#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
ATAD3C	219293	broad.mit.edu	37	1	1390860	1390860	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:1390860C>T	ENST00000378785.2	+	5	1394	c.399C>T	c.(397-399)ctC>ctT	p.L133L		NM_001039211.2	NP_001034300.2	Q5T2N8	ATD3C_HUMAN	ATPase family, AAA domain containing 3C	133							ATP binding (GO:0005524)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|lung(4)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		GGCGGCTCCTCAGTCGACCCC	0.667																																						uc001aft.2		NA																	0					0						c.(397-399)CTC>CTT		ATPase family, AAA domain containing 3C							56.0	57.0	57.0					1																	1390860		692	1591	2283	SO:0001819	synonymous_variant	219293						ATP binding|nucleoside-triphosphatase activity	g.chr1:1390860C>T	AK091918	CCDS44039.1	1p36.33	2010-04-21		2007-02-08	ENSG00000215915	ENSG00000215915		"""ATPases / AAA-type"""	32151	protein-coding gene	gene with protein product							Standard	NM_001039211		Approved	FLJ34599	uc001aft.2	Q5T2N8	OTTHUMG00000000531	ENST00000378785.2:c.399C>T	1.37:g.1390860C>T			Somatic					p.L133L	NM_001039211	NP_001034300	WXS	Illumina HiSeq	Unspecified	Q5T2N8	ATD3C_HUMAN		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)	5	1394	+	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)	133					Q8N1Z5	Silent	SNP	ENST00000378785.2	37	c.399C>T	CCDS44039.1																																																																																				0.667	ATAD3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001279.3	NM_001039211		8	21	0	0	0	0	8	21				
SPSB1	80176	broad.mit.edu	37	1	9427562	9427562	+	Silent	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:9427562G>C	ENST00000328089.6	+	3	1091	c.750G>C	c.(748-750)ggG>ggC	p.G250G	SPSB1_ENST00000377399.2_Silent_p.G250G|SPSB1_ENST00000357898.3_Silent_p.G250G	NM_025106.3	NP_079382.2	Q96BD6	SPSB1_HUMAN	splA/ryanodine receptor domain and SOCS box containing 1	250	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				breast(1)|endometrium(3)|kidney(2)|lung(5)|prostate(2)	13	all_lung(157;0.194)	all_epithelial(116;4.38e-15)|all_lung(118;0.000156)|Lung NSC(185;0.000446)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.72e-07)|COAD - Colon adenocarcinoma(227;9.12e-05)|Kidney(185;0.000296)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00193)|BRCA - Breast invasive adenocarcinoma(304;0.00202)|READ - Rectum adenocarcinoma(331;0.0419)		TGGCCCTGGGGAGGGAGCGCC	0.672																																						uc010oae.1		NA																	0					0						c.(748-750)GGG>GGC		splA/ryanodine receptor domain and SOCS box							39.0	43.0	41.0					1																	9427562		2203	4299	6502	SO:0001819	synonymous_variant	80176				intracellular signal transduction	cytoplasm		g.chr1:9427562G>C		CCDS102.1	1p36.22	2008-02-05			ENSG00000171621	ENSG00000171621			30628	protein-coding gene	gene with protein product		611657				15713673, 12076535	Standard	NM_025106		Approved	SSB-1	uc010oae.2	Q96BD6	OTTHUMG00000001279	ENST00000328089.6:c.750G>C	1.37:g.9427562G>C			Somatic				SPSB1_uc001apv.2_Silent_p.G250G	p.G250G	NM_025106	NP_079382	WXS	Illumina HiSeq	Unspecified	Q96BD6	SPSB1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.72e-07)|COAD - Colon adenocarcinoma(227;9.12e-05)|Kidney(185;0.000296)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00193)|BRCA - Breast invasive adenocarcinoma(304;0.00202)|READ - Rectum adenocarcinoma(331;0.0419)	3	1089	+	all_lung(157;0.194)	all_epithelial(116;4.38e-15)|all_lung(118;0.000156)|Lung NSC(185;0.000446)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)	250			SOCS box.		A2A275|Q59FA1|Q5TIH9|Q9BRY9|Q9H6C5	Silent	SNP	ENST00000328089.6	37	c.750G>C	CCDS102.1																																																																																				0.672	SPSB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003727.2	NM_025106		13	46	0	0	0	0	13	46				
SPSB1	80176	broad.mit.edu	37	1	9427566	9427566	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:9427566G>A	ENST00000328089.6	+	3	1095	c.754G>A	c.(754-756)Gag>Aag	p.E252K	SPSB1_ENST00000377399.2_Missense_Mutation_p.E252K|SPSB1_ENST00000357898.3_Missense_Mutation_p.E252K	NM_025106.3	NP_079382.2	Q96BD6	SPSB1_HUMAN	splA/ryanodine receptor domain and SOCS box containing 1	252	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				breast(1)|endometrium(3)|kidney(2)|lung(5)|prostate(2)	13	all_lung(157;0.194)	all_epithelial(116;4.38e-15)|all_lung(118;0.000156)|Lung NSC(185;0.000446)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.72e-07)|COAD - Colon adenocarcinoma(227;9.12e-05)|Kidney(185;0.000296)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00193)|BRCA - Breast invasive adenocarcinoma(304;0.00202)|READ - Rectum adenocarcinoma(331;0.0419)		CCTGGGGAGGGAGCGCCTGGG	0.672																																						uc010oae.1		NA																	0					0						c.(754-756)GAG>AAG		splA/ryanodine receptor domain and SOCS box							37.0	41.0	40.0					1																	9427566		2203	4299	6502	SO:0001583	missense	80176				intracellular signal transduction	cytoplasm		g.chr1:9427566G>A		CCDS102.1	1p36.22	2008-02-05			ENSG00000171621	ENSG00000171621			30628	protein-coding gene	gene with protein product		611657				15713673, 12076535	Standard	NM_025106		Approved	SSB-1	uc010oae.2	Q96BD6	OTTHUMG00000001279	ENST00000328089.6:c.754G>A	1.37:g.9427566G>A	ENSP00000330221:p.Glu252Lys		Somatic				SPSB1_uc001apv.2_Missense_Mutation_p.E252K	p.E252K	NM_025106	NP_079382	WXS	Illumina HiSeq	Unspecified	Q96BD6	SPSB1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.72e-07)|COAD - Colon adenocarcinoma(227;9.12e-05)|Kidney(185;0.000296)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00193)|BRCA - Breast invasive adenocarcinoma(304;0.00202)|READ - Rectum adenocarcinoma(331;0.0419)	3	1093	+	all_lung(157;0.194)	all_epithelial(116;4.38e-15)|all_lung(118;0.000156)|Lung NSC(185;0.000446)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)	252			SOCS box.		A2A275|Q59FA1|Q5TIH9|Q9BRY9|Q9H6C5	Missense_Mutation	SNP	ENST00000328089.6	37	c.754G>A	CCDS102.1	.	.	.	.	.	.	.	.	.	.	G	15.74	2.921658	0.52653	.	.	ENSG00000171621	ENST00000328089;ENST00000357898;ENST00000377399	T;T;T	0.42513	0.97;0.97;0.97	5.16	4.22	0.49857	SOCS protein, C-terminal (3);	0.105342	0.64402	D	0.000006	T	0.26629	0.0651	N	0.17764	0.52	0.54753	D	0.999987	B	0.09022	0.002	B	0.12837	0.008	T	0.05989	-1.0852	10	0.08179	T	0.78	-5.2247	14.5475	0.68041	0.0:0.1472:0.8528:0.0	.	252	Q96BD6	SPSB1_HUMAN	K	252	ENSP00000330221:E252K;ENSP00000350573:E252K;ENSP00000366616:E252K	ENSP00000330221:E252K	E	+	1	0	SPSB1	9350153	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.185000	0.65076	1.128000	0.42052	0.655000	0.94253	GAG		0.672	SPSB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003727.2	NM_025106		13	43	0	0	0	0	13	43				
CASZ1	54897	broad.mit.edu	37	1	10702951	10702951	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:10702951G>A	ENST00000377022.3	-	20	4444	c.4127C>T	c.(4126-4128)tCc>tTc	p.S1376F	RP4-734G22.3_ENST00000606802.1_RNA	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	1376					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		GGGGGTGCTGGAGCAGCTCCG	0.667																																						uc001aro.2		NA																	0				skin(1)	1						c.(4126-4128)TCC>TTC		castor homolog 1, zinc finger isoform a							23.0	27.0	26.0					1																	10702951		2124	4234	6358	SO:0001583	missense	54897				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding	g.chr1:10702951G>A	AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.4127C>T	1.37:g.10702951G>A	ENSP00000366221:p.Ser1376Phe		Somatic					p.S1376F	NM_001079843	NP_001073312	WXS	Illumina HiSeq	Unspecified	Q86V15	CASZ1_HUMAN	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)	20	4447	-	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	1376					Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Missense_Mutation	SNP	ENST00000377022.3	37	c.4127C>T	CCDS41246.1	.	.	.	.	.	.	.	.	.	.	G	18.87	3.714628	0.68730	.	.	ENSG00000130940	ENST00000377022	.	.	.	4.91	3.98	0.46160	.	0.137736	0.28635	U	0.014657	T	0.39784	0.1091	N	0.22421	0.69	0.80722	D	1	P	0.45078	0.85	B	0.39562	0.303	T	0.41413	-0.9510	9	0.66056	D	0.02	-27.2074	14.5014	0.67724	0.0:0.0:0.852:0.148	.	1376	Q86V15	CASZ1_HUMAN	F	1376	.	ENSP00000366221:S1376F	S	-	2	0	CASZ1	10625538	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.445000	0.80570	1.038000	0.40049	0.555000	0.69702	TCC		0.667	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005673.2	NM_017766		3	22	0	0	0	0	3	22				
CASZ1	54897	broad.mit.edu	37	1	10703259	10703259	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:10703259C>T	ENST00000377022.3	-	19	4295	c.3978G>A	c.(3976-3978)cgG>cgA	p.R1326R	RP4-734G22.3_ENST00000606802.1_RNA	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	1326					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		CCAGCATCCTCCGCATGTGCT	0.652																																						uc001aro.2		NA																	0				skin(1)	1						c.(3976-3978)CGG>CGA		castor homolog 1, zinc finger isoform a							56.0	64.0	61.0					1																	10703259		2080	4214	6294	SO:0001819	synonymous_variant	54897				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding	g.chr1:10703259C>T	AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.3978G>A	1.37:g.10703259C>T			Somatic					p.R1326R	NM_001079843	NP_001073312	WXS	Illumina HiSeq	Unspecified	Q86V15	CASZ1_HUMAN	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)	19	4298	-	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	1326					Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Silent	SNP	ENST00000377022.3	37	c.3978G>A	CCDS41246.1																																																																																				0.652	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005673.2	NM_017766		7	49	0	0	0	0	7	49				
HNRNPCL1	343069	broad.mit.edu	37	1	12907868	12907868	+	Missense_Mutation	SNP	C	C	T	rs540095399		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:12907868C>T	ENST00000317869.6	-	2	500	c.275G>A	c.(274-276)cGa>cAa	p.R92Q		NM_001013631.1|NM_001136561.2|NM_001146181.1	NP_001013653.1|NP_001130033.2|NP_001139653.1	O60812	HNRC1_HUMAN	heterogeneous nuclear ribonucleoprotein C-like 1	92						nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|stomach(2)	29						TGCGTTTCCTCGGTTCACTTT	0.483																																						uc009vno.2		NA																	0					0						c.(274-276)CGA>CAA		heterogeneous nuclear ribonucleoprotein C-like							134.0	131.0	132.0					1																	12907868		2203	4300	6503	SO:0001583	missense	649330						nucleic acid binding|nucleotide binding	g.chr1:12907868C>T	BC002696	CCDS30591.1	1p36.21	2013-02-12		2008-04-18	ENSG00000179172	ENSG00000179172		"""RNA binding motif (RRM) containing"""	29295	protein-coding gene	gene with protein product				HNRPCL1			Standard	NM_001013631		Approved			O60812	OTTHUMG00000001931	ENST00000317869.6:c.275G>A	1.37:g.12907868C>T	ENSP00000365370:p.Arg92Gln		Somatic				HNRNPCL1_uc010obf.1_Missense_Mutation_p.R92Q	p.R92Q	NM_001146181	NP_001139653	WXS	Illumina HiSeq	Unspecified	B7ZW38	B7ZW38_HUMAN			1	370	-			92					B2RP44	Missense_Mutation	SNP	ENST00000317869.6	37	c.275G>A	CCDS30591.1	.	.	.	.	.	.	.	.	.	.	.	8.904	0.957023	0.18507	.	.	ENSG00000179172	ENST00000317869	T	0.43294	0.95	1.09	-1.91	0.07641	Nucleotide-binding, alpha-beta plait (1);	0.000000	0.64402	U	0.000009	T	0.33789	0.0875	M	0.82193	2.58	0.09310	N	1	B	0.34264	0.446	B	0.24394	0.053	T	0.20306	-1.0279	10	0.52906	T	0.07	.	3.8597	0.08990	0.2208:0.602:0.0:0.1772	.	92	O60812	HNRCL_HUMAN	Q	92	ENSP00000365370:R92Q	ENSP00000365370:R92Q	R	-	2	0	HNRNPCL1	12830455	0.418000	0.25440	0.000000	0.03702	0.000000	0.00434	1.003000	0.29809	-0.877000	0.04012	-1.218000	0.01608	CGA		0.483	HNRNPCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005462.1	NM_001013631		9	150	0	0	0	0	9	150				
KAZN	23254	broad.mit.edu	37	1	15392164	15392164	+	Silent	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:15392164G>A	ENST00000376030.2	+	8	1431	c.1137G>A	c.(1135-1137)aaG>aaA	p.K379K	KAZN_ENST00000422387.2_Silent_p.K379K|KAZN_ENST00000400798.2_Silent_p.K285K|KAZN_ENST00000361144.5_Silent_p.K373K|KAZN_ENST00000400797.3_Silent_p.K285K|KAZN_ENST00000503743.1_Silent_p.K379K	NM_201628.2	NP_963922.2	Q674X7	KAZRN_HUMAN	kazrin, periplakin interacting protein	379	Poly-Lys.				keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(1)|prostate(2)	25						GGAAAAAGAAGAAAGAGAAGA	0.552																																						uc001avm.3		NA																	0					0						c.(1135-1137)AAG>AAA		kazrin isoform E							79.0	87.0	84.0					1																	15392164		2203	4300	6503	SO:0001819	synonymous_variant	23254				keratinization	cornified envelope|cytoplasm|desmosome|nucleus		g.chr1:15392164G>A	AY505119	CCDS30604.1, CCDS41267.1, CCDS152.2, CCDS41268.1	1p36.21	2014-02-12	2011-01-31		ENSG00000189337	ENSG00000189337		"""Sterile alpha motif (SAM) domain containing"""	29173	protein-coding gene	gene with protein product						15337775, 18840647	Standard	NM_015209		Approved	KIAA1026, KAZRIN, FLJ43806	uc001avm.4	Q674X7	OTTHUMG00000002042	ENST00000376030.2:c.1137G>A	1.37:g.15392164G>A			Somatic				KAZ_uc009vog.1_Silent_p.K379K|KAZ_uc010obj.1_Silent_p.K379K|KAZ_uc001avo.2_Silent_p.K373K|KAZ_uc001avp.2_Silent_p.K285K|KAZ_uc001avq.2_Silent_p.K285K|KAZ_uc001avr.2_3'UTR	p.K379K	NM_201628	NP_963922	WXS	Illumina HiSeq	Unspecified	Q674X7	KAZRN_HUMAN			8	1418	+			379			Poly-Lys.		B0QYQ0|B1AK78|Q5TGF1|Q674X4|Q674X6|Q6ZUD1|Q8IYN7|Q8N409|Q9UIL2|Q9UPX4	Silent	SNP	ENST00000376030.2	37	c.1137G>A	CCDS152.2																																																																																				0.552	KAZN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005690.2	NM_001017999		7	76	0	0	0	0	7	76				
CROCC	9696	broad.mit.edu	37	1	17292539	17292539	+	Missense_Mutation	SNP	G	G	A	rs573793650		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:17292539G>A	ENST00000375541.5	+	29	4690	c.4621G>A	c.(4621-4623)Gag>Aag	p.E1541K		NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		CCAGCTGGCCGAGATGGAGGC	0.632																																						uc001azt.2		NA																	0				ovary(2)|breast(2)|central_nervous_system(1)	5						c.(4621-4623)GAG>AAG		ciliary rootlet coiled-coil							53.0	51.0	52.0					1																	17292539		2203	4300	6503	SO:0001583	missense	9696				cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity	g.chr1:17292539G>A	AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.4621G>A	1.37:g.17292539G>A	ENSP00000364691:p.Glu1541Lys		Somatic				CROCC_uc001azu.2_Missense_Mutation_p.E844K|CROCC_uc001azv.2_5'Flank	p.E1541K	NM_014675	NP_055490	WXS	Illumina HiSeq	Unspecified	Q5TZA2	CROCC_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)	29	4690	+		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)	1541			Potential.			Missense_Mutation	SNP	ENST00000375541.5	37	c.4621G>A	CCDS30616.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.344616	0.82022	.	.	ENSG00000058453	ENST00000375541;ENST00000445545	T	0.57436	0.4	4.13	4.13	0.48395	.	.	.	.	.	T	0.67126	0.2860	M	0.78637	2.42	0.53688	D	0.999971	D;D	0.69078	0.997;0.986	P;P	0.61477	0.875;0.889	T	0.65524	-0.6147	9	0.18276	T	0.48	.	14.703	0.69168	0.0:0.0:1.0:0.0	.	844;1541	Q5TZA2-2;Q5TZA2	.;CROCC_HUMAN	K	1541;1422	ENSP00000364691:E1541K	ENSP00000364691:E1541K	E	+	1	0	CROCC	17165126	1.000000	0.71417	0.932000	0.37286	0.641000	0.38312	6.305000	0.72805	2.225000	0.72522	0.478000	0.44815	GAG		0.632	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006249.2	NM_014675		6	34	0	0	0	0	6	34				
RUNX3	864	broad.mit.edu	37	1	25254140	25254140	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:25254140G>A	ENST00000308873.6	-	2	372	c.364C>T	c.(364-366)Cgc>Tgc	p.R122C	RUNX3_ENST00000496967.1_5'UTR|RUNX3_ENST00000399916.1_Missense_Mutation_p.R136C|RUNX3_ENST00000338888.3_Missense_Mutation_p.R136C|RUNX3_ENST00000540420.1_Missense_Mutation_p.R29C	NM_004350.2	NP_004341.1	Q13761	RUNX3_HUMAN	runt-related transcription factor 3	122	Runt. {ECO:0000255|PROSITE- ProRule:PRU00399}.				axon guidance (GO:0007411)|cell maturation (GO:0048469)|chondrocyte differentiation (GO:0002062)|hair follicle morphogenesis (GO:0031069)|interferon-gamma production (GO:0032609)|negative regulation of cell cycle (GO:0045786)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peripheral nervous system neuron development (GO:0048935)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(3)	18		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00131)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;2.85e-26)|Colorectal(126;4.35e-08)|COAD - Colon adenocarcinoma(152;1.92e-06)|GBM - Glioblastoma multiforme(114;0.000102)|STAD - Stomach adenocarcinoma(196;0.000766)|KIRC - Kidney renal clear cell carcinoma(1967;0.00148)|BRCA - Breast invasive adenocarcinoma(304;0.00173)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.136)		GAGGCATTGCGCAGCTCAGCG	0.632																																						uc001bjq.2		NA																	0					0						c.(364-366)CGC>TGC		runt-related transcription factor 3 isoform 2							147.0	130.0	136.0					1																	25254140		2203	4300	6503	SO:0001583	missense	864				cell proliferation|induction of apoptosis|negative regulation of cell cycle|negative regulation of epithelial cell proliferation|protein phosphorylation|transcription from RNA polymerase II promoter	cytoplasm|nucleus	ATP binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr1:25254140G>A	BC013362	CCDS257.1, CCDS30633.1	1p36	2008-02-05			ENSG00000020633	ENSG00000020633			10473	protein-coding gene	gene with protein product		600210		CBFA3		7835892	Standard	NM_001031680		Approved	AML2, PEBP2A3	uc001bjq.3	Q13761	OTTHUMG00000003316	ENST00000308873.6:c.364C>T	1.37:g.25254140G>A	ENSP00000308051:p.Arg122Cys		Somatic				RUNX3_uc010oen.1_Missense_Mutation_p.R122C|RUNX3_uc009vrj.2_Missense_Mutation_p.R136C|RUNX3_uc001bjr.2_Missense_Mutation_p.R136C	p.R122C	NM_004350	NP_004341	WXS	Illumina HiSeq	Unspecified	Q13761	RUNX3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;2.85e-26)|Colorectal(126;4.35e-08)|COAD - Colon adenocarcinoma(152;1.92e-06)|GBM - Glioblastoma multiforme(114;0.000102)|STAD - Stomach adenocarcinoma(196;0.000766)|KIRC - Kidney renal clear cell carcinoma(1967;0.00148)|BRCA - Breast invasive adenocarcinoma(304;0.00173)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.136)	2	775	-		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00131)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)	122			Runt.		B1AJV5|Q12969|Q13760	Missense_Mutation	SNP	ENST00000308873.6	37	c.364C>T	CCDS257.1	.	.	.	.	.	.	.	.	.	.	G	17.19	3.325203	0.60634	.	.	ENSG00000020633	ENST00000399916;ENST00000308873;ENST00000338888;ENST00000540420;ENST00000428150	D;D;D;D	0.99598	-6.26;-6.26;-6.26;-6.26	5.38	5.38	0.77491	Acute myeloid leukemia 1 (AML 1)/Runt (2);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99625	0.9863	M	0.88842	2.985	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.997;0.997	D	0.97825	1.0259	10	0.87932	D	0	-33.332	13.703	0.62620	0.0:0.0:0.8458:0.1542	.	122;136;122	E9PH34;B1AJV5;Q13761	.;.;RUNX3_HUMAN	C	136;122;136;29;122	ENSP00000382800:R136C;ENSP00000308051:R122C;ENSP00000343477:R136C;ENSP00000444872:R29C	ENSP00000308051:R122C	R	-	1	0	RUNX3	25126727	1.000000	0.71417	1.000000	0.80357	0.102000	0.19082	2.075000	0.41538	2.514000	0.84764	0.655000	0.94253	CGC		0.632	RUNX3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000009284.1	NM_004350		14	104	0	0	0	0	14	104				
BAI2	576	broad.mit.edu	37	1	32210323	32210323	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:32210323G>A	ENST00000373658.3	-	5	1189	c.848C>T	c.(847-849)cCg>cTg	p.P283L	BAI2_ENST00000527361.1_Missense_Mutation_p.P283L|BAI2_ENST00000257070.4_Missense_Mutation_p.P283L|BAI2_ENST00000398547.1_Missense_Mutation_p.P271L|BAI2_ENST00000373655.2_Missense_Mutation_p.P283L|BAI2_ENST00000398542.1_Missense_Mutation_p.P271L|BAI2_ENST00000398538.1_Missense_Mutation_p.P271L|BAI2_ENST00000440175.2_5'UTR|BAI2_ENST00000398556.3_Missense_Mutation_p.P286L	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	283					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		TTCCTCTTCCGGCTCCTCACC	0.612																																						uc001btn.2		NA																	0				lung(5)|breast(4)|ovary(2)|central_nervous_system(1)|skin(1)	13						c.(847-849)CCG>CTG		brain-specific angiogenesis inhibitor 2							89.0	74.0	79.0					1																	32210323		2203	4300	6503	SO:0001583	missense	576				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr1:32210323G>A	AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.848C>T	1.37:g.32210323G>A	ENSP00000362762:p.Pro283Leu		Somatic				BAI2_uc010ogo.1_5'UTR|BAI2_uc010ogp.1_Missense_Mutation_p.P271L|BAI2_uc010ogq.1_Missense_Mutation_p.P283L|BAI2_uc001bto.2_Missense_Mutation_p.P283L|BAI2_uc001btq.1_Missense_Mutation_p.P271L|BAI2_uc010ogr.1_Missense_Mutation_p.P271L	p.P283L	NM_001703	NP_001694	WXS	Illumina HiSeq	Unspecified	O60241	BAI2_HUMAN		STAD - Stomach adenocarcinoma(196;0.0557)	5	1202	-		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)	283			Extracellular (Potential).		B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Missense_Mutation	SNP	ENST00000373658.3	37	c.848C>T	CCDS346.2	.	.	.	.	.	.	.	.	.	.	G	13.03	2.114277	0.37339	.	.	ENSG00000121753	ENST00000398556;ENST00000398547;ENST00000373658;ENST00000373655;ENST00000398542;ENST00000257070;ENST00000527361;ENST00000398538;ENST00000420125;ENST00000533175	T;T;T;T;T;T;T;T;T;T	0.42131	1.62;1.83;1.02;1.01;1.97;0.98;0.98;1.04;1.59;1.47	4.72	4.72	0.59763	.	0.000000	0.33712	N	0.004637	T	0.20700	0.0498	N	0.08118	0	0.80722	D	1	B;P;B;B;P;B	0.50066	0.414;0.594;0.01;0.004;0.931;0.017	B;B;B;B;B;B	0.38880	0.027;0.052;0.019;0.005;0.284;0.008	T	0.03433	-1.1037	10	0.48119	T	0.1	.	9.3369	0.38056	0.1003:0.0:0.8997:0.0	.	271;283;271;271;283;283	A2A3C3;O60241-4;O60241-3;A2A3C1;O60241-2;O60241	.;.;.;.;.;BAI2_HUMAN	L	286;271;283;283;271;283;283;271;276;317	ENSP00000381564:P286L;ENSP00000381555:P271L;ENSP00000362762:P283L;ENSP00000362759:P283L;ENSP00000381550:P271L;ENSP00000257070:P283L;ENSP00000435397:P283L;ENSP00000381548:P271L;ENSP00000410921:P276L;ENSP00000437219:P317L	ENSP00000257070:P283L	P	-	2	0	BAI2	31982910	0.894000	0.30519	1.000000	0.80357	0.948000	0.59901	2.439000	0.44846	2.347000	0.79759	0.313000	0.20887	CCG		0.612	BAI2-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000381838.1	NM_001703		6	39	0	0	0	0	6	39				
ZMYM1	79830	broad.mit.edu	37	1	35578687	35578687	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:35578687C>T	ENST00000373330.1	+	11	1430	c.1256C>T	c.(1255-1257)tCc>tTc	p.S419F	ZMYM1_ENST00000359858.4_Missense_Mutation_p.S419F|ZMYM1_ENST00000373329.1_3'UTR			Q5SVZ6	ZMYM1_HUMAN	zinc finger, MYM-type 1	419	Ser-rich.					nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(8)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GCAATTGGTTCCAGTACAGAA	0.368																																						uc001bym.2		NA																	0					0						c.(1255-1257)TCC>TTC		zinc finger, MYM domain containing 1							64.0	62.0	62.0					1																	35578687		1898	4135	6033	SO:0001583	missense	79830					nucleus	nucleic acid binding|protein dimerization activity|zinc ion binding	g.chr1:35578687C>T	AK096206	CCDS41302.1	1p34.3	2008-05-02	2005-09-12		ENSG00000197056	ENSG00000197056		"""Zinc fingers, MYM type"""	26253	protein-coding gene	gene with protein product			"""zinc finger, MYM domain containing 1"""			12477932	Standard	XM_005271216		Approved	FLJ23151, MYM	uc001bym.3	Q5SVZ6	OTTHUMG00000004374	ENST00000373330.1:c.1256C>T	1.37:g.35578687C>T	ENSP00000362427:p.Ser419Phe		Somatic				ZMYM1_uc001byn.2_Missense_Mutation_p.S419F|ZMYM1_uc010ohu.1_Missense_Mutation_p.S400F|ZMYM1_uc001byo.2_Missense_Mutation_p.S59F|ZMYM1_uc009vut.2_Missense_Mutation_p.S344F	p.S419F	NM_024772	NP_079048	WXS	Illumina HiSeq	Unspecified	Q5SVZ6	ZMYM1_HUMAN			11	1404	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)	419			Ser-rich.		D3DPR7|Q7Z3Q4	Missense_Mutation	SNP	ENST00000373330.1	37	c.1256C>T	CCDS41302.1	.	.	.	.	.	.	.	.	.	.	C	10.00	1.233268	0.22626	.	.	ENSG00000197056	ENST00000417119;ENST00000359858;ENST00000373329;ENST00000373330	T;T;T;T	0.19532	2.14;2.46;2.2;2.46	4.6	2.73	0.32206	.	0.865563	0.09906	N	0.740429	T	0.15219	0.0367	L	0.44542	1.39	0.09310	N	1	P;P	0.40476	0.718;0.718	B;B	0.31290	0.127;0.127	T	0.16867	-1.0388	10	0.59425	D	0.04	-0.0924	6.5883	0.22632	0.0:0.7236:0.1805:0.0959	.	400;419	B4DSJ9;Q5SVZ6	.;ZMYM1_HUMAN	F	419;419;344;419	ENSP00000394233:S419F;ENSP00000352920:S419F;ENSP00000362426:S344F;ENSP00000362427:S419F	ENSP00000352920:S419F	S	+	2	0	ZMYM1	35351274	0.003000	0.15002	0.002000	0.10522	0.709000	0.40893	1.279000	0.33191	0.875000	0.35847	0.591000	0.81541	TCC		0.368	ZMYM1-001	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012705.1	NM_024772		6	27	0	0	0	0	6	27				
MACF1	23499	broad.mit.edu	37	1	39750825	39750825	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:39750825G>A	ENST00000372915.3	+	11	1304	c.1217G>A	c.(1216-1218)gGa>gAa	p.G406E	MACF1_ENST00000545844.1_Missense_Mutation_p.G406E|MACF1_ENST00000361689.2_Missense_Mutation_p.G406E|MACF1_ENST00000564288.1_Missense_Mutation_p.G401E|MACF1_ENST00000539005.1_Missense_Mutation_p.G406E|MACF1_ENST00000567887.1_Missense_Mutation_p.G438E|MACF1_ENST00000317713.7_Missense_Mutation_p.G406E			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	406					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GAAGAGTGGGGAAAGCTCATC	0.458																																						uc010ois.1		NA																	0				ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16						c.(1216-1218)GGA>GAA		microfilament and actin filament cross-linker							171.0	165.0	167.0					1																	39750825		2203	4300	6503	SO:0001583	missense	23499				cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding	g.chr1:39750825G>A	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.1217G>A	1.37:g.39750825G>A	ENSP00000362006:p.Gly406Glu		Somatic				MACF1_uc001cda.1_Missense_Mutation_p.G314E	p.G406E	NM_012090	NP_036222	WXS	Illumina HiSeq	Unspecified	Q9UPN3	MACF1_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)		13	1422	+	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	406					B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37	c.1217G>A		.	.	.	.	.	.	.	.	.	.	G	26.8	4.768328	0.90020	.	.	ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000524432;ENST00000530262;ENST00000372900	T;T;T;T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09;-0.09;-0.09;-0.09	5.82	5.82	0.92795	.	.	.	.	.	T	0.80204	0.4580	M	0.75777	2.31	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.993	T	0.77920	-0.2407	9	0.41790	T	0.15	.	20.0953	0.97838	0.0:0.0:1.0:0.0	.	406;371	F8W8Q1;Q9UPN3-3	.;.	E	406;406;406;406;406;364;555;566	ENSP00000439537:G406E;ENSP00000362006:G406E;ENSP00000354573:G406E;ENSP00000313438:G406E;ENSP00000444364:G406E;ENSP00000435070:G364E;ENSP00000437059:G555E	ENSP00000313438:G406E	G	+	2	0	MACF1	39523412	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.767000	0.95098	0.655000	0.94253	GGA		0.458	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044		14	68	0	0	0	0	14	68				
KIAA0754	643314	broad.mit.edu	37	1	39876389	39876389	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:39876389C>T	ENST00000530275.1	+	1	239	c.44C>T	c.(43-45)tCt>tTt	p.S15F	MACF1_ENST00000545844.1_Intron|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000564288.1_Intron|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000372915.3_Intron|MACF1_ENST00000567887.1_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000289893.4_Intron	NM_015038.1	NP_055853.1	O94854	K0754_HUMAN	KIAA0754	15										central_nervous_system(1)|large_intestine(6)|skin(1)	8	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			ATAGAAGCTTCTCTCAGTGAG	0.468																																						uc009vvt.1		NA																	0					0						c.(451-453)TCT>TTT		hypothetical protein LOC643314							80.0	79.0	80.0					1																	39876389		1899	4117	6016	SO:0001583	missense	643314							g.chr1:39876389C>T			1p34.2	2009-07-09				ENSG00000255103			29111	protein-coding gene	gene with protein product						9872452	Standard	NM_015038		Approved		uc009vvt.1	O94854		ENST00000530275.1:c.44C>T	1.37:g.39876389C>T	ENSP00000431179:p.Ser15Phe		Somatic				MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc010oiu.1_Intron	p.S151F	NM_015038	NP_055853	WXS	Illumina HiSeq	Unspecified	O94854	K0754_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)		1	1214	+	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	15					E9PMC2|Q6ZSB2	Missense_Mutation	SNP	ENST00000530275.1	37	c.452C>T		.	.	.	.	.	.	.	.	.	.	C	17.41	3.382221	0.61845	.	.	ENSG00000255103	ENST00000530275	T	0.42513	0.97	4.88	3.96	0.45880	.	.	.	.	.	T	0.33760	0.0874	L	0.27053	0.805	0.30826	N	0.737236	P	0.52170	0.951	B	0.42827	0.399	T	0.35151	-0.9800	9	0.87932	D	0	.	13.2726	0.60170	0.0:0.9228:0.0:0.0772	.	15	O94854	K0754_HUMAN	F	15	ENSP00000431179:S15F	ENSP00000431179:S15F	S	+	2	0	RP4-562N20.1	39648976	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.182000	0.77689	1.052000	0.40392	0.555000	0.69702	TCT		0.468	KIAA0754-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000392100.1	NM_015038		6	115	0	0	0	0	6	115				
SLFNL1	200172	broad.mit.edu	37	1	41481844	41481844	+	Silent	SNP	C	C	T	rs142166637		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:41481844C>T	ENST00000359345.1	-	4	3734	c.1158G>A	c.(1156-1158)gaG>gaA	p.E386E	SLFNL1_ENST00000302946.8_Silent_p.E386E|SLFNL1_ENST00000439569.2_Silent_p.E386E|SLFNL1_ENST00000372613.2_Silent_p.E338E|SLFNL1_ENST00000372611.1_Silent_p.E327E|SLFNL1_ENST00000397197.2_Silent_p.E338E	NM_144990.3	NP_659427.3	Q499Z3	SLNL1_HUMAN	schlafen-like 1	386							ATP binding (GO:0005524)	p.E386E(1)		endometrium(3)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	10	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Breast(333;0.1)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0393)				GCTGCTCCTTCTCCATCATCA	0.637																																						uc001cgm.1		NA																	1	Substitution - coding silent(1)	p.E386E(1)	skin(1)	skin(1)	1						c.(1156-1158)GAG>GAA		schlafen-like 1							93.0	84.0	87.0					1																	41481844		2203	4300	6503	SO:0001819	synonymous_variant	200172						ATP binding	g.chr1:41481844C>T	BC022037	CCDS460.1, CCDS72766.1	1p34.2	2008-02-05			ENSG00000171790	ENSG00000171790			26313	protein-coding gene	gene with protein product							Standard	NM_144990		Approved	FLJ23878	uc001cgm.2	Q499Z3	OTTHUMG00000005719	ENST00000359345.1:c.1158G>A	1.37:g.41481844C>T			Somatic				SLFNL1_uc009vwf.1_Silent_p.E338E|SLFNL1_uc001cgn.1_Silent_p.E327E|SLFNL1_uc009vwg.1_Silent_p.E386E	p.E386E	NM_144990	NP_659427	WXS	Illumina HiSeq	Unspecified	Q499Z3	SLNL1_HUMAN			5	1378	-	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Breast(333;0.1)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0393)	386			Potential.		A8K8D1|Q49AG8|Q5VW72|Q5VW74|Q8N7V7|Q8TCH6|Q8WVZ8	Silent	SNP	ENST00000359345.1	37	c.1158G>A	CCDS460.1																																																																																				0.637	SLFNL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015650.1	NM_144990		14	94	0	0	0	0	14	94				
SLFNL1	200172	broad.mit.edu	37	1	41481853	41481853	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:41481853C>T	ENST00000359345.1	-	4	3725	c.1149G>A	c.(1147-1149)ctG>ctA	p.L383L	SLFNL1_ENST00000302946.8_Silent_p.L383L|SLFNL1_ENST00000439569.2_Silent_p.L383L|SLFNL1_ENST00000372613.2_Silent_p.L335L|SLFNL1_ENST00000372611.1_Silent_p.L324L|SLFNL1_ENST00000397197.2_Silent_p.L335L	NM_144990.3	NP_659427.3	Q499Z3	SLNL1_HUMAN	schlafen-like 1	383							ATP binding (GO:0005524)			endometrium(3)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	10	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Breast(333;0.1)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0393)				TCTCCATCATCAGCGCCTTCA	0.642																																						uc001cgm.1		NA																	0				skin(1)	1						c.(1147-1149)CTG>CTA		schlafen-like 1							96.0	86.0	89.0					1																	41481853		2203	4300	6503	SO:0001819	synonymous_variant	200172						ATP binding	g.chr1:41481853C>T	BC022037	CCDS460.1, CCDS72766.1	1p34.2	2008-02-05			ENSG00000171790	ENSG00000171790			26313	protein-coding gene	gene with protein product							Standard	NM_144990		Approved	FLJ23878	uc001cgm.2	Q499Z3	OTTHUMG00000005719	ENST00000359345.1:c.1149G>A	1.37:g.41481853C>T			Somatic				SLFNL1_uc009vwf.1_Silent_p.L335L|SLFNL1_uc001cgn.1_Silent_p.L324L|SLFNL1_uc009vwg.1_Silent_p.L383L	p.L383L	NM_144990	NP_659427	WXS	Illumina HiSeq	Unspecified	Q499Z3	SLNL1_HUMAN			5	1369	-	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Breast(333;0.1)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0393)	383			Potential.		A8K8D1|Q49AG8|Q5VW72|Q5VW74|Q8N7V7|Q8TCH6|Q8WVZ8	Silent	SNP	ENST00000359345.1	37	c.1149G>A	CCDS460.1																																																																																				0.642	SLFNL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015650.1	NM_144990		15	90	0	0	0	0	15	90				
KIF2C	11004	broad.mit.edu	37	1	45221866	45221866	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:45221866G>C	ENST00000372224.4	+	10	1047	c.934G>C	c.(934-936)Gac>Cac	p.D312H	RP11-269F19.2_ENST00000440985.1_RNA|KIF2C_ENST00000372222.3_Missense_Mutation_p.D199H|KIF2C_ENST00000493027.1_3'UTR|KIF2C_ENST00000372217.1_Missense_Mutation_p.D258H|RP11-269F19.2_ENST00000428791.1_RNA|KIF2C_ENST00000372218.4_Missense_Mutation_p.D271H	NM_006845.3	NP_006836.2	Q99661	KIF2C_HUMAN	kinesin family member 2C	312	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|centromeric DNA binding (GO:0019237)|microtubule motor activity (GO:0003777)|microtubule plus-end binding (GO:0051010)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(16)|ovary(1)|skin(1)|urinary_tract(1)	34	Acute lymphoblastic leukemia(166;0.155)					ATTCTGCTTTGACTTTGCATT	0.423																																						uc001cmg.3		NA																	0				ovary(1)	1						c.(934-936)GAC>CAC		kinesin family member 2C							199.0	194.0	196.0					1																	45221866		2203	4300	6503	SO:0001583	missense	11004				blood coagulation|cell division|cell proliferation|chromosome segregation|establishment or maintenance of microtubule cytoskeleton polarity|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|kinesin complex|microtubule|nucleus	ATP binding|centromeric DNA binding|microtubule motor activity|microtubule plus-end binding	g.chr1:45221866G>C	U63743	CCDS512.1, CCDS72774.1	1p34.1	2014-01-21	2003-01-13	2003-01-17	ENSG00000142945	ENSG00000142945		"""Kinesins"""	6393	protein-coding gene	gene with protein product		604538	"""kinesin-like 6 (mitotic centromere-associated kinesin)"""	KNSL6		9434124	Standard	NM_006845		Approved	MCAK, CT139	uc001cmg.4	Q99661	OTTHUMG00000008416	ENST00000372224.4:c.934G>C	1.37:g.45221866G>C	ENSP00000361298:p.Asp312His		Somatic				KIF2C_uc010olb.1_Missense_Mutation_p.D271H|KIF2C_uc010olc.1_Missense_Mutation_p.D199H|KIF2C_uc001cmh.3_Missense_Mutation_p.D258H	p.D312H	NM_006845	NP_006836	WXS	Illumina HiSeq	Unspecified	Q99661	KIF2C_HUMAN			10	1049	+	Acute lymphoblastic leukemia(166;0.155)		312			Kinesin-motor.		B3ITR9|Q5JR88|Q6ICU1|Q96C18|Q96HB8|Q9BWV8	Missense_Mutation	SNP	ENST00000372224.4	37	c.934G>C	CCDS512.1	.	.	.	.	.	.	.	.	.	.	G	19.48	3.835104	0.71373	.	.	ENSG00000142945	ENST00000452259;ENST00000372224;ENST00000372218;ENST00000372222;ENST00000372217	D;D;D;D;D	0.83075	-1.68;-1.68;-1.68;-1.68;-1.68	6.08	6.08	0.98989	Kinesin, motor domain (4);	0.000000	0.85682	D	0.000000	D	0.94245	0.8152	H	0.94423	3.535	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.94725	0.7904	10	0.87932	D	0	.	20.6634	0.99662	0.0:0.0:1.0:0.0	.	271;258;312	B7Z6Q6;Q99661-2;Q99661	.;.;KIF2C_HUMAN	H	271;312;271;199;258	ENSP00000410346:D271H;ENSP00000361298:D312H;ENSP00000361292:D271H;ENSP00000361296:D199H;ENSP00000361291:D258H	ENSP00000361291:D258H	D	+	1	0	KIF2C	44994453	1.000000	0.71417	1.000000	0.80357	0.065000	0.16274	9.869000	0.99810	2.894000	0.99253	0.655000	0.94253	GAC		0.423	KIF2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023180.1	NM_006845		28	143	0	0	0	0	28	143				
CYP4A11	1579	broad.mit.edu	37	1	47398445	47398445	+	Nonsense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:47398445G>C	ENST00000310638.4	-	11	1383	c.1352C>G	c.(1351-1353)tCa>tGa	p.S451*	CYP4A11_ENST00000496519.1_5'Flank|CYP4A11_ENST00000371904.4_Nonsense_Mutation_p.S452*|CYP4A11_ENST00000462347.1_Nonsense_Mutation_p.S353*|CYP4A11_ENST00000371905.1_Nonsense_Mutation_p.S451*	NM_000778.3	NP_000769.2	Q02928	CP4AB_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 11	451					arachidonic acid metabolic process (GO:0019369)|cellular lipid metabolic process (GO:0044255)|epoxygenase P450 pathway (GO:0019373)|fatty acid metabolic process (GO:0006631)|leukotriene B4 catabolic process (GO:0036101)|leukotriene metabolic process (GO:0006691)|long-chain fatty acid metabolic process (GO:0001676)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|positive regulation of icosanoid secretion (GO:0032305)|pressure natriuresis (GO:0003095)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|xenobiotic metabolic process (GO:0006805)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid epoxygenase activity (GO:0008392)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)			endometrium(2)|kidney(5)|large_intestine(6)|lung(6)|ovary(5)|prostate(3)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	36					Cisplatin(DB00515)|Clofibrate(DB00636)|Dexamethasone(DB01234)|Estrone(DB00655)|Ethanol(DB00898)|Lansoprazole(DB00448)|Pegvisomant(DB00082)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Rifampicin(DB01045)|Tretinoin(DB00755)	TGATCCTCCTGAGAAGGGCAG	0.507																																						uc001cqp.3		NA																	0				ovary(2)|skin(2)	4						c.(1351-1353)TCA>TGA		cytochrome P450, family 4, subfamily A,	NADH(DB00157)						256.0	269.0	265.0					1																	47398445		2203	4300	6503	SO:0001587	stop_gained	1579				long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|oxygen binding	g.chr1:47398445G>C	L04751	CCDS543.1	1p33	2008-02-05	2003-01-14		ENSG00000187048	ENSG00000187048		"""Cytochrome P450s"""	2642	protein-coding gene	gene with protein product		601310	"""cytochrome P450, subfamily IVA, polypeptide 11"""	CYP4A2		7679927	Standard	NM_000778		Approved	CYP4AII	uc001cqp.4	Q02928	OTTHUMG00000008020	ENST00000310638.4:c.1352C>G	1.37:g.47398445G>C	ENSP00000311095:p.Ser451*		Somatic				CYP4A11_uc001cqq.2_Nonsense_Mutation_p.S451*	p.S451*	NM_000778	NP_000769	WXS	Illumina HiSeq	Unspecified	Q02928	CP4AB_HUMAN			11	1403	-			451					Q06766|Q16865|Q16866|Q5VSP8|Q86SU6|Q8IWY5	Nonsense_Mutation	SNP	ENST00000310638.4	37	c.1352C>G	CCDS543.1	.	.	.	.	.	.	.	.	.	.	N	20.7	4.027935	0.75390	.	.	ENSG00000187048	ENST00000310638;ENST00000371904;ENST00000371905	.	.	.	5.11	4.17	0.49024	.	0.125811	0.56097	D	0.000036	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.3242	0.74147	0.0:0.1409:0.8591:0.0	.	.	.	.	X	451;452;451	.	ENSP00000311095:S451X	S	-	2	0	CYP4A11	47171032	1.000000	0.71417	1.000000	0.80357	0.230000	0.25150	6.365000	0.73090	1.259000	0.44117	0.650000	0.86243	TCA		0.507	CYP4A11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022022.1	NM_000778		61	311	0	0	0	0	61	311				
CMPK1	51727	broad.mit.edu	37	1	47840885	47840885	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:47840885C>T	ENST00000371873.5	+	5	714	c.565C>T	c.(565-567)Cag>Tag	p.Q189*	CMPK1_ENST00000450808.2_Nonsense_Mutation_p.Q140*	NM_001136140.1|NM_016308.2	NP_001129612.1|NP_057392.1			cytidine monophosphate (UMP-CMP) kinase 1, cytosolic											endometrium(1)|large_intestine(3)|lung(1)|ovary(1)|stomach(2)	8						GACCTACCTTCAGTCAACAAA	0.368																																						uc001cri.2		NA																	0				ovary(1)	1						c.(565-567)CAG>TAG		UMP-CMP kinase 1 isoform a	Gemcitabine(DB00441)						136.0	145.0	142.0					1																	47840885		2203	4300	6503	SO:0001587	stop_gained	51727				nucleobase, nucleoside and nucleotide interconversion	cytosol|nucleus	ATP binding|cytidylate kinase activity|nucleoside phosphate kinase activity|uridine kinase activity	g.chr1:47840885C>T	AF070416	CCDS549.1, CCDS44135.1	1p34.1-p33	2008-02-05	2008-01-25	2008-01-25	ENSG00000162368	ENSG00000162368	2.7.4.14		18170	protein-coding gene	gene with protein product	"""UMP-CMP kinase"", ""Cytidine monophosphate kinase"""	191710	"""cytidylate kinase"""	CMPK		10462544	Standard	NM_016308		Approved	UMP-CMPK	uc001cri.3	P30085	OTTHUMG00000007849	ENST00000371873.5:c.565C>T	1.37:g.47840885C>T	ENSP00000360939:p.Gln189*		Somatic				CMPK1_uc010omp.1_Nonsense_Mutation_p.Q140*|CMPK1_uc010omq.1_RNA	p.Q189*	NM_016308	NP_057392	WXS	Illumina HiSeq	Unspecified	P30085	KCY_HUMAN			5	714	+			157						Nonsense_Mutation	SNP	ENST00000371873.5	37	c.565C>T	CCDS549.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.049981	0.75846	.	.	ENSG00000162368	ENST00000371873;ENST00000450808	.	.	.	5.86	4.93	0.64822	.	0.050554	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	-9.2748	15.7939	0.78394	0.0:0.7341:0.2659:0.0	.	.	.	.	X	189;140	.	ENSP00000360939:Q189X	Q	+	1	0	CMPK1	47613472	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.079000	0.41577	1.429000	0.47314	0.650000	0.86243	CAG		0.368	CMPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021646.2	NM_016308		24	140	0	0	0	0	24	140				
FAM159A	348378	broad.mit.edu	37	1	53108622	53108622	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:53108622C>T	ENST00000517870.1	+	2	420	c.270C>T	c.(268-270)atC>atT	p.I90I	FAM159A_ENST00000401050.3_3'UTR	NM_001042693.1	NP_001036158.1	Q6UWV7	F159A_HUMAN	family with sequence similarity 159, member A	90						integral component of membrane (GO:0016021)				endometrium(3)|lung(6)|upper_aerodigestive_tract(1)	10						ACCTGTTCATCAGCTCTAAGC	0.527																																						uc001cuf.2		NA																	0					0						c.(268-270)ATC>ATT		hypothetical protein LOC348378							159.0	152.0	154.0					1																	53108622		2060	4186	6246	SO:0001819	synonymous_variant	348378					integral to membrane		g.chr1:53108622C>T		CCDS41336.1	1p32.3	2008-08-08			ENSG00000182183	ENSG00000182183			28757	protein-coding gene	gene with protein product						12477932	Standard	NM_001042693		Approved	MGC52498	uc001cuf.3	Q6UWV7	OTTHUMG00000008330	ENST00000517870.1:c.270C>T	1.37:g.53108622C>T			Somatic				FAM159A_uc001cug.1_RNA|FAM159A_uc001cuh.2_RNA	p.I90I	NM_001042693	NP_001036158	WXS	Illumina HiSeq	Unspecified	Q6UWV7	F159A_HUMAN			2	370	+			90			Helical; (Potential).		Q6ZRG4	Silent	SNP	ENST00000517870.1	37	c.270C>T	CCDS41336.1																																																																																				0.527	FAM159A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022934.2	NM_001042693		20	125	0	0	0	0	20	125				
ERICH3	127254	broad.mit.edu	37	1	75038328	75038328	+	Silent	SNP	G	G	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:75038328G>T	ENST00000326665.5	-	14	3284	c.3066C>A	c.(3064-3066)gcC>gcA	p.A1022A	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		1022	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						TGCAAAGGAAGGCTTCCTTTG	0.502																																						uc001dgg.2		NA																	0				ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						c.(3064-3066)GCC>GCA		hypothetical protein LOC127254							122.0	122.0	122.0					1																	75038328		2203	4300	6503	SO:0001819	synonymous_variant	127254							g.chr1:75038328G>T																												ENST00000326665.5:c.3066C>A	1.37:g.75038328G>T			Somatic					p.A1022A	NM_001002912	NP_001002912	WXS	Illumina HiSeq	Unspecified	Q5RHP9	CA173_HUMAN			14	3285	-			1022			Glu-rich.		Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Silent	SNP	ENST00000326665.5	37	c.3066C>A	CCDS30755.1																																																																																				0.502	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1			17	95	1	0	0.000175454	0.000181819	17	95				
ASB17	127247	broad.mit.edu	37	1	76397847	76397847	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:76397847C>A	ENST00000284142.6	-	1	269	c.130G>T	c.(130-132)Gaa>Taa	p.E44*		NM_080868.2	NP_543144.1	Q8WXJ9	ASB17_HUMAN	ankyrin repeat and SOCS box containing 17	44					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|urinary_tract(1)	21						ATCCTTGGTTCGTAACAGTGA	0.398																																						uc001dhe.1		NA																	0				ovary(1)	1						c.(130-132)GAA>TAA		ankyrin repeat and SOCS box-containing 17							134.0	128.0	130.0					1																	76397847		2203	4300	6503	SO:0001587	stop_gained	127247				intracellular signal transduction			g.chr1:76397847C>A	AF403035	CCDS671.1	1p22.3	2013-01-11	2011-01-25		ENSG00000154007	ENSG00000154007		"""Ankyrin repeat domain containing"""	19769	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 17"""			12076535	Standard	NM_080868		Approved		uc001dhe.2	Q8WXJ9	OTTHUMG00000009787	ENST00000284142.6:c.130G>T	1.37:g.76397847C>A	ENSP00000284142:p.Glu44*		Somatic				ASB17_uc001dhf.1_RNA	p.E44*	NM_080868	NP_543144	WXS	Illumina HiSeq	Unspecified	Q8WXJ9	ASB17_HUMAN			1	270	-			44					B1APB8|Q8N0X5	Nonsense_Mutation	SNP	ENST00000284142.6	37	c.130G>T	CCDS671.1	.	.	.	.	.	.	.	.	.	.	C	37	6.133602	0.97310	.	.	ENSG00000154007	ENST00000284142	.	.	.	6.08	6.08	0.98989	.	0.000000	0.64402	D	0.000014	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	16.1648	0.81747	0.0:1.0:0.0:0.0	.	.	.	.	X	44	.	ENSP00000284142:E44X	E	-	1	0	ASB17	76170435	1.000000	0.71417	1.000000	0.80357	0.696000	0.40369	4.054000	0.57434	2.890000	0.99128	0.655000	0.94253	GAA		0.398	ASB17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026982.1	NM_080868		34	132	1	0	1.41e-09	1.5e-09	34	132				
PRKACB	5567	broad.mit.edu	37	1	84650847	84650847	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:84650847G>A	ENST00000370689.2	+	5	665	c.401G>A	c.(400-402)aGa>aAa	p.R134K	PRKACB_ENST00000370682.3_Missense_Mutation_p.R138K|PRKACB_ENST00000470673.1_3'UTR|PRKACB_ENST00000370688.3_Missense_Mutation_p.R134K|PRKACB_ENST00000370685.3_Missense_Mutation_p.R181K|PRKACB_ENST00000394839.2_Missense_Mutation_p.R104K|PRKACB_ENST00000394838.2_Missense_Mutation_p.R141K|PRKACB_ENST00000370680.1_Missense_Mutation_p.R140K	NM_001242862.1|NM_002731.2	NP_001229791.1|NP_002722.1	P22694	KAPCB_HUMAN	protein kinase, cAMP-dependent, catalytic, beta	134	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of protein processing (GO:0070613)|response to clozapine (GO:0097338)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|ciliary base (GO:0097546)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|magnesium ion binding (GO:0000287)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(2)|kidney(1)|lung(11)|ovary(1)	16				all cancers(265;0.00536)|Epithelial(280;0.0161)|OV - Ovarian serous cystadenocarcinoma(397;0.141)		TCACATCTAAGAAGAATTGGA	0.308																																						uc001djj.2		NA																	0				lung(2)|ovary(1)	3						c.(400-402)AGA>AAA		cAMP-dependent protein kinase catalytic subunit							110.0	122.0	118.0					1																	84650847		2203	4298	6501	SO:0001583	missense	5567				activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein signaling, coupled to cAMP nucleotide second messenger|gluconeogenesis|intracellular protein kinase cascade|nerve growth factor receptor signaling pathway|regulation of insulin secretion|synaptic transmission|transmembrane transport|triglyceride catabolic process|water transport	cAMP-dependent protein kinase complex|centrosome|cytosol|nucleoplasm|plasma membrane	ATP binding|cAMP-dependent protein kinase activity|magnesium ion binding|protein binding	g.chr1:84650847G>A	BC035058	CCDS691.1, CCDS692.1, CCDS693.1, CCDS55610.1, CCDS55611.1, CCDS72812.1, CCDS72813.1, CCDS72814.1, CCDS72815.1, CCDS72816.1	1p36.1	2012-10-02			ENSG00000142875	ENSG00000142875	2.7.11.1		9381	protein-coding gene	gene with protein product		176892					Standard	XM_005271016		Approved	PKACb	uc001djl.3	P22694	OTTHUMG00000009975	ENST00000370689.2:c.401G>A	1.37:g.84650847G>A	ENSP00000359723:p.Arg134Lys		Somatic				PRKACB_uc001djl.2_Missense_Mutation_p.R181K|PRKACB_uc010ort.1_Missense_Mutation_p.R141K|PRKACB_uc001djn.2_Missense_Mutation_p.R138K|PRKACB_uc010oru.1_Missense_Mutation_p.R122K|PRKACB_uc001djp.2_Missense_Mutation_p.R140K|PRKACB_uc001djq.2_Missense_Mutation_p.R104K|PRKACB_uc010orv.1_Missense_Mutation_p.R121K|PRKACB_uc001dji.2_Missense_Mutation_p.R134K|PRKACB_uc001djk.2_Missense_Mutation_p.R181K|PRKACB_uc009wcf.1_Missense_Mutation_p.R140K	p.R134K	NM_002731	NP_002722	WXS	Illumina HiSeq	Unspecified	P22694	KAPCB_HUMAN		all cancers(265;0.00536)|Epithelial(280;0.0161)|OV - Ovarian serous cystadenocarcinoma(397;0.141)	5	665	+			134			Protein kinase.		B1APG4|B4DKB0|B4E2Q1|Q14VH1|Q59GC0|Q5BNE9|Q5BNF0|Q5BNF1|Q5BNF2|Q5BNF3|Q5CZ92|Q5T1K3|Q7Z3M1|Q8IYR5|Q8IZQ0|Q96B09	Missense_Mutation	SNP	ENST00000370689.2	37	c.401G>A	CCDS691.1	.	.	.	.	.	.	.	.	.	.	G	31	5.062040	0.93846	.	.	ENSG00000142875	ENST00000370689;ENST00000370688;ENST00000370685;ENST00000446538;ENST00000370684;ENST00000436133;ENST00000394838;ENST00000370682;ENST00000370679;ENST00000432111;ENST00000450730;ENST00000370680;ENST00000413538;ENST00000417530;ENST00000394839;ENST00000370681	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06;-0.06;-0.06;-0.06;-0.06;-0.06;-0.06;-0.06;-0.06;-0.06;-0.06	4.87	4.87	0.63330	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.54727	0.1876	N	0.02865	-0.47	0.80722	D	1	P;B;B;B;B;B;B;B;B;P;B	0.38223	0.623;0.085;0.104;0.036;0.107;0.085;0.014;0.137;0.033;0.623;0.014	D;B;B;B;B;B;B;B;B;D;B	0.67725	0.953;0.042;0.101;0.191;0.129;0.061;0.061;0.061;0.223;0.953;0.09	T	0.73244	-0.4044	10	0.87932	D	0	-16.3499	18.3734	0.90420	0.0:0.0:1.0:0.0	.	134;122;141;140;104;140;138;181;181;134;134	B2RB89;P22694-3;B4DKB0;B1APG3;B1APG4;P22694-6;P22694-7;P22694-2;B4E2L0;P22694;P22694-8	.;.;.;.;.;.;.;.;.;KAPCB_HUMAN;.	K	134;134;181;141;122;138;141;138;140;130;137;140;129;121;104;96	ENSP00000359723:R134K;ENSP00000359722:R134K;ENSP00000359719:R181K;ENSP00000401252:R141K;ENSP00000359718:R122K;ENSP00000390906:R138K;ENSP00000378314:R141K;ENSP00000359716:R138K;ENSP00000392275:R130K;ENSP00000393654:R137K;ENSP00000359714:R140K;ENSP00000397175:R129K;ENSP00000399326:R121K;ENSP00000378315:R104K	ENSP00000359713:R140K	R	+	2	0	PRKACB	84423435	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.680000	0.98651	2.422000	0.82143	0.557000	0.71058	AGA		0.308	PRKACB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027641.1	NM_182948		23	152	0	0	0	0	23	152				
RPF1	80135	broad.mit.edu	37	1	84948646	84948646	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:84948646G>A	ENST00000370654.5	+	3	349	c.334G>A	c.(334-336)Gat>Aat	p.D112N	RPF1_ENST00000370656.1_Missense_Mutation_p.D112N	NM_025065.6	NP_079341.2	Q9H9Y2	RPF1_HUMAN	ribosome production factor 1 homolog (S. cerevisiae)	112					rRNA processing (GO:0006364)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)			breast(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(2)|prostate(1)	14						GCGAGTGTATGATGAAACCAC	0.318																																						uc001djv.3		NA																	0					0						c.(334-336)GAT>AAT		RNA processing factor 1							113.0	105.0	108.0					1																	84948646		2203	4300	6503	SO:0001583	missense	80135				rRNA processing|translation	nucleolus	aminoacyl-tRNA ligase activity|ATP binding|rRNA binding	g.chr1:84948646G>A	AF322053	CCDS695.1	1p22.3	2009-09-25	2009-09-25	2009-09-25	ENSG00000117133	ENSG00000117133			30350	protein-coding gene	gene with protein product	"""RNA processing factor 1"", ""ribosome production factor 1"""		"""brix domain containing 5"""	BXDC5		11864606	Standard	NM_025065		Approved		uc001djv.4	Q9H9Y2	OTTHUMG00000009857	ENST00000370654.5:c.334G>A	1.37:g.84948646G>A	ENSP00000359688:p.Asp112Asn		Somatic					p.D112N	NM_025065	NP_079341	WXS	Illumina HiSeq	Unspecified	Q9H9Y2	RPF1_HUMAN			3	379	+			112					Q5VSK7|Q6AHX1|Q8WXZ8	Missense_Mutation	SNP	ENST00000370654.5	37	c.334G>A	CCDS695.1	.	.	.	.	.	.	.	.	.	.	G	35	5.459798	0.96240	.	.	ENSG00000117133	ENST00000370656;ENST00000370654	T;T	0.70749	-0.51;1.19	5.93	5.93	0.95920	.	0.046655	0.85682	D	0.000000	D	0.85831	0.5788	M	0.88450	2.955	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	D	0.86589	0.1859	10	0.62326	D	0.03	-20.8713	20.3368	0.98748	0.0:0.0:1.0:0.0	.	112	Q9H9Y2	RPF1_HUMAN	N	112	ENSP00000359690:D112N;ENSP00000359688:D112N	ENSP00000359688:D112N	D	+	1	0	RPF1	84721234	1.000000	0.71417	0.987000	0.45799	0.942000	0.58702	8.895000	0.92512	2.805000	0.96524	0.655000	0.94253	GAT		0.318	RPF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027238.1	NM_025065		6	32	0	0	0	0	6	32				
COL24A1	255631	broad.mit.edu	37	1	86313410	86313410	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:86313410C>G	ENST00000370571.2	-	39	3766	c.3400G>C	c.(3400-3402)Ggt>Cgt	p.G1134R	COL24A1_ENST00000436319.1_Missense_Mutation_p.G1134R	NM_152890.5	NP_690850.2	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1	1134	Collagen-like 11.				extracellular matrix organization (GO:0030198)|hematopoietic progenitor cell differentiation (GO:0002244)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			NS(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(9)|liver(1)|lung(56)|ovary(4)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	101				all cancers(265;0.0627)|Epithelial(280;0.0689)		CCAGGAGGACCTCTGCTTCCA	0.418																																						uc001dlj.2		NA																	0				ovary(3)|central_nervous_system(1)|skin(1)	5						c.(3400-3402)GGT>CGT		collagen, type XXIV, alpha 1 precursor							150.0	139.0	142.0					1																	86313410		1861	4088	5949	SO:0001583	missense	255631				cell adhesion	collagen	extracellular matrix structural constituent	g.chr1:86313410C>G	AF410793	CCDS41353.1	1p22.3-p22.2	2013-01-16			ENSG00000171502	ENSG00000171502		"""Collagens"""	20821	protein-coding gene	gene with protein product		610025					Standard	NM_152890		Approved		uc001dlj.3	Q17RW2	OTTHUMG00000010629	ENST00000370571.2:c.3400G>C	1.37:g.86313410C>G	ENSP00000359603:p.Gly1134Arg		Somatic				COL24A1_uc001dli.2_Missense_Mutation_p.G270R|COL24A1_uc010osd.1_Missense_Mutation_p.G434R|COL24A1_uc001dlk.2_RNA|COL24A1_uc010ose.1_RNA|COL24A1_uc010osf.1_RNA	p.G1134R	NM_152890	NP_690850	WXS	Illumina HiSeq	Unspecified	Q17RW2	COOA1_HUMAN		all cancers(265;0.0627)|Epithelial(280;0.0689)	39	3442	-			1134			Collagen-like 11.		C9J1X6|Q14BD7|Q59EX5|Q5VY50|Q7Z5L5	Missense_Mutation	SNP	ENST00000370571.2	37	c.3400G>C	CCDS41353.1	.	.	.	.	.	.	.	.	.	.	C	15.46	2.838964	0.51057	.	.	ENSG00000171502	ENST00000370571;ENST00000436319	D;D	0.99637	-6.29;-6.29	5.53	5.53	0.82687	.	0.453527	0.16336	N	0.218922	D	0.99819	0.9920	H	0.96489	3.83	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98096	1.0412	10	0.87932	D	0	.	18.2192	0.89896	0.0:1.0:0.0:0.0	.	1134;1134	Q17RW2;Q17RW2-2	COOA1_HUMAN;.	R	1134	ENSP00000359603:G1134R;ENSP00000392531:G1134R	ENSP00000359603:G1134R	G	-	1	0	COL24A1	86085998	1.000000	0.71417	1.000000	0.80357	0.681000	0.39784	5.974000	0.70465	2.602000	0.87976	0.585000	0.79938	GGT		0.418	COL24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029335.4	NM_152890		15	121	0	0	0	0	15	121				
CLCA1	1179	broad.mit.edu	37	1	86964330	86964330	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:86964330G>C	ENST00000234701.3	+	14	2540	c.2189G>C	c.(2188-2190)aGa>aCa	p.R730T	CLCA1_ENST00000394711.1_Missense_Mutation_p.R730T			A8K7I4	CLCA1_HUMAN	chloride channel accessory 1	730					calcium ion transport (GO:0006816)|cellular response to hypoxia (GO:0071456)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|zymogen granule membrane (GO:0042589)	chloride channel activity (GO:0005254)			NS(1)|breast(3)|endometrium(1)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)		TGTTTCAGCAGAACATCCTCG	0.423																																						uc001dlt.2		NA																	0				ovary(1)	1						c.(2188-2190)AGA>ACA		chloride channel accessory 1 precursor							118.0	114.0	115.0					1																	86964330		2203	4300	6503	SO:0001583	missense	1179				calcium ion transport	extracellular space|integral to plasma membrane	chloride channel activity	g.chr1:86964330G>C		CCDS709.1	1p22.3	2012-02-26	2009-01-29		ENSG00000016490	ENSG00000016490			2015	protein-coding gene	gene with protein product		603906	"""chloride channel, calcium activated, family member 1"", ""chloride channel regulator 1"""			9828122	Standard	NM_001285		Approved	CaCC, CLCRG1	uc001dlt.3	A8K7I4	OTTHUMG00000010254	ENST00000234701.3:c.2189G>C	1.37:g.86964330G>C	ENSP00000234701:p.Arg730Thr		Somatic					p.R730T	NM_001285	NP_001276	WXS	Illumina HiSeq	Unspecified	A8K7I4	CLCA1_HUMAN		all cancers(265;0.0249)|Epithelial(280;0.0476)	13	2318	+		Lung NSC(277;0.239)	730					B2RAV5|O95151|Q5TDF4|Q9UNF6|Q9UPC6	Missense_Mutation	SNP	ENST00000234701.3	37	c.2189G>C	CCDS709.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.438300	0.83885	.	.	ENSG00000016490	ENST00000234701;ENST00000394711	T;T	0.09723	2.95;2.95	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.39784	0.1091	M	0.92459	3.31	0.42046	D	0.991094	D	0.89917	1.0	D	0.91635	0.999	T	0.49890	-0.8891	10	0.72032	D	0.01	-28.5954	20.0189	0.97489	0.0:0.0:1.0:0.0	.	730	A8K7I4	CLCA1_HUMAN	T	730	ENSP00000234701:R730T;ENSP00000378200:R730T	ENSP00000234701:R730T	R	+	2	0	CLCA1	86736918	1.000000	0.71417	1.000000	0.80357	0.730000	0.41778	7.342000	0.79310	2.828000	0.97474	0.655000	0.94253	AGA		0.423	CLCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028277.1	NM_001285		13	94	0	0	0	0	13	94				
ABCA4	24	broad.mit.edu	37	1	94502326	94502326	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:94502326C>T	ENST00000370225.3	-	26	3918	c.3832G>A	c.(3832-3834)Gag>Aag	p.E1278K		NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	1278					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		TCAGAATCCTCCGTGACCTTC	0.438																																						uc001dqh.2		NA																	0				ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12						c.(3832-3834)GAG>AAG		ATP-binding cassette, sub-family A member 4							103.0	114.0	111.0					1																	94502326		2203	4300	6503	SO:0001583	missense	24				phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr1:94502326C>T	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.3832G>A	1.37:g.94502326C>T	ENSP00000359245:p.Glu1278Lys		Somatic					p.E1278K	NM_000350	NP_000341	WXS	Illumina HiSeq	Unspecified	P78363	ABCA4_HUMAN		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)	26	3936	-		all_lung(203;0.000757)|Lung NSC(277;0.00335)	1278			Cytoplasmic.		O15112|O60438|O60915|Q0QD48|Q4LE31	Missense_Mutation	SNP	ENST00000370225.3	37	c.3832G>A	CCDS747.1	.	.	.	.	.	.	.	.	.	.	C	19.43	3.825760	0.71143	.	.	ENSG00000198691	ENST00000546054;ENST00000370225	D	0.84298	-1.83	5.31	5.31	0.75309	.	0.111214	0.64402	D	0.000014	T	0.74068	0.3668	L	0.38175	1.15	0.80722	D	1	B	0.11235	0.004	B	0.12156	0.007	T	0.68577	-0.5372	10	0.41790	T	0.15	.	19.1694	0.93570	0.0:1.0:0.0:0.0	.	1278	P78363	ABCA4_HUMAN	K	70;1278	ENSP00000359245:E1278K	ENSP00000359245:E1278K	E	-	1	0	ABCA4	94274914	0.934000	0.31675	0.544000	0.28141	0.891000	0.51852	4.823000	0.62694	2.765000	0.95021	0.655000	0.94253	GAG		0.438	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350		31	125	0	0	0	0	31	125				
ABCA4	24	broad.mit.edu	37	1	94577116	94577116	+	Silent	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:94577116C>G	ENST00000370225.3	-	3	266	c.180G>C	c.(178-180)gcG>gcC	p.A60A	ABCA4_ENST00000535735.1_Silent_p.A60A	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	60			A -> E (in STGD1). {ECO:0000269|PubMed:10958763}.|A -> T (in STGD1). {ECO:0000269|PubMed:10958763}.|A -> V (in STGD1). {ECO:0000269|PubMed:10206579, ECO:0000269|PubMed:11527935}.		phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)	p.A60A(1)		NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		CTGAGGGCATCGCCTTGTTGG	0.512																																						uc001dqh.2		NA																	1	Substitution - coding silent(1)		breast(1)	ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12						c.(178-180)GCG>GCC		ATP-binding cassette, sub-family A member 4							68.0	68.0	68.0					1																	94577116		2203	4300	6503	SO:0001819	synonymous_variant	24				phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr1:94577116C>G	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.180G>C	1.37:g.94577116C>G			Somatic				ABCA4_uc010otn.1_Silent_p.A60A	p.A60A	NM_000350	NP_000341	WXS	Illumina HiSeq	Unspecified	P78363	ABCA4_HUMAN		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)	3	284	-		all_lung(203;0.000757)|Lung NSC(277;0.00335)	60		A -> T (in STGD1).|A -> E (in STGD1).|A -> V (in STGD1).	Extracellular.		O15112|O60438|O60915|Q0QD48|Q4LE31	Silent	SNP	ENST00000370225.3	37	c.180G>C	CCDS747.1																																																																																				0.512	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350		10	52	0	0	0	0	10	52				
FAM102B	284611	broad.mit.edu	37	1	109154857	109154857	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:109154857C>T	ENST00000370035.3	+	4	686	c.346C>T	c.(346-348)Cgc>Tgc	p.R116C	FAM102B_ENST00000405454.1_Missense_Mutation_p.R116C	NM_001010883.2	NP_001010883.2	Q5T8I3	F102B_HUMAN	family with sequence similarity 102, member B	116										autonomic_ganglia(1)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	5		all_epithelial(167;5.52e-05)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0217)|Lung(183;0.109)|COAD - Colon adenocarcinoma(174;0.141)|Epithelial(280;0.182)		TACCACTCGCCGCTGTTTACT	0.363																																						uc010ouy.1		NA																	0				large_intestine(1)	1						c.(346-348)CGC>TGC		hypothetical protein LOC284611							107.0	104.0	105.0					1																	109154857		2203	4300	6503	SO:0001583	missense	284611							g.chr1:109154857C>T	CR749397	CCDS30786.2	1p13.3	2012-11-05			ENSG00000162636	ENSG00000162636			27637	protein-coding gene	gene with protein product	"""sym-3 homolog B (C. elegans)"""						Standard	NM_001010883		Approved	DKFZp779B126, SYM-3B	uc010ouy.2	Q5T8I3	OTTHUMG00000010967	ENST00000370035.3:c.346C>T	1.37:g.109154857C>T	ENSP00000359052:p.Arg116Cys		Somatic					p.R116C	NM_001010883	NP_001010883	WXS	Illumina HiSeq	Unspecified	Q5T8I3	F102B_HUMAN		Colorectal(144;0.0217)|Lung(183;0.109)|COAD - Colon adenocarcinoma(174;0.141)|Epithelial(280;0.182)	4	426	+		all_epithelial(167;5.52e-05)|all_lung(203;0.00026)|Lung NSC(277;0.000508)	116					A1L1A1|B0QZ46|B0QZ47|Q68DH7	Missense_Mutation	SNP	ENST00000370035.3	37	c.346C>T	CCDS30786.2	.	.	.	.	.	.	.	.	.	.	C	27.4	4.830242	0.91036	.	.	ENSG00000162636	ENST00000370035;ENST00000405454;ENST00000437902	T;T	0.49720	0.77;0.77	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.45637	0.1352	N	0.20304	0.555	0.80722	D	1	D	0.89917	1.0	D	0.67231	0.95	T	0.45920	-0.9228	10	0.40728	T	0.16	-10.34	19.0387	0.92989	0.0:1.0:0.0:0.0	.	116	Q5T8I3	F102B_HUMAN	C	116	ENSP00000359052:R116C;ENSP00000386084:R116C	ENSP00000359052:R116C	R	+	1	0	FAM102B	108956380	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.957000	0.70323	2.500000	0.84329	0.655000	0.94253	CGC		0.363	FAM102B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030188.3	NM_001010883		24	72	0	0	0	0	24	72				
CSF1	1435	broad.mit.edu	37	1	110466425	110466425	+	Silent	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:110466425C>G	ENST00000329608.6	+	6	1573	c.1182C>G	c.(1180-1182)ctC>ctG	p.L394L	CSF1_ENST00000369801.1_Intron|CSF1_ENST00000369802.3_Silent_p.L394L|CSF1_ENST00000420111.2_Intron|CSF1_ENST00000344188.5_Intron	NM_000757.5|NM_172211.3	NP_000748|NP_757350.1	P09603	CSF1_HUMAN	colony stimulating factor 1 (macrophage)	394					branching involved in mammary gland duct morphogenesis (GO:0060444)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|developmental process involved in reproduction (GO:0003006)|hemopoiesis (GO:0030097)|homeostasis of number of cells within a tissue (GO:0048873)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage differentiation (GO:0030225)|mammary duct terminal end bud growth (GO:0060763)|mammary gland fat development (GO:0060611)|monocyte activation (GO:0042117)|odontogenesis (GO:0042476)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|osteoclast proliferation (GO:0002158)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of monocyte differentiation (GO:0045657)|positive regulation of mononuclear cell proliferation (GO:0032946)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of odontogenesis of dentin-containing tooth (GO:0042488)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of macrophage derived foam cell differentiation (GO:0010743)|regulation of ossification (GO:0030278)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|macrophage colony-stimulating factor receptor binding (GO:0005157)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(3)|large_intestine(3)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	20		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Acute lymphoblastic leukemia(138;0.204)		Lung(183;0.0238)|Colorectal(144;0.112)|all cancers(265;0.117)|Epithelial(280;0.127)|LUSC - Lung squamous cell carcinoma(189;0.135)		CTGCCCTGCTCAGAGACCCCC	0.642																																						uc001dyu.2		NA																	0				ovary(1)	1						c.(1180-1182)CTC>CTG		colony stimulating factor 1 isoform a precursor							46.0	52.0	50.0					1																	110466425		2203	4300	6503	SO:0001819	synonymous_variant	1435				cell proliferation|developmental process involved in reproduction|macrophage differentiation|monocyte activation|osteoclast differentiation|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of cellular protein metabolic process|positive regulation of gene expression|positive regulation of macrophage derived foam cell differentiation|positive regulation of macrophage differentiation|positive regulation of monocyte differentiation|positive regulation of mononuclear cell proliferation|positive regulation of protein kinase activity	extracellular space|integral to membrane|perinuclear region of cytoplasm|plasma membrane|receptor complex	cytokine activity|growth factor activity|macrophage colony-stimulating factor receptor binding|protein homodimerization activity	g.chr1:110466425C>G	BC021117	CCDS816.1, CCDS817.1, CCDS30797.1	1p13.3	2012-09-20			ENSG00000184371	ENSG00000184371			2432	protein-coding gene	gene with protein product		120420				1540160	Standard	NM_172210		Approved	M-CSF, MCSF, MGC31930	uc001dyw.4	P09603	OTTHUMG00000011646	ENST00000329608.6:c.1182C>G	1.37:g.110466425C>G			Somatic				CSF1_uc001dyt.2_Intron|CSF1_uc001dyv.3_Intron|CSF1_uc001dyw.3_Silent_p.L394L	p.L394L	NM_172212	NP_757351	WXS	Illumina HiSeq	Unspecified	P09603	CSF1_HUMAN		Lung(183;0.0238)|Colorectal(144;0.112)|all cancers(265;0.117)|Epithelial(280;0.127)|LUSC - Lung squamous cell carcinoma(189;0.135)	6	1595	+		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Acute lymphoblastic leukemia(138;0.204)	394			Lumenal (Potential).		A8K6J5|Q13130|Q14086|Q14806|Q5VVF3|Q5VVF4|Q9UQR8	Silent	SNP	ENST00000329608.6	37	c.1182C>G	CCDS816.1																																																																																				0.642	CSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032208.1	NM_000757		9	39	0	0	0	0	9	39				
GOLPH3L	55204	broad.mit.edu	37	1	150634351	150634351	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:150634351C>T	ENST00000271732.3	-	4	413	c.369G>A	c.(367-369)ctG>ctA	p.L123L	GOLPH3L_ENST00000540514.1_Silent_p.L79L	NM_018178.5	NP_060648.2	Q9H4A5	GLP3L_HUMAN	golgi phosphoprotein 3-like	123					Golgi organization (GO:0007030)|positive regulation of protein secretion (GO:0050714)	Golgi membrane (GO:0000139)|trans-Golgi network membrane (GO:0032588)	phosphatidylinositol-4-phosphate binding (GO:0070273)			breast(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)	8	all_cancers(9;3.09e-52)|all_epithelial(9;4.47e-43)|all_lung(15;1.09e-34)|Lung NSC(24;4.04e-31)|Breast(34;0.000615)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;1.2e-23)|all cancers(9;4.81e-23)|OV - Ovarian serous cystadenocarcinoma(6;1.93e-15)|BRCA - Breast invasive adenocarcinoma(12;0.000479)|LUSC - Lung squamous cell carcinoma(543;0.171)			TGATGTGTTTCAGAGTTTCAT	0.388																																						uc001evj.2		NA																	0				ovary(1)	1						c.(367-369)CTG>CTA		Golgi phosphoprotein 3-like							193.0	187.0	189.0					1																	150634351		2203	4300	6503	SO:0001819	synonymous_variant	55204					Golgi cisterna membrane		g.chr1:150634351C>T	AJ296153	CCDS966.1	1q21	2008-02-05			ENSG00000143457	ENSG00000143457			24882	protein-coding gene	gene with protein product		612208					Standard	NM_018178		Approved	GPP34R	uc001evj.2	Q9H4A5	OTTHUMG00000035009	ENST00000271732.3:c.369G>A	1.37:g.150634351C>T			Somatic				GOLPH3L_uc010pci.1_Silent_p.L79L	p.L123L	NM_018178	NP_060648	WXS	Illumina HiSeq	Unspecified	Q9H4A5	GLP3L_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;1.2e-23)|all cancers(9;4.81e-23)|OV - Ovarian serous cystadenocarcinoma(6;1.93e-15)|BRCA - Breast invasive adenocarcinoma(12;0.000479)|LUSC - Lung squamous cell carcinoma(543;0.171)		4	586	-	all_cancers(9;3.09e-52)|all_epithelial(9;4.47e-43)|all_lung(15;1.09e-34)|Lung NSC(24;4.04e-31)|Breast(34;0.000615)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		123					B1AN09|B7Z6N3|Q9NVK0	Silent	SNP	ENST00000271732.3	37	c.369G>A	CCDS966.1																																																																																				0.388	GOLPH3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084734.1	NM_018178		17	95	0	0	0	0	17	95				
DCST1	149095	broad.mit.edu	37	1	155011959	155011959	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:155011959G>A	ENST00000295542.1	+	5	439	c.343G>A	c.(343-345)Gaa>Aaa	p.E115K	DCST1_ENST00000368419.2_Missense_Mutation_p.E115K|DCST1_ENST00000392480.1_Missense_Mutation_p.E115K|DCST1_ENST00000423025.2_Missense_Mutation_p.E90K	NM_152494.3	NP_689707.2	Q5T197	DCST1_HUMAN	DC-STAMP domain containing 1	115						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	27	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			GCTGGGCAAGGAAGGCAGGCT	0.612																																						uc001fgn.1		NA																	0				ovary(1)|skin(1)	2						c.(343-345)GAA>AAA		DC-STAMP domain containing 1 isoform 1							128.0	119.0	122.0					1																	155011959		2203	4300	6503	SO:0001583	missense	149095					integral to membrane	zinc ion binding	g.chr1:155011959G>A	AK057347	CCDS1083.1, CCDS44235.1	1q22	2008-02-05			ENSG00000163357	ENSG00000163357			26539	protein-coding gene	gene with protein product							Standard	NM_152494		Approved	FLJ32785	uc001fgn.2	Q5T197	OTTHUMG00000041314	ENST00000295542.1:c.343G>A	1.37:g.155011959G>A	ENSP00000295542:p.Glu115Lys		Somatic				DCST1_uc010per.1_Missense_Mutation_p.E140K|DCST1_uc010pes.1_Missense_Mutation_p.E90K	p.E115K	NM_152494	NP_689707	WXS	Illumina HiSeq	Unspecified	Q5T197	DCST1_HUMAN	BRCA - Breast invasive adenocarcinoma(34;0.000434)		5	439	+	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		115			Cytoplasmic (Potential).		B4DXA0|E9PHV3|Q5T198|Q6P1W6|Q71S70|Q96M70	Missense_Mutation	SNP	ENST00000295542.1	37	c.343G>A	CCDS1083.1	.	.	.	.	.	.	.	.	.	.	G	16.95	3.263982	0.59431	.	.	ENSG00000163357	ENST00000295542;ENST00000392480;ENST00000423025;ENST00000368419	T;T;T;T	0.59772	0.24;0.24;0.24;0.24	5.26	5.26	0.73747	.	0.443123	0.23545	N	0.047031	T	0.43678	0.1258	M	0.65975	2.015	0.31827	N	0.62519	D;P;D	0.53151	0.958;0.716;0.958	B;B;P	0.45138	0.386;0.294;0.471	T	0.46582	-0.9181	10	0.16420	T	0.52	-27.3443	14.3669	0.66812	0.0:0.0:1.0:0.0	.	90;140;115	E9PHV3;E9PJX3;Q5T197	.;.;DCST1_HUMAN	K	115;115;90;115	ENSP00000295542:E115K;ENSP00000376271:E115K;ENSP00000387369:E90K;ENSP00000357404:E115K	ENSP00000295542:E115K	E	+	1	0	DCST1	153278583	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	4.515000	0.60489	2.472000	0.83506	0.585000	0.79938	GAA		0.612	DCST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099006.1	NM_152494		5	97	0	0	0	0	5	97				
FCRL3	115352	broad.mit.edu	37	1	157648586	157648586	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:157648586C>T	ENST00000368184.3	-	15	2410	c.2119G>A	c.(2119-2121)Gct>Act	p.A707T	FCRL3_ENST00000368186.5_Missense_Mutation_p.A707T|FCRL3_ENST00000473231.1_5'UTR	NM_052939.3	NP_443171.2	Q96P31	FCRL3_HUMAN	Fc receptor-like 3	707						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(1)|large_intestine(13)|lung(31)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)	69	all_hematologic(112;0.0378)					CTGCTGCTAGCCTCCCCTGCA	0.468																																						uc001frb.2		NA																	0				ovary(3)|breast(1)	4						c.(2119-2121)GCT>ACT		Fc receptor-like 3 precursor							125.0	110.0	115.0					1																	157648586		2203	4300	6503	SO:0001583	missense	115352					integral to membrane|plasma membrane	receptor activity	g.chr1:157648586C>T	AF459027	CCDS1167.1	1q21-q22	2013-01-11			ENSG00000160856	ENSG00000160856		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18506	protein-coding gene	gene with protein product		606510				11493702, 12014205	Standard	XR_241065		Approved	FCRH3, IRTA3, IFGP3, SPAP2a, SPAP2, SPAP2b, SPAP2c, SPAP2d, SPAP2e, CD307c	uc001frb.3	Q96P31	OTTHUMG00000019400	ENST00000368184.3:c.2119G>A	1.37:g.157648586C>T	ENSP00000357167:p.Ala707Thr		Somatic				FCRL3_uc001fqx.3_RNA|FCRL3_uc001fqy.3_RNA|FCRL3_uc001fqz.3_Missense_Mutation_p.A707T|FCRL3_uc009wsn.2_RNA|FCRL3_uc009wso.2_RNA|FCRL3_uc001fra.2_Missense_Mutation_p.A433T|FCRL3_uc001frc.1_Missense_Mutation_p.A707T	p.A707T	NM_052939	NP_443171	WXS	Illumina HiSeq	Unspecified	Q96P31	FCRL3_HUMAN			15	2411	-	all_hematologic(112;0.0378)		707			Cytoplasmic (Potential).		A0N0M4|A8MTH7|D3DVD2|Q5VXZ8|Q8N6S2|Q96LA4|Q96P27|Q96P28|Q96P29|Q96P30	Missense_Mutation	SNP	ENST00000368184.3	37	c.2119G>A	CCDS1167.1	.	.	.	.	.	.	.	.	.	.	C	10.31	1.315993	0.23908	.	.	ENSG00000160856	ENST00000368186;ENST00000368184	T;T	0.49432	0.78;0.78	3.75	-0.631	0.11526	.	.	.	.	.	T	0.17109	0.0411	L	0.57536	1.79	0.09310	N	1	B;B;B	0.18461	0.003;0.028;0.016	B;B;B	0.17722	0.004;0.009;0.019	T	0.24799	-1.0150	9	0.32370	T	0.25	.	3.0118	0.06046	0.4132:0.3608:0.0:0.2261	.	707;612;707	Q96P31;D3DVD1;Q96P31-6	FCRL3_HUMAN;.;.	T	707	ENSP00000357169:A707T;ENSP00000357167:A707T	ENSP00000357167:A707T	A	-	1	0	FCRL3	155915210	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.055000	0.14229	-0.115000	0.11915	0.655000	0.94253	GCT		0.468	FCRL3-006	NOVEL	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051419.2	NM_052939		12	56	0	0	0	0	12	56				
FCRL3	115352	broad.mit.edu	37	1	157665912	157665912	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:157665912C>G	ENST00000368184.3	-	7	1341	c.1050G>C	c.(1048-1050)gaG>gaC	p.E350D	FCRL3_ENST00000368186.5_Missense_Mutation_p.E350D|FCRL3_ENST00000473231.1_5'UTR|RP11-367J7.3_ENST00000453692.1_RNA	NM_052939.3	NP_443171.2	Q96P31	FCRL3_HUMAN	Fc receptor-like 3	350	Ig-like C2-type 4.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(1)|large_intestine(13)|lung(31)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)	69	all_hematologic(112;0.0378)					CTGCATCACTCTCCTTCACGG	0.512																																						uc001frb.2		NA																	0				ovary(3)|breast(1)	4						c.(1048-1050)GAG>GAC		Fc receptor-like 3 precursor							143.0	124.0	130.0					1																	157665912		2203	4300	6503	SO:0001583	missense	115352					integral to membrane|plasma membrane	receptor activity	g.chr1:157665912C>G	AF459027	CCDS1167.1	1q21-q22	2013-01-11			ENSG00000160856	ENSG00000160856		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18506	protein-coding gene	gene with protein product		606510				11493702, 12014205	Standard	XR_241065		Approved	FCRH3, IRTA3, IFGP3, SPAP2a, SPAP2, SPAP2b, SPAP2c, SPAP2d, SPAP2e, CD307c	uc001frb.3	Q96P31	OTTHUMG00000019400	ENST00000368184.3:c.1050G>C	1.37:g.157665912C>G	ENSP00000357167:p.Glu350Asp		Somatic				FCRL3_uc001fqx.3_RNA|FCRL3_uc001fqy.3_RNA|FCRL3_uc001fqz.3_Missense_Mutation_p.E350D|FCRL3_uc009wsn.2_RNA|FCRL3_uc009wso.2_RNA|FCRL3_uc001fra.2_Missense_Mutation_p.E76D|FCRL3_uc001frc.1_Missense_Mutation_p.E350D	p.E350D	NM_052939	NP_443171	WXS	Illumina HiSeq	Unspecified	Q96P31	FCRL3_HUMAN			7	1342	-	all_hematologic(112;0.0378)		350			Ig-like C2-type 4.|Extracellular (Potential).		A0N0M4|A8MTH7|D3DVD2|Q5VXZ8|Q8N6S2|Q96LA4|Q96P27|Q96P28|Q96P29|Q96P30	Missense_Mutation	SNP	ENST00000368184.3	37	c.1050G>C	CCDS1167.1	.	.	.	.	.	.	.	.	.	.	C	16.42	3.118788	0.56505	.	.	ENSG00000160856	ENST00000368186;ENST00000368184;ENST00000292392	T;T	0.13538	2.58;2.58	5.44	-1.22	0.09494	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.520143	0.16241	N	0.223144	T	0.11623	0.0283	M	0.89095	3.005	0.09310	N	1	B;P;P	0.42649	0.359;0.786;0.566	B;P;B	0.48089	0.395;0.566;0.274	T	0.06643	-1.0815	10	0.49607	T	0.09	.	5.1587	0.15048	0.0:0.3769:0.1485:0.4747	.	350;255;350	Q96P31;D3DVD1;Q96P31-6	FCRL3_HUMAN;.;.	D	350	ENSP00000357169:E350D;ENSP00000357167:E350D	ENSP00000292392:E350D	E	-	3	2	FCRL3	155932536	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.215000	0.17562	-0.557000	0.06126	0.563000	0.77884	GAG		0.512	FCRL3-006	NOVEL	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051419.2	NM_052939		9	64	0	0	0	0	9	64				
SDHC	6391	broad.mit.edu	37	1	161326611	161326611	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:161326611G>A	ENST00000367975.2	+	5	535	c.386G>A	c.(385-387)tGg>tAg	p.W129*	SDHC_ENST00000432287.2_Nonsense_Mutation_p.W95*|SDHC_ENST00000392169.2_Nonsense_Mutation_p.W76*|SDHC_ENST00000513009.1_Intron|SDHC_ENST00000470743.3_3'UTR|SDHC_ENST00000342751.4_Intron	NM_003001.3	NP_002992.1	Q99643	C560_HUMAN	succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa	129					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|oxidation-reduction process (GO:0055114)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)|respiratory chain complex II (GO:0045273)	electron carrier activity (GO:0009055)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|succinate dehydrogenase activity (GO:0000104)			urinary_tract(1)	1	all_cancers(52;6.96e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Succinic acid(DB00139)	TATCATACCTGGAATGGGATC	0.463			"""Mis, N, F"""			"""paraganglioma, pheochromocytoma"""			Familial Paragangliomas;Carney-Stratakis syndrome																													uc001gag.2		NA	yes	Rec		Familial paraganglioma	1	1q21	6391	Mis|N|F	"""succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa"""			O		paraganglioma|pheochromocytoma			0					0						c.(385-387)TGG>TAG		succinate dehydrogenase complex, subunit C	Succinic acid(DB00139)						142.0	133.0	136.0					1																	161326611		2203	4300	6503	SO:0001587	stop_gained	6391	Familial_Paragangliomas|Carney-Stratakis_syndrome	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss;Carney-Stratakis dyad, Paraganglioma-Gastric Stromal Sarcoma dyad	respiratory electron transport chain|transport|tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain complex II|plasma membrane succinate dehydrogenase complex	electron carrier activity|heme binding|succinate dehydrogenase activity	g.chr1:161326611G>A	D49737	CCDS1230.1, CCDS41431.1, CCDS41432.1, CCDS44263.1, CCDS60330.1	1q23.3	2014-09-17	2002-08-29		ENSG00000143252	ENSG00000143252		"""Mitochondrial respiratory chain complex / Complex II"""	10682	protein-coding gene	gene with protein product		602413	"""succinate dehydrogenase complex, subunit C, integral membrane protein, 15kD"""	PGL3		9533030, 12658451	Standard	NM_001278172		Approved		uc001gag.3	Q99643	OTTHUMG00000034468	ENST00000367975.2:c.386G>A	1.37:g.161326611G>A	ENSP00000356953:p.Trp129*		Somatic				SDHC_uc001gai.2_Intron|SDHC_uc001gaj.2_Nonsense_Mutation_p.W76*|SDHC_uc001gak.2_Intron|SDHC_uc001gah.2_Nonsense_Mutation_p.W95*	p.W129*	NM_003001	NP_002992	WXS	Illumina HiSeq	Unspecified	Q99643	C560_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00376)		5	416	+	all_cancers(52;6.96e-17)|all_hematologic(112;0.093)		129			Helical; (By similarity).		O75609|Q3C259|Q3C2D8|Q3C2H4|Q5VTH3	Nonsense_Mutation	SNP	ENST00000367975.2	37	c.386G>A	CCDS1230.1	.	.	.	.	.	.	.	.	.	.	g	22.4	4.282445	0.80692	.	.	ENSG00000143252	ENST00000367975;ENST00000432287;ENST00000392169	.	.	.	5.24	3.28	0.37604	.	0.252163	0.43110	D	0.000602	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	.	12.1572	0.54083	0.0:0.0:0.6589:0.341	.	.	.	.	X	129;95;76	.	ENSP00000356953:W129X	W	+	2	0	SDHC	159593235	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.216000	0.42871	0.622000	0.30249	0.639000	0.83563	TGG		0.463	SDHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083316.2	NM_003001		24	143	0	0	0	0	24	143				
