ENST00000396879.1_Missense_Mutation_p.F67L|CATSPER2_ENST00000355438.2_Missense_Mutation_p.F67L|CATSPER2_ENST00000354127.4_Missense_Mutation_p.F67L|STRC_ENST00000541030.1_Intron			Q96P56	CTSR2_HUMAN	cation channel, sperm associated 2	67					calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)		GCTTTATAGAGAAACGCACTA	0.443																																						uc001zsh.2		NA																	0				ovary(1)	1						c.(199-201)TTC>TTG		sperm-associated cation channel 2 isoform 2							80.0	89.0	86.0					15																	43939610		2199	4296	6495	SO:0001583	missense	117155				cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	calcium channel activity|protein binding|voltage-gated ion channel activity	g.chr15:43939610G>C	AF411817	CCDS10099.1, CCDS32216.1, CCDS73714.1	15q15.3	2011-07-05			ENSG00000166762	ENSG00000166762		"""Voltage-gated ion channels / Cation channels, sperm associated"""	18810	protein-coding gene	gene with protein product		607249				11675491, 16382101	Standard	NM_172095		Approved		uc001zsh.3	Q96P56	OTTHUMG00000059902	ENST00000321596.5:c.201C>G	15.37:g.43939610G>C	ENSP00000321463:p.Phe67Leu		Somatic				CATSPER2_uc010bdm.2_RNA|CATSPER2_uc001zsi.2_Missense_Mutation_p.F67L|CATSPER2_uc001zsj.2_Missense_Mutation_p.F67L|CATSPER2_uc001zsk.2_Missense_Mutation_p.F67L|CATSPER2_uc001zsl.1_RNA	p.F67L	NM_172095	NP_742093	WXS	Illumina HiSeq	Unspecified	Q96P56	CTSR2_HUMAN		GBM - Glioblastoma multiforme(94;3.56e-07)	3	416	-		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)	67			Cytoplasmic (Potential).		Q8NHT9|Q96P54|Q96P55	Missense_Mutation	SNP	ENST00000321596.5	37	c.201C>G	CCDS10099.1	.	.	.	.	.	.	.	.	.	.	G	18.37	3.610196	0.66558	.	.	ENSG00000166762	ENST00000396879;ENST00000299989;ENST00000381761;ENST00000321596;ENST00000354127;ENST00000355438;ENST00000432420	T;T;T;T;T;T	0.40476	1.03;1.03;1.03;1.03;1.03;1.03	3.38	2.45	0.29901	.	0.251223	0.25135	U	0.032862	T	0.58409	0.2120	M	0.76002	2.32	0.29634	N	0.845219	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.97110	0.994;1.0;0.999	T	0.54794	-0.8240	10	0.87932	D	0	.	6.5231	0.22287	0.1394:0.0:0.8606:0.0	.	67;73;67	Q96P56-4;F8W9H2;Q96P56	.;.;CTSR2_HUMAN	L	67;67;73;67;67;67;67	ENSP00000380088:F67L;ENSP00000371180:F73L;ENSP00000321463:F67L;ENSP00000339137:F67L;ENSP00000347613:F67L;ENSP00000407694:F67L	ENSP00000299989:F67L	F	-	3	2	CATSPER2	41726902	1.000000	0.71417	1.000000	0.80357	0.069000	0.16628	0.832000	0.27490	0.744000	0.32741	0.184000	0.17185	TTC		0.443	CATSPER2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000133151.2	NM_054020		52	59	0	0	0	0	52	59				
UNC13C	440279	broad.mit.edu	37	15	54305533	54305533	+	Missense_Mutation	SNP	A	A	G			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr15:54305533A>G	ENST00000260323.11	+	1	433	c.433A>G	c.(433-435)Aca>Gca	p.T145A	UNC13C_ENST00000545554.1_Missense_Mutation_p.T145A|UNC13C_ENST00000537900.1_Missense_Mutation_p.T145A	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	145					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		GGCACAATCAACACACACAAT	0.458																																						uc002ack.2		NA																	0				ovary(5)|pancreas(2)	7						c.(433-435)ACA>GCA		unc-13 homolog C							80.0	79.0	79.0					15																	54305533		2030	4189	6219	SO:0001583	missense	440279				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding	g.chr15:54305533A>G	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.433A>G	15.37:g.54305533A>G	ENSP00000260323:p.Thr145Ala		Somatic					p.T145A	NM_001080534	NP_001074003	WXS	Illumina HiSeq	Unspecified	Q8NB66	UN13C_HUMAN		GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)	1	433	+			145					Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	37	c.433A>G	CCDS45264.1	.	.	.	.	.	.	.	.	.	.	A	0.378	-0.930353	0.02359	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.77229	-1.08;-1.08;-1.08	5.16	-5.21	0.02815	.	.	.	.	.	T	0.50034	0.1592	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42120	-0.9470	9	0.11794	T	0.64	.	7.977	0.30161	0.2388:0.0:0.5587:0.2025	.	145	Q8NB66	UN13C_HUMAN	A	145	ENSP00000260323:T145A;ENSP00000438156:T145A;ENSP00000442569:T145A	ENSP00000260323:T145A	T	+	1	0	UNC13C	52092825	0.861000	0.29849	0.001000	0.08648	0.009000	0.06853	0.745000	0.26259	-0.498000	0.06632	-0.290000	0.09829	ACA		0.458	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166		4	87	0	0	0	0	4	87				
PIGB	9488	broad.mit.edu	37	15	55626120	55626120	+	Missense_Mutation	SNP	A	A	C			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr15:55626120A>C	ENST00000164305.5	+	6	1000	c.709A>C	c.(709-711)Att>Ctt	p.I237L	PIGB_ENST00000539642.1_Missense_Mutation_p.I42L	NM_004855.4	NP_004846.4	Q92521	PIGB_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class B	237					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	mannosyltransferase activity (GO:0000030)			endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	11				all cancers(107;0.0255)		CACAGCTGTCATTCTGTGGAC	0.398																																						uc002act.2		NA																	0					0						c.(709-711)ATT>CTT		phosphatidylinositol glycan, class B							127.0	119.0	121.0					15																	55626120		1870	4116	5986	SO:0001583	missense	9488				C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	integral to membrane|intrinsic to endoplasmic reticulum membrane	glycolipid mannosyltransferase activity	g.chr15:55626120A>C	D42138	CCDS61641.1	15q21.3	2013-02-26	2006-06-28		ENSG00000069943	ENSG00000069943		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	8959	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 3"", ""dol-P-Man dependent GPI mannosyltransferase"""	604122	"""phosphatidylinositol glycan, class B"""			8861954	Standard	NM_004855		Approved		uc002act.3	Q92521	OTTHUMG00000172654	ENST00000164305.5:c.709A>C	15.37:g.55626120A>C	ENSP00000164305:p.Ile237Leu		Somatic				PIGB_uc010ugg.1_Missense_Mutation_p.I42L	p.I237L	NM_004855	NP_004846	WXS	Illumina HiSeq	Unspecified	Q92521	PIGB_HUMAN		all cancers(107;0.0255)	6	1025	+			237			Helical; (Potential).		Q53FF9|Q8WVN7	Missense_Mutation	SNP	ENST00000164305.5	37	c.709A>C		.	.	.	.	.	.	.	.	.	.	A	17.06	3.291306	0.59976	.	.	ENSG00000069943	ENST00000164305;ENST00000539642	T;T	0.58358	0.34;0.34	5.9	3.6	0.41247	.	0.096933	0.64402	D	0.000001	T	0.48429	0.1499	L	0.35414	1.06	0.51012	D	0.9999	P	0.47604	0.898	P	0.57548	0.823	T	0.49322	-0.8952	10	0.05833	T	0.94	-18.7743	8.3121	0.32077	0.8468:0.0:0.1532:0.0	.	237	Q92521	PIGB_HUMAN	L	237;42	ENSP00000164305:I237L;ENSP00000438963:I42L	ENSP00000164305:I237L	I	+	1	0	PIGB	53413412	1.000000	0.71417	0.165000	0.22776	0.478000	0.33099	5.661000	0.68025	0.498000	0.27948	0.460000	0.39030	ATT		0.398	PIGB-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000419687.1	NM_004855		7	43	0	0	0	0	7	43				
AP3B2	8120	broad.mit.edu	37	15	83349371	83349371	+	Missense_Mutation	SNP	C	C	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr15:83349371C>T	ENST00000261722.3	-	8	1115	c.908G>A	c.(907-909)cGg>cAg	p.R303Q	RP11-752G15.3_ENST00000560650.1_RNA|AP3B2_ENST00000535359.1_Missense_Mutation_p.R303Q|AP3B2_ENST00000535348.1_Missense_Mutation_p.R271Q	NM_004644.3	NP_004635.2	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2 subunit	303					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)|post-Golgi vesicle-mediated transport (GO:0006892)	AP-3 adaptor complex (GO:0030123)|COPI-coated vesicle (GO:0030137)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(4)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(2)	41			BRCA - Breast invasive adenocarcinoma(143;0.229)			CAGCAGCAGCCGGTGGTCGGG	0.706																																						uc010uoh.1		NA																	0				ovary(3)|breast(1)|pancreas(1)	5						c.(907-909)CGG>CAG		adaptor-related protein complex 3, beta 2							9.0	10.0	10.0					15																	83349371		1771	3894	5665	SO:0001583	missense	8120				endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport	clathrin coated vesicle membrane|COPI-coated vesicle|membrane coat	binding|protein transporter activity	g.chr15:83349371C>T	U37673	CCDS45331.1, CCDS61736.1, CCDS61737.1	15q	2008-07-07			ENSG00000103723	ENSG00000103723			567	protein-coding gene	gene with protein product		602166				7671305, 1851215	Standard	NM_004644		Approved	NAPTB	uc010uoh.2	Q13367	OTTHUMG00000168009	ENST00000261722.3:c.908G>A	15.37:g.83349371C>T	ENSP00000261722:p.Arg303Gln		Somatic				AP3B2_uc010uoi.1_Missense_Mutation_p.R303Q|AP3B2_uc010uoj.1_Missense_Mutation_p.R271Q|AP3B2_uc010uog.1_5'Flank	p.R303Q	NM_004644	NP_004635	WXS	Illumina HiSeq	Unspecified	Q13367	AP3B2_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.229)		8	1085	-			303					A4Z4T7|B7ZKR7|B7ZKS0|O14808|Q52LY8	Missense_Mutation	SNP	ENST00000261722.3	37	c.908G>A	CCDS45331.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.363121	0.82353	.	.	ENSG00000103723	ENST00000261722;ENST00000535348;ENST00000535359	T;T;T	0.25912	1.77;1.77;1.77	4.9	3.96	0.45880	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.115307	0.64402	D	0.000018	T	0.41880	0.1178	L	0.51914	1.62	0.80722	D	1	D;D;P	0.76494	0.999;0.989;0.796	P;P;P	0.62435	0.898;0.902;0.466	T	0.38499	-0.9658	10	0.72032	D	0.01	-14.5089	14.5211	0.67851	0.1479:0.8521:0.0:0.0	.	271;303;303	B7ZKR7;B7ZKS0;Q13367	.;.;AP3B2_HUMAN	Q	303;271;303	ENSP00000261722:R303Q;ENSP00000438721:R271Q;ENSP00000440984:R303Q	ENSP00000261722:R303Q	R	-	2	0	AP3B2	81146425	1.000000	0.71417	0.999000	0.59377	0.049000	0.14656	7.549000	0.82163	1.249000	0.43950	0.655000	0.94253	CGG		0.706	AP3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397463.1			4	29	0	0	0	0	4	29				
TM6SF1	53346	broad.mit.edu	37	15	83796130	83796130	+	Silent	SNP	T	T	C			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr15:83796130T>C	ENST00000322019.9	+	9	1096	c.822T>C	c.(820-822)taT>taC	p.Y274Y	TM6SF1_ENST00000565774.1_Silent_p.Y243Y|TM6SF1_ENST00000379386.4_Silent_p.Y277Y|TM6SF1_ENST00000379390.6_Missense_Mutation_p.F168L			Q9BZW5	TM6S1_HUMAN	transmembrane 6 superfamily member 1	274						integral component of membrane (GO:0016021)				endometrium(1)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	15						ATATGTTCTATTCTGTTCCTT	0.408																																						uc002bjp.2		NA																	0				ovary(1)	1						c.(820-822)TAT>TAC		transmembrane 6 superfamily member 1 isoform 1							284.0	249.0	261.0					15																	83796130		2203	4300	6503	SO:0001819	synonymous_variant	53346					integral to membrane		g.chr15:83796130T>C	AF255922	CCDS10323.1, CCDS45338.1	15q24-q26	2003-04-04			ENSG00000136404	ENSG00000136404			11860	protein-coding gene	gene with protein product		606562				11124529	Standard	NM_001144903		Approved		uc002bjp.3	Q9BZW5	OTTHUMG00000147365	ENST00000322019.9:c.822T>C	15.37:g.83796130T>C			Somatic				TM6SF1_uc010bmq.2_Silent_p.Y243Y|TM6SF1_uc002bjq.2_Missense_Mutation_p.F168L|TM6SF1_uc010bmr.2_RNA|TM6SF1_uc002bjr.2_Silent_p.Y126Y	p.Y274Y	NM_023003	NP_075379	WXS	Illumina HiSeq	Unspecified	Q9BZW5	TM6S1_HUMAN			9	931	+			274			Helical; (Potential).		A8K7T5|H3BU56|Q4U0U5	Silent	SNP	ENST00000322019.9	37	c.822T>C	CCDS10323.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.94|14.94	2.685373|2.685373	0.47991|0.47991	.|.	.|.	ENSG00000136404|ENSG00000136404	ENST00000379390|ENST00000258909	T|T	0.34472|0.34072	1.36|1.38	5.8|5.8	0.989|0.989	0.19802|0.19802	.|.	.|.	.|.	.|.	.|.	T|T	0.44973|0.44973	0.1319|0.1319	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	B|.	0.06786|.	0.001|.	B|.	0.09377|.	0.004|.	T|T	0.38887|0.38887	-0.9640|-0.9640	8|6	0.07325|0.62326	T|D	0.83|0.03	-4.4485|-4.4485	9.4691|9.4691	0.38831|0.38831	0.0:0.4554:0.0:0.5446|0.0:0.4554:0.0:0.5446	.|.	168|.	Q6P4D7|.	.|.	L|T	168|140	ENSP00000368700:F168L|ENSP00000258909:I140T	ENSP00000368700:F168L|ENSP00000258909:I140T	F|I	+|+	1|2	0|0	TM6SF1|TM6SF1	81587134|81587134	0.952000|0.952000	0.32445|0.32445	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	-0.027000|-0.027000	0.12371|0.12371	0.131000|0.131000	0.18576|0.18576	0.533000|0.533000	0.62120|0.62120	TTC|ATT		0.408	TM6SF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000304009.1	NM_023003		132	113	0	0	0	0	132	113				
ZNF592	9640	broad.mit.edu	37	15	85333936	85333936	+	Splice_Site	SNP	A	A	G			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr15:85333936A>G	ENST00000560079.2	+	5	2509	c.2221A>G	c.(2221-2223)Acc>Gcc	p.T741A	ZNF592_ENST00000299927.3_Splice_Site_p.T741A	NM_014630.2	NP_055445.2	Q92610	ZN592_HUMAN	zinc finger protein 592	741					cell death (GO:0008219)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(143;0.0587)			TCTTTCCTAGACCTGCCAGGT	0.552																																						uc002bld.2		NA																	0				ovary(4)|skin(2)	6						c.(2221-2223)ACC>GCC		zinc finger protein 592							115.0	99.0	104.0					15																	85333936		2203	4299	6502	SO:0001630	splice_region_variant	9640				cell death|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr15:85333936A>G	D86966	CCDS32317.1	15q25.2	2011-03-15				ENSG00000166716		"""Zinc fingers, C2H2-type"""	28986	protein-coding gene	gene with protein product		613624	"""spinocerebellar ataxia, autosomal recessive 5"""	SCAR5		9039502, 12030328, 20531441	Standard	NM_014630		Approved	KIAA0211, CAMOS	uc002bld.3	Q92610		ENST00000560079.2:c.2221-1A>G	15.37:g.85333936A>G			Somatic				ZNF592_uc010upb.1_RNA	p.T741A	NM_014630	NP_055445	WXS	Illumina HiSeq	Unspecified	Q92610	ZN592_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0587)		5	2557	+			741			C2H2-type 4.		Q2M1T2|Q504Y9	Missense_Mutation	SNP	ENST00000560079.2	37	c.2221A>G	CCDS32317.1	.	.	.	.	.	.	.	.	.	.	A	26.0	4.692277	0.88735	.	.	ENSG00000166716	ENST00000299927	T	0.01963	4.53	5.64	5.64	0.86602	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.133960	0.64402	D	0.000002	T	0.04634	0.0126	L	0.33753	1.03	0.50467	D	0.999877	D	0.55385	0.971	P	0.53062	0.717	T	0.59584	-0.7427	9	.	.	.	-18.7668	13.8204	0.63315	1.0:0.0:0.0:0.0	.	741	Q92610	ZN592_HUMAN	A	741	ENSP00000299927:T741A	.	T	+	1	0	ZNF592	83134940	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.207000	0.72159	2.148000	0.66965	0.533000	0.62120	ACC		0.552	ZNF592-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418779.2	NM_014630	Missense_Mutation	29	64	0	0	0	0	29	64				
DNAH3	55567	broad.mit.edu	37	16	20944608	20944608	+	Missense_Mutation	SNP	A	A	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr16:20944608A>T	ENST00000261383.3	-	62	12218	c.12219T>A	c.(12217-12219)agT>agA	p.S4073R	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	4073					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		CTCTGCGGGCACTTGTTTTGT	0.512																																						uc010vbe.1		NA																	0				ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18						c.(12217-12219)AGT>AGA		dynein, axonemal, heavy chain 3							153.0	155.0	154.0					16																	20944608		2201	4300	6501	SO:0001583	missense	55567				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr16:20944608A>T	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.12219T>A	16.37:g.20944608A>T	ENSP00000261383:p.Ser4073Arg		Somatic				DNAH3_uc010vbd.1_Missense_Mutation_p.S1508R	p.S4073R	NM_017539	NP_060009	WXS	Illumina HiSeq	Unspecified	Q8TD57	DYH3_HUMAN		GBM - Glioblastoma multiforme(48;0.207)	62	12219	-			4073					O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	c.12219T>A	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.949063	0.73787	.	.	ENSG00000158486	ENST00000261383	T	0.42131	0.98	5.37	1.9	0.25705	Dynein heavy chain (1);	0.054392	0.64402	D	0.000001	T	0.55752	0.1940	M	0.77820	2.39	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.52873	-0.8517	10	0.22706	T	0.39	.	5.4986	0.16817	0.7298:0.0:0.1414:0.1288	.	4073	Q8TD57	DYH3_HUMAN	R	4073	ENSP00000261383:S4073R	ENSP00000261383:S4073R	S	-	3	2	DNAH3	20852109	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.101000	0.31037	0.342000	0.23796	0.533000	0.62120	AGT		0.512	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539		58	104	0	0	0	0	58	104				
GGA2	23062	broad.mit.edu	37	16	23480233	23480233	+	Missense_Mutation	SNP	T	T	C			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr16:23480233T>C	ENST00000309859.4	-	16	1787	c.1705A>G	c.(1705-1707)Atg>Gtg	p.M569V	GGA2_ENST00000567468.1_Intron	NM_015044.4	NP_055859.1	Q9UJY4	GGA2_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 2	569	GAE. {ECO:0000255|PROSITE- ProRule:PRU00093}.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(48;0.0386)		AGCAGCAGCATCTGAGATATC	0.512																																						uc002dlq.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1705-1707)ATG>GTG		ADP-ribosylation factor binding protein 2							110.0	100.0	103.0					16																	23480233		2197	4300	6497	SO:0001583	missense	23062				intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|clathrin-coated vesicle|endosome membrane|trans-Golgi network	ADP-ribosylation factor binding	g.chr16:23480233T>C	AF190863	CCDS10611.1	16p12	2010-02-12	2010-02-12		ENSG00000103365	ENSG00000103365			16064	protein-coding gene	gene with protein product		606005				10747088, 10749927	Standard	NM_015044		Approved	VEAR, KIAA1080	uc002dlq.3	Q9UJY4	OTTHUMG00000096957	ENST00000309859.4:c.1705A>G	16.37:g.23480233T>C	ENSP00000311962:p.Met569Val		Somatic					p.M569V	NM_015044	NP_055859	WXS	Illumina HiSeq	Unspecified	Q9UJY4	GGA2_HUMAN		GBM - Glioblastoma multiforme(48;0.0386)	16	1781	-			569			GAE.		D3DWF0|O14564|Q9NYN2|Q9UPS2	Missense_Mutation	SNP	ENST00000309859.4	37	c.1705A>G	CCDS10611.1	.	.	.	.	.	.	.	.	.	.	t	4.388	0.071562	0.08436	.	.	ENSG00000103365	ENST00000309859	T	0.26518	1.73	5.71	3.1	0.35709	Coatomer/clathrin adaptor appendage, Ig-like subdomain (1);Clathrin adaptor, gamma-adaptin, appendage (2);Clathrin adaptor, alpha/beta/gamma-adaptin, appendage, Ig-like subdomain (2);	0.494980	0.21708	N	0.070314	T	0.03959	0.0111	N	0.00133	-2.03	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.30327	-0.9982	10	0.02654	T	1	-19.5898	5.2883	0.15714	0.0:0.4194:0.0:0.5806	.	569	Q9UJY4	GGA2_HUMAN	V	569	ENSP00000311962:M569V	ENSP00000311962:M569V	M	-	1	0	GGA2	23387734	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	0.794000	0.26958	0.871000	0.35750	0.524000	0.50904	ATG		0.512	GGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214019.1			29	39	0	0	0	0	29	39				
KIF22	3835	broad.mit.edu	37	16	29814096	29814096	+	Silent	SNP	A	A	G			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr16:29814096A>G	ENST00000160827.4	+	9	1327	c.1287A>G	c.(1285-1287)ctA>ctG	p.L429L	KIF22_ENST00000400750.2_5'UTR|KIF22_ENST00000561482.1_Silent_p.L361L|KIF22_ENST00000400751.5_Silent_p.L361L|KIF22_ENST00000569382.2_Silent_p.L361L	NM_001256269.1|NM_007317.2	NP_001243198.1|NP_015556.1	Q14807	KIF22_HUMAN	kinesin family member 22	429				APASASQKLSPLQKLSSMDPAMLERLLSLDRLLASQGSQ -> SSSLCLPETQPPTEAKAAWTRPCGAPPQLGPSACLPGE P (in Ref. 2; BAA33063). {ECO:0000305}.	antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|DNA repair (GO:0006281)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)			endometrium(1)|large_intestine(1)|lung(11)|skin(1)	14						TCAGCCCCCTACAGAAGCTAA	0.592																																						uc002dts.3		NA																	0					0						c.(1285-1287)CTA>CTG		kinesin family member 22							52.0	56.0	55.0					16																	29814096		2197	4297	6494	SO:0001819	synonymous_variant	3835				blood coagulation|DNA repair|microtubule-based movement|mitosis	cytosol|kinetochore|microtubule|nucleus	ATP binding|DNA binding|microtubule motor activity|protein binding	g.chr16:29814096A>G	D38751	CCDS10653.1, CCDS58444.1	16p11.2	2008-03-03	2003-01-09	2003-01-10	ENSG00000079616	ENSG00000079616		"""Kinesins"""	6391	protein-coding gene	gene with protein product		603213	"""kinesin-like 4"""	KNSL4		8599929, 11416179	Standard	NM_007317		Approved	Kid, OBP-1, OBP-2	uc002dts.4	Q14807	OTTHUMG00000097771	ENST00000160827.4:c.1287A>G	16.37:g.29814096A>G			Somatic				uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|KIF22_uc010vdv.1_Silent_p.L361L|KIF22_uc010vdw.1_Silent_p.L361L|KIF22_uc010bzf.2_Silent_p.L361L|KIF22_uc002dtt.1_5'Flank|KIF22_uc002frc.1_5'Flank	p.L429L	NM_007317	NP_015556	WXS	Illumina HiSeq	Unspecified	Q14807	KIF22_HUMAN			9	1311	+			429	APASASQKLSPLQKLSSMDPAMLERLLSLDRLLASQGSQ -> SSSLCLPETQPPTEAKAAWTRPCGAPPQLGPSACLPGE P (in Ref. 2; BAA33063).				B2R5M0|B7Z265|O60845|O94814|Q53F58|Q9BT46	Silent	SNP	ENST00000160827.4	37	c.1287A>G	CCDS10653.1																																																																																				0.592	KIF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215012.2			3	93	0	0	0	0	3	93				
ASPHD1	253982	broad.mit.edu	37	16	29913176	29913176	+	Missense_Mutation	SNP	T	T	C			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr16:29913176T>C	ENST00000308748.5	+	1	1136	c.884T>C	c.(883-885)cTc>cCc	p.L295P	ASPHD1_ENST00000483405.1_Missense_Mutation_p.L14P|SEZ6L2_ENST00000308713.5_5'Flank|SEZ6L2_ENST00000350527.3_5'Flank|SEZ6L2_ENST00000537485.1_5'Flank|SEZ6L2_ENST00000346932.5_5'Flank	NM_181718.3	NP_859069.2	Q5U4P2	ASPH1_HUMAN	aspartate beta-hydroxylase domain containing 1	295					peptidyl-amino acid modification (GO:0018193)	integral component of membrane (GO:0016021)	dioxygenase activity (GO:0051213)			endometrium(4)|large_intestine(2)|lung(1)|prostate(1)	8						TTTTCCGTTCTCCTGCCTGGG	0.657																																						uc002dut.2		NA																	0					0						c.(883-885)CTC>CCC		aspartate beta-hydroxylase domain containing 1							21.0	21.0	21.0					16																	29913176		2134	4196	6330	SO:0001583	missense	253982				peptidyl-amino acid modification	integral to endoplasmic reticulum membrane	oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity	g.chr16:29913176T>C	AF070642	CCDS10660.1	16p11.2	2008-02-05			ENSG00000174939	ENSG00000174939			27380	protein-coding gene	gene with protein product							Standard	NM_181718		Approved		uc002dut.3	Q5U4P2	OTTHUMG00000132121	ENST00000308748.5:c.884T>C	16.37:g.29913176T>C	ENSP00000311447:p.Leu295Pro		Somatic				uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|SEZ6L2_uc002dup.3_5'Flank|SEZ6L2_uc002dur.3_5'Flank|SEZ6L2_uc002duq.3_5'Flank|SEZ6L2_uc002dus.3_5'Flank|SEZ6L2_uc010vec.1_5'Flank|SEZ6L2_uc010ved.1_5'Flank|ASPHD1_uc002duu.3_RNA|ASPHD1_uc010bzi.2_RNA	p.L295P	NM_181718	NP_859069	WXS	Illumina HiSeq	Unspecified	Q5U4P2	ASPH1_HUMAN			1	1030	+			295			Lumenal (Potential).		A0AVE3|B7ZLZ3|Q8IW63|Q8N316|Q96H00	Missense_Mutation	SNP	ENST00000308748.5	37	c.884T>C	CCDS10660.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.517257	0.85495	.	.	ENSG00000174939	ENST00000414952;ENST00000308748	T;T	0.60672	0.17;0.17	5.83	5.83	0.93111	.	0.000000	0.64402	D	0.000013	T	0.81083	0.4749	M	0.91818	3.245	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.85463	0.1168	10	0.87932	D	0	-17.3881	15.1973	0.73104	0.0:0.0:0.0:1.0	.	295	Q5U4P2	ASPH1_HUMAN	P	295	ENSP00000388036:L295P;ENSP00000311447:L295P	ENSP00000311447:L295P	L	+	2	0	ASPHD1	29820677	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.459000	0.80802	2.231000	0.72958	0.460000	0.39030	CTC		0.657	ASPHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255163.2	NM_181718		14	16	0	0	0	0	14	16				
ZNF646	9726	broad.mit.edu	37	16	31089215	31089215	+	Missense_Mutation	SNP	A	A	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr16:31089215A>T	ENST00000394979.2	+	1	1993	c.1570A>T	c.(1570-1572)Atc>Ttc	p.I524F	ZNF646_ENST00000300850.5_Missense_Mutation_p.I524F			O15015	ZN646_HUMAN	zinc finger protein 646	524					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(1)|lung(21)|ovary(1)|prostate(4)|skin(3)	49						AAGTGCAGACATCGGGGCTGA	0.622																																						uc002eap.2		NA																	0				breast(2)	2						c.(1570-1572)ATC>TTC		zinc finger protein 646							44.0	40.0	41.0					16																	31089215		2197	4300	6497	SO:0001583	missense	9726				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr16:31089215A>T	AB002294	CCDS10702.1	16p11.2	2013-01-08			ENSG00000167395	ENSG00000167395		"""Zinc fingers, C2H2-type"""	29004	protein-coding gene	gene with protein product							Standard	NM_014699		Approved	KIAA0296	uc002eap.3	O15015	OTTHUMG00000047355	ENST00000394979.2:c.1570A>T	16.37:g.31089215A>T	ENSP00000378429:p.Ile524Phe		Somatic					p.I524F	NM_014699	NP_055514	WXS	Illumina HiSeq	Unspecified	O15015	ZN646_HUMAN			2	1859	+			524					Q8IVD8	Missense_Mutation	SNP	ENST00000394979.2	37	c.1570A>T		.	.	.	.	.	.	.	.	.	.	A	0.436	-0.900808	0.02472	.	.	ENSG00000167395	ENST00000300850;ENST00000394979	T;T	0.08458	3.09;3.1	5.11	3.09	0.35607	.	.	.	.	.	T	0.04272	0.0118	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.38628	-0.9652	9	0.48119	T	0.1	-0.0804	5.2387	0.15460	0.154:0.6227:0.1432:0.0802	.	524	O15015-2	.	F	524	ENSP00000300850:I524F;ENSP00000378429:I524F	ENSP00000300850:I524F	I	+	1	0	ZNF646	30996716	0.000000	0.05858	0.032000	0.17829	0.031000	0.12232	0.273000	0.18662	0.704000	0.31869	-0.302000	0.09304	ATC		0.622	ZNF646-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000108510.2	NM_014699		10	16	0	0	0	0	10	16				
SNX20	124460	broad.mit.edu	37	16	50707787	50707787	+	Silent	SNP	G	G	A			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr16:50707787G>A	ENST00000330943.4	-	4	652	c.481C>T	c.(481-483)Ctg>Ttg	p.L161L	RP11-401P9.5_ENST00000570167.1_RNA|RP11-401P9.5_ENST00000570241.2_RNA|SNX20_ENST00000300590.3_Intron|SNX20_ENST00000423026.2_Intron	NM_182854.2	NP_878274.1	Q7Z614	SNX20_HUMAN	sorting nexin 20	161	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				protein transport (GO:0015031)	endosome (GO:0005768)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)			kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|skin(2)|stomach(1)	15						TACTCCTGCAGGGCGCGCCGA	0.647																																						uc002egk.2		NA																	0				ovary(1)	1						c.(481-483)CTG>TTG		sorting nexin 20 isoform 1							45.0	43.0	44.0					16																	50707787		2198	4300	6498	SO:0001819	synonymous_variant	124460				cell communication|protein transport	endosome membrane|nucleus|plasma membrane	phosphatidylinositol binding|protein binding	g.chr16:50707787G>A	AK055837	CCDS10745.1, CCDS10744.1, CCDS45481.1	16q12.1	2008-03-25	2008-03-25		ENSG00000167208	ENSG00000167208		"""Sorting nexins"""	30390	protein-coding gene	gene with protein product	"""selectin ligand interactor cytoplasmic 1"""	613281				18196517, 16782399	Standard	NM_182854		Approved	SLIC-1, SLIC1	uc002egk.2	Q7Z614	OTTHUMG00000133173	ENST00000330943.4:c.481C>T	16.37:g.50707787G>A			Somatic				SNX20_uc010vgp.1_Intron|SNX20_uc002egi.3_Intron	p.L161L	NM_182854	NP_878274	WXS	Illumina HiSeq	Unspecified	Q7Z614	SNX20_HUMAN			4	654	-			161			PX.		A8K9D5|Q08E98|Q6P4H2|Q8IV59	Silent	SNP	ENST00000330943.4	37	c.481C>T	CCDS10745.1																																																																																				0.647	SNX20-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256879.2	NM_153337		5	25	0	0	0	0	5	25				
