#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
IL22RA1	58985	broad.mit.edu	37	1	24465129	24465129	+	Missense_Mutation	SNP	G	G	A	rs201599737		TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr1:24465129G>A	ENST00000270800.1	-	2	157	c.119C>T	c.(118-120)aCg>aTg	p.T40M		NM_021258.3	NP_067081.2	Q8N6P7	I22R1_HUMAN	interleukin 22 receptor, alpha 1	40	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)	integral component of membrane (GO:0016021)	interferon receptor activity (GO:0004904)			breast(2)|endometrium(2)|large_intestine(4)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	19		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000992)|all_lung(284;0.00138)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-24)|Colorectal(126;6.43e-08)|COAD - Colon adenocarcinoma(152;3.51e-06)|GBM - Glioblastoma multiforme(114;5.06e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00911)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.148)		GCTGTCCCACGTCAGGATGTT	0.582																																						uc001biq.1		NA																	0				skin(1)	1						c.(118-120)ACG>ATG		interleukin 22 receptor, alpha 1 precursor							89.0	85.0	86.0					1																	24465129		2203	4300	6503	SO:0001583	missense	58985					integral to membrane	interferon receptor activity	g.chr1:24465129G>A	AF286095	CCDS247.1	1p36.11	2009-10-06	2002-12-02	2002-12-06	ENSG00000142677	ENSG00000142677		"""Interleukins and interleukin receptors"""	13700	protein-coding gene	gene with protein product		605457	"""interleukin 22 receptor"""	IL22R		10875937	Standard	NM_021258		Approved	CRF2-9	uc001biq.2	Q8N6P7	OTTHUMG00000003041	ENST00000270800.1:c.119C>T	1.37:g.24465129G>A	ENSP00000270800:p.Thr40Met		Somatic				IL22RA1_uc010oeg.1_5'Flank|IL22RA1_uc009vrb.1_Translation_Start_Site|IL22RA1_uc010oeh.1_Missense_Mutation_p.T40M	p.T40M	NM_021258	NP_067081	WXS	Illumina HiSeq	Unspecified	Q8N6P7	I22R1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-24)|Colorectal(126;6.43e-08)|COAD - Colon adenocarcinoma(152;3.51e-06)|GBM - Glioblastoma multiforme(114;5.06e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00911)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.148)	2	158	-		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000992)|all_lung(284;0.00138)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)	40			Extracellular (Potential).|Fibronectin type-III 1.		A8K839|B2R9Y9|Q9HB22	Missense_Mutation	SNP	ENST00000270800.1	37	c.119C>T	CCDS247.1	.	.	.	.	.	.	.	.	.	.	G	17.97	3.517842	0.64634	.	.	ENSG00000142677	ENST00000270800	T	0.74209	-0.82	4.96	2.88	0.33553	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.515159	0.20841	N	0.084719	T	0.79839	0.4515	M	0.75777	2.31	0.35197	D	0.773949	D	0.89917	1.0	D	0.64410	0.925	T	0.80708	-0.1262	10	0.33141	T	0.24	-21.6501	4.7564	0.13086	0.1122:0.0:0.6574:0.2304	.	40	Q8N6P7	I22R1_HUMAN	M	40	ENSP00000270800:T40M	ENSP00000270800:T40M	T	-	2	0	IL22RA1	24337716	0.284000	0.24287	1.000000	0.80357	0.955000	0.61496	0.352000	0.20113	2.292000	0.77174	0.585000	0.79938	ACG		0.582	IL22RA1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008412.1			14	84	0	0	0	0	14	84				
AGO3	192669	broad.mit.edu	37	1	36474311	36474311	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr1:36474311C>G	ENST00000373191.4	+	7	1163	c.814C>G	c.(814-816)Cat>Gat	p.H272D	AGO3_ENST00000246314.6_Missense_Mutation_p.H38D|RP4-665N4.8_ENST00000479395.2_RNA|RP4-665N4.8_ENST00000466576.2_RNA	NM_024852.3	NP_079128.2	Q9H9G7	AGO3_HUMAN	argonaute RISC catalytic component 3	272	PAZ. {ECO:0000255|HAMAP-Rule:MF_03032}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of stem cell proliferation (GO:0072091)	cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)										TGAAGTGACTCATTGTGGAAC	0.393																																						uc001bzp.2		NA																	0					0						c.(814-816)CAT>GAT		eukaryotic translation initiation factor 2C, 3							72.0	75.0	74.0					1																	36474311		2203	4300	6503	SO:0001583	missense	192669				mRNA catabolic process|negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|cytosol	protein binding|RNA binding	g.chr1:36474311C>G	AB046787	CCDS399.1, CCDS400.1	1p34	2013-06-03	2013-02-15	2013-02-15	ENSG00000126070	ENSG00000126070		"""Argonaute/PIWI family"""	18421	protein-coding gene	gene with protein product	"""argonaute 3"""	607355	"""eukaryotic translation initiation factor 2C, 3"""	EIF2C3		12906857	Standard	NM_024852		Approved	hAGO3, FLJ12765	uc001bzp.3	Q9H9G7	OTTHUMG00000184172	ENST00000373191.4:c.814C>G	1.37:g.36474311C>G	ENSP00000362287:p.His272Asp		Somatic				EIF2C3_uc001bzq.2_Missense_Mutation_p.H38D	p.H272D	NM_024852	NP_079128	WXS	Illumina HiSeq	Unspecified	Q9H9G7	AGO3_HUMAN			7	1070	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)	272			PAZ.		B1ALI0|Q5TA55|Q9H1U6	Missense_Mutation	SNP	ENST00000373191.4	37	c.814C>G	CCDS399.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.840556	0.91197	.	.	ENSG00000126070	ENST00000373191;ENST00000246314	T;T	0.19938	2.11;2.11	5.44	5.44	0.79542	Argonaute/Dicer protein, PAZ (4);	0.000000	0.85682	D	0.000000	T	0.59932	0.2230	M	0.91972	3.26	0.80722	D	1	P	0.39883	0.693	D	0.65684	0.937	T	0.64537	-0.6384	10	0.87932	D	0	-40.0094	19.6436	0.95767	0.0:1.0:0.0:0.0	.	272	Q9H9G7	AGO3_HUMAN	D	272;38	ENSP00000362287:H272D;ENSP00000246314:H38D	ENSP00000246314:H38D	H	+	1	0	EIF2C3	36246898	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.712000	0.92718	0.650000	0.86243	CAT		0.393	AGO3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019831.4	NM_024852		39	100	0	0	0	0	39	100				
LRRC41	10489	broad.mit.edu	37	1	46745880	46745880	+	Silent	SNP	C	C	T			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr1:46745880C>T	ENST00000343304.6	-	7	2289	c.2004G>A	c.(2002-2004)caG>caA	p.Q668Q	LRRC41_ENST00000472710.1_5'UTR	NM_006369.4	NP_006360.3	Q15345	LRC41_HUMAN	leucine rich repeat containing 41	668					protein ubiquitination (GO:0016567)	membrane (GO:0016020)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					GAGTCAGATTCTGTAGCAAAA	0.468																																						uc001cpn.2		NA																	0				ovary(2)|breast(1)|pancreas(1)	4						c.(2002-2004)CAG>CAA		MUF1 protein							105.0	100.0	102.0					1																	46745880		2203	4300	6503	SO:0001819	synonymous_variant	10489							g.chr1:46745880C>T	AK024051	CCDS533.1	1p34.1	2008-02-05			ENSG00000132128	ENSG00000132128			16917	protein-coding gene	gene with protein product						11384984	Standard	XM_005270376		Approved	MUF1	uc001cpn.3	Q15345	OTTHUMG00000007810	ENST00000343304.6:c.2004G>A	1.37:g.46745880C>T			Somatic				LRRC41_uc010omb.1_Silent_p.Q668Q	p.Q668Q	NM_006369	NP_006360	WXS	Illumina HiSeq	Unspecified	Q15345	LRC41_HUMAN			7	2048	-	Acute lymphoblastic leukemia(166;0.155)		668					A8K5G8|Q3MJ96|Q5TDF5|Q71RA8|Q9BSM0	Silent	SNP	ENST00000343304.6	37	c.2004G>A	CCDS533.1																																																																																				0.468	LRRC41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021438.1	NM_006369		25	67	0	0	0	0	25	67				
HFM1	164045	broad.mit.edu	37	1	91727872	91727872	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr1:91727872G>T	ENST00000370425.3	-	38	4262	c.4164C>A	c.(4162-4164)aaC>aaA	p.N1388K	HFM1_ENST00000370424.3_Missense_Mutation_p.N1067K|Y_RNA_ENST00000384090.1_RNA|HFM1_ENST00000294696.5_3'UTR|HFM1_ENST00000462405.1_5'UTR	NM_001017975.3	NP_001017975.3	A2PYH4	HFM1_HUMAN	HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)	1388					resolution of meiotic recombination intermediates (GO:0000712)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(33)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	75		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		AAGAATTTGGGTTTTTTTCAG	0.284																																						uc001doa.3		NA																	0					0						c.(4162-4164)AAC>AAA		HFM1 protein							55.0	55.0	55.0					1																	91727872		1907	4133	6040	SO:0001583	missense	164045						ATP binding|ATP-dependent helicase activity|nucleic acid binding	g.chr1:91727872G>T	AB204867	CCDS30769.2	1p22.2	2008-03-26			ENSG00000162669	ENSG00000162669			20193	protein-coding gene	gene with protein product		615684	"""SEC63 domain containing 1"""	SEC63D1		14702039, 17286053	Standard	XM_006710395		Approved	MER3, FLJ39011, FLJ36760	uc001doa.4	A2PYH4	OTTHUMG00000010093	ENST00000370425.3:c.4164C>A	1.37:g.91727872G>T	ENSP00000359454:p.Asn1388Lys		Somatic				HFM1_uc009wdb.2_RNA|HFM1_uc010osu.1_Missense_Mutation_p.N1067K|HFM1_uc001dob.3_Missense_Mutation_p.N576K	p.N1388K	NM_001017975	NP_001017975	WXS	Illumina HiSeq	Unspecified	A2PYH4	HFM1_HUMAN		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)	38	4264	-		all_lung(203;0.00961)|Lung NSC(277;0.0351)	1388					B1B0B6|Q8N9Q0	Missense_Mutation	SNP	ENST00000370425.3	37	c.4164C>A	CCDS30769.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.001|0.001	-2.943927|-2.943927	0.00052|0.00052	.|.	.|.	ENSG00000162669|ENSG00000162669	ENST00000370425;ENST00000370424|ENST00000430465	T;T|.	0.62498|.	0.4;0.02|.	4.85|4.85	1.05|1.05	0.20165|0.20165	.|.	3.247920|.	0.00772|.	N|.	0.001206|.	T|T	0.05318|0.05318	0.0141|0.0141	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.01281|.	0.0;0.0|.	T|T	0.41645|0.41645	-0.9497|-0.9497	10|5	0.06099|.	T|.	0.92|.	.|.	5.7508|5.7508	0.18146|0.18146	0.2841:0.0:0.1537:0.5622|0.2841:0.0:0.1537:0.5622	.|.	599;1388|.	B1B0B5;A2PYH4|.	.;HFM1_HUMAN|.	K|N	1388;1067|600	ENSP00000359454:N1388K;ENSP00000359453:N1067K|.	ENSP00000359453:N1067K|.	N|T	-|-	3|2	2|0	HFM1|HFM1	91500460|91500460	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	0.249000|0.249000	0.18216|0.18216	0.061000|0.061000	0.16311|0.16311	-0.375000|-0.375000	0.07067|0.07067	AAC|ACC		0.284	HFM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316716.2	NM_001017975		50	83	1	0	4e-15	4.58e-15	50	83				
CSDE1	7812	broad.mit.edu	37	1	115261328	115261328	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr1:115261328C>T	ENST00000358528.4	-	19	2681	c.2255G>A	c.(2254-2256)cGg>cAg	p.R752Q	CSDE1_ENST00000339438.6_Missense_Mutation_p.R721Q|CSDE1_ENST00000530886.1_Missense_Mutation_p.R622Q|NRAS_ENST00000369535.4_5'Flank|CSDE1_ENST00000369530.1_Missense_Mutation_p.R767Q|CSDE1_ENST00000534699.1_Missense_Mutation_p.R752Q|CSDE1_ENST00000438362.2_Missense_Mutation_p.R798Q|CSDE1_ENST00000261443.5_Missense_Mutation_p.R721Q|CSDE1_ENST00000483407.1_5'UTR	NM_001007553.2	NP_001007554.1	O75534	CSDE1_HUMAN	cold shock domain containing E1, RNA-binding	752					male gonad development (GO:0008584)|nuclear-transcribed mRNA catabolic process, no-go decay (GO:0070966)|regulation of transcription, DNA-templated (GO:0006355)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|endometrium(11)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	51	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;2.21e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATTGACCAACCGATCAGGTCG	0.498																																						uc001efk.2		NA																	0				ovary(1)	1						c.(2254-2256)CGG>CAG		upstream of NRAS isoform 1							75.0	66.0	69.0					1																	115261328		2203	4300	6503	SO:0001583	missense	7812				male gonad development|regulation of transcription, DNA-dependent	cytoplasm	DNA binding|protein binding|RNA binding	g.chr1:115261328C>T		CCDS30811.1, CCDS30812.1, CCDS44197.1, CCDS55626.1	1p13.2	2011-11-02			ENSG00000009307	ENSG00000009307			29905	protein-coding gene	gene with protein product	"""upstream of NRAS"""	191510				2204029, 10048485	Standard	NM_007158		Approved	D1S155E, UNR	uc001efi.3	O75534	OTTHUMG00000012060	ENST00000358528.4:c.2255G>A	1.37:g.115261328C>T	ENSP00000351329:p.Arg752Gln		Somatic				NRAS_uc009wgu.2_5'Flank|CSDE1_uc001efi.2_Missense_Mutation_p.R798Q|CSDE1_uc001efj.2_RNA|CSDE1_uc001efl.2_Missense_Mutation_p.R721Q|CSDE1_uc001efm.2_Missense_Mutation_p.R767Q|CSDE1_uc009wgv.2_Missense_Mutation_p.R752Q|CSDE1_uc001efn.2_Missense_Mutation_p.R721Q	p.R752Q	NM_001007553	NP_001007554	WXS	Illumina HiSeq	Unspecified	O75534	CSDE1_HUMAN		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	19	2721	-	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;2.21e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)	752					A8K281|E9PGZ0|G5E9Q2|O94961|Q5TF04|Q5TF05|Q68DF1|Q68DI9|Q9Y2S4	Missense_Mutation	SNP	ENST00000358528.4	37	c.2255G>A	CCDS30812.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.089597	0.76756	.	.	ENSG00000009307	ENST00000339438;ENST00000438362;ENST00000358528;ENST00000261443;ENST00000530886;ENST00000369530;ENST00000534699	.	.	.	5.95	5.04	0.67666	.	0.046800	0.85682	D	0.000000	T	0.42720	0.1215	M	0.71036	2.16	0.58432	D	0.999992	P;B;B	0.44044	0.825;0.034;0.057	B;B;B	0.34418	0.182;0.002;0.004	T	0.56402	-0.7985	9	0.72032	D	0.01	-3.2159	15.3601	0.74464	0.0:0.9332:0.0:0.0668	.	767;752;798	E9PGZ0;O75534;G5E9Q2	.;CSDE1_HUMAN;.	Q	721;798;752;721;622;767;752	.	ENSP00000261443:R721Q	R	-	2	0	CSDE1	115062851	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.433000	0.80362	1.526000	0.49068	0.655000	0.94253	CGG		0.498	CSDE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033397.1	NM_007158		3	71	0	0	0	0	3	71				
TMEM79	84283	broad.mit.edu	37	1	156255560	156255560	+	Silent	SNP	G	G	A	rs140033065	byFrequency	TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr1:156255560G>A	ENST00000405535.2	+	2	714	c.543G>A	c.(541-543)ccG>ccA	p.P181P	TMEM79_ENST00000357501.2_Intron|TMEM79_ENST00000495881.1_3'UTR|SMG5_ENST00000361813.5_5'Flank|TMEM79_ENST00000295694.5_Silent_p.P181P|SMG5_ENST00000368267.5_5'Flank	NM_032323.2	NP_115699.1	Q9BSE2	TMM79_HUMAN	transmembrane protein 79	181					cornification (GO:0070268)|cuticle development (GO:0042335)|epithelial cell maturation (GO:0002070)|establishment of skin barrier (GO:0061436)|hair follicle morphogenesis (GO:0031069)|positive regulation of epidermis development (GO:0045684)|regulated secretory pathway (GO:0045055)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|urinary_tract(1)	21	Hepatocellular(266;0.158)					TGGTGAGGCCGCCTGGCTGTT	0.682													G|||	5	0.000998403	0.0	0.0	5008	,	,		12551	0.0		0.004	False		,,,				2504	0.001					uc010phi.1		NA																	0				central_nervous_system(1)	1						c.(541-543)CCG>CCA		transmembrane protein 79		G		5,4395		0,5,2195	39.0	45.0	43.0		543	-11.3	0.0	1	dbSNP_134	43	29,8569		1,27,4271	no	coding-synonymous	TMEM79	NM_032323.2		1,32,6466	AA,AG,GG		0.3373,0.1136,0.2616		181/395	156255560	34,12964	2200	4299	6499	SO:0001819	synonymous_variant	84283					integral to membrane		g.chr1:156255560G>A	BC005094	CCDS1138.1	1q22	2014-04-22			ENSG00000163472	ENSG00000163472			28196	protein-coding gene	gene with protein product	"""mattrin"""	615531					Standard	NM_032323		Approved	MGC13102, FLJ16057, FLJ32254, MATT	uc009wrw.3	Q9BSE2	OTTHUMG00000019788	ENST00000405535.2:c.543G>A	1.37:g.156255560G>A			Somatic				SMG5_uc001foc.3_5'Flank|TMEM79_uc001fod.2_Silent_p.P22P|TMEM79_uc009wrw.2_Silent_p.P181P	p.P181P	NM_032323	NP_115699	WXS	Illumina HiSeq	Unspecified	Q9BSE2	TMM79_HUMAN			2	739	+	Hepatocellular(266;0.158)		181					B2RE22|D3DVB8	Silent	SNP	ENST00000405535.2	37	c.543G>A	CCDS1138.1																																																																																				0.682	TMEM79-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052101.1	NM_032323		35	52	0	0	0	0	35	52				
AKT3	10000	broad.mit.edu	37	1	243727052	243727052	+	Silent	SNP	G	G	A			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr1:243727052G>A	ENST00000366539.1	-	10	1118	c.918C>T	c.(916-918)ttC>ttT	p.F306F	AKT3_ENST00000366540.1_Silent_p.F306F|AKT3_ENST00000263826.5_Silent_p.F306F|AKT3_ENST00000336199.5_Silent_p.F306F			Q9Y243	AKT3_HUMAN	v-akt murine thymoma viral oncogene homolog 3	306	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				mitochondrial genome maintenance (GO:0000002)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|skin(3)|stomach(1)	26	all_cancers(71;0.000307)|all_epithelial(71;0.000374)|all_lung(81;0.0323)|Ovarian(71;0.0619)|all_neural(11;0.101)|Lung NSC(105;0.168)	all_cancers(173;0.0274)	all cancers(7;4.3e-08)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00196)			GAGTGCCACAGAATGTCTTCA	0.398																																						uc001iab.1		NA																	0				stomach(1)|lung(1)|breast(1)|central_nervous_system(1)	4						c.(916-918)TTC>TTT		AKT3 kinase isoform 1							176.0	161.0	166.0					1																	243727052		2203	4300	6503	SO:0001819	synonymous_variant	10000				signal transduction	Golgi apparatus|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr1:243727052G>A	AF124141	CCDS31076.1, CCDS31077.1	1q44	2013-07-09	2013-07-09		ENSG00000117020	ENSG00000117020	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	393	protein-coding gene	gene with protein product	"""protein kinase B, gamma"""	611223				10092583, 10208883	Standard	NM_005465		Approved	PKBG, RAC-gamma, PRKBG	uc001iab.2	Q9Y243	OTTHUMG00000039994	ENST00000366539.1:c.918C>T	1.37:g.243727052G>A			Somatic				AKT3_uc001hzz.1_Silent_p.F306F	p.F306F	NM_005465	NP_005456	WXS	Illumina HiSeq	Unspecified	Q9Y243	AKT3_HUMAN	all cancers(7;4.3e-08)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00196)		9	999	-	all_cancers(71;0.000307)|all_epithelial(71;0.000374)|all_lung(81;0.0323)|Ovarian(71;0.0619)|all_neural(11;0.101)|Lung NSC(105;0.168)	all_cancers(173;0.0274)	306			Protein kinase.		Q0VAA6|Q5VTI1|Q5VTI2|Q96QV3|Q9UFP5	Silent	SNP	ENST00000366539.1	37	c.918C>T	CCDS31077.1																																																																																				0.398	AKT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096479.1	NM_181690		38	131	0	0	0	0	38	131				
ARID5B	84159	broad.mit.edu	37	10	63852287	63852287	+	Missense_Mutation	SNP	T	T	C			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr10:63852287T>C	ENST00000279873.7	+	10	3475	c.3065T>C	c.(3064-3066)gTg>gCg	p.V1022A	ARID5B_ENST00000309334.5_Missense_Mutation_p.V779A	NM_032199.2	NP_115575.1	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)	1022					adipose tissue development (GO:0060612)|adrenal gland development (GO:0030325)|cell development (GO:0048468)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|fat pad development (GO:0060613)|female gonad development (GO:0008585)|fibroblast migration (GO:0010761)|kidney development (GO:0001822)|liver development (GO:0001889)|male gonad development (GO:0008584)|multicellular organism growth (GO:0035264)|muscle organ morphogenesis (GO:0048644)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(13)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	Prostate(12;0.016)|all_hematologic(501;0.215)					TTGGACCTTGTGATTGCAGGG	0.587																																						uc001jlt.1		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|kidney(1)	4						c.(3064-3066)GTG>GCG		AT rich interactive domain 5B (MRF1-like)							70.0	79.0	76.0					10																	63852287		2203	4300	6503	SO:0001583	missense	84159				liver development|negative regulation of transcription, DNA-dependent|positive regulation of sequence-specific DNA binding transcription factor activity|transcription, DNA-dependent		protein binding|transcription regulatory region DNA binding	g.chr10:63852287T>C	M73837	CCDS31208.1, CCDS58082.1	10q11.22	2013-02-07			ENSG00000150347	ENSG00000150347		"""-"""	17362	protein-coding gene	gene with protein product		608538				11483573, 11478881	Standard	NM_032199		Approved	FLJ21150, MRF2	uc001jlt.2	Q14865	OTTHUMG00000018298	ENST00000279873.7:c.3065T>C	10.37:g.63852287T>C	ENSP00000279873:p.Val1022Ala		Somatic					p.V1022A	NM_032199	NP_115575	WXS	Illumina HiSeq	Unspecified	Q14865	ARI5B_HUMAN			10	3091	+	Prostate(12;0.016)|all_hematologic(501;0.215)		1022					B4DLB3|Q05DG6|Q32Q59|Q5VST4|Q6NZ42|Q7Z3M4|Q8N421|Q9H786	Missense_Mutation	SNP	ENST00000279873.7	37	c.3065T>C	CCDS31208.1	.	.	.	.	.	.	.	.	.	.	T	4.607	0.112831	0.08831	.	.	ENSG00000150347	ENST00000279873;ENST00000309334	T;T	0.42513	0.98;0.97	5.72	5.72	0.89469	.	0.373567	0.30556	N	0.009379	T	0.28101	0.0693	L	0.34521	1.04	0.35635	D	0.810518	B	0.18610	0.029	B	0.12837	0.008	T	0.30995	-0.9959	10	0.12766	T	0.61	-16.9906	8.4045	0.32605	0.0:0.1458:0.0:0.8542	.	1022	Q14865	ARI5B_HUMAN	A	1022;779	ENSP00000279873:V1022A;ENSP00000308862:V779A	ENSP00000279873:V1022A	V	+	2	0	ARID5B	63522293	1.000000	0.71417	0.937000	0.37676	0.987000	0.75469	3.023000	0.49666	2.182000	0.69389	0.533000	0.62120	GTG		0.587	ARID5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048233.1	XM_084482		72	113	0	0	0	0	72	113				
BTAF1	9044	broad.mit.edu	37	10	93719841	93719841	+	Missense_Mutation	SNP	T	T	G			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr10:93719841T>G	ENST00000265990.6	+	11	1501	c.1193T>G	c.(1192-1194)cTt>cGt	p.L398R	BTAF1_ENST00000471217.1_3'UTR	NM_003972.2	NP_003963.1	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa	398					negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(6)	59		Colorectal(252;0.0846)				CTAAAATTACTTACACAAGAA	0.393																																						uc001khr.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(1192-1194)CTT>CGT		BTAF1 RNA polymerase II, B-TFIID transcription							169.0	167.0	168.0					10																	93719841		2203	4300	6503	SO:0001583	missense	9044				negative regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|sequence-specific DNA binding transcription factor activity	g.chr10:93719841T>G	AJ001017	CCDS7419.1	10q22-q23	2013-05-01	2013-05-01		ENSG00000095564	ENSG00000095564			17307	protein-coding gene	gene with protein product	"""Mot1 homolog (S. cerevisiae)"""	605191	"""BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kD (Mot1 homolog, S. cerevisiae)"""			9342322, 9488487	Standard	NM_003972		Approved	TAFII170, TAF172, MOT1, TAF-172, TAF(II)170	uc001khr.3	O14981	OTTHUMG00000018752	ENST00000265990.6:c.1193T>G	10.37:g.93719841T>G	ENSP00000265990:p.Leu398Arg		Somatic				BTAF1_uc001khs.1_Missense_Mutation_p.L68R	p.L398R	NM_003972	NP_003963	WXS	Illumina HiSeq	Unspecified	O14981	BTAF1_HUMAN			11	1291	+		Colorectal(252;0.0846)	398			HEAT 1.		B4E0W6|O43578	Missense_Mutation	SNP	ENST00000265990.6	37	c.1193T>G	CCDS7419.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.253040	0.80135	.	.	ENSG00000095564	ENST00000265990	T	0.75821	-0.97	5.26	5.26	0.73747	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000001	T	0.78654	0.4317	M	0.69823	2.125	0.80722	D	1	D	0.58620	0.983	P	0.48982	0.597	T	0.80289	-0.1445	10	0.45353	T	0.12	-25.2648	15.1695	0.72858	0.0:0.0:0.0:1.0	.	398	O14981	BTAF1_HUMAN	R	398	ENSP00000265990:L398R	ENSP00000265990:L398R	L	+	2	0	BTAF1	93709821	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.013000	0.88655	1.993000	0.58246	0.477000	0.44152	CTT		0.393	BTAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049380.4	NM_003972		61	111	0	0	0	0	61	111				
LDB1	8861	broad.mit.edu	37	10	103867955	103867955	+	Silent	SNP	G	G	A			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr10:103867955G>A	ENST00000425280.1	-	11	1473	c.1131C>T	c.(1129-1131)agC>agT	p.S377S	LDB1_ENST00000361198.5_Silent_p.S341S|LDB1_ENST00000490751.1_5'Flank	NM_001113407.1	NP_001106878.1	Q86U70	LDB1_HUMAN	LIM domain binding 1	377					anterior/posterior axis specification (GO:0009948)|cellular component assembly (GO:0022607)|cerebellar Purkinje cell differentiation (GO:0021702)|epithelial structure maintenance (GO:0010669)|gastrulation with mouth forming second (GO:0001702)|hair follicle development (GO:0001942)|head development (GO:0060322)|histone H3-K4 acetylation (GO:0043973)|multicellular organismal development (GO:0007275)|negative regulation of erythrocyte differentiation (GO:0045647)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron differentiation (GO:0030182)|positive regulation of cell adhesion (GO:0045785)|positive regulation of hemoglobin biosynthetic process (GO:0046985)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription, DNA-templated (GO:0006355)|somatic stem cell maintenance (GO:0035019)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|transcription-dependent tethering of RNA polymerase II gene DNA at nuclear periphery (GO:0000972)|Wnt signaling pathway (GO:0016055)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|enzyme binding (GO:0019899)|LIM domain binding (GO:0030274)|protein homodimerization activity (GO:0042803)|RNA polymerase II activating transcription factor binding (GO:0001102)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(1)|skin(1)	21		Colorectal(252;0.122)		Epithelial(162;1.11e-07)|all cancers(201;1.82e-06)		AGTTGTTAAAGCTGTCCTCGT	0.622																																						uc009xwz.2		NA																	0				large_intestine(1)	1						c.(1129-1131)AGC>AGT		LIM domain binding 1 isoform 1							203.0	164.0	177.0					10																	103867955		2203	4300	6503	SO:0001819	synonymous_variant	8861				histone H3-K4 acetylation|negative regulation of erythrocyte differentiation|negative regulation of transcription, DNA-dependent|positive regulation of hemoglobin biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription elongation, DNA-dependent|transcription, DNA-dependent|transcription-dependent tethering of RNA polymerase II gene DNA at nuclear periphery	nuclear chromatin|protein complex	LIM domain binding|protein homodimerization activity|transcription corepressor activity	g.chr10:103867955G>A	AF068652	CCDS7528.1, CCDS44472.1	10q24-q25	2008-08-01			ENSG00000198728	ENSG00000198728			6532	protein-coding gene	gene with protein product	"""carboxy terminal LIM domain protein 2"""	603451				9503020, 9799849	Standard	NM_003893		Approved	NLI, CLIM2	uc009xwz.3	Q86U70	OTTHUMG00000018950	ENST00000425280.1:c.1131C>T	10.37:g.103867955G>A			Somatic				LDB1_uc001kuk.3_Silent_p.S341S	p.S377S	NM_001113407	NP_001106878	WXS	Illumina HiSeq	Unspecified	Q86U70	LDB1_HUMAN		Epithelial(162;1.11e-07)|all cancers(201;1.82e-06)	11	1474	-		Colorectal(252;0.122)	377					B4DUC4|O75479|O96010|Q1EQX1|Q9UGM4	Silent	SNP	ENST00000425280.1	37	c.1131C>T	CCDS44472.1																																																																																				0.622	LDB1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001113407		71	117	0	0	0	0	71	117				