RGS4	5999	broad.mit.edu	37	1	163039306	163039306	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:163039306C>G	ENST00000367909.6	+	1	372	c.32C>G	c.(31-33)tCt>tGt	p.S11C	RGS4_ENST00000491263.1_3'UTR|RGS4_ENST00000531057.1_Missense_Mutation_p.S11C|RGS4_ENST00000367908.4_Missense_Mutation_p.S11C|RGS4_ENST00000421743.2_Missense_Mutation_p.S108C|RGS4_ENST00000367906.3_5'Flank|RGS4_ENST00000527809.1_Intron	NM_001113380.1|NM_005613.5	NP_001106851.1|NP_005604.1	P49798	RGS4_HUMAN	regulator of G-protein signaling 4	11					inactivation of MAPK activity (GO:0000188)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|upper_aerodigestive_tract(2)	21						CTGCCGGCTTCTTGCTTGAGG	0.438											OREG0013952	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Ovarian(76;1257 1738 3039 6086)	uc009wuy.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(31-33)TCT>TGT		regulator of G-protein signaling 4 isoform 2							63.0	59.0	61.0					1																	163039306		2203	4300	6503	SO:0001583	missense	5999				inactivation of MAPK activity|regulation of G-protein coupled receptor protein signaling pathway	plasma membrane	calmodulin binding|GTPase activator activity|signal transducer activity	g.chr1:163039306C>G	BC051869	CCDS1243.1, CCDS44270.1, CCDS44271.1, CCDS44272.1	1q23.3	2008-05-14	2007-08-14		ENSG00000117152	ENSG00000117152		"""Regulators of G-protein signaling"""	10000	protein-coding gene	gene with protein product		602516	"""regulator of G-protein signalling 4"", ""schizophrenia disorder 9"""	SCZD9		8602223, 8756726	Standard	NM_001102445		Approved		uc001gcl.4	P49798	OTTHUMG00000034417	ENST00000367909.6:c.32C>G	1.37:g.163039306C>G	ENSP00000356885:p.Ser11Cys		Somatic	OREG0013952	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1828	RGS4_uc001gcl.3_Missense_Mutation_p.S108C|RGS4_uc009wuz.2_Missense_Mutation_p.S11C|RGS4_uc009wva.2_5'Flank	p.S11C	NM_005613	NP_005604	WXS	Illumina HiSeq	Unspecified	P49798	RGS4_HUMAN			1	543	+			11					A7XA56|A7XA58|A7XA59|A7YVV7|B1APZ3	Missense_Mutation	SNP	ENST00000367909.6	37	c.32C>G	CCDS1243.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.187494	0.78789	.	.	ENSG00000117152	ENST00000421743;ENST00000367909;ENST00000531057;ENST00000367908	T;T;D	0.87103	0.51;0.63;-2.21	4.57	4.57	0.56435	.	0.055955	0.64402	D	0.000001	T	0.81123	0.4757	L	0.34521	1.04	0.31924	N	0.6130979999999999	D;B;B	0.58268	0.982;0.214;0.126	P;B;B	0.50490	0.642;0.174;0.06	D	0.84802	0.0785	9	0.87932	D	0	.	13.0479	0.58937	0.0:1.0:0.0:0.0	.	11;11;108	B1APZ3;P49798;A7XA59	.;RGS4_HUMAN;.	C	108;11;11;11	ENSP00000397181:S108C;ENSP00000356885:S11C;ENSP00000436106:S11C	ENSP00000356884:S11C	S	+	2	0	RGS4	161305930	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.582000	0.67477	2.516000	0.84829	0.655000	0.94253	TCT		0.438	RGS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083197.2	NM_005613		15	42	0	0	0	0	15	42				
DUSP27	92235	broad.mit.edu	37	1	167095830	167095830	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:167095830G>C	ENST00000361200.2	+	6	1628	c.1462G>C	c.(1462-1464)Gag>Cag	p.E488Q	DUSP27_ENST00000271385.5_Missense_Mutation_p.E488Q|DUSP27_ENST00000485151.1_Intron|DUSP27_ENST00000443333.1_Missense_Mutation_p.E488Q			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	488					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						GCTGGAGATTGAGAAGGAGGC	0.647																																						uc001geb.1		NA																	0				ovary(3)	3						c.(1462-1464)GAG>CAG		dual specificity phosphatase 27							36.0	35.0	36.0					1																	167095830		2203	4300	6503	SO:0001583	missense	92235				protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity	g.chr1:167095830G>C	AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.1462G>C	1.37:g.167095830G>C	ENSP00000354483:p.Glu488Gln		Somatic					p.E488Q	NM_001080426	NP_001073895	WXS	Illumina HiSeq	Unspecified	Q5VZP5	DUS27_HUMAN			5	1462	+			488					A0AUM4|Q9C074	Missense_Mutation	SNP	ENST00000361200.2	37	c.1462G>C	CCDS30932.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.628264	0.87560	.	.	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	T;T;T	0.09445	2.98;2.98;2.98	5.36	5.36	0.76844	.	0.160857	0.41712	D	0.000832	T	0.27384	0.0672	M	0.71581	2.175	0.54753	D	0.999988	D	0.89917	1.0	D	0.83275	0.996	T	0.02625	-1.1132	10	0.87932	D	0	-27.6078	19.1027	0.93281	0.0:0.0:1.0:0.0	.	488	Q5VZP5	DUS27_HUMAN	Q	488	ENSP00000354483:E488Q;ENSP00000271385:E488Q;ENSP00000404874:E488Q	ENSP00000271385:E488Q	E	+	1	0	DUSP27	165362454	1.000000	0.71417	0.226000	0.23910	0.682000	0.39822	9.328000	0.96403	2.488000	0.83962	0.643000	0.83706	GAG		0.647	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1	NM_001080426		7	27	0	0	0	0	7	27				
DUSP27	92235	broad.mit.edu	37	1	167097324	167097324	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:167097324G>A	ENST00000361200.2	+	6	3122	c.2956G>A	c.(2956-2958)Gag>Aag	p.E986K	DUSP27_ENST00000271385.5_Missense_Mutation_p.E986K|DUSP27_ENST00000485151.1_Intron|DUSP27_ENST00000443333.1_Missense_Mutation_p.E986K			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	986	Ser-rich.				protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						ATCCCAGTCAGAGGAACAGGA	0.517																																						uc001geb.1		NA																	0				ovary(3)	3						c.(2956-2958)GAG>AAG		dual specificity phosphatase 27							83.0	77.0	79.0					1																	167097324		2203	4300	6503	SO:0001583	missense	92235				protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity	g.chr1:167097324G>A	AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.2956G>A	1.37:g.167097324G>A	ENSP00000354483:p.Glu986Lys		Somatic					p.E986K	NM_001080426	NP_001073895	WXS	Illumina HiSeq	Unspecified	Q5VZP5	DUS27_HUMAN			5	2956	+			986			Ser-rich.		A0AUM4|Q9C074	Missense_Mutation	SNP	ENST00000361200.2	37	c.2956G>A	CCDS30932.1	.	.	.	.	.	.	.	.	.	.	G	10.92	1.487944	0.26686	.	.	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	T;T;T	0.03689	3.84;3.84;3.84	5.42	1.21	0.21127	.	0.405917	0.20876	N	0.084085	T	0.01558	0.0050	L	0.57536	1.79	0.09310	N	0.999997	B	0.18741	0.03	B	0.12837	0.008	T	0.42032	-0.9475	10	0.51188	T	0.08	-14.031	8.9487	0.35776	0.1333:0.3159:0.5508:0.0	.	986	Q5VZP5	DUS27_HUMAN	K	986	ENSP00000354483:E986K;ENSP00000271385:E986K;ENSP00000404874:E986K	ENSP00000271385:E986K	E	+	1	0	DUSP27	165363948	0.998000	0.40836	0.071000	0.20095	0.722000	0.41435	2.683000	0.46943	-0.030000	0.13804	0.643000	0.83706	GAG		0.517	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1	NM_001080426		12	59	0	0	0	0	12	59				
CCDC181	57821	broad.mit.edu	37	1	169390719	169390719	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:169390719G>C	ENST00000367806.3	-	3	1102	c.950C>G	c.(949-951)tCt>tGt	p.S317C	CCDC181_ENST00000367805.3_Missense_Mutation_p.S317C|CCDC181_ENST00000491570.1_5'UTR|CCDC181_ENST00000545005.1_Missense_Mutation_p.S317C	NM_021179.1	NP_067002.1	Q5TID7	CC181_HUMAN	coiled-coil domain containing 181	317						nucleus (GO:0005634)											CCTGTGATTAGATTTCCCATT	0.458																																						uc001gga.1		NA																	0					0						c.(949-951)TCT>TGT		hypothetical protein LOC57821							158.0	146.0	150.0					1																	169390719		2203	4300	6503	SO:0001583	missense	57821							g.chr1:169390719G>C	AL049687	CCDS1279.1, CCDS72979.1	1q24	2013-03-14	2013-03-14	2013-03-14	ENSG00000117477	ENSG00000117477			28051	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 114"""	C1orf114			Standard	XM_005245381		Approved	FLJ25846	uc001gfz.1	Q5TID7	OTTHUMG00000035448	ENST00000367806.3:c.950C>G	1.37:g.169390719G>C	ENSP00000356780:p.Ser317Cys		Somatic				C1orf114_uc001gfz.1_Missense_Mutation_p.S317C|C1orf114_uc009wvq.1_Missense_Mutation_p.S317C|C1orf114_uc001ggb.2_Missense_Mutation_p.S317C|C1orf114_uc001ggc.1_Missense_Mutation_p.S317C	p.S317C	NM_021179	NP_067002	WXS	Illumina HiSeq	Unspecified	Q5TID7	CA114_HUMAN			3	1118	-	all_hematologic(923;0.208)		317					O60780|Q53FD5|Q5TID9|Q8TC48	Missense_Mutation	SNP	ENST00000367806.3	37	c.950C>G		.	.	.	.	.	.	.	.	.	.	G	7.589	0.670371	0.14776	.	.	ENSG00000117477	ENST00000367805;ENST00000367806;ENST00000545005;ENST00000456107	T;T;T;T	0.32753	1.74;1.74;1.74;1.44	5.17	1.01	0.19927	.	0.876213	0.10392	N	0.680248	T	0.27967	0.0689	M	0.62723	1.935	0.27939	N	0.937571	B;D;D	0.64830	0.058;0.994;0.994	B;P;P	0.58873	0.035;0.847;0.847	T	0.05716	-1.0868	9	0.66056	D	0.02	0.4307	6.5895	0.22639	0.0623:0.2031:0.5237:0.211	.	317;317;317	Q5TID7-2;Q5TID7;Q5TID7-3	.;CA114_HUMAN;.	C	317	ENSP00000356779:S317C;ENSP00000356780:S317C;ENSP00000442297:S317C;ENSP00000411000:S317C	ENSP00000356779:S317C	S	-	2	0	C1orf114	167657343	0.038000	0.19896	0.000000	0.03702	0.015000	0.08874	0.889000	0.28282	-0.312000	0.08741	-2.157000	0.00329	TCT		0.458	CCDC181-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000086099.1	NM_021179		21	97	0	0	0	0	21	97				
SOAT1	6646	broad.mit.edu	37	1	179311274	179311274	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:179311274C>T	ENST00000367619.3	+	8	949	c.806C>T	c.(805-807)tCa>tTa	p.S269L	SOAT1_ENST00000540564.1_Missense_Mutation_p.S211L|SOAT1_ENST00000535686.1_Missense_Mutation_p.S5L|SOAT1_ENST00000539888.1_Missense_Mutation_p.S204L	NM_003101.5	NP_003092.4	P35610	SOAT1_HUMAN	sterol O-acyltransferase 1	269					cholesterol efflux (GO:0033344)|cholesterol esterification (GO:0034435)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol storage (GO:0010878)|macrophage derived foam cell differentiation (GO:0010742)|positive regulation of amyloid precursor protein biosynthetic process (GO:0042986)|very-low-density lipoprotein particle assembly (GO:0034379)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	cholesterol binding (GO:0015485)|cholesterol O-acyltransferase activity (GO:0034736)|fatty-acyl-CoA binding (GO:0000062)|sterol O-acyltransferase activity (GO:0004772)			central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(10)|prostate(1)|skin(3)|stomach(1)	20					Ezetimibe(DB00973)|Hesperetin(DB01094)	AAGGCCCACTCATTTGTCAGA	0.408																																						uc001gml.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(805-807)TCA>TTA		sterol O-acyltransferase 1	Ezetimibe(DB00973)|Hesperetin(DB01094)						136.0	133.0	134.0					1																	179311274		2203	4300	6503	SO:0001583	missense	6646				cholesterol efflux|cholesterol esterification|cholesterol homeostasis|cholesterol metabolic process|cholesterol storage|macrophage derived foam cell differentiation|positive regulation of amyloid precursor protein biosynthetic process|very-low-density lipoprotein particle assembly	endoplasmic reticulum membrane|integral to membrane|microsome	cholesterol binding|cholesterol O-acyltransferase activity|fatty-acyl-CoA binding	g.chr1:179311274C>T	L21934	CCDS1330.1, CCDS58047.1, CCDS58048.1	1q25	2008-08-26	2008-08-26		ENSG00000057252	ENSG00000057252	2.3.1.26		11177	protein-coding gene	gene with protein product	"""acyl-Coenzyme A: cholesterol acyltransferase"""	102642	"""sterol O-acyltransferase (acyl-Coenzyme A: cholesterol acyltransferase) 1"""	SOAT, STAT		8407899	Standard	NM_003101		Approved	ACAT	uc001gml.3	P35610	OTTHUMG00000035253	ENST00000367619.3:c.806C>T	1.37:g.179311274C>T	ENSP00000356591:p.Ser269Leu		Somatic				SOAT1_uc010pni.1_Missense_Mutation_p.S204L|SOAT1_uc001gmm.2_Missense_Mutation_p.S211L|SOAT1_uc010pnj.1_Missense_Mutation_p.S5L|SOAT1_uc010pnk.1_Missense_Mutation_p.S204L	p.S269L	NM_003101	NP_003092	WXS	Illumina HiSeq	Unspecified	P35610	SOAT1_HUMAN			8	869	+			269					A6NC40|A8K3P4|A9Z1V7|B4DU95|Q5T0X4|Q8N1E4	Missense_Mutation	SNP	ENST00000367619.3	37	c.806C>T	CCDS1330.1	.	.	.	.	.	.	.	.	.	.	C	34	5.387370	0.95988	.	.	ENSG00000057252	ENST00000539888;ENST00000540564;ENST00000535686;ENST00000367619	T;T;T;T	0.36157	2.37;2.37;1.27;2.37	5.41	5.41	0.78517	.	0.119241	0.64402	D	0.000015	T	0.68403	0.2997	M	0.92317	3.295	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.992	T	0.76173	-0.3056	10	0.87932	D	0	-2.2802	15.071	0.72037	0.0:1.0:0.0:0.0	.	211;269	A8K3P4;P35610	.;SOAT1_HUMAN	L	204;211;5;269	ENSP00000441356:S204L;ENSP00000445315:S211L;ENSP00000442503:S5L;ENSP00000356591:S269L	ENSP00000356591:S269L	S	+	2	0	SOAT1	177577897	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.357000	0.79456	2.686000	0.91538	0.650000	0.86243	TCA		0.408	SOAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085286.2	NM_003101		14	52	0	0	0	0	14	52				
QSOX1	5768	broad.mit.edu	37	1	180163447	180163447	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:180163447C>G	ENST00000367602.3	+	11	1462	c.1388C>G	c.(1387-1389)tCc>tGc	p.S463C	QSOX1_ENST00000367600.5_Missense_Mutation_p.S463C			O00391	QSOX1_HUMAN	quiescin Q6 sulfhydryl oxidase 1	463	ERV/ALR sulfhydryl oxidase. {ECO:0000255|PROSITE-ProRule:PRU00654}.				cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of Golgi membrane (GO:0030173)	flavin-linked sulfhydryl oxidase activity (GO:0016971)|protein disulfide isomerase activity (GO:0003756)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31						GCTGCTGCCTCCATGCACCGG	0.627																																						uc001gnz.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1387-1389)TCC>TGC		quiescin Q6 sulfhydryl oxidase 1 isoform a							62.0	56.0	58.0					1																	180163447		2203	4300	6503	SO:0001583	missense	5768				cell redox homeostasis|protein thiol-disulfide exchange	extracellular space|integral to Golgi membrane	flavin-linked sulfhydryl oxidase activity	g.chr1:180163447C>G	U97276	CCDS1337.1, CCDS30950.1	1q24	2008-02-05	2007-04-23	2007-04-23	ENSG00000116260	ENSG00000116260			9756	protein-coding gene	gene with protein product		603120	"""quiescin Q6"""	QSCN6		9878249, 8396966	Standard	NM_002826		Approved		uc001gnz.3	O00391	OTTHUMG00000035256	ENST00000367602.3:c.1388C>G	1.37:g.180163447C>G	ENSP00000356574:p.Ser463Cys		Somatic				QSOX1_uc001gny.2_Missense_Mutation_p.S463C|QSOX1_uc001goa.2_Missense_Mutation_p.S463C|QSOX1_uc001goc.2_Missense_Mutation_p.S5C	p.S463C	NM_002826	NP_002817	WXS	Illumina HiSeq	Unspecified	O00391	QSOX1_HUMAN			11	1463	+			463			ERV/ALR sulfhydryl oxidase.		Q59G29|Q5T2X0|Q8TDL6|Q8WVP4	Missense_Mutation	SNP	ENST00000367602.3	37	c.1388C>G	CCDS1337.1	.	.	.	.	.	.	.	.	.	.	C	17.83	3.485309	0.63962	.	.	ENSG00000116260	ENST00000367602;ENST00000367600	T;T	0.45276	0.9;2.15	4.75	4.75	0.60458	Erv1/Alr (3);ERV/ALR sulphydryl oxidase (1);	0.159198	0.56097	D	0.000031	T	0.68449	0.3002	M	0.88105	2.93	0.53688	D	0.999977	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.993;0.996	T	0.74850	-0.3524	10	0.66056	D	0.02	-29.4997	13.0261	0.58817	0.0:0.8367:0.1633:0.0	.	463;463;463;463	A8K4C2;A8K477;O00391;O00391-2	.;.;QSOX1_HUMAN;.	C	463	ENSP00000356574:S463C;ENSP00000356572:S463C	ENSP00000356572:S463C	S	+	2	0	QSOX1	178430070	0.930000	0.31532	0.977000	0.42913	0.719000	0.41307	2.173000	0.42472	2.199000	0.70637	0.462000	0.41574	TCC		0.627	QSOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085289.1	NM_002826		12	48	0	0	0	0	12	48				
RGS16	6004	broad.mit.edu	37	1	182569610	182569610	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:182569610C>T	ENST00000367558.5	-	5	574	c.426G>A	c.(424-426)atG>atA	p.M142I		NM_002928.3	NP_002919.3	O15492	RGS16_HUMAN	regulator of G-protein signaling 16	142	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)			NS(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(1)	11						TCTGCAGGTTCATCCTCGTCA	0.592																																						uc001gpl.3		NA																	0				ovary(1)	1						c.(424-426)ATG>ATA		regulator of G-protein signalling 16							136.0	106.0	116.0					1																	182569610		2203	4300	6503	SO:0001583	missense	6004				negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway|visual perception	cytoplasm|plasma membrane	calmodulin binding|GTPase activator activity|signal transducer activity	g.chr1:182569610C>T	U70426	CCDS1348.1	1q25-q31	2008-02-05	2007-08-14		ENSG00000143333	ENSG00000143333		"""Regulators of G-protein signaling"""	9997	protein-coding gene	gene with protein product		602514	"""regulator of G-protein signalling 16"""			9469939	Standard	NM_002928		Approved	A28-RGS14, RGS-r	uc001gpl.4	O15492	OTTHUMG00000035212	ENST00000367558.5:c.426G>A	1.37:g.182569610C>T	ENSP00000356529:p.Met142Ile		Somatic					p.M142I	NM_002928	NP_002919	WXS	Illumina HiSeq	Unspecified	O15492	RGS16_HUMAN			5	580	-			142			RGS.		B2R4M4|Q5VYN9|Q99701	Missense_Mutation	SNP	ENST00000367558.5	37	c.426G>A	CCDS1348.1	.	.	.	.	.	.	.	.	.	.	C	7.637	0.680124	0.14907	.	.	ENSG00000143333	ENST00000367558	T	0.29142	1.58	5.38	-0.706	0.11249	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.697426	0.15253	N	0.272217	T	0.16685	0.0401	N	0.14661	0.345	0.09310	N	0.999998	B	0.02656	0.0	B	0.06405	0.002	T	0.16689	-1.0394	10	0.66056	D	0.02	.	9.3593	0.38186	0.0:0.5261:0.3825:0.0914	.	142	O15492	RGS16_HUMAN	I	142	ENSP00000356529:M142I	ENSP00000356529:M142I	M	-	3	0	RGS16	180836233	0.000000	0.05858	0.347000	0.25668	0.009000	0.06853	-1.342000	0.02645	-0.431000	0.07307	-0.321000	0.08615	ATG		0.592	RGS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085188.1	NM_002928		10	64	0	0	0	0	10	64				
LAMC2	3918	broad.mit.edu	37	1	183209330	183209330	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:183209330G>C	ENST00000264144.4	+	21	3290	c.3225G>C	c.(3223-3225)caG>caC	p.Q1075H	LAMC2_ENST00000493293.1_Missense_Mutation_p.Q1075H|LAMC2_ENST00000461729.1_3'UTR	NM_005562.2	NP_005553.2	Q13753	LAMC2_HUMAN	laminin, gamma 2	1075	Domain II and I.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	cell cortex (GO:0005938)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-2 complex (GO:0005607)|laminin-5 complex (GO:0005610)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	heparin binding (GO:0008201)			breast(2)|endometrium(6)|kidney(8)|large_intestine(11)|lung(18)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55						ATGCAGTACAGATGGTGAGTT	0.473																																						uc001gqa.2		NA																	0				skin(2)|ovary(1)	3						c.(3223-3225)CAG>CAC		laminin, gamma 2 isoform a precursor							139.0	130.0	133.0					1																	183209330		2203	4300	6503	SO:0001583	missense	3918				cell adhesion|epidermis development|hemidesmosome assembly		heparin binding	g.chr1:183209330G>C	Z15008	CCDS1352.1, CCDS44285.1	1q25-q31	2013-03-01	2002-08-29		ENSG00000058085	ENSG00000058085		"""Laminins"""	6493	protein-coding gene	gene with protein product		150292	"""laminin, gamma 2 (nicein (100kD), kalinin (105kD), BM600 (100kD), Herlitz junctional epidermolysis bullosa))"""	EBR2, LAMB2T, LAMNB2, EBR2A		1383240	Standard	NM_005562		Approved	nicein-100kDa, kalinin-105kDa, BM600-100kDa	uc001gqa.2	Q13753	OTTHUMG00000035520	ENST00000264144.4:c.3225G>C	1.37:g.183209330G>C	ENSP00000264144:p.Gln1075His		Somatic				LAMC2_uc001gpz.3_Missense_Mutation_p.Q1075H|LAMC2_uc010poa.1_Missense_Mutation_p.Q775H	p.Q1075H	NM_005562	NP_005553	WXS	Illumina HiSeq	Unspecified	Q13753	LAMC2_HUMAN			21	3539	+			1075			Potential.|Domain II and I.		Q02536|Q02537|Q13752|Q14941|Q14DF7|Q2M1N2|Q5VYE8	Missense_Mutation	SNP	ENST00000264144.4	37	c.3225G>C	CCDS1352.1	.	.	.	.	.	.	.	.	.	.	G	16.42	3.119144	0.56505	.	.	ENSG00000058085	ENST00000493293;ENST00000264144	T;T	0.79554	2.39;-1.28	5.69	4.75	0.60458	.	0.274118	0.31821	N	0.007008	D	0.86736	0.6004	M	0.65975	2.015	0.37910	D	0.931326	D;D;D	0.65815	0.991;0.991;0.995	P;P;D	0.63381	0.823;0.823;0.914	D	0.87868	0.2669	10	0.46703	T	0.11	.	14.4689	0.67501	0.0:0.0:0.8537:0.1462	.	1075;1075;1075	Q2M1N2;Q13753;Q13753-2	.;LAMC2_HUMAN;.	H	1075	ENSP00000432063:Q1075H;ENSP00000264144:Q1075H	ENSP00000264144:Q1075H	Q	+	3	2	LAMC2	181475953	1.000000	0.71417	1.000000	0.80357	0.568000	0.35870	2.466000	0.45084	2.674000	0.91012	0.650000	0.86243	CAG		0.473	LAMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086258.1	NM_005562		22	81	0	0	0	0	22	81				
RGL1	23179	broad.mit.edu	37	1	183775568	183775568	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:183775568C>T	ENST00000360851.3	+	2	265	c.87C>T	c.(85-87)ctC>ctT	p.L29L	RGL1_ENST00000536277.1_Intron|RGL1_ENST00000304685.4_Silent_p.L64L|RGL1_ENST00000539189.1_Silent_p.L29L			Q9NZL6	RGL1_HUMAN	ral guanine nucleotide dissociation stimulator-like 1	29					cellular lipid metabolic process (GO:0044255)|positive regulation of Ral GTPase activity (GO:0032852)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	Ral guanyl-nucleotide exchange factor activity (GO:0008321)			breast(5)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(17)|ovary(4)|prostate(3)|stomach(1)	51						ATGTCACCCTCAAAAGAGTCC	0.473																																						uc001gqo.2		NA																	0				breast(5)|ovary(4)|lung(2)	11						c.(85-87)CTC>CTT		ral guanine nucleotide dissociation							110.0	103.0	105.0					1																	183775568		2203	4300	6503	SO:0001819	synonymous_variant	23179				cellular lipid metabolic process|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	protein binding|Ral guanyl-nucleotide exchange factor activity	g.chr1:183775568C>T	AF186780	CCDS1359.1, CCDS72992.1	1q25.2	2008-02-05			ENSG00000143344	ENSG00000143344			30281	protein-coding gene	gene with protein product		605667				10760592, 10231032	Standard	XM_005245010		Approved	RGL	uc001gqm.3	Q9NZL6	OTTHUMG00000035328	ENST00000360851.3:c.87C>T	1.37:g.183775568C>T			Somatic				RGL1_uc010pof.1_Intron|RGL1_uc001gqm.2_Silent_p.L64L|RGL1_uc010pog.1_Intron|RGL1_uc010poh.1_Intron|RGL1_uc010poi.1_Silent_p.L29L	p.L29L	NM_015149	NP_055964	WXS	Illumina HiSeq	Unspecified	Q9NZL6	RGL1_HUMAN			2	244	+			29					Q5SXQ2|Q5SXQ6|Q9HBY3|Q9HBY4|Q9NZL5|Q9UG43|Q9Y2G6	Silent	SNP	ENST00000360851.3	37	c.87C>T																																																																																					0.473	RGL1-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000085742.1	NM_015149		19	80	0	0	0	0	19	80				
RGL1	23179	broad.mit.edu	37	1	183853004	183853004	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:183853004C>T	ENST00000360851.3	+	6	873	c.695C>T	c.(694-696)tCa>tTa	p.S232L	RGL1_ENST00000536277.1_Missense_Mutation_p.S230L|RGL1_ENST00000304685.4_Missense_Mutation_p.S267L|RGL1_ENST00000539189.1_Missense_Mutation_p.S232L			Q9NZL6	RGL1_HUMAN	ral guanine nucleotide dissociation stimulator-like 1	232	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				cellular lipid metabolic process (GO:0044255)|positive regulation of Ral GTPase activity (GO:0032852)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	Ral guanyl-nucleotide exchange factor activity (GO:0008321)			breast(5)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(17)|ovary(4)|prostate(3)|stomach(1)	51						ACGTGCTTCTCAGAAGATCTC	0.483																																						uc001gqo.2		NA																	0				breast(5)|ovary(4)|lung(2)	11						c.(694-696)TCA>TTA		ral guanine nucleotide dissociation							171.0	146.0	154.0					1																	183853004		2203	4300	6503	SO:0001583	missense	23179				cellular lipid metabolic process|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	protein binding|Ral guanyl-nucleotide exchange factor activity	g.chr1:183853004C>T	AF186780	CCDS1359.1, CCDS72992.1	1q25.2	2008-02-05			ENSG00000143344	ENSG00000143344			30281	protein-coding gene	gene with protein product		605667				10760592, 10231032	Standard	XM_005245010		Approved	RGL	uc001gqm.3	Q9NZL6	OTTHUMG00000035328	ENST00000360851.3:c.695C>T	1.37:g.183853004C>T	ENSP00000354097:p.Ser232Leu		Somatic				RGL1_uc010pof.1_Missense_Mutation_p.S37L|RGL1_uc001gqm.2_Missense_Mutation_p.S267L|RGL1_uc010pog.1_Missense_Mutation_p.S230L|RGL1_uc010poh.1_Missense_Mutation_p.S230L|RGL1_uc010poi.1_Missense_Mutation_p.S232L	p.S232L	NM_015149	NP_055964	WXS	Illumina HiSeq	Unspecified	Q9NZL6	RGL1_HUMAN			6	852	+			232			Ras-GEF.		Q5SXQ2|Q5SXQ6|Q9HBY3|Q9HBY4|Q9NZL5|Q9UG43|Q9Y2G6	Missense_Mutation	SNP	ENST00000360851.3	37	c.695C>T		.	.	.	.	.	.	.	.	.	.	C	12.61	1.989693	0.35131	.	.	ENSG00000143344	ENST00000304685;ENST00000367531;ENST00000536277;ENST00000543395;ENST00000360851;ENST00000539189	T;T;T;T;T	0.34667	1.35;1.35;1.35;1.35;1.35	5.15	5.15	0.70609	Guanine-nucleotide dissociation stimulator CDC25 (3);Ras guanine nucleotide exchange factor, domain (1);	0.905139	0.09650	N	0.773823	T	0.37598	0.1009	M	0.62723	1.935	0.09310	N	1	B;B;B;B;B	0.17667	0.013;0.017;0.023;0.017;0.017	B;B;B;B;B	0.19666	0.009;0.026;0.025;0.016;0.026	T	0.18366	-1.0339	10	0.26408	T	0.33	.	10.6763	0.45787	0.1327:0.6178:0.2496:0.0	.	232;230;37;232;267	F5H6U6;B7Z2W5;F5H3C3;Q9NZL6;Q5SXQ6	.;.;.;RGL1_HUMAN;.	L	267;267;230;37;232;232	ENSP00000303192:S267L;ENSP00000356501:S267L;ENSP00000438662:S230L;ENSP00000354097:S232L;ENSP00000437355:S232L	ENSP00000303192:S267L	S	+	2	0	RGL1	182119627	0.162000	0.22906	0.777000	0.31699	0.808000	0.45660	1.217000	0.32455	2.556000	0.86216	0.655000	0.94253	TCA		0.483	RGL1-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000085742.1	NM_015149		25	111	0	0	0	0	25	111				
RNF2	6045	broad.mit.edu	37	1	185062311	185062311	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:185062311C>T	ENST00000367510.3	+	4	655	c.367C>T	c.(367-369)Cat>Tat	p.H123Y	RNF2_ENST00000367509.4_Intron	NM_007212.3	NP_009143.1	Q99496	RING2_HUMAN	ring finger protein 2	123	Interaction with HIP2.				anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|large_intestine(4)|lung(3)|skin(2)	14		Breast(1374;0.000496)		Colorectal(1306;6.9e-08)|KIRC - Kidney renal clear cell carcinoma(1967;8.12e-06)		GTATGAAGCTCATCAAGAGAG	0.423																																						uc001grc.1		NA																	0				breast(1)	1						c.(367-369)CAT>TAT		ring finger protein 2							98.0	90.0	92.0					1																	185062311		2203	4300	6503	SO:0001583	missense	6045				histone H2A monoubiquitination|transcription, DNA-dependent	MLL1 complex|PcG protein complex|ubiquitin ligase complex	RING-like zinc finger domain binding|zinc ion binding	g.chr1:185062311C>T	BC012583, Y10571	CCDS1365.1	1q25.3	2013-01-09			ENSG00000121481	ENSG00000121481		"""RING-type (C3HC4) zinc fingers"""	10061	protein-coding gene	gene with protein product		608985				11513855	Standard	XM_005245413		Approved	BAP-1, BAP1, DING, HIPI3, RING1B, RING2	uc001grc.1	Q99496	OTTHUMG00000035391	ENST00000367510.3:c.367C>T	1.37:g.185062311C>T	ENSP00000356480:p.His123Tyr		Somatic				RNF2_uc001grd.1_Intron|RNF2_uc001gre.1_RNA	p.H123Y	NM_007212	NP_009143	WXS	Illumina HiSeq	Unspecified	Q99496	RING2_HUMAN		Colorectal(1306;6.9e-08)|KIRC - Kidney renal clear cell carcinoma(1967;8.12e-06)	4	600	+		Breast(1374;0.000496)	123			Interaction with HIP2.		B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Missense_Mutation	SNP	ENST00000367510.3	37	c.367C>T	CCDS1365.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.496263	0.85069	.	.	ENSG00000121481	ENST00000367510;ENST00000453650	T;T	0.21932	1.98;1.98	5.34	5.34	0.76211	Zinc finger, RING/FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.34861	0.0912	M	0.67397	2.05	0.80722	D	1	P	0.46784	0.884	P	0.47162	0.54	T	0.07790	-1.0754	10	0.52906	T	0.07	-23.2697	19.408	0.94656	0.0:1.0:0.0:0.0	.	123	Q99496	RING2_HUMAN	Y	123	ENSP00000356480:H123Y;ENSP00000400722:H123Y	ENSP00000356480:H123Y	H	+	1	0	RNF2	183328934	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.265000	0.78442	2.643000	0.89663	0.650000	0.86243	CAT		0.423	RNF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085793.1	NM_007212		6	44	0	0	0	0	6	44				
PRG4	10216	broad.mit.edu	37	1	186275736	186275736	+	Silent	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:186275736G>A	ENST00000445192.2	+	7	930	c.885G>A	c.(883-885)caG>caA	p.Q295Q	PRG4_ENST00000367486.3_Silent_p.Q252Q|PRG4_ENST00000367483.4_Silent_p.Q254Q|PRG4_ENST00000367484.3_Silent_p.Q254Q|PRG4_ENST00000367485.4_Silent_p.Q202Q	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	295					cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						CAAATAAACAGACTTCAACTG	0.368																																						uc001gru.3		NA																	0				skin(1)	1						c.(883-885)CAG>CAA		proteoglycan 4 isoform A							129.0	145.0	139.0					1																	186275736		2203	4300	6503	SO:0001819	synonymous_variant	10216				cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity	g.chr1:186275736G>A	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.885G>A	1.37:g.186275736G>A			Somatic				PRG4_uc001grt.3_Silent_p.Q254Q|PRG4_uc009wyl.2_Silent_p.Q202Q|PRG4_uc009wym.2_Silent_p.Q161Q|PRG4_uc010poo.1_RNA	p.Q295Q	NM_005807	NP_005798	WXS	Illumina HiSeq	Unspecified	Q92954	PRG4_HUMAN			7	936	+			295					Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Silent	SNP	ENST00000445192.2	37	c.885G>A	CCDS1369.1																																																																																				0.368	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807		32	174	0	0	0	0	32	174				
TPR	7175	broad.mit.edu	37	1	186315362	186315362	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:186315362G>A	ENST00000367478.4	-	23	3297	c.3001C>T	c.(3001-3003)Cag>Tag	p.Q1001*		NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	1001					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		AACTGTGTCTGAAATTCAGCT	0.348			T	NTRK1	papillary thyroid																																	uc001grv.2		NA		Dom	yes		1	1q25	7175	T	translocated promoter region			E	NTRK1		papillary thyroid		0				ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7						c.(3001-3003)CAG>TAG		nuclear pore complex-associated protein TPR							170.0	149.0	155.0					1																	186315362		1845	4091	5936	SO:0001587	stop_gained	7175				carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity	g.chr1:186315362G>A	U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.3001C>T	1.37:g.186315362G>A	ENSP00000356448:p.Gln1001*		Somatic					p.Q1001*	NM_003292	NP_003283	WXS	Illumina HiSeq	Unspecified	P12270	TPR_HUMAN		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)	23	3298	-		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)	1001			Potential.		Q15655|Q5SWY0|Q99968	Nonsense_Mutation	SNP	ENST00000367478.4	37	c.3001C>T	CCDS41446.1	.	.	.	.	.	.	.	.	.	.	G	44	10.675873	0.99448	.	.	ENSG00000047410	ENST00000367478	.	.	.	5.66	5.66	0.87406	.	0.226336	0.45867	D	0.000329	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	.	18.7343	0.91749	0.0:0.0:1.0:0.0	.	.	.	.	X	1001	.	ENSP00000356448:Q1001X	Q	-	1	0	TPR	184581985	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.467000	0.66737	2.645000	0.89757	0.650000	0.86243	CAG		0.348	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086353.2	NM_003292		10	78	0	0	0	0	10	78				
F13B	2165	broad.mit.edu	37	1	197031034	197031034	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:197031034G>C	ENST00000367412.1	-	3	374	c.331C>G	c.(331-333)Caa>Gaa	p.Q111E		NM_001994.2	NP_001985.2	P05160	F13B_HUMAN	coagulation factor XIII, B polypeptide	111	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)	extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(40)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	66						ATGTTCTCTTGAATTTTATAC	0.373																																						uc001gtt.1		NA																	0				upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						c.(331-333)CAA>GAA		coagulation factor XIII B subunit precursor							106.0	92.0	97.0					1																	197031034		2203	4300	6503	SO:0001583	missense	2165				blood coagulation	extracellular region		g.chr1:197031034G>C	M14057	CCDS1388.1	1q31-q32.1	2012-10-02			ENSG00000143278	ENSG00000143278			3534	protein-coding gene	gene with protein product		134580				2339067, 2271707	Standard	NM_001994		Approved	FXIIIB	uc001gtt.1	P05160	OTTHUMG00000036519	ENST00000367412.1:c.331C>G	1.37:g.197031034G>C	ENSP00000356382:p.Gln111Glu		Somatic					p.Q111E	NM_001994	NP_001985	WXS	Illumina HiSeq	Unspecified	P05160	F13B_HUMAN			3	375	-			111			Sushi 2.		A8K3E5|Q5VYL5	Missense_Mutation	SNP	ENST00000367412.1	37	c.331C>G	CCDS1388.1	.	.	.	.	.	.	.	.	.	.	G	10.81	1.454499	0.26161	.	.	ENSG00000143278	ENST00000367412	T	0.64803	-0.12	5.85	0.171	0.15026	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.32106	N	0.006577	T	0.58452	0.2123	M	0.70595	2.14	0.09310	N	1	B	0.32862	0.387	B	0.40702	0.338	T	0.49771	-0.8904	10	0.24483	T	0.36	.	6.3732	0.21493	0.0615:0.1047:0.368:0.4658	.	111	P05160	F13B_HUMAN	E	111	ENSP00000356382:Q111E	ENSP00000356382:Q111E	Q	-	1	0	F13B	195297657	0.154000	0.22792	0.013000	0.15412	0.320000	0.28249	0.260000	0.18424	-0.217000	0.10033	0.655000	0.94253	CAA		0.373	F13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088821.2	NM_001994		6	35	0	0	0	0	6	35				
KIF14	9928	broad.mit.edu	37	1	200524573	200524573	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:200524573C>G	ENST00000367350.4	-	28	4801	c.4363G>C	c.(4363-4365)Gaa>Caa	p.E1455Q		NM_014875.2	NP_055690.1	Q15058	KIF14_HUMAN	kinesin family member 14	1455	Required for CIT-binding.				ATP catabolic process (GO:0006200)|cytoskeleton-dependent intracellular transport (GO:0030705)|establishment of protein localization (GO:0045184)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of integrin activation (GO:0033624)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of Rap protein signal transduction (GO:0032487)|substrate adhesion-dependent cell spreading (GO:0034446)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|PDZ domain binding (GO:0030165)	p.E1455*(1)|p.E1455Q(1)		NS(1)|breast(5)|central_nervous_system(2)|endometrium(8)|kidney(8)|large_intestine(15)|lung(13)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	61						GTTTTCATTTCTTTGGTAACC	0.264																																						uc010ppk.1		NA																	2	Substitution - Missense(1)|Substitution - Nonsense(1)	p.E1455Q(1)	large_intestine(1)|breast(1)	breast(3)|ovary(2)|skin(2)	7						c.(4363-4365)GAA>CAA		kinesin family member 14							53.0	57.0	55.0					1																	200524573		2199	4282	6481	SO:0001583	missense	9928				microtubule-based movement	cytoplasm|microtubule|nucleus|spindle	ATP binding|microtubule motor activity|protein binding	g.chr1:200524573C>G	D26361	CCDS30963.1	1q32.1	2008-03-03			ENSG00000118193	ENSG00000118193		"""Kinesins"""	19181	protein-coding gene	gene with protein product		611279				7584044	Standard	NM_014875		Approved	KIAA0042	uc010ppk.1	Q15058	OTTHUMG00000035723	ENST00000367350.4:c.4363G>C	1.37:g.200524573C>G	ENSP00000356319:p.Glu1455Gln		Somatic				KIF14_uc010ppj.1_Missense_Mutation_p.E964Q	p.E1455Q	NM_014875	NP_055690	WXS	Illumina HiSeq	Unspecified	Q15058	KIF14_HUMAN			28	4802	-			1455			Required for CIT-binding.		Q14CI8|Q4G0A5|Q5T1W3	Missense_Mutation	SNP	ENST00000367350.4	37	c.4363G>C	CCDS30963.1	.	.	.	.	.	.	.	.	.	.	C	0.170	-1.072659	0.01918	.	.	ENSG00000118193	ENST00000367350	T	0.71934	-0.61	4.97	2.94	0.34122	.	0.768392	0.12153	N	0.494681	T	0.31918	0.0812	N	0.00583	-1.355	0.18873	N	0.999988	B	0.02656	0.0	B	0.04013	0.001	T	0.26155	-1.0111	10	0.02654	T	1	.	9.2363	0.37468	0.0:0.1542:0.6824:0.1634	.	1455	Q15058	KIF14_HUMAN	Q	1455	ENSP00000356319:E1455Q	ENSP00000356319:E1455Q	E	-	1	0	KIF14	198791196	0.913000	0.31002	0.763000	0.31416	0.857000	0.48899	2.785000	0.47782	1.301000	0.44836	-0.165000	0.13383	GAA		0.264	KIF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086878.1	NM_014875		8	34	0	0	0	0	8	34				
PLEKHA6	22874	broad.mit.edu	37	1	204197211	204197211	+	Splice_Site	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:204197211C>T	ENST00000272203.3	-	21	3347	c.3031G>A	c.(3031-3033)Gtg>Atg	p.V1011M	PLEKHA6_ENST00000414478.1_Splice_Site_p.V1031M	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	1011										breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			CCCCTCTCACCAGACAGCATG	0.647																																						uc001hau.2		NA																	0				ovary(3)|pancreas(1)	4						c.(3031-3033)GTG>ATG		phosphoinositol 3-phosphate-binding protein-3							20.0	22.0	21.0					1																	204197211		2203	4300	6503	SO:0001630	splice_region_variant	22874							g.chr1:204197211C>T	AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.3031+1G>A	1.37:g.204197211C>T			Somatic					p.V1011M	NM_014935	NP_055750	WXS	Illumina HiSeq	Unspecified	Q9Y2H5	PKHA6_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)		21	3348	-	all_cancers(21;0.0222)|Breast(84;0.179)		1011					A7MD51|Q5VTI6	Missense_Mutation	SNP	ENST00000272203.3	37	c.3031G>A	CCDS1444.1	.	.	.	.	.	.	.	.	.	.	C	32	5.163718	0.94727	.	.	ENSG00000143850	ENST00000272203;ENST00000414478	T;T	0.17370	2.28;2.75	5.65	5.65	0.86999	.	0.363396	0.24527	N	0.037745	T	0.25644	0.0624	L	0.32530	0.975	0.48185	D	0.999603	D	0.61080	0.989	P	0.53450	0.726	T	0.00446	-1.1734	9	.	.	.	-11.5135	19.3223	0.94246	0.0:1.0:0.0:0.0	.	1011	Q9Y2H5	PKHA6_HUMAN	M	1011;1031	ENSP00000272203:V1011M;ENSP00000402046:V1031M	.	V	-	1	0	PLEKHA6	202463834	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.171000	0.77595	2.646000	0.89796	0.655000	0.94253	GTG		0.647	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087889.3	NM_014935	Missense_Mutation	7	28	0	0	0	0	7	28				
PIGR	5284	broad.mit.edu	37	1	207112542	207112542	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:207112542C>T	ENST00000356495.4	-	3	493	c.310G>A	c.(310-312)Gac>Aac	p.D104N		NM_002644.3	NP_002635.2	P01833	PIGR_HUMAN	polymeric immunoglobulin receptor	104	Ig-like V-type 1.				detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc receptor signaling pathway (GO:0038093)|immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor (GO:0002415)|receptor clustering (GO:0043113)|retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	polymeric immunoglobulin receptor activity (GO:0001792)			central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						CGCCCGGAGTCATCCTGGCTC	0.582																																						uc001hez.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(310-312)GAC>AAC		polymeric immunoglobulin receptor precursor							88.0	71.0	77.0					1																	207112542		2203	4300	6503	SO:0001583	missense	5284					extracellular region|integral to plasma membrane	protein binding	g.chr1:207112542C>T		CCDS1474.1	1q31-q41	2013-01-11			ENSG00000162896	ENSG00000162896		"""Immunoglobulin superfamily / V-set domain containing"""	8968	protein-coding gene	gene with protein product		173880					Standard	NM_002644		Approved		uc001hez.3	P01833	OTTHUMG00000036581	ENST00000356495.4:c.310G>A	1.37:g.207112542C>T	ENSP00000348888:p.Asp104Asn		Somatic				PIGR_uc009xbz.2_Missense_Mutation_p.D104N	p.D104N	NM_002644	NP_002635	WXS	Illumina HiSeq	Unspecified	P01833	PIGR_HUMAN			3	494	-			104			Ig-like V-type 1.|Extracellular (Potential).		Q68D81|Q8IZY7	Missense_Mutation	SNP	ENST00000356495.4	37	c.310G>A	CCDS1474.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.095335	0.76870	.	.	ENSG00000162896	ENST00000356495	D	0.87809	-2.3	5.67	5.67	0.87782	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	D	0.94132	0.8118	M	0.86097	2.795	0.47862	D	0.999534	D	0.89917	1.0	D	0.97110	1.0	D	0.94378	0.7602	10	0.72032	D	0.01	-29.5476	17.2861	0.87142	0.0:1.0:0.0:0.0	.	104	P01833	PIGR_HUMAN	N	104	ENSP00000348888:D104N	ENSP00000348888:D104N	D	-	1	0	PIGR	205179165	0.992000	0.36948	0.574000	0.28523	0.359000	0.29487	4.590000	0.61013	2.837000	0.97791	0.655000	0.94253	GAC		0.582	PIGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088975.1	NM_002644		9	27	0	0	0	0	9	27				
KCNH1	3756	broad.mit.edu	37	1	210856787	210856787	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:210856787C>T	ENST00000271751.4	-	11	2833	c.2806G>A	c.(2806-2808)Gac>Aac	p.D936N	KCNH1_ENST00000367007.4_Missense_Mutation_p.D909N			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	936	CAD (involved in subunit assembly). {ECO:0000250}.				myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		GCCTTGATGTCCTCCTTCAGC	0.517																																						uc001hib.2		NA																	0				ovary(4)|central_nervous_system(1)	5						c.(2806-2808)GAC>AAC		potassium voltage-gated channel, subfamily H,							91.0	76.0	81.0					1																	210856787		2203	4300	6503	SO:0001583	missense	3756				myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity	g.chr1:210856787C>T	AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.2806G>A	1.37:g.210856787C>T	ENSP00000271751:p.Asp936Asn		Somatic				KCNH1_uc001hic.2_Missense_Mutation_p.D909N	p.D936N	NM_172362	NP_758872	WXS	Illumina HiSeq	Unspecified	O95259	KCNH1_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)	11	2976	-			936			Cytoplasmic (Potential).|CAD (involved in subunit assembly) (By similarity).		B1AQ26|O76035|Q14CL3	Missense_Mutation	SNP	ENST00000271751.4	37	c.2806G>A	CCDS1496.1	.	.	.	.	.	.	.	.	.	.	C	19.93	3.918071	0.73098	.	.	ENSG00000143473	ENST00000271751;ENST00000367007	D;D	0.99388	-5.75;-5.81	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	D	0.98251	0.9421	L	0.53249	1.67	0.80722	D	1	B;B	0.15473	0.006;0.013	B;B	0.21151	0.018;0.033	D	0.96773	0.9570	10	0.72032	D	0.01	.	18.462	0.90741	0.0:1.0:0.0:0.0	.	909;936	Q14CL3;O95259	.;KCNH1_HUMAN	N	936;909	ENSP00000271751:D936N;ENSP00000355974:D909N	ENSP00000271751:D936N	D	-	1	0	KCNH1	208923410	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.538000	0.82048	2.360000	0.80028	0.655000	0.94253	GAC		0.517	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088332.1	NM_002238		12	50	0	0	0	0	12	50				
TP53BP2	7159	broad.mit.edu	37	1	223990037	223990037	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:223990037C>T	ENST00000343537.7	-	9	1297	c.1006G>A	c.(1006-1008)Gat>Aat	p.D336N	TP53BP2_ENST00000391878.2_Missense_Mutation_p.D207N|TP53BP2_ENST00000391879.2_5'Flank|TP53BP2_ENST00000498843.1_5'UTR	NM_001031685.2	NP_001026855.2	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein 2	330	Interaction with APPBP1.				cell cycle (GO:0007049)|central nervous system development (GO:0007417)|embryo development ending in birth or egg hatching (GO:0009792)|heart development (GO:0007507)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)|positive regulation of signal transduction (GO:0009967)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(131;0.0958)		AGATTTCCATCAGATGAAACC	0.458																																						uc010pvb.1		NA																	0				ovary(2)|lung(1)	3						c.(1006-1008)GAT>AAT		tumor protein p53 binding protein, 2 isoform 1							42.0	43.0	43.0					1																	223990037		2203	4299	6502	SO:0001583	missense	7159				apoptosis|cell cycle|induction of apoptosis|negative regulation of cell cycle|signal transduction	nucleus|perinuclear region of cytoplasm	NF-kappaB binding|protein binding|SH3 domain binding|SH3/SH2 adaptor activity	g.chr1:223990037C>T	U09582	CCDS1538.1, CCDS44319.1	1q41	2014-06-24	2014-06-24		ENSG00000143514	ENSG00000143514		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	12000	protein-coding gene	gene with protein product		602143	"""tumor protein p53-binding protein, 2"""			8668206, 8016121	Standard	NM_005426		Approved	PPP1R13A, ASPP2, 53BP2	uc010pvb.2	Q13625	OTTHUMG00000037379	ENST00000343537.7:c.1006G>A	1.37:g.223990037C>T	ENSP00000341957:p.Asp336Asn		Somatic				TP53BP2_uc001hod.2_Missense_Mutation_p.D207N|TP53BP2_uc010puz.1_5'Flank|TP53BP2_uc010pva.1_5'UTR	p.D336N	NM_001031685	NP_001026855	WXS	Illumina HiSeq	Unspecified	Q13625	ASPP2_HUMAN		GBM - Glioblastoma multiforme(131;0.0958)	9	1298	-			330					B4DG66|Q12892|Q86X75|Q96KQ3	Missense_Mutation	SNP	ENST00000343537.7	37	c.1006G>A	CCDS44319.1	.	.	.	.	.	.	.	.	.	.	c	23.8	4.457150	0.84317	.	.	ENSG00000143514	ENST00000391878;ENST00000343537	T;T	0.32515	1.45;1.45	5.71	4.81	0.61882	.	0.131941	0.64402	N	0.000002	T	0.50650	0.1628	L	0.60455	1.87	0.80722	D	1	D;P	0.89917	1.0;0.609	D;B	0.83275	0.996;0.186	T	0.44802	-0.9304	10	0.32370	T	0.25	.	14.9654	0.71188	0.0:0.9316:0.0:0.0684	.	336;330	B4DG66;Q13625	.;ASPP2_HUMAN	N	207;336	ENSP00000375750:D207N;ENSP00000341957:D336N	ENSP00000341957:D336N	D	-	1	0	TP53BP2	222056660	1.000000	0.71417	0.934000	0.37439	0.956000	0.61745	5.185000	0.65076	1.437000	0.47472	-0.119000	0.15052	GAT		0.458	TP53BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090985.3	NM_001031685, NM_005426		7	49	0	0	0	0	7	49				
TP53BP2	7159	broad.mit.edu	37	1	223990487	223990487	+	Silent	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:223990487C>G	ENST00000343537.7	-	8	1233	c.942G>C	c.(940-942)ctG>ctC	p.L314L	TP53BP2_ENST00000391878.2_Silent_p.L185L|TP53BP2_ENST00000391879.2_5'Flank|TP53BP2_ENST00000498843.1_5'Flank	NM_001031685.2	NP_001026855.2	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein 2	308					cell cycle (GO:0007049)|central nervous system development (GO:0007417)|embryo development ending in birth or egg hatching (GO:0009792)|heart development (GO:0007507)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)|positive regulation of signal transduction (GO:0009967)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(131;0.0958)		GCCGGTCCCTCAGCTCATTAA	0.443																																						uc010pvb.1		NA																	0				ovary(2)|lung(1)	3						c.(940-942)CTG>CTC		tumor protein p53 binding protein, 2 isoform 1							182.0	177.0	179.0					1																	223990487		2203	4300	6503	SO:0001819	synonymous_variant	7159				apoptosis|cell cycle|induction of apoptosis|negative regulation of cell cycle|signal transduction	nucleus|perinuclear region of cytoplasm	NF-kappaB binding|protein binding|SH3 domain binding|SH3/SH2 adaptor activity	g.chr1:223990487C>G	U09582	CCDS1538.1, CCDS44319.1	1q41	2014-06-24	2014-06-24		ENSG00000143514	ENSG00000143514		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	12000	protein-coding gene	gene with protein product		602143	"""tumor protein p53-binding protein, 2"""			8668206, 8016121	Standard	NM_005426		Approved	PPP1R13A, ASPP2, 53BP2	uc010pvb.2	Q13625	OTTHUMG00000037379	ENST00000343537.7:c.942G>C	1.37:g.223990487C>G			Somatic				TP53BP2_uc001hod.2_Silent_p.L185L|TP53BP2_uc010puz.1_5'Flank|TP53BP2_uc010pva.1_5'Flank	p.L314L	NM_001031685	NP_001026855	WXS	Illumina HiSeq	Unspecified	Q13625	ASPP2_HUMAN		GBM - Glioblastoma multiforme(131;0.0958)	8	1234	-			308					B4DG66|Q12892|Q86X75|Q96KQ3	Silent	SNP	ENST00000343537.7	37	c.942G>C	CCDS44319.1																																																																																				0.443	TP53BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090985.3	NM_001031685, NM_005426		32	131	0	0	0	0	32	131				
CAPN9	10753	broad.mit.edu	37	1	230907820	230907820	+	Missense_Mutation	SNP	G	G	C	rs145028426		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:230907820G>C	ENST00000271971.2	+	7	963	c.850G>C	c.(850-852)Gag>Cag	p.E284Q	CAPN9_ENST00000366666.2_Missense_Mutation_p.E221Q|CAPN9_ENST00000354537.1_Missense_Mutation_p.E284Q|RP11-99J16__A.2_ENST00000412344.1_RNA	NM_006615.2	NP_006606.1	O14815	CAN9_HUMAN	calpain 9	284	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				digestion (GO:0007586)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	25	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)				GGGCCAGGTTGAGTGGAACGG	0.572																																						uc001htz.1		NA																	0				ovary(1)	1						c.(850-852)GAG>CAG		calpain 9 isoform 1							97.0	89.0	92.0					1																	230907820		2203	4300	6503	SO:0001583	missense	10753				digestion|proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity	g.chr1:230907820G>C	AF022799	CCDS1586.1, CCDS31053.1	1q42.11-q42.3	2013-01-10	2004-11-11		ENSG00000135773	ENSG00000135773		"""EF-hand domain containing"""	1486	protein-coding gene	gene with protein product	"""novel calpain large subunit-4"""	606401	"""calpain 9 (nCL-4)"""			9524069, 10835488	Standard	XM_005273010		Approved	nCL-4, GC36	uc001htz.1	O14815	OTTHUMG00000037779	ENST00000271971.2:c.850G>C	1.37:g.230907820G>C	ENSP00000271971:p.Glu284Gln		Somatic				CAPN9_uc009xfg.1_Missense_Mutation_p.E221Q|CAPN9_uc001hua.1_Missense_Mutation_p.E284Q	p.E284Q	NM_006615	NP_006606	WXS	Illumina HiSeq	Unspecified	O14815	CAN9_HUMAN			7	963	+	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)	284			Calpain catalytic.		B1APS1|B1AQI0|Q9NS74	Missense_Mutation	SNP	ENST00000271971.2	37	c.850G>C	CCDS1586.1	.	.	.	.	.	.	.	.	.	.	G	32	5.163619	0.94727	.	.	ENSG00000135773	ENST00000271971;ENST00000354537;ENST00000366666	D;D;D	0.89939	-2.59;-2.59;-2.59	5.26	5.26	0.73747	Peptidase C2, calpain, catalytic domain (3);	0.000000	0.85682	D	0.000000	D	0.97084	0.9047	H	0.99042	4.41	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.997	D	0.98920	1.0783	10	0.87932	D	0	.	17.859	0.88775	0.0:0.0:1.0:0.0	.	221;284;284	E7ESS6;O14815-2;O14815	.;.;CAN9_HUMAN	Q	284;284;221	ENSP00000271971:E284Q;ENSP00000346538:E284Q;ENSP00000355626:E221Q	ENSP00000271971:E284Q	E	+	1	0	CAPN9	228974443	1.000000	0.71417	0.942000	0.38095	0.974000	0.67602	9.514000	0.98013	2.445000	0.82738	0.655000	0.94253	GAG		0.572	CAPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092179.1	NM_006615		9	58	0	0	0	0	9	58				
MAP10	54627	broad.mit.edu	37	1	232942141	232942141	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:232942141C>T	ENST00000418460.1	+	1	1499	c.1372C>T	c.(1372-1374)Cct>Tct	p.P458S		NM_019090.2	NP_061963.2	Q9P2G4	MAP10_HUMAN	microtubule-associated protein 10	316					cytoplasmic microtubule organization (GO:0031122)|positive regulation of cytokinesis (GO:0032467)|regulation of microtubule-based process (GO:0032886)|spindle midzone assembly involved in mitosis (GO:0051256)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|mitotic spindle pole (GO:0097431)	microtubule binding (GO:0008017)										AAAACCGCCCCCTGCACAGGC	0.448																																						uc001hvh.2		NA																	0				ovary(1)	1						c.(1372-1374)CCT>TCT		hypothetical protein LOC54627							100.0	104.0	103.0					1																	232942141		1866	4096	5962	SO:0001583	missense	54627							g.chr1:232942141C>T	AB037804	CCDS44334.1	1q42.2	2013-02-12	2013-02-12	2013-02-12	ENSG00000212916	ENSG00000212916			29265	protein-coding gene	gene with protein product	"""microtubule regulator 120 KDa"""		"""KIAA1383"""	KIAA1383		23264731	Standard	NM_019090		Approved	MTR120	uc001hvh.2	Q9P2G4	OTTHUMG00000037819	ENST00000418460.1:c.1372C>T	1.37:g.232942141C>T	ENSP00000403208:p.Pro458Ser		Somatic					p.P458S	NM_019090	NP_061963	WXS	Illumina HiSeq	Unspecified	Q9P2G4	K1383_HUMAN			1	1504	+		all_cancers(173;0.00528)|Prostate(94;0.122)|all_epithelial(177;0.169)	316					A8K2F1|Q32MI1|Q58EZ9|Q5VV83	Missense_Mutation	SNP	ENST00000418460.1	37	c.1372C>T	CCDS44334.1	.	.	.	.	.	.	.	.	.	.	C	13.27	2.185662	0.38609	.	.	ENSG00000212916	ENST00000418460	.	.	.	5.4	2.51	0.30379	.	0.330771	0.24209	N	0.040559	T	0.30541	0.0768	L	0.46741	1.465	0.09310	N	1	P	0.51537	0.946	P	0.46253	0.509	T	0.13602	-1.0503	9	0.16420	T	0.52	-6.9185	7.9003	0.29731	0.0:0.7363:0.0:0.2637	.	316	Q9P2G4	K1383_HUMAN	S	458	.	ENSP00000403208:P458S	P	+	1	0	KIAA1383	231008764	0.002000	0.14202	0.002000	0.10522	0.010000	0.07245	0.839000	0.27586	0.400000	0.25396	-0.150000	0.13652	CCT		0.448	MAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092317.3	NM_019090		27	167	0	0	0	0	27	167				
LYST	1130	broad.mit.edu	37	1	235915332	235915332	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:235915332G>A	ENST00000389794.3	-	27	7774	c.7600C>T	c.(7600-7602)Caa>Taa	p.Q2534*	LYST_ENST00000389793.2_Nonsense_Mutation_p.Q2534*			Q99698	LYST_HUMAN	lysosomal trafficking regulator	2534					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TTGCTATTTTGAAGATATCCA	0.343																																						uc001hxj.2		NA																	0				ovary(6)|breast(4)|central_nervous_system(2)	12						c.(7600-7602)CAA>TAA		lysosomal trafficking regulator							74.0	66.0	68.0					1																	235915332		2203	4296	6499	SO:0001587	stop_gained	1130	Chediak-Higashi_syndrome			defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding	g.chr1:235915332G>A	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.7600C>T	1.37:g.235915332G>A	ENSP00000374444:p.Gln2534*		Somatic				LYST_uc009xga.1_Nonsense_Mutation_p.Q116*	p.Q2534*	NM_000081	NP_000072	WXS	Illumina HiSeq	Unspecified	Q99698	LYST_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.000674)		27	7775	-	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	2534					O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Nonsense_Mutation	SNP	ENST00000389794.3	37	c.7600C>T	CCDS31062.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.0|28.0	4.885284|4.885284	0.91814|0.91814	.|.	.|.	ENSG00000143669|ENSG00000143669	ENST00000389794;ENST00000389793|ENST00000487530	.|.	.|.	.|.	5.41|5.41	4.49|4.49	0.54785|0.54785	.|.	0.571802|.	0.21083|.	N|.	0.080456|.	.|T	.|0.71082	.|0.3298	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.70988	.|-0.4722	.|4	0.66056|.	D|.	0.02|.	.|.	15.8252|15.8252	0.78698|0.78698	0.0:0.0:0.8629:0.1371|0.0:0.0:0.8629:0.1371	.|.	.|.	.|.	.|.	X|L	2534|47	.|.	ENSP00000374443:Q2534X|.	Q|S	-|-	1|2	0|0	LYST|LYST	233981955|233981955	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	7.222000|7.222000	0.78025|0.78025	1.391000|1.391000	0.46566|0.46566	-0.182000|-0.182000	0.12963|0.12963	CAA|TCA		0.343	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5			8	26	0	0	0	0	8	26				
LYST	1130	broad.mit.edu	37	1	235922480	235922480	+	Missense_Mutation	SNP	G	G	A	rs375665715		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:235922480G>A	ENST00000389794.3	-	23	6847	c.6673C>T	c.(6673-6675)Cgc>Tgc	p.R2225C	LYST_ENST00000389793.2_Missense_Mutation_p.R2225C			Q99698	LYST_HUMAN	lysosomal trafficking regulator	2225					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TCAGGTCGGCGTGGGCAGGAC	0.532																																						uc001hxj.2		NA																	0				ovary(6)|breast(4)|central_nervous_system(2)	12						c.(6673-6675)CGC>TGC		lysosomal trafficking regulator		A	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	108.0	107.0	107.0		6673	4.0	1.0	1		107	0,8600		0,0,4300	no	missense	LYST	NM_000081.2	180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	2225/3802	235922480	1,13005	2203	4300	6503	SO:0001583	missense	1130	Chediak-Higashi_syndrome			defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding	g.chr1:235922480G>A	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.6673C>T	1.37:g.235922480G>A	ENSP00000374444:p.Arg2225Cys		Somatic				LYST_uc009xgb.1_RNA|LYST_uc010pxs.1_RNA	p.R2225C	NM_000081	NP_000072	WXS	Illumina HiSeq	Unspecified	Q99698	LYST_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.000674)		23	6848	-	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	2225					O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	ENST00000389794.3	37	c.6673C>T	CCDS31062.1	.	.	.	.	.	.	.	.	.	.	g	21.7	4.192194	0.78902	2.27E-4	0.0	ENSG00000143669	ENST00000389794;ENST00000389793	T;T	0.67345	-0.26;-0.26	4.93	4.02	0.46733	.	0.441099	0.26062	N	0.026575	T	0.71195	0.3311	L	0.57536	1.79	0.80722	D	1	D	0.76494	0.999	P	0.56127	0.792	T	0.71842	-0.4470	10	0.52906	T	0.07	.	9.5887	0.39532	0.0747:0.0:0.7844:0.1409	.	2225	Q99698	LYST_HUMAN	C	2225	ENSP00000374444:R2225C;ENSP00000374443:R2225C	ENSP00000374443:R2225C	R	-	1	0	LYST	233989103	0.890000	0.30428	1.000000	0.80357	0.861000	0.49209	1.794000	0.38774	1.237000	0.43756	-0.220000	0.12472	CGC		0.532	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5			12	55	0	0	0	0	12	55				
ZNF124	7678	broad.mit.edu	37	1	247322349	247322349	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:247322349C>G	ENST00000543802.2	-	3	266	c.177G>C	c.(175-177)caG>caC	p.Q59H	ZNF124_ENST00000491356.1_Missense_Mutation_p.Q59H|ZNF124_ENST00000340684.6_Missense_Mutation_p.Q59H|ZNF124_ENST00000491848.1_5'UTR|ZNF124_ENST00000472531.1_Missense_Mutation_p.Q59H			Q15973	ZN124_HUMAN	zinc finger protein 124	59	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			biliary_tract(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(3)|urinary_tract(2)	14	all_cancers(71;5.07e-05)|all_epithelial(71;8.72e-06)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0488)|Lung NSC(105;0.053)		OV - Ovarian serous cystadenocarcinoma(106;0.00739)			CTTCAATGCTCTGGTCTTCCC	0.353																																						uc001ick.2		NA																	0				breast(1)	1						c.(175-177)CAG>CAC		zinc finger protein 124							83.0	84.0	83.0					1																	247322349		2202	4298	6500	SO:0001583	missense	7678				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr1:247322349C>G	S54641	CCDS31089.1, CCDS58067.1, CCDS73057.1	1q44	2013-01-08	2006-06-13		ENSG00000196418	ENSG00000196418		"""Zinc fingers, C2H2-type"", ""-"""	12907	protein-coding gene	gene with protein product		194631	"""zinc finger protein 124 (HZF-16)"""			7916577	Standard	XM_005273256		Approved	HZF16, HZF-16	uc001icj.1	Q15973	OTTHUMG00000041112	ENST00000543802.2:c.177G>C	1.37:g.247322349C>G	ENSP00000440365:p.Gln59His		Somatic				ZNF124_uc001ici.2_RNA|ZNF124_uc001icj.1_Missense_Mutation_p.Q59H	p.Q59H	NM_003431	NP_003422	WXS	Illumina HiSeq	Unspecified	Q15973	ZN124_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00739)		3	316	-	all_cancers(71;5.07e-05)|all_epithelial(71;8.72e-06)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0488)|Lung NSC(105;0.053)		59			KRAB.		B3KNP3|J3KSE1|Q15974|Q4VAJ7|Q5T2V4	Missense_Mutation	SNP	ENST00000543802.2	37	c.177G>C		.	.	.	.	.	.	.	.	.	.	C	2.848	-0.238985	0.05944	.	.	ENSG00000196418	ENST00000340684	T	0.00816	5.66	0.427	-0.593	0.11667	Krueppel-associated box (3);	.	.	.	.	T	0.01558	0.0050	.	.	.	0.20307	N	0.999911	B;D	0.54397	0.002;0.966	B;P	0.61592	0.001;0.891	T	0.45659	-0.9246	7	0.11485	T	0.65	.	.	.	.	.	59;59	Q15973;Q15973-4	ZN124_HUMAN;.	H	59	ENSP00000340749:Q59H	ENSP00000340749:Q59H	Q	-	3	2	ZNF124	245388972	0.475000	0.25894	0.463000	0.27130	0.458000	0.32498	0.281000	0.18810	-0.384000	0.07845	-0.373000	0.07131	CAG		0.353	ZNF124-009	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000447393.1	NM_003431		7	28	0	0	0	0	7	28				
OR2M4	26245	broad.mit.edu	37	1	248402793	248402793	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr1:248402793C>G	ENST00000306687.1	+	1	563	c.563C>G	c.(562-564)tCc>tGc	p.S188C		NM_017504.1	NP_059974.1	Q96R27	OR2M4_HUMAN	olfactory receptor, family 2, subfamily M, member 4	188					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(27)|skin(3)|upper_aerodigestive_tract(2)	50	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			TTACCTCTATCCTGCACAGAA	0.403																																						uc010pzh.1		NA																	0				breast(2)	2						c.(562-564)TCC>TGC		olfactory receptor, family 2, subfamily M,							137.0	132.0	133.0					1																	248402793		2203	4300	6503	SO:0001583	missense	26245				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248402793C>G	X64992	CCDS31108.1	1q44	2012-08-09			ENSG00000171180	ENSG00000171180		"""GPCR / Class A : Olfactory receptors"""	8270	protein-coding gene	gene with protein product						1370859, 9119360	Standard	NM_017504		Approved	HTPCRX18, TPCR100, HSHTPCRX18, OST710	uc010pzh.2	Q96R27	OTTHUMG00000040456	ENST00000306687.1:c.563C>G	1.37:g.248402793C>G	ENSP00000306688:p.Ser188Cys		Somatic					p.S188C	NM_017504	NP_059974	WXS	Illumina HiSeq	Unspecified	Q96R27	OR2M4_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0245)		1	563	+	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		188			Extracellular (Potential).		Q15611|Q8NG82	Missense_Mutation	SNP	ENST00000306687.1	37	c.563C>G	CCDS31108.1	.	.	.	.	.	.	.	.	.	.	c	12.80	2.045655	0.36085	.	.	ENSG00000171180	ENST00000306687	T	0.00301	8.21	3.34	2.41	0.29592	GPCR, rhodopsin-like superfamily (1);	0.189240	0.25975	N	0.027119	T	0.00845	0.0028	H	0.95850	3.73	0.09310	N	1	D	0.89917	1.0	D	0.76071	0.987	T	0.23655	-1.0182	10	0.87932	D	0	.	6.792	0.23705	0.0:0.7678:0.0:0.2322	.	188	Q96R27	OR2M4_HUMAN	C	188	ENSP00000306688:S188C	ENSP00000306688:S188C	S	+	2	0	OR2M4	246469416	0.000000	0.05858	0.519000	0.27824	0.987000	0.75469	0.765000	0.26546	1.840000	0.53500	0.543000	0.68304	TCC		0.403	OR2M4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097352.1	NM_017504		6	141	0	0	0	0	6	141				
ITIH2	3698	broad.mit.edu	37	10	7759731	7759731	+	Missense_Mutation	SNP	C	C	T	rs375764473		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr10:7759731C>T	ENST00000358415.4	+	6	776	c.610C>T	c.(610-612)Cgg>Tgg	p.R204W	ITIH2_ENST00000480387.1_3'UTR|ITIH2_ENST00000379587.4_Missense_Mutation_p.R193W	NM_002216.2	NP_002207.2	P19823	ITIH2_HUMAN	inter-alpha-trypsin inhibitor heavy chain 2	204					hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(2)|breast(1)|endometrium(8)|kidney(1)|large_intestine(17)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64						GCAACCTGGACGGCTGGCCAA	0.512																																						uc001ijs.2		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(610-612)CGG>TGG		inter-alpha globulin inhibitor H2 polypeptide		C	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	137.0	132.0	133.0		610	2.4	0.2	10		133	1,8599	1.2+/-3.3	0,1,4299	no	missense	ITIH2	NM_002216.2	101	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging	204/947	7759731	2,13004	2203	4300	6503	SO:0001583	missense	3698				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity	g.chr10:7759731C>T	X07173	CCDS31141.1	10p14	2011-10-26	2011-10-26		ENSG00000151655	ENSG00000151655			6167	protein-coding gene	gene with protein product		146640	"""inter-alpha (globulin) inhibitor, H2 polypeptide"""			1385302, 10100603	Standard	NM_002216		Approved	H2P	uc001ijs.3	P19823	OTTHUMG00000017633	ENST00000358415.4:c.610C>T	10.37:g.7759731C>T	ENSP00000351190:p.Arg204Trp		Somatic					p.R204W	NM_002216	NP_002207	WXS	Illumina HiSeq	Unspecified	P19823	ITIH2_HUMAN			6	772	+			204					Q14659|Q15484|Q5T986	Missense_Mutation	SNP	ENST00000358415.4	37	c.610C>T	CCDS31141.1	.	.	.	.	.	.	.	.	.	.	C	14.48	2.548509	0.45383	2.27E-4	1.16E-4	ENSG00000151655	ENST00000358415;ENST00000429820;ENST00000379587	T;T;T	0.19394	4.79;2.15;4.78	5.47	2.42	0.29668	.	0.058960	0.64402	D	0.000002	T	0.43656	0.1257	M	0.71581	2.175	0.24745	N	0.993017	D	0.76494	0.999	D	0.69479	0.964	T	0.42749	-0.9433	10	0.87932	D	0	-8.4165	14.8555	0.70332	0.6025:0.3975:0.0:0.0	.	204	P19823	ITIH2_HUMAN	W	204;179;193	ENSP00000351190:R204W;ENSP00000388826:R179W;ENSP00000368906:R193W	ENSP00000351190:R204W	R	+	1	2	ITIH2	7799737	0.018000	0.18449	0.206000	0.23566	0.460000	0.32559	0.154000	0.16343	0.193000	0.20303	0.655000	0.94253	CGG		0.512	ITIH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046678.2	NM_002216		24	135	0	0	0	0	24	135				
C10orf111	221060	broad.mit.edu	37	10	15138708	15138708	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr10:15138708C>T	ENST00000378207.3	-	2	389	c.116G>A	c.(115-117)aGa>aAa	p.R39K	RPP38_ENST00000378202.5_5'Flank|RPP38_ENST00000378197.4_5'Flank	NM_153244.1	NP_694976.1	Q8N326	CJ111_HUMAN	chromosome 10 open reading frame 111	39						integral component of membrane (GO:0016021)				lung(5)|upper_aerodigestive_tract(1)	6						TACTGCCTTTCTCTTTTCGGG	0.498																																						uc001inw.2		NA																	0					0						c.(115-117)AGA>AAA		hypothetical protein LOC221060							161.0	149.0	153.0					10																	15138708		2203	4300	6503	SO:0001583	missense	221060					integral to membrane		g.chr10:15138708C>T	BC029034	CCDS7107.1	10p13	2004-04-20			ENSG00000176236	ENSG00000176236			28582	protein-coding gene	gene with protein product						12477932	Standard	NM_153244		Approved	MGC35468, bA455B2.4	uc001inw.3	Q8N326	OTTHUMG00000017727	ENST00000378207.3:c.116G>A	10.37:g.15138708C>T	ENSP00000367449:p.Arg39Lys		Somatic				RPP38_uc001iny.3_5'Flank|RPP38_uc009xjm.2_5'Flank|RPP38_uc001inx.3_5'Flank	p.R39K	NM_153244	NP_694976	WXS	Illumina HiSeq	Unspecified	Q8N326	CJ111_HUMAN			2	390	-			39					B2RAC4	Missense_Mutation	SNP	ENST00000378207.3	37	c.116G>A	CCDS7107.1	.	.	.	.	.	.	.	.	.	.	C	10.04	1.241210	0.22711	.	.	ENSG00000176236	ENST00000378207	T	0.53857	0.6	3.27	-0.149	0.13420	.	.	.	.	.	T	0.27134	0.0665	N	0.08118	0	0.09310	N	1	B	0.28713	0.22	B	0.20184	0.028	T	0.16129	-1.0413	9	0.87932	D	0	.	5.6512	0.17616	0.0:0.5249:0.0:0.4751	.	39	Q8N326	CJ111_HUMAN	K	39	ENSP00000367449:R39K	ENSP00000367449:R39K	R	-	2	0	C10orf111	15178714	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-1.348000	0.02629	-0.029000	0.13827	0.561000	0.74099	AGA		0.498	C10orf111-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046975.1	NM_153244		33	112	0	0	0	0	33	112				
VIM	7431	broad.mit.edu	37	10	17275592	17275592	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr10:17275592G>C	ENST00000224237.5	+	3	776	c.631G>C	c.(631-633)Gac>Cac	p.D211H	RP11-124N14.3_ENST00000456355.1_RNA|VIM_ENST00000544301.1_Missense_Mutation_p.D211H			P08670	VIME_HUMAN	vimentin	211	Coil 1B.|Rod.				apoptotic process (GO:0006915)|astrocyte development (GO:0014002)|Bergmann glial cell differentiation (GO:0060020)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular component movement (GO:0006928)|intermediate filament organization (GO:0045109)|lens fiber cell development (GO:0070307)|muscle filament sliding (GO:0030049)|negative regulation of neuron projection development (GO:0010977)|positive regulation of gene expression (GO:0010628)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|neuron projection (GO:0043005)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	double-stranded RNA binding (GO:0003725)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of eye lens (GO:0005212)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(18)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						ATAGGATGTTGACAATGCGTC	0.403																																						uc001iou.2		NA																	0				large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						c.(631-633)GAC>CAC		vimentin							78.0	70.0	72.0					10																	17275592		2203	4300	6503	SO:0001583	missense	7431				cellular component disassembly involved in apoptosis|cellular component movement|interspecies interaction between organisms|muscle filament sliding	cytosol|intermediate filament	protein C-terminus binding|structural constituent of cytoskeleton	g.chr10:17275592G>C	M14144	CCDS7120.1	10p13	2013-01-16			ENSG00000026025	ENSG00000026025		"""Intermediate filaments type III"""	12692	protein-coding gene	gene with protein product		193060					Standard	NM_003380		Approved		uc001iou.2	P08670	OTTHUMG00000017744	ENST00000224237.5:c.631G>C	10.37:g.17275592G>C	ENSP00000224237:p.Asp211His		Somatic				VIM_uc001iov.1_Missense_Mutation_p.D211H|VIM_uc001iow.1_RNA|VIM_uc001iox.1_Missense_Mutation_p.D211H|VIM_uc001ioy.1_Missense_Mutation_p.D211H|VIM_uc001ioz.1_RNA|VIM_uc001ipb.1_RNA|VIM_uc009xjv.1_Missense_Mutation_p.D211H|VIM_uc001ipc.1_Missense_Mutation_p.D211H	p.D211H	NM_003380	NP_003371	WXS	Illumina HiSeq	Unspecified	P08670	VIME_HUMAN			4	1044	+			211			Rod.|Coil 1B.		B0YJC2|D3DRU4|Q15867|Q15868|Q15869|Q548L2|Q6LER9|Q8N850|Q96ML2|Q9NTM3	Missense_Mutation	SNP	ENST00000224237.5	37	c.631G>C	CCDS7120.1	.	.	.	.	.	.	.	.	.	.	G	32	5.192165	0.94960	.	.	ENSG00000026025	ENST00000544301;ENST00000224237;ENST00000545533;ENST00000421459	D;D;D	0.91945	-2.94;-2.94;-2.94	6.14	6.14	0.99180	Filament (1);	0.000000	0.49305	D	0.000151	D	0.97408	0.9152	H	0.97214	3.96	0.80722	D	1	D;P;P;P;D	0.67145	0.985;0.948;0.906;0.906;0.996	P;P;P;B;P	0.57776	0.827;0.612;0.454;0.354;0.818	D	0.97754	1.0216	10	0.72032	D	0.01	.	20.819	0.99723	0.0:0.0:1.0:0.0	.	211;198;198;211;211	Q53HU8;F5H288;B3KRK8;B0YJC4;P08670	.;.;.;.;VIME_HUMAN	H	211;211;198;37	ENSP00000446007:D211H;ENSP00000224237:D211H;ENSP00000391842:D37H	ENSP00000224237:D211H	D	+	1	0	VIM	17315598	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	9.789000	0.99068	2.927000	0.99377	0.637000	0.83480	GAC		0.403	VIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047015.1	NM_003380		7	37	0	0	0	0	7	37				
SLC39A12	221074	broad.mit.edu	37	10	18250518	18250518	+	Missense_Mutation	SNP	A	A	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr10:18250518A>T	ENST00000377369.2	+	3	543	c.270A>T	c.(268-270)gaA>gaT	p.E90D	SLC39A12_ENST00000377371.3_Missense_Mutation_p.E90D|SLC39A12_ENST00000539911.1_5'UTR|SLC39A12_ENST00000377374.4_Missense_Mutation_p.E90D	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter), member 12	90					regulation of microtubule polymerization (GO:0031113)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)|zinc ion transmembrane import (GO:0071578)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	zinc ion transmembrane transporter activity (GO:0005385)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(5)|lung(38)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	60						AGTGCTTTGAACCAGATGCAC	0.368																																						uc001ipo.2		NA																	0				ovary(1)|breast(1)	2						c.(268-270)GAA>GAT		solute carrier family 39 (zinc transporter),							64.0	68.0	66.0					10																	18250518		2203	4300	6503	SO:0001583	missense	221074				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity	g.chr10:18250518A>T		CCDS7124.1, CCDS44362.1, CCDS60493.1, CCDS60494.1	10p12.33	2013-05-22			ENSG00000148482	ENSG00000148482		"""Solute carriers"""	20860	protein-coding gene	gene with protein product		608734	"""solute carrier family 39 (metal ion transporter), member 12"""			12659941	Standard	NM_152725		Approved	FLJ30499	uc001ipo.2	Q504Y0	OTTHUMG00000017759	ENST00000377369.2:c.270A>T	10.37:g.18250518A>T	ENSP00000366586:p.Glu90Asp		Somatic				SLC39A12_uc001ipn.2_Missense_Mutation_p.E90D|SLC39A12_uc001ipp.2_Missense_Mutation_p.E90D|SLC39A12_uc010qck.1_5'UTR	p.E90D	NM_001145195	NP_001138667	WXS	Illumina HiSeq	Unspecified	Q504Y0	S39AC_HUMAN			3	543	+			90			Extracellular (Potential).		B7ZL35|C9JJL4|Q49AN8|Q4G0L3|Q5VWV8|Q5VWV9|Q6NZY5|Q96NN4	Missense_Mutation	SNP	ENST00000377369.2	37	c.270A>T	CCDS44362.1	.	.	.	.	.	.	.	.	.	.	A	18.30	3.593453	0.66219	.	.	ENSG00000148482	ENST00000377369;ENST00000377374;ENST00000377371;ENST00000425219	T;T;T	0.22539	1.95;1.95;1.95	5.43	1.93	0.25924	.	0.360249	0.32518	N	0.005999	T	0.38746	0.1052	M	0.72118	2.19	0.80722	D	1	D;D;D	0.71674	0.998;0.996;0.998	D;P;D	0.65987	0.94;0.872;0.94	T	0.21759	-1.0236	10	0.59425	D	0.04	-14.5193	9.455	0.38750	0.8011:0.0:0.1989:0.0	.	90;90;90	Q504Y0-4;Q504Y0;Q504Y0-3	.;S39AC_HUMAN;.	D	90;90;90;10	ENSP00000366586:E90D;ENSP00000366591:E90D;ENSP00000366588:E90D	ENSP00000366586:E90D	E	+	3	2	SLC39A12	18290524	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	1.773000	0.38563	0.899000	0.36444	-0.256000	0.11100	GAA		0.368	SLC39A12-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_152725		11	65	0	0	0	0	11	65				
DNAJC1	64215	broad.mit.edu	37	10	22209807	22209807	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr10:22209807C>A	ENST00000376980.3	-	4	747	c.457G>T	c.(457-459)Gag>Tag	p.E153*	DNAJC1_ENST00000376946.1_3'UTR	NM_022365.3	NP_071760.2	Q96KC8	DNJC1_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 1	153					negative regulation of proteolysis (GO:0045861)|positive regulation of ATPase activity (GO:0032781)|protein folding (GO:0006457)|regulation of protein secretion (GO:0050708)|regulation of translation (GO:0006417)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(13)|skin(2)|upper_aerodigestive_tract(2)	21		Breast(68;0.00869)|Prostate(175;0.0181)|Lung SC(717;0.0262)				AATGCCAGCTCAGCATTGCTC	0.398																																						uc001irc.2		NA																	0				lung(1)	1						c.(457-459)GAG>TAG		DnaJ (Hsp40) homolog, subfamily C, member 1							106.0	105.0	106.0					10																	22209807		2203	4300	6503	SO:0001587	stop_gained	64215				negative regulation of proteolysis|regulation of protein secretion|regulation of transcription, DNA-dependent	endoplasmic reticulum membrane|integral to membrane|microsome|nuclear membrane	ATPase activator activity|DNA binding|heat shock protein binding|unfolded protein binding	g.chr10:22209807C>A	AK026062	CCDS7136.1	10p11.23	2011-09-02			ENSG00000136770	ENSG00000136770		"""Heat shock proteins / DNAJ (HSP40)"""	20090	protein-coding gene	gene with protein product		611207					Standard	NM_022365		Approved	DNAJL1, ERdj1, MTJ1	uc001irc.3	Q96KC8	OTTHUMG00000017800	ENST00000376980.3:c.457G>T	10.37:g.22209807C>A	ENSP00000366179:p.Glu153*		Somatic				DNAJC1_uc001ird.2_Nonsense_Mutation_p.E39*	p.E153*	NM_022365	NP_071760	WXS	Illumina HiSeq	Unspecified	Q96KC8	DNJC1_HUMAN			4	744	-		Breast(68;0.00869)|Prostate(175;0.0181)|Lung SC(717;0.0262)	153			Lumenal (By similarity).		B0YIZ8|Q5VX89|Q9H6B8	Nonsense_Mutation	SNP	ENST00000376980.3	37	c.457G>T	CCDS7136.1	.	.	.	.	.	.	.	.	.	.	C	37	6.045548	0.97231	.	.	ENSG00000136770	ENST00000376980	.	.	.	5.31	5.31	0.75309	.	0.089480	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	-11.8956	19.3377	0.94326	0.0:1.0:0.0:0.0	.	.	.	.	X	153	.	ENSP00000366179:E153X	E	-	1	0	DNAJC1	22249813	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.731000	0.84895	2.638000	0.89438	0.563000	0.77884	GAG		0.398	DNAJC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047149.1	NM_022365		12	63	1	0	0.000978159	0.00100257	12	63				
ANKRD26	22852	broad.mit.edu	37	10	27306526	27306526	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr10:27306526C>G	ENST00000376087.4	-	30	4576	c.4411G>C	c.(4411-4413)Gaa>Caa	p.E1471Q	ANKRD26_ENST00000376070.3_Missense_Mutation_p.E1028Q|ANKRD26_ENST00000436985.2_Missense_Mutation_p.E1487Q	NM_001256053.1|NM_014915.2	NP_001242982.1|NP_055730.2	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	1470					glucose homeostasis (GO:0042593)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|regulation of fatty acid metabolic process (GO:0019217)|regulation of feeding behavior (GO:0060259)	actin filament (GO:0005884)|centrosome (GO:0005813)		p.E1471K(1)		breast(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|urinary_tract(2)	70						TGACCAAGTTCTACCATATTC	0.318																																						uc001ith.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|skin(1)	4						c.(4408-4410)GAA>CAA		ankyrin repeat domain 26							142.0	129.0	133.0					10																	27306526		1836	4083	5919	SO:0001583	missense	22852					centrosome		g.chr10:27306526C>G	AB028997	CCDS41499.1	10p12.1	2014-09-17			ENSG00000107890	ENSG00000107890		"""Ankyrin repeat domain containing"""	29186	protein-coding gene	gene with protein product		610855	"""thrombocytopenia 2 (autosomal dominant)"""	THC2		10470851, 21211618	Standard	NM_014915		Approved	KIAA1074	uc009xku.1	Q9UPS8	OTTHUMG00000017851	ENST00000376087.4:c.4411G>C	10.37:g.27306526C>G	ENSP00000365255:p.Glu1471Gln		Somatic				ANKRD26_uc001itg.2_Missense_Mutation_p.E1157Q|ANKRD26_uc009xku.1_Missense_Mutation_p.E1471Q	p.E1470Q	NM_014915	NP_055730	WXS	Illumina HiSeq	Unspecified	Q9UPS8	ANR26_HUMAN			30	4580	-			1470			Potential.		A6NH29|Q2TAZ3|Q6ZR14|Q9H1Q1|Q9NSK9|Q9NTD5|Q9NW69	Missense_Mutation	SNP	ENST00000376087.4	37	c.4408G>C	CCDS41499.1	.	.	.	.	.	.	.	.	.	.	C	12.28	1.891513	0.33442	.	.	ENSG00000107890	ENST00000376070;ENST00000376087;ENST00000436985	T;T;T	0.39592	3.61;1.07;1.08	4.82	1.9	0.25705	.	0.339717	0.23712	N	0.045314	T	0.35828	0.0945	M	0.64676	1.99	0.09310	N	1	P;B;P	0.47106	0.496;0.363;0.89	B;B;B	0.40901	0.178;0.087;0.343	T	0.26258	-1.0108	10	0.56958	D	0.05	.	6.2225	0.20689	0.0:0.6693:0.1544:0.1763	.	1471;1470;1487	Q9UPS8-3;Q9UPS8;A1L497	.;ANR26_HUMAN;.	Q	1028;1471;1487	ENSP00000365238:E1028Q;ENSP00000365255:E1471Q;ENSP00000405112:E1487Q	ENSP00000365238:E1028Q	E	-	1	0	ANKRD26	27346532	0.966000	0.33281	0.002000	0.10522	0.064000	0.16182	2.586000	0.46119	0.185000	0.20105	0.455000	0.32223	GAA		0.318	ANKRD26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047296.1			19	85	0	0	0	0	19	85				
FZD8	8325	broad.mit.edu	37	10	35929113	35929113	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr10:35929113C>T	ENST00000374694.1	-	1	1249	c.1245G>A	c.(1243-1245)gtG>gtA	p.V415V	MIR4683_ENST00000579659.1_RNA	NM_031866.2	NP_114072.1	Q9H461	FZD8_HUMAN	frizzled class receptor 8	415					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|gonad development (GO:0008406)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|T cell differentiation in thymus (GO:0033077)|vasculature development (GO:0001944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.V415V(1)		central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	11						GCGACAAGATCACCCACCAGA	0.632																																						uc001iyz.1		NA																	1	Substitution - coding silent(1)		large_intestine(1)		0						c.(1243-1245)GTG>GTA		frizzled 8 precursor							56.0	54.0	55.0					10																	35929113		2203	4300	6503	SO:0001819	synonymous_variant	8325				axonogenesis|brain development|canonical Wnt receptor signaling pathway|embryo development|gonad development|T cell differentiation in thymus|vasculature development	cell projection|Golgi apparatus|integral to membrane|plasma membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding	g.chr10:35929113C>T	AB043703	CCDS7192.1	10p11.2	2014-01-29	2014-01-29		ENSG00000177283	ENSG00000177283		"""GPCR / Class F : Frizzled receptors"""	4046	protein-coding gene	gene with protein product		606146	"""frizzled (Drosophila) homolog 8"", ""frizzled homolog 8 (Drosophila)"", ""frizzled 8, seven transmembrane spanning receptor"", ""frizzled family receptor 8"""			11295046	Standard	NM_031866		Approved		uc001iyz.1	Q9H461	OTTHUMG00000017956	ENST00000374694.1:c.1245G>A	10.37:g.35929113C>T			Somatic					p.V415V	NM_031866	NP_114072	WXS	Illumina HiSeq	Unspecified	Q9H461	FZD8_HUMAN			1	1250	-			415			Helical; Name=3; (Potential).			Silent	SNP	ENST00000374694.1	37	c.1245G>A	CCDS7192.1																																																																																				0.632	FZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047575.2	NM_031866		10	38	0	0	0	0	10	38				