CTCF	10664	broad.mit.edu	37	16	67670700	67670700	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr16:67670700A>T	ENST00000264010.4	+	11	2389	c.1945A>T	c.(1945-1947)Aag>Tag	p.K649*	CTCF_ENST00000401394.1_Nonsense_Mutation_p.K321*	NM_006565.3	NP_006556.1	P49711	CTCF_HUMAN	CCCTC-binding factor (zinc finger protein)	649					chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|DNA methylation (GO:0006306)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome positioning (GO:0016584)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone acetylation (GO:0035065)|regulation of histone methylation (GO:0031060)|regulation of molecular function, epigenetic (GO:0040030)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin insulator sequence binding (GO:0043035)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(6)|central_nervous_system(2)|cervix(1)|endometrium(34)|haematopoietic_and_lymphoid_tissue(7)|kidney(3)|large_intestine(9)|liver(1)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	79		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)		ACCACCCGCCAAGAAGCGGAG	0.587																																					Colon(175;1200 1966 6945 23069 27405)	uc002etl.2		NA																	0				ovary(1)	1						c.(1945-1947)AAG>TAG		CCCTC-binding factor							116.0	125.0	122.0					16																	67670700		2198	4300	6498	SO:0001587	stop_gained	10664				chromatin modification|chromosome segregation|negative regulation of transcription, DNA-dependent|nucleosome positioning|positive regulation of transcription, DNA-dependent|regulation of centromeric sister chromatid cohesion|regulation of molecular function, epigenetic	chromosome, centromeric region|condensed chromosome|nucleolus|nucleoplasm	chromatin insulator sequence binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr16:67670700A>T	U25435	CCDS10841.1, CCDS54029.1	16q21-q22.3	2013-01-08			ENSG00000102974	ENSG00000102974		"""Zinc fingers, C2H2-type"""	13723	protein-coding gene	gene with protein product	"""11 zinc finger transcriptional repressor"""	604167				8649389, 18550811	Standard	NM_006565		Approved		uc002etl.3	P49711	OTTHUMG00000137539	ENST00000264010.4:c.1945A>T	16.37:g.67670700A>T	ENSP00000264010:p.Lys649*		Somatic				CTCF_uc010cek.2_Nonsense_Mutation_p.K321*|CTCF_uc002etm.1_Nonsense_Mutation_p.K138*	p.K649*	NM_006565	NP_006556	WXS	Illumina HiSeq	Unspecified	P49711	CTCF_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)	11	2235	+		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)	649					B5MC38|Q53XI7|Q59EL8	Nonsense_Mutation	SNP	ENST00000264010.4	37	c.1945A>T	CCDS10841.1	.	.	.	.	.	.	.	.	.	.	A	40	8.378463	0.98784	.	.	ENSG00000102974	ENST00000264010;ENST00000401394	.	.	.	6.03	6.03	0.97812	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.6826	16.5582	0.84512	1.0:0.0:0.0:0.0	.	.	.	.	X	649;321	.	ENSP00000264010:K649X	K	+	1	0	CTCF	66228201	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.187000	0.77730	2.308000	0.77769	0.533000	0.62120	AAG		0.587	CTCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268870.2	NM_006565		79	135	0	0	0	0	79	135				
CENPT	80152	broad.mit.edu	37	16	67861219	67861219	+	IGR	SNP	G	G	A			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr16:67861219G>A	ENST00000562787.1	-	0	2345				TSNAXIP1_ENST00000388833.3_Missense_Mutation_p.G524S|TSNAXIP1_ENST00000415766.3_Missense_Mutation_p.G509S|TSNAXIP1_ENST00000561639.1_Missense_Mutation_p.G578S	NM_025082.3	NP_079358.3	Q96BT3	CENPT_HUMAN	centromere protein T						chromosome organization (GO:0051276)|chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|lung(6)|urinary_tract(1)	10		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00429)|Epithelial(162;0.019)|all cancers(182;0.124)		GGAGGCAGGGGGCTGGCATCC	0.597																																						uc002euj.2		NA																	0					0						c.(1570-1572)GGC>AGC		translin-associated factor X interacting protein							86.0	84.0	84.0					16																	67861219		2198	4300	6498	SO:0001628	intergenic_variant	55815				cell differentiation|multicellular organismal development|spermatogenesis	perinuclear region of cytoplasm		g.chr16:67861219G>A	AK056097	CCDS42182.1	16q22.1	2013-11-05	2006-06-15	2006-06-15		ENSG00000102901			25787	protein-coding gene	gene with protein product		611510	"""chromosome 16 open reading frame 56"""	C16orf56		16622420, 16622419	Standard	NM_025082		Approved	FLJ13111, CENP-T	uc002eun.4	Q96BT3			16.37:g.67861219G>A			Somatic				TSNAXIP1_uc010vjz.1_Missense_Mutation_p.G401S|TSNAXIP1_uc002euf.3_Missense_Mutation_p.G257S|TSNAXIP1_uc010vka.1_Missense_Mutation_p.G578S|TSNAXIP1_uc010vkb.1_Missense_Mutation_p.G509S|TSNAXIP1_uc002eug.3_Missense_Mutation_p.G232S|TSNAXIP1_uc002euh.3_Missense_Mutation_p.G232S|TSNAXIP1_uc002eui.3_Missense_Mutation_p.G232S|TSNAXIP1_uc002euk.2_Missense_Mutation_p.G257S	p.G524S	NM_018430	NP_060900	WXS	Illumina HiSeq	Unspecified	Q2TAA8	TXIP1_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.00432)|Epithelial(162;0.0192)|all cancers(182;0.125)	14	1964	+		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)	524					Q96I29|Q96IC6|Q96NK9|Q9H901	Missense_Mutation	SNP	ENST00000562787.1	37	c.1570G>A	CCDS42182.1	.	.	.	.	.	.	.	.	.	.	G	18.49	3.635891	0.67130	.	.	ENSG00000102904	ENST00000415766;ENST00000388833;ENST00000431934	.	.	.	6.06	6.06	0.98353	.	0.343747	0.26939	N	0.021722	T	0.72439	0.3460	L	0.51422	1.61	0.40406	D	0.979705	D;D;D;D;D;P	0.89917	0.999;0.999;0.999;1.0;0.999;0.949	D;D;D;D;D;P	0.74674	0.974;0.952;0.952;0.984;0.952;0.57	T	0.64245	-0.6453	9	0.10902	T	0.67	-23.5763	17.5376	0.87837	0.0:0.0:1.0:0.0	.	509;578;314;232;524;509	E7ENJ7;B4DXD0;B4DY78;Q2TAA8-2;Q2TAA8;B4E1H3	.;.;.;.;TXIP1_HUMAN;.	S	509;524;314	.	ENSP00000373485:G524S	G	+	1	0	TSNAXIP1	66418720	0.993000	0.37304	0.988000	0.46212	0.937000	0.57800	2.182000	0.42556	2.882000	0.98803	0.655000	0.94253	GGC		0.597	CENPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422020.1	NM_025082		32	36	0	0	0	0	32	36				
TP53	7157	broad.mit.edu	37	17	7579386	7579386	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr17:7579386T>A	ENST00000269305.4	-	4	490	c.301A>T	c.(301-303)Aaa>Taa	p.K101*	TP53_ENST00000455263.2_Nonsense_Mutation_p.K101*|TP53_ENST00000413465.2_Nonsense_Mutation_p.K101*|TP53_ENST00000359597.4_Nonsense_Mutation_p.K101*|TP53_ENST00000445888.2_Nonsense_Mutation_p.K101*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Nonsense_Mutation_p.K101*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	101	Interaction with HIPK1. {ECO:0000250}.|Interaction with WWOX.|Required for interaction with ZNF385A.		K -> N (in a sporadic cancer; somatic mutation).|K -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.K101*(4)|p.Q100fs*37(3)|p.G59fs*23(3)|p.T102fs*21(2)|p.V73fs*9(1)|p.K101fs*48(1)|p.W91fs*13(1)|p.P13fs*18(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGGTAGGTTTTCTGGGAAGGG	0.642		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		25	Deletion - Frameshift(12)|Whole gene deletion(8)|Substitution - Nonsense(4)|Insertion - Frameshift(1)	p.0?(7)|p.K101R(3)|p.G59fs*23(3)|p.T102fs*21(2)|p.V73fs*9(1)|p.K101fs*48(1)|p.K101N(1)|p.W91fs*13(1)|p.K101*(1)|p.P13fs*18(1)|p.S33fs*23(1)	lung(5)|bone(4)|upper_aerodigestive_tract(3)|ovary(3)|central_nervous_system(2)|breast(2)|cervix(1)|large_intestine(1)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)|liver(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245						c.(301-303)AAA>TAA	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							50.0	51.0	51.0					17																	7579386		2203	4300	6503	SO:0001587	stop_gained	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7579386T>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.301A>T	17.37:g.7579386T>A	ENSP00000269305:p.Lys101*	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)	Somatic				TP53_uc002gig.1_Nonsense_Mutation_p.K101*|TP53_uc002gih.2_Nonsense_Mutation_p.K101*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_5'Flank|TP53_uc010cng.1_5'Flank|TP53_uc002gii.1_5'Flank|TP53_uc010cnh.1_Nonsense_Mutation_p.K101*|TP53_uc010cni.1_Nonsense_Mutation_p.K101*|TP53_uc002gij.2_Nonsense_Mutation_p.K101*|TP53_uc010cnj.1_5'Flank|TP53_uc002gin.2_Intron|TP53_uc002gio.2_Intron|TP53_uc010vug.1_Nonsense_Mutation_p.K62*|TP53_uc010cnk.1_Nonsense_Mutation_p.K116*	p.K101*	NM_001126112	NP_001119584	WXS	Illumina HiSeq	Unspecified	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	4	495	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	101		K -> R (in sporadic cancers; somatic mutation).|K -> N (in a sporadic cancer; somatic mutation).	Interaction with HIPK1 (By similarity).|Interaction with WWOX.		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	c.301A>T	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	18.02	3.530501	0.64860	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	.	.	.	4.75	3.64	0.41730	.	0.462648	0.25596	N	0.029584	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	-14.3503	4.8692	0.13624	0.0:0.0959:0.191:0.7131	.	.	.	.	X	101	.	ENSP00000269305:K101X	K	-	1	0	TP53	7520111	0.857000	0.29778	0.003000	0.11579	0.440000	0.31957	1.332000	0.33805	0.906000	0.36621	0.533000	0.62120	AAA		0.642	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		33	8	0	0	0	0	33	8				
SEZ6	124925	broad.mit.edu	37	17	27308731	27308731	+	Missense_Mutation	SNP	C	C	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr17:27308731C>T	ENST00000317338.12	-	2	810	c.382G>A	c.(382-384)Gcg>Acg	p.A128T	SEZ6_ENST00000360295.9_Missense_Mutation_p.A128T|PIPOX_ENST00000583215.1_Intron|SEZ6_ENST00000442608.3_Missense_Mutation_p.A128T|SEZ6_ENST00000335960.6_Missense_Mutation_p.A128T			Q53EL9	SEZ6_HUMAN	seizure related 6 homolog (mouse)	128	Pro-rich.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|negative regulation of dendrite development (GO:2000171)|positive regulation of dendrite development (GO:1900006)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	apical dendrite (GO:0097440)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(4)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	29	Lung NSC(42;0.0137)		Epithelial(11;4.73e-06)|all cancers(11;2.91e-05)|BRCA - Breast invasive adenocarcinoma(11;8.06e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.111)			GTGGGTACCGCAGCCATGGCT	0.652																																						uc002hdp.2		NA																	0				large_intestine(1)|central_nervous_system(1)	2						c.(382-384)GCG>ACG		seizure related 6 homolog isoform 1							27.0	33.0	31.0					17																	27308731		2202	4300	6502	SO:0001583	missense	124925					integral to membrane|plasma membrane		g.chr17:27308731C>T	AY038048	CCDS45638.1, CCDS45639.1	17q11.2	2008-03-06	2001-11-28		ENSG00000063015	ENSG00000063015			15955	protein-coding gene	gene with protein product			"""seizure related gene 6 (mouse) homolog"""			17086543	Standard	NM_178860		Approved		uc002hdp.2	Q53EL9	OTTHUMG00000168010	ENST00000317338.12:c.382G>A	17.37:g.27308731C>T	ENSP00000312942:p.Ala128Thr		Somatic				SEZ6_uc002hdm.2_RNA|SEZ6_uc010cry.1_Missense_Mutation_p.A128T|SEZ6_uc002hdq.1_Missense_Mutation_p.A3T|SEZ6_uc010crz.1_Missense_Mutation_p.A128T	p.A128T	NM_178860	NP_849191	WXS	Illumina HiSeq	Unspecified	Q53EL9	SEZ6_HUMAN	Epithelial(11;4.73e-06)|all cancers(11;2.91e-05)|BRCA - Breast invasive adenocarcinoma(11;8.06e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.111)		2	576	-	Lung NSC(42;0.0137)		128			Pro-rich.|Extracellular (Potential).		B6ZDN1|Q8N701|Q8NB57|Q8ND50|Q8TD25|Q96NI5|Q96NQ3	Missense_Mutation	SNP	ENST00000317338.12	37	c.382G>A	CCDS45639.1	.	.	.	.	.	.	.	.	.	.	C	7.985	0.752081	0.15778	.	.	ENSG00000063015	ENST00000442608;ENST00000360295;ENST00000317338;ENST00000335960;ENST00000541381	T;T;T	0.27104	1.72;1.69;2.65	4.98	2.9	0.33743	.	0.385688	0.21502	N	0.073504	T	0.15392	0.0371	L	0.29908	0.895	0.09310	N	1	B;B;B	0.30361	0.145;0.277;0.181	B;B;B	0.24394	0.053;0.053;0.024	T	0.16867	-1.0388	10	0.72032	D	0.01	.	5.7121	0.17941	0.0:0.6199:0.2643:0.1158	.	128;128;128	F5GZF9;Q53EL9-3;Q53EL9	.;.;SEZ6_HUMAN	T	128;128;3;128;128	ENSP00000403784:A128T;ENSP00000353440:A128T;ENSP00000337407:A128T	ENSP00000312942:A3T	A	-	1	0	SEZ6	24332857	0.010000	0.17322	0.031000	0.17742	0.081000	0.17604	0.601000	0.24119	1.099000	0.41499	0.462000	0.41574	GCG		0.652	SEZ6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397475.3			13	21	0	0	0	0	13	21				
RFFL	117584	broad.mit.edu	37	17	33343508	33343508	+	Missense_Mutation	SNP	C	C	T	rs559325960		TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr17:33343508C>T	ENST00000315249.7	-	5	989	c.767G>A	c.(766-768)cGg>cAg	p.R256Q	RFFL_ENST00000268850.7_Missense_Mutation_p.R228Q|RFFL_ENST00000415395.2_Missense_Mutation_p.R256Q|RFFL_ENST00000394597.2_Missense_Mutation_p.R256Q|RAD51L3-RFFL_ENST00000593039.1_Missense_Mutation_p.R173Q|RFFL_ENST00000584655.1_Missense_Mutation_p.R228Q|RFFL_ENST00000378516.2_Missense_Mutation_p.R256Q|RFFL_ENST00000447669.2_Missense_Mutation_p.R256Q|RFFL_ENST00000413582.2_Missense_Mutation_p.R256Q					ring finger and FYVE-like domain containing E3 ubiquitin protein ligase											kidney(1)|large_intestine(2)|lung(3)	6		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		TTTCAGCTGCCGCACTGTCAG	0.537													C|||	1	0.000199681	0.0008	0.0	5008	,	,		21487	0.0		0.0	False		,,,				2504	0.0					uc002hin.1		NA																	0					0						c.(766-768)CGG>CAG		rififylin							120.0	115.0	117.0					17																	33343508		2203	4300	6503	SO:0001583	missense	117584				apoptosis	membrane	ligase activity|zinc ion binding	g.chr17:33343508C>T	AF434816	CCDS11286.1	17q12	2012-02-23	2012-02-23		ENSG00000092871	ENSG00000092871		"""RING-type (C3HC4) zinc fingers"""	24821	protein-coding gene	gene with protein product		609735	"""ring finger and FYVE-like domain containing"""			15229288	Standard	NR_037713		Approved	rififylin, fring, RNF189, RNF34L	uc002hin.1	Q8WZ73	OTTHUMG00000132933	ENST00000315249.7:c.767G>A	17.37:g.33343508C>T	ENSP00000326170:p.Arg256Gln		Somatic				RFFL_uc002hiq.2_Missense_Mutation_p.R173Q|RFFL_uc002him.1_Missense_Mutation_p.R256Q|RFFL_uc010cti.1_Missense_Mutation_p.R262Q|RFFL_uc002hip.1_Missense_Mutation_p.R228Q|RFFL_uc002hio.1_Missense_Mutation_p.R256Q	p.R256Q	NM_001017368	NP_001017368	WXS	Illumina HiSeq	Unspecified	Q8WZ73	RFFL_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)	5	940	-		Ovarian(249;0.17)	256			SAP 2.			Missense_Mutation	SNP	ENST00000315249.7	37	c.767G>A	CCDS11286.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.912115	0.92178	.	.	ENSG00000092871	ENST00000315249;ENST00000394597;ENST00000378516;ENST00000268850;ENST00000413582	T;T;T;T;T	0.55588	0.53;0.53;0.51;0.59;0.51	5.23	4.27	0.50696	.	0.000000	0.85682	D	0.000000	T	0.70911	0.3278	M	0.74467	2.265	0.58432	D	0.999999	D;D;D;D	0.89917	0.999;0.999;1.0;0.999	D;D;D;D	0.91635	0.99;0.99;0.999;0.99	T	0.75136	-0.3424	10	0.87932	D	0	-20.5454	13.1261	0.59356	0.0:0.9233:0.0:0.0767	.	256;228;256;256	C9JN73;Q8WZ73-3;Q8WZ73;Q8WZ73-2	.;.;RFFL_HUMAN;.	Q	256;256;256;228;256	ENSP00000326170:R256Q;ENSP00000378096:R256Q;ENSP00000367777:R256Q;ENSP00000268850:R228Q;ENSP00000408513:R256Q	ENSP00000268850:R228Q	R	-	2	0	RFFL	30367621	1.000000	0.71417	0.268000	0.24571	0.639000	0.38242	5.922000	0.70036	1.434000	0.47414	0.655000	0.94253	CGG		0.537	RFFL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256460.2	NM_057178		10	163	0	0	0	0	10	163				
KRT26	353288	broad.mit.edu	37	17	38926053	38926053	+	Missense_Mutation	SNP	G	G	A			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr17:38926053G>A	ENST00000335552.4	-	5	970	c.922C>T	c.(922-924)Cgc>Tgc	p.R308C		NM_181539.4	NP_853517.2			keratin 26											central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(5)	16		Breast(137;0.00526)				TGCAGATTGCGTTTTAATTCG	0.438																																						uc002hvf.2		NA																	0					0						c.(922-924)CGC>TGC		keratin 26							185.0	170.0	175.0					17																	38926053		2203	4300	6503	SO:0001583	missense	353288					intermediate filament	structural molecule activity	g.chr17:38926053G>A	AJ564205	CCDS11374.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000186393	ENSG00000186393		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30840	protein-coding gene	gene with protein product			"""keratin 25B"""	KRT25B		16831889	Standard	NM_181539		Approved		uc002hvf.3	Q7Z3Y9	OTTHUMG00000133370	ENST00000335552.4:c.922C>T	17.37:g.38926053G>A	ENSP00000334798:p.Arg308Cys		Somatic					p.R308C	NM_181539	NP_853517	WXS	Illumina HiSeq	Unspecified	Q7Z3Y9	K1C26_HUMAN			5	968	-		Breast(137;0.00526)	308			Rod.|Coil 2.			Missense_Mutation	SNP	ENST00000335552.4	37	c.922C>T	CCDS11374.1	.	.	.	.	.	.	.	.	.	.	G	15.21	2.764993	0.49574	.	.	ENSG00000186393	ENST00000335552	D	0.90732	-2.72	5.24	5.24	0.73138	Filament (1);	0.000000	0.64402	D	0.000019	D	0.93635	0.7967	M	0.79258	2.445	0.53688	D	0.999976	D	0.57899	0.981	P	0.56648	0.803	D	0.93921	0.7206	10	0.62326	D	0.03	.	14.0715	0.64863	0.0:0.0:0.8492:0.1508	.	308	Q7Z3Y9	K1C26_HUMAN	C	308	ENSP00000334798:R308C	ENSP00000334798:R308C	R	-	1	0	KRT26	36179579	1.000000	0.71417	0.997000	0.53966	0.070000	0.16714	3.877000	0.56123	2.601000	0.87937	0.655000	0.94253	CGC		0.438	KRT26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257215.1	NM_181539		45	20	0	0	0	0	45	20				
H3F3B	3021	broad.mit.edu	37	17	73775146	73775146	+	Missense_Mutation	SNP	T	T	A			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr17:73775146T>A	ENST00000254810.4	-	2	242	c.110A>T	c.(109-111)aAg>aTg	p.K37M	H3F3B_ENST00000589599.1_Missense_Mutation_p.K37M|H3F3B_ENST00000587560.1_Missense_Mutation_p.K37M|H3F3B_ENST00000591890.1_Missense_Mutation_p.K37M|H3F3B_ENST00000593254.1_Intron|H3F3B_ENST00000592643.1_Missense_Mutation_p.K37M|H3F3B_ENST00000586607.1_Missense_Mutation_p.K37M	NM_005324.3	NP_005315.1	P84243	H33_HUMAN	H3 histone, family 3B (H3.3B)	37					blood coagulation (GO:0007596)|brain development (GO:0007420)|DNA replication-independent nucleosome assembly (GO:0006336)|positive regulation of cell growth (GO:0030307)|response to hormone (GO:0009725)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nuclear nucleosome (GO:0000788)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	nucleosomal DNA binding (GO:0031492)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)			large_intestine(1)|lung(4)|ovary(2)|skin(1)	8	all_cancers(13;1.5e-07)		all cancers(21;2.61e-06)|Epithelial(20;7.39e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|LUSC - Lung squamous cell carcinoma(166;0.154)			ATGAGGCTTCTTCACCCCGCC	0.662											OREG0024740	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										uc002jpl.2		NA																	0				ovary(1)	1						c.(109-111)AAG>ATG		H3 histone, family 3B							27.0	29.0	28.0					17																	73775146		2202	4300	6502	SO:0001583	missense	3021				blood coagulation|nucleosome assembly	nucleoplasm|nucleosome	DNA binding	g.chr17:73775146T>A	Z48950	CCDS11729.1	17q25.1	2011-06-01			ENSG00000132475	ENSG00000132475		"""Histones / Replication-independent"""	4765	protein-coding gene	gene with protein product		601058				8586426	Standard	NM_005324		Approved	H3.3B	uc002jpl.3	P84243		ENST00000254810.4:c.110A>T	17.37:g.73775146T>A	ENSP00000254810:p.Lys37Met		Somatic	OREG0024740	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1147		p.K37M	NM_005324	NP_005315	WXS	Illumina HiSeq	Unspecified	P84243	H33_HUMAN	all cancers(21;2.61e-06)|Epithelial(20;7.39e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|LUSC - Lung squamous cell carcinoma(166;0.154)		2	243	-	all_cancers(13;1.5e-07)		37					P06351|P33155|Q5VV55|Q5VV56|Q66I33|Q9V3W4	Missense_Mutation	SNP	ENST00000254810.4	37	c.110A>T	CCDS11729.1	.	.	.	.	.	.	.	.	.	.	T	13.08	2.128986	0.37533	.	.	ENSG00000132475	ENST00000254810	T	0.56776	0.44	5.08	5.08	0.68730	.	0.000000	0.64402	U	0.000012	T	0.78723	0.4328	M	0.93978	3.48	0.52501	D	0.999953	.	.	.	.	.	.	D	0.84968	0.0881	8	0.87932	D	0	.	15.0159	0.71584	0.0:0.0:0.0:1.0	.	.	.	.	M	37	ENSP00000254810:K37M	ENSP00000254810:K37M	K	-	2	0	H3F3B	71286741	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	7.467000	0.80930	2.132000	0.65825	0.533000	0.62120	AAG		0.662	H3F3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448499.1	NM_005324		13	19	0	0	0	0	13	19				
ANGPTL6	83854	broad.mit.edu	37	19	10204170	10204170	+	Silent	SNP	G	G	A			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr19:10204170G>A	ENST00000253109.4	-	5	1315	c.1077C>T	c.(1075-1077)gcC>gcT	p.A359A	ANGPTL6_ENST00000592641.1_Silent_p.A359A|ANGPTL6_ENST00000589181.1_Silent_p.A319A	NM_031917.2	NP_114123.2	Q8NI99	ANGL6_HUMAN	angiopoietin-like 6	359	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|secretory granule (GO:0030141)				endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)	12			OV - Ovarian serous cystadenocarcinoma(20;3.58e-08)|Epithelial(33;2.5e-05)|all cancers(31;5.96e-05)			CATCATAGTGGGCACGTGCTC	0.612																																						uc002mmx.1		NA																	0					0						c.(1075-1077)GCC>GCT		angiopoietin-like 6 precursor							62.0	52.0	55.0					19																	10204170		2203	4300	6503	SO:0001819	synonymous_variant	83854				angiogenesis|cell differentiation|signal transduction	extracellular space	receptor binding	g.chr19:10204170G>A	AB054064	CCDS12224.1	19p13.2	2013-02-06				ENSG00000130812		"""Fibrinogen C domain containing"""	23140	protein-coding gene	gene with protein product	"""angiopoietin-related protein 5"""	609336				12871997	Standard	NM_031917		Approved	ARP5, AGF	uc002mmy.1	Q8NI99		ENST00000253109.4:c.1077C>T	19.37:g.10204170G>A			Somatic				ANGPTL6_uc002mmy.1_Silent_p.A359A	p.A359A	NM_031917	NP_114123	WXS	Illumina HiSeq	Unspecified	Q8NI99	ANGL6_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;3.58e-08)|Epithelial(33;2.5e-05)|all cancers(31;5.96e-05)		5	1195	-			359			Fibrinogen C-terminal.		A5PKV7|Q9BZZ0	Silent	SNP	ENST00000253109.4	37	c.1077C>T	CCDS12224.1																																																																																				0.612	ANGPTL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451142.1	NM_031917		15	31	0	0	0	0	15	31				
CCDC105	126402	broad.mit.edu	37	19	15132682	15132682	+	Missense_Mutation	SNP	A	A	G	rs568917459	byFrequency	TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr19:15132682A>G	ENST00000292574.3	+	6	1284	c.1202A>G	c.(1201-1203)tAc>tGc	p.Y401C		NM_173482.2	NP_775753.2	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105	401						extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(4)|skin(2)	23						GTTCGCATGTACCAGAGACAC	0.632																																						uc002nae.2		NA																	0				ovary(1)	1						c.(1201-1203)TAC>TGC		coiled-coil domain containing 105							62.0	69.0	67.0					19																	15132682		2203	4300	6503	SO:0001583	missense	126402				microtubule cytoskeleton organization	microtubule		g.chr19:15132682A>G	AK097684	CCDS12322.1	19p13.12	2008-02-05				ENSG00000160994			26866	protein-coding gene	gene with protein product						12477932	Standard	NM_173482		Approved	FLJ40365	uc002nae.2	Q8IYK2		ENST00000292574.3:c.1202A>G	19.37:g.15132682A>G	ENSP00000292574:p.Tyr401Cys		Somatic					p.Y401C	NM_173482	NP_775753	WXS	Illumina HiSeq	Unspecified	Q8IYK2	CC105_HUMAN			6	1301	+			401					Q8N7T5|Q8NDL5	Missense_Mutation	SNP	ENST00000292574.3	37	c.1202A>G	CCDS12322.1	.	.	.	.	.	.	.	.	.	.	A	16.32	3.089542	0.55968	.	.	ENSG00000160994	ENST00000292574	T	0.00976	5.48	3.78	2.69	0.31865	.	0.129543	0.31847	N	0.006967	T	0.03011	0.0089	M	0.67953	2.075	0.31541	N	0.659989	D	0.76494	0.999	D	0.70487	0.969	T	0.12243	-1.0555	10	0.42905	T	0.14	-21.1357	5.593	0.17311	0.7334:0.0:0.0:0.2666	.	401	Q8IYK2	CC105_HUMAN	C	401	ENSP00000292574:Y401C	ENSP00000292574:Y401C	Y	+	2	0	CCDC105	14993682	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.514000	0.45503	1.606000	0.50161	0.449000	0.29647	TAC		0.632	CCDC105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466293.1	NM_173482		15	34	0	0	0	0	15	34				
KXD1	79036	broad.mit.edu	37	19	18675832	18675832	+	Splice_Site	SNP	G	G	A			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr19:18675832G>A	ENST00000602094.1	+	3	1714		c.e3+1		KXD1_ENST00000599319.1_Splice_Site|KXD1_ENST00000601630.1_Splice_Site|KXD1_ENST00000595073.1_Splice_Site|KXD1_ENST00000540691.1_Splice_Site|KXD1_ENST00000539106.1_Splice_Site|KXD1_ENST00000599000.1_Splice_Site|KXD1_ENST00000222307.4_Splice_Site|KXD1_ENST00000598830.1_Splice_Site			Q9BQD3	KXDL1_HUMAN	KxDL motif containing 1						vesicle-mediated transport (GO:0016192)	BLOC-1 complex (GO:0031083)											GCCGTATCAGGTGGGTGCTCA	0.587																																						uc002njo.2		NA																	0					0						c.e3+1		hypothetical protein LOC79036							89.0	90.0	90.0					19																	18675832		2203	4300	6503	SO:0001630	splice_region_variant	79036						protein binding	g.chr19:18675832G>A	AK098346	CCDS12381.1	19p13.11	2011-11-24	2011-11-24	2011-11-24	ENSG00000105700	ENSG00000105700			28420	protein-coding gene	gene with protein product		615178	"""chromosome 19 open reading frame 50"""	C19orf50		21159114	Standard	NM_001171948		Approved	FLJ25480, MGC2749, KXDL	uc002njo.3	Q9BQD3		ENST00000602094.1:c.254+1G>A	19.37:g.18675832G>A			Somatic				C19orf50_uc002njp.2_Splice_Site|C19orf50_uc002njq.2_Splice_Site_p.R85_splice	p.R85_splice	NM_024069	NP_076974	WXS	Illumina HiSeq	Unspecified	Q9BQD3	CS050_HUMAN			3	396	+								O76098	Splice_Site	SNP	ENST00000602094.1	37	c.254_splice	CCDS12381.1	.	.	.	.	.	.	.	.	.	.	g	16.28	3.077837	0.55753	.	.	ENSG00000105700	ENST00000540691;ENST00000539106;ENST00000222307	.	.	.	5.05	5.05	0.67936	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.3723	0.87382	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C19orf50	18536832	1.000000	0.71417	0.996000	0.52242	0.435000	0.31806	8.512000	0.90538	2.349000	0.79799	0.486000	0.48141	.		0.587	KXD1-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465107.1	NM_024069	Intron	32	44	0	0	0	0	32	44				
NUDT19	390916	broad.mit.edu	37	19	33200149	33200149	+	Missense_Mutation	SNP	C	C	G			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr19:33200149C>G	ENST00000397061.3	+	2	773	c.773C>G	c.(772-774)cCc>cGc	p.P258R		NM_001105570.1	NP_001099040.1	A8MXV4	NUD19_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 19	258	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.					mitochondrion (GO:0005739)|peroxisome (GO:0005777)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)|receptor binding (GO:0005102)			endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	8	Esophageal squamous(110;0.137)					TGGTTGCCACCCCCACAGTTC	0.433																																						uc010edf.2		NA																	0					0						c.(772-774)CCC>CGC		nudix (nucleoside diphosphate linked moiety							194.0	187.0	189.0					19																	33200149		1861	4087	5948	SO:0001583	missense	390916					mitochondrion|peroxisome	hydrolase activity|metal ion binding	g.chr19:33200149C>G		CCDS42543.1	19q13.11	2011-11-16			ENSG00000213965	ENSG00000213965		"""Nudix motif containing"""	32036	protein-coding gene	gene with protein product							Standard	NM_001105570		Approved	RP2	uc010edf.3	A8MXV4		ENST00000397061.3:c.773C>G	19.37:g.33200149C>G	ENSP00000380251:p.Pro258Arg		Somatic					p.P258R	NM_001105570	NP_001099040	WXS	Illumina HiSeq	Unspecified	A8MXV4	NUD19_HUMAN			2	773	+	Esophageal squamous(110;0.137)		258			Nudix hydrolase.			Missense_Mutation	SNP	ENST00000397061.3	37	c.773C>G	CCDS42543.1	.	.	.	.	.	.	.	.	.	.	C	14.66	2.602181	0.46423	.	.	ENSG00000213965	ENST00000397061	T	0.09255	3.0	4.88	3.84	0.44239	NUDIX hydrolase domain (3);NUDIX hydrolase domain-like (1);	0.000000	0.85682	U	0.000000	T	0.34658	0.0905	M	0.86805	2.84	0.44136	D	0.996923	D	0.89917	1.0	D	0.97110	1.0	T	0.15809	-1.0424	10	0.72032	D	0.01	-25.2788	9.5548	0.39332	0.0:0.9009:0.0:0.0991	.	258	A8MXV4	NUD19_HUMAN	R	258	ENSP00000380251:P258R	ENSP00000380251:P258R	P	+	2	0	NUDT19	37891989	0.878000	0.30173	0.309000	0.25155	0.645000	0.38454	1.785000	0.38684	1.170000	0.42753	0.591000	0.81541	CCC		0.433	NUDT19-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000450338.3	XM_372723		29	229	0	0	0	0	29	229				