SLC6A5	9152	broad.mit.edu	37	11	20622730	20622730	+	Missense_Mutation	SNP	C	C	T	rs200496125		TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr11:20622730C>T	ENST00000525748.1	+	2	332	c.59C>T	c.(58-60)gCg>gTg	p.A20V		NM_004211.3	NP_004202.2	Q9Y345	SC6A5_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 5	20					glycine import (GO:0036233)|synaptic transmission (GO:0007268)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine:sodium symporter activity (GO:0015375)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(34)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	63					Glycine(DB00145)	CCGGAGGCGGCGGCGGCGCAG	0.652																																						uc001mqd.2		NA																	0				ovary(2)|breast(1)|skin(1)	4						c.(58-60)GCG>GTG		solute carrier family 6 (neurotransmitter	Glycine(DB00145)	C	VAL/ALA	1,4125		0,1,2062	7.0	9.0	8.0		59	0.7	0.2	11		8	6,8314		0,6,4154	yes	missense	SLC6A5	NM_004211.3	64	0,7,6216	TT,TC,CC		0.0721,0.0242,0.0562	benign	20/798	20622730	7,12439	2063	4160	6223	SO:0001583	missense	9152				synaptic transmission	integral to membrane|plasma membrane	glycine:sodium symporter activity|neurotransmitter:sodium symporter activity	g.chr11:20622730C>T	AF085412	CCDS7854.1	11p15.1	2013-07-19	2013-07-19		ENSG00000165970	ENSG00000165970		"""Solute carriers"""	11051	protein-coding gene	gene with protein product	"""glycine transporter 2"""	604159	"""solute carrier family 6 (neurotransmitter transporter, glycine), member 5"""	NET1		9845349	Standard	NM_004211		Approved	GLYT2	uc001mqd.3	Q9Y345	OTTHUMG00000166024	ENST00000525748.1:c.59C>T	11.37:g.20622730C>T	ENSP00000434364:p.Ala20Val		Somatic				SLC6A5_uc009yic.2_5'UTR	p.A20V	NM_004211	NP_004202	WXS	Illumina HiSeq	Unspecified	Q9Y345	SC6A5_HUMAN			2	332	+			20			Cytoplasmic (Potential).		O95288|Q4VAM7|Q9BX77	Missense_Mutation	SNP	ENST00000525748.1	37	c.59C>T	CCDS7854.1	.	.	.	.	.	.	.	.	.	.	C	10.05	1.243224	0.22796	2.42E-4	7.21E-4	ENSG00000165970	ENST00000525748	T	0.72394	-0.65	4.07	0.702	0.18110	.	1.133010	0.06494	N	0.735138	T	0.51924	0.1703	N	0.19112	0.55	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.45190	-0.9278	10	0.66056	D	0.02	.	2.1071	0.03694	0.203:0.4847:0.1978:0.1145	.	20	Q9Y345	SC6A5_HUMAN	V	20	ENSP00000434364:A20V	ENSP00000298923:A20V	A	+	2	0	SLC6A5	20579306	0.002000	0.14202	0.204000	0.23530	0.378000	0.30076	1.156000	0.31712	0.417000	0.25871	0.462000	0.41574	GCG		0.652	SLC6A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387497.2	NM_004211		8	7	0	0	0	0	8	7				
CD163	9332	broad.mit.edu	37	12	7639365	7639365	+	Missense_Mutation	SNP	C	C	A			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr12:7639365C>A	ENST00000359156.4	-	10	2390	c.2188G>T	c.(2188-2190)Ggg>Tgg	p.G730W	CD163_ENST00000539632.1_5'Flank|CD163_ENST00000396620.3_Missense_Mutation_p.G763W|CD163_ENST00000541972.1_Missense_Mutation_p.G718W|CD163_ENST00000432237.2_Missense_Mutation_p.G730W	NM_004244.5	NP_004235.4	Q86VB7	C163A_HUMAN	CD163 molecule	730	SRCR 7. {ECO:0000255|PROSITE- ProRule:PRU00196}.				acute-phase response (GO:0006953)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(6)|pancreas(2)|prostate(1)|skin(5)|urinary_tract(4)	76					WF10(DB05389)	TCTACTCTCCCAGCACAGCGA	0.483																																						uc001qsz.3		NA																	0				ovary(6)|pancreas(1)|skin(1)	8						c.(2188-2190)GGG>TGG		CD163 antigen isoform a							95.0	91.0	93.0					12																	7639365		2203	4300	6503	SO:0001583	missense	9332				acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity	g.chr12:7639365C>A	Z22968	CCDS8578.1, CCDS53742.1	12p13	2006-03-28	2006-03-28		ENSG00000177575	ENSG00000177575		"""CD molecules"""	1631	protein-coding gene	gene with protein product		605545	"""CD163 antigen"""			10403791, 8370408	Standard	NM_004244		Approved	M130, MM130	uc001qsz.3	Q86VB7	OTTHUMG00000168353	ENST00000359156.4:c.2188G>T	12.37:g.7639365C>A	ENSP00000352071:p.Gly730Trp		Somatic				CD163_uc001qta.3_Missense_Mutation_p.G730W|CD163_uc009zfw.2_Missense_Mutation_p.G763W	p.G730W	NM_004244	NP_004235	WXS	Illumina HiSeq	Unspecified	Q86VB7	C163A_HUMAN			10	2316	-			730			SRCR 7.|Extracellular (Potential).		C9JIG2|Q07898|Q07899|Q07900|Q07901|Q2VLH7	Missense_Mutation	SNP	ENST00000359156.4	37	c.2188G>T	CCDS8578.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.522656	0.85600	.	.	ENSG00000177575	ENST00000359156;ENST00000541972;ENST00000396620;ENST00000432237	D;D;D;D	0.84298	-1.83;-1.83;-1.83;-1.83	5.54	5.54	0.83059	Speract/scavenger receptor (4);Speract/scavenger receptor-related (2);	0.000000	0.64402	D	0.000001	D	0.96710	0.8926	H	0.99958	5.055	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98463	1.0597	10	0.87932	D	0	.	17.3432	0.87303	0.0:1.0:0.0:0.0	.	763;730;730	C9JHR8;Q86VB7-3;Q86VB7	.;.;C163A_HUMAN	W	730;718;763;730	ENSP00000352071:G730W;ENSP00000444071:G718W;ENSP00000379863:G763W;ENSP00000403885:G730W	ENSP00000352071:G730W	G	-	1	0	CD163	7530632	1.000000	0.71417	0.992000	0.48379	0.902000	0.53008	7.782000	0.85680	2.776000	0.95493	0.650000	0.86243	GGG		0.483	CD163-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399396.2	NM_004244, NM_203416		9	205	1	0	0.00448238	0.00475459	9	205				
KMT2D	8085	broad.mit.edu	37	12	49418485	49418485	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr12:49418485C>T	ENST00000301067.7	-	50	15927	c.15928G>A	c.(15928-15930)Ggg>Agg	p.G5310R		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	5310	FYR C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00876}.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CTCTCCACCCCGGGCAGCTGT	0.582																																						uc001rta.3		NA								N|F|Mis							medulloblastoma|renal		0				kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						c.(15928-15930)GGG>AGG		myeloid/lymphoid or mixed-lineage leukemia 2							33.0	34.0	34.0					12																	49418485		1900	4124	6024	SO:0001583	missense	8085				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding	g.chr12:49418485C>T	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.15928G>A	12.37:g.49418485C>T	ENSP00000301067:p.Gly5310Arg	HNSCC(34;0.089)	Somatic					p.G5310R	NM_003482	NP_003473	WXS	Illumina HiSeq	Unspecified	O14686	MLL2_HUMAN			50	15928	-			5310			FYR C-terminal.		O14687	Missense_Mutation	SNP	ENST00000301067.7	37	c.15928G>A	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	C	16.37	3.104076	0.56291	.	.	ENSG00000167548	ENST00000301067	T	0.51071	0.72	5.36	5.36	0.76844	FY-rich, C-terminal (1);FY-rich, C-terminal subgroup (1);	0.000000	0.35407	N	0.003229	T	0.71771	0.3379	M	0.82056	2.57	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75337	-0.3353	10	0.87932	D	0	.	18.2502	0.90000	0.0:1.0:0.0:0.0	.	5310	O14686	MLL2_HUMAN	R	5310	ENSP00000301067:G5310R	ENSP00000301067:G5310R	G	-	1	0	MLL2	47704752	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.685000	0.91497	0.655000	0.94253	GGG		0.582	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2			16	20	0	0	0	0	16	20				
DIP2B	57609	broad.mit.edu	37	12	51072578	51072578	+	Missense_Mutation	SNP	C	C	T	rs145274091		TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr12:51072578C>T	ENST00000301180.5	+	8	1067	c.1033C>T	c.(1033-1035)Cgc>Tgc	p.R345C		NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)	345						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						TGCCCTGCAGCGCTGGGGTAC	0.532																																						uc001rwv.2		NA																	0				ovary(4)|breast(1)|pancreas(1)	6						c.(1033-1035)CGC>TGC		DIP2 disco-interacting protein 2 homolog B		C	CYS/ARG	0,4406		0,0,2203	79.0	70.0	73.0		1033	4.7	1.0	12	dbSNP_134	73	1,8599	1.2+/-3.3	0,1,4299	no	missense	DIP2B	NM_173602.2	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	345/1577	51072578	1,13005	2203	4300	6503	SO:0001583	missense	57609					nucleus	catalytic activity|transcription factor binding	g.chr12:51072578C>T	AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.1033C>T	12.37:g.51072578C>T	ENSP00000301180:p.Arg345Cys		Somatic				DIP2B_uc001rwu.2_Missense_Mutation_p.R345C|DIP2B_uc009zls.1_Missense_Mutation_p.R227C	p.R345C	NM_173602	NP_775873	WXS	Illumina HiSeq	Unspecified	Q9P265	DIP2B_HUMAN			8	1189	+			345					Q6B011|Q8N1L5|Q8NB38	Missense_Mutation	SNP	ENST00000301180.5	37	c.1033C>T	CCDS31799.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.991227	0.93106	0.0	1.16E-4	ENSG00000066084	ENST00000455310;ENST00000301180	T	0.48836	0.8	4.73	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.70465	0.3227	M	0.78049	2.395	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.915;0.998	T	0.74084	-0.3779	10	0.62326	D	0.03	-11.713	18.2696	0.90064	0.0:1.0:0.0:0.0	.	345;355	Q9P265;E9PHD6	DIP2B_HUMAN;.	C	355;345	ENSP00000301180:R345C	ENSP00000301180:R345C	R	+	1	0	DIP2B	49358845	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.609000	0.82925	2.619000	0.88677	0.467000	0.42956	CGC		0.532	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404243.1	NM_173602		36	64	0	0	0	0	36	64				
ACVRL1	94	broad.mit.edu	37	12	52307464	52307464	+	Silent	SNP	G	G	A			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr12:52307464G>A	ENST00000388922.4	+	4	718	c.435G>A	c.(433-435)cgG>cgA	p.R145R	ACVRL1_ENST00000550683.1_Silent_p.R159R|ACVRL1_ENST00000419526.2_Intron	NM_000020.2	NP_000011.2	P37023	ACVL1_HUMAN	activin A receptor type II-like 1	145					activin receptor signaling pathway (GO:0032924)|angiogenesis (GO:0001525)|artery development (GO:0060840)|blood circulation (GO:0008015)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|blood vessel maturation (GO:0001955)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|cellular response to transforming growth factor beta stimulus (GO:0071560)|endothelial tube morphogenesis (GO:0061154)|in utero embryonic development (GO:0001701)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of focal adhesion assembly (GO:0051895)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of blood pressure (GO:0008217)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of DNA replication (GO:0006275)|regulation of endothelial cell proliferation (GO:0001936)|regulation of transcription, DNA-templated (GO:0006355)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|venous blood vessel development (GO:0060841)|wound healing, spreading of epidermal cells (GO:0035313)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	activin binding (GO:0048185)|activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	20				BRCA - Breast invasive adenocarcinoma(357;0.0991)	Adenosine triphosphate(DB00171)	ATGTCCGACGGAGGCAGGAGA	0.662																																						uc001rzj.2		NA																	0				lung(2)	2	GRCh37	CD052978|CI063638	ACVRL1	D|I		c.(433-435)CGG>CGA		activin A receptor type II-like 1 precursor	Adenosine triphosphate(DB00171)						35.0	31.0	32.0					12																	52307464		2203	4300	6503	SO:0001819	synonymous_variant	94	Hereditary_Hemorrhagic_Telangiectasia			blood vessel endothelial cell proliferation involved in sprouting angiogenesis|blood vessel maturation|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of endothelial cell migration|negative regulation of focal adhesion assembly|positive regulation of BMP signaling pathway|positive regulation of transcription, DNA-dependent|regulation of blood pressure|regulation of blood vessel endothelial cell migration|regulation of DNA replication|regulation of endothelial cell proliferation|transforming growth factor beta receptor signaling pathway|wound healing, spreading of epidermal cells	cell surface|integral to plasma membrane	activin binding|activin receptor activity, type I|ATP binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity	g.chr12:52307464G>A	L17075	CCDS31804.1	12q13.13	2014-09-17			ENSG00000139567	ENSG00000139567			175	protein-coding gene	gene with protein product		601284		ACVRLK1, ORW2		8397373, 8640225	Standard	NM_000020		Approved	HHT2, ALK1, HHT	uc001rzk.3	P37023	OTTHUMG00000169507	ENST00000388922.4:c.435G>A	12.37:g.52307464G>A			Somatic				ACVRL1_uc001rzk.2_Silent_p.R145R|ACVRL1_uc010snm.1_Intron	p.R145R	NM_000020	NP_000011	WXS	Illumina HiSeq	Unspecified	P37023	ACVL1_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.0991)	4	718	+			145			Cytoplasmic (Potential).		A6NGA8	Silent	SNP	ENST00000388922.4	37	c.435G>A	CCDS31804.1																																																																																				0.662	ACVRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404520.2			20	28	0	0	0	0	20	28				
MAP3K12	7786	broad.mit.edu	37	12	53876860	53876860	+	Missense_Mutation	SNP	C	C	A			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr12:53876860C>A	ENST00000267079.2	-	12	1853	c.1628G>T	c.(1627-1629)gGc>gTc	p.G543V	MAP3K12_ENST00000547035.1_Missense_Mutation_p.G576V|MAP3K12_ENST00000547488.1_Missense_Mutation_p.G576V	NM_001193511.1|NM_006301.3	NP_001180440.1|NP_006292.3	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase 12	543					histone phosphorylation (GO:0016572)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	37						ACGGGTCTTGCCACGGCGACT	0.647																																						uc001sdm.1		NA																	0				lung(2)|ovary(1)|breast(1)|skin(1)	5						c.(1627-1629)GGC>GTC		mitogen-activated protein kinase kinase kinase							28.0	34.0	32.0					12																	53876860		2200	4296	6496	SO:0001583	missense	7786				histone phosphorylation|JNK cascade|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|protein autophosphorylation	cytosol|membrane fraction|plasma membrane	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein kinase binding	g.chr12:53876860C>A	U07358	CCDS8860.1, CCDS55831.1	12q13.13	2013-10-30			ENSG00000139625	ENSG00000139625		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6851	protein-coding gene	gene with protein product	"""dual leucine zipper kinase DLK"""	600447		ZPK		8037767	Standard	NM_006301		Approved	MUK, DLK, ZPKP1, MEKK12	uc001sdn.2	Q12852	OTTHUMG00000169854	ENST00000267079.2:c.1628G>T	12.37:g.53876860C>A	ENSP00000267079:p.Gly543Val		Somatic				MAP3K12_uc001sdn.1_Missense_Mutation_p.G576V	p.G543V	NM_006301	NP_006292	WXS	Illumina HiSeq	Unspecified	Q12852	M3K12_HUMAN			12	1726	-			543					B3KSS9|G3V1Y2|Q86VQ5|Q8WY25	Missense_Mutation	SNP	ENST00000267079.2	37	c.1628G>T	CCDS8860.1	.	.	.	.	.	.	.	.	.	.	C	12.85	2.060559	0.36373	.	.	ENSG00000139625	ENST00000267079;ENST00000547488;ENST00000547035	T;T;T	0.12984	2.63;2.63;2.63	4.08	4.08	0.47627	.	0.000000	0.46758	D	0.000276	T	0.09642	0.0237	N	0.19112	0.55	0.80722	D	1	B;B	0.26876	0.162;0.101	B;B	0.29440	0.102;0.047	T	0.22347	-1.0219	10	0.27785	T	0.31	.	12.4979	0.55940	0.0:0.8297:0.1703:0.0	.	576;543	G3V1Y2;Q12852	.;M3K12_HUMAN	V	543;576;576	ENSP00000267079:G543V;ENSP00000449038:G576V;ENSP00000448689:G576V	ENSP00000267079:G543V	G	-	2	0	MAP3K12	52163127	0.786000	0.28738	1.000000	0.80357	0.994000	0.84299	1.308000	0.33528	2.571000	0.86741	0.561000	0.74099	GGC		0.647	MAP3K12-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406267.1	NM_006301		36	40	1	0	1.42e-22	1.65e-22	36	40				
PARP4	143	broad.mit.edu	37	13	25068806	25068806	+	Missense_Mutation	SNP	C	C	G	rs145170390		TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr13:25068806C>G	ENST00000381989.3	-	7	751	c.646G>C	c.(646-648)Gaa>Caa	p.E216Q		NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	216					cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		ATGTAATTTTCAAAGTATTCA	0.338																																						uc001upl.2		NA																	0				ovary(3)|skin(1)	4						c.(646-648)GAA>CAA		poly (ADP-ribose) polymerase family, member 4		C	GLN/GLU	0,4406		0,0,2203	142.0	139.0	140.0		646	4.5	0.6	13	dbSNP_134	140	1,8599	1.2+/-3.3	0,1,4299	no	missense	PARP4	NM_006437.3	29	0,1,6502	GG,GC,CC		0.0116,0.0,0.0077	probably-damaging	216/1725	25068806	1,13005	2203	4300	6503	SO:0001583	missense	143				cell death|DNA repair|inflammatory response|protein ADP-ribosylation|response to drug|transport	cytoplasm|nucleus|ribonucleoprotein complex|spindle microtubule	DNA binding|enzyme binding|NAD+ ADP-ribosyltransferase activity	g.chr13:25068806C>G	AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.646G>C	13.37:g.25068806C>G	ENSP00000371419:p.Glu216Gln		Somatic				PARP4_uc010tdc.1_Missense_Mutation_p.E216Q	p.E216Q	NM_006437	NP_006428	WXS	Illumina HiSeq	Unspecified	Q9UKK3	PARP4_HUMAN		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)	7	752	-		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)	216					O75903|Q14682|Q5QNZ9|Q9H1M6	Missense_Mutation	SNP	ENST00000381989.3	37	c.646G>C	CCDS9307.1	.	.	.	.	.	.	.	.	.	.	C	14.16	2.452805	0.43531	0.0	1.16E-4	ENSG00000102699	ENST00000381989	T	0.43294	0.95	4.52	4.52	0.55395	.	0.214121	0.36972	N	0.002302	T	0.61438	0.2347	M	0.73598	2.24	0.29101	N	0.881468	D	0.76494	0.999	D	0.68765	0.96	T	0.58222	-0.7674	10	0.30854	T	0.27	-20.4413	14.772	0.69688	0.0:1.0:0.0:0.0	.	216	Q9UKK3	PARP4_HUMAN	Q	216	ENSP00000371419:E216Q	ENSP00000371419:E216Q	E	-	1	0	PARP4	23966806	0.997000	0.39634	0.621000	0.29145	0.045000	0.14185	2.644000	0.46613	2.361000	0.80049	0.549000	0.68633	GAA		0.338	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044189.1	NM_006437		43	17	0	0	0	0	43	17				
SLITRK5	26050	broad.mit.edu	37	13	88328310	88328310	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr13:88328310C>G	ENST00000325089.6	+	2	886	c.667C>G	c.(667-669)Cac>Gac	p.H223D	SLITRK5_ENST00000400028.3_Intron	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	223					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					GCTCTTGCAGCACATGGATAA	0.498																																						uc001vln.2		NA																	0				ovary(2)|pancreas(2)|central_nervous_system(1)	5						c.(667-669)CAC>GAC		SLIT and NTRK-like family, member 5 precursor							71.0	75.0	74.0					13																	88328310		2203	4300	6503	SO:0001583	missense	26050					integral to membrane		g.chr13:88328310C>G	AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.667C>G	13.37:g.88328310C>G	ENSP00000366283:p.His223Asp		Somatic				SLITRK5_uc010tic.1_Intron	p.H223D	NM_015567	NP_056382	WXS	Illumina HiSeq	Unspecified	O94991	SLIK5_HUMAN			2	886	+	all_neural(89;0.101)|Medulloblastoma(90;0.163)		223			Extracellular (Potential).		B3KNB8|B4DSH5|Q5VT81	Missense_Mutation	SNP	ENST00000325089.6	37	c.667C>G	CCDS9465.1	.	.	.	.	.	.	.	.	.	.	C	16.21	3.059405	0.55325	.	.	ENSG00000165300	ENST00000325089	T	0.51817	0.69	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.49167	0.1541	N	0.05619	-0.005	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	T	0.51052	-0.8754	9	.	.	.	-22.0463	17.527	0.87803	0.0:1.0:0.0:0.0	.	223	O94991	SLIK5_HUMAN	D	223	ENSP00000366283:H223D	.	H	+	1	0	SLITRK5	87126311	1.000000	0.71417	1.000000	0.80357	0.779000	0.44077	7.818000	0.86416	2.749000	0.94314	0.491000	0.48974	CAC		0.498	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045416.3			4	137	0	0	0	0	4	137				
ATP11A	23250	broad.mit.edu	37	13	113530144	113530144	+	Silent	SNP	C	C	T	rs185868076		TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr13:113530144C>T	ENST00000487903.1	+	28	3304	c.3216C>T	c.(3214-3216)agC>agT	p.S1072S	ATP11A_ENST00000375645.3_Silent_p.S1072S|ATP11A_ENST00000283558.8_Silent_p.S1072S|ATP11A_ENST00000375630.2_Silent_p.S1072S			P98196	AT11A_HUMAN	ATPase, class VI, type 11A	1072					phospholipid translocation (GO:0045332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(12)|lung(17)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	51	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				TGCTGTCCAGCGGGCCCGCCT	0.612													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18472	0.0		0.0	False		,,,				2504	0.0					uc001vsi.3		NA																	0				large_intestine(2)|ovary(2)	4						c.(3214-3216)AGC>AGT		ATPase, class VI, type 11A isoform a							77.0	72.0	74.0					13																	113530144		2203	4300	6503	SO:0001819	synonymous_variant	23250				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr13:113530144C>T	AB028944	CCDS32011.1	13q34	2010-04-20	2007-09-19		ENSG00000068650	ENSG00000068650	3.6.3.1	"""ATPases / P-type"""	13552	protein-coding gene	gene with protein product	"""potential phospholipid-transporting ATPase IH"", ""phospholipid-translocating ATPase"""	605868	"""ATPase, Class VI, type 11A"""			11015572	Standard	NM_032189		Approved	ATPIH, ATPIS, KIAA1021	uc001vsj.4	P98196	OTTHUMG00000017371	ENST00000487903.1:c.3216C>T	13.37:g.113530144C>T			Somatic				ATP11A_uc001vsj.3_Silent_p.S1072S|ATP11A_uc010ago.2_RNA	p.S1072S	NM_015205	NP_056020	WXS	Illumina HiSeq	Unspecified	P98196	AT11A_HUMAN			28	3304	+	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)	1072			Helical; (Potential).		Q5VXT2	Silent	SNP	ENST00000487903.1	37	c.3216C>T	CCDS32011.1	26	0.011904761904761904	11	0.022357723577235773	5	0.013812154696132596	2	0.0034965034965034965	8	0.010554089709762533	C	2.690	-0.273482	0.05679	.	.	ENSG00000068650	ENST00000415301	.	.	.	4.79	-3.2	0.05156	.	.	.	.	.	T	0.41442	0.1159	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53662	-0.8407	4	.	.	.	.	12.4011	0.55414	0.0:0.1793:0.0:0.8207	.	.	.	.	W	8	.	.	R	+	1	2	ATP11A	112578145	0.997000	0.39634	0.911000	0.35937	0.042000	0.13812	0.342000	0.19926	-0.555000	0.06142	-0.258000	0.10820	CGG		0.612	ATP11A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000045834.3	NM_015205		69	23	0	0	0	0	69	23				
CLEC14A	161198	broad.mit.edu	37	14	38724510	38724510	+	Missense_Mutation	SNP	C	C	A			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr14:38724510C>A	ENST00000342213.2	-	1	1064	c.718G>T	c.(718-720)Ggc>Tgc	p.G240C		NM_175060.2	NP_778230.1	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	240						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		AACACATCGCCCGAGAGTTTG	0.622																																						uc001wum.1		NA																	0				ovary(3)|skin(1)	4						c.(718-720)GGC>TGC		C-type lectin domain family 14, member A							118.0	127.0	124.0					14																	38724510		2203	4300	6503	SO:0001583	missense	161198					integral to membrane	sugar binding	g.chr14:38724510C>A		CCDS9667.1	14q21.1	2010-04-27	2005-02-11	2005-02-11	ENSG00000176435	ENSG00000176435		"""C-type lectin domain containing"""	19832	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 27"""	C14orf27			Standard	NM_175060		Approved		uc001wum.2	Q86T13	OTTHUMG00000140248	ENST00000342213.2:c.718G>T	14.37:g.38724510C>A	ENSP00000353013:p.Gly240Cys		Somatic					p.G240C	NM_175060	NP_778230	WXS	Illumina HiSeq	Unspecified	Q86T13	CLC14_HUMAN	Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)	1	1065	-	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		240			Extracellular (Potential).		Q695G9|Q6PWT6|Q8N5V5	Missense_Mutation	SNP	ENST00000342213.2	37	c.718G>T	CCDS9667.1	.	.	.	.	.	.	.	.	.	.	C	10.79	1.448672	0.26074	.	.	ENSG00000176435	ENST00000342213	T	0.76709	-1.04	3.88	1.99	0.26369	.	0.000000	0.32190	U	0.006458	T	0.74891	0.3776	L	0.32530	0.975	0.09310	N	1	D	0.69078	0.997	P	0.60345	0.873	T	0.63782	-0.6559	10	0.62326	D	0.03	-5.3129	5.1943	0.15227	0.0:0.6731:0.2115:0.1154	.	240	Q86T13	CLC14_HUMAN	C	240	ENSP00000353013:G240C	ENSP00000353013:G240C	G	-	1	0	CLEC14A	37794261	0.007000	0.16637	0.001000	0.08648	0.006000	0.05464	1.911000	0.39937	0.588000	0.29660	0.491000	0.48974	GGC		0.622	CLEC14A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276729.1	NM_175060		21	338	1	0	6.45e-10	7.31e-10	21	338				
FSCB	84075	broad.mit.edu	37	14	44976120	44976120	+	Missense_Mutation	SNP	C	C	A			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr14:44976120C>A	ENST00000340446.4	-	1	362	c.71G>T	c.(70-72)aGc>aTc	p.S24I	RP11-163M18.1_ENST00000557465.1_RNA|RP11-163M18.1_ENST00000555433.1_RNA|RP11-163M18.1_ENST00000556228.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	24						sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		AGCTTTGGGGCTAGATGATTT	0.423																																						uc001wvn.2		NA																	0				lung(3)|breast(3)|ovary(2)|central_nervous_system(1)	9						c.(70-72)AGC>ATC		fibrous sheath CABYR binding protein							254.0	243.0	247.0					14																	44976120		2203	4300	6503	SO:0001583	missense	84075					cilium		g.chr14:44976120C>A	AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.71G>T	14.37:g.44976120C>A	ENSP00000344579:p.Ser24Ile		Somatic					p.S24I	NM_032135	NP_115511	WXS	Illumina HiSeq	Unspecified	Q5H9T9	FSCB_HUMAN		GBM - Glioblastoma multiforme(112;0.128)	1	380	-			24					Q5H9U7|Q86YI2|Q9H0J3	Missense_Mutation	SNP	ENST00000340446.4	37	c.71G>T	CCDS9679.1	.	.	.	.	.	.	.	.	.	.	C	12.81	2.050307	0.36181	.	.	ENSG00000189139	ENST00000340446;ENST00000537803	T	0.12672	2.66	5.49	-1.39	0.08997	.	.	.	.	.	T	0.06962	0.0177	L	0.29908	0.895	0.09310	N	1	P	0.40230	0.708	B	0.32928	0.155	T	0.28170	-1.0052	9	0.72032	D	0.01	0.5947	2.2432	0.04024	0.1697:0.2494:0.4054:0.1755	.	24	Q5H9T9	FSCB_HUMAN	I	24	ENSP00000344579:S24I	ENSP00000344579:S24I	S	-	2	0	FSCB	44045870	0.001000	0.12720	0.761000	0.31378	0.387000	0.30353	-1.014000	0.03641	0.029000	0.15352	0.555000	0.69702	AGC		0.423	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276788.1	NM_032135		145	202	1	0	2.99e-77	3.53e-77	145	202				
PELI2	57161	broad.mit.edu	37	14	56755238	56755238	+	Silent	SNP	C	C	T			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr14:56755238C>T	ENST00000267460.4	+	4	679	c.393C>T	c.(391-393)atC>atT	p.I131I		NM_021255.2	NP_067078.1	Q9HAT8	PELI2_HUMAN	pellino E3 ubiquitin protein ligase family member 2	131	FHA; atypical.				innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein phosphorylation (GO:0001934)|protein ubiquitination (GO:0016567)|Toll signaling pathway (GO:0008063)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytosol (GO:0005829)	ligase activity (GO:0016874)			kidney(6)|large_intestine(3)|lung(11)|ovary(1)|skin(1)	22						AAGCCCAGATCACACAGAGCA	0.502																																						uc001xch.2		NA																	0				ovary(1)	1						c.(391-393)ATC>ATT		pellino 2							103.0	84.0	90.0					14																	56755238		2203	4300	6503	SO:0001819	synonymous_variant	57161				innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of MAPKKK cascade|positive regulation of protein phosphorylation|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol	protein binding	g.chr14:56755238C>T	AF302502	CCDS9726.1	14q21	2012-02-23	2012-02-23		ENSG00000139946	ENSG00000139946		"""Pellino homologs"""	8828	protein-coding gene	gene with protein product		614798	"""pellino (Drosophila) homolog 2"", ""pellino homolog 2 (Drosophila)"""			11306823, 12860405	Standard	XM_006720211		Approved		uc001xch.3	Q9HAT8	OTTHUMG00000152336	ENST00000267460.4:c.393C>T	14.37:g.56755238C>T			Somatic					p.I131I	NM_021255	NP_067078	WXS	Illumina HiSeq	Unspecified	Q9HAT8	PELI2_HUMAN			4	679	+			131					B2RDY5	Silent	SNP	ENST00000267460.4	37	c.393C>T	CCDS9726.1																																																																																				0.502	PELI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276925.1			16	26	0	0	0	0	16	26				