ZNF33A	7581	broad.mit.edu	37	10	38344019	38344019	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr10:38344019G>A	ENST00000458705.2	+	5	1122	c.964G>A	c.(964-966)Gat>Aat	p.D322N	ZNF33A_ENST00000469037.2_Intron|ZNF33A_ENST00000432900.2_Missense_Mutation_p.D329N|ZNF33A_ENST00000374618.3_Missense_Mutation_p.D323N|ZNF33A_ENST00000307441.9_Missense_Mutation_p.D322N			Q06730	ZN33A_HUMAN	zinc finger protein 33A	322					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(2)|large_intestine(8)|liver(2)|lung(27)|ovary(2)|prostate(1)|skin(2)	46						TCAGAAAGGTGATAAAGGAGA	0.423																																						uc001izh.2		NA																	0				ovary(2)|skin(1)	3						c.(964-966)GAT>AAT		zinc finger protein 33A isoform b							108.0	103.0	105.0					10																	38344019		2203	4299	6502	SO:0001583	missense	7581					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr10:38344019G>A	D31763	CCDS31182.1, CCDS60514.1, CCDS73088.1, CCDS73089.1	10p11.2	2013-01-08	2005-03-18		ENSG00000189180	ENSG00000189180		"""Zinc fingers, C2H2-type"", ""-"""	13096	protein-coding gene	gene with protein product	"""zinc finger and ZAK associated protein with KRAB domain"""	194521	"""zinc finger protein 33a (KOX 31)"", ""zinc finger protein 11A"""	ZNF33, ZNF11A		2014798, 8464732	Standard	NM_006974		Approved	KOX5, KOX31, KIAA0065, FLJ23404, ZZAPK	uc031pui.1	Q06730	OTTHUMG00000017983	ENST00000458705.2:c.964G>A	10.37:g.38344019G>A	ENSP00000387713:p.Asp322Asn		Somatic				ZNF33A_uc001izg.2_Missense_Mutation_p.D323N|ZNF33A_uc010qev.1_Missense_Mutation_p.D329N|ZNF33A_uc001izi.1_Intron	p.D322N	NM_006974	NP_008905	WXS	Illumina HiSeq	Unspecified	Q06730	ZN33A_HUMAN			5	1142	+			322					A8K9X9|B4E0M8|F6TH33|F8WAJ5|P17013|Q5VZ86	Missense_Mutation	SNP	ENST00000458705.2	37	c.964G>A	CCDS31182.1	.	.	.	.	.	.	.	.	.	.	G	8.112	0.779076	0.16120	.	.	ENSG00000189180	ENST00000374618;ENST00000432900;ENST00000458705;ENST00000307441	T;T;T;T	0.27720	1.65;1.65;1.65;1.65	2.05	1.08	0.20341	.	0.939819	0.08706	N	0.905691	T	0.16938	0.0407	N	0.14661	0.345	0.28576	N	0.910397	B;B;B	0.32467	0.372;0.156;0.241	B;B;B	0.25140	0.058;0.026;0.058	T	0.19095	-1.0316	10	0.72032	D	0.01	.	8.0252	0.30434	0.0:0.7249:0.2751:0.0	.	329;322;323	F6TH33;Q06730;F8WAJ5	.;ZN33A_HUMAN;.	N	323;329;322;322	ENSP00000363747:D323N;ENSP00000402467:D329N;ENSP00000387713:D322N;ENSP00000304268:D322N	ENSP00000304268:D322N	D	+	1	0	ZNF33A	38384025	0.000000	0.05858	0.826000	0.32828	0.182000	0.23217	0.320000	0.19540	0.168000	0.19655	-0.515000	0.04445	GAT		0.423	ZNF33A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047614.1	NM_006974		14	85	0	0	0	0	14	85				
ANK3	288	broad.mit.edu	37	10	61840377	61840377	+	Splice_Site	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr10:61840377C>T	ENST00000280772.2	-	36	4542		c.e36-1		ANK3_ENST00000355288.2_Splice_Site|ANK3_ENST00000503366.1_Splice_Site|Y_RNA_ENST00000365320.1_RNA|ANK3_ENST00000373827.2_Splice_Site	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)						axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						TTTTCTCAATCTGAAAAGGAA	0.378																																						uc001jky.2		NA																	0				skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						c.e36-1		ankyrin 3 isoform 1							65.0	61.0	63.0					10																	61840377		2203	4300	6503	SO:0001630	splice_region_variant	288				establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding	g.chr10:61840377C>T	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.4351-1G>A	10.37:g.61840377C>T			Somatic				ANK3_uc001jkw.2_Splice_Site_p.I576_splice|ANK3_uc009xpa.2_Splice_Site_p.I576_splice|ANK3_uc001jkx.2_Splice_Site_p.I620_splice|ANK3_uc010qih.1_Splice_Site_p.I1443_splice|ANK3_uc001jkz.3_Splice_Site_p.I1436_splice|ANK3_uc001jla.1_Intron|ANK3_uc001jkv.2_Splice_Site|ANK3_uc009xpb.1_5'Flank|ANK3_uc009xpc.1_5'Flank	p.I1451_splice	NM_020987	NP_066267	WXS	Illumina HiSeq	Unspecified	Q12955	ANK3_HUMAN			36	4543	-								B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Splice_Site	SNP	ENST00000280772.2	37	c.4351_splice	CCDS7258.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.33|19.33	3.807566|3.807566	0.70797|0.70797	.|.	.|.	ENSG00000151150|ENSG00000151150	ENST00000280772;ENST00000373827;ENST00000373820;ENST00000355288;ENST00000423532;ENST00000503366;ENST00000395299;ENST00000373817;ENST00000395293;ENST00000395304|ENST00000511043	.|.	.|.	.|.	5.36|5.36	5.36|5.36	0.76844|0.76844	.|.	.|.	.|.	.|.	.|.	.|T	.|0.75064	.|0.3799	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.73704	.|-0.3899	.|4	.|.	.|.	.|.	.|.	19.0941|19.0941	0.93242|0.93242	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	.|K	-1|1	.|.	.|.	.|R	-|-	.|2	.|0	ANK3|ANK3	61510383|61510383	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.975000|0.975000	0.68041|0.68041	7.487000|7.487000	0.81328|0.81328	2.508000|2.508000	0.84585|0.84585	0.563000|0.563000	0.77884|0.77884	.|AGA		0.378	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	Intron	6	37	0	0	0	0	6	37				
PRF1	5551	broad.mit.edu	37	10	72358020	72358020	+	Missense_Mutation	SNP	T	T	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr10:72358020T>A	ENST00000441259.1	-	3	1617	c.1457A>T	c.(1456-1458)gAc>gTc	p.D486V	PRF1_ENST00000373209.2_Missense_Mutation_p.D486V	NM_001083116.1|NM_005041.4	NP_001076585.1|NP_005032.2	P14222	PERF_HUMAN	perforin 1 (pore forming protein)	486	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)|cytolysis (GO:0019835)|defense response to tumor cell (GO:0002357)|defense response to virus (GO:0051607)|immune response to tumor cell (GO:0002418)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)	cytolytic granule (GO:0044194)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|wide pore channel activity (GO:0022829)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(3)|urinary_tract(3)	23						CCTGCCAGAGTCCTGATCCCA	0.572			M			"""various leukaemia, lymphoma"""	Type 2 familial hemophagocytic lymphohistiocytosis		Familial Hemophagocytic Lymphohistiocytosis																													uc009xqg.2		NA	yes	Rec			10	10q22	5551	M	perforin 1 (pore forming protein)		Type 2 familial hemophagocytic lymphohistiocytosis	L		various leukaemia|lymphoma			0				large_intestine(1)|ovary(1)|central_nervous_system(1)	3						c.(1456-1458)GAC>GTC		perforin 1 precursor							117.0	123.0	121.0					10																	72358020		2203	4300	6503	SO:0001583	missense	5551	Familial_Hemophagocytic_Lymphohistiocytosis	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	apoptosis|cellular defense response|cytolysis|defense response to tumor cell|defense response to virus|immune response to tumor cell|protein homooligomerization	cytolytic granule|endosome lumen|extracellular region|integral to membrane|plasma membrane	calcium ion binding|protein binding|wide pore channel activity	g.chr10:72358020T>A	BC047695	CCDS7305.1	10q22	2014-09-17			ENSG00000180644	ENSG00000180644			9360	protein-coding gene	gene with protein product	"""Perforin"", ""perforin 1 (preforming protein)"""	170280				1505959, 2592021	Standard	NM_005041		Approved	PFP, P1, HPLH2	uc001jrf.4	P14222	OTTHUMG00000018412	ENST00000441259.1:c.1457A>T	10.37:g.72358020T>A	ENSP00000398568:p.Asp486Val		Somatic				PRF1_uc001jrf.3_Missense_Mutation_p.D486V	p.D486V	NM_001083116	NP_001076585	WXS	Illumina HiSeq	Unspecified	P14222	PERF_HUMAN			3	1618	-			486			C2.	Calcium 2; via carbonyl oxygen (By similarity).	B2R6X4|Q59F57|Q86WX7	Missense_Mutation	SNP	ENST00000441259.1	37	c.1457A>T	CCDS7305.1	.	.	.	.	.	.	.	.	.	.	T	13.95	2.391251	0.42410	.	.	ENSG00000180644	ENST00000373209;ENST00000441259;ENST00000318971	D;D	0.97114	-4.25;-4.25	5.97	4.83	0.62350	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.043336	0.85682	D	0.000000	D	0.98994	0.9657	H	0.98525	4.255	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98465	1.0598	10	0.87932	D	0	-33.4927	10.4029	0.44239	0.0:0.0772:0.0:0.9228	.	486	P14222	PERF_HUMAN	V	486	ENSP00000362305:D486V;ENSP00000398568:D486V	ENSP00000316746:D486V	D	-	2	0	PRF1	72028026	1.000000	0.71417	0.042000	0.18584	0.008000	0.06430	6.956000	0.76013	1.069000	0.40788	0.533000	0.62120	GAC		0.572	PRF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048517.2	NM_005041		21	72	0	0	0	0	21	72				
POLR3A	11128	broad.mit.edu	37	10	79784393	79784393	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr10:79784393C>T	ENST00000372371.3	-	5	696	c.559G>A	c.(559-561)Gat>Aat	p.D187N		NM_007055.3	NP_008986.2	O14802	RPC1_HUMAN	polymerase (RNA) III (DNA directed) polypeptide A, 155kDa	187					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|ribonucleoside binding (GO:0032549)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)			ACAATGGGATCCACCACTTTT	0.383																																						uc001jzn.2		NA																	0					0						c.(559-561)GAT>AAT		polymerase (RNA) III (DNA directed) polypeptide							121.0	120.0	121.0					10																	79784393		2203	4300	6503	SO:0001583	missense	11128				innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity|ribonucleoside binding|zinc ion binding	g.chr10:79784393C>T	AF021351	CCDS7354.1	10q22-q23	2013-01-21			ENSG00000148606	ENSG00000148606		"""RNA polymerase subunits"""	30074	protein-coding gene	gene with protein product		614258				9331371, 12391170	Standard	NM_007055		Approved	RPC1, RPC155, hRPC155	uc001jzn.3	O14802	OTTHUMG00000018550	ENST00000372371.3:c.559G>A	10.37:g.79784393C>T	ENSP00000361446:p.Asp187Asn		Somatic					p.D187N	NM_007055	NP_008986	WXS	Illumina HiSeq	Unspecified	O14802	RPC1_HUMAN	Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)		5	653	-	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		187					Q8IW34|Q8TCW5	Missense_Mutation	SNP	ENST00000372371.3	37	c.559G>A	CCDS7354.1	.	.	.	.	.	.	.	.	.	.	C	18.94	3.729053	0.69074	.	.	ENSG00000148606	ENST00000372371;ENST00000540842	T	0.66280	-0.2	5.52	5.52	0.82312	RNA polymerase Rpb1, domain 1 (1);	0.045015	0.85682	D	0.000000	T	0.59348	0.2187	L	0.51914	1.62	0.80722	D	1	B	0.14012	0.009	B	0.18871	0.023	T	0.53408	-0.8443	9	.	.	.	-23.3091	19.4533	0.94876	0.0:1.0:0.0:0.0	.	187	O14802	RPC1_HUMAN	N	187	ENSP00000361446:D187N	.	D	-	1	0	POLR3A	79454399	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.246000	0.78247	2.604000	0.88044	0.555000	0.69702	GAT		0.383	POLR3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048923.1	NM_007055		13	66	0	0	0	0	13	66				
LRIT1	26103	broad.mit.edu	37	10	85994045	85994045	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr10:85994045C>T	ENST00000372105.3	-	3	700	c.679G>A	c.(679-681)Gag>Aag	p.E227K		NM_015613.2	NP_056428.1	Q9P2V4	LRIT1_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 1	227	LRRCT.					integral component of endoplasmic reticulum membrane (GO:0030176)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|skin(1)	23						AGTTCAGTCTCAATGAAGGCC	0.582																																						uc001kcz.1		NA																	0					0						c.(679-681)GAG>AAG		retina specific protein PAL							89.0	89.0	89.0					10																	85994045		2203	4300	6503	SO:0001583	missense	26103					integral to endoplasmic reticulum membrane		g.chr10:85994045C>T	AB031547	CCDS7373.1	10q23	2013-02-11	2007-06-19	2007-06-19	ENSG00000148602	ENSG00000148602		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	23404	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 9"""		"""leucine rich repeat containing 21"""	LRRC21		10777785	Standard	NM_015613		Approved	PAL, DKFZP434K091, FIGLER9	uc001kcz.1	Q9P2V4	OTTHUMG00000018632	ENST00000372105.3:c.679G>A	10.37:g.85994045C>T	ENSP00000361177:p.Glu227Lys		Somatic					p.E227K	NM_015613	NP_056428	WXS	Illumina HiSeq	Unspecified	Q9P2V4	LRIT1_HUMAN			3	701	-			227			LRRCT.|Lumenal (Potential).		Q0QD41|Q9Y4N7	Missense_Mutation	SNP	ENST00000372105.3	37	c.679G>A	CCDS7373.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.742073	0.89573	.	.	ENSG00000148602	ENST00000372105	T	0.37411	1.2	5.91	5.91	0.95273	Cysteine-rich flanking region, C-terminal (1);	0.099589	0.64402	D	0.000002	T	0.44350	0.1289	L	0.58583	1.82	0.80722	D	1	P	0.47409	0.895	P	0.45071	0.468	T	0.34403	-0.9830	10	0.52906	T	0.07	.	19.07	0.93130	0.0:1.0:0.0:0.0	.	227	Q9P2V4	LRIT1_HUMAN	K	227	ENSP00000361177:E227K	ENSP00000361177:E227K	E	-	1	0	LRIT1	85984025	1.000000	0.71417	0.894000	0.35097	0.317000	0.28152	7.487000	0.81328	2.793000	0.96121	0.655000	0.94253	GAG		0.582	LRIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049109.1	NM_015613		13	66	0	0	0	0	13	66				
SLC35G1	159371	broad.mit.edu	37	10	95660597	95660597	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr10:95660597G>A	ENST00000427197.1	+	3	509	c.448G>A	c.(448-450)Gct>Act	p.A150T	SLC35G1_ENST00000371408.3_Missense_Mutation_p.A149T	NM_001134658.1|NM_153226.2	NP_001128130.1|NP_694958.1	Q2M3R5	S35G1_HUMAN	solute carrier family 35, member G1	150	EamA 1.				calcium ion export from cell (GO:1990034)|cytosolic calcium ion homeostasis (GO:0051480)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											TATATACTATGCTTACCAGAC	0.413																																						uc001kjg.1		NA																	0				upper_aerodigestive_tract(1)	1						c.(448-450)GCT>ACT		transmembrane protein 20 isoform 1							159.0	143.0	148.0					10																	95660597		2203	4300	6503	SO:0001583	missense	159371					integral to membrane		g.chr10:95660597G>A	AK091309	CCDS7432.1, CCDS44459.1	10q23.33	2013-05-22	2011-08-03	2011-08-03	ENSG00000176273	ENSG00000176273		"""Solute carriers"""	26607	protein-coding gene	gene with protein product			"""transmembrane protein 20"""	TMEM20		21569384	Standard	NM_153226		Approved	FLJ33990, C10orf60	uc001kjg.2	Q2M3R5	OTTHUMG00000018779	ENST00000427197.1:c.448G>A	10.37:g.95660597G>A	ENSP00000400932:p.Ala150Thr		Somatic				TMEM20_uc001kji.2_Intron|TMEM20_uc001kjf.1_Missense_Mutation_p.A149T|TMEM20_uc001kjh.2_Intron|TMEM20_uc010qnw.1_Missense_Mutation_p.A133T|TMEM20_uc001kjj.2_Intron	p.A150T	NM_001134658	NP_001128130	WXS	Illumina HiSeq	Unspecified	Q2M3R5	TMM20_HUMAN		STAD - Stomach adenocarcinoma(243;0.00345)	3	509	+		Colorectal(252;3.46e-05)|Renal(717;0.018)|Ovarian(717;0.0228)|all_hematologic(284;0.189)	150			DUF6 1.|Helical; (Potential).		Q86YG5|Q8NBA5	Missense_Mutation	SNP	ENST00000427197.1	37	c.448G>A	CCDS44459.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.825416	0.90955	.	.	ENSG00000176273	ENST00000371408;ENST00000427197	T;T	0.77489	-1.1;-1.1	5.95	5.03	0.67393	.	0.151936	0.64402	D	0.000017	D	0.86777	0.6014	M	0.68317	2.08	0.58432	D	0.999997	D;D;D	0.89917	1.0;0.997;0.979	D;D;P	0.78314	0.991;0.967;0.835	D	0.87717	0.2570	10	0.56958	D	0.05	.	16.4208	0.83758	0.0:0.0:0.8673:0.1327	.	133;150;149	B7ZKP0;Q2M3R5;Q2M3R5-2	.;S35G1_HUMAN;.	T	149;150	ENSP00000360462:A149T;ENSP00000400932:A150T	ENSP00000360462:A149T	A	+	1	0	SLC35G1	95650587	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.528000	0.67129	1.487000	0.48415	0.650000	0.86243	GCT		0.413	SLC35G1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_153226		15	69	0	0	0	0	15	69				
ALDH18A1	5832	broad.mit.edu	37	10	97373783	97373783	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr10:97373783C>T	ENST00000371224.2	-	14	1878	c.1741G>A	c.(1741-1743)Gaa>Aaa	p.E581K	ALDH18A1_ENST00000371221.3_Missense_Mutation_p.E579K	NM_002860.3	NP_002851.2	P54886	P5CS_HUMAN	aldehyde dehydrogenase 18 family, member A1	581	Gamma-glutamyl phosphate reductase.				cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|citrulline biosynthetic process (GO:0019240)|glutamate metabolic process (GO:0006536)|L-proline biosynthetic process (GO:0055129)|ornithine biosynthetic process (GO:0006592)|proline biosynthetic process (GO:0006561)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|glutamate 5-kinase activity (GO:0004349)|glutamate-5-semialdehyde dehydrogenase activity (GO:0004350)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(9)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Colorectal(252;0.0402)		Epithelial(162;9.1e-07)|all cancers(201;2.55e-05)		CAGATCCCTTCGCTGTGCCCC	0.502																																						uc001kkz.2		NA																	0				pancreas(1)|central_nervous_system(1)|skin(1)	3						c.(1741-1743)GAA>AAA		pyrroline-5-carboxylate synthetase isoform 1	L-Glutamic Acid(DB00142)						175.0	172.0	173.0					10																	97373783		2203	4300	6503	SO:0001583	missense	5832				proline biosynthetic process	mitochondrial inner membrane	ATP binding|glutamate 5-kinase activity|glutamate-5-semialdehyde dehydrogenase activity	g.chr10:97373783C>T	X94453	CCDS7443.1, CCDS31257.1	10q24.3-q24.6	2004-08-12	2004-08-12	2004-08-12	ENSG00000059573	ENSG00000059573		"""Aldehyde dehydrogenases"""	9722	protein-coding gene	gene with protein product		138250	"""pyrroline-5-carboxylate synthetase (glutamate gamma-semialdehyde synthetase)"""	GSAS, PYCS		8921385	Standard	XM_006717933		Approved	P5CS	uc001kkz.3	P54886	OTTHUMG00000018815	ENST00000371224.2:c.1741G>A	10.37:g.97373783C>T	ENSP00000360268:p.Glu581Lys		Somatic				ALDH18A1_uc001kky.2_Missense_Mutation_p.E579K|ALDH18A1_uc010qog.1_Missense_Mutation_p.E470K|ALDH18A1_uc010qoh.1_Missense_Mutation_p.E369K	p.E581K	NM_002860	NP_002851	WXS	Illumina HiSeq	Unspecified	P54886	P5CS_HUMAN		Epithelial(162;9.1e-07)|all cancers(201;2.55e-05)	14	1983	-		Colorectal(252;0.0402)	581			Gamma-glutamyl phosphate reductase.		B2R5Q4|B7Z350|B7Z5X8|B7ZLP1|D3DR44|O95952|Q3KQU2|Q5T566|Q5T567|Q9UM72	Missense_Mutation	SNP	ENST00000371224.2	37	c.1741G>A	CCDS7443.1	.	.	.	.	.	.	.	.	.	.	C	30	5.057830	0.93846	.	.	ENSG00000059573	ENST00000371224;ENST00000371221	T;T	0.76316	-1.01;-1.01	5.83	4.9	0.64082	Aldehyde dehydrogenase domain (1);Aldehyde/histidinol dehydrogenase (1);Gamma-glutamyl phosphate reductase GPR (1);	0.092204	0.85682	D	0.000000	D	0.83289	0.5222	L	0.48174	1.505	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.67900	0.954;0.923	D	0.84821	0.0796	10	0.72032	D	0.01	-18.5298	13.8253	0.63346	0.154:0.846:0.0:0.0	.	581;579	P54886;P54886-2	P5CS_HUMAN;.	K	581;579	ENSP00000360268:E581K;ENSP00000360265:E579K	ENSP00000360265:E579K	E	-	1	0	ALDH18A1	97363773	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.301000	0.78850	1.414000	0.47017	0.655000	0.94253	GAA		0.502	ALDH18A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049552.1	NM_002860		7	179	0	0	0	0	7	179				
TLL2	7093	broad.mit.edu	37	10	98133495	98133495	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr10:98133495C>T	ENST00000357947.3	-	19	2745	c.2520G>A	c.(2518-2520)ccG>ccA	p.P840P		NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	840	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		CCAGGCTGTCCGGCCCGTCAT	0.542																																						uc001kml.1		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(2518-2520)CCG>CCA		tolloid-like 2 precursor							58.0	62.0	60.0					10																	98133495		2203	4300	6503	SO:0001819	synonymous_variant	7093				cell differentiation|multicellular organismal development|proteolysis	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding	g.chr10:98133495C>T	AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.2520G>A	10.37:g.98133495C>T			Somatic					p.P840P	NM_012465	NP_036597	WXS	Illumina HiSeq	Unspecified	Q9Y6L7	TLL2_HUMAN		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)	19	2746	-		Colorectal(252;0.0846)	840			CUB 4.		A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Silent	SNP	ENST00000357947.3	37	c.2520G>A	CCDS7449.1																																																																																				0.542	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049608.1			11	61	0	0	0	0	11	61				
TLX1	3195	broad.mit.edu	37	10	102891411	102891411	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr10:102891411C>T	ENST00000370196.6	+	1	2155	c.113C>T	c.(112-114)tCg>tTg	p.S38L	TLX1NB_ENST00000425505.1_5'Flank|TLX1_ENST00000467928.2_Missense_Mutation_p.S38L|TLX1NB_ENST00000445873.1_5'Flank			P31314	TLX1_HUMAN	T-cell leukemia homeobox 1	38					cell fate commitment (GO:0045165)|central nervous system development (GO:0007417)|neuron differentiation (GO:0030182)|organ formation (GO:0048645)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spleen development (GO:0048536)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(1)|upper_aerodigestive_tract(1)	2				Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		GGACCCGCCTCGCGCCTCCAG	0.706			T	"""TRB@, TRD@"""	T-ALL																																	uc001ksw.2		NA		Dom	yes		10	10q24	3195	T	""" T-cell leukemia, homeobox 1 (HOX11)"""			L	TRB@|TRD@		T-ALL		0				breast(1)	1						c.(112-114)TCG>TTG		T-cell leukemia homeobox 1							20.0	22.0	21.0					10																	102891411		2201	4298	6499	SO:0001583	missense	3195					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr10:102891411C>T	M62626	CCDS7510.1, CCDS55725.1	10q24.32	2011-06-20	2005-12-22	2002-05-31	ENSG00000107807	ENSG00000107807		"""Homeoboxes / ANTP class : NKL subclass"""	5056	protein-coding gene	gene with protein product	"""Homeo box-11 (T-cell leukemia-3 associated breakpoint, homologous to Drosophila Notch)"", ""homeo box 11 (T-cell lymphoma 3-associated breakpoint)"""	186770	"""homeo box 11 (T-cell lymphoma 3-associated breakpoint)"", ""T-cell leukemia, homeobox 1"""	TCL3, HOX11		1676542, 1973146	Standard	NM_005521		Approved		uc001ksw.3	P31314	OTTHUMG00000019341	ENST00000370196.6:c.113C>T	10.37:g.102891411C>T	ENSP00000359215:p.Ser38Leu		Somatic				TLX1NB_uc001ksv.2_5'Flank	p.S38L	NM_005521	NP_005512	WXS	Illumina HiSeq	Unspecified	P31314	TLX1_HUMAN		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)	1	351	+			38					A1L4G3|O75699|Q5VXP2|Q9HCA0|Q9UD59	Missense_Mutation	SNP	ENST00000370196.6	37	c.113C>T	CCDS7510.1	.	.	.	.	.	.	.	.	.	.	C	18.79	3.699338	0.68501	.	.	ENSG00000107807	ENST00000370196;ENST00000463716;ENST00000467928	D;D	0.92199	-2.7;-2.99	4.45	4.45	0.53987	.	0.475710	0.22557	N	0.058503	D	0.85725	0.5763	L	0.27053	0.805	0.23227	N	0.998081	B	0.28208	0.203	B	0.15052	0.012	T	0.73199	-0.4058	10	0.24483	T	0.36	.	16.6933	0.85327	0.0:1.0:0.0:0.0	.	38	P31314	TLX1_HUMAN	L	38	ENSP00000359215:S38L;ENSP00000434914:S38L	ENSP00000359215:S38L	S	+	2	0	TLX1	102881401	0.093000	0.21703	0.964000	0.40570	0.984000	0.73092	2.561000	0.45905	2.029000	0.59856	0.462000	0.41574	TCG		0.706	TLX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051193.3	NM_005521		4	16	0	0	0	0	4	16				
PDCD11	22984	broad.mit.edu	37	10	105194617	105194617	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr10:105194617G>A	ENST00000369797.3	+	25	3824	c.3730G>A	c.(3730-3732)Gag>Aag	p.E1244K		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	1244	S1 motif 11. {ECO:0000255|PROSITE- ProRule:PRU00180}.				mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		GACTCCCAACGAGGGGCTGAC	0.547																																						uc001kwy.1		NA																	0				ovary(2)|breast(2)|skin(2)|central_nervous_system(1)	7						c.(3730-3732)GAG>AAG		programmed cell death 11							72.0	62.0	65.0					10																	105194617		2203	4300	6503	SO:0001583	missense	22984				mRNA processing|rRNA processing	nucleolus	RNA binding|transcription factor binding	g.chr10:105194617G>A	D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.3730G>A	10.37:g.105194617G>A	ENSP00000358812:p.Glu1244Lys		Somatic					p.E1244K	NM_014976	NP_055791	WXS	Illumina HiSeq	Unspecified	Q14690	RRP5_HUMAN		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)	25	3817	+		Colorectal(252;0.0747)|Breast(234;0.128)	1244			S1 motif 11.		Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Missense_Mutation	SNP	ENST00000369797.3	37	c.3730G>A	CCDS31276.1	.	.	.	.	.	.	.	.	.	.	G	0.256	-1.003000	0.02128	.	.	ENSG00000148843	ENST00000369797	T	0.08896	3.04	5.71	-2.05	0.07321	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);RNA-binding domain, S1 (1);Ribosomal protein S1, RNA-binding domain (1);	1.196990	0.05393	N	0.539228	T	0.03564	0.0102	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45789	-0.9237	10	0.16896	T	0.51	-4.6614	7.6564	0.28377	0.5149:0.0:0.3823:0.1028	.	1244	Q14690	RRP5_HUMAN	K	1244	ENSP00000358812:E1244K	ENSP00000358812:E1244K	E	+	1	0	PDCD11	105184607	0.000000	0.05858	0.012000	0.15200	0.145000	0.21501	-0.224000	0.09164	-0.612000	0.05701	0.561000	0.74099	GAG		0.547	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050151.1			10	39	0	0	0	0	10	39				
COL17A1	1308	broad.mit.edu	37	10	105819884	105819884	+	Silent	SNP	G	G	A	rs574787396		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr10:105819884G>A	ENST00000353479.5	-	14	1424	c.1134C>T	c.(1132-1134)atC>atT	p.I378I	COL17A1_ENST00000393211.3_Silent_p.I378I|COL17A1_ENST00000369733.3_Silent_p.I378I	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	378	Nonhelical region (NC16).				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		CACTTGCAGCGATGCTGGCAG	0.517																																						uc001kxr.2		NA																	0				ovary(4)|pancreas(1)	5						c.(1132-1134)ATC>ATT		alpha 1 type XVII collagen							130.0	92.0	105.0					10																	105819884		2203	4300	6503	SO:0001819	synonymous_variant	1308				cell-matrix adhesion|epidermis development|hemidesmosome assembly	basement membrane|cell-cell junction|collagen|hemidesmosome|integral to plasma membrane	protein binding	g.chr10:105819884G>A	M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.1134C>T	10.37:g.105819884G>A			Somatic				COL17A1_uc010qqv.1_Silent_p.I362I	p.I378I	NM_000494	NP_000485	WXS	Illumina HiSeq	Unspecified	Q9UMD9	COHA1_HUMAN		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)	14	1303	-		Colorectal(252;0.103)|Breast(234;0.122)	378			Cytoplasmic (Potential).|Nonhelical region (NC16).		Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Silent	SNP	ENST00000353479.5	37	c.1134C>T	CCDS7554.1																																																																																				0.517	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050181.1	NM_130778, NM_000494		9	67	0	0	0	0	9	67				
ABLIM1	3983	broad.mit.edu	37	10	116213165	116213165	+	Nonsense_Mutation	SNP	G	G	A	rs531628426		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr10:116213165G>A	ENST00000277895.5	-	13	1616	c.1519C>T	c.(1519-1521)Cag>Tag	p.Q507*	ABLIM1_ENST00000369266.3_Intron|ABLIM1_ENST00000392952.3_Intron|ABLIM1_ENST00000369252.4_Nonsense_Mutation_p.Q447*|ABLIM1_ENST00000369253.2_Intron|ABLIM1_ENST00000533213.2_Nonsense_Mutation_p.Q447*	NM_002313.5	NP_002304.3	O14639	ABLM1_HUMAN	actin binding LIM protein 1	507					axon guidance (GO:0007411)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|visual perception (GO:0007601)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	30		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)		TTAGGGGCCTGAGCGTAAGTT	0.532																																						uc010qsg.1		NA																	0				breast(1)	1						c.(1519-1521)CAG>TAG		actin-binding LIM protein 1 isoform a							89.0	84.0	86.0					10																	116213165		2203	4300	6503	SO:0001587	stop_gained	3983				axon guidance|cytoskeleton organization|organ morphogenesis|visual perception	actin cytoskeleton|cytoplasm	actin binding|zinc ion binding	g.chr10:116213165G>A	AF005654	CCDS7590.1, CCDS31289.1	10q25	2008-07-07		2002-09-13	ENSG00000099204	ENSG00000099204			78	protein-coding gene	gene with protein product		602330		LIMAB1, ABLIM		9245787	Standard	NM_002313		Approved	abLIM, limatin	uc021pyw.1	O14639	OTTHUMG00000019088	ENST00000277895.5:c.1519C>T	10.37:g.116213165G>A	ENSP00000277895:p.Gln507*		Somatic				ABLIM1_uc010qsh.1_Nonsense_Mutation_p.Q475*|ABLIM1_uc010qsi.1_Nonsense_Mutation_p.Q447*|ABLIM1_uc010qsk.1_Nonsense_Mutation_p.Q431*|ABLIM1_uc009xyp.2_Nonsense_Mutation_p.Q469*|ABLIM1_uc010qsf.1_Intron|ABLIM1_uc009xyn.2_Intron|ABLIM1_uc010qsj.1_Intron|ABLIM1_uc009xyo.2_Intron	p.Q507*	NM_002313	NP_002304	WXS	Illumina HiSeq	Unspecified	O14639	ABLM1_HUMAN		Epithelial(162;0.0132)|all cancers(201;0.0383)	13	1618	-		Colorectal(252;0.0373)|Breast(234;0.231)	507					A6NI16|A6NJ06|A8MXA9|B3KVH2|Q15039|Q5JVV1|Q5JVV2|Q5T6N2|Q5T6N3|Q5T6N5|Q68CQ9|Q9BUP1	Nonsense_Mutation	SNP	ENST00000277895.5	37	c.1519C>T	CCDS7590.1	.	.	.	.	.	.	.	.	.	.	G	41	8.600834	0.98879	.	.	ENSG00000099204	ENST00000336585;ENST00000369252;ENST00000369267;ENST00000533213;ENST00000369262;ENST00000369263;ENST00000369256;ENST00000369260;ENST00000277895;ENST00000369253	.	.	.	5.47	5.47	0.80525	.	0.065120	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	.	17.8564	0.88765	0.0:0.0:1.0:0.0	.	.	.	.	X	507;447;475;447;575;431;431;431;575;259	.	ENSP00000277895:Q575X	Q	-	1	0	ABLIM1	116203155	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.148000	0.94652	2.729000	0.93468	0.591000	0.81541	CAG		0.532	ABLIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050469.3			6	54	0	0	0	0	6	54				
ATRNL1	26033	broad.mit.edu	37	10	117059722	117059722	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr10:117059722C>T	ENST00000355044.3	+	16	2720	c.2594C>T	c.(2593-2595)tCt>tTt	p.S865F	ATRNL1_ENST00000303745.7_5'Flank|ATRNL1_ENST00000423111.2_5'Flank	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	865	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		CCTTGTACATCTATGGCAAAT	0.433																																						uc001lcg.2		NA																	0				ovary(5)|lung(1)|central_nervous_system(1)	7						c.(2593-2595)TCT>TTT		attractin-like 1 precursor							77.0	77.0	77.0					10																	117059722		2203	4300	6503	SO:0001583	missense	26033					integral to membrane	sugar binding	g.chr10:117059722C>T	AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.2594C>T	10.37:g.117059722C>T	ENSP00000347152:p.Ser865Phe		Somatic				ATRNL1_uc010qsm.1_Missense_Mutation_p.S40F|ATRNL1_uc010qsn.1_5'Flank	p.S865F	NM_207303	NP_997186	WXS	Illumina HiSeq	Unspecified	Q5VV63	ATRN1_HUMAN		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)	16	2980	+		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)	865			C-type lectin.|Extracellular (Potential).		O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Missense_Mutation	SNP	ENST00000355044.3	37	c.2594C>T	CCDS7592.1	.	.	.	.	.	.	.	.	.	.	C	17.73	3.461023	0.63513	.	.	ENSG00000107518	ENST00000355044	T	0.20463	2.07	5.45	5.45	0.79879	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (2);	0.047771	0.85682	D	0.000000	T	0.22742	0.0549	L	0.36672	1.1	0.80722	D	1	P	0.37955	0.612	B	0.37833	0.259	T	0.01951	-1.1241	10	0.62326	D	0.03	-13.4372	19.653	0.95825	0.0:1.0:0.0:0.0	.	865	Q5VV63	ATRN1_HUMAN	F	865	ENSP00000347152:S865F	ENSP00000347152:S865F	S	+	2	0	ATRNL1	117049712	1.000000	0.71417	0.834000	0.33040	0.998000	0.95712	5.916000	0.69981	2.721000	0.93114	0.585000	0.79938	TCT		0.433	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349		11	33	0	0	0	0	11	33				
EIF3A	8661	broad.mit.edu	37	10	120801689	120801689	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr10:120801689C>T	ENST00000369144.3	-	19	3470	c.3343G>A	c.(3343-3345)Gat>Aat	p.D1115N	EIF3A_ENST00000541549.1_Missense_Mutation_p.D1081N	NM_003750.2	NP_003741.1	P56537	IF6_HUMAN	eukaryotic translation initiation factor 3, subunit A	0					mature ribosome assembly (GO:0042256)|ribosomal large subunit biogenesis (GO:0042273)|ribosomal subunit export from nucleus (GO:0000054)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lamin filament (GO:0005638)|nucleus (GO:0005634)	ribosomal large subunit binding (GO:0043023)|ribosome binding (GO:0043022)|translation initiation factor activity (GO:0003743)			endometrium(8)|kidney(4)|large_intestine(14)|lung(22)|prostate(1)|skin(4)|urinary_tract(3)	56		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		CCTCGATCATCATCCAACCCT	0.602																																						uc001ldu.2		NA																	0					0						c.(3343-3345)GAT>AAT		eukaryotic translation initiation factor 3,							168.0	162.0	164.0					10																	120801689		2203	4300	6503	SO:0001583	missense	8661				formation of translation initiation complex	cytosol|eukaryotic translation initiation factor 3 complex	protein binding|structural molecule activity|translation initiation factor activity	g.chr10:120801689C>T	U78311	CCDS7608.1	10q26.11	2007-08-03	2007-07-27	2007-07-27	ENSG00000107581	ENSG00000107581			3271	protein-coding gene	gene with protein product		602039	"""eukaryotic translation initiation factor 3, subunit 10 theta, 150/170kDa"""	EIF3, EIF3S10		9054404, 8590280	Standard	NM_003750		Approved	eIF3-theta, eIF3-p170, KIAA0139, eIF3a, TIF32	uc001ldu.3	Q14152	OTTHUMG00000019144	ENST00000369144.3:c.3343G>A	10.37:g.120801689C>T	ENSP00000358140:p.Asp1115Asn		Somatic				EIF3A_uc010qsu.1_Missense_Mutation_p.D1081N|EIF3A_uc009xzg.1_Missense_Mutation_p.D154N	p.D1115N	NM_003750	NP_003741	WXS	Illumina HiSeq	Unspecified	Q14152	EIF3A_HUMAN		all cancers(201;0.0236)	19	3489	-		Lung NSC(174;0.094)|all_lung(145;0.123)	1115			20.|Asp-rich.|25 X 10 AA approximate tandem repeats of [DE]-[DE]-[DE]-R-[SEVGFPILV]-[HPSN]- [RSW]-[RL]-[DRGTIHN]-[EPMANLGDT].		B7ZBG9|Q6IBN8|Q96TD5	Missense_Mutation	SNP	ENST00000369144.3	37	c.3343G>A	CCDS7608.1	.	.	.	.	.	.	.	.	.	.	C	16.90	3.250343	0.59212	.	.	ENSG00000107581	ENST00000369144;ENST00000541549	T;T	0.26810	1.74;1.71	5.45	5.45	0.79879	.	0.172346	0.26373	N	0.024747	T	0.49253	0.1546	M	0.76574	2.34	0.50467	D	0.999879	D;P	0.63046	0.992;0.7	P;B	0.61592	0.891;0.322	T	0.34129	-0.9841	10	0.25106	T	0.35	-7.9511	19.3018	0.94146	0.0:1.0:0.0:0.0	.	1081;1115	F5H335;Q14152	.;EIF3A_HUMAN	N	1115;1081	ENSP00000358140:D1115N;ENSP00000438178:D1081N	ENSP00000358140:D1115N	D	-	1	0	EIF3A	120791679	1.000000	0.71417	0.994000	0.49952	0.968000	0.65278	6.791000	0.75120	2.569000	0.86673	0.655000	0.94253	GAT		0.602	EIF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050634.1	NM_003750		25	131	0	0	0	0	25	131				
TACC2	10579	broad.mit.edu	37	10	123844325	123844325	+	Silent	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr10:123844325G>C	ENST00000369005.1	+	4	2650	c.2310G>C	c.(2308-2310)tcG>tcC	p.S770S	TACC2_ENST00000515273.1_Silent_p.S770S|TACC2_ENST00000358010.1_Intron|TACC2_ENST00000334433.3_Silent_p.S770S|TACC2_ENST00000513429.1_Intron|TACC2_ENST00000453444.2_Silent_p.S770S|TACC2_ENST00000515603.1_Silent_p.S770S	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	770					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				GTGATGCGTCGAGACAGGAAT	0.607																																						uc001lfv.2		NA																	0				ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10						c.(2308-2310)TCG>TCC		transforming, acidic coiled-coil containing							57.0	65.0	62.0					10																	123844325		2203	4300	6503	SO:0001819	synonymous_variant	10579					microtubule organizing center|nucleus	nuclear hormone receptor binding	g.chr10:123844325G>C	AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.2310G>C	10.37:g.123844325G>C			Somatic				TACC2_uc001lfw.2_Intron|TACC2_uc009xzx.2_Silent_p.S770S|TACC2_uc010qtv.1_Silent_p.S770S	p.S770S	NM_206862	NP_996744	WXS	Illumina HiSeq	Unspecified	O95359	TACC2_HUMAN			4	2670	+		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)	770					Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Silent	SNP	ENST00000369005.1	37	c.2310G>C	CCDS7626.1																																																																																				0.607	TACC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090004.1			16	79	0	0	0	0	16	79				
PHRF1	57661	broad.mit.edu	37	11	587351	587351	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr11:587351G>A	ENST00000264555.5	+	4	435	c.307G>A	c.(307-309)Gat>Aat	p.D103N	PHRF1_ENST00000416188.2_Missense_Mutation_p.D103N|PHRF1_ENST00000413872.2_Missense_Mutation_p.D102N|PHRF1_ENST00000533464.1_Missense_Mutation_p.D99N	NM_020901.2	NP_065952.2	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	103					mRNA processing (GO:0006397)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)	RNA polymerase binding (GO:0070063)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|urinary_tract(2)	28						CAATTCTGATGATGATGCAGA	0.557																																						uc001lqe.2		NA																	0					0						c.(307-309)GAT>AAT		PHD and ring finger domains 1							82.0	89.0	87.0					11																	587351		2022	4175	6197	SO:0001583	missense	57661						RNA polymerase binding|zinc ion binding	g.chr11:587351G>A	BC004950	CCDS44507.1, CCDS65987.1, CCDS65988.1, CCDS65989.1	11p15.5	2014-06-13			ENSG00000070047	ENSG00000070047		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	24351	protein-coding gene	gene with protein product	"""CTD binding SR like protein rA9"", ""protein phosphatase 1, regulatory subunit 125"""	611780		RNF221			Standard	XM_005253027		Approved	KIAA1542, PPP1R125	uc010qwc.2	Q9P1Y6	OTTHUMG00000165141	ENST00000264555.5:c.307G>A	11.37:g.587351G>A	ENSP00000264555:p.Asp103Asn		Somatic				PHRF1_uc010qwc.1_Missense_Mutation_p.D103N|PHRF1_uc010qwd.1_Missense_Mutation_p.D102N|PHRF1_uc010qwe.1_Missense_Mutation_p.D99N	p.D103N	NM_020901	NP_065952	WXS	Illumina HiSeq	Unspecified	Q9P1Y6	PHRF1_HUMAN			4	438	+			103					A6H8W1|B7ZM64|B9EGP0|C9JS82|Q6PJP2|Q8IVY2|Q8N2Y7|Q9BSM2	Missense_Mutation	SNP	ENST00000264555.5	37	c.307G>A		.	.	.	.	.	.	.	.	.	.	G	25.9	4.687548	0.88639	.	.	ENSG00000070047	ENST00000264555;ENST00000413872;ENST00000416188;ENST00000533464	T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31	4.81	3.88	0.44766	Zinc finger, RING/FYVE/PHD-type (1);	0.622464	0.13217	N	0.404685	T	0.67069	0.2854	L	0.33668	1.02	0.46954	D	0.999268	D;D;D;D	0.56746	0.961;0.977;0.977;0.961	P;P;P;P	0.53593	0.541;0.73;0.73;0.541	T	0.66464	-0.5917	10	0.72032	D	0.01	-10.851	12.2896	0.54810	0.0854:0.0:0.9146:0.0	.	99;102;103;103	E9PJ24;F8WEF5;Q9P1Y6-3;Q9P1Y6	.;.;.;PHRF1_HUMAN	N	103;102;103;99	ENSP00000264555:D103N;ENSP00000388589:D102N;ENSP00000410626:D103N;ENSP00000431870:D99N	ENSP00000264555:D103N	D	+	1	0	PHRF1	577351	1.000000	0.71417	0.031000	0.17742	0.066000	0.16364	6.352000	0.73027	0.995000	0.38917	0.561000	0.74099	GAT		0.557	PHRF1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000382133.1	NM_020901		10	36	0	0	0	0	10	36				
PHRF1	57661	broad.mit.edu	37	11	587453	587453	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr11:587453G>A	ENST00000264555.5	+	4	537	c.409G>A	c.(409-411)Gaa>Aaa	p.E137K	PHRF1_ENST00000416188.2_Missense_Mutation_p.E137K|PHRF1_ENST00000413872.2_Missense_Mutation_p.E136K|PHRF1_ENST00000533464.1_Missense_Mutation_p.E133K	NM_020901.2	NP_065952.2	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	137					mRNA processing (GO:0006397)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)	RNA polymerase binding (GO:0070063)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|urinary_tract(2)	28						CTGCATTGTCGAATGGTCCAA	0.562																																						uc001lqe.2		NA																	0					0						c.(409-411)GAA>AAA		PHD and ring finger domains 1							112.0	117.0	115.0					11																	587453		2102	4204	6306	SO:0001583	missense	57661						RNA polymerase binding|zinc ion binding	g.chr11:587453G>A	BC004950	CCDS44507.1, CCDS65987.1, CCDS65988.1, CCDS65989.1	11p15.5	2014-06-13			ENSG00000070047	ENSG00000070047		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	24351	protein-coding gene	gene with protein product	"""CTD binding SR like protein rA9"", ""protein phosphatase 1, regulatory subunit 125"""	611780		RNF221			Standard	XM_005253027		Approved	KIAA1542, PPP1R125	uc010qwc.2	Q9P1Y6	OTTHUMG00000165141	ENST00000264555.5:c.409G>A	11.37:g.587453G>A	ENSP00000264555:p.Glu137Lys		Somatic				PHRF1_uc010qwc.1_Missense_Mutation_p.E137K|PHRF1_uc010qwd.1_Missense_Mutation_p.E136K|PHRF1_uc010qwe.1_Missense_Mutation_p.E133K	p.E137K	NM_020901	NP_065952	WXS	Illumina HiSeq	Unspecified	Q9P1Y6	PHRF1_HUMAN			4	540	+			137			RING-type; degenerate.		A6H8W1|B7ZM64|B9EGP0|C9JS82|Q6PJP2|Q8IVY2|Q8N2Y7|Q9BSM2	Missense_Mutation	SNP	ENST00000264555.5	37	c.409G>A		.	.	.	.	.	.	.	.	.	.	G	22.4	4.280554	0.80692	.	.	ENSG00000070047	ENST00000264555;ENST00000413872;ENST00000416188;ENST00000533464	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	4.08	4.08	0.47627	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.202363	0.23997	N	0.042504	T	0.47619	0.1455	N	0.12920	0.275	0.47698	D	0.999494	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.996;0.993;0.993;0.996	T	0.56798	-0.7919	10	0.72032	D	0.01	-22.1931	15.206	0.73180	0.0:0.0:1.0:0.0	.	133;136;137;137	E9PJ24;F8WEF5;Q9P1Y6-3;Q9P1Y6	.;.;.;PHRF1_HUMAN	K	137;136;137;133	ENSP00000264555:E137K;ENSP00000388589:E136K;ENSP00000410626:E137K;ENSP00000431870:E133K	ENSP00000264555:E137K	E	+	1	0	PHRF1	577453	1.000000	0.71417	0.799000	0.32177	0.381000	0.30169	7.241000	0.78201	2.100000	0.63781	0.561000	0.74099	GAA		0.562	PHRF1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000382133.1	NM_020901		9	54	0	0	0	0	9	54				
PIDD1	55367	broad.mit.edu	37	11	801315	801315	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr11:801315C>G	ENST00000347755.5	-	9	1674	c.1533G>C	c.(1531-1533)gaG>gaC	p.E511D	PIDD_ENST00000534649.1_5'Flank|PIDD_ENST00000411829.2_Missense_Mutation_p.E511D	NM_145886.3|NM_145887.3	NP_665893.2|NP_665894.2																					TCACTGCAGCCTCTGGTTCTC	0.697																																						uc001lro.1		NA																	0					0						c.(1531-1533)GAG>GAC		leucine rich repeat and death domain containing							15.0	20.0	19.0					11																	801315		2181	4276	6457	SO:0001583	missense	55367				apoptosis|signal transduction	cytoplasm|nucleus	death receptor binding	g.chr11:801315C>G																												ENST00000347755.5:c.1533G>C	11.37:g.801315C>G	ENSP00000337797:p.Glu511Asp		Somatic				LRDD_uc009yck.1_RNA|LRDD_uc001lrk.1_Missense_Mutation_p.E511D|LRDD_uc001lrl.1_Missense_Mutation_p.E365D|LRDD_uc001lrm.1_Missense_Mutation_p.E198D|LRDD_uc001lrn.1_Missense_Mutation_p.E365D|LRDD_uc001lrp.1_Missense_Mutation_p.E149D	p.E511D	NM_145886	NP_665893	WXS	Illumina HiSeq	Unspecified	Q9HB75	PIDD_HUMAN		all cancers(45;1.45e-25)|Epithelial(43;1.17e-24)|OV - Ovarian serous cystadenocarcinoma(40;6.76e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	9	1675	-		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)	511			ZU5 2.			Missense_Mutation	SNP	ENST00000347755.5	37	c.1533G>C	CCDS7716.1	.	.	.	.	.	.	.	.	.	.	C	15.76	2.929405	0.52759	.	.	ENSG00000177595	ENST00000411829;ENST00000347755	T;T	0.56103	0.48;0.48	4.59	3.66	0.41972	ZU5 (2);	0.242826	0.35179	N	0.003395	T	0.50360	0.1611	N	0.24115	0.695	0.27793	N	0.942743	D;D;D;D	0.59767	0.977;0.984;0.986;0.974	P;P;P;P	0.57204	0.721;0.815;0.648;0.647	T	0.44937	-0.9295	10	0.25751	T	0.34	.	13.1662	0.59573	0.2884:0.7116:0.0:0.0	.	198;511;365;511	Q9HB75-5;Q9HB75;Q9HB75-3;Q9HB75-2	.;PIDD_HUMAN;.;.	D	511	ENSP00000416801:E511D;ENSP00000337797:E511D	ENSP00000337797:E511D	E	-	3	2	PIDD	791315	0.003000	0.15002	0.483000	0.27378	0.060000	0.15804	1.573000	0.36472	1.103000	0.41568	0.561000	0.74099	GAG		0.697	PIDD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257103.1			5	14	0	0	0	0	5	14				
TRPM5	29850	broad.mit.edu	37	11	2433448	2433448	+	Silent	SNP	C	C	T	rs550081696		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr11:2433448C>T	ENST00000155858.6	-	16	2399	c.2391G>A	c.(2389-2391)aaG>aaA	p.K797K	TRPM5_ENST00000533060.1_Silent_p.K797K|TRPM5_ENST00000452833.1_Silent_p.K799K|TRPM5_ENST00000528453.1_Silent_p.K797K	NM_014555.3	NP_055370.1			transient receptor potential cation channel, subfamily M, member 5											breast(1)|central_nervous_system(1)|endometrium(4)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	23		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		GTGTGAACTTCTTCACCAGGT	0.597																																					NSCLC(1;49 61 17205 18850 43201)	uc001lwm.3		NA																	0				ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4						c.(2389-2391)AAG>AAA		transient receptor potential cation channel,							243.0	202.0	216.0					11																	2433448		2202	4299	6501	SO:0001819	synonymous_variant	29850					integral to membrane|plasma membrane	receptor activity|voltage-gated ion channel activity	g.chr11:2433448C>T	AF177473	CCDS31340.1	11p15.5	2011-12-14			ENSG00000070985	ENSG00000070985		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	14323	protein-coding gene	gene with protein product		604600				10607831, 16382100	Standard	NM_014555		Approved	LTRPC5, MTR1	uc001lwm.4	Q9NZQ8	OTTHUMG00000009896	ENST00000155858.6:c.2391G>A	11.37:g.2433448C>T			Somatic				TRPM5_uc010qxl.1_Silent_p.K797K|TRPM5_uc009ydn.2_Silent_p.K799K	p.K797K	NM_014555	NP_055370	WXS	Illumina HiSeq	Unspecified	Q9NZQ8	TRPM5_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)	16	2400	-		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)	797			Cytoplasmic (Potential).			Silent	SNP	ENST00000155858.6	37	c.2391G>A	CCDS31340.1																																																																																				0.597	TRPM5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000027378.1	NM_014555		29	104	0	0	0	0	29	104				
RPS13	6207	broad.mit.edu	37	11	17098993	17098993	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr11:17098993G>C	ENST00000525634.1	-	2	200	c.55C>G	c.(55-57)Cga>Gga	p.R19G	PIK3C2A_ENST00000531428.1_5'Flank|RPS13_ENST00000228140.2_Missense_Mutation_p.R19G|RPS13_ENST00000526895.1_5'UTR|SNORD14A_ENST00000606526.1_RNA|SNORD14B_ENST00000364533.1_RNA			P62277	RS13_HUMAN	ribosomal protein S13	19					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|negative regulation of RNA splicing (GO:0033119)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribosome (GO:0005840)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)	5						ACGCTGCGTCGATAGGGTAAA	0.632																																						uc001mmp.2		NA																	0					0						c.(55-57)CGA>GGA		ribosomal protein S13							47.0	52.0	50.0					11																	17098993		2200	4294	6494	SO:0001583	missense	6207				endocrine pancreas development|negative regulation of RNA splicing|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleolus	mRNA binding|protein binding|structural constituent of ribosome	g.chr11:17098993G>C	X79239	CCDS7823.1	11p	2011-04-05			ENSG00000110700	ENSG00000110700		"""S ribosomal proteins"""	10386	protein-coding gene	gene with protein product	"""40S ribosomal protein S13"""	180476				8332508, 9582194	Standard	NM_001017		Approved	S13	uc001mmp.3	P62277	OTTHUMG00000165988	ENST00000525634.1:c.55C>G	11.37:g.17098993G>C	ENSP00000435777:p.Arg19Gly		Somatic					p.R19G	NM_001017	NP_001008	WXS	Illumina HiSeq	Unspecified	P62277	RS13_HUMAN			2	87	-			19					B2R549|P19116|Q02546|Q29200|Q498Y0	Missense_Mutation	SNP	ENST00000525634.1	37	c.55C>G	CCDS7823.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.447511	0.84101	.	.	ENSG00000110700	ENST00000228140;ENST00000525634;ENST00000533969	T	0.26660	1.72	6.07	6.07	0.98685	Ribosomal protein S13/S15, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.44074	0.1276	M	0.89534	3.04	0.80722	D	1	B	0.15719	0.014	B	0.32211	0.142	T	0.45381	-0.9265	10	0.72032	D	0.01	-36.9433	14.175	0.65534	0.0:0.0:0.8507:0.1493	.	19	P62277	RS13_HUMAN	G	19	ENSP00000432096:R19G	ENSP00000228140:R19G	R	-	1	2	RPS13	17055569	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	2.097000	0.41748	2.884000	0.98904	0.655000	0.94253	CGA		0.632	RPS13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387320.2	NM_001017		6	22	0	0	0	0	6	22				
AMBRA1	55626	broad.mit.edu	37	11	46564069	46564069	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr11:46564069G>A	ENST00000458649.2	-	7	1916	c.1498C>T	c.(1498-1500)Cag>Tag	p.Q500*	AMBRA1_ENST00000534300.1_Nonsense_Mutation_p.Q500*|AMBRA1_ENST00000533727.1_Nonsense_Mutation_p.Q410*|AMBRA1_ENST00000528950.1_Nonsense_Mutation_p.Q500*|AMBRA1_ENST00000426438.1_Nonsense_Mutation_p.Q500*|AMBRA1_ENST00000298834.3_Nonsense_Mutation_p.Q500*|AMBRA1_ENST00000314845.3_Nonsense_Mutation_p.Q410*			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	500					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		AGGTCACACTGAAGCTCATGG	0.567																																						uc010rgu.1		NA																	0				large_intestine(1)|ovary(1)|central_nervous_system(1)	3						c.(1498-1500)CAG>TAG		activating molecule in beclin-1-regulated							89.0	87.0	88.0					11																	46564069		2201	4299	6500	SO:0001587	stop_gained	55626				autophagy|cell differentiation|nervous system development	autophagic vacuole|cytoplasmic vesicle		g.chr11:46564069G>A	AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.1498C>T	11.37:g.46564069G>A	ENSP00000415327:p.Gln500*		Somatic				AMBRA1_uc010rgt.1_Nonsense_Mutation_p.Q66*|AMBRA1_uc009ylc.1_Nonsense_Mutation_p.Q500*|AMBRA1_uc001ncu.1_Nonsense_Mutation_p.Q410*|AMBRA1_uc001ncv.2_Nonsense_Mutation_p.Q410*|AMBRA1_uc001ncw.2_Nonsense_Mutation_p.Q410*|AMBRA1_uc001ncx.2_Nonsense_Mutation_p.Q500*	p.Q500*	NM_017749	NP_060219	WXS	Illumina HiSeq	Unspecified	Q9C0C7	AMRA1_HUMAN		GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)	7	1858	-			500					A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Nonsense_Mutation	SNP	ENST00000458649.2	37	c.1498C>T		.	.	.	.	.	.	.	.	.	.	G	40	7.938877	0.98571	.	.	ENSG00000110497	ENST00000314845;ENST00000533727;ENST00000534300;ENST00000426438;ENST00000298834;ENST00000314823;ENST00000458649;ENST00000528950	.	.	.	6.03	6.03	0.97812	.	0.165864	0.56097	D	0.000025	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	20.5568	0.99304	0.0:0.0:1.0:0.0	.	.	.	.	X	410;410;500;500;500;410;500;500	.	ENSP00000298834:Q500X	Q	-	1	0	AMBRA1	46520645	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	9.066000	0.93949	2.861000	0.98227	0.655000	0.94253	CAG		0.567	AMBRA1-005	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000390103.1	NM_017749		15	67	0	0	0	0	15	67				
AMBRA1	55626	broad.mit.edu	37	11	46564092	46564092	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr11:46564092G>C	ENST00000458649.2	-	7	1893	c.1475C>G	c.(1474-1476)tCg>tGg	p.S492W	AMBRA1_ENST00000534300.1_Missense_Mutation_p.S492W|AMBRA1_ENST00000533727.1_Missense_Mutation_p.S402W|AMBRA1_ENST00000528950.1_Missense_Mutation_p.S492W|AMBRA1_ENST00000426438.1_Missense_Mutation_p.S492W|AMBRA1_ENST00000298834.3_Missense_Mutation_p.S492W|AMBRA1_ENST00000314845.3_Missense_Mutation_p.S402W			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	492					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		AATGCTGCCCGAGTTGTTTTG	0.562																																						uc010rgu.1		NA																	0				large_intestine(1)|ovary(1)|central_nervous_system(1)	3						c.(1474-1476)TCG>TGG		activating molecule in beclin-1-regulated							97.0	94.0	95.0					11																	46564092		2201	4299	6500	SO:0001583	missense	55626				autophagy|cell differentiation|nervous system development	autophagic vacuole|cytoplasmic vesicle		g.chr11:46564092G>C	AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.1475C>G	11.37:g.46564092G>C	ENSP00000415327:p.Ser492Trp		Somatic				AMBRA1_uc010rgt.1_Missense_Mutation_p.S58W|AMBRA1_uc009ylc.1_Missense_Mutation_p.S492W|AMBRA1_uc001ncu.1_Missense_Mutation_p.S402W|AMBRA1_uc001ncv.2_Missense_Mutation_p.S402W|AMBRA1_uc001ncw.2_Missense_Mutation_p.S402W|AMBRA1_uc001ncx.2_Missense_Mutation_p.S492W	p.S492W	NM_017749	NP_060219	WXS	Illumina HiSeq	Unspecified	Q9C0C7	AMRA1_HUMAN		GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)	7	1835	-			492					A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Missense_Mutation	SNP	ENST00000458649.2	37	c.1475C>G		.	.	.	.	.	.	.	.	.	.	G	12.64	1.997531	0.35226	.	.	ENSG00000110497	ENST00000314845;ENST00000533727;ENST00000534300;ENST00000426438;ENST00000298834;ENST00000314823;ENST00000458649;ENST00000528950	T;T;T;T;T;T;T	0.73258	-0.56;-0.73;-0.29;-0.41;-0.29;-0.41;-0.41	6.17	6.17	0.99709	.	0.379646	0.30762	N	0.008923	T	0.73606	0.3608	N	0.19112	0.55	0.80722	D	1	D;D;D;D;D;D	0.65815	0.992;0.988;0.988;0.988;0.995;0.988	P;P;P;P;P;P	0.57960	0.823;0.638;0.638;0.638;0.83;0.638	T	0.75783	-0.3196	10	0.72032	D	0.01	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	492;492;492;402;402;402	Q9C0C7;Q9C0C7-3;Q9C0C7-2;G3V193;Q9C0C7-5;Q9C0C7-4	AMRA1_HUMAN;.;.;.;.;.	W	402;402;492;492;492;402;492;492	ENSP00000318313:S402W;ENSP00000433372:S402W;ENSP00000431926:S492W;ENSP00000410899:S492W;ENSP00000298834:S492W;ENSP00000415327:S492W;ENSP00000433945:S492W	ENSP00000298834:S492W	S	-	2	0	AMBRA1	46520668	1.000000	0.71417	0.779000	0.31741	0.428000	0.31595	7.246000	0.78247	2.941000	0.99782	0.655000	0.94253	TCG		0.562	AMBRA1-005	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000390103.1	NM_017749		15	72	0	0	0	0	15	72				
GIF	2694	broad.mit.edu	37	11	59604756	59604756	+	Silent	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr11:59604756G>C	ENST00000257248.2	-	6	809	c.762C>G	c.(760-762)ctC>ctG	p.L254L	GIF_ENST00000541311.1_Silent_p.L229L	NM_005142.2	NP_005133.2	P27352	IF_HUMAN	gastric intrinsic factor (vitamin B synthesis)	254					cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|cobalt ion transport (GO:0006824)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|lysosomal lumen (GO:0043202)|microvillus (GO:0005902)	cobalamin binding (GO:0031419)			large_intestine(4)|liver(1)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	17					Cyanocobalamin(DB00115)	TAATCTCATTGAGTATCATAT	0.463																																					NSCLC(53;1139 1245 16872 38474 42853)	uc001noi.2		NA																	0				ovary(1)|liver(1)	2						c.(760-762)CTC>CTG		gastric intrinsic factor (vitamin B synthesis)							235.0	212.0	220.0					11																	59604756		2201	4295	6496	SO:0001819	synonymous_variant	2694				cobalamin metabolic process|cobalamin transport|cobalt ion transport	apical plasma membrane|endosome|extracellular space|microvillus	cobalamin binding	g.chr11:59604756G>C	X76562	CCDS7977.1	11q12.1	2013-09-20			ENSG00000134812	ENSG00000134812			4268	protein-coding gene	gene with protein product		609342				2071148	Standard	NM_005142		Approved	TCN3, IF, IFMH, INF	uc001noi.3	P27352	OTTHUMG00000167399	ENST00000257248.2:c.762C>G	11.37:g.59604756G>C			Somatic					p.L254L	NM_005142	NP_005133	WXS	Illumina HiSeq	Unspecified	P27352	IF_HUMAN			6	810	-			254					B2RAN8|B4DVZ1	Silent	SNP	ENST00000257248.2	37	c.762C>G	CCDS7977.1																																																																																				0.463	GIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394497.1	NM_005142		13	53	0	0	0	0	13	53				
MS4A6E	245802	broad.mit.edu	37	11	60107353	60107353	+	Silent	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr11:60107353G>C	ENST00000300182.4	+	3	434	c.369G>C	c.(367-369)ctG>ctC	p.L123L		NM_139249.2	NP_640342.1	Q96DS6	M4A6E_HUMAN	membrane-spanning 4-domains, subfamily A, member 6E	123						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|lung(9)|stomach(1)	13						CTCTGTCTCTGATGCTGGTTT	0.483																																						uc001npd.2		NA																	0					0						c.(367-369)CTG>CTC		membrane-spanning 4-domains, subfamily A, member							263.0	248.0	253.0					11																	60107353		2203	4300	6503	SO:0001819	synonymous_variant	245802					integral to membrane	receptor activity	g.chr11:60107353G>C	AF354931	CCDS7984.1	11q12	2008-03-25				ENSG00000166926			14285	protein-coding gene	gene with protein product		608402				11486273	Standard	NM_139249		Approved		uc001npd.3	Q96DS6		ENST00000300182.4:c.369G>C	11.37:g.60107353G>C			Somatic					p.L123L	NM_139249	NP_640342	WXS	Illumina HiSeq	Unspecified	Q96DS6	M4A6E_HUMAN			3	383	+			123			Helical; (Potential).		Q3MIL2|Q8NE56|Q96PG4|Q96PG5	Silent	SNP	ENST00000300182.4	37	c.369G>C	CCDS7984.1																																																																																				0.483	MS4A6E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394296.1			27	173	0	0	0	0	27	173				
SLC25A45	283130	broad.mit.edu	37	11	65147398	65147398	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr11:65147398C>G	ENST00000527174.1	-	3	148	c.93G>C	c.(91-93)caG>caC	p.Q31H	SLC25A45_ENST00000526432.1_Missense_Mutation_p.Q31H|SLC25A45_ENST00000360662.3_Intron|SLC25A45_ENST00000294187.6_5'UTR|SLC25A45_ENST00000534028.1_Intron|SLC25A45_ENST00000398802.1_Missense_Mutation_p.Q31H|SLC25A45_ENST00000377152.2_5'UTR|SLC25A45_ENST00000417511.2_5'UTR			Q8N413	S2545_HUMAN	solute carrier family 25, member 45	31					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	14						TGGTCTGGGTCTGCAGCCTCA	0.632																																						uc001odp.1		NA																	0					0						c.(91-93)CAG>CAC		solute carrier family 25, member 45 isoform b							59.0	66.0	64.0					11																	65147398		2071	4195	6266	SO:0001583	missense	283130				transmembrane transport	integral to membrane|mitochondrial inner membrane	binding	g.chr11:65147398C>G	BC041100	CCDS41670.1, CCDS41671.1, CCDS60850.1	11q13.1	2013-05-22			ENSG00000162241	ENSG00000162241		"""Solute carriers"""	27442	protein-coding gene	gene with protein product		610825				16949250	Standard	XM_006718507		Approved		uc001odr.1	Q8N413	OTTHUMG00000166255	ENST00000527174.1:c.93G>C	11.37:g.65147398C>G	ENSP00000435489:p.Gln31His		Somatic				SLC25A45_uc009yqi.1_Missense_Mutation_p.Q31H|SLC25A45_uc001odq.1_Intron|SLC25A45_uc001odr.1_Missense_Mutation_p.Q31H|SLC25A45_uc001ods.1_5'UTR|SLC25A45_uc001odt.1_5'UTR	p.Q31H	NM_001077241	NP_001070709	WXS	Illumina HiSeq	Unspecified	Q8N413	S2545_HUMAN			3	515	-			31			Solcar 1.		Q6PL49|Q8IW29	Missense_Mutation	SNP	ENST00000527174.1	37	c.93G>C	CCDS41670.1	.	.	.	.	.	.	.	.	.	.	C	17.66	3.445106	0.63178	.	.	ENSG00000162241	ENST00000527174;ENST00000398802;ENST00000526432;ENST00000530936	D;D;D;D	0.86366	-2.11;-2.11;-2.11;-2.11	4.38	3.47	0.39725	Mitochondrial carrier domain (2);	.	.	.	.	D	0.95118	0.8418	H	0.97758	4.07	0.80722	D	1	D;D	0.76494	0.999;0.973	D;D	0.77557	0.99;0.927	D	0.94796	0.7966	9	0.66056	D	0.02	.	9.8349	0.40963	0.0:0.8993:0.0:0.1007	.	31;31	E9PJQ3;Q8N413	.;S2545_HUMAN	H	31	ENSP00000435489:Q31H;ENSP00000381782:Q31H;ENSP00000435547:Q31H;ENSP00000431642:Q31H	ENSP00000381782:Q31H	Q	-	3	2	SLC25A45	64903974	1.000000	0.71417	1.000000	0.80357	0.837000	0.47467	2.939000	0.48995	1.049000	0.40321	0.561000	0.74099	CAG		0.632	SLC25A45-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388744.3	NM_182556		6	38	0	0	0	0	6	38				
CTSW	1521	broad.mit.edu	37	11	65649791	65649791	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr11:65649791C>T	ENST00000307886.3	+	4	478	c.432C>T	c.(430-432)atC>atT	p.I144I	CTSW_ENST00000528419.1_Silent_p.I144I	NM_001335.3	NP_001326	P56202	CATW_HUMAN	cathepsin W	144					immune response (GO:0006955)	membrane (GO:0016020)	cysteine-type peptidase activity (GO:0008234)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(5)	9				READ - Rectum adenocarcinoma(159;0.168)		TCTCACCCATCAAGGACCAGG	0.612																																						uc001ogc.1		NA																	0				central_nervous_system(1)	1						c.(430-432)ATC>ATT		cathepsin W preproprotein							71.0	68.0	69.0					11																	65649791		2201	4296	6497	SO:0001819	synonymous_variant	1521				immune response|proteolysis		cysteine-type endopeptidase activity	g.chr11:65649791C>T	AF055903	CCDS8117.1	11q13.1	2008-02-01	2006-12-05		ENSG00000172543	ENSG00000172543		"""Cathepsins"""	2546	protein-coding gene	gene with protein product		602364	"""cathepsin W (lymphopain)"""			9108299, 9675123	Standard	NM_001335		Approved		uc001ogc.1	P56202	OTTHUMG00000166663	ENST00000307886.3:c.432C>T	11.37:g.65649791C>T			Somatic				CTSW_uc001ogb.1_Silent_p.I144I	p.I144I	NM_001335	NP_001326	WXS	Illumina HiSeq	Unspecified	P56202	CATW_HUMAN		READ - Rectum adenocarcinoma(159;0.168)	4	474	+			144					Q86VT4	Silent	SNP	ENST00000307886.3	37	c.432C>T	CCDS8117.1																																																																																				0.612	CTSW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391042.1	NM_001335		10	45	0	0	0	0	10	45				
CTSW	1521	broad.mit.edu	37	11	65650706	65650706	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr11:65650706C>G	ENST00000307886.3	+	9	877	c.831C>G	c.(829-831)atC>atG	p.I277M	CTSW_ENST00000528419.1_Missense_Mutation_p.I277M|FIBP_ENST00000426652.2_5'Flank	NM_001335.3	NP_001326	P56202	CATW_HUMAN	cathepsin W	277					immune response (GO:0006955)	membrane (GO:0016020)	cysteine-type peptidase activity (GO:0008234)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(5)	9				READ - Rectum adenocarcinoma(159;0.168)		AAGGTGTGATCAAGGCCACAC	0.617																																						uc001ogc.1		NA																	0				central_nervous_system(1)	1						c.(829-831)ATC>ATG		cathepsin W preproprotein							98.0	102.0	101.0					11																	65650706		2201	4296	6497	SO:0001583	missense	1521				immune response|proteolysis		cysteine-type endopeptidase activity	g.chr11:65650706C>G	AF055903	CCDS8117.1	11q13.1	2008-02-01	2006-12-05		ENSG00000172543	ENSG00000172543		"""Cathepsins"""	2546	protein-coding gene	gene with protein product		602364	"""cathepsin W (lymphopain)"""			9108299, 9675123	Standard	NM_001335		Approved		uc001ogc.1	P56202	OTTHUMG00000166663	ENST00000307886.3:c.831C>G	11.37:g.65650706C>G	ENSP00000311300:p.Ile277Met		Somatic				CTSW_uc001ogb.1_Missense_Mutation_p.I277M	p.I277M	NM_001335	NP_001326	WXS	Illumina HiSeq	Unspecified	P56202	CATW_HUMAN		READ - Rectum adenocarcinoma(159;0.168)	9	873	+			277					Q86VT4	Missense_Mutation	SNP	ENST00000307886.3	37	c.831C>G	CCDS8117.1	.	.	.	.	.	.	.	.	.	.	C	14.77	2.635986	0.47049	.	.	ENSG00000172543	ENST00000307886;ENST00000528419	T;T	0.31247	1.5;1.5	4.99	2.98	0.34508	Peptidase C1A, papain C-terminal (2);	0.249600	0.34338	N	0.004050	T	0.18045	0.0433	N	0.20574	0.59	0.31864	N	0.620669	B;P	0.34934	0.236;0.476	B;B	0.37989	0.262;0.223	T	0.12760	-1.0535	10	0.30854	T	0.27	.	5.8893	0.18899	0.0:0.6981:0.1965:0.1054	.	277;277	P56202;E9PI30	CATW_HUMAN;.	M	277	ENSP00000311300:I277M;ENSP00000436568:I277M	ENSP00000311300:I277M	I	+	3	3	CTSW	65407282	0.149000	0.22717	0.980000	0.43619	0.574000	0.36063	0.107000	0.15375	1.098000	0.41479	0.491000	0.48974	ATC		0.617	CTSW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391042.1	NM_001335		17	71	0	0	0	0	17	71				
GPR152	390212	broad.mit.edu	37	11	67220094	67220094	+	Silent	SNP	G	G	A	rs531715668		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr11:67220094G>A	ENST00000312457.2	-	1	106	c.102C>T	c.(100-102)gtC>gtT	p.V34V	CABP4_ENST00000325656.5_5'Flank|CABP4_ENST00000438189.2_5'UTR|CABP4_ENST00000542025.2_3'UTR	NM_206997.1	NP_996880.1	Q8TDT2	GP152_HUMAN	G protein-coupled receptor 152	34						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	16			BRCA - Breast invasive adenocarcinoma(15;8.18e-06)			CCACCAGGAAGACCGTGTCCC	0.667													G|||	1	0.000199681	0.0	0.0	5008	,	,		18215	0.0		0.0	False		,,,				2504	0.001				Pancreas(102;800 1581 2723 7382 33622)	uc001olm.2		NA																	0					0						c.(100-102)GTC>GTT		G protein-coupled receptor 152							41.0	42.0	42.0					11																	67220094		2199	4290	6489	SO:0001819	synonymous_variant	390212					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr11:67220094G>A	AY255600	CCDS8165.1	11q13.2	2013-09-20			ENSG00000175514	ENSG00000175514		"""GPCR / Class A : Orphans"""	23622	protein-coding gene	gene with protein product						12679517	Standard	NM_206997		Approved	PGR5	uc001olm.3	Q8TDT2	OTTHUMG00000168032	ENST00000312457.2:c.102C>T	11.37:g.67220094G>A			Somatic				uc009yrw.1_RNA|CABP4_uc001oln.2_5'UTR|CABP4_uc001olo.2_5'Flank	p.V34V	NM_206997	NP_996880	WXS	Illumina HiSeq	Unspecified	Q8TDT2	GP152_HUMAN	BRCA - Breast invasive adenocarcinoma(15;8.18e-06)		1	107	-			34			Helical; Name=1; (Potential).		Q0VD88|Q86SM0	Silent	SNP	ENST00000312457.2	37	c.102C>T	CCDS8165.1																																																																																				0.667	GPR152-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397623.1			6	14	0	0	0	0	6	14				
TBX10	347853	broad.mit.edu	37	11	67399081	67399081	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr11:67399081G>A	ENST00000335385.3	-	8	1240	c.1153C>T	c.(1153-1155)Cag>Tag	p.Q385*	NUDT8_ENST00000301490.4_5'Flank|NUDT8_ENST00000376693.2_5'Flank	NM_005995.4	NP_005986.2	O75333	TBX10_HUMAN	T-box 10	385					anatomical structure morphogenesis (GO:0009653)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|lung(4)|ovary(1)	7						TGGCATCACTGGGAGTCCTGG	0.672																																						uc001omp.2		NA																	0					0						c.(1153-1155)CAG>TAG		T-box 10							12.0	12.0	12.0					11																	67399081		2183	4263	6446	SO:0001587	stop_gained	347853				anatomical structure morphogenesis|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr11:67399081G>A	AH006177	CCDS31621.1	11q13.2	2005-10-11	2004-10-05		ENSG00000167800	ENSG00000167800		"""T-boxes"""	11593	protein-coding gene	gene with protein product		604648	"""T-box 7"""	TBX7		9545502	Standard	NM_005995		Approved	TBX13	uc001omp.3	O75333	OTTHUMG00000167291	ENST00000335385.3:c.1153C>T	11.37:g.67399081G>A	ENSP00000335191:p.Gln385*		Somatic				NUDT8_uc001omn.2_5'Flank|NUDT8_uc001omo.1_5'Flank	p.Q385*	NM_005995	NP_005986	WXS	Illumina HiSeq	Unspecified	O75333	TBX10_HUMAN			8	1241	-			385					Q14D64|Q86XS3	Nonsense_Mutation	SNP	ENST00000335385.3	37	c.1153C>T	CCDS31621.1	.	.	.	.	.	.	.	.	.	.	G	13.38	2.220283	0.39201	.	.	ENSG00000167800	ENST00000335385	.	.	.	3.28	-1.5	0.08691	.	1.030990	0.07812	N	0.958298	.	.	.	.	.	.	0.09310	N	0.999995	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	0.7296	0.00955	0.2318:0.1861:0.3924:0.1897	.	.	.	.	X	385	.	ENSP00000335191:Q385X	Q	-	1	0	TBX10	67155657	0.001000	0.12720	0.030000	0.17652	0.053000	0.15095	0.295000	0.19065	-0.067000	0.12976	0.561000	0.74099	CAG		0.672	TBX10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394034.1	NM_005995		4	9	0	0	0	0	4	9				
DNAJB13	374407	broad.mit.edu	37	11	73675980	73675980	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr11:73675980G>C	ENST00000339764.1	+	4	1143	c.392G>C	c.(391-393)cGa>cCa	p.R131P	DNAJB13_ENST00000537753.1_5'UTR|DNAJB13_ENST00000543947.1_5'Flank|RP11-167N4.2_ENST00000540886.1_RNA|RP11-167N4.2_ENST00000537019.1_RNA	NM_153614.2	NP_705842.2	P59910	DJB13_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 13	131					protein folding (GO:0006457)					large_intestine(3)|lung(2)	5	Breast(11;7.42e-05)					CTCCAGGGCCGAGGGGTCAAG	0.498											OREG0021218	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										uc001ouo.2		NA																	0					0						c.(391-393)CGA>CCA		testis spermatogenesis apoptosis-related protein							54.0	60.0	58.0					11																	73675980		2200	4293	6493	SO:0001583	missense	374407				apoptosis|protein folding|spermatogenesis		heat shock protein binding|unfolded protein binding	g.chr11:73675980G>C	AF516185	CCDS8227.1	11q13.3	2011-09-02	2010-04-21		ENSG00000187726	ENSG00000187726		"""Heat shock proteins / DNAJ (HSP40)"""	30718	protein-coding gene	gene with protein product	"""radial spoke 16 homolog A (Chlamydomonas)"""	610263	"""DnaJ (Hsp40) related, subfamily B, member 13"""				Standard	NM_153614		Approved	TSARG6, RSPH16A	uc001ouo.3	P59910	OTTHUMG00000168093	ENST00000339764.1:c.392G>C	11.37:g.73675980G>C	ENSP00000344431:p.Arg131Pro		Somatic	OREG0021218	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1147		p.R131P	NM_153614	NP_705842	WXS	Illumina HiSeq	Unspecified	P59910	DJB13_HUMAN			4	1143	+	Breast(11;7.42e-05)		131					B3LEP4|Q8IZW5	Missense_Mutation	SNP	ENST00000339764.1	37	c.392G>C	CCDS8227.1	.	.	.	.	.	.	.	.	.	.	g	19.75	3.886526	0.72410	.	.	ENSG00000187726	ENST00000339764	D	0.83914	-1.78	5.35	5.35	0.76521	.	0.627610	0.15700	N	0.248989	D	0.88164	0.6363	L	0.60012	1.86	0.80722	D	1	D	0.65815	0.995	P	0.58266	0.836	D	0.86917	0.2064	10	0.42905	T	0.14	.	17.678	0.88236	0.0:0.0:1.0:0.0	.	131	P59910	DJB13_HUMAN	P	131	ENSP00000344431:R131P	ENSP00000344431:R131P	R	+	2	0	DNAJB13	73353628	0.857000	0.29778	1.000000	0.80357	0.982000	0.71751	2.942000	0.49018	2.528000	0.85240	0.449000	0.29647	CGA		0.498	DNAJB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398100.1	NM_153614		9	61	0	0	0	0	9	61				
ME3	10873	broad.mit.edu	37	11	86153891	86153891	+	Missense_Mutation	SNP	C	C	T	rs372905882		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr11:86153891C>T	ENST00000393324.3	-	13	1878	c.1625G>A	c.(1624-1626)cGa>cAa	p.R542Q	ME3_ENST00000543262.1_Missense_Mutation_p.R542Q|ME3_ENST00000359636.2_Missense_Mutation_p.R542Q|RP11-317J19.1_ENST00000524610.1_RNA	NM_001014811.1	NP_001014811.1	Q16798	MAON_HUMAN	malic enzyme 3, NADP(+)-dependent, mitochondrial	542					aerobic respiration (GO:0009060)|malate metabolic process (GO:0006108)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|pyruvate metabolic process (GO:0006090)	mitochondrion (GO:0005739)	cofactor binding (GO:0048037)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|oxaloacetate decarboxylase activity (GO:0008948)			endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|skin(3)|stomach(2)|urinary_tract(1)	27		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)				AGACACGTCTCGGATGGTGCT	0.517																																						uc001pbz.2		NA																	0				ovary(1)	1						c.(1624-1626)CGA>CAA		mitochondrial malic enzyme 3 precursor	NADH(DB00157)	C	GLN/ARG,GLN/ARG,GLN/ARG	0,4404		0,0,2202	161.0	139.0	147.0		1625,1625,1625	4.7	1.0	11		147	1,8597	1.2+/-3.3	0,1,4298	no	missense,missense,missense	ME3	NM_006680.2,NM_001161586.1,NM_001014811.1	43,43,43	0,1,6500	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign	542/605,542/605,542/605	86153891	1,13001	2202	4299	6501	SO:0001583	missense	10873				aerobic respiration|malate metabolic process|oxygen metabolic process|pyruvate metabolic process	mitochondrial matrix	malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|metal ion binding|NAD binding	g.chr11:86153891C>T	X79440	CCDS8277.1	11q14.2	2012-09-20			ENSG00000151376	ENSG00000151376	1.1.1.40		6985	protein-coding gene	gene with protein product		604626				7818469	Standard	NM_001161586		Approved		uc001pbz.3	Q16798	OTTHUMG00000167217	ENST00000393324.3:c.1625G>A	11.37:g.86153891C>T	ENSP00000376998:p.Arg542Gln		Somatic				ME3_uc001pca.2_Missense_Mutation_p.R542Q|ME3_uc009yvk.2_Missense_Mutation_p.R542Q	p.R542Q	NM_001014811	NP_001014811	WXS	Illumina HiSeq	Unspecified	Q16798	MAON_HUMAN			13	1879	-		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)	542					B7Z6V0|Q8TBJ0	Missense_Mutation	SNP	ENST00000393324.3	37	c.1625G>A	CCDS8277.1	.	.	.	.	.	.	.	.	.	.	C	17.99	3.522870	0.64747	0.0	1.16E-4	ENSG00000151376	ENST00000359636;ENST00000543262;ENST00000393324;ENST00000524826	T;T;T;T	0.34275	1.37;1.37;1.37;1.37	5.59	4.68	0.58851	Malic enzyme, NAD-binding (2);NAD(P)-binding domain (1);	0.097775	0.64402	N	0.000002	T	0.34250	0.0891	L	0.59912	1.85	0.80722	D	1	B	0.18968	0.032	B	0.08055	0.003	T	0.09997	-1.0649	9	.	.	.	-7.1988	13.337	0.60522	0.0:0.9243:0.0:0.0757	.	542	Q16798	MAON_HUMAN	Q	542	ENSP00000352657:R542Q;ENSP00000440246:R542Q;ENSP00000376998:R542Q;ENSP00000431182:R542Q	.	R	-	2	0	ME3	85831539	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.556000	0.60775	1.356000	0.45884	0.650000	0.86243	CGA		0.517	ME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393767.2			12	68	0	0	0	0	12	68				
CNTN5	53942	broad.mit.edu	37	11	100061931	100061931	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr11:100061931C>T	ENST00000524871.1	+	14	1944	c.1654C>T	c.(1654-1656)Cga>Tga	p.R552*	CNTN5_ENST00000279463.3_Nonsense_Mutation_p.R552*|CNTN5_ENST00000527185.1_Nonsense_Mutation_p.R552*|CNTN5_ENST00000524560.1_3'UTR|CNTN5_ENST00000528682.1_Nonsense_Mutation_p.R552*|CNTN5_ENST00000418526.2_Nonsense_Mutation_p.R478*	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	552	Ig-like C2-type 5.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		GTACGTTTGCCGAGGGGAAAA	0.393																																						uc001pga.2		NA																	0				skin(3)|ovary(2)|pancreas(2)|breast(1)	8						c.(1654-1656)CGA>TGA		contactin 5 isoform long							68.0	71.0	70.0					11																	100061931		1832	4081	5913	SO:0001587	stop_gained	53942				cell adhesion	anchored to membrane|plasma membrane	protein binding	g.chr11:100061931C>T	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.1654C>T	11.37:g.100061931C>T	ENSP00000435637:p.Arg552*		Somatic				CNTN5_uc009ywv.1_Nonsense_Mutation_p.R552*|CNTN5_uc001pfz.2_Nonsense_Mutation_p.R552*|CNTN5_uc001pgb.2_Nonsense_Mutation_p.R478*|CNTN5_uc010ruk.1_5'UTR	p.R552*	NM_014361	NP_055176	WXS	Illumina HiSeq	Unspecified	O94779	CNTN5_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)	14	1993	+		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)	552			Ig-like C2-type 5.		A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Nonsense_Mutation	SNP	ENST00000524871.1	37	c.1654C>T	CCDS53696.1	.	.	.	.	.	.	.	.	.	.	C	41	8.772271	0.98948	.	.	ENSG00000149972	ENST00000527185;ENST00000528682;ENST00000524871;ENST00000418526;ENST00000279463	.	.	.	5.52	4.58	0.56647	.	0.569863	0.20213	N	0.096855	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	.	14.9127	0.70770	0.1444:0.8556:0.0:0.0	.	.	.	.	X	552;552;552;478;552	.	ENSP00000279463:R552X	R	+	1	2	CNTN5	99567141	0.997000	0.39634	0.963000	0.40424	0.983000	0.72400	3.390000	0.52523	1.426000	0.47256	0.650000	0.86243	CGA		0.393	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361		10	36	0	0	0	0	10	36				
ATM	472	broad.mit.edu	37	11	108106437	108106437	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr11:108106437C>T	ENST00000452508.2	+	6	561	c.372C>T	c.(370-372)atC>atT	p.I124I	ATM_ENST00000278616.4_Silent_p.I124I			Q13315	ATM_HUMAN	ATM serine/threonine kinase	124					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	TAAATTATATCATGGATACAG	0.313			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																												uc001pkb.1		NA	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	D|Mis|N|F|S	ataxia telangiectasia mutated			"""L, O"""		leukemia|lymphoma|medulloblastoma|glioma	T-PLL		0				haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240						c.(370-372)ATC>ATT	Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	ataxia telangiectasia mutated isoform 1							118.0	120.0	119.0					11																	108106437		2201	4298	6499	SO:0001819	synonymous_variant	472	Ataxia_Telangiectasia	Familial Cancer Database	AT, Louis-Bar syndrome	cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding	g.chr11:108106437C>T	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.372C>T	11.37:g.108106437C>T		TSP Lung(14;0.12)	Somatic				ATM_uc009yxr.1_Silent_p.I124I	p.I124I	NM_000051	NP_000042	WXS	Illumina HiSeq	Unspecified	Q13315	ATM_HUMAN		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	5	757	+		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)	124					B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Silent	SNP	ENST00000452508.2	37	c.372C>T	CCDS31669.1																																																																																				0.313	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051		15	42	0	0	0	0	15	42				
PPP2R1B	5519	broad.mit.edu	37	11	111636039	111636039	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr11:111636039C>T	ENST00000527614.1	-	2	249	c.184G>A	c.(184-186)Gaa>Aaa	p.E62K	PPP2R1B_ENST00000393055.2_Missense_Mutation_p.E62K|PPP2R1B_ENST00000427203.2_5'UTR|PPP2R1B_ENST00000426998.2_Intron|PPP2R1B_ENST00000341980.6_Missense_Mutation_p.E62K|PPP2R1B_ENST00000311129.5_Missense_Mutation_p.E62K	NM_001177562.1|NM_002716.4	NP_001171033.1|NP_002707.3	P30154	2AAB_HUMAN	protein phosphatase 2, regulatory subunit A, beta	62					apoptotic process involved in morphogenesis (GO:0060561)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)	extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|liver(1)|lung(10)|prostate(1)|urinary_tract(2)	22		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|Epithelial(105;2.36e-06)|all cancers(92;3.78e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0761)		GGCAACAATTCACTTCGGGTC	0.363																																						uc001plx.1		NA																	0					0						c.(184-186)GAA>AAA		beta isoform of regulatory subunit A, protein							117.0	118.0	118.0					11																	111636039		2201	4297	6498	SO:0001583	missense	5519						protein binding	g.chr11:111636039C>T	AF087438	CCDS8348.1, CCDS8349.1, CCDS53706.1, CCDS53707.1, CCDS53708.1	11q23.1	2010-06-18	2010-04-14		ENSG00000137713	ENSG00000137713	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9303	protein-coding gene	gene with protein product	"""PP2A-A-beta"", ""protein phosphatase 2A, regulatory subunit A, beta isoform"""	603113	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoform"""			2159327, 9795170	Standard	NM_181699		Approved	PR65B, PP2A-Abeta	uc001plw.1	P30154	OTTHUMG00000166741	ENST00000527614.1:c.184G>A	11.37:g.111636039C>T	ENSP00000437193:p.Glu62Lys		Somatic				PPP2R1B_uc001plw.1_Missense_Mutation_p.E62K|PPP2R1B_uc010rwi.1_Intron|PPP2R1B_uc010rwj.1_5'UTR|PPP2R1B_uc010rwk.1_Missense_Mutation_p.E62K|PPP2R1B_uc010rwl.1_Missense_Mutation_p.E62K	p.E62K	NM_002716	NP_002707	WXS	Illumina HiSeq	Unspecified	P30154	2AAB_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|Epithelial(105;2.36e-06)|all cancers(92;3.78e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0761)	2	268	-		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)	62			HEAT 2.		A8MY67|B0YJ69|B4DGQ6|B4DK91|B4DWW5|F8W8G1|O75620|Q8NHV8	Missense_Mutation	SNP	ENST00000527614.1	37	c.184G>A	CCDS8349.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.474632	0.84640	.	.	ENSG00000137713	ENST00000311129;ENST00000412902;ENST00000527614;ENST00000341980;ENST00000393055;ENST00000531373	T;T;T;T;T	0.33654	3.45;3.45;3.45;1.4;1.4	5.82	5.82	0.92795	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.68540	0.3012	M	0.92412	3.305	0.80722	D	1	D;D;D;D	0.60160	0.985;0.987;0.974;0.987	P;D;P;P	0.64410	0.688;0.925;0.731;0.732	T	0.76138	-0.3069	10	0.87932	D	0	-18.2762	17.603	0.88030	0.0:1.0:0.0:0.0	.	62;62;62;62	A8MY67;F8W8G1;P30154;P30154-2	.;.;2AAB_HUMAN;.	K	62;62;62;62;62;47	ENSP00000311344:E62K;ENSP00000437193:E62K;ENSP00000343317:E62K;ENSP00000376775:E62K;ENSP00000434705:E47K	ENSP00000311344:E62K	E	-	1	0	PPP2R1B	111141249	1.000000	0.71417	1.000000	0.80357	0.013000	0.08279	7.315000	0.78998	2.745000	0.94114	0.655000	0.94253	GAA		0.363	PPP2R1B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391298.1	NM_002716		12	81	0	0	0	0	12	81				
BCO2	83875	broad.mit.edu	37	11	112071361	112071361	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr11:112071361C>T	ENST00000357685.5	+	7	1026	c.891C>T	c.(889-891)ttC>ttT	p.F297F	AP002884.3_ENST00000532612.1_Silent_p.F195F|BCO2_ENST00000438022.1_Silent_p.F263F|BCO2_ENST00000531169.1_Silent_p.F263F|BCO2_ENST00000361053.4_Silent_p.F224F|BCO2_ENST00000526088.1_Silent_p.F263F|BCO2_ENST00000393032.2_Silent_p.F263F|BCO2_ENST00000532593.1_Silent_p.F192F			Q9BYV7	BCDO2_HUMAN	beta-carotene oxygenase 2	297					carotene catabolic process (GO:0016121)|carotene metabolic process (GO:0016119)|carotenoid metabolic process (GO:0016116)|oxidation-reduction process (GO:0055114)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of reactive oxygen species metabolic process (GO:2000377)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	intracellular (GO:0005622)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			NS(1)|breast(1)|kidney(3)|large_intestine(1)|lung(9)|skin(1)	16						ATATAATTTTCATTGAACAAC	0.383																																					GBM(177;1916 2099 21049 29541 39946)	uc001pnf.2		NA																	0					0						c.(889-891)TTC>TTT		beta-carotene dioxygenase 2 isoform a							75.0	80.0	78.0					11																	112071361		2201	4297	6498	SO:0001819	synonymous_variant	83875				carotene metabolic process|retinal metabolic process|retinoic acid metabolic process		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	g.chr11:112071361C>T	AJ290393	CCDS8358.2, CCDS41716.1, CCDS58181.1, CCDS58182.1, CCDS58183.1	11q23.1	2014-05-12	2008-04-15	2008-04-15	ENSG00000197580	ENSG00000197580	1.13.11.71		18503	protein-coding gene	gene with protein product	"""beta-carotene 9',10' oxygenase"", ""carotenoid-9',10'-cleaving dioxygenase"""	611740	"""beta-carotene dioxygenase 2"""	BCDO2		11278918, 15983114, 15949678	Standard	NM_031938		Approved	FLJ34464, B-DIOX-II	uc001pnf.3	Q9BYV7	OTTHUMG00000167155	ENST00000357685.5:c.891C>T	11.37:g.112071361C>T			Somatic				BCO2_uc001pne.1_Silent_p.F124F|BCO2_uc001png.2_Silent_p.F224F|BCO2_uc001pnh.2_Silent_p.F263F|BCO2_uc010rwt.1_Silent_p.F192F|BCO2_uc009yyn.2_Silent_p.F263F|BCO2_uc001pni.2_Silent_p.F263F	p.F297F	NM_031938	NP_114144	WXS	Illumina HiSeq	Unspecified	Q9BYV7	BCDO2_HUMAN			7	1008	+			297					B0YIX5|B4DNC3|E9PBI8|E9PJJ1|Q8IUS0|Q96JC8|Q96JY5	Silent	SNP	ENST00000357685.5	37	c.891C>T	CCDS8358.2																																																																																				0.383	BCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256570.3	NM_001037290		13	57	0	0	0	0	13	57				