ARHGAP35	2909	broad.mit.edu	37	19	47492882	47492882	+	Missense_Mutation	SNP	C	C	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr19:47492882C>T	ENST00000404338.3	+	4	3986	c.3986C>T	c.(3985-3987)cCt>cTt	p.P1329L		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	1329	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)										TCAGAACTGCCTGACCCCCTG	0.542																																						uc010ekv.2		NA																	0				central_nervous_system(1)	1						c.(3985-3987)CCT>CTT		glucocorticoid receptor DNA binding factor 1							152.0	152.0	152.0					19																	47492882		1993	4167	6160	SO:0001583	missense	2909				axon guidance|negative regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol	DNA binding|Rho GTPase activator activity|transcription corepressor activity	g.chr19:47492882C>T	M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.3986C>T	19.37:g.47492882C>T	ENSP00000385720:p.Pro1329Leu		Somatic					p.P1329L	NM_004491	NP_004482	WXS	Illumina HiSeq	Unspecified	Q9NRY4	RHG35_HUMAN		all cancers(93;2.03e-05)|OV - Ovarian serous cystadenocarcinoma(262;2.57e-05)|Epithelial(262;0.00135)|GBM - Glioblastoma multiforme(486;0.0289)	4	3986	+		all_cancers(25;1.51e-09)|all_epithelial(76;1.87e-07)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|Ovarian(192;0.0129)|all_neural(266;0.026)|Breast(70;0.077)	1329			Rho-GAP.		A7E2A4|Q14452|Q9C0E1	Missense_Mutation	SNP	ENST00000404338.3	37	c.3986C>T	CCDS46127.1	.	.	.	.	.	.	.	.	.	.	C	18.09	3.546420	0.65198	.	.	ENSG00000160007	ENST00000317082;ENST00000404338	T	0.59083	0.29	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.71953	0.3401	M	0.92077	3.27	0.80722	D	1	P	0.43973	0.823	P	0.44921	0.464	T	0.75986	-0.3124	10	0.32370	T	0.25	-14.7909	18.1907	0.89806	0.0:1.0:0.0:0.0	.	1329	Q9NRY4-2	.	L	1329	ENSP00000385720:P1329L	ENSP00000324820:P1329L	P	+	2	0	ARHGAP35	52184722	1.000000	0.71417	0.995000	0.50966	0.971000	0.66376	7.337000	0.79256	2.604000	0.88044	0.655000	0.94253	CCT		0.542	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466652.1	NM_004491		52	86	0	0	0	0	52	86				
DKKL1	27120	broad.mit.edu	37	19	49867878	49867878	+	Missense_Mutation	SNP	T	T	C			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr19:49867878T>C	ENST00000221498.2	+	2	455	c.50T>C	c.(49-51)cTg>cCg	p.L17P	DKKL1_ENST00000594268.1_Intron|TEAD2_ENST00000593945.1_5'Flank|TEAD2_ENST00000601519.1_5'Flank|TEAD2_ENST00000539846.1_5'Flank|TEAD2_ENST00000311227.2_5'Flank	NM_014419.3	NP_055234.1	Q9UK85	DKKL1_HUMAN	dickkopf-like 1	17					anatomical structure morphogenesis (GO:0009653)|positive regulation of fat cell differentiation (GO:0045600)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	signal transducer activity (GO:0004871)			large_intestine(2)|upper_aerodigestive_tract(1)	3		all_lung(116;1.66e-06)|Lung NSC(112;5.89e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0456)		CTGCTGGTCCTGCTGCTGCTC	0.677																																						uc002pnk.2		NA																	0					0						c.(49-51)CTG>CCG		dickkopf-like 1 precursor							48.0	42.0	44.0					19																	49867878		2203	4300	6503	SO:0001583	missense	27120				anatomical structure morphogenesis	extracellular space	protein binding|signal transducer activity	g.chr19:49867878T>C	AB047816	CCDS12762.1	19q13.3	2010-10-12	2010-10-12		ENSG00000104901	ENSG00000104901			16528	protein-coding gene	gene with protein product	"""cancer/testis antigen 34"", ""soggy"""	605418	"""dickkopf-like 1 (soggy)"""			10570958	Standard	NM_001197301		Approved	SGY-1, CT34	uc002pnk.3	Q9UK85		ENST00000221498.2:c.50T>C	19.37:g.49867878T>C	ENSP00000221498:p.Leu17Pro		Somatic				TEAD2_uc002pni.2_5'Flank|TEAD2_uc002pnj.2_5'Flank|TEAD2_uc010yao.1_5'Flank|TEAD2_uc010emw.2_5'Flank	p.L17P	NM_014419	NP_055234	WXS	Illumina HiSeq	Unspecified	Q9UK85	DKKL1_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0456)	2	264	+		all_lung(116;1.66e-06)|Lung NSC(112;5.89e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)	17						Missense_Mutation	SNP	ENST00000221498.2	37	c.50T>C	CCDS12762.1	.	.	.	.	.	.	.	.	.	.	T	18.69	3.678400	0.68042	.	.	ENSG00000104901	ENST00000221498	T	0.23754	1.89	3.25	1.04	0.20106	.	0.000000	0.30930	N	0.008591	T	0.25644	0.0624	L	0.31294	0.92	0.35330	D	0.785544	D	0.61697	0.99	P	0.58266	0.836	T	0.32161	-0.9917	10	0.87932	D	0	.	3.249	0.06807	0.0:0.1342:0.2459:0.6199	.	17	Q9UK85	DKKL1_HUMAN	P	17	ENSP00000221498:L17P	ENSP00000221498:L17P	L	+	2	0	DKKL1	54559690	0.934000	0.31675	0.251000	0.24312	0.961000	0.63080	0.099000	0.15210	0.154000	0.19237	0.459000	0.35465	CTG		0.677	DKKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465454.2	NM_014419		3	55	0	0	0	0	3	55				
PRKD3	23683	broad.mit.edu	37	2	37501741	37501741	+	Missense_Mutation	SNP	T	T	A			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr2:37501741T>A	ENST00000379066.1	-	11	2236	c.1474A>T	c.(1474-1476)Act>Tct	p.T492S	PRKD3_ENST00000234179.2_Missense_Mutation_p.T492S			O94806	KPCD3_HUMAN	protein kinase D3	492	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				intracellular signal transduction (GO:0035556)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)			breast(3)|central_nervous_system(2)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33		all_hematologic(82;0.21)				TATACCATAGTATCAGTAATG	0.423																																					Melanoma(80;621 1355 8613 11814 51767)	uc002rqd.2		NA																	0				lung(2)|ovary(1)|central_nervous_system(1)	4						c.(1474-1476)ACT>TCT		protein kinase D3							112.0	101.0	104.0					2																	37501741		2203	4300	6503	SO:0001583	missense	23683				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction	cytoplasm|membrane|nucleus	ATP binding|metal ion binding|protein binding|protein kinase C activity	g.chr2:37501741T>A	AB015982	CCDS1789.1	2p21	2013-01-10	2004-10-28	2004-10-30	ENSG00000115825	ENSG00000115825		"""Pleckstrin homology (PH) domain containing"""	9408	protein-coding gene	gene with protein product		607077	"""protein kinase C, nu"""	PRKCN		10231560	Standard	NM_005813		Approved	EPK2	uc002rqd.3	O94806	OTTHUMG00000100961	ENST00000379066.1:c.1474A>T	2.37:g.37501741T>A	ENSP00000368356:p.Thr492Ser		Somatic				PRKD3_uc002rqe.1_Missense_Mutation_p.T92S|PRKD3_uc002rqf.1_Missense_Mutation_p.T492S	p.T492S	NM_005813	NP_005804	WXS	Illumina HiSeq	Unspecified	O94806	KPCD3_HUMAN			10	2029	-		all_hematologic(82;0.21)	492			PH.		D6W587|Q53TR7|Q8NEL8	Missense_Mutation	SNP	ENST00000379066.1	37	c.1474A>T	CCDS1789.1	.	.	.	.	.	.	.	.	.	.	T	15.30	2.792909	0.50102	.	.	ENSG00000115825	ENST00000379066;ENST00000234179;ENST00000443977	T;T;T	0.23348	2.13;2.13;1.91	5.42	5.42	0.78866	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.057094	0.64402	D	0.000002	T	0.22044	0.0531	L	0.39085	1.19	0.51767	D	0.99993	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.03641	-1.1017	10	0.23302	T	0.38	-22.2696	15.4588	0.75336	0.0:0.0:0.0:1.0	.	492;492	O94806-2;O94806	.;KPCD3_HUMAN	S	492;492;3	ENSP00000368356:T492S;ENSP00000234179:T492S;ENSP00000398743:T3S	ENSP00000234179:T492S	T	-	1	0	PRKD3	37355245	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.999000	0.70665	2.036000	0.60181	0.477000	0.44152	ACT		0.423	PRKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218570.3	NM_005813		26	28	0	0	0	0	26	28				
ZNF638	27332	broad.mit.edu	37	2	71629115	71629115	+	Silent	SNP	C	C	G			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr2:71629115C>G	ENST00000409544.1	+	16	3357	c.2727C>G	c.(2725-2727)gtC>gtG	p.V909V	ZNF638_ENST00000355812.3_Silent_p.V909V|ZNF638_ENST00000264447.4_Silent_p.V909V	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	909	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						TGATGCTTGTCTCTAATTTGC	0.269																																						uc002shx.2		NA																	0				pancreas(2)|ovary(1)|skin(1)	4						c.(2725-2727)GTC>GTG		zinc finger protein 638							82.0	87.0	85.0					2																	71629115		2202	4296	6498	SO:0001819	synonymous_variant	27332				RNA splicing	cytoplasm|nuclear speck	double-stranded DNA binding|nucleotide binding|RNA binding|zinc ion binding	g.chr2:71629115C>G	D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.2727C>G	2.37:g.71629115C>G			Somatic				ZNF638_uc010yqw.1_Silent_p.V488V|ZNF638_uc002shy.2_Silent_p.V909V|ZNF638_uc002shz.2_Silent_p.V909V|ZNF638_uc002sia.2_Silent_p.V909V|ZNF638_uc002sib.1_Silent_p.V909V|ZNF638_uc010fed.2_RNA|ZNF638_uc002sic.2_Silent_p.V6V	p.V909V	NM_014497	NP_055312	WXS	Illumina HiSeq	Unspecified	Q14966	ZN638_HUMAN			16	3046	+			909			RRM 2.		B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Silent	SNP	ENST00000409544.1	37	c.2727C>G	CCDS1917.1																																																																																				0.269	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327431.1	NM_014497		18	34	0	0	0	0	18	34				
DYSF	8291	broad.mit.edu	37	2	71901427	71901427	+	Splice_Site	SNP	G	G	A			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr2:71901427G>A	ENST00000258104.3	+	51	6044		c.e51+1		DYSF_ENST00000409762.1_Splice_Site|DYSF_ENST00000409744.1_Splice_Site|DYSF_ENST00000409582.3_Splice_Site|DYSF_ENST00000410020.3_Splice_Site|DYSF_ENST00000479049.2_Splice_Site|DYSF_ENST00000409366.1_Splice_Site|DYSF_ENST00000409651.1_Splice_Site|DYSF_ENST00000410041.1_Splice_Site|DYSF_ENST00000429174.2_Splice_Site|DYSF_ENST00000394120.2_Splice_Site|DYSF_ENST00000413539.2_Splice_Site	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin						plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						GATTTTCTGGGTAAGCGCTAT	0.522																																						uc002sie.2		NA																	0				ovary(3)|breast(2)|pancreas(1)|skin(1)	7	GRCh37	CS090610	DYSF	S		c.e51+1		dysferlin isoform 8							128.0	106.0	113.0					2																	71901427		2203	4300	6503	SO:0001630	splice_region_variant	8291					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding	g.chr2:71901427G>A	AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.5767+1G>A	2.37:g.71901427G>A			Somatic				DYSF_uc010feg.2_Splice_Site_p.G1954_splice|DYSF_uc010feh.2_Splice_Site_p.G1930_splice|DYSF_uc002sig.3_Splice_Site_p.G1909_splice|DYSF_uc010yqx.1_Splice_Site|DYSF_uc010fee.2_Splice_Site_p.G1944_splice|DYSF_uc010fef.2_Splice_Site_p.G1961_splice|DYSF_uc010fei.2_Splice_Site_p.G1940_splice|DYSF_uc010fek.2_Splice_Site_p.G1941_splice|DYSF_uc010fej.2_Splice_Site_p.G1931_splice|DYSF_uc010fel.2_Splice_Site_p.G1910_splice|DYSF_uc010feo.2_Splice_Site_p.G1955_splice|DYSF_uc010fem.2_Splice_Site_p.G1945_splice|DYSF_uc010fen.2_Splice_Site_p.G1962_splice|DYSF_uc002sif.2_Splice_Site_p.G1924_splice|DYSF_uc010yqy.1_Splice_Site_p.G804_splice|DYSF_uc010yqz.1_Splice_Site_p.G684_splice	p.G1923_splice	NM_003494	NP_003485	WXS	Illumina HiSeq	Unspecified	O75923	DYSF_HUMAN			51	6143	+								A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Splice_Site	SNP	ENST00000258104.3	37	c.5767_splice	CCDS1918.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.266774	0.80358	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	.	.	.	5.56	5.56	0.83823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.3679	0.87368	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DYSF	71754935	1.000000	0.71417	1.000000	0.80357	0.763000	0.43281	9.646000	0.98474	2.779000	0.95612	0.561000	0.74099	.		0.522	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494	Intron	15	28	0	0	0	0	15	28				
TUBA3E	112714	broad.mit.edu	37	2	130949610	130949610	+	Missense_Mutation	SNP	C	C	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr2:130949610C>T	ENST00000312988.7	-	5	1247	c.1147G>A	c.(1147-1149)Gcc>Acc	p.A383T		NM_207312.2	NP_997195	Q6PEY2	TBA3E_HUMAN	tubulin, alpha 3e	383					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			endometrium(4)|kidney(7)|large_intestine(6)|lung(9)|skin(2)	28	Colorectal(110;0.1)					TCCGCAATGGCCGTGGTGTTG	0.632																																						uc002tqv.2		NA																	0				skin(1)	1						c.(1147-1149)GCC>ACC		tubulin, alpha 3e							66.0	65.0	65.0					2																	130949610		2203	4300	6503	SO:0001583	missense	112714				microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity	g.chr2:130949610C>T	BC057811	CCDS2158.1	2q21.1	2007-03-16			ENSG00000152086	ENSG00000152086		"""Tubulins"""	20765	protein-coding gene	gene with protein product							Standard	NM_207312		Approved		uc002tqv.3	Q6PEY2	OTTHUMG00000131626	ENST00000312988.7:c.1147G>A	2.37:g.130949610C>T	ENSP00000318197:p.Ala383Thr		Somatic					p.A383T	NM_207312	NP_997195	WXS	Illumina HiSeq	Unspecified	Q6PEY2	TBA3E_HUMAN			5	1248	-	Colorectal(110;0.1)		383						Missense_Mutation	SNP	ENST00000312988.7	37	c.1147G>A	CCDS2158.1	.	.	.	.	.	.	.	.	.	.	c	15.90	2.968384	0.53614	.	.	ENSG00000152086	ENST00000312988	D	0.84298	-1.83	2.96	2.96	0.34315	Tubulin/FtsZ, 2-layer sandwich domain (3);Tubulin/FtsZ, C-terminal (1);	0.000000	0.48286	U	0.000195	D	0.95421	0.8513	H	0.99659	4.685	0.49798	D	0.999822	P	0.46784	0.884	D	0.64687	0.928	D	0.95988	0.8983	10	0.87932	D	0	.	11.6912	0.51516	0.0:1.0:0.0:0.0	.	383	Q6PEY2	TBA3E_HUMAN	T	383	ENSP00000318197:A383T	ENSP00000318197:A383T	A	-	1	0	TUBA3E	130666080	0.999000	0.42202	0.586000	0.28679	0.807000	0.45602	4.326000	0.59241	1.668000	0.50843	0.455000	0.32223	GCC		0.632	TUBA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254519.1	NM_207312		48	84	0	0	0	0	48	84				
RIF1	55183	broad.mit.edu	37	2	152266962	152266962	+	Missense_Mutation	SNP	C	C	T	rs572659964		TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr2:152266962C>T	ENST00000243326.5	+	1	508	c.25C>T	c.(25-27)Ctc>Ttc	p.L9F	RIF1_ENST00000453091.2_Missense_Mutation_p.L9F|RIF1_ENST00000433166.2_Missense_Mutation_p.L9F|RIF1_ENST00000444746.2_Missense_Mutation_p.L9F|RIF1_ENST00000430328.2_Missense_Mutation_p.L9F|RIF1_ENST00000428287.2_Missense_Mutation_p.L9F			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1	0					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		TCAGAGCCCCCTCGCGCCGCT	0.652											OREG0015013	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	1	0.000199681	0.0	0.0	5008	,	,		14789	0.001		0.0	False		,,,				2504	0.0					uc002txm.2		NA																	0				ovary(5)|breast(4)|skin(3)|lung(2)|kidney(1)	15						c.(25-27)CTC>TTC		RAP1 interacting factor 1							27.0	32.0	30.0					2																	152266962		2203	4300	6503	SO:0001583	missense	55183				cell cycle|response to DNA damage stimulus	chromosome, telomeric region|cytoplasm|nucleus|spindle	binding	g.chr2:152266962C>T	AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.25C>T	2.37:g.152266962C>T	ENSP00000243326:p.Leu9Phe		Somatic	OREG0015013	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1746	RIF1_uc002txl.2_Missense_Mutation_p.L9F|RIF1_uc010fnv.1_Intron|RIF1_uc002txn.2_Missense_Mutation_p.L9F|RIF1_uc002txo.2_Missense_Mutation_p.L9F|RIF1_uc010zby.1_RNA	p.L9F	NM_018151	NP_060621	WXS	Illumina HiSeq	Unspecified	Q5UIP0	RIF1_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0429)	2	155	+			9					A0AVS0|Q9NS16	Missense_Mutation	SNP	ENST00000243326.5	37	c.25C>T	CCDS2194.1	.	.	.	.	.	.	.	.	.	.	C	14.90	2.672425	0.47781	.	.	ENSG00000080345	ENST00000444746;ENST00000453091;ENST00000428287;ENST00000433166;ENST00000420714;ENST00000243326;ENST00000430328	T;T;T;T;T	0.15718	2.41;2.4;2.4;2.41;2.4	4.03	2.23	0.28157	Armadillo-type fold (1);	0.147080	0.46145	D	0.000304	T	0.26484	0.0647	L	0.58669	1.825	0.39735	D	0.971663	P;D	0.67145	0.802;0.996	B;D	0.63957	0.133;0.92	T	0.11251	-1.0595	10	0.26408	T	0.33	-5.0E-4	4.3099	0.10965	0.0:0.6014:0.1877:0.2109	.	9;9	Q5UIP0;Q5UIP0-2	RIF1_HUMAN;.	F	9	ENSP00000390181:L9F;ENSP00000414615:L9F;ENSP00000415691:L9F;ENSP00000243326:L9F;ENSP00000416123:L9F	ENSP00000243326:L9F	L	+	1	0	RIF1	151975208	0.169000	0.23002	0.184000	0.23157	0.969000	0.65631	0.679000	0.25291	0.362000	0.24319	0.455000	0.32223	CTC		0.652	RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254836.3			18	53	0	0	0	0	18	53				
TTC21B	79809	broad.mit.edu	37	2	166764213	166764213	+	Missense_Mutation	SNP	C	C	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr2:166764213C>T	ENST00000243344.7	-	19	2680	c.2543G>A	c.(2542-2544)gGt>gAt	p.G848D		NM_024753.4	NP_079029.3	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B	848					forebrain dorsal/ventral pattern formation (GO:0021798)|intraciliary retrograde transport (GO:0035721)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|protein localization to cilium (GO:0061512)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|nuclear chromatin (GO:0000790)				breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(9)|lung(28)|ovary(2)|pancreas(2)|skin(2)|urinary_tract(1)	58						GATCGCATCACCAAGTTTTTC	0.393																																						uc002udk.2		NA																	0				ovary(2)|pancreas(2)|breast(1)	5						c.(2542-2544)GGT>GAT		tetratricopeptide repeat domain 21B							126.0	104.0	112.0					2																	166764213		2203	4300	6503	SO:0001583	missense	79809					cilium axoneme|cytoplasm|cytoskeleton	binding	g.chr2:166764213C>T	AB082523	CCDS33315.1	2q24.3	2014-09-04			ENSG00000123607	ENSG00000123607		"""Tetratricopeptide (TTC) repeat domain containing"", ""Intraflagellar transport homologs"""	25660	protein-coding gene	gene with protein product		612014				12056414, 21258341	Standard	NM_024753		Approved	FLJ11457, JBTS11, NPHP12, IFT139, THM1	uc002udk.3	Q7Z4L5	OTTHUMG00000154083	ENST00000243344.7:c.2543G>A	2.37:g.166764213C>T	ENSP00000243344:p.Gly848Asp		Somatic					p.G848D	NM_024753	NP_079029	WXS	Illumina HiSeq	Unspecified	Q7Z4L5	TT21B_HUMAN			19	2676	-			848			TPR 12.		A8MUZ3|Q3LIE4|Q53T84|Q6P4A1|Q6PIF5|Q8NCN3|Q96MA4|Q9HAK8	Missense_Mutation	SNP	ENST00000243344.7	37	c.2543G>A	CCDS33315.1	.	.	.	.	.	.	.	.	.	.	C	7.760	0.705233	0.15172	.	.	ENSG00000123607	ENST00000243344	T	0.51574	0.7	5.38	-2.46	0.06461	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.368649	0.32802	N	0.005623	T	0.14399	0.0348	N	0.02011	-0.69	0.29136	N	0.879299	B	0.02656	0.0	B	0.01281	0.0	T	0.24440	-1.0160	10	0.14656	T	0.56	0.02	5.8972	0.18945	0.0:0.2608:0.252:0.4871	.	848	Q7Z4L5	TT21B_HUMAN	D	848	ENSP00000243344:G848D	ENSP00000243344:G848D	G	-	2	0	TTC21B	166472459	0.032000	0.19561	0.252000	0.24328	0.853000	0.48598	0.025000	0.13577	-0.217000	0.10033	0.555000	0.69702	GGT		0.393	TTC21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333770.1	NM_024753		17	19	0	0	0	0	17	19				
HECW2	57520	broad.mit.edu	37	2	197081812	197081812	+	Missense_Mutation	SNP	G	G	A			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr2:197081812G>A	ENST00000260983.3	-	27	4596	c.4414C>T	c.(4414-4416)Cat>Tat	p.H1472Y	snoU13_ENST00000459047.1_RNA|HECW2_ENST00000409111.1_Missense_Mutation_p.H1116Y	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	1472	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						TGATTGTCATGGTATCCTATC	0.388																																						uc002utm.1		NA																	0				skin(5)|ovary(5)|lung(4)|pancreas(2)|central_nervous_system(1)|kidney(1)	18						c.(4414-4416)CAT>TAT		HECT, C2 and WW domain containing E3 ubiquitin							143.0	134.0	137.0					2																	197081812		2203	4300	6503	SO:0001583	missense	57520				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity	g.chr2:197081812G>A	AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.4414C>T	2.37:g.197081812G>A	ENSP00000260983:p.His1472Tyr		Somatic				HECW2_uc002utl.1_Missense_Mutation_p.H1116Y	p.H1472Y	NM_020760	NP_065811	WXS	Illumina HiSeq	Unspecified	Q9P2P5	HECW2_HUMAN			27	4597	-			1472			HECT.		B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	ENST00000260983.3	37	c.4414C>T	CCDS33354.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.329932	0.81690	.	.	ENSG00000138411	ENST00000409111;ENST00000260983	T;T	0.57752	0.38;0.38	4.85	4.85	0.62838	HECT (4);	0.000000	0.85682	D	0.000000	T	0.69495	0.3117	L	0.58810	1.83	0.80722	D	1	D	0.69078	0.997	D	0.79108	0.992	T	0.68454	-0.5404	10	0.44086	T	0.13	.	18.535	0.91008	0.0:0.0:1.0:0.0	.	1472	Q9P2P5	HECW2_HUMAN	Y	1116;1472	ENSP00000386775:H1116Y;ENSP00000260983:H1472Y	ENSP00000260983:H1472Y	H	-	1	0	HECW2	196790057	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	9.208000	0.95075	2.674000	0.91012	0.655000	0.94253	CAT		0.388	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3	NM_020760		11	100	0	0	0	0	11	100				
CATIP	375307	broad.mit.edu	37	2	219221907	219221907	+	Missense_Mutation	SNP	C	C	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr2:219221907C>T	ENST00000289388.3	+	2	144	c.115C>T	c.(115-117)Ctc>Ttc	p.L39F	AC021016.8_ENST00000411433.1_RNA	NM_198559.1	NP_940961.1	Q7Z7H3	CATIP_HUMAN		39					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	16		Renal(207;0.0915)		Epithelial(149;8.08e-07)|all cancers(144;0.000146)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCTCAGCTCCCTCCGTGAGCT	0.607																																						uc002vhr.2		NA																	0					0						c.(115-117)CTC>TTC		hypothetical protein LOC375307							36.0	39.0	38.0					2																	219221907		2203	4300	6503	SO:0001583	missense	375307							g.chr2:219221907C>T																												ENST00000289388.3:c.115C>T	2.37:g.219221907C>T	ENSP00000289388:p.Leu39Phe		Somatic				C2orf62_uc002vhs.2_5'Flank	p.L39F	NM_198559	NP_940961	WXS	Illumina HiSeq	Unspecified	Q7Z7H3	CB062_HUMAN		Epithelial(149;8.08e-07)|all cancers(144;0.000146)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	2	144	+		Renal(207;0.0915)	39						Missense_Mutation	SNP	ENST00000289388.3	37	c.115C>T	CCDS2414.1	.	.	.	.	.	.	.	.	.	.	C	12.82	2.052666	0.36181	.	.	ENSG00000158428	ENST00000289388	.	.	.	4.48	0.495	0.16890	.	0.284754	0.27567	N	0.018784	T	0.21227	0.0511	L	0.33485	1.01	0.09310	N	1	B	0.27498	0.18	B	0.26310	0.068	T	0.11518	-1.0584	9	0.48119	T	0.1	-0.1713	3.2676	0.06870	0.1864:0.5095:0.0:0.3041	.	39	Q7Z7H3	CB062_HUMAN	F	39	.	ENSP00000289388:L39F	L	+	1	0	C2orf62	218930151	0.002000	0.14202	0.097000	0.21041	0.941000	0.58515	-0.098000	0.11024	-0.017000	0.14103	0.563000	0.77884	CTC		0.607	C2orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256771.1			23	38	0	0	0	0	23	38				
BCS1L	617	broad.mit.edu	37	2	219526164	219526164	+	Missense_Mutation	SNP	G	G	A			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr2:219526164G>A	ENST00000431802.1	+	3	1055	c.356G>A	c.(355-357)cGa>cAa	p.R119Q	ZNF142_ENST00000411696.2_5'Flank|BCS1L_ENST00000439945.1_Missense_Mutation_p.R119Q|BCS1L_ENST00000412366.1_Missense_Mutation_p.R119Q|BCS1L_ENST00000392110.2_Missense_Mutation_p.R119Q|BCS1L_ENST00000392109.1_Missense_Mutation_p.R119Q|ZNF142_ENST00000449707.1_5'Flank|BCS1L_ENST00000392111.2_Missense_Mutation_p.R119Q|BCS1L_ENST00000359273.3_Missense_Mutation_p.R119Q			Q9Y276	BCS1_HUMAN	BC1 (ubiquinol-cytochrome c reductase) synthesis-like	119					mitochondrial respiratory chain complex I assembly (GO:0032981)|mitochondrial respiratory chain complex III assembly (GO:0034551)|mitochondrial respiratory chain complex IV assembly (GO:0033617)|mitochondrion organization (GO:0007005)	mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	8		Renal(207;0.0474)		Epithelial(149;7.12e-07)|all cancers(144;0.000131)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GAACGAAGTCGAGAGATGCAG	0.493																																						uc002vio.2		NA																	0					0						c.(355-357)CGA>CAA		BCS1-like							107.0	121.0	116.0					2																	219526164		2203	4300	6503	SO:0001583	missense	617				mitochondrial respiratory chain complex I assembly|mitochondrial respiratory chain complex III assembly|mitochondrial respiratory chain complex IV assembly	integral to membrane|mitochondrial respiratory chain complex III	ATP binding|nucleoside-triphosphatase activity|protein binding	g.chr2:219526164G>A	AF026849	CCDS2419.1	2q35	2014-09-17	2012-10-12		ENSG00000074582	ENSG00000074582		"""ATPases / AAA-type"", ""Mitochondrial respiratory chain complex assembly factors"""	1020	protein-coding gene	gene with protein product	"""GRACILE syndrome"", ""Bjornstad syndrome"""	603647	"""BCS1 (yeast homolog)-like"", ""BCS1-like (yeast)"", ""BCS1-like (S. cerevisiae)"""			9878253, 17314340	Standard	NM_001079866		Approved	Hs.6719, BCS, h-BCS, BJS	uc002viq.3	Q9Y276	OTTHUMG00000133114	ENST00000431802.1:c.356G>A	2.37:g.219526164G>A	ENSP00000413908:p.Arg119Gln		Somatic				ZNF142_uc002vin.2_5'Flank|ZNF142_uc010fvt.2_5'Flank|ZNF142_uc002vim.2_5'Flank|BCS1L_uc002vip.2_Missense_Mutation_p.R119Q|BCS1L_uc002viq.2_Missense_Mutation_p.R119Q|BCS1L_uc010fvu.2_Missense_Mutation_p.R119Q|BCS1L_uc010fvv.2_Missense_Mutation_p.R119Q|BCS1L_uc002vir.2_Missense_Mutation_p.R119Q|BCS1L_uc002vis.2_Missense_Mutation_p.R119Q	p.R119Q	NM_004328	NP_004319	WXS	Illumina HiSeq	Unspecified	Q9Y276	BCS1_HUMAN		Epithelial(149;7.12e-07)|all cancers(144;0.000131)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	3	774	+		Renal(207;0.0474)	119			Mitochondrial matrix (Potential).		B3KTW9|Q7Z2V7	Missense_Mutation	SNP	ENST00000431802.1	37	c.356G>A	CCDS2419.1	.	.	.	.	.	.	.	.	.	.	G	36	5.786241	0.96937	.	.	ENSG00000074582	ENST00000430322;ENST00000456050;ENST00000359273;ENST00000392109;ENST00000392110;ENST00000392111;ENST00000412366;ENST00000439945;ENST00000431802	D;D;D;D;D;D;D;D;D	0.96885	-4.16;-4.16;-4.16;-4.16;-4.16;-4.16;-4.16;-4.16;-4.16	5.33	5.33	0.75918	BCS1, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98566	0.9521	H	0.95539	3.685	0.80722	D	1	D	0.64830	0.994	P	0.62491	0.903	D	0.98393	1.0564	10	0.37606	T	0.19	-20.0973	19.2185	0.93788	0.0:0.0:1.0:0.0	.	119	Q9Y276	BCS1_HUMAN	Q	119	ENSP00000398957:R119Q;ENSP00000395440:R119Q;ENSP00000352219:R119Q;ENSP00000375957:R119Q;ENSP00000375958:R119Q;ENSP00000375959:R119Q;ENSP00000406494:R119Q;ENSP00000404999:R119Q;ENSP00000413908:R119Q	ENSP00000352219:R119Q	R	+	2	0	BCS1L	219234408	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.568000	0.73987	2.774000	0.95407	0.650000	0.86243	CGA		0.493	BCS1L-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336756.1	NM_004328		76	56	0	0	0	0	76	56				