LGMN	5641	broad.mit.edu	37	14	93182496	93182496	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr14:93182496C>T	ENST00000393218.2	-	6	726	c.389G>A	c.(388-390)gGc>gAc	p.G130D	LGMN_ENST00000557434.1_Missense_Mutation_p.G130D|LGMN_ENST00000555699.1_Missense_Mutation_p.G130D|LGMN_ENST00000334869.4_Missense_Mutation_p.G130D	NM_001008530.2	NP_001008530.1	Q99538	LGMN_HUMAN	legumain	130					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|innate immune response (GO:0045087)|negative regulation of ERBB signaling pathway (GO:1901185)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of neuron apoptotic process (GO:0043524)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|receptor catabolic process (GO:0032801)|renal system process (GO:0003014)|response to acidic pH (GO:0010447)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|toll-like receptor signaling pathway (GO:0002224)|vitamin D metabolic process (GO:0042359)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	cysteine-type endopeptidase activity (GO:0004197)|peptidase activity (GO:0008233)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(5)|skin(2)	18		all_cancers(154;0.0706)		COAD - Colon adenocarcinoma(157;0.224)		CAGGACTTTGCCGGATCCTAT	0.468																																						uc001yav.2		NA																	0				skin(1)	1						c.(388-390)GGC>GAC		legumain preproprotein							174.0	151.0	159.0					14																	93182496		2203	4300	6503	SO:0001583	missense	5641				hormone biosynthetic process|negative regulation of neuron apoptosis|vitamin D metabolic process	lysosome	cysteine-type endopeptidase activity|protein serine/threonine kinase activity	g.chr14:93182496C>T	D55696	CCDS9904.1	14q32.12	2011-04-08		2002-01-18	ENSG00000100600	ENSG00000100600			9472	protein-coding gene	gene with protein product		602620	"""protease, cysteine, 1 (legumain)"""	PRSC1		8893817, 9065484	Standard	NM_001008530		Approved	LGMN1	uc001yaw.3	Q99538		ENST00000393218.2:c.389G>A	14.37:g.93182496C>T	ENSP00000376911:p.Gly130Asp		Somatic				LGMN_uc001yat.2_Missense_Mutation_p.G130D|LGMN_uc001yau.2_Missense_Mutation_p.G130D|LGMN_uc001yaw.2_Missense_Mutation_p.G130D|LGMN_uc010aul.2_Intron|LGMN_uc001yax.2_Missense_Mutation_p.G130D|LGMN_uc001yay.2_Missense_Mutation_p.G130D	p.G130D	NM_001008530	NP_001008530	WXS	Illumina HiSeq	Unspecified	Q99538	LGMN_HUMAN		COAD - Colon adenocarcinoma(157;0.224)	6	715	-		all_cancers(154;0.0706)	130					O00123|Q86TV2|Q86TV3|Q9BTY1	Missense_Mutation	SNP	ENST00000393218.2	37	c.389G>A	CCDS9904.1	.	.	.	.	.	.	.	.	.	.	C	19.92	3.916451	0.73098	.	.	ENSG00000100600	ENST00000555699;ENST00000334869;ENST00000557434;ENST00000334864;ENST00000262004;ENST00000393218;ENST00000539531;ENST00000535855;ENST00000553802	T;T;T;T;T	0.50813	0.76;0.73;0.78;0.73;0.82	5.51	5.51	0.81932	.	0.200813	0.52532	D	0.000069	T	0.79505	0.4457	H	0.95079	3.62	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.87578	0.998;0.987;0.996	D	0.85224	0.1028	10	0.87932	D	0	-26.1505	19.3815	0.94540	0.0:1.0:0.0:0.0	.	130;130;130	Q99538;Q86TV2;Q86TV3	LGMN_HUMAN;.;.	D	130;130;130;130;130;130;107;95;121	ENSP00000451861:G130D;ENSP00000334052:G130D;ENSP00000452572:G130D;ENSP00000376911:G130D;ENSP00000450854:G121D	ENSP00000262004:G130D	G	-	2	0	LGMN	92252249	1.000000	0.71417	0.913000	0.36048	0.382000	0.30200	5.340000	0.65958	2.765000	0.95021	0.655000	0.94253	GGC		0.468	LGMN-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412288.1	NM_005606		4	198	0	0	0	0	4	198				
TRAF3	7187	broad.mit.edu	37	14	103371927	103371927	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr14:103371927C>T	ENST00000560371.1	+	11	1730	c.1513C>T	c.(1513-1515)Cga>Tga	p.R505*	TRAF3_ENST00000539721.1_Nonsense_Mutation_p.R422*|TRAF3_ENST00000347662.4_Nonsense_Mutation_p.R480*|TRAF3_ENST00000392745.2_Nonsense_Mutation_p.R505*|TRAF3_ENST00000351691.5_Nonsense_Mutation_p.R480*	NM_003300.3|NM_145725.2	NP_003291.2|NP_663777.1	Q13114	TRAF3_HUMAN	TNF receptor-associated factor 3	505	MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.				apoptotic process (GO:0006915)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|regulation of apoptotic process (GO:0042981)|regulation of cytokine production (GO:0001817)|regulation of defense response to virus (GO:0050688)|regulation of interferon-beta production (GO:0032648)|regulation of proteolysis (GO:0030162)|signal transduction (GO:0007165)|Toll signaling pathway (GO:0008063)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	CD40 receptor complex (GO:0035631)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endosome (GO:0005768)|mitochondrion (GO:0005739)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|liver(2)|lung(7)|ovary(1)|prostate(2)	30		all_cancers(154;7.87e-06)|all_epithelial(191;0.0024)		Epithelial(152;9.92e-24)|all cancers(159;2.23e-21)|OV - Ovarian serous cystadenocarcinoma(161;7.85e-12)|Colorectal(3;0.0971)		GGGGTCCTCTCGACGTCATTT	0.517																																						uc001ymc.1		NA																	0				ovary(1)|lung(1)|breast(1)	3						c.(1513-1515)CGA>TGA		TNF receptor-associated factor 3 isoform 1							159.0	149.0	152.0					14																	103371927		2203	4300	6503	SO:0001587	stop_gained	7187				apoptosis|induction of apoptosis|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|regulation of defense response to virus|regulation of interferon-beta production|regulation of proteolysis|toll-like receptor signaling pathway|tumor necrosis factor-mediated signaling pathway	CD40 receptor complex|cytosol|endosome|internal side of plasma membrane|mitochondrion	signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding	g.chr14:103371927C>T	U21092	CCDS9975.1, CCDS9976.1, CCDS55946.1	14q32.32	2014-09-17				ENSG00000131323			12033	protein-coding gene	gene with protein product		601896				7530216, 7859281	Standard	NM_145725		Approved	CAP-1, CD40bp, CRAF1, LAP1	uc001ymd.2	Q13114		ENST00000560371.1:c.1513C>T	14.37:g.103371927C>T	ENSP00000454207:p.Arg505*		Somatic				TRAF3_uc001yme.1_Nonsense_Mutation_p.R480*|TRAF3_uc001ymd.1_Nonsense_Mutation_p.R505*|TRAF3_uc010txy.1_Nonsense_Mutation_p.R422*	p.R505*	NM_145725	NP_663777	WXS	Illumina HiSeq	Unspecified	Q13114	TRAF3_HUMAN		Epithelial(152;9.92e-24)|all cancers(159;2.23e-21)|OV - Ovarian serous cystadenocarcinoma(161;7.85e-12)|Colorectal(3;0.0971)	12	1866	+		all_cancers(154;7.87e-06)|all_epithelial(191;0.0024)	505			MATH.		B7Z8C4|Q12990|Q13076|Q13947|Q6AZX1|Q9UNL1	Nonsense_Mutation	SNP	ENST00000560371.1	37	c.1513C>T	CCDS9975.1	.	.	.	.	.	.	.	.	.	.	C	17.66	3.444695	0.63178	.	.	ENSG00000131323	ENST00000392745;ENST00000347662;ENST00000351691;ENST00000539721	.	.	.	5.56	3.69	0.42338	.	0.051997	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-32.0692	14.775	0.69724	0.2634:0.7366:0.0:0.0	.	.	.	.	X	505;480;505;422	.	ENSP00000328003:R480X	R	+	1	2	TRAF3	102441680	0.994000	0.37717	0.035000	0.18076	0.013000	0.08279	3.172000	0.50832	0.692000	0.31613	-0.175000	0.13238	CGA		0.517	TRAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415735.1	NM_145725		161	36	0	0	0	0	161	36				
MLST8	64223	broad.mit.edu	37	16	2258607	2258607	+	Silent	SNP	C	C	T	rs200094349		TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr16:2258607C>T	ENST00000569417.1	+	8	1209	c.855C>T	c.(853-855)atC>atT	p.I285I	MLST8_ENST00000564088.1_Silent_p.I285I|MLST8_ENST00000382450.4_Silent_p.I284I|MLST8_ENST00000397124.1_Silent_p.I285I|MLST8_ENST00000301724.10_Silent_p.I285I|MLST8_ENST00000301725.7_3'UTR|MLST8_ENST00000565250.1_Silent_p.I285I	NM_022372.4	NP_071767.3	Q9BVC4	LST8_HUMAN	MTOR associated protein, LST8 homolog (S. cerevisiae)	285					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of TOR signaling (GO:0032008)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of Rac GTPase activity (GO:0032314)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				large_intestine(3)|lung(2)|skin(1)	6						CCCAGTACATCGTCACTGGTG	0.711													C|||	1	0.000199681	0.0008	0.0	5008	,	,		13401	0.0		0.0	False		,,,				2504	0.0					uc002coz.2		NA																	0					0						c.(853-855)ATC>ATT		G protein beta subunit-like		C	,,,	2,3916		0,2,1957	46.0	55.0	52.0		855,855,852,855	-3.8	1.0	16		52	1,8257		0,1,4128	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	MLST8	NM_001199173.1,NM_001199174.1,NM_001199175.1,NM_022372.4	,,,	0,3,6085	TT,TC,CC		0.0121,0.051,0.0246	,,,	285/327,285/327,284/326,285/327	2258607	3,12173	1959	4129	6088	SO:0001819	synonymous_variant	64223				insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|T cell costimulation	cytosol	protein binding	g.chr16:2258607C>T		CCDS10462.2, CCDS58409.1	16p13.3	2013-01-09			ENSG00000167965	ENSG00000167965		"""WD repeat domain containing"""	24825	protein-coding gene	gene with protein product	"""G protein beta subunit like"""	612190				12477932	Standard	NM_022372		Approved	Lst8, Pop3, GBL, GbetaL	uc002cpc.3	Q9BVC4	OTTHUMG00000128827	ENST00000569417.1:c.855C>T	16.37:g.2258607C>T			Somatic				MLST8_uc002coy.2_Silent_p.I285I|MLST8_uc002cpa.2_Silent_p.I101I|MLST8_uc002cpb.2_Silent_p.I284I|MLST8_uc010uvx.1_Silent_p.I219I|MLST8_uc002cpc.2_Silent_p.I285I|MLST8_uc002cpd.2_Silent_p.I219I|MLST8_uc002cpe.2_Silent_p.I285I|MLST8_uc002cpg.2_Silent_p.I304I|MLST8_uc002cph.2_RNA|MLST8_uc002cpf.2_Silent_p.I285I	p.I285I	NM_022372	NP_071767	WXS	Illumina HiSeq	Unspecified	Q9BVC4	LST8_HUMAN			8	974	+			285			WD 7.		B3KMM4|B4DY00|D3DU88|Q5M800|Q86Y18|Q8WUI5|Q9HA66|Q9UJV6	Silent	SNP	ENST00000569417.1	37	c.855C>T	CCDS10462.2																																																																																				0.711	MLST8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250763.2	NM_022372		46	70	0	0	0	0	46	70				
RFWD3	55159	broad.mit.edu	37	16	74695298	74695298	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr16:74695298G>A	ENST00000361070.4	-	2	147	c.50C>T	c.(49-51)gCc>gTc	p.A17V	RFWD3_ENST00000571750.1_Missense_Mutation_p.A17V	NM_018124.3	NP_060594.3	Q6PCD5	RFWD3_HUMAN	ring finger and WD repeat domain 3	17					DNA repair (GO:0006281)|mitotic G1 DNA damage checkpoint (GO:0031571)|protein ubiquitination (GO:0016567)|regulation of DNA damage checkpoint (GO:2000001)|response to ionizing radiation (GO:0010212)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|MDM2/MDM4 family protein binding (GO:0097371)|p53 binding (GO:0002039)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	26						CTGTTGTTCGGCATGATTTAA	0.478																																						uc002fda.2		NA																	0				lung(2)|breast(1)	3						c.(49-51)GCC>GTC		ring finger and WD repeat domain 3							126.0	135.0	132.0					16																	74695298		2198	4299	6497	SO:0001583	missense	55159				DNA repair|mitotic cell cycle G1/S transition DNA damage checkpoint|response to ionizing radiation	nucleus	MDM2 binding|p53 binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr16:74695298G>A	AK001382	CCDS32486.1	16q22.3	2013-01-09						"""WD repeat domain containing"", ""RING-type (C3HC4) zinc fingers"""	25539	protein-coding gene	gene with protein product		614151				21504906	Standard	XM_005256021		Approved	FLJ10520, RNF201	uc002fda.3	Q6PCD5		ENST00000361070.4:c.50C>T	16.37:g.74695298G>A	ENSP00000354361:p.Ala17Val		Somatic				RFWD3_uc010cgq.2_Missense_Mutation_p.A17V	p.A17V	NM_018124	NP_060594	WXS	Illumina HiSeq	Unspecified	Q6PCD5	RFWD3_HUMAN			2	148	-			17					A8K585|B2RE35|D3DUJ8|Q5XKR3|Q9H9Q3|Q9NVT4	Missense_Mutation	SNP	ENST00000361070.4	37	c.50C>T	CCDS32486.1	.	.	.	.	.	.	.	.	.	.	G	10.09	1.254103	0.22965	.	.	ENSG00000168411	ENST00000361070;ENST00000444004	T	0.20200	2.09	4.21	2.21	0.28008	.	3.651800	0.00654	N	0.000564	T	0.15869	0.0382	L	0.29908	0.895	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.22138	-1.0225	10	0.12430	T	0.62	-13.0752	5.9006	0.18964	0.1042:0.1942:0.7016:0.0	.	17	Q6PCD5	RFWD3_HUMAN	V	17	ENSP00000354361:A17V	ENSP00000354361:A17V	A	-	2	0	RFWD3	73252799	0.003000	0.15002	0.003000	0.11579	0.009000	0.06853	0.414000	0.21164	0.700000	0.31782	0.655000	0.94253	GCC		0.478	RFWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436506.2	NM_018124		4	224	0	0	0	0	4	224				
KDM6B	23135	broad.mit.edu	37	17	7751611	7751611	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr17:7751611C>T	ENST00000448097.2	+	11	2336	c.2005C>T	c.(2005-2007)Cga>Tga	p.R669*	KDM6B_ENST00000254846.5_Nonsense_Mutation_p.R669*			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	669	Pro-rich.				cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						CCGAGGCCCTCGACTCTTTGA	0.647																																						uc002giw.1		NA																	0				central_nervous_system(1)|pancreas(1)	2						c.(2005-2007)CGA>TGA		lysine (K)-specific demethylase 6B							46.0	56.0	52.0					17																	7751611		2194	4288	6482	SO:0001587	stop_gained	23135				inflammatory response	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	g.chr17:7751611C>T	AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		ENST00000448097.2:c.2005C>T	17.37:g.7751611C>T	ENSP00000412513:p.Arg669*		Somatic				KDM6B_uc002gix.2_5'UTR	p.R669*	NM_001080424	NP_001073893	WXS	Illumina HiSeq	Unspecified	O15054	KDM6B_HUMAN			11	2381	+			669			Pro-rich.		C9IZ40|Q96G33	Nonsense_Mutation	SNP	ENST00000448097.2	37	c.2005C>T		.	.	.	.	.	.	.	.	.	.	C	38	7.030315	0.98013	.	.	ENSG00000132510	ENST00000254846;ENST00000448097	.	.	.	4.52	3.52	0.40303	.	0.547848	0.17060	N	0.188602	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.3136	12.7349	0.57218	0.1718:0.8282:0.0:0.0	.	.	.	.	X	669	.	ENSP00000254846:R669X	R	+	1	2	KDM6B	7692336	0.299000	0.24426	0.309000	0.25155	0.858000	0.48976	0.773000	0.26661	1.207000	0.43291	0.491000	0.48974	CGA		0.647	KDM6B-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000440248.1	XM_043272		61	79	0	0	0	0	61	79				
HNF1B	6928	broad.mit.edu	37	17	36091723	36091723	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr17:36091723C>T	ENST00000225893.4	-	4	1269	c.908G>A	c.(907-909)cGc>cAc	p.R303H	HNF1B_ENST00000560016.1_Missense_Mutation_p.R303H|HNF1B_ENST00000427275.2_Missense_Mutation_p.R277H|HNF1B_ENST00000561193.1_Missense_Mutation_p.R277H	NM_000458.2|NM_001165923.1	NP_000449.1|NP_001159395.1	P35680	HNF1B_HUMAN	HNF1 homeobox B	303					anterior/posterior pattern specification (GO:0009952)|branching morphogenesis of an epithelial tube (GO:0048754)|embryonic digestive tract morphogenesis (GO:0048557)|endocrine pancreas development (GO:0031018)|endodermal cell fate specification (GO:0001714)|epithelial cell proliferation (GO:0050673)|genitalia development (GO:0048806)|hepatoblast differentiation (GO:0061017)|hindbrain development (GO:0030902)|inner cell mass cell differentiation (GO:0001826)|insulin secretion (GO:0030073)|kidney development (GO:0001822)|mesonephric duct formation (GO:0072181)|negative regulation of mesenchymal cell apoptotic process involved in mesonephric nephron morphogenesis (GO:0061296)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric nephron tubule development (GO:0039020)|pronephros development (GO:0048793)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of endodermal cell fate specification (GO:0042663)|regulation of pronephros size (GO:0035565)|regulation of Wnt signaling pathway (GO:0030111)|response to glucose (GO:0009749)|ureteric bud elongation (GO:0060677)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(6)|kidney(3)|large_intestine(2)|liver(1)|lung(3)|ovary(3)|prostate(1)|skin(2)	28		Breast(25;0.00765)|Ovarian(249;0.15)	STAD - Stomach adenocarcinoma(1;0.0142)			CTCCTTCCTGCGGTTTGCAAA	0.607																																					Colon(71;102 1179 9001 27917 43397)	uc002hok.3		NA																	0				ovary(3)	3						c.(907-909)CGC>CAC		hepatocyte nuclear factor 1-beta isoform 1							141.0	112.0	122.0					17																	36091723		2203	4300	6503	SO:0001583	missense	6928	Hereditary_Prostate_Cancer			endocrine pancreas development|genitalia development|kidney development|positive regulation of transcription initiation from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|pronephric nephron tubule development|regulation of pronephros size	nucleus	DNA binding|protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr17:36091723C>T	BC017714	CCDS11324.1, CCDS58538.1	17q12	2014-05-06	2007-08-24	2007-08-24	ENSG00000108753	ENSG00000275410		"""Homeoboxes / HNF class"""	11630	protein-coding gene	gene with protein product		189907	"""transcription factor 2, hepatic; LF-B3; variant hepatic nuclear factor"""	TCF2		1677179, 10484768	Standard	NM_000458		Approved	LFB3, VHNF1, HNF1beta, MODY5	uc002hok.4	P35680	OTTHUMG00000188478	ENST00000225893.4:c.908G>A	17.37:g.36091723C>T	ENSP00000225893:p.Arg303His		Somatic				HNF1B_uc010wdi.1_Missense_Mutation_p.R277H|HNF1B_uc010cve.1_Missense_Mutation_p.R111H	p.R303H	NM_000458	NP_000449	WXS	Illumina HiSeq	Unspecified	P35680	HNF1B_HUMAN	STAD - Stomach adenocarcinoma(1;0.0142)		4	1129	-		Breast(25;0.00765)|Ovarian(249;0.15)	303			Homeobox; HNF1-type.		B4DKM3|E0YMJ9	Missense_Mutation	SNP	ENST00000225893.4	37	c.908G>A	CCDS11324.1	.	.	.	.	.	.	.	.	.	.	C	32	5.152751	0.94645	.	.	ENSG00000108753	ENST00000225893;ENST00000427275;ENST00000544593;ENST00000539087	D;D	0.97529	-4.42;-4.42	5.32	5.32	0.75619	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.091883	0.64402	N	0.000001	D	0.98372	0.9459	M	0.81942	2.565	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.998	D;D;P	0.72338	0.946;0.977;0.877	D	0.99160	1.0861	10	0.87932	D	0	-5.0336	17.7156	0.88336	0.0:1.0:0.0:0.0	.	277;303;303	E0YMJ6;P35680-3;P35680	.;.;HNF1B_HUMAN	H	303;277;303;191	ENSP00000225893:R303H;ENSP00000412212:R277H	ENSP00000225893:R303H	R	-	2	0	HNF1B	33165836	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.320000	0.79064	2.775000	0.95449	0.655000	0.94253	CGC		0.607	HNF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256807.3	NM_000458		59	100	0	0	0	0	59	100				
GRN	2896	broad.mit.edu	37	17	42427094	42427094	+	Silent	SNP	C	C	T	rs578182427		TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr17:42427094C>T	ENST00000053867.3	+	4	386	c.324C>T	c.(322-324)gaC>gaT	p.D108D	GRN_ENST00000589265.1_Silent_p.D108D	NM_002087.2	NP_002078.1	P28799	GRN_HUMAN	granulin	108					blastocyst hatching (GO:0001835)|cell death (GO:0008219)|embryo implantation (GO:0007566)|positive regulation of epithelial cell proliferation (GO:0050679)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)	growth factor activity (GO:0008083)|poly(A) RNA binding (GO:0044822)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		GCAGTGCAGACGGGCGATCCT	0.637													c|||	1	0.000199681	0.0008	0.0	5008	,	,		18289	0.0		0.0	False		,,,				2504	0.0					uc002igp.1		NA																	0				ovary(2)|central_nervous_system(2)|skin(1)	5						c.(322-324)GAC>GAT		granulin precursor							41.0	37.0	39.0					17																	42427094		2203	4300	6503	SO:0001819	synonymous_variant	2896				signal transduction	extracellular space	cytokine activity|growth factor activity	g.chr17:42427094C>T	M75161	CCDS11483.1	17q21.32	2014-09-17				ENSG00000030582			4601	protein-coding gene	gene with protein product	"""progranulin"""	138945				1417868, 9826678	Standard	XM_005257253		Approved	PCDGF, PGRN, CLN11	uc002igp.1	P28799		ENST00000053867.3:c.324C>T	17.37:g.42427094C>T			Somatic				GRN_uc002igq.1_3'UTR|GRN_uc002igr.1_5'Flank	p.D108D	NM_002087	NP_002078	WXS	Illumina HiSeq	Unspecified	P28799	GRN_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.189)	4	543	+		Prostate(33;0.0181)	108					D3DX55|P23781|P23782|P23783|P23784|Q53HQ8|Q53Y88|Q540U8|Q9BWE7|Q9H8S1|Q9UCH0	Silent	SNP	ENST00000053867.3	37	c.324C>T	CCDS11483.1	.	.	.	.	.	.	.	.	.	.	c	5.556	0.287485	0.10513	.	.	ENSG00000030582	ENST00000393566	.	.	.	4.11	-7.86	0.01187	.	.	.	.	.	T	0.34164	0.0888	.	.	.	0.24058	N	0.996029	.	.	.	.	.	.	T	0.49634	-0.8919	5	0.62326	D	0.03	-12.0981	7.4431	0.27196	0.1125:0.481:0.0:0.4066	.	.	.	.	M	15	.	ENSP00000377196:T15M	T	+	2	0	GRN	39782620	0.000000	0.05858	0.009000	0.14445	0.190000	0.23558	-3.765000	0.00372	-1.879000	0.01126	-2.095000	0.00367	ACG		0.637	GRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457766.1	NM_002087		18	36	0	0	0	0	18	36				
TIMP2	7077	broad.mit.edu	37	17	76851860	76851860	+	Silent	SNP	G	G	A	rs373804430		TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr17:76851860G>A	ENST00000262768.7	-	5	850	c.552C>T	c.(550-552)aaC>aaT	p.N184N	TIMP2_ENST00000586057.1_Silent_p.N107N|TIMP2_ENST00000536189.2_Silent_p.N107N|TIMP2_ENST00000585421.1_Silent_p.N107N|RP11-323N12.5_ENST00000587434.1_RNA	NM_003255.4	NP_003246.1	P16035	TIMP2_HUMAN	TIMP metallopeptidase inhibitor 2	184					aging (GO:0007568)|cellular response to organic substance (GO:0071310)|central nervous system development (GO:0007417)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of proteolysis (GO:0045861)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|regulation of Rap protein signal transduction (GO:0032487)|response to cytokine (GO:0034097)|response to drug (GO:0042493)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)			central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.194)			CCTGGTGCCCGTTGATGTTCT	0.632																																						uc002jwf.2		NA																	0				central_nervous_system(2)	2						c.(550-552)AAC>AAT		TIMP metallopeptidase inhibitor 2 precursor		G		0,4406		0,0,2203	106.0	80.0	89.0		552	-4.6	0.9	17		89	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	TIMP2	NM_003255.4		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		184/221	76851860	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	7077						metal ion binding|metalloendopeptidase inhibitor activity	g.chr17:76851860G>A		CCDS11758.1	17q25	2008-07-18	2005-08-08		ENSG00000035862	ENSG00000035862			11821	protein-coding gene	gene with protein product		188825	"""tissue inhibitor of metalloproteinase 2"""			1427908	Standard	NM_003255		Approved	CSC-21K	uc002jwf.3	P16035	OTTHUMG00000154517	ENST00000262768.7:c.552C>T	17.37:g.76851860G>A			Somatic				TIMP2_uc002jwe.2_Silent_p.N107N|TIMP2_uc010wty.1_Silent_p.N107N	p.N184N	NM_003255	NP_003246	WXS	Illumina HiSeq	Unspecified	P16035	TIMP2_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.194)		5	854	-			184					Q16121|Q93006|Q9UDF7	Silent	SNP	ENST00000262768.7	37	c.552C>T	CCDS11758.1																																																																																				0.632	TIMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335662.1	NM_003255		43	65	0	0	0	0	43	65				
ENDOV	284131	broad.mit.edu	37	17	78389501	78389501	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr17:78389501G>A	ENST00000518137.1	+	2	136	c.108G>A	c.(106-108)tgG>tgA	p.W36*	CTD-2047H16.4_ENST00000575034.1_RNA|ENDOV_ENST00000522751.1_5'UTR|ENDOV_ENST00000518901.1_Intron|ENDOV_ENST00000521847.1_3'UTR|ENDOV_ENST00000517295.2_5'UTR|ENDOV_ENST00000323854.5_Nonsense_Mutation_p.W36*|ENDOV_ENST00000518644.1_5'UTR|ENDOV_ENST00000517795.1_Intron|ENDOV_ENST00000520284.1_5'UTR|ENDOV_ENST00000520367.1_Nonsense_Mutation_p.W36*|ENDOV_ENST00000518907.1_Intron|ENDOV_ENST00000523999.1_Nonsense_Mutation_p.W36*|CTD-2047H16.4_ENST00000573394.1_RNA|CTD-2047H16.4_ENST00000572151.1_RNA	NM_173627.3	NP_775898.2	Q8N8Q3	ENDOV_HUMAN	endonuclease V	36					DNA repair (GO:0006281)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|endoribonuclease activity, producing 5'-phosphomonoesters (GO:0016891)|magnesium ion binding (GO:0000287)|single-stranded RNA binding (GO:0003727)|structure-specific DNA binding (GO:0043566)			endometrium(1)|lung(1)|pancreas(1)|prostate(1)	4						CCGAGGCGTGGCAGCGAGACC	0.642								Direct reversal of damage																														uc002jym.1		NA																	0					0						c.(106-108)TGG>TGA	Direct_reversal_of_damage|Editing_and_processing_nucleases	hypothetical protein LOC284131 isoform 1							35.0	42.0	40.0					17																	78389501		2027	4156	6183	SO:0001587	stop_gained	284131				DNA repair		endodeoxyribonuclease activity, producing 5'-phosphomonoesters|magnesium ion binding	g.chr17:78389501G>A		CCDS54172.1, CCDS54173.1, CCDS54174.1	17q25.3	2011-05-05			ENSG00000173818	ENSG00000173818			26640	protein-coding gene	gene with protein product						12853604	Standard	NM_001164638		Approved	FLJ35220	uc021ueo.1	Q8N8Q3	OTTHUMG00000164638	ENST00000518137.1:c.108G>A	17.37:g.78389501G>A	ENSP00000429190:p.Trp36*		Somatic				uc002jyi.1_5'Flank|FLJ35220_uc002jyj.1_Nonsense_Mutation_p.W36*|FLJ35220_uc002jyk.2_Nonsense_Mutation_p.W36*|FLJ35220_uc002jyl.1_Nonsense_Mutation_p.W36*|FLJ35220_uc002jyn.2_5'UTR	p.W36*	NM_173627	NP_775898	WXS	Illumina HiSeq	Unspecified	Q8N8Q3	ENDOV_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0487)		2	136	+	all_neural(118;0.0538)		36					I3L3S4|Q6P2G2|Q86X99|Q8NAK0	Nonsense_Mutation	SNP	ENST00000518137.1	37	c.108G>A	CCDS54172.1	.	.	.	.	.	.	.	.	.	.	G	36	5.765875	0.96914	.	.	ENSG00000173818	ENST00000518137;ENST00000520367;ENST00000523999;ENST00000323854;ENST00000517295	.	.	.	4.62	3.63	0.41609	.	0.082269	0.53938	U	0.000049	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.9421	14.597	0.68415	0.0:0.1473:0.8527:0.0	.	.	.	.	X	36;36;36;36;11	.	ENSP00000317810:W36X	W	+	3	0	ENDOV	76004096	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	8.341000	0.90046	0.888000	0.36160	0.585000	0.79938	TGG		0.642	ENDOV-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379487.1	NM_173627		3	20	0	0	0	0	3	20				
RALBP1	10928	broad.mit.edu	37	18	9535827	9535827	+	Silent	SNP	G	G	A			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr18:9535827G>A	ENST00000019317.4	+	10	2083	c.1860G>A	c.(1858-1860)ccG>ccA	p.P620P	RALBP1_ENST00000383432.3_Silent_p.P620P			Q15311	RBP1_HUMAN	ralA binding protein 1	620					ATP catabolic process (GO:0006200)|chemotaxis (GO:0006935)|positive regulation of Cdc42 GTPase activity (GO:0043089)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|transport (GO:0006810)	cytosol (GO:0005829)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ATPase activity, coupled to movement of substances (GO:0043492)|GTPase activator activity (GO:0005096)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(3)|upper_aerodigestive_tract(1)	14					Carbamazepine(DB00564)|Doxorubicin(DB00997)|Sorafenib(DB00398)|Vincristine(DB00541)	CCGTCCAGCCGCCCAGAGACG	0.667																																						uc002kob.2		NA																	0				central_nervous_system(1)	1						c.(1858-1860)CCG>CCA		ralA binding protein 1							15.0	17.0	16.0					18																	9535827		2202	4286	6488	SO:0001819	synonymous_variant	10928				chemotaxis|positive regulation of Cdc42 GTPase activity|small GTPase mediated signal transduction|transport	cytosol|membrane	ATPase activity, coupled to movement of substances|Rac GTPase activator activity|Rac GTPase binding|Ral GTPase binding	g.chr18:9535827G>A	L42542	CCDS11845.1	18p11.22	2006-04-22			ENSG00000017797	ENSG00000017797			9841	protein-coding gene	gene with protein product		605801				7673236	Standard	NM_006788		Approved	RLIP76, RIP1, RIP	uc002koc.3	Q15311	OTTHUMG00000131596	ENST00000019317.4:c.1860G>A	18.37:g.9535827G>A			Somatic				RALBP1_uc002koc.2_Silent_p.P620P	p.P620P	NM_006788	NP_006779	WXS	Illumina HiSeq	Unspecified	Q15311	RBP1_HUMAN			10	2083	+			620					D3DUI0	Silent	SNP	ENST00000019317.4	37	c.1860G>A	CCDS11845.1																																																																																				0.667	RALBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254479.1	NM_006788		6	11	0	0	0	0	6	11				