DDX6	1656	broad.mit.edu	37	11	118633977	118633977	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr11:118633977G>T	ENST00000526070.2	-	7	1045	c.685C>A	c.(685-687)Ctt>Att	p.L229I	DDX6_ENST00000534980.1_Missense_Mutation_p.L229I|DDX6_ENST00000264018.4_Missense_Mutation_p.L229I	NM_001257191.1	NP_001244120.1	P26196	DDX6_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 6	229	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cytoplasmic mRNA processing body assembly (GO:0033962)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)	13	all_hematologic(175;0.0839)	Renal(330;0.0183)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)|Hepatocellular(160;0.0893)|Breast(348;0.0979)|all_hematologic(192;0.103)		OV - Ovarian serous cystadenocarcinoma(223;3.39e-06)|BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Colorectal(284;0.0377)		TTCTTAATAAGATCCAGGATT	0.368			T	IGH@	B-NHL																																	uc001pub.2		NA		Dom	yes		11	11q23.3	1656	T	DEAD (Asp-Glu-Ala-Asp) box polypeptide 6			L	IGH@		B-NHL		0				ovary(1)	1						c.(685-687)CTT>ATT		DEAD (Asp-Glu-Ala-Asp) box polypeptide 6							177.0	169.0	172.0					11																	118633977		1864	4105	5969	SO:0001583	missense	1656				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay	cytoplasmic mRNA processing body|cytosol|RNA-induced silencing complex|stress granule	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding|RNA helicase activity	g.chr11:118633977G>T	D17532	CCDS44751.1	11q23.3	2012-02-23	2012-02-23		ENSG00000110367	ENSG00000110367		"""DEAD-boxes"""	2747	protein-coding gene	gene with protein product		600326	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 6 (RNA helicase, 54kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 6"""	HLR2		1579499, 11839790	Standard	NM_004397		Approved	RCK	uc001pub.2	P26196	OTTHUMG00000166411	ENST00000526070.2:c.685C>A	11.37:g.118633977G>T	ENSP00000433704:p.Leu229Ile		Somatic				DDX6_uc001puc.2_Missense_Mutation_p.L229I	p.L229I	NM_004397	NP_004388	WXS	Illumina HiSeq	Unspecified	P26196	DDX6_HUMAN		OV - Ovarian serous cystadenocarcinoma(223;3.39e-06)|BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Colorectal(284;0.0377)	7	1046	-	all_hematologic(175;0.0839)	Renal(330;0.0183)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)|Hepatocellular(160;0.0893)|Breast(348;0.0979)|all_hematologic(192;0.103)	229			Helicase ATP-binding.		Q5D048	Missense_Mutation	SNP	ENST00000526070.2	37	c.685C>A	CCDS44751.1	.	.	.	.	.	.	.	.	.	.	G	34	5.380187	0.95945	.	.	ENSG00000110367	ENST00000264018;ENST00000534980;ENST00000526070	T;T;T	0.05580	3.42;3.42;3.42	5.99	5.99	0.97316	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.17874	0.0429	L	0.50333	1.59	0.80722	D	1	P	0.43477	0.808	P	0.52672	0.706	T	0.00004	-1.2564	10	0.87932	D	0	.	20.0728	0.97731	0.0:0.0:1.0:0.0	.	229	P26196	DDX6_HUMAN	I	229	ENSP00000264018:L229I;ENSP00000442266:L229I;ENSP00000433704:L229I	ENSP00000264018:L229I	L	-	1	0	DDX6	118139187	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.974000	0.88039	2.840000	0.97914	0.655000	0.94253	CTT		0.368	DDX6-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000389647.2	NM_004397		17	121	1	0	1.68e-08	1.78e-08	17	121				
NTM	50863	broad.mit.edu	37	11	131781512	131781512	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr11:131781512C>T	ENST00000374786.1	+	1	616	c.137C>T	c.(136-138)aCg>aTg	p.T46M	NTM_ENST00000427481.2_Missense_Mutation_p.T37M|NTM_ENST00000539799.1_Missense_Mutation_p.T46M|NTM_ENST00000425719.2_Missense_Mutation_p.T46M|NTM_ENST00000374784.1_Missense_Mutation_p.T46M|NTM_ENST00000374791.3_Missense_Mutation_p.T46M	NM_001144058.1|NM_016522.2	NP_001137530.1|NP_057606.1	Q9P121	NTRI_HUMAN	neurotrimin	46	Ig-like C2-type 1.				cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						GACAACGTGACGGTCCGGCAG	0.617											OREG0021537	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										uc001qgp.2		NA																	0				ovary(4)|central_nervous_system(1)|skin(1)	6						c.(136-138)ACG>ATG		neurotrimin isoform 1							89.0	87.0	87.0					11																	131781512		2201	4295	6496	SO:0001583	missense	50863				cell adhesion|neuron recognition	anchored to membrane|plasma membrane		g.chr11:131781512C>T	AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374786.1:c.137C>T	11.37:g.131781512C>T	ENSP00000363918:p.Thr46Met		Somatic	OREG0021537	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1590	NTM_uc001qgm.2_Missense_Mutation_p.T46M|NTM_uc010sch.1_Missense_Mutation_p.T37M|NTM_uc010sci.1_Missense_Mutation_p.T46M|NTM_uc010scj.1_Missense_Mutation_p.T5M|NTM_uc001qgo.2_Missense_Mutation_p.T46M|NTM_uc001qgq.2_Missense_Mutation_p.T46M	p.T46M	NM_016522	NP_057606	WXS	Illumina HiSeq	Unspecified	Q9P121	NTRI_HUMAN			1	801	+			46			Ig-like C2-type 1.		A0MTT2|Q6UXJ3|Q86VJ9	Missense_Mutation	SNP	ENST00000374786.1	37	c.137C>T	CCDS8491.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.812884	0.90707	.	.	ENSG00000182667	ENST00000374791;ENST00000539799;ENST00000550167;ENST00000427481;ENST00000374786;ENST00000425719;ENST00000374784	T;T;T;T;T;T;T	0.68624	-0.34;-0.34;-0.34;-0.34;-0.34;-0.34;-0.34	5.28	5.28	0.74379	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.138695	0.47093	D	0.000253	T	0.80654	0.4664	M	0.93808	3.46	0.58432	D	0.999992	P;P;P;P;P;P	0.48350	0.687;0.797;0.817;0.909;0.889;0.638	B;B;B;P;B;B	0.46940	0.316;0.409;0.211;0.532;0.397;0.176	D	0.85951	0.1464	10	0.56958	D	0.05	-5.9322	18.896	0.92423	0.0:1.0:0.0:0.0	.	46;37;46;46;46;46	B7Z1Z5;B7Z1I4;Q9P121-4;Q9P121;Q9P121-3;Q9P121-2	.;.;.;NTRI_HUMAN;.;.	M	46;46;37;37;46;46;46	ENSP00000363923:T46M;ENSP00000437668:T46M;ENSP00000448104:T37M;ENSP00000416320:T37M;ENSP00000363918:T46M;ENSP00000396722:T46M;ENSP00000363916:T46M	ENSP00000363916:T46M	T	+	2	0	NTM	131286722	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.311000	0.78958	2.479000	0.83701	0.561000	0.74099	ACG		0.617	NTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141937.1	NM_016522		19	84	0	0	0	0	19	84				
WNK1	65125	broad.mit.edu	37	12	996423	996423	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:996423C>T	ENST00000315939.6	+	20	5960	c.5317C>T	c.(5317-5319)Cta>Tta	p.L1773L	WNK1_ENST00000535572.1_Silent_p.L1526L|WNK1_ENST00000340908.4_Silent_p.L1366L|WNK1_ENST00000530271.2_Silent_p.L2271L|WNK1_ENST00000537687.1_Silent_p.L2033L	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	1773					intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			AGCAGGTACTCTACCCAGCGA	0.483																																					Colon(19;451 567 6672 12618 28860)	uc001qio.3		NA																	0				stomach(6)|breast(6)|ovary(5)|lung(4)|large_intestine(1)|central_nervous_system(1)	23						c.(5317-5319)CTA>TTA		WNK lysine deficient protein kinase 1							126.0	118.0	121.0					12																	996423		2203	4300	6503	SO:0001819	synonymous_variant	65125				intracellular protein kinase cascade|ion transport|neuron development	cytoplasm	ATP binding|protein binding|protein kinase inhibitor activity|protein serine/threonine kinase activity	g.chr12:996423C>T	AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.5317C>T	12.37:g.996423C>T			Somatic				WNK1_uc001qip.3_Silent_p.L1526L|WNK1_uc001qir.3_Silent_p.L946L	p.L1773L	NM_018979	NP_061852	WXS	Illumina HiSeq	Unspecified	Q9H4A3	WNK1_HUMAN	Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)		20	5824	+	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		1773					A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Silent	SNP	ENST00000315939.6	37	c.5317C>T	CCDS8506.1																																																																																				0.483	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206683.1	NM_018979		16	102	0	0	0	0	16	102				
DYRK4	8798	broad.mit.edu	37	12	4721834	4721834	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:4721834C>T	ENST00000540757.2	+	12	1431	c.1271C>T	c.(1270-1272)tCt>tTt	p.S424F	RP11-500M8.7_ENST00000536588.1_Intron|DYRK4_ENST00000010132.5_Missense_Mutation_p.S424F|DYRK4_ENST00000543431.1_Missense_Mutation_p.S424F|DYRK4_ENST00000545342.1_Missense_Mutation_p.S61F	NM_001282285.1|NM_001282286.1|NM_003845.1	NP_001269214.1|NP_001269215.1|NP_003836.1	Q9NR20	DYRK4_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4	424						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27			Colorectal(7;0.103)			TTTTTCCCCTCTGAGACAAGG	0.522																																						uc001qmx.2		NA																	0				lung(2)|skin(1)	3						c.(1270-1272)TCT>TTT		dual-specificity tyrosine-(Y)-phosphorylation							111.0	101.0	104.0					12																	4721834		2203	4300	6503	SO:0001583	missense	8798					Golgi apparatus	ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr12:4721834C>T	Y09305	CCDS8530.1	12p13.32	2014-09-11			ENSG00000010219	ENSG00000010219			3095	protein-coding gene	gene with protein product		609181				9748265	Standard	NM_003845		Approved		uc001qmx.3	Q9NR20	OTTHUMG00000168204	ENST00000540757.2:c.1271C>T	12.37:g.4721834C>T	ENSP00000441755:p.Ser424Phe		Somatic				DYRK4_uc009zeh.1_Missense_Mutation_p.S539F|DYRK4_uc001qmy.1_Missense_Mutation_p.S424F|DYRK4_uc001qmz.1_Missense_Mutation_p.S138F|DYRK4_uc001qna.1_Missense_Mutation_p.S61F|DYRK4_uc010ser.1_Missense_Mutation_p.S61F	p.S424F	NM_003845	NP_003836	WXS	Illumina HiSeq	Unspecified	Q9NR20	DYRK4_HUMAN	Colorectal(7;0.103)		12	1431	+			424					A8K8F7|Q8NEF2|Q92631	Missense_Mutation	SNP	ENST00000540757.2	37	c.1271C>T	CCDS8530.1	.	.	.	.	.	.	.	.	.	.	C	5.216	0.225454	0.09916	.	.	ENSG00000010219	ENST00000542744;ENST00000540757;ENST00000010132;ENST00000543431;ENST00000545342	T;T;T;T;T	0.64618	-0.11;-0.08;-0.08;-0.08;0.7	4.98	-0.439	0.12264	Protein kinase-like domain (1);	0.522047	0.17871	N	0.159194	T	0.46151	0.1378	L	0.40543	1.245	0.09310	N	1	B;B;B;B	0.18741	0.007;0.03;0.001;0.001	B;B;B;B	0.14578	0.007;0.011;0.005;0.001	T	0.37267	-0.9713	10	0.56958	D	0.05	.	5.6333	0.17522	0.0:0.5179:0.1346:0.3474	.	539;138;424;424	F5H6L9;B4E1A4;Q9NR20-2;Q9NR20	.;.;.;DYRK4_HUMAN	F	539;424;424;424;61	ENSP00000437534:S539F;ENSP00000441755:S424F;ENSP00000010132:S424F;ENSP00000439697:S424F;ENSP00000446005:S61F	ENSP00000010132:S424F	S	+	2	0	DYRK4	4592095	0.002000	0.14202	0.016000	0.15963	0.029000	0.11900	0.369000	0.20416	0.024000	0.15214	0.655000	0.94253	TCT		0.522	DYRK4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398780.2			17	102	0	0	0	0	17	102				
USP5	8078	broad.mit.edu	37	12	6966015	6966015	+	Silent	SNP	G	G	A	rs367936917		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:6966015G>A	ENST00000229268.8	+	6	781	c.729G>A	c.(727-729)ccG>ccA	p.P243P	USP5_ENST00000389231.5_Silent_p.P243P	NM_001098536.1	NP_001092006.1	P45974	UBP5_HUMAN	ubiquitin specific peptidase 5 (isopeptidase T)	243					positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)	lysosome (GO:0005764)	cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin thiolesterase activity (GO:0004221)|zinc ion binding (GO:0008270)			breast(6)|endometrium(4)|kidney(2)|large_intestine(6)|lung(14)|skin(2)|urinary_tract(2)	36						CAGGCTACCCGTTAGCTGTCA	0.537																																						uc001qri.3		NA																	0				lung(2)|breast(1)|skin(1)	4						c.(727-729)CCG>CCA		ubiquitin specific peptidase 5 isoform 1		G	,	1,4405	2.1+/-5.4	0,1,2202	100.0	75.0	84.0		729,729	-5.6	0.0	12		84	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	USP5	NM_001098536.1,NM_003481.2	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	243/859,243/836	6966015	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	8078				positive regulation of proteasomal ubiquitin-dependent protein catabolic process|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process	lysosome	cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|zinc ion binding	g.chr12:6966015G>A	U35116	CCDS31733.1, CCDS41743.1	12p13	2007-03-02	2005-08-08		ENSG00000111667	ENSG00000111667		"""Ubiquitin-specific peptidases"""	12628	protein-coding gene	gene with protein product		601447	"""ubiquitin specific protease 5 (isopeptidase T)"""			12838346, 8723724	Standard	NM_003481		Approved	IsoT	uc001qri.4	P45974	OTTHUMG00000169233	ENST00000229268.8:c.729G>A	12.37:g.6966015G>A			Somatic				USP5_uc001qrh.3_Silent_p.P243P	p.P243P	NM_001098536	NP_001092006	WXS	Illumina HiSeq	Unspecified	P45974	UBP5_HUMAN			6	788	+			243			UBP-type.		D3DUS7|D3DUS8|Q96J22	Silent	SNP	ENST00000229268.8	37	c.729G>A	CCDS41743.1																																																																																				0.537	USP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402982.1			9	48	0	0	0	0	9	48				
C1S	716	broad.mit.edu	37	12	7169796	7169796	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:7169796C>T	ENST00000406697.1	+	6	651	c.23C>T	c.(22-24)tCa>tTa	p.S8L	C1S_ENST00000402681.3_Intron|C1S_ENST00000360817.5_Missense_Mutation_p.S8L|C1S_ENST00000328916.3_Missense_Mutation_p.S8L			P09871	C1S_HUMAN	complement component 1, s subcomponent	8					complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(5)|kidney(2)|large_intestine(8)|liver(4)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	33					Abciximab(DB00054)|Adalimumab(DB00051)|Basiliximab(DB00074)|Cetuximab(DB00002)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Muromonab(DB00075)|Rituximab(DB00073)|Trastuzumab(DB00072)	GTCCTGTTTTCACTTTTGGCA	0.502																																					GBM(156;750 1943 12971 24779 31015)	uc001qsj.2		NA																	0				skin(1)	1						c.(22-24)TCA>TTA		complement component 1, s subcomponent	Abciximab(DB00054)|Adalimumab(DB00051)|Basiliximab(DB00074)|Cetuximab(DB00002)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Rituximab(DB00073)|Trastuzumab(DB00072)						118.0	108.0	112.0					12																	7169796		2203	4300	6503	SO:0001583	missense	716				complement activation, classical pathway|innate immune response|proteolysis	extracellular region	calcium ion binding|serine-type endopeptidase activity	g.chr12:7169796C>T		CCDS31735.1	12p13	2014-09-17			ENSG00000182326	ENSG00000182326	3.4.21.42	"""Complement system"""	1247	protein-coding gene	gene with protein product		120580					Standard	NM_201442		Approved		uc001qsl.3	P09871	OTTHUMG00000150305	ENST00000406697.1:c.23C>T	12.37:g.7169796C>T	ENSP00000385035:p.Ser8Leu		Somatic				C1S_uc001qsk.2_Missense_Mutation_p.S8L|C1S_uc001qsl.2_Missense_Mutation_p.S8L|C1S_uc009zfr.2_Intron|C1S_uc009zfs.2_RNA	p.S8L	NM_201442	NP_958850	WXS	Illumina HiSeq	Unspecified	P09871	C1S_HUMAN			6	742	+			8					D3DUT4|Q9UCU7|Q9UCU8|Q9UCU9|Q9UCV0|Q9UCV1|Q9UCV2|Q9UCV3|Q9UCV4|Q9UCV5|Q9UM14	Missense_Mutation	SNP	ENST00000406697.1	37	c.23C>T	CCDS31735.1	.	.	.	.	.	.	.	.	.	.	C	13.81	2.346747	0.41599	.	.	ENSG00000182326	ENST00000406697;ENST00000328916;ENST00000360817;ENST00000423384;ENST00000413211;ENST00000403949	D;D;D;T;T;T	0.84800	-1.9;-1.9;-1.9;1.4;1.39;1.59	5.77	4.88	0.63580	CUB (1);	0.585786	0.14380	N	0.323203	T	0.77572	0.4150	L	0.38838	1.175	0.21802	N	0.99954	B	0.06786	0.001	B	0.06405	0.002	T	0.62746	-0.6789	10	0.24483	T	0.36	.	10.0387	0.42144	0.0:0.6484:0.2811:0.0706	.	8	P09871	C1S_HUMAN	L	8	ENSP00000385035:S8L;ENSP00000328173:S8L;ENSP00000354057:S8L;ENSP00000399892:S8L;ENSP00000406643:S8L;ENSP00000384464:S8L	ENSP00000328173:S8L	S	+	2	0	C1S	7040057	0.029000	0.19370	0.988000	0.46212	0.829000	0.46940	1.539000	0.36104	1.457000	0.47850	-0.218000	0.12543	TCA		0.502	C1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317481.1	NM_001734		9	69	0	0	0	0	9	69				
TAS2R50	259296	broad.mit.edu	37	12	11138872	11138872	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:11138872C>T	ENST00000506868.1	-	1	639	c.588G>A	c.(586-588)ctG>ctA	p.L196L	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176890.2	NP_795371.2	P59544	T2R50_HUMAN	taste receptor, type 2, member 50	196					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(4)|ovary(2)|pancreas(1)	17						AGATTAGCATCAGAAAAGATA	0.408																																						uc001qzl.2		NA																	0				ovary(2)	2						c.(586-588)CTG>CTA		taste receptor, type 2, member 50							131.0	121.0	124.0					12																	11138872		2203	4300	6503	SO:0001819	synonymous_variant	259296				sensory perception of taste	integral to membrane	G-protein coupled receptor activity	g.chr12:11138872C>T	AF494235	CCDS8638.1	12p13.2	2012-08-22			ENSG00000212126	ENSG00000212126		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18882	protein-coding gene	gene with protein product		609627				12379855, 12584440, 16175505	Standard	NM_176890		Approved	T2R51	uc001qzl.2	P59544	OTTHUMG00000162719	ENST00000506868.1:c.588G>A	12.37:g.11138872C>T			Somatic				PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron|PRH1_uc001qzj.2_Intron	p.L196L	NM_176890	NP_795371	WXS	Illumina HiSeq	Unspecified	P59544	T2R50_HUMAN			1	640	-			196			Helical; Name=5; (Potential).		P59545|Q2M255|Q645Y0	Silent	SNP	ENST00000506868.1	37	c.588G>A	CCDS8638.1																																																																																				0.408	TAS2R50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370192.2	NM_176890		23	132	0	0	0	0	23	132				
PRB3	5544	broad.mit.edu	37	12	11420963	11420963	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:11420963G>A	ENST00000279573.7	-	3	355	c.220C>T	c.(220-222)Cgt>Tgt	p.R74C	PRB3_ENST00000440870.3_5'UTR|PRB3_ENST00000538488.1_Missense_Mutation_p.R74C|PRB3_ENST00000381842.3_Missense_Mutation_p.R74C			Q04118	PRB3_HUMAN	proline-rich protein BstNI subfamily 3	74	10 X 21 AA tandem repeats of [RH]-P-G-K- P-[EQ]-G-[PQS]-P-[PS]-Q-[GE]-G-N-[QK]- [SP]-[QR]-[GR]-P-P-P.|Pro-rich.				defense response to Gram-negative bacterium (GO:0050829)	extracellular region (GO:0005576)				breast(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(5)	25			OV - Ovarian serous cystadenocarcinoma(49;0.201)			TTTCCTGGACGAGGTGGGGGA	0.627																																						uc001qzs.2		NA																	0				skin(1)	1						c.(220-222)CGT>TGT		proline-rich protein BstNI subfamily 3							165.0	190.0	182.0					12																	11420963		2181	4289	6470	SO:0001583	missense	5544					extracellular region	Gram-negative bacterial cell surface binding	g.chr12:11420963G>A			12p13.2	2012-10-02				ENSG00000197870			9339	protein-coding gene	gene with protein product		168840				1894623	Standard	NM_006249		Approved	PRG	uc001qzs.3	Q04118		ENST00000279573.7:c.220C>T	12.37:g.11420963G>A	ENSP00000279573:p.Arg74Cys		Somatic				PRB4_uc001qzf.1_Intron	p.R74C	NM_006249	NP_006240	WXS	Illumina HiSeq	Unspecified	Q04118	PRB3_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;0.201)		3	258	-			74			2.|10 X 21 AA tandem repeats of [RH]-P-G-K- P-[EQ]-G-[PQS]-P-[PS]-Q-[GE]-G-N-[QK]- [SP]-[QR]-[GR]-P-P-P.|Pro-rich.		Q15188|Q4VAY3|Q4VAY4|Q7M4M9|Q9UCT9	Missense_Mutation	SNP	ENST00000279573.7	37	c.220C>T		.	.	.	.	.	.	.	.	.	.	.	6.205	0.405993	0.11754	.	.	ENSG00000197870	ENST00000381842;ENST00000538488	T;T	0.04758	3.56;3.56	0.396	0.396	0.16309	.	.	.	.	.	T	0.02807	0.0084	.	.	.	0.09310	N	1	B	0.32031	0.352	B	0.06405	0.002	T	0.42849	-0.9427	8	0.56958	D	0.05	.	3.3804	0.07252	1.0E-4:1.0E-4:0.5454:0.4545	.	74	Q04118	PRB3_HUMAN	C	74	ENSP00000371264:R74C;ENSP00000442626:R74C	ENSP00000279573:R74C	R	-	1	0	PRB3	11312230	0.001000	0.12720	0.006000	0.13384	0.012000	0.07955	-0.365000	0.07573	0.462000	0.27095	0.194000	0.17425	CGT		0.627	PRB3-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000402119.5	NM_006249		49	386	0	0	0	0	49	386				
ETV6	2120	broad.mit.edu	37	12	12043951	12043951	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:12043951G>A	ENST00000396373.4	+	8	1604	c.1330G>A	c.(1330-1332)Gaa>Aaa	p.E444K		NM_001987.4	NP_001978.1	P41212	ETV6_HUMAN	ets variant 6	444					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		ETV6/JAK2(11)|ETV6/ITPR2(2)|ETV6/NTRK3(238)	breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(15)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)				GGAGCTGGATGAACAAATATA	0.527			T	"""NTRK3, RUNX1, PDGFRB, ABL1, MN1, ABL2, FACL6, CHIC2, ARNT, JAK2, EVI1, CDX2, STL, HLXB9, MDS2, PER1, SYK, TTL, FGFR3, PAX5"""	"""congenital fibrosarcoma, multiple leukemia and lymphoma,  secretory breast, MDS, ALL"""																																	uc001qzz.2		NA		Dom	yes		12	12p13	2120	T	ets variant gene 6 (TEL oncogene)			"""L, E, M"""	NTRK3|RUNX1|PDGFRB|ABL1|MN1|ABL2|FACL6|CHIC2|ARNT|JAK2|EVI1|CDX2|STL|HLXB9|MDS2|PER1|SYK|TTL|FGFR3|PAX5		congenital fibrosarcoma|multiple leukemia and lymphoma| secretory breast|MDS|ALL	ETV6/NTRK3(234)|ETV6/JAK2(11)	0				soft_tissue(85)|kidney(66)|breast(55)|salivary_gland(26)|haematopoietic_and_lymphoid_tissue(13)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)|pancreas(1)	250						c.(1330-1332)GAA>AAA		ets variant 6							126.0	133.0	130.0					12																	12043951		2203	4300	6503	SO:0001583	missense	2120					cytoplasm|nucleolus	protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr12:12043951G>A	BC043399	CCDS8643.1	12p13	2014-09-17	2008-09-12		ENSG00000139083	ENSG00000139083			3495	protein-coding gene	gene with protein product	"""TEL oncogene"""	600618	"""ets variant gene 6 (TEL oncogene)"""			7731705	Standard	NM_001987		Approved	TEL	uc001qzz.3	P41212	OTTHUMG00000168538	ENST00000396373.4:c.1330G>A	12.37:g.12043951G>A	ENSP00000379658:p.Glu444Lys		Somatic				ETV6_uc001raa.1_Intron	p.E444K	NM_001987	NP_001978	WXS	Illumina HiSeq	Unspecified	P41212	ETV6_HUMAN			8	1604	+		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)	444					A3QVP6|A8K076|Q9UMF6|Q9UMF7|Q9UMG0	Missense_Mutation	SNP	ENST00000396373.4	37	c.1330G>A	CCDS8643.1	.	.	.	.	.	.	.	.	.	.	G	34	5.309910	0.95629	.	.	ENSG00000139083	ENST00000396373	T	0.09911	2.93	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.12305	0.0299	L	0.36672	1.1	0.80722	D	1	P	0.37781	0.608	B	0.39339	0.297	T	0.15122	-1.0448	10	0.15499	T	0.54	.	19.6126	0.95616	0.0:0.0:1.0:0.0	.	444	P41212	ETV6_HUMAN	K	444	ENSP00000379658:E444K	ENSP00000379658:E444K	E	+	1	0	ETV6	11935218	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.934000	0.92915	2.730000	0.93505	0.650000	0.86243	GAA		0.527	ETV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400130.2	NM_001987		29	145	0	0	0	0	29	145				
DUSP16	80824	broad.mit.edu	37	12	12629840	12629840	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:12629840G>A	ENST00000228862.2	-	7	2556	c.1925C>T	c.(1924-1926)tCa>tTa	p.S642L	DUSP16_ENST00000545864.1_5'Flank|DUSP16_ENST00000298573.4_3'UTR	NM_030640.2	NP_085143.1	Q9BY84	DUS16_HUMAN	dual specificity phosphatase 16	642					dephosphorylation (GO:0016311)|inactivation of MAPK activity (GO:0000188)|MAPK export from nucleus (GO:0045204)|MAPK phosphatase export from nucleus, leptomycin B sensitive (GO:0045209)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(7)|kidney(2)|large_intestine(6)|lung(6)|pancreas(1)|prostate(1)|urinary_tract(3)	26		Prostate(47;0.0687)		BRCA - Breast invasive adenocarcinoma(232;0.0203)		CTCTTCCCGTGACCTGTTCTC	0.498																																					Ovarian(158;443 1896 15437 36069 46477)	uc001rao.1		NA																	0					0						c.(1924-1926)TCA>TTA		dual specificity phosphatase 16							143.0	152.0	149.0					12																	12629840		2203	4300	6503	SO:0001583	missense	80824				inactivation of MAPK activity|MAPK export from nucleus|MAPK phosphatase export from nucleus, leptomycin B sensitive	cytoplasmic membrane-bounded vesicle|nucleus	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity	g.chr12:12629840G>A	AB052156	CCDS8650.1	12p13	2011-06-09				ENSG00000111266		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	17909	protein-coding gene	gene with protein product	"""MAPK phosphatase-7"""	607175				11359773, 11489891, 15888437	Standard	NM_030640		Approved	MKP-7, KIAA1700, MKP7	uc001rao.2	Q9BY84		ENST00000228862.2:c.1925C>T	12.37:g.12629840G>A	ENSP00000228862:p.Ser642Leu		Somatic				DUSP16_uc001ram.1_5'Flank|DUSP16_uc001ran.1_Missense_Mutation_p.S494L	p.S642L	NM_030640	NP_085143	WXS	Illumina HiSeq	Unspecified	Q9BY84	DUS16_HUMAN		BRCA - Breast invasive adenocarcinoma(232;0.0203)	7	2557	-		Prostate(47;0.0687)	642					Q547C7|Q96QS2|Q9C0G3	Missense_Mutation	SNP	ENST00000228862.2	37	c.1925C>T	CCDS8650.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.048490	0.75846	.	.	ENSG00000111266	ENST00000228862	T	0.02498	4.27	4.97	4.97	0.65823	.	0.730148	0.12332	N	0.478279	T	0.08846	0.0219	L	0.40543	1.245	0.80722	D	1	D;D	0.63880	0.993;0.993	P;P	0.58520	0.84;0.84	T	0.11817	-1.0572	10	0.87932	D	0	.	15.2118	0.73230	0.0:0.1408:0.8592:0.0	.	642;642	Q9BY84;Q96N49	DUS16_HUMAN;.	L	642	ENSP00000228862:S642L	ENSP00000228862:S642L	S	-	2	0	DUSP16	12521107	1.000000	0.71417	0.994000	0.49952	0.959000	0.62525	6.081000	0.71309	2.735000	0.93741	0.655000	0.94253	TCA		0.498	DUSP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400311.1	NM_030640		36	205	0	0	0	0	36	205				
ERP27	121506	broad.mit.edu	37	12	15090892	15090892	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:15090892G>C	ENST00000266397.2	-	2	762	c.189C>G	c.(187-189)ttC>ttG	p.F63L		NM_152321.2	NP_689534.1	Q96DN0	ERP27_HUMAN	endoplasmic reticulum protein 27	63	Thioredoxin.					endoplasmic reticulum (GO:0005783)				breast(2)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(4)|lung(3)|prostate(2)|skin(1)	19						TAACCTGGAAGAAGCCTATGA	0.547																																						uc001rco.2		NA																	0				breast(1)	1						c.(187-189)TTC>TTG		endoplasmic reticulum protein 27 kDa precursor							113.0	114.0	114.0					12																	15090892		2203	4300	6503	SO:0001583	missense	121506					endoplasmic reticulum lumen		g.chr12:15090892G>C	AK056677	CCDS8670.1, CCDS73450.1	12p12.3	2011-10-19	2009-02-23	2007-03-26	ENSG00000139055	ENSG00000139055		"""Protein disulfide isomerases"""	26495	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 8"""	610642	"""chromosome 12 open reading frame 46"", ""endoplasmic reticulum protein 27 kDa"""	C12orf46		12975309, 16940051	Standard	XM_005253303		Approved	FLJ32115, ERp27, PDIA8	uc001rco.3	Q96DN0	OTTHUMG00000168741	ENST00000266397.2:c.189C>G	12.37:g.15090892G>C	ENSP00000266397:p.Phe63Leu		Somatic					p.F63L	NM_152321	NP_689534	WXS	Illumina HiSeq	Unspecified	Q96DN0	ERP27_HUMAN			2	210	-			63			Thioredoxin.			Missense_Mutation	SNP	ENST00000266397.2	37	c.189C>G	CCDS8670.1	.	.	.	.	.	.	.	.	.	.	G	16.58	3.162072	0.57368	.	.	ENSG00000139055	ENST00000266397	T	0.35048	1.33	4.87	4.87	0.63330	Thioredoxin-like fold (2);	0.000000	0.85682	D	0.000000	T	0.59810	0.2221	M	0.86178	2.8	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.61657	-0.7018	10	0.44086	T	0.13	-12.8043	9.0208	0.36198	0.0977:0.0:0.9023:0.0	.	63	Q96DN0	ERP27_HUMAN	L	63	ENSP00000266397:F63L	ENSP00000266397:F63L	F	-	3	2	ERP27	14982159	1.000000	0.71417	1.000000	0.80357	0.446000	0.32137	3.659000	0.54489	2.533000	0.85409	0.561000	0.74099	TTC		0.547	ERP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400868.1	NM_152321		15	118	0	0	0	0	15	118				
ABCC9	10060	broad.mit.edu	37	12	22069956	22069956	+	Nonsense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:22069956G>C	ENST00000261201.4	-	4	487	c.488C>G	c.(487-489)tCa>tGa	p.S163*	ABCC9_ENST00000345162.2_Nonsense_Mutation_p.S163*|ABCC9_ENST00000261200.4_Nonsense_Mutation_p.S163*	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	163					defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	ACGCAGGTTTGATATGTCCAA	0.418																																						uc001rfi.1		NA																	0				ovary(4)|skin(2)	6						c.(487-489)TCA>TGA		ATP-binding cassette, sub-family C, member 9	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)						199.0	190.0	193.0					12																	22069956		2203	4300	6503	SO:0001587	stop_gained	10060				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity	g.chr12:22069956G>C	AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.488C>G	12.37:g.22069956G>C	ENSP00000261201:p.Ser163*		Somatic				ABCC9_uc001rfh.2_Nonsense_Mutation_p.S163*|ABCC9_uc001rfj.1_Nonsense_Mutation_p.S163*	p.S163*	NM_005691	NP_005682	WXS	Illumina HiSeq	Unspecified	O60706	ABCC9_HUMAN			4	508	-			163			Extracellular (Potential).		O60707	Nonsense_Mutation	SNP	ENST00000261201.4	37	c.488C>G	CCDS8694.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.989772	0.74589	.	.	ENSG00000069431	ENST00000261200;ENST00000261201;ENST00000345162	.	.	.	5.09	5.09	0.68999	.	0.276491	0.36101	N	0.002796	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-2.316	13.4654	0.61251	0.0:0.0:0.8434:0.1566	.	.	.	.	X	163	.	ENSP00000261200:S163X	S	-	2	0	ABCC9	21961223	0.659000	0.27411	0.876000	0.34364	0.532000	0.34746	3.349000	0.52217	2.371000	0.80710	0.650000	0.86243	TCA		0.418	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402230.1	NM_005691		33	187	0	0	0	0	33	187				
CAPRIN2	65981	broad.mit.edu	37	12	30876222	30876222	+	Nonsense_Mutation	SNP	G	G	A	rs79465544		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:30876222G>A	ENST00000395805.2	-	11	2561	c.2014C>T	c.(2014-2016)Caa>Taa	p.Q672*	CAPRIN2_ENST00000251071.5_Nonsense_Mutation_p.Q672*|CAPRIN2_ENST00000308433.5_Nonsense_Mutation_p.Q339*|CAPRIN2_ENST00000417045.1_Nonsense_Mutation_p.Q672*|CAPRIN2_ENST00000298892.5_Nonsense_Mutation_p.Q672*	NM_001206856.1	NP_001193785.1			caprin family member 2											breast(1)|central_nervous_system(1)|endometrium(8)|kidney(4)|large_intestine(13)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	48	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					AAATCACTTTGACTGGACAGA	0.358																																						uc001rji.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(2014-2016)CAA>TAA		C1q domain containing 1 isoform 1							89.0	87.0	88.0					12																	30876222		2202	4300	6502	SO:0001587	stop_gained	65981				negative regulation of cell growth|negative regulation of translation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of dendrite morphogenesis|positive regulation of dendritic spine morphogenesis|positive regulation of peptidyl-serine phosphorylation|positive regulation of protein binding|positive regulation of transcription from RNA polymerase II promoter	mitochondrion|receptor complex	receptor binding|RNA binding	g.chr12:30876222G>A	AY074491	CCDS8720.1, CCDS41766.1, CCDS41766.2, CCDS55816.1	12p11	2010-08-03	2007-03-27	2007-03-27	ENSG00000110888	ENSG00000110888			21259	protein-coding gene	gene with protein product		610375	"""C1q domain containing 1"""	C1QDC1		11347906, 14764709	Standard	NM_001002259		Approved	EEG1, FLJ22569, FLJ11391, caprin-2, RNG140	uc001rji.1	Q6IMN6	OTTHUMG00000169185	ENST00000395805.2:c.2014C>T	12.37:g.30876222G>A	ENSP00000379150:p.Gln672*		Somatic				CAPRIN2_uc001rjf.1_Nonsense_Mutation_p.Q469*|CAPRIN2_uc001rjg.1_Nonsense_Mutation_p.Q339*|CAPRIN2_uc001rjh.1_Nonsense_Mutation_p.Q672*|CAPRIN2_uc001rjj.1_Nonsense_Mutation_p.Q339*|CAPRIN2_uc001rjk.3_Nonsense_Mutation_p.Q672*|CAPRIN2_uc001rjl.3_Nonsense_Mutation_p.Q672*|CAPRIN2_uc001rjm.1_Nonsense_Mutation_p.Q339*	p.Q672*	NM_001002259	NP_001002259	WXS	Illumina HiSeq	Unspecified	Q6IMN6	CAPR2_HUMAN			11	2765	-	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)		672						Nonsense_Mutation	SNP	ENST00000395805.2	37	c.2014C>T	CCDS55816.1	.	.	.	.	.	.	.	.	.	.	G	36	5.642226	0.96704	.	.	ENSG00000110888	ENST00000433722;ENST00000298892;ENST00000395805;ENST00000251071;ENST00000308433;ENST00000417045;ENST00000438006;ENST00000537108	.	.	.	4.47	3.57	0.40892	.	0.385336	0.29369	N	0.012351	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-0.7249	12.4761	0.55814	0.0:0.0:0.8323:0.1677	.	.	.	.	X	418;672;672;672;339;672;398;591	.	ENSP00000251071:Q672X	Q	-	1	0	CAPRIN2	30767489	1.000000	0.71417	0.991000	0.47740	0.997000	0.91878	4.214000	0.58527	1.218000	0.43458	0.650000	0.86243	CAA		0.358	CAPRIN2-004	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000403322.2	NM_023925		7	71	0	0	0	0	7	71				
DNM1L	10059	broad.mit.edu	37	12	32873662	32873662	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:32873662C>G	ENST00000549701.1	+	8	879	c.805C>G	c.(805-807)Ctt>Gtt	p.L269V	DNM1L_ENST00000452533.2_Missense_Mutation_p.L269V|DNM1L_ENST00000547312.1_Missense_Mutation_p.L269V|DNM1L_ENST00000553257.1_Missense_Mutation_p.L282V|DNM1L_ENST00000266481.6_Missense_Mutation_p.L269V|DNM1L_ENST00000414834.2_Missense_Mutation_p.L66V|DNM1L_ENST00000358214.5_Missense_Mutation_p.L282V|DNM1L_ENST00000381000.4_Missense_Mutation_p.L282V			O00429	DNM1L_HUMAN	dynamin 1-like	269	Dynamin-type G.|GTPase domain.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|dynamin polymerization involved in mitochondrial fission (GO:0003374)|endocytosis (GO:0006897)|GTP catabolic process (GO:0006184)|membrane fission involved in mitochondrial fission (GO:0090149)|membrane fusion (GO:0061025)|mitochondrial fission (GO:0000266)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrion morphogenesis (GO:0070584)|necroptotic process (GO:0070266)|peroxisome fission (GO:0016559)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein secretion (GO:0050714)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein homotetramerization (GO:0051289)|protein localization to mitochondrion (GO:0070585)|regulation of mitochondrion organization (GO:0010821)|regulation of peroxisome organization (GO:1900063)|regulation of protein oligomerization (GO:0032459)|release of cytochrome c from mitochondria (GO:0001836)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)|protein complex (GO:0043234)|synapse (GO:0045202)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	23	Lung NSC(5;2.15e-06)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					GTATGCTTTTCTTCAAAAGAA	0.343																																						uc001rld.2		NA																	0				ovary(1)|pancreas(1)	2						c.(805-807)CTT>GTT		dynamin 1-like isoform 1							106.0	105.0	105.0					12																	32873662		2203	4300	6503	SO:0001583	missense	10059				cellular component disassembly involved in apoptosis|mitochondrial fragmentation involved in apoptosis|mitochondrial membrane organization|positive regulation of mitochondrial fission	cis-Golgi network|cytosol|endomembrane system|endoplasmic reticulum|mitochondrial outer membrane	GTP binding|GTPase activity|ubiquitin protein ligase binding	g.chr12:32873662C>G	AF000430	CCDS8728.1, CCDS8729.1, CCDS8730.1, CCDS61095.1, CCDS61096.1, CCDS61098.1, CCDS61099.1	12p11.21	2012-10-02			ENSG00000087470	ENSG00000087470			2973	protein-coding gene	gene with protein product		603850				9348079, 9731200	Standard	NM_012062		Approved	DRP1, DVLP, HDYNIV, DYMPLE, VPS1	uc001rld.2	O00429	OTTHUMG00000169451	ENST00000549701.1:c.805C>G	12.37:g.32873662C>G	ENSP00000450399:p.Leu269Val		Somatic				DNM1L_uc010skf.1_RNA|DNM1L_uc010skg.1_RNA|DNM1L_uc001rle.2_Missense_Mutation_p.L269V|DNM1L_uc001rlf.2_Missense_Mutation_p.L269V|DNM1L_uc010skh.1_Missense_Mutation_p.L335V|DNM1L_uc001rlg.2_Missense_Mutation_p.L335V|DNM1L_uc001rlh.2_Missense_Mutation_p.L322V|DNM1L_uc010ski.1_Missense_Mutation_p.L66V	p.L269V	NM_012062	NP_036192	WXS	Illumina HiSeq	Unspecified	O00429	DNM1L_HUMAN			8	966	+	Lung NSC(5;2.15e-06)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)		269			GTPase domain.		A8K4X9|B4DGC9|B4DSU8|J3KPI2|O14541|O60709|Q59GN9|Q7L6B3|Q8TBT7|Q9BWM1|Q9Y5J2	Missense_Mutation	SNP	ENST00000549701.1	37	c.805C>G	CCDS8729.1	.	.	.	.	.	.	.	.	.	.	C	19.67	3.870600	0.72065	.	.	ENSG00000087470	ENST00000452533;ENST00000411996;ENST00000266479;ENST00000553257;ENST00000549701;ENST00000358214;ENST00000266481;ENST00000547312;ENST00000414834;ENST00000381000;ENST00000548750	T;T;T;T;T;T;T;T;T	0.73469	-0.75;-0.75;-0.75;-0.75;-0.75;-0.75;-0.75;-0.75;-0.75	5.57	4.67	0.58626	Dynamin central domain (1);	0.000000	0.85682	D	0.000000	D	0.85978	0.5823	M	0.80183	2.485	0.58432	D	0.999991	D;D;D;D;D;D	0.89917	1.0;0.971;0.995;0.983;0.971;0.995	D;P;D;P;P;D	0.77557	0.99;0.868;0.955;0.885;0.868;0.955	D	0.87720	0.2572	10	0.87932	D	0	.	14.8305	0.70146	0.0:0.9293:0.0:0.0707	.	66;322;322;335;322;269	B4DGC9;D3DUW6;D3DUW5;F8W8D1;D3DUW7;O00429	.;.;.;.;.;DNM1L_HUMAN	V	269;335;269;282;269;282;269;269;66;282;240	ENSP00000415131:L269V;ENSP00000449089:L282V;ENSP00000450399:L269V;ENSP00000350948:L282V;ENSP00000266481:L269V;ENSP00000448610:L269V;ENSP00000404160:L66V;ENSP00000370388:L282V;ENSP00000447788:L240V	ENSP00000266479:L269V	L	+	1	0	DNM1L	32764929	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.065000	0.49994	2.630000	0.89119	0.467000	0.42956	CTT		0.343	DNM1L-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404124.1	NM_012062		11	61	0	0	0	0	11	61				
ABCD2	225	broad.mit.edu	37	12	39967597	39967597	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:39967597C>T	ENST00000308666.3	-	9	2059	c.1924G>A	c.(1924-1926)Gat>Aat	p.D642N		NM_005164.3	NP_005155.1	Q9UBJ2	ABCD2_HUMAN	ATP-binding cassette, sub-family D (ALD), member 2	642	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				fatty acid beta-oxidation (GO:0006635)|positive regulation of fatty acid beta-oxidation (GO:0032000)|transmembrane transport (GO:0055085)|very long-chain fatty acid catabolic process (GO:0042760)|very long-chain fatty acid metabolic process (GO:0000038)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(24)|ovary(2)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	52						CCTTCGACATCAATGCTGACA	0.353																																						uc001rmb.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)|central_nervous_system(1)|skin(1)	6						c.(1924-1926)GAT>AAT		ATP-binding cassette, sub-family D, member 2							118.0	103.0	108.0					12																	39967597		2203	4300	6503	SO:0001583	missense	225				fatty acid metabolic process|transport	ATP-binding cassette (ABC) transporter complex|integral to plasma membrane|peroxisomal membrane	ATP binding|ATPase activity|protein binding	g.chr12:39967597C>T	U28150	CCDS8734.1	12q12	2012-05-16			ENSG00000173208	ENSG00000173208		"""ATP binding cassette transporters / subfamily D"""	66	protein-coding gene	gene with protein product		601081		ALDL1		8577752	Standard	NM_005164		Approved	ALDR, ALDRP	uc001rmb.2	Q9UBJ2	OTTHUMG00000169337	ENST00000308666.3:c.1924G>A	12.37:g.39967597C>T	ENSP00000310688:p.Asp642Asn		Somatic					p.D642N	NM_005164	NP_005155	WXS	Illumina HiSeq	Unspecified	Q9UBJ2	ABCD2_HUMAN			9	2350	-			642			ABC transporter.		B2RAM3|Q13210|Q2M3H9	Missense_Mutation	SNP	ENST00000308666.3	37	c.1924G>A	CCDS8734.1	.	.	.	.	.	.	.	.	.	.	C	34	5.299958	0.95574	.	.	ENSG00000173208	ENST00000308666	D	0.99848	-7.14	5.03	5.03	0.67393	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.99677	0.9879	M	0.62266	1.93	0.80722	D	1	D	0.71674	0.998	P	0.61722	0.893	D	0.97964	1.0339	9	.	.	.	0.2859	18.7232	0.91703	0.0:1.0:0.0:0.0	.	642	Q9UBJ2	ABCD2_HUMAN	N	642	ENSP00000310688:D642N	.	D	-	1	0	ABCD2	38253864	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.983000	0.70540	2.482000	0.83794	0.563000	0.77884	GAT		0.353	ABCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403591.1	NM_005164		7	71	0	0	0	0	7	71				
ADAMTS20	80070	broad.mit.edu	37	12	43846363	43846363	+	Silent	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:43846363G>A	ENST00000389420.3	-	13	1895	c.1896C>T	c.(1894-1896)atC>atT	p.I632I	ADAMTS20_ENST00000553158.1_Silent_p.I632I	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	632	Cys-rich.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		GAATGCCACTGATGTCCAAAT	0.388																																						uc010skx.1		NA																	0				central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19						c.(1894-1896)ATC>ATT		a disintegrin-like and metalloprotease with							93.0	81.0	85.0					12																	43846363		2203	4299	6502	SO:0001819	synonymous_variant	80070					proteinaceous extracellular matrix	zinc ion binding	g.chr12:43846363G>A	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.1896C>T	12.37:g.43846363G>A			Somatic					p.I632I	NM_025003	NP_079279	WXS	Illumina HiSeq	Unspecified	P59510	ATS20_HUMAN		GBM - Glioblastoma multiforme(48;0.0473)	13	1896	-	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)	632			Cys-rich.		A6NNC9|J3QT00	Silent	SNP	ENST00000389420.3	37	c.1896C>T	CCDS31778.2																																																																																				0.388	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003		7	36	0	0	0	0	7	36				
HDAC7	51564	broad.mit.edu	37	12	48179624	48179624	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:48179624C>T	ENST00000427332.2	-	23	2656	c.2500G>A	c.(2500-2502)Gca>Aca	p.A834T	HDAC7_ENST00000488927.1_5'Flank|AC004466.1_ENST00000599515.1_3'UTR|HDAC7_ENST00000354334.3_Missense_Mutation_p.A836T|HDAC7_ENST00000080059.7_Missense_Mutation_p.A873T|HDAC7_ENST00000552960.1_Missense_Mutation_p.A856T|HDAC7_ENST00000380610.4_Missense_Mutation_p.A890T			Q8WUI4	HDAC7_HUMAN	histone deacetylase 7	834	Histone deacetylase.				cell-cell junction assembly (GO:0007043)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25				GBM - Glioblastoma multiforme(48;0.137)		AGCACCACTGCGCCTCCTGCC	0.602																																						uc010slo.1		NA																	0				lung(1)|breast(1)	2						c.(2617-2619)GCA>ACA		histone deacetylase 7 isoform a							50.0	39.0	43.0					12																	48179624		2203	4300	6503	SO:0001583	missense	51564				negative regulation of interleukin-2 production|negative regulation of osteoblast differentiation|positive regulation of cell migration involved in sprouting angiogenesis|transcription, DNA-dependent	cytoplasm|histone deacetylase complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein kinase C binding|repressing transcription factor binding	g.chr12:48179624C>T	AF239243	CCDS8756.2, CCDS41776.1	12q13.1	2008-02-25	2008-02-25	2008-02-25	ENSG00000061273	ENSG00000061273			14067	protein-coding gene	gene with protein product		606542	"""histone deacetylase 7A"""	HDAC7A		10922406, 10640276	Standard	NM_015401		Approved	DKFZP586J0917	uc010slo.2	Q8WUI4	OTTHUMG00000152968	ENST00000427332.2:c.2500G>A	12.37:g.48179624C>T	ENSP00000404394:p.Ala834Thr		Somatic				HDAC7_uc009zku.2_RNA|HDAC7_uc001rqe.2_Missense_Mutation_p.A307T|HDAC7_uc001rqj.3_Missense_Mutation_p.A836T|HDAC7_uc001rqk.3_Missense_Mutation_p.A856T|HDAC7_uc010slp.1_Missense_Mutation_p.A117T	p.A873T	NM_015401	NP_056216	WXS	Illumina HiSeq	Unspecified	Q8WUI4	HDAC7_HUMAN		GBM - Glioblastoma multiforme(48;0.137)	23	2812	-			834			Histone deacetylase.		B3KY08|B4DWI0|B4E0Q5|Q6P1W9|Q6W9G7|Q7Z4K2|Q7Z5I1|Q96K01|Q9BR73|Q9H7L0|Q9NW41|Q9NWA9|Q9NYK9|Q9UFU7	Missense_Mutation	SNP	ENST00000427332.2	37	c.2617G>A		.	.	.	.	.	.	.	.	.	.	C	25.0	4.587402	0.86851	.	.	ENSG00000061273	ENST00000080059;ENST00000354334;ENST00000552960;ENST00000380610;ENST00000427332	T;T;T;T;T	0.69926	-0.44;-0.44;-0.44;-0.44;-0.44	4.78	4.78	0.61160	Histone deacetylase domain (2);	0.160329	0.42548	D	0.000691	T	0.68485	0.3006	L	0.38175	1.15	0.44181	D	0.996999	D;P;D;D	0.71674	0.994;0.916;0.992;0.998	P;P;P;P	0.56343	0.796;0.693;0.693;0.785	T	0.71764	-0.4494	10	0.72032	D	0.01	.	12.6931	0.56988	0.0:0.8339:0.1661:0.0	.	834;873;856;836	Q8WUI4;Q8WUI4-5;Q8WUI4-6;Q8WUI4-7	HDAC7_HUMAN;.;.;.	T	873;836;856;890;834	ENSP00000080059:A873T;ENSP00000351326:A836T;ENSP00000448532:A856T;ENSP00000369984:A890T;ENSP00000404394:A834T	ENSP00000080059:A873T	A	-	1	0	HDAC7	46465891	0.999000	0.42202	0.265000	0.24526	0.956000	0.61745	3.331000	0.52075	2.407000	0.81776	0.543000	0.68304	GCA		0.602	HDAC7-013	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000328804.2			7	37	0	0	0	0	7	37				
DNAJC22	79962	broad.mit.edu	37	12	49742881	49742881	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:49742881C>G	ENST00000549441.2	+	3	1430	c.226C>G	c.(226-228)Ctg>Gtg	p.L76V	DNAJC22_ENST00000395069.3_Missense_Mutation_p.L76V			Q8N4W6	DJC22_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 22	76						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|liver(2)|lung(1)|ovary(1)|pancreas(1)	10						GACACCCCCTCTGAGTCCCAT	0.557																																						uc001rua.2		NA																	0				ovary(1)	1						c.(226-228)CTG>GTG		DnaJ (Hsp40) homolog, subfamily C, member 22							105.0	116.0	112.0					12																	49742881		2203	4300	6503	SO:0001583	missense	79962				protein folding	integral to membrane	heat shock protein binding|unfolded protein binding	g.chr12:49742881C>G	AK055747	CCDS8785.1	12q13.12	2011-09-02		2008-07-08	ENSG00000178401	ENSG00000178401		"""Heat shock proteins / DNAJ (HSP40)"""	25802	protein-coding gene	gene with protein product	"""wurst homolog (Drosophila)"""					17558392	Standard	NM_024902		Approved	wus, FLJ13236	uc001rua.3	Q8N4W6		ENST00000549441.2:c.226C>G	12.37:g.49742881C>G	ENSP00000446830:p.Leu76Val		Somatic				DNAJC22_uc001rub.2_Missense_Mutation_p.L76V	p.L76V	NM_024902	NP_079178	WXS	Illumina HiSeq	Unspecified	Q8N4W6	DJC22_HUMAN			2	627	+			76					B3KP54	Missense_Mutation	SNP	ENST00000549441.2	37	c.226C>G	CCDS8785.1	.	.	.	.	.	.	.	.	.	.	C	1.271	-0.613193	0.03690	.	.	ENSG00000178401	ENST00000549441;ENST00000395069	T;T	0.42131	0.98;0.98	5.16	-1.9	0.07665	.	0.803177	0.11441	N	0.563751	T	0.30103	0.0754	L	0.46157	1.445	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.20306	-1.0279	10	0.34782	T	0.22	0.0974	6.0095	0.19567	0.0:0.3572:0.345:0.2977	.	76	Q8N4W6	DJC22_HUMAN	V	76	ENSP00000446830:L76V;ENSP00000378508:L76V	ENSP00000378508:L76V	L	+	1	2	DNAJC22	48029148	0.000000	0.05858	0.001000	0.08648	0.516000	0.34256	-0.427000	0.06999	-0.611000	0.05709	-0.367000	0.07326	CTG		0.557	DNAJC22-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404302.2	NM_024902		18	123	0	0	0	0	18	123				
KCNH3	23416	broad.mit.edu	37	12	49944103	49944103	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:49944103G>A	ENST00000257981.6	+	10	2169	c.1909G>A	c.(1909-1911)Gcc>Acc	p.A637T		NM_012284.1	NP_036416.1	Q9ULD8	KCNH3_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 3	637					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36						CACCGTGCTCGCCATCCTAGG	0.622																																						uc001ruh.1		NA																	0					0						c.(1909-1911)GCC>ACC		potassium voltage-gated channel, subfamily H							66.0	60.0	62.0					12																	49944103		2203	4300	6503	SO:0001583	missense	23416				regulation of transcription, DNA-dependent	integral to membrane	two-component sensor activity|voltage-gated potassium channel activity	g.chr12:49944103G>A	AB022696	CCDS8786.1	12q13	2012-07-05				ENSG00000135519		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6252	protein-coding gene	gene with protein product		604527				10455180, 16382104	Standard	NM_012284		Approved	Kv12.2, BEC1, elk2	uc001ruh.1	Q9ULD8	OTTHUMG00000169517	ENST00000257981.6:c.1909G>A	12.37:g.49944103G>A	ENSP00000257981:p.Ala637Thr		Somatic				KCNH3_uc010smj.1_Missense_Mutation_p.A577T	p.A637T	NM_012284	NP_036416	WXS	Illumina HiSeq	Unspecified	Q9ULD8	KCNH3_HUMAN			10	2169	+			637			cNMP.|Cytoplasmic (Potential).		Q9UQ06	Missense_Mutation	SNP	ENST00000257981.6	37	c.1909G>A	CCDS8786.1	.	.	.	.	.	.	.	.	.	.	G	35	5.549491	0.96501	.	.	ENSG00000135519	ENST00000257981	D	0.92699	-3.09	5.48	5.48	0.80851	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.48286	D	0.000195	D	0.95875	0.8657	M	0.90595	3.13	0.80722	D	1	P	0.44946	0.846	P	0.53313	0.723	D	0.96399	0.9295	10	0.87932	D	0	.	17.2178	0.86949	0.0:0.0:1.0:0.0	.	637	Q9ULD8	KCNH3_HUMAN	T	637	ENSP00000257981:A637T	ENSP00000257981:A637T	A	+	1	0	KCNH3	48230370	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.869000	0.99810	2.755000	0.94549	0.655000	0.94253	GCC		0.622	KCNH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404571.2	NM_012284		10	56	0	0	0	0	10	56				
TMBIM6	7009	broad.mit.edu	37	12	50152485	50152485	+	Silent	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:50152485G>A	ENST00000267115.5	+	7	538	c.453G>A	c.(451-453)ctG>ctA	p.L151L	TMBIM6_ENST00000549385.1_Silent_p.L151L|TMBIM6_ENST00000547798.1_Silent_p.L114L|TMBIM6_ENST00000423828.1_Silent_p.L209L|TMBIM6_ENST00000395006.4_Silent_p.L151L|TMBIM6_ENST00000552699.1_Silent_p.L209L	NM_003217.2	NP_003208.2	P55061	BI1_HUMAN	transmembrane BAX inhibitor motif containing 6	151					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)				lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	6						TGTCAGCCCTGAGCTTGTTGC	0.443																																						uc001rux.2		NA																	0					0						c.(451-453)CTG>CTA		testis enhanced gene transcript (BAX inhibitor							241.0	207.0	219.0					12																	50152485		2203	4300	6503	SO:0001819	synonymous_variant	7009				apoptosis|negative regulation of apoptosis	endoplasmic reticulum|insoluble fraction|integral to plasma membrane|nucleus		g.chr12:50152485G>A	X75861	CCDS31797.1, CCDS44875.1	12q13.12	2013-10-08	2008-09-17	2008-09-17	ENSG00000139644	ENSG00000139644			11723	protein-coding gene	gene with protein product	"""BAX inhibitor 1"""	600748	"""testis enhanced gene transcript"""	TEGT		8530040, 9660918	Standard	NM_001098576		Approved	BI-1, BAXI1	uc001ruy.2	P55061	OTTHUMG00000169652	ENST00000267115.5:c.453G>A	12.37:g.50152485G>A			Somatic				TMBIM6_uc010sml.1_Intron|TMBIM6_uc001ruy.2_Silent_p.L209L|TMBIM6_uc001ruz.2_Silent_p.L151L	p.L151L	NM_003217	NP_003208	WXS	Illumina HiSeq	Unspecified	P55061	BI1_HUMAN			7	585	+			151			Helical; (Potential).		B2R5M4|F8W034|O14938|Q643A7|Q96J50	Silent	SNP	ENST00000267115.5	37	c.453G>A	CCDS31797.1																																																																																				0.443	TMBIM6-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405289.1	NM_003217		21	79	0	0	0	0	21	79				
MAP3K12	7786	broad.mit.edu	37	12	53895890	53895890	+	5'Flank	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:53895890G>A	ENST00000267079.2	-	0	0				RP11-793H13.11_ENST00000602306.1_RNA|TARBP2_ENST00000552857.1_Intron|TARBP2_ENST00000266987.2_Missense_Mutation_p.D49N|TARBP2_ENST00000394357.2_Missense_Mutation_p.D28N|TARBP2_ENST00000456234.2_Missense_Mutation_p.D28N|MAP3K12_ENST00000547151.1_5'Flank|MAP3K12_ENST00000547488.1_5'Flank|TARBP2_ENST00000549028.1_3'UTR	NM_001193511.1|NM_006301.3	NP_001180440.1|NP_006292.3	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase 12						histone phosphorylation (GO:0016572)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	37						GCCTGTGTACGACCTTCTCAA	0.592																																						uc001sdo.2		NA																	0				central_nervous_system(1)	1						c.(145-147)GAC>AAC		TAR RNA binding protein 2 isoform a							101.0	85.0	91.0					12																	53895890		2203	4300	6503	SO:0001631	upstream_gene_variant	6895				miRNA loading onto RISC involved in gene silencing by miRNA|negative regulation of defense response to virus by host|negative regulation of protein kinase activity|positive regulation of viral genome replication|pre-miRNA processing|production of siRNA involved in RNA interference|regulation of transcription from RNA polymerase II promoter|regulation of translation|regulation of viral transcription|targeting of mRNA for destruction involved in RNA interference	cytosol|nucleus|perinuclear region of cytoplasm|RNA-induced silencing complex	double-stranded RNA binding|protein homodimerization activity|siRNA binding	g.chr12:53895890G>A	U07358	CCDS8860.1, CCDS55831.1	12q13.13	2013-10-30			ENSG00000139625	ENSG00000139625		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6851	protein-coding gene	gene with protein product	"""dual leucine zipper kinase DLK"""	600447		ZPK		8037767	Standard	NM_006301		Approved	MUK, DLK, ZPKP1, MEKK12	uc001sdn.2	Q12852	OTTHUMG00000169854		12.37:g.53895890G>A	Exception_encountered		Somatic				MAP3K12_uc001sdm.1_5'Flank|MAP3K12_uc001sdn.1_5'Flank|TARBP2_uc009znb.2_Missense_Mutation_p.D49N|TARBP2_uc001sdp.2_Missense_Mutation_p.D28N|TARBP2_uc001sdq.2_5'UTR|TARBP2_uc001sdr.2_5'UTR|TARBP2_uc001sds.2_Missense_Mutation_p.D49N|TARBP2_uc001sdt.2_Missense_Mutation_p.D28N|TARBP2_uc001sdu.2_5'UTR|TARBP2_uc001sdv.2_RNA	p.D49N	NM_134323	NP_599150	WXS	Illumina HiSeq	Unspecified	Q15633	TRBP2_HUMAN			2	633	+			49			Sufficient for interaction with PRKRA.|DRBM 1.		B3KSS9|G3V1Y2|Q86VQ5|Q8WY25	Missense_Mutation	SNP	ENST00000267079.2	37	c.145G>A	CCDS8860.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.341713	0.81911	.	.	ENSG00000139546	ENST00000266987;ENST00000456234;ENST00000549610;ENST00000394357	T;T;T	0.76060	-0.99;-0.99;-0.99	3.95	2.86	0.33363	Double-stranded RNA-binding (3);Double-stranded RNA-binding-like (1);	0.167512	0.50627	N	0.000118	T	0.56746	0.2006	L	0.43701	1.375	0.58432	D	0.999998	P;B;B	0.41159	0.74;0.033;0.225	B;B;B	0.21360	0.034;0.012;0.02	T	0.58691	-0.7592	10	0.66056	D	0.02	-16.9335	8.7871	0.34827	0.1498:0.0:0.8502:0.0	.	49;49;49	F8VWR8;A8K3X2;Q15633	.;.;TRBP2_HUMAN	N	49;28;49;28	ENSP00000266987:D49N;ENSP00000416077:D28N;ENSP00000377885:D28N	ENSP00000266987:D49N	D	+	1	0	TARBP2	52182157	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.187000	0.94912	0.754000	0.32968	0.467000	0.42956	GAC		0.592	MAP3K12-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406267.1	NM_006301		13	55	0	0	0	0	13	55				
STAT2	6773	broad.mit.edu	37	12	56737683	56737683	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:56737683C>T	ENST00000314128.4	-	23	2362	c.2339G>A	c.(2338-2340)gGa>gAa	p.G780E	STAT2_ENST00000557235.1_Missense_Mutation_p.G776E|STAT2_ENST00000556539.1_5'UTR			P52630	STAT2_HUMAN	signal transducer and activator of transcription 2, 113kDa	780					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|skin(3)	31						TGATACAGGTCCTTGGTCTGG	0.517																																						uc001slc.2		NA																	0				ovary(1)|lung(1)|kidney(1)	3						c.(2338-2340)GGA>GAA		signal transducer and activator of transcription							201.0	175.0	184.0					12																	56737683		2203	4300	6503	SO:0001583	missense	6773				interspecies interaction between organisms|JAK-STAT cascade|regulation of transcription from RNA polymerase II promoter|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	cytosol|nucleoplasm|plasma membrane	calcium ion binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity	g.chr12:56737683C>T	BC051284	CCDS8917.1, CCDS55836.1	12q13.2	2013-02-14	2002-08-29			ENSG00000170581		"""SH2 domain containing"""	11363	protein-coding gene	gene with protein product		600556	"""signal transducer and activator of transcription 2, 113kD"""			7885841	Standard	NM_005419		Approved	STAT113	uc001slc.3	P52630		ENST00000314128.4:c.2339G>A	12.37:g.56737683C>T	ENSP00000315768:p.Gly780Glu		Somatic				STAT2_uc001slb.2_Missense_Mutation_p.G322E|STAT2_uc001sld.2_Missense_Mutation_p.G776E	p.G780E	NM_005419	NP_005410	WXS	Illumina HiSeq	Unspecified	P52630	STAT2_HUMAN			23	2417	-			780					B4DLC7|G3V2M6|Q16430|Q16431|Q9UDL4	Missense_Mutation	SNP	ENST00000314128.4	37	c.2339G>A	CCDS8917.1	.	.	.	.	.	.	.	.	.	.	C	0.227	-1.023974	0.02061	.	.	ENSG00000170581	ENST00000314128;ENST00000557235	D;D	0.85629	-2.01;-2.01	4.12	-2.14	0.07123	.	.	.	.	.	T	0.64549	0.2608	N	0.22421	0.69	0.09310	N	1	B;B	0.12013	0.004;0.005	B;B	0.12837	0.008;0.003	T	0.53337	-0.8453	9	0.02654	T	1	0.1786	0.9594	0.01392	0.156:0.3624:0.1654:0.3162	.	776;780	G3V2M6;P52630	.;STAT2_HUMAN	E	780;776	ENSP00000315768:G780E;ENSP00000450751:G776E	ENSP00000315768:G780E	G	-	2	0	STAT2	55023950	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.553000	0.06012	-0.374000	0.07967	-0.310000	0.09108	GGA		0.517	STAT2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410277.1	NM_005419		7	159	0	0	0	0	7	159				
SLC26A10	65012	broad.mit.edu	37	12	58019209	58019209	+	Missense_Mutation	SNP	G	G	A	rs377400696		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:58019209G>A	ENST00000320442.4	+	13	1801	c.1490G>A	c.(1489-1491)cGa>cAa	p.R497Q	SLC26A10_ENST00000490243.1_3'UTR|SLC26A10_ENST00000379218.2_3'UTR	NM_133489.2	NP_597996.2	Q8NG04	S2610_HUMAN	solute carrier family 26, member 10	497	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.					integral component of membrane (GO:0016021)	antiporter activity (GO:0015297)|sulfate transmembrane transporter activity (GO:0015116)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)	19	Melanoma(17;0.122)					AGCCGATGTCGAGATGCTAGG	0.582																																						uc001spe.2		NA																	0				large_intestine(1)|central_nervous_system(1)	2						c.(1489-1491)CGA>CAA		solute carrier family 26, member 10		G	GLN/ARG	0,4406		0,0,2203	65.0	64.0	64.0		1490	0.2	1.0	12		64	1,8599		0,1,4299	no	missense	SLC26A10	NM_133489.2	43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	497/564	58019209	1,13005	2203	4300	6503	SO:0001583	missense	65012					integral to membrane	antiporter activity	g.chr12:58019209G>A		CCDS8949.2	12q13	2013-07-18			ENSG00000135502	ENSG00000135502		"""Solute carriers"""	14470	protein-coding gene	gene with protein product							Standard	NM_133489		Approved		uc001spe.3	Q8NG04	OTTHUMG00000128505	ENST00000320442.4:c.1490G>A	12.37:g.58019209G>A	ENSP00000320217:p.Arg497Gln		Somatic				SLC26A10_uc001spf.2_RNA|SLC26A10_uc009zpz.1_Intron	p.R497Q	NM_133489	NP_597996	WXS	Illumina HiSeq	Unspecified	Q8NG04	S2610_HUMAN			13	1801	+	Melanoma(17;0.122)		497			STAS.		A6NMJ2|B6ZDQ3|Q6ZWI7	Missense_Mutation	SNP	ENST00000320442.4	37	c.1490G>A	CCDS8949.2	.	.	.	.	.	.	.	.	.	.	.	9.460	1.092932	0.20471	0.0	1.16E-4	ENSG00000135502	ENST00000320442	D	0.88124	-2.34	4.07	0.23	0.15372	Sulphate transporter/antisigma-factor antagonist STAS (4);	.	.	.	.	T	0.69251	0.3090	N	0.11201	0.11	0.58432	D	0.999996	B	0.16802	0.019	B	0.11329	0.006	T	0.50583	-0.8811	9	0.16420	T	0.52	.	6.2238	0.20695	0.6358:0.0:0.3642:0.0	.	497	Q8NG04	S2610_HUMAN	Q	497	ENSP00000320217:R497Q	ENSP00000320217:R497Q	R	+	2	0	SLC26A10	56305476	0.942000	0.31987	0.980000	0.43619	0.726000	0.41606	-0.095000	0.11077	-0.086000	0.12550	-0.140000	0.14226	CGA		0.582	SLC26A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250311.2			8	36	0	0	0	0	8	36				
THAP2	83591	broad.mit.edu	37	12	72068122	72068122	+	Missense_Mutation	SNP	C	C	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:72068122C>A	ENST00000308086.2	+	2	1712	c.211C>A	c.(211-213)Ctt>Att	p.L71I	RP11-293I14.2_ENST00000548802.1_Missense_Mutation_p.L47I	NM_031435.3	NP_113623.1	Q9H0W7	THAP2_HUMAN	THAP domain containing, apoptosis associated protein 2	71						nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	10						AACTCGACGACTTAAAATGGA	0.368																																						uc001swq.2		NA																	0				ovary(1)	1						c.(211-213)CTT>ATT		THAP domain containing, apoptosis associated							123.0	122.0	122.0					12																	72068122		2203	4300	6503	SO:0001583	missense	83591					nucleolus	DNA binding|metal ion binding	g.chr12:72068122C>A	BC008358	CCDS9001.1	12q21.1	2013-01-25				ENSG00000173451		"""THAP (C2CH-type zinc finger) domain containing"""	20854	protein-coding gene	gene with protein product		612531				12575992	Standard	NM_031435		Approved	DKFZP564I0422	uc001swq.3	Q9H0W7	OTTHUMG00000169556	ENST00000308086.2:c.211C>A	12.37:g.72068122C>A	ENSP00000310796:p.Leu71Ile		Somatic					p.L71I	NM_031435	NP_113623	WXS	Illumina HiSeq	Unspecified	Q9H0W7	THAP2_HUMAN			2	717	+			71			THAP-type.		B2R8P3	Missense_Mutation	SNP	ENST00000308086.2	37	c.211C>A	CCDS9001.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.472903	0.84640	.	.	ENSG00000173451	ENST00000308086	D	0.97976	-4.64	6.08	6.08	0.98989	Zinc finger, C2CH-type (4);	0.090330	0.43747	D	0.000532	D	0.98748	0.9579	M	0.89534	3.04	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.98630	1.0671	10	0.52906	T	0.07	.	11.4275	0.50020	0.0:0.9188:0.0:0.0812	.	71	Q9H0W7	THAP2_HUMAN	I	71	ENSP00000310796:L71I	ENSP00000310796:L71I	L	+	1	0	THAP2	70354389	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.854000	0.39368	2.890000	0.99128	0.655000	0.94253	CTT		0.368	THAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404796.1	NM_031435		15	69	1	0	2.32e-05	2.42e-05	15	69				
TPH2	121278	broad.mit.edu	37	12	72335507	72335507	+	Silent	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:72335507C>G	ENST00000333850.3	+	2	390	c.249C>G	c.(247-249)ctC>ctG	p.L83L	TPH2_ENST00000546576.1_3'UTR	NM_173353.3	NP_775489.2	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2	83	ACT. {ECO:0000255|PROSITE- ProRule:PRU01007}.				aromatic amino acid family metabolic process (GO:0009072)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to lithium ion (GO:0071285)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|response to activity (GO:0014823)|response to calcium ion (GO:0051592)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to nutrient levels (GO:0031667)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|neuron projection (GO:0043005)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|tryptophan 5-monooxygenase activity (GO:0004510)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	41					L-Tryptophan(DB00150)	CACTGAGGCTCTTTCAGGTGA	0.403																																						uc009zrw.1		NA																	0				ovary(2)|central_nervous_system(1)|skin(1)	4						c.(247-249)CTC>CTG		tryptophan hydroxylase 2	L-Tryptophan(DB00150)						120.0	121.0	121.0					12																	72335507		2203	4300	6503	SO:0001819	synonymous_variant	121278				aromatic amino acid family metabolic process|hormone biosynthetic process|serotonin biosynthetic process	cytosol	amino acid binding|iron ion binding|tryptophan 5-monooxygenase activity	g.chr12:72335507C>G	AY098914	CCDS31859.1	12q15	2008-02-07				ENSG00000139287	1.14.16.4		20692	protein-coding gene	gene with protein product		607478				12511643	Standard	NM_173353		Approved	NTPH, FLJ37295	uc009zrw.1	Q8IWU9		ENST00000333850.3:c.249C>G	12.37:g.72335507C>G			Somatic				TPH2_uc001swy.2_5'UTR	p.L83L	NM_173353	NP_775489	WXS	Illumina HiSeq	Unspecified	Q8IWU9	TPH2_HUMAN			2	390	+			83			ACT.		A6NGA4|Q14CB0	Silent	SNP	ENST00000333850.3	37	c.249C>G	CCDS31859.1																																																																																				0.403	TPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405234.1	NM_173353		9	94	0	0	0	0	9	94				
KCNC2	3747	broad.mit.edu	37	12	75437009	75437009	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:75437009G>A	ENST00000549446.1	-	5	2473	c.1793C>T	c.(1792-1794)tCc>tTc	p.S598F	KCNC2_ENST00000548513.1_Intron|KCNC2_ENST00000350228.2_Intron|RP11-81K13.1_ENST00000547040.1_RNA|KCNC2_ENST00000540018.1_Missense_Mutation_p.S543F|KCNC2_ENST00000341669.3_Intron|RP11-81K13.1_ENST00000549762.1_RNA|RP11-81K13.1_ENST00000550049.1_RNA|KCNC2_ENST00000298972.1_Intron|KCNC2_ENST00000550433.1_Intron	NM_001260497.1|NM_139137.3	NP_001247426.1|NP_631875.1	Q96PR1	KCNC2_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 2	598					action potential (GO:0001508)|energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(28)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	54					Dalfampridine(DB06637)	TAAGCTTCGGGATTTTTCATA	0.433																																						uc001sxg.1		NA																	0				breast(2)|pancreas(2)|skin(1)|lung(1)	6						c.(1792-1794)TCC>TTC		Shaw-related voltage-gated potassium channel							108.0	109.0	109.0					12																	75437009		2203	4300	6503	SO:0001583	missense	3747				energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr12:75437009G>A	AF268896	CCDS9005.1, CCDS9006.1, CCDS9007.1, CCDS58255.1, CCDS58256.1, CCDS58257.1	12q14.1	2012-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6234	protein-coding gene	gene with protein product		176256				8111118, 16382104	Standard	NM_139136		Approved	Kv3.2	uc001sxg.2	Q96PR1	OTTHUMG00000169717	ENST00000549446.1:c.1793C>T	12.37:g.75437009G>A	ENSP00000449253:p.Ser598Phe		Somatic				KCNC2_uc009zry.2_Intron|KCNC2_uc001sxe.2_Intron|KCNC2_uc001sxf.2_Intron|KCNC2_uc010stw.1_Missense_Mutation_p.S543F	p.S598F	NM_139137	NP_631875	WXS	Illumina HiSeq	Unspecified	Q96PR1	KCNC2_HUMAN			5	2337	-			598			Cytoplasmic (Potential).		B7Z231|F5H030|J3KPP5|Q4LE77|Q86W09|Q8N1V9|Q96PR0	Missense_Mutation	SNP	ENST00000549446.1	37	c.1793C>T	CCDS9007.1	.	.	.	.	.	.	.	.	.	.	G	15.04	2.715381	0.48622	.	.	ENSG00000166006	ENST00000549446;ENST00000540018	D;D	0.97924	-4.61;-4.58	6.17	5.28	0.74379	.	1.763890	0.02657	N	0.107091	D	0.96288	0.8789	L	0.39898	1.24	0.80722	D	1	B;P	0.47106	0.001;0.89	B;B	0.36719	0.001;0.231	D	0.85866	0.1413	10	0.62326	D	0.03	.	17.0431	0.86495	0.0:0.0:0.8718:0.1282	.	543;598	F5H030;Q96PR1	.;KCNC2_HUMAN	F	598;543	ENSP00000449253:S598F;ENSP00000438423:S543F	ENSP00000438423:S543F	S	-	2	0	KCNC2	73723276	1.000000	0.71417	0.991000	0.47740	0.997000	0.91878	9.869000	0.99810	1.610000	0.50200	0.655000	0.94253	TCC		0.433	KCNC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405581.2	NM_153748		5	42	0	0	0	0	5	42				
HSP90B1	7184	broad.mit.edu	37	12	104336982	104336982	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:104336982C>G	ENST00000299767.5	+	13	1957	c.1775C>G	c.(1774-1776)gCc>gGc	p.A592G		NM_003299.2	NP_003290.1	P14625	ENPL_HUMAN	heat shock protein 90kDa beta (Grp94), member 1	592					actin rod assembly (GO:0031247)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cellular response to ATP (GO:0071318)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|protein folding (GO:0006457)|protein transport (GO:0015031)|regulation of phosphoprotein phosphatase activity (GO:0043666)|response to hypoxia (GO:0001666)|sequestering of calcium ion (GO:0051208)|toll-like receptor signaling pathway (GO:0002224)	cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|low-density lipoprotein particle receptor binding (GO:0050750)|protein phosphatase binding (GO:0019903)|RNA binding (GO:0003723)|virion binding (GO:0046790)			central_nervous_system(1)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(4)	29					Rifabutin(DB00615)	CAGAATGTTGCCAAGGAAGGA	0.418																																						uc001tkb.1		NA																	0				ovary(2)|skin(1)	3						c.(1774-1776)GCC>GGC		heat shock protein 90kDa beta, member 1	Rifabutin(DB00615)						69.0	71.0	71.0					12																	104336982		2203	4300	6503	SO:0001583	missense	7184				actin rod assembly|anti-apoptosis|cellular response to ATP|ER-associated protein catabolic process|protein folding|protein transport|regulation of phosphoprotein phosphatase activity|response to hypoxia|sequestering of calcium ion	cytosol|endoplasmic reticulum lumen|endoplasmic reticulum membrane|melanosome|microsome|midbody|perinuclear region of cytoplasm	ATP binding|calcium ion binding|low-density lipoprotein particle receptor binding|protein phosphatase binding|RNA binding|unfolded protein binding|virion binding	g.chr12:104336982C>G	AY040226	CCDS9094.1	12q24.2-q24.3	2011-09-02	2006-02-24	2006-02-24		ENSG00000166598		"""Heat shock proteins / HSPC"""	12028	protein-coding gene	gene with protein product		191175	"""tumor rejection antigen (gp96) 1"""	TRA1		16269234	Standard	NM_003299		Approved	GP96, GRP94	uc001tkb.2	P14625	OTTHUMG00000170118	ENST00000299767.5:c.1775C>G	12.37:g.104336982C>G	ENSP00000299767:p.Ala592Gly		Somatic				HSP90B1_uc010swg.1_Missense_Mutation_p.A257G|HSP90B1_uc009zui.1_Intron	p.A592G	NM_003299	NP_003290	WXS	Illumina HiSeq	Unspecified	P14625	ENPL_HUMAN			13	1880	+			592					Q96A97	Missense_Mutation	SNP	ENST00000299767.5	37	c.1775C>G	CCDS9094.1	.	.	.	.	.	.	.	.	.	.	C	34	5.391012	0.95988	.	.	ENSG00000166598	ENST00000299767;ENST00000421266	T	0.10573	2.86	5.85	5.85	0.93711	Ribosomal protein S5 domain 2-type fold (1);	0.000000	0.85682	D	0.000000	T	0.41971	0.1182	M	0.88775	2.98	0.80722	D	1	D	0.59767	0.986	D	0.66084	0.941	T	0.39742	-0.9599	10	0.87932	D	0	.	20.542	0.99273	0.0:1.0:0.0:0.0	.	592	P14625	ENPL_HUMAN	G	592;342	ENSP00000299767:A592G	ENSP00000299767:A592G	A	+	2	0	HSP90B1	102861112	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.072000	0.71238	2.932000	0.99384	0.643000	0.83706	GCC		0.418	HSP90B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407349.1	NM_003299		11	68	0	0	0	0	11	68				
PWP1	11137	broad.mit.edu	37	12	108091362	108091362	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:108091362G>C	ENST00000412830.3	+	7	900	c.732G>C	c.(730-732)aaG>aaC	p.K244N	PWP1_ENST00000541166.1_Missense_Mutation_p.K182N	NM_007062.1	NP_008993.1	Q13610	PWP1_HUMAN	PWP1 homolog (S. cerevisiae)	244					transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(3)|endometrium(4)|kidney(1)|large_intestine(8)|lung(6)|urinary_tract(1)	23						AGAAGAAAAAGAAAGGAAAGA	0.378																																						uc001tmo.1		NA																	0					0						c.(730-732)AAG>AAC		periodic tryptophan protein 1							59.0	61.0	60.0					12																	108091362		2203	4300	6503	SO:0001583	missense	11137				transcription, DNA-dependent	nucleus		g.chr12:108091362G>C	BC000067	CCDS9114.1	12q23.3	2013-06-10				ENSG00000136045		"""WD repeat domain containing"""	17015	protein-coding gene	gene with protein product	"""endonuclein"""					7828893, 11850830	Standard	NM_007062		Approved	IEF-SSP-9502	uc001tmo.1	Q13610	OTTHUMG00000169913	ENST00000412830.3:c.732G>C	12.37:g.108091362G>C	ENSP00000387365:p.Lys244Asn		Somatic				PWP1_uc001tmn.1_RNA|PWP1_uc009zuu.1_Missense_Mutation_p.K244N	p.K244N	NM_007062	NP_008993	WXS	Illumina HiSeq	Unspecified	Q13610	PWP1_HUMAN			7	819	+			244					A8K3R6|Q7Z3X9	Missense_Mutation	SNP	ENST00000412830.3	37	c.732G>C	CCDS9114.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.014475	0.75161	.	.	ENSG00000136045	ENST00000412830;ENST00000258531;ENST00000546068;ENST00000538327;ENST00000541166	T;T	0.73789	-0.76;-0.78	5.88	4.99	0.66335	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.041700	0.85682	D	0.000000	D	0.84964	0.5589	M	0.86178	2.8	0.58432	D	0.999998	D	0.59357	0.985	P	0.59115	0.852	D	0.86791	0.1985	10	0.54805	T	0.06	.	13.8806	0.63680	0.0741:0.0:0.9259:0.0	.	244	Q13610	PWP1_HUMAN	N	244;244;244;244;182	ENSP00000387365:K244N;ENSP00000445249:K182N	ENSP00000258531:K244N	K	+	3	2	PWP1	106615492	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.509000	0.53386	1.482000	0.48325	0.637000	0.83480	AAG		0.378	PWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406539.1	NM_007062		11	24	0	0	0	0	11	24				
TRPV4	59341	broad.mit.edu	37	12	110252302	110252302	+	Silent	SNP	C	C	T	rs370135765		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:110252302C>T	ENST00000418703.2	-	1	394	c.300G>A	c.(298-300)aaG>aaA	p.K100K	TRPV4_ENST00000541794.1_Silent_p.K100K|TRPV4_ENST00000346520.2_Silent_p.K100K|TRPV4_ENST00000544971.1_Silent_p.K100K|TRPV4_ENST00000392719.2_Silent_p.K100K|TRPV4_ENST00000261740.2_Silent_p.K100K|TRPV4_ENST00000537083.1_Silent_p.K100K|TRPV4_ENST00000536838.1_Silent_p.K66K|TRPV4_ENST00000536570.1_5'Flank	NM_001177431.1	NP_001170902.1	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel, subfamily V, member 4	100					actin cytoskeleton reorganization (GO:0031532)|actin filament organization (GO:0007015)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cell death (GO:0008219)|cell volume homeostasis (GO:0006884)|cell-cell junction assembly (GO:0007043)|cellular calcium ion homeostasis (GO:0006874)|cellular hypotonic response (GO:0071476)|cellular response to heat (GO:0034605)|cellular response to osmotic stress (GO:0071470)|cortical microtubule organization (GO:0043622)|hyperosmotic salinity response (GO:0042538)|ion transmembrane transport (GO:0034220)|microtubule polymerization (GO:0046785)|negative regulation of neuron projection development (GO:0010977)|osmosensory signaling pathway (GO:0007231)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of microtubule depolymerization (GO:0031117)|regulation of response to osmotic stress (GO:0047484)|response to mechanical stimulus (GO:0009612)|transmembrane transport (GO:0055085)|vasopressin secretion (GO:0030103)	adherens junction (GO:0005912)|cell surface (GO:0009986)|cilium (GO:0005929)|cortical actin cytoskeleton (GO:0030864)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|beta-tubulin binding (GO:0048487)|calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)|cation channel activity (GO:0005261)|microtubule binding (GO:0008017)|osmosensor activity (GO:0005034)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(7)|ovary(3)|prostate(2)|skin(4)|stomach(1)	35						TGGGTGCTTTCTTGGGCCCAG	0.552																																						uc001tpj.1		NA																	0				ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						c.(298-300)AAG>AAA		transient receptor potential cation channel,		C	,,,,	1,4405	2.1+/-5.4	0,1,2202	75.0	71.0	73.0		300,198,300,300,300	3.7	1.0	12		73	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	TRPV4	NM_001177428.1,NM_001177431.1,NM_001177433.1,NM_021625.4,NM_147204.2	,,,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,,,	100/825,66/838,100/765,100/872,100/812	110252302	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	59341				actin cytoskeleton reorganization|actin filament organization|calcium ion import|cell death|cell volume homeostasis|cell-cell junction assembly|cellular hypotonic response|cortical microtubule organization|elevation of cytosolic calcium ion concentration|microtubule polymerization|negative regulation of neuron projection development|osmosensory signaling pathway|positive regulation of microtubule depolymerization|response to mechanical stimulus	cortical actin cytoskeleton|filopodium|focal adhesion|growth cone|integral to membrane|lamellipodium|ruffle membrane	actin filament binding|alpha-tubulin binding|beta-tubulin binding|calcium channel activity|calmodulin binding|microtubule binding|protein binding|protein kinase C binding|SH2 domain binding	g.chr12:110252302C>T	AF263523	CCDS9134.1, CCDS9135.1, CCDS53827.1, CCDS53828.1, CCDS53829.1	12q24.1	2014-09-17				ENSG00000111199		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18083	protein-coding gene	gene with protein product	"""osmosensitive transient receptor potential channel 4"""	605427				11025659, 11081638, 16382100, 20037587	Standard	NM_147204		Approved	OTRPC4, TRP12, VROAC, VRL-2, VR-OAC, CMT2C	uc001tpk.2	Q9HBA0		ENST00000418703.2:c.300G>A	12.37:g.110252302C>T			Somatic				TRPV4_uc001tpg.1_Silent_p.K66K|TRPV4_uc001tph.1_Silent_p.K100K|TRPV4_uc001tpi.1_Silent_p.K100K|TRPV4_uc001tpk.1_Silent_p.K100K|TRPV4_uc001tpl.1_Silent_p.K100K	p.K100K	NM_021625	NP_067638	WXS	Illumina HiSeq	Unspecified	Q9HBA0	TRPV4_HUMAN			1	395	-			100			Cytoplasmic (Potential).		B7ZKQ6|Q17R79|Q2Y122|Q2Y123|Q2Y124|Q86YZ6|Q8NDY7|Q8NG64|Q96Q92|Q96RS7|Q9HBC0	Silent	SNP	ENST00000418703.2	37	c.300G>A	CCDS9134.1																																																																																				0.552	TRPV4-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403270.1	NM_021625		8	40	0	0	0	0	8	40				
CUX2	23316	broad.mit.edu	37	12	111776184	111776184	+	Silent	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:111776184G>A	ENST00000261726.6	+	20	3445	c.3291G>A	c.(3289-3291)ctG>ctA	p.L1097L	RNA5SP373_ENST00000517271.1_RNA	NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	1097					cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						AGCTGAGCCTGAAGGGGCGGG	0.592																																						uc001tsa.1		NA																	0				ovary(3)|skin(2)|breast(1)	6						c.(3289-3291)CTG>CTA		cut-like 2							50.0	57.0	54.0					12																	111776184		1992	4184	6176	SO:0001819	synonymous_variant	23316					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr12:111776184G>A	AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.3291G>A	12.37:g.111776184G>A			Somatic					p.L1097L	NM_015267	NP_056082	WXS	Illumina HiSeq	Unspecified	O14529	CUX2_HUMAN			20	3444	+			1097			CUT 3.		A7E2Y4	Silent	SNP	ENST00000261726.6	37	c.3291G>A	CCDS41837.1																																																																																				0.592	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404765.1	NM_015267		13	49	0	0	0	0	13	49				
FBXO21	23014	broad.mit.edu	37	12	117627050	117627050	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:117627050C>G	ENST00000330622.5	-	2	356	c.357G>C	c.(355-357)aaG>aaC	p.K119N	FBXO21_ENST00000549689.1_5'Flank|FBXO21_ENST00000427718.2_Missense_Mutation_p.K119N			O94952	FBX21_HUMAN	F-box protein 21	119					protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	ubiquitin ligase complex (GO:0000151)	DNA binding (GO:0003677)|ubiquitin-protein transferase activity (GO:0004842)			breast(4)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|pancreas(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	29	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0291)		AAAAGAACCTCTTTGAGAACG	0.488																																					GBM(168;452 2038 13535 17701 43680)	uc001twk.2		NA																	0				kidney(1)	1						c.(355-357)AAG>AAC		F-box only protein 21 isoform 1							184.0	158.0	167.0					12																	117627050		2203	4300	6503	SO:0001583	missense	23014				ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	ubiquitin-protein ligase activity	g.chr12:117627050C>G	AB020682	CCDS9184.1, CCDS44989.1	12q24.23	2004-06-15	2004-06-15					"""F-boxes /  ""other"""""	13592	protein-coding gene	gene with protein product		609095	"""F-box only protein 21"""			10048485, 10531035	Standard	NM_033624		Approved	FBX21, KIAA0875	uc001twk.3	O94952	OTTHUMG00000169495	ENST00000330622.5:c.357G>C	12.37:g.117627050C>G	ENSP00000328187:p.Lys119Asn		Somatic				FBXO21_uc001twj.2_Missense_Mutation_p.K119N|FBXO21_uc009zwq.2_Missense_Mutation_p.K119N	p.K119N	NM_033624	NP_296373	WXS	Illumina HiSeq	Unspecified	O94952	FBX21_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.0291)	2	396	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		119					B3KMF0|Q5BJG0|Q9H087	Missense_Mutation	SNP	ENST00000330622.5	37	c.357G>C	CCDS9184.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.89|18.89	3.719988|3.719988	0.68844|0.68844	.|.	.|.	ENSG00000135108|ENSG00000135108	ENST00000550180|ENST00000427718;ENST00000257563;ENST00000535590;ENST00000330622	.|T;T	.|0.49139	.|0.79;0.79	4.95|4.95	2.66|2.66	0.31614|0.31614	.|F-box domain, Skp2-like (1);	.|0.056568	.|0.64402	.|D	.|0.000002	T|T	0.56963|0.56963	0.2021|0.2021	L|L	0.57536|0.57536	1.79|1.79	0.45979|0.45979	D|D	0.998795|0.998795	.|P;D;P	.|0.71674	.|0.915;0.998;0.764	.|P;D;B	.|0.73708	.|0.477;0.981;0.305	T|T	0.53479|0.53479	-0.8433|-0.8433	5|10	.|0.33940	.|T	.|0.23	-11.8305|-11.8305	6.8064|6.8064	0.23780|0.23780	0.0:0.6718:0.0:0.3282|0.0:0.6718:0.0:0.3282	.|.	.|35;119;119	.|Q8IUQ5;O94952;O94952-1	.|.;FBX21_HUMAN;.	Q|N	63|119;35;35;119	.|ENSP00000414468:K119N;ENSP00000328187:K119N	.|ENSP00000257563:K35N	E|K	-|-	1|3	0|2	FBXO21|FBXO21	116111433|116111433	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	1.251000|1.251000	0.32862|0.32862	1.175000|1.175000	0.42826|0.42826	0.655000|0.655000	0.94253|0.94253	GAG|AAG		0.488	FBXO21-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404409.1	NM_033624		13	85	0	0	0	0	13	85				
CIT	11113	broad.mit.edu	37	12	120204897	120204897	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:120204897C>G	ENST00000261833.7	-	18	2224	c.2172G>C	c.(2170-2172)aaG>aaC	p.K724N	CIT_ENST00000392521.2_Missense_Mutation_p.K766N|CIT_ENST00000537607.1_5'UTR	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	724					cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		TTACTTTAATCTTTTCCTCAT	0.488																																						uc001txi.1		NA																	0				ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10						c.(2170-2172)AAG>AAC		citron							241.0	226.0	231.0					12																	120204897		2203	4300	6503	SO:0001583	missense	11113				intracellular signal transduction		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity	g.chr12:120204897C>G	AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.2172G>C	12.37:g.120204897C>G	ENSP00000261833:p.Lys724Asn		Somatic				CIT_uc001txh.1_Missense_Mutation_p.K258N|CIT_uc001txj.1_Missense_Mutation_p.K766N	p.K724N	NM_007174	NP_009105	WXS	Illumina HiSeq	Unspecified	O14578	CTRO_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.211)	18	2225	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)	724			Potential.		Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Missense_Mutation	SNP	ENST00000261833.7	37	c.2172G>C	CCDS9192.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.00|14.00	2.404714|2.404714	0.42613|0.42613	.|.	.|.	ENSG00000122966|ENSG00000122966	ENST00000392521;ENST00000261833|ENST00000392520	T;T|.	0.79940|.	-1.32;-0.27|.	5.98|5.98	2.2|2.2	0.27929|0.27929	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.41858|0.41858	0.1177|0.1177	L|L	0.27053|0.27053	0.805|0.805	0.51482|0.51482	D|D	0.999926|0.999926	P;P;B|.	0.41366|.	0.747;0.535;0.241|.	B;B;B|.	0.40375|.	0.327;0.247;0.127|.	T|T	0.08576|0.08576	-1.0715|-1.0715	10|5	0.44086|.	T|.	0.13|.	.|.	9.0413|9.0413	0.36319|0.36319	0.0:0.3663:0.0:0.6337|0.0:0.3663:0.0:0.6337	.|.	766;724;257|.	Q2M5E1;O14578;O14578-3|.	.;CTRO_HUMAN;.|.	N|T	766;724|352	ENSP00000376306:K766N;ENSP00000261833:K724N|.	ENSP00000261833:K724N|.	K|R	-|-	3|2	2|0	CIT|CIT	118689280|118689280	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.697000|0.697000	0.40408|0.40408	1.405000|1.405000	0.34635|0.34635	0.167000|0.167000	0.19631|0.19631	-0.300000|-0.300000	0.09419|0.09419	AAG|AGA		0.488	CIT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259410.4	NM_007174		30	164	0	0	0	0	30	164				