STK36	27148	broad.mit.edu	37	2	219543897	219543897	+	Silent	SNP	C	C	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr2:219543897C>T	ENST00000295709.3	+	7	970	c.691C>T	c.(691-693)Ctg>Ttg	p.L231L	STK36_ENST00000440309.1_Silent_p.L231L|STK36_ENST00000392105.3_Silent_p.L231L|STK36_ENST00000392106.2_Silent_p.L231L	NM_015690.4	NP_056505.2			serine/threonine kinase 36											biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(20)|ovary(4)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	52		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)		GTAGAACTTCCTGCAGGGACT	0.478																																						uc002viu.2		NA																	0				ovary(4)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)	11						c.(691-693)CTG>TTG		serine/threonine kinase 36							127.0	124.0	125.0					2																	219543897		2203	4300	6503	SO:0001819	synonymous_variant	27148				cilium assembly|positive regulation of hh target transcription factor activity|positive regulation of smoothened signaling pathway|post-embryonic development	aggresome|cytoplasm|focal adhesion|intermediate filament cytoskeleton|nucleus	ATP binding|protein serine/threonine kinase activity|transcription factor binding	g.chr2:219543897C>T	AB033104	CCDS2421.1, CCDS58750.1	2q35	2010-06-25	2010-06-25		ENSG00000163482	ENSG00000163482			17209	protein-coding gene	gene with protein product	"""fused homolog (Drosophila)"""	607652	"""serine/threonine kinase 36 (fused homolog, Drosophila)"""			10806483	Standard	NM_001243313		Approved	KIAA1278, FU	uc002viu.3	Q9NRP7	OTTHUMG00000133079	ENST00000295709.3:c.691C>T	2.37:g.219543897C>T			Somatic				STK36_uc002viv.2_Silent_p.L231L	p.L231L	NM_015690	NP_056505	WXS	Illumina HiSeq	Unspecified	Q9NRP7	STK36_HUMAN		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)	7	957	+		Renal(207;0.0915)	231			Protein kinase.			Silent	SNP	ENST00000295709.3	37	c.691C>T	CCDS2421.1																																																																																				0.478	STK36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256723.2			39	85	0	0	0	0	39	85				
CHRND	1144	broad.mit.edu	37	2	233399048	233399048	+	Missense_Mutation	SNP	A	A	C	rs144433265		TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr2:233399048A>C	ENST00000258385.3	+	11	1399	c.1367A>C	c.(1366-1368)aAt>aCt	p.N456T	CHRND_ENST00000543200.1_Missense_Mutation_p.N441T|CHRND_ENST00000457943.2_Missense_Mutation_p.N262T	NM_000751.2	NP_000742.1	Q07001	ACHD_HUMAN	cholinergic receptor, nicotinic, delta (muscle)	456					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|musculoskeletal movement (GO:0050881)|neuromuscular process (GO:0050905)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)	34		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.89e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00078)|Lung(119;0.00579)|LUSC - Lung squamous cell carcinoma(224;0.00754)	Galantamine(DB00674)	AACAATTACAATGAGGTAAGG	0.488																																						uc002vsw.2		NA																	0				ovary(1)|breast(1)|skin(1)	3						c.(1366-1368)AAT>ACT		nicotinic acetylcholine receptor delta							65.0	64.0	65.0					2																	233399048		2203	4300	6503	SO:0001583	missense	1144				muscle contraction|musculoskeletal movement|neuromuscular process|skeletal muscle tissue growth|synaptic transmission	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	nicotinic acetylcholine-activated cation-selective channel activity|receptor activity	g.chr2:233399048A>C	X55019	CCDS2494.1, CCDS58754.1	2q37.1	2012-02-11	2012-02-07		ENSG00000135902	ENSG00000135902		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1965	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, delta (muscle)"""	100720	"""cholinergic receptor, nicotinic, delta"""	ACHRD			Standard	NM_000751		Approved		uc002vsw.4	Q07001	OTTHUMG00000133261	ENST00000258385.3:c.1367A>C	2.37:g.233399048A>C	ENSP00000258385:p.Asn456Thr		Somatic				CHRND_uc010zmg.1_Missense_Mutation_p.N441T|CHRND_uc010fyc.2_Missense_Mutation_p.N329T|CHRND_uc010zmh.1_Missense_Mutation_p.N262T	p.N456T	NM_000751	NP_000742	WXS	Illumina HiSeq	Unspecified	Q07001	ACHD_HUMAN		Epithelial(121;1.89e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00078)|Lung(119;0.00579)|LUSC - Lung squamous cell carcinoma(224;0.00754)	11	1371	+		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)	456			Cytoplasmic (Potential).		A8K661|B4DT92|Q52LH4	Missense_Mutation	SNP	ENST00000258385.3	37	c.1367A>C	CCDS2494.1	.	.	.	.	.	.	.	.	.	.	a	18.82	3.704700	0.68615	.	.	ENSG00000135902	ENST00000543200;ENST00000258385;ENST00000457943	D;D;D	0.84589	-1.87;-1.87;-1.87	5.19	5.19	0.71726	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.184234	0.56097	D	0.000034	D	0.85665	0.5749	L	0.45051	1.395	0.52099	D	0.999947	D;P;P;P	0.62365	0.991;0.907;0.907;0.907	P;P;P;P	0.57720	0.826;0.57;0.57;0.57	D	0.83611	0.0134	10	0.30078	T	0.28	.	10.3053	0.43676	0.9228:0.0:0.0772:0.0	.	262;441;456;456	B4E3W4;B4DT92;A8K661;Q07001	.;.;.;ACHD_HUMAN	T	441;456;262	ENSP00000438380:N441T;ENSP00000258385:N456T;ENSP00000391055:N262T	ENSP00000258385:N456T	N	+	2	0	CHRND	233107292	0.997000	0.39634	0.998000	0.56505	0.912000	0.54170	4.091000	0.57700	1.968000	0.57251	0.375000	0.23000	AAT		0.488	CHRND-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257038.2			7	98	0	0	0	0	7	98				
USP40	55230	broad.mit.edu	37	2	234460155	234460155	+	Nonsense_Mutation	SNP	A	A	C			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr2:234460155A>C	ENST00000427112.2	-	6	739	c.704T>G	c.(703-705)tTa>tGa	p.L235*	USP40_ENST00000251722.6_Nonsense_Mutation_p.L235*|USP40_ENST00000450966.1_Nonsense_Mutation_p.L247*			Q9NVE5	UBP40_HUMAN	ubiquitin specific peptidase 40	235	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(1)|endometrium(6)|kidney(5)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0539)		Epithelial(121;1.71e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000407)|Lung(119;0.00277)|LUSC - Lung squamous cell carcinoma(224;0.00646)		CAGCTTACGTAATTTGGCCGA	0.308																																						uc010zmu.1		NA																	0				ovary(1)|lung(1)|breast(1)	3						c.(703-705)TTA>TGA		SubName: Full=cDNA FLJ56772, highly similar to Ubiquitin carboxyl-terminal hydrolase 40 (EC 3.1.2.15);							41.0	38.0	39.0					2																	234460155		1820	4079	5899	SO:0001587	stop_gained	55230				ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity	g.chr2:234460155A>C	AK001647	CCDS46547.1	2q37.1	2005-08-08	2005-08-08		ENSG00000085982	ENSG00000085982		"""Ubiquitin-specific peptidases"""	20069	protein-coding gene	gene with protein product		610570	"""ubiquitin specific protease 40"""			12838346	Standard	NM_018218		Approved	FLJ10785	uc010zmr.2	Q9NVE5	OTTHUMG00000153199	ENST00000427112.2:c.704T>G	2.37:g.234460155A>C	ENSP00000387898:p.Leu235*		Somatic				USP40_uc010zmr.1_Nonsense_Mutation_p.L247*|USP40_uc010zmt.1_5'Flank	p.L235*			WXS	Illumina HiSeq	Unspecified	Q9NVE5	UBP40_HUMAN		Epithelial(121;1.71e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000407)|Lung(119;0.00277)|LUSC - Lung squamous cell carcinoma(224;0.00646)	7	822	-		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0539)	235					Q6NX38|Q70EL0	Nonsense_Mutation	SNP	ENST00000427112.2	37	c.704T>G	CCDS46547.1	.	.	.	.	.	.	.	.	.	.	A	39	7.435995	0.98282	.	.	ENSG00000085982	ENST00000450966;ENST00000251722;ENST00000427112;ENST00000435959	.	.	.	5.86	5.86	0.93980	.	0.213391	0.40144	N	0.001166	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.2526	0.82494	1.0:0.0:0.0:0.0	.	.	.	.	X	247;235;235;235	.	ENSP00000251722:L235X	L	-	2	0	USP40	234124894	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	9.154000	0.94694	2.241000	0.73720	0.482000	0.46254	TTA		0.308	USP40-017	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397235.1	XM_114294		11	9	0	0	0	0	11	9				
TBC1D20	128637	broad.mit.edu	37	20	428589	428589	+	Missense_Mutation	SNP	C	C	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr20:428589C>T	ENST00000354200.4	-	2	347	c.200G>A	c.(199-201)cGa>cAa	p.R67Q	Y_RNA_ENST00000384070.1_RNA	NM_144628.2	NP_653229.1	Q96BZ9	TBC20_HUMAN	TBC1 domain family, member 20	67	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				acrosome assembly (GO:0001675)|cargo loading into COPII-coated vesicle (GO:0090110)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|lens fiber cell morphogenesis (GO:0070309)|lipid particle organization (GO:0034389)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|seminiferous tubule development (GO:0072520)|virion assembly (GO:0019068)	endoplasmic reticulum membrane (GO:0005789)|integral component of Golgi membrane (GO:0030173)|nuclear membrane (GO:0031965)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	12		all_epithelial(17;0.228)|Breast(17;0.231)				CCACACTTTTCGTCTGATCTC	0.537																																						uc002wds.2		NA																	0				central_nervous_system(1)	1						c.(199-201)CGA>CAA		TBC1 domain family, member 20							142.0	109.0	120.0					20																	428589		2203	4300	6503	SO:0001583	missense	128637				interspecies interaction between organisms	integral to membrane|intracellular	Rab GTPase activator activity	g.chr20:428589C>T	AK055573	CCDS13002.1	20p13	2013-07-10	2005-01-05	2005-01-05	ENSG00000125875	ENSG00000125875			16133	protein-coding gene	gene with protein product		611663	"""chromosome 20 open reading frame 140"""	C20orf140		17901050	Standard	XM_005260661		Approved	dJ852M4.2	uc002wds.3	Q96BZ9	OTTHUMG00000031637	ENST00000354200.4:c.200G>A	20.37:g.428589C>T	ENSP00000346139:p.Arg67Gln		Somatic				TBC1D20_uc002wdv.2_5'UTR|TBC1D20_uc002wdt.2_RNA|TBC1D20_uc002wdu.2_RNA	p.R67Q	NM_144628	NP_653229	WXS	Illumina HiSeq	Unspecified	Q96BZ9	TBC20_HUMAN			2	338	-		all_epithelial(17;0.228)|Breast(17;0.231)	67			Rab-GAP TBC.		A8K6I3|B9A6M1|Q5JWQ7|Q6ZSY8|Q96NE1|Q9BYM7|Q9H140	Missense_Mutation	SNP	ENST00000354200.4	37	c.200G>A	CCDS13002.1	.	.	.	.	.	.	.	.	.	.	C	11.36	1.615471	0.28801	.	.	ENSG00000125875	ENST00000354200;ENST00000246077	T	0.11063	2.81	5.24	-0.0676	0.13759	Rab-GAP/TBC domain (4);	0.366631	0.31020	N	0.008404	T	0.08447	0.0210	L	0.50333	1.59	0.09310	N	1	B	0.22346	0.068	B	0.19666	0.026	T	0.42396	-0.9454	10	0.12103	T	0.63	-0.0907	9.027	0.36236	0.0:0.616:0.0:0.384	.	67	Q96BZ9	TBC20_HUMAN	Q	67;92	ENSP00000346139:R67Q	ENSP00000246077:R92Q	R	-	2	0	TBC1D20	376589	0.001000	0.12720	0.000000	0.03702	0.569000	0.35902	1.125000	0.31332	-0.129000	0.11620	-0.142000	0.14014	CGA		0.537	TBC1D20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251397.2	NM_144628		8	60	0	0	0	0	8	60				
PAX1	5075	broad.mit.edu	37	20	21695341	21695341	+	Missense_Mutation	SNP	C	C	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr20:21695341C>T	ENST00000398485.2	+	5	1559	c.1505C>T	c.(1504-1506)gCa>gTa	p.A502V	PAX1_ENST00000444366.2_3'UTR	NM_001257096.1|NM_006192.4	NP_001244025.1|NP_006183.2	P15863	PAX1_HUMAN	paired box 1	502					bone morphogenesis (GO:0060349)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cell proliferation (GO:0008283)|parathyroid gland development (GO:0060017)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sclerotome development (GO:0061056)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(21)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	38						CCGCGGGGTGCACGCCCAGCC	0.687																																						uc002wsj.2		NA																	0				upper_aerodigestive_tract(1)|kidney(1)	2						c.(1504-1506)GCA>GTA		paired box 1							38.0	36.0	37.0					20																	21695341		2200	4298	6498	SO:0001583	missense	5075				regulation of transcription, DNA-dependent|skeletal system development|transcription from RNA polymerase II promoter	nucleus	DNA binding	g.chr20:21695341C>T		CCDS13146.2, CCDS74709.1	20p11.22	2007-07-12	2007-07-12		ENSG00000125813	ENSG00000125813		"""Paired boxes"""	8615	protein-coding gene	gene with protein product		167411	"""paired box gene 1"""			1358810	Standard	NM_006192		Approved		uc002wsj.3	P15863	OTTHUMG00000032034	ENST00000398485.2:c.1505C>T	20.37:g.21695341C>T	ENSP00000381499:p.Ala502Val		Somatic				PAX1_uc010zsl.1_3'UTR|PAX1_uc010zsm.1_3'UTR	p.A502V	NM_006192	NP_006183	WXS	Illumina HiSeq	Unspecified	P15863	PAX1_HUMAN			5	1559	+			502					B4E0D6|Q642X9|Q6NTC0|Q9Y558	Missense_Mutation	SNP	ENST00000398485.2	37	c.1505C>T	CCDS13146.2	.	.	.	.	.	.	.	.	.	.	C	11.90	1.776353	0.31411	.	.	ENSG00000125813	ENST00000398485	D	0.97529	-4.42	2.79	-5.49	0.02584	.	2.411830	0.02758	N	0.118296	D	0.90256	0.6953	N	0.14661	0.345	0.09310	N	1	B	0.17465	0.022	B	0.08055	0.003	T	0.80264	-0.1455	10	0.87932	D	0	.	0.1025	0.00049	0.3483:0.2105:0.1726:0.2687	.	502	P15863	PAX1_HUMAN	V	502	ENSP00000381499:A502V	ENSP00000381499:A502V	A	+	2	0	PAX1	21643341	0.001000	0.12720	0.000000	0.03702	0.006000	0.05464	0.596000	0.24044	-0.595000	0.05828	-0.350000	0.07774	GCA		0.687	PAX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078282.3			13	24	0	0	0	0	13	24				
RALGAPB	57148	broad.mit.edu	37	20	37199442	37199442	+	Missense_Mutation	SNP	A	A	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr20:37199442A>T	ENST00000262879.6	+	28	4378	c.4094A>T	c.(4093-4095)gAg>gTg	p.E1365V	RALGAPB_ENST00000397042.3_Missense_Mutation_p.E1362V|RALGAPB_ENST00000397040.1_Missense_Mutation_p.E1365V|RALGAPB_ENST00000397038.1_Missense_Mutation_p.E1144V			Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit (non-catalytic)	1365	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)|Ral protein signal transduction (GO:0032484)|regulation of exocyst localization (GO:0060178)		protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(29)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						CTGATGACAGAGATCAGTACT	0.358																																						uc002xiw.2		NA																	0				pancreas(1)|skin(1)	2						c.(4093-4095)GAG>GTG		Ral GTPase activating protein, beta subunit							81.0	82.0	82.0					20																	37199442		2203	4300	6503	SO:0001583	missense	57148				activation of Ral GTPase activity	intracellular	protein heterodimerization activity|Ral GTPase activator activity	g.chr20:37199442A>T	AB033045	CCDS13305.1, CCDS63272.1	20q11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000170471	ENSG00000170471			29221	protein-coding gene	gene with protein product			"""KIAA1219"""	KIAA1219		19520869	Standard	XM_005260462		Approved	DKFZp781M2411, RalGAPbeta	uc002xiw.3	Q86X10	OTTHUMG00000140270	ENST00000262879.6:c.4094A>T	20.37:g.37199442A>T	ENSP00000262879:p.Glu1365Val		Somatic				RALGAPB_uc002xix.2_Missense_Mutation_p.E1362V|RALGAPB_uc002xiy.1_Intron|RALGAPB_uc002xiz.2_Missense_Mutation_p.E1144V	p.E1365V	NM_020336	NP_065069	WXS	Illumina HiSeq	Unspecified	Q86X10	RLGPB_HUMAN			28	4351	+			1365			Rap-GAP.		A2A2E8|A2A2E9|Q5TG31|Q8N3D1|Q8WWC0|Q9H3X8|Q9UJR1|Q9ULK1|Q9Y3G9	Missense_Mutation	SNP	ENST00000262879.6	37	c.4094A>T	CCDS13305.1	.	.	.	.	.	.	.	.	.	.	A	22.9	4.355023	0.82243	.	.	ENSG00000170471	ENST00000262879;ENST00000397042;ENST00000397038;ENST00000397040;ENST00000438490	.	.	.	5.64	5.64	0.86602	Rap/ran-GAP (1);	0.000000	0.85682	D	0.000000	T	0.66346	0.2780	L	0.41236	1.265	0.80722	D	1	D;D	0.61080	0.989;0.989	D;D	0.75020	0.985;0.985	T	0.60806	-0.7190	9	0.16896	T	0.51	.	15.8579	0.78994	1.0:0.0:0.0:0.0	.	1362;1365	A2A2E9;Q86X10	.;RLGPB_HUMAN	V	1365;1362;1144;1365;1194	.	ENSP00000262879:E1365V	E	+	2	0	RALGAPB	36632856	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.347000	0.90062	2.131000	0.65755	0.460000	0.39030	GAG		0.358	RALGAPB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079191.1	NM_020336		22	29	0	0	0	0	22	29				
GRIK1	2897	broad.mit.edu	37	21	30934039	30934039	+	Silent	SNP	G	G	T	rs532500333		TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr21:30934039G>T	ENST00000399907.1	-	15	2673	c.2262C>A	c.(2260-2262)tcC>tcA	p.S754S	GRIK1_ENST00000309434.7_Silent_p.S756S|GRIK1_ENST00000327783.4_Silent_p.S754S|GRIK1_ENST00000399913.1_Silent_p.S754S|GRIK1_ENST00000389124.2_Silent_p.S754S|GRIK1_ENST00000399914.1_Silent_p.S739S|GRIK1_ENST00000399909.1_Silent_p.S739S|GRIK1_ENST00000535441.1_Silent_p.S756S|GRIK1_ENST00000389125.3_Silent_p.S739S	NM_000830.3	NP_000821.1	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	754					adult behavior (GO:0030534)|behavioral response to pain (GO:0048266)|central nervous system development (GO:0007417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|nervous system development (GO:0007399)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(18)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	45					Topiramate(DB00273)	CAATGCTGGTGGACTCCATCA	0.542																																						uc002yno.1		NA																	0				large_intestine(1)|ovary(1)|skin(1)	3						c.(2260-2262)TCC>TCA		glutamate receptor, ionotropic, kainate 1	L-Glutamic Acid(DB00142)|Topiramate(DB00273)						162.0	130.0	141.0					21																	30934039		2203	4300	6503	SO:0001819	synonymous_variant	2897				central nervous system development|synaptic transmission	cell junction|postsynaptic membrane	kainate selective glutamate receptor activity	g.chr21:30934039G>T		CCDS33530.1, CCDS42913.1	21q22	2012-08-29			ENSG00000171189	ENSG00000171189		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4579	protein-coding gene	gene with protein product		138245		GLUR5		8468067	Standard	XM_005260942		Approved	GluK1	uc002yno.1	P39086	OTTHUMG00000078879	ENST00000399907.1:c.2262C>A	21.37:g.30934039G>T			Somatic				GRIK1_uc002ynn.2_Silent_p.S739S|GRIK1_uc011acs.1_Silent_p.S754S|GRIK1_uc011act.1_Silent_p.S615S	p.S754S	NM_000830	NP_000821	WXS	Illumina HiSeq	Unspecified	P39086	GRIK1_HUMAN			15	2726	-			754			Extracellular (Potential).		Q13001|Q86SU9	Silent	SNP	ENST00000399907.1	37	c.2262C>A	CCDS42913.1																																																																																				0.542	GRIK1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171979.1			19	36	1	0	2.39e-15	4.02e-15	19	36				
HUNK	30811	broad.mit.edu	37	21	33296871	33296871	+	Missense_Mutation	SNP	T	T	C			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr21:33296871T>C	ENST00000270112.2	+	2	713	c.353T>C	c.(352-354)aTc>aCc	p.I118T		NM_014586.1	NP_055401.1	P57058	HUNK_HUMAN	hormonally up-regulated Neu-associated kinase	118	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(2)|stomach(1)	30						CAGCAGATGATCCGCCACCCC	0.493																																						uc002yph.2		NA																	0				stomach(1)|skin(1)	2						c.(352-354)ATC>ACC		hormonally upregulated Neu-associated kinase							66.0	61.0	62.0					21																	33296871		2203	4300	6503	SO:0001583	missense	30811				multicellular organismal development|signal transduction		ATP binding|protein serine/threonine kinase activity	g.chr21:33296871T>C	AJ271722	CCDS13610.1	21q22.1	2008-06-05	2008-06-05		ENSG00000142149	ENSG00000142149			13326	protein-coding gene	gene with protein product		606532	"""hormonally upregulated Neu-associated kinase"""			10662544, 10830953	Standard	NM_014586		Approved		uc002yph.3	P57058	OTTHUMG00000085019	ENST00000270112.2:c.353T>C	21.37:g.33296871T>C	ENSP00000270112:p.Ile118Thr		Somatic					p.I118T	NM_014586	NP_055401	WXS	Illumina HiSeq	Unspecified	P57058	HUNK_HUMAN			2	713	+			118			Protein kinase.			Missense_Mutation	SNP	ENST00000270112.2	37	c.353T>C	CCDS13610.1	.	.	.	.	.	.	.	.	.	.	T	19.95	3.922546	0.73213	.	.	ENSG00000142149	ENST00000270112;ENST00000430354	T;T	0.25749	1.78;1.78	4.86	4.86	0.63082	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.42630	0.1211	L	0.45581	1.43	0.80722	D	1	D	0.67145	0.996	D	0.65684	0.937	T	0.36768	-0.9734	10	0.87932	D	0	-21.3748	14.6364	0.68692	0.0:0.0:0.0:1.0	.	118	P57058	HUNK_HUMAN	T	118;3	ENSP00000270112:I118T;ENSP00000411860:I3T	ENSP00000270112:I118T	I	+	2	0	HUNK	32218742	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	7.480000	0.81109	2.034000	0.60081	0.528000	0.53228	ATC		0.493	HUNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192782.1	NM_014586		21	23	0	0	0	0	21	23				
TCP10L	140290	broad.mit.edu	37	21	33951084	33951084	+	Missense_Mutation	SNP	G	G	A			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr21:33951084G>A	ENST00000300258.3	-	4	531	c.418C>T	c.(418-420)Ccc>Tcc	p.P140S	LINC00846_ENST00000334165.4_lincRNA|TCP10L_ENST00000472557.1_Missense_Mutation_p.P54S	NM_144659.5	NP_653260.1	Q8TDR4	TCP1L_HUMAN	t-complex 10-like	140					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	protein self-association (GO:0043621)|repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)			breast(1)|central_nervous_system(1)|liver(1)|skin(1)	4						GCGTATTTGGGTATTGTCTCT	0.433																																						uc002ypw.3		NA																	0					0						c.(418-420)CCC>TCC		T-complex 10A-2							153.0	136.0	142.0					21																	33951084		2203	4300	6503	SO:0001583	missense	140290							g.chr21:33951084G>A	AF115967	CCDS13616.1	21p22.11	2012-09-20	2012-09-20		ENSG00000242220	ENSG00000242220			11657	protein-coding gene	gene with protein product		608365	"""t-complex 10 (a murine tcp homolog)-like"", ""t-complex 10 (mouse)-like"""			10830953	Standard	NM_144659		Approved	PRED77		Q8TDR4	OTTHUMG00000064901	ENST00000300258.3:c.418C>T	21.37:g.33951084G>A	ENSP00000300258:p.Pro140Ser		Somatic					p.P140S	NM_144659	NP_653260	WXS	Illumina HiSeq	Unspecified	Q9NV44	CU077_HUMAN			4	534	-			Error:Variant_position_missing_in_Q9NV44_after_alignment					Q53EW0|Q96LN5	Missense_Mutation	SNP	ENST00000300258.3	37	c.418C>T	CCDS13616.1	.	.	.	.	.	.	.	.	.	.	G	11.51	1.659315	0.29515	.	.	ENSG00000242220	ENST00000300258	T	0.27890	1.64	0.459	0.459	0.16678	.	.	.	.	.	T	0.41213	0.1149	L	0.54323	1.7	0.09310	N	1	D	0.69078	0.997	P	0.62298	0.9	T	0.22208	-1.0223	8	0.33141	T	0.24	.	.	.	.	.	140	Q8TDR4	TCP1L_HUMAN	S	140	ENSP00000300258:P140S	ENSP00000300258:P140S	P	-	1	0	TCP10L	32872955	0.039000	0.19947	0.004000	0.12327	0.033000	0.12548	0.727000	0.25999	0.479000	0.27511	0.195000	0.17529	CCC		0.433	TCP10L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139350.1	NM_144659		56	64	0	0	0	0	56	64				
MORC3	23515	broad.mit.edu	37	21	37736544	37736544	+	Missense_Mutation	SNP	C	C	G			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr21:37736544C>G	ENST00000400485.1	+	14	1682	c.1606C>G	c.(1606-1608)Cct>Gct	p.P536A	AP000692.9_ENST00000397184.2_RNA|MORC3_ENST00000487909.1_3'UTR	NM_015358.2	NP_056173.1	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3	536					cell aging (GO:0007569)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of fibroblast proliferation (GO:0048147)|peptidyl-serine phosphorylation (GO:0018105)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)	PML body (GO:0016605)	zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	35						TCAGTCTGAACCTGAGAGCAA	0.398																																						uc002yvi.2		NA																	0				ovary(2)	2						c.(1606-1608)CCT>GCT		MORC family CW-type zinc finger 3							64.0	56.0	59.0					21																	37736544		1860	4102	5962	SO:0001583	missense	23515				cell aging|maintenance of protein location in nucleus|negative regulation of fibroblast proliferation|peptidyl-serine phosphorylation|protein stabilization	aggresome|intermediate filament cytoskeleton|PML body	ATP binding|zinc ion binding	g.chr21:37736544C>G	AK025327	CCDS42924.1	21q22.13	2005-06-15	2005-06-15	2005-06-15	ENSG00000159256	ENSG00000159256			23572	protein-coding gene	gene with protein product		610078	"""zinc finger, CW-type with coiled-coil domain 3"", ""zinc finger, CW type with coiled-coil domain 3"""	ZCWCC3		14607086	Standard	NM_015358		Approved	ZCW5, NXP2, KIAA0136	uc002yvi.3	Q14149	OTTHUMG00000086620	ENST00000400485.1:c.1606C>G	21.37:g.37736544C>G	ENSP00000383333:p.Pro536Ala		Somatic					p.P536A	NM_015358	NP_056173	WXS	Illumina HiSeq	Unspecified	Q14149	MORC3_HUMAN			14	1682	+			536					A8KA92|Q9UEZ2	Missense_Mutation	SNP	ENST00000400485.1	37	c.1606C>G	CCDS42924.1	.	.	.	.	.	.	.	.	.	.	C	8.582	0.882441	0.17467	.	.	ENSG00000159256	ENST00000400485	T	0.14022	2.54	5.38	3.44	0.39384	.	0.518961	0.20208	N	0.096948	T	0.09024	0.0223	L	0.43152	1.355	0.32834	D	0.504411	B	0.06786	0.001	B	0.09377	0.004	T	0.14868	-1.0457	10	0.10111	T	0.7	-9.1586	4.8813	0.13681	0.0:0.6478:0.2059:0.1463	.	536	Q14149	MORC3_HUMAN	A	536	ENSP00000383333:P536A	ENSP00000383333:P536A	P	+	1	0	MORC3	36658414	0.997000	0.39634	0.999000	0.59377	0.425000	0.31504	0.721000	0.25911	2.683000	0.91414	0.561000	0.74099	CCT		0.398	MORC3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000194640.1	NM_015358		12	28	0	0	0	0	12	28				
CLTCL1	8218	broad.mit.edu	37	22	19209568	19209568	+	Missense_Mutation	SNP	C	C	G			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr22:19209568C>G	ENST00000263200.10	-	16	2539	c.2467G>C	c.(2467-2469)Gat>Cat	p.D823H	CLTCL1_ENST00000427926.1_Missense_Mutation_p.D823H|CLTCL1_ENST00000353891.5_Missense_Mutation_p.D823H	NM_007098.3	NP_009029.3	P53675	CLH2_HUMAN	clathrin, heavy chain-like 1	823	Heavy chain arm.|Proximal segment.				anatomical structure morphogenesis (GO:0009653)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|positive regulation of glucose import (GO:0046326)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|spindle (GO:0005819)|trans-Golgi network (GO:0005802)	signal transducer activity (GO:0004871)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	Colorectal(54;0.0993)					TCAGAACAATCCACATCAAGC	0.443			T	?	ALCL																																	uc002zpb.2		NA		Dom	yes		22	22q11.21	8218	T	"""clathrin, heavy polypeptide-like 1"""			L	?		ALCL		0				ovary(4)|central_nervous_system(1)	5						c.(2467-2469)GAT>CAT		clathrin, heavy polypeptide-like 1 isoform 1							119.0	121.0	120.0					22																	19209568		2016	4194	6210	SO:0001583	missense	8218				anatomical structure morphogenesis|intracellular protein transport|mitosis|positive regulation of glucose import|receptor-mediated endocytosis	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|spindle|trans-Golgi network	protein binding|signal transducer activity|structural molecule activity	g.chr22:19209568C>G		CCDS46662.1, CCDS54497.1, CCDS46662.2, CCDS54497.2	22q11.2	2008-06-10	2006-09-29		ENSG00000070371	ENSG00000070371			2093	protein-coding gene	gene with protein product		601273	"""clathrin, heavy polypeptide-like 1"""	CLTCL		8844170, 15133132	Standard	NM_007098		Approved	CLTD, CLH22, CHC22	uc021wle.1	P53675	OTTHUMG00000150109	ENST00000263200.10:c.2467G>C	22.37:g.19209568C>G	ENSP00000445677:p.Asp823His		Somatic				CLTCL1_uc011agv.1_Missense_Mutation_p.D823H|CLTCL1_uc011agw.1_Missense_Mutation_p.D823H	p.D823H	NM_007098	NP_009029	WXS	Illumina HiSeq	Unspecified	P53675	CLH2_HUMAN			16	2542	-	Colorectal(54;0.0993)		823			Proximal segment.|Heavy chain arm.		B7Z7U5|Q14017|Q15808|Q15809	Missense_Mutation	SNP	ENST00000263200.10	37	c.2467G>C	CCDS46662.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.415404	0.83449	.	.	ENSG00000070371	ENST00000353891;ENST00000263200;ENST00000427926	T;T;T	0.19938	2.11;2.11;2.11	3.87	3.87	0.44632	Tetratricopeptide-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.56140	0.1965	M	0.92219	3.285	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.70791	-0.4776	10	0.87932	D	0	-17.5844	16.3525	0.83220	0.0:1.0:0.0:0.0	.	823;823	P53675-2;P53675	.;CLH2_HUMAN	H	823	ENSP00000439662:D823H;ENSP00000445677:D823H;ENSP00000441158:D823H	ENSP00000445677:D823H	D	-	1	0	CLTCL1	17589568	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.881000	0.75584	2.155000	0.67459	0.563000	0.77884	GAT		0.443	CLTCL1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316397.5	NM_007098		43	84	0	0	0	0	43	84				