ROCK1	6093	broad.mit.edu	37	18	18547018	18547018	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr18:18547018G>A	ENST00000399799.2	-	27	4152	c.3212C>T	c.(3211-3213)gCa>gTa	p.A1071V		NM_005406.2	NP_005397.1	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein kinase 1	1071					actin cytoskeleton organization (GO:0030036)|apical constriction (GO:0003383)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|bleb assembly (GO:0032060)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of focal adhesion assembly (GO:0051894)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(8)|lung(2)	16	Melanoma(1;0.165)					ATTCCTATGTGCACATTCTTC	0.333																																						uc002kte.2		NA																	0				lung(2)|breast(2)|central_nervous_system(1)	5						c.(3211-3213)GCA>GTA		Rho-associated, coiled-coil containing protein							144.0	131.0	135.0					18																	18547018		2203	4300	6503	SO:0001583	missense	6093				actin cytoskeleton organization|axon guidance|cellular component disassembly involved in apoptosis|cytokinesis|leukocyte tethering or rolling|membrane to membrane docking|Rho protein signal transduction	centriole|cytosol|Golgi membrane	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity	g.chr18:18547018G>A		CCDS11870.2	18q11.2	2013-01-10			ENSG00000067900	ENSG00000067900	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10251	protein-coding gene	gene with protein product		601702				8617235	Standard	NM_005406		Approved	p160ROCK	uc002kte.3	Q13464	OTTHUMG00000131723	ENST00000399799.2:c.3212C>T	18.37:g.18547018G>A	ENSP00000382697:p.Ala1071Val		Somatic					p.A1071V	NM_005406	NP_005397	WXS	Illumina HiSeq	Unspecified	Q13464	ROCK1_HUMAN			27	4153	-	Melanoma(1;0.165)		1071			Potential.		B0YJ91|Q2KHM4|Q59GZ4	Missense_Mutation	SNP	ENST00000399799.2	37	c.3212C>T	CCDS11870.2	.	.	.	.	.	.	.	.	.	.	G	15.23	2.771508	0.49680	.	.	ENSG00000067900	ENST00000399799	T	0.14391	2.51	5.61	5.61	0.85477	.	0.470684	0.22337	N	0.061390	T	0.07324	0.0185	N	0.03608	-0.345	0.22401	N	0.999138	B	0.02656	0.0	B	0.04013	0.001	T	0.30416	-0.9979	10	0.37606	T	0.19	.	14.4675	0.67494	0.0:0.0:0.8529:0.1471	.	1071	Q13464	ROCK1_HUMAN	V	1071	ENSP00000382697:A1071V	ENSP00000382697:A1071V	A	-	2	0	ROCK1	16801016	0.970000	0.33590	1.000000	0.80357	0.972000	0.66771	3.360000	0.52299	2.646000	0.89796	0.585000	0.79938	GCA		0.333	ROCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254641.2	NM_005406		63	96	0	0	0	0	63	96				
DNM2	1785	broad.mit.edu	37	19	10887831	10887831	+	Silent	SNP	G	G	C			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr19:10887831G>C	ENST00000355667.6	+	5	707	c.627G>C	c.(625-627)ctG>ctC	p.L209L	DNM2_ENST00000408974.4_Silent_p.L209L|DNM2_ENST00000314646.5_Silent_p.L209L|DNM2_ENST00000591819.1_3'UTR|DNM2_ENST00000585892.1_Silent_p.L209L|DNM2_ENST00000389253.4_Silent_p.L209L|DNM2_ENST00000359692.6_Silent_p.L209L	NM_001005360.2|NM_001190716.1	NP_001005360.1|NP_001177645.1	P50570	DYN2_HUMAN	dynamin 2	209	Dynamin-type G.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|endocytosis (GO:0006897)|G2/M transition of mitotic cell cycle (GO:0000086)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|nitric oxide metabolic process (GO:0046209)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic vesicle transport (GO:0048489)|transferrin transport (GO:0033572)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	enzyme binding (GO:0019899)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|microtubule binding (GO:0008017)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	42			Epithelial(33;4.17e-05)|all cancers(31;8.48e-05)			AGCTTGACCTGATGGACGAGG	0.597			"""F, N, Splice, Mis, O"""		ETP ALL																																	uc002mps.1		NA		Rec	yes		19	19p13.2	1785		dynamin 2			L					0				central_nervous_system(2)|skin(2)|ovary(1)|breast(1)	6						c.(625-627)CTG>CTC		dynamin 2 isoform 2							113.0	98.0	103.0					19																	10887831		2203	4300	6503	SO:0001819	synonymous_variant	1785				G2/M transition of mitotic cell cycle|positive regulation of apoptosis|positive regulation of transcription, DNA-dependent|post-Golgi vesicle-mediated transport|receptor internalization|signal transduction|synaptic vesicle transport|transferrin transport	cell junction|cytosol|Golgi membrane|microtubule|postsynaptic density|postsynaptic membrane	GTP binding|GTPase activity|microtubule binding	g.chr19:10887831G>C		CCDS32907.1, CCDS32908.1, CCDS45968.1, CCDS45969.1, CCDS59351.1	19p	2014-09-17						"""Pleckstrin homology (PH) domain containing"""	2974	protein-coding gene	gene with protein product	"""dynamin II"", ""cytoskeletal protein"""	602378				7590285, 9143510	Standard	NM_001190716		Approved	DYNII, DYN2, CMTDIB, CMTDI1, DI-CMTB	uc002mps.2	P50570		ENST00000355667.6:c.627G>C	19.37:g.10887831G>C			Somatic				DNM2_uc010dxk.2_RNA|DNM2_uc002mpt.1_Silent_p.L209L|DNM2_uc002mpv.1_Silent_p.L209L|DNM2_uc002mpu.1_Silent_p.L209L|DNM2_uc010dxl.1_Silent_p.L209L	p.L209L	NM_001005361	NP_001005361	WXS	Illumina HiSeq	Unspecified	P50570	DYN2_HUMAN	Epithelial(33;4.17e-05)|all cancers(31;8.48e-05)		5	791	+			209					A8K1B6|E7EV30|E9PEQ4|K7ESI9|Q5I0Y0|Q7Z5S3|Q9UPH4	Silent	SNP	ENST00000355667.6	37	c.627G>C	CCDS45968.1																																																																																				0.597	DNM2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452592.1	NM_004945		27	60	0	0	0	0	27	60				
ZNF433	163059	broad.mit.edu	37	19	12126251	12126251	+	Silent	SNP	C	C	T	rs189458355	byFrequency	TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr19:12126251C>T	ENST00000344980.6	-	4	1601	c.1431G>A	c.(1429-1431)ccG>ccA	p.P477P	CTD-2006C1.2_ENST00000476474.1_RNA|CTD-2006C1.2_ENST00000495324.1_RNA|ZNF433_ENST00000419886.2_Silent_p.P442P|CTD-2006C1.2_ENST00000406892.2_RNA	NM_001080411.1	NP_001073880.1	Q8N7K0	ZN433_HUMAN	zinc finger protein 433	477					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(1)|prostate(1)|skin(1)	14						TACATTCATACGGCTTCTCTT	0.388													C|||	3	0.000599042	0.0	0.0014	5008	,	,		25047	0.0		0.002	False		,,,				2504	0.0					uc002msy.1		NA																	0					0						c.(1429-1431)CCG>CCA		zinc finger protein 433		C		0,4298		0,0,2149	58.0	62.0	61.0		1431	-2.5	0.0	19		61	4,8542		0,4,4269	no	coding-synonymous	ZNF433	NM_001080411.1		0,4,6418	TT,TC,CC		0.0468,0.0,0.0311		477/674	12126251	4,12840	2149	4273	6422	SO:0001819	synonymous_variant	163059				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:12126251C>T	AK098300	CCDS45983.1	19p13.13	2013-01-08			ENSG00000197647	ENSG00000197647		"""Zinc fingers, C2H2-type"", ""-"""	20811	protein-coding gene	gene with protein product							Standard	NM_001080411		Approved	FLJ40981	uc002msy.1	Q8N7K0	OTTHUMG00000156427	ENST00000344980.6:c.1431G>A	19.37:g.12126251C>T			Somatic				uc002msx.1_Intron|ZNF433_uc002msz.1_Silent_p.P442P	p.P477P	NM_001080411	NP_001073880	WXS	Illumina HiSeq	Unspecified	Q8N7K0	ZN433_HUMAN			4	1602	-			477					Q86VX3	Silent	SNP	ENST00000344980.6	37	c.1431G>A	CCDS45983.1																																																																																				0.388	ZNF433-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403716.1	NM_152602		19	41	0	0	0	0	19	41				
ZNF90	7643	broad.mit.edu	37	19	20228642	20228642	+	Silent	SNP	T	T	C			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr19:20228642T>C	ENST00000418063.2	+	4	391	c.279T>C	c.(277-279)gaT>gaC	p.D93D	ZNF90_ENST00000474284.1_Intron	NM_007138.1	NP_009069.1	Q03938	ZNF90_HUMAN	zinc finger protein 90	93					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|lung(2)|ovary(1)|skin(1)	5						GCCTAAAAGATTCCTTCCAAA	0.343																																						uc002nor.2		NA																	0				ovary(1)|skin(1)	2						c.(277-279)GAT>GAC		zinc finger protein 90							103.0	93.0	96.0					19																	20228642		692	1591	2283	SO:0001819	synonymous_variant	7643					Golgi apparatus|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:20228642T>C	M61870	CCDS46028.1	19p12	2013-01-08	2006-02-01		ENSG00000213988	ENSG00000213988		"""Zinc fingers, C2H2-type"", ""-"""	13165	protein-coding gene	gene with protein product		603973	"""zinc finger protein 90 (HTF9)"""			8467795	Standard	NM_007138		Approved	HTF9	uc002nor.2	Q03938	OTTHUMG00000158057	ENST00000418063.2:c.279T>C	19.37:g.20228642T>C			Somatic				ZNF90_uc002nos.1_Intron|ZNF90_uc002not.1_Intron	p.D93D	NM_007138	NP_009069	WXS	Illumina HiSeq	Unspecified	Q03938	ZNF90_HUMAN			4	418	+			93					B9EH87	Silent	SNP	ENST00000418063.2	37	c.279T>C	CCDS46028.1																																																																																				0.343	ZNF90-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350101.1	NM_007138		5	24	0	0	0	0	5	24				
MAG	4099	broad.mit.edu	37	19	35800939	35800939	+	Missense_Mutation	SNP	G	G	A	rs147583558		TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr19:35800939G>A	ENST00000392213.3	+	8	1553	c.1394G>A	c.(1393-1395)cGc>cAc	p.R465H	MAG_ENST00000537831.2_Missense_Mutation_p.R440H|MAG_ENST00000593348.1_3'UTR|MAG_ENST00000361922.4_Missense_Mutation_p.R465H	NM_002361.3	NP_002352.1	P20916	MAG_HUMAN	myelin associated glycoprotein	465	Ig-like C2-type 4.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)|substantia nigra development (GO:0021762)	integral component of membrane (GO:0016021)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)	carbohydrate binding (GO:0030246)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(11)|skin(2)|upper_aerodigestive_tract(2)	34	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			TACTCGGAGCGCAGCGGCCTC	0.677																																						uc002nyy.1		NA																	0				breast(3)|lung(2)|central_nervous_system(1)|skin(1)	7						c.(1393-1395)CGC>CAC		myelin associated glycoprotein isoform a		G	HIS/ARG,HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	64.0	57.0	60.0		1319,1394,1394	4.8	1.0	19	dbSNP_134	60	0,8600		0,0,4300	no	missense,missense,missense	MAG	NM_001199216.1,NM_002361.3,NM_080600.2	29,29,29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging	440/602,465/627,465/583	35800939	1,13005	2203	4300	6503	SO:0001583	missense	4099				blood coagulation|cell adhesion|leukocyte migration|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	integral to membrane|plasma membrane	sugar binding	g.chr19:35800939G>A	M29273	CCDS12455.1, CCDS12456.1, CCDS56090.1	19q13.1	2013-01-29			ENSG00000105695	ENSG00000105695		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6783	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 4A"""	159460		GMA		2476987, 8432525	Standard	NM_080600		Approved	SIGLEC4A, SIGLEC-4A, S-MAG	uc002nyy.2	P20916		ENST00000392213.3:c.1394G>A	19.37:g.35800939G>A	ENSP00000376048:p.Arg465His		Somatic				MAG_uc002nyx.1_Missense_Mutation_p.R465H|MAG_uc010eds.1_Missense_Mutation_p.R440H|MAG_uc002nyz.1_Missense_Mutation_p.R465H	p.R465H	NM_002361	NP_002352	WXS	Illumina HiSeq	Unspecified	P20916	MAG_HUMAN	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)		8	1543	+	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	465			Ig-like C2-type 4.|Extracellular (Potential).		B7Z2E5|F5GYC0|Q567S4	Missense_Mutation	SNP	ENST00000392213.3	37	c.1394G>A	CCDS12455.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.705707	0.89018	2.27E-4	0.0	ENSG00000105695	ENST00000262624;ENST00000361922;ENST00000392213;ENST00000537831	T;T;T	0.13657	2.57;2.57;2.57	4.8	4.8	0.61643	.	0.124703	0.52532	D	0.000077	T	0.14917	0.0360	N	0.24115	0.695	0.42787	D	0.993886	D;P;D	0.69078	0.996;0.754;0.997	P;B;P	0.49332	0.512;0.095;0.607	T	0.02275	-1.1184	10	0.44086	T	0.13	.	15.3881	0.74718	0.0:0.0:1.0:0.0	.	502;465;465	Q59GD9;P20916;Q567S4	.;MAG_HUMAN;.	H	502;465;465;440	ENSP00000355234:R465H;ENSP00000376048:R465H;ENSP00000440695:R440H	ENSP00000262624:R502H	R	+	2	0	MAG	40492779	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	2.724000	0.47285	2.497000	0.84241	0.462000	0.41574	CGC		0.677	MAG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000466071.1	NM_080600		36	64	0	0	0	0	36	64				
CPT1C	126129	broad.mit.edu	37	19	50216294	50216294	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr19:50216294C>G	ENST00000392518.4	+	19	2571	c.2199C>G	c.(2197-2199)atC>atG	p.I733M	CPT1C_ENST00000323446.5_Missense_Mutation_p.I733M|CPT1C_ENST00000598293.1_Missense_Mutation_p.I733M|CPT1C_ENST00000405931.2_Missense_Mutation_p.I722M|CPT1C_ENST00000354199.5_Missense_Mutation_p.I644M	NM_001199752.1	NP_001186681.1	Q8TCG5	CPT1C_HUMAN	carnitine palmitoyltransferase 1C	733					carnitine metabolic process (GO:0009437)|fatty acid beta-oxidation (GO:0006635)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|endoplasmic reticulum membrane (GO:0005789)|mitochondrial outer membrane (GO:0005741)|synapse (GO:0045202)	carnitine O-palmitoyltransferase activity (GO:0004095)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.00786)		CCTTCCACATCTCCAGCAAAA	0.493																																						uc002ppj.2		NA																	0				ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(2197-2199)ATC>ATG		carnitine palmitoyltransferase 1C isoform 2							219.0	188.0	198.0					19																	50216294		2203	4300	6503	SO:0001583	missense	126129				fatty acid metabolic process	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity	g.chr19:50216294C>G	AF357970	CCDS12779.1, CCDS46147.1	19q13.33	2014-03-14				ENSG00000169169			18540	protein-coding gene	gene with protein product		608846				12376098, 11001805	Standard	NM_001136052		Approved	FLJ23809, CPTIC, CPT1P	uc010eng.3	Q8TCG5		ENST00000392518.4:c.2199C>G	19.37:g.50216294C>G	ENSP00000376303:p.Ile733Met		Somatic				CPT1C_uc002ppi.2_Missense_Mutation_p.I650M|CPT1C_uc002ppk.2_Missense_Mutation_p.I722M|CPT1C_uc010eng.2_Missense_Mutation_p.I733M|CPT1C_uc010enh.2_Missense_Mutation_p.I733M|CPT1C_uc010eni.1_Missense_Mutation_p.I301M	p.I733M	NM_152359	NP_689572	WXS	Illumina HiSeq	Unspecified	Q8TCG5	CPT1C_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.00786)	18	2404	+		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)	733			Cytoplasmic (Potential).		A8K0Z8|Q5K6N5|Q8N6Q9|Q8NDS6|Q8TE84	Missense_Mutation	SNP	ENST00000392518.4	37	c.2199C>G	CCDS12779.1	.	.	.	.	.	.	.	.	.	.	C	16.79	3.220792	0.58560	.	.	ENSG00000169169	ENST00000392518;ENST00000354199;ENST00000405931;ENST00000323446	D;D;D;D	0.91631	-2.88;-2.88;-2.88;-2.88	4.62	2.45	0.29901	.	0.000000	0.44285	D	0.000467	D	0.94212	0.8142	M	0.80183	2.485	0.80722	D	1	D;D	0.76494	0.999;0.993	D;D	0.74023	0.97;0.982	D	0.91853	0.5493	10	0.87932	D	0	-25.7173	3.1199	0.06387	0.3115:0.4494:0.1516:0.0875	.	722;733	Q8TCG5-2;Q8TCG5	.;CPT1C_HUMAN	M	733;644;722;733	ENSP00000376303:I733M;ENSP00000346138:I644M;ENSP00000384465:I722M;ENSP00000319343:I733M	ENSP00000319343:I733M	I	+	3	3	CPT1C	54908106	0.992000	0.36948	1.000000	0.80357	0.998000	0.95712	0.300000	0.19156	0.668000	0.31126	0.650000	0.86243	ATC		0.493	CPT1C-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465873.1	NM_152359		121	214	0	0	0	0	121	214				
MYH14	79784	broad.mit.edu	37	19	50720993	50720993	+	Missense_Mutation	SNP	C	C	A			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr19:50720993C>A	ENST00000596571.1	+	2	527	c.527C>A	c.(526-528)gCa>gAa	p.A176E	MYH14_ENST00000598205.1_Missense_Mutation_p.A176E|MYH14_ENST00000262269.8_Missense_Mutation_p.A176E|MYH14_ENST00000601313.1_Missense_Mutation_p.A176E|MYH14_ENST00000425460.1_Missense_Mutation_p.A176E|MYH14_ENST00000376970.2_Missense_Mutation_p.A176E|MYH14_ENST00000440075.2_Missense_Mutation_p.A176E			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	176	Myosin motor.				actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		CACGTGTACGCAGTGACCGAG	0.637																																						uc002prr.1		NA																	0				central_nervous_system(1)	1						c.(526-528)GCA>GAA		myosin, heavy chain 14 isoform 2							58.0	65.0	62.0					19																	50720993		2123	4248	6371	SO:0001583	missense	79784				axon guidance|regulation of cell shape	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity	g.chr19:50720993C>A	AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.527C>A	19.37:g.50720993C>A	ENSP00000472819:p.Ala176Glu		Somatic				MYH14_uc010enu.1_Missense_Mutation_p.A176E|MYH14_uc002prq.1_Missense_Mutation_p.A176E	p.A176E	NM_024729	NP_079005	WXS	Illumina HiSeq	Unspecified	Q7Z406	MYH14_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)	3	574	+		all_neural(266;0.0571)|Ovarian(192;0.0728)	176			Myosin head-like.		B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Missense_Mutation	SNP	ENST00000596571.1	37	c.527C>A	CCDS59411.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.533275	0.85812	.	.	ENSG00000105357	ENST00000301415;ENST00000440075;ENST00000376970;ENST00000425460;ENST00000376965;ENST00000262269	D;D;D;D	0.88664	-2.41;-2.41;-2.41;-2.41	4.63	4.63	0.57726	Myosin head, motor domain (2);	.	.	.	.	D	0.95793	0.8631	H	0.94808	3.585	0.80722	D	1	D;D;D	0.76494	0.996;0.999;0.999	D;D;D	0.73380	0.95;0.98;0.967	D	0.96731	0.9539	9	0.87932	D	0	.	15.3635	0.74499	0.0:1.0:0.0:0.0	.	176;176;176	Q7Z406-2;Q7Z406;Q7Z406-6	.;MYH14_HUMAN;.	E	176	ENSP00000406273:A176E;ENSP00000366169:A176E;ENSP00000407879:A176E;ENSP00000262269:A176E	ENSP00000262269:A176E	A	+	2	0	MYH14	55412805	1.000000	0.71417	0.598000	0.28837	0.714000	0.41099	7.606000	0.82863	2.579000	0.87056	0.655000	0.94253	GCA		0.637	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464710.2	NM_024729		42	71	1	0	2.56e-15	2.94e-15	42	71				
ZNF845	91664	broad.mit.edu	37	19	53856710	53856710	+	Missense_Mutation	SNP	T	T	G			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr19:53856710T>G	ENST00000595091.1	+	5	3001	c.2782T>G	c.(2782-2784)Tca>Gca	p.S928A	ZNF845_ENST00000458035.1_Missense_Mutation_p.S928A			Q96IR2	ZN845_HUMAN	zinc finger protein 845	928					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(10)|lung(7)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	26						CCGTCACAATTCAGTCCTTGT	0.373																																						uc010ydv.1		NA																	0					0						c.(2782-2784)TCA>GCA		zinc finger protein 845							33.0	30.0	31.0					19																	53856710		692	1591	2283	SO:0001583	missense	91664				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53856710T>G	BC007307	CCDS46170.1	19q13.42	2013-01-08			ENSG00000213799	ENSG00000213799		"""Zinc fingers, C2H2-type"", ""-"""	25112	protein-coding gene	gene with protein product							Standard	NM_138374		Approved		uc010ydv.1	Q96IR2		ENST00000595091.1:c.2782T>G	19.37:g.53856710T>G	ENSP00000470005:p.Ser928Ala		Somatic				ZNF845_uc010ydw.1_Missense_Mutation_p.S928A	p.S928A	NM_138374	NP_612383	WXS	Illumina HiSeq	Unspecified	Q96IR2	ZN845_HUMAN			4	2899	+			928			C2H2-type 26.			Missense_Mutation	SNP	ENST00000595091.1	37	c.2782T>G	CCDS46170.1	.	.	.	.	.	.	.	.	.	.	T	7.684	0.689624	0.14973	.	.	ENSG00000213799	ENST00000458035;ENST00000427984	T	0.40756	1.02	2.0	0.819	0.18785	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.34106	0.0886	L	0.49350	1.555	0.09310	N	1	B	0.18013	0.025	B	0.21708	0.036	T	0.31752	-0.9932	9	0.49607	T	0.09	.	5.5659	0.17170	0.4372:0.0:0.0:0.5628	.	928	Q96IR2	ZN845_HUMAN	A	928;844	ENSP00000388311:S928A	ENSP00000412086:S844A	S	+	1	0	ZNF845	58548522	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.832000	0.04400	0.011000	0.14865	0.333000	0.21579	TCA		0.373	ZNF845-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464359.1	XM_039908		14	21	0	0	0	0	14	21				
YWHAQ	10971	broad.mit.edu	37	2	9770492	9770492	+	Silent	SNP	G	G	C			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr2:9770492G>C	ENST00000381844.4	-	1	253	c.90C>G	c.(88-90)acC>acG	p.T30T	YWHAQ_ENST00000238081.3_Silent_p.T30T			P27348	1433T_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta	30					apoptotic process (GO:0006915)|intrinsic apoptotic signaling pathway (GO:0097193)|membrane organization (GO:0061024)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein targeting (GO:0006605)|small GTPase mediated signal transduction (GO:0007264)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|protein complex (GO:0043234)	protein N-terminus binding (GO:0047485)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)	6	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.241)		CGCCCTGCTCGGTCACTGCCT	0.662																																						uc002qzw.2		NA																	0				breast(1)	1						c.(88-90)ACC>ACG		tyrosine 3/tryptophan 5 -monooxygenase							39.0	38.0	38.0					2																	9770492		2203	4300	6503	SO:0001819	synonymous_variant	10971				negative regulation of transcription, DNA-dependent	centrosome|nucleus	protein N-terminus binding	g.chr2:9770492G>C	AF070556	CCDS1666.1	2p25.2-p25.1	2013-12-03	2013-12-03		ENSG00000134308	ENSG00000134308			12854	protein-coding gene	gene with protein product	"""protein tau"""	609009	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide"""			11080204	Standard	NM_006826		Approved	HS1, 14-3-3	uc002qzx.3	P27348	OTTHUMG00000013848	ENST00000381844.4:c.90C>G	2.37:g.9770492G>C			Somatic				YWHAQ_uc002qzx.2_Silent_p.T30T	p.T30T	NM_006826	NP_006817	WXS	Illumina HiSeq	Unspecified	P27348	1433T_HUMAN		Epithelial(75;0.241)	1	254	-	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		30					D6W4Z5|Q567U5|Q5TZU8|Q9UP48	Silent	SNP	ENST00000381844.4	37	c.90C>G	CCDS1666.1																																																																																				0.662	YWHAQ-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039014.4	NM_006826		25	28	0	0	0	0	25	28				
REG1B	5968	broad.mit.edu	37	2	79313560	79313560	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr2:79313560G>T	ENST00000305089.3	-	4	334	c.254C>A	c.(253-255)gCc>gAc	p.A85D		NM_006507.3	NP_006498.1	P48304	REG1B_HUMAN	regenerating islet-derived 1 beta	85	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell proliferation (GO:0008283)	extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(40)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	51						AATCAGTGAGGCCACGAAGGC	0.502																																						uc002sny.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(253-255)GCC>GAC		regenerating islet-derived 1 beta precursor							130.0	116.0	121.0					2																	79313560		2203	4300	6503	SO:0001583	missense	5968				cell proliferation	extracellular region	sugar binding	g.chr2:79313560G>T		CCDS1963.1	2p12	2008-06-04	2008-06-04		ENSG00000172023	ENSG00000172023			9952	protein-coding gene	gene with protein product	"""lithostathine 1 beta"", ""secretory pancreatic stone protein 2"""	167771	"""regenerating islet-derived 1 beta (pancreatic stone protein, pancreatic thread protein)"""			8110835	Standard	NM_006507		Approved	REGL, PSPS2, REGH, REGI-BETA	uc002sny.2	P48304	OTTHUMG00000130019	ENST00000305089.3:c.254C>A	2.37:g.79313560G>T	ENSP00000303206:p.Ala85Asp		Somatic				REG1B_uc010ffv.1_Missense_Mutation_p.A85D|REG1B_uc010ffw.2_3'UTR	p.A85D	NM_006507	NP_006498	WXS	Illumina HiSeq	Unspecified	P48304	REG1B_HUMAN			4	366	-			85			C-type lectin.			Missense_Mutation	SNP	ENST00000305089.3	37	c.254C>A	CCDS1963.1	.	.	.	.	.	.	.	.	.	.	g	15.99	2.996095	0.54147	.	.	ENSG00000172023	ENST00000454188;ENST00000305089	T;T	0.19532	2.14;2.14	3.51	1.63	0.23807	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.37178	N	0.002209	T	0.43656	0.1257	M	0.88704	2.975	0.28385	N	0.919346	D;D	0.89917	1.0;0.999	D;D	0.75020	0.985;0.975	T	0.29181	-1.0020	10	0.45353	T	0.12	.	4.8425	0.13498	0.1265:0.2209:0.6527:0.0	.	85;85	Q6ICS1;P48304	.;REG1B_HUMAN	D	36;85	ENSP00000387410:A36D;ENSP00000303206:A85D	ENSP00000303206:A85D	A	-	2	0	REG1B	79167068	0.025000	0.19082	0.392000	0.26245	0.958000	0.62258	0.984000	0.29565	0.282000	0.22254	0.491000	0.48974	GCC		0.502	REG1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252292.2	NM_006507		56	66	1	0	2.54e-28	2.97e-28	56	66				
ACTR1B	10120	broad.mit.edu	37	2	98274472	98274472	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr2:98274472C>T	ENST00000289228.5	-	8	1075	c.859G>A	c.(859-861)Gac>Aac	p.D287N		NM_005735.3	NP_005726.1	P42025	ACTY_HUMAN	ARP1 actin-related protein 1 homolog B, centractin beta (yeast)	287					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)			endometrium(1)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	15						AGGTCCATGTCGGACTTGTGT	0.607																																						uc002syb.2		NA																	0				skin(1)	1						c.(859-861)GAC>AAC		ARP1 actin-related protein 1 homolog B,							84.0	77.0	80.0					2																	98274472		2203	4300	6503	SO:0001583	missense	10120					centrosome|dynactin complex	ATP binding|protein binding	g.chr2:98274472C>T	X82207	CCDS2033.1	2q11.1-q11.2	2008-05-20	2001-11-28		ENSG00000115073	ENSG00000115073			168	protein-coding gene	gene with protein product		605144	"""ARP1 (actin-related protein 1, yeast) homolog B (centractin beta)"""	CTRN2		7696711, 10343100	Standard	NM_005735		Approved		uc002syb.2	P42025	OTTHUMG00000130549	ENST00000289228.5:c.859G>A	2.37:g.98274472C>T	ENSP00000289228:p.Asp287Asn		Somatic					p.D287N	NM_005735	NP_005726	WXS	Illumina HiSeq	Unspecified	P42025	ACTY_HUMAN			8	1067	-			287					D3DVH2|Q53SK5|Q9BRB7	Missense_Mutation	SNP	ENST00000289228.5	37	c.859G>A	CCDS2033.1	.	.	.	.	.	.	.	.	.	.	.	29.1	4.975968	0.92982	.	.	ENSG00000115073	ENST00000289228	T	0.09630	2.96	4.46	4.46	0.54185	.	0.000000	0.85682	D	0.000000	T	0.37705	0.1013	M	0.86651	2.83	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.41840	-0.9486	10	0.87932	D	0	.	14.636	0.68689	0.0:1.0:0.0:0.0	.	287	P42025	ACTY_HUMAN	N	287	ENSP00000289228:D287N	ENSP00000289228:D287N	D	-	1	0	ACTR1B	97640904	1.000000	0.71417	0.952000	0.39060	0.919000	0.55068	7.557000	0.82243	2.303000	0.77524	0.655000	0.94253	GAC		0.607	ACTR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252973.1	NM_005735		5	128	0	0	0	0	5	128				