SBNO1	55206	broad.mit.edu	37	12	123804454	123804454	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:123804454C>G	ENST00000602398.1	-	20	2919	c.2792G>C	c.(2791-2793)gGa>gCa	p.G931A	SBNO1_ENST00000602750.1_Missense_Mutation_p.G930A|SBNO1_ENST00000420886.2_Missense_Mutation_p.G931A|SBNO1_ENST00000267176.4_Missense_Mutation_p.G930A			A3KN83	SBNO1_HUMAN	strawberry notch homolog 1 (Drosophila)	931					regulation of transcription, DNA-templated (GO:0006355)					NS(2)|breast(6)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(11)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(2)	62	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		TACCTTATCTCCATCCATAAA	0.338																																						uc010tap.1		NA																	0				breast(5)|skin(2)|ovary(1)|kidney(1)	9						c.(2791-2793)GGA>GCA		sno, strawberry notch homolog 1							166.0	147.0	153.0					12																	123804454		2203	4300	6503	SO:0001583	missense	55206						ATP binding|DNA binding|hydrolase activity	g.chr12:123804454C>G	AK001563	CCDS9246.1, CCDS53844.1	12q24.31	2006-10-06	2006-10-06			ENSG00000139697			22973	protein-coding gene	gene with protein product		614274	"""sno, strawberry notch homolog 1 (Drosophila)"""				Standard	NM_018183		Approved	MOP3, FLJ10701, FLJ10833, Sno	uc010tap.2	A3KN83		ENST00000602398.1:c.2792G>C	12.37:g.123804454C>G	ENSP00000473665:p.Gly931Ala		Somatic				SBNO1_uc010tao.1_Missense_Mutation_p.G930A|SBNO1_uc010taq.1_Intron	p.G931A	NM_018183	NP_060653	WXS	Illumina HiSeq	Unspecified	A3KN83	SBNO1_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)	19	2792	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)		931					Q05C06|Q3ZTS3|Q9H3T8|Q9NVB2	Missense_Mutation	SNP	ENST00000602398.1	37	c.2792G>C	CCDS53844.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.799778	0.90538	.	.	ENSG00000139697	ENST00000420886;ENST00000267176	T;T	0.81330	-1.48;-1.48	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	D	0.93096	0.7802	H	0.94964	3.605	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.91635	0.999;0.998	D	0.94377	0.7601	10	0.87932	D	0	-26.203	19.8804	0.96895	0.0:1.0:0.0:0.0	.	931;930	A3KN83;A3KN83-2	SBNO1_HUMAN;.	A	931;930	ENSP00000387361:G931A;ENSP00000267176:G930A	ENSP00000267176:G930A	G	-	2	0	SBNO1	122370407	1.000000	0.71417	1.000000	0.80357	0.840000	0.47671	7.800000	0.85949	2.684000	0.91462	0.563000	0.77884	GGA		0.338	SBNO1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467684.1	NM_018183		6	41	0	0	0	0	6	41				
SBNO1	55206	broad.mit.edu	37	12	123805101	123805101	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:123805101C>T	ENST00000602398.1	-	19	2672	c.2545G>A	c.(2545-2547)Gaa>Aaa	p.E849K	SBNO1_ENST00000602750.1_Missense_Mutation_p.E848K|SBNO1_ENST00000420886.2_Missense_Mutation_p.E849K|SBNO1_ENST00000267176.4_Missense_Mutation_p.E848K			A3KN83	SBNO1_HUMAN	strawberry notch homolog 1 (Drosophila)	849					regulation of transcription, DNA-templated (GO:0006355)					NS(2)|breast(6)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(11)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(2)	62	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		TGAGCCCTTTCCACAGCATCC	0.383																																						uc010tap.1		NA																	0				breast(5)|skin(2)|ovary(1)|kidney(1)	9						c.(2545-2547)GAA>AAA		sno, strawberry notch homolog 1							142.0	141.0	141.0					12																	123805101		2203	4300	6503	SO:0001583	missense	55206						ATP binding|DNA binding|hydrolase activity	g.chr12:123805101C>T	AK001563	CCDS9246.1, CCDS53844.1	12q24.31	2006-10-06	2006-10-06			ENSG00000139697			22973	protein-coding gene	gene with protein product		614274	"""sno, strawberry notch homolog 1 (Drosophila)"""				Standard	NM_018183		Approved	MOP3, FLJ10701, FLJ10833, Sno	uc010tap.2	A3KN83		ENST00000602398.1:c.2545G>A	12.37:g.123805101C>T	ENSP00000473665:p.Glu849Lys		Somatic				SBNO1_uc010tao.1_Missense_Mutation_p.E848K|SBNO1_uc010taq.1_Intron	p.E849K	NM_018183	NP_060653	WXS	Illumina HiSeq	Unspecified	A3KN83	SBNO1_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)	18	2545	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)		849			Potential.		Q05C06|Q3ZTS3|Q9H3T8|Q9NVB2	Missense_Mutation	SNP	ENST00000602398.1	37	c.2545G>A	CCDS53844.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.484469	0.84854	.	.	ENSG00000139697	ENST00000420886;ENST00000267176	T;T	0.33438	1.41;1.41	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.44138	0.1279	L	0.58101	1.795	0.80722	D	1	P;D	0.54207	0.941;0.965	P;P	0.50970	0.453;0.655	T	0.09378	-1.0677	10	0.30854	T	0.27	-31.8312	19.8879	0.96917	0.0:1.0:0.0:0.0	.	849;848	A3KN83;A3KN83-2	SBNO1_HUMAN;.	K	849;848	ENSP00000387361:E849K;ENSP00000267176:E848K	ENSP00000267176:E848K	E	-	1	0	SBNO1	122371054	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.740000	0.84986	2.693000	0.91896	0.655000	0.94253	GAA		0.383	SBNO1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467684.1	NM_018183		30	118	0	0	0	0	30	118				
SBNO1	55206	broad.mit.edu	37	12	123810101	123810101	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:123810101C>T	ENST00000602398.1	-	15	2048	c.1921G>A	c.(1921-1923)Gaa>Aaa	p.E641K	SBNO1_ENST00000602750.1_Missense_Mutation_p.E640K|SBNO1_ENST00000420886.2_Missense_Mutation_p.E641K|SBNO1_ENST00000267176.4_Missense_Mutation_p.E640K			A3KN83	SBNO1_HUMAN	strawberry notch homolog 1 (Drosophila)	641					regulation of transcription, DNA-templated (GO:0006355)					NS(2)|breast(6)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(11)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(2)	62	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		TCCAAAGCTTCTAATGTTCTA	0.343																																						uc010tap.1		NA																	0				breast(5)|skin(2)|ovary(1)|kidney(1)	9						c.(1921-1923)GAA>AAA		sno, strawberry notch homolog 1							169.0	177.0	174.0					12																	123810101		2203	4300	6503	SO:0001583	missense	55206						ATP binding|DNA binding|hydrolase activity	g.chr12:123810101C>T	AK001563	CCDS9246.1, CCDS53844.1	12q24.31	2006-10-06	2006-10-06			ENSG00000139697			22973	protein-coding gene	gene with protein product		614274	"""sno, strawberry notch homolog 1 (Drosophila)"""				Standard	NM_018183		Approved	MOP3, FLJ10701, FLJ10833, Sno	uc010tap.2	A3KN83		ENST00000602398.1:c.1921G>A	12.37:g.123810101C>T	ENSP00000473665:p.Glu641Lys		Somatic				SBNO1_uc010tao.1_Missense_Mutation_p.E640K|SBNO1_uc010taq.1_Intron|SBNO1_uc001uet.2_Missense_Mutation_p.E641K|SBNO1_uc001ueu.2_Missense_Mutation_p.E640K|SBNO1_uc001uev.2_Missense_Mutation_p.E639K|SBNO1_uc009zxy.1_Missense_Mutation_p.E606K	p.E641K	NM_018183	NP_060653	WXS	Illumina HiSeq	Unspecified	A3KN83	SBNO1_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)	14	1921	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)		641					Q05C06|Q3ZTS3|Q9H3T8|Q9NVB2	Missense_Mutation	SNP	ENST00000602398.1	37	c.1921G>A	CCDS53844.1	.	.	.	.	.	.	.	.	.	.	C	34	5.340045	0.95783	.	.	ENSG00000139697	ENST00000420886;ENST00000267176;ENST00000442601	T;T	0.33654	1.4;1.4	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.60586	0.2280	M	0.67569	2.06	0.80722	D	1	P;P;D	0.67145	0.949;0.928;0.996	P;P;D	0.76071	0.715;0.79;0.987	T	0.62383	-0.6866	10	0.59425	D	0.04	-33.8952	19.0116	0.92875	0.0:1.0:0.0:0.0	.	641;640;639	A3KN83;A3KN83-2;A3KN83-3	SBNO1_HUMAN;.;.	K	641;640;640	ENSP00000387361:E641K;ENSP00000267176:E640K	ENSP00000267176:E640K	E	-	1	0	SBNO1	122376054	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.811000	0.86092	2.474000	0.83562	0.650000	0.86243	GAA		0.343	SBNO1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467684.1	NM_018183		31	204	0	0	0	0	31	204				
TMEM132D	121256	broad.mit.edu	37	12	129558534	129558534	+	Missense_Mutation	SNP	C	C	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:129558534C>A	ENST00000422113.2	-	9	3512	c.3186G>T	c.(3184-3186)agG>agT	p.R1062S	TMEM132D_ENST00000389441.4_Missense_Mutation_p.R600S	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	1062					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		CGATGGAGTTCCTGGTGGGGT	0.517																																						uc009zyl.1		NA																	0				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14						c.(3184-3186)AGG>AGT		transmembrane protein 132D precursor							159.0	153.0	155.0					12																	129558534		2203	4300	6503	SO:0001583	missense	121256					integral to membrane		g.chr12:129558534C>A	AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.3186G>T	12.37:g.129558534C>A	ENSP00000408581:p.Arg1062Ser		Somatic				TMEM132D_uc001uia.2_Missense_Mutation_p.R600S	p.R1062S	NM_133448	NP_597705	WXS	Illumina HiSeq	Unspecified	Q14C87	T132D_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)	9	3514	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)	1062			Cytoplasmic (Potential).		Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	ENST00000422113.2	37	c.3186G>T	CCDS9266.1	.	.	.	.	.	.	.	.	.	.	C	9.200	1.028192	0.19512	.	.	ENSG00000151952	ENST00000389441;ENST00000422113	T;T	0.09073	3.02;3.83	4.16	0.334	0.15948	.	0.845994	0.09975	N	0.731741	T	0.03477	0.0100	N	0.08118	0	0.09310	N	1	B;B	0.17465	0.022;0.002	B;B	0.15870	0.014;0.0	T	0.47249	-0.9132	9	.	.	.	-1.4604	3.5094	0.07703	0.1802:0.2827:0.4378:0.0992	.	1062;600	Q14C87;Q14C87-2	T132D_HUMAN;.	S	600;1062	ENSP00000374092:R600S;ENSP00000408581:R1062S	.	R	-	3	2	TMEM132D	128124487	0.018000	0.18449	0.000000	0.03702	0.049000	0.14656	0.459000	0.21908	0.296000	0.22592	0.563000	0.77884	AGG		0.517	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448		23	111	1	0	2.4e-15	2.57e-15	23	111				
TMEM132D	121256	broad.mit.edu	37	12	130184842	130184842	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:130184842C>T	ENST00000422113.2	-	2	807	c.481G>A	c.(481-483)Gcc>Acc	p.A161T	RP11-174M13.2_ENST00000544036.1_lincRNA	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	161					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		TTCTCCCCGGCGCTGCGGTCG	0.642																																						uc009zyl.1		NA																	0				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14						c.(481-483)GCC>ACC		transmembrane protein 132D precursor							21.0	22.0	22.0					12																	130184842		2203	4300	6503	SO:0001583	missense	121256					integral to membrane		g.chr12:130184842C>T	AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.481G>A	12.37:g.130184842C>T	ENSP00000408581:p.Ala161Thr		Somatic					p.A161T	NM_133448	NP_597705	WXS	Illumina HiSeq	Unspecified	Q14C87	T132D_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)	2	809	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)	161			Extracellular (Potential).		Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	ENST00000422113.2	37	c.481G>A	CCDS9266.1	.	.	.	.	.	.	.	.	.	.	C	4.892	0.165772	0.09339	.	.	ENSG00000151952	ENST00000422113	T	0.11712	2.75	5.33	-3.75	0.04372	.	6.172450	0.00447	N	0.000088	T	0.06962	0.0177	N	0.13098	0.295	0.09310	N	1	B	0.13145	0.007	B	0.08055	0.003	T	0.34750	-0.9816	9	.	.	.	-5.3276	10.2169	0.43173	0.0:0.2696:0.4808:0.2495	.	161	Q14C87	T132D_HUMAN	T	161	ENSP00000408581:A161T	.	A	-	1	0	TMEM132D	128750795	0.000000	0.05858	0.000000	0.03702	0.109000	0.19521	-0.842000	0.04354	-0.576000	0.05974	-1.006000	0.02489	GCC		0.642	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448		3	22	0	0	0	0	3	22				
ULK1	8408	broad.mit.edu	37	12	132404537	132404537	+	Silent	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:132404537G>A	ENST00000321867.4	+	26	3168	c.2817G>A	c.(2815-2817)ctG>ctA	p.L939L	ULK1_ENST00000540647.1_Silent_p.L184L	NM_003565.2	NP_003556	O75385	ULK1_HUMAN	unc-51 like autophagy activating kinase 1	939					autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|cellular response to nutrient levels (GO:0031669)|cerebellar granule cell differentiation (GO:0021707)|negative regulation of collateral sprouting (GO:0048671)|neuron projection development (GO:0031175)|neuron projection regeneration (GO:0031102)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|protein autophosphorylation (GO:0046777)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|radial glia guided migration of cerebellar granule cell (GO:0021933)|Ras protein signal transduction (GO:0007265)|receptor internalization (GO:0031623)|regulation of autophagy (GO:0010506)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|response to starvation (GO:0042594)	ATG1/UKL1 signaling complex (GO:0034273)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extrinsic component of autophagic vacuole membrane (GO:0097635)|extrinsic component of omegasome membrane (GO:0097629)|extrinsic component of pre-autophagosomal structure membrane (GO:0097632)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)	ATP binding (GO:0005524)|protein complex binding (GO:0032403)|protein serine/threonine kinase activity (GO:0004674)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	29	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		TGCGCAGGCTGAATGAGCTGT	0.647																																						uc001uje.2		NA																	0				ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4						c.(2815-2817)CTG>CTA		Unc-51-like kinase 1							55.0	58.0	57.0					12																	132404537		2203	4299	6502	SO:0001819	synonymous_variant	8408				autophagy|protein localization|regulation of autophagy	autophagic vacuole|cytosol|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	ATP binding|protein complex binding|protein serine/threonine kinase activity	g.chr12:132404537G>A	AF045458	CCDS9274.1	12q24.3	2014-02-12	2013-07-02		ENSG00000177169	ENSG00000177169			12558	protein-coding gene	gene with protein product	"""ATG1 autophagy related 1 homolog (S. cerevisiae)"""	603168	"""unc-51 (C. elegans)-like kinase 1"", ""unc-51-like kinase 1 (C. elegans)"""			9693035	Standard	NM_003565		Approved	ATG1, ATG1A	uc001uje.3	O75385	OTTHUMG00000168052	ENST00000321867.4:c.2817G>A	12.37:g.132404537G>A			Somatic					p.L939L	NM_003565	NP_003556	WXS	Illumina HiSeq	Unspecified	O75385	ULK1_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)	26	3085	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)		939					Q9UQ28	Silent	SNP	ENST00000321867.4	37	c.2817G>A	CCDS9274.1																																																																																				0.647	ULK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397769.3			5	44	0	0	0	0	5	44				
EP400	57634	broad.mit.edu	37	12	132498089	132498089	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:132498089C>T	ENST00000333577.4	+	19	3883	c.3774C>T	c.(3772-3774)ctC>ctT	p.L1258L	EP400_ENST00000389561.2_Silent_p.L1222L|EP400_ENST00000389562.2_Silent_p.L1221L|EP400_ENST00000332482.4_Silent_p.L1185L|EP400_ENST00000330386.6_Silent_p.L1222L			Q96L91	EP400_HUMAN	E1A binding protein p400	1258	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.|Interactions with RUVBL1 and RUVBL2.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		TCCTGGAGCTCTGGACCATGG	0.572																																						uc001ujn.2		NA																	0				central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12						c.(3664-3666)CTC>CTT		E1A binding protein p400							86.0	85.0	85.0					12																	132498089		2203	4300	6503	SO:0001819	synonymous_variant	57634				histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity	g.chr12:132498089C>T	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.3774C>T	12.37:g.132498089C>T			Somatic				EP400_uc001ujl.2_Silent_p.L1221L|EP400_uc001ujm.2_Silent_p.L1222L	p.L1222L	NM_015409	NP_056224	WXS	Illumina HiSeq	Unspecified	Q96L91	EP400_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)	17	3701	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)	1258			Interactions with RUVBL1 and RUVBL2.|Helicase ATP-binding.		O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37	c.3666C>T																																																																																					0.572	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409		13	86	0	0	0	0	13	86				
GOLGA3	2802	broad.mit.edu	37	12	133358996	133358996	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:133358996C>T	ENST00000450791.2	-	16	3534	c.3351G>A	c.(3349-3351)gaG>gaA	p.E1117E	GOLGA3_ENST00000204726.3_Silent_p.E1117E|GOLGA3_ENST00000456883.2_Silent_p.E1117E			Q08378	GOGA3_HUMAN	golgin A3	1117					intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		GCTTCCCTTTCTCGTGCTCTA	0.493																																						uc001ukz.1		NA																	0				ovary(3)|central_nervous_system(2)|pancreas(1)	6						c.(3349-3351)GAG>GAA		Golgi autoantigen, golgin subfamily a, 3							206.0	194.0	198.0					12																	133358996		2203	4300	6503	SO:0001819	synonymous_variant	2802				intra-Golgi vesicle-mediated transport	Golgi cisterna membrane|Golgi transport complex	protein binding|transporter activity	g.chr12:133358996C>T	AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.3351G>A	12.37:g.133358996C>T			Somatic				GOLGA3_uc001ula.1_Silent_p.E1117E	p.E1117E	NM_005895	NP_005886	WXS	Illumina HiSeq	Unspecified	Q08378	GOGA3_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)	17	3910	-	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)	1117			Potential.		A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Silent	SNP	ENST00000450791.2	37	c.3351G>A	CCDS9281.1																																																																																				0.493	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397569.2	NM_005895		33	157	0	0	0	0	33	157				
ATP12A	479	broad.mit.edu	37	13	25263408	25263408	+	Silent	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr13:25263408G>A	ENST00000381946.3	+	5	608	c.441G>A	c.(439-441)ttG>ttA	p.L147L	ATP12A_ENST00000218548.6_Silent_p.L147L			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	147					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		AGGTGTACTTGGGCTGTGTGC	0.532																																					Pancreas(156;1582 1935 18898 22665 26498)	uc001upp.2		NA																	0				ovary(2)|central_nervous_system(2)|large_intestine(1)|breast(1)	6						c.(439-441)TTG>TTA		hydrogen/potassium-exchanging ATPase 12A	Esomeprazole(DB00736)|Pantoprazole(DB00213)						195.0	183.0	187.0					13																	25263408		2203	4300	6503	SO:0001819	synonymous_variant	479				ATP biosynthetic process	hydrogen:potassium-exchanging ATPase complex	ATP binding|hydrogen:potassium-exchanging ATPase activity|metal ion binding	g.chr13:25263408G>A	L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.441G>A	13.37:g.25263408G>A			Somatic				ATP12A_uc010aaa.2_Silent_p.L147L	p.L147L	NM_001676	NP_001667	WXS	Illumina HiSeq	Unspecified	P54707	AT12A_HUMAN		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)	5	628	+		Lung SC(185;0.0225)|Breast(139;0.077)	147			Helical; (Potential).		Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Silent	SNP	ENST00000381946.3	37	c.441G>A	CCDS31948.1																																																																																				0.532	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044199.1	NM_001676		19	187	0	0	0	0	19	187				
PROSER1	80209	broad.mit.edu	37	13	39588581	39588581	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr13:39588581G>C	ENST00000352251.3	-	11	1641	c.808C>G	c.(808-810)Cct>Gct	p.P270A	PROSER1_ENST00000484434.3_Intron|PROSER1_ENST00000350125.3_Missense_Mutation_p.P248A	NM_025138.4	NP_079414.3	Q86XN7	PRSR1_HUMAN	proline and serine rich 1	270	Pro-rich.																GAACCATGAGGAGAAAAGAGT	0.433																																						uc001uwy.2		NA																	0				ovary(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)	5						c.(808-810)CCT>GCT		hypothetical protein LOC80209 isoform 1							74.0	68.0	70.0					13																	39588581		2203	4300	6503	SO:0001583	missense	80209							g.chr13:39588581G>C	AK022723	CCDS9368.2	13q13.2	2011-08-09	2011-08-09	2011-08-09	ENSG00000120685	ENSG00000120685			20291	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 23"""	C13orf23			Standard	NM_025138		Approved	bA50D16.2, FLJ12661	uc001uwy.4	Q86XN7	OTTHUMG00000016764	ENST00000352251.3:c.808C>G	13.37:g.39588581G>C	ENSP00000332034:p.Pro270Ala		Somatic				C13orf23_uc001uwz.2_Missense_Mutation_p.P248A	p.P270A	NM_025138	NP_079414	WXS	Illumina HiSeq	Unspecified	Q86XN7	CM023_HUMAN		all cancers(112;3.7e-08)|Epithelial(112;4.28e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00114)|BRCA - Breast invasive adenocarcinoma(63;0.00366)|GBM - Glioblastoma multiforme(144;0.0146)	11	1681	-		Lung NSC(96;6.01e-07)|Breast(139;0.00394)|Prostate(109;0.00676)|Lung SC(185;0.0548)|Hepatocellular(188;0.114)	270			Pro-rich.		A6NJ97|Q6P2S2|Q7Z3X5|Q8N3D2|Q8N3P1|Q9H9M1	Missense_Mutation	SNP	ENST00000352251.3	37	c.808C>G	CCDS9368.2	.	.	.	.	.	.	.	.	.	.	G	21.8	4.206673	0.79127	.	.	ENSG00000120685	ENST00000352251;ENST00000350125	T;T	0.63417	-0.0;-0.04	5.09	5.09	0.68999	.	.	.	.	.	T	0.76948	0.4059	M	0.61703	1.905	0.51767	D	0.999933	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.996	T	0.76416	-0.2967	8	.	.	.	-21.3215	17.4692	0.87641	0.0:0.0:1.0:0.0	.	248;270	A6NJ97;Q86XN7	.;PRSR1_HUMAN	A	270;248	ENSP00000332034:P270A;ENSP00000339123:P248A	.	P	-	1	0	PROSER1	38486581	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.450000	0.66626	2.361000	0.80049	0.650000	0.86243	CCT		0.433	PROSER1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044607.5	NM_025138		5	31	0	0	0	0	5	31				
FNDC3A	22862	broad.mit.edu	37	13	49771891	49771891	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr13:49771891G>A	ENST00000492622.2	+	21	2676	c.2371G>A	c.(2371-2373)Gaa>Aaa	p.E791K	FNDC3A_ENST00000541916.1_Missense_Mutation_p.E791K|FNDC3A_ENST00000398316.3_Missense_Mutation_p.E735K	NM_001079673.1	NP_001073141.1	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A	791	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				fertilization (GO:0009566)|Sertoli cell development (GO:0060009)|single organismal cell-cell adhesion (GO:0016337)|spermatid development (GO:0007286)	acrosomal vesicle (GO:0001669)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|prostate(5)|skin(2)|urinary_tract(1)	41		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)		AGATGTCACTGAATATCGACT	0.388																																						uc001vcm.2		NA																	0				lung(2)	2						c.(2371-2373)GAA>AAA		fibronectin type III domain containing 3A							134.0	138.0	137.0					13																	49771891		2203	4300	6503	SO:0001583	missense	22862					Golgi membrane|integral to membrane		g.chr13:49771891G>A	AB023187	CCDS9413.2, CCDS41886.1	13q14.12	2013-02-11	2005-01-20	2005-01-22	ENSG00000102531	ENSG00000102531		"""Fibronectin type III domain containing"""	20296	protein-coding gene	gene with protein product		615794	"""fibronectin type III domain containing 3"""	FNDC3			Standard	NM_001079673		Approved	bA203I16.5, KIAA0970	uc001vcm.3	Q9Y2H6	OTTHUMG00000016911	ENST00000492622.2:c.2371G>A	13.37:g.49771891G>A	ENSP00000417257:p.Glu791Lys		Somatic				FNDC3A_uc001vcn.2_Missense_Mutation_p.E791K|FNDC3A_uc001vco.2_RNA|FNDC3A_uc001vcq.2_Missense_Mutation_p.E735K	p.E791K	NM_001079673	NP_001073141	WXS	Illumina HiSeq	Unspecified	Q9Y2H6	FND3A_HUMAN	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)	21	2676	+		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	791			Fibronectin type-III 6.		B4DYG1|Q5HYC9|Q5JVF8|Q5JVF9|Q6EVH3|Q6EVH4|Q6N020|Q6P9D5|Q6ZME4|Q9H1W1	Missense_Mutation	SNP	ENST00000492622.2	37	c.2371G>A	CCDS41886.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.501830	0.85176	.	.	ENSG00000102531	ENST00000492622;ENST00000337156;ENST00000541916;ENST00000398316	T;T;T	0.55760	0.5;0.5;0.5	5.76	5.76	0.90799	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.075955	0.53938	D	0.000059	T	0.69620	0.3131	L	0.60067	1.865	0.80722	D	1	D;P	0.76494	0.999;0.903	D;P	0.68483	0.958;0.744	T	0.67585	-0.5633	10	0.46703	T	0.11	-23.1892	18.9545	0.92653	0.0:0.0:1.0:0.0	.	735;791	Q9Y2H6-2;Q9Y2H6	.;FND3A_HUMAN	K	791;727;791;735	ENSP00000417257:E791K;ENSP00000441831:E791K;ENSP00000381362:E735K	ENSP00000338579:E727K	E	+	1	0	FNDC3A	48669892	1.000000	0.71417	0.999000	0.59377	0.745000	0.42441	9.230000	0.95299	2.724000	0.93272	0.650000	0.86243	GAA		0.388	FNDC3A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354845.2	NM_014923		21	73	0	0	0	0	21	73				
RBM26	64062	broad.mit.edu	37	13	79952987	79952987	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr13:79952987C>G	ENST00000438737.2	-	2	567	c.127G>C	c.(127-129)Gac>Cac	p.D43H	RBM26_ENST00000267229.7_Missense_Mutation_p.D43H|RBM26_ENST00000438724.1_Missense_Mutation_p.D43H			Q5T8P6	RBM26_HUMAN	RNA binding motif protein 26	43					mRNA processing (GO:0006397)|negative regulation of phosphatase activity (GO:0010923)		metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(6)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	33		Acute lymphoblastic leukemia(28;0.0279)		GBM - Glioblastoma multiforme(99;0.0188)		TCACTTTTGTCTTTCTTTACC	0.328																																						uc001vkz.2		NA																	0				ovary(1)	1						c.(127-129)GAC>CAC		RNA binding motif protein 26							97.0	87.0	91.0					13																	79952987		2203	4300	6503	SO:0001583	missense	64062				mRNA processing		nucleotide binding|protein binding|RNA binding|zinc ion binding	g.chr13:79952987C>G	AF116667	CCDS9462.1, CCDS66566.1, CCDS73591.1	13q31.1	2014-06-13	2006-06-22	2006-06-22	ENSG00000139746	ENSG00000139746		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	20327	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 2"", ""protein phosphatase 1, regulatory 132"""		"""chromosome 13 open reading frame 10"""	C13orf10		11149944, 15741184	Standard	XM_005266497		Approved	PRO1777, SE70-2, FLJ20957, ZC3H17, ARRS2, PPP1R132	uc001vky.2	Q5T8P6	OTTHUMG00000017133	ENST00000438737.2:c.127G>C	13.37:g.79952987C>G	ENSP00000387531:p.Asp43His		Somatic				RBM26_uc001vky.2_Missense_Mutation_p.D43H|RBM26_uc001vla.2_Missense_Mutation_p.D43H|RBM26_uc001vlc.1_Missense_Mutation_p.D43H	p.D43H	NM_022118	NP_071401	WXS	Illumina HiSeq	Unspecified	Q5T8P6	RBM26_HUMAN		GBM - Glioblastoma multiforme(99;0.0188)	2	141	-		Acute lymphoblastic leukemia(28;0.0279)	43					B4DZE0|Q2NKM2|Q2NKQ2|Q5CZH8|Q5T8P5|Q5T8P8|Q5U5P5|Q5W0G7|Q8N3H5|Q96K92|Q96SZ3|Q9H2F8|Q9H7F9|Q9P1G7	Missense_Mutation	SNP	ENST00000438737.2	37	c.127G>C		.	.	.	.	.	.	.	.	.	.	C	21.7	4.191550	0.78902	.	.	ENSG00000139746	ENST00000267229;ENST00000438737;ENST00000327303;ENST00000438724	T;T	0.47869	0.83;0.83	5.78	5.78	0.91487	Splicing factor PWI (2);	0.000000	0.85682	D	0.000000	T	0.76399	0.3982	M	0.90650	3.135	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.998;0.999;0.998	T	0.79659	-0.1711	9	.	.	.	-10.9574	20.0118	0.97458	0.0:1.0:0.0:0.0	.	43;43;43;43	Q5T8P6-6;Q5T8P6-2;Q5T8P6;Q5T8P6-3	.;.;RBM26_HUMAN;.	H	43;44;43;43	ENSP00000267229:D43H;ENSP00000390222:D43H	.	D	-	1	0	RBM26	78850988	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.742000	0.94016	0.650000	0.86243	GAC		0.328	RBM26-004	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000045373.4	NM_022118		4	27	0	0	0	0	4	27				
NPAS3	64067	broad.mit.edu	37	14	34145537	34145537	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr14:34145537G>A	ENST00000356141.4	+	6	679	c.679G>A	c.(679-681)Gag>Aag	p.E227K	NPAS3_ENST00000551492.1_Missense_Mutation_p.E232K|NPAS3_ENST00000547068.1_Missense_Mutation_p.E123K|NPAS3_ENST00000346562.2_Missense_Mutation_p.E195K|NPAS3_ENST00000548645.1_Missense_Mutation_p.E197K|NPAS3_ENST00000357798.5_Missense_Mutation_p.E214K|NPAS3_ENST00000551008.1_Missense_Mutation_p.E125K|NPAS3_ENST00000341321.4_Missense_Mutation_p.E227K			Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3	227					locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|positive regulation of transcription, DNA-templated (GO:0045893)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	40	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		GGGCACTGCTGAGGACGGAGC	0.617																																						uc001wru.2		NA																	0				ovary(1)|skin(1)	2						c.(679-681)GAG>AAG		neuronal PAS domain protein 3 isoform 3							58.0	57.0	57.0					14																	34145537		2203	4300	6503	SO:0001583	missense	64067				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity	g.chr14:34145537G>A	AF164438	CCDS9645.1, CCDS53891.1, CCDS53892.1, CCDS55912.1	14q13.1	2013-08-23			ENSG00000151322	ENSG00000151322		"""Basic helix-loop-helix proteins"""	19311	protein-coding gene	gene with protein product		609430					Standard	NM_022123		Approved	MOP6, PASD6, bHLHe12	uc001wru.3	Q8IXF0	OTTHUMG00000140215	ENST00000356141.4:c.679G>A	14.37:g.34145537G>A	ENSP00000348460:p.Glu227Lys		Somatic				NPAS3_uc001wrs.2_Missense_Mutation_p.E214K|NPAS3_uc001wrt.2_Missense_Mutation_p.E195K|NPAS3_uc001wrv.2_Missense_Mutation_p.E197K|NPAS3_uc001wrw.2_Missense_Mutation_p.E125K	p.E227K	NM_173159	NP_071406	WXS	Illumina HiSeq	Unspecified	Q8IXF0	NPAS3_HUMAN	LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)	6	743	+	Breast(36;0.0102)|Hepatocellular(127;0.133)		227					Q86US6|Q86US7|Q8IXF2|Q9BY81|Q9H323|Q9Y4L8	Missense_Mutation	SNP	ENST00000356141.4	37	c.679G>A	CCDS53891.1	.	.	.	.	.	.	.	.	.	.	G	15.95	2.985406	0.53934	.	.	ENSG00000151322	ENST00000551634;ENST00000551492;ENST00000346562;ENST00000341321;ENST00000548645;ENST00000356141;ENST00000357798;ENST00000547068;ENST00000551008	T;T;T;T;T;T;T	0.45276	3.55;3.41;3.42;0.9;3.43;3.41;3.29	5.75	5.75	0.90469	.	0.054849	0.64402	D	0.000001	T	0.43456	0.1248	L	0.32530	0.975	0.80722	D	1	P;P;B;D;B	0.55385	0.59;0.622;0.302;0.971;0.351	B;B;B;P;B	0.50934	0.158;0.146;0.121;0.654;0.146	T	0.08868	-1.0701	10	0.11794	T	0.64	.	19.9525	0.97208	0.0:0.0:1.0:0.0	.	125;197;227;195;214	F8W0C2;Q8IXF0-2;Q8IXF0;Q8IXF0-4;Q8IXF0-3	.;.;NPAS3_HUMAN;.;.	K	204;232;195;227;197;227;214;123;125	ENSP00000448373:E204K;ENSP00000450392:E232K;ENSP00000319610:E195K;ENSP00000344158:E227K;ENSP00000448916:E197K;ENSP00000348460:E227K;ENSP00000350446:E214K	ENSP00000344158:E227K	E	+	1	0	NPAS3	33215288	1.000000	0.71417	0.958000	0.39756	0.811000	0.45836	9.793000	0.99091	2.719000	0.93026	0.655000	0.94253	GAG		0.617	NPAS3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276645.1			9	43	0	0	0	0	9	43				
RALGAPA1	253959	broad.mit.edu	37	14	36143457	36143457	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr14:36143457C>T	ENST00000389698.3	-	23	3718	c.3328G>A	c.(3328-3330)Gat>Aat	p.D1110N	RALGAPA1_ENST00000382366.3_Missense_Mutation_p.D1123N|RALGAPA1_ENST00000258840.6_Missense_Mutation_p.D1157N|RALGAPA1_ENST00000307138.6_Missense_Mutation_p.D1110N	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)	1110					activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						GTCAGGTTATCAGTTGAAATG	0.318																																						uc001wti.2		NA																	0				ovary(3)|breast(1)	4						c.(3328-3330)GAT>AAT		Ral GTPase activating protein, alpha subunit 1							50.0	55.0	54.0					14																	36143457		2203	4297	6500	SO:0001583	missense	253959				activation of Ral GTPase activity	cytosol|mitochondrion|nucleus	protein heterodimerization activity|Ral GTPase activator activity	g.chr14:36143457C>T	AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.3328G>A	14.37:g.36143457C>T	ENSP00000374348:p.Asp1110Asn		Somatic				RALGAPA1_uc010amp.2_5'Flank|RALGAPA1_uc001wtj.2_Missense_Mutation_p.D1110N|RALGAPA1_uc010tpv.1_Missense_Mutation_p.D1123N|RALGAPA1_uc010tpw.1_Missense_Mutation_p.D1157N	p.D1110N	NM_014990	NP_055805	WXS	Illumina HiSeq	Unspecified	Q6GYQ0	RGPA1_HUMAN			23	3719	-			1110					A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Missense_Mutation	SNP	ENST00000389698.3	37	c.3328G>A	CCDS32065.1	.	.	.	.	.	.	.	.	.	.	C	33	5.277772	0.95459	.	.	ENSG00000174373	ENST00000389698;ENST00000307138;ENST00000335518;ENST00000258840;ENST00000382366;ENST00000553892	T;T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37;-0.37	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.82006	0.4943	M	0.71206	2.165	0.58432	D	0.999998	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.85130	0.997;0.994;0.988;0.994	D	0.83552	0.0102	10	0.72032	D	0.01	-18.5296	19.1266	0.93388	0.0:1.0:0.0:0.0	.	1157;1123;1110;1110	Q6GYQ0-6;B9EK38;Q6GYQ0-2;Q6GYQ0	.;.;.;RGPA1_HUMAN	N	1110;1110;1110;1157;1123;1157	ENSP00000374348:D1110N;ENSP00000302647:D1110N;ENSP00000258840:D1157N;ENSP00000371803:D1123N;ENSP00000451877:D1157N	ENSP00000258840:D1157N	D	-	1	0	RALGAPA1	35213208	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.487000	0.81328	2.528000	0.85240	0.585000	0.79938	GAT		0.318	RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409829.1	XM_210022		6	20	0	0	0	0	6	20				
FANCM	57697	broad.mit.edu	37	14	45606317	45606317	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr14:45606317G>C	ENST00000267430.5	+	2	639	c.554G>C	c.(553-555)aGa>aCa	p.R185T	FANCM_ENST00000556036.1_Missense_Mutation_p.R185T|FKBP3_ENST00000396062.3_5'Flank|FKBP3_ENST00000216330.3_5'Flank|FANCM_ENST00000542564.2_Missense_Mutation_p.R185T	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	185	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						TGCAGTAAGAGAGTGCTTTTT	0.373								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													uc001wwd.3		NA																	0				ovary(3)|lung(2)|breast(2)	7						c.(553-555)AGA>ACA	Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi anemia, complementation group M							109.0	111.0	110.0					14																	45606317		2203	4300	6503	SO:0001583	missense	57697	Fanconi_Anemia	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	DNA repair	Fanconi anaemia nuclear complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|nuclease activity|protein binding	g.chr14:45606317G>C	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.554G>C	14.37:g.45606317G>C	ENSP00000267430:p.Arg185Thr		Somatic				FANCM_uc001wwc.2_Missense_Mutation_p.R185T|FANCM_uc010anf.2_Missense_Mutation_p.R185T|FKBP3_uc010tqf.1_5'Flank	p.R185T	NM_020937	NP_065988	WXS	Illumina HiSeq	Unspecified	Q8IYD8	FANCM_HUMAN			2	653	+			185			Helicase ATP-binding.		B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Missense_Mutation	SNP	ENST00000267430.5	37	c.554G>C	CCDS32070.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.461500	0.84317	.	.	ENSG00000187790	ENST00000556036;ENST00000267430;ENST00000542564	T;T;T	0.04917	3.53;3.53;3.53	5.39	5.39	0.77823	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.26484	0.0647	M	0.84156	2.68	0.47621	D	0.999472	D;D;D	0.89917	0.999;1.0;0.987	D;D;P	0.91635	0.996;0.999;0.891	T	0.00754	-1.1580	10	0.87932	D	0	.	12.0941	0.53744	0.0834:0.0:0.9166:0.0	.	185;185;185	B2RTQ9;Q8IYD8;Q8IYD8-2	.;FANCM_HUMAN;.	T	185	ENSP00000450596:R185T;ENSP00000267430:R185T;ENSP00000442493:R185T	ENSP00000267430:R185T	R	+	2	0	FANCM	44676067	1.000000	0.71417	0.994000	0.49952	0.992000	0.81027	7.862000	0.87013	2.530000	0.85305	0.650000	0.86243	AGA		0.373	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	XM_048128		8	63	0	0	0	0	8	63				
FANCM	57697	broad.mit.edu	37	14	45644452	45644452	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr14:45644452C>G	ENST00000267430.5	+	14	2580	c.2495C>G	c.(2494-2496)tCt>tGt	p.S832C	FANCM_ENST00000542564.2_Missense_Mutation_p.S806C	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	832					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						GTGATAGAATCTGATGAAGAA	0.294								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													uc001wwd.3		NA																	0				ovary(3)|lung(2)|breast(2)	7						c.(2494-2496)TCT>TGT	Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi anemia, complementation group M							64.0	60.0	61.0					14																	45644452		2203	4299	6502	SO:0001583	missense	57697	Fanconi_Anemia	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	DNA repair	Fanconi anaemia nuclear complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|nuclease activity|protein binding	g.chr14:45644452C>G	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.2495C>G	14.37:g.45644452C>G	ENSP00000267430:p.Ser832Cys		Somatic				FANCM_uc010anf.2_Missense_Mutation_p.S806C|FANCM_uc001wwe.3_Missense_Mutation_p.S368C|FANCM_uc010ang.2_Missense_Mutation_p.S46C	p.S832C	NM_020937	NP_065988	WXS	Illumina HiSeq	Unspecified	Q8IYD8	FANCM_HUMAN			14	2594	+			832					B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Missense_Mutation	SNP	ENST00000267430.5	37	c.2495C>G	CCDS32070.1	.	.	.	.	.	.	.	.	.	.	C	11.04	1.521655	0.27211	.	.	ENSG00000187790	ENST00000267430;ENST00000542564;ENST00000556250	T;T;T	0.22134	2.61;2.6;1.97	5.23	-1.2	0.09554	.	0.943496	0.09017	N	0.860707	T	0.22820	0.0551	L	0.53249	1.67	0.25754	N	0.985023	D;D	0.63880	0.985;0.993	P;P	0.49999	0.628;0.628	T	0.16188	-1.0411	10	0.48119	T	0.1	.	2.6778	0.05085	0.1176:0.4706:0.1152:0.2967	.	806;832	B2RTQ9;Q8IYD8	.;FANCM_HUMAN	C	832;806;348	ENSP00000267430:S832C;ENSP00000442493:S806C;ENSP00000452033:S348C	ENSP00000267430:S832C	S	+	2	0	FANCM	44714202	0.121000	0.22262	0.863000	0.33907	0.465000	0.32709	0.134000	0.15932	-0.193000	0.10415	0.585000	0.79938	TCT		0.294	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	XM_048128		10	33	0	0	0	0	10	33				
FANCM	57697	broad.mit.edu	37	14	45665674	45665674	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr14:45665674C>T	ENST00000267430.5	+	21	5725	c.5640C>T	c.(5638-5640)ttC>ttT	p.F1880F	FANCM_ENST00000542564.2_Silent_p.F1854F	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	1880	Interaction with FAAP24 and EME1.				DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						AGAACAAGTTCATTGAGCAGA	0.368								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													uc001wwd.3		NA																	0				ovary(3)|lung(2)|breast(2)	7						c.(5638-5640)TTC>TTT	Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi anemia, complementation group M							121.0	114.0	116.0					14																	45665674		2203	4300	6503	SO:0001819	synonymous_variant	57697	Fanconi_Anemia	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	DNA repair	Fanconi anaemia nuclear complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|nuclease activity|protein binding	g.chr14:45665674C>T	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.5640C>T	14.37:g.45665674C>T			Somatic				FANCM_uc010anf.2_Silent_p.F1854F|FANCM_uc001wwe.3_Silent_p.F1416F|FANCM_uc010ang.2_Silent_p.F1129F	p.F1880F	NM_020937	NP_065988	WXS	Illumina HiSeq	Unspecified	Q8IYD8	FANCM_HUMAN			21	5739	+			1880			Interaction with FAAP24 and EME1.		B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Silent	SNP	ENST00000267430.5	37	c.5640C>T	CCDS32070.1	.	.	.	.	.	.	.	.	.	.	C	4.504	0.093405	0.08632	.	.	ENSG00000187790	ENST00000554809	.	.	.	5.27	0.568	0.17333	.	.	.	.	.	T	0.23370	0.0565	.	.	.	0.20975	N	0.999818	.	.	.	.	.	.	T	0.24083	-1.0170	4	.	.	.	.	3.4822	0.07606	0.2401:0.3178:0.3521:0.0899	.	.	.	.	Y	848	.	.	H	+	1	0	FANCM	44735424	0.017000	0.18338	0.729000	0.30791	0.769000	0.43574	-0.008000	0.12788	0.190000	0.20209	-0.309000	0.09137	CAT		0.368	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	XM_048128		17	71	0	0	0	0	17	71				
NIN	51199	broad.mit.edu	37	14	51208379	51208379	+	Missense_Mutation	SNP	C	C	T	rs369558417		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr14:51208379C>T	ENST00000382041.3	-	25	5559	c.5369G>A	c.(5368-5370)cGa>cAa	p.R1790Q	NIN_ENST00000530997.2_Missense_Mutation_p.R1790Q|NIN_ENST00000382043.4_Missense_Mutation_p.R1077Q|NIN_ENST00000453196.1_Missense_Mutation_p.R1790Q|NIN_ENST00000389868.3_Missense_Mutation_p.R1077Q|NIN_ENST00000245441.5_Missense_Mutation_p.R1790Q|NIN_ENST00000324330.9_Missense_Mutation_p.R1790Q	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	1790					centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					CTGAGTCACTCGTAGGTCAGA	0.393			T	PDGFRB	MPD																																	uc001wym.2		NA		Dom	yes		14	14q24	51199	T	ninein (GSK3B interacting protein)			L	PDGFRB		MPD		0				skin(3)|ovary(1)|kidney(1)|central_nervous_system(1)	6						c.(5368-5370)CGA>CAA		ninein isoform 5		C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	200.0	190.0	194.0		3230,5369,5369,5369	2.6	1.0	14		194	0,8600		0,0,4300	no	missense,missense,missense,missense	NIN	NM_016350.4,NM_020921.3,NM_182944.2,NM_182946.1	43,43,43,43	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign,benign,benign	1077/1378,1790/2134,1790/2047,1790/2091	51208379	1,13005	2203	4300	6503	SO:0001583	missense	51199				centrosome localization	centrosome|microtubule	calcium ion binding|GTP binding|protein binding	g.chr14:51208379C>T	AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.5369G>A	14.37:g.51208379C>T	ENSP00000371472:p.Arg1790Gln		Somatic				NIN_uc001wyi.2_Missense_Mutation_p.R1790Q|NIN_uc001wyj.2_RNA|NIN_uc001wyk.2_Missense_Mutation_p.R1077Q|NIN_uc010tqp.1_Missense_Mutation_p.R1796Q|NIN_uc001wyo.2_Missense_Mutation_p.R1790Q|NIN_uc001wyn.2_5'Flank	p.R1790Q	NM_182946	NP_891991	WXS	Illumina HiSeq	Unspecified	Q8N4C6	NIN_HUMAN			25	5560	-	all_epithelial(31;0.00244)|Breast(41;0.127)		1790			Potential.		A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Missense_Mutation	SNP	ENST00000382041.3	37	c.5369G>A	CCDS32079.1	.	.	.	.	.	.	.	.	.	.	C	14.91	2.676103	0.47886	2.27E-4	0.0	ENSG00000100503	ENST00000245441;ENST00000311149;ENST00000389868;ENST00000382043;ENST00000324292;ENST00000382041;ENST00000324330;ENST00000453196	T;T;T;T;T;T	0.62788	-0.0;-0.0;-0.0;-0.0;-0.0;-0.0	5.51	2.63	0.31362	.	0.363661	0.26967	N	0.021597	T	0.35682	0.0940	N	0.14661	0.345	0.32684	N	0.515114	B;B;B;P;B	0.36412	0.437;0.437;0.062;0.552;0.03	B;B;B;B;B	0.29267	0.056;0.1;0.016;0.099;0.003	T	0.44267	-0.9339	10	0.12103	T	0.63	-2.5372	10.3393	0.43868	0.0:0.7637:0.0:0.2363	.	1796;1790;1790;1077;1790	Q8N4C6-5;C9J066;Q8N4C6;Q5BKU3;Q8N4C6-7	.;.;NIN_HUMAN;.;.	Q	1790;1773;1077;1077;1796;1790;1790;1790	ENSP00000245441:R1790Q;ENSP00000374518:R1077Q;ENSP00000371474:R1077Q;ENSP00000371472:R1790Q;ENSP00000324210:R1790Q;ENSP00000412391:R1790Q	ENSP00000245441:R1790Q	R	-	2	0	NIN	50278129	0.821000	0.29204	0.999000	0.59377	0.971000	0.66376	0.393000	0.20817	0.803000	0.34113	0.655000	0.94253	CGA		0.393	NIN-016	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395207.2	NM_182946		28	144	0	0	0	0	28	144				
CDKN3	1033	broad.mit.edu	37	14	54875501	54875501	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr14:54875501G>C	ENST00000541304.1	+	4	227	c.187G>C	c.(187-189)Gat>Cat	p.D63H	CDKN3_ENST00000335183.6_Missense_Mutation_p.D63H|CDKN3_ENST00000458126.2_Missense_Mutation_p.D63H|CDKN3_ENST00000556305.1_3'UTR|CDKN3_ENST00000556102.2_Missense_Mutation_p.D63H|CDKN3_ENST00000543789.2_Missense_Mutation_p.D63H|CDKN3_ENST00000395577.2_Missense_Mutation_p.D17H|CDKN3_ENST00000442975.2_Missense_Mutation_p.D23H			Q00526	CDK3_HUMAN	cyclin-dependent kinase inhibitor 3	0	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|G0 to G1 transition (GO:0045023)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|regulation of cell cycle (GO:0051726)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(2)|stomach(1)	3						TGTCCAAAAAGATACAGGTAG	0.279																																					Pancreas(40;634 1012 9382 49950 52462)	uc001xap.2		NA																	0					0						c.(187-189)GAT>CAT		cyclin-dependent kinase inhibitor 3 isoform 1							67.0	74.0	72.0					14																	54875501		2203	4281	6484	SO:0001583	missense	1033				cell cycle arrest|G1/S transition of mitotic cell cycle|negative regulation of cell proliferation|regulation of cyclin-dependent protein kinase activity	perinuclear region of cytoplasm	protein binding|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr14:54875501G>C	U02681	CCDS9716.1, CCDS45109.1	14q22	2011-08-25	2008-08-01		ENSG00000100526	ENSG00000100526		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	1791	protein-coding gene	gene with protein product	"""kinase associated phosphatase"", ""cyclin-dependent kinase inhibitor"", ""CDK2-associated dual specificity phosphatase"""	123832				8242750, 7698009	Standard	NM_005192		Approved	KAP, CDI1	uc001xap.3	Q16667	OTTHUMG00000140302	ENST00000541304.1:c.187G>C	14.37:g.54875501G>C	ENSP00000445572:p.Asp63His		Somatic				CDKN3_uc001xar.2_Missense_Mutation_p.D23H|CDKN3_uc001xaq.2_Missense_Mutation_p.D63H|CDKN3_uc010aoi.1_RNA|CDKN3_uc001xas.1_Intron|CDKN3_uc010aoj.1_Intron	p.D63H	NM_005192	NP_005183	WXS	Illumina HiSeq	Unspecified	Q16667	CDKN3_HUMAN			4	301	+			63						Missense_Mutation	SNP	ENST00000541304.1	37	c.187G>C		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.1|22.1	4.241462|4.241462	0.79912|0.79912	.|.	.|.	ENSG00000100526|ENSG00000100526	ENST00000335183;ENST00000543789;ENST00000442975;ENST00000458126;ENST00000556102;ENST00000541304;ENST00000439312;ENST00000395577|ENST00000434252	T;T;T;T;T;T;T|.	0.57273|.	0.41;0.41;0.41;0.41;0.41;0.41;0.41|.	5.94|5.94	5.94|5.94	0.96194|0.96194	Cyclin-dependent kinase inhibitor 3, bac/eukaryotic (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78155|0.78155	0.4239|0.4239	M|M	0.76002|0.76002	2.32|2.32	0.58432|0.58432	D|D	0.999996|0.999996	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;1.0;1.0|.	T|T	0.79460|0.79460	-0.1794|-0.1794	10|6	0.87932|0.87932	D|D	0|0	-20.4508|-20.4508	18.5357|18.5357	0.91009|0.91009	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	23;63;63|.	Q16667-2;F8WDR6;Q16667|.	.;.;CDKN3_HUMAN|.	H|Q	63;63;23;63;63;63;63;17|63	ENSP00000335357:D63H;ENSP00000440404:D63H;ENSP00000415333:D23H;ENSP00000396451:D63H;ENSP00000450711:D63H;ENSP00000445572:D63H;ENSP00000378944:D17H|.	ENSP00000335357:D63H|ENSP00000401430:E63Q	D|E	+|+	1|1	0|0	CDKN3|CDKN3	53945251|53945251	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.844000|0.844000	0.47949|0.47949	6.634000|6.634000	0.74290|0.74290	2.812000|2.812000	0.96745|0.96745	0.557000|0.557000	0.71058|0.71058	GAT|GAA		0.279	CDKN3-004	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000411158.1			15	92	0	0	0	0	15	92				
KIAA0586	9786	broad.mit.edu	37	14	58932685	58932685	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr14:58932685G>A	ENST00000556134.1	+	16	2421	c.2147G>A	c.(2146-2148)aGa>aAa	p.R716K	KIAA0586_ENST00000354386.6_Missense_Mutation_p.R784K|KIAA0586_ENST00000261244.5_Missense_Mutation_p.R655K|KIAA0586_ENST00000538571.2_3'UTR|KIAA0586_ENST00000423743.3_Missense_Mutation_p.R687K	NM_001244190.1|NM_001244193.1	NP_001231119.1|NP_001231122.1	Q9BVV6	TALD3_HUMAN	KIAA0586	716					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|regulation of establishment of protein localization (GO:0070201)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				endometrium(4)|kidney(6)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						AGCCCAAGTAGAGAAATGCCT	0.358																																						uc001xdv.3		NA																	0				ovary(1)	1						c.(1963-1965)AGA>AAA		talpid3 protein							177.0	169.0	172.0					14																	58932685		1881	4099	5980	SO:0001583	missense	9786							g.chr14:58932685G>A	AB011158	CCDS45115.1, CCDS58320.1, CCDS58321.1, CCDS58322.1, CCDS73639.1	14q23.1	2012-12-06			ENSG00000100578	ENSG00000100578			19960	protein-coding gene	gene with protein product		610178				16702409	Standard	NM_014749		Approved	Talpid3	uc010trr.2	Q9BVV6	OTTHUMG00000171141	ENST00000556134.1:c.2147G>A	14.37:g.58932685G>A	ENSP00000452351:p.Arg716Lys		Somatic				KIAA0586_uc010trr.1_Missense_Mutation_p.R772K|KIAA0586_uc001xdt.3_Missense_Mutation_p.R687K|KIAA0586_uc001xdu.3_Missense_Mutation_p.R716K|KIAA0586_uc010trs.1_Missense_Mutation_p.R646K|KIAA0586_uc010trt.1_Missense_Mutation_p.R591K|KIAA0586_uc010tru.1_Missense_Mutation_p.R591K	p.R655K	NM_014749	NP_055564	WXS	Illumina HiSeq	Unspecified	E9PGW8	E9PGW8_HUMAN			14	2237	+			655					B4DZB6|E7EWM8|J3KQH9|O60328|Q6NYC6|Q6UV20	Missense_Mutation	SNP	ENST00000556134.1	37	c.1964G>A	CCDS58321.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.109896	0.77210	.	.	ENSG00000100578	ENST00000354386;ENST00000556134;ENST00000423743;ENST00000261244;ENST00000546216	T;T;T;T	0.52526	0.66;0.66;0.66;0.66	5.37	4.47	0.54385	.	0.089250	0.47852	D	0.000203	T	0.53738	0.1815	L	0.34521	1.04	0.29798	N	0.832676	P;P;P;D;P;P	0.61697	0.946;0.946;0.734;0.99;0.946;0.946	B;B;B;D;B;B	0.72982	0.41;0.41;0.203;0.979;0.41;0.41	T	0.48747	-0.9008	10	0.34782	T	0.22	.	11.4122	0.49931	0.1769:0.0:0.8231:0.0	.	591;591;784;655;716;687	F5GWA3;B7Z7W7;E7EWM8;E9PGW8;Q9BVV6;Q6UV20	.;.;.;.;K0586_HUMAN;.	K	784;716;687;655;591	ENSP00000346359:R784K;ENSP00000452351:R716K;ENSP00000399427:R687K;ENSP00000261244:R655K	ENSP00000261244:R655K	R	+	2	0	KIAA0586	58002438	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	2.312000	0.43726	2.500000	0.84329	0.655000	0.94253	AGA		0.358	KIAA0586-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000411887.1	NM_014749		6	166	0	0	0	0	6	166				
PLEKHG3	26030	broad.mit.edu	37	14	65198093	65198093	+	Silent	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr14:65198093C>G	ENST00000394691.1	+	8	1011	c.864C>G	c.(862-864)ctC>ctG	p.L288L	PLEKHG3_ENST00000247226.7_Silent_p.L232L			A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 3	288							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(5)|kidney(2)|large_intestine(1)|lung(14)|prostate(2)|skin(3)|urinary_tract(2)	29				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		TTCAGTCACTCCTCATCAACT	0.602																																						uc001xho.1		NA																	0				skin(1)	1						c.(862-864)CTC>CTG		pleckstrin homology domain containing, family G,							48.0	47.0	48.0					14																	65198093		2203	4300	6503	SO:0001819	synonymous_variant	26030				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity	g.chr14:65198093C>G	AB011171	CCDS32098.1	14q23.3	2013-01-10	2004-12-01	2004-12-01	ENSG00000126822	ENSG00000126822		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20364	protein-coding gene	gene with protein product			"""KIAA0599"""	KIAA0599			Standard	XM_005267511		Approved	ARHGEF43	uc001xhp.2	A1L390	OTTHUMG00000029671	ENST00000394691.1:c.864C>G	14.37:g.65198093C>G			Somatic				PLEKHG3_uc001xhn.1_Silent_p.L232L|PLEKHG3_uc001xhp.2_Silent_p.L288L|PLEKHG3_uc010aqh.1_5'UTR	p.L288L	NM_015549	NP_056364	WXS	Illumina HiSeq	Unspecified	A1L390	PKHG3_HUMAN		all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)	8	1133	+			288					A1L389|B5MEC9|O60339|Q6GMS3|Q6P4B1|Q7L3S3|Q86SW7|Q8TEF5|Q96EW6|Q9BT82	Silent	SNP	ENST00000394691.1	37	c.864C>G																																																																																					0.602	PLEKHG3-010	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000412028.1	NM_015549		5	33	0	0	0	0	5	33				
RBM25	58517	broad.mit.edu	37	14	73566393	73566393	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr14:73566393G>T	ENST00000261973.7	+	9	1087	c.802G>T	c.(802-804)Gaa>Taa	p.E268*	RBM25_ENST00000527432.1_Nonsense_Mutation_p.E268*|RBM25_ENST00000526754.1_Nonsense_Mutation_p.E268*|RBM25_ENST00000540173.1_Nonsense_Mutation_p.E268*|RBM25_ENST00000525321.1_Nonsense_Mutation_p.E268*	NM_021239.2	NP_067062.1	P49756	RBM25_HUMAN	RNA binding motif protein 25	268					mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of apoptotic process (GO:0042981)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(6)|ovary(2)|pancreas(1)	31				BRCA - Breast invasive adenocarcinoma(234;0.00362)|OV - Ovarian serous cystadenocarcinoma(108;0.0688)		AAATGCTATAGAAATGGAAGA	0.348																																						uc001xno.2		NA																	0				central_nervous_system(2)|ovary(1)|breast(1)	4						c.(802-804)GAA>TAA		RNA binding motif protein 25							130.0	134.0	133.0					14																	73566393		2203	4300	6503	SO:0001587	stop_gained	58517				apoptosis|mRNA processing|regulation of alternative nuclear mRNA splicing, via spliceosome|RNA splicing	cytoplasm|nuclear speck	mRNA binding|nucleotide binding|protein binding	g.chr14:73566393G>T	BX647116	CCDS32113.1	14q24.3	2013-02-12	2004-04-23	2004-04-29	ENSG00000119707	ENSG00000119707		"""RNA binding motif (RRM) containing"""	23244	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 94"""	612427	"""RNA-binding region (RNP1, RRM) containing 7"""	RNPC7		9847074, 7596406	Standard	NM_021239		Approved	S164, fSAP94, NET52, Snu71	uc001xno.3	P49756	OTTHUMG00000167540	ENST00000261973.7:c.802G>T	14.37:g.73566393G>T	ENSP00000261973:p.Glu268*		Somatic				RBM25_uc001xnn.3_Nonsense_Mutation_p.E268*|RBM25_uc010ttu.1_Nonsense_Mutation_p.E268*|RBM25_uc001xnp.2_Nonsense_Mutation_p.E63*	p.E268*	NM_021239	NP_067062	WXS	Illumina HiSeq	Unspecified	P49756	RBM25_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00362)|OV - Ovarian serous cystadenocarcinoma(108;0.0688)	9	1010	+			268					A0PJL9|B2RNA8|B3KT03|Q2TA72|Q5XJ17|Q6P665|Q9H6A1|Q9UEQ5|Q9UIE9	Nonsense_Mutation	SNP	ENST00000261973.7	37	c.802G>T	CCDS32113.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	37|37	6.630759|6.630759	0.97718|0.97718	.|.	.|.	ENSG00000119707|ENSG00000119707	ENST00000261973;ENST00000540173;ENST00000527432;ENST00000525321;ENST00000526754|ENST00000532192	.|.	.|.	.|.	5.06|5.06	5.06|5.06	0.68205|0.68205	.|.	0.046603|.	0.85682|.	D|.	0.000000|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.56958|.	D|.	0.05|.	.|.	18.3985|18.3985	0.90507|0.90507	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|Y	268|46	.|.	ENSP00000261973:E268X|.	E|X	+|+	1|3	0|2	RBM25|RBM25	72636146|72636146	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	9.824000|9.824000	0.99380|0.99380	2.346000|2.346000	0.79739|0.79739	0.484000|0.484000	0.47621|0.47621	GAA|TAG		0.348	RBM25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394966.1	XM_027330		18	90	1	0	1.5e-11	1.6e-11	18	90				
HEATR4	399671	broad.mit.edu	37	14	73989358	73989358	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr14:73989358G>A	ENST00000553558.1	-	3	820	c.499C>T	c.(499-501)Cat>Tat	p.H167Y	RP3-414A15.2_ENST00000555972.2_RNA|HEATR4_ENST00000560393.1_Missense_Mutation_p.H120Y|RP3-414A15.11_ENST00000553394.1_RNA|HEATR4_ENST00000334988.2_Missense_Mutation_p.H167Y	NM_001220484.1	NP_001207413.1	Q86WZ0	HEAT4_HUMAN	HEAT repeat containing 4	167										breast(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00386)|OV - Ovarian serous cystadenocarcinoma(108;0.0719)		ATGCAGGGATGATGGATGAGA	0.562																																						uc010tub.1		NA																	0				ovary(1)	1						c.(499-501)CAT>TAT		HEAT repeat containing 4							72.0	67.0	69.0					14																	73989358		2203	4300	6503	SO:0001583	missense	399671							g.chr14:73989358G>A	BC047590	CCDS9815.1, CCDS9815.2	14q24.3	2013-09-20			ENSG00000187105	ENSG00000187105			16761	protein-coding gene	gene with protein product						15489334	Standard	NM_203309		Approved	MGC48595	uc021rwf.2	Q86WZ0	OTTHUMG00000171602	ENST00000553558.1:c.499C>T	14.37:g.73989358G>A	ENSP00000450444:p.His167Tyr		Somatic				HEATR4_uc010tua.1_Missense_Mutation_p.H120Y	p.H167Y	NM_203309	NP_976054	WXS	Illumina HiSeq	Unspecified				BRCA - Breast invasive adenocarcinoma(234;0.00386)|OV - Ovarian serous cystadenocarcinoma(108;0.0719)	3	821	-								B7Z7V9|E9KL41	Missense_Mutation	SNP	ENST00000553558.1	37	c.499C>T	CCDS9815.2	.	.	.	.	.	.	.	.	.	.	G	1.913	-0.450218	0.04572	.	.	ENSG00000187105	ENST00000553558;ENST00000334988;ENST00000556455	T	0.42513	0.97	5.54	1.62	0.23740	.	1.880590	0.02067	N	0.051245	T	0.32255	0.0823	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.30475	-0.9977	10	0.59425	D	0.04	1.6445	8.4262	0.32731	0.2902:0.0:0.7098:0.0	.	167	Q86WZ0	HEAT4_HUMAN	Y	167;120;167	ENSP00000450444:H167Y	ENSP00000335447:H120Y	H	-	1	0	HEATR4	73059111	0.001000	0.12720	0.000000	0.03702	0.019000	0.09904	0.392000	0.20801	0.444000	0.26612	0.655000	0.94253	CAT		0.562	HEATR4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414422.2	NM_203309		9	46	0	0	0	0	9	46				
NEK9	91754	broad.mit.edu	37	14	75568401	75568401	+	Missense_Mutation	SNP	C	C	T	rs200363570		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr14:75568401C>T	ENST00000238616.5	-	15	1957	c.1799G>A	c.(1798-1800)cGt>cAt	p.R600H		NM_033116.4	NP_149107.4	Q8TD19	NEK9_HUMAN	NIMA-related kinase 9	600					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	31				BRCA - Breast invasive adenocarcinoma(234;0.00718)		GGCAATGGTACGGATCTTATA	0.413																																						uc001xrl.2		NA																	0				lung(2)|stomach(2)|ovary(1)	5						c.(1798-1800)CGT>CAT		NIMA-related kinase 9							178.0	161.0	167.0					14																	75568401		2203	4300	6503	SO:0001583	missense	91754				cell division|mitosis	mitochondrion|nucleus	ATP binding|metal ion binding|protein kinase binding|protein serine/threonine kinase activity	g.chr14:75568401C>T	AY048580	CCDS9839.1	14q24.2	2012-11-15	2012-11-15		ENSG00000119638	ENSG00000119638			18591	protein-coding gene	gene with protein product		609798	"""NIMA (never in mitosis gene a)- related kinase 9"""			11864968	Standard	NM_033116		Approved	Nek8, NERCC, DKFZp434D0935, MGC16714	uc001xrl.3	Q8TD19	OTTHUMG00000171768	ENST00000238616.5:c.1799G>A	14.37:g.75568401C>T	ENSP00000238616:p.Arg600His		Somatic				NEK9_uc001xrk.2_Missense_Mutation_p.R100H	p.R600H	NM_033116	NP_149107	WXS	Illumina HiSeq	Unspecified	Q8TD19	NEK9_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00718)	15	1953	-			600			RCC1 4.		Q52LK6|Q8NCN0|Q8TCY4|Q9UPI4|Q9Y6S4|Q9Y6S5|Q9Y6S6	Missense_Mutation	SNP	ENST00000238616.5	37	c.1799G>A	CCDS9839.1	.	.	.	.	.	.	.	.	.	.	C	16.83	3.232297	0.58777	.	.	ENSG00000119638	ENST00000238616	T	0.80566	-1.39	5.18	5.18	0.71444	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.125321	0.53938	D	0.000045	T	0.70500	0.3231	N	0.19112	0.55	0.50467	D	0.999879	B	0.19935	0.04	B	0.11329	0.006	T	0.64364	-0.6425	10	0.29301	T	0.29	.	19.0423	0.93006	0.0:1.0:0.0:0.0	.	600	Q8TD19	NEK9_HUMAN	H	600	ENSP00000238616:R600H	ENSP00000238616:R600H	R	-	2	0	NEK9	74638154	0.998000	0.40836	1.000000	0.80357	0.989000	0.77384	2.527000	0.45615	2.544000	0.85801	0.563000	0.77884	CGT		0.413	NEK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415021.1	NM_033116		17	146	0	0	0	0	17	146				
ALKBH1	8846	broad.mit.edu	37	14	78146284	78146284	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr14:78146284C>T	ENST00000216489.3	-	4	500	c.485G>A	c.(484-486)cGa>cAa	p.R162Q		NM_006020.2	NP_006011.2	Q13686	ALKB1_HUMAN	alkB, alkylation repair homolog 1 (E. coli)	162					developmental growth (GO:0048589)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA demethylation (GO:0080111)|DNA repair (GO:0006281)|in utero embryonic development (GO:0001701)|negative regulation of neuron apoptotic process (GO:0043524)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|oxidative demethylation (GO:0070989)|placenta development (GO:0001890)|RNA repair (GO:0042245)	mitochondrion (GO:0005739)|nuclear euchromatin (GO:0005719)	chemoattractant activity (GO:0042056)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)			endometrium(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	9			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		CAGTAAACTTCGGGGTCTCCG	0.398																																						uc001xuc.1		NA																	0				ovary(1)|skin(1)	2						c.(484-486)CGA>CAA		alkylated DNA repair protein alkB homolog							89.0	91.0	90.0					14																	78146284		2203	4300	6503	SO:0001583	missense	8846				DNA dealkylation involved in DNA repair|DNA demethylation|oxidative demethylation|RNA repair	mitochondrion	DNA-(apurinic or apyrimidinic site) lyase activity|ferrous iron binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	g.chr14:78146284C>T	X91992	CCDS32127.1	14q24	2014-07-23	2006-02-09	2006-02-09	ENSG00000100601	ENSG00000100601		"""Alkylation repair homologs"""	17911	protein-coding gene	gene with protein product		605345	"""alkB, alkylation repair homolog (E. coli)"""	ALKBH		8600462	Standard	XM_005268165		Approved	hABH, alkB, ABH	uc001xuc.1	Q13686	OTTHUMG00000171542	ENST00000216489.3:c.485G>A	14.37:g.78146284C>T	ENSP00000216489:p.Arg162Gln		Somatic				ALKBH1_uc001xud.1_RNA	p.R162Q	NM_006020	NP_006011	WXS	Illumina HiSeq	Unspecified	Q13686	ALKB1_HUMAN	Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)	4	494	-			162					Q8TAU1|Q9ULA7	Missense_Mutation	SNP	ENST00000216489.3	37	c.485G>A	CCDS32127.1	.	.	.	.	.	.	.	.	.	.	C	16.41	3.116566	0.56505	.	.	ENSG00000100601	ENST00000216489	T	0.10573	2.86	5.97	5.09	0.68999	.	0.057396	0.64402	D	0.000002	T	0.15262	0.0368	L	0.41710	1.295	0.32751	N	0.506332	D	0.63880	0.993	P	0.53954	0.738	T	0.13980	-1.0489	10	0.28530	T	0.3	-33.7261	9.6328	0.39789	0.0:0.7911:0.0:0.2089	.	162	Q13686	ALKB1_HUMAN	Q	162	ENSP00000216489:R162Q	ENSP00000216489:R162Q	R	-	2	0	ALKBH1	77216037	1.000000	0.71417	0.997000	0.53966	0.732000	0.41865	2.919000	0.48836	1.534000	0.49203	0.585000	0.79938	CGA		0.398	ALKBH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414037.1	NM_006020		15	94	0	0	0	0	15	94				
FAM181A	90050	broad.mit.edu	37	14	94394757	94394757	+	Silent	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr14:94394757G>A	ENST00000267594.5	+	3	619	c.312G>A	c.(310-312)caG>caA	p.Q104Q	FAM181A_ENST00000557000.2_Silent_p.Q42Q|FAM181A_ENST00000557719.1_Silent_p.Q42Q|FAM181A_ENST00000556222.1_Silent_p.Q42Q|FAM181A-AS1_ENST00000554742.1_RNA	NM_001207073.1|NM_001207074.1|NM_138344.4	NP_001194002.1|NP_001194003.1|NP_612353.3	Q8N9Y4	F181A_HUMAN	family with sequence similarity 181, member A	104										cervix(1)|endometrium(2)|large_intestine(8)|lung(4)|prostate(1)|skin(2)	18						AGTACCTGCAGAAGCAGCTCA	0.632																																						uc001ybz.1		NA																	0					0						c.(310-312)CAG>CAA		hypothetical protein LOC90050							49.0	46.0	47.0					14																	94394757		2203	4300	6503	SO:0001819	synonymous_variant	90050							g.chr14:94394757G>A	BC009073	CCDS9914.1, CCDS55939.1	14q32.12	2011-11-30	2008-07-22	2008-07-22	ENSG00000140067	ENSG00000140067			20491	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 152"""	C14orf152			Standard	NM_138344		Approved		uc021saz.1	Q8N9Y4	OTTHUMG00000171297	ENST00000267594.5:c.312G>A	14.37:g.94394757G>A			Somatic				C14orf86_uc001yby.2_5'Flank|FAM181A_uc010aus.1_Silent_p.Q42Q|FAM181A_uc001yca.1_Silent_p.Q42Q	p.Q104Q	NM_138344	NP_612353	WXS	Illumina HiSeq	Unspecified	Q8N9Y4	F181A_HUMAN			3	619	+			104					B2RD39|Q96GY1	Silent	SNP	ENST00000267594.5	37	c.312G>A	CCDS9914.1																																																																																				0.632	FAM181A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412840.1	NM_138344		5	22	0	0	0	0	5	22				
MTA1	9112	broad.mit.edu	37	14	105936499	105936499	+	Missense_Mutation	SNP	C	C	T	rs587655368		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr14:105936499C>T	ENST00000331320.7	+	21	2309	c.2095C>T	c.(2095-2097)Cgg>Tgg	p.R699W	MTA1_ENST00000405646.1_Missense_Mutation_p.R682W|MTA1_ENST00000406191.1_Missense_Mutation_p.R687W|MTA1_ENST00000435036.2_Missense_Mutation_p.R239W|RP11-521B24.5_ENST00000552675.1_RNA|CRIP2_ENST00000483017.3_5'Flank	NM_001203258.1|NM_004689.3	NP_001190187.1|NP_004680.2	Q13330	MTA1_HUMAN	metastasis associated 1	699	Poly-Pro.				circadian regulation of gene expression (GO:0032922)|double-strand break repair (GO:0006302)|entrainment of circadian clock by photoperiod (GO:0043153)|locomotor rhythm (GO:0045475)|positive regulation of protein autoubiquitination (GO:1902499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of gene expression, epigenetic (GO:0040029)|regulation of inflammatory response (GO:0050727)|response to ionizing radiation (GO:0010212)|response to lipopolysaccharide (GO:0032496)|secretory granule organization (GO:0033363)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|microtubule (GO:0005874)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|core promoter sequence-specific DNA binding (GO:0001046)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|stomach(1)	14		all_cancers(154;0.0293)|all_epithelial(191;0.128)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00897)|Epithelial(46;0.026)	Epithelial(152;0.19)		CCTGCCGCCGCGGCCACCGCC	0.736																																						uc001yqx.2		NA																	0				breast(1)|central_nervous_system(1)	2						c.(2095-2097)CGG>TGG		metastasis associated protein							20.0	18.0	19.0					14																	105936499		2155	4223	6378	SO:0001583	missense	9112				signal transduction	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr14:105936499C>T	U35113	CCDS32169.1, CCDS55954.1	14q32.33	2013-01-25			ENSG00000182979	ENSG00000182979		"""GATA zinc finger domain containing"""	7410	protein-coding gene	gene with protein product		603526				8083195, 7607577	Standard	NM_004689		Approved		uc001yqx.3	Q13330	OTTHUMG00000150362	ENST00000331320.7:c.2095C>T	14.37:g.105936499C>T	ENSP00000333633:p.Arg699Trp		Somatic				MTA1_uc001yqy.2_RNA|MTA1_uc001yrb.2_Missense_Mutation_p.R464W|CRIP2_uc010tyr.1_5'Flank|CRIP2_uc001yrc.2_5'Flank	p.R699W	NM_004689	NP_004680	WXS	Illumina HiSeq	Unspecified	Q13330	MTA1_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.00897)|Epithelial(46;0.026)	Epithelial(152;0.19)	21	2282	+		all_cancers(154;0.0293)|all_epithelial(191;0.128)|Melanoma(154;0.155)	699			Poly-Pro.|SH3-binding (Potential).		A5PLK4|Q86SW2|Q8NFI8|Q96GI8	Missense_Mutation	SNP	ENST00000331320.7	37	c.2095C>T	CCDS32169.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.33|15.33	2.800138|2.800138	0.50208|0.50208	.|.	.|.	ENSG00000182979|ENSG00000182979	ENST00000494981|ENST00000414153;ENST00000331320;ENST00000406191;ENST00000405646;ENST00000434050;ENST00000435036;ENST00000426567	.|T;T;T;T;T;T	.|0.48836	.|1.44;1.46;1.44;1.45;0.84;0.8	4.56|4.56	2.4|2.4	0.29515|0.29515	.|.	.|0.184996	.|0.36854	.|N	.|0.002374	T|T	0.35393|0.35393	0.0930|0.0930	N|N	0.24115|0.24115	0.695|0.695	0.32819|0.32819	D|D	0.502458|0.502458	.|D;D	.|0.62365	.|0.991;0.989	.|B;B	.|0.44315	.|0.446;0.409	T|T	0.53365|0.53365	-0.8449|-0.8449	5|10	.|0.59425	.|D	.|0.04	-13.6366|-13.6366	12.44|12.44	0.55619|0.55619	0.4019:0.5981:0.0:0.0|0.4019:0.5981:0.0:0.0	.|.	.|495;699	.|Q59FW1;Q13330	.|.;MTA1_HUMAN	V|W	125|612;699;687;682;495;239;111	.|ENSP00000333633:R699W;ENSP00000385702:R687W;ENSP00000384180:R682W;ENSP00000394106:R495W;ENSP00000389425:R239W;ENSP00000395371:R111W	.|ENSP00000333633:R699W	A|R	+|+	2|1	0|2	MTA1|MTA1	105007544|105007544	0.936000|0.936000	0.31750|0.31750	0.666000|0.666000	0.29783|0.29783	0.194000|0.194000	0.23727|0.23727	0.959000|0.959000	0.29240|0.29240	0.894000|0.894000	0.36317|0.36317	0.491000|0.491000	0.48974|0.48974	GCG|CGG		0.736	MTA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000317849.15			5	17	0	0	0	0	5	17				
HERC2	8924	broad.mit.edu	37	15	28413555	28413555	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr15:28413555C>G	ENST00000261609.7	-	67	10519	c.10411G>C	c.(10411-10413)Gag>Cag	p.E3471Q		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GCTTTTACCTCTCTCTTTTCT	0.428																																						uc001zbj.2		NA																	0				ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13						c.(10411-10413)GAG>CAG		hect domain and RLD 2							148.0	137.0	141.0					15																	28413555		2203	4300	6503	SO:0001583	missense	8924				DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr15:28413555C>G	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.10411G>C	15.37:g.28413555C>G	ENSP00000261609:p.Glu3471Gln		Somatic					p.E3471Q	NM_004667	NP_004658	WXS	Illumina HiSeq	Unspecified	O95714	HERC2_HUMAN		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)	67	10517	-		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)	3471						Missense_Mutation	SNP	ENST00000261609.7	37	c.10411G>C	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	C	17.50	3.406034	0.62288	.	.	ENSG00000128731	ENST00000261609	T	0.38722	1.12	5.25	5.25	0.73442	.	0.053166	0.64402	D	0.000001	T	0.47875	0.1469	M	0.68952	2.095	0.80722	D	1	P	0.49783	0.928	P	0.45276	0.475	T	0.41574	-0.9501	10	0.20519	T	0.43	.	19.2064	0.93732	0.0:1.0:0.0:0.0	.	3471	O95714	HERC2_HUMAN	Q	3471	ENSP00000261609:E3471Q	ENSP00000261609:E3471Q	E	-	1	0	HERC2	26087150	1.000000	0.71417	1.000000	0.80357	0.633000	0.38033	5.551000	0.67274	2.606000	0.88127	0.491000	0.48974	GAG		0.428	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667		25	125	0	0	0	0	25	125				
HERC2	8924	broad.mit.edu	37	15	28459835	28459835	+	Silent	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr15:28459835G>A	ENST00000261609.7	-	40	6432	c.6324C>T	c.(6322-6324)ctC>ctT	p.L2108L		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		AGCAGGTAGTGAGCAAGCTTC	0.562																																						uc001zbj.2		NA																	0				ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13						c.(6322-6324)CTC>CTT		hect domain and RLD 2							103.0	76.0	85.0					15																	28459835		2203	4300	6503	SO:0001819	synonymous_variant	8924				DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr15:28459835G>A	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.6324C>T	15.37:g.28459835G>A			Somatic					p.L2108L	NM_004667	NP_004658	WXS	Illumina HiSeq	Unspecified	O95714	HERC2_HUMAN		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)	40	6430	-		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)	2108						Silent	SNP	ENST00000261609.7	37	c.6324C>T	CCDS10021.1																																																																																				0.562	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667		5	22	0	0	0	0	5	22				
TRPM1	4308	broad.mit.edu	37	15	31323259	31323259	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr15:31323259C>T	ENST00000256552.6	-	23	3201	c.3054G>A	c.(3052-3054)tgG>tgA	p.W1018*	TRPM1_ENST00000397795.2_Nonsense_Mutation_p.W996*|RP11-348B17.1_ENST00000558755.1_RNA|TRPM1_ENST00000542188.1_Nonsense_Mutation_p.W1035*|RP11-348B17.1_ENST00000561299.1_RNA	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1											NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		GGGCCAGTTTCCAAGAGGGCT	0.478																																						uc001zfm.2		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(2986-2988)TGG>TGA		transient receptor potential cation channel,							140.0	143.0	142.0					15																	31323259		2163	4289	6452	SO:0001587	stop_gained	4308				cellular response to light stimulus|visual perception	integral to plasma membrane	calcium channel activity|receptor activity	g.chr15:31323259C>T	AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.3054G>A	15.37:g.31323259C>T	ENSP00000256552:p.Trp1018*		Somatic				TRPM1_uc010azy.2_Nonsense_Mutation_p.W903*|TRPM1_uc001zfl.2_Intron	p.W996*	NM_002420	NP_002411	WXS	Illumina HiSeq	Unspecified	Q7Z4N2	TRPM1_HUMAN		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)	22	3116	-		all_lung(180;1.92e-11)	996			Cytoplasmic (Potential).			Nonsense_Mutation	SNP	ENST00000256552.6	37	c.2988G>A	CCDS58346.1	.	.	.	.	.	.	.	.	.	.	C	43	10.302569	0.99379	.	.	ENSG00000134160	ENST00000397795;ENST00000542188;ENST00000256552;ENST00000397793	.	.	.	5.96	5.96	0.96718	.	0.062026	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.4127	20.394	0.98981	0.0:1.0:0.0:0.0	.	.	.	.	X	996;1035;1018;996	.	ENSP00000256552:W1018X	W	-	3	0	TRPM1	29110551	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	7.776000	0.85560	2.830000	0.97506	0.585000	0.79938	TGG		0.478	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417166.2	NM_002420		12	99	0	0	0	0	12	99				
FMN1	342184	broad.mit.edu	37	15	33359906	33359906	+	Intron	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr15:33359906G>A	ENST00000559047.1	-	3	2043				FMN1_ENST00000558197.1_Silent_p.F60F|FMN1_ENST00000559150.1_Intron|FMN1_ENST00000561249.1_Intron|FMN1_ENST00000334528.9_Silent_p.F60F			Q68DA7	FMN1_HUMAN	formin 1						actin nucleation (GO:0045010)	actin filament (GO:0005884)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(3)	29		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		CTAAACTATGGAATGCTTTCA	0.453																																						uc001zhf.3		NA																	0				ovary(1)	1						c.(178-180)TTC>TTT		formin 1							77.0	74.0	75.0					15																	33359906		1932	4151	6083	SO:0001627	intron_variant	342184				actin cytoskeleton organization	actin cytoskeleton|adherens junction|cytoplasm|nucleus	actin binding	g.chr15:33359906G>A	AH002864	CCDS45209.1, CCDS61581.1, CCDS61582.1	15q13.3	2013-06-13	2005-01-20	2005-01-22	ENSG00000248905	ENSG00000248905			3768	protein-coding gene	gene with protein product	"""limb deformity protein"""	136535	"""formin (limb deformity)"""	LD, FMN		1673046	Standard	NM_001277313		Approved	DKFZP686C2281, FLJ45135, MGC125288, MGC125289	uc031qrh.1	Q68DA7	OTTHUMG00000172201	ENST00000559047.1:c.2044-2631C>T	15.37:g.33359906G>A			Somatic				FMN1_uc001zhg.2_Silent_p.F60F	p.F60F	NM_001103184	NP_001096654	WXS	Illumina HiSeq	Unspecified	Q68DA7	FMN1_HUMAN		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)	1	180	-		all_lung(180;1.14e-07)	Error:Variant_position_missing_in_Q68DA7_after_alignment					Q3B7I6|Q3ZAR4|Q6ZSY1	Silent	SNP	ENST00000559047.1	37	c.180C>T																																																																																					0.453	FMN1-005	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000417414.1	NM_001103184		10	71	0	0	0	0	10	71				
NUTM1	256646	broad.mit.edu	37	15	34648777	34648777	+	Silent	SNP	C	C	T	rs137916466		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr15:34648777C>T	ENST00000333756.4	+	7	2639	c.2484C>T	c.(2482-2484)acC>acT	p.T828T	NUTM1_ENST00000438749.3_Silent_p.T846T|NUTM1_ENST00000537011.1_Silent_p.T856T	NM_175741.1	NP_786883	Q86Y26	NUTM1_HUMAN	NUT midline carcinoma, family member 1	828						cytoplasm (GO:0005737)|nucleus (GO:0005634)											GCTGTGAAACCGTAGGGCATC	0.507																																						uc001zif.2		NA								T					BRD3|BRD4		lethal midline carcinoma	BRD4_ENST00000263377/C15orf55(24)|BRD3/C15orf55(3)	0				midline_organs(25)|ovary(2)|lung(2)|skin(1)	30						c.(2482-2484)ACC>ACT		nuclear protein in testis		C		1,4401	2.1+/-5.4	0,1,2200	59.0	62.0	61.0		2484	2.8	0.0	15	dbSNP_134	61	0,8596		0,0,4298	no	coding-synonymous	C15orf55	NM_175741.1		0,1,6498	TT,TC,CC		0.0,0.0227,0.0077		828/1133	34648777	1,12997	2201	4298	6499	SO:0001819	synonymous_variant	256646					cytoplasm|nucleus		g.chr15:34648777C>T	AF482429	CCDS32190.1, CCDS61584.1, CCDS61585.1	15q14	2014-01-28	2013-03-14	2013-03-14	ENSG00000184507	ENSG00000184507			29919	protein-coding gene	gene with protein product	"""nuclear protein in testis"""	608963	"""chromosome 15 open reading frame 55"""	C15orf55		12543779	Standard	NM_175741		Approved	NUT, DKFZp434O192, FAM22H	uc001zif.3	Q86Y26	OTTHUMG00000172348	ENST00000333756.4:c.2484C>T	15.37:g.34648777C>T			Somatic				C15orf55_uc010ucc.1_Silent_p.T856T|C15orf55_uc010ucd.1_Silent_p.T846T	p.T828T	NM_175741	NP_786883	WXS	Illumina HiSeq	Unspecified	Q86Y26	NUT_HUMAN		all cancers(64;4.53e-18)|GBM - Glioblastoma multiforme(113;8.29e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0249)	7	2639	+		all_lung(180;2.78e-08)	828					B4DZ00|B7Z7Y4|E7EVE8|F5H4I6|Q86YS8|Q8N7F2|Q9NTB3	Silent	SNP	ENST00000333756.4	37	c.2484C>T	CCDS32190.1																																																																																				0.507	NUTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418026.1	NM_175741		11	60	0	0	0	0	11	60				
MAPKBP1	23005	broad.mit.edu	37	15	42110227	42110227	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr15:42110227G>C	ENST00000456763.2	+	18	2139	c.1943G>C	c.(1942-1944)gGa>gCa	p.G648A	MAPKBP1_ENST00000260357.7_Missense_Mutation_p.G481A|MAPKBP1_ENST00000457542.2_Missense_Mutation_p.G642A|MAPKBP1_ENST00000514566.1_Missense_Mutation_p.G642A|MAPKBP1_ENST00000221214.6_Missense_Mutation_p.G525A	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	648										breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		ATCAGCAGTGGAAAGCAGAAG	0.517																																						uc001zok.3		NA																	0				central_nervous_system(5)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	10						c.(1942-1944)GGA>GCA		mitogen-activated protein kinase binding protein							126.0	130.0	129.0					15																	42110227		2203	4300	6503	SO:0001583	missense	23005							g.chr15:42110227G>C	AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.1943G>C	15.37:g.42110227G>C	ENSP00000393099:p.Gly648Ala		Somatic				MAPKBP1_uc001zoj.3_Missense_Mutation_p.G642A|MAPKBP1_uc010bcj.2_Missense_Mutation_p.G149A|MAPKBP1_uc010bci.2_Missense_Mutation_p.G642A|MAPKBP1_uc010udb.1_Missense_Mutation_p.G481A|MAPKBP1_uc010bck.2_5'UTR|MAPKBP1_uc010bcl.2_Missense_Mutation_p.G149A	p.G648A	NM_001128608	NP_001122080	WXS	Illumina HiSeq	Unspecified	O60336	MABP1_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)	18	2229	+		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)	648			WD 10.		A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Missense_Mutation	SNP	ENST00000456763.2	37	c.1943G>C	CCDS45239.1	.	.	.	.	.	.	.	.	.	.	g	23.7	4.451995	0.84209	.	.	ENSG00000137802	ENST00000457542;ENST00000221214;ENST00000260357;ENST00000456763;ENST00000514566	T;T;T;T;T	0.70986	1.33;1.33;0.57;-0.53;0.57	5.51	5.51	0.81932	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.046583	0.85682	D	0.000000	D	0.84529	0.5492	M	0.77313	2.365	0.80722	D	1	D;D;D;D;D	0.89917	0.989;0.999;1.0;0.998;0.997	P;D;D;D;D	0.85130	0.708;0.993;0.997;0.984;0.995	T	0.82370	-0.0491	10	0.31617	T	0.26	-21.2419	19.4093	0.94662	0.0:0.0:1.0:0.0	.	481;525;642;648;642	F8WC21;O60336-3;O60336-2;O60336;O60336-6	.;.;.;MABP1_HUMAN;.	A	642;525;481;648;642	ENSP00000397570:G642A;ENSP00000221214:G525A;ENSP00000260357:G481A;ENSP00000393099:G648A;ENSP00000426154:G642A	ENSP00000221214:G525A	G	+	2	0	MAPKBP1	39897519	1.000000	0.71417	1.000000	0.80357	0.797000	0.45037	7.480000	0.81109	2.574000	0.86865	0.563000	0.77884	GGA		0.517	MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000359745.1	NM_014994		28	140	0	0	0	0	28	140				
TGM5	9333	broad.mit.edu	37	15	43552604	43552604	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr15:43552604C>G	ENST00000220420.5	-	2	191	c.184G>C	c.(184-186)Gaa>Caa	p.E62Q	TGM5_ENST00000349114.4_Missense_Mutation_p.E62Q	NM_201631.3	NP_963925.2	O43548	TGM5_HUMAN	transglutaminase 5	62					cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(11)|lung(15)|skin(6)|urinary_tract(1)	44		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;4e-07)	L-Glutamine(DB00130)	TTACCAGTTTCAACCACGAAG	0.597																																						uc001zrd.1		NA																	0				central_nervous_system(1)	1						c.(184-186)GAA>CAA		transglutaminase 5 isoform 1	L-Glutamine(DB00130)						66.0	74.0	72.0					15																	43552604		2202	4299	6501	SO:0001583	missense	9333				epidermis development|peptide cross-linking	cytoplasm	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity	g.chr15:43552604C>G	AF035960	CCDS32211.1, CCDS32212.1	15q15	2004-07-07				ENSG00000104055		"""Transglutaminases"""	11781	protein-coding gene	gene with protein product		603805				9452468, 11390390	Standard	NM_201631		Approved	TGX	uc001zrd.2	O43548		ENST00000220420.5:c.184G>C	15.37:g.43552604C>G	ENSP00000220420:p.Glu62Gln		Somatic				TGM5_uc001zre.1_Missense_Mutation_p.E62Q	p.E62Q	NM_201631	NP_963925	WXS	Illumina HiSeq	Unspecified	O43548	TGM5_HUMAN		GBM - Glioblastoma multiforme(94;4e-07)	2	192	-		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)	62					O43549|Q0VF40|Q9UEZ4	Missense_Mutation	SNP	ENST00000220420.5	37	c.184G>C	CCDS32212.1	.	.	.	.	.	.	.	.	.	.	C	17.54	3.414172	0.62511	.	.	ENSG00000104055	ENST00000220420;ENST00000349114;ENST00000396996	D;D	0.84873	-1.91;-1.91	5.11	5.11	0.69529	Immunoglobulin E-set (1);Transglutaminase, N-terminal (1);Immunoglobulin-like fold (1);	0.244810	0.40469	N	0.001096	D	0.89181	0.6642	L	0.43152	1.355	0.30931	N	0.726896	D;B	0.89917	1.0;0.268	D;B	0.74348	0.983;0.309	D	0.87631	0.2516	10	0.56958	D	0.05	-24.357	16.0816	0.81007	0.0:1.0:0.0:0.0	.	62;62	O43548-2;O43548	.;TGM5_HUMAN	Q	62;62;61	ENSP00000220420:E62Q;ENSP00000220419:E62Q	ENSP00000220420:E62Q	E	-	1	0	TGM5	41339896	0.978000	0.34361	0.973000	0.42090	0.186000	0.23388	3.753000	0.55180	2.664000	0.90586	0.555000	0.69702	GAA		0.597	TGM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432257.1	NM_004245		5	49	0	0	0	0	5	49				