CAMK1	8536	broad.mit.edu	37	3	9807481	9807481	+	Silent	SNP	C	C	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr3:9807481C>T	ENST00000256460.3	-	3	354	c.177G>A	c.(175-177)aaG>aaA	p.K59K	OGG1_ENST00000302036.7_Intron|OGG1_ENST00000302008.8_Intron|OGG1_ENST00000449570.2_Intron|OGG1_ENST00000349503.5_Intron|OGG1_ENST00000383826.5_Intron	NM_003656.4	NP_003647.1	Q14012	KCC1A_HUMAN	calcium/calmodulin-dependent protein kinase I	59	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|nucleocytoplasmic transport (GO:0006913)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of synapse structural plasticity (GO:0051835)|protein phosphorylation (GO:0006468)|regulation of muscle cell differentiation (GO:0051147)|regulation of protein binding (GO:0043393)|regulation of protein localization (GO:0032880)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	12	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.0475)		TGCTGCCTTCCTTGCCCTCCA	0.602																																						uc003bst.2		NA																	0				ovary(1)|skin(1)	2						c.(175-177)AAG>AAA		calcium/calmodulin-dependent protein kinase I							78.0	71.0	73.0					3																	9807481		2203	4300	6503	SO:0001819	synonymous_variant	8536				cell differentiation|nervous system development|positive regulation of muscle cell differentiation|signal transduction	cytoplasm|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity	g.chr3:9807481C>T	L41816	CCDS2582.1	3p25.3	2004-02-27			ENSG00000134072	ENSG00000134072			1459	protein-coding gene	gene with protein product		604998				7641687	Standard	NM_003656		Approved	CaMKI	uc003bst.3	Q14012	OTTHUMG00000128419	ENST00000256460.3:c.177G>A	3.37:g.9807481C>T			Somatic				OGG1_uc003bsk.2_Intron|OGG1_uc003bsl.2_Intron|OGG1_uc003bsm.2_Intron|OGG1_uc003bsn.2_Intron|OGG1_uc003bso.2_Intron|CAMK1_uc003bsu.2_RNA	p.K59K	NM_003656	NP_003647	WXS	Illumina HiSeq	Unspecified	Q14012	KCC1A_HUMAN		OV - Ovarian serous cystadenocarcinoma(96;0.0475)	3	355	-	Medulloblastoma(99;0.227)		59			Protein kinase.		Q3KPF6	Silent	SNP	ENST00000256460.3	37	c.177G>A	CCDS2582.1																																																																																				0.602	CAMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250206.1	NM_003656		29	6	0	0	0	0	29	6				
USP19	10869	broad.mit.edu	37	3	49151435	49151435	+	Missense_Mutation	SNP	C	C	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr3:49151435C>T	ENST00000398888.2	-	16	2504	c.2186G>A	c.(2185-2187)cGt>cAt	p.R729H	USP19_ENST00000453664.1_Missense_Mutation_p.R820H|USP19_ENST00000434032.2_Missense_Mutation_p.R830H|USP19_ENST00000398892.3_Missense_Mutation_p.R769H|USP19_ENST00000398898.2_Missense_Mutation_p.R769H|USP19_ENST00000417901.1_Missense_Mutation_p.R832H|USP19_ENST00000398896.1_Missense_Mutation_p.R537H	NM_006677.2	NP_006668.1	O94966	UBP19_HUMAN	ubiquitin specific peptidase 19	729	USP.				ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of skeletal muscle tissue development (GO:0048642)|positive regulation of cell cycle process (GO:0090068)|protein deubiquitination (GO:0016579)|regulation of cellular response to hypoxia (GO:1900037)|regulation of protein stability (GO:0031647)|response to endoplasmic reticulum stress (GO:0034976)|skeletal muscle atrophy (GO:0014732)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)			NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(10)|lung(5)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CTCCGCCAAACGCAGGTTCTC	0.512																																						uc003cwd.1		NA																	0				ovary(4)|breast(2)|lung(1)	7						c.(2185-2187)CGT>CAT		ubiquitin thioesterase 19							95.0	99.0	98.0					3																	49151435		2015	4180	6195	SO:0001583	missense	10869				ER-associated protein catabolic process|positive regulation of cell cycle process|protein deubiquitination|regulation of protein stability|response to endoplasmic reticulum stress|skeletal muscle atrophy	endoplasmic reticulum membrane|integral to membrane	ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding	g.chr3:49151435C>T	AB020698	CCDS43090.1, CCDS56254.1, CCDS56255.1, CCDS56256.1	3p21.31	2005-10-13	2005-08-08		ENSG00000172046	ENSG00000172046		"""Zinc fingers, MYND-type"", ""Ubiquitin-specific peptidases"""	12617	protein-coding gene	gene with protein product		614471	"""ubiquitin specific protease 19"""			12838346	Standard	NM_001199160		Approved	KIAA0891, ZMYND9	uc011bch.2	O94966	OTTHUMG00000133611	ENST00000398888.2:c.2186G>A	3.37:g.49151435C>T	ENSP00000381863:p.Arg729His		Somatic				USP19_uc003cwa.2_Missense_Mutation_p.R537H|USP19_uc003cvz.3_Missense_Mutation_p.R832H|USP19_uc011bcg.1_Missense_Mutation_p.R820H|USP19_uc003cwb.2_Intron|USP19_uc003cwc.1_Missense_Mutation_p.R487H|USP19_uc011bch.1_Missense_Mutation_p.R830H	p.R729H	NM_006677	NP_006668	WXS	Illumina HiSeq	Unspecified	O94966	UBP19_HUMAN		BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	16	2347	-			729			Cytoplasmic (Potential).		A5PKX8|A6H8U2|B4DGT3|B4DTZ0|E7EN22|E7ETS0|E9PEG8|Q3KQW4|Q641Q9|Q6NZY8|Q86XV9	Missense_Mutation	SNP	ENST00000398888.2	37	c.2186G>A	CCDS43090.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.798585	0.90538	.	.	ENSG00000172046	ENST00000398896;ENST00000398898;ENST00000417901;ENST00000453664;ENST00000398892;ENST00000398888;ENST00000434032	T;T;T;T;T;T;T	0.21191	2.04;2.03;2.12;2.12;2.02;2.13;2.11	6.17	6.17	0.99709	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	1.757220	0.02330	N	0.073821	T	0.50205	0.1602	L	0.58810	1.83	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999	D;D;D;D;D	0.87578	0.986;0.993;0.989;0.998;0.964	T	0.01557	-1.1325	10	0.66056	D	0.02	-12.0953	13.6552	0.62333	0.0:0.9294:0.0:0.0706	.	830;820;729;769;537	E9PEG8;E7EN22;O94966;B5MEG5;E7ESU0	.;.;UBP19_HUMAN;.;.	H	537;769;832;820;769;729;830	ENSP00000381870:R537H;ENSP00000381872:R769H;ENSP00000395260:R832H;ENSP00000400090:R820H;ENSP00000381867:R769H;ENSP00000381863:R729H;ENSP00000401197:R830H	ENSP00000381863:R729H	R	-	2	0	USP19	49126439	1.000000	0.71417	0.999000	0.59377	0.716000	0.41182	4.338000	0.59316	2.941000	0.99782	0.655000	0.94253	CGT		0.512	USP19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257721.1	NM_006677		7	21	0	0	0	0	7	21				
USP19	10869	broad.mit.edu	37	3	49154907	49154907	+	Missense_Mutation	SNP	G	G	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr3:49154907G>T	ENST00000398888.2	-	5	887	c.569C>A	c.(568-570)cCc>cAc	p.P190H	USP19_ENST00000453664.1_Missense_Mutation_p.P190H|USP19_ENST00000488993.1_5'UTR|USP19_ENST00000434032.2_Missense_Mutation_p.P190H|USP19_ENST00000398892.3_Missense_Mutation_p.P128H|USP19_ENST00000398898.2_Missense_Mutation_p.P128H|USP19_ENST00000417901.1_Missense_Mutation_p.P190H|USP19_ENST00000398896.1_5'UTR	NM_006677.2	NP_006668.1	O94966	UBP19_HUMAN	ubiquitin specific peptidase 19	190	CS 1. {ECO:0000255|PROSITE- ProRule:PRU00547}.				ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of skeletal muscle tissue development (GO:0048642)|positive regulation of cell cycle process (GO:0090068)|protein deubiquitination (GO:0016579)|regulation of cellular response to hypoxia (GO:1900037)|regulation of protein stability (GO:0031647)|response to endoplasmic reticulum stress (GO:0034976)|skeletal muscle atrophy (GO:0014732)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)			NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(10)|lung(5)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CACCTTTTTGGGCAGTGTCAG	0.552																																						uc003cwd.1		NA																	0				ovary(4)|breast(2)|lung(1)	7						c.(568-570)CCC>CAC		ubiquitin thioesterase 19							72.0	75.0	74.0					3																	49154907		2004	4183	6187	SO:0001583	missense	10869				ER-associated protein catabolic process|positive regulation of cell cycle process|protein deubiquitination|regulation of protein stability|response to endoplasmic reticulum stress|skeletal muscle atrophy	endoplasmic reticulum membrane|integral to membrane	ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding	g.chr3:49154907G>T	AB020698	CCDS43090.1, CCDS56254.1, CCDS56255.1, CCDS56256.1	3p21.31	2005-10-13	2005-08-08		ENSG00000172046	ENSG00000172046		"""Zinc fingers, MYND-type"", ""Ubiquitin-specific peptidases"""	12617	protein-coding gene	gene with protein product		614471	"""ubiquitin specific protease 19"""			12838346	Standard	NM_001199160		Approved	KIAA0891, ZMYND9	uc011bch.2	O94966	OTTHUMG00000133611	ENST00000398888.2:c.569C>A	3.37:g.49154907G>T	ENSP00000381863:p.Pro190His		Somatic				USP19_uc003cwa.2_5'UTR|USP19_uc003cvz.3_Missense_Mutation_p.P190H|USP19_uc011bcg.1_Missense_Mutation_p.P190H|USP19_uc003cwb.2_Missense_Mutation_p.P175H|USP19_uc003cwc.1_5'Flank|USP19_uc011bch.1_Missense_Mutation_p.P190H|USP19_uc011bci.1_Missense_Mutation_p.P175H	p.P190H	NM_006677	NP_006668	WXS	Illumina HiSeq	Unspecified	O94966	UBP19_HUMAN		BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	5	730	-			190			Cytoplasmic (Potential).|CS 1.		A5PKX8|A6H8U2|B4DGT3|B4DTZ0|E7EN22|E7ETS0|E9PEG8|Q3KQW4|Q641Q9|Q6NZY8|Q86XV9	Missense_Mutation	SNP	ENST00000398888.2	37	c.569C>A	CCDS43090.1	.	.	.	.	.	.	.	.	.	.	G	10.37	1.331816	0.24167	.	.	ENSG00000172046	ENST00000398898;ENST00000417901;ENST00000453664;ENST00000398892;ENST00000398888;ENST00000434032;ENST00000306026;ENST00000425298	T;T;T;T;T;T;T	0.13657	2.57;2.57;2.57;2.57;2.57;2.57;2.57	5.86	3.9	0.45041	CS-like domain (1);CS domain (1);HSP20-like chaperone (1);	1.195090	0.05639	N	0.583015	T	0.07234	0.0183	N	0.03608	-0.345	0.34815	D	0.738068	B;B;B;B;B	0.15930	0.015;0.015;0.005;0.0;0.008	B;B;B;B;B	0.18561	0.022;0.022;0.011;0.003;0.013	T	0.24368	-1.0162	10	0.23302	T	0.38	-11.5658	7.9531	0.30027	0.0:0.1205:0.5811:0.2984	.	253;190;190;190;175	A5PKX8;E9PEG8;E7EN22;O94966;O94966-2	.;.;.;UBP19_HUMAN;.	H	128;190;190;128;190;190;175;175	ENSP00000381872:P128H;ENSP00000395260:P190H;ENSP00000400090:P190H;ENSP00000381867:P128H;ENSP00000381863:P190H;ENSP00000401197:P190H;ENSP00000303503:P175H	ENSP00000303503:P175H	P	-	2	0	USP19	49129911	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.670000	0.54569	1.462000	0.47948	0.650000	0.86243	CCC		0.552	USP19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257721.1	NM_006677		31	10	1	0	1.75e-13	2.94e-13	31	10				
PLA1A	51365	broad.mit.edu	37	3	119331938	119331938	+	Missense_Mutation	SNP	G	G	A	rs140761557		TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr3:119331938G>A	ENST00000273371.4	+	5	709	c.637G>A	c.(637-639)Gtg>Atg	p.V213M	PLA1A_ENST00000488919.1_Missense_Mutation_p.V40M|PLA1A_ENST00000494440.1_Missense_Mutation_p.V197M|PLA1A_ENST00000495992.1_Missense_Mutation_p.V197M	NM_015900.3	NP_056984.1	Q53H76	PLA1A_HUMAN	phospholipase A1 member A	213				V -> T (in Ref. 4; BAD96425). {ECO:0000305}.	lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)|phosphatidylserine metabolic process (GO:0006658)	extracellular vesicular exosome (GO:0070062)	phosphatidylcholine 1-acylhydrolase activity (GO:0008970)			NS(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						TGCCCTCTTCGTGGAAGCCAT	0.592																																						uc003ecu.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						c.(637-639)GTG>ATG		phospholipase A1 member A precursor		G	MET/VAL,MET/VAL,MET/VAL	0,4406		0,0,2203	69.0	52.0	58.0		589,118,637	5.7	1.0	3	dbSNP_134	58	2,8598	1.2+/-3.3	0,2,4298	no	missense,missense,missense	PLA1A	NM_001206960.1,NM_001206961.1,NM_015900.3	21,21,21	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging,probably-damaging	197/441,40/284,213/457	119331938	2,13004	2203	4300	6503	SO:0001583	missense	51365				lipid catabolic process|phosphatidylserine metabolic process	extracellular region	phospholipase A1 activity	g.chr3:119331938G>A	AF035268	CCDS2991.1, CCDS56268.1, CCDS56269.1	3q13.13-q13.2	2002-11-28			ENSG00000144837	ENSG00000144837			17661	protein-coding gene	gene with protein product		607460				10196188	Standard	NM_015900		Approved	ps-PLA1	uc003ecu.3	Q53H76	OTTHUMG00000159425	ENST00000273371.4:c.637G>A	3.37:g.119331938G>A	ENSP00000273371:p.Val213Met		Somatic				PLA1A_uc003ecv.2_Missense_Mutation_p.V197M|PLA1A_uc003ecw.2_RNA|PLA1A_uc011bjc.1_Missense_Mutation_p.V40M	p.V213M	NM_015900	NP_056984	WXS	Illumina HiSeq	Unspecified	Q53H76	PLA1A_HUMAN			5	676	+			213	V -> T (in Ref. 4; BAD96425).				B2R8V2|B4DXA2|O95991|Q86WX6|Q9UPD2	Missense_Mutation	SNP	ENST00000273371.4	37	c.637G>A	CCDS2991.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.935632	0.92458	0.0	2.33E-4	ENSG00000144837	ENST00000273371;ENST00000488919;ENST00000495992;ENST00000494440;ENST00000475963	D;D;D;D;D	0.96104	-3.91;-3.91;-3.91;-3.91;-3.91	5.68	5.68	0.88126	Lipase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98729	0.9573	H	0.98133	4.155	0.53688	D	0.999979	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.99564	1.0969	10	0.87932	D	0	-15.9752	17.5869	0.87984	0.0:0.0:1.0:0.0	.	197;213	Q53H76-3;Q53H76	.;PLA1A_HUMAN	M	213;40;197;197;79	ENSP00000273371:V213M;ENSP00000420625:V40M;ENSP00000417326:V197M;ENSP00000418793:V197M;ENSP00000417295:V79M	ENSP00000273371:V213M	V	+	1	0	PLA1A	120814628	1.000000	0.71417	0.991000	0.47740	0.934000	0.57294	8.933000	0.92911	2.696000	0.92011	0.555000	0.69702	GTG		0.592	PLA1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355252.2			11	11	0	0	0	0	11	11				
GOLGB1	2804	broad.mit.edu	37	3	121410533	121410533	+	Missense_Mutation	SNP	G	G	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr3:121410533G>T	ENST00000340645.5	-	14	7788	c.7663C>A	c.(7663-7665)Ctt>Att	p.L2555I	GOLGB1_ENST00000393667.3_Missense_Mutation_p.L2560I	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	2555					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		TGAACTTCAAGAAGCTGCTTT	0.388																																						uc003eei.3		NA																	0				ovary(6)|breast(2)|skin(2)	10						c.(7663-7665)CTT>ATT		golgi autoantigen, golgin subfamily b,							127.0	131.0	130.0					3																	121410533		2203	4300	6503	SO:0001583	missense	2804				Golgi organization	ER-Golgi intermediate compartment|Golgi membrane|Golgi stack|integral to membrane	protein binding	g.chr3:121410533G>T	X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.7663C>A	3.37:g.121410533G>T	ENSP00000341848:p.Leu2555Ile		Somatic				GOLGB1_uc010hrc.2_Missense_Mutation_p.L2560I|GOLGB1_uc003eej.3_Missense_Mutation_p.L2521I	p.L2555I	NM_004487	NP_004478	WXS	Illumina HiSeq	Unspecified	Q14789	GOGB1_HUMAN		GBM - Glioblastoma multiforme(114;0.0989)	14	7789	-			2555			Cytoplasmic (Potential).|Potential.		B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	ENST00000340645.5	37	c.7663C>A	CCDS3004.1	.	.	.	.	.	.	.	.	.	.	G	9.321	1.058070	0.19987	.	.	ENSG00000173230	ENST00000340645;ENST00000393667	T;T	0.60040	0.22;0.22	5.25	4.36	0.52297	.	0.000000	0.56097	D	0.000026	T	0.70937	0.3281	M	0.78049	2.395	0.54753	D	0.999985	B;D;P	0.71674	0.069;0.998;0.518	B;P;B	0.61201	0.043;0.885;0.281	T	0.70521	-0.4849	10	0.39692	T	0.17	.	12.1081	0.53823	0.0856:0.0:0.9144:0.0	.	2560;2560;2555	E7EP74;B2ZZ91;Q14789	.;.;GOGB1_HUMAN	I	2555;2560	ENSP00000341848:L2555I;ENSP00000377275:L2560I	ENSP00000341848:L2555I	L	-	1	0	GOLGB1	122893223	1.000000	0.71417	0.999000	0.59377	0.824000	0.46624	3.936000	0.56568	2.717000	0.92951	0.655000	0.94253	CTT		0.388	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355159.1	NM_004487		88	66	1	0	3.14e-36	5.42e-36	88	66				
DNAJC13	23317	broad.mit.edu	37	3	132185174	132185174	+	Nonsense_Mutation	SNP	C	C	G			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr3:132185174C>G	ENST00000260818.6	+	19	2248	c.2000C>G	c.(1999-2001)tCa>tGa	p.S667*	DNAJC13_ENST00000486798.1_3'UTR	NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	667					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						TTGGAAAGCTCAGATCTCGTA	0.378																																						uc003eor.2		NA																	0				ovary(1)|breast(1)	2						c.(1999-2001)TCA>TGA		DnaJ (Hsp40) homolog, subfamily C, member 13							102.0	99.0	100.0					3																	132185174		2203	4300	6503	SO:0001587	stop_gained	23317						heat shock protein binding	g.chr3:132185174C>G	AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.2000C>G	3.37:g.132185174C>G	ENSP00000260818:p.Ser667*		Somatic				DNAJC13_uc010htq.1_Nonsense_Mutation_p.S667*	p.S667*	NM_015268	NP_056083	WXS	Illumina HiSeq	Unspecified	O75165	DJC13_HUMAN			19	2065	+			667					Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Nonsense_Mutation	SNP	ENST00000260818.6	37	c.2000C>G	CCDS33857.1	.	.	.	.	.	.	.	.	.	.	C	39	7.759197	0.98474	.	.	ENSG00000138246	ENST00000260818	.	.	.	5.76	5.76	0.90799	.	0.474638	0.20703	N	0.087227	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	.	14.2667	0.66123	0.1496:0.8504:0.0:0.0	.	.	.	.	X	667	.	ENSP00000260818:S667X	S	+	2	0	DNAJC13	133667864	0.957000	0.32711	1.000000	0.80357	0.972000	0.66771	2.261000	0.43276	2.716000	0.92895	0.557000	0.71058	TCA		0.378	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356807.2	NM_015268		21	57	0	0	0	0	21	57				
C4orf50	389197	broad.mit.edu	37	4	5961272	5961272	+	Missense_Mutation	SNP	G	G	A	rs201256752		TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr4:5961272G>A	ENST00000324058.5	-	7	750	c.661C>T	c.(661-663)Cgt>Tgt	p.R221C	C4orf50_ENST00000531445.1_Missense_Mutation_p.R695C			Q6ZRC1	CD050_HUMAN	chromosome 4 open reading frame 50	221										breast(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(2)|skin(3)|urinary_tract(1)	15						TCTTGCAGACGTTGTGCGGGG	0.587																																						uc003git.1		NA																	0				pancreas(2)|breast(1)	3						c.(661-663)CGT>TGT		hypothetical protein LOC389197							97.0	93.0	94.0					4																	5961272		2203	4300	6503	SO:0001583	missense	389197							g.chr4:5961272G>A	BC140710		4p16.1	2009-04-14			ENSG00000181215	ENSG00000181215			33766	protein-coding gene	gene with protein product							Standard	XM_003119922		Approved	FLJ46481		Q6ZRC1	OTTHUMG00000149971	ENST00000324058.5:c.661C>T	4.37:g.5961272G>A	ENSP00000317287:p.Arg221Cys		Somatic					p.R221C	NM_207405	NP_997288	WXS	Illumina HiSeq	Unspecified	Q6ZRC1	CD050_HUMAN			7	751	-			221						Missense_Mutation	SNP	ENST00000324058.5	37	c.661C>T		.	.	.	.	.	.	.	.	.	.	G	8.813	0.935701	0.18206	.	.	ENSG00000181215	ENST00000531445;ENST00000324058	T;T	0.22336	1.96;1.96	4.07	-8.14	0.01069	.	2.575630	0.01619	N	0.022905	T	0.07413	0.0187	N	0.03115	-0.41	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.21965	-1.0230	10	0.41790	T	0.15	20.8814	2.0042	0.03474	0.4632:0.098:0.1231:0.3158	.	221	Q6ZRC1	CD050_HUMAN	C	695;221	ENSP00000437121:R695C;ENSP00000317287:R221C	ENSP00000317287:R221C	R	-	1	0	C4orf50	6012173	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.912000	0.00336	-2.520000	0.00498	0.655000	0.94253	CGT		0.587	C4orf50-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_207405		21	32	0	0	0	0	21	32				
SLC34A2	10568	broad.mit.edu	37	4	25676210	25676210	+	Missense_Mutation	SNP	G	G	A	rs377112763		TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr4:25676210G>A	ENST00000382051.3	+	12	1467	c.1417G>A	c.(1417-1419)Gcc>Acc	p.A473T	SLC34A2_ENST00000503434.1_Missense_Mutation_p.A472T|SLC34A2_ENST00000504570.1_Missense_Mutation_p.A472T	NM_001177998.1|NM_006424.2	NP_001171469.1|NP_006415	O95436	NPT2B_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 2	473					aging (GO:0007568)|cellular phosphate ion homeostasis (GO:0030643)|in utero embryonic development (GO:0001701)|ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|response to fructose (GO:0009750)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	phosphate ion binding (GO:0042301)|sodium ion binding (GO:0031402)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:phosphate symporter activity (GO:0005436)		SLC34A2/ROS1(14)	breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(4)	41		Breast(46;0.0503)				CATCCTGGCCGCCTTAGCCAG	0.607			T	ROS1	NSCLC																																	uc003grr.2		NA		Dom	yes		4	4p15.2	10568		"""solute carrier family 34 (sodium phosphate), member 2"""			E					0				skin(3)|ovary(1)|kidney(1)	5						c.(1417-1419)GCC>ACC		solute carrier family 34 (sodium phosphate),		G	THR/ALA,THR/ALA,THR/ALA	0,4406		0,0,2203	75.0	77.0	77.0		1414,1414,1417	4.3	0.9	4		77	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	SLC34A2	NM_001177998.1,NM_001177999.1,NM_006424.2	58,58,58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	472/690,472/690,473/691	25676210	1,13005	2203	4300	6503	SO:0001583	missense	10568				cellular phosphate ion homeostasis	apical plasma membrane|brush border membrane|integral to plasma membrane	phosphate binding|sodium ion binding|sodium-dependent phosphate transmembrane transporter activity|sodium:phosphate symporter activity	g.chr4:25676210G>A	AF111856	CCDS3435.1, CCDS54750.1	4p15.2	2013-07-17	2013-07-17		ENSG00000157765	ENSG00000157765		"""Solute carriers"""	11020	protein-coding gene	gene with protein product		604217	"""solute carrier family 34 (sodium phosphate), member 2"""			10329428, 10610722	Standard	NM_006424		Approved	NAPI-3B	uc003grr.3	O95436	OTTHUMG00000097757	ENST00000382051.3:c.1417G>A	4.37:g.25676210G>A	ENSP00000371483:p.Ala473Thr		Somatic				SLC34A2_uc003grs.2_Missense_Mutation_p.A472T|SLC34A2_uc010iev.2_Missense_Mutation_p.A472T	p.A473T	NM_006424	NP_006415	WXS	Illumina HiSeq	Unspecified	O95436	NPT2B_HUMAN			12	1498	+		Breast(46;0.0503)	473			Extracellular (Potential).		A5PL17|Q8N2K2|Q8WYA9|Q9P0V7	Missense_Mutation	SNP	ENST00000382051.3	37	c.1417G>A	CCDS3435.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.938082	0.92526	0.0	1.16E-4	ENSG00000157765	ENST00000504570;ENST00000382051;ENST00000503434	D;D;D	0.87571	-2.27;-2.27;-2.27	5.2	4.35	0.52113	.	0.050246	0.85682	D	0.000000	D	0.93284	0.7860	M	0.84219	2.685	0.80722	D	1	D;D	0.76494	0.994;0.999	P;D	0.69142	0.867;0.962	D	0.94198	0.7447	10	0.72032	D	0.01	-32.0041	15.4221	0.75022	0.0:0.0:0.8597:0.1403	.	472;473	O95436-2;O95436	.;NPT2B_HUMAN	T	472;473;472	ENSP00000425501:A472T;ENSP00000371483:A473T;ENSP00000423021:A472T	ENSP00000371483:A473T	A	+	1	0	SLC34A2	25285308	1.000000	0.71417	0.932000	0.37286	0.775000	0.43874	7.995000	0.88328	1.320000	0.45209	0.561000	0.74099	GCC		0.607	SLC34A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214990.1	NM_006424		49	60	0	0	0	0	49	60				
NPFFR2	10886	broad.mit.edu	37	4	72994497	72994497	+	Missense_Mutation	SNP	T	T	G			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr4:72994497T>G	ENST00000308744.6	+	2	593	c.495T>G	c.(493-495)aaT>aaG	p.N165K	NPFFR2_ENST00000358749.3_Missense_Mutation_p.N63K|NPFFR2_ENST00000395999.1_Missense_Mutation_p.N66K|NPFFR2_ENST00000344413.5_Intron	NM_004885.2	NP_004876.2	Q9Y5X5	NPFF2_HUMAN	neuropeptide FF receptor 2	165					detection of abiotic stimulus (GO:0009582)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of adenylate cyclase activity (GO:0045761)|regulation of cAMP-dependent protein kinase activity (GO:2000479)|regulation of MAPK cascade (GO:0043408)	actin cytoskeleton (GO:0015629)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(24)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)			TGATGGGAAATACTGTGGTTT	0.358																																						uc003hgg.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(493-495)AAT>AAG		neuropeptide FF receptor 2 isoform 1							207.0	190.0	196.0					4																	72994497		2203	4300	6503	SO:0001583	missense	10886				detection of abiotic stimulus	actin cytoskeleton|integral to plasma membrane	neuropeptide receptor activity	g.chr4:72994497T>G	AF236083	CCDS3551.1, CCDS3552.1, CCDS47072.1	4q21	2012-08-10	2006-02-15	2006-02-15	ENSG00000056291	ENSG00000056291		"""GPCR / Class A :  Neuropeptide receptors : FF/AF"", ""GPCR / Class A : RF amide peptide receptors"""	4525	protein-coding gene	gene with protein product	"""neuropeptide FF 2"""	607449	"""G protein-coupled receptor 74"""	GPR74		10079187, 10851242	Standard	NM_001144756		Approved	NPFF2, NPGPR	uc003hgg.2	Q9Y5X5	OTTHUMG00000129918	ENST00000308744.6:c.495T>G	4.37:g.72994497T>G	ENSP00000307822:p.Asn165Lys		Somatic				NPFFR2_uc010iig.1_Intron|NPFFR2_uc003hgi.2_Missense_Mutation_p.N66K|NPFFR2_uc003hgh.2_Missense_Mutation_p.N63K	p.N165K	NM_004885	NP_004876	WXS	Illumina HiSeq	Unspecified	Q9Y5X5	NPFF2_HUMAN	Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)		2	593	+			165			Helical; Name=1; (Potential).		Q96RV1|Q9NR49	Missense_Mutation	SNP	ENST00000308744.6	37	c.495T>G	CCDS3551.1	.	.	.	.	.	.	.	.	.	.	T	19.19	3.780072	0.70222	.	.	ENSG00000056291	ENST00000308744;ENST00000395999;ENST00000358749	D;D;D	0.96619	-4.07;-4.07;-4.07	5.9	0.691	0.18045	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000032	D	0.98833	0.9606	H	0.99650	4.68	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97317	0.9941	10	0.87932	D	0	.	10.0429	0.42169	0.0:0.2402:0.0:0.7598	.	66;165	Q9Y5X5-3;Q9Y5X5	.;NPFF2_HUMAN	K	165;66;63	ENSP00000307822:N165K;ENSP00000379321:N66K;ENSP00000351599:N63K	ENSP00000307822:N165K	N	+	3	2	NPFFR2	73213361	0.372000	0.25064	0.393000	0.26258	0.921000	0.55340	-0.326000	0.07965	-0.079000	0.12707	0.528000	0.53228	AAT		0.358	NPFFR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252170.2	NM_004885		40	51	0	0	0	0	40	51				
PRMT9	90826	broad.mit.edu	37	4	148559781	148559781	+	Missense_Mutation	SNP	C	C	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr4:148559781C>T	ENST00000322396.6	-	12	2682	c.2440G>A	c.(2440-2442)Gtt>Att	p.V814I	PRMT10_ENST00000541232.1_Missense_Mutation_p.V701I|TMEM184C_ENST00000508208.1_Intron	NM_138364.2	NP_612373.2	Q6P2P2	ANM9_HUMAN		814	SAM-dependent MTase PRMT-type 2. {ECO:0000255|PROSITE-ProRule:PRU01015}.					cytoplasm (GO:0005737)	protein methyltransferase activity (GO:0008276)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28						TCTAAAACAACTGCAGCTTGT	0.413																																						uc003ilc.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(2440-2442)GTT>ATT		protein arginine methyltransferase 10							159.0	140.0	147.0					4																	148559781		2203	4300	6503	SO:0001583	missense	90826					cytoplasm	binding|protein methyltransferase activity	g.chr4:148559781C>T																												ENST00000322396.6:c.2440G>A	4.37:g.148559781C>T	ENSP00000314396:p.Val814Ile		Somatic				PRMT10_uc003ilb.2_Missense_Mutation_p.V458I|PRMT10_uc003ild.2_Missense_Mutation_p.V701I	p.V814I	NM_138364	NP_612373	WXS	Illumina HiSeq	Unspecified	Q6P2P2	ANM10_HUMAN			12	2582	-			814					A8KA39|B3KU92|Q6ZR58|Q8N383|Q9BT55|Q9NT98	Missense_Mutation	SNP	ENST00000322396.6	37	c.2440G>A	CCDS3771.1	.	.	.	.	.	.	.	.	.	.	C	16.20	3.056968	0.55325	.	.	ENSG00000164169	ENST00000322396;ENST00000541232	T;T	0.21932	1.98;1.98	5.4	5.4	0.78164	.	0.060847	0.64402	D	0.000004	T	0.20659	0.0497	L	0.55103	1.725	0.41925	D	0.990532	P	0.35456	0.502	B	0.31016	0.123	T	0.02512	-1.1148	10	0.35671	T	0.21	-7.8778	14.0672	0.64837	0.1507:0.8493:0.0:0.0	.	814	Q6P2P2	ANM10_HUMAN	I	814;701	ENSP00000314396:V814I;ENSP00000439508:V701I	ENSP00000314396:V814I	V	-	1	0	PRMT10	148779231	0.999000	0.42202	1.000000	0.80357	0.991000	0.79684	5.370000	0.66144	2.532000	0.85374	0.462000	0.41574	GTT		0.413	PRMT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364650.1			20	20	0	0	0	0	20	20				