HS6ST1	9394	broad.mit.edu	37	2	129026403	129026403	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr2:129026403C>G	ENST00000259241.6	-	2	582	c.569G>C	c.(568-570)cGc>cCc	p.R190P		NM_004807.2	NP_004798.3	O60243	H6ST1_HUMAN	heparan sulfate 6-O-sulfotransferase 1	190	3'-phosphate binding. {ECO:0000255}.				angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|labyrinthine layer blood vessel development (GO:0060716)|lung alveolus development (GO:0048286)|neuron development (GO:0048666)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)|sulfotransferase activity (GO:0008146)			endometrium(3)|liver(1)|lung(7)|pancreas(1)|prostate(2)|skin(1)	15	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.117)		GCTCAGGTAGCGGGACACGGG	0.642																																						uc002tpt.3		NA																	0				pancreas(1)	1						c.(568-570)CGC>CCC		heparan sulfate 6-O-sulfotransferase 1							31.0	34.0	33.0					2																	129026403		1973	4013	5986	SO:0001583	missense	9394				heparan sulfate proteoglycan biosynthetic process, enzymatic modification	integral to plasma membrane	sulfotransferase activity	g.chr2:129026403C>G	AB006179	CCDS42748.1	2q21	2010-03-19		2002-08-23	ENSG00000136720	ENSG00000136720		"""Sulfotransferases, membrane-bound"""	5201	protein-coding gene	gene with protein product		604846		HS6ST		9535912	Standard	NM_004807		Approved		uc002tpt.4	O60243	OTTHUMG00000153542	ENST00000259241.6:c.569G>C	2.37:g.129026403C>G	ENSP00000259241:p.Arg190Pro		Somatic					p.R190P	NM_004807	NP_004798	WXS	Illumina HiSeq	Unspecified	O60243	H6ST1_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.117)	2	603	-	Colorectal(110;0.1)		190			Lumenal (Potential).|3'-phosphate binding (Potential).		B4DEP2|B4DJ29|Q53SL2|Q9BVI1	Missense_Mutation	SNP	ENST00000259241.6	37	c.569G>C	CCDS42748.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.648489	0.87958	.	.	ENSG00000136720	ENST00000259241	D	0.98978	-5.29	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	D	0.99408	0.9791	M	0.90814	3.15	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.98681	1.0692	9	.	.	.	.	17.9666	0.89101	0.0:1.0:0.0:0.0	.	190	O60243	H6ST1_HUMAN	P	190	ENSP00000259241:R190P	.	R	-	2	0	HS6ST1	128742873	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.487000	0.81328	2.235000	0.73313	0.462000	0.41574	CGC		0.642	HS6ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331572.1	NM_004807		19	53	0	0	0	0	19	53				
GMPPA	29926	broad.mit.edu	37	2	220368880	220368880	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr2:220368880G>A	ENST00000358215.3	+	7	934	c.565G>A	c.(565-567)Gaa>Aaa	p.E189K	GMPPA_ENST00000373908.1_Missense_Mutation_p.E189K|GMPPA_ENST00000341142.3_Missense_Mutation_p.E189K|GMPPA_ENST00000373917.3_Missense_Mutation_p.E189K|GMPPA_ENST00000313597.5_Missense_Mutation_p.E189K|AC053503.11_ENST00000429882.1_RNA	NM_205847.2	NP_995319.1	Q96IJ6	GMPPA_HUMAN	GDP-mannose pyrophosphorylase A	189					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotidyltransferase activity (GO:0016779)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	20		Renal(207;0.0183)		Epithelial(149;3.82e-10)|all cancers(144;6.25e-08)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00807)|READ - Rectum adenocarcinoma(5;0.148)		CTTTTCTCCTGAAGCCTTGAA	0.527																																						uc002vlr.2		NA																	0					0						c.(565-567)GAA>AAA		GDP-mannose pyrophosphorylase A							207.0	182.0	191.0					2																	220368880		2203	4300	6503	SO:0001583	missense	29926				dolichol-linked oligosaccharide biosynthetic process|GDP-mannose biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine		GTP binding|mannose-1-phosphate guanylyltransferase activity	g.chr2:220368880G>A	AF135422	CCDS2441.1	2q36.1	2008-02-05			ENSG00000144591	ENSG00000144591			22923	protein-coding gene	gene with protein product		615495					Standard	NM_205847		Approved		uc002vlr.3	Q96IJ6	OTTHUMG00000058922	ENST00000358215.3:c.565G>A	2.37:g.220368880G>A	ENSP00000350949:p.Glu189Lys		Somatic				GMPPA_uc002vls.2_Missense_Mutation_p.E189K|GMPPA_uc002vlt.2_Missense_Mutation_p.E189K|GMPPA_uc002vlu.2_Missense_Mutation_p.E189K|GMPPA_uc002vlv.2_Missense_Mutation_p.E189K|GMPPA_uc002vlw.2_RNA|GMPPA_uc002vlx.2_Missense_Mutation_p.E189K	p.E189K	NM_013335	NP_037467	WXS	Illumina HiSeq	Unspecified	Q96IJ6	GMPPA_HUMAN		Epithelial(149;3.82e-10)|all cancers(144;6.25e-08)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00807)|READ - Rectum adenocarcinoma(5;0.148)	7	633	+		Renal(207;0.0183)	189					A6NJ74|A8K3Q6|B3KMT4|Q53GI0|Q9NWC3|Q9Y5P5	Missense_Mutation	SNP	ENST00000358215.3	37	c.565G>A	CCDS2441.1	.	.	.	.	.	.	.	.	.	.	G	14.63	2.592426	0.46214	.	.	ENSG00000144591	ENST00000313597;ENST00000373917;ENST00000358215;ENST00000373908;ENST00000435316;ENST00000341142;ENST00000373924	D;D;D;D;T;D	0.94232	-3.38;-3.38;-3.38;-3.38;-0.73;-3.38	5.13	5.13	0.70059	Nucleotidyl transferase (1);	0.358899	0.29389	N	0.012282	D	0.90034	0.6888	L	0.45698	1.435	0.50467	D	0.999877	B;B	0.18166	0.026;0.01	B;B	0.22152	0.025;0.038	D	0.85853	0.1405	10	0.25106	T	0.35	-3.5053	13.2077	0.59807	0.0:0.0:0.8406:0.1593	.	189;189	Q96IJ6-2;Q96IJ6	.;GMPPA_HUMAN	K	189;189;189;189;154;189;119	ENSP00000315925:E189K;ENSP00000363027:E189K;ENSP00000350949:E189K;ENSP00000363016:E189K;ENSP00000411060:E154K;ENSP00000340760:E189K	ENSP00000315925:E189K	E	+	1	0	GMPPA	220077124	1.000000	0.71417	0.974000	0.42286	0.510000	0.34073	5.482000	0.66833	2.392000	0.81423	0.591000	0.81541	GAA		0.527	GMPPA-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130230.1	NM_013335		5	128	0	0	0	0	5	128				
HTR2B	3357	broad.mit.edu	37	2	231973477	231973477	+	Silent	SNP	C	C	A			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr2:231973477C>A	ENST00000258400.3	-	4	1712	c.1200G>T	c.(1198-1200)cgG>cgT	p.R400R	PSMD1_ENST00000373635.4_Intron|PSMD1_ENST00000488354.1_3'UTR|PSMD1_ENST00000409643.1_Intron|PSMD1_ENST00000308696.6_Intron	NM_000867.4	NP_000858.3	P41595	5HT2B_HUMAN	5-hydroxytryptamine (serotonin) receptor 2B, G protein-coupled	400					activation of phospholipase C activity (GO:0007202)|behavior (GO:0007610)|calcium-mediated signaling (GO:0019722)|cardiac muscle hypertrophy (GO:0003300)|cellular calcium ion homeostasis (GO:0006874)|cellular response to temperature stimulus (GO:0071502)|cGMP biosynthetic process (GO:0006182)|embryonic morphogenesis (GO:0048598)|ERK1 and ERK2 cascade (GO:0070371)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway (GO:0007186)|heart morphogenesis (GO:0003007)|intestine smooth muscle contraction (GO:0014827)|negative regulation of apoptotic process (GO:0043066)|negative regulation of autophagy (GO:0010507)|negative regulation of cell death (GO:0060548)|neural crest cell differentiation (GO:0014033)|neural crest cell migration (GO:0001755)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphorylation (GO:0016310)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine production (GO:0001819)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|protein kinase C signaling (GO:0070528)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of behavior (GO:0050795)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|vasoconstriction (GO:0042310)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	drug binding (GO:0008144)|G-protein alpha-subunit binding (GO:0001965)|Ras GTPase activator activity (GO:0005099)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|urinary_tract(1)	11		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)|Medulloblastoma(418;0.232)		Epithelial(121;4.48e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0141)	Amoxapine(DB00543)|Apomorphine(DB00714)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clomipramine(DB01242)|Dihydroergotamine(DB00320)|Doxepin(DB01142)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ketamine(DB01221)|Lisuride(DB00589)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Pergolide(DB01186)|Pramipexole(DB00413)|Ropinirole(DB00268)|Triflupromazine(DB00508)|Yohimbine(DB01392)	ACTTTGTGGCCCGGTAATTGC	0.428																																					Ovarian(155;1331 1891 12853 14038 34991)	uc002vro.2		NA																	0					0						c.(1198-1200)CGG>CGT		5-hydroxytryptamine (serotonin) receptor 2B	Chlorprothixene(DB01239)|Eletriptan(DB00216)|Fenfluramine(DB00574)|Methotrimeprazine(DB01403)|Minaprine(DB00805)|Quetiapine(DB01224)|Sumatriptan(DB00669)|Tegaserod(DB01079)|Triflupromazine(DB00508)						137.0	136.0	136.0					2																	231973477		2203	4300	6503	SO:0001819	synonymous_variant	3357				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cardiac muscle hypertrophy|cellular response to calcium ion|cellular response to temperature stimulus|cGMP biosynthetic process|embryonic morphogenesis|ERK1 and ERK2 cascade|G-protein coupled receptor internalization|heart morphogenesis|intestine smooth muscle contraction|negative regulation of apoptosis|negative regulation of autophagy|neural crest cell migration|phosphatidylinositol 3-kinase cascade|phosphatidylinositol biosynthetic process|phosphorylation|positive regulation of cell division|positive regulation of cytokine production|positive regulation of cytokine secretion|positive regulation of endothelial cell proliferation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of MAP kinase activity|positive regulation of nitric-oxide synthase activity|protein kinase C signaling cascade|regulation of behavior|release of sequestered calcium ion into cytosol|response to drug|vasoconstriction	cytoplasm|integral to membrane|plasma membrane	calcium channel activity|drug binding|G-protein alpha-subunit binding|phosphatidylinositol phospholipase C activity|Ras GTPase activator activity|serotonin binding|serotonin receptor activity	g.chr2:231973477C>A		CCDS2483.1	2q36.3-q37.1	2012-08-08	2012-02-03		ENSG00000135914	ENSG00000135914		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5294	protein-coding gene	gene with protein product		601122	"""5-hydroxytryptamine (serotonin) receptor 2B"""			8143856	Standard	NM_000867		Approved	5-HT(2B), 5-HT2B	uc002vro.3	P41595	OTTHUMG00000133222	ENST00000258400.3:c.1200G>T	2.37:g.231973477C>A			Somatic				PSMD1_uc002vrm.1_Intron|PSMD1_uc010fxu.1_Intron|PSMD1_uc002vrn.1_Intron|HTR2B_uc010fxv.2_Silent_p.R333R	p.R400R	NM_000867	NP_000858	WXS	Illumina HiSeq	Unspecified	P41595	5HT2B_HUMAN		Epithelial(121;4.48e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0141)	4	1705	-		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)|Medulloblastoma(418;0.232)	400			Cytoplasmic (By similarity).		B2R9D5|Q53TI1|Q62221|Q6P523	Silent	SNP	ENST00000258400.3	37	c.1200G>T	CCDS2483.1																																																																																				0.428	HTR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256957.2	NM_000867		4	147	1	0	0.00909568	0.00957055	4	147				
ADAM33	80332	broad.mit.edu	37	20	3652265	3652265	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr20:3652265C>T	ENST00000356518.2	-	16	2109	c.1868G>A	c.(1867-1869)gGc>gAc	p.G623D	ADAM33_ENST00000379861.4_Missense_Mutation_p.G623D|ADAM33_ENST00000466620.1_5'UTR|ADAM33_ENST00000350009.2_Missense_Mutation_p.G623D	NM_025220.2	NP_079496.1	Q9BZ11	ADA33_HUMAN	ADAM metallopeptidase domain 33	623	Cys-rich.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|skin(3)	29						CTCTACCAGGCCCAGGCCAAG	0.632																																						uc002wit.2		NA																	0				large_intestine(2)|ovary(1)|skin(1)	4						c.(1867-1869)GGC>GAC		ADAM metallopeptidase domain 33 isoform alpha							21.0	19.0	20.0					20																	3652265		2197	4292	6489	SO:0001583	missense	80332				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding	g.chr20:3652265C>T	AL117415, AB055891	CCDS13058.1, CCDS63219.1	20p13	2010-04-06	2005-08-18		ENSG00000149451	ENSG00000149451		"""ADAM metallopeptidase domain containing"""	15478	protein-coding gene	gene with protein product		607114	"""a disintegrin and metalloproteinase domain 33"", ""chromosome 20 open reading frame 153"""	C20orf153		11814695	Standard	XM_005260843		Approved	DKFZp434K0521, dJ964F7.1	uc002wit.3	Q9BZ11	OTTHUMG00000031758	ENST00000356518.2:c.1868G>A	20.37:g.3652265C>T	ENSP00000348912:p.Gly623Asp		Somatic				ADAM33_uc002wiq.1_5'Flank|ADAM33_uc002wir.1_Missense_Mutation_p.G623D|ADAM33_uc002wis.2_Missense_Mutation_p.G145D|ADAM33_uc002wiu.2_Missense_Mutation_p.G623D|uc002wiv.1_5'Flank|ADAM33_uc002wiw.1_RNA|ADAM33_uc010gba.1_Intron|ADAM33_uc010gbb.1_Missense_Mutation_p.G139D	p.G623D	NM_025220	NP_079496	WXS	Illumina HiSeq	Unspecified	Q9BZ11	ADA33_HUMAN			16	1955	-			623			Extracellular (Potential).|Cys-rich.		A0A1K6|Q5JT75|Q5JT76|Q8N0W6	Missense_Mutation	SNP	ENST00000356518.2	37	c.1868G>A	CCDS13058.1	.	.	.	.	.	.	.	.	.	.	C	17.25	3.342585	0.61073	.	.	ENSG00000149451	ENST00000356518;ENST00000379861;ENST00000350009;ENST00000428784;ENST00000439201	T;T;T	0.02015	4.53;4.53;4.5	5.46	5.46	0.80206	ADAM, cysteine-rich (1);	.	.	.	.	T	0.14527	0.0351	M	0.80982	2.52	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.991;0.979;0.979	T	0.00070	-1.2133	9	0.87932	D	0	.	17.8629	0.88787	0.0:1.0:0.0:0.0	.	139;623;623;623	E9PEB2;Q9BZ11-2;Q9BZ11;A2A2L3	.;.;ADA33_HUMAN;.	D	623;623;623;139;503	ENSP00000348912:G623D;ENSP00000369190:G623D;ENSP00000322550:G623D	ENSP00000322550:G623D	G	-	2	0	ADAM33	3600265	0.633000	0.27181	0.931000	0.37212	0.025000	0.11179	1.146000	0.31589	2.558000	0.86282	0.561000	0.74099	GGC		0.632	ADAM33-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077763.2	NM_025220		3	29	0	0	0	0	3	29				
CDC25B	994	broad.mit.edu	37	20	3781917	3781917	+	Missense_Mutation	SNP	G	G	A	rs201435494	byFrequency	TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr20:3781917G>A	ENST00000245960.5	+	8	1419	c.722G>A	c.(721-723)cGg>cAg	p.R241Q	CDC25B_ENST00000467519.1_3'UTR|CDC25B_ENST00000344256.6_Missense_Mutation_p.R177Q|CDC25B_ENST00000340833.4_Missense_Mutation_p.R200Q|CDC25B_ENST00000439880.2_Missense_Mutation_p.R227Q|CDC25B_ENST00000379598.5_Missense_Mutation_p.R177Q	NM_004358.3|NM_021872.2|NM_021873.2	NP_004349.1|NP_068658.1|NP_068659.1	P30305	MPIP2_HUMAN	cell division cycle 25B	241					female meiosis I (GO:0007144)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|oocyte maturation (GO:0001556)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein kinase activity (GO:0045860)|protein phosphorylation (GO:0006468)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			NS(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(1)	18						AGTCCTGACCGGAAGATGGAA	0.562													G|||	3	0.000599042	0.0015	0.0	5008	,	,		19451	0.0		0.0	False		,,,				2504	0.001					uc002wjn.2		NA																	0				lung(3)|ovary(2)	5						c.(721-723)CGG>CAG		cell division cycle 25B isoform 1							102.0	97.0	98.0					20																	3781917		2203	4300	6503	SO:0001583	missense	994				cell division|G2/M transition of mitotic cell cycle|mitosis|positive regulation of cell proliferation	cytosol|microtubule organizing center|nucleoplasm	protein binding|protein tyrosine phosphatase activity	g.chr20:3781917G>A		CCDS13065.1, CCDS13066.1, CCDS13067.1, CCDS74700.1, CCDS74701.1	20p13	2013-01-17	2013-01-17		ENSG00000101224	ENSG00000101224		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"""	1726	protein-coding gene	gene with protein product		116949	"""cell division cycle 25B"", ""cell division cycle 25 homolog B (S. cerevisiae)"", ""cell division cycle 25 homolog B (S. pombe)"""			1836978	Standard	NM_021873		Approved		uc002wjn.3	P30305	OTTHUMG00000031764	ENST00000245960.5:c.722G>A	20.37:g.3781917G>A	ENSP00000245960:p.Arg241Gln		Somatic				CDC25B_uc010zqk.1_Missense_Mutation_p.R177Q|CDC25B_uc010zql.1_Missense_Mutation_p.R163Q|CDC25B_uc010zqm.1_Missense_Mutation_p.R177Q|CDC25B_uc002wjl.2_Missense_Mutation_p.R129Q|CDC25B_uc002wjm.2_Missense_Mutation_p.R129Q|CDC25B_uc002wjo.2_Missense_Mutation_p.R227Q|CDC25B_uc002wjp.2_Missense_Mutation_p.R200Q|CDC25B_uc002wjq.2_Missense_Mutation_p.R41Q|CDC25B_uc010gbc.2_5'Flank	p.R241Q	NM_021873	NP_068659	WXS	Illumina HiSeq	Unspecified	P30305	MPIP2_HUMAN			8	1500	+			241					D3DVY1|D3DVY2|D3DVY3|D3DVY4|O43551|Q13971|Q5JX77|Q6RSS1|Q9BRA6	Missense_Mutation	SNP	ENST00000245960.5	37	c.722G>A	CCDS13067.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	G	10.05	1.243553	0.22796	.	.	ENSG00000101224	ENST00000344256;ENST00000379598;ENST00000245960;ENST00000439880;ENST00000340833	T;T;T;T;T	0.23147	1.92;1.92;1.92;1.92;1.92	4.53	-2.36	0.06663	.	0.919120	0.09244	N	0.828751	T	0.16599	0.0399	L	0.34521	1.04	0.20764	N	0.999853	P;P;P;P;P;P	0.50710	0.833;0.902;0.833;0.799;0.799;0.938	B;B;B;B;B;B	0.41571	0.187;0.187;0.187;0.117;0.117;0.36	T	0.27400	-1.0075	10	0.21540	T	0.41	-1.8948	8.9833	0.35979	0.552:0.0:0.448:0.0	.	177;163;177;200;227;241	B4DQZ3;B4DRC3;B4DIG0;P30305-3;P30305-2;P30305	.;.;.;.;.;MPIP2_HUMAN	Q	177;177;241;227;200	ENSP00000339125:R177Q;ENSP00000368918:R177Q;ENSP00000245960:R241Q;ENSP00000405972:R227Q;ENSP00000339170:R200Q	ENSP00000245960:R241Q	R	+	2	0	CDC25B	3729917	0.000000	0.05858	0.376000	0.26042	0.564000	0.35744	-0.442000	0.06871	-0.518000	0.06452	-0.258000	0.10820	CGG		0.562	CDC25B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077779.2	NM_021874		5	238	0	0	0	0	5	238				
HAO1	54363	broad.mit.edu	37	20	7920988	7920988	+	Missense_Mutation	SNP	T	T	C			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr20:7920988T>C	ENST00000378789.3	-	1	133	c.82A>G	c.(82-84)Agg>Ggg	p.R28G		NM_017545.2	NP_060015.1	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase (glycolate oxidase) 1	28	FMN hydroxy acid dehydrogenase. {ECO:0000255|PROSITE-ProRule:PRU00683}.				cellular nitrogen compound metabolic process (GO:0034641)|fatty acid alpha-oxidation (GO:0001561)|glycolate catabolic process (GO:0046296)|glyoxylate metabolic process (GO:0046487)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	(S)-2-hydroxy-acid oxidase activity (GO:0003973)|FMN binding (GO:0010181)|glycolate oxidase activity (GO:0008891)|glyoxylate oxidase activity (GO:0047969)|long-chain-(S)-2-hydroxy-long-chain-acid oxidase activity (GO:0052853)|medium-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052854)|receptor binding (GO:0005102)|very-long-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052852)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						GCCCCAGACCTGTAATAGTCA	0.313																																						uc002wmw.1		NA																	0				ovary(3)	3						c.(82-84)AGG>GGG		hydroxyacid oxidase 1							70.0	71.0	70.0					20																	7920988		2203	4300	6503	SO:0001583	missense	54363				cellular nitrogen compound metabolic process|fatty acid alpha-oxidation|glycolate catabolic process|glyoxylate metabolic process	peroxisomal matrix	FMN binding|glycolate oxidase activity|glyoxylate oxidase activity	g.chr20:7920988T>C	AL021879	CCDS13100.1	20p12	2005-01-10			ENSG00000101323	ENSG00000101323	1.1.3.15		4809	protein-coding gene	gene with protein product		605023		GOX1		9891009	Standard	NM_017545		Approved	GOX	uc002wmw.1	Q9UJM8	OTTHUMG00000031841	ENST00000378789.3:c.82A>G	20.37:g.7920988T>C	ENSP00000368066:p.Arg28Gly		Somatic				HAO1_uc010gbu.2_Missense_Mutation_p.R28G	p.R28G	NM_017545	NP_060015	WXS	Illumina HiSeq	Unspecified	Q9UJM8	HAOX1_HUMAN			1	106	-			28			FMN hydroxy acid dehydrogenase.		Q14CQ0|Q9UPZ0|Q9Y3I7	Missense_Mutation	SNP	ENST00000378789.3	37	c.82A>G	CCDS13100.1	.	.	.	.	.	.	.	.	.	.	T	8.825	0.938413	0.18206	.	.	ENSG00000101323	ENST00000378789	T	0.30182	1.54	5.16	3.98	0.46160	Aldolase-type TIM barrel (1);FMN-dependent dehydrogenase (1);	0.298997	0.41605	D	0.000858	T	0.22704	0.0548	L	0.35854	1.095	0.21416	N	0.999696	B;B	0.06786	0.001;0.001	B;B	0.12837	0.008;0.008	T	0.10567	-1.0624	10	0.24483	T	0.36	-10.0061	10.8499	0.46765	0.0:0.0:0.2637:0.7363	.	28;28	A8K058;Q9UJM8	.;HAOX1_HUMAN	G	28	ENSP00000368066:R28G	ENSP00000368066:R28G	R	-	1	2	HAO1	7868988	0.050000	0.20438	0.820000	0.32676	0.853000	0.48598	2.443000	0.44881	2.060000	0.61445	0.459000	0.35465	AGG		0.313	HAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077926.2			3	186	0	0	0	0	3	186				
PLAGL2	5326	broad.mit.edu	37	20	30784277	30784277	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr20:30784277C>T	ENST00000246229.4	-	3	1733	c.1469G>A	c.(1468-1470)cGt>cAt	p.R490H		NM_002657.3	NP_002648.1	Q9UPG8	PLAL2_HUMAN	pleiomorphic adenoma gene-like 2	490					chylomicron assembly (GO:0034378)|lipid metabolic process (GO:0006629)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|post-embryonic development (GO:0009791)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|liver(1)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	21			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			TTGATGGAAACGAGGCAGGGT	0.577																																					Colon(163;15 1893 11280 16306 47518)	uc002wxn.2		NA																	0				ovary(1)|skin(1)	2						c.(1468-1470)CGT>CAT		pleiomorphic adenoma gene-like 2							54.0	58.0	57.0					20																	30784277		2203	4300	6503	SO:0001583	missense	5326					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr20:30784277C>T		CCDS13197.1	20q11.21	2013-01-08			ENSG00000126003	ENSG00000126003		"""Zinc fingers, C2H2-type"""	9047	protein-coding gene	gene with protein product	"""C2H2-type zinc finger protein"""	604866				15585652, 17950244	Standard	NM_002657		Approved	ZNF900	uc002wxn.2	Q9UPG8	OTTHUMG00000032210	ENST00000246229.4:c.1469G>A	20.37:g.30784277C>T	ENSP00000246229:p.Arg490His		Somatic					p.R490H	NM_002657	NP_002648	WXS	Illumina HiSeq	Unspecified	Q9UPG8	PLAL2_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)		3	1686	-			490					A8K8T5|E1P5M3|Q92584	Missense_Mutation	SNP	ENST00000246229.4	37	c.1469G>A	CCDS13197.1	.	.	.	.	.	.	.	.	.	.	C	8.176	0.792787	0.16327	.	.	ENSG00000126003	ENST00000246229	T	0.10288	2.89	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.18341	0.0440	N	0.21545	0.675	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.07673	-1.0760	10	0.08599	T	0.76	.	18.0856	0.89456	0.0:1.0:0.0:0.0	.	490	Q9UPG8	PLAL2_HUMAN	H	490	ENSP00000246229:R490H	ENSP00000246229:R490H	R	-	2	0	PLAGL2	30247938	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.923000	0.70045	2.500000	0.84329	0.591000	0.81541	CGT		0.577	PLAGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078615.2	NM_002657		20	142	0	0	0	0	20	142				
ZNF512B	57473	broad.mit.edu	37	20	62660835	62660835	+	Intron	SNP	C	C	T			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr20:62660835C>T	ENST00000450537.1	-	1	56				ZNF512B_ENST00000217130.3_Intron|PRPF6_ENST00000535781.1_Missense_Mutation_p.A806V			Q96KM6	Z512B_HUMAN	zinc finger protein 512B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					GTGCTCCTGGCCGTGGCCAAG	0.587																																						uc002yho.2		NA																	0				ovary(2)	2						c.(2536-2538)GCC>GTC		PRP6 pre-mRNA processing factor 6 homolog							80.0	75.0	76.0					20																	62660835		2203	4300	6503	SO:0001627	intron_variant	24148				assembly of spliceosomal tri-snRNP|positive regulation of transcription from RNA polymerase II promoter|spliceosome assembly	catalytic step 2 spliceosome|nucleoplasm|U4/U6 snRNP|U4/U6 x U5 tri-snRNP complex|U5 snRNP	androgen receptor binding|ribonucleoprotein binding|transcription coactivator activity	g.chr20:62660835C>T	AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.4+19222G>A	20.37:g.62660835C>T			Somatic				PRPF6_uc002yhp.2_Missense_Mutation_p.A806V	p.A846V	NM_012469	NP_036601	WXS	Illumina HiSeq	Unspecified	O94906	PRP6_HUMAN			19	2705	+	all_cancers(38;6.47e-12)|all_epithelial(29;1.26e-13)|Lung NSC(23;9.37e-10)|all_lung(23;3.23e-09)		846					Q08AK9|Q9ULM4	Missense_Mutation	SNP	ENST00000450537.1	37	c.2537C>T	CCDS13548.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.819184	0.90873	.	.	ENSG00000101161	ENST00000266079;ENST00000535781	T;T	0.36340	1.26;1.26	5.44	4.48	0.54585	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.63474	0.2514	M	0.86178	2.8	0.80722	D	1	D;D	0.89917	0.985;1.0	P;D	0.91635	0.749;0.999	T	0.67277	-0.5711	10	0.52906	T	0.07	-15.2538	15.2286	0.73369	0.0:0.9286:0.0:0.0714	.	806;846	O94906-2;O94906	.;PRP6_HUMAN	V	846;806	ENSP00000266079:A846V;ENSP00000446216:A806V	ENSP00000266079:A846V	A	+	2	0	PRPF6	62131279	1.000000	0.71417	0.988000	0.46212	0.811000	0.45836	7.683000	0.84093	2.728000	0.93425	0.655000	0.94253	GCC		0.587	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080246.1	NM_020713		4	187	0	0	0	0	4	187				
TRIOBP	11078	broad.mit.edu	37	22	38154082	38154082	+	Silent	SNP	C	C	G			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr22:38154082C>G	ENST00000406386.3	+	16	6405	c.6150C>G	c.(6148-6150)ctC>ctG	p.L2050L	TRIOBP_ENST00000407319.2_Silent_p.L337L|TRIOBP_ENST00000403663.2_Silent_p.L337L	NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	2050					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					CTGCCCTGCTCAACCAAAGCC	0.642																																						uc003atr.2		NA																	0				central_nervous_system(1)	1						c.(6148-6150)CTC>CTG		TRIO and F-actin binding protein isoform 6							19.0	24.0	22.0					22																	38154082		2184	4262	6446	SO:0001819	synonymous_variant	11078				actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding	g.chr22:38154082C>G	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.6150C>G	22.37:g.38154082C>G			Somatic				TRIOBP_uc003atu.2_Silent_p.L1878L|TRIOBP_uc003atv.2_Silent_p.L337L|TRIOBP_uc003atw.2_Silent_p.L337L|TRIOBP_uc003atx.1_5'UTR|TRIOBP_uc010gxh.2_5'UTR	p.L2050L	NM_001039141	NP_001034230	WXS	Illumina HiSeq	Unspecified	Q9H2D6	TARA_HUMAN			16	6421	+	Melanoma(58;0.0574)		2050					B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Silent	SNP	ENST00000406386.3	37	c.6150C>G	CCDS43015.1	.	.	.	.	.	.	.	.	.	.	C	14.76	2.630432	0.46944	.	.	ENSG00000100106	ENST00000428075	.	.	.	5.66	3.43	0.39272	.	.	.	.	.	T	0.68100	0.2964	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.67581	-0.5634	4	.	.	.	.	13.7892	0.63128	0.0:0.5472:0.4528:0.0	.	.	.	.	E	291	.	.	Q	+	1	0	TRIOBP	36484028	0.997000	0.39634	1.000000	0.80357	0.993000	0.82548	0.258000	0.18387	1.380000	0.46344	0.561000	0.74099	CAA		0.642	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2			10	16	0	0	0	0	10	16				