MAP1A	4130	broad.mit.edu	37	15	43814069	43814069	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr15:43814069G>C	ENST00000300231.5	+	4	848	c.398G>C	c.(397-399)gGa>gCa	p.G133A	MAP1A_ENST00000382031.1_Missense_Mutation_p.G371A|MAP1A_ENST00000399453.1_Missense_Mutation_p.G133A			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	133					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	CCTGAGCTTGGAGTTGTCTTT	0.557																																						uc001zrt.2		NA																	0				ovary(3)|breast(3)|pancreas(2)|skin(1)	9						c.(397-399)GGA>GCA		microtubule-associated protein 1A	Estramustine(DB01196)						123.0	126.0	125.0					15																	43814069		2014	4179	6193	SO:0001583	missense	4130					cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity	g.chr15:43814069G>C	U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.398G>C	15.37:g.43814069G>C	ENSP00000300231:p.Gly133Ala		Somatic					p.G133A	NM_002373	NP_002364	WXS	Illumina HiSeq	Unspecified	P78559	MAP1A_HUMAN		GBM - Glioblastoma multiforme(94;3.05e-06)	4	865	+		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)	133					O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	ENST00000300231.5	37	c.398G>C	CCDS42031.1	.	.	.	.	.	.	.	.	.	.	G	15.19	2.759052	0.49468	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231;ENST00000442025	T;T;T	0.25912	1.77;1.77;1.77	5.1	5.1	0.69264	.	.	.	.	.	T	0.60209	0.2251	M	0.90309	3.105	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.69150	-0.5221	9	0.87932	D	0	-12.0246	18.7051	0.91635	0.0:0.0:1.0:0.0	.	133	P78559	MAP1A_HUMAN	A	371;133;133;133	ENSP00000371462:G371A;ENSP00000382380:G133A;ENSP00000300231:G133A	ENSP00000300231:G133A	G	+	2	0	MAP1A	41601361	1.000000	0.71417	0.988000	0.46212	0.986000	0.74619	9.657000	0.98554	2.659000	0.90383	0.561000	0.74099	GGA		0.557	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132894.5	NM_002373		13	51	0	0	0	0	13	51				
PPIP5K1	9677	broad.mit.edu	37	15	43827592	43827592	+	Silent	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr15:43827592G>A	ENST00000396923.3	-	30	3703	c.3582C>T	c.(3580-3582)ttC>ttT	p.F1194F	PPIP5K1_ENST00000420765.1_Silent_p.F1194F|PPIP5K1_ENST00000381885.1_Silent_p.F1190F|PPIP5K1_ENST00000334933.4_Silent_p.F1169F|PPIP5K1_ENST00000381879.4_Silent_p.F1170F|PPIP5K1_ENST00000348806.6_Silent_p.F1167F|PPIP5K1_ENST00000360135.4_Silent_p.F1167F|PPIP5K1_ENST00000360301.4_Silent_p.F1169F			Q6PFW1	VIP1_HUMAN	diphosphoinositol pentakisphosphate kinase 1	1194					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)			large_intestine(1)	1						GTTGATCACTGAAGCCAAATT	0.522																																						uc001zrw.2		NA																	0					0						c.(3580-3582)TTC>TTT		histidine acid phosphatase domain containing 2A							73.0	71.0	71.0					15																	43827592		2201	4298	6499	SO:0001819	synonymous_variant	9677				inositol metabolic process	cytosol	acid phosphatase activity|ATP binding|diphosphoinositol-pentakisphosphate kinase activity|inositol 1,3,4,5,6-pentakisphosphate kinase activity|inositol hexakisphosphate 5-kinase activity	g.chr15:43827592G>A	AF502586	CCDS32215.1, CCDS45252.1, CCDS53937.1	15q15.3	2010-01-27	2010-01-26	2010-01-26	ENSG00000168781	ENSG00000168781	2.7.4.24		29023	protein-coding gene	gene with protein product		610979	"""histidine acid phosphatase domain containing 2A"""	HISPPD2A		17412958, 17690096, 18981179	Standard	NM_001190214		Approved	KIAA0377, IPS1, VIP1	uc001zrw.3	Q6PFW1	OTTHUMG00000059758	ENST00000396923.3:c.3582C>T	15.37:g.43827592G>A			Somatic				PPIP5K1_uc001zrx.1_Silent_p.F1167F|PPIP5K1_uc001zru.2_Silent_p.F1169F|PPIP5K1_uc001zry.3_Silent_p.F1169F|PPIP5K1_uc001zrv.2_Intron	p.F1194F	NM_001130858	NP_001124330	WXS	Illumina HiSeq	Unspecified	Q6PFW1	VIP1_HUMAN			31	3765	-			1194					O15082|Q5HYF8|Q7Z3A7|Q86TE7|Q86UV3|Q86UV4|Q86XW8|Q8IZN0	Silent	SNP	ENST00000396923.3	37	c.3582C>T	CCDS45252.1																																																																																				0.522	PPIP5K1-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000132907.1	NM_014659		16	85	0	0	0	0	16	85				
DMXL2	23312	broad.mit.edu	37	15	51790872	51790872	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr15:51790872G>A	ENST00000251076.5	-	18	4836	c.4549C>T	c.(4549-4551)Cat>Tat	p.H1517Y	RP11-707P17.1_ENST00000561007.1_RNA|DMXL2_ENST00000543779.2_Missense_Mutation_p.H1517Y|DMXL2_ENST00000449909.3_Intron	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	1517						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		TGCATAAGATGACTTGAAAGT	0.408																																						uc002abf.2		NA																	0				ovary(6)|skin(3)	9						c.(4549-4551)CAT>TAT		Dmx-like 2							143.0	134.0	137.0					15																	51790872		2195	4293	6488	SO:0001583	missense	23312					cell junction|synaptic vesicle membrane	Rab GTPase binding	g.chr15:51790872G>A	AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.4549C>T	15.37:g.51790872G>A	ENSP00000251076:p.His1517Tyr		Somatic				DMXL2_uc010ufy.1_Missense_Mutation_p.H1517Y|DMXL2_uc010bfa.2_Intron	p.H1517Y	NM_015263	NP_056078	WXS	Illumina HiSeq	Unspecified	Q8TDJ6	DMXL2_HUMAN		all cancers(107;0.00494)	18	4774	-			1517					B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	ENST00000251076.5	37	c.4549C>T	CCDS10141.1	.	.	.	.	.	.	.	.	.	.	G	19.60	3.857716	0.71834	.	.	ENSG00000104093	ENST00000251076;ENST00000543779	T;T	0.43294	0.95;0.95	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.64283	0.2584	M	0.64404	1.975	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.87578	0.998;0.994	T	0.61941	-0.6959	10	0.46703	T	0.11	.	19.6363	0.95735	0.0:0.0:1.0:0.0	.	1517;1517	F5GWF1;Q8TDJ6	.;DMXL2_HUMAN	Y	1517	ENSP00000251076:H1517Y;ENSP00000441858:H1517Y	ENSP00000251076:H1517Y	H	-	1	0	DMXL2	49578164	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.441000	0.97557	2.652000	0.90054	0.484000	0.47621	CAT		0.408	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263		19	46	0	0	0	0	19	46				
THSD4	79875	broad.mit.edu	37	15	71535293	71535293	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr15:71535293C>T	ENST00000355327.3	+	5	904	c.770C>T	c.(769-771)tCa>tTa	p.S257L	THSD4_ENST00000261862.6_Missense_Mutation_p.S257L			Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4	257	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				elastic fiber assembly (GO:0048251)	extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)			breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						CCTGCAGCTTCAAGTCTCTTT	0.562																																						uc002atb.1		NA																	0				ovary(2)	2						c.(769-771)TCA>TTA		thrombospondin, type I, domain containing 4							80.0	82.0	81.0					15																	71535293		1977	4164	6141	SO:0001583	missense	79875					proteinaceous extracellular matrix	metalloendopeptidase activity	g.chr15:71535293C>T	AK023772	CCDS10238.2, CCDS66817.1	15q23	2009-11-09			ENSG00000187720	ENSG00000187720			25835	protein-coding gene	gene with protein product		614476				19734141	Standard	NM_001286429		Approved	FVSY9334, PRO34005, FLJ13710, ADAMTSL6	uc002atb.1	Q6ZMP0	OTTHUMG00000133389	ENST00000355327.3:c.770C>T	15.37:g.71535293C>T	ENSP00000347484:p.Ser257Leu		Somatic				THSD4_uc002atd.1_5'UTR	p.S257L	NM_024817	NP_079093	WXS	Illumina HiSeq	Unspecified	Q6ZMP0	THSD4_HUMAN			4	849	+			257			TSP type-1 1.		B2RTY3|B4DR13|Q6MZI3|Q6UXZ8|Q9H8E4	Missense_Mutation	SNP	ENST00000355327.3	37	c.770C>T	CCDS10238.2	.	.	.	.	.	.	.	.	.	.	C	13.82	2.349869	0.41599	.	.	ENSG00000187720	ENST00000355327;ENST00000261862	T;T	0.61859	0.07;0.07	5.63	5.63	0.86233	.	0.481917	0.20970	N	0.082401	T	0.47838	0.1467	L	0.29908	0.895	0.35613	D	0.808814	P	0.47762	0.9	B	0.42282	0.382	T	0.56117	-0.8032	10	0.30078	T	0.28	.	15.1727	0.72888	0.0:1.0:0.0:0.0	.	257	Q6ZMP0	THSD4_HUMAN	L	257	ENSP00000347484:S257L;ENSP00000261862:S257L	ENSP00000261862:S257L	S	+	2	0	THSD4	69322347	0.432000	0.25554	0.608000	0.28969	0.850000	0.48378	3.540000	0.53611	2.653000	0.90120	0.563000	0.77884	TCA		0.562	THSD4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257253.2	NM_024817		17	64	0	0	0	0	17	64				
C15orf27	123591	broad.mit.edu	37	15	76496185	76496185	+	Silent	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr15:76496185C>G	ENST00000388942.3	+	11	1401	c.1125C>G	c.(1123-1125)ctC>ctG	p.L375L		NM_152335.2	NP_689548.2	Q2M3C6	CO027_HUMAN	chromosome 15 open reading frame 27	375					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|membrane depolarization during action potential (GO:0086010)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	voltage-gated calcium channel activity (GO:0005245)			endometrium(1)|large_intestine(1)|lung(10)|pancreas(1)	13						ACATGCCCCTCAAACTCGGCG	0.632																																						uc002bbq.2		NA																	0					0						c.(1123-1125)CTC>CTG		hypothetical protein LOC123591							160.0	143.0	149.0					15																	76496185		2197	4294	6491	SO:0001819	synonymous_variant	123591					integral to membrane		g.chr15:76496185C>G	AK095509	CCDS10289.2	15q23-q24.1	2012-09-27			ENSG00000169758	ENSG00000169758			26763	protein-coding gene	gene with protein product						14702039, 22020278	Standard	NM_152335		Approved	FLJ38190	uc002bbq.3	Q2M3C6	OTTHUMG00000142918	ENST00000388942.3:c.1125C>G	15.37:g.76496185C>G			Somatic				C15orf27_uc010bkp.2_Silent_p.L191L|C15orf27_uc002bbr.2_Silent_p.L191L|C15orf27_uc002bbs.2_Silent_p.L53L	p.L375L	NM_152335	NP_689548	WXS	Illumina HiSeq	Unspecified	Q2M3C6	CO027_HUMAN			11	1280	+			375					Q8N993|Q96LL5	Silent	SNP	ENST00000388942.3	37	c.1125C>G	CCDS10289.2																																																																																				0.632	C15orf27-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000286637.2	NM_152335		23	103	0	0	0	0	23	103				
C15orf27	123591	broad.mit.edu	37	15	76496280	76496280	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr15:76496280C>T	ENST00000388942.3	+	11	1496	c.1220C>T	c.(1219-1221)tCc>tTc	p.S407F		NM_152335.2	NP_689548.2	Q2M3C6	CO027_HUMAN	chromosome 15 open reading frame 27	407					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|membrane depolarization during action potential (GO:0086010)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	voltage-gated calcium channel activity (GO:0005245)			endometrium(1)|large_intestine(1)|lung(10)|pancreas(1)	13						ACGCTGGGCTCCTCCATGGAC	0.697																																						uc002bbq.2		NA																	0					0						c.(1219-1221)TCC>TTC		hypothetical protein LOC123591							41.0	43.0	42.0					15																	76496280		2197	4294	6491	SO:0001583	missense	123591					integral to membrane		g.chr15:76496280C>T	AK095509	CCDS10289.2	15q23-q24.1	2012-09-27			ENSG00000169758	ENSG00000169758			26763	protein-coding gene	gene with protein product						14702039, 22020278	Standard	NM_152335		Approved	FLJ38190	uc002bbq.3	Q2M3C6	OTTHUMG00000142918	ENST00000388942.3:c.1220C>T	15.37:g.76496280C>T	ENSP00000373594:p.Ser407Phe		Somatic				C15orf27_uc010bkp.2_Missense_Mutation_p.S223F|C15orf27_uc002bbr.2_Missense_Mutation_p.S223F|C15orf27_uc002bbs.2_Missense_Mutation_p.S85F	p.S407F	NM_152335	NP_689548	WXS	Illumina HiSeq	Unspecified	Q2M3C6	CO027_HUMAN			11	1375	+			407					Q8N993|Q96LL5	Missense_Mutation	SNP	ENST00000388942.3	37	c.1220C>T	CCDS10289.2	.	.	.	.	.	.	.	.	.	.	C	14.42	2.530045	0.45073	.	.	ENSG00000169758	ENST00000388942	T	0.44083	0.93	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.42337	0.1198	M	0.72894	2.215	0.58432	D	0.999999	B;B	0.31769	0.339;0.033	B;B	0.30646	0.118;0.027	T	0.48736	-0.9009	10	0.87932	D	0	-17.731	10.8345	0.46679	0.0:0.909:0.0:0.091	.	371;407	Q2M3C6-2;Q2M3C6	.;CO027_HUMAN	F	407	ENSP00000373594:S407F	ENSP00000373594:S407F	S	+	2	0	C15orf27	74283335	1.000000	0.71417	1.000000	0.80357	0.046000	0.14306	6.977000	0.76141	2.244000	0.73946	0.455000	0.32223	TCC		0.697	C15orf27-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000286637.2	NM_152335		9	30	0	0	0	0	9	30				
IL16	3603	broad.mit.edu	37	15	81575003	81575003	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr15:81575003G>A	ENST00000302987.4	+	8	1105	c.1105G>A	c.(1105-1107)Ggc>Agc	p.G369S	IL16_ENST00000394660.2_Missense_Mutation_p.G369S			Q14005	IL16_HUMAN	interleukin 16	369	Interaction with GRIN2A.|PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				immune response (GO:0006955)|induction of positive chemotaxis (GO:0050930)|leukocyte chemotaxis (GO:0030595)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(3)|skin(3)|stomach(1)|urinary_tract(1)	57						CCTGGGCATCGGCCTGTGCAG	0.642																																						uc002bgh.3		NA																	0				ovary(2)|lung(1)|skin(1)	4						c.(1105-1107)GGC>AGC		interleukin 16 isoform 2							107.0	115.0	112.0					15																	81575003		2095	4217	6312	SO:0001583	missense	3603				immune response|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus|plasma membrane	cytokine activity	g.chr15:81575003G>A	U82972	CCDS10317.1, CCDS42069.1, CCDS53966.1	15q26.3	2011-07-14	2011-07-14		ENSG00000172349	ENSG00000172349		"""Interleukins and interleukin receptors"""	5980	protein-coding gene	gene with protein product	"""prointerleukin 16"", ""lymphocyte chemoattractant factor"""	603035	"""interleukin 16 (lymphocyte chemoattractant factor)"""			9144227	Standard	NM_004513		Approved	LCF, IL-16, prIL-16, HsT19289, FLJ42735, FLJ16806	uc021ssh.1	Q14005	OTTHUMG00000144186	ENST00000302987.4:c.1105G>A	15.37:g.81575003G>A	ENSP00000302935:p.Gly369Ser		Somatic				IL16_uc002bgc.2_RNA|IL16_uc010blq.1_Missense_Mutation_p.G369S|IL16_uc002bge.3_RNA|IL16_uc010unp.1_Missense_Mutation_p.G411S|IL16_uc002bgg.2_Missense_Mutation_p.G369S|IL16_uc002bgi.1_5'UTR	p.G369S	NM_172217	NP_757366	WXS	Illumina HiSeq	Unspecified	Q14005	IL16_HUMAN			9	1481	+			369			PDZ 2.|Interaction with GRIN2A.		A6NM20|A8MU65|B5TY35|B9EGR6|H3BVH5|Q16435|Q6VVE6|Q6ZMQ7|Q9UP18	Missense_Mutation	SNP	ENST00000302987.4	37	c.1105G>A	CCDS42069.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.083278	0.76642	.	.	ENSG00000172349	ENST00000394655;ENST00000394660;ENST00000355368;ENST00000302987	T;T	0.13778	2.56;2.56	5.46	5.46	0.80206	PDZ/DHR/GLGF (3);	0.000000	0.45361	D	0.000364	T	0.23014	0.0556	N	0.21097	0.63	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.03957	-1.0989	10	0.07990	T	0.79	.	19.3014	0.94145	0.0:0.0:1.0:0.0	.	369;369	Q14005;Q14005-2	IL16_HUMAN;.	S	369;369;201;369	ENSP00000378155:G369S;ENSP00000302935:G369S	ENSP00000302935:G369S	G	+	1	0	IL16	79362058	1.000000	0.71417	0.992000	0.48379	0.140000	0.21249	8.539000	0.90637	2.557000	0.86248	0.591000	0.81541	GGC		0.642	IL16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000303952.1	NM_172217		26	125	0	0	0	0	26	125				
ALPK3	57538	broad.mit.edu	37	15	85406114	85406114	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr15:85406114C>T	ENST00000258888.5	+	10	5151	c.4984C>T	c.(4984-4986)Ctt>Ttt	p.L1662F		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1662	Alpha-type protein kinase. {ECO:0000255|PROSITE-ProRule:PRU00501}.				heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			TGAGACTTCTCTTGTGGGCAG	0.557																																						uc002ble.2		NA																	0				stomach(3)|ovary(3)|lung(2)|skin(2)|central_nervous_system(1)|breast(1)	12						c.(4984-4986)CTT>TTT		alpha-kinase 3							138.0	140.0	139.0					15																	85406114		2203	4299	6502	SO:0001583	missense	57538				heart development	nucleus	ATP binding|protein serine/threonine kinase activity	g.chr15:85406114C>T	AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.4984C>T	15.37:g.85406114C>T	ENSP00000258888:p.Leu1662Phe		Somatic				ALPK3_uc010upc.1_5'Flank	p.L1662F	NM_020778	NP_065829	WXS	Illumina HiSeq	Unspecified	Q96L96	ALPK3_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0587)		10	5151	+			1662			Alpha-type protein kinase.		Q9P2L6	Missense_Mutation	SNP	ENST00000258888.5	37	c.4984C>T	CCDS10333.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.111749	0.77210	.	.	ENSG00000136383	ENST00000258888	T	0.07908	3.15	4.54	4.54	0.55810	MHCK/EF2 kinase (3);Protein kinase-like domain (1);	0.000000	0.64402	D	0.000002	T	0.22513	0.0543	M	0.64404	1.975	0.47341	D	0.999398	D	0.89917	1.0	D	0.97110	1.0	T	0.00256	-1.1873	10	0.87932	D	0	-16.2596	8.4096	0.32636	0.0:0.8957:0.0:0.1043	.	1662	Q96L96	ALPK3_HUMAN	F	1662	ENSP00000258888:L1662F	ENSP00000258888:L1662F	L	+	1	0	ALPK3	83207118	1.000000	0.71417	0.999000	0.59377	0.964000	0.63967	4.381000	0.59587	2.334000	0.79466	0.561000	0.74099	CTT		0.557	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308997.1	NM_020778		17	95	0	0	0	0	17	95				
ALPK3	57538	broad.mit.edu	37	15	85406847	85406847	+	Missense_Mutation	SNP	C	C	T	rs538810746		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr15:85406847C>T	ENST00000258888.5	+	11	5248	c.5081C>T	c.(5080-5082)gCg>gTg	p.A1694V		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1694	Alpha-type protein kinase. {ECO:0000255|PROSITE-ProRule:PRU00501}.				heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			GCCCGGGCCGCGCCTGGCTTT	0.557																																						uc002ble.2		NA																	0				stomach(3)|ovary(3)|lung(2)|skin(2)|central_nervous_system(1)|breast(1)	12						c.(5080-5082)GCG>GTG		alpha-kinase 3							54.0	47.0	50.0					15																	85406847		2203	4299	6502	SO:0001583	missense	57538				heart development	nucleus	ATP binding|protein serine/threonine kinase activity	g.chr15:85406847C>T	AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.5081C>T	15.37:g.85406847C>T	ENSP00000258888:p.Ala1694Val		Somatic				ALPK3_uc010upc.1_5'Flank	p.A1694V	NM_020778	NP_065829	WXS	Illumina HiSeq	Unspecified	Q96L96	ALPK3_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0587)		11	5248	+			1694			Alpha-type protein kinase.		Q9P2L6	Missense_Mutation	SNP	ENST00000258888.5	37	c.5081C>T	CCDS10333.1	.	.	.	.	.	.	.	.	.	.	C	0.020	-1.434769	0.01108	.	.	ENSG00000136383	ENST00000258888	T	0.14391	2.51	5.8	-0.938	0.10412	MHCK/EF2 kinase (3);Protein kinase-like domain (1);	0.547339	0.18356	N	0.143705	T	0.02888	0.0086	N	0.00823	-1.155	0.09310	N	1	B	0.27286	0.174	B	0.25140	0.058	T	0.44421	-0.9329	10	0.02654	T	1	-2.1553	9.8249	0.40905	0.0:0.3438:0.0:0.6562	.	1694	Q96L96	ALPK3_HUMAN	V	1694	ENSP00000258888:A1694V	ENSP00000258888:A1694V	A	+	2	0	ALPK3	83207851	0.144000	0.22641	0.000000	0.03702	0.002000	0.02628	0.804000	0.27098	-0.146000	0.11274	-0.136000	0.14681	GCG		0.557	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308997.1	NM_020778		6	21	0	0	0	0	6	21				
AEN	64782	broad.mit.edu	37	15	89173347	89173347	+	Missense_Mutation	SNP	G	G	A	rs201760461		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr15:89173347G>A	ENST00000332810.3	+	4	951	c.800G>A	c.(799-801)cGg>cAg	p.R267Q	AEN_ENST00000379231.3_Missense_Mutation_p.R267Q	NM_022767.3	NP_073604.3	Q8WTP8	AEN_HUMAN	apoptosis enhancing nuclease	267					intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|response to ionizing radiation (GO:0010212)	nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	exonuclease activity (GO:0004527)|nucleic acid binding (GO:0003676)			NS(1)|kidney(1)|large_intestine(1)|lung(4)	7						GAGCTCTACCGGCTGGTGGAG	0.607																																						uc002bmt.2		NA																	0					0						c.(799-801)CGG>CAG		interferon stimulated exonuclease gene		G	GLN/ARG	1,4399	2.1+/-5.4	0,1,2199	50.0	50.0	50.0		800	1.8	1.0	15		50	1,8597	1.2+/-3.3	0,1,4298	no	missense	AEN	NM_022767.3	43	0,2,6497	AA,AG,GG		0.0116,0.0227,0.0154	benign	267/326	89173347	2,12996	2200	4299	6499	SO:0001583	missense	64782				apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|response to ionizing radiation	nucleolus|nucleoplasm	exonuclease activity|nucleic acid binding	g.chr15:89173347G>A	BC020988	CCDS10344.1	15q26.1	2008-07-15	2008-07-15	2008-07-15	ENSG00000181026	ENSG00000181026			25722	protein-coding gene	gene with protein product		610177	"""interferon stimulated exonuclease gene 20kDa-like 1"""	ISG20L1		18264133, 16171785	Standard	NM_022767		Approved	FLJ12484, FLJ12562	uc002bmt.2	Q8WTP8	OTTHUMG00000148681	ENST00000332810.3:c.800G>A	15.37:g.89173347G>A	ENSP00000331944:p.Arg267Gln		Somatic				AEN_uc010bnm.1_Missense_Mutation_p.R267Q	p.R267Q	NM_022767	NP_073604	WXS	Illumina HiSeq	Unspecified	Q8WTP8	AEN_HUMAN			4	951	+			267					C9J571|Q9BSA5|Q9H9X7	Missense_Mutation	SNP	ENST00000332810.3	37	c.800G>A	CCDS10344.1	.	.	.	.	.	.	.	.	.	.	G	9.914	1.210289	0.22289	2.27E-4	1.16E-4	ENSG00000181026	ENST00000332810;ENST00000379231	T;T	0.30182	1.54;1.54	5.76	1.8	0.24995	Exonuclease (1);Ribonuclease H-like (1);	0.295611	0.18466	N	0.140387	T	0.13243	0.0321	N	0.08118	0	0.28087	N	0.931976	B;B	0.27229	0.172;0.107	B;B	0.20767	0.031;0.014	T	0.18871	-1.0323	10	0.27785	T	0.31	-0.5297	8.0535	0.30591	0.3938:0.0:0.6062:0.0	.	267;267	Q8WTP8-2;Q8WTP8	.;AEN_HUMAN	Q	267	ENSP00000331944:R267Q;ENSP00000368533:R267Q	ENSP00000331944:R267Q	R	+	2	0	AEN	86974351	1.000000	0.71417	0.969000	0.41365	0.080000	0.17528	2.420000	0.44679	0.354000	0.24105	-0.140000	0.14226	CGG		0.607	AEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309071.1	NM_022767		8	42	0	0	0	0	8	42				
LINS	55180	broad.mit.edu	37	15	101109585	101109585	+	Missense_Mutation	SNP	C	C	T	rs148450316		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr15:101109585C>T	ENST00000314742.8	-	7	2354	c.2132G>A	c.(2131-2133)aGa>aAa	p.R711K	LINS_ENST00000559149.1_5'Flank	NM_001040616.2	NP_001035706	Q8NG48	LINES_HUMAN	lines homolog (Drosophila)	711										central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(1)|skin(1)|stomach(4)	21						TTTTACTATTCTGTAAAATAT	0.383																																						uc002bwe.2		NA																	0					0						c.(2131-2133)AGA>AAA		lines homolog 1							108.0	117.0	114.0					15																	101109585		2203	4300	6503	SO:0001583	missense	55180							g.chr15:101109585C>T	AK095448	CCDS10385.1	15q26.3	2010-09-08	2010-09-08	2010-09-08	ENSG00000140471	ENSG00000140471			30922	protein-coding gene	gene with protein product		610350	"""lines homolog 1 (Drosophila)"""	LINS1		12119551, 8889548	Standard	NM_001040616		Approved	WINS1	uc002bwg.3	Q8NG48	OTTHUMG00000149865	ENST00000314742.8:c.2132G>A	15.37:g.101109585C>T	ENSP00000318423:p.Arg711Lys		Somatic				LINS1_uc002bwd.2_Missense_Mutation_p.R298K|LINS1_uc002bwf.2_Missense_Mutation_p.R711K|LINS1_uc002bwg.2_Missense_Mutation_p.R711K|LINS1_uc002bwh.2_Missense_Mutation_p.R711K	p.R711K	NM_001040614	NP_001035704	WXS	Illumina HiSeq	Unspecified	Q8NG48	LINES_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.00095)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)		8	2423	-	Lung NSC(78;0.0018)|all_lung(78;0.00223)|Melanoma(26;0.00852)		711					Q96FW2|Q9NVQ3	Missense_Mutation	SNP	ENST00000314742.8	37	c.2132G>A	CCDS10385.1	.	.	.	.	.	.	.	.	.	.	C	0.017	-1.488913	0.01018	.	.	ENSG00000140471	ENST00000314742	T	0.07216	3.21	5.9	1.49	0.22878	.	0.213651	0.37906	N	0.001899	T	0.02727	0.0082	N	0.10837	0.055	0.09310	N	1	B	0.26975	0.165	B	0.17722	0.019	T	0.44345	-0.9334	10	0.02654	T	1	-4.9475	4.66	0.12637	0.0:0.4251:0.1634:0.4115	.	711	Q8NG48	LINES_HUMAN	K	711	ENSP00000318423:R711K	ENSP00000318423:R711K	R	-	2	0	LINS	98927108	0.936000	0.31750	0.000000	0.03702	0.042000	0.13812	0.358000	0.20216	0.128000	0.18479	-1.273000	0.01405	AGA		0.383	LINS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313592.1	NM_018148		24	124	0	0	0	0	24	124				
OR4F6	390648	broad.mit.edu	37	15	102346152	102346152	+	Missense_Mutation	SNP	C	C	T	rs558260972		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr15:102346152C>T	ENST00000328882.4	+	1	251	c.230C>T	c.(229-231)aCa>aTa	p.T77I		NM_001005326.1	NP_001005326.1	Q8NGB9	OR4F6_HUMAN	olfactory receptor, family 4, subfamily F, member 6	77						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(1)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			TGTTCCTCCACAGCTCCCAAG	0.463													c|||	1	0.000199681	0.0008	0.0	5008	,	,		20803	0.0		0.0	False		,,,				2504	0.0					uc010utr.1		NA																	0				ovary(1)	1						c.(229-231)ACA>ATA		olfactory receptor, family 4, subfamily F,							258.0	247.0	251.0					15																	102346152		2203	4300	6503	SO:0001583	missense	390648				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr15:102346152C>T	AC025234	CCDS32341.1	15q26.3	2014-02-19	2002-02-28		ENSG00000184140	ENSG00000184140		"""GPCR / Class A : Olfactory receptors"""	15372	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily F, member 12"""	OR4F12			Standard	NM_001005326		Approved		uc010utr.2	Q8NGB9	OTTHUMG00000172267	ENST00000328882.4:c.230C>T	15.37:g.102346152C>T	ENSP00000327525:p.Thr77Ile		Somatic					p.T77I	NM_001005326	NP_001005326	WXS	Illumina HiSeq	Unspecified	Q8NGB9	OR4F6_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)		1	230	+	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		77			Helical; Name=2; (Potential).		B9EH28|Q6IF95	Missense_Mutation	SNP	ENST00000328882.4	37	c.230C>T	CCDS32341.1	.	.	.	.	.	.	.	.	.	.	.	6.089	0.384667	0.11524	.	.	ENSG00000184140	ENST00000328882	T	0.00675	5.88	4.75	3.81	0.43845	GPCR, rhodopsin-like superfamily (1);	0.931204	0.09038	N	0.857736	T	0.00936	0.0031	L	0.38953	1.18	0.09310	N	1	B	0.14012	0.009	B	0.12837	0.008	T	0.47235	-0.9133	10	0.49607	T	0.09	.	5.938	0.19177	0.1915:0.7122:0.0:0.0964	.	77	Q8NGB9	OR4F6_HUMAN	I	77	ENSP00000327525:T77I	ENSP00000327525:T77I	T	+	2	0	OR4F6	100163675	0.000000	0.05858	0.074000	0.20217	0.323000	0.28346	0.357000	0.20199	1.304000	0.44892	0.591000	0.81541	ACA		0.463	OR4F6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417593.1			49	253	0	0	0	0	49	253				
CAPN15	6650	broad.mit.edu	37	16	599044	599044	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr16:599044G>A	ENST00000219611.2	+	5	1864	c.1501G>A	c.(1501-1503)Ggc>Agc	p.G501S	LA16c-366D1.3_ENST00000565879.1_RNA	NM_005632.2	NP_005623.1	O75808	CAN15_HUMAN	calpain 15	501	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										CGAGTCTGTCGGCTTCCCCGC	0.657																																						uc002chi.2		NA																	0				ovary(1)|breast(1)	2						c.(1501-1503)GGC>AGC		small optic lobes							103.0	95.0	98.0					16																	599044		2197	4297	6494	SO:0001583	missense	6650				proteolysis	intracellular	calcium-dependent cysteine-type endopeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:599044G>A	U85647	CCDS10410.1	16p13.3	2013-06-27	2013-06-27	2013-06-27	ENSG00000103326	ENSG00000103326			11182	protein-coding gene	gene with protein product		603267	"""small optic lobes (Drosophila) homolog"", ""small optic lobes homolog (Drosophila)"""	SOLH		9722942	Standard	NM_005632		Approved		uc002chi.3	O75808	OTTHUMG00000119059	ENST00000219611.2:c.1501G>A	16.37:g.599044G>A	ENSP00000219611:p.Gly501Ser		Somatic					p.G501S	NM_005632	NP_005623	WXS	Illumina HiSeq	Unspecified	O75808	CAN15_HUMAN			5	1864	+		Hepatocellular(780;0.00335)	501			Calpain catalytic.		B1B1M4|Q2KHS2|Q8WTY9|Q9BUW0	Missense_Mutation	SNP	ENST00000219611.2	37	c.1501G>A	CCDS10410.1	.	.	.	.	.	.	.	.	.	.	g	17.74	3.463739	0.63513	.	.	ENSG00000103326	ENST00000219611	T	0.44881	0.91	5.04	5.04	0.67666	Peptidase C2, calpain, catalytic domain (3);	0.047479	0.85682	D	0.000000	T	0.57651	0.2068	L	0.55990	1.75	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.50432	-0.8829	10	0.13470	T	0.59	.	16.9735	0.86306	0.0:0.0:1.0:0.0	.	501	O75808	CAN15_HUMAN	S	501	ENSP00000219611:G501S	ENSP00000219611:G501S	G	+	1	0	SOLH	539045	1.000000	0.71417	1.000000	0.80357	0.051000	0.14879	7.682000	0.84083	2.347000	0.79759	0.556000	0.70494	GGC		0.657	CAPN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239271.1	NM_005632		31	90	0	0	0	0	31	90				
BAIAP3	8938	broad.mit.edu	37	16	1398119	1398119	+	Missense_Mutation	SNP	C	C	T	rs535167017		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr16:1398119C>T	ENST00000324385.5	+	33	3435	c.3277C>T	c.(3277-3279)Cgc>Tgc	p.R1093C	BAIAP3_ENST00000397489.1_Missense_Mutation_p.R1075C|BAIAP3_ENST00000397488.2_Missense_Mutation_p.R1075C|BAIAP3_ENST00000426824.3_Missense_Mutation_p.R1058C|BAIAP3_ENST00000568887.1_Missense_Mutation_p.R1030C|BAIAP3_ENST00000421665.2_Missense_Mutation_p.R1022C|BAIAP3_ENST00000562208.1_Missense_Mutation_p.R1035C	NM_003933.4	NP_003924.2	O94812	BAIP3_HUMAN	BAI1-associated protein 3	1093	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				G-protein coupled receptor signaling pathway (GO:0007186)|neurotransmitter secretion (GO:0007269)		protein C-terminus binding (GO:0008022)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(25)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42		Hepatocellular(780;0.0893)				CGAGGCGTGCCGCCGCCGCGC	0.701													C|||	1	0.000199681	0.0	0.0	5008	,	,		12748	0.001		0.0	False		,,,				2504	0.0					uc002clk.1		NA																	0				pancreas(1)	1						c.(3277-3279)CGC>TGC		BAI1-associated protein 3							24.0	25.0	25.0					16																	1398119		2193	4294	6487	SO:0001583	missense	8938				G-protein coupled receptor protein signaling pathway|neurotransmitter secretion		protein C-terminus binding	g.chr16:1398119C>T	AB017111	CCDS10434.1, CCDS55978.1, CCDS55979.1, CCDS58402.1, CCDS58403.1, CCDS66894.1	16p13.3	2008-07-04			ENSG00000007516	ENSG00000007516			948	protein-coding gene	gene with protein product		604009				9790924	Standard	NM_003933		Approved	BAP3, KIAA0734	uc002clk.2	O94812	OTTHUMG00000047833	ENST00000324385.5:c.3277C>T	16.37:g.1398119C>T	ENSP00000324510:p.Arg1093Cys		Somatic				BAIAP3_uc002clj.2_Missense_Mutation_p.R1075C|BAIAP3_uc010uuz.1_Missense_Mutation_p.R1058C|BAIAP3_uc010uva.1_Missense_Mutation_p.R1030C|BAIAP3_uc010uvc.1_Missense_Mutation_p.R1022C	p.R1093C	NM_003933	NP_003924	WXS	Illumina HiSeq	Unspecified	O94812	BAIP3_HUMAN			33	3277	+		Hepatocellular(780;0.0893)	1093			C2 2.		A2A2B2|B2RCD7|B4DGS5|B4DIK3|B4DRK9|B4DRP1|E7EUB9|H3BUH8|H3BVI3|H7C2Q1|O94839|Q2M226|Q658J2|Q76N05|Q96RZ3|Q9UJK1	Missense_Mutation	SNP	ENST00000324385.5	37	c.3277C>T	CCDS10434.1	.	.	.	.	.	.	.	.	.	.	C	11.75	1.732641	0.30684	.	.	ENSG00000007516	ENST00000426824;ENST00000397488;ENST00000324385;ENST00000397489;ENST00000421665	T;T;T;T;T	0.69561	-0.41;-0.41;-0.41;-0.41;-0.41	4.65	3.69	0.42338	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.64068	0.2565	M	0.74467	2.265	0.80722	D	1	P;P;P;P	0.38767	0.458;0.646;0.646;0.646	B;B;B;B	0.36244	0.066;0.22;0.22;0.22	T	0.66176	-0.5989	10	0.56958	D	0.05	-24.582	10.8412	0.46718	0.0:0.9046:0.0:0.0954	.	1022;1035;1093;1075	E7EUB9;B4DIK3;O94812;A2A2B2	.;.;BAIP3_HUMAN;.	C	1058;1075;1093;1075;1022	ENSP00000407242:R1058C;ENSP00000380625:R1075C;ENSP00000324510:R1093C;ENSP00000380626:R1075C;ENSP00000409533:R1022C	ENSP00000324510:R1093C	R	+	1	0	BAIAP3	1338120	1.000000	0.71417	0.994000	0.49952	0.232000	0.25224	1.896000	0.39789	0.932000	0.37266	0.561000	0.74099	CGC		0.701	BAIAP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109056.3			7	33	0	0	0	0	7	33				
BAIAP3	8938	broad.mit.edu	37	16	1399439	1399439	+	3'UTR	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr16:1399439C>T	ENST00000324385.5	+	0	4678				BAIAP3_ENST00000397489.1_3'UTR|BAIAP3_ENST00000397488.2_3'UTR|TSR3_ENST00000007390.2_Silent_p.*313*|GNPTG_ENST00000204679.4_5'Flank	NM_003933.4	NP_003924.2	O94812	BAIP3_HUMAN	BAI1-associated protein 3						G-protein coupled receptor signaling pathway (GO:0007186)|neurotransmitter secretion (GO:0007269)		protein C-terminus binding (GO:0008022)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(25)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42		Hepatocellular(780;0.0893)				CTGCAACCCTCAGTCTCTCTG	0.567																																						uc002cll.2		NA																	0					0						c.(937-939)TGA>TAA		hypothetical protein LOC115939							167.0	190.0	182.0					16																	1399439		2199	4300	6499	SO:0001624	3_prime_UTR_variant	115939				rRNA processing			g.chr16:1399439C>T	AB017111	CCDS10434.1, CCDS55978.1, CCDS55979.1, CCDS58402.1, CCDS58403.1, CCDS66894.1	16p13.3	2008-07-04			ENSG00000007516	ENSG00000007516			948	protein-coding gene	gene with protein product		604009				9790924	Standard	NM_003933		Approved	BAP3, KIAA0734	uc002clk.2	O94812	OTTHUMG00000047833	ENST00000324385.5:c.*956C>T	16.37:g.1399439C>T			Somatic				BAIAP3_uc002clj.2_3'UTR|BAIAP3_uc010uuz.1_3'UTR|BAIAP3_uc010uva.1_3'UTR|BAIAP3_uc002clk.1_3'UTR|BAIAP3_uc010uvc.1_3'UTR|GNPTG_uc002clm.2_5'Flank	p.*313*	NM_001001410	NP_001001410	WXS	Illumina HiSeq	Unspecified	Q9UJK0	TSR3_HUMAN			6	1006	-		Hepatocellular(780;0.0893)	313					A2A2B2|B2RCD7|B4DGS5|B4DIK3|B4DRK9|B4DRP1|E7EUB9|H3BUH8|H3BVI3|H7C2Q1|O94839|Q2M226|Q658J2|Q76N05|Q96RZ3|Q9UJK1	Silent	SNP	ENST00000324385.5	37	c.938G>A	CCDS10434.1																																																																																				0.567	BAIAP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109056.3			39	322	0	0	0	0	39	322				
GNPTG	84572	broad.mit.edu	37	16	1399524	1399524	+	5'Flank	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr16:1399524C>T	ENST00000204679.4	+	0	0				TSR3_ENST00000007390.2_Missense_Mutation_p.E285K	NM_032520.4	NP_115909.1	Q9UJJ9	GNPTG_HUMAN	N-acetylglucosamine-1-phosphate transferase, gamma subunit						carbohydrate phosphorylation (GO:0046835)|N-glycan processing to lysosome (GO:0016256)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	7		Hepatocellular(780;0.0893)				TGCTCCTCTTCACAGCAGCTG	0.652																																						uc002cll.2		NA																	0					0						c.(853-855)GAA>AAA		hypothetical protein LOC115939							97.0	114.0	108.0					16																	1399524		2199	4300	6499	SO:0001631	upstream_gene_variant	115939				rRNA processing			g.chr16:1399524C>T	BC014592	CCDS10436.1	16p13.3	2009-04-17		2004-10-01	ENSG00000090581	ENSG00000090581			23026	protein-coding gene	gene with protein product	"""GlcNAc-phosphotransferase gamma-subunit"""	607838	"""N-acetylglucosamine-1-phosphotransferase, gamma subunit"", ""chromosome 16 open reading frame 27"""	GNPTAG, C16orf27		10712439	Standard	NM_032520		Approved	CAB56184, c316G12.3	uc002clm.3	Q9UJJ9	OTTHUMG00000047835		16.37:g.1399524C>T	Exception_encountered		Somatic				GNPTG_uc002clm.2_5'Flank	p.E285K	NM_001001410	NP_001001410	WXS	Illumina HiSeq	Unspecified	Q9UJK0	TSR3_HUMAN			6	921	-		Hepatocellular(780;0.0893)	285					B2R556|Q6XYD7|Q96L13	Missense_Mutation	SNP	ENST00000204679.4	37	c.853G>A	CCDS10436.1	.	.	.	.	.	.	.	.	.	.	C	13.16	2.152905	0.38021	.	.	ENSG00000007520	ENST00000007390	.	.	.	4.67	-2.26	0.06867	.	2.091850	0.02228	N	0.064651	T	0.35158	0.0922	L	0.50333	1.59	0.09310	N	1	B	0.26318	0.146	B	0.22152	0.038	T	0.31668	-0.9935	9	0.66056	D	0.02	1.9901	3.7962	0.08740	0.1458:0.3436:0.4091:0.1015	.	285	Q9UJK0	TSR3_HUMAN	K	285	.	ENSP00000007390:E285K	E	-	1	0	C16orf42	1339525	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.042000	0.12063	-0.179000	0.10654	-0.367000	0.07326	GAA		0.652	GNPTG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109058.2	NM_032520		36	214	0	0	0	0	36	214				
MAPK8IP3	23162	broad.mit.edu	37	16	1816351	1816351	+	Silent	SNP	C	C	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr16:1816351C>A	ENST00000250894.4	+	22	2914	c.2757C>A	c.(2755-2757)ctC>ctA	p.L919L	MAPK8IP3_ENST00000356010.5_Silent_p.L913L	NM_015133.3	NP_055948.2	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting protein 3	919					activation of JUN kinase activity (GO:0007257)|axon guidance (GO:0007411)|forebrain development (GO:0030900)|in utero embryonic development (GO:0001701)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|positive regulation of neuron differentiation (GO:0045666)|post-embryonic development (GO:0009791)|protein localization (GO:0008104)|regulation of gene expression (GO:0010468)|regulation of JNK cascade (GO:0046328)|respiratory gaseous exchange (GO:0007585)|vesicle-mediated transport (GO:0016192)	axolemma (GO:0030673)|dendrite (GO:0030425)|Golgi membrane (GO:0000139)|smooth endoplasmic reticulum (GO:0005790)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	42						CCGGGCCTCTCACAGAGCACG	0.687																																						uc002cmk.2		NA																	0				breast(2)|central_nervous_system(1)	3						c.(2755-2757)CTC>CTA		mitogen-activated protein kinase 8 interacting							26.0	37.0	33.0					16																	1816351		2053	4187	6240	SO:0001819	synonymous_variant	23162				vesicle-mediated transport	Golgi membrane	kinesin binding|MAP-kinase scaffold activity|protein kinase binding	g.chr16:1816351C>A	AB028989	CCDS10442.2, CCDS45379.1	16p13.3	2009-11-23			ENSG00000138834	ENSG00000138834			6884	protein-coding gene	gene with protein product	"""homolog of Drosophila Sunday driver 2"""	605431				10523642, 10629060	Standard	XM_005255187		Approved	KIAA1066, JSAP1, JIP3, syd	uc002cmk.3	Q9UPT6	OTTHUMG00000128637	ENST00000250894.4:c.2757C>A	16.37:g.1816351C>A			Somatic				MAPK8IP3_uc002cml.2_Silent_p.L913L|MAPK8IP3_uc010uvl.1_Silent_p.L920L	p.L919L	NM_015133	NP_055948	WXS	Illumina HiSeq	Unspecified	Q9UPT6	JIP3_HUMAN			22	2877	+			919					A2A2B3|A7E2B3|Q96RY4|Q9H4I4|Q9H7P1|Q9NUG0	Silent	SNP	ENST00000250894.4	37	c.2757C>A	CCDS10442.2																																																																																				0.687	MAPK8IP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250508.2	NM_001040439		6	38	1	0	3.6e-05	3.75e-05	6	38				
SRRM2	23524	broad.mit.edu	37	16	2811883	2811883	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr16:2811883G>T	ENST00000301740.8	+	11	1903	c.1354G>T	c.(1354-1356)Gag>Tag	p.E452*		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	452	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						GTCCCACCGAGAGATTTCTTC	0.547																																						uc002crk.2		NA																	0				ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						c.(1354-1356)GAG>TAG		splicing coactivator subunit SRm300							120.0	127.0	124.0					16																	2811883		2198	4300	6498	SO:0001587	stop_gained	23524					Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding	g.chr16:2811883G>T	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.1354G>T	16.37:g.2811883G>T	ENSP00000301740:p.Glu452*		Somatic				SRRM2_uc002crj.1_Nonsense_Mutation_p.E356*|SRRM2_uc002crl.1_Nonsense_Mutation_p.E452*|SRRM2_uc010bsu.1_Nonsense_Mutation_p.E356*	p.E452*	NM_016333	NP_057417	WXS	Illumina HiSeq	Unspecified	Q9UQ35	SRRM2_HUMAN			11	1903	+			452			Ser-rich.		A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Nonsense_Mutation	SNP	ENST00000301740.8	37	c.1354G>T	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	G	37	6.008918	0.97195	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000426305	.	.	.	5.88	5.88	0.94601	.	0.000000	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	-13.0277	15.7423	0.77910	0.0:0.0:1.0:0.0	.	.	.	.	X	452;452;417	.	ENSP00000301740:E452X	E	+	1	0	SRRM2	2751884	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	3.227000	0.51262	2.782000	0.95742	0.655000	0.94253	GAG		0.547	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1			19	207	1	0	1.56e-12	1.67e-12	19	207				
CREBBP	1387	broad.mit.edu	37	16	3830809	3830809	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr16:3830809G>A	ENST00000262367.5	-	8	2556	c.1747C>T	c.(1747-1749)Cct>Tct	p.P583S	CREBBP_ENST00000382070.3_Missense_Mutation_p.P545S	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	583					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GTGCTAGAAGGAGGAGCTGCT	0.483			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																															uc002cvv.2		NA		Dom/Rec	yes		16	16p13.3	1387	T|N|F|Mis|O	CREB binding protein (CBP)	yes	Rubinstein-Taybi syndrome	L	MLL|MORF|RUNXBP2		ALL|AML|DLBCL|B-NHL 		0				haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127						c.(1747-1749)CCT>TCT		CREB binding protein isoform a							119.0	102.0	108.0					16																	3830809		2197	4300	6497	SO:0001583	missense	1387	Rubinstein-Taybi_syndrome			cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding	g.chr16:3830809G>A	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.1747C>T	16.37:g.3830809G>A	ENSP00000262367:p.Pro583Ser		Somatic				CREBBP_uc002cvw.2_Missense_Mutation_p.P545S	p.P583S	NM_004380	NP_004371	WXS	Illumina HiSeq	Unspecified	Q92793	CBP_HUMAN		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)	8	1951	-		Ovarian(90;0.0266)	583					D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	ENST00000262367.5	37	c.1747C>T	CCDS10509.1	.	.	.	.	.	.	.	.	.	.	G	13.91	2.377760	0.42105	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	D;D	0.84944	-1.92;-1.86	5.65	4.68	0.58851	.	0.070917	0.64402	D	0.000013	D	0.86024	0.5834	L	0.56280	1.765	0.50171	D	0.999852	P;D	0.57257	0.573;0.979	B;P	0.52957	0.396;0.714	D	0.84394	0.0556	10	0.33940	T	0.23	-4.8267	12.2421	0.54549	0.0:0.1296:0.7357:0.1347	.	613;583	Q4LE28;Q92793	.;CBP_HUMAN	S	583;613;545	ENSP00000262367:P583S;ENSP00000371502:P545S	ENSP00000262367:P583S	P	-	1	0	CREBBP	3770810	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	5.434000	0.66526	1.362000	0.46000	0.591000	0.81541	CCT		0.483	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380		7	49	0	0	0	0	7	49				
SEPT12	124404	broad.mit.edu	37	16	4835884	4835884	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr16:4835884C>A	ENST00000268231.8	-	4	561	c.298G>T	c.(298-300)Gag>Tag	p.E100*	SMIM22_ENST00000589721.1_5'Flank|SEPT12_ENST00000591861.1_5'UTR|SEPT12_ENST00000396693.5_Nonsense_Mutation_p.E100*|SMIM22_ENST00000589327.1_5'Flank	NM_144605.4	NP_653206.2	Q8IYM1	SEP12_HUMAN	septin 12	100	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)	cleavage furrow (GO:0032154)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|septin complex (GO:0031105)|sperm annulus (GO:0097227)|spindle (GO:0005819)|stress fiber (GO:0001725)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)			NS(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|skin(2)|stomach(3)	23						CCCTTCTCCTCTATGACTGTG	0.582																																						uc002cxq.2		NA																	0				skin(1)	1						c.(298-300)GAG>TAG		septin 12 isoform 2							75.0	71.0	73.0					16																	4835884		2197	4300	6497	SO:0001587	stop_gained	124404				cell cycle|cell division	cleavage furrow|midbody|perinuclear region of cytoplasm|septin complex|spindle|stress fiber	GDP binding|GTP binding|phosphatidylinositol binding|protein homodimerization activity	g.chr16:4835884C>A	AK058139	CCDS10522.1, CCDS53987.1	16p13.3	2013-01-21			ENSG00000140623	ENSG00000140623		"""Septins"""	26348	protein-coding gene	gene with protein product		611562				14611653, 15915442	Standard	NM_001154458		Approved	FLJ25410	uc002cxq.3	Q8IYM1	OTTHUMG00000129481	ENST00000268231.8:c.298G>T	16.37:g.4835884C>A	ENSP00000268231:p.Glu100*		Somatic				SEPT12_uc002cxr.2_Nonsense_Mutation_p.E100*|SEPT12_uc010bty.2_RNA|uc002cxt.2_5'Flank	p.E100*	NM_144605	NP_653206	WXS	Illumina HiSeq	Unspecified	Q8IYM1	SEP12_HUMAN			4	439	-			100					Q0P6B0|Q1PBH0|Q96LL0	Nonsense_Mutation	SNP	ENST00000268231.8	37	c.298G>T	CCDS10522.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.315779	0.81469	.	.	ENSG00000140623	ENST00000396693;ENST00000268231	.	.	.	4.61	3.66	0.41972	.	0.101452	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	.	13.0545	0.58971	0.1623:0.8377:0.0:0.0	.	.	.	.	X	100	.	ENSP00000268231:E100X	E	-	1	0	SEPT12	4775885	1.000000	0.71417	0.995000	0.50966	0.242000	0.25591	5.830000	0.69324	1.169000	0.42739	-0.380000	0.06706	GAG		0.582	SEPT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251645.2	NM_144605		9	78	1	0	0.00621372	0.00632932	9	78				
GRIN2A	2903	broad.mit.edu	37	16	9943615	9943615	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr16:9943615G>C	ENST00000396573.2	-	6	1635	c.1326C>G	c.(1324-1326)atC>atG	p.I442M	GRIN2A_ENST00000330684.3_Missense_Mutation_p.I442M|GRIN2A_ENST00000535259.1_Missense_Mutation_p.I285M|GRIN2A_ENST00000562109.1_Missense_Mutation_p.I442M|GRIN2A_ENST00000404927.2_Missense_Mutation_p.I442M|GRIN2A_ENST00000396575.2_Missense_Mutation_p.I442M	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	442					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CCACTCACTTGATTTTGACGA	0.493																																						uc002czo.3		NA																	0				skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45						c.(1324-1326)ATC>ATG		N-methyl-D-aspartate receptor subunit 2A isoform	Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)						138.0	109.0	118.0					16																	9943615		2197	4300	6497	SO:0001583	missense	2903				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	g.chr16:9943615G>C		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.1326C>G	16.37:g.9943615G>C	ENSP00000379818:p.Ile442Met		Somatic				GRIN2A_uc010uym.1_Missense_Mutation_p.I442M|GRIN2A_uc010uyn.1_Missense_Mutation_p.I285M|GRIN2A_uc002czr.3_Missense_Mutation_p.I442M	p.I442M	NM_001134407	NP_001127879	WXS	Illumina HiSeq	Unspecified	Q12879	NMDE1_HUMAN			5	1874	-			442			Extracellular (Potential).		O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	37	c.1326C>G	CCDS10539.1	.	.	.	.	.	.	.	.	.	.	G	12.05	1.822553	0.32237	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	T;T;T;T;T	0.12361	2.71;2.69;2.69;2.71;2.71	5.31	5.31	0.75309	Glutamate receptor, L-glutamate/glycine-binding (1);Ionotropic glutamate receptor (1);	0.157135	0.56097	D	0.000021	T	0.10208	0.0250	L	0.40543	1.245	0.30092	N	0.80821	B;B;B	0.29627	0.004;0.003;0.252	B;B;B	0.26416	0.014;0.006;0.069	T	0.08764	-1.0706	9	.	.	.	.	6.5288	0.22316	0.0938:0.0:0.7245:0.1817	.	285;442;442	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	M	442;442;285;442;442	ENSP00000379818:I442M;ENSP00000385872:I442M;ENSP00000441572:I285M;ENSP00000332549:I442M;ENSP00000379820:I442M	.	I	-	3	3	GRIN2A	9851116	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.428000	0.34892	2.482000	0.83794	0.650000	0.86243	ATC		0.493	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3			13	59	0	0	0	0	13	59				
ABCC6	368	broad.mit.edu	37	16	16286777	16286777	+	Silent	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr16:16286777G>A	ENST00000205557.7	-	11	1370	c.1341C>T	c.(1339-1341)ctC>ctT	p.L447L	ABCC6_ENST00000574094.1_5'UTR	NM_001171.5	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 6	447	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|skin(6)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)	AGGGCCCCAGGAGCTGGGGAT	0.562																																						uc002den.3		NA																	0				skin(2)|ovary(1)	3						c.(1339-1341)CTC>CTT		ATP-binding cassette, sub-family C, member 6							51.0	53.0	53.0					16																	16286777		2197	4300	6497	SO:0001819	synonymous_variant	368				response to drug|visual perception	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr16:16286777G>A	AF076622	CCDS10568.1, CCDS58430.1	16p13.11	2013-01-08			ENSG00000091262	ENSG00000091262		"""ATP binding cassette transporters / subfamily C"""	57	protein-coding gene	gene with protein product		603234	"""pseudoxanthoma elasticum"""	ARA, PXE		9721217, 11439001	Standard	NM_001079528		Approved	MRP6, EST349056, MLP1, URG7	uc002den.4	O95255	OTTHUMG00000129967	ENST00000205557.7:c.1341C>T	16.37:g.16286777G>A			Somatic				ABCC6_uc010bvo.2_RNA|ABCC6_uc010uzz.1_Silent_p.L459L	p.L447L	NM_001171	NP_001162	WXS	Illumina HiSeq	Unspecified	O95255	MRP6_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (3;0.123)	11	1378	-			447			ABC transmembrane type-1 1.|Helical; Name=8; (By similarity).		A2RRN8|A8KIG6|A8Y988|E7ESW8|P78420|Q8TCY8|Q9UMZ7	Silent	SNP	ENST00000205557.7	37	c.1341C>T	CCDS10568.1																																																																																				0.562	ABCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252232.2			14	59	0	0	0	0	14	59				
ZP2	7783	broad.mit.edu	37	16	21213295	21213295	+	Missense_Mutation	SNP	G	G	A	rs190038226		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr16:21213295G>A	ENST00000574002.1	-	13	1819	c.1337C>T	c.(1336-1338)aCg>aTg	p.T446M	AF001550.7_ENST00000572747.1_RNA|ZP2_ENST00000574091.1_Missense_Mutation_p.T446M|ZP2_ENST00000219593.4_Missense_Mutation_p.T446M			Q05996	ZP2_HUMAN	zona pellucida glycoprotein 2 (sperm receptor)	446	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				binding of sperm to zona pellucida (GO:0007339)|intracellular protein transport (GO:0006886)|multicellular organism reproduction (GO:0032504)|prevention of polyspermy (GO:0060468)|signal transduction (GO:0007165)|single fertilization (GO:0007338)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	acrosin binding (GO:0032190)|coreceptor activity (GO:0015026)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(16)|ovary(1)|prostate(1)|stomach(1)	41				GBM - Glioblastoma multiforme(48;0.0573)		AGGAAAATCCGTCCAGAGAGC	0.363													g|||	1	0.000199681	0.0	0.0	5008	,	,		23014	0.0		0.001	False		,,,				2504	0.0					uc002dii.2		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(1336-1338)ACG>ATG		zona pellucida glycoprotein 2 preproprotein							101.0	97.0	98.0					16																	21213295		2200	4300	6500	SO:0001583	missense	7783				binding of sperm to zona pellucida|intracellular protein transport	endoplasmic reticulum|Golgi apparatus|integral to membrane|multivesicular body|plasma membrane|proteinaceous extracellular matrix|stored secretory granule	acrosin binding|coreceptor activity	g.chr16:21213295G>A	M90366	CCDS10596.1, CCDS73843.1	16p12	2014-07-04			ENSG00000103310	ENSG00000103310		"""Zona pellucida glycoproteins"""	13188	protein-coding gene	gene with protein product		182888				8385033	Standard	XM_005255562		Approved	ZPA	uc002dii.2	Q05996	OTTHUMG00000090681	ENST00000574002.1:c.1337C>T	16.37:g.21213295G>A	ENSP00000460971:p.Thr446Met		Somatic				ZP2_uc010bwn.1_Missense_Mutation_p.T485M	p.T446M	NM_003460	NP_003451	WXS	Illumina HiSeq	Unspecified	Q05996	ZP2_HUMAN		GBM - Glioblastoma multiforme(48;0.0573)	12	1337	-			446			Extracellular (Potential).|ZP.		B2R7J2|Q4VAN9|Q4VAP0|Q4VAP1	Missense_Mutation	SNP	ENST00000574002.1	37	c.1337C>T	CCDS10596.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	g	7.567	0.665874	0.14710	.	.	ENSG00000103310	ENST00000219593	D	0.82344	-1.6	5.83	-11.7	0.00046	Endoglin/CD105 antigen subgroup (1);Zona pellucida sperm-binding protein (3);	2.328650	0.01496	N	0.017315	T	0.63390	0.2507	N	0.08118	0	0.09310	N	1	B;B	0.23185	0.045;0.081	B;B	0.26202	0.067;0.067	T	0.57734	-0.7760	10	0.48119	T	0.1	0.2807	8.0802	0.30739	0.2819:0.0:0.1358:0.5823	.	446;446	Q4VAP1;Q05996	.;ZP2_HUMAN	M	446	ENSP00000219593:T446M	ENSP00000219593:T446M	T	-	2	0	ZP2	21120796	0.000000	0.05858	0.000000	0.03702	0.321000	0.28281	-0.490000	0.06482	-2.476000	0.00526	-1.399000	0.01144	ACG		0.363	ZP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207365.2			17	81	0	0	0	0	17	81				
ARHGAP17	55114	broad.mit.edu	37	16	24950751	24950751	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr16:24950751G>A	ENST00000289968.6	-	17	1727	c.1658C>T	c.(1657-1659)tCt>tTt	p.S553F	ARHGAP17_ENST00000441763.2_3'UTR|ARHGAP17_ENST00000303665.5_Intron	NM_001006634.1	NP_001006635.1	Q68EM7	RHG17_HUMAN	Rho GTPase activating protein 17	553	Pro-rich.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)			breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|urinary_tract(2)	30				GBM - Glioblastoma multiforme(48;0.0407)		CCCACCCCCAGAGCTGCTTTC	0.687																																						uc002dnb.2		NA																	0					0						c.(1657-1659)TCT>TTT		nadrin isoform 1							18.0	24.0	22.0					16																	24950751		2194	4297	6491	SO:0001583	missense	55114				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|tight junction	GTPase activator activity|SH3 domain binding	g.chr16:24950751G>A	AJ306731	CCDS32408.1, CCDS32409.1	16p12.2-p12.1	2011-06-29				ENSG00000140750		"""Rho GTPase activating proteins"""	18239	protein-coding gene	gene with protein product		608293				10967100, 11431473	Standard	XM_005255413		Approved	RICH1, FLJ10308, NADRIN, FLJ13219, WBP15	uc002dnb.3	Q68EM7		ENST00000289968.6:c.1658C>T	16.37:g.24950751G>A	ENSP00000289968:p.Ser553Phe		Somatic				ARHGAP17_uc002dmy.2_5'Flank|ARHGAP17_uc002dmz.2_Missense_Mutation_p.S77F|ARHGAP17_uc002dna.2_Missense_Mutation_p.S280F|ARHGAP17_uc002dnc.2_Intron|ARHGAP17_uc010vcf.1_Intron	p.S553F	NM_001006634	NP_001006635	WXS	Illumina HiSeq	Unspecified	Q68EM7	RHG17_HUMAN		GBM - Glioblastoma multiforme(48;0.0407)	17	1751	-			553			Pro-rich.		A8K6M6|Q6ZUS4|Q7Z2F2|Q8NDG2|Q96KS2|Q96KS3|Q96SS8|Q9BVF6|Q9H8U5|Q9NW54	Missense_Mutation	SNP	ENST00000289968.6	37	c.1658C>T	CCDS32409.1	.	.	.	.	.	.	.	.	.	.	G	16.20	3.054908	0.55325	.	.	ENSG00000140750	ENST00000289968;ENST00000455311	T	0.21932	1.98	5.32	4.33	0.51752	.	1.032810	0.07756	N	0.949250	T	0.24470	0.0593	L	0.36672	1.1	0.80722	D	1	P;P	0.45283	0.855;0.545	B;P	0.45138	0.271;0.471	T	0.03566	-1.1024	10	0.54805	T	0.06	.	12.0826	0.53680	0.0:0.1719:0.8281:0.0	.	553;86	Q68EM7;Q68EM7-7	RHG17_HUMAN;.	F	553	ENSP00000289968:S553F	ENSP00000289968:S553F	S	-	2	0	ARHGAP17	24858252	1.000000	0.71417	0.959000	0.39883	0.958000	0.62258	3.140000	0.50585	2.767000	0.95098	0.655000	0.94253	TCT		0.687	ARHGAP17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436548.3	NM_018054		5	25	0	0	0	0	5	25				
GTF3C1	2975	broad.mit.edu	37	16	27495572	27495572	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr16:27495572G>A	ENST00000356183.4	-	25	3976	c.3961C>T	c.(3961-3963)Cgc>Tgc	p.R1321C	GTF3C1_ENST00000561623.1_Missense_Mutation_p.R1321C	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	1321					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						ACTATGTAGCGAGCTCTTCGT	0.488																																						uc002dov.1		NA																	0				ovary(2)|pancreas(1)|breast(1)|skin(1)	5						c.(3961-3963)CGC>TGC		general transcription factor IIIC, polypeptide							144.0	132.0	136.0					16																	27495572		2197	4300	6497	SO:0001583	missense	2975					transcription factor TFIIIC complex	DNA binding|protein binding	g.chr16:27495572G>A	U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.3961C>T	16.37:g.27495572G>A	ENSP00000348510:p.Arg1321Cys		Somatic				GTF3C1_uc002dou.2_Missense_Mutation_p.R1321C	p.R1321C	NM_001520	NP_001511	WXS	Illumina HiSeq	Unspecified	Q12789	TF3C1_HUMAN			25	4001	-			1321					B2RP21|Q12838|Q6DKN9|Q9Y4W9	Missense_Mutation	SNP	ENST00000356183.4	37	c.3961C>T	CCDS32414.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.965551	0.92855	.	.	ENSG00000077235	ENST00000356183;ENST00000388971	T	0.26518	1.73	5.91	5.91	0.95273	.	0.058654	0.64402	D	0.000001	T	0.56156	0.1966	M	0.77616	2.38	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.57213	-0.7850	10	0.87932	D	0	-30.1426	19.9089	0.97019	0.0:0.0:1.0:0.0	.	1321;1321	Q12789;Q12789-3	TF3C1_HUMAN;.	C	1321;1317	ENSP00000348510:R1321C	ENSP00000348510:R1321C	R	-	1	0	GTF3C1	27403073	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.838000	0.69388	2.793000	0.96121	0.655000	0.94253	CGC		0.488	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433856.1	NM_001520		25	54	0	0	0	0	25	54				
ZNF768	79724	broad.mit.edu	37	16	30537313	30537313	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr16:30537313C>T	ENST00000380412.5	-	2	323	c.148G>A	c.(148-150)Gaa>Aaa	p.E50K	ZNF747_ENST00000535210.1_3'UTR|ZNF747_ENST00000569360.1_3'UTR|ZNF768_ENST00000562803.1_Missense_Mutation_p.E19K	NM_024671.3	NP_078947.3	Q9H5H4	ZN768_HUMAN	zinc finger protein 768	50					regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	DNA-directed RNA polymerase II, core complex (GO:0005665)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|prostate(1)	15						TCTTCgacttcatagtcccca	0.507																																						uc002dyk.3		NA																	0					0						c.(148-150)GAA>AAA		zinc finger protein 768							132.0	128.0	130.0					16																	30537313		2197	4300	6497	SO:0001583	missense	79724				regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	DNA-directed RNA polymerase II, core complex	DNA binding|zinc ion binding	g.chr16:30537313C>T	BC013760	CCDS10681.2	16p11.2	2013-01-08			ENSG00000169957	ENSG00000169957		"""Zinc fingers, C2H2-type"""	26273	protein-coding gene	gene with protein product						12477932	Standard	NM_024671		Approved	FLJ23436	uc002dyk.4	Q9H5H4	OTTHUMG00000132392	ENST00000380412.5:c.148G>A	16.37:g.30537313C>T	ENSP00000369777:p.Glu50Lys		Somatic				ZNF768_uc010vex.1_Missense_Mutation_p.E19K|uc002dyl.1_5'Flank|ZNF768_uc010vew.1_Missense_Mutation_p.E19K	p.E50K	NM_024671	NP_078947	WXS	Illumina HiSeq	Unspecified	Q9H5H4	ZN768_HUMAN			2	324	-			50					Q569L7|Q96CX4	Missense_Mutation	SNP	ENST00000380412.5	37	c.148G>A	CCDS10681.2	.	.	.	.	.	.	.	.	.	.	C	16.21	3.059533	0.55325	.	.	ENSG00000169957	ENST00000380412;ENST00000538507	T	0.06449	3.3	4.44	4.44	0.53790	.	0.000000	0.48286	D	0.000192	T	0.03959	0.0111	N	0.19112	0.55	0.80722	D	1	B	0.26363	0.147	B	0.15870	0.014	T	0.24119	-1.0169	10	0.05959	T	0.93	-10.2843	14.0862	0.64957	0.0:1.0:0.0:0.0	.	50	Q9H5H4	ZN768_HUMAN	K	50;19	ENSP00000369777:E50K	ENSP00000369777:E50K	E	-	1	0	ZNF768	30444814	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.287000	0.43505	2.287000	0.76781	0.561000	0.74099	GAA		0.507	ZNF768-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255522.2	NM_024671		23	162	0	0	0	0	23	162				
GPR114	221188	broad.mit.edu	37	16	57597888	57597888	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr16:57597888C>G	ENST00000340339.4	+	5	949	c.426C>G	c.(424-426)ttC>ttG	p.F142L	GPR114_ENST00000394361.4_3'UTR|GPR114_ENST00000349457.3_Missense_Mutation_p.F142L	NM_153837.1	NP_722579.1	Q8IZF4	GP114_HUMAN	G protein-coupled receptor 114	142					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(5)|ovary(2)|stomach(1)|urinary_tract(1)	23						CCCACTTTTTCAAGGTCAGTG	0.637																																						uc002elx.3		NA																	0				central_nervous_system(1)	1						c.(424-426)TTC>TTG		G protein-coupled receptor 114 precursor							73.0	75.0	75.0					16																	57597888		2198	4300	6498	SO:0001583	missense	221188				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr16:57597888C>G	AY140956	CCDS10785.1	16q13	2014-08-08			ENSG00000159618	ENSG00000159618		"""-"", ""GPCR / Class B : Orphans"""	19010	protein-coding gene	gene with protein product						12435584	Standard	NM_153837		Approved	PGR27	uc002ely.3	Q8IZF4	OTTHUMG00000133461	ENST00000340339.4:c.426C>G	16.37:g.57597888C>G	ENSP00000342981:p.Phe142Leu		Somatic				GPR114_uc010vhr.1_Missense_Mutation_p.F142L|GPR114_uc002ely.2_Missense_Mutation_p.F142L	p.F142L	NM_153837	NP_722579	WXS	Illumina HiSeq	Unspecified	Q8IZF4	GP114_HUMAN			5	511	+			142			Extracellular (Potential).		B3KXZ5|Q6ZMH7|Q6ZML4|Q86SL8|Q8IZ14	Missense_Mutation	SNP	ENST00000340339.4	37	c.426C>G	CCDS10785.1	.	.	.	.	.	.	.	.	.	.	C	15.07	2.723842	0.48728	.	.	ENSG00000159618	ENST00000394361;ENST00000340339;ENST00000349457	T;T	0.36340	1.26;1.26	5.03	0.756	0.18421	.	0.000000	0.64402	D	0.000020	T	0.50616	0.1626	M	0.66939	2.045	0.50813	D	0.999896	B;D	0.76494	0.217;0.999	B;D	0.80764	0.135;0.994	T	0.43702	-0.9375	10	0.52906	T	0.07	.	7.5061	0.27545	0.0:0.6256:0.0:0.3744	.	142;142	B4E148;Q8IZF4	.;GP114_HUMAN	L	142	ENSP00000342981:F142L;ENSP00000290823:F142L	ENSP00000342981:F142L	F	+	3	2	GPR114	56155389	0.998000	0.40836	0.938000	0.37757	0.663000	0.39108	0.336000	0.19823	0.159000	0.19401	0.491000	0.48974	TTC		0.637	GPR114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257336.3	NM_153837		11	70	0	0	0	0	11	70				
GPR114	221188	broad.mit.edu	37	16	57598964	57598964	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr16:57598964C>G	ENST00000340339.4	+	6	971	c.448C>G	c.(448-450)Ctg>Gtg	p.L150V	GPR114_ENST00000394361.4_3'UTR|GPR114_ENST00000349457.3_Missense_Mutation_p.L150V	NM_153837.1	NP_722579.1	Q8IZF4	GP114_HUMAN	G protein-coupled receptor 114	150					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(5)|ovary(2)|stomach(1)|urinary_tract(1)	23						CAACTCATCTCTGCTGAATAA	0.567																																						uc002elx.3		NA																	0				central_nervous_system(1)	1						c.(448-450)CTG>GTG		G protein-coupled receptor 114 precursor							107.0	91.0	96.0					16																	57598964		2198	4300	6498	SO:0001583	missense	221188				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr16:57598964C>G	AY140956	CCDS10785.1	16q13	2014-08-08			ENSG00000159618	ENSG00000159618		"""-"", ""GPCR / Class B : Orphans"""	19010	protein-coding gene	gene with protein product						12435584	Standard	NM_153837		Approved	PGR27	uc002ely.3	Q8IZF4	OTTHUMG00000133461	ENST00000340339.4:c.448C>G	16.37:g.57598964C>G	ENSP00000342981:p.Leu150Val		Somatic				GPR114_uc010vhr.1_Missense_Mutation_p.L150V|GPR114_uc002ely.2_Missense_Mutation_p.L150V	p.L150V	NM_153837	NP_722579	WXS	Illumina HiSeq	Unspecified	Q8IZF4	GP114_HUMAN			6	533	+			150			Extracellular (Potential).		B3KXZ5|Q6ZMH7|Q6ZML4|Q86SL8|Q8IZ14	Missense_Mutation	SNP	ENST00000340339.4	37	c.448C>G	CCDS10785.1	.	.	.	.	.	.	.	.	.	.	C	6.800	0.516549	0.12944	.	.	ENSG00000159618	ENST00000394361;ENST00000340339;ENST00000349457	T;T	0.26957	1.7;1.7	5.14	2.1	0.27182	.	0.000000	0.41938	D	0.000793	T	0.20659	0.0497	M	0.66939	2.045	0.25213	N	0.989961	B;D	0.57899	0.22;0.981	B;P	0.46362	0.168;0.514	T	0.24621	-1.0155	10	0.02654	T	1	.	2.412	0.04427	0.1531:0.5295:0.1486:0.1688	.	150;150	B4E148;Q8IZF4	.;GP114_HUMAN	V	150	ENSP00000342981:L150V;ENSP00000290823:L150V	ENSP00000342981:L150V	L	+	1	2	GPR114	56156465	0.156000	0.22821	0.893000	0.35052	0.637000	0.38172	0.340000	0.19892	0.202000	0.20498	0.484000	0.47621	CTG		0.567	GPR114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257336.3	NM_153837		9	72	0	0	0	0	9	72				
SLC38A7	55238	broad.mit.edu	37	16	58704061	58704061	+	Silent	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr16:58704061G>A	ENST00000570101.1	-	10	2125	c.1242C>T	c.(1240-1242)ctC>ctT	p.L414L	SLC38A7_ENST00000566953.1_5'UTR|SLC38A7_ENST00000564010.1_Silent_p.L325L|SLC38A7_ENST00000219320.4_Silent_p.L414L|SLC38A7_ENST00000564100.1_Intron			Q9NVC3	S38A7_HUMAN	solute carrier family 38, member 7	414					sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	L-alanine transmembrane transporter activity (GO:0015180)|L-amino acid transmembrane transporter activity (GO:0015179)|L-asparagine transmembrane transporter activity (GO:0015182)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|L-glutamine transmembrane transporter activity (GO:0015186)|L-histidine transmembrane transporter activity (GO:0005290)|L-leucine transmembrane transporter activity (GO:0015190)|L-methionine transmembrane transporter activity (GO:0015191)|L-serine transmembrane transporter activity (GO:0015194)			endometrium(1)|large_intestine(2)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	13						TGGCTTGAATGAGGCACAGCC	0.557																																						uc002eod.1		NA																	0				ovary(1)	1						c.(1240-1242)CTC>CTT		solute carrier family 38, member 7							110.0	86.0	94.0					16																	58704061		2198	4300	6498	SO:0001819	synonymous_variant	55238				amino acid transport|sodium ion transport	integral to membrane		g.chr16:58704061G>A	BC001961	CCDS10800.1	16q21	2013-05-22			ENSG00000103042	ENSG00000103042		"""Solute carriers"""	25582	protein-coding gene	gene with protein product		614236					Standard	XM_006721229		Approved	FLJ10815	uc002eod.1	Q9NVC3	OTTHUMG00000133491	ENST00000570101.1:c.1242C>T	16.37:g.58704061G>A			Somatic				SLC38A7_uc002eob.1_RNA|SLC38A7_uc002eoc.1_Intron|SLC38A7_uc010vil.1_Silent_p.L325L	p.L414L	NM_018231	NP_060701	WXS	Illumina HiSeq	Unspecified	Q9NVC3	S38A7_HUMAN			11	1635	-			414			Helical; (Potential).		Q53GJ9|Q9H9I5	Silent	SNP	ENST00000570101.1	37	c.1242C>T	CCDS10800.1																																																																																				0.557	SLC38A7-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422206.2	NM_018231		14	42	0	0	0	0	14	42				
RLTPR	146206	broad.mit.edu	37	16	67680670	67680670	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr16:67680670C>T	ENST00000334583.6	+	7	848	c.520C>T	c.(520-522)Cga>Tga	p.R174*	RLTPR_ENST00000545661.1_Nonsense_Mutation_p.R174*	NM_001013838.1	NP_001013860.1	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing	174					cell migration (GO:0016477)|establishment of protein localization (GO:0045184)|homeostasis of number of cells (GO:0048872)|maintenance of cell polarity (GO:0030011)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma secretion (GO:1902715)|positive regulation of interleukin-2 secretion (GO:1900042)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|F-actin capping protein complex (GO:0008290)|immunological synapse (GO:0001772)|membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(4)|kidney(1)|lung(9)|urinary_tract(2)	18		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		CTTCCCTTTCCGAGAGGAGAT	0.582																																						uc002etn.2		NA																	0				breast(1)	1						c.(520-522)CGA>TGA		RGD motif, leucine rich repeats, tropomodulin							110.0	108.0	109.0					16																	67680670		1982	4205	6187	SO:0001587	stop_gained	146206							g.chr16:67680670C>T	AB113647	CCDS45513.1	16q22.1	2010-09-10				ENSG00000159753			27089	protein-coding gene	gene with protein product	"""RGD, leucine-rich repeat, tropomodulin and proline-rich containing protein"", ""leucine rich repeat containing 16C"""	610859				15588584, 19846667	Standard	XM_005255807		Approved	LRRC16C, CARMIL2	uc002etn.3	Q6F5E8		ENST00000334583.6:c.520C>T	16.37:g.67680670C>T	ENSP00000334958:p.Arg174*		Somatic				RLTPR_uc010cel.1_Nonsense_Mutation_p.R174*|RLTPR_uc010vjr.1_Nonsense_Mutation_p.R174*	p.R174*	NM_001013838	NP_001013860	WXS	Illumina HiSeq	Unspecified	Q6F5E8	LR16C_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)	7	640	+		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)	174					B8X2Z3	Nonsense_Mutation	SNP	ENST00000334583.6	37	c.520C>T	CCDS45513.1	.	.	.	.	.	.	.	.	.	.	C	37	6.046637	0.97231	.	.	ENSG00000159753	ENST00000334583;ENST00000545661	.	.	.	5.15	4.19	0.49359	.	0.231180	0.38492	N	0.001680	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.1272	12.1407	0.53996	0.0:0.9198:0.0:0.0802	.	.	.	.	X	174	.	ENSP00000334958:R174X	R	+	1	2	RLTPR	66238171	0.985000	0.35326	1.000000	0.80357	0.997000	0.91878	1.624000	0.37018	1.302000	0.44855	0.561000	0.74099	CGA		0.582	RLTPR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467858.1	NM_001013838		10	90	0	0	0	0	10	90				
THAP11	57215	broad.mit.edu	37	16	67876995	67876995	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr16:67876995C>G	ENST00000303596.1	+	1	783	c.538C>G	c.(538-540)Ccc>Gcc	p.P180A	CENPT_ENST00000562787.1_Intron	NM_020457.2	NP_065190.2	Q96EK4	THA11_HUMAN	THAP domain containing 11	180					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|urinary_tract(1)	8		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00412)|Epithelial(162;0.018)|all cancers(182;0.118)		GCCCATCACTCCCACTGGAGA	0.647																																						uc002euo.2		NA																	0					0						c.(538-540)CCC>GCC		THAP domain containing 11							96.0	110.0	105.0					16																	67876995		2198	4300	6498	SO:0001583	missense	57215				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|identical protein binding|metal ion binding	g.chr16:67876995C>G	AB015338	CCDS10847.1	16q22.1	2013-01-25			ENSG00000168286	ENSG00000168286		"""THAP (C2CH-type zinc finger) domain containing"""	23194	protein-coding gene	gene with protein product		609119				12575992, 8325628	Standard	NM_020457		Approved	HRIHFB2206, CTG-B45d, CTG-B43a	uc002euo.3	Q96EK4	OTTHUMG00000137546	ENST00000303596.1:c.538C>G	16.37:g.67876995C>G	ENSP00000304689:p.Pro180Ala		Somatic				CENPT_uc002eun.3_Intron	p.P180A	NM_020457	NP_065190	WXS	Illumina HiSeq	Unspecified	Q96EK4	THA11_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.00412)|Epithelial(162;0.018)|all cancers(182;0.118)	1	783	+		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)	180					A4UCT5|A8K002|O94795	Missense_Mutation	SNP	ENST00000303596.1	37	c.538C>G	CCDS10847.1	.	.	.	.	.	.	.	.	.	.	C	10.31	1.314318	0.23908	.	.	ENSG00000168286	ENST00000303596	T	0.26957	1.7	5.33	4.37	0.52481	.	0.477055	0.22236	N	0.062760	T	0.16128	0.0388	N	0.22421	0.69	0.32660	N	0.518223	B	0.34015	0.435	B	0.33121	0.158	T	0.19128	-1.0315	10	0.28530	T	0.3	-18.0923	9.3551	0.38161	0.0:0.7767:0.1441:0.0792	.	180	Q96EK4	THA11_HUMAN	A	180	ENSP00000304689:P180A	ENSP00000304689:P180A	P	+	1	0	THAP11	66434496	0.321000	0.24625	0.999000	0.59377	0.674000	0.39518	1.270000	0.33086	1.352000	0.45808	0.514000	0.50259	CCC		0.647	THAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268879.1	NM_020457		19	132	0	0	0	0	19	132				
THAP11	57215	broad.mit.edu	37	16	67877127	67877127	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr16:67877127C>T	ENST00000303596.1	+	1	915	c.670C>T	c.(670-672)Cct>Tct	p.P224S	CENPT_ENST00000562787.1_Intron	NM_020457.2	NP_065190.2	Q96EK4	THA11_HUMAN	THAP domain containing 11	224					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|urinary_tract(1)	8		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00412)|Epithelial(162;0.018)|all cancers(182;0.118)		TGCCGAGTGCCCTATGGGCCC	0.657																																						uc002euo.2		NA																	0					0						c.(670-672)CCT>TCT		THAP domain containing 11							64.0	73.0	70.0					16																	67877127		2198	4300	6498	SO:0001583	missense	57215				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|identical protein binding|metal ion binding	g.chr16:67877127C>T	AB015338	CCDS10847.1	16q22.1	2013-01-25			ENSG00000168286	ENSG00000168286		"""THAP (C2CH-type zinc finger) domain containing"""	23194	protein-coding gene	gene with protein product		609119				12575992, 8325628	Standard	NM_020457		Approved	HRIHFB2206, CTG-B45d, CTG-B43a	uc002euo.3	Q96EK4	OTTHUMG00000137546	ENST00000303596.1:c.670C>T	16.37:g.67877127C>T	ENSP00000304689:p.Pro224Ser		Somatic				CENPT_uc002eun.3_Intron	p.P224S	NM_020457	NP_065190	WXS	Illumina HiSeq	Unspecified	Q96EK4	THA11_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.00412)|Epithelial(162;0.018)|all cancers(182;0.118)	1	915	+		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)	224					A4UCT5|A8K002|O94795	Missense_Mutation	SNP	ENST00000303596.1	37	c.670C>T	CCDS10847.1	.	.	.	.	.	.	.	.	.	.	C	8.667	0.901983	0.17760	.	.	ENSG00000168286	ENST00000303596	.	.	.	5.66	3.64	0.41730	.	0.552844	0.17074	N	0.188062	T	0.16214	0.0390	N	0.08118	0	0.24227	N	0.995417	B	0.02656	0.0	B	0.01281	0.0	T	0.19976	-1.0289	9	0.07482	T	0.82	-4.8816	9.9799	0.41806	0.1436:0.7836:0.0:0.0728	.	224	Q96EK4	THA11_HUMAN	S	224	.	ENSP00000304689:P224S	P	+	1	0	THAP11	66434628	0.839000	0.29477	1.000000	0.80357	0.993000	0.82548	0.172000	0.16704	1.465000	0.48006	0.609000	0.83330	CCT		0.657	THAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268879.1	NM_020457		7	68	0	0	0	0	7	68				
PSMB10	5699	broad.mit.edu	37	16	67969349	67969349	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr16:67969349C>T	ENST00000358514.4	-	6	869	c.532G>A	c.(532-534)Gaa>Aaa	p.E178K	CTC-479C5.12_ENST00000573493.1_Silent_p.*31*	NM_002801.3	NP_002792.1	P40306	PSB10_HUMAN	proteasome (prosome, macropain) subunit, beta type, 10	178					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cell morphogenesis (GO:0000902)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|humoral immune response (GO:0006959)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|T cell proliferation (GO:0042098)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|spermatoproteasome complex (GO:1990111)	threonine-type endopeptidase activity (GO:0004298)			NS(2)|endometrium(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00415)|Epithelial(162;0.0182)|all cancers(182;0.119)	Carfilzomib(DB08889)	AACCGGTCTTCTAGCACCGCC	0.647																																						uc002eux.1		NA																	0					0						c.(532-534)GAA>AAA		proteasome beta 10 subunit proprotein							76.0	80.0	78.0					16																	67969349		2198	4300	6498	SO:0001583	missense	5699				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|humoral immune response|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex	threonine-type endopeptidase activity	g.chr16:67969349C>T	Y13640	CCDS10853.1	16q22.1	2008-02-05			ENSG00000205220	ENSG00000205220		"""Proteasome (prosome, macropain) subunits"""	9538	protein-coding gene	gene with protein product		176847		MECL1		8268911	Standard	NM_002801		Approved	LMP10, MGC1665, beta2i	uc002eux.2	P40306	OTTHUMG00000137553	ENST00000358514.4:c.532G>A	16.37:g.67969349C>T	ENSP00000351314:p.Glu178Lys		Somatic					p.E178K	NM_002801	NP_002792	WXS	Illumina HiSeq	Unspecified	P40306	PSB10_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.00415)|Epithelial(162;0.0182)|all cancers(182;0.119)	6	633	-		Ovarian(137;0.0563)	178					B2R5J4|Q5U098	Missense_Mutation	SNP	ENST00000358514.4	37	c.532G>A	CCDS10853.1	.	.	.	.	.	.	.	.	.	.	C	35	5.524719	0.96431	.	.	ENSG00000205220	ENST00000358514	T	0.30182	1.54	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.64832	0.2634	M	0.93283	3.4	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.73953	-0.3820	10	0.87932	D	0	-17.3833	13.729	0.62776	0.0:1.0:0.0:0.0	.	178	P40306	PSB10_HUMAN	K	178	ENSP00000351314:E178K	ENSP00000351314:E178K	E	-	1	0	PSMB10	66526850	1.000000	0.71417	0.993000	0.49108	0.532000	0.34746	3.516000	0.53436	2.613000	0.88420	0.555000	0.69702	GAA		0.647	PSMB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268887.1	NM_002801		19	65	0	0	0	0	19	65				
PSMB10	5699	broad.mit.edu	37	16	67970194	67970194	+	Missense_Mutation	SNP	C	C	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr16:67970194C>A	ENST00000358514.4	-	3	503	c.166G>T	c.(166-168)Gat>Tat	p.D56Y	CTC-479C5.12_ENST00000573493.1_5'Flank	NM_002801.3	NP_002792.1	P40306	PSB10_HUMAN	proteasome (prosome, macropain) subunit, beta type, 10	56					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cell morphogenesis (GO:0000902)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|humoral immune response (GO:0006959)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|T cell proliferation (GO:0042098)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|spermatoproteasome complex (GO:1990111)	threonine-type endopeptidase activity (GO:0004298)			NS(2)|endometrium(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00415)|Epithelial(162;0.0182)|all cancers(182;0.119)	Carfilzomib(DB08889)	GCTCGCGTATCGGCGCCCAGA	0.632																																						uc002eux.1		NA																	0					0						c.(166-168)GAT>TAT		proteasome beta 10 subunit proprotein							51.0	51.0	51.0					16																	67970194		2198	4300	6498	SO:0001583	missense	5699				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|humoral immune response|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex	threonine-type endopeptidase activity	g.chr16:67970194C>A	Y13640	CCDS10853.1	16q22.1	2008-02-05			ENSG00000205220	ENSG00000205220		"""Proteasome (prosome, macropain) subunits"""	9538	protein-coding gene	gene with protein product		176847		MECL1		8268911	Standard	NM_002801		Approved	LMP10, MGC1665, beta2i	uc002eux.2	P40306	OTTHUMG00000137553	ENST00000358514.4:c.166G>T	16.37:g.67970194C>A	ENSP00000351314:p.Asp56Tyr		Somatic					p.D56Y	NM_002801	NP_002792	WXS	Illumina HiSeq	Unspecified	P40306	PSB10_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.00415)|Epithelial(162;0.0182)|all cancers(182;0.119)	3	267	-		Ovarian(137;0.0563)	56					B2R5J4|Q5U098	Missense_Mutation	SNP	ENST00000358514.4	37	c.166G>T	CCDS10853.1	.	.	.	.	.	.	.	.	.	.	c	22.7	4.323699	0.81580	.	.	ENSG00000205220	ENST00000358514	T	0.59502	0.26	5.42	5.42	0.78866	Proteasome, beta-type subunit, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.86472	0.5941	H	0.99379	4.54	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91741	0.5404	10	0.87932	D	0	-13.9573	15.0824	0.72125	0.0:1.0:0.0:0.0	.	56	P40306	PSB10_HUMAN	Y	56	ENSP00000351314:D56Y	ENSP00000351314:D56Y	D	-	1	0	PSMB10	66527695	1.000000	0.71417	0.805000	0.32314	0.213000	0.24496	7.004000	0.76317	2.702000	0.92279	0.651000	0.88453	GAT		0.632	PSMB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268887.1	NM_002801		8	53	1	0	0.00307968	0.00314185	8	53				
CDH3	1001	broad.mit.edu	37	16	68729708	68729708	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr16:68729708G>A	ENST00000264012.4	+	15	2706	c.2162G>A	c.(2161-2163)gGt>gAt	p.G721D	CDH3_ENST00000429102.2_Missense_Mutation_p.G721D|CDH3_ENST00000581171.1_Missense_Mutation_p.G666D	NM_001793.4	NP_001784.2	P22223	CADH3_HUMAN	cadherin 3, type 1, P-cadherin (placental)	721					adherens junction organization (GO:0034332)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|hair cycle process (GO:0022405)|homophilic cell adhesion (GO:0007156)|keratinization (GO:0031424)|negative regulation of catagen (GO:0051796)|negative regulation of transforming growth factor beta2 production (GO:0032912)|positive regulation of gene expression (GO:0010628)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanosome transport (GO:1902910)|positive regulation of monophenol monooxygenase activity (GO:0032773)|regulation of hair cycle by canonical Wnt signaling pathway (GO:0060901)|response to drug (GO:0042493)|retina homeostasis (GO:0001895)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)|wound healing (GO:0042060)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.?(2)		NS(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(3)|skin(1)|urinary_tract(1)	25		Ovarian(137;0.0564)		OV - Ovarian serous cystadenocarcinoma(108;0.000782)|Epithelial(162;0.0054)|all cancers(182;0.0384)		CTCCACCGAGGTCTGGAGGCC	0.602																																						uc002ewf.2		NA																	2	Unknown(2)	p.?(1)	breast(2)	ovary(3)|breast(1)|skin(1)	5						c.(2161-2163)GGT>GAT		cadherin 3, type 1 preproprotein							94.0	77.0	83.0					16																	68729708		2198	4300	6498	SO:0001583	missense	1001				adherens junction organization|cell junction assembly|homophilic cell adhesion|response to stimulus|visual perception	integral to membrane	calcium ion binding	g.chr16:68729708G>A	X63629	CCDS10868.1	16q22.1	2013-01-08	2001-12-04		ENSG00000062038	ENSG00000062038		"""Cadherins / Major cadherins"""	1762	protein-coding gene	gene with protein product		114021	"""cadherin 3, P-cadherin (placental)"""			1427864	Standard	NM_001793		Approved	CDHP, PCAD	uc002ewf.2	P22223	OTTHUMG00000137560	ENST00000264012.4:c.2162G>A	16.37:g.68729708G>A	ENSP00000264012:p.Gly721Asp		Somatic				CDH3_uc010vli.1_Missense_Mutation_p.G666D	p.G721D	NM_001793	NP_001784	WXS	Illumina HiSeq	Unspecified	P22223	CADH3_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.000782)|Epithelial(162;0.0054)|all cancers(182;0.0384)	15	3294	+		Ovarian(137;0.0564)	721			Cytoplasmic (Potential).		B2R6F4|Q05DI6	Missense_Mutation	SNP	ENST00000264012.4	37	c.2162G>A	CCDS10868.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.473076	0.84640	.	.	ENSG00000062038	ENST00000429102;ENST00000264012;ENST00000542274	T;T	0.75154	-0.91;-0.91	5.37	5.37	0.77165	Cadherin, cytoplasmic domain (1);	0.000000	0.42172	D	0.000760	D	0.82972	0.5153	L	0.59912	1.85	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.78460	-0.2195	10	0.20519	T	0.43	.	16.9748	0.86310	0.0:0.0:1.0:0.0	.	721	P22223	CADH3_HUMAN	D	721;721;666	ENSP00000398485:G721D;ENSP00000264012:G721D	ENSP00000264012:G721D	G	+	2	0	CDH3	67287209	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	9.203000	0.95033	2.677000	0.91161	0.561000	0.74099	GGT		0.602	CDH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268896.2	NM_001793		7	64	0	0	0	0	7	64				