KLHL2	11275	broad.mit.edu	37	4	166238995	166238995	+	Missense_Mutation	SNP	G	G	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr4:166238995G>T	ENST00000226725.6	+	14	1886	c.1627G>T	c.(1627-1629)Ggt>Tgt	p.G543C	KLHL2_ENST00000514860.1_Missense_Mutation_p.G547C|KLHL2_ENST00000538127.1_Missense_Mutation_p.G455C|KLHL2_ENST00000421009.2_Missense_Mutation_p.G446C|KLHL2_ENST00000509028.1_3'UTR|KLHL2_ENST00000506761.1_Missense_Mutation_p.G377C	NM_007246.3	NP_009177.3	O95198	KLHL2_HUMAN	kelch-like family member 2	543					protein ubiquitination (GO:0016567)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)	actin binding (GO:0003779)			endometrium(3)|large_intestine(5)|lung(4)|prostate(1)|urinary_tract(1)	14	all_hematologic(180;0.221)			GBM - Glioblastoma multiforme(119;2.94e-27)|COAD - Colon adenocarcinoma(41;1.4e-05)|Kidney(143;4.95e-05)|KIRC - Kidney renal clear cell carcinoma(143;0.000927)		TGCAGTTAATGGTCTGTTATA	0.348																																						uc003irb.2		NA																	0					0						c.(1627-1629)GGT>TGT		kelch-like 2, Mayven isoform 1							153.0	149.0	151.0					4																	166238995		2203	4300	6503	SO:0001583	missense	11275				intracellular protein transport	actin cytoskeleton|cytoplasm	actin binding|transporter activity	g.chr4:166238995G>T	AF059569	CCDS34094.1, CCDS54815.1, CCDS54816.1	4q21.2	2013-01-30	2013-01-30		ENSG00000109466	ENSG00000109466		"""Kelch-like"", ""BTB/POZ domain containing"""	6353	protein-coding gene	gene with protein product	"""mayven"""	605774	"""kelch (Drosophila)-like 2 (Mayven)"", ""kelch-like 2, Mayven (Drosophila)"""			10397770, 16035103	Standard	NM_007246		Approved	MAV	uc011cjm.2	O95198	OTTHUMG00000161294	ENST00000226725.6:c.1627G>T	4.37:g.166238995G>T	ENSP00000226725:p.Gly543Cys		Somatic				KLHL2_uc011cjm.1_Missense_Mutation_p.G547C|KLHL2_uc003irc.2_Missense_Mutation_p.G455C|KLHL2_uc010ira.2_Missense_Mutation_p.G196C	p.G543C	NM_007246	NP_009177	WXS	Illumina HiSeq	Unspecified	O95198	KLHL2_HUMAN		GBM - Glioblastoma multiforme(119;2.94e-27)|COAD - Colon adenocarcinoma(41;1.4e-05)|Kidney(143;4.95e-05)|KIRC - Kidney renal clear cell carcinoma(143;0.000927)	14	1886	+	all_hematologic(180;0.221)		543			Kelch 5.		A6NCM7|B2RD18|B4DFH7|F5H6M3|Q8N484|Q8TBH5	Missense_Mutation	SNP	ENST00000226725.6	37	c.1627G>T	CCDS34094.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.217963	0.79352	.	.	ENSG00000109466	ENST00000226725;ENST00000514860;ENST00000538127;ENST00000421009;ENST00000506761	D;D;D;D;D	0.82619	-1.63;-1.63;-1.63;-1.63;-1.63	6.17	6.17	0.99709	Galactose oxidase, beta-propeller (1);	0.250315	0.47852	D	0.000217	D	0.94489	0.8226	H	0.95712	3.71	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.996;0.996	D	0.94902	0.8057	10	0.87932	D	0	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	547;543;543	B4DFH7;B2RD18;O95198	.;.;KLHL2_HUMAN	C	543;547;455;446;377	ENSP00000226725:G543C;ENSP00000424198:G547C;ENSP00000437526:G455C;ENSP00000408974:G446C;ENSP00000424108:G377C	ENSP00000226725:G543C	G	+	1	0	KLHL2	166458445	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.062000	0.71155	2.941000	0.99782	0.655000	0.94253	GGT		0.348	KLHL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364439.1			26	12	1	0	5.62e-17	9.52e-17	26	12				
IRX4	50805	broad.mit.edu	37	5	1879828	1879828	+	Missense_Mutation	SNP	T	T	C			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr5:1879828T>C	ENST00000505790.1	-	5	982	c.526A>G	c.(526-528)Atc>Gtc	p.I176V	IRX4_ENST00000231357.2_Missense_Mutation_p.I176V|IRX4_ENST00000513692.1_Missense_Mutation_p.I176V|IRX4_ENST00000505938.1_5'UTR	NM_001278634.1	NP_001265563.1	P78413	IRX4_HUMAN	iroquois homeobox 4	176					establishment of organ orientation (GO:0048561)|heart development (GO:0007507)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|lung(7)|ovary(1)|prostate(1)	10				GBM - Glioblastoma multiforme(108;0.242)		GCCAGCATGATCTTCTCGCCC	0.642																																						uc003jcz.2		NA																	0					0						c.(526-528)ATC>GTC		iroquois homeobox 4							195.0	144.0	161.0					5																	1879828		2203	4300	6503	SO:0001583	missense	50805				heart development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr5:1879828T>C	AF124733	CCDS3867.1, CCDS75225.1	5p15.33	2011-06-20	2007-07-13		ENSG00000113430	ENSG00000113430		"""Homeoboxes / TALE class"""	6129	protein-coding gene	gene with protein product		606199	"""iroquois homeobox protein 4"""			10625552	Standard	NM_016358		Approved		uc003jcz.2	P78413	OTTHUMG00000090411	ENST00000505790.1:c.526A>G	5.37:g.1879828T>C	ENSP00000423161:p.Ile176Val		Somatic				IRX4_uc011cmf.1_Missense_Mutation_p.I37V	p.I176V	NM_016358	NP_057442	WXS	Illumina HiSeq	Unspecified	P78413	IRX4_HUMAN		GBM - Glioblastoma multiforme(108;0.242)	4	645	-			176			Homeobox; TALE-type.		B2RMW5|D3DTC5|H1AFL0|H1AFL1|Q2NL64|Q9UHR2	Missense_Mutation	SNP	ENST00000505790.1	37	c.526A>G	CCDS3867.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.373846	0.82573	.	.	ENSG00000113430	ENST00000231357;ENST00000505790;ENST00000513692;ENST00000511126	D;D;D;D	0.91351	-2.83;-2.83;-2.83;-2.83	4.55	4.55	0.56014	Homeodomain-related (1);Homeobox (2);Homeobox KN domain (1);Homeodomain-like (1);	0.057177	0.64402	D	0.000002	D	0.90390	0.6992	N	0.16790	0.44	0.80722	D	1	D	0.58620	0.983	D	0.73708	0.981	D	0.91639	0.5325	10	0.66056	D	0.02	-26.0403	12.8941	0.58089	0.0:0.0:0.0:1.0	.	176	P78413	IRX4_HUMAN	V	176;176;176;202	ENSP00000231357:I176V;ENSP00000423161:I176V;ENSP00000424235:I176V;ENSP00000421772:I202V	ENSP00000231357:I176V	I	-	1	0	IRX4	1932828	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.592000	0.82676	1.680000	0.50976	0.379000	0.24179	ATC		0.642	IRX4-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365500.1	NM_016358		35	53	0	0	0	0	35	53				
DNAH5	1767	broad.mit.edu	37	5	13830247	13830247	+	Missense_Mutation	SNP	G	G	C			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr5:13830247G>C	ENST00000265104.4	-	37	6241	c.6137C>G	c.(6136-6138)gCc>gGc	p.A2046G		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2046	AAA 1. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					AATTTGCTGGGCTGCAACCGA	0.383									Kartagener syndrome																													uc003jfd.2		NA																	0				ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31						c.(6136-6138)GCC>GGC		dynein, axonemal, heavy chain 5							80.0	80.0	80.0					5																	13830247		2203	4300	6503	SO:0001583	missense	1767	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr5:13830247G>C	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.6137C>G	5.37:g.13830247G>C	ENSP00000265104:p.Ala2046Gly		Somatic					p.A2046G	NM_001369	NP_001360	WXS	Illumina HiSeq	Unspecified	Q8TE73	DYH5_HUMAN			37	6179	-	Lung NSC(4;0.00476)		2046			AAA 1 (By similarity).		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	c.6137C>G	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	G	31	5.094534	0.94149	.	.	ENSG00000039139	ENST00000265104	T	0.14266	2.52	6.17	6.17	0.99709	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.51244	0.1663	M	0.92268	3.29	0.80722	D	1	D	0.64830	0.994	D	0.78314	0.991	T	0.58951	-0.7545	10	0.87932	D	0	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	2046	Q8TE73	DYH5_HUMAN	G	2046	ENSP00000265104:A2046G	ENSP00000265104:A2046G	A	-	2	0	DNAH5	13883247	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.941000	0.99782	0.655000	0.94253	GCC		0.383	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		20	20	0	0	0	0	20	20				
IL7R	3575	broad.mit.edu	37	5	35876219	35876219	+	Missense_Mutation	SNP	G	G	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr5:35876219G>T	ENST00000303115.3	+	8	1140	c.1011G>T	c.(1009-1011)aaG>aaT	p.K337N	IL7R_ENST00000343305.4_3'UTR	NM_002185.3	NP_002176.2	P16871	IL7RA_HUMAN	interleukin 7 receptor	337					B cell proliferation (GO:0042100)|cell growth (GO:0016049)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|homeostasis of number of cells (GO:0048872)|immune response (GO:0006955)|immunoglobulin production (GO:0002377)|interleukin-7-mediated signaling pathway (GO:0038111)|lymph node development (GO:0048535)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|positive regulation of gene expression (GO:0010628)|positive regulation of T cell differentiation in thymus (GO:0033089)|regulation of cell size (GO:0008361)|regulation of DNA recombination (GO:0000018)|signal transduction (GO:0007165)|T cell differentiation (GO:0030217)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|interleukin-7 receptor activity (GO:0004917)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(78)|kidney(2)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|skin(5)|stomach(3)	126	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			AATCTGAGAAGCAGAGGCTTG	0.488			"""Mis, O"""		"""ALL, ETP ALL"""		Severe combined immune deficiency																															uc003jjs.2		NA		Dom	yes		5	5p13	146661		interleukin 7 receptor	yes		L					0				ovary(3)|breast(1)|skin(1)	5						c.(1009-1011)AAG>AAT		interleukin 7 receptor precursor							70.0	69.0	69.0					5																	35876219		2203	4300	6503	SO:0001583	missense	3575				immune response|regulation of DNA recombination	extracellular region|integral to membrane	antigen binding|interleukin-7 receptor activity	g.chr5:35876219G>T	M29696	CCDS3911.1	5p13	2014-09-17			ENSG00000168685	ENSG00000168685		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6024	protein-coding gene	gene with protein product		146661				2317865	Standard	NM_002185		Approved	CD127	uc003jjs.4	P16871	OTTHUMG00000090791	ENST00000303115.3:c.1011G>T	5.37:g.35876219G>T	ENSP00000306157:p.Lys337Asn		Somatic				IL7R_uc011cop.1_RNA	p.K337N	NM_002185	NP_002176	WXS	Illumina HiSeq	Unspecified	P16871	IL7RA_HUMAN	Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)		8	1100	+	all_lung(31;0.00015)		337			Cytoplasmic (Potential).		B2RCS6|B4DVT1|Q05CU8|Q6NSP4|Q6NWM0|Q6NWM1|Q6NWM2|Q6NWM3|Q6SV45|Q9UPC1	Missense_Mutation	SNP	ENST00000303115.3	37	c.1011G>T	CCDS3911.1	.	.	.	.	.	.	.	.	.	.	G	7.352	0.623132	0.14193	.	.	ENSG00000168685	ENST00000303115;ENST00000505875	T;T	0.38240	1.47;1.15	5.79	-3.88	0.04205	.	1.687080	0.02406	N	0.081100	T	0.37183	0.0994	L	0.53249	1.67	0.47374	D	0.999408	B	0.15719	0.014	B	0.17433	0.018	T	0.39375	-0.9617	10	0.59425	D	0.04	-21.8843	12.7888	0.57522	0.657:0.0:0.343:0.0	.	337	P16871	IL7RA_HUMAN	N	337;103	ENSP00000306157:K337N;ENSP00000420923:K103N	ENSP00000306157:K337N	K	+	3	2	IL7R	35911976	0.002000	0.14202	0.025000	0.17156	0.193000	0.23685	-0.994000	0.03716	-0.651000	0.05415	-0.137000	0.14449	AAG		0.488	IL7R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207577.2			15	38	1	0	4.15e-12	6.86e-12	15	38				
ELL2	22936	broad.mit.edu	37	5	95242283	95242283	+	Missense_Mutation	SNP	G	G	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr5:95242283G>T	ENST00000237853.4	-	5	1034	c.685C>A	c.(685-687)Cag>Aag	p.Q229K	ELL2_ENST00000431061.2_Intron|ELL2_ENST00000506628.1_5'UTR	NM_012081.5	NP_036213.2	O00472	ELL2_HUMAN	elongation factor, RNA polymerase II, 2	229					regulation of transcription, DNA-templated (GO:0006355)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|transcription elongation from RNA polymerase II promoter (GO:0006368)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)	24		all_cancers(142;2.04e-06)|all_epithelial(76;3.1e-09)|all_lung(232;0.00309)|Lung NSC(167;0.00454)|Ovarian(225;0.0165)|Colorectal(57;0.0343)|Breast(839;0.198)		all cancers(79;2.16e-15)		CCATCTTTCTGGAGTCTAGCA	0.502																																						uc003klr.3		NA																	0				central_nervous_system(1)	1						c.(685-687)CAG>AAG		elongation factor, RNA polymerase II, 2							114.0	117.0	116.0					5																	95242283		2203	4300	6503	SO:0001583	missense	22936				regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter	transcription elongation factor complex		g.chr5:95242283G>T	U88629	CCDS4080.1	5q15	2010-11-29			ENSG00000118985	ENSG00000118985			17064	protein-coding gene	gene with protein product		601874				9108030	Standard	NM_012081		Approved		uc003klr.4	O00472	OTTHUMG00000122085	ENST00000237853.4:c.685C>A	5.37:g.95242283G>T	ENSP00000237853:p.Gln229Lys		Somatic					p.Q229K	NM_012081	NP_036213	WXS	Illumina HiSeq	Unspecified	O00472	ELL2_HUMAN		all cancers(79;2.16e-15)	5	1035	-		all_cancers(142;2.04e-06)|all_epithelial(76;3.1e-09)|all_lung(232;0.00309)|Lung NSC(167;0.00454)|Ovarian(225;0.0165)|Colorectal(57;0.0343)|Breast(839;0.198)	229					B4DNK7	Missense_Mutation	SNP	ENST00000237853.4	37	c.685C>A	CCDS4080.1	.	.	.	.	.	.	.	.	.	.	G	19.66	3.868536	0.72065	.	.	ENSG00000118985	ENST00000237853	T	0.30981	1.51	6.08	6.08	0.98989	.	0.051177	0.85682	D	0.000000	T	0.37758	0.1015	L	0.51914	1.62	0.80722	D	1	P	0.43231	0.801	P	0.46419	0.516	T	0.06409	-1.0828	10	0.59425	D	0.04	-4.0486	14.4438	0.67336	0.0706:0.0:0.9294:0.0	.	229	O00472	ELL2_HUMAN	K	229	ENSP00000237853:Q229K	ENSP00000237853:Q229K	Q	-	1	0	ELL2	95268039	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	7.658000	0.83755	2.894000	0.99253	0.591000	0.81541	CAG		0.502	ELL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242846.1	NM_012081		14	122	1	0	4.38e-07	6.97e-07	14	122				
FBN2	2201	broad.mit.edu	37	5	127670501	127670501	+	Missense_Mutation	SNP	T	T	A			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr5:127670501T>A	ENST00000508053.1	-	37	4983	c.4009A>T	c.(4009-4011)Atg>Ttg	p.M1337L	FBN2_ENST00000507835.1_Missense_Mutation_p.M187L|FBN2_ENST00000262464.4_Missense_Mutation_p.M1337L|FBN2_ENST00000508989.1_Missense_Mutation_p.M1304L			P35556	FBN2_HUMAN	fibrillin 2	1337	EGF-like 21; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TCCCCAAACATGCAGATATTT	0.378																																						uc003kuu.2		NA																	0				ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15						c.(4009-4011)ATG>TTG		fibrillin 2 precursor							154.0	140.0	145.0					5																	127670501		2203	4300	6503	SO:0001583	missense	2201				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent	g.chr5:127670501T>A	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.4009A>T	5.37:g.127670501T>A	ENSP00000424571:p.Met1337Leu		Somatic				FBN2_uc003kuv.2_Missense_Mutation_p.M1304L	p.M1337L	NM_001999	NP_001990	WXS	Illumina HiSeq	Unspecified	P35556	FBN2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)	31	4448	-		all_cancers(142;0.0216)|Prostate(80;0.0551)	1337			EGF-like 21; calcium-binding.		B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	c.4009A>T	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	T	4.330	0.060603	0.08339	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000507835;ENST00000508989	D;D;D;D	0.91843	-2.92;-2.92;-2.92;-2.92	4.79	3.61	0.41365	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	T	0.81673	0.4872	N	0.05554	-0.025	0.36194	D	0.850249	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.001	T	0.76350	-0.2991	10	0.22109	T	0.4	.	12.0464	0.53483	0.0:0.0:0.1444:0.8556	.	1304;1337	D6RJI3;P35556	.;FBN2_HUMAN	L	1337;1337;187;1304	ENSP00000262464:M1337L;ENSP00000424571:M1337L;ENSP00000426839:M187L;ENSP00000425596:M1304L	ENSP00000262464:M1337L	M	-	1	0	FBN2	127698400	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	1.770000	0.38532	0.945000	0.37605	-0.291000	0.09656	ATG		0.378	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999		27	37	0	0	0	0	27	37				
PRELID1	27166	broad.mit.edu	37	5	176732933	176732933	+	Missense_Mutation	SNP	G	G	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr5:176732933G>T	ENST00000303204.4	+	3	592	c.380G>T	c.(379-381)cGc>cTc	p.R127L	RAB24_ENST00000393611.2_5'Flank|RAB24_ENST00000303270.6_5'Flank|PRELID1_ENST00000503216.1_Missense_Mutation_p.R127L|MXD3_ENST00000427908.2_3'UTR|RAB24_ENST00000303251.6_5'Flank			Q9Y255	PRLD1_HUMAN	PRELI domain containing 1	127	PRELI/MSF1. {ECO:0000255|PROSITE- ProRule:PRU00158}.			R -> H (in Ref. 1; AAF09255). {ECO:0000305}.	apoptotic process (GO:0006915)|immune response (GO:0006955)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of mitochondrial membrane potential (GO:0010917)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|phospholipid transport (GO:0015914)|positive regulation of cellular respiration (GO:1901857)|positive regulation of endopeptidase activity (GO:0010950)|positive regulation of phospholipid transport (GO:2001140)|positive regulation of T cell apoptotic process (GO:0070234)|regulation of membrane lipid distribution (GO:0097035)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of T cell differentiation (GO:0045580)	mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)				endometrium(1)|kidney(2)|lung(2)|prostate(1)|stomach(1)	7	all_cancers(89;2.49e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ACTGAAATCCGCCGGGAAGCC	0.547																																						uc003mfx.2		NA																	0					0						c.(379-381)CGC>CTC		PRELI domain containing 1 precursor							93.0	87.0	89.0					5																	176732933		2203	4300	6503	SO:0001583	missense	27166				immune response|multicellular organismal development	mitochondrion|nucleus		g.chr5:176732933G>T	BC013748	CCDS4415.1, CCDS64328.1	5q35.3	2010-01-18			ENSG00000169230	ENSG00000169230			30255	protein-coding gene	gene with protein product	"""protein of relevant evolutionary and lymphoid interest"", ""px19-like protein"""	605733				10784606, 14640972	Standard	NM_013237		Approved	CGI-106, PX19, PRELI	uc003mfx.4	Q9Y255	OTTHUMG00000130847	ENST00000303204.4:c.380G>T	5.37:g.176732933G>T	ENSP00000302114:p.Arg127Leu		Somatic				RAB24_uc003mfu.2_5'Flank|RAB24_uc003mfv.2_5'Flank|RAB24_uc003mfw.2_5'Flank|PRELID1_uc003mfy.2_Missense_Mutation_p.R127L|MXD3_uc010jkk.2_3'UTR	p.R127L	NM_013237	NP_037369	WXS	Illumina HiSeq	Unspecified	Q9Y255	PRLD1_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		3	532	+	all_cancers(89;2.49e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	127	R -> H (in Ref. 1; AAF09255).		PRELI/MSF1.		B2R5F7|D6RD25|Q549N2|Q9UI13|Q9UJS9	Missense_Mutation	SNP	ENST00000303204.4	37	c.380G>T	CCDS4415.1	.	.	.	.	.	.	.	.	.	.	G	8.756	0.922542	0.17982	.	.	ENSG00000169230	ENST00000303204;ENST00000503216	T;T	0.17054	2.3;2.3	4.48	2.7	0.31948	PRELI/MSF1 (2);	0.457796	0.23676	N	0.045668	T	0.12902	0.0313	L	0.41824	1.3	0.30739	N	0.746432	B;B	0.16396	0.017;0.002	B;B	0.26416	0.069;0.049	T	0.09930	-1.0652	10	0.46703	T	0.11	-3.4473	3.8467	0.08937	0.3693:0.1766:0.454:0.0	.	127;127	D6RD25;Q9Y255	.;PRLD1_HUMAN	L	127	ENSP00000302114:R127L;ENSP00000427097:R127L	ENSP00000302114:R127L	R	+	2	0	PRELID1	176665539	0.994000	0.37717	1.000000	0.80357	0.973000	0.67179	1.167000	0.31847	0.530000	0.28619	0.561000	0.74099	CGC		0.547	PRELID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253414.1	NM_013237		24	36	1	0	3.67e-16	6.2e-16	24	36				
TDRD6	221400	broad.mit.edu	37	6	46656253	46656253	+	Missense_Mutation	SNP	G	G	A			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr6:46656253G>A	ENST00000316081.6	+	1	388	c.388G>A	c.(388-390)Gtg>Atg	p.V130M	RP11-446F17.3_ENST00000422284.2_RNA|RP11-446F17.3_ENST00000434329.2_RNA|RP11-446F17.3_ENST00000571590.1_RNA|TDRD6_ENST00000544460.1_Missense_Mutation_p.V130M	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	130					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)				NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			GCTGGGCTGCGTGCTAGCGGG	0.706																																						uc003oyj.2		NA																	0				breast(3)|ovary(2)|skin(1)	6						c.(388-390)GTG>ATG		tudor domain containing 6							6.0	9.0	8.0					6																	46656253		1999	3948	5947	SO:0001583	missense	221400				cell differentiation|multicellular organismal development|spermatogenesis	chromatoid body	nucleic acid binding	g.chr6:46656253G>A	AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.388G>A	6.37:g.46656253G>A	ENSP00000346065:p.Val130Met		Somatic				TDRD6_uc010jze.2_Missense_Mutation_p.V124M	p.V130M	NM_001010870	NP_001010870	WXS	Illumina HiSeq	Unspecified	O60522	TDRD6_HUMAN	Lung(136;0.192)		1	388	+			130					B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Missense_Mutation	SNP	ENST00000316081.6	37	c.388G>A	CCDS34470.1	.	.	.	.	.	.	.	.	.	.	G	16.39	3.110949	0.56398	.	.	ENSG00000180113	ENST00000544460;ENST00000316081	T;T	0.09350	2.99;2.99	5.31	5.31	0.75309	Maternal tudor protein (1);	0.322853	0.30311	N	0.009913	T	0.20047	0.0482	M	0.65498	2.005	0.33610	D	0.603457	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.01805	-1.1270	10	0.33940	T	0.23	-12.094	14.5672	0.68185	0.0:0.1461:0.8539:0.0	.	130;130	F5H5M3;O60522	.;TDRD6_HUMAN	M	130	ENSP00000443299:V130M;ENSP00000346065:V130M	ENSP00000346065:V130M	V	+	1	0	TDRD6	46764212	1.000000	0.71417	1.000000	0.80357	0.864000	0.49448	1.356000	0.34079	2.482000	0.83794	0.563000	0.77884	GTG		0.706	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040800.1	XM_166443		5	6	0	0	0	0	5	6				
PNISR	25957	broad.mit.edu	37	6	99848618	99848618	+	Missense_Mutation	SNP	T	T	A			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr6:99848618T>A	ENST00000369239.5	-	12	2420	c.2216A>T	c.(2215-2217)gAt>gTt	p.D739V	PNISR_ENST00000438806.1_Missense_Mutation_p.D739V	NM_032870.2	NP_116259.2	Q8TF01	PNISR_HUMAN	PNN-interacting serine/arginine-rich protein	739	Ser-rich.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24						TTTCTTACTATCCTGTCTAGA	0.353																																						uc003ppo.3		NA																	0					0						c.(2215-2217)GAT>GTT		splicing factor, arginine/serine-rich 130							167.0	168.0	168.0					6																	99848618		2203	4300	6503	SO:0001583	missense	25957					nuclear speck		g.chr6:99848618T>A	AK027759	CCDS5043.1	6q16.3	2011-06-06	2011-06-06	2011-06-06	ENSG00000132424	ENSG00000132424			21222	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 111"", ""splicing factor, arginine/serine-rich 18"""	C6orf111, SFRS18		14578391	Standard	NM_032870		Approved	FLJ14752, bA98I9.2, DKFZp564B0769, SRrp130	uc021zdd.1	Q8TF01	OTTHUMG00000015262	ENST00000369239.5:c.2216A>T	6.37:g.99848618T>A	ENSP00000358242:p.Asp739Val		Somatic				SFRS18_uc003ppl.2_Missense_Mutation_p.D285V|SFRS18_uc003ppp.3_Missense_Mutation_p.D739V|SFRS18_uc011eag.1_Missense_Mutation_p.D739V	p.D739V	NM_032870	NP_116259	WXS	Illumina HiSeq	Unspecified	Q8TF01	PNISR_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0631)	12	2444	-		all_cancers(76;1.24e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.00716)|Colorectal(196;0.0691)|Lung NSC(302;0.186)	739			Ser-rich.		A8K540|E1P5D2|Q5T064|Q5T065|Q6P2B4|Q6P2N4|Q6PJ93|Q6PK36|Q7Z640|Q8N2L1|Q8TF00|Q96K10|Q96SI3|Q96SM5|Q9P076|Q9P0C0|Q9Y4N3	Missense_Mutation	SNP	ENST00000369239.5	37	c.2216A>T	CCDS5043.1	.	.	.	.	.	.	.	.	.	.	T	15.26	2.780549	0.49891	.	.	ENSG00000132424	ENST00000369239;ENST00000438806	.	.	.	5.5	5.5	0.81552	.	0.268590	0.42053	D	0.000778	T	0.29524	0.0736	L	0.27053	0.805	0.80722	D	1	P	0.39250	0.665	B	0.39068	0.289	T	0.17167	-1.0378	9	0.40728	T	0.16	.	15.6032	0.76642	0.0:0.0:0.0:1.0	.	739	Q8TF01	PNISR_HUMAN	V	739	.	ENSP00000358242:D739V	D	-	2	0	PNISR	99955339	1.000000	0.71417	0.999000	0.59377	0.953000	0.61014	3.930000	0.56522	2.090000	0.63153	0.448000	0.29417	GAT		0.353	PNISR-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041598.1	NM_032870		44	80	0	0	0	0	44	80				
TBC1D32	221322	broad.mit.edu	37	6	121615732	121615732	+	Silent	SNP	T	T	C			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr6:121615732T>C	ENST00000398212.2	-	11	1264	c.1215A>G	c.(1213-1215)ggA>ggG	p.G405G	TBC1D32_ENST00000275159.6_Silent_p.G405G	NM_152730.4	NP_689943.4	Q96NH3	BROMI_HUMAN	TBC1 domain family, member 32	405					cilium morphogenesis (GO:0060271)|embryonic digit morphogenesis (GO:0042733)|lens development in camera-type eye (GO:0002088)|protein localization to cilium (GO:0061512)|retinal pigment epithelium development (GO:0003406)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cilium (GO:0005929)|cytoplasm (GO:0005737)	Rab GTPase activator activity (GO:0005097)										GCTTTGAATGTCCCAAAGTTT	0.279																																						uc003pyo.1		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(1213-1215)GGA>GGG		hypothetical protein LOC221322							141.0	133.0	135.0					6																	121615732		1822	4075	5897	SO:0001819	synonymous_variant	221322				multicellular organismal development	cilium|cytoplasm	Rab GTPase activator activity	g.chr6:121615732T>C	AK055461	CCDS43501.1	6q22.31	2014-02-20	2013-07-10	2013-07-10	ENSG00000146350	ENSG00000146350			21485	protein-coding gene	gene with protein product	"""broad-minded homolog"""	615867	"""chromosome 6 open reading frame 171"", ""chromosome 6 open reading frame 170"""	C6orf171, C6orf170		20159594, 24285566	Standard	NM_152730		Approved	FLJ30899, dJ310J6.1, FLJ34235, bA57L9.1, BROMI	uc003pyo.1	Q96NH3	OTTHUMG00000015474	ENST00000398212.2:c.1215A>G	6.37:g.121615732T>C			Somatic				C6orf170_uc003pyq.1_RNA|C6orf170_uc003pyp.1_5'Flank	p.G405G	NM_152730	NP_689943	WXS	Illumina HiSeq	Unspecified	Q96NH3	BROMI_HUMAN		GBM - Glioblastoma multiforme(226;0.00521)	11	1283	-			405					Q5SZD6|Q5SZM6|Q6ZMY4|Q6ZUR7|Q8NB47	Silent	SNP	ENST00000398212.2	37	c.1215A>G	CCDS43501.1																																																																																				0.279	TBC1D32-005	PUTATIVE	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380937.2	NM_152730		58	74	0	0	0	0	58	74				
MTHFD1L	25902	broad.mit.edu	37	6	151293090	151293090	+	Missense_Mutation	SNP	C	C	A			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr6:151293090C>A	ENST00000367321.3	+	20	2295	c.2021C>A	c.(2020-2022)cCt>cAt	p.P674H	MTHFD1L_ENST00000478643.1_3'UTR	NM_001242767.1|NM_001242768.1|NM_015440.4	NP_001229696.1|NP_001229697.1|NP_056255.2	Q6UB35	C1TM_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like	674	Formyltetrahydrofolate synthetase.				folic acid-containing compound biosynthetic process (GO:0009396)|folic acid-containing compound metabolic process (GO:0006760)|formate metabolic process (GO:0015942)|one-carbon metabolic process (GO:0006730)|oxidation-reduction process (GO:0055114)|tetrahydrofolate interconversion (GO:0035999)|tetrahydrofolate metabolic process (GO:0046653)	membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	29		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)		TAGGGGACACCTGTGTTCGTG	0.443																																						uc003qob.2		NA																	0				ovary(3)|large_intestine(1)	4						c.(2020-2022)CCT>CAT		methylenetetrahydrofolate dehydrogenase (NADP+							126.0	115.0	119.0					6																	151293090		2203	4300	6503	SO:0001583	missense	25902				folic acid-containing compound biosynthetic process|formate metabolic process|one-carbon metabolic process|tetrahydrofolate metabolic process	mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|protein homodimerization activity	g.chr6:151293090C>A	BC017477	CCDS5228.1, CCDS56457.1, CCDS75535.1, CCDS75536.1	6q25.1	2010-07-19	2004-12-13	2004-12-14	ENSG00000120254	ENSG00000120254	6.3.4.3		21055	protein-coding gene	gene with protein product	"""10-formyl-THF synthetase"", ""mitochondrial C1-tetrahydrofolate synthase"", ""monofunctional C1-tetrahydrofolate synthase, mitochondrial"""	611427	"""formyltetrahydrofolate synthetase domain containing 1"""	FTHFSDC1		18804703	Standard	NM_015440		Approved	DKFZP586G1517, FLJ21145	uc021zgs.1	Q6UB35	OTTHUMG00000015828	ENST00000367321.3:c.2021C>A	6.37:g.151293090C>A	ENSP00000356290:p.Pro674His		Somatic				MTHFD1L_uc011een.1_RNA|MTHFD1L_uc011eeo.1_Missense_Mutation_p.P675H|MTHFD1L_uc003qoc.2_Missense_Mutation_p.P622H	p.P674H	NM_015440	NP_056255	WXS	Illumina HiSeq	Unspecified	Q6UB35	C1TM_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)	20	2289	+		Ovarian(120;0.128)	674			Formyltetrahydrofolate synthetase.		Q2TBF3|Q8WVW0|Q96HG8|Q9H789|Q9UFU8	Missense_Mutation	SNP	ENST00000367321.3	37	c.2021C>A	CCDS5228.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.060696	0.76074	.	.	ENSG00000120254	ENST00000367321	T	0.55234	0.53	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	D	0.84511	0.5488	H	0.99609	4.655	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.91448	0.5179	10	0.87932	D	0	.	18.3264	0.90255	0.0:1.0:0.0:0.0	.	675;429;674	B7ZM99;B2RD24;Q6UB35	.;.;C1TM_HUMAN	H	674	ENSP00000356290:P674H	ENSP00000356290:P674H	P	+	2	0	MTHFD1L	151334783	1.000000	0.71417	1.000000	0.80357	0.552000	0.35366	7.468000	0.80943	2.622000	0.88805	0.655000	0.94253	CCT		0.443	MTHFD1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042699.1	NM_015440		17	76	1	0	1.5e-11	2.47e-11	17	76				