NCAPH2	29781	broad.mit.edu	37	22	50961570	50961570	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr22:50961570G>C	ENST00000420993.2	+	19	1774	c.1652G>C	c.(1651-1653)cGt>cCt	p.R551P	CTA-384D8.36_ENST00000608319.1_RNA|NCAPH2_ENST00000395701.3_Missense_Mutation_p.R551P|NCAPH2_ENST00000299821.11_Missense_Mutation_p.R552P	NM_001185011.1|NM_152299.3	NP_001171940.1|NP_689512.2	Q6IBW4	CNDH2_HUMAN	non-SMC condensin II complex, subunit H2	551					chromosome condensation (GO:0030261)|mitotic cell cycle (GO:0000278)	chromosome (GO:0005694)|membrane (GO:0016020)|nucleoplasm (GO:0005654)				breast(1)|cervix(1)|endometrium(2)|kidney(3)|lung(10)|ovary(1)|prostate(2)|skin(3)|stomach(1)	24		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.212)		GAGGTGTGTCGTTCCATGCTG	0.647																																						uc003blr.3		NA																	0				ovary(1)|skin(1)	2						c.(1651-1653)CGT>CCT		kleisin beta isoform 2							57.0	52.0	54.0					22																	50961570		2202	4300	6502	SO:0001583	missense	29781				chromosome condensation	chromosome|nucleus		g.chr22:50961570G>C	BC001937	CCDS14094.2, CCDS43038.1, CCDS54546.1	22q13.33	2008-02-04			ENSG00000025770	ENSG00000025770			25071	protein-coding gene	gene with protein product	"""kleisin beta"", ""CAP-H2 subunit of the condensin II complex"""	611230				10493829	Standard	NM_014551		Approved	384D8-2, hCAP-H2, CAP-H2	uc003blx.4	Q6IBW4	OTTHUMG00000150205	ENST00000420993.2:c.1652G>C	22.37:g.50961570G>C	ENSP00000410088:p.Arg551Pro		Somatic				NCAPH2_uc003blv.2_Missense_Mutation_p.R551P|NCAPH2_uc010hbb.2_Intron|NCAPH2_uc003blu.3_RNA|NCAPH2_uc003bls.3_RNA|NCAPH2_uc003blt.3_RNA|NCAPH2_uc003blw.3_RNA|NCAPH2_uc003blx.3_Missense_Mutation_p.R552P|NCAPH2_uc003bly.3_RNA	p.R551P	NM_152299	NP_689512	WXS	Illumina HiSeq	Unspecified	Q6IBW4	CNDH2_HUMAN		BRCA - Breast invasive adenocarcinoma(115;0.212)	19	1774	+		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)	551					B7WPH1|O43788|Q13391|Q96C14|Q96GJ0|Q9BQ71|Q9BUT3|Q9BVD1	Missense_Mutation	SNP	ENST00000420993.2	37	c.1652G>C	CCDS14094.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.22|18.22	3.575959|3.575959	0.65878|0.65878	.|.	.|.	ENSG00000025770|ENSG00000025770	ENST00000420993;ENST00000395701;ENST00000299821|ENST00000522304	.|.	.|.	.|.	4.79|4.79	4.79|4.79	0.61399|0.61399	.|.	0.055373|.	0.64402|.	D|.	0.000004|.	T|T	0.78407|0.78407	0.4278|0.4278	M|M	0.83603|0.83603	2.65|2.65	0.49213|0.49213	D|D	0.99976|0.99976	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.91635|.	0.999;0.999;0.999|.	T|T	0.80772|0.80772	-0.1233|-0.1233	9|5	0.87932|.	D|.	0|.	-17.7446|-17.7446	16.7947|16.7947	0.85598|0.85598	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	552;529;551|.	Q6IBW4-4;Q6IBW4-2;Q6IBW4|.	.;.;CNDH2_HUMAN|.	P|L	551;551;552|87	.|.	ENSP00000299821:R552P|.	R|V	+|+	2|1	0|0	NCAPH2|NCAPH2	49308436|49308436	1.000000|1.000000	0.71417|0.71417	0.694000|0.694000	0.30210|0.30210	0.722000|0.722000	0.41435|0.41435	4.463000|4.463000	0.60128|0.60128	2.393000|2.393000	0.81446|0.81446	0.561000|0.561000	0.74099|0.74099	CGT|GTT		0.647	NCAPH2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317012.1	NM_152299		10	14	0	0	0	0	10	14				
FGD5	152273	broad.mit.edu	37	3	14960293	14960293	+	Nonsense_Mutation	SNP	C	C	A	rs371774174		TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr3:14960293C>A	ENST00000285046.5	+	13	3632	c.3522C>A	c.(3520-3522)taC>taA	p.Y1174*	FGD5-AS1_ENST00000430166.1_RNA|FGD5_ENST00000543601.1_Nonsense_Mutation_p.Y933*|FGD5_ENST00000476851.1_3'UTR	NM_152536.3	NP_689749.3	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	1174	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(2)|breast(2)|endometrium(3)|kidney(5)|large_intestine(10)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(1)	54						AAGTGCCCTACGCTCTAAAGA	0.602																																						uc003bzc.2		NA																	0				ovary(3)|kidney(1)|pancreas(1)	5						c.(3520-3522)TAC>TAA		FYVE, RhoGEF and PH domain containing 5							101.0	99.0	100.0					3																	14960293		2046	4193	6239	SO:0001587	stop_gained	152273				actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding	g.chr3:14960293C>A	AK097276	CCDS46767.1	3p25.1	2013-01-10			ENSG00000154783	ENSG00000154783		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19117	protein-coding gene	gene with protein product		614788					Standard	NM_152536		Approved	ZFYVE23, FLJ39957, FLJ00274	uc003bzc.3	Q6ZNL6	OTTHUMG00000155556	ENST00000285046.5:c.3522C>A	3.37:g.14960293C>A	ENSP00000285046:p.Tyr1174*		Somatic				FGD5_uc011avk.1_Nonsense_Mutation_p.Y1174*|FGD5_uc003bzd.2_Nonsense_Mutation_p.Y252*	p.Y1174*	NM_152536	NP_689749	WXS	Illumina HiSeq	Unspecified	Q6ZNL6	FGD5_HUMAN			13	3632	+			1174			PH 1.		B3KVQ3|Q6MZY1|Q7Z303|Q8IYP3|Q8N861|Q8N8G4	Nonsense_Mutation	SNP	ENST00000285046.5	37	c.3522C>A	CCDS46767.1	.	.	.	.	.	.	.	.	.	.	C	39	7.645666	0.98409	.	.	ENSG00000154783	ENST00000285046;ENST00000543601	.	.	.	3.86	-7.71	0.01254	.	0.556047	0.15056	N	0.283030	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	-14.8634	11.3041	0.49325	0.0:0.4535:0.0:0.5465	.	.	.	.	X	1174;933	.	ENSP00000285046:Y1174X	Y	+	3	2	FGD5	14935297	0.002000	0.14202	0.289000	0.24876	0.649000	0.38597	-2.025000	0.01435	-1.814000	0.01224	-0.948000	0.02665	TAC		0.602	FGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340628.1	NM_152536		19	9	1	0	3.6e-14	4.1e-14	19	9				
KIAA1524	57650	broad.mit.edu	37	3	108285471	108285471	+	Missense_Mutation	SNP	C	C	A			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr3:108285471C>A	ENST00000295746.8	-	11	1364	c.1288G>T	c.(1288-1290)Gat>Tat	p.D430Y	KIAA1524_ENST00000487834.1_5'UTR|KIAA1524_ENST00000491772.1_Missense_Mutation_p.D271Y	NM_020890.2	NP_065941.2	Q8TCG1	CIP2A_HUMAN	KIAA1524	430					positive regulation of neural precursor cell proliferation (GO:2000179)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(21)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TTTAGTGTATCATCTCCACAG	0.303																																						uc003dxb.3		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(1288-1290)GAT>TAT		p90 autoantigen							111.0	112.0	111.0					3																	108285471		2203	4299	6502	SO:0001583	missense	57650					cytoplasm|integral to membrane	protein binding	g.chr3:108285471C>A	AB040957	CCDS33812.1	3q13.13	2014-01-14			ENSG00000163507	ENSG00000163507			29302	protein-coding gene	gene with protein product	"""cancerous inhibitor of protein phosphatase 2A"""	610643				10819331, 24214971	Standard	NM_020890		Approved	CIP2A	uc003dxb.4	Q8TCG1	OTTHUMG00000159233	ENST00000295746.8:c.1288G>T	3.37:g.108285471C>A	ENSP00000295746:p.Asp430Tyr		Somatic				KIAA1524_uc010hpv.1_5'UTR	p.D430Y	NM_020890	NP_065941	WXS	Illumina HiSeq	Unspecified	Q8TCG1	CIP2A_HUMAN			11	1557	-			430					A1L4J7|B9EGC3|Q6P4G6|Q8WVP8|Q96PI2|Q9H9C6|Q9P204	Missense_Mutation	SNP	ENST00000295746.8	37	c.1288G>T	CCDS33812.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.066043	0.76187	.	.	ENSG00000163507	ENST00000491772;ENST00000295746	T;T	0.13901	2.55;2.7	5.59	5.59	0.84812	Armadillo-type fold (1);	0.379178	0.32328	N	0.006253	T	0.30198	0.0757	L	0.60455	1.87	0.80722	D	1	P	0.51147	0.942	P	0.54210	0.745	T	0.00719	-1.1595	10	0.87932	D	0	-5.6235	19.5932	0.95523	0.0:1.0:0.0:0.0	.	430	Q8TCG1	CIP2A_HUMAN	Y	271;430	ENSP00000419487:D271Y;ENSP00000295746:D430Y	ENSP00000295746:D430Y	D	-	1	0	KIAA1524	109768161	1.000000	0.71417	0.949000	0.38748	0.876000	0.50452	5.599000	0.67592	2.630000	0.89119	0.650000	0.86243	GAT		0.303	KIAA1524-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353975.2	NM_020890		4	172	1	0	0.00909568	0.00957055	4	172				
GK5	256356	broad.mit.edu	37	3	141884548	141884548	+	Missense_Mutation	SNP	C	C	A			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr3:141884548C>A	ENST00000392993.2	-	16	1657	c.1506G>T	c.(1504-1506)caG>caT	p.Q502H		NM_001039547.2	NP_001034636.1	Q6ZS86	GLPK5_HUMAN	glycerol kinase 5 (putative)	502					glycerol catabolic process (GO:0019563)		ATP binding (GO:0005524)|glycerol kinase activity (GO:0004370)			kidney(1)|large_intestine(1)|lung(7)|urinary_tract(1)	10						GACATTTCTTCTGTGGCTTGA	0.353																																						uc003euq.1		NA																	0					0						c.(1504-1506)CAG>CAT		glycerol kinase 5 (putative)							177.0	163.0	168.0					3																	141884548		2203	4300	6503	SO:0001583	missense	256356				glycerol metabolic process		ATP binding|glycerol kinase activity	g.chr3:141884548C>A	BX648681	CCDS33871.1	3q23	2014-02-12	2006-09-21		ENSG00000175066	ENSG00000175066		"""Glycerol kinases"""	28635	protein-coding gene	gene with protein product						12477932	Standard	NM_001039547		Approved	MGC40579	uc003euq.2	Q6ZS86	OTTHUMG00000133572	ENST00000392993.2:c.1506G>T	3.37:g.141884548C>A	ENSP00000418001:p.Gln502His		Somatic				GK5_uc003eup.1_Missense_Mutation_p.Q223H|GK5_uc010hus.1_RNA	p.Q502H	NM_001039547	NP_001034636	WXS	Illumina HiSeq	Unspecified	Q6ZS86	GLPK5_HUMAN			16	1637	-			502					B2R9I2|D3DNG2|Q8N2A7|Q8N5E6	Missense_Mutation	SNP	ENST00000392993.2	37	c.1506G>T	CCDS33871.1	.	.	.	.	.	.	.	.	.	.	C	15.89	2.967503	0.53507	.	.	ENSG00000175066	ENST00000392993	D	0.90385	-2.66	5.98	5.11	0.69529	.	0.180448	0.49916	N	0.000122	D	0.87313	0.6146	L	0.60845	1.875	0.80722	D	1	B	0.29716	0.255	B	0.26202	0.067	D	0.84634	0.0691	10	0.40728	T	0.16	-13.1058	10.8244	0.46622	0.0:0.8487:0.0:0.1513	.	502	Q6ZS86	GLPK5_HUMAN	H	502	ENSP00000418001:Q502H	ENSP00000418001:Q502H	Q	-	3	2	GK5	143367238	0.992000	0.36948	1.000000	0.80357	0.990000	0.78478	0.226000	0.17776	1.542000	0.49330	0.591000	0.81541	CAG		0.353	GK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353999.1	NM_001039547		87	209	1	0	9.18e-55	1.08e-54	87	209				
PIK3CA	5290	broad.mit.edu	37	3	178936082	178936082	+	Missense_Mutation	SNP	G	G	A	rs121913273		TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr3:178936082G>A	ENST00000263967.3	+	10	1781	c.1624G>A	c.(1624-1626)Gaa>Aaa	p.E542K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	542	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> K (in CLOVE, KERSEB, CRC and BC; also found in glioblastoma multiforme and endometrial carcinoma; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N- terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|E -> Q (found in an endometrial carcinoma sample; unknown pathological significance). {ECO:0000269|PubMed:16322209}.|E -> V (in BC; unknown pathological significance). {ECO:0000269|PubMed:16353168}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E542K(545)|p.E542Q(10)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TCCTCTCTCTGAAATCACTGA	0.333	E542K(BT483_BREAST)|E542K(CAL51_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(VMCUB1_URINARY_TRACT)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	uc003fjk.2	E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(CAL51_BREAST)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(VMCUB1_URINARY_TRACT)|E542K(BT483_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)	57		Dom	yes		3	3q26.3	5290	Mis	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			"""E, O"""			colorectal|gastric|gliobastoma|breast		555	Substitution - Missense(555)	p.E542K(481)|p.E542V(8)|p.E542Q(6)|p.E542G(1)	breast(176)|large_intestine(166)|urinary_tract(45)|endometrium(37)|skin(19)|lung(18)|stomach(16)|ovary(16)|thyroid(14)|upper_aerodigestive_tract(9)|central_nervous_system(7)|cervix(6)|liver(6)|oesophagus(5)|penis(4)|kidney(3)|soft_tissue(2)|haematopoietic_and_lymphoid_tissue(2)|prostate(2)|biliary_tract(1)|pituitary(1)	breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553						c.(1624-1626)GAA>AAA		phosphoinositide-3-kinase, catalytic, alpha							56.0	56.0	56.0					3																	178936082		1809	4069	5878	SO:0001583	missense	5290				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	g.chr3:178936082G>A		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1624G>A	3.37:g.178936082G>A	ENSP00000263967:p.Glu542Lys	HNSCC(19;0.045)|TSP Lung(28;0.18)	Somatic					p.E542K	NM_006218	NP_006209	WXS	Illumina HiSeq	Unspecified	P42336	PK3CA_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		10	1781	+	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		542		E -> V (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation).|E -> Q (in cancer).	PI3K helical.		Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	c.1624G>A	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	34	5.360420	0.95877	.	.	ENSG00000121879	ENST00000263967	T	0.62105	0.05	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69287	0.3094	L	0.41356	1.27	0.80722	D	1	D	0.65815	0.995	D	0.63192	0.912	T	0.60296	-0.7291	10	0.09843	T	0.71	-23.9623	20.0024	0.97423	0.0:0.0:1.0:0.0	.	542	P42336	PK3CA_HUMAN	K	542	ENSP00000263967:E542K	ENSP00000263967:E542K	E	+	1	0	PIK3CA	180418776	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAA		0.333	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2			41	85	0	0	0	0	41	85				
EIF2B5	8893	broad.mit.edu	37	3	183855991	183855991	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr3:183855991G>A	ENST00000273783.3	+	5	844	c.722G>A	c.(721-723)cGa>cAa	p.R241Q	RP11-778D9.12_ENST00000608135.1_RNA|EIF2B5_ENST00000444495.1_Missense_Mutation_p.R241Q	NM_003907.2	NP_003898.2	Q13144	EI2BE_HUMAN	eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa	241					astrocyte development (GO:0014002)|astrocyte differentiation (GO:0048708)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|gene expression (GO:0010467)|myelination (GO:0042552)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|ovarian follicle development (GO:0001541)|positive regulation of GTPase activity (GO:0043547)|positive regulation of translational initiation (GO:0045948)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)|nucleus (GO:0005634)	guanyl-nucleotide exchange factor activity (GO:0005085)|translation initiation factor activity (GO:0003743)|translation initiation factor binding (GO:0031369)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(9)|ovary(5)|urinary_tract(1)	27	all_cancers(143;7.59e-11)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			GTGGAGGTTCGATATGATTTA	0.483																																						uc003fmp.2		NA																	0				ovary(5)	5						c.(721-723)CGA>CAA		eukaryotic translation initiation factor 2B,							178.0	164.0	169.0					3																	183855991		2203	4300	6503	SO:0001583	missense	8893				astrocyte development|myelination|negative regulation of translational initiation in response to stress|oligodendrocyte development|ovarian follicle development|positive regulation of translational initiation|response to glucose stimulus|response to heat|response to peptide hormone stimulus|RNA metabolic process	cytosol|eukaryotic translation initiation factor 2B complex|nucleus	guanyl-nucleotide exchange factor activity|transferase activity|translation initiation factor activity|translation initiation factor binding	g.chr3:183855991G>A	U23028	CCDS3252.1	3q27.3	2006-07-18	2002-08-29		ENSG00000145191	ENSG00000145191			3261	protein-coding gene	gene with protein product		603945	"""eukaryotic translation initiation factor 2B, subunit 5 (epsilon, 82kD)"""			8688466	Standard	NM_003907		Approved	EIF2Bepsilon, EIF-2B	uc003fmp.3	Q13144	OTTHUMG00000156840	ENST00000273783.3:c.722G>A	3.37:g.183855991G>A	ENSP00000273783:p.Arg241Gln		Somatic				EIF2B5_uc003fmq.2_5'UTR	p.R241Q	NM_003907	NP_003898	WXS	Illumina HiSeq	Unspecified	Q13144	EI2BE_HUMAN	Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)		5	1086	+	all_cancers(143;7.59e-11)|Ovarian(172;0.0303)		241					Q541Z1|Q96D04	Missense_Mutation	SNP	ENST00000273783.3	37	c.722G>A	CCDS3252.1	.	.	.	.	.	.	.	.	.	.	g	35	5.514399	0.96402	.	.	ENSG00000145191	ENST00000273783;ENST00000444495	D;D	0.94376	-3.41;-3.41	5.8	5.8	0.92144	.	0.051954	0.85682	D	0.000000	D	0.97049	0.9036	M	0.86805	2.84	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.95751	0.8792	10	0.29301	T	0.29	-8.048	19.0588	0.93078	0.0:0.0:1.0:0.0	.	241	Q13144	EI2BE_HUMAN	Q	241	ENSP00000273783:R241Q;ENSP00000409142:R241Q	ENSP00000273783:R241Q	R	+	2	0	EIF2B5	185338685	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	9.835000	0.99442	2.744000	0.94065	0.655000	0.94253	CGA		0.483	EIF2B5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346168.1			46	117	0	0	0	0	46	117				
IL1RAP	3556	broad.mit.edu	37	3	190366168	190366168	+	Missense_Mutation	SNP	C	C	T	rs201706120		TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr3:190366168C>T	ENST00000412504.2	+	11	1639	c.1387C>T	c.(1387-1389)Cgc>Tgc	p.R463C	IL1RAP_ENST00000443369.2_Intron|IL1RAP_ENST00000439062.1_Missense_Mutation_p.R463C|IL1RAP_ENST00000447382.1_Missense_Mutation_p.R463C|IL1RAP_ENST00000317757.3_Intron|IL1RAP_ENST00000072516.3_Missense_Mutation_p.R463C			Q9NPH3	IL1AP_HUMAN	interleukin 1 receptor accessory protein	463	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				immune response (GO:0006955)|inflammatory response (GO:0006954)|interleukin-2 biosynthetic process (GO:0042094)|protein complex assembly (GO:0006461)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20	all_cancers(143;3.61e-10)|Ovarian(172;0.0733)|Breast(254;0.21)		Lung(62;1.95e-06)|LUSC - Lung squamous cell carcinoma(58;2.05e-06)	GBM - Glioblastoma multiforme(93;0.00851)		GAAAAGCAGACGCCTCCTGGT	0.502													C|||	1	0.000199681	0.0	0.0	5008	,	,		17093	0.0		0.001	False		,,,				2504	0.0					uc003fsm.1		NA																	0				ovary(1)	1						c.(1387-1389)CGC>TGC		interleukin 1 receptor accessory protein isoform							115.0	129.0	124.0					3																	190366168		2203	4300	6503	SO:0001583	missense	3556				inflammatory response|innate immune response|protein complex assembly	extracellular region|integral to plasma membrane		g.chr3:190366168C>T	AB006537	CCDS3298.1, CCDS46982.1, CCDS54696.1	3q28	2013-01-11			ENSG00000196083	ENSG00000196083		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5995	protein-coding gene	gene with protein product		602626				9479509, 9065432	Standard	NM_002182		Approved	IL-1RAcP, IL1R3, C3orf13	uc003fsq.3	Q9NPH3	OTTHUMG00000156211	ENST00000412504.2:c.1387C>T	3.37:g.190366168C>T	ENSP00000412053:p.Arg463Cys		Somatic				IL1RAP_uc010hzg.1_Missense_Mutation_p.R463C|IL1RAP_uc003fsn.1_RNA|IL1RAP_uc003fso.1_Missense_Mutation_p.R463C|IL1RAP_uc003fsp.1_RNA|IL1RAP_uc003fsq.2_Intron	p.R463C	NM_002182	NP_002173	WXS	Illumina HiSeq	Unspecified	Q9NPH3	IL1AP_HUMAN	Lung(62;1.95e-06)|LUSC - Lung squamous cell carcinoma(58;2.05e-06)	GBM - Glioblastoma multiforme(93;0.00851)	12	1593	+	all_cancers(143;3.61e-10)|Ovarian(172;0.0733)|Breast(254;0.21)		463			Cytoplasmic (Potential).|TIR.		B1NLD0|D3DNW0|O14915|Q86WJ7	Missense_Mutation	SNP	ENST00000412504.2	37	c.1387C>T	CCDS3298.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	25.9	4.687179	0.88639	.	.	ENSG00000196083	ENST00000072516;ENST00000412504;ENST00000439062;ENST00000447382	T;T;T;T	0.10960	2.82;2.82;2.82;2.82	5.64	5.64	0.86602	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.000000	0.85682	D	0.000000	T	0.44891	0.1315	M	0.92459	3.31	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.56056	-0.8042	10	0.87932	D	0	.	18.6964	0.91603	0.0:1.0:0.0:0.0	.	463	Q9NPH3	IL1AP_HUMAN	C	463	ENSP00000072516:R463C;ENSP00000412053:R463C;ENSP00000401132:R463C;ENSP00000390541:R463C	ENSP00000072516:R463C	R	+	1	0	IL1RAP	191848862	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.268000	0.78473	2.676000	0.91093	0.557000	0.71058	CGC		0.502	IL1RAP-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000343497.1			120	343	0	0	0	0	120	343				
HRASLS	57110	broad.mit.edu	37	3	192980878	192980878	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr3:192980878G>C	ENST00000602513.1	+	3	668	c.259G>C	c.(259-261)Gat>Cat	p.D87H	HRASLS_ENST00000264735.2_Missense_Mutation_p.D192H			Q9HDD0	HRSL1_HUMAN	HRAS-like suppressor	87					ether lipid metabolic process (GO:0046485)|lipid catabolic process (GO:0016042)|peroxisome organization (GO:0007031)	integral component of membrane (GO:0016021)|nuclear envelope lumen (GO:0005641)|peroxisome (GO:0005777)	phospholipase activity (GO:0004620)|transferase activity (GO:0016740)	p.D87Y(1)		breast(1)|large_intestine(2)|lung(4)|prostate(1)|skin(2)	10	all_cancers(143;9.1e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000159)		CAATAAATACGATGAAACGTA	0.433																																						uc003fta.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(259-261)GAT>CAT		HRAS-like suppressor							151.0	152.0	152.0					3																	192980878		2203	4300	6503	SO:0001583	missense	57110							g.chr3:192980878G>C	AB030816	CCDS3303.1, CCDS3303.2	3q29	2008-05-15			ENSG00000127252	ENSG00000127252			14922	protein-coding gene	gene with protein product		606487					Standard	NM_020386		Approved	H-REV107, HRASLS1	uc003fta.4	Q9HDD0	OTTHUMG00000156104	ENST00000602513.1:c.259G>C	3.37:g.192980878G>C	ENSP00000473258:p.Asp87His		Somatic					p.D87H	NM_020386	NP_065119	WXS	Illumina HiSeq	Unspecified	Q9HDD0	HRSL1_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000159)	3	664	+	all_cancers(143;9.1e-09)|Ovarian(172;0.0386)		87					D2KX19	Missense_Mutation	SNP	ENST00000602513.1	37	c.259G>C		.	.	.	.	.	.	.	.	.	.	G	20.8	4.057183	0.76074	.	.	ENSG00000127252	ENST00000264735	.	.	.	6.17	6.17	0.99709	NC (1);	0.000000	0.85682	D	0.000000	D	0.87462	0.6183	M	0.93939	3.475	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89274	0.3607	9	0.87932	D	0	1.0076	19.8676	0.96824	0.0:0.0:1.0:0.0	.	87	Q9HDD0	HRSL1_HUMAN	H	87	.	ENSP00000264735:D87H	D	+	1	0	HRASLS	194463572	1.000000	0.71417	0.857000	0.33713	0.485000	0.33311	9.476000	0.97823	2.941000	0.99782	0.655000	0.94253	GAT		0.433	HRASLS-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				78	203	0	0	0	0	78	203				
EVC2	132884	broad.mit.edu	37	4	5664846	5664846	+	Missense_Mutation	SNP	T	T	G			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr4:5664846T>G	ENST00000344408.5	-	9	1186	c.1133A>C	c.(1132-1134)cAa>cCa	p.Q378P	EVC2_ENST00000310917.2_Missense_Mutation_p.Q298P|EVC2_ENST00000344938.1_Missense_Mutation_p.Q378P	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	378					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						TTCTAAGGCTTGAAGCATGCT	0.433																																						uc003gij.2		NA																	0				large_intestine(3)|ovary(2)	5						c.(1132-1134)CAA>CCA		limbin							111.0	105.0	107.0					4																	5664846		2203	4300	6503	SO:0001583	missense	132884					integral to membrane		g.chr4:5664846T>G	AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.1133A>C	4.37:g.5664846T>G	ENSP00000342144:p.Gln378Pro		Somatic				EVC2_uc011bwb.1_5'UTR|EVC2_uc003gik.2_Missense_Mutation_p.Q298P	p.Q378P	NM_147127	NP_667338	WXS	Illumina HiSeq	Unspecified	Q86UK5	LBN_HUMAN			9	1187	-			378					Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	SNP	ENST00000344408.5	37	c.1133A>C	CCDS3382.2	.	.	.	.	.	.	.	.	.	.	T	14.53	2.561970	0.45590	.	.	ENSG00000173040	ENST00000344938;ENST00000310917;ENST00000344408	T;T;T	0.80653	-1.4;-1.4;-1.4	5.07	5.07	0.68467	.	0.000000	0.64402	D	0.000020	D	0.87402	0.6168	M	0.68952	2.095	0.42940	D	0.994347	D	0.76494	0.999	D	0.87578	0.998	D	0.88096	0.2816	10	0.56958	D	0.05	-4.9734	11.4968	0.50413	0.0:0.0:0.0:1.0	.	378	Q86UK5	LBN_HUMAN	P	378;298;378	ENSP00000339954:Q378P;ENSP00000311683:Q298P;ENSP00000342144:Q378P	ENSP00000311683:Q298P	Q	-	2	0	EVC2	5715747	0.999000	0.42202	0.850000	0.33497	0.260000	0.26232	1.032000	0.30178	2.019000	0.59389	0.533000	0.62120	CAA		0.433	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289822.2	NM_147127		37	133	0	0	0	0	37	133				
CD38	952	broad.mit.edu	37	4	15818249	15818249	+	Missense_Mutation	SNP	G	G	A	rs375909727		TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr4:15818249G>A	ENST00000226279.3	+	2	486	c.349G>A	c.(349-351)Gta>Ata	p.V117I		NM_001775.2	NP_001766.2	P28907	CD38_HUMAN	CD38 molecule	117					apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|female pregnancy (GO:0007565)|long term synaptic depression (GO:0060292)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone resorption (GO:0045779)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell growth (GO:0030307)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of insulin secretion (GO:0032024)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasoconstriction (GO:0045907)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hydroperoxide (GO:0033194)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	NAD(P)+ nucleosidase activity (GO:0050135)|NAD+ nucleosidase activity (GO:0003953)|phosphorus-oxygen lyase activity (GO:0016849)|transferase activity (GO:0016740)	p.V117I(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|stomach(1)	14						AACTCAGACCGTACCTTGCAA	0.378																																						uc011bxc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(349-351)GTA>ATA		CD38 antigen		G	ILE/VAL	0,4406		0,0,2203	106.0	99.0	102.0		349	-6.1	0.0	4		102	1,8599	1.2+/-3.3	0,1,4299	no	missense	CD38	NM_001775.2	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	117/301	15818249	1,13005	2203	4300	6503	SO:0001583	missense	952				B cell receptor signaling pathway|induction of apoptosis by extracellular signals|negative regulation of apoptosis|negative regulation of transcription, DNA-dependent|positive regulation of B cell proliferation|positive regulation of transcription, DNA-dependent|response to drug	integral to membrane|plasma membrane	binding|NAD+ nucleosidase activity|receptor activity	g.chr4:15818249G>A	D84276	CCDS3417.1	4p15.32	2010-05-04	2006-03-28		ENSG00000004468	ENSG00000004468	3.2.2.5	"""CD molecules"""	1667	protein-coding gene	gene with protein product	"""ADP-ribosyl cyclase 1"", ""NAD(+) nucleosidase"""	107270	"""CD38 antigen (p45)"""			9074508, 2319135	Standard	NM_001775		Approved		uc003gol.1	P28907	OTTHUMG00000048206	ENST00000226279.3:c.349G>A	4.37:g.15818249G>A	ENSP00000226279:p.Val117Ile		Somatic				CD38_uc003goj.1_Missense_Mutation_p.V117I|CD38_uc003gol.1_Missense_Mutation_p.V117I	p.V117I	NM_001775	NP_001766	WXS	Illumina HiSeq	Unspecified	P28907	CD38_HUMAN			2	456	+			117			Extracellular (Potential).		O00121|O00122|Q96HY4	Missense_Mutation	SNP	ENST00000226279.3	37	c.349G>A	CCDS3417.1	.	.	.	.	.	.	.	.	.	.	G	1.161	-0.643796	0.03531	0.0	1.16E-4	ENSG00000004468	ENST00000226279;ENST00000540195;ENST00000510674	T;T	0.13307	2.6;2.6	5.57	-6.1	0.02138	NAD(P)-binding domain (1);	0.874278	0.10376	N	0.682136	T	0.03305	0.0096	N	0.12611	0.24	0.09310	N	1	P;P	0.36222	0.544;0.544	B;B	0.21546	0.035;0.035	T	0.41431	-0.9509	10	0.05620	T	0.96	-3.1627	5.0548	0.14527	0.4146:0.0:0.2773:0.3081	.	117;117	P28907;B2R880	CD38_HUMAN;.	I	117;117;11	ENSP00000226279:V117I;ENSP00000423047:V11I	ENSP00000226279:V117I	V	+	1	0	CD38	15427347	0.000000	0.05858	0.003000	0.11579	0.101000	0.19017	-1.565000	0.02150	-1.148000	0.02847	-0.253000	0.11424	GTA		0.378	CD38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250322.2	NM_001775		4	152	0	0	0	0	4	152				