PMFBP1	83449	broad.mit.edu	37	16	72188118	72188118	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr16:72188118C>G	ENST00000237353.10	-	4	667	c.406G>C	c.(406-408)Gaa>Caa	p.E136Q	PMFBP1_ENST00000537465.1_Missense_Mutation_p.E136Q|PMFBP1_ENST00000355636.6_5'UTR|PMFBP1_ENST00000543746.1_5'Flank	NM_031293.2	NP_112583.2	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	136						cytoplasm (GO:0005737)				NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	45		Ovarian(137;0.179)				ACCTCATCTTCTTTCAGTTTG	0.463																																						uc002fcc.3		NA																	0				ovary(2)	2						c.(406-408)GAA>CAA		polyamine modulated factor 1 binding protein 1							154.0	147.0	149.0					16																	72188118		2198	4300	6498	SO:0001583	missense	83449							g.chr16:72188118C>G	AF239683	CCDS32483.1	16q23.1	2008-08-04			ENSG00000118557	ENSG00000118557			17728	protein-coding gene	gene with protein product						11468771	Standard	NM_031293		Approved		uc002fcd.3	Q8TBY8	OTTHUMG00000167827	ENST00000237353.10:c.406G>C	16.37:g.72188118C>G	ENSP00000237353:p.Glu136Gln		Somatic				PMFBP1_uc002fcd.2_Missense_Mutation_p.E136Q|PMFBP1_uc002fce.2_RNA|PMFBP1_uc002fcf.2_5'UTR	p.E136Q	NM_031293	NP_112583	WXS	Illumina HiSeq	Unspecified	Q8TBY8	PMFBP_HUMAN			4	578	-		Ovarian(137;0.179)	136					B3KVI9|H7BY07|Q8NA09|Q9BY16|Q9H0H4	Missense_Mutation	SNP	ENST00000237353.10	37	c.406G>C	CCDS32483.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.237370	0.79800	.	.	ENSG00000118557	ENST00000537465;ENST00000237353;ENST00000535461	T;T	0.80033	-1.33;-1.33	5.63	5.63	0.86233	.	0.000000	0.50627	D	0.000106	T	0.82222	0.4990	N	0.24115	0.695	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.79235	-0.1887	10	0.24483	T	0.36	-21.5589	15.1899	0.73035	0.0:1.0:0.0:0.0	.	136;136	Q8TBY8-2;G3V1Q7	.;.	Q	136	ENSP00000443817:E136Q;ENSP00000237353:E136Q	ENSP00000237353:E136Q	E	-	1	0	PMFBP1	70745619	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.334000	0.43920	2.669000	0.90835	0.655000	0.94253	GAA		0.463	PMFBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396473.2	NM_031293		19	99	0	0	0	0	19	99				
PKD1L2	114780	broad.mit.edu	37	16	81209259	81209259	+	RNA	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr16:81209259G>C	ENST00000527937.1	-	0	415				PKD1L2_ENST00000525539.1_RNA|PKD1L2_ENST00000337114.4_RNA|PKD1L2_ENST00000533478.1_RNA|PKD1L2_ENST00000531391.1_RNA			Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						ATTGGTGGCAGAAATAACTAC	0.532																																						uc002fgh.1		NA																	0				ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(2533-2535)TCT>TGT		polycystin 1-like 2 isoform a							108.0	108.0	108.0					16																	81209259		2049	4210	6259			114780				neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding	g.chr16:81209259G>C	AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81209259G>C			Somatic				PKD1L2_uc002fgg.1_RNA|PKD1L2_uc002fgi.2_Missense_Mutation_p.S160C|PKD1L2_uc002fgj.2_Missense_Mutation_p.S845C|PKD1L2_uc002fgk.1_5'UTR|PKD1L2_uc002fgl.1_Missense_Mutation_p.S101C	p.S845C	NM_052892	NP_443124	WXS	Illumina HiSeq	Unspecified	Q7Z442	PK1L2_HUMAN			15	2534	-			845			REJ.|Extracellular (Potential).		Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Missense_Mutation	SNP	ENST00000527937.1	37	c.2534C>G		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.13|15.13	2.741583|2.741583	0.49151|0.49151	.|.	.|.	ENSG00000166473|ENSG00000166473	ENST00000526632|ENST00000531391;ENST00000337114;ENST00000527937	.|T;T;T	.|0.71817	.|-0.6;-0.6;1.38	4.82|4.82	3.86|3.86	0.44501|0.44501	.|Egg jelly receptor, REJ-like (1);PKD/REJ-like protein (1);	.|0.138167	.|0.45867	.|D	.|0.000333	T|T	0.81273|0.81273	0.4788|0.4788	.|.	.|.	.|.	0.23186|0.23186	N|N	0.998152|0.998152	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.70935	.|0.967;0.971;0.942	T|T	0.72620|0.72620	-0.4238|-0.4238	4|9	.|0.87932	.|D	.|0	-6.2233|-6.2233	10.4485|10.4485	0.44507|0.44507	0.093:0.0:0.907:0.0|0.093:0.0:0.907:0.0	.|.	.|101;845;845	.|Q7Z442-6;Q7Z442-3;Q7Z442	.|.;.;PK1L2_HUMAN	L|C	372|160;845;101	.|ENSP00000436309:S160C;ENSP00000337397:S845C;ENSP00000432818:S101C	.|ENSP00000337397:S845C	F|S	-|-	3|2	2|0	PKD1L2|PKD1L2	79766760|79766760	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.480000|0.480000	0.33159|0.33159	2.435000|2.435000	0.44811|0.44811	1.025000|1.025000	0.39708|0.39708	0.455000|0.455000	0.32223|0.32223	TTC|TCT		0.532	PKD1L2-007	KNOWN	basic|exp_conf	protein_coding	polymorphic_pseudogene	OTTHUMT00000387978.1			14	61	0	0	0	0	14	61				
SPG7	6687	broad.mit.edu	37	16	89597147	89597147	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr16:89597147C>T	ENST00000268704.2	+	7	933	c.918C>T	c.(916-918)gtC>gtT	p.V306V	RNU7-117P_ENST00000516770.1_RNA|SPG7_ENST00000341316.2_Silent_p.V306V	NM_003119.2	NP_003110.1	Q9UQ90	SPG7_HUMAN	spastic paraplegia 7 (pure and complicated autosomal recessive)	306					anterograde axon cargo transport (GO:0008089)|cell death (GO:0008219)|mitochondrion organization (GO:0007005)|nervous system development (GO:0007399)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|peptidase activity (GO:0008233)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|urinary_tract(1)	20		all_hematologic(23;0.00824)|Colorectal(91;0.102)		all cancers(4;1.39e-07)|OV - Ovarian serous cystadenocarcinoma(4;5.64e-06)|BRCA - Breast invasive adenocarcinoma(80;0.015)		GGAAAGGAGTCAGCTTCAAAG	0.517																																						uc002fnj.2		NA																	0					0						c.(916-918)GTC>GTT		spastic paraplegia 7 isoform 1							117.0	108.0	111.0					16																	89597147		2198	4300	6498	SO:0001819	synonymous_variant	6687				cell death|nervous system development|protein catabolic process|proteolysis	integral to membrane|mitochondrial membrane	ATP binding|metalloendopeptidase activity|nucleoside-triphosphatase activity|unfolded protein binding|zinc ion binding	g.chr16:89597147C>T	Y16610	CCDS10977.1, CCDS10978.1	16q24.3	2010-04-21	2007-04-23		ENSG00000197912	ENSG00000197912		"""ATPases / AAA-type"""	11237	protein-coding gene	gene with protein product	"""paraplegin"""	602783	"""cell matrix adhesion regulator"""	CMAR		9635427, 9634528	Standard	XM_006721264		Approved	CAR, SPG5C	uc002fnj.3	Q9UQ90	OTTHUMG00000138046	ENST00000268704.2:c.918C>T	16.37:g.89597147C>T			Somatic				SPG7_uc002fni.2_Silent_p.V306V	p.V306V	NM_003119	NP_003110	WXS	Illumina HiSeq	Unspecified	Q9UQ90	SPG7_HUMAN		all cancers(4;1.39e-07)|OV - Ovarian serous cystadenocarcinoma(4;5.64e-06)|BRCA - Breast invasive adenocarcinoma(80;0.015)	7	939	+		all_hematologic(23;0.00824)|Colorectal(91;0.102)	306			Mitochondrial matrix (Potential).		O75756|Q2TB70|Q58F00|Q96IB0	Silent	SNP	ENST00000268704.2	37	c.918C>T	CCDS10977.1																																																																																				0.517	SPG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269921.2	NM_003119		8	79	0	0	0	0	8	79				
FANCA	2175	broad.mit.edu	37	16	89877208	89877208	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr16:89877208C>G	ENST00000389301.3	-	5	459	c.429G>C	c.(427-429)aaG>aaC	p.K143N	FANCA_ENST00000534992.1_Missense_Mutation_p.K143N|FANCA_ENST00000568369.1_Missense_Mutation_p.K143N|FANCA_ENST00000389302.3_Missense_Mutation_p.K143N|FANCA_ENST00000563673.1_Missense_Mutation_p.K143N|FANCA_ENST00000543736.1_Intron	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	143					DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		AAGACAGCTTCTTCTGAAAAG	0.348			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													uc002fou.1		NA	yes	Rec		Fanconi anaemia A	16	16q24.3	2175	D|Mis|N|F|S	"""Fanconi anemia, complementation group A"""			L		AML|leukemia			0				ovary(2)|breast(2)|central_nervous_system(1)|skin(1)	6						c.(427-429)AAG>AAC	Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi anemia, complementation group A isoform							99.0	103.0	101.0					16																	89877208		2198	4300	6498	SO:0001583	missense	2175	Fanconi_Anemia	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	DNA repair|protein complex assembly	cytoplasm|nucleoplasm	protein binding	g.chr16:89877208C>G	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.429G>C	16.37:g.89877208C>G	ENSP00000373952:p.Lys143Asn		Somatic				FANCA_uc010vpn.1_Missense_Mutation_p.K143N|FANCA_uc002fov.1_Missense_Mutation_p.K126N|FANCA_uc002fow.1_Missense_Mutation_p.K143N|FANCA_uc002fox.1_Missense_Mutation_p.K143N|FANCA_uc010ciu.1_Intron|FANCA_uc002foy.2_Missense_Mutation_p.K143N	p.K143N	NM_000135	NP_000126	WXS	Illumina HiSeq	Unspecified	O15360	FANCA_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.028)	5	471	-		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)	143					A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Missense_Mutation	SNP	ENST00000389301.3	37	c.429G>C	CCDS32515.1	.	.	.	.	.	.	.	.	.	.	C	16.68	3.189950	0.58017	.	.	ENSG00000187741	ENST00000389301;ENST00000389302;ENST00000534992	T;T;T	0.47869	0.83;0.83;0.83	4.96	4.0	0.46444	.	0.390178	0.21489	N	0.073720	T	0.59046	0.2165	M	0.67953	2.075	0.29823	N	0.830707	D;D;D;D;D	0.71674	0.998;0.996;0.996;0.996;0.998	P;P;P;P;P	0.60541	0.738;0.876;0.876;0.876;0.738	T	0.58999	-0.7536	10	0.59425	D	0.04	-14.5278	7.9417	0.29963	0.0:0.8105:0.0:0.1895	.	143;143;143;143;143	B4DRI7;A0PJU8;F5H8D5;O15360-2;O15360	.;.;.;.;FANCA_HUMAN	N	143	ENSP00000373952:K143N;ENSP00000373953:K143N;ENSP00000443675:K143N	ENSP00000373952:K143N	K	-	3	2	FANCA	88404709	1.000000	0.71417	0.997000	0.53966	0.714000	0.41099	1.605000	0.36815	1.229000	0.43630	0.650000	0.86243	AAG		0.348	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000421927.1			20	105	0	0	0	0	20	105				
MYBBP1A	10514	broad.mit.edu	37	17	4457189	4457189	+	Silent	SNP	C	C	G	rs369129296		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:4457189C>G	ENST00000254718.4	-	5	783	c.477G>C	c.(475-477)tcG>tcC	p.S159S	MYBBP1A_ENST00000381556.2_Silent_p.S159S			Q9BQG0	MBB1A_HUMAN	MYB binding protein (P160) 1a	159	Interaction with MYB. {ECO:0000250}.				cellular response to glucose starvation (GO:0042149)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleocytoplasmic transport (GO:0006913)|osteoblast differentiation (GO:0001649)|positive regulation of cell cycle arrest (GO:0071158)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|NLS-dependent protein nuclear import complex (GO:0042564)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA-directed DNA polymerase activity (GO:0003887)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)	24						GCAGCTTCACCGACTTCATCA	0.627																																						uc002fyb.3		NA																	0				ovary(1)|skin(1)	2						c.(475-477)TCG>TCC		MYB binding protein 1a isoform 2							66.0	65.0	66.0					17																	4457189		2203	4300	6503	SO:0001819	synonymous_variant	10514				nucleocytoplasmic transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NLS-dependent protein nuclear import complex|nucleolus	DNA binding|DNA-directed DNA polymerase activity|transcription factor binding	g.chr17:4457189C>G	AF147709	CCDS11046.1, CCDS42238.1	17p13.3	2008-07-18			ENSG00000132382	ENSG00000132382			7546	protein-coding gene	gene with protein product	"""p53-activated protein-2"""	604885				10644447	Standard	NM_014520		Approved	P160, PAP2, FLJ37886	uc002fxz.4	Q9BQG0	OTTHUMG00000090747	ENST00000254718.4:c.477G>C	17.37:g.4457189C>G			Somatic				MYBBP1A_uc002fxz.3_Silent_p.S159S	p.S159S	NM_014520	NP_055335	WXS	Illumina HiSeq	Unspecified	Q9BQG0	MBB1A_HUMAN			5	539	-			159			Interaction with MYB (By similarity).		Q86VM3|Q9BW49|Q9P0V5|Q9UF99	Silent	SNP	ENST00000254718.4	37	c.477G>C	CCDS11046.1																																																																																				0.627	MYBBP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207488.2	NM_014520		4	19	0	0	0	0	4	19				
SMTNL2	342527	broad.mit.edu	37	17	4510765	4510765	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:4510765C>T	ENST00000389313.4	+	8	1436	c.1369C>T	c.(1369-1371)Ctg>Ttg	p.L457L	RP11-141J13.5_ENST00000573270.1_lincRNA|SMTNL2_ENST00000338859.4_Silent_p.L313L	NM_001114974.1	NP_001108446.1	Q2TAL5	SMTL2_HUMAN	smoothelin-like 2	457										breast(1)|endometrium(9)|kidney(1)|lung(1)|skin(1)	13				READ - Rectum adenocarcinoma(115;0.0325)		GTACAACCACCTGCGTCGCTT	0.617																																						uc002fyf.1		NA																	0					0						c.(1369-1371)CTG>TTG		smoothelin-like 2 isoform 1							133.0	129.0	130.0					17																	4510765		2203	4300	6503	SO:0001819	synonymous_variant	342527							g.chr17:4510765C>T	AK124452	CCDS11048.1, CCDS45583.1	17p13.2	2006-04-26			ENSG00000188176	ENSG00000188176			24764	protein-coding gene	gene with protein product							Standard	NM_001114974		Approved	FLJ42461	uc002fyf.1	Q2TAL5	OTTHUMG00000132938	ENST00000389313.4:c.1369C>T	17.37:g.4510765C>T			Somatic				SMTNL2_uc002fye.2_Silent_p.L313L|uc002fyg.1_5'Flank	p.L457L	NM_001114974	NP_001108446	WXS	Illumina HiSeq	Unspecified	Q2TAL5	SMTL2_HUMAN		READ - Rectum adenocarcinoma(115;0.0325)	8	1436	+			457					Q6ZVK6	Silent	SNP	ENST00000389313.4	37	c.1369C>T	CCDS45583.1																																																																																				0.617	SMTNL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439129.1	NM_198501		22	94	0	0	0	0	22	94				
DERL2	51009	broad.mit.edu	37	17	5392414	5392414	+	5'Flank	SNP	C	C	G	rs34335907		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:5392414C>G	ENST00000158771.4	-	0	0				DERL2_ENST00000571968.1_5'Flank|MIS12_ENST00000573759.1_Missense_Mutation_p.L78V|DERL2_ENST00000572834.1_5'Flank|MIS12_ENST00000381165.3_Missense_Mutation_p.L78V|DERL2_ENST00000570848.1_5'Flank	NM_016041.3	NP_057125.2	Q9GZP9	DERL2_HUMAN	derlin 2						endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|retrograde protein transport, ER to cytosol (GO:0030970)|suckling behavior (GO:0001967)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|late endosome (GO:0005770)|membrane (GO:0016020)				large_intestine(3)	3						TTTTGATAACCTTTTTAGCAA	0.403																																						uc002gcd.2		NA																	0					0						c.(232-234)CTT>GTT		MIS12 homolog							84.0	77.0	79.0					17																	5392414		2203	4300	6503	SO:0001631	upstream_gene_variant	79003				cell division|chromosome segregation|kinetochore assembly|mitotic prometaphase	cytosol|MIS12/MIND type complex|nucleus	protein binding	g.chr17:5392414C>G	BC010890	CCDS11073.1	17p13.2	2012-02-01	2012-02-01		ENSG00000072849	ENSG00000072849			17943	protein-coding gene	gene with protein product		610304	"""Der1-like domain family, member 2"""			10810093, 11500051	Standard	NM_016041		Approved	F-LAN-1, FLANa, F-LANa, CGI-101, derlin-2	uc002gcc.1	Q9GZP9	OTTHUMG00000102040		17.37:g.5392414C>G	Exception_encountered		Somatic				DERL2_uc002gcc.1_5'Flank|MIS12_uc002gce.2_Missense_Mutation_p.L78V	p.L78V	NM_024039	NP_076944	WXS	Illumina HiSeq	Unspecified	Q9H081	MIS12_HUMAN			2	561	+			78					Q9Y3A7	Missense_Mutation	SNP	ENST00000158771.4	37	c.232C>G	CCDS11073.1	.	.	.	.	.	.	.	.	.	.	C	19.74	3.884526	0.72410	.	.	ENSG00000167842	ENST00000381165	T	0.45668	0.89	6.17	6.17	0.99709	.	0.061993	0.64402	D	0.000003	T	0.66346	0.2780	M	0.73598	2.24	0.48511	D	0.999668	D	0.76494	0.999	D	0.71184	0.972	T	0.61964	-0.6954	10	0.42905	T	0.14	-8.9588	19.8676	0.96824	0.0:1.0:0.0:0.0	.	78	Q9H081	MIS12_HUMAN	V	78	ENSP00000370557:L78V	ENSP00000370557:L78V	L	+	1	0	MIS12	5333138	0.998000	0.40836	0.975000	0.42487	0.965000	0.64279	4.069000	0.57541	2.941000	0.99782	0.655000	0.94253	CTT		0.403	DERL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219825.1	NM_016041		12	45	0	0	0	0	12	45				
MFSD6L	162387	broad.mit.edu	37	17	8700953	8700953	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:8700953G>A	ENST00000329805.4	-	1	1714	c.1486C>T	c.(1486-1488)Cga>Tga	p.R496*		NM_152599.3	NP_689812.3	Q8IWD5	MFS6L_HUMAN	major facilitator superfamily domain containing 6-like	496						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(7)|skin(4)	17						AAGTGGCCTCGGAACAAGGCA	0.612																																						uc002glp.1		NA																	0				central_nervous_system(1)	1						c.(1486-1488)CGA>TGA		major facilitator superfamily domain containing							41.0	41.0	41.0					17																	8700953		2203	4300	6503	SO:0001587	stop_gained	162387					integral to membrane		g.chr17:8700953G>A	AK093092	CCDS11146.1	17p13.1	2014-05-30			ENSG00000185156	ENSG00000185156			26656	protein-coding gene	gene with protein product							Standard	NM_152599		Approved	FLJ35773	uc002glp.2	Q8IWD5	OTTHUMG00000178584	ENST00000329805.4:c.1486C>T	17.37:g.8700953G>A	ENSP00000330051:p.Arg496*		Somatic					p.R496*	NM_152599	NP_689812	WXS	Illumina HiSeq	Unspecified	Q8IWD5	MFS6L_HUMAN			1	1634	-			496					Q6YL34|Q8NA76	Nonsense_Mutation	SNP	ENST00000329805.4	37	c.1486C>T	CCDS11146.1	.	.	.	.	.	.	.	.	.	.	G	37	6.039452	0.97226	.	.	ENSG00000185156	ENST00000329805	.	.	.	4.89	1.45	0.22620	.	0.604741	0.14621	N	0.308426	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	-10.9623	13.6507	0.62310	0.0:0.0:0.5967:0.4033	.	.	.	.	X	496	.	ENSP00000330051:R496X	R	-	1	2	MFSD6L	8641678	0.919000	0.31177	0.598000	0.28837	0.651000	0.38670	1.804000	0.38873	0.599000	0.29845	0.557000	0.71058	CGA		0.612	MFSD6L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442554.1	NM_152599		9	32	0	0	0	0	9	32				
NCOR1	9611	broad.mit.edu	37	17	15965063	15965063	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:15965063C>T	ENST00000268712.3	-	37	5790	c.5533G>A	c.(5533-5535)Gaa>Aaa	p.E1845K	NCOR1_ENST00000395857.3_Missense_Mutation_p.E429K|NCOR1_ENST00000395851.1_Intron	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	1845	Interaction with C1D. {ECO:0000250}.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		CTGGCAGCTTCATGCTTACTC	0.507																																						uc002gpo.2		NA																	0				upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5						c.(5533-5535)GAA>AAA		nuclear receptor co-repressor 1							79.0	79.0	79.0					17																	15965063		2203	4300	6503	SO:0001583	missense	9611				cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding	g.chr17:15965063C>T	AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.5533G>A	17.37:g.15965063C>T	ENSP00000268712:p.Glu1845Lys		Somatic				NCOR1_uc002gpn.2_Intron|NCOR1_uc002gpm.2_Missense_Mutation_p.E365K|NCOR1_uc010vwb.1_Missense_Mutation_p.E429K|NCOR1_uc010coy.2_Missense_Mutation_p.E753K|NCOR1_uc010vwc.1_Missense_Mutation_p.E655K	p.E1845K	NM_006311	NP_006302	WXS	Illumina HiSeq	Unspecified	O75376	NCOR1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (92;0.101)	37	5773	-			1845			Interaction with C1D (By similarity).		B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Missense_Mutation	SNP	ENST00000268712.3	37	c.5533G>A	CCDS11175.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.518266	0.85495	.	.	ENSG00000141027	ENST00000268712;ENST00000395849;ENST00000395857	T;T	0.51817	0.69;0.71	5.87	5.87	0.94306	.	0.255046	0.49305	D	0.000148	T	0.45256	0.1333	L	0.40543	1.245	0.48185	D	0.999608	P;B;B;P	0.39903	0.51;0.203;0.034;0.694	B;B;B;B	0.38755	0.142;0.05;0.025;0.281	T	0.45571	-0.9252	10	0.66056	D	0.02	-6.7606	19.1914	0.93667	0.0:1.0:0.0:0.0	.	655;1749;1845;365	B4DZ48;E7EVK1;O75376;Q86YY1	.;.;NCOR1_HUMAN;.	K	1845;1749;429	ENSP00000268712:E1845K;ENSP00000379198:E429K	ENSP00000268712:E1845K	E	-	1	0	NCOR1	15905788	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.496000	0.66918	2.785000	0.95823	0.650000	0.86243	GAA		0.507	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131751.5	NM_006311		24	113	0	0	0	0	24	113				
PEMT	10400	broad.mit.edu	37	17	17409126	17409126	+	Silent	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:17409126G>A	ENST00000395783.1	-	7	758	c.579C>T	c.(577-579)tcC>tcT	p.S193S	PEMT_ENST00000395782.1_Silent_p.S193S|PEMT_ENST00000435340.2_3'UTR|RP11-524F11.1_ENST00000582325.1_RNA|PEMT_ENST00000395781.2_3'UTR|PEMT_ENST00000484838.2_5'UTR|PEMT_ENST00000255389.5_Silent_p.S230S	NM_007169.2	NP_009100.2	Q9UBM1	PEMT_HUMAN	phosphatidylethanolamine N-methyltransferase	193					cell proliferation (GO:0008283)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	phosphatidyl-N-dimethylethanolamine N-methyltransferase activity (GO:0080101)|phosphatidyl-N-methylethanolamine N-methyltransferase activity (GO:0000773)|phosphatidylethanolamine N-methyltransferase activity (GO:0004608)			endometrium(1)|kidney(1)|large_intestine(2)|prostate(3)	7				Colorectal(2;0.0157)|READ - Rectum adenocarcinoma(2;0.0891)		TGTGGGACCCGGAGGCTTTCT	0.672																																						uc002grj.2		NA																	0					0						c.(577-579)TCC>TCT		phosphatidylethanolamine N-methyltransferase							66.0	60.0	62.0					17																	17409126		2203	4300	6503	SO:0001819	synonymous_variant	10400				cell proliferation|phosphatidylcholine biosynthetic process	endoplasmic reticulum membrane|integral to membrane|mitochondrial membrane	phosphatidylethanolamine N-methyltransferase activity	g.chr17:17409126G>A	AF176806	CCDS11186.1, CCDS11187.1, CCDS58520.1	17p11.2	2008-02-05			ENSG00000133027	ENSG00000133027	2.1.1.17		8830	protein-coding gene	gene with protein product		602391				9989271, 17881348	Standard	NM_148173		Approved	PEMPT, PEMT2	uc002grl.4	Q9UBM1	OTTHUMG00000059290	ENST00000395783.1:c.579C>T	17.37:g.17409126G>A			Somatic				PEMT_uc002grk.2_Silent_p.S193S|PEMT_uc002grl.2_Silent_p.S230S|PEMT_uc010vwx.1_3'UTR	p.S193S	NM_148173	NP_680478	WXS	Illumina HiSeq	Unspecified	Q9UBM1	PEMT_HUMAN		Colorectal(2;0.0157)|READ - Rectum adenocarcinoma(2;0.0891)	7	646	-			193					A8MZ66|B4DY41|D3DXC3|Q6IAQ5|Q86VL3|Q9BW86|Q9UHY6|Q9Y6V9	Silent	SNP	ENST00000395783.1	37	c.579C>T	CCDS11187.1																																																																																				0.672	PEMT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131657.1	NM_007169		4	22	0	0	0	0	4	22				
NLK	51701	broad.mit.edu	37	17	26518200	26518200	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:26518200G>A	ENST00000407008.3	+	9	2108	c.1390G>A	c.(1390-1392)Gat>Aat	p.D464N		NM_016231.4	NP_057315.3	Q9UBE8	NLK_HUMAN	nemo-like kinase	464	Required for homodimerization and kinase activation and localization to the nucleus. {ECO:0000250}.|Required for interaction with TAB2. {ECO:0000250}.				intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of Wnt signaling pathway (GO:0030178)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|serine phosphorylation of STAT3 protein (GO:0033136)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase activity (GO:0004707)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|SH2 domain binding (GO:0042169)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(1)	14	all_lung(13;0.000343)|Lung NSC(42;0.00184)			UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		TCCCAAATTTGATGACACTTT	0.428																																						uc010crj.2		NA																	0				ovary(1)|lung(1)|central_nervous_system(1)	3						c.(1390-1392)GAT>AAT		nemo like kinase							116.0	97.0	103.0					17																	26518200		2203	4300	6503	SO:0001583	missense	51701				intracellular protein kinase cascade|negative regulation of Wnt receptor signaling pathway|peptidyl-threonine phosphorylation|regulation of transcription, DNA-dependent|serine phosphorylation of STAT3 protein|transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway|Wnt receptor signaling pathway	cytoplasm|nucleus	ATP binding|magnesium ion binding|MAP kinase activity|SH2 domain binding|transcription factor binding|ubiquitin protein ligase binding	g.chr17:26518200G>A	AF197898	CCDS11224.2	17q11.2	2005-12-22	2005-12-22		ENSG00000087095	ENSG00000087095			29858	protein-coding gene	gene with protein product		609476	"""nemo like kinase"""			9448268, 10863097	Standard	NM_016231		Approved		uc010crj.3	Q9UBE8	OTTHUMG00000132451	ENST00000407008.3:c.1390G>A	17.37:g.26518200G>A	ENSP00000384625:p.Asp464Asn		Somatic				NLK_uc010cri.1_RNA	p.D464N	NM_016231	NP_057315	WXS	Illumina HiSeq	Unspecified	Q9UBE8	NLK_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (53;0.168)	9	1602	+	all_lung(13;0.000343)|Lung NSC(42;0.00184)		464					B2RCX1|Q2PNI9|Q6P2A3	Missense_Mutation	SNP	ENST00000407008.3	37	c.1390G>A	CCDS11224.2	.	.	.	.	.	.	.	.	.	.	G	22.5	4.297297	0.81025	.	.	ENSG00000087095	ENST00000407008	T	0.73897	-0.79	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.74772	0.3760	M	0.76838	2.35	0.80722	D	1	P	0.38048	0.616	B	0.32533	0.147	T	0.75019	-0.3465	10	0.34782	T	0.22	-0.6125	19.1228	0.93371	0.0:0.0:1.0:0.0	.	464	Q9UBE8	NLK_HUMAN	N	464	ENSP00000384625:D464N	ENSP00000384625:D464N	D	+	1	0	NLK	23542327	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.342000	0.79310	2.765000	0.95021	0.655000	0.94253	GAT		0.428	NLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255607.3	NM_016231		10	57	0	0	0	0	10	57				
KIAA0100	9703	broad.mit.edu	37	17	26943185	26943185	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:26943185C>T	ENST00000528896.2	-	37	6393	c.6319G>A	c.(6319-6321)Gag>Aag	p.E2107K	SGK494_ENST00000469832.3_5'Flank|KIAA0100_ENST00000389003.3_Missense_Mutation_p.E1964K|SGK494_ENST00000301037.5_5'Flank|RP11-192H23.4_ENST00000577790.1_5'Flank|SPAG5-AS1_ENST00000554154.1_RNA|KIAA0100_ENST00000544884.1_Missense_Mutation_p.E1964K|SPAG5-AS1_ENST00000414744.1_RNA|KIAA0100_ENST00000579924.2_5'Flank|SPAG5-AS1_ENST00000424210.1_RNA|RP11-192H23.4_ENST00000534850.1_5'Flank	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	2107						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					GCAGCTCGCTCTTTCATCTTG	0.483																																						uc002hbu.2		NA																	0				ovary(2)|breast(1)|skin(1)	4						c.(6319-6321)GAG>AAG		hypothetical protein LOC9703 precursor							82.0	66.0	72.0					17																	26943185		2203	4300	6503	SO:0001583	missense	9703					extracellular region		g.chr17:26943185C>T	D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.6319G>A	17.37:g.26943185C>T	ENSP00000436773:p.Glu2107Lys		Somatic				SGK494_uc010waq.1_5'Flank|SGK494_uc010war.1_5'Flank|SGK494_uc002hbr.1_5'Flank|uc002hbs.1_Intron|KIAA0100_uc002hbt.2_Missense_Mutation_p.E436K	p.E2107K	NM_014680	NP_055495	WXS	Illumina HiSeq	Unspecified	Q14667	K0100_HUMAN			37	6418	-	Lung NSC(42;0.00431)		2107					A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	ENST00000528896.2	37	c.6319G>A	CCDS32595.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.873165	0.91664	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896;ENST00000544884	T;T	0.42900	0.96;0.96	5.63	5.63	0.86233	FMP27,  C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.63757	0.2538	M	0.66297	2.02	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.56195	-0.8019	10	0.23302	T	0.38	.	19.6959	0.96026	0.0:1.0:0.0:0.0	.	2107	Q14667	K0100_HUMAN	K	2107;2077;2107;1964	ENSP00000436773:E2107K;ENSP00000446443:E1964K	ENSP00000005905:E2107K	E	-	1	0	KIAA0100	23967312	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.449000	0.80643	2.648000	0.89879	0.655000	0.94253	GAG		0.483	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	NM_014680		4	56	0	0	0	0	4	56				
ATAD5	79915	broad.mit.edu	37	17	29161435	29161435	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:29161435G>C	ENST00000321990.4	+	2	714	c.336G>C	c.(334-336)aaG>aaC	p.K112N	CTD-2349P21.11_ENST00000580873.1_RNA	NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	112					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				AGTTTAAGAAGAAAAGAAAGA	0.338																																						uc002hfs.1		NA																	0				ovary(3)	3						c.(334-336)AAG>AAC		ATPase family, AAA domain containing 5							82.0	93.0	90.0					17																	29161435		2202	4297	6499	SO:0001583	missense	79915				response to DNA damage stimulus	nucleus	ATP binding|nucleoside-triphosphatase activity	g.chr17:29161435G>C		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.336G>C	17.37:g.29161435G>C	ENSP00000313171:p.Lys112Asn		Somatic				ATAD5_uc002hft.1_Missense_Mutation_p.K9N	p.K112N	NM_024857	NP_079133	WXS	Illumina HiSeq	Unspecified	Q96QE3	ATAD5_HUMAN			2	682	+		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)	112					Q05DH0|Q69YR6|Q9H9I1	Missense_Mutation	SNP	ENST00000321990.4	37	c.336G>C	CCDS11260.1	.	.	.	.	.	.	.	.	.	.	G	1.381	-0.583476	0.03827	.	.	ENSG00000176208	ENST00000321990	T	0.17691	2.26	5.77	3.75	0.43078	.	0.614844	0.17733	N	0.163826	T	0.25269	0.0614	L	0.60455	1.87	0.27876	N	0.939879	P;P	0.41848	0.763;0.651	P;B	0.44897	0.463;0.115	T	0.06698	-1.0812	10	0.87932	D	0	.	14.5279	0.67902	0.2087:0.0:0.7913:0.0	.	112;112	Q96QE3-2;Q96QE3	.;ATAD5_HUMAN	N	112	ENSP00000313171:K112N	ENSP00000313171:K112N	K	+	3	2	ATAD5	26185561	1.000000	0.71417	1.000000	0.80357	0.200000	0.23975	1.210000	0.32370	0.912000	0.36772	-0.797000	0.03246	AAG		0.338	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256206.2	NM_024857		15	136	0	0	0	0	15	136				
ATAD5	79915	broad.mit.edu	37	17	29161585	29161585	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:29161585G>C	ENST00000321990.4	+	2	864	c.486G>C	c.(484-486)aaG>aaC	p.K162N	CTD-2349P21.11_ENST00000580873.1_RNA	NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	162					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				TACGTTACAAGAAACAAGTAG	0.313																																						uc002hfs.1		NA																	0				ovary(3)	3						c.(484-486)AAG>AAC		ATPase family, AAA domain containing 5							108.0	120.0	116.0					17																	29161585		2202	4297	6499	SO:0001583	missense	79915				response to DNA damage stimulus	nucleus	ATP binding|nucleoside-triphosphatase activity	g.chr17:29161585G>C		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.486G>C	17.37:g.29161585G>C	ENSP00000313171:p.Lys162Asn		Somatic				ATAD5_uc002hft.1_Missense_Mutation_p.K59N	p.K162N	NM_024857	NP_079133	WXS	Illumina HiSeq	Unspecified	Q96QE3	ATAD5_HUMAN			2	832	+		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)	162					Q05DH0|Q69YR6|Q9H9I1	Missense_Mutation	SNP	ENST00000321990.4	37	c.486G>C	CCDS11260.1	.	.	.	.	.	.	.	.	.	.	G	2.400	-0.337711	0.05278	.	.	ENSG00000176208	ENST00000321990	T	0.17528	2.27	5.55	2.36	0.29203	.	0.834036	0.11347	N	0.573383	T	0.23094	0.0558	L	0.59436	1.845	0.22389	N	0.999141	D;P	0.56746	0.977;0.931	P;B	0.50659	0.647;0.444	T	0.14448	-1.0472	10	0.72032	D	0.01	.	4.3976	0.11370	0.1302:0.2277:0.5247:0.1173	.	162;162	Q96QE3-2;Q96QE3	.;ATAD5_HUMAN	N	162	ENSP00000313171:K162N	ENSP00000313171:K162N	K	+	3	2	ATAD5	26185711	0.165000	0.22948	0.330000	0.25442	0.323000	0.28346	0.170000	0.16663	0.341000	0.23771	0.655000	0.94253	AAG		0.313	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256206.2	NM_024857		16	197	0	0	0	0	16	197				
ATAD5	79915	broad.mit.edu	37	17	29161714	29161714	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:29161714G>C	ENST00000321990.4	+	2	993	c.615G>C	c.(613-615)ttG>ttC	p.L205F	CTD-2349P21.11_ENST00000580873.1_RNA	NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	205					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				TCAAAAAGTTGAGAAAAAGGA	0.328																																						uc002hfs.1		NA																	0				ovary(3)	3						c.(613-615)TTG>TTC		ATPase family, AAA domain containing 5							79.0	86.0	84.0					17																	29161714		2203	4300	6503	SO:0001583	missense	79915				response to DNA damage stimulus	nucleus	ATP binding|nucleoside-triphosphatase activity	g.chr17:29161714G>C		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.615G>C	17.37:g.29161714G>C	ENSP00000313171:p.Leu205Phe		Somatic				ATAD5_uc002hft.1_Missense_Mutation_p.L102F	p.L205F	NM_024857	NP_079133	WXS	Illumina HiSeq	Unspecified	Q96QE3	ATAD5_HUMAN			2	961	+		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)	205					Q05DH0|Q69YR6|Q9H9I1	Missense_Mutation	SNP	ENST00000321990.4	37	c.615G>C	CCDS11260.1	.	.	.	.	.	.	.	.	.	.	G	7.759	0.704993	0.15172	.	.	ENSG00000176208	ENST00000321990	T	0.18657	2.2	5.68	1.15	0.20763	.	1.091850	0.07070	N	0.835218	T	0.24774	0.0601	L	0.53249	1.67	0.09310	N	1	D;P	0.53462	0.96;0.779	P;B	0.48921	0.595;0.178	T	0.20405	-1.0276	10	0.39692	T	0.17	.	4.0671	0.09866	0.3779:0.3336:0.2885:0.0	.	205;205	Q96QE3-2;Q96QE3	.;ATAD5_HUMAN	F	205	ENSP00000313171:L205F	ENSP00000313171:L205F	L	+	3	2	ATAD5	26185840	0.096000	0.21769	0.861000	0.33841	0.995000	0.86356	0.132000	0.15891	0.792000	0.33850	0.655000	0.94253	TTG		0.328	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256206.2	NM_024857		23	141	0	0	0	0	23	141				
ATAD5	79915	broad.mit.edu	37	17	29161793	29161793	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:29161793G>C	ENST00000321990.4	+	2	1072	c.694G>C	c.(694-696)Gat>Cat	p.D232H	CTD-2349P21.11_ENST00000580873.1_RNA	NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	232					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				GCTTAAAAAAGATGGTAAAGA	0.338																																						uc002hfs.1		NA																	0				ovary(3)	3						c.(694-696)GAT>CAT		ATPase family, AAA domain containing 5							88.0	95.0	92.0					17																	29161793		2202	4298	6500	SO:0001583	missense	79915				response to DNA damage stimulus	nucleus	ATP binding|nucleoside-triphosphatase activity	g.chr17:29161793G>C		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.694G>C	17.37:g.29161793G>C	ENSP00000313171:p.Asp232His		Somatic				ATAD5_uc002hft.1_Missense_Mutation_p.D129H	p.D232H	NM_024857	NP_079133	WXS	Illumina HiSeq	Unspecified	Q96QE3	ATAD5_HUMAN			2	1040	+		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)	232					Q05DH0|Q69YR6|Q9H9I1	Missense_Mutation	SNP	ENST00000321990.4	37	c.694G>C	CCDS11260.1	.	.	.	.	.	.	.	.	.	.	G	0.021	-1.432049	0.01108	.	.	ENSG00000176208	ENST00000321990	T	0.17213	2.29	4.83	0.563	0.17296	.	1.611130	0.02639	N	0.105185	T	0.33962	0.0881	L	0.57536	1.79	0.09310	N	1	D;D	0.71674	0.998;0.989	P;P	0.61592	0.891;0.781	T	0.09037	-1.0693	10	0.66056	D	0.02	.	5.7627	0.18209	0.2303:0.1394:0.6303:0.0	.	232;232	Q96QE3-2;Q96QE3	.;ATAD5_HUMAN	H	232	ENSP00000313171:D232H	ENSP00000313171:D232H	D	+	1	0	ATAD5	26185919	0.780000	0.28664	0.000000	0.03702	0.056000	0.15407	1.380000	0.34351	0.072000	0.16694	0.655000	0.94253	GAT		0.338	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256206.2	NM_024857		16	126	0	0	0	0	16	126				
ATAD5	79915	broad.mit.edu	37	17	29162131	29162131	+	Silent	SNP	G	G	A	rs111343309		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:29162131G>A	ENST00000321990.4	+	2	1410	c.1032G>A	c.(1030-1032)ttG>ttA	p.L344L	CTD-2349P21.11_ENST00000580873.1_RNA	NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	344					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				GAATTTTCTTGAAACAAAAGC	0.378																																						uc002hfs.1		NA																	0				ovary(3)	3						c.(1030-1032)TTG>TTA		ATPase family, AAA domain containing 5							41.0	44.0	43.0					17																	29162131		2138	4264	6402	SO:0001819	synonymous_variant	79915				response to DNA damage stimulus	nucleus	ATP binding|nucleoside-triphosphatase activity	g.chr17:29162131G>A		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.1032G>A	17.37:g.29162131G>A			Somatic				ATAD5_uc002hft.1_Silent_p.L241L	p.L344L	NM_024857	NP_079133	WXS	Illumina HiSeq	Unspecified	Q96QE3	ATAD5_HUMAN			2	1378	+		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)	344					Q05DH0|Q69YR6|Q9H9I1	Silent	SNP	ENST00000321990.4	37	c.1032G>A	CCDS11260.1																																																																																				0.378	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256206.2	NM_024857		9	42	0	0	0	0	9	42				
ATAD5	79915	broad.mit.edu	37	17	29162199	29162199	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:29162199G>C	ENST00000321990.4	+	2	1478	c.1100G>C	c.(1099-1101)aGa>aCa	p.R367T	CTD-2349P21.11_ENST00000580873.1_RNA	NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	367					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				GTTCAGAAAAGAAAATCTAAT	0.343																																						uc002hfs.1		NA																	0				ovary(3)	3						c.(1099-1101)AGA>ACA		ATPase family, AAA domain containing 5							49.0	54.0	52.0					17																	29162199		2202	4300	6502	SO:0001583	missense	79915				response to DNA damage stimulus	nucleus	ATP binding|nucleoside-triphosphatase activity	g.chr17:29162199G>C		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.1100G>C	17.37:g.29162199G>C	ENSP00000313171:p.Arg367Thr		Somatic				ATAD5_uc002hft.1_Missense_Mutation_p.R264T	p.R367T	NM_024857	NP_079133	WXS	Illumina HiSeq	Unspecified	Q96QE3	ATAD5_HUMAN			2	1446	+		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)	367					Q05DH0|Q69YR6|Q9H9I1	Missense_Mutation	SNP	ENST00000321990.4	37	c.1100G>C	CCDS11260.1	.	.	.	.	.	.	.	.	.	.	G	12.72	2.022802	0.35701	.	.	ENSG00000176208	ENST00000321990	T	0.22336	1.96	5.91	5.91	0.95273	.	0.049099	0.85682	D	0.000000	T	0.49881	0.1583	M	0.70275	2.135	0.40094	D	0.976294	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.994	T	0.47774	-0.9091	10	0.87932	D	0	.	20.2963	0.98556	0.0:0.0:1.0:0.0	.	367;367	Q96QE3-2;Q96QE3	.;ATAD5_HUMAN	T	367	ENSP00000313171:R367T	ENSP00000313171:R367T	R	+	2	0	ATAD5	26186325	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.870000	0.87175	2.813000	0.96785	0.655000	0.94253	AGA		0.343	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256206.2	NM_024857		11	50	0	0	0	0	11	50				
ATAD5	79915	broad.mit.edu	37	17	29162272	29162272	+	Silent	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:29162272G>A	ENST00000321990.4	+	2	1551	c.1173G>A	c.(1171-1173)gtG>gtA	p.V391V	CTD-2349P21.11_ENST00000580873.1_RNA	NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	391					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				CTGAAGCTGTGAAACCAAAAT	0.363																																						uc002hfs.1		NA																	0				ovary(3)	3						c.(1171-1173)GTG>GTA		ATPase family, AAA domain containing 5							63.0	68.0	66.0					17																	29162272		2203	4300	6503	SO:0001819	synonymous_variant	79915				response to DNA damage stimulus	nucleus	ATP binding|nucleoside-triphosphatase activity	g.chr17:29162272G>A		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.1173G>A	17.37:g.29162272G>A			Somatic				ATAD5_uc002hft.1_Silent_p.V288V	p.V391V	NM_024857	NP_079133	WXS	Illumina HiSeq	Unspecified	Q96QE3	ATAD5_HUMAN			2	1519	+		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)	391					Q05DH0|Q69YR6|Q9H9I1	Silent	SNP	ENST00000321990.4	37	c.1173G>A	CCDS11260.1																																																																																				0.363	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256206.2	NM_024857		15	72	0	0	0	0	15	72				
ATAD5	79915	broad.mit.edu	37	17	29162420	29162420	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:29162420G>A	ENST00000321990.4	+	2	1699	c.1321G>A	c.(1321-1323)Gat>Aat	p.D441N	CTD-2349P21.11_ENST00000580873.1_RNA	NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	441					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				AGGAAGAGATGATAATTCTAA	0.323																																						uc002hfs.1		NA																	0				ovary(3)	3						c.(1321-1323)GAT>AAT		ATPase family, AAA domain containing 5							40.0	45.0	44.0					17																	29162420		2137	4267	6404	SO:0001583	missense	79915				response to DNA damage stimulus	nucleus	ATP binding|nucleoside-triphosphatase activity	g.chr17:29162420G>A		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.1321G>A	17.37:g.29162420G>A	ENSP00000313171:p.Asp441Asn		Somatic				ATAD5_uc002hft.1_Missense_Mutation_p.D338N	p.D441N	NM_024857	NP_079133	WXS	Illumina HiSeq	Unspecified	Q96QE3	ATAD5_HUMAN			2	1667	+		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)	441					Q05DH0|Q69YR6|Q9H9I1	Missense_Mutation	SNP	ENST00000321990.4	37	c.1321G>A	CCDS11260.1	.	.	.	.	.	.	.	.	.	.	G	6.427	0.446917	0.12223	.	.	ENSG00000176208	ENST00000321990	T	0.09255	3.0	5.6	-3.08	0.05347	.	1.051140	0.07327	N	0.878667	T	0.02929	0.0087	N	0.01705	-0.755	0.09310	N	1	B;B	0.11235	0.004;0.001	B;B	0.11329	0.006;0.001	T	0.44590	-0.9318	10	0.13853	T	0.58	.	3.0321	0.06110	0.3348:0.1216:0.4172:0.1264	.	441;441	Q96QE3-2;Q96QE3	.;ATAD5_HUMAN	N	441	ENSP00000313171:D441N	ENSP00000313171:D441N	D	+	1	0	ATAD5	26186546	0.000000	0.05858	0.000000	0.03702	0.749000	0.42624	-0.462000	0.06704	-0.493000	0.06678	-0.471000	0.05019	GAT		0.323	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256206.2	NM_024857		10	63	0	0	0	0	10	63				
ATAD5	79915	broad.mit.edu	37	17	29162726	29162726	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:29162726G>A	ENST00000321990.4	+	2	2005	c.1627G>A	c.(1627-1629)Gat>Aat	p.D543N	CTD-2349P21.11_ENST00000580873.1_RNA	NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	543					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				TGTTTATGAAGATATAGCAAA	0.289																																						uc002hfs.1		NA																	0				ovary(3)	3						c.(1627-1629)GAT>AAT		ATPase family, AAA domain containing 5							57.0	65.0	62.0					17																	29162726		2193	4297	6490	SO:0001583	missense	79915				response to DNA damage stimulus	nucleus	ATP binding|nucleoside-triphosphatase activity	g.chr17:29162726G>A		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.1627G>A	17.37:g.29162726G>A	ENSP00000313171:p.Asp543Asn		Somatic				ATAD5_uc002hft.1_Missense_Mutation_p.D440N	p.D543N	NM_024857	NP_079133	WXS	Illumina HiSeq	Unspecified	Q96QE3	ATAD5_HUMAN			2	1973	+		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)	543					Q05DH0|Q69YR6|Q9H9I1	Missense_Mutation	SNP	ENST00000321990.4	37	c.1627G>A	CCDS11260.1	.	.	.	.	.	.	.	.	.	.	G	2.523	-0.310271	0.05458	.	.	ENSG00000176208	ENST00000321990	T	0.10477	2.87	5.15	2.05	0.26809	.	4.383600	0.00357	N	0.000024	T	0.09379	0.0231	L	0.48642	1.525	0.22424	N	0.999118	P;P	0.41848	0.763;0.501	B;B	0.31101	0.124;0.086	T	0.36648	-0.9739	10	0.20046	T	0.44	.	6.0737	0.19903	0.1674:0.1548:0.6778:0.0	.	543;543	Q96QE3-2;Q96QE3	.;ATAD5_HUMAN	N	543	ENSP00000313171:D543N	ENSP00000313171:D543N	D	+	1	0	ATAD5	26186852	0.863000	0.29885	0.123000	0.21794	0.187000	0.23431	1.117000	0.31234	0.194000	0.20326	0.467000	0.42956	GAT		0.289	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256206.2	NM_024857		20	70	0	0	0	0	20	70				
ATAD5	79915	broad.mit.edu	37	17	29164285	29164285	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:29164285G>A	ENST00000321990.4	+	3	2407	c.2029G>A	c.(2029-2031)Gag>Aag	p.E677K	CTD-2349P21.11_ENST00000580873.1_RNA	NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	677					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				caaaagatctgagaaaTCTGA	0.289																																						uc002hfs.1		NA																	0				ovary(3)	3						c.(2029-2031)GAG>AAG		ATPase family, AAA domain containing 5							37.0	41.0	40.0					17																	29164285		2191	4290	6481	SO:0001583	missense	79915				response to DNA damage stimulus	nucleus	ATP binding|nucleoside-triphosphatase activity	g.chr17:29164285G>A		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.2029G>A	17.37:g.29164285G>A	ENSP00000313171:p.Glu677Lys		Somatic				ATAD5_uc002hft.1_Missense_Mutation_p.E574K	p.E677K	NM_024857	NP_079133	WXS	Illumina HiSeq	Unspecified	Q96QE3	ATAD5_HUMAN			3	2375	+		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)	677					Q05DH0|Q69YR6|Q9H9I1	Missense_Mutation	SNP	ENST00000321990.4	37	c.2029G>A	CCDS11260.1	.	.	.	.	.	.	.	.	.	.	G	10.84	1.464991	0.26335	.	.	ENSG00000176208	ENST00000321990	T	0.08193	3.12	3.89	-5.51	0.02568	.	1.634710	0.04052	N	0.304905	T	0.04318	0.0119	N	0.12569	0.235	0.22342	N	0.999189	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.41963	-0.9479	10	0.17832	T	0.49	.	7.9767	0.30159	0.7387:0.1357:0.1256:0.0	.	677;677	Q96QE3-2;Q96QE3	.;ATAD5_HUMAN	K	677	ENSP00000313171:E677K	ENSP00000313171:E677K	E	+	1	0	ATAD5	26188411	0.035000	0.19736	0.413000	0.26509	0.970000	0.65996	-0.442000	0.06871	-1.102000	0.03023	-0.258000	0.10820	GAG		0.289	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256206.2	NM_024857		11	51	0	0	0	0	11	51				
LRRC37B	114659	broad.mit.edu	37	17	30349317	30349317	+	Silent	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:30349317G>A	ENST00000341671.7	+	1	1157	c.1152G>A	c.(1150-1152)ctG>ctA	p.L384L	LRRC37B_ENST00000394713.3_Silent_p.L384L|LRRC37B_ENST00000543378.2_Silent_p.L302L|LRRC37B_ENST00000581786.1_3'UTR|LRRC37B_ENST00000327564.7_Silent_p.L411L|LRRC37B_ENST00000584368.1_Silent_p.L396L	NM_052888.2	NP_443120.2	Q96QE4	LR37B_HUMAN	leucine rich repeat containing 37B	384						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	29		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.111)|Ovarian(249;0.182)|Breast(31;0.244)				CTACAGCCCTGAGGACTACAG	0.542																																						uc002hgu.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(1150-1152)CTG>CTA		leucine rich repeat containing 37B precursor							95.0	103.0	100.0					17																	30349317		2203	4300	6503	SO:0001819	synonymous_variant	114659					integral to membrane		g.chr17:30349317G>A	AJ314647	CCDS32609.1	17q11.2	2006-11-29		2005-08-09	ENSG00000185158	ENSG00000185158			29070	protein-coding gene	gene with protein product	"""KIAA0563-related"""					11468690, 10843809	Standard	NM_052888		Approved		uc002hgu.3	Q96QE4	OTTHUMG00000132785	ENST00000341671.7:c.1152G>A	17.37:g.30349317G>A			Somatic				LRRC37B_uc010wbx.1_Silent_p.L302L|LRRC37B_uc010csu.2_Silent_p.L384L	p.L384L	NM_052888	NP_443120	WXS	Illumina HiSeq	Unspecified	Q96QE4	LR37B_HUMAN			1	1163	+		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.111)|Ovarian(249;0.182)|Breast(31;0.244)	384			Extracellular (Potential).		Q17RC9|Q5YKG6	Silent	SNP	ENST00000341671.7	37	c.1152G>A	CCDS32609.1																																																																																				0.542	LRRC37B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446508.1	NM_052888		33	193	0	0	0	0	33	193				
LRRC37B	114659	broad.mit.edu	37	17	30376174	30376174	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:30376174G>A	ENST00000341671.7	+	10	2442	c.2437G>A	c.(2437-2439)Gag>Aag	p.E813K	LRRC37B_ENST00000394713.3_Missense_Mutation_p.E762K|LRRC37B_ENST00000543378.2_Missense_Mutation_p.E731K|LRRC37B_ENST00000327564.7_Missense_Mutation_p.E840K|LRRC37B_ENST00000584368.1_Missense_Mutation_p.E774K	NM_052888.2	NP_443120.2	Q96QE4	LR37B_HUMAN	leucine rich repeat containing 37B	813						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	29		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.111)|Ovarian(249;0.182)|Breast(31;0.244)				CATCCCCAACGAGGATGTGAG	0.498																																						uc002hgu.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(2437-2439)GAG>AAG		leucine rich repeat containing 37B precursor							76.0	69.0	71.0					17																	30376174		2202	4299	6501	SO:0001583	missense	114659					integral to membrane		g.chr17:30376174G>A	AJ314647	CCDS32609.1	17q11.2	2006-11-29		2005-08-09	ENSG00000185158	ENSG00000185158			29070	protein-coding gene	gene with protein product	"""KIAA0563-related"""					11468690, 10843809	Standard	NM_052888		Approved		uc002hgu.3	Q96QE4	OTTHUMG00000132785	ENST00000341671.7:c.2437G>A	17.37:g.30376174G>A	ENSP00000340519:p.Glu813Lys		Somatic				LRRC37B_uc010wbx.1_Missense_Mutation_p.E731K|LRRC37B_uc010csu.2_Missense_Mutation_p.E762K	p.E813K	NM_052888	NP_443120	WXS	Illumina HiSeq	Unspecified	Q96QE4	LR37B_HUMAN			10	2448	+		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.111)|Ovarian(249;0.182)|Breast(31;0.244)	813			Extracellular (Potential).		Q17RC9|Q5YKG6	Missense_Mutation	SNP	ENST00000341671.7	37	c.2437G>A	CCDS32609.1	.	.	.	.	.	.	.	.	.	.	N	4.615	0.114331	0.08831	.	.	ENSG00000185158	ENST00000543378;ENST00000327564;ENST00000394713;ENST00000341671	T;T;T;T	0.45668	0.89;0.89;0.89;0.89	1.78	0.321	0.15883	.	.	.	.	.	T	0.16727	0.0402	N	0.11427	0.14	0.09310	N	1	B;B	0.33694	0.421;0.421	B;B	0.11329	0.006;0.006	T	0.11036	-1.0604	9	0.44086	T	0.13	.	3.7007	0.08382	0.7782:0.0:0.2218:0.0	.	762;813	Q17RC9;Q96QE4	.;LR37B_HUMAN	K	731;840;762;813	ENSP00000443345:E731K;ENSP00000332536:E840K;ENSP00000378202:E762K;ENSP00000340519:E813K	ENSP00000332536:E840K	E	+	1	0	LRRC37B	27400287	0.001000	0.12720	0.094000	0.20943	0.001000	0.01503	-0.183000	0.09712	0.134000	0.18681	-0.708000	0.03648	GAG		0.498	LRRC37B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446508.1	NM_052888		22	105	0	0	0	0	22	105				
SRCIN1	80725	broad.mit.edu	37	17	36704795	36704795	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:36704795C>G	ENST00000264659.7	-	17	3492	c.3268G>C	c.(3268-3270)Gag>Cag	p.E1090Q	SRCIN1_ENST00000398579.4_5'UTR|SRCIN1_ENST00000578925.1_Missense_Mutation_p.E1124Q	NM_025248.2	NP_079524.2	Q9C0H9	SRCN1_HUMAN	SRC kinase signaling inhibitor 1	962					exocytosis (GO:0006887)|negative regulation of protein tyrosine kinase activity (GO:0061099)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell migration (GO:0030334)|regulation of dendritic spine morphogenesis (GO:0061001)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	protein kinase binding (GO:0019901)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)	19						TGACCTACCTCTAGCTCTGCG	0.662																																						uc002hqd.2		NA																	0					0						c.(3268-3270)GAG>CAG		SNAP25-interacting protein							85.0	87.0	86.0					17																	36704795		2077	4199	6276	SO:0001583	missense	80725				exocytosis|negative regulation of protein tyrosine kinase activity|positive regulation of protein tyrosine kinase activity|regulation of cell migration|regulation of dendritic spine morphogenesis|substrate adhesion-dependent cell spreading	actin cytoskeleton|axon|cell junction|cytoplasm|dendrite|postsynaptic density|postsynaptic membrane	protein kinase binding	g.chr17:36704795C>G		CCDS45660.1	17q12	2009-12-14			ENSG00000017373	ENSG00000277363			29506	protein-coding gene	gene with protein product	"""p130Cas-associated protein"", ""SNAP-25-interacting protein"""	610786				11214970	Standard	NM_025248		Approved	SNIP, p140Cap, KIAA1684	uc002hqd.3	Q9C0H9		ENST00000264659.7:c.3268G>C	17.37:g.36704795C>G	ENSP00000264659:p.Glu1090Gln		Somatic				SRCIN1_uc002hqf.1_Missense_Mutation_p.E962Q|SRCIN1_uc002hqe.2_Missense_Mutation_p.E944Q	p.E1090Q	NM_025248	NP_079524	WXS	Illumina HiSeq	Unspecified	Q9C0H9	SRCN1_HUMAN			17	3493	-			962					Q75T46|Q8N4W8	Missense_Mutation	SNP	ENST00000264659.7	37	c.3268G>C	CCDS45660.1	.	.	.	.	.	.	.	.	.	.	C	13.37	2.216440	0.39201	.	.	ENSG00000017373	ENST00000264659;ENST00000542707;ENST00000398579	T	0.30448	1.53	4.26	4.26	0.50523	.	0.063428	0.64402	D	0.000010	T	0.31979	0.0814	N	0.16567	0.415	0.54753	D	0.999987	D;D;D	0.76494	0.98;0.999;0.999	P;D;D	0.65443	0.773;0.935;0.935	T	0.03017	-1.1082	10	0.02654	T	1	-31.6281	15.6097	0.76707	0.0:1.0:0.0:0.0	.	962;962;1090	Q9C0H9-2;Q9C0H9;Q9C0H9-5	.;SRCN1_HUMAN;.	Q	1090;871;944	ENSP00000264659:E1090Q	ENSP00000264659:E1090Q	E	-	1	0	SRCIN1	33958321	1.000000	0.71417	1.000000	0.80357	0.453000	0.32348	7.127000	0.77210	2.208000	0.71279	0.462000	0.41574	GAG		0.662	SRCIN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000441878.4	NM_025248		11	58	0	0	0	0	11	58				
SRCIN1	80725	broad.mit.edu	37	17	36704826	36704826	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:36704826C>T	ENST00000264659.7	-	17	3461	c.3237G>A	c.(3235-3237)gaG>gaA	p.E1079E	SRCIN1_ENST00000398579.4_5'UTR|SRCIN1_ENST00000578925.1_Silent_p.E1113E	NM_025248.2	NP_079524.2	Q9C0H9	SRCN1_HUMAN	SRC kinase signaling inhibitor 1	951					exocytosis (GO:0006887)|negative regulation of protein tyrosine kinase activity (GO:0061099)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell migration (GO:0030334)|regulation of dendritic spine morphogenesis (GO:0061001)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	protein kinase binding (GO:0019901)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)	19						CCTCGTCATCCTCGTCCTTGA	0.667																																						uc002hqd.2		NA																	0					0						c.(3235-3237)GAG>GAA		SNAP25-interacting protein							84.0	88.0	87.0					17																	36704826		2103	4201	6304	SO:0001819	synonymous_variant	80725				exocytosis|negative regulation of protein tyrosine kinase activity|positive regulation of protein tyrosine kinase activity|regulation of cell migration|regulation of dendritic spine morphogenesis|substrate adhesion-dependent cell spreading	actin cytoskeleton|axon|cell junction|cytoplasm|dendrite|postsynaptic density|postsynaptic membrane	protein kinase binding	g.chr17:36704826C>T		CCDS45660.1	17q12	2009-12-14			ENSG00000017373	ENSG00000277363			29506	protein-coding gene	gene with protein product	"""p130Cas-associated protein"", ""SNAP-25-interacting protein"""	610786				11214970	Standard	NM_025248		Approved	SNIP, p140Cap, KIAA1684	uc002hqd.3	Q9C0H9		ENST00000264659.7:c.3237G>A	17.37:g.36704826C>T			Somatic				SRCIN1_uc002hqf.1_Silent_p.E951E|SRCIN1_uc002hqe.2_Silent_p.E933E	p.E1079E	NM_025248	NP_079524	WXS	Illumina HiSeq	Unspecified	Q9C0H9	SRCN1_HUMAN			17	3462	-			951					Q75T46|Q8N4W8	Silent	SNP	ENST00000264659.7	37	c.3237G>A	CCDS45660.1																																																																																				0.667	SRCIN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000441878.4	NM_025248		11	59	0	0	0	0	11	59				
MLLT6	4302	broad.mit.edu	37	17	36876644	36876644	+	Silent	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:36876644G>C	ENST00000325718.7	+	15	2266	c.2175G>C	c.(2173-2175)gcG>gcC	p.A725A	MIR4726_ENST00000577947.1_RNA|CTB-58E17.9_ENST00000579499.1_RNA	NM_005937.3	NP_005928	P55198	AF17_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6	725					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(3)|lung(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8	Breast(7;4.43e-21)					TGCTGAAGGCGCTGCACGCGC	0.682			T	MLL	AL																																	uc002hqi.3		NA		Dom	yes		17	17q21	4302	T	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 (AF17)"""			L	MLL		AL		0				breast(3)|prostate(1)|lung(1)|skin(1)	6						c.(2173-2175)GCG>GCC		myeloid/lymphoid or mixed-lineage leukemia							26.0	24.0	25.0					17																	36876644		2197	4289	6486	SO:0001819	synonymous_variant	4302				regulation of transcription, DNA-dependent	nucleus	protein binding|zinc ion binding	g.chr17:36876644G>C		CCDS11327.1	17q21	2014-04-10	2001-11-28		ENSG00000108292	ENSG00000275023		"""Zinc fingers, PHD-type"""	7138	protein-coding gene	gene with protein product	"""Myeloid/lymphoid or mixed-lineage leukemia, translocated to, 6"", ""trithorax homolog"""	600328	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 6"""			8058765	Standard	NM_005937		Approved	AF17, FLJ23480	uc002hqi.4	P55198	OTTHUMG00000188498	ENST00000325718.7:c.2175G>C	17.37:g.36876644G>C			Somatic				MLLT6_uc002hqj.2_Silent_p.A160A|MLLT6_uc002hqk.3_Silent_p.A56A	p.A725A	NM_005937	NP_005928	WXS	Illumina HiSeq	Unspecified	P55198	AF17_HUMAN			15	2188	+	Breast(7;4.43e-21)		725					Q59F28|Q96IU3|Q9H5F6|Q9UF49	Silent	SNP	ENST00000325718.7	37	c.2175G>C	CCDS11327.1																																																																																				0.682	MLLT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256799.1	NM_005937		4	24	0	0	0	0	4	24				
PNMT	5409	broad.mit.edu	37	17	37826388	37826388	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:37826388G>C	ENST00000269582.2	+	3	913	c.595G>C	c.(595-597)Gac>Cac	p.D199H	PNMT_ENST00000394246.1_Missense_Mutation_p.D101H	NM_002686.3	NP_002677.1	P11086	PNMT_HUMAN	phenylethanolamine N-methyltransferase	199					catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|epinephrine biosynthetic process (GO:0042418)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phenylethanolamine N-methyltransferase activity (GO:0004603)			NS(1)|breast(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	8	all_cancers(6;6.59e-85)|all_epithelial(6;2.89e-103)|Breast(7;1.05e-86)|Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|BRCA - Breast invasive adenocarcinoma(8;3.87e-45)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			GCGGGCCCTGGACCACATCAC	0.682																																						uc002hsi.1		NA																	0				ovary(1)	1						c.(595-597)GAC>CAC		phenylethanolamine N-methyltransferase							35.0	33.0	34.0					17																	37826388		2203	4300	6503	SO:0001583	missense	5409				catecholamine biosynthetic process|hormone biosynthetic process	cytosol	phenylethanolamine N-methyltransferase activity	g.chr17:37826388G>C		CCDS11343.1	17q	2010-04-16			ENSG00000141744	ENSG00000141744	2.1.1.28		9160	protein-coding gene	gene with protein product		171190		PENT		3372503	Standard	NM_002686		Approved		uc002hsi.2	P11086	OTTHUMG00000133209	ENST00000269582.2:c.595G>C	17.37:g.37826388G>C	ENSP00000269582:p.Asp199His		Somatic					p.D199H	NM_002686	NP_002677	WXS	Illumina HiSeq	Unspecified	P11086	PNMT_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|BRCA - Breast invasive adenocarcinoma(8;3.87e-45)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)		3	817	+	all_cancers(6;6.59e-85)|all_epithelial(6;2.89e-103)|Breast(7;1.05e-86)|Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		199						Missense_Mutation	SNP	ENST00000269582.2	37	c.595G>C	CCDS11343.1	.	.	.	.	.	.	.	.	.	.	G	8.792	0.930809	0.18131	.	.	ENSG00000141744	ENST00000394246;ENST00000269582	T;T	0.04317	3.65;3.65	4.94	3.87	0.44632	.	0.371511	0.26939	N	0.021733	T	0.04998	0.0134	L	0.29908	0.895	0.80722	D	1	B	0.12630	0.006	B	0.06405	0.002	T	0.36962	-0.9726	10	0.36615	T	0.2	-8.6604	14.3135	0.66432	0.0:0.3576:0.6424:0.0	.	199	P11086	PNMT_HUMAN	H	101;199	ENSP00000377791:D101H;ENSP00000269582:D199H	ENSP00000269582:D199H	D	+	1	0	PNMT	35079914	0.014000	0.17966	0.990000	0.47175	0.944000	0.59088	0.101000	0.15251	0.881000	0.35993	0.491000	0.48974	GAC		0.682	PNMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256923.2	NM_002686		6	40	0	0	0	0	6	40				
GRB7	2886	broad.mit.edu	37	17	37900456	37900456	+	Missense_Mutation	SNP	C	C	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:37900456C>A	ENST00000309156.4	+	7	1054	c.797C>A	c.(796-798)tCt>tAt	p.S266Y	GRB7_ENST00000394211.3_Missense_Mutation_p.S266Y|GRB7_ENST00000445327.2_Missense_Mutation_p.S289Y|GRB7_ENST00000309185.3_Missense_Mutation_p.S266Y|GRB7_ENST00000394204.1_Missense_Mutation_p.S266Y|GRB7_ENST00000394209.2_Missense_Mutation_p.S266Y	NM_005310.3	NP_005301.2	Q14451	GRB7_HUMAN	growth factor receptor-bound protein 7	266	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|leukocyte migration (GO:0050900)|negative regulation of translation (GO:0017148)|positive regulation of cell migration (GO:0030335)|positive regulation of signal transduction (GO:0009967)|stress granule assembly (GO:0034063)	cell projection (GO:0042995)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;6.86e-60)|all cancers(3;1.65e-53)|BRCA - Breast invasive adenocarcinoma(8;2.03e-43)|STAD - Stomach adenocarcinoma(3;1.43e-12)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			AAGGGCACCTCTAAGGTAAGG	0.572																																						uc002hsr.2		NA																	0				lung(2)|ovary(1)|breast(1)|skin(1)	5						c.(796-798)TCT>TAT		growth factor receptor-bound protein 7							132.0	136.0	134.0					17																	37900456		2203	4300	6503	SO:0001583	missense	2886				blood coagulation|epidermal growth factor receptor signaling pathway|leukocyte migration|negative regulation of translation|positive regulation of cell migration|stress granule assembly	cytosol|focal adhesion|stress granule	phosphatidylinositol binding|protein kinase binding|SH3/SH2 adaptor activity	g.chr17:37900456C>A	D43772	CCDS11345.1, CCDS56028.1	17q12	2013-02-14			ENSG00000141738	ENSG00000141738		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4567	protein-coding gene	gene with protein product		601522					Standard	NM_005310		Approved		uc021twu.1	Q14451	OTTHUMG00000133253	ENST00000309156.4:c.797C>A	17.37:g.37900456C>A	ENSP00000310771:p.Ser266Tyr		Somatic				GRB7_uc002hss.2_Missense_Mutation_p.S266Y|GRB7_uc010cwc.2_Missense_Mutation_p.S266Y|GRB7_uc002hst.2_Missense_Mutation_p.S266Y	p.S266Y	NM_005310	NP_005301	WXS	Illumina HiSeq	Unspecified	Q14451	GRB7_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;6.86e-60)|all cancers(3;1.65e-53)|BRCA - Breast invasive adenocarcinoma(8;2.03e-43)|STAD - Stomach adenocarcinoma(3;1.43e-12)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)		7	1047	+	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		266			PH.		B2RAV1|B3KNL0|B3KWP9|B7WP75|J3KQM4|Q53YD3|Q92568|Q96DF9|Q9Y220	Missense_Mutation	SNP	ENST00000309156.4	37	c.797C>A	CCDS11345.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.937513	0.92458	.	.	ENSG00000141738	ENST00000309185;ENST00000309156;ENST00000394211;ENST00000394209;ENST00000445327;ENST00000394204	T;T;T;T;T;T	0.19532	2.14;2.14;2.14;2.14;2.14;2.14	5.42	5.42	0.78866	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.54127	0.1839	M	0.87900	2.915	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.61850	-0.6978	10	0.87932	D	0	-33.5469	17.9724	0.89117	0.0:1.0:0.0:0.0	.	266;266	Q14451-2;Q14451	.;GRB7_HUMAN	Y	266;266;266;266;289;266	ENSP00000311752:S266Y;ENSP00000310771:S266Y;ENSP00000377761:S266Y;ENSP00000377759:S266Y;ENSP00000403459:S289Y;ENSP00000377754:S266Y	ENSP00000310771:S266Y	S	+	2	0	GRB7	35153982	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.738000	0.84966	2.545000	0.85829	0.561000	0.74099	TCT		0.572	GRB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257024.2	NM_005310		17	186	1	0	5.04e-11	5.37e-11	17	186				
RAPGEFL1	51195	broad.mit.edu	37	17	38348898	38348898	+	Missense_Mutation	SNP	C	C	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:38348898C>A	ENST00000456989.2	+	12	1290	c.1244C>A	c.(1243-1245)tCc>tAc	p.S415Y	RAPGEFL1_ENST00000436615.3_Missense_Mutation_p.S360Y|RAPGEFL1_ENST00000264644.6_Missense_Mutation_p.S360Y|RAPGEFL1_ENST00000544503.1_Missense_Mutation_p.S409Y			Q9UHV5	RPGFL_HUMAN	Rap guanine nucleotide exchange factor (GEF)-like 1	566					G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(1)	15						GAAGTGATCTCCAAAATGAAG	0.527																																					Esophageal Squamous(28;274 750 6870 14218 42203)	uc010cwu.1		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(1078-1080)TCC>TAC		Rap guanine nucleotide exchange factor							270.0	270.0	270.0					17																	38348898		2203	4300	6503	SO:0001583	missense	51195				G-protein coupled receptor protein signaling pathway|nervous system development|small GTPase mediated signal transduction	intracellular|membrane fraction	guanyl-nucleotide exchange factor activity	g.chr17:38348898C>A	AF117946	CCDS11363.1	17q21.2	2006-08-01	2004-03-26		ENSG00000108352	ENSG00000108352			17428	protein-coding gene	gene with protein product	"""Link guanine nucleotide exchange factor II"""		"""RAP guanine-nucleotide-exchange factor (GEF)-like 1"""				Standard	NM_016339		Approved	Link-GEFII	uc010cwu.1	Q9UHV5	OTTHUMG00000133325	ENST00000456989.2:c.1244C>A	17.37:g.38348898C>A	ENSP00000394530:p.Ser415Tyr		Somatic				RAPGEFL1_uc010wfd.1_Missense_Mutation_p.S296Y	p.S360Y	NM_016339	NP_057423	WXS	Illumina HiSeq	Unspecified	Q9UHV5	RPGFL_HUMAN			12	1569	+			566			Ras-GEF.			Missense_Mutation	SNP	ENST00000456989.2	37	c.1079C>A		.	.	.	.	.	.	.	.	.	.	C	22.4	4.288153	0.80803	.	.	ENSG00000108352	ENST00000456989;ENST00000544503;ENST00000537255;ENST00000264644;ENST00000436615	T;T;T	0.32753	1.44;1.44;1.44	5.17	5.17	0.71159	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.183276	0.35349	N	0.003266	T	0.52613	0.1745	M	0.70595	2.14	0.51482	D	0.999928	P;D	0.55385	0.947;0.971	P;P	0.59761	0.863;0.69	T	0.56571	-0.7957	10	0.72032	D	0.01	.	17.4368	0.87554	0.0:1.0:0.0:0.0	.	296;566	B4DGK9;Q9UHV5	.;RPGFL_HUMAN	Y	415;409;360;565;360	ENSP00000394530:S415Y;ENSP00000438631:S409Y;ENSP00000408322:S360Y	ENSP00000264644:S565Y	S	+	2	0	RAPGEFL1	35602424	0.971000	0.33674	1.000000	0.80357	0.980000	0.70556	2.870000	0.48451	2.419000	0.82065	0.491000	0.48974	TCC		0.527	RAPGEFL1-005	PUTATIVE	non_canonical_conserved|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000397518.1	NM_016339		38	233	1	0	4.67e-22	5.02e-22	38	233				
KRTAP4-11	653240	broad.mit.edu	37	17	39274291	39274291	+	Missense_Mutation	SNP	T	T	C	rs200214744|rs565505867	byFrequency	TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:39274291T>C	ENST00000391413.2	-	1	315	c.277A>G	c.(277-279)Atg>Gtg	p.M93V		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	93	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament (GO:0045095)		p.M93V(4)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			TGGCAGCACATAGACTGGCAG	0.662																																						uc002hvz.2		NA																	4	Substitution - Missense(4)		endometrium(3)|kidney(1)		0						c.(277-279)ATG>GTG		keratin associated protein 4-11							6.0	10.0	8.0					17																	39274291		651	1556	2207	SO:0001583	missense	653240					keratin filament		g.chr17:39274291T>C	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.277A>G	17.37:g.39274291T>C	ENSP00000375232:p.Met93Val		Somatic					p.M93V	NM_033059	NP_149048	WXS	Illumina HiSeq	Unspecified	Q9BYQ6	KR411_HUMAN	STAD - Stomach adenocarcinoma(17;0.000371)		1	316	-		Breast(137;0.000496)	93			14.|27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].		A0AUY2	Missense_Mutation	SNP	ENST00000391413.2	37	c.277A>G	CCDS45675.1	.	.	.	.	.	.	.	.	.	.	.	0.073	-1.199029	0.01581	.	.	ENSG00000212721	ENST00000391413	T	0.00580	6.43	4.25	-4.9	0.03094	.	.	.	.	.	T	0.00109	0.0003	N	0.00040	-2.49	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43097	-0.9412	9	0.02654	T	1	.	0.4739	0.00536	0.3479:0.2455:0.1203:0.2863	.	93	Q9BYQ6	KR411_HUMAN	V	93	ENSP00000375232:M93V	ENSP00000375232:M93V	M	-	1	0	KRTAP4-11	36527817	.	.	0.012000	0.15200	0.010000	0.07245	.	.	-1.319000	0.02286	-1.132000	0.01976	ATG		0.662	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1			6	37	0	0	0	0	6	37				
WNK4	65266	broad.mit.edu	37	17	40948652	40948652	+	Intron	SNP	C	C	T	rs372929812	byFrequency	TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:40948652C>T	ENST00000246914.5	+	19	3750				CNTD1_ENST00000588527.1_5'Flank|CNTD1_ENST00000588408.1_5'Flank	NM_032387.4	NP_115763.2	Q96J92	WNK4_HUMAN	WNK lysine deficient protein kinase 4						chloride transport (GO:0006821)|distal tubule morphogenesis (GO:0072156)|intracellular signal transduction (GO:0035556)|ion homeostasis (GO:0050801)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)|renal sodium ion absorption (GO:0070294)	cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|prostate(1)|skin(5)|stomach(1)	35		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		GCTGCAGCTTCGCCTTCCTCC	0.587													C|||	3	0.000599042	0.0023	0.0	5008	,	,		16660	0.0		0.0	False		,,,				2504	0.0				Esophageal Squamous(6;201 374 4964 23855 42828)	uc010wgz.1		NA																	0					0						c.(73-75)GAA>AAA		SubName: Full=cDNA FLJ50764;		C		0,3136		0,0,1568	76.0	82.0	80.0			-0.2	0.0	17		80	1,7163		0,1,3581	no	intron	WNK4	NM_032387.4		0,1,5149	TT,TC,CC		0.014,0.0,0.0097			40948652	1,10299	1568	3582	5150	SO:0001627	intron_variant	28958					integral to membrane		g.chr17:40948652C>T	AJ309861	CCDS11439.1	17q21-q22	2005-01-19	2005-01-19	2005-01-19		ENSG00000126562			14544	protein-coding gene	gene with protein product		601844	"""protein kinase, lysine deficient 4"""	PRKWNK4			Standard	NM_032387		Approved		uc002ibj.3	Q96J92		ENST00000246914.5:c.3730-52C>T	17.37:g.40948652C>T			Somatic				WNK4_uc002ibj.2_Intron|WNK4_uc010wgx.1_Intron|CNTD1_uc002ibm.3_5'Flank|CNTD1_uc010wha.1_5'Flank	p.E25K			WXS	Illumina HiSeq	Unspecified	Q9Y2R0	CCD56_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.0741)	2	350	-		Breast(137;0.00104)	Error:Variant_position_missing_in_Q9Y2R0_after_alignment					B0LPI0|Q8N8X3|Q8N8Z2|Q96DT8|Q9BYS5	Missense_Mutation	SNP	ENST00000246914.5	37	c.73G>A	CCDS11439.1																																																																																				0.587	WNK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452389.1			16	69	0	0	0	0	16	69				
TMEM101	84336	broad.mit.edu	37	17	42092252	42092252	+	Silent	SNP	G	G	A	rs540158668		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:42092252G>A	ENST00000589334.1	-	2	384	c.69C>T	c.(67-69)ctC>ctT	p.L23L	TMEM101_ENST00000542039.1_Intron|TMEM101_ENST00000587529.1_Silent_p.L23L|TMEM101_ENST00000206380.3_Silent_p.L23L			Q96IK0	TM101_HUMAN	transmembrane protein 101	23					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		Breast(137;0.0264)|Prostate(33;0.0861)		BRCA - Breast invasive adenocarcinoma(366;0.113)		GGCAGCGTGTGAGCAGCACCG	0.627													G|||	1	0.000199681	0.0	0.0	5008	,	,		18228	0.0		0.001	False		,,,				2504	0.0					uc002ieu.2		NA																	0				upper_aerodigestive_tract(1)|central_nervous_system(1)	2						c.(67-69)CTC>CTT		transmembrane protein 101							97.0	87.0	90.0					17																	42092252		2203	4300	6503	SO:0001819	synonymous_variant	84336				positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to membrane	signal transducer activity	g.chr17:42092252G>A	AK172826	CCDS11474.1	17q21.31	2005-12-16							28653	protein-coding gene	gene with protein product						12761501	Standard	NM_032376		Approved	MGC4251, FLJ23987	uc002ieu.3	Q96IK0		ENST00000589334.1:c.69C>T	17.37:g.42092252G>A			Somatic				TMEM101_uc010wis.1_Intron	p.L23L	NM_032376	NP_115752	WXS	Illumina HiSeq	Unspecified	Q96IK0	TM101_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.113)	1	94	-		Breast(137;0.0264)|Prostate(33;0.0861)	23			Helical; (Potential).		B2R9N6	Silent	SNP	ENST00000589334.1	37	c.69C>T	CCDS11474.1																																																																																				0.627	TMEM101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457665.1	NM_032376		22	63	0	0	0	0	22	63				
G6PC3	92579	broad.mit.edu	37	17	42153206	42153206	+	Missense_Mutation	SNP	G	G	A	rs373207529		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:42153206G>A	ENST00000269097.4	+	6	1067	c.836G>A	c.(835-837)gGa>gAa	p.G279E		NM_138387.3	NP_612396.1	Q9BUM1	G6PC3_HUMAN	glucose 6 phosphatase, catalytic, 3	279					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glucose-6-phosphate transport (GO:0015760)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucose-6-phosphatase activity (GO:0004346)			endometrium(2)|large_intestine(5)|lung(1)|ovary(2)|skin(1)	11		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.113)		GCACAGCTGGGAAATGGCCAG	0.652																																						uc002iex.2		NA																	0				skin(1)	1						c.(835-837)GGA>GAA		glucose-6-phosphatase catalytic subunit 3		G	GLU/GLY	0,4406		0,0,2203	54.0	53.0	54.0		836	2.1	0.3	17		54	1,8599	1.2+/-3.3	0,1,4299	no	missense	G6PC3	NM_138387.3	98	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	279/347	42153206	1,13005	2203	4300	6503	SO:0001583	missense	92579				gluconeogenesis|transmembrane transport	endoplasmic reticulum membrane|integral to membrane	glucose-6-phosphatase activity	g.chr17:42153206G>A	BC021574	CCDS11476.1	17q21.31	2014-09-17				ENSG00000141349			24861	protein-coding gene	gene with protein product		611045				12370122, 12965222	Standard	NM_138387		Approved	UGRP	uc002iex.3	Q9BUM1		ENST00000269097.4:c.836G>A	17.37:g.42153206G>A	ENSP00000269097:p.Gly279Glu		Somatic				G6PC3_uc002iey.2_Missense_Mutation_p.G154E|G6PC3_uc010czo.2_Missense_Mutation_p.G135E|G6PC3_uc002iez.2_Missense_Mutation_p.G154E|G6PC3_uc002ifb.2_Missense_Mutation_p.G154E|G6PC3_uc002ifc.2_Missense_Mutation_p.G88E	p.G279E	NM_138387	NP_612396	WXS	Illumina HiSeq	Unspecified	Q9BUM1	G6PC3_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.113)	6	1052	+		Breast(137;0.00637)|Prostate(33;0.0313)	279			Cytoplasmic (Potential).		Q8WU15	Missense_Mutation	SNP	ENST00000269097.4	37	c.836G>A	CCDS11476.1	.	.	.	.	.	.	.	.	.	.	G	11.80	1.747434	0.30955	0.0	1.16E-4	ENSG00000141349	ENST00000269097	T	0.78816	-1.21	5.18	2.08	0.27032	.	0.483859	0.21797	N	0.068964	T	0.62478	0.2431	L	0.40543	1.245	0.19575	N	0.999962	B	0.28713	0.22	B	0.21708	0.036	T	0.47156	-0.9139	10	0.27785	T	0.31	-13.5412	5.7787	0.18294	0.1739:0.1611:0.6651:0.0	.	279	Q9BUM1	G6PC3_HUMAN	E	279	ENSP00000269097:G279E	ENSP00000269097:G279E	G	+	2	0	G6PC3	39508732	0.077000	0.21312	0.260000	0.24451	0.954000	0.61252	0.230000	0.17852	0.334000	0.23590	0.655000	0.94253	GGA		0.652	G6PC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457675.1	NM_138387		12	52	0	0	0	0	12	52				
NMT1	4836	broad.mit.edu	37	17	43171126	43171126	+	Silent	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:43171126C>G	ENST00000592782.1	+	5	590	c.459C>G	c.(457-459)ccC>ccG	p.P153P	NMT1_ENST00000590114.1_3'UTR|NMT1_ENST00000258960.2_Silent_p.P153P			P30419	NMT1_HUMAN	N-myristoyltransferase 1	153					apoptotic process (GO:0006915)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|N-terminal protein myristoylation (GO:0006499)|phototransduction, visible light (GO:0007603)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein lipoylation (GO:0009249)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	catalytic activity (GO:0003824)|glycylpeptide N-tetradecanoyltransferase activity (GO:0004379)			breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)	8		Prostate(33;0.155)				ACACCCTGCCCCAGGGCTTCA	0.597																																						uc002ihz.2		NA																	0					0						c.(457-459)CCC>CCG		N-myristoyltransferase 1							71.0	63.0	66.0					17																	43171126		2203	4300	6503	SO:0001819	synonymous_variant	4836				activation of pro-apoptotic gene products|induction of apoptosis by intracellular signals|N-terminal protein myristoylation|protein lipoylation	actin cytoskeleton|cell junction|cytosol	glycylpeptide N-tetradecanoyltransferase activity	g.chr17:43171126C>G		CCDS11494.1	17q21.31	2012-10-02			ENSG00000136448	ENSG00000136448			7857	protein-coding gene	gene with protein product	"""alternative, short form NMT-S"", ""myristoyl-CoA:protein N-myristoyltransferase"", ""long form, NMT-L"""	160993				1570339	Standard	NM_021079		Approved	NMT	uc002ihz.3	P30419	OTTHUMG00000180003	ENST00000592782.1:c.459C>G	17.37:g.43171126C>G			Somatic				NMT1_uc002iia.2_RNA	p.P153P	NM_021079	NP_066565	WXS	Illumina HiSeq	Unspecified	P30419	NMT1_HUMAN			4	477	+		Prostate(33;0.155)	153					A8K7C1|Q9UE09	Silent	SNP	ENST00000592782.1	37	c.459C>G	CCDS11494.1																																																																																				0.597	NMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449239.1	NM_021079		9	54	0	0	0	0	9	54				
COPZ2	51226	broad.mit.edu	37	17	46111232	46111232	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:46111232C>T	ENST00000006101.4	-	4	258	c.259G>A	c.(259-261)Gag>Aag	p.E87K	COPZ2_ENST00000584666.1_5'UTR	NM_016429.2	NP_057513.1	Q9P299	COPZ2_HUMAN	coatomer protein complex, subunit zeta 2	89					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	cis-Golgi network (GO:0005801)|COPI vesicle coat (GO:0030126)				lung(3)|upper_aerodigestive_tract(1)	4						CACTTACTCTCAGTCCGGCTG	0.483																																						uc002imy.2		NA																	0					0						c.(265-267)GAG>AAG		coatomer protein complex, subunit zeta 2							78.0	82.0	81.0					17																	46111232		2052	4207	6259	SO:0001583	missense	51226				intracellular protein transport|vesicle-mediated transport	cis-Golgi network|COPI vesicle coat		g.chr17:46111232C>T	AB037938	CCDS74092.1	17q21.2	2008-07-18				ENSG00000005243			19356	protein-coding gene	gene with protein product	"""nonclathrin coat protein zeta-COP"", ""zeta2-COP"", ""zeta-2 coat protein"""	615526				11056392	Standard	NM_016429		Approved	MGC23008	uc002imy.3	Q9P299		ENST00000006101.4:c.259G>A	17.37:g.46111232C>T	ENSP00000006101:p.Glu87Lys		Somatic					p.E89K	NM_016429	NP_057513	WXS	Illumina HiSeq	Unspecified	Q9P299	COPZ2_HUMAN			7	278	-			89						Missense_Mutation	SNP	ENST00000006101.4	37	c.265G>A		.	.	.	.	.	.	.	.	.	.	C	15.66	2.899898	0.52227	.	.	ENSG00000005243	ENST00000006101	.	.	.	5.59	5.59	0.84812	Longin-like (1);AP complex, mu/sigma subunit (1);	0.127940	0.49916	D	0.000130	T	0.62502	0.2433	L	0.47016	1.485	0.47245	D	0.999367	B	0.30179	0.271	B	0.35770	0.21	T	0.63690	-0.6580	9	0.72032	D	0.01	.	18.3509	0.90338	0.0:1.0:0.0:0.0	.	89	Q9P299	COPZ2_HUMAN	K	87	.	ENSP00000006101:E87K	E	-	1	0	COPZ2	43466231	1.000000	0.71417	1.000000	0.80357	0.503000	0.33858	6.238000	0.72350	2.635000	0.89317	0.643000	0.83706	GAG		0.483	COPZ2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_016429		3	20	0	0	0	0	3	20				
HOXB8	3218	broad.mit.edu	37	17	46690757	46690757	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:46690757G>C	ENST00000239144.4	-	2	773	c.539C>G	c.(538-540)tCg>tGg	p.S180W	HOXB7_ENST00000239165.7_5'Flank|HOXB8_ENST00000576562.1_Missense_Mutation_p.S179W|HOXB7_ENST00000567101.2_Intron	NM_024016.3	NP_076921.1	P17481	HXB8_HUMAN	homeobox B8	180					adult locomotory behavior (GO:0008344)|anterior/posterior pattern specification (GO:0009952)|dorsal spinal cord development (GO:0021516)|embryonic skeletal system morphogenesis (GO:0048704)|grooming behavior (GO:0007625)|negative regulation of myeloid cell differentiation (GO:0045638)|sensory perception of pain (GO:0019233)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)|lung(8)|urinary_tract(2)	11						CAGGGCGTGCGATACCTCGAT	0.532																																						uc002inw.2		NA																	0					0						c.(538-540)TCG>TGG		homeobox B8							114.0	107.0	109.0					17																	46690757		2203	4300	6503	SO:0001583	missense	3218					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr17:46690757G>C		CCDS11533.1	17q21.32	2011-06-20	2005-12-22		ENSG00000120068	ENSG00000120068		"""Homeoboxes / ANTP class : HOXL subclass"""	5119	protein-coding gene	gene with protein product		142963	"""homeo box B8"""	HOX2, HOX2D		1973146, 1358459	Standard	XM_005257286		Approved		uc002inw.3	P17481	OTTHUMG00000159904	ENST00000239144.4:c.539C>G	17.37:g.46690757G>C	ENSP00000239144:p.Ser180Trp		Somatic				HOXB7_uc002inv.2_5'Flank	p.S180W	NM_024016	NP_076921	WXS	Illumina HiSeq	Unspecified	P17481	HXB8_HUMAN			2	774	-			180			Homeobox.		Q9H1I2	Missense_Mutation	SNP	ENST00000239144.4	37	c.539C>G	CCDS11533.1	.	.	.	.	.	.	.	.	.	.	G	18.37	3.608974	0.66558	.	.	ENSG00000120068	ENST00000239144	D	0.97041	-4.22	3.08	3.08	0.35506	Homeodomain-related (1);Helix-turn-helix motif, lambda-like repressor (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.38959	U	0.001505	D	0.98701	0.9564	M	0.94101	3.495	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.99482	1.0948	10	0.87932	D	0	.	14.6622	0.68879	0.0:0.0:1.0:0.0	.	180	P17481	HXB8_HUMAN	W	180	ENSP00000239144:S180W	ENSP00000239144:S180W	S	-	2	0	HOXB8	44045756	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	8.618000	0.90932	1.738000	0.51689	0.484000	0.47621	TCG		0.532	HOXB8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358092.3			11	93	0	0	0	0	11	93				