AGMO	392636	broad.mit.edu	37	7	15584411	15584411	+	Missense_Mutation	SNP	T	T	G			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr7:15584411T>G	ENST00000342526.3	-	3	564	c.395A>C	c.(394-396)cAt>cCt	p.H132P		NM_001004320.1	NP_001004320.1	Q6ZNB7	ALKMO_HUMAN	alkylglycerol monooxygenase	132					ether lipid metabolic process (GO:0046485)|fatty acid biosynthetic process (GO:0006633)|membrane lipid metabolic process (GO:0006643)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glyceryl-ether monooxygenase activity (GO:0050479)|iron ion binding (GO:0005506)			breast(1)|kidney(1)|large_intestine(6)|liver(1)|lung(30)|prostate(1)|skin(2)	42						AGCCATACGATGGAACCAGTA	0.393																																						uc003stb.1		NA																	0					0						c.(394-396)CAT>CCT		transmembrane protein 195							137.0	128.0	131.0					7																	15584411		2203	4300	6503	SO:0001583	missense	392636				ether lipid metabolic process|fatty acid biosynthetic process|membrane lipid metabolic process	endoplasmic reticulum membrane|integral to membrane	glyceryl-ether monooxygenase activity|iron ion binding	g.chr7:15584411T>G		CCDS34604.1	7p21.1	2013-03-04	2011-01-31	2011-01-31	ENSG00000187546	ENSG00000187546	1.14.16.5	"""Fatty acid hydroxylase domain containing"""	33784	protein-coding gene	gene with protein product		613738	"""transmembrane protein 195"""	TMEM195		20643956	Standard	NM_001004320		Approved	FLJ16237	uc003stb.1	Q6ZNB7	OTTHUMG00000152387	ENST00000342526.3:c.395A>C	7.37:g.15584411T>G	ENSP00000341662:p.His132Pro		Somatic					p.H132P	NM_001004320	NP_001004320	WXS	Illumina HiSeq	Unspecified	Q6ZNB7	ALKMO_HUMAN			3	565	-			132	H->A: Loss of function; when associated with A-136; A-145; A-148; A-149; A-221; A-224 and A-225.		Histidine box-1.		A4D114|A6NCH5	Missense_Mutation	SNP	ENST00000342526.3	37	c.395A>C	CCDS34604.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.336307	0.81801	.	.	ENSG00000187546	ENST00000342526	D	0.99499	-6.02	6.12	6.12	0.99158	Fatty acid hydroxylase (1);	0.000000	0.85682	D	0.000000	D	0.99775	0.9907	H	0.98918	4.37	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.96930	0.9680	10	0.87932	D	0	-27.4729	15.9711	0.80019	0.0:0.0:0.0:1.0	.	132	Q6ZNB7	ALKMO_HUMAN	P	132	ENSP00000341662:H132P	ENSP00000341662:H132P	H	-	2	0	AGMO	15550936	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.662000	0.68032	2.364000	0.80123	0.524000	0.50904	CAT		0.393	AGMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326049.2	NM_001004320		6	100	0	0	0	0	6	100				
PRPS1L1	221823	broad.mit.edu	37	7	18067176	18067176	+	Missense_Mutation	SNP	C	C	A			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr7:18067176C>A	ENST00000506618.2	-	1	310	c.230G>T	c.(229-231)tGc>tTc	p.C77F		NM_175886.2	NP_787082	P21108	PRPS3_HUMAN	phosphoribosyl pyrophosphate synthetase 1-like 1	77					5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|nucleotide biosynthetic process (GO:0009165)|ribonucleoside monophosphate biosynthetic process (GO:0009156)		ATP binding (GO:0005524)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)|ribose phosphate diphosphokinase activity (GO:0004749)			endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(3)	18	Lung NSC(10;0.0385)|all_lung(11;0.0736)					AGCAATCTTGCAGGCATTAAT	0.483																																						uc003stz.2		NA																	0				ovary(1)	1						c.(229-231)TGC>TTC		phosphoribosyl pyrophosphate synthetase 1-like							300.0	294.0	296.0					7																	18067176		2203	4300	6503	SO:0001583	missense	221823				nucleoside metabolic process|ribonucleoside monophosphate biosynthetic process		ATP binding|kinase activity|magnesium ion binding|protein homodimerization activity|ribose phosphate diphosphokinase activity	g.chr7:18067176C>A	M57423	CCDS47552.1	7p21.1	2010-12-10			ENSG00000229937	ENSG00000229937			9463	protein-coding gene	gene with protein product		611566		PRPSL		2168892	Standard	NM_175886		Approved	PRPS3	uc003stz.3	P21108	OTTHUMG00000152742	ENST00000506618.2:c.230G>T	7.37:g.18067176C>A	ENSP00000424595:p.Cys77Phe		Somatic					p.C77F	NM_175886	NP_787082	WXS	Illumina HiSeq	Unspecified	P21108	PRPS3_HUMAN			1	311	-	Lung NSC(10;0.0385)|all_lung(11;0.0736)		77					Q6P5P6	Missense_Mutation	SNP	ENST00000506618.2	37	c.230G>T	CCDS47552.1	.	.	.	.	.	.	.	.	.	.	C	17.43	3.387155	0.61956	.	.	ENSG00000229937	ENST00000506618	D	0.91351	-2.83	4.67	3.79	0.43588	.	.	.	.	.	D	0.93485	0.7921	M	0.73598	2.24	.	.	.	D	0.67145	0.996	D	0.65773	0.938	D	0.93898	0.7186	8	0.33141	T	0.24	.	10.854	0.46786	0.0:0.9076:0.0:0.0924	.	77	P21108	PRPS3_HUMAN	F	77	ENSP00000424595:C77F	ENSP00000424595:C77F	C	-	2	0	PRPS1L1	18033701	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.989000	0.76219	1.338000	0.45544	0.650000	0.86243	TGC		0.483	PRPS1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327667.1	NM_175886		110	164	1	0	5.77e-36	9.93e-36	110	164				
POU6F2	11281	broad.mit.edu	37	7	39472771	39472771	+	Silent	SNP	G	G	A			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr7:39472771G>A	ENST00000403058.1	+	8	1276	c.1122G>A	c.(1120-1122)caG>caA	p.Q374Q	POU6F2_ENST00000559001.1_Silent_p.Q319Q|POU6F2_ENST00000518318.2_Silent_p.Q374Q	NM_001166018.1|NM_007252.3	NP_001159490.1|NP_009183.3	P78424	PO6F2_HUMAN	POU class 6 homeobox 2	374	Gln-rich.				central nervous system development (GO:0007417)|ganglion mother cell fate determination (GO:0007402)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42						TCACCCCCCAGCTCCTCACAA	0.587																																						uc003thb.1		NA																	0				central_nervous_system(1)	1						c.(1120-1122)CAG>CAA		POU class 6 homeobox 2 isoform 1							114.0	91.0	99.0					7																	39472771		2203	4300	6503	SO:0001819	synonymous_variant	11281				central nervous system development|ganglion mother cell fate determination|transcription from RNA polymerase II promoter|visual perception		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:39472771G>A	U91934	CCDS34620.2, CCDS55103.1	7p14.1	2011-06-20	2007-07-13		ENSG00000106536	ENSG00000106536		"""Homeoboxes / POU class"""	21694	protein-coding gene	gene with protein product	"""Retina-derived POU-domain factor-1"""	609062	"""POU domain, class 6, transcription factor 2"""			8601806	Standard	NM_007252		Approved	RPF-1	uc003thb.2	P78424	OTTHUMG00000150803	ENST00000403058.1:c.1122G>A	7.37:g.39472771G>A			Somatic					p.Q374Q	NM_007252	NP_009183	WXS	Illumina HiSeq	Unspecified	P78424	PO6F2_HUMAN			7	1164	+			374			Gln-rich.		A4D1W2|C4AMB9|P78425|Q75ME8|Q86UM6|Q9UDS7	Silent	SNP	ENST00000403058.1	37	c.1122G>A	CCDS34620.2																																																																																				0.587	POU6F2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320146.3	NM_007252		5	59	0	0	0	0	5	59				
NPC1L1	29881	broad.mit.edu	37	7	44578580	44578580	+	Silent	SNP	G	G	A			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr7:44578580G>A	ENST00000289547.4	-	2	1471	c.1416C>T	c.(1414-1416)taC>taT	p.Y472Y	NPC1L1_ENST00000381160.3_Silent_p.Y472Y|NPC1L1_ENST00000546276.1_Silent_p.Y472Y|NPC1L1_ENST00000423141.1_Silent_p.Y472Y	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	472					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	TGAGGGGGGCGTAGCAGATGT	0.592																																						uc003tlb.2		NA																	0				ovary(3)|central_nervous_system(1)|skin(1)	5						c.(1414-1416)TAC>TAT		Niemann-Pick C1-like protein 1 isoform 1	Ezetimibe(DB00973)						121.0	106.0	111.0					7																	44578580		2203	4300	6503	SO:0001819	synonymous_variant	29881				cholesterol biosynthetic process|intestinal cholesterol absorption|lipoprotein metabolic process	apical plasma membrane|cytoplasmic vesicle membrane|integral to membrane	hedgehog receptor activity|protein binding	g.chr7:44578580G>A		CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.1416C>T	7.37:g.44578580G>A			Somatic				NPC1L1_uc003tlc.2_Silent_p.Y472Y|NPC1L1_uc011kbw.1_Silent_p.Y472Y|NPC1L1_uc003tld.2_Silent_p.Y472Y	p.Y472Y	NM_013389	NP_037521	WXS	Illumina HiSeq	Unspecified	Q9UHC9	NPCL1_HUMAN			2	1472	-			472			Extracellular (Potential).		A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Silent	SNP	ENST00000289547.4	37	c.1416C>T	CCDS5491.1																																																																																				0.592	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251256.1	NM_013389		12	26	0	0	0	0	12	26				
ELN	2006	broad.mit.edu	37	7	73480043	73480043	+	Silent	SNP	C	C	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr7:73480043C>T	ENST00000252034.7	+	30	2412	c.2013C>T	c.(2011-2013)gcC>gcT	p.A671A	ELN_ENST00000380562.4_Silent_p.A677A|ELN_ENST00000358929.4_Silent_p.A739A|ELN_ENST00000320492.7_Silent_p.A590A|ELN_ENST00000458204.1_Silent_p.A661A|ELN_ENST00000357036.5_Silent_p.A676A|ELN_ENST00000380584.4_Silent_p.A623A|ELN_ENST00000380553.4_Silent_p.A535A|ELN_ENST00000414324.1_Silent_p.A647A|ELN_ENST00000380575.4_Silent_p.A642A|ELN_ENST00000380576.5_Silent_p.A652A|ELN_ENST00000429192.1_Silent_p.A657A|ELN_ENST00000320399.6_Silent_p.A704A|ELN_ENST00000445912.1_Silent_p.A671A	NM_000501.2|NM_001278915.1	NP_000492.2|NP_001265844.1	P15502	ELN_HUMAN	elastin	0	Ala-rich.				blood circulation (GO:0008015)|blood vessel remodeling (GO:0001974)|cell proliferation (GO:0008283)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|organ morphogenesis (GO:0009887)|regulation of actin filament polymerization (GO:0030833)|respiratory gaseous exchange (GO:0007585)|skeletal muscle tissue development (GO:0007519)|stress fiber assembly (GO:0043149)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(4)|pancreas(2)|prostate(1)|skin(2)|stomach(1)	32		Lung NSC(55;0.159)				CAGCTGCAGCCGCTAAAGCAG	0.562			T	PAX5	B-ALL		"""Supravalvular Aortic Stenosis, Cutis laxa , Williams-Beuren Syndrome"""																															uc003tzw.2		NA		Dom	yes		7	7q11.23	2006	T	elastin	yes	Supravalvular Aortic Stenosis|Cutis laxa |Williams-Beuren Syndrome	L	PAX5		B-ALL		0				ovary(3)|pancreas(2)	5						c.(2029-2031)GCC>GCT		elastin isoform a precursor	Rofecoxib(DB00533)						97.0	78.0	85.0					7																	73480043		2203	4300	6503	SO:0001819	synonymous_variant	2006				blood circulation|cell proliferation|organ morphogenesis|respiratory gaseous exchange	proteinaceous extracellular matrix	extracellular matrix constituent conferring elasticity|protein binding	g.chr7:73480043C>T		CCDS5562.2, CCDS43598.1, CCDS43599.1, CCDS47611.1, CCDS47612.1, CCDS64673.1, CCDS64674.1, CCDS64675.1, CCDS64676.1, CCDS64677.1, CCDS64678.1, CCDS75616.1, CCDS75617.1	7q11.1-q21.1	2008-08-01	2008-08-01		ENSG00000049540	ENSG00000049540			3327	protein-coding gene	gene with protein product	"""tropoelastin"", ""supravalvular aortic stenosis"", ""Williams-Beuren syndrome"""	130160				8096434	Standard	NM_001278939		Approved	WBS, WS, SVAS	uc003tzn.3	P15502	OTTHUMG00000150229	ENST00000252034.7:c.2013C>T	7.37:g.73480043C>T			Somatic				RFC2_uc011kfa.1_Intron|ELN_uc003tzn.2_Silent_p.A671A|ELN_uc003tzz.2_Silent_p.A590A|ELN_uc003tzo.2_Silent_p.A623A|ELN_uc003tzp.2_Silent_p.A582A|ELN_uc003tzq.2_Silent_p.A535A|ELN_uc003tzr.2_RNA|ELN_uc003tzs.2_Silent_p.A652A|ELN_uc003tzt.2_Silent_p.A676A|ELN_uc003tzu.2_Silent_p.A657A|ELN_uc003tzv.2_Silent_p.A642A|ELN_uc003tzx.2_Silent_p.A661A|ELN_uc011kff.1_Silent_p.A671A|ELN_uc003tzy.2_Silent_p.A647A	p.A677A	NM_000501	NP_001075224	WXS	Illumina HiSeq	Unspecified	P15502	ELN_HUMAN			30	2122	+		Lung NSC(55;0.159)	733			Ala-rich.		B3KTS6|O15336|O15337|Q14233|Q14234|Q14235|Q14238|Q6P0L4|Q6ZWJ6|Q75MU5|Q7Z316|Q7Z3F5|Q9UMF5	Silent	SNP	ENST00000252034.7	37	c.2031C>T	CCDS5562.2																																																																																				0.562	ELN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316913.1	NM_000501		15	24	0	0	0	0	15	24				
MAGI2	9863	broad.mit.edu	37	7	77885383	77885383	+	Missense_Mutation	SNP	C	C	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr7:77885383C>T	ENST00000354212.4	-	10	2177	c.1924G>A	c.(1924-1926)Gaa>Aaa	p.E642K	MAGI2_ENST00000535697.1_Missense_Mutation_p.E479K|MAGI2_ENST00000419488.1_Missense_Mutation_p.E642K|MAGI2_ENST00000522391.1_Missense_Mutation_p.E642K|MAGI2_ENST00000536571.1_Missense_Mutation_p.E474K	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	642	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				AGGTCGCCTTCACACAGGCCA	0.493																																						uc003ugx.2		NA																	0				ovary(5)|lung(4)|breast(1)|skin(1)	11						c.(1924-1926)GAA>AAA		membrane associated guanylate kinase, WW and PDZ							72.0	61.0	65.0					7																	77885383		2203	4300	6503	SO:0001583	missense	9863					cell junction|synapse|synaptosome	phosphatase binding	g.chr7:77885383C>T	AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.1924G>A	7.37:g.77885383C>T	ENSP00000346151:p.Glu642Lys		Somatic				MAGI2_uc003ugy.2_Missense_Mutation_p.E642K|MAGI2_uc010ldx.1_Missense_Mutation_p.E251K|MAGI2_uc010ldy.1_Missense_Mutation_p.E251K|MAGI2_uc011kgr.1_Missense_Mutation_p.E474K|MAGI2_uc011kgs.1_Missense_Mutation_p.E479K	p.E642K	NM_012301	NP_036433	WXS	Illumina HiSeq	Unspecified	Q86UL8	MAGI2_HUMAN			10	2178	-		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)	642			PDZ 3.		A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	ENST00000354212.4	37	c.1924G>A	CCDS5594.1	.	.	.	.	.	.	.	.	.	.	C	15.90	2.969542	0.53614	.	.	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391;ENST00000536571;ENST00000535697	T;T;T;T;T	0.29142	1.58;1.58;1.58;1.58;1.58	5.74	5.74	0.90152	PDZ/DHR/GLGF (4);	0.000000	0.37483	U	0.002063	T	0.49541	0.1563	L	0.45744	1.44	0.80722	D	1	B;B;D;D;B;D	0.76494	0.074;0.095;0.965;0.965;0.14;0.999	B;B;P;P;B;D	0.81914	0.063;0.09;0.696;0.696;0.111;0.995	T	0.16897	-1.0387	10	0.25751	T	0.34	.	18.9145	0.92499	0.0:1.0:0.0:0.0	.	479;474;642;642;642;642	F5GWH1;F5GWK7;B7Z4H4;E7EWI0;Q86UL8-2;Q86UL8	.;.;.;.;.;MAGI2_HUMAN	K	642;642;642;642;474;479	ENSP00000405766:E642K;ENSP00000346151:E642K;ENSP00000428389:E642K;ENSP00000441584:E474K;ENSP00000441603:E479K	ENSP00000346151:E642K	E	-	1	0	MAGI2	77723319	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.814000	0.86154	2.700000	0.92200	0.561000	0.74099	GAA		0.493	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	NM_012301		10	12	0	0	0	0	10	12				
PDK4	5166	broad.mit.edu	37	7	95224465	95224465	+	Missense_Mutation	SNP	C	C	A			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr7:95224465C>A	ENST00000005178.5	-	2	339	c.142G>T	c.(142-144)Gca>Tca	p.A48S	AC002451.3_ENST00000432265.1_RNA|AC002451.3_ENST00000416502.1_RNA	NM_002612.3	NP_002603.1	Q16654	PDK4_HUMAN	pyruvate dehydrogenase kinase, isozyme 4	48					cellular metabolic process (GO:0044237)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|negative regulation of anoikis (GO:2000811)|protein phosphorylation (GO:0006468)|pyruvate metabolic process (GO:0006090)|reactive oxygen species metabolic process (GO:0072593)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of bone resorption (GO:0045124)|regulation of cellular ketone metabolic process (GO:0010565)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of fatty acid oxidation (GO:0046320)|regulation of glucose metabolic process (GO:0010906)|regulation of pH (GO:0006885)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	15	all_cancers(62;1.06e-10)|all_epithelial(64;1.04e-09)|Lung NSC(181;0.128)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0151)			CTTTCACATGCATTTTCTGAA	0.318																																						uc003uoa.2		NA																	0					0						c.(142-144)GCA>TCA		pyruvate dehydrogenase kinase 4 precursor							62.0	63.0	63.0					7																	95224465		2203	4300	6503	SO:0001583	missense	5166				glucose metabolic process|peptidyl-histidine phosphorylation|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	ATP binding|pyruvate dehydrogenase (acetyl-transferring) kinase activity|two-component sensor activity	g.chr7:95224465C>A	U54617	CCDS5643.1	7q21.3-q22.1	2008-07-18	2005-11-16		ENSG00000004799	ENSG00000004799			8812	protein-coding gene	gene with protein product		602527	"""pyruvate dehydrogenase kinase, isoenzyme 4"""			7499431	Standard	NM_002612		Approved		uc003uoa.3	Q16654	OTTHUMG00000153977	ENST00000005178.5:c.142G>T	7.37:g.95224465C>A	ENSP00000005178:p.Ala48Ser		Somatic				PDK4_uc003unz.2_5'Flank	p.A48S	NM_002612	NP_002603	WXS	Illumina HiSeq	Unspecified	Q16654	PDK4_HUMAN	STAD - Stomach adenocarcinoma(171;0.0151)		2	462	-	all_cancers(62;1.06e-10)|all_epithelial(64;1.04e-09)|Lung NSC(181;0.128)|all_lung(186;0.151)		48						Missense_Mutation	SNP	ENST00000005178.5	37	c.142G>T	CCDS5643.1	.	.	.	.	.	.	.	.	.	.	C	18.11	3.549891	0.65311	.	.	ENSG00000004799	ENST00000005178;ENST00000542888	T	0.29655	1.56	5.3	5.3	0.74995	Branched-chain alpha-ketoacid dehydrogenase kinase/Pyruvate dehydrogenase kinase, N-terminal (3);	0.104898	0.64402	D	0.000005	T	0.50051	0.1593	M	0.83852	2.665	0.80722	D	1	B	0.27951	0.195	B	0.42692	0.395	T	0.46345	-0.9198	10	0.19147	T	0.46	.	19.3413	0.94342	0.0:1.0:0.0:0.0	.	48	Q16654	PDK4_HUMAN	S	48;12	ENSP00000005178:A48S	ENSP00000005178:A48S	A	-	1	0	PDK4	95062401	1.000000	0.71417	0.997000	0.53966	0.952000	0.60782	7.818000	0.86416	2.660000	0.90430	0.650000	0.86243	GCA		0.318	PDK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333298.1	NM_002612		10	25	1	0	0.000442599	0.000678458	10	25				
RELN	5649	broad.mit.edu	37	7	103179606	103179606	+	Missense_Mutation	SNP	T	T	C			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr7:103179606T>C	ENST00000428762.1	-	45	7258	c.7099A>G	c.(7099-7101)Agc>Ggc	p.S2367G	RELN_ENST00000343529.5_Missense_Mutation_p.S2367G|RELN_ENST00000424685.2_Missense_Mutation_p.S2367G	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2367					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		ACGTCTGTGCTGACCACGTAA	0.542																																					NSCLC(146;835 1944 15585 22231 52158)	uc003vca.2		NA																	0				ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19						c.(7099-7101)AGC>GGC		reelin isoform a							112.0	94.0	100.0					7																	103179606		2203	4300	6503	SO:0001583	missense	5649				axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity	g.chr7:103179606T>C		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.7099A>G	7.37:g.103179606T>C	ENSP00000392423:p.Ser2367Gly		Somatic				RELN_uc010liz.2_Missense_Mutation_p.S2367G	p.S2367G	NM_005045	NP_005036	WXS	Illumina HiSeq	Unspecified	P78509	RELN_HUMAN		COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)	45	7259	-			2367					A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	c.7099A>G	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	T	17.04	3.288167	0.59976	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.19806	2.12;2.12;2.12	5.35	5.35	0.76521	Neuraminidase (1);	0.171393	0.50627	D	0.000101	T	0.14098	0.0341	N	0.08118	0	0.29549	N	0.851461	B;B	0.21821	0.047;0.061	B;B	0.26094	0.061;0.066	T	0.13764	-1.0497	10	0.87932	D	0	.	15.3372	0.74266	0.0:0.0:0.0:1.0	.	2367;2367	P78509-2;P78509	.;RELN_HUMAN	G	2367	ENSP00000392423:S2367G;ENSP00000345694:S2367G;ENSP00000388446:S2367G	ENSP00000345694:S2367G	S	-	1	0	RELN	102966842	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.953000	0.70290	2.032000	0.59987	0.533000	0.62120	AGC		0.542	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045		3	45	0	0	0	0	3	45				
NRCAM	4897	broad.mit.edu	37	7	107880402	107880402	+	Splice_Site	SNP	C	C	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr7:107880402C>T	ENST00000425651.2	-	1	106		c.e1+1		NRCAM_ENST00000379028.3_Splice_Site|NRCAM_ENST00000413765.2_Splice_Site|NRCAM_ENST00000379024.4_Splice_Site|NRCAM_ENST00000379022.4_Splice_Site|NRCAM_ENST00000351718.4_Splice_Site	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule						angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						TTAATACTTACGATCAAGAGG	0.453																																						uc003vfb.2		NA																	0				ovary(3)|breast(2)	5						c.e4+1		neuronal cell adhesion molecule isoform A							92.0	89.0	90.0					7																	107880402		2203	4300	6503	SO:0001630	splice_region_variant	4897				angiogenesis|axon guidance|axonal fasciculation|cell-cell adhesion|central nervous system development|clustering of voltage-gated sodium channels|neuron migration|positive regulation of neuron differentiation|regulation of axon extension|synapse assembly	external side of plasma membrane|integral to plasma membrane	ankyrin binding	g.chr7:107880402C>T		CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.106+1G>A	7.37:g.107880402C>T			Somatic				NRCAM_uc003vfc.2_Splice_Site_p.L36_splice|NRCAM_uc011kmk.1_Splice_Site_p.P31_splice|NRCAM_uc003vfd.2_Splice_Site_p.P31_splice|NRCAM_uc003vfe.2_Splice_Site_p.P31_splice	p.P36_splice	NM_001037132	NP_001032209	WXS	Illumina HiSeq	Unspecified	Q92823	NRCAM_HUMAN			4	577	-								A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Splice_Site	SNP	ENST00000425651.2	37	c.106_splice	CCDS47686.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.543509	0.86022	.	.	ENSG00000091129	ENST00000379032;ENST00000379028;ENST00000413765;ENST00000537765;ENST00000351718;ENST00000379024;ENST00000425651;ENST00000379022;ENST00000445979;ENST00000417701;ENST00000442580;ENST00000419936;ENST00000456431;ENST00000418239	.	.	.	6.17	6.17	0.99709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NRCAM	107667638	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.020000	0.76419	2.941000	0.99782	0.655000	0.94253	.		0.453	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337942.2	NM_001037132	Intron	28	42	0	0	0	0	28	42				
LGI3	203190	broad.mit.edu	37	8	22009005	22009005	+	Missense_Mutation	SNP	G	G	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr8:22009005G>T	ENST00000306317.2	-	7	1115	c.826C>A	c.(826-828)Cca>Aca	p.P276T	LGI3_ENST00000424267.2_Missense_Mutation_p.P252T	NM_139278.2	NP_644807.1	Q8N145	LGI3_HUMAN	leucine-rich repeat LGI family, member 3	276					exocytosis (GO:0006887)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|extracellular region (GO:0005576)|neuron projection (GO:0043005)|synaptic vesicle (GO:0008021)	catalytic activity (GO:0003824)			endometrium(4)|large_intestine(3)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	17				Colorectal(74;0.00189)|COAD - Colon adenocarcinoma(73;0.0612)|READ - Rectum adenocarcinoma(644;0.0999)		CAGGTACCTGGGATTCTATCA	0.572																																						uc003xav.2		NA																	0				ovary(1)	1						c.(826-828)CCA>ACA		leucine-rich repeat LGI family, member 3							109.0	118.0	115.0					8																	22009005		2203	4300	6503	SO:0001583	missense	203190				exocytosis	cell junction|extracellular region|synaptic vesicle|synaptosome		g.chr8:22009005G>T	AJ487518	CCDS6025.1	8p21.2	2008-07-28			ENSG00000168481	ENSG00000168481			18711	protein-coding gene	gene with protein product		608302				12023020, 18628660	Standard	NM_139278		Approved		uc003xav.3	Q8N145	OTTHUMG00000131599	ENST00000306317.2:c.826C>A	8.37:g.22009005G>T	ENSP00000302297:p.Pro276Thr		Somatic				LGI3_uc010ltu.2_Missense_Mutation_p.P252T	p.P276T	NM_139278	NP_644807	WXS	Illumina HiSeq	Unspecified	Q8N145	LGI3_HUMAN		Colorectal(74;0.00189)|COAD - Colon adenocarcinoma(73;0.0612)|READ - Rectum adenocarcinoma(644;0.0999)	7	1115	-			276			EAR 2.		A5PLP2|Q86TL4|Q8N296	Missense_Mutation	SNP	ENST00000306317.2	37	c.826C>A	CCDS6025.1	.	.	.	.	.	.	.	.	.	.	G	3.934	-0.015581	0.07681	.	.	ENSG00000168481	ENST00000306317;ENST00000424267	D;D	0.83250	-1.7;-1.7	5.11	5.11	0.69529	.	0.129853	0.52532	D	0.000073	T	0.56790	0.2009	N	0.02181	-0.65	0.36289	D	0.856296	B;B	0.21071	0.008;0.051	B;B	0.19391	0.012;0.025	T	0.60737	-0.7204	10	0.02654	T	1	.	11.1817	0.48631	0.0:0.0:0.8164:0.1836	.	252;276	A5PLP2;Q8N145	.;LGI3_HUMAN	T	276;252	ENSP00000302297:P276T;ENSP00000399121:P252T	ENSP00000302297:P276T	P	-	1	0	LGI3	22064950	0.976000	0.34144	1.000000	0.80357	0.965000	0.64279	0.801000	0.27055	2.365000	0.80145	0.650000	0.86243	CCA		0.572	LGI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254482.1			5	96	1	0	2.01e-06	3.17e-06	5	96				
TRIM55	84675	broad.mit.edu	37	8	67039641	67039641	+	Silent	SNP	G	G	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr8:67039641G>T	ENST00000315962.4	+	1	511	c.138G>T	c.(136-138)ctG>ctT	p.L46L	TRIM55_ENST00000276573.7_Silent_p.L46L|TRIM55_ENST00000353317.5_Silent_p.L46L|TRIM55_ENST00000350034.4_Silent_p.L46L	NM_184085.1	NP_908973.1	Q9BYV6	TRI55_HUMAN	tripartite motif containing 55	46					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	39		Lung NSC(129;0.138)|all_lung(136;0.221)	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)			AGCACAACCTGTGTAGGAAAT	0.463																																						uc003xvv.2		NA																	0				skin(3)|ovary(1)|central_nervous_system(1)	5						c.(136-138)CTG>CTT		tripartite motif-containing 55 isoform 1							225.0	217.0	220.0					8																	67039641		2203	4300	6503	SO:0001819	synonymous_variant	84675					cytoplasm|microtubule|nucleus	signal transducer activity|zinc ion binding	g.chr8:67039641G>T	AJ291712	CCDS6184.1, CCDS6185.1, CCDS6186.1, CCDS6187.1	8q13.1	2013-01-09	2011-01-25	2004-11-17	ENSG00000147573	ENSG00000147573		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	14215	protein-coding gene	gene with protein product		606469	"""ring finger protein 29"", ""tripartite motif-containing 55"""	RNF29		11243782	Standard	NM_033058		Approved	MURF-2	uc003xvv.3	Q9BYV6	OTTHUMG00000164473	ENST00000315962.4:c.138G>T	8.37:g.67039641G>T			Somatic				TRIM55_uc003xvu.2_Silent_p.L46L|TRIM55_uc003xvw.2_Silent_p.L46L|TRIM55_uc003xvx.2_Silent_p.L46L	p.L46L	NM_184085	NP_908973	WXS	Illumina HiSeq	Unspecified	Q9BYV6	TRI55_HUMAN	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)		1	364	+		Lung NSC(129;0.138)|all_lung(136;0.221)	46			RING-type.		B3KRC0|B3KRJ3|Q53XX3|Q8IUD9|Q8IUE4|Q96DV2|Q96DV3|Q9BYV5	Silent	SNP	ENST00000315962.4	37	c.138G>T	CCDS6184.1																																																																																				0.463	TRIM55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378921.1	NM_184085		5	206	1	0	2.77e-08	4.48e-08	5	206				