PTPN13	5783	broad.mit.edu	37	4	87653773	87653773	+	Missense_Mutation	SNP	G	G	A	rs371279294		TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr4:87653773G>A	ENST00000411767.2	+	12	1775	c.1712G>A	c.(1711-1713)cGa>cAa	p.R571Q	PTPN13_ENST00000511467.1_Missense_Mutation_p.R571Q|PTPN13_ENST00000436978.1_Missense_Mutation_p.R571Q|PTPN13_ENST00000316707.6_Missense_Mutation_p.R571Q|PTPN13_ENST00000427191.2_Missense_Mutation_p.R571Q			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	571					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		GAGGATAACCGAAGGAAAGTA	0.328																																						uc003hpz.2		NA																	0				ovary(4)|breast(1)|kidney(1)	6						c.(1711-1713)CGA>CAA		protein tyrosine phosphatase, non-receptor type		G	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	1,3731		0,1,1865	117.0	108.0	111.0		1712,1712,1712,1712	5.7	1.0	4		111	0,8186		0,0,4093	no	missense,missense,missense,missense	PTPN13	NM_006264.2,NM_080683.2,NM_080684.2,NM_080685.2	43,43,43,43	0,1,5958	AA,AG,GG		0.0,0.0268,0.0084	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	571/2467,571/2486,571/2295,571/2491	87653773	1,11917	1866	4093	5959	SO:0001583	missense	5783					cytoplasm|cytoskeleton|plasma membrane	protein binding|protein binding|protein tyrosine phosphatase activity	g.chr4:87653773G>A		CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.1712G>A	4.37:g.87653773G>A	ENSP00000407249:p.Arg571Gln		Somatic				PTPN13_uc003hpy.2_Missense_Mutation_p.R571Q|PTPN13_uc003hqa.2_Missense_Mutation_p.R571Q|PTPN13_uc003hqb.2_Missense_Mutation_p.R571Q	p.R571Q	NM_080683	NP_542414	WXS	Illumina HiSeq	Unspecified	Q12923	PTN13_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.00082)	12	2192	+		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)	571					B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Missense_Mutation	SNP	ENST00000411767.2	37	c.1712G>A	CCDS47094.1	.	.	.	.	.	.	.	.	.	.	G	12.65	2.001760	0.35320	2.68E-4	0.0	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000316707;ENST00000411767;ENST00000511467;ENST00000357349	T;T;T;T;T	0.47528	0.85;0.87;0.9;0.84;0.87	5.65	5.65	0.86999	Band 4.1 domain (1);	0.000000	0.42294	D	0.000738	T	0.31389	0.0795	N	0.15975	0.35	0.43025	D	0.994581	B;P;P;P	0.50156	0.289;0.777;0.888;0.932	B;B;B;B	0.38755	0.082;0.184;0.146;0.281	T	0.10590	-1.0623	10	0.15499	T	0.54	.	19.7233	0.96151	0.0:0.0:1.0:0.0	.	571;571;571;571	Q12923-2;Q12923-3;Q12923;Q12923-4	.;.;PTN13_HUMAN;.	Q	571;571;571;571;571;539	ENSP00000408368:R571Q;ENSP00000394794:R571Q;ENSP00000322675:R571Q;ENSP00000407249:R571Q;ENSP00000426626:R571Q	ENSP00000322675:R571Q	R	+	2	0	PTPN13	87872797	1.000000	0.71417	0.990000	0.47175	0.570000	0.35934	7.581000	0.82535	2.653000	0.90120	0.563000	0.77884	CGA		0.328	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363191.1			30	68	0	0	0	0	30	68				
PKD2	5311	broad.mit.edu	37	4	88973183	88973183	+	Nonsense_Mutation	SNP	C	C	G			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr4:88973183C>G	ENST00000237596.2	+	7	1655	c.1589C>G	c.(1588-1590)tCa>tGa	p.S530*	PKD2_ENST00000508588.1_5'UTR	NM_000297.3	NP_000288.1	Q9BZL6	KPCD2_HUMAN	polycystic kidney disease 2 (autosomal dominant)	0					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(2)|lung(15)|skin(4)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)		TACAGAACATCAAATGTGGAG	0.333																																						uc003hre.2		NA																	0				skin(1)	1						c.(1588-1590)TCA>TGA		polycystin 2							78.0	78.0	78.0					4																	88973183		2203	4300	6503	SO:0001587	stop_gained	5311					basal cortex|basal plasma membrane|endoplasmic reticulum|integral to membrane|lamellipodium|microtubule basal body	calcium ion binding|cytoskeletal protein binding|voltage-gated chloride channel activity|voltage-gated sodium channel activity	g.chr4:88973183C>G	U50928	CCDS3627.1	4q22.1	2014-01-28			ENSG00000118762	ENSG00000118762		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""EF-hand domain containing"""	9009	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 2"""	173910				8298643	Standard	NM_000297		Approved	PKD4, PC2, Pc-2, TRPP2	uc003hre.3	Q13563	OTTHUMG00000160982	ENST00000237596.2:c.1589C>G	4.37:g.88973183C>G	ENSP00000237596:p.Ser530*		Somatic				PKD2_uc011cdf.1_Translation_Start_Site|PKD2_uc011cdg.1_Translation_Start_Site|PKD2_uc011cdh.1_Translation_Start_Site	p.S530*	NM_000297	NP_000288	WXS	Illumina HiSeq	Unspecified	Q13563	PKD2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)	7	1655	+		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)	530			Extracellular (Potential).		Q8TB08|Q9P0T6|Q9Y3X8	Nonsense_Mutation	SNP	ENST00000237596.2	37	c.1589C>G	CCDS3627.1	.	.	.	.	.	.	.	.	.	.	C	36	5.778438	0.96929	.	.	ENSG00000118762	ENST00000237596	.	.	.	5.23	4.39	0.52855	.	0.060038	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	-2.4688	14.0948	0.65013	0.0:0.9275:0.0:0.0725	.	.	.	.	X	530	.	ENSP00000237596:S530X	S	+	2	0	PKD2	89192207	0.992000	0.36948	0.039000	0.18376	0.035000	0.12851	4.751000	0.62169	1.338000	0.45544	0.655000	0.94253	TCA		0.333	PKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253042.4	NM_000297		18	80	0	0	0	0	18	80				
JADE1	79960	broad.mit.edu	37	4	129792809	129792809	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr4:129792809C>T	ENST00000226319.6	+	11	2201	c.1921C>T	c.(1921-1923)Cgt>Tgt	p.R641C	PHF17_ENST00000512960.1_Missense_Mutation_p.R641C|PHF17_ENST00000452328.2_Missense_Mutation_p.R629C	NM_199320.2	NP_955352.1														NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						TGCAGAAGCACGTCTCATATC	0.458																																						uc003igk.2		NA																	0					0						c.(1921-1923)CGT>TGT		PHD finger protein 17 long isoform							71.0	73.0	72.0					4																	129792809		2203	4300	6503	SO:0001583	missense	79960				apoptosis|histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation|negative regulation of cell growth|regulation of transcription, DNA-dependent|response to stress|transcription, DNA-dependent	histone acetyltransferase complex|mitochondrion	protein binding|zinc ion binding	g.chr4:129792809C>T																												ENST00000226319.6:c.1921C>T	4.37:g.129792809C>T	ENSP00000226319:p.Arg641Cys		Somatic				PHF17_uc003igl.2_Missense_Mutation_p.R629C|PHF17_uc011cgy.1_Missense_Mutation_p.R641C	p.R641C	NM_199320	NP_955352	WXS	Illumina HiSeq	Unspecified	Q6IE81	JADE1_HUMAN			11	2201	+			641						Missense_Mutation	SNP	ENST00000226319.6	37	c.1921C>T	CCDS34062.1	.	.	.	.	.	.	.	.	.	.	C	16.14	3.038359	0.54896	.	.	ENSG00000077684	ENST00000226319;ENST00000452328;ENST00000512960;ENST00000535321	T;T;T	0.48836	0.8;0.81;0.8	4.59	4.59	0.56863	.	0.416363	0.26349	N	0.024884	T	0.41259	0.1151	L	0.27053	0.805	0.80722	D	1	D;D	0.56968	0.969;0.978	P;B	0.46975	0.533;0.353	T	0.19614	-1.0300	9	.	.	.	.	16.1541	0.81644	0.0:1.0:0.0:0.0	.	629;641	Q6IE81-2;Q6IE81	.;JADE1_HUMAN	C	641;629;641;641	ENSP00000226319:R641C;ENSP00000388015:R629C;ENSP00000425730:R641C	.	R	+	1	0	PHF17	130012259	0.977000	0.34250	1.000000	0.80357	0.556000	0.35491	2.894000	0.48640	2.542000	0.85734	0.655000	0.94253	CGT		0.458	PHF17-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364280.1			42	70	0	0	0	0	42	70				
ASB5	140458	broad.mit.edu	37	4	177142616	177142616	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr4:177142616C>T	ENST00000296525.3	-	4	633	c.520G>A	c.(520-522)Gag>Aag	p.E174K	ASB5_ENST00000511879.1_5'Flank|ASB5_ENST00000512254.1_Missense_Mutation_p.E121K	NM_080874.3	NP_543150.1	Q8WWX0	ASB5_HUMAN	ankyrin repeat and SOCS box containing 5	174					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					endometrium(2)|kidney(1)|large_intestine(9)|lung(18)|prostate(2)|skin(2)	34		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.13e-20)|Epithelial(43;9.94e-18)|OV - Ovarian serous cystadenocarcinoma(60;2e-09)|GBM - Glioblastoma multiforme(59;0.000254)|STAD - Stomach adenocarcinoma(60;0.000653)|LUSC - Lung squamous cell carcinoma(193;0.0393)		CTGGCGGCCTCATGCGTTGGG	0.488																																						uc003iuq.1		NA																	0				skin(2)	2						c.(520-522)GAG>AAG		ankyrin repeat and SOCS box-containing protein							118.0	117.0	117.0					4																	177142616		2203	4300	6503	SO:0001583	missense	140458				intracellular signal transduction			g.chr4:177142616C>T	AY057053	CCDS3827.1	4q34.1	2013-01-10	2011-01-25		ENSG00000164122	ENSG00000164122		"""Ankyrin repeat domain containing"""	17180	protein-coding gene	gene with protein product		615050	"""ankyrin repeat and SOCS box-containing 5"""				Standard	NM_080874		Approved		uc003iuq.2	Q8WWX0	OTTHUMG00000160793	ENST00000296525.3:c.520G>A	4.37:g.177142616C>T	ENSP00000296525:p.Glu174Lys		Somatic				ASB5_uc003iup.1_Missense_Mutation_p.E121K	p.E174K	NM_080874	NP_543150	WXS	Illumina HiSeq	Unspecified	Q8WWX0	ASB5_HUMAN		all cancers(43;2.13e-20)|Epithelial(43;9.94e-18)|OV - Ovarian serous cystadenocarcinoma(60;2e-09)|GBM - Glioblastoma multiforme(59;0.000254)|STAD - Stomach adenocarcinoma(60;0.000653)|LUSC - Lung squamous cell carcinoma(193;0.0393)	4	536	-		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)	174			ANK 4.		Q8N7B5	Missense_Mutation	SNP	ENST00000296525.3	37	c.520G>A	CCDS3827.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.757794	0.89843	.	.	ENSG00000164122	ENST00000296525;ENST00000512254	T;T	0.63580	0.64;-0.05	5.91	5.91	0.95273	Ankyrin repeat-containing domain (4);	0.047998	0.85682	D	0.000000	T	0.68329	0.2989	N	0.26042	0.785	0.80722	D	1	D;D	0.76494	0.995;0.999	P;D	0.66196	0.809;0.942	T	0.63528	-0.6617	10	0.27785	T	0.31	-11.2284	19.2865	0.94077	0.0:1.0:0.0:0.0	.	174;121	Q8WWX0;Q8N7B5	ASB5_HUMAN;.	K	174;121	ENSP00000296525:E174K;ENSP00000422877:E121K	ENSP00000296525:E174K	E	-	1	0	ASB5	177379610	1.000000	0.71417	1.000000	0.80357	0.385000	0.30292	7.014000	0.76380	2.802000	0.96397	0.655000	0.94253	GAG		0.488	ASB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362344.1			68	106	0	0	0	0	68	106				
DNAH5	1767	broad.mit.edu	37	5	13871017	13871017	+	Silent	SNP	G	G	A			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr5:13871017G>A	ENST00000265104.4	-	24	3797	c.3693C>T	c.(3691-3693)aaC>aaT	p.N1231N	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1231	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GCATAAAAATGTTTTCCATCT	0.408									Kartagener syndrome																													uc003jfd.2		NA																	0				ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31						c.(3691-3693)AAC>AAT		dynein, axonemal, heavy chain 5							106.0	105.0	106.0					5																	13871017		2203	4300	6503	SO:0001819	synonymous_variant	1767	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr5:13871017G>A	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.3693C>T	5.37:g.13871017G>A			Somatic					p.N1231N	NM_001369	NP_001360	WXS	Illumina HiSeq	Unspecified	Q8TE73	DYH5_HUMAN			24	3735	-	Lung NSC(4;0.00476)		1231			Stem (By similarity).		Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	ENST00000265104.4	37	c.3693C>T	CCDS3882.1																																																																																				0.408	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		37	191	0	0	0	0	37	191				
FNIP1	96459	broad.mit.edu	37	5	130987626	130987626	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr5:130987626C>G	ENST00000510461.1	-	16	3270	c.3175G>C	c.(3175-3177)Gtt>Ctt	p.V1059L	FNIP1_ENST00000307954.8_Missense_Mutation_p.V1014L|CTC-432M15.3_ENST00000514667.1_Intron|FNIP1_ENST00000307968.7_Missense_Mutation_p.V1031L	NM_133372.2	NP_588613	Q8TF40	FNIP1_HUMAN	folliculin interacting protein 1	1059					cellular response to starvation (GO:0009267)|immature B cell differentiation (GO:0002327)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell apoptotic process (GO:0002904)|positive regulation of GTPase activity (GO:0043547)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|regulation of pro-B cell differentiation (GO:2000973)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34		all_cancers(142;0.00347)|Lung NSC(810;0.106)|all_lung(232;0.123)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0665)		GCCACTTGAACAGTCCATTTA	0.383																																						uc003kvs.1		NA																	0				pancreas(1)|skin(1)	2						c.(3175-3177)GTT>CTT		folliculin interacting protein 1 isoform 1							108.0	99.0	102.0					5																	130987626		2203	4300	6503	SO:0001583	missense	96459				regulation of protein phosphorylation	cytoplasm	protein binding	g.chr5:130987626C>G	DQ145719	CCDS34226.1, CCDS34227.1	5q23.3	2014-01-28				ENSG00000217128			29418	protein-coding gene	gene with protein product		610594				11853319, 17028174	Standard	NM_001008738		Approved	KIAA1961		Q8TF40		ENST00000510461.1:c.3175G>C	5.37:g.130987626C>G	ENSP00000421985:p.Val1059Leu		Somatic				RAPGEF6_uc003kvp.1_Intron|FNIP1_uc003kvt.1_Missense_Mutation_p.V1031L	p.V1059L	NM_133372	NP_588613	WXS	Illumina HiSeq	Unspecified	Q8TF40	FNIP1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0665)	16	3317	-		all_cancers(142;0.00347)|Lung NSC(810;0.106)|all_lung(232;0.123)|Breast(839;0.198)	1059					D6RJH5|Q86T47|Q9BUT0	Missense_Mutation	SNP	ENST00000510461.1	37	c.3175G>C	CCDS34227.1	.	.	.	.	.	.	.	.	.	.	C	34	5.395510	0.96009	.	.	ENSG00000217128	ENST00000307968;ENST00000307954;ENST00000544351;ENST00000510461	T;T;T	0.27720	1.65;1.7;1.67	5.82	5.82	0.92795	.	.	.	.	.	T	0.61248	0.2332	M	0.80616	2.505	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.80764	0.989;0.994	T	0.63427	-0.6640	9	0.72032	D	0.01	-8.5695	20.0953	0.97838	0.0:1.0:0.0:0.0	.	1031;1059	Q8TF40-3;Q8TF40	.;FNIP1_HUMAN	L	1031;1014;811;1059	ENSP00000309266:V1031L;ENSP00000310453:V1014L;ENSP00000421985:V1059L	ENSP00000310453:V1014L	V	-	1	0	FNIP1	131015525	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.767000	0.95098	0.655000	0.94253	GTT		0.383	FNIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370077.1	NM_133372		30	67	0	0	0	0	30	67				
SLC22A5	6584	broad.mit.edu	37	5	131721136	131721136	+	Missense_Mutation	SNP	C	C	T	rs386134203		TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr5:131721136C>T	ENST00000245407.3	+	4	990	c.769C>T	c.(769-771)Cgg>Tgg	p.R257W	SLC22A5_ENST00000435065.2_Missense_Mutation_p.R281W	NM_003060.3	NP_003051.1	O76082	S22A5_HUMAN	solute carrier family 22 (organic cation/carnitine transporter), member 5	257			R -> W (in CDSP). {ECO:0000269|PubMed:20574985}.		carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|drug transmembrane transport (GO:0006855)|drug transport (GO:0015893)|positive regulation of intestinal epithelial structure maintenance (GO:0060731)|quaternary ammonium group transport (GO:0015697)|quorum sensing involved in interaction with host (GO:0052106)|sodium ion transport (GO:0006814)|sodium-dependent organic cation transport (GO:0070715)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antibiotic transporter activity (GO:0042895)|ATP binding (GO:0005524)|carnitine transmembrane transporter activity (GO:0015226)|drug transmembrane transporter activity (GO:0015238)|PDZ domain binding (GO:0030165)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|symporter activity (GO:0015293)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|stomach(1)	8		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Acetylcarnitine(DB08842)|Aminohippurate(DB00345)|Amphetamine(DB00182)|Ampicillin(DB00415)|Azidocillin(DB08795)|Benzylpenicillin(DB01053)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefdinir(DB00535)|Cefepime(DB01413)|Cefixime(DB00671)|Cefradine(DB01333)|Ceftazidime(DB00438)|Cephalexin(DB00567)|Cephaloglycin(DB00689)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Creatine(DB00148)|Cyclacillin(DB01000)|Dactinomycin(DB00970)|Desipramine(DB01151)|Diphenhydramine(DB01075)|Dopamine(DB00988)|Epinephrine(DB00668)|Furosemide(DB00695)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Ipratropium bromide(DB00332)|L-Arginine(DB00125)|L-Carnitine(DB00583)|Lidocaine(DB00281)|Lomefloxacin(DB00978)|Mepyramine(DB06691)|Methamphetamine(DB01577)|Niacin(DB00627)|Nicotine(DB00184)|Norepinephrine(DB00368)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Probenecid(DB01032)|Procainamide(DB01035)|Quinidine(DB00908)|Quinine(DB00468)|Sparfloxacin(DB01208)|Thiamine(DB00152)|Tiotropium(DB01409)|Valproic Acid(DB00313)|Verapamil(DB00661)	CCGAGACTGGCGGATGCTGCT	0.522											OREG0016766	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										uc003kww.3		NA																	0					0						c.(769-771)CGG>TGG		solute carrier family 22 member 5	L-Carnitine(DB00583)	C	TRP/ARG	0,4406		0,0,2203	126.0	115.0	119.0		769	2.8	1.0	5		119	1,8599	1.2+/-3.3	0,1,4299	no	missense	SLC22A5	NM_003060.3	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	257/558	131721136	1,13005	2203	4300	6503	SO:0001583	missense	6584				positive regulation of intestinal epithelial structure maintenance|quorum sensing involved in interaction with host|sodium ion transport|sodium-dependent organic cation transport	apical plasma membrane|brush border membrane|integral to membrane	ATP binding|carnitine transporter activity|PDZ domain binding|symporter activity	g.chr5:131721136C>T	AF057164	CCDS4154.1	5q23.3	2013-05-22	2008-01-11		ENSG00000197375	ENSG00000197375		"""Solute carriers"""	10969	protein-coding gene	gene with protein product		603377		CDSP		9618255, 9916797, 9685390	Standard	NM_003060		Approved	OCTN2, SCD	uc003kww.4	O76082	OTTHUMG00000059634	ENST00000245407.3:c.769C>T	5.37:g.131721136C>T	ENSP00000245407:p.Arg257Trp		Somatic	OREG0016766	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1589	SLC22A5_uc003kwx.3_Missense_Mutation_p.R281W|SLC22A5_uc010jdr.1_5'UTR	p.R257W	NM_003060	NP_003051	WXS	Illumina HiSeq	Unspecified	O76082	S22A5_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		4	1033	+		all_cancers(142;0.0751)|Breast(839;0.198)	257		R -> W (in CDSP).	Extracellular (Potential).		A2Q0V1|B2R844|D3DQ87|Q6ZQZ8|Q96EH6	Missense_Mutation	SNP	ENST00000245407.3	37	c.769C>T	CCDS4154.1	.	.	.	.	.	.	.	.	.	.	C	19.71	3.879152	0.72294	0.0	1.16E-4	ENSG00000197375	ENST00000245407;ENST00000435065;ENST00000415928	T;T;T	0.67698	-0.28;-0.28;-0.28	5.9	2.76	0.32466	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.83644	0.5299	M	0.86864	2.845	0.54753	D	0.999988	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87677	0.2545	10	0.87932	D	0	.	16.9932	0.86359	0.4673:0.5327:0.0:0.0	.	281;257	A2Q0V1;O76082	.;S22A5_HUMAN	W	257;281;180	ENSP00000245407:R257W;ENSP00000402760:R281W;ENSP00000388838:R180W	ENSP00000245407:R257W	R	+	1	2	SLC22A5	131749035	0.996000	0.38824	1.000000	0.80357	0.827000	0.46813	0.468000	0.22051	0.776000	0.33473	0.650000	0.86243	CGG		0.522	SLC22A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132631.1	NM_003060		21	87	0	0	0	0	21	87				
FSTL4	23105	broad.mit.edu	37	5	132736645	132736645	+	Missense_Mutation	SNP	C	C	A			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr5:132736645C>A	ENST00000265342.7	-	4	443	c.194G>T	c.(193-195)tGc>tTc	p.C65F		NM_015082.1	NP_055897.1	Q6MZW2	FSTL4_HUMAN	follistatin-like 4	65						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(8)|skin(2)|upper_aerodigestive_tract(1)	23		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CTTCTTCCCGCAGGAGGCCAG	0.627																																						uc003kyn.1		NA																	0				central_nervous_system(1)|skin(1)	2						c.(193-195)TGC>TTC		follistatin-like 4 precursor							28.0	31.0	30.0					5																	132736645		2201	4293	6494	SO:0001583	missense	23105					extracellular region	calcium ion binding	g.chr5:132736645C>A	AB028984	CCDS34238.1	5q31.1	2013-01-29			ENSG00000053108	ENSG00000053108		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21389	protein-coding gene	gene with protein product						10470851, 15527507	Standard	NM_015082		Approved	KIAA1061	uc003kyn.1	Q6MZW2	OTTHUMG00000162729	ENST00000265342.7:c.194G>T	5.37:g.132736645C>A	ENSP00000265342:p.Cys65Phe		Somatic					p.C65F	NM_015082	NP_055897	WXS	Illumina HiSeq	Unspecified	Q6MZW2	FSTL4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		4	412	-		all_cancers(142;0.244)	65					Q8TBU0|Q9UPU1	Missense_Mutation	SNP	ENST00000265342.7	37	c.194G>T	CCDS34238.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.064699	0.76187	.	.	ENSG00000053108	ENST00000265342;ENST00000360575;ENST00000510685	T;T	0.76578	-1.03;-1.03	5.57	5.57	0.84162	.	0.098319	0.64402	D	0.000001	D	0.86732	0.6003	L	0.58510	1.815	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.87460	0.2407	10	0.87932	D	0	-13.867	18.5328	0.90999	0.0:1.0:0.0:0.0	.	65	Q6MZW2	FSTL4_HUMAN	F	65;65;67	ENSP00000265342:C65F;ENSP00000427662:C67F	ENSP00000265342:C65F	C	-	2	0	FSTL4	132764544	1.000000	0.71417	0.992000	0.48379	0.593000	0.36681	7.322000	0.79097	2.638000	0.89438	0.655000	0.94253	TGC		0.627	FSTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370212.1	XM_048786		12	26	1	0	3.27e-08	3.67e-08	12	26				
DOCK2	1794	broad.mit.edu	37	5	169508958	169508958	+	Silent	SNP	G	G	A			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr5:169508958G>A	ENST00000256935.8	+	51	5480	c.5400G>A	c.(5398-5400)cgG>cgA	p.R1800R	DOCK2_ENST00000520908.1_Silent_p.R1292R|DOCK2_ENST00000540750.1_Silent_p.R861R|DOCK2_ENST00000523351.1_3'UTR	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1800					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CACTCACACGGAAGAAGGTCA	0.527																																						uc003maf.2		NA																	0				ovary(5)|pancreas(2)	7						c.(5398-5400)CGG>CGA		dedicator of cytokinesis 2							112.0	104.0	106.0					5																	169508958		2203	4300	6503	SO:0001819	synonymous_variant	1794				actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding	g.chr5:169508958G>A	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.5400G>A	5.37:g.169508958G>A			Somatic				DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Silent_p.R1292R|DOCK2_uc003mah.2_Silent_p.R356R	p.R1800R	NM_004946	NP_004937	WXS	Illumina HiSeq	Unspecified	Q92608	DOCK2_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		51	5480	+	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	1800					Q2M3I0|Q96AK7	Silent	SNP	ENST00000256935.8	37	c.5400G>A	CCDS4371.1																																																																																				0.527	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946		31	49	0	0	0	0	31	49				
HIST1H4C	8364	broad.mit.edu	37	6	26104203	26104203	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr6:26104203G>C	ENST00000377803.2	+	1	100	c.28G>C	c.(28-30)Ggc>Cgc	p.G10R		NM_003542.3	NP_003533.1	P62805	H4_HUMAN	histone cluster 1, H4c	10					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)	7						AGGCGGAAAAGGCTTGGGGAA	0.527																																						uc003ngi.2		NA																	0					0						c.(28-30)GGC>CGC		histone cluster 1, H4c							57.0	58.0	57.0					6																	26104203		2203	4300	6503	SO:0001583	missense	8364				CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding	g.chr6:26104203G>C	X60486	CCDS4583.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000197061	ENSG00000197061		"""Histones / Replication-dependent"""	4787	protein-coding gene	gene with protein product		602827	"""H4 histone family, member G"", ""histone 1, H4c"""	H4FG		9119399, 12408966	Standard	NM_003542		Approved	H4/g, dJ221C16.1	uc003ngi.3	P62805	OTTHUMG00000014429	ENST00000377803.2:c.28G>C	6.37:g.26104203G>C	ENSP00000367034:p.Gly10Arg		Somatic					p.G10R	NM_003542	NP_003533	WXS	Illumina HiSeq	Unspecified	P62805	H4_HUMAN			1	28	+			10					A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	ENST00000377803.2	37	c.28G>C	CCDS4583.1	.	.	.	.	.	.	.	.	.	.	.	18.89	3.719948	0.68844	.	.	ENSG00000197061	ENST00000377803	.	.	.	4.57	4.57	0.56435	.	0.000000	0.85682	D	0.000000	T	0.69833	0.3155	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.72459	-0.4287	6	0.56958	D	0.05	.	16.8752	0.86050	0.0:0.0:1.0:0.0	.	.	.	.	R	10	.	ENSP00000367034:G10R	G	+	1	0	HIST1H4C	26212182	1.000000	0.71417	0.111000	0.21465	0.005000	0.04900	7.795000	0.85887	2.538000	0.85594	0.561000	0.74099	GGC		0.527	HIST1H4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040092.2	NM_003542		33	67	0	0	0	0	33	67				
UFL1	23376	broad.mit.edu	37	6	96990812	96990812	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr6:96990812G>A	ENST00000369278.4	+	12	1388	c.1322G>A	c.(1321-1323)aGa>aAa	p.R441K		NM_015323.4	NP_056138.1	O94874	UFL1_HUMAN	UFM1-specific ligase 1	441					negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein ubiquitination (GO:0031397)|osteoblast differentiation (GO:0001649)|protein ufmylation (GO:0071569)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	UFM1 conjugating enzyme activity (GO:0071568)										GGCAATGCCAGAGAGTACAAA	0.378																																						uc003por.2		NA																	0				ovary(1)	1						c.(1321-1323)AGA>AAA		hypothetical protein LOC23376							63.0	64.0	63.0					6																	96990812		2203	4300	6503	SO:0001583	missense	23376				negative regulation of NF-kappaB transcription factor activity|negative regulation of protein ubiquitination|protein ufmylation	endoplasmic reticulum|nucleus	protein binding|UFM1 conjugating enzyme activity	g.chr6:96990812G>A	BC036379	CCDS5034.1	6q16.3	2011-08-18	2011-08-18	2011-08-18	ENSG00000014123	ENSG00000014123			23039	protein-coding gene	gene with protein product	"""novel LZAP-binding protein"", ""Regulator of CDK5RAP3 and DDRGK1"""	613372	"""KIAA0776"""	KIAA0776		20018847, 20164180, 20228063, 20531390	Standard	NM_015323		Approved	NLBP, Maxer, RCAD	uc003por.3	O94874	OTTHUMG00000015238	ENST00000369278.4:c.1322G>A	6.37:g.96990812G>A	ENSP00000358283:p.Arg441Lys		Somatic				KIAA0776_uc010kck.2_RNA	p.R441K	NM_015323	NP_056138	WXS	Illumina HiSeq	Unspecified	O94874	UFL1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0934)	12	1370	+		all_cancers(76;5.83e-05)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.0604)|Colorectal(196;0.0721)	441					A0PJ53|B4DJ57|C0H5X5|Q8N765|Q9NTQ0	Missense_Mutation	SNP	ENST00000369278.4	37	c.1322G>A	CCDS5034.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.731412	0.89390	.	.	ENSG00000014123	ENST00000369278	T	0.45276	0.9	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.30854	0.0778	L	0.61387	1.9	0.80722	D	1	P	0.48503	0.911	B	0.39185	0.293	T	0.09773	-1.0659	10	0.27785	T	0.31	-26.5698	19.3156	0.94211	0.0:0.0:1.0:0.0	.	441	O94874	UFL1_HUMAN	K	441	ENSP00000358283:R441K	ENSP00000358283:R441K	R	+	2	0	KIAA0776	97097533	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.502000	0.90505	2.799000	0.96334	0.655000	0.94253	AGA		0.378	UFL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041557.1	NM_015323		37	53	0	0	0	0	37	53				
SCAF8	22828	broad.mit.edu	37	6	155145427	155145427	+	Silent	SNP	G	G	A	rs201177064		TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr6:155145427G>A	ENST00000367178.3	+	17	2562	c.1986G>A	c.(1984-1986)tcG>tcA	p.S662S	SCAF8_ENST00000367186.4_Silent_p.S728S|SCAF8_ENST00000417268.1_Silent_p.S662S|RNU6-824P_ENST00000363724.1_RNA	NM_014892.3	NP_055707.3	Q9UPN6	SCAF8_HUMAN	SR-related CTD-associated factor 8	662	Pro-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase core enzyme binding (GO:0043175)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(15)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	46						TTCCTGTGTCGATGCCGGTTC	0.458													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17697	0.0		0.0	False		,,,				2504	0.0					uc003qqa.2		NA																	0					0						c.(1984-1986)TCG>TCA		RNA-binding motif protein 16							198.0	193.0	195.0					6																	155145427		2203	4300	6503	SO:0001819	synonymous_variant	22828				mRNA processing|RNA splicing	nuclear matrix|spliceosomal complex	nucleotide binding|RNA binding|RNA polymerase core enzyme binding	g.chr6:155145427G>A	AB029039	CCDS5247.1, CCDS69226.1, CCDS75541.1	6q25.1-q25.3	2013-02-12	2011-01-10	2011-01-10	ENSG00000213079	ENSG00000213079		"""RNA binding motif (RRM) containing"""	20959	protein-coding gene	gene with protein product			"""RNA binding motif protein 16"""	RBM16		10470851	Standard	NM_001286189		Approved	KIAA1116	uc003qpz.3	Q9UPN6	OTTHUMG00000015877	ENST00000367178.3:c.1986G>A	6.37:g.155145427G>A			Somatic				RBM16_uc011efj.1_Silent_p.S728S|RBM16_uc011efk.1_Silent_p.S707S|RBM16_uc003qpz.2_Silent_p.S662S|RBM16_uc010kji.2_Silent_p.S683S	p.S662S	NM_014892	NP_055707	WXS	Illumina HiSeq	Unspecified	Q9UPN6	SCAF8_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;2.33e-15)|BRCA - Breast invasive adenocarcinoma(81;0.00524)	18	2218	+		Ovarian(120;0.196)	662			Pro-rich.		B7Z888|Q5TBU6|Q6NSK3|Q9BQN8|Q9BX43	Silent	SNP	ENST00000367178.3	37	c.1986G>A	CCDS5247.1																																																																																				0.458	SCAF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042798.1	NM_014892		89	202	0	0	0	0	89	202				
SLC29A4	222962	broad.mit.edu	37	7	5338650	5338650	+	Missense_Mutation	SNP	A	A	G			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr7:5338650A>G	ENST00000396872.3	+	8	1075	c.914A>G	c.(913-915)gAg>gGg	p.E305G	SLC29A4_ENST00000406453.3_Missense_Mutation_p.E291G|SLC29A4_ENST00000297195.4_Missense_Mutation_p.E305G			Q7RTT9	S29A4_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 4	305					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nucleoside transmembrane transporter activity (GO:0005337)			breast(1)|cervix(2)|kidney(7)|large_intestine(1)|liver(1)|lung(7)|urinary_tract(1)	20		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0903)|OV - Ovarian serous cystadenocarcinoma(56;2.65e-15)	Metformin(DB00331)	GCCCCCAACGAGTCCCCAAAG	0.692																																						uc003sod.2		NA																	0				liver(1)	1						c.(913-915)GAG>GGG		solute carrier family 29 (nucleoside							18.0	24.0	22.0					7																	5338650		2195	4296	6491	SO:0001583	missense	222962				nucleobase, nucleoside and nucleotide metabolic process	apical plasma membrane|integral to membrane	nucleoside transmembrane transporter activity	g.chr7:5338650A>G	AK075422	CCDS5340.1, CCDS75561.1	7p22.2	2013-07-17	2013-07-17		ENSG00000164638	ENSG00000164638		"""Solute carriers"""	23097	protein-coding gene	gene with protein product		609149	"""solute carrier family 29 (nucleoside transporters), member 4"""			12838422	Standard	NM_153247		Approved	FLJ34923, ENT4	uc003soc.3	Q7RTT9	OTTHUMG00000023797	ENST00000396872.3:c.914A>G	7.37:g.5338650A>G	ENSP00000380081:p.Glu305Gly		Somatic				SLC29A4_uc011jwg.1_RNA|SLC29A4_uc003soc.2_Missense_Mutation_p.E305G|SLC29A4_uc003soe.2_Missense_Mutation_p.E291G|SLC29A4_uc010ksw.2_RNA	p.E305G	NM_153247	NP_694979	WXS	Illumina HiSeq	Unspecified	Q7RTT9	S29A4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.0903)|OV - Ovarian serous cystadenocarcinoma(56;2.65e-15)	8	1075	+		Ovarian(82;0.0175)	305			Cytoplasmic (Potential).		Q6PJ08|Q86WY8|Q8NAR3|Q8NBM2	Missense_Mutation	SNP	ENST00000396872.3	37	c.914A>G	CCDS5340.1	.	.	.	.	.	.	.	.	.	.	.	2.121	-0.401351	0.04865	.	.	ENSG00000164638	ENST00000396872;ENST00000297195;ENST00000406453	T;T;T	0.67865	-0.29;-0.29;-0.29	3.54	1.68	0.24146	Major facilitator superfamily domain, general substrate transporter (1);	0.318703	0.32719	N	0.005735	T	0.33294	0.0858	N	0.02011	-0.69	0.19945	N	0.999949	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.20605	-1.0270	10	0.21014	T	0.42	-7.857	7.3564	0.26721	0.2967:0.0:0.7033:0.0	.	291;305	Q7RTT9-2;Q7RTT9	.;S29A4_HUMAN	G	305;305;291	ENSP00000380081:E305G;ENSP00000297195:E305G;ENSP00000385845:E291G	ENSP00000297195:E305G	E	+	2	0	SLC29A4	5305176	0.967000	0.33354	0.545000	0.28153	0.329000	0.28539	1.040000	0.30278	0.015000	0.14971	-0.464000	0.05259	GAG		0.692	SLC29A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060118.6	NM_153247		4	45	0	0	0	0	4	45				
GLI3	2737	broad.mit.edu	37	7	42005532	42005532	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr7:42005532G>T	ENST00000395925.3	-	15	3223	c.3139C>A	c.(3139-3141)Cag>Aag	p.Q1047K	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	1047					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						GTGTAATTCTGAAGCACGAGA	0.672									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																													uc011kbh.1		NA																	0				lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19						c.(3139-3141)CAG>AAG		GLI-Kruppel family member GLI3							41.0	45.0	44.0					7																	42005532		2203	4300	6503	SO:0001583	missense	2737	Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome	Familial Cancer Database	;	negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr7:42005532G>T		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.3139C>A	7.37:g.42005532G>T	ENSP00000379258:p.Gln1047Lys		Somatic				GLI3_uc011kbg.1_Missense_Mutation_p.Q988K	p.Q1047K	NM_000168	NP_000159	WXS	Illumina HiSeq	Unspecified	P10071	GLI3_HUMAN			15	3230	-			1047					A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	ENST00000395925.3	37	c.3139C>A	CCDS5465.1	.	.	.	.	.	.	.	.	.	.	G	12.32	1.902199	0.33628	.	.	ENSG00000106571	ENST00000395925	T	0.18502	2.21	5.47	4.6	0.57074	.	0.050094	0.85682	D	0.000000	T	0.25938	0.0632	M	0.84326	2.69	0.80722	D	1	B	0.29378	0.243	B	0.28465	0.09	T	0.04467	-1.0949	10	0.44086	T	0.13	.	14.2147	0.65786	0.0718:0.0:0.9282:0.0	.	1047	P10071	GLI3_HUMAN	K	1047	ENSP00000379258:Q1047K	ENSP00000379258:Q1047K	Q	-	1	0	GLI3	41972057	1.000000	0.71417	0.985000	0.45067	0.292000	0.27327	7.666000	0.83877	1.311000	0.45024	-0.251000	0.11542	CAG		0.672	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168		16	22	1	0	1.15e-07	1.28e-07	16	22				
CLDN15	24146	broad.mit.edu	37	7	100877667	100877667	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr7:100877667C>T	ENST00000401528.1	-	3	1399	c.274G>A	c.(274-276)Ggc>Agc	p.G92S	CLDN15_ENST00000308344.5_Missense_Mutation_p.G92S|CLDN15_ENST00000433422.1_5'UTR	NM_001185080.1	NP_001172009.1	P56746	CLD15_HUMAN	claudin 15	92					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|ion transport (GO:0006811)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	10	Lung NSC(181;0.168)|all_lung(186;0.215)					AGCAAGAGGCCGAGGAAGCCC	0.647																																						uc003uyg.1		NA																	0				ovary(1)	1						c.(274-276)GGC>AGC		claudin 15							60.0	64.0	63.0					7																	100877667		2203	4300	6503	SO:0001583	missense	24146				calcium-independent cell-cell adhesion|tight junction assembly	integral to membrane|tight junction	identical protein binding|structural molecule activity	g.chr7:100877667C>T	AJ245738	CCDS5717.1	7q22	2008-07-18			ENSG00000106404	ENSG00000106404		"""Claudins"""	2036	protein-coding gene	gene with protein product		615778					Standard	NM_014343		Approved		uc003uyg.2	P56746	OTTHUMG00000150512	ENST00000401528.1:c.274G>A	7.37:g.100877667C>T	ENSP00000385300:p.Gly92Ser		Somatic				CLDN15_uc003uyh.1_Missense_Mutation_p.G92S|CLDN15_uc003uyi.2_3'UTR	p.G92S	NM_014343	NP_055158	WXS	Illumina HiSeq	Unspecified	P56746	CLD15_HUMAN			2	528	-	Lung NSC(181;0.168)|all_lung(186;0.215)		92			Helical; (Potential).		B3KPB5	Missense_Mutation	SNP	ENST00000401528.1	37	c.274G>A	CCDS5717.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.216284	0.79352	.	.	ENSG00000106404	ENST00000308344;ENST00000401528	D;D	0.86497	-2.13;-2.13	5.11	5.11	0.69529	.	0.239682	0.41823	N	0.000819	D	0.86134	0.5860	L	0.53671	1.685	0.53005	D	0.999962	D	0.53151	0.958	P	0.45037	0.467	D	0.86536	0.1825	10	0.42905	T	0.14	.	16.0449	0.80714	0.0:1.0:0.0:0.0	.	92	P56746	CLD15_HUMAN	S	92	ENSP00000308870:G92S;ENSP00000385300:G92S	ENSP00000308870:G92S	G	-	1	0	CLDN15	100664387	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	4.215000	0.58534	2.379000	0.81126	0.462000	0.41574	GGC		0.647	CLDN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318698.1	NM_014343		27	71	0	0	0	0	27	71				
OR2F1	26211	broad.mit.edu	37	7	143657530	143657530	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr7:143657530C>G	ENST00000392899.1	+	1	504	c.467C>G	c.(466-468)tCt>tGt	p.S156C	RP4-669B10.3_ENST00000466281.1_lincRNA	NM_012369.2	NP_036501.2	Q13607	OR2F1_HUMAN	olfactory receptor, family 2, subfamily F, member 1 (gene/pseudogene)	156					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|skin(4)	34	Melanoma(164;0.0903)					TTCATCAGCTCTCCTGTGCAG	0.522																																						uc003wds.1		NA																	0				skin(2)|ovary(1)	3						c.(466-468)TCT>TGT		olfactory receptor, family 2, subfamily F,							140.0	117.0	125.0					7																	143657530		2203	4300	6503	SO:0001583	missense	26211				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143657530C>G	U56421	CCDS5887.1	7q35	2013-06-03	2013-06-03		ENSG00000213215	ENSG00000213215		"""GPCR / Class A : Olfactory receptors"""	8246	protein-coding gene	gene with protein product		608497	"""olfactory receptor, family 2, subfamily F, member 1"""	OR2F4, OR2F5, OR2F3, OR2F3P		9500546	Standard	NM_012369		Approved	OLF3, OR7-140, OR7-139, OR14-60	uc003wds.1	Q13607	OTTHUMG00000157771	ENST00000392899.1:c.467C>G	7.37:g.143657530C>G	ENSP00000376633:p.Ser156Cys		Somatic					p.S156C	NM_012369	NP_036501	WXS	Illumina HiSeq	Unspecified	Q13607	OR2F1_HUMAN			1	511	+	Melanoma(164;0.0903)		156			Helical; Name=4; (Potential).		A4D2G1|Q6IFP7|Q96R49|Q9UDX1	Missense_Mutation	SNP	ENST00000392899.1	37	c.467C>G	CCDS5887.1	.	.	.	.	.	.	.	.	.	.	C	13.61	2.287663	0.40494	.	.	ENSG00000213215	ENST00000392899	T	0.44482	0.92	5.53	5.53	0.82687	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000066	T	0.69115	0.3075	M	0.85099	2.735	0.42344	D	0.992342	D	0.89917	1.0	D	0.91635	0.999	T	0.72994	-0.4122	10	0.66056	D	0.02	-25.1823	17.0114	0.86407	0.0:1.0:0.0:0.0	.	156	Q13607	OR2F1_HUMAN	C	156	ENSP00000376633:S156C	ENSP00000376633:S156C	S	+	2	0	OR2F1	143288463	0.000000	0.05858	0.578000	0.28575	0.022000	0.10575	0.316000	0.19469	2.871000	0.98454	0.655000	0.94253	TCT		0.522	OR2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349581.1			38	68	0	0	0	0	38	68				
OR2A7	401427	broad.mit.edu	37	7	143956023	143956023	+	Silent	SNP	C	C	T			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr7:143956023C>T	ENST00000493325.1	-	1	792	c.699G>A	c.(697-699)caG>caA	p.Q233Q	OR2A1-AS1_ENST00000476560.1_RNA|OR2A1-AS1_ENST00000478806.1_RNA|OR2A1-AS1_ENST00000463561.1_RNA|OR2A1-AS1_ENST00000461843.1_RNA|RP4-545C24.1_ENST00000460955.1_RNA|ARHGEF35_ENST00000543357.1_Intron|OR2A1-AS1_ENST00000487102.1_RNA|OR2A1-AS1_ENST00000498397.1_RNA|OR2A1-AS1_ENST00000489488.1_RNA	NM_001005328.1	NP_001005328.1	Q96R45	OR2A7_HUMAN	olfactory receptor, family 2, subfamily A, member 7	233						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)	6	Melanoma(164;0.14)					AGGCTTTCCTCTGAACTTCCC	0.483																																						uc011kuc.1		NA																	0				ovary(1)	1						c.(697-699)CAG>CAA		olfactory receptor, family 2, subfamily A,							170.0	172.0	171.0					7																	143956023		2203	4300	6503	SO:0001819	synonymous_variant	401427				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143956023C>T		CCDS55177.1	7q35	2013-09-20			ENSG00000243896	ENSG00000243896		"""GPCR / Class A : Olfactory receptors"""	8234	protein-coding gene	gene with protein product							Standard	NM_001005328		Approved	HSDJ0798C17	uc011kuc.2	Q96R45	OTTHUMG00000158002	ENST00000493325.1:c.699G>A	7.37:g.143956023C>T			Somatic				OR2A9P_uc003wec.1_Intron|uc003wed.2_5'Flank	p.Q233Q	NM_001005328	NP_001005328	WXS	Illumina HiSeq	Unspecified	Q96R45	OR2A7_HUMAN			1	699	-	Melanoma(164;0.14)		233			Cytoplasmic (Potential).		B2RN57|Q6IFP4	Silent	SNP	ENST00000493325.1	37	c.699G>A	CCDS55177.1																																																																																				0.483	OR2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349979.1			47	268	0	0	0	0	47	268				
C9orf131	138724	broad.mit.edu	37	9	35044336	35044336	+	Silent	SNP	G	G	A	rs115027328		TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr9:35044336G>A	ENST00000312292.5	+	2	1757	c.1710G>A	c.(1708-1710)ccG>ccA	p.P570P	C9orf131_ENST00000421362.2_Silent_p.P522P|FLJ00273_ENST00000595331.1_5'Flank|C9orf131_ENST00000354479.5_Silent_p.P497P	NM_001040410.1|NM_203299.2	NP_001035500.1|NP_976044.2	Q5VYM1	CI131_HUMAN	chromosome 9 open reading frame 131	570										cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(23)|prostate(2)|skin(2)|stomach(1)	39	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)			CTCTTGCACCGGAGCTGCTCA	0.527																																						uc003zvw.2		NA																	0					0						c.(1708-1710)CCG>CCA		hypothetical protein LOC138724 isoform A							125.0	128.0	127.0					9																	35044336		2203	4300	6503	SO:0001819	synonymous_variant	138724							g.chr9:35044336G>A	BC045643	CCDS6572.2, CCDS47961.1, CCDS47962.1	9p13.3	2008-02-05			ENSG00000174038	ENSG00000174038			31418	protein-coding gene	gene with protein product							Standard	NM_001287391		Approved	MGC41945	uc003zvw.3	Q5VYM1	OTTHUMG00000019853	ENST00000312292.5:c.1710G>A	9.37:g.35044336G>A			Somatic				C9orf131_uc003zvu.2_Silent_p.P522P|C9orf131_uc003zvv.2_Silent_p.P497P|C9orf131_uc003zvx.2_Silent_p.P535P	p.P570P	NM_203299	NP_976044	WXS	Illumina HiSeq	Unspecified	Q5VYM1	CI131_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)		2	1739	+	all_epithelial(49;0.22)		570					A6NLE6|E9PB26|Q86XC6|Q9UF74	Silent	SNP	ENST00000312292.5	37	c.1710G>A	CCDS6572.2																																																																																				0.527	C9orf131-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052283.5	NM_203299		4	264	0	0	0	0	4	264				
FAM120A	23196	broad.mit.edu	37	9	96291641	96291641	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr9:96291641G>A	ENST00000277165.6	+	9	1707	c.1513G>A	c.(1513-1515)Ggc>Agc	p.G505S	FAM120A_ENST00000375389.3_Missense_Mutation_p.G505S|FAM120A_ENST00000340893.4_Missense_Mutation_p.G505S|FAM120A_ENST00000333936.5_Missense_Mutation_p.G533S	NM_014612.3	NP_055427.2	Q9NZB2	F120A_HUMAN	family with sequence similarity 120A	505						cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(8)|lung(12)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						GTAGGCAGAAGGCTCGTCCAC	0.537																																						uc004atw.2		NA																	0					0						c.(1513-1515)GGC>AGC		oxidative stress-associated Src activator							51.0	45.0	47.0					9																	96291641		2203	4300	6503	SO:0001583	missense	23196					cytoplasm|plasma membrane	RNA binding	g.chr9:96291641G>A	AF214737	CCDS6706.1, CCDS75859.1	9q22.31	2013-03-08	2006-07-04	2006-07-04	ENSG00000048828	ENSG00000048828			13247	protein-coding gene	gene with protein product	"""DNA polymerase-transactivated protein 1"", ""oxidative stess-associated Src activator"""	612265	"""chromosome 9 open reading frame 10"""	C9orf10		14585507	Standard	NM_001286722		Approved	KIAA0183, DNAPTP1, OSSA	uc004atw.3	Q9NZB2	OTTHUMG00000020252	ENST00000277165.6:c.1513G>A	9.37:g.96291641G>A	ENSP00000277165:p.Gly505Ser		Somatic				FAM120A_uc004atv.2_Missense_Mutation_p.G505S|FAM120A_uc004atx.2_Missense_Mutation_p.G287S|FAM120A_uc004aty.2_Missense_Mutation_p.G286S|FAM120A_uc004atz.2_Missense_Mutation_p.G154S|FAM120A_uc010mrf.1_RNA|FAM120A_uc010mrg.2_5'Flank	p.G505S	NM_014612	NP_055427	WXS	Illumina HiSeq	Unspecified	Q9NZB2	F120A_HUMAN			9	1538	+			505					A6NGU0|C4AMC6|O60649|Q14688|Q4VXF4|Q4VXF5|Q4VXG2|Q86V69|Q96I21|Q9NZB1	Missense_Mutation	SNP	ENST00000277165.6	37	c.1513G>A	CCDS6706.1	.	.	.	.	.	.	.	.	.	.	G	18.25	3.582198	0.65992	.	.	ENSG00000048828	ENST00000375389;ENST00000277165;ENST00000333936;ENST00000340893	T;T;T;T	0.48522	0.81;0.81;0.81;0.81	5.63	5.63	0.86233	.	0.178879	0.40554	N	0.001075	T	0.46112	0.1376	L	0.29908	0.895	0.49483	D	0.999792	P;P;P;P;P	0.49559	0.728;0.867;0.728;0.728;0.925	B;B;B;B;P	0.49752	0.366;0.382;0.277;0.297;0.621	T	0.17198	-1.0377	10	0.11182	T	0.66	-11.876	19.6835	0.95972	0.0:0.0:1.0:0.0	.	505;533;505;505;505	Q9NZB2-4;Q9NZB2-6;Q9NZB2-5;Q9NZB2;Q9NZB2-2	.;.;.;F120A_HUMAN;.	S	505;505;533;505	ENSP00000364538:G505S;ENSP00000277165:G505S;ENSP00000334918:G533S;ENSP00000344698:G505S	ENSP00000277165:G505S	G	+	1	0	FAM120A	95331462	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.517000	0.81783	2.650000	0.89964	0.655000	0.94253	GGC		0.537	FAM120A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053160.2	NM_014612		33	37	0	0	0	0	33	37				
NOTCH1	4851	broad.mit.edu	37	9	139402754	139402754	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr9:139402754G>C	ENST00000277541.6	-	20	3330	c.3255C>G	c.(3253-3255)tgC>tgG	p.C1085W		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	1085	EGF-like 28. {ECO:0000255|PROSITE- ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		AGCCGCTGGGGCACTCGCAGC	0.652			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																												uc004chz.2		NA		Dom	yes		9	9q34.3	4851	T|Mis|O	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""			L	TRB@		T-ALL		0				haematopoietic_and_lymphoid_tissue(791)|upper_aerodigestive_tract(29)|lung(13)|central_nervous_system(10)|breast(9)|large_intestine(1)|skin(1)|oesophagus(1)|pancreas(1)	856						c.(3253-3255)TGC>TGG		notch1 preproprotein							70.0	88.0	82.0					9																	139402754		2127	4216	6343	SO:0001583	missense	4851				aortic valve morphogenesis|immune response|negative regulation of BMP signaling pathway|negative regulation of cell-substrate adhesion|negative regulation of myoblast differentiation|negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|Notch receptor processing	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity	g.chr9:139402754G>C	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.3255C>G	9.37:g.139402754G>C	ENSP00000277541:p.Cys1085Trp	HNSCC(8;0.001)	Somatic				NOTCH1_uc004cia.1_Missense_Mutation_p.C315W	p.C1085W	NM_017617	NP_060087	WXS	Illumina HiSeq	Unspecified	P46531	NOTC1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)	20	3255	-	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)	1085			Extracellular (Potential).|EGF-like 28.		Q59ED8|Q5SXM3	Missense_Mutation	SNP	ENST00000277541.6	37	c.3255C>G	CCDS43905.1	.	.	.	.	.	.	.	.	.	.	G	17.93	3.510218	0.64522	.	.	ENSG00000148400	ENST00000277541	D	0.99992	-12.4	5.23	3.4	0.38934	EGF (1);Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.99994	0.9999	H	0.98721	4.31	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.99930	1.1315	10	0.87932	D	0	.	11.0806	0.48057	0.1513:0.0:0.8487:0.0	.	1085	P46531	NOTC1_HUMAN	W	1085	ENSP00000277541:C1085W	ENSP00000277541:C1085W	C	-	3	2	NOTCH1	138522575	1.000000	0.71417	0.905000	0.35620	0.942000	0.58702	3.460000	0.53028	0.599000	0.29845	-0.137000	0.14449	TGC		0.652	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617		36	65	0	0	0	0	36	65				
PTCHD1	139411	broad.mit.edu	37	X	23411520	23411520	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chrX:23411520G>A	ENST00000379361.4	+	3	2745	c.1885G>A	c.(1885-1887)Gac>Aac	p.D629N		NM_173495.2	NP_775766.2	Q96NR3	PTHD1_HUMAN	patched domain containing 1	629					cognition (GO:0050890)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(4)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(4)|skin(2)|urinary_tract(2)	42						TTTTCAAGAGGACATCATCTT	0.398																																						uc004dal.3		NA																	0				ovary(4)|kidney(1)|skin(1)	6						c.(1885-1887)GAC>AAC		patched domain containing 1							63.0	63.0	63.0					X																	23411520		2199	4299	6498	SO:0001583	missense	139411				cognition|smoothened signaling pathway	integral to membrane|plasma membrane	hedgehog receptor activity	g.chrX:23411520G>A	AK054858	CCDS35215.2	Xp22.13	2008-02-05			ENSG00000165186	ENSG00000165186			26392	protein-coding gene	gene with protein product		300828					Standard	NM_173495		Approved	FLJ30296	uc004dal.4	Q96NR3	OTTHUMG00000021251	ENST00000379361.4:c.1885G>A	X.37:g.23411520G>A	ENSP00000368666:p.Asp629Asn		Somatic					p.D629N	NM_173495	NP_775766	WXS	Illumina HiSeq	Unspecified	Q96NR3	PTHD1_HUMAN			3	1893	+			629					B4DQH0|Q0IJ60|Q6P6B8	Missense_Mutation	SNP	ENST00000379361.4	37	c.1885G>A	CCDS35215.2	.	.	.	.	.	.	.	.	.	.	G	20.8	4.056935	0.76074	.	.	ENSG00000165186	ENST00000379361	D	0.86694	-2.16	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.92156	0.7513	M	0.66297	2.02	0.80722	D	1	D	0.54397	0.966	D	0.64687	0.928	D	0.90201	0.4257	10	0.27785	T	0.31	.	18.7851	0.91951	0.0:0.0:1.0:0.0	.	629	Q96NR3	PTHD1_HUMAN	N	629	ENSP00000368666:D629N	ENSP00000368666:D629N	D	+	1	0	PTCHD1	23321441	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.381000	0.81170	0.600000	0.82982	GAC		0.398	PTCHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056047.2	NM_173495		37	64	0	0	0	0	37	64				
B2M	567	broad.mit.edu	37	15	45003781	45003782	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr15:45003781_45003782delCT	ENST00000558401.1	+	1	107_108	c.37_38delCT	c.(37-39)ctcfs	p.L13fs	B2M_ENST00000559916.1_Frame_Shift_Del_p.L13fs|B2M_ENST00000544417.1_Frame_Shift_Del_p.L13fs|PATL2_ENST00000558573.1_5'Flank	NM_004048.2	NP_004039.1	P61769	B2MG_HUMAN	beta-2-microglobulin	13					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein refolding (GO:0042026)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to molecule of bacterial origin (GO:0002237)|retina homeostasis (GO:0001895)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cytoplasm (GO:0005737)|early endosome lumen (GO:0031905)|early endosome membrane (GO:0031901)|endoplasmic reticulum lumen (GO:0005788)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)	p.L15fs*41(4)|p.A11fs*42(1)|p.L13F(1)		breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(30)|kidney(8)|large_intestine(6)|lung(6)|ovary(2)|skin(2)|urinary_tract(1)	59		all_cancers(109;1.88e-13)|all_epithelial(112;2.13e-11)|Lung NSC(122;2.22e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;4.16e-21)|GBM - Glioblastoma multiforme(94;8.97e-07)|COAD - Colon adenocarcinoma(120;0.0357)|Colorectal(105;0.0377)|Lung(196;0.0903)|LUSC - Lung squamous cell carcinoma(244;0.192)		GCTCGCGCTACTCTCTCTTTCT	0.614																																						uc001zuc.2		NA																	6	Deletion - Frameshift(5)|Substitution - Missense(1)		large_intestine(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|skin(1)	ovary(2)|skin(1)	3						c.(37-39)CTCfs		beta-2-microglobulin precursor																																				SO:0001589	frameshift_variant	567				antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|regulation of defense response to virus by virus|viral reproduction	early endosome membrane|Golgi membrane|MHC class I protein complex	protein binding	g.chr15:45003781_45003782delCT	AB021288	CCDS10113.1	15q21-q22.2	2013-01-11			ENSG00000166710	ENSG00000166710		"""Immunoglobulin superfamily / C1-set domain containing"""	914	protein-coding gene	gene with protein product		109700					Standard	NM_004048		Approved		uc001zuc.3	P61769	OTTHUMG00000131247	ENST00000558401.1:c.37_38delCT	15.37:g.45003787_45003788delCT	ENSP00000452780:p.Leu13fs		Somatic				B2M_uc010uek.1_Frame_Shift_Del_p.L13fs|B2M_uc010bdx.1_Frame_Shift_Del_p.L13fs	p.L13fs	NM_004048	NP_004039	WXS	Illumina HiSeq	Unspecified	P61769	B2MG_HUMAN		all cancers(107;4.16e-21)|GBM - Glioblastoma multiforme(94;8.97e-07)|COAD - Colon adenocarcinoma(120;0.0357)|Colorectal(105;0.0377)|Lung(196;0.0903)|LUSC - Lung squamous cell carcinoma(244;0.192)	1	97_98	+		all_cancers(109;1.88e-13)|all_epithelial(112;2.13e-11)|Lung NSC(122;2.22e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)	13					P01884|Q540F8|Q6IAT8|Q9UCK0|Q9UD48|Q9UDF4	Frame_Shift_Del	DEL	ENST00000558401.1	37	c.37_38delCT	CCDS10113.1																																																																																				0.614	B2M-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254007.2	NM_004048		31	26	NA	NA	NA	NA	31	26	---	---	---	---
ZNF221	7638	broad.mit.edu	37	19	44470025	44470025	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CR-5243-01A-01D-1512-08	TCGA-CR-5243-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	297e8b35-5b8b-4d5b-b812-86165f949a20	20992f4c-7762-48d2-8fb2-8f6eb1763134	g.chr19:44470025delA	ENST00000251269.5	+	6	699	c.371delA	c.(370-372)caafs	p.Q124fs	ZNF221_ENST00000592350.1_Frame_Shift_Del_p.Q124fs|ZNF221_ENST00000587682.1_Frame_Shift_Del_p.Q124fs	NM_013359.2	NP_037491	Q9UK13	ZN221_HUMAN	zinc finger protein 221	124					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(11)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	30		Prostate(69;0.0352)				TCCTGTCAGCAAATATGGGAA	0.443																																						uc002oxx.2		NA																	0				skin(1)	1						c.(370-372)CAAfs		zinc finger protein 221							89.0	82.0	85.0					19																	44470025		2203	4300	6503	SO:0001589	frameshift_variant	7638				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:44470025delA	AF187987	CCDS12633.1	19q13.31	2013-01-08				ENSG00000159905		"""Zinc fingers, C2H2-type"", ""-"""	13014	protein-coding gene	gene with protein product							Standard	NM_013359		Approved		uc002oxx.2	Q9UK13		ENST00000251269.5:c.371delA	19.37:g.44470025delA	ENSP00000251269:p.Gln124fs		Somatic				ZNF221_uc010ejb.1_Frame_Shift_Del_p.Q124fs|ZNF221_uc010xws.1_Frame_Shift_Del_p.Q124fs	p.Q124fs	NM_013359	NP_037491	WXS	Illumina HiSeq	Unspecified	Q9UK13	ZN221_HUMAN			6	699	+		Prostate(69;0.0352)	124					B2RAI6|Q2M2H2|Q9P1U8	Frame_Shift_Del	DEL	ENST00000251269.5	37	c.371delA	CCDS12633.1																																																																																				0.443	ZNF221-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460068.1			47	112	NA	NA	NA	NA	47	112	---	---	---	---