CSMD3	114788	broad.mit.edu	37	8	113304927	113304927	+	Missense_Mutation	SNP	C	C	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr8:113304927C>T	ENST00000297405.5	-	55	8871	c.8627G>A	c.(8626-8628)gGt>gAt	p.G2876D	CSMD3_ENST00000352409.3_Missense_Mutation_p.G2806D|CSMD3_ENST00000455883.2_Missense_Mutation_p.G2707D|CSMD3_ENST00000343508.3_Missense_Mutation_p.G2836D	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2876	Sushi 19. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ACCAGGGTGACCACAGCTAAC	0.363										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												uc003ynu.2		NA																	0				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(8626-8628)GGT>GAT		CUB and Sushi multiple domains 3 isoform 1							93.0	80.0	85.0					8																	113304927		2203	4300	6503	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113304927C>T	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.8627G>A	8.37:g.113304927C>T	ENSP00000297405:p.Gly2876Asp	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003yns.2_Missense_Mutation_p.G2078D|CSMD3_uc003ynt.2_Missense_Mutation_p.G2836D|CSMD3_uc011lhx.1_Missense_Mutation_p.G2707D	p.G2876D	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			55	8786	-			2876			Extracellular (Potential).|Sushi 19.		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.8627G>A	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	31	5.063905	0.93898	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13;-0.13	5.76	5.76	0.90799	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	T	0.80639	0.4661	M	0.78344	2.41	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.988	D;D;D	0.97110	1.0;1.0;0.915	T	0.78555	-0.2159	10	0.39692	T	0.17	.	19.9664	0.97271	0.0:1.0:0.0:0.0	.	2707;2876;2836	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	D	2836;2876;2146;2707;2806	ENSP00000345799:G2836D;ENSP00000297405:G2876D;ENSP00000341558:G2146D;ENSP00000412263:G2707D;ENSP00000343124:G2806D	ENSP00000297405:G2876D	G	-	2	0	CSMD3	113374103	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.792000	0.85828	2.724000	0.93272	0.650000	0.86243	GGT		0.363	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		4	74	0	0	0	0	4	74				
TAF1L	138474	broad.mit.edu	37	9	32631631	32631631	+	Missense_Mutation	SNP	T	T	A			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr9:32631631T>A	ENST00000242310.4	-	1	4036	c.3947A>T	c.(3946-3948)gAa>gTa	p.E1316V	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	1316					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		CTCCTGCTCTTCTGTCATGGC	0.428																																						uc003zrg.1		NA																	0				lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26						c.(3946-3948)GAA>GTA		TBP-associated factor RNA polymerase 1-like							212.0	212.0	212.0					9																	32631631		2203	4300	6503	SO:0001583	missense	138474				male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding	g.chr9:32631631T>A	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.3947A>T	9.37:g.32631631T>A	ENSP00000418379:p.Glu1316Val		Somatic				uc003zrh.1_5'Flank	p.E1316V	NM_153809	NP_722516	WXS	Illumina HiSeq	Unspecified	Q8IZX4	TAF1L_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)	1	4037	-			1316					Q0VG57	Missense_Mutation	SNP	ENST00000242310.4	37	c.3947A>T	CCDS35003.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.258696	0.80246	.	.	ENSG00000122728	ENST00000242310	T	0.50001	0.76	1.56	1.56	0.23342	.	0.044921	0.85682	D	0.000000	T	0.52964	0.1767	L	0.52011	1.625	0.53688	D	0.999978	D	0.67145	0.996	P	0.61477	0.889	T	0.51810	-0.8658	10	0.87932	D	0	.	6.7809	0.23646	0.0:0.0:0.0:1.0	.	1316	Q8IZX4	TAF1L_HUMAN	V	1316	ENSP00000418379:E1316V	ENSP00000418379:E1316V	E	-	2	0	TAF1L	32621631	1.000000	0.71417	0.981000	0.43875	0.801000	0.45260	5.241000	0.65384	0.426000	0.26116	0.164000	0.16699	GAA		0.428	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2			119	39	0	0	0	0	119	39				
ZBTB6	10773	broad.mit.edu	37	9	125673155	125673155	+	Missense_Mutation	SNP	C	C	G			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr9:125673155C>G	ENST00000373659.3	-	2	1285	c.1197G>C	c.(1195-1197)aaG>aaC	p.K399N		NM_006626.5	NP_006617.1	Q15916	ZBTB6_HUMAN	zinc finger and BTB domain containing 6	399					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(1)|large_intestine(2)|lung(1)|skin(1)	11						AGGTTAAGTGCTTTTTGAGAG	0.413																																						uc004bnh.2		NA																	0					0						c.(1195-1197)AAG>AAC		zinc finger and BTB domain containing 6							98.0	89.0	92.0					9																	125673155		2203	4300	6503	SO:0001583	missense	10773				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr9:125673155C>G	X82018	CCDS6846.1	9q33.1-q33.3	2013-01-08	2006-04-10	2006-04-10	ENSG00000186130	ENSG00000186130		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16764	protein-coding gene	gene with protein product		605976	"""zinc finger protein 482"""	ZNF482		7958847	Standard	NM_006626		Approved	ZID	uc004bnh.4	Q15916	OTTHUMG00000020628	ENST00000373659.3:c.1197G>C	9.37:g.125673155C>G	ENSP00000362763:p.Lys399Asn		Somatic					p.K399N	NM_006626	NP_006617	WXS	Illumina HiSeq	Unspecified	Q15916	ZBTB6_HUMAN			2	1286	-			399			C2H2-type 4.		A8K8N6	Missense_Mutation	SNP	ENST00000373659.3	37	c.1197G>C	CCDS6846.1	.	.	.	.	.	.	.	.	.	.	C	15.06	2.720264	0.48728	.	.	ENSG00000186130	ENST00000373659	T	0.07567	3.18	5.61	1.31	0.21738	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.12646	0.0307	N	0.21508	0.67	0.46564	D	0.999106	D	0.89917	1.0	D	0.72982	0.979	T	0.04427	-1.0952	10	0.34782	T	0.22	.	9.0777	0.36531	0.0:0.6704:0.0:0.3296	.	399	Q15916	ZBTB6_HUMAN	N	399	ENSP00000362763:K399N	ENSP00000362763:K399N	K	-	3	2	ZBTB6	124712976	0.877000	0.30153	0.994000	0.49952	0.941000	0.58515	0.011000	0.13264	0.031000	0.15407	0.462000	0.41574	AAG		0.413	ZBTB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053962.1	NM_006626		4	37	0	0	0	0	4	37				
CACFD1	11094	broad.mit.edu	37	9	136333048	136333048	+	Missense_Mutation	SNP	C	C	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr9:136333048C>T	ENST00000316948.4	+	4	406	c.326C>T	c.(325-327)gCg>gTg	p.A109V	CACFD1_ENST00000542192.1_Missense_Mutation_p.A67V|CACFD1_ENST00000291722.7_Missense_Mutation_p.A67V|CACFD1_ENST00000540581.1_Missense_Mutation_p.A109V	NM_017586.3	NP_060056.1	Q9UGQ2	FLOWR_HUMAN	calcium channel flower domain containing 1	109					synaptic vesicle endocytosis (GO:0048488)	integral component of synaptic vesicle membrane (GO:0030285)	calcium channel activity (GO:0005262)	p.A109V(1)									CCCAGGATGGCGGTCGTTCCC	0.637																																						uc011mdg.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(325-327)GCG>GTG		hypothetical protein LOC11094 isoform a							70.0	61.0	64.0					9																	136333048		2203	4300	6503	SO:0001583	missense	11094					integral to membrane		g.chr9:136333048C>T		CCDS6974.1, CCDS48051.1, CCDS56591.1, CCDS56592.1	9q34	2012-03-06	2012-03-06	2012-03-06	ENSG00000160325	ENSG00000160325			1365	protein-coding gene	gene with protein product		613104	"""chromosome 9 open reading frame 7"""	C9orf7		19737521	Standard	NM_001242370		Approved	D9S2135, flower	uc011mdh.1	Q9UGQ2	OTTHUMG00000020875	ENST00000316948.4:c.326C>T	9.37:g.136333048C>T	ENSP00000317121:p.Ala109Val		Somatic				C9orf7_uc004cec.2_Missense_Mutation_p.A67V|C9orf7_uc011mdh.1_Missense_Mutation_p.A109V|C9orf7_uc011mdi.1_Missense_Mutation_p.A67V|C9orf7_uc010nan.2_RNA	p.A109V	NM_017586	NP_060056	WXS	Illumina HiSeq	Unspecified	Q9UGQ2	FLOWR_HUMAN		GBM - Glioblastoma multiforme(294;5.7e-39)|all cancers(34;1.83e-23)|OV - Ovarian serous cystadenocarcinoma(145;8.94e-08)|Epithelial(140;1.01e-06)	4	428	+			109			Helical; (Potential).		B7Z3T8|B7Z5E1|F5GXX4|Q5SXD4|Q8NBM6	Missense_Mutation	SNP	ENST00000316948.4	37	c.326C>T	CCDS6974.1	.	.	.	.	.	.	.	.	.	.	C	18.21	3.573124	0.65765	.	.	ENSG00000160325	ENST00000291722;ENST00000535514;ENST00000316948;ENST00000540581;ENST00000542192;ENST00000444798	T;T;T;T;T	0.58358	0.34;0.34;0.34;0.34;0.34	5.23	4.29	0.51040	Membrane protein, Golgi apparatus TVP18/Calcium channel flower (1);	0.000000	0.85682	D	0.000000	T	0.71837	0.3387	M	0.78637	2.42	0.58432	D	0.999998	D;D;D;D	0.89917	1.0;0.998;1.0;0.999	D;P;D;P	0.77004	0.985;0.901;0.989;0.903	T	0.75402	-0.3330	10	0.59425	D	0.04	-23.7602	14.8986	0.70661	0.0:0.8566:0.1434:0.0	.	67;109;109;67	B7Z5E1;F5GXX4;Q9UGQ2;Q9UGQ2-2	.;.;FLOWR_HUMAN;.	V	67;99;109;109;67;81	ENSP00000291722:A67V;ENSP00000317121:A109V;ENSP00000440832:A109V;ENSP00000444328:A67V;ENSP00000414495:A81V	ENSP00000291722:A67V	A	+	2	0	C9orf7	135322869	1.000000	0.71417	0.951000	0.38953	0.042000	0.13812	6.045000	0.71020	2.467000	0.83353	0.491000	0.48974	GCG		0.637	CACFD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054915.1	NM_017586		36	5	0	0	0	0	36	5				
NR0B1	190	broad.mit.edu	37	X	30326947	30326947	+	Silent	SNP	C	C	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chrX:30326947C>T	ENST00000378970.4	-	1	768	c.534G>A	c.(532-534)gcG>gcA	p.A178A	NR0B1_ENST00000378963.1_5'Flank|NR0B1_ENST00000453287.1_Silent_p.A178A	NM_000475.4	NP_000466.2	P51843	NR0B1_HUMAN	nuclear receptor subfamily 0, group B, member 1	178	4 X 67 AA tandem repeats.				adrenal gland development (GO:0030325)|gene expression (GO:0010467)|gonad development (GO:0008406)|hypothalamus development (GO:0021854)|intracellular receptor signaling pathway (GO:0030522)|Leydig cell differentiation (GO:0033327)|male gonad development (GO:0008584)|male sex determination (GO:0030238)|negative regulation of cell differentiation (GO:0045596)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pituitary gland development (GO:0021983)|protein localization (GO:0008104)|response to immobilization stress (GO:0035902)|Sertoli cell differentiation (GO:0060008)|spermatogenesis (GO:0007283)|steroid biosynthetic process (GO:0006694)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	AF-2 domain binding (GO:0050682)|DNA binding (GO:0003677)|DNA hairpin binding (GO:0032448)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|steroid hormone receptor binding (GO:0035258)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(13)|ovary(1)|skin(2)	24					Dexamethasone(DB01234)|Tretinoin(DB00755)	CTGGCCTCTGCGCGAAGTAGG	0.677											OREG0019719	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										uc004dcf.3		NA																	0				ovary(1)|lung(1)	2						c.(532-534)GCG>GCA		nuclear receptor subfamily 0, group B, member 1	Dexamethasone(DB01234)|Tretinoin(DB00755)						12.0	10.0	11.0					X																	30326947		2190	4280	6470	SO:0001819	synonymous_variant	190				adrenal gland development|hypothalamus development|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of steroid hormone receptor signaling pathway|pituitary gland development|protein localization|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|steroid biosynthetic process	cytoplasm|membrane fraction|nucleoplasm|nucleus|polysomal ribosome	AF-2 domain binding|DNA hairpin binding|ligand-regulated transcription factor activity|protein domain specific binding|protein homodimerization activity|RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|steroid hormone receptor binding|transcription corepressor activity|transcription factor binding	g.chrX:30326947C>T	S74720	CCDS14223.1	Xp21.3	2014-06-28			ENSG00000169297	ENSG00000169297		"""Nuclear hormone receptors"""	7960	protein-coding gene	gene with protein product		300473	"""dosage-sensitive sex reversal"""	AHC, DSS		1301166, 10412368	Standard	NM_000475		Approved	DAX1, AHCH	uc004dcf.4	P51843	OTTHUMG00000021323	ENST00000378970.4:c.534G>A	X.37:g.30326947C>T			Somatic	OREG0019719	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	816		p.A178A	NM_000475	NP_000466	WXS	Illumina HiSeq	Unspecified	P51843	NR0B1_HUMAN			1	549	-			178			4 X 67 AA tandem repeats.|3.		Q96F69	Silent	SNP	ENST00000378970.4	37	c.534G>A	CCDS14223.1																																																																																				0.677	NR0B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056161.1	NM_000475		11	9	0	0	0	0	11	9				
UBQLN2	29978	broad.mit.edu	37	X	56591210	56591210	+	Missense_Mutation	SNP	G	G	A			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chrX:56591210G>A	ENST00000338222.5	+	1	1185	c.904G>A	c.(904-906)Ggg>Agg	p.G302R		NM_013444.3	NP_038472.2	Q9UHD9	UBQL2_HUMAN	ubiquilin 2	302					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)	21						TTCCTCCTCTGGGGAAGGTAC	0.567																																					Esophageal Squamous(104;218 1492 6022 10838 28884)	uc004dus.2		NA																	0				ovary(1)|skin(1)	2						c.(904-906)GGG>AGG		ubiquilin 2							55.0	48.0	50.0					X																	56591210		2203	4300	6503	SO:0001583	missense	29978					cytoplasm|nucleus|plasma membrane	binding	g.chrX:56591210G>A	AF189009	CCDS14374.1	Xp11.21	2014-09-17			ENSG00000188021	ENSG00000188021		"""Ubiquilin family"""	12509	protein-coding gene	gene with protein product	"""NEDD4 binding protein 4"""	300264				10675567	Standard	NM_013444		Approved	Chap1, Dsk2, RIHFB2157, LIC-2, CHAP1/DSK2, PLIC-2, N4BP4, PLIC2	uc004dus.3	Q9UHD9	OTTHUMG00000021669	ENST00000338222.5:c.904G>A	X.37:g.56591210G>A	ENSP00000345195:p.Gly302Arg		Somatic				UBQLN2_uc011moq.1_Missense_Mutation_p.G302R	p.G302R	NM_013444	NP_038472	WXS	Illumina HiSeq	Unspecified	Q9UHD9	UBQL2_HUMAN			1	1139	+			302					O94798|Q5D027|Q9H3W6|Q9HAZ4	Missense_Mutation	SNP	ENST00000338222.5	37	c.904G>A	CCDS14374.1	.	.	.	.	.	.	.	.	.	.	G	17.63	3.438433	0.62955	.	.	ENSG00000188021	ENST00000338222;ENST00000535171	T	0.79653	-1.29	4.93	4.93	0.64822	.	0.174275	0.39615	N	0.001304	T	0.78604	0.4309	L	0.39898	1.24	0.48087	D	0.99958	P;D	0.54047	0.919;0.964	P;P	0.53912	0.649;0.737	T	0.75758	-0.3205	10	0.32370	T	0.25	-5.5337	8.3024	0.32023	0.1071:0.0:0.8929:0.0	.	302;302	B4DZF1;Q9UHD9	.;UBQL2_HUMAN	R	302	ENSP00000345195:G302R	ENSP00000345195:G302R	G	+	1	0	UBQLN2	56607935	1.000000	0.71417	0.890000	0.34922	0.933000	0.57130	6.070000	0.71220	2.440000	0.82611	0.600000	0.82982	GGG		0.567	UBQLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056891.1	NM_013444		22	25	0	0	0	0	22	25				
GPRASP1	9737	broad.mit.edu	37	X	101912582	101912582	+	Silent	SNP	T	T	C			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chrX:101912582T>C	ENST00000361600.5	+	5	4542	c.3741T>C	c.(3739-3741)taT>taC	p.Y1247Y	RP4-769N13.7_ENST00000602441.1_RNA|GPRASP1_ENST00000415986.1_Silent_p.Y1247Y|GPRASP1_ENST00000444152.1_Silent_p.Y1247Y|GPRASP1_ENST00000537097.1_Silent_p.Y1247Y	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	1247	OPRD1-binding.				endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)				NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						CCCTTGCTTATAGCGTGGATT	0.408																																						uc004ejj.3		NA																	0				ovary(1)|lung(1)	2						c.(3739-3741)TAT>TAC		G protein-coupled receptor associated sorting							98.0	86.0	90.0					X																	101912582		2203	4300	6503	SO:0001819	synonymous_variant	9737					cytoplasm	protein binding	g.chrX:101912582T>C	AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.3741T>C	X.37:g.101912582T>C			Somatic				GPRASP1_uc004eji.3_Silent_p.Y1247Y|GPRASP1_uc010nod.2_Silent_p.Y1247Y	p.Y1247Y	NM_014710	NP_055525	WXS	Illumina HiSeq	Unspecified	Q5JY77	GASP1_HUMAN			5	4542	+			1247			OPRD1-binding.		O43168|Q96LA1	Silent	SNP	ENST00000361600.5	37	c.3741T>C	CCDS35352.1																																																																																				0.408	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057634.2	NM_014710		27	61	0	0	0	0	27	61				
STK26	51765	broad.mit.edu	37	X	131197495	131197495	+	Missense_Mutation	SNP	G	G	A			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chrX:131197495G>A	ENST00000354719.6	+	4	524	c.308G>A	c.(307-309)gGc>gAc	p.G103D	MST4_ENST00000481105.1_Missense_Mutation_p.G125D|MST4_ENST00000496850.1_Missense_Mutation_p.G103D|MST4_ENST00000394334.2_Missense_Mutation_p.G103D|MST4_ENST00000394335.2_Missense_Mutation_p.G26D																endometrium(2)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(192;0.000127)					GAATACCTGGGCGGTGGTTCA	0.318																																						uc004ewk.1		NA																	0				ovary(3)|lung(3)|stomach(2)|upper_aerodigestive_tract(1)	9						c.(307-309)GGC>GAC		serine/threonine protein kinase MST4 isoform 1							106.0	105.0	105.0					X																	131197495		2203	4300	6503	SO:0001583	missense	51765				cellular component disassembly involved in apoptosis|regulation of apoptosis	cytosol|Golgi membrane	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity	g.chrX:131197495G>A																												ENST00000354719.6:c.308G>A	X.37:g.131197495G>A	ENSP00000346755:p.Gly103Asp		Somatic				MST4_uc004ewl.1_Missense_Mutation_p.G26D|MST4_uc011mux.1_Missense_Mutation_p.G125D|MST4_uc010nrj.1_Missense_Mutation_p.G103D|MST4_uc004ewm.1_Missense_Mutation_p.G103D	p.G103D	NM_016542	NP_057626	WXS	Illumina HiSeq	Unspecified	Q9P289	MST4_HUMAN			4	609	+	Acute lymphoblastic leukemia(192;0.000127)		103			Protein kinase.			Missense_Mutation	SNP	ENST00000354719.6	37	c.308G>A		.	.	.	.	.	.	.	.	.	.	G	28.5	4.922068	0.92319	.	.	ENSG00000134602	ENST00000394334;ENST00000481105;ENST00000354719;ENST00000394335;ENST00000496850	T;T;T;T;T	0.22945	1.93;1.93;1.93;1.93;1.93	4.96	4.96	0.65561	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.218971	0.32244	N	0.006375	T	0.26882	0.0658	N	0.01779	-0.725	0.80722	D	1	P;P;B;D;D	0.89917	0.6;0.791;0.414;1.0;0.987	B;B;B;D;P	0.75020	0.394;0.345;0.233;0.985;0.884	T	0.57213	-0.7850	10	0.87932	D	0	.	17.585	0.87979	0.0:0.0:1.0:0.0	.	125;103;103;26;103	B4E0Y9;Q8NBY1;Q9P289-3;Q9P289-2;Q9P289	.;.;.;.;MST4_HUMAN	D	103;125;103;26;103	ENSP00000377867:G103D;ENSP00000418753:G125D;ENSP00000346755:G103D;ENSP00000377868:G26D;ENSP00000419702:G103D	ENSP00000346755:G103D	G	+	2	0	AL109749.1	131025176	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	9.794000	0.99096	2.169000	0.68431	0.544000	0.68410	GGC		0.318	MST4-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000058308.2			30	64	0	0	0	0	30	64				
FAM58A	92002	broad.mit.edu	37	X	152860037	152860037	+	Missense_Mutation	SNP	G	G	T			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chrX:152860037G>T	ENST00000406277.2	-	5	493	c.391C>A	c.(391-393)Cgc>Agc	p.R131S	FAM58A_ENST00000370175.4_5'UTR	NM_001130997.1|NM_152274.3	NP_001124469.1|NP_689487.2	Q8N1B3	FA58A_HUMAN	family with sequence similarity 58, member A	133					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)					endometrium(2)|kidney(1)|large_intestine(1)|liver(1)|lung(1)	6	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ACCTGGAAGCGCAGAACTCTC	0.537																																						uc010nug.2		NA																	0					0						c.(211-213)CGC>AGC		RecName: Full=Cyclin-related protein FAM58B;							96.0	84.0	88.0					X																	152860037		2203	4300	6503	SO:0001583	missense	92002				regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent		protein kinase binding	g.chrX:152860037G>T	BC032121	CCDS76054.1	Xq28	2014-08-12	2012-11-30	2012-11-30	ENSG00000147382	ENSG00000262919			28434	protein-coding gene	gene with protein product	"""cyclin M"""	300708				18297069, 24218572	Standard	NM_152274		Approved	MGC29729, FLJ21610	uc011myr.2	Q8N1B3	OTTHUMG00000024206	ENST00000406277.2:c.391C>A	X.37:g.152860037G>T	ENSP00000384396:p.Arg131Ser		Somatic					p.R71S			WXS	Illumina HiSeq	Unspecified	Q8N1B3	FA58A_HUMAN			2	314	-	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		133					Q2I380|Q330J9|Q96IU5|Q9BUU1	Missense_Mutation	SNP	ENST00000406277.2	37	c.211C>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.94|12.94	2.089778|2.089778	0.36855|0.36855	.|.	.|.	ENSG00000147382|ENSG00000147382	ENST00000429336;ENST00000440428|ENST00000370175;ENST00000406277;ENST00000370171;ENST00000276345;ENST00000370173	.|T	.|0.39997	.|1.05	4.81|4.81	4.81|4.81	0.61882|0.61882	.|Cyclin, N-terminal (1);Cyclin-like (2);	.|0.504196	.|0.22241	.|N	.|0.062697	T|T	0.33962|0.33962	0.0881|0.0881	L|L	0.48362|0.48362	1.52|1.52	0.30108|0.30108	N|N	0.806801|0.806801	.|B;B;B	.|0.34214	.|0.387;0.308;0.442	.|B;B;B	.|0.35727	.|0.198;0.209;0.209	T|T	0.38499|0.38499	-0.9658|-0.9658	5|10	.|0.45353	.|T	.|0.12	-24.884|-24.884	5.7984|5.7984	0.18399|0.18399	0.1019:0.0:0.7037:0.1944|0.1019:0.0:0.7037:0.1944	.|.	.|133;133;131	.|Q8N1B3-2;Q8N1B3;B5MD73	.|.;FA58A_HUMAN;.	E|S	54;35|99;131;99;131;131	.|ENSP00000384396:R131S	.|ENSP00000276345:R131S	A|R	-|-	2|1	0|0	FAM58A|FAM58A	152513231|152513231	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.996000|0.996000	0.88848|0.88848	1.457000|1.457000	0.35212|0.35212	2.108000|2.108000	0.64289|0.64289	0.529000|0.529000	0.55759|0.55759	GCG|CGC		0.537	FAM58A-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_152274		8	98	1	0	5.18e-06	8.13e-06	8	98				
SSR4	6748	broad.mit.edu	37	X	153063240	153063240	+	Missense_Mutation	SNP	G	G	A			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chrX:153063240G>A	ENST00000320857.3	+	5	1406	c.322G>A	c.(322-324)Gac>Aac	p.D108N	SSR4_ENST00000370086.3_Missense_Mutation_p.D108N|SSR4_ENST00000370085.3_Missense_Mutation_p.D83N|SSR4_ENST00000460616.1_3'UTR|SSR4_ENST00000370087.1_Missense_Mutation_p.D108N	NM_001204526.1	NP_001191455.1	P51571	SSRD_HUMAN	signal sequence receptor, delta	108					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|Sec61 translocon complex (GO:0005784)				central_nervous_system(1)|endometrium(1)|lung(2)	4	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					TAGATTCTTCGACGAGGAGTC	0.617																																						uc004fiw.2		NA																	0					0						c.(322-324)GAC>AAC		signal sequence receptor, delta precursor							36.0	29.0	32.0					X																	153063240		2203	4299	6502	SO:0001583	missense	6748				intracellular protein transport	integral to membrane|Sec61 translocon complex	calcium ion binding|protein binding	g.chrX:153063240G>A	BC032351	CCDS14731.1	Xq28	2011-08-31	2011-08-31		ENSG00000180879	ENSG00000180879			11326	protein-coding gene	gene with protein product	"""translocon-associated protein delta"""	300090				9286695	Standard	NM_001204526		Approved	TRAPD	uc022chw.1	P51571	OTTHUMG00000024212	ENST00000320857.3:c.322G>A	X.37:g.153063240G>A	ENSP00000317331:p.Asp108Asn		Somatic				SSR4_uc004fiv.2_Missense_Mutation_p.D119N	p.D108N	NM_006280	NP_006271	WXS	Illumina HiSeq	Unspecified	P51571	SSRD_HUMAN			4	371	+	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)		108			Lumenal (Potential).		A8K378|Q53XY1	Missense_Mutation	SNP	ENST00000320857.3	37	c.322G>A	CCDS14731.1	.	.	.	.	.	.	.	.	.	.	G	18.54	3.646228	0.67358	.	.	ENSG00000180879	ENST00000320857;ENST00000370087;ENST00000370086;ENST00000370085	T;T;T;T	0.58506	0.33;0.33;0.33;0.33	5.5	4.62	0.57501	.	0.045887	0.85682	D	0.000000	T	0.75946	0.3919	M	0.80847	2.515	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.77653	-0.2507	10	0.51188	T	0.08	-16.7011	13.4831	0.61348	0.0:0.0:0.8421:0.1579	.	108;83	P51571;A6NLM8	SSRD_HUMAN;.	N	108;108;108;83	ENSP00000317331:D108N;ENSP00000359104:D108N;ENSP00000359103:D108N;ENSP00000359102:D83N	ENSP00000317331:D108N	D	+	1	0	SSR4	152716434	1.000000	0.71417	0.080000	0.20451	0.531000	0.34715	8.925000	0.92832	1.050000	0.40346	0.529000	0.55759	GAC		0.617	SSR4-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061029.1	NM_006280		6	15	0	0	0	0	6	15				
TMPRSS3	64699	broad.mit.edu	37	21	43795867	43795873	+	Frame_Shift_Del	DEL	GGTGTAC	GGTGTAC	-	rs374775170		TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr21:43795867_43795873delGGTGTAC	ENST00000291532.3	-	12	2254_2260	c.1299_1305delGTACACC	c.(1297-1305)gtgtacaccfs	p.VYT433fs	TMPRSS3_ENST00000433957.2_Frame_Shift_Del_p.VYT432fs|TMPRSS3_ENST00000398405.1_Frame_Shift_Del_p.VYT430fs|TMPRSS3_ENST00000474596.1_5'UTR|TMPRSS3_ENST00000380399.1_Frame_Shift_Del_p.VYT517fs	NM_032404.2	NP_115780.1	P57727	TMPS3_HUMAN	transmembrane protease, serine 3	433	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cellular sodium ion homeostasis (GO:0006883)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(4)|skin(1)	13						AGGTGACACGGGTGTACACCCCAGGCT	0.628																																						uc002zbb.2		NA																	0				ovary(2)|breast(1)	3						c.(1297-1305)GTGTACACCfs		transmembrane protease, serine 3 isoform 1																																				SO:0001589	frameshift_variant	64699				cellular sodium ion homeostasis|proteolysis	endoplasmic reticulum membrane|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity|sodium channel regulator activity	g.chr21:43795867_43795873delGGTGTAC	AF201380	CCDS13686.1, CCDS42939.1, CCDS58790.1	21q22.3	2010-04-13			ENSG00000160183	ENSG00000160183		"""Serine peptidases / Transmembrane"""	11877	protein-coding gene	gene with protein product		605511		DFNB10, DFNB8		11462234, 11907649	Standard	NM_032405		Approved		uc002zbc.3	P57727	OTTHUMG00000086796	ENST00000291532.3:c.1299_1305delGTACACC	21.37:g.43795867_43795873delGGTGTAC	ENSP00000291532:p.Val433fs		Somatic				TMPRSS3_uc002zay.2_Frame_Shift_Del_p.V190fs|TMPRSS3_uc002zaz.2_Frame_Shift_Del_p.V306fs|TMPRSS3_uc002zba.2_Frame_Shift_Del_p.V306fs|TMPRSS3_uc002zbc.2_Frame_Shift_Del_p.V432fs	p.V433fs	NM_024022	NP_076927	WXS	Illumina HiSeq	Unspecified	P57727	TMPS3_HUMAN			12	1500_1506	-			433_435			Peptidase S1.|Extracellular (Potential).		D3DSJ6|Q5USC7|Q6ZMC3	Frame_Shift_Del	DEL	ENST00000291532.3	37	c.1299_1305delGTACACC	CCDS13686.1																																																																																				0.628	TMPRSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000195347.1			40	69	NA	NA	NA	NA	40	69	---	---	---	---
IMPDH2	3615	broad.mit.edu	37	3	49063994	49063999	+	In_Frame_Del	DEL	TGTACT	TGTACT	-			TCGA-CQ-6228-01A-11D-1912-08	TCGA-CQ-6228-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	655e502b-1a6e-4eab-a948-4120d6c31c29	4ce6601d-842c-4551-8a3e-a8892f66e1ed	g.chr3:49063994_49063999delTGTACT	ENST00000326739.4	-	8	902_907	c.863_868delAGTACA	c.(862-870)aagtacatc>atc	p.KY288del	RP13-131K19.6_ENST00000607245.1_RNA	NM_000884.2	NP_000875.2			IMP (inosine 5'-monophosphate) dehydrogenase 2											breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(2)|stomach(1)|urinary_tract(1)	16				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		TTGTCTTTGATGTACTTGATCATATT	0.485																																						uc003cvt.2		NA																	0				lung(1)	1						c.(862-870)AAGTACATC>ATC		inosine monophosphate dehydrogenase 2	Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|NADH(DB00157)																																			SO:0001651	inframe_deletion	3615				GMP biosynthetic process|purine base metabolic process	cytosol|nucleus	IMP dehydrogenase activity|metal ion binding|nucleotide binding|protein binding	g.chr3:49063994_49063999delTGTACT		CCDS2786.1	3p21.2	2014-05-15	2010-04-29		ENSG00000178035	ENSG00000178035	1.1.1.205		6053	protein-coding gene	gene with protein product		146691				9858805, 1969416	Standard	XM_006713128		Approved		uc003cvt.3	P12268	OTTHUMG00000156771	ENST00000326739.4:c.863_868delAGTACA	3.37:g.49063994_49063999delTGTACT	ENSP00000321584:p.Lys288_Tyr289del		Somatic					p.KY288del	NM_000884	NP_000875	WXS	Illumina HiSeq	Unspecified	P12268	IMDH2_HUMAN		BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)	8	955_960	-			288_289						In_Frame_Del	DEL	ENST00000326739.4	37	c.863_868delAGTACA	CCDS2786.1																																																																																				0.485	IMPDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345657.1			7	2	NA	NA	NA	NA	7	2	---	---	---	---