KAT7	11143	broad.mit.edu	37	17	47886529	47886529	+	Missense_Mutation	SNP	C	C	G	rs377599635		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:47886529C>G	ENST00000259021.4	+	6	992	c.712C>G	c.(712-714)Cac>Gac	p.H238D	KAT7_ENST00000510819.1_Intron|KAT7_ENST00000509773.1_Intron|KAT7_ENST00000424009.2_Intron|KAT7_ENST00000503935.2_Missense_Mutation_p.H82D|KAT7_ENST00000435742.2_Intron|KAT7_ENST00000454930.2_Missense_Mutation_p.H99D	NM_007067.4	NP_008998.1	O95251	KAT7_HUMAN	K(lysine) acetyltransferase 7	238					chromatin organization (GO:0006325)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										GATGCTGTCTCACAGGCAAGA	0.478																																						uc002ipm.2		NA																	0				ovary(1)|lung(1)|skin(1)	3						c.(712-714)CAC>GAC		MYST histone acetyltransferase 2							150.0	121.0	131.0					17																	47886529		2203	4300	6503	SO:0001583	missense	11143				DNA replication|histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation	histone acetyltransferase complex	histone acetyltransferase activity|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr17:47886529C>G	AF074606	CCDS11554.1, CCDS56035.1, CCDS56036.1, CCDS56037.1, CCDS56038.1	17q21.32	2013-01-10	2011-07-21	2011-07-21	ENSG00000136504	ENSG00000136504	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	17016	protein-coding gene	gene with protein product	"""histone acetyltransferase binding to ORC1"""	609880	"""MYST histone acetyltransferase 2"""	MYST2		10438470, 10930412	Standard	NM_001199155		Approved	HBOA, HBO1, ZC2HC7	uc002ipm.3	O95251	OTTHUMG00000161770	ENST00000259021.4:c.712C>G	17.37:g.47886529C>G	ENSP00000259021:p.His238Asp		Somatic				MYST2_uc002ipl.1_Intron|MYST2_uc010wma.1_Missense_Mutation_p.H99D|MYST2_uc010wmb.1_Intron|MYST2_uc010wmc.1_Intron|MYST2_uc010wmd.1_Missense_Mutation_p.H82D|MYST2_uc010wme.1_Intron	p.H238D	NM_007067	NP_008998	WXS	Illumina HiSeq	Unspecified	O95251	MYST2_HUMAN			6	838	+			238					B3KN74|B4DF85|B4DFB4|B4DFE0|B4DGY4|E7ER15|G5E9K7	Missense_Mutation	SNP	ENST00000259021.4	37	c.712C>G	CCDS11554.1	.	.	.	.	.	.	.	.	.	.	C	16.54	3.151190	0.57151	.	.	ENSG00000136504	ENST00000259021;ENST00000454930;ENST00000503935	.	.	.	5.8	5.8	0.92144	.	0.287646	0.40144	N	0.001173	T	0.53302	0.1788	L	0.36672	1.1	0.80722	D	1	B;B	0.21520	0.009;0.057	B;B	0.16722	0.005;0.016	T	0.49476	-0.8936	9	0.11485	T	0.65	-18.9793	19.6588	0.95855	0.0:1.0:0.0:0.0	.	99;238	E7ER15;O95251	.;KAT7_HUMAN	D	238;99;82	.	ENSP00000259021:H238D	H	+	1	0	KAT7	45241528	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.789000	0.75110	2.751000	0.94390	0.650000	0.86243	CAC		0.478	KAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366032.1	NM_007067		10	49	0	0	0	0	10	49				
USP32	84669	broad.mit.edu	37	17	58282903	58282903	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:58282903C>T	ENST00000300896.4	-	26	3348	c.3154G>A	c.(3154-3156)Gag>Aag	p.E1052K	USP32_ENST00000592339.1_Missense_Mutation_p.E722K	NM_032582.3	NP_115971.2	Q8NFA0	UBP32_HUMAN	ubiquitin specific peptidase 32	1052	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			NS(3)|breast(5)|endometrium(5)|kidney(4)|large_intestine(12)|liver(1)|lung(24)|pancreas(1)|prostate(3)|skin(3)|urinary_tract(1)	62	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)			AAGTTCTTCTCAGTTCCACAT	0.443																																						uc002iyo.1		NA																	0				lung(2)|breast(2)|large_intestine(1)	5						c.(3154-3156)GAG>AAG		ubiquitin specific protease 32							86.0	80.0	82.0					17																	58282903		2202	4281	6483	SO:0001583	missense	84669				protein deubiquitination|ubiquitin-dependent protein catabolic process	Golgi apparatus|membrane	calcium ion binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity	g.chr17:58282903C>T	AF533230	CCDS32697.1	17q23.3	2013-01-10	2005-08-08		ENSG00000170832	ENSG00000170832		"""Ubiquitin-specific peptidases"", ""EF-hand domain containing"""	19143	protein-coding gene	gene with protein product		607740	"""ubiquitin specific protease 32"""			12838346	Standard	NM_032582		Approved	NY-REN-60, USP10	uc002iyo.1	Q8NFA0		ENST00000300896.4:c.3154G>A	17.37:g.58282903C>T	ENSP00000300896:p.Glu1052Lys		Somatic				USP32_uc002iyn.1_Missense_Mutation_p.E722K	p.E1052K	NM_032582	NP_115971	WXS	Illumina HiSeq	Unspecified	Q8NFA0	UBP32_HUMAN	Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)		26	3440	-	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		1052					Q7Z5T3|Q9BX85|Q9Y591	Missense_Mutation	SNP	ENST00000300896.4	37	c.3154G>A	CCDS32697.1	.	.	.	.	.	.	.	.	.	.	C	34	5.375351	0.95923	.	.	ENSG00000170832	ENST00000300896	T	0.45668	0.89	4.72	4.72	0.59763	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.40040	0.1101	L	0.38175	1.15	0.80722	D	1	D	0.57257	0.979	P	0.49085	0.6	T	0.14144	-1.0483	10	0.07990	T	0.79	.	18.0377	0.89309	0.0:1.0:0.0:0.0	.	1052	Q8NFA0	UBP32_HUMAN	K	1052	ENSP00000300896:E1052K	ENSP00000300896:E1052K	E	-	1	0	USP32	55637685	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.300000	0.78841	2.321000	0.78463	0.655000	0.94253	GAG		0.443	USP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449235.2	NM_032582		11	78	0	0	0	0	11	78				
TLK2	11011	broad.mit.edu	37	17	60598187	60598187	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:60598187G>C	ENST00000326270.9	+	3	403	c.135G>C	c.(133-135)ttG>ttC	p.L45F	TLK2_ENST00000542523.1_Missense_Mutation_p.L45F|TLK2_ENST00000346027.5_Missense_Mutation_p.L45F|TLK2_ENST00000582809.1_5'UTR|TLK2_ENST00000343388.7_Missense_Mutation_p.L45F	NM_001284333.1	NP_001271262.1	Q86UE8	TLK2_HUMAN	tousled-like kinase 2	45					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|negative regulation of autophagy (GO:0010507)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of chromatin assembly or disassembly (GO:0001672)	intermediate filament (GO:0005882)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(4)|large_intestine(6)|liver(2)|lung(10)|prostate(1)|stomach(1)|urinary_tract(1)	39						TCGGATCCTTGAGTGATAAAG	0.408																																						uc010ddp.2		NA																	0				stomach(1)|kidney(1)	2						c.(133-135)TTG>TTC		tousled-like kinase 2 isoform A							123.0	108.0	113.0					17																	60598187		2203	4300	6503	SO:0001583	missense	11011				cell cycle|chromatin modification|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr17:60598187G>C	AB004884	CCDS11633.1, CCDS45753.1, CCDS62283.1	17q23	2008-07-18							11842	protein-coding gene	gene with protein product		608439				9427565, 10523312	Standard	NM_006852		Approved	PKU-ALPHA, MGC44450	uc002izz.4	Q86UE8		ENST00000326270.9:c.135G>C	17.37:g.60598187G>C	ENSP00000316512:p.Leu45Phe		Somatic				TLK2_uc002izx.3_5'UTR|TLK2_uc002izz.3_Missense_Mutation_p.L45F|TLK2_uc002jaa.3_Missense_Mutation_p.L45F|TLK2_uc010wpd.1_Missense_Mutation_p.L45F	p.L45F	NM_006852	NP_006843	WXS	Illumina HiSeq	Unspecified	Q86UE8	TLK2_HUMAN			3	403	+			45					D3DU07|Q9UKI7|Q9Y4F7	Missense_Mutation	SNP	ENST00000326270.9	37	c.135G>C		.	.	.	.	.	.	.	.	.	.	G	11.49	1.653866	0.29425	.	.	ENSG00000146872	ENST00000346027;ENST00000343388;ENST00000326270;ENST00000542523	D;D;D;D	0.86562	-2.14;-2.14;-2.14;-2.14	5.49	5.49	0.81192	.	0.127557	0.53938	D	0.000056	D	0.90679	0.7076	L	0.50333	1.59	0.58432	D	0.999999	D;D;D	0.76494	0.996;0.977;0.999	D;P;D	0.73708	0.934;0.886;0.981	D	0.88269	0.2928	10	0.25751	T	0.34	.	15.5588	0.76223	0.0:0.1379:0.8621:0.0	.	45;45;45	Q86UE8;Q86UE8-3;Q86UE8-2	TLK2_HUMAN;.;.	F	45	ENSP00000275780:L45F;ENSP00000340800:L45F;ENSP00000316512:L45F;ENSP00000442311:L45F	ENSP00000316512:L45F	L	+	3	2	TLK2	57951919	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	2.984000	0.49353	2.576000	0.86940	0.591000	0.81541	TTG		0.408	TLK2-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000445140.1	NM_006852		12	79	0	0	0	0	12	79				
LIMD2	80774	broad.mit.edu	37	17	61776232	61776232	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:61776232C>T	ENST00000259006.3	-	4	309	c.151G>A	c.(151-153)Gag>Aag	p.E51K	LIMD2_ENST00000578402.1_Missense_Mutation_p.E51K|LIMD2_ENST00000578993.1_Intron|LIMD2_ENST00000582055.1_Missense_Mutation_p.E2K|LIMD2_ENST00000578061.1_Missense_Mutation_p.E51K|LIMD2_ENST00000583211.1_Missense_Mutation_p.E2K	NM_030576.3	NP_085053.1	Q9BT23	LIMD2_HUMAN	LIM domain containing 2	51	LIM zinc-binding. {ECO:0000255|PROSITE- ProRule:PRU00125}.						zinc ion binding (GO:0008270)			kidney(1)|lung(2)	3						ACCAGCCGCTCCATGGGGTAC	0.657																																						uc002jbj.3		NA																	0					0						c.(151-153)GAG>AAG		LIM domain containing 2							69.0	70.0	70.0					17																	61776232		2203	4300	6503	SO:0001583	missense	80774						zinc ion binding	g.chr17:61776232C>T	AK092301	CCDS11641.1	17q23.3	2006-02-03				ENSG00000136490			28142	protein-coding gene	gene with protein product						12477932	Standard	NM_030576		Approved	MGC10986	uc002jbj.4	Q9BT23		ENST00000259006.3:c.151G>A	17.37:g.61776232C>T	ENSP00000259006:p.Glu51Lys		Somatic				LIMD2_uc002jbk.3_Missense_Mutation_p.G52E|LIMD2_uc002jbl.3_Missense_Mutation_p.E51K	p.E51K	NM_030576	NP_085053	WXS	Illumina HiSeq	Unspecified	Q9BT23	LIMD2_HUMAN			4	329	-			51			LIM zinc-binding.		D3DU16|Q96S91	Missense_Mutation	SNP	ENST00000259006.3	37	c.151G>A	CCDS11641.1	.	.	.	.	.	.	.	.	.	.	C	36	5.908385	0.97093	.	.	ENSG00000136490	ENST00000259006	D	0.88046	-2.33	5.35	5.35	0.76521	Zinc finger, LIM-type (5);	0.000000	0.85682	D	0.000000	D	0.95802	0.8634	H	0.95574	3.69	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96937	0.9685	10	0.87932	D	0	-3.6944	19.0841	0.93196	0.0:1.0:0.0:0.0	.	51	Q9BT23	LIMD2_HUMAN	K	51	ENSP00000259006:E51K	ENSP00000259006:E51K	E	-	1	0	LIMD2	59129964	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.388000	0.79795	2.505000	0.84491	0.448000	0.29417	GAG		0.657	LIMD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443877.1	NM_030576		12	74	0	0	0	0	12	74				
PRKCA	5578	broad.mit.edu	37	17	64683318	64683318	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:64683318G>A	ENST00000413366.3	+	6	645	c.619G>A	c.(619-621)Gaa>Aaa	p.E207K		NM_002737.2	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha	207	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|chondrocyte differentiation (GO:0002062)|desmosome assembly (GO:0002159)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|histone H3-T6 phosphorylation (GO:0035408)|inactivation of MAPK activity (GO:0000188)|induction of positive chemotaxis (GO:0050930)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA metabolic process (GO:0016071)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|peptidyl-serine autophosphorylation (GO:0036289)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of dense core granule biogenesis (GO:2000707)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein phosphorylation (GO:0001934)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of muscle contraction (GO:0006937)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of the force of heart contraction (GO:0002026)|response to interleukin-1 (GO:0070555)|rhodopsin mediated signaling pathway (GO:0016056)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|enzyme binding (GO:0019899)|histone kinase activity (H3-T6 specific) (GO:0035403)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Ingenol Mebutate(DB05013)|Phosphatidylserine(DB00144)|Tamoxifen(DB00675)|Vitamin E(DB00163)	TCCCAAGAATGAAAGCAAGCA	0.408																																						uc002jfp.1		NA																	0				central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9						c.(619-621)GAA>AAA		protein kinase C, alpha	Phosphatidylserine(DB00144)|Vitamin E(DB00163)						160.0	163.0	162.0					17																	64683318		2203	4300	6503	SO:0001583	missense	5578				activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding	g.chr17:64683318G>A		CCDS11664.1	17q22-q24	2009-07-10				ENSG00000154229	2.7.11.1		9393	protein-coding gene	gene with protein product		176960		PKCA			Standard	NM_002737		Approved		uc002jfp.1	P17252		ENST00000413366.3:c.619G>A	17.37:g.64683318G>A	ENSP00000408695:p.Glu207Lys		Somatic				PRKCA_uc002jfo.1_Missense_Mutation_p.E78K	p.E207K	NM_002737	NP_002728	WXS	Illumina HiSeq	Unspecified	P17252	KPCA_HUMAN	BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		6	663	+			207			C2.		B5BU22|Q15137|Q32M72|Q96RE4	Missense_Mutation	SNP	ENST00000413366.3	37	c.619G>A	CCDS11664.1	.	.	.	.	.	.	.	.	.	.	G	11.41	1.632033	0.29068	.	.	ENSG00000154229	ENST00000413366;ENST00000284384	T;D	0.85258	1.05;-1.96	4.98	4.98	0.66077	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	U	0.000000	T	0.66982	0.2845	N	0.02539	-0.55	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.12837	0.006;0.008	T	0.65348	-0.6190	10	0.07482	T	0.82	.	18.2731	0.90074	0.0:0.0:1.0:0.0	.	207;118	P17252;Q59FI5	KPCA_HUMAN;.	K	207;114	ENSP00000408695:E207K;ENSP00000284384:E114K	ENSP00000284384:E114K	E	+	1	0	PRKCA	62113780	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	7.690000	0.84178	2.302000	0.77476	0.313000	0.20887	GAA		0.408	PRKCA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446976.1			27	127	0	0	0	0	27	127				
HELZ	9931	broad.mit.edu	37	17	65147302	65147302	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:65147302G>A	ENST00000358691.5	-	18	2382	c.2216C>T	c.(2215-2217)cCa>cTa	p.P739L	HELZ_ENST00000580168.1_Missense_Mutation_p.P740L	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	739						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					ATGCACAACTGGGTGGACAGT	0.373																																						uc010wqk.1		NA																	0				ovary(1)|pancreas(1)	2						c.(2218-2220)CCA>CTA		helicase with zinc finger domain							127.0	125.0	125.0					17																	65147302		1900	4094	5994	SO:0001583	missense	9931							g.chr17:65147302G>A	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.2216C>T	17.37:g.65147302G>A	ENSP00000351524:p.Pro739Leu		Somatic				HELZ_uc002jfv.3_RNA|HELZ_uc002jfx.3_Missense_Mutation_p.P739L	p.P740L	NM_014877	NP_055692	WXS	Illumina HiSeq	Unspecified					18	2406	-	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)							I6L9H4	Missense_Mutation	SNP	ENST00000358691.5	37	c.2219C>T	CCDS42374.1	.	.	.	.	.	.	.	.	.	.	G	16.43	3.122000	0.56613	.	.	ENSG00000198265	ENST00000358691	D	0.81821	-1.54	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	D	0.90480	0.7018	M	0.83603	2.65	0.80722	D	1	D;D	0.71674	0.998;0.971	D;P	0.67900	0.954;0.898	D	0.91374	0.5122	10	0.87932	D	0	-10.3565	19.6177	0.95640	0.0:0.0:1.0:0.0	.	740;739	B7ZLW2;P42694	.;HELZ_HUMAN	L	739	ENSP00000351524:P739L	ENSP00000351524:P739L	P	-	2	0	HELZ	62577764	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.632000	0.89209	0.650000	0.86243	CCA		0.373	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	NM_014877		21	87	0	0	0	0	21	87				
KPNA2	3838	broad.mit.edu	37	17	66039309	66039309	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:66039309C>T	ENST00000537025.2	+	7	1380	c.760C>T	c.(760-762)Cct>Tct	p.P254S	KPNA2_ENST00000330459.3_Missense_Mutation_p.P254S			P52292	IMA1_HUMAN	karyopherin alpha 2 (RAG cohort 1, importin alpha 1)	254					cytokine-mediated signaling pathway (GO:0019221)|DNA metabolic process (GO:0006259)|NLS-bearing protein import into nucleus (GO:0006607)|regulation of DNA recombination (GO:0000018)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone deacetylase binding (GO:0042826)|nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)			breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|kidney(2)|lung(9)|prostate(1)|urinary_tract(2)	22	all_cancers(12;1.18e-09)		BRCA - Breast invasive adenocarcinoma(8;1.03e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			GCAGATTCTTCCTACCTTAGT	0.468																																						uc002jgk.2		NA																	0				central_nervous_system(2)	2						c.(760-762)CCT>TCT		karyopherin alpha 2							183.0	190.0	188.0					17																	66039309		2203	4300	6503	SO:0001583	missense	3838				DNA metabolic process|G2 phase of mitotic cell cycle|interspecies interaction between organisms|M phase specific microtubule process|NLS-bearing substrate import into nucleus|regulation of DNA recombination	cytoplasm|nuclear pore|nucleoplasm	histone deacetylase binding|nuclear localization sequence binding|protein transporter activity	g.chr17:66039309C>T	U09559	CCDS32713.1	17q24.2	2013-02-14						"""Importins"", ""Armadillo repeat containing"""	6395	protein-coding gene	gene with protein product		600685		RCH1		8016130, 7754385	Standard	NM_002266		Approved	SRP1alpha, IPOA1, QIP2	uc002jgk.3	P52292		ENST00000537025.2:c.760C>T	17.37:g.66039309C>T	ENSP00000438483:p.Pro254Ser		Somatic				KPNA2_uc002jgl.2_Missense_Mutation_p.P254S	p.P254S	NM_002266	NP_002257	WXS	Illumina HiSeq	Unspecified	P52292	IMA2_HUMAN	BRCA - Breast invasive adenocarcinoma(8;1.03e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)		7	892	+	all_cancers(12;1.18e-09)		254			ARM 5.		B9EJD6|Q53YE3|Q9BRU5	Missense_Mutation	SNP	ENST00000537025.2	37	c.760C>T	CCDS32713.1	.	.	.	.	.	.	.	.	.	.	C	19.37	3.814817	0.70912	.	.	ENSG00000182481	ENST00000330459;ENST00000537025	T;T	0.77229	-1.08;-1.08	5.56	5.56	0.83823	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	U	0.000000	D	0.87075	0.6087	M	0.70842	2.15	0.80722	D	1	D	0.58970	0.984	D	0.63113	0.911	D	0.87239	0.2265	10	0.56958	D	0.05	.	19.5266	0.95209	0.0:1.0:0.0:0.0	.	254	P52292	IMA2_HUMAN	S	254	ENSP00000332455:P254S;ENSP00000438483:P254S	ENSP00000332455:P254S	P	+	1	0	KPNA2	63469771	1.000000	0.71417	1.000000	0.80357	0.106000	0.19336	7.640000	0.83355	2.604000	0.88044	0.557000	0.71058	CCT		0.468	KPNA2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448111.1	NM_002266		49	291	0	0	0	0	49	291				
KPNA2	3838	broad.mit.edu	37	17	66042035	66042035	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:66042035G>A	ENST00000537025.2	+	10	2115	c.1495G>A	c.(1495-1497)Gag>Aag	p.E499K	KPNA2_ENST00000582898.1_3'UTR|KPNA2_ENST00000330459.3_Missense_Mutation_p.E499K			P52292	IMA1_HUMAN	karyopherin alpha 2 (RAG cohort 1, importin alpha 1)	499	Poly-Glu.				cytokine-mediated signaling pathway (GO:0019221)|DNA metabolic process (GO:0006259)|NLS-bearing protein import into nucleus (GO:0006607)|regulation of DNA recombination (GO:0000018)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone deacetylase binding (GO:0042826)|nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)			breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|kidney(2)|lung(9)|prostate(1)|urinary_tract(2)	22	all_cancers(12;1.18e-09)		BRCA - Breast invasive adenocarcinoma(8;1.03e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			TTTCTCTGTAGAGGTGAGTAA	0.328																																						uc002jgk.2		NA																	0				central_nervous_system(2)	2						c.(1495-1497)GAG>AAG		karyopherin alpha 2							90.0	96.0	94.0					17																	66042035		2203	4294	6497	SO:0001583	missense	3838				DNA metabolic process|G2 phase of mitotic cell cycle|interspecies interaction between organisms|M phase specific microtubule process|NLS-bearing substrate import into nucleus|regulation of DNA recombination	cytoplasm|nuclear pore|nucleoplasm	histone deacetylase binding|nuclear localization sequence binding|protein transporter activity	g.chr17:66042035G>A	U09559	CCDS32713.1	17q24.2	2013-02-14						"""Importins"", ""Armadillo repeat containing"""	6395	protein-coding gene	gene with protein product		600685		RCH1		8016130, 7754385	Standard	NM_002266		Approved	SRP1alpha, IPOA1, QIP2	uc002jgk.3	P52292		ENST00000537025.2:c.1495G>A	17.37:g.66042035G>A	ENSP00000438483:p.Glu499Lys		Somatic				KPNA2_uc002jgl.2_Missense_Mutation_p.E499K	p.E499K	NM_002266	NP_002257	WXS	Illumina HiSeq	Unspecified	P52292	IMA2_HUMAN	BRCA - Breast invasive adenocarcinoma(8;1.03e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)		10	1627	+	all_cancers(12;1.18e-09)		499			Poly-Glu.		B9EJD6|Q53YE3|Q9BRU5	Missense_Mutation	SNP	ENST00000537025.2	37	c.1495G>A	CCDS32713.1	.	.	.	.	.	.	.	.	.	.	G	33	5.207792	0.95033	.	.	ENSG00000182481	ENST00000330459;ENST00000537025	T;T	0.61980	0.06;0.06	5.17	5.17	0.71159	Armadillo-like helical (1);Armadillo-type fold (1);	0.186042	0.44902	U	0.000405	T	0.73202	0.3557	M	0.89163	3.01	0.80722	D	1	B	0.22851	0.076	B	0.31390	0.129	T	0.75470	-0.3306	10	0.87932	D	0	.	18.7334	0.91744	0.0:0.0:1.0:0.0	.	499	P52292	IMA2_HUMAN	K	499	ENSP00000332455:E499K;ENSP00000438483:E499K	ENSP00000332455:E499K	E	+	1	0	KPNA2	63472497	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.287000	0.95975	2.414000	0.81942	0.461000	0.40582	GAG		0.328	KPNA2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448111.1	NM_002266		23	102	0	0	0	0	23	102				
GGA3	23163	broad.mit.edu	37	17	73237033	73237033	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:73237033G>A	ENST00000245541.6	-	11	1268	c.1052C>T	c.(1051-1053)tCa>tTa	p.S351L	GGA3_ENST00000538886.1_Missense_Mutation_p.S229L|GGA3_ENST00000579743.1_5'Flank|GGA3_ENST00000351904.7_Missense_Mutation_p.S318L|GGA3_ENST00000582486.1_Missense_Mutation_p.S279L|GGA3_ENST00000582717.1_Missense_Mutation_p.S279L|GGA3_ENST00000537686.1_3'UTR|GGA3_ENST00000578348.1_Missense_Mutation_p.S229L	NM_138619.2	NP_619525.1	Q9NZ52	GGA3_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 3	351	Unstructured hinge.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|endosome (GO:0005768)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)			breast(2)|endometrium(3)|large_intestine(4)|liver(1)|lung(4)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	20			all cancers(21;2.39e-06)|Epithelial(20;2.38e-05)			TGGGATGCCTGAGGAGGGTGG	0.647											OREG0024730	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										uc002jni.1		NA																	0				ovary(1)|breast(1)	2						c.(1051-1053)TCA>TTA		ADP-ribosylation factor binding protein 3							117.0	109.0	111.0					17																	73237033		2203	4300	6503	SO:0001583	missense	23163				intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|endosome membrane|trans-Golgi network	ADP-ribosylation factor binding	g.chr17:73237033G>A	AF190864	CCDS11716.1, CCDS11717.1, CCDS54164.1, CCDS58597.1	17q25	2010-02-12	2010-02-12			ENSG00000125447			17079	protein-coding gene	gene with protein product		606006				10747089, 10749927	Standard	NR_033345		Approved	KIAA0154	uc002jni.2	Q9NZ52		ENST00000245541.6:c.1052C>T	17.37:g.73237033G>A	ENSP00000245541:p.Ser351Leu		Somatic	OREG0024730	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1143	GGA3_uc002jnj.1_Missense_Mutation_p.S318L|GGA3_uc010wrw.1_Missense_Mutation_p.S229L|GGA3_uc002jnk.1_Missense_Mutation_p.S279L|GGA3_uc010wrx.1_Missense_Mutation_p.S229L|GGA3_uc010wry.1_Missense_Mutation_p.S279L	p.S351L	NM_138619	NP_619525	WXS	Illumina HiSeq	Unspecified	Q9NZ52	GGA3_HUMAN	all cancers(21;2.39e-06)|Epithelial(20;2.38e-05)		11	1061	-			351			Unstructured hinge.		B7Z7E2|B7Z7M9|J3KRN0|Q15017|Q6IS16|Q9UJY3	Missense_Mutation	SNP	ENST00000245541.6	37	c.1052C>T	CCDS11717.1	.	.	.	.	.	.	.	.	.	.	G	10.19	1.282363	0.23392	.	.	ENSG00000125447	ENST00000245541;ENST00000351904;ENST00000537584;ENST00000538886	T;T	0.49432	2.11;0.78	5.7	3.7	0.42460	.	0.541335	0.18458	N	0.140626	T	0.41834	0.1176	L	0.54323	1.7	0.80722	D	1	B;B;B	0.09022	0.002;0.0;0.0	B;B;B	0.08055	0.003;0.001;0.002	T	0.18116	-1.0347	10	0.22109	T	0.4	-19.2969	12.4045	0.55432	0.1364:0.0:0.8636:0.0	.	229;318;351	B7Z7E2;Q9NZ52-2;Q9NZ52	.;.;GGA3_HUMAN	L	351;318;279;229	ENSP00000245541:S351L;ENSP00000326575:S318L	ENSP00000245541:S351L	S	-	2	0	GGA3	70748628	0.007000	0.16637	0.009000	0.14445	0.017000	0.09413	1.429000	0.34903	0.749000	0.32854	0.655000	0.94253	TCA		0.647	GGA3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446645.1	NM_138619		7	56	0	0	0	0	7	56				
TRIM65	201292	broad.mit.edu	37	17	73887415	73887415	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:73887415C>T	ENST00000269383.3	-	6	1064	c.999G>A	c.(997-999)ctG>ctA	p.L333L		NM_001256124.1|NM_173547.3	NP_001243053.1|NP_775818.2	Q6PJ69	TRI65_HUMAN	tripartite motif containing 65	333	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|lung(5)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	12			Epithelial(20;7.53e-06)|all cancers(21;9.11e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00092)|LUSC - Lung squamous cell carcinoma(166;0.154)			GATCAAAGGTCAGATTGCGAT	0.597																																						uc002jpx.2		NA																	0					0						c.(997-999)CTG>CTA		tripartite motif-containing 65							25.0	26.0	26.0					17																	73887415		2199	4281	6480	SO:0001819	synonymous_variant	201292					intracellular	zinc ion binding	g.chr17:73887415C>T	BC006138	CCDS11732.1	17q25.1	2013-01-09	2011-01-25		ENSG00000141569	ENSG00000141569		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	27316	protein-coding gene	gene with protein product			"""tripartite motif-containing 65"""			12477932	Standard	NM_173547		Approved		uc002jpx.4	Q6PJ69	OTTHUMG00000132127	ENST00000269383.3:c.999G>A	17.37:g.73887415C>T			Somatic					p.L333L	NM_173547	NP_775818	WXS	Illumina HiSeq	Unspecified	Q6PJ69	TRI65_HUMAN	Epithelial(20;7.53e-06)|all cancers(21;9.11e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00092)|LUSC - Lung squamous cell carcinoma(166;0.154)		6	1035	-			333			B30.2/SPRY.		Q4G0F0|Q6DKJ6|Q9BRP6	Silent	SNP	ENST00000269383.3	37	c.999G>A	CCDS11732.1																																																																																				0.597	TRIM65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255170.2	NM_173547		8	19	0	0	0	0	8	19				
TNRC6C	57690	broad.mit.edu	37	17	76045388	76045388	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:76045388G>A	ENST00000588061.1	+	5	972	c.245G>A	c.(244-246)aGa>aAa	p.R82K	TNRC6C_ENST00000544502.1_Missense_Mutation_p.R82K|TNRC6C_ENST00000588847.1_Missense_Mutation_p.R82K|TNRC6C_ENST00000335749.4_Missense_Mutation_p.R82K|TNRC6C_ENST00000541771.1_Missense_Mutation_p.R82K|TNRC6C_ENST00000301624.4_Missense_Mutation_p.R82K			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	82	Sufficient for interaction with argonaute family proteins.				embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			GGAGATGGGAGAAGTCAGAAT	0.522																																						uc002jud.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(244-246)AGA>AAA		trinucleotide repeat containing 6C isoform 2							70.0	75.0	74.0					17																	76045388		2010	4169	6179	SO:0001583	missense	57690				gene silencing by RNA|regulation of translation		nucleotide binding|RNA binding	g.chr17:76045388G>A	AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.245G>A	17.37:g.76045388G>A	ENSP00000468647:p.Arg82Lys		Somatic				TNRC6C_uc002juf.2_Missense_Mutation_p.R82K|TNRC6C_uc002jue.2_Missense_Mutation_p.R82K	p.R82K	NM_018996	NP_061869	WXS	Illumina HiSeq	Unspecified	Q9HCJ0	TNR6C_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)		4	845	+			82			Sufficient for interaction with argonaute family proteins.		G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Missense_Mutation	SNP	ENST00000588061.1	37	c.245G>A	CCDS45798.1	.	.	.	.	.	.	.	.	.	.	G	15.57	2.872889	0.51695	.	.	ENSG00000078687	ENST00000455761;ENST00000395801;ENST00000335749;ENST00000301624;ENST00000541771;ENST00000544502	T;T;T;T	0.13901	2.57;2.55;2.55;2.57	5.15	4.18	0.49190	.	0.090839	0.85682	D	0.000000	T	0.13157	0.0319	L	0.29908	0.895	0.36171	D	0.848745	B;B;B	0.29627	0.252;0.252;0.163	B;B;B	0.34722	0.188;0.188;0.092	T	0.17349	-1.0372	10	0.45353	T	0.12	-1.1226	13.9641	0.64199	0.0729:0.0:0.9271:0.0	.	82;82;82	G3XAB8;Q9HCJ0-2;Q9HCJ0	.;.;TNR6C_HUMAN	K	82	ENSP00000336783:R82K;ENSP00000301624:R82K;ENSP00000440310:R82K;ENSP00000442421:R82K	ENSP00000301624:R82K	R	+	2	0	TNRC6C	73556983	1.000000	0.71417	0.880000	0.34516	0.998000	0.95712	7.075000	0.76798	1.397000	0.46682	0.655000	0.94253	AGA		0.522	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395947.1	NM_018996		15	79	0	0	0	0	15	79				
LGALS3BP	3959	broad.mit.edu	37	17	76967746	76967746	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:76967746G>A	ENST00000262776.3	-	6	1978	c.1670C>T	c.(1669-1671)tCc>tTc	p.S557F	LGALS3BP_ENST00000591778.1_3'UTR	NM_005567.3	NP_005558.1	Q08380	LG3BP_HUMAN	lectin, galactoside-binding, soluble, 3 binding protein	557					cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	scavenger receptor activity (GO:0005044)	p.S557F(2)		NS(1)|breast(1)|central_nervous_system(5)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17			BRCA - Breast invasive adenocarcinoma(99;0.0677)|OV - Ovarian serous cystadenocarcinoma(97;0.139)			GGGGAAGGAGGAGGTGCTCTT	0.632											OREG0024787	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									GBM(89;1105 1755 18102 21513)	uc002jwh.2		NA																	2	Substitution - Missense(2)		lung(1)|endometrium(1)	central_nervous_system(3)|ovary(1)	4						c.(1669-1671)TCC>TTC		galectin 3 binding protein							59.0	55.0	56.0					17																	76967746		2203	4300	6503	SO:0001583	missense	3959				cell adhesion|cellular defense response	extracellular space|membrane|proteinaceous extracellular matrix	protein binding|scavenger receptor activity	g.chr17:76967746G>A	L13210	CCDS11759.1	17q25	2014-07-09				ENSG00000108679		"""BTB/POZ domain containing"", ""Endogenous ligands"""	6564	protein-coding gene	gene with protein product	"""L3 antigen"", ""Mac-2-binding protein"", ""serum protein 90K"", ""transport and golgi organization 10 homolog B (Drosophila)"""	600626				7698018, 8034587, 8390986	Standard	NM_005567		Approved	MAC-2-BP, 90K, BTBD17B, TANGO10B, M2BP, gp90, CyCAP	uc002jwh.3	Q08380		ENST00000262776.3:c.1670C>T	17.37:g.76967746G>A	ENSP00000262776:p.Ser557Phe		Somatic	OREG0024787	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1172	LGALS3BP_uc002jwi.2_Missense_Mutation_p.S363F|LGALS3BP_uc010dhr.2_Missense_Mutation_p.S363F	p.S557F	NM_005567	NP_005558	WXS	Illumina HiSeq	Unspecified	Q08380	LG3BP_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0677)|OV - Ovarian serous cystadenocarcinoma(97;0.139)		6	1849	-			557					Q7M4S0|Q9UCH8|Q9UCH9|Q9UCI0	Missense_Mutation	SNP	ENST00000262776.3	37	c.1670C>T	CCDS11759.1	.	.	.	.	.	.	.	.	.	.	G	14.51	2.557172	0.45590	.	.	ENSG00000108679	ENST00000262776;ENST00000536190	T	0.01484	4.84	3.42	2.44	0.29823	.	0.228757	0.22682	N	0.056934	T	0.06462	0.0166	M	0.64997	1.995	0.22961	N	0.998508	D	0.71674	0.998	D	0.77557	0.99	T	0.08330	-1.0727	10	0.72032	D	0.01	-48.4936	6.9499	0.24540	0.1282:0.0:0.8718:0.0	.	557	Q08380	LG3BP_HUMAN	F	557;545	ENSP00000262776:S557F	ENSP00000262776:S557F	S	-	2	0	LGALS3BP	74479341	0.581000	0.26741	0.003000	0.11579	0.015000	0.08874	2.014000	0.40951	1.002000	0.39104	0.491000	0.48974	TCC		0.632	LGALS3BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437785.3	NM_005567		4	55	0	0	0	0	4	55				
CARD14	79092	broad.mit.edu	37	17	78156549	78156549	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:78156549C>T	ENST00000573882.1	+	5	845	c.309C>T	c.(307-309)gtC>gtT	p.V103V	CARD14_ENST00000570421.1_Silent_p.V103V|CARD14_ENST00000344227.2_Silent_p.V103V|CARD14_ENST00000392434.2_5'Flank			Q9BXL6	CAR14_HUMAN	caspase recruitment domain family, member 14	103	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)			NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(5)|prostate(1)|skin(1)	23	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.017)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			ACACCCTGGTCACCGGGCTGC	0.557																																						uc002jxw.1		NA																	0				ovary(4)|skin(1)	5						c.(307-309)GTC>GTT		caspase recruitment domain protein 14 isoform 1							134.0	101.0	112.0					17																	78156549		2203	4300	6503	SO:0001819	synonymous_variant	79092				activation of NF-kappaB-inducing kinase activity|positive regulation of protein phosphorylation|regulation of apoptosis	aggresome|cytoplasm|plasma membrane	CARD domain binding	g.chr17:78156549C>T	AF322642	CCDS11768.1, CCDS58605.1	17q25.3	2014-09-04			ENSG00000141527	ENSG00000141527			16446	protein-coding gene	gene with protein product		607211	"""psoriasis susceptibility 2"""	PSORS2		11278692, 11356195, 22521418	Standard	NM_052819		Approved	CARMA2, BIMP2	uc031res.1	Q9BXL6	OTTHUMG00000177549	ENST00000573882.1:c.309C>T	17.37:g.78156549C>T			Somatic				CARD14_uc002jxt.1_RNA|CARD14_uc002jxv.2_Silent_p.V103V|CARD14_uc010wud.1_5'Flank	p.V103V	NM_024110	NP_077015	WXS	Illumina HiSeq	Unspecified	Q9BXL6	CAR14_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.017)|BRCA - Breast invasive adenocarcinoma(99;0.0908)		3	504	+	all_neural(118;0.0952)		103			CARD.		B8QQJ3|Q9BVB5	Silent	SNP	ENST00000573882.1	37	c.309C>T	CCDS11768.1																																																																																				0.557	CARD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437507.1			8	35	0	0	0	0	8	35				
RNF213	57674	broad.mit.edu	37	17	78320513	78320513	+	Nonsense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:78320513C>G	ENST00000582970.1	+	29	8521	c.8378C>G	c.(8377-8379)tCa>tGa	p.S2793*	RNF213_ENST00000336301.6_Nonsense_Mutation_p.S866*|RNF213_ENST00000508628.2_Nonsense_Mutation_p.S2842*	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	2793					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GCTGCCTACTCAGATCTCTTC	0.642																																						uc002jyh.1		NA																	0				ovary(8)|lung(6)|breast(3)|large_intestine(2)|central_nervous_system(1)|pancreas(1)	21						c.(2596-2598)TCA>TGA		ring finger protein 213							29.0	27.0	28.0					17																	78320513		2203	4300	6503	SO:0001587	stop_gained	57674							g.chr17:78320513C>G	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.8378C>G	17.37:g.78320513C>G	ENSP00000464087:p.Ser2793*		Somatic					p.S866*	NM_020914	NP_065965	WXS	Illumina HiSeq	Unspecified	Q9HCF4	ALO17_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)		4	2820	+	all_neural(118;0.0538)		Error:Variant_position_missing_in_Q9HCF4_after_alignment					C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Nonsense_Mutation	SNP	ENST00000582970.1	37	c.2597C>G	CCDS58606.1	.	.	.	.	.	.	.	.	.	.	C	49	15.710489	0.99842	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	.	.	.	5.82	4.82	0.62117	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	16.2985	0.82793	0.133:0.867:0.0:0.0	.	.	.	.	X	2793;2842;866	.	ENSP00000338218:S866X	S	+	2	0	RNF213	75935108	0.942000	0.31987	0.422000	0.26621	0.291000	0.27294	3.130000	0.50508	2.751000	0.94390	0.563000	0.77884	TCA		0.642	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914		4	11	0	0	0	0	4	11				
FN3KRP	79672	broad.mit.edu	37	17	80674690	80674690	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:80674690C>A	ENST00000269373.6	+	1	132	c.59C>A	c.(58-60)tCg>tAg	p.S20*	RP11-388C12.1_ENST00000574471.1_lincRNA|FN3KRP_ENST00000535965.1_5'UTR	NM_024619.3	NP_078895.2	Q9HA64	KT3K_HUMAN	fructosamine 3 kinase related protein	20							kinase activity (GO:0016301)	p.G23fs*31(1)		breast(1)|large_intestine(2)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	7	Breast(20;0.000523)|all_neural(118;0.0952)		BRCA - Breast invasive adenocarcinoma(99;0.0344)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			ACGGGCCACTCGGGGGGCGGG	0.706																																						uc002kfu.2		NA																	1	Insertion - Frameshift(1)		large_intestine(1)		0						c.(58-60)TCG>TAG		fructosamine 3 kinase related protein							21.0	23.0	22.0					17																	80674690		2196	4292	6488	SO:0001587	stop_gained	79672						kinase activity	g.chr17:80674690C>A	AY360465	CCDS11817.1	17q25.3	2014-08-12			ENSG00000141560	ENSG00000141560			25700	protein-coding gene	gene with protein product		611683				14633848	Standard	NM_024619		Approved	FLJ12171, FN3KL	uc002kfu.3	Q9HA64	OTTHUMG00000177846	ENST00000269373.6:c.59C>A	17.37:g.80674690C>A	ENSP00000269373:p.Ser20*		Somatic				FN3KRP_uc010wvr.1_5'UTR	p.S20*	NM_024619	NP_078895	WXS	Illumina HiSeq	Unspecified	Q9HA64	KT3K_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0344)|OV - Ovarian serous cystadenocarcinoma(97;0.061)		1	109	+	Breast(20;0.000523)|all_neural(118;0.0952)		20					Q969F4|Q9H0U7	Nonsense_Mutation	SNP	ENST00000269373.6	37	c.59C>A	CCDS11817.1	.	.	.	.	.	.	.	.	.	.	C	34	5.373085	0.95923	.	.	ENSG00000141560	ENST00000269373	.	.	.	5.29	4.31	0.51392	.	0.266688	0.39475	N	0.001359	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	-7.6902	7.9761	0.30155	0.0:0.7252:0.1346:0.1402	.	.	.	.	X	20	.	ENSP00000269373:S20X	S	+	2	0	FN3KRP	78267979	0.703000	0.27826	0.158000	0.22627	0.441000	0.31987	3.190000	0.50973	1.329000	0.45376	0.650000	0.86243	TCG		0.706	FN3KRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439219.1	NM_024619		5	19	1	0	0.00116845	0.00119389	5	19				
ZNF750	79755	broad.mit.edu	37	17	80788498	80788498	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:80788498C>T	ENST00000269394.3	-	3	2525	c.1692G>A	c.(1690-1692)ccG>ccA	p.P564P	TBCD_ENST00000355528.4_Intron|ZNF750_ENST00000572562.1_Silent_p.P165P|TBCD_ENST00000397466.2_Intron|TBCD_ENST00000539345.2_Intron	NM_024702.2	NP_078978.2	Q32MQ0	ZN750_HUMAN	zinc finger protein 750	564					cell differentiation (GO:0030154)|epidermis development (GO:0008544)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	31	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0514)|all_epithelial(8;0.0748)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.149)			AGGCAGGCCTCGGAGCCTGGG	0.627																																						uc002kga.2		NA																	0				central_nervous_system(1)	1						c.(1690-1692)CCG>CCA		zinc finger protein 750							60.0	65.0	63.0					17																	80788498		2203	4300	6503	SO:0001819	synonymous_variant	79755					intracellular	zinc ion binding	g.chr17:80788498C>T	AK023903	CCDS11819.1	17q25.3	2008-05-02				ENSG00000141579			25843	protein-coding gene	gene with protein product		610226				16751772	Standard	NM_024702		Approved	FLJ13841, Zfp750	uc002kga.3	Q32MQ0		ENST00000269394.3:c.1692G>A	17.37:g.80788498C>T			Somatic				TBCD_uc002kfx.1_Intron|TBCD_uc002kfy.1_Intron|TBCD_uc002kfz.2_Intron	p.P564P	NM_024702	NP_078978	WXS	Illumina HiSeq	Unspecified	Q32MQ0	ZN750_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.149)		3	2003	-	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0514)|all_epithelial(8;0.0748)	564					Q9H899	Silent	SNP	ENST00000269394.3	37	c.1692G>A	CCDS11819.1																																																																																				0.627	ZNF750-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439074.2	NM_024702		14	57	0	0	0	0	14	57				
ZNF750	79755	broad.mit.edu	37	17	80789280	80789280	+	Missense_Mutation	SNP	C	C	T	rs377565207		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:80789280C>T	ENST00000269394.3	-	2	1884	c.1051G>A	c.(1051-1053)Gaa>Aaa	p.E351K	TBCD_ENST00000355528.4_Intron|ZNF750_ENST00000572562.1_5'UTR|TBCD_ENST00000397466.2_Intron|TBCD_ENST00000539345.2_Intron	NM_024702.2	NP_078978.2	Q32MQ0	ZN750_HUMAN	zinc finger protein 750	351					cell differentiation (GO:0030154)|epidermis development (GO:0008544)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	31	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0514)|all_epithelial(8;0.0748)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.149)			GTGGCTTCTTCAAGCAGGTGA	0.532																																						uc002kga.2		NA																	0				central_nervous_system(1)	1						c.(1051-1053)GAA>AAA		zinc finger protein 750							110.0	122.0	118.0					17																	80789280		2203	4300	6503	SO:0001583	missense	79755					intracellular	zinc ion binding	g.chr17:80789280C>T	AK023903	CCDS11819.1	17q25.3	2008-05-02				ENSG00000141579			25843	protein-coding gene	gene with protein product		610226				16751772	Standard	NM_024702		Approved	FLJ13841, Zfp750	uc002kga.3	Q32MQ0		ENST00000269394.3:c.1051G>A	17.37:g.80789280C>T	ENSP00000269394:p.Glu351Lys		Somatic				TBCD_uc002kfx.1_Intron|TBCD_uc002kfy.1_Intron|TBCD_uc002kfz.2_Intron	p.E351K	NM_024702	NP_078978	WXS	Illumina HiSeq	Unspecified	Q32MQ0	ZN750_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.149)		2	1362	-	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0514)|all_epithelial(8;0.0748)	351					Q9H899	Missense_Mutation	SNP	ENST00000269394.3	37	c.1051G>A	CCDS11819.1	.	.	.	.	.	.	.	.	.	.	C	15.82	2.947399	0.53186	.	.	ENSG00000141579	ENST00000269394	T	0.15017	2.46	4.62	4.62	0.57501	.	0.170606	0.39407	N	0.001361	T	0.29458	0.0734	M	0.64997	1.995	0.80722	D	1	P	0.49961	0.93	P	0.50440	0.641	T	0.02610	-1.1134	9	.	.	.	-21.7092	16.7975	0.85606	0.0:1.0:0.0:0.0	.	351	Q32MQ0	ZN750_HUMAN	K	351	ENSP00000269394:E351K	.	E	-	1	0	ZNF750	78382569	1.000000	0.71417	0.460000	0.27093	0.018000	0.09664	5.168000	0.64978	2.286000	0.76751	0.563000	0.77884	GAA		0.532	ZNF750-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439074.2	NM_024702		32	129	0	0	0	0	32	129				
ZNF750	79755	broad.mit.edu	37	17	80790150	80790150	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr17:80790150G>A	ENST00000269394.3	-	2	1014	c.181C>T	c.(181-183)Cga>Tga	p.R61*	TBCD_ENST00000355528.4_Intron|ZNF750_ENST00000572562.1_Intron|TBCD_ENST00000397466.2_Intron|TBCD_ENST00000539345.2_Intron	NM_024702.2	NP_078978.2	Q32MQ0	ZN750_HUMAN	zinc finger protein 750	61					cell differentiation (GO:0030154)|epidermis development (GO:0008544)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	31	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0514)|all_epithelial(8;0.0748)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.149)			TTGGGAACTCGATCCTGCTCT	0.448																																						uc002kga.2		NA																	0				central_nervous_system(1)	1						c.(181-183)CGA>TGA		zinc finger protein 750							134.0	116.0	122.0					17																	80790150		2203	4300	6503	SO:0001587	stop_gained	79755					intracellular	zinc ion binding	g.chr17:80790150G>A	AK023903	CCDS11819.1	17q25.3	2008-05-02				ENSG00000141579			25843	protein-coding gene	gene with protein product		610226				16751772	Standard	NM_024702		Approved	FLJ13841, Zfp750	uc002kga.3	Q32MQ0		ENST00000269394.3:c.181C>T	17.37:g.80790150G>A	ENSP00000269394:p.Arg61*		Somatic				TBCD_uc002kfx.1_Intron|TBCD_uc002kfy.1_Intron|TBCD_uc002kfz.2_Intron	p.R61*	NM_024702	NP_078978	WXS	Illumina HiSeq	Unspecified	Q32MQ0	ZN750_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.149)		2	492	-	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0514)|all_epithelial(8;0.0748)	61					Q9H899	Nonsense_Mutation	SNP	ENST00000269394.3	37	c.181C>T	CCDS11819.1	.	.	.	.	.	.	.	.	.	.	G	43	9.912107	0.99294	.	.	ENSG00000141579	ENST00000269394	.	.	.	5.86	5.86	0.93980	.	0.000000	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-38.8224	19.1589	0.93524	0.0:0.0:1.0:0.0	.	.	.	.	X	61	.	.	R	-	1	2	ZNF750	78383439	1.000000	0.71417	0.523000	0.27875	0.587000	0.36485	4.754000	0.62191	2.773000	0.95371	0.655000	0.94253	CGA		0.448	ZNF750-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439074.2	NM_024702		15	63	0	0	0	0	15	63				
CLUL1	27098	broad.mit.edu	37	18	627346	627346	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr18:627346G>A	ENST00000400606.2	+	5	818	c.673G>A	c.(673-675)Gag>Aag	p.E225K	CLUL1_ENST00000338387.7_Missense_Mutation_p.E225K|CLUL1_ENST00000581619.1_Missense_Mutation_p.E250K|CLUL1_ENST00000540035.1_Missense_Mutation_p.E277K|CLUL1_ENST00000579494.1_Missense_Mutation_p.E225K	NM_014410.4	NP_055225.1	Q15846	CLUL1_HUMAN	clusterin-like 1 (retinal)	225					cell death (GO:0008219)	extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(5)|large_intestine(5)|liver(2)|lung(7)|ovary(2)|skin(1)	24						AGACCTAACTGAGCCTTACTT	0.388																																						uc002kkp.2		NA																	0				ovary(2)	2						c.(673-675)GAG>AAG		clusterin-like 1 (retinal) precursor							158.0	146.0	150.0					18																	627346		1846	4110	5956	SO:0001583	missense	27098				cell death	extracellular region		g.chr18:627346G>A	D63813	CCDS42405.1, CCDS74187.1	18p11.32	2008-07-28				ENSG00000079101			2096	protein-coding gene	gene with protein product						10675623, 14507903	Standard	NM_199167		Approved		uc002kkq.3	Q15846		ENST00000400606.2:c.673G>A	18.37:g.627346G>A	ENSP00000383449:p.Glu225Lys		Somatic				CLUL1_uc010wys.1_Missense_Mutation_p.E277K|CLUL1_uc002kkq.2_Missense_Mutation_p.E225K	p.E225K	NM_014410	NP_055225	WXS	Illumina HiSeq	Unspecified	Q15846	CLUL1_HUMAN			5	818	+			225					A0FDN7	Missense_Mutation	SNP	ENST00000400606.2	37	c.673G>A	CCDS42405.1	.	.	.	.	.	.	.	.	.	.	G	13.57	2.276114	0.40294	.	.	ENSG00000079101	ENST00000400606;ENST00000540035;ENST00000338387	T;T;T	0.22743	1.94;1.94;1.94	5.86	4.98	0.66077	Clusterin, N-terminal (1);	0.474486	0.23519	N	0.047304	T	0.36991	0.0987	L	0.50333	1.59	0.30738	N	0.746516	D;D	0.60160	0.983;0.987	P;P	0.58620	0.755;0.842	T	0.33727	-0.9857	10	0.41790	T	0.15	-15.9962	16.9437	0.86225	0.0:0.128:0.872:0.0	.	277;225	F5GWQ8;Q15846	.;CLUL1_HUMAN	K	225;277;225	ENSP00000383449:E225K;ENSP00000441726:E277K;ENSP00000341128:E225K	ENSP00000341128:E225K	E	+	1	0	CLUL1	617346	0.953000	0.32496	0.030000	0.17652	0.005000	0.04900	2.946000	0.49050	1.450000	0.47717	0.561000	0.74099	GAG		0.388	CLUL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441183.1			16	115	0	0	0	0	16	115				
MTCL1	23255	broad.mit.edu	37	18	8796233	8796233	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr18:8796233G>C	ENST00000306329.11	+	7	2971	c.2971G>C	c.(2971-2973)Gag>Cag	p.E991Q	SOGA2_ENST00000518815.1_5'UTR|SOGA2_ENST00000517570.1_Missense_Mutation_p.E631Q|SOGA2_ENST00000359865.3_Missense_Mutation_p.E672Q|SOGA2_ENST00000400050.3_Missense_Mutation_p.E631Q|SOGA2_ENST00000306285.7_5'UTR																							ATTCAAGATGGAGGAGGAGCA	0.498																																						uc002knr.2		NA																	0					0						c.(2014-2016)GAG>CAG		hypothetical protein LOC23255							111.0	102.0	105.0					18																	8796233		2203	4300	6503	SO:0001583	missense	23255							g.chr18:8796233G>C																												ENST00000306329.11:c.2971G>C	18.37:g.8796233G>C	ENSP00000305027:p.Glu991Gln		Somatic				KIAA0802_uc002knq.2_Missense_Mutation_p.E631Q|KIAA0802_uc002kns.2_Missense_Mutation_p.E2Q	p.E672Q	NM_015210	NP_056025	WXS	Illumina HiSeq	Unspecified	Q9Y4B5	CC165_HUMAN			9	2156	+			982						Missense_Mutation	SNP	ENST00000306329.11	37	c.2014G>C		.	.	.	.	.	.	.	.	.	.	G	14.72	2.620260	0.46736	.	.	ENSG00000168502	ENST00000306329;ENST00000517570;ENST00000359865;ENST00000400050	T;T;T	0.47528	0.84;0.84;0.84	5.82	5.82	0.92795	.	0.116909	0.39274	N	0.001416	T	0.66366	0.2782	L	0.53249	1.67	0.80722	D	1	D;P	0.89917	1.0;0.89	D;P	0.75484	0.986;0.472	T	0.62096	-0.6926	10	0.42905	T	0.14	-18.424	20.1054	0.97890	0.0:0.0:1.0:0.0	.	982;672	Q9Y4B5;Q9Y4B5-3	CC165_HUMAN;.	Q	693;631;672;631	ENSP00000429556:E631Q;ENSP00000352927:E672Q;ENSP00000382924:E631Q	ENSP00000305027:E693Q	E	+	1	0	CCDC165	8786233	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	4.393000	0.59665	2.757000	0.94681	0.655000	0.94253	GAG		0.498	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000444141.1			10	87	0	0	0	0	10	87				
MTCL1	23255	broad.mit.edu	37	18	8796331	8796331	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr18:8796331G>C	ENST00000306329.11	+	7	3069	c.3069G>C	c.(3067-3069)aaG>aaC	p.K1023N	SOGA2_ENST00000518815.1_Missense_Mutation_p.K19N|SOGA2_ENST00000517570.1_Missense_Mutation_p.K663N|SOGA2_ENST00000359865.3_Missense_Mutation_p.K704N|SOGA2_ENST00000400050.3_Missense_Mutation_p.K663N|SOGA2_ENST00000306285.7_Missense_Mutation_p.K19N																							GTGATGAGAAGAATCTGATGC	0.522																																						uc002knr.2		NA																	0					0						c.(2110-2112)AAG>AAC		hypothetical protein LOC23255							126.0	116.0	120.0					18																	8796331		2203	4300	6503	SO:0001583	missense	23255							g.chr18:8796331G>C																												ENST00000306329.11:c.3069G>C	18.37:g.8796331G>C	ENSP00000305027:p.Lys1023Asn		Somatic				KIAA0802_uc002knq.2_Missense_Mutation_p.K663N|KIAA0802_uc002kns.2_Missense_Mutation_p.K34N	p.K704N	NM_015210	NP_056025	WXS	Illumina HiSeq	Unspecified	Q9Y4B5	CC165_HUMAN			9	2254	+			1014						Missense_Mutation	SNP	ENST00000306329.11	37	c.2112G>C		.	.	.	.	.	.	.	.	.	.	G	19.40	3.819554	0.71028	.	.	ENSG00000168502	ENST00000306329;ENST00000517570;ENST00000359865;ENST00000400050;ENST00000306285	T;T;T;T	0.51574	0.7;0.7;0.7;0.7	5.76	4.89	0.63831	.	0.371835	0.23682	N	0.045602	T	0.47322	0.1439	L	0.55990	1.75	0.33043	D	0.531688	P;P	0.50272	0.933;0.726	B;P	0.45232	0.395;0.474	T	0.64956	-0.6285	10	0.87932	D	0	-29.9909	11.3152	0.49388	0.1916:0.0:0.8084:0.0	.	1014;704	Q9Y4B5;Q9Y4B5-3	CC165_HUMAN;.	N	725;663;704;663;19	ENSP00000429556:K663N;ENSP00000352927:K704N;ENSP00000382924:K663N;ENSP00000303670:K19N	ENSP00000303670:K19N	K	+	3	2	CCDC165	8786331	0.994000	0.37717	0.818000	0.32626	0.998000	0.95712	1.639000	0.37176	1.437000	0.47472	0.655000	0.94253	AAG		0.522	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000444141.1			12	80	0	0	0	0	12	80				
ASXL3	80816	broad.mit.edu	37	18	31324832	31324832	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr18:31324832G>A	ENST00000269197.5	+	12	5020	c.5020G>A	c.(5020-5022)Gaa>Aaa	p.E1674K		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1674					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						TGAACTTCACGAAGCAGACAA	0.478																																						uc010dmg.1		NA																	0				ovary(2)|pancreas(1)	3						c.(5020-5022)GAA>AAA		additional sex combs like 3							77.0	81.0	80.0					18																	31324832		2028	4196	6224	SO:0001583	missense	80816				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding	g.chr18:31324832G>A	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.5020G>A	18.37:g.31324832G>A	ENSP00000269197:p.Glu1674Lys		Somatic				ASXL3_uc002kxq.2_Missense_Mutation_p.E1381K	p.E1674K	NM_030632	NP_085135	WXS	Illumina HiSeq	Unspecified	Q9C0F0	ASXL3_HUMAN			12	5075	+			1674					Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	c.5020G>A	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	G	11.21	1.571596	0.28003	.	.	ENSG00000141431	ENST00000269197	T	0.16457	2.34	5.86	5.86	0.93980	.	.	.	.	.	T	0.13372	0.0324	L	0.27053	0.805	0.40577	D	0.981353	P	0.46020	0.871	B	0.32583	0.148	T	0.03278	-1.1053	9	0.66056	D	0.02	.	20.1865	0.98220	0.0:0.0:1.0:0.0	.	1674	Q9C0F0	ASXL3_HUMAN	K	1674	ENSP00000269197:E1674K	ENSP00000269197:E1674K	E	+	1	0	ASXL3	29578830	1.000000	0.71417	0.243000	0.24186	0.058000	0.15608	4.933000	0.63484	2.775000	0.95449	0.655000	0.94253	GAA		0.478	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2			12	63	0	0	0	0	12	63				
ASXL3	80816	broad.mit.edu	37	18	31325319	31325319	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr18:31325319G>A	ENST00000269197.5	+	12	5507	c.5507G>A	c.(5506-5508)gGa>gAa	p.G1836E		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1836					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						AGGACTGTAGGAGAACACACT	0.483																																						uc010dmg.1		NA																	0				ovary(2)|pancreas(1)	3						c.(5506-5508)GGA>GAA		additional sex combs like 3							189.0	187.0	188.0					18																	31325319		1955	4144	6099	SO:0001583	missense	80816				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding	g.chr18:31325319G>A	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.5507G>A	18.37:g.31325319G>A	ENSP00000269197:p.Gly1836Glu		Somatic				ASXL3_uc002kxq.2_Missense_Mutation_p.G1543E	p.G1836E	NM_030632	NP_085135	WXS	Illumina HiSeq	Unspecified	Q9C0F0	ASXL3_HUMAN			12	5562	+			1836					Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	c.5507G>A	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	G	18.93	3.727005	0.69074	.	.	ENSG00000141431	ENST00000269197	T	0.33654	1.4	5.87	5.87	0.94306	.	.	.	.	.	T	0.51143	0.1657	L	0.27053	0.805	0.44899	D	0.997914	D	0.89917	1.0	D	0.91635	0.999	T	0.51957	-0.8639	9	0.72032	D	0.01	.	20.266	0.98459	0.0:0.0:1.0:0.0	.	1836	Q9C0F0	ASXL3_HUMAN	E	1836	ENSP00000269197:G1836E	ENSP00000269197:G1836E	G	+	2	0	ASXL3	29579317	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	5.396000	0.66297	2.799000	0.96334	0.644000	0.83932	GGA		0.483	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2			44	210	0	0	0	0	44	210				
SLC39A6	25800	broad.mit.edu	37	18	33689584	33689584	+	Missense_Mutation	SNP	T	T	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr18:33689584T>A	ENST00000590986.1	-	10	2529	c.2240A>T	c.(2239-2241)cAt>cTt	p.H747L	SLC39A6_ENST00000269187.5_Missense_Mutation_p.H747L			Q13433	S39A6_HUMAN	solute carrier family 39 (zinc transporter), member 6	747					cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)|zinc ion transmembrane import (GO:0071578)|zinc ion transmembrane transport (GO:0071577)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|lamellipodium membrane (GO:0031258)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	41						CACGATTTTATGTTCAAATAT	0.353																																						uc010dmy.2		NA																	0				ovary(1)|pancreas(1)	2						c.(2239-2241)CAT>CTT		solute carrier family 39 (zinc transporter),							93.0	94.0	94.0					18																	33689584		1820	4084	5904	SO:0001583	missense	25800					integral to membrane|lamellipodium membrane	zinc ion transmembrane transporter activity	g.chr18:33689584T>A	U41060	CCDS42428.1, CCDS45854.1	18q12.2	2013-05-22				ENSG00000141424		"""Solute carriers"""	18607	protein-coding gene	gene with protein product		608731	"""solute carrier family 39 (metal ion transporter), member 6"""			12659941, 12839489	Standard	NM_012319		Approved	LIV-1	uc010dmy.3	Q13433		ENST00000590986.1:c.2240A>T	18.37:g.33689584T>A	ENSP00000465915:p.His747Leu		Somatic					p.H747L	NM_012319	NP_036451	WXS	Illumina HiSeq	Unspecified	Q13433	S39A6_HUMAN			10	2530	-			747			Extracellular (Potential).		B4DR49|B4E224|Q8IXR3|Q96HP5	Missense_Mutation	SNP	ENST00000590986.1	37	c.2240A>T	CCDS42428.1	.	.	.	.	.	.	.	.	.	.	T	25.0	4.596627	0.86953	.	.	ENSG00000141424	ENST00000269187;ENST00000543723	T	0.63417	-0.04	5.53	5.53	0.82687	.	0.142496	0.64402	D	0.000007	T	0.75213	0.3819	M	0.64404	1.975	0.80722	D	1	D	0.71674	0.998	D	0.68765	0.96	T	0.77104	-0.2711	10	0.59425	D	0.04	-16.2721	13.8924	0.63747	0.0:0.0:0.0:1.0	.	747	Q13433	S39A6_HUMAN	L	747;402	ENSP00000269187:H747L	ENSP00000269187:H747L	H	-	2	0	SLC39A6	31943582	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.841000	0.86834	2.229000	0.72834	0.482000	0.46254	CAT		0.353	SLC39A6-004	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000444136.1			21	118	0	0	0	0	21	118				
CCBE1	147372	broad.mit.edu	37	18	57363888	57363888	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr18:57363888G>C	ENST00000439986.4	-	2	222	c.185C>G	c.(184-186)tCt>tGt	p.S62C	RP11-2N1.2_ENST00000588946.1_RNA	NM_133459.3	NP_597716.1	Q6UXH8	CCBE1_HUMAN	collagen and calcium binding EGF domains 1	62					lymphangiogenesis (GO:0001946)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of lymphangiogenesis (GO:1901492)|positive regulation of protein processing (GO:0010954)|positive regulation of vascular endothelial growth factor signaling pathway (GO:1900748)|positive regulation vascular endothelial growth factor production (GO:0010575)|sprouting angiogenesis (GO:0002040)|venous blood vessel morphogenesis (GO:0048845)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|protease binding (GO:0002020)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|prostate(1)|skin(3)	24		Colorectal(73;0.175)				CTCGCCTGAAGACTTCAGACA	0.572											OREG0025022	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									NSCLC(137;1340 1860 15773 39604 51087)|Esophageal Squamous(139;339 1777 2926 19691 38524)	uc002lib.2		NA																	0				skin(2)|ovary(1)	3						c.(184-186)TCT>TGT		collagen and calcium binding EGF domains 1							112.0	114.0	113.0					18																	57363888		2203	4300	6503	SO:0001583	missense	147372				lymphangiogenesis|sprouting angiogenesis|venous blood vessel morphogenesis	collagen	calcium ion binding	g.chr18:57363888G>C	AB075863	CCDS32838.1	18q21.32	2005-01-18				ENSG00000183287			29426	protein-coding gene	gene with protein product		612753				11853319, 12975309	Standard	NM_133459		Approved	FLJ30681, KIAA1983	uc002lib.3	Q6UXH8		ENST00000439986.4:c.185C>G	18.37:g.57363888G>C	ENSP00000404464:p.Ser62Cys		Somatic	OREG0025022	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1022		p.S62C	NM_133459	NP_597716	WXS	Illumina HiSeq	Unspecified	Q6UXH8	CCBE1_HUMAN			2	255	-		Colorectal(73;0.175)	62					Q6MZX5|Q86SS2|Q8TF19	Missense_Mutation	SNP	ENST00000439986.4	37	c.185C>G	CCDS32838.1	.	.	.	.	.	.	.	.	.	.	G	10.62	1.401128	0.25291	.	.	ENSG00000183287	ENST00000439986	D	0.85411	-1.98	5.95	5.95	0.96441	.	0.624961	0.15216	N	0.274218	T	0.79058	0.4382	N	0.19112	0.55	0.80722	D	1	P	0.35527	0.507	B	0.37091	0.241	T	0.79157	-0.1919	10	0.62326	D	0.03	0.0434	15.872	0.79127	0.0:0.0:1.0:0.0	.	62	Q6UXH8	CCBE1_HUMAN	C	62	ENSP00000404464:S62C	ENSP00000404464:S62C	S	-	2	0	CCBE1	55514868	0.997000	0.39634	0.040000	0.18447	0.044000	0.14063	5.520000	0.67080	2.826000	0.97356	0.491000	0.48974	TCT		0.572	CCBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449685.2	NM_133459		14	117	0	0	0	0	14	117				
ZNF554	115196	broad.mit.edu	37	19	2834250	2834250	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr19:2834250G>C	ENST00000317243.5	+	5	1215	c.1017G>C	c.(1015-1017)ttG>ttC	p.L339F		NM_001102651.1	NP_001096121.1	Q86TJ5	ZN554_HUMAN	zinc finger protein 554	339					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|liver(3)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCATTCTTTGAGCGAACATC	0.537																																						uc002lwm.2		NA																	0				ovary(1)	1						c.(1015-1017)TTG>TTC		zinc finger protein 554							69.0	75.0	73.0					19																	2834250		2067	4233	6300	SO:0001583	missense	115196				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:2834250G>C	AK027860	CCDS42462.1	19p13.3	2013-09-20			ENSG00000172006	ENSG00000172006		"""Zinc fingers, C2H2-type"", ""-"""	26629	protein-coding gene	gene with protein product						12477932	Standard	NM_001102651		Approved	FLJ34817	uc002lwm.2	Q86TJ5	OTTHUMG00000180493	ENST00000317243.5:c.1017G>C	19.37:g.2834250G>C	ENSP00000321132:p.Leu339Phe		Somatic				ZNF554_uc002lwl.2_Missense_Mutation_p.L288F	p.L339F	NM_001102651	NP_001096121	WXS	Illumina HiSeq	Unspecified	Q86TJ5	ZN554_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	5	1215	+		Hepatocellular(1079;0.137)	339			C2H2-type 2.		Q8NAT3|Q9BWN3	Missense_Mutation	SNP	ENST00000317243.5	37	c.1017G>C	CCDS42462.1	.	.	.	.	.	.	.	.	.	.	G	8.859	0.946554	0.18356	.	.	ENSG00000172006	ENST00000317243	T	0.52057	0.68	2.65	-1.64	0.08318	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.58438	0.2122	M	0.82323	2.585	0.09310	N	0.999999	D	0.59357	0.985	P	0.54965	0.765	T	0.52442	-0.8575	9	0.62326	D	0.03	.	6.8865	0.24206	0.0:0.3315:0.4969:0.1716	.	339	Q86TJ5	ZN554_HUMAN	F	339	ENSP00000321132:L339F	ENSP00000321132:L339F	L	+	3	2	ZNF554	2785250	0.000000	0.05858	0.048000	0.18961	0.442000	0.32017	-2.306000	0.01133	0.020000	0.15106	0.573000	0.79308	TTG		0.537	ZNF554-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451598.3	NM_152303		9	66	0	0	0	0	9	66				
ZNF554	115196	broad.mit.edu	37	19	2834551	2834551	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr19:2834551G>A	ENST00000317243.5	+	5	1516	c.1318G>A	c.(1318-1320)Gaa>Aaa	p.E440K		NM_001102651.1	NP_001096121.1	Q86TJ5	ZN554_HUMAN	zinc finger protein 554	440					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|liver(3)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGAATGCAGTGAATGTGGAAA	0.522																																						uc002lwm.2		NA																	0				ovary(1)	1						c.(1318-1320)GAA>AAA		zinc finger protein 554							66.0	75.0	72.0					19																	2834551		2201	4300	6501	SO:0001583	missense	115196				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:2834551G>A	AK027860	CCDS42462.1	19p13.3	2013-09-20			ENSG00000172006	ENSG00000172006		"""Zinc fingers, C2H2-type"", ""-"""	26629	protein-coding gene	gene with protein product						12477932	Standard	NM_001102651		Approved	FLJ34817	uc002lwm.2	Q86TJ5	OTTHUMG00000180493	ENST00000317243.5:c.1318G>A	19.37:g.2834551G>A	ENSP00000321132:p.Glu440Lys		Somatic				ZNF554_uc002lwl.2_Missense_Mutation_p.E389K	p.E440K	NM_001102651	NP_001096121	WXS	Illumina HiSeq	Unspecified	Q86TJ5	ZN554_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	5	1516	+		Hepatocellular(1079;0.137)	440			C2H2-type 6.		Q8NAT3|Q9BWN3	Missense_Mutation	SNP	ENST00000317243.5	37	c.1318G>A	CCDS42462.1	.	.	.	.	.	.	.	.	.	.	G	7.920	0.738354	0.15574	.	.	ENSG00000172006	ENST00000317243	T	0.35973	1.28	2.78	1.72	0.24424	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.24122	0.0584	N	0.26162	0.8	0.09310	N	0.999993	B	0.14012	0.009	B	0.15484	0.013	T	0.20075	-1.0286	9	0.46703	T	0.11	.	7.5449	0.27761	0.1361:0.0:0.8638:0.0	.	440	Q86TJ5	ZN554_HUMAN	K	440	ENSP00000321132:E440K	ENSP00000321132:E440K	E	+	1	0	ZNF554	2785551	0.000000	0.05858	0.003000	0.11579	0.007000	0.05969	0.191000	0.17076	0.509000	0.28195	0.643000	0.83706	GAA		0.522	ZNF554-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451598.3	NM_152303		8	40	0	0	0	0	8	40				
UHRF1	29128	broad.mit.edu	37	19	4929378	4929378	+	RNA	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr19:4929378G>C	ENST00000592666.1	+	0	874							Q96T88	UHRF1_HUMAN	ubiquitin-like with PHD and ring finger domains 1						cell cycle (GO:0007049)|cell proliferation (GO:0008283)|DNA repair (GO:0006281)|histone monoubiquitination (GO:0010390)|histone ubiquitination (GO:0016574)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of DNA topoisomerase (ATP-hydrolyzing) activity (GO:2000373)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autoubiquitination (GO:0051865)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|replication fork (GO:0005657)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|hemi-methylated DNA-binding (GO:0044729)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|methyl-CpG binding (GO:0008327)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|upper_aerodigestive_tract(2)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0276)		CTGCTGCCTGGGCCAGAGTGA	0.657																																						uc002mbo.2		NA																	0				lung(2)	2						c.(298-300)GGC>CGC		ubiquitin-like with PHD and ring finger domains							35.0	42.0	39.0					19																	4929378		2184	4283	6467			29128				cell cycle|cell proliferation|DNA repair|regulation of transcription from RNA polymerase II promoter	nucleus	acid-amino acid ligase activity|methyl-CpG binding|methylated histone residue binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:4929378G>C	AF129507	CCDS74262.1, CCDS74263.1	19p13.3	2012-04-20	2008-08-14		ENSG00000034063	ENSG00000276043		"""RING-type (C3HC4) zinc fingers"""	12556	protein-coding gene	gene with protein product		607990				10646863	Standard	NM_001048201		Approved	ICBP90, Np95, FLJ21925, RNF106	uc002mbo.3	Q96T88			19.37:g.4929378G>C			Somatic				UHRF1_uc010xik.1_Intron|UHRF1_uc010duf.2_RNA|UHRF1_uc002mbp.2_Missense_Mutation_p.G113R	p.G100R	NM_001048201	NP_001041666	WXS	Illumina HiSeq	Unspecified	Q96T88	UHRF1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0276)	3	466	+			100					A0JBR2|A8K024|B2RBA9|Q2HIX7|Q8J022|Q9H6S6|Q9P115|Q9P1U7	Missense_Mutation	SNP	ENST00000592666.1	37	c.298G>C		.	.	.	.	.	.	.	.	.	.	G	15.61	2.883226	0.51908	.	.	ENSG00000034063	ENST00000262952;ENST00000455180;ENST00000543616;ENST00000398240	.	.	.	4.62	4.62	0.57501	.	0.317291	0.33938	N	0.004404	T	0.66742	0.2820	L	0.55481	1.735	0.37585	D	0.919971	D;P	0.60160	0.987;0.76	P;B	0.55785	0.784;0.439	T	0.74321	-0.3703	8	0.59425	D	0.04	-19.8207	16.7768	0.85552	0.0:0.0:1.0:0.0	.	113;100	Q2HIX7;Q96T88	.;UHRF1_HUMAN	R	100;100;100;113	.	ENSP00000262952:G100R	G	+	1	0	UHRF1	4880378	1.000000	0.71417	1.000000	0.80357	0.338000	0.28826	3.435000	0.52849	2.273000	0.75805	0.561000	0.74099	GGC		0.657	UHRF1-006	KNOWN	sequence_error|basic	processed_transcript	processed_transcript	OTTHUMT00000450444.1	NM_001048201		6	26	0	0	0	0	6	26				
TRIP10	9322	broad.mit.edu	37	19	6741022	6741022	+	Splice_Site	SNP	A	A	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr19:6741022A>T	ENST00000313244.9	+	2	61	c.26A>T	c.(25-27)gAt>gTt	p.D9V	TRIP10_ENST00000600428.1_5'UTR|TRIP10_ENST00000596758.1_Splice_Site_p.D9V|TRIP10_ENST00000313285.8_Splice_Site_p.D9V|TRIP10_ENST00000596543.1_3'UTR			Q15642	CIP4_HUMAN	thyroid hormone receptor interactor 10	9	F-BAR domain.|FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.|Required for podosome formation and interaction with AKAP9 and microtubules.|Required for translocation to the plasma membrane in response to insulin. {ECO:0000250}.				actin cytoskeleton organization (GO:0030036)|cell communication (GO:0007154)|endocytosis (GO:0006897)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			NS(1)|breast(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	16						CCATGTCAGGATCAGTTCGAG	0.617																																						uc002mfs.2		NA																	0				ovary(1)	1						c.(25-27)GAT>GTT		thyroid hormone receptor interactor 10							58.0	57.0	58.0					19																	6741022		2203	4300	6503	SO:0001630	splice_region_variant	9322				actin cytoskeleton organization|cell communication|endocytosis|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell cortex|cell projection|cytoskeleton|cytosol|Golgi apparatus|lysosome|perinuclear region of cytoplasm|phagocytic cup	GTPase activator activity|identical protein binding|lipid binding	g.chr19:6741022A>T	AB072596	CCDS12172.1, CCDS74271.1, CCDS74272.1	19p13.3	2008-02-05			ENSG00000125733	ENSG00000125733			12304	protein-coding gene	gene with protein product	"""Cdc42-interacting protein"""	604504	"""salt tolerator"""	STOT		7776974, 9210375, 11294612	Standard	XM_005259683		Approved	STP, HSTP, CIP4	uc002mfr.3	Q15642	OTTHUMG00000150255	ENST00000313244.9:c.25-1A>T	19.37:g.6741022A>T			Somatic				TRIP10_uc010dux.1_Missense_Mutation_p.D9V|TRIP10_uc002mfr.2_Missense_Mutation_p.D9V|TRIP10_uc010duy.2_RNA|TRIP10_uc010duz.2_5'UTR	p.D9V	NM_004240	NP_004231	WXS	Illumina HiSeq	Unspecified	Q15642	CIP4_HUMAN			2	92	+			9			FCH.|Required for podosome formation and interaction with AKAP9 and microtubules.|Induction of membrane tubulation.|Required for translocation to the plasma membrane in response to insulin (By similarity).		B2R8A6|B7WP22|D6W645|O15184|Q53G22|Q5TZN1|Q6FI24|Q8NFL1|Q8TCY1|Q8TDX3|Q96RJ1	Missense_Mutation	SNP	ENST00000313244.9	37	c.26A>T		.	.	.	.	.	.	.	.	.	.	A	20.6	4.010795	0.75046	.	.	ENSG00000125733	ENST00000313285;ENST00000313244;ENST00000420690	T;T	0.56103	0.48;2.05	4.11	4.11	0.48088	Fps/Fes/Fer/CIP4 homology (3);	0.063415	0.64402	D	0.000009	T	0.72914	0.3520	M	0.85859	2.78	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.97110	1.0;0.998;0.999	T	0.77199	-0.2675	10	0.87932	D	0	-19.1886	11.0616	0.47950	1.0:0.0:0.0:0.0	.	9;9;9	G5E9U1;Q15642;Q15642-2	.;CIP4_HUMAN;.	V	9	ENSP00000320493:D9V;ENSP00000320117:D9V	ENSP00000320117:D9V	D	+	2	0	TRIP10	6692022	1.000000	0.71417	1.000000	0.80357	0.612000	0.37316	8.597000	0.90847	1.496000	0.48567	0.379000	0.24179	GAT		0.617	TRIP10-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000317129.2		Missense_Mutation	7	44	0	0	0	0	7	44				
RDH8	50700	broad.mit.edu	37	19	10132365	10132365	+	Silent	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr19:10132365C>G	ENST00000171214.1	+	6	1125	c.876C>G	c.(874-876)ctC>ctG	p.L292L	RDH8_ENST00000591589.1_Silent_p.L312L	NM_015725.2	NP_056540.2	Q9NYR8	RDH8_HUMAN	retinol dehydrogenase 8 (all-trans)	292					estrogen biosynthetic process (GO:0006703)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|steroid biosynthetic process (GO:0006694)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|NADP-retinol dehydrogenase activity (GO:0052650)|retinol dehydrogenase activity (GO:0004745)			endometrium(3)|large_intestine(3)|lung(10)|ovary(3)|pancreas(1)|prostate(1)	21			Epithelial(33;4.24e-05)		Vitamin A(DB00162)	CACGCCTCCTCAACCTTGGCC	0.612																																						uc002mmr.2		NA																	0				ovary(3)|pancreas(1)	4						c.(874-876)CTC>CTG		retinol dehydrogenase 8 (all-trans)	Vitamin A(DB00162)						110.0	105.0	107.0					19																	10132365		2203	4300	6503	SO:0001819	synonymous_variant	50700				estrogen biosynthetic process|response to stimulus|visual perception	cytoplasm|integral to plasma membrane	binding|estradiol 17-beta-dehydrogenase activity|NADP-retinol dehydrogenase activity|retinol dehydrogenase activity	g.chr19:10132365C>G	AF229845	CCDS12223.1, CCDS12223.2	19p13.2	2011-09-14				ENSG00000080511	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	14423	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 28C, member 2"""	608575				10753906, 19027726	Standard	NM_015725		Approved	PRRDH, SDR28C2	uc002mmr.4	Q9NYR8		ENST00000171214.1:c.876C>G	19.37:g.10132365C>G			Somatic					p.L292L	NM_015725	NP_056540	WXS	Illumina HiSeq	Unspecified	Q9NYR8	RDH8_HUMAN	Epithelial(33;4.24e-05)		6	1125	+			292					Q9H838	Silent	SNP	ENST00000171214.1	37	c.876C>G																																																																																					0.612	RDH8-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				6	37	0	0	0	0	6	37				
ANGPTL6	83854	broad.mit.edu	37	19	10204253	10204253	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr19:10204253C>T	ENST00000253109.4	-	5	1232	c.994G>A	c.(994-996)Gaa>Aaa	p.E332K	ANGPTL6_ENST00000592641.1_Missense_Mutation_p.E332K|ANGPTL6_ENST00000589181.1_Missense_Mutation_p.E292K	NM_031917.2	NP_114123.2	Q8NI99	ANGL6_HUMAN	angiopoietin-like 6	332	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|secretory granule (GO:0030141)				endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)	12			OV - Ovarian serous cystadenocarcinoma(20;3.58e-08)|Epithelial(33;2.5e-05)|all cancers(31;5.96e-05)			TACACGGGTTCAAGGCCCAGC	0.642																																						uc002mmx.1		NA																	0					0						c.(994-996)GAA>AAA		angiopoietin-like 6 precursor							29.0	27.0	28.0					19																	10204253		2203	4300	6503	SO:0001583	missense	83854				angiogenesis|cell differentiation|signal transduction	extracellular space	receptor binding	g.chr19:10204253C>T	AB054064	CCDS12224.1	19p13.2	2013-02-06				ENSG00000130812		"""Fibrinogen C domain containing"""	23140	protein-coding gene	gene with protein product	"""angiopoietin-related protein 5"""	609336				12871997	Standard	NM_031917		Approved	ARP5, AGF	uc002mmy.1	Q8NI99		ENST00000253109.4:c.994G>A	19.37:g.10204253C>T	ENSP00000253109:p.Glu332Lys		Somatic				ANGPTL6_uc002mmy.1_Missense_Mutation_p.E332K	p.E332K	NM_031917	NP_114123	WXS	Illumina HiSeq	Unspecified	Q8NI99	ANGL6_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;3.58e-08)|Epithelial(33;2.5e-05)|all cancers(31;5.96e-05)		5	1112	-			332			Fibrinogen C-terminal.		A5PKV7|Q9BZZ0	Missense_Mutation	SNP	ENST00000253109.4	37	c.994G>A	CCDS12224.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.633209	0.87660	.	.	ENSG00000130812	ENST00000253109	D	0.84660	-1.88	4.71	4.71	0.59529	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.000000	0.85682	D	0.000000	D	0.92691	0.7677	M	0.85373	2.75	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	D	0.92942	0.6373	10	0.48119	T	0.1	.	16.6474	0.85180	0.0:1.0:0.0:0.0	.	332	Q8NI99	ANGL6_HUMAN	K	332	ENSP00000253109:E332K	ENSP00000253109:E332K	E	-	1	0	ANGPTL6	10065253	1.000000	0.71417	0.800000	0.32199	0.954000	0.61252	7.646000	0.83445	2.477000	0.83638	0.485000	0.47835	GAA		0.642	ANGPTL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451142.1	NM_031917		7	20	0	0	0	0	7	20				
ANGPTL6	83854	broad.mit.edu	37	19	10204273	10204273	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr19:10204273C>T	ENST00000253109.4	-	5	1212	c.974G>A	c.(973-975)gGa>gAa	p.G325E	ANGPTL6_ENST00000592641.1_Missense_Mutation_p.G325E|ANGPTL6_ENST00000589181.1_Missense_Mutation_p.G285E	NM_031917.2	NP_114123.2	Q8NI99	ANGL6_HUMAN	angiopoietin-like 6	325	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|secretory granule (GO:0030141)				endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)	12			OV - Ovarian serous cystadenocarcinoma(20;3.58e-08)|Epithelial(33;2.5e-05)|all cancers(31;5.96e-05)			CCAGTATTCTCCGTCTGGCCG	0.647																																						uc002mmx.1		NA																	0					0						c.(973-975)GGA>GAA		angiopoietin-like 6 precursor							27.0	27.0	27.0					19																	10204273		2203	4300	6503	SO:0001583	missense	83854				angiogenesis|cell differentiation|signal transduction	extracellular space	receptor binding	g.chr19:10204273C>T	AB054064	CCDS12224.1	19p13.2	2013-02-06				ENSG00000130812		"""Fibrinogen C domain containing"""	23140	protein-coding gene	gene with protein product	"""angiopoietin-related protein 5"""	609336				12871997	Standard	NM_031917		Approved	ARP5, AGF	uc002mmy.1	Q8NI99		ENST00000253109.4:c.974G>A	19.37:g.10204273C>T	ENSP00000253109:p.Gly325Glu		Somatic				ANGPTL6_uc002mmy.1_Missense_Mutation_p.G325E	p.G325E	NM_031917	NP_114123	WXS	Illumina HiSeq	Unspecified	Q8NI99	ANGL6_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;3.58e-08)|Epithelial(33;2.5e-05)|all cancers(31;5.96e-05)		5	1092	-			325			Fibrinogen C-terminal.		A5PKV7|Q9BZZ0	Missense_Mutation	SNP	ENST00000253109.4	37	c.974G>A	CCDS12224.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.522013	0.85600	.	.	ENSG00000130812	ENST00000253109	D	0.84370	-1.84	4.71	4.71	0.59529	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.000000	0.85682	D	0.000000	D	0.93380	0.7889	M	0.89353	3.025	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.94569	0.7769	10	0.87932	D	0	.	16.6474	0.85180	0.0:1.0:0.0:0.0	.	325	Q8NI99	ANGL6_HUMAN	E	325	ENSP00000253109:G325E	ENSP00000253109:G325E	G	-	2	0	ANGPTL6	10065273	1.000000	0.71417	0.476000	0.27291	0.952000	0.60782	7.646000	0.83445	2.477000	0.83638	0.485000	0.47835	GGA		0.647	ANGPTL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451142.1	NM_031917		6	20	0	0	0	0	6	20				
PPAN	56342	broad.mit.edu	37	19	10220614	10220614	+	Missense_Mutation	SNP	G	G	A	rs149200523	byFrequency	TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr19:10220614G>A	ENST00000253107.7	+	7	722	c.616G>A	c.(616-618)Gcg>Acg	p.A206T	SNORD105B_ENST00000458770.1_RNA|P2RY11_ENST00000321826.4_5'Flank|SNORD105_ENST00000386910.1_RNA|PPAN_ENST00000393793.1_Missense_Mutation_p.A153T|PPAN-P2RY11_ENST00000393796.4_Missense_Mutation_p.A206T|PPAN-P2RY11_ENST00000428358.1_Missense_Mutation_p.A206T|PPAN_ENST00000556468.1_Missense_Mutation_p.A206T	NM_020230.5	NP_064615.3	Q9NQ55	SSF1_HUMAN	peter pan homolog (Drosophila)	206	Brix. {ECO:0000255|PROSITE- ProRule:PRU00034}.				RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(3)|liver(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	15			OV - Ovarian serous cystadenocarcinoma(20;2.19e-08)|Epithelial(33;1.76e-05)|all cancers(31;3.54e-05)			TCCTGTGGGCGCGAGTCGCGG	0.627																																						uc002mna.2		NA																	0				ovary(2)	2						c.(616-618)GCG>ACG		PPAN-P2RY11 protein		G	THR/ALA,THR/ALA,THR/ALA	1,4405	2.1+/-5.4	0,1,2202	121.0	125.0	123.0		616,616,616	5.3	0.5	19	dbSNP_134	123	10,8590	7.7+/-29.5	0,10,4290	yes	missense,missense,missense	PPAN,PPAN-P2RY11	NM_001040664.2,NM_001198690.1,NM_020230.5	58,58,58	0,11,6492	AA,AG,GG		0.1163,0.0227,0.0846	possibly-damaging,possibly-damaging,possibly-damaging	206/795,206/521,206/474	10220614	11,12995	2203	4300	6503	SO:0001583	missense	692312				RNA splicing	nucleolus	protein binding	g.chr19:10220614G>A	BC033202	CCDS12225.1	19p13.2	2008-02-05	2001-11-28		ENSG00000130810	ENSG00000130810			9227	protein-coding gene	gene with protein product		607793	"""peter pan (Drosophila) homolog"""			10873382	Standard	NM_020230		Approved	SSF1, SSF2, SSF, BXDC3		Q9NQ55	OTTHUMG00000156826	ENST00000253107.7:c.616G>A	19.37:g.10220614G>A	ENSP00000253107:p.Ala206Thr		Somatic				PPAN-P2RY11_uc010xla.1_Missense_Mutation_p.A206T|P2RY11_uc002mnc.2_5'Flank|PPAN_uc002mmz.1_Missense_Mutation_p.A206T|PPAN_uc002mnb.1_Missense_Mutation_p.A153T	p.A206T	NM_001040664	NP_001035754	WXS	Illumina HiSeq	Unspecified	Q9NQ55	SSF1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.19e-08)|Epithelial(33;1.76e-05)|all cancers(31;3.54e-05)		7	616	+			206			Brix.		C9J3F9|Q9BW97|Q9H170	Missense_Mutation	SNP	ENST00000253107.7	37	c.616G>A	CCDS12225.1	.	.	.	.	.	.	.	.	.	.	G	19.42	3.825051	0.71143	2.27E-4	0.001163	ENSG00000243207;ENSG00000243207;ENSG00000130810;ENSG00000130810;ENSG00000130810;ENSG00000130810;ENSG00000130810	ENST00000428358;ENST00000393796;ENST00000253107;ENST00000556468;ENST00000342696;ENST00000393793;ENST00000446223	T;T;T;T;T;T	0.22945	1.93;1.93;1.93;1.93;1.93;1.93	5.33	5.33	0.75918	Brix domain (3);	.	.	.	.	T	0.29061	0.0722	L	0.32530	0.975	0.36017	D	0.838459	D;D;D	0.69078	0.997;0.988;0.988	P;P;P	0.55260	0.772;0.645;0.645	T	0.20306	-1.0279	9	0.42905	T	0.14	-21.1208	8.2751	0.31868	0.1707:0.0:0.8293:0.0	.	206;206;206	C9J3F9;C9JW41;Q9NQ55	.;.;SSF1_HUMAN	T	206;206;206;206;206;153;144	ENSP00000411918:A206T;ENSP00000377385:A206T;ENSP00000253107:A206T;ENSP00000450710:A206T;ENSP00000377382:A153T;ENSP00000410485:A144T	ENSP00000253107:A206T	A	+	1	0	PPAN;PPAN-P2RY11	10081614	0.377000	0.25106	0.537000	0.28052	0.539000	0.34962	2.079000	0.41577	2.503000	0.84419	0.561000	0.74099	GCG		0.627	PPAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316658.1	NM_020230		8	107	0	0	0	0	8	107				
ZNF627	199692	broad.mit.edu	37	19	11725686	11725686	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr19:11725686C>T	ENST00000361113.5	+	3	383	c.175C>T	c.(175-177)Ccc>Tcc	p.P59S	ZNF627_ENST00000588174.1_Missense_Mutation_p.P59S	NM_145295.3	NP_660338.1	Q7L945	ZN627_HUMAN	zinc finger protein 627	59	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14						ATTCAAAATTCCCAGGAGAAA	0.289																																					Melanoma(112;173 1614 10731 17751 23322)	uc002msk.2		NA																	0				skin(1)	1						c.(175-177)CCC>TCC		zinc finger protein 627							18.0	19.0	19.0					19																	11725686		1814	4084	5898	SO:0001583	missense	199692				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:11725686C>T	AK074846	CCDS42502.1	19p13.2	2013-01-08				ENSG00000198551		"""Zinc fingers, C2H2-type"", ""-"""	30570	protein-coding gene	gene with protein product		612248				12477932	Standard	NM_145295		Approved	FLJ90365	uc002msk.2	Q7L945		ENST00000361113.5:c.175C>T	19.37:g.11725686C>T	ENSP00000354414:p.Pro59Ser		Somatic				ZNF627_uc010dyf.2_5'UTR	p.P59S	NM_145295	NP_660338	WXS	Illumina HiSeq	Unspecified	Q7L945	ZN627_HUMAN			3	383	+			59			KRAB.		O14846|Q4KMP9|Q6NT81|Q9BRG4	Missense_Mutation	SNP	ENST00000361113.5	37	c.175C>T	CCDS42502.1	.	.	.	.	.	.	.	.	.	.	c	0.376	-0.931577	0.02359	.	.	ENSG00000198551	ENST00000361113	T	0.06068	3.35	1.84	0.445	0.16597	Krueppel-associated box (3);	.	.	.	.	T	0.03095	0.0091	N	0.17564	0.495	0.09310	N	1	B	0.25235	0.121	B	0.20767	0.031	T	0.46938	-0.9155	9	0.15066	T	0.55	.	3.4067	0.07343	0.2839:0.4349:0.2812:0.0	.	59	Q7L945	ZN627_HUMAN	S	59	ENSP00000354414:P59S	ENSP00000354414:P59S	P	+	1	0	ZNF627	11586686	0.000000	0.05858	0.001000	0.08648	0.145000	0.21501	0.140000	0.16056	0.961000	0.38030	0.455000	0.32223	CCC		0.289	ZNF627-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458875.1	NM_145295		3	21	0	0	0	0	3	21				
ZNF563	147837	broad.mit.edu	37	19	12429881	12429881	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr19:12429881G>A	ENST00000293725.5	-	4	1163	c.958C>T	c.(958-960)Cat>Tat	p.H320Y		NM_145276.2	NP_660319.1	Q8TA94	ZN563_HUMAN	zinc finger protein 563	320					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20						CTTCCAAGATGATGAAATGTT	0.438																																					GBM(39;623 795 5132 29510 31476)	uc002mtp.2		NA																	0					0						c.(958-960)CAT>TAT		zinc finger protein 563							173.0	165.0	168.0					19																	12429881		2203	4300	6503	SO:0001583	missense	147837				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:12429881G>A	BC022523	CCDS12270.1	19p13.2	2013-09-20			ENSG00000188868	ENSG00000188868		"""Zinc fingers, C2H2-type"", ""-"""	30498	protein-coding gene	gene with protein product							Standard	NM_145276		Approved	FLJ34797	uc002mtp.3	Q8TA94	OTTHUMG00000156413	ENST00000293725.5:c.958C>T	19.37:g.12429881G>A	ENSP00000293725:p.His320Tyr		Somatic					p.H320Y	NM_145276	NP_660319	WXS	Illumina HiSeq	Unspecified	Q8TA94	ZN563_HUMAN			4	1196	-			320			C2H2-type 7.		B2R9E7|Q8NAT7	Missense_Mutation	SNP	ENST00000293725.5	37	c.958C>T	CCDS12270.1	.	.	.	.	.	.	.	.	.	.	G	0.965	-0.702173	0.03255	.	.	ENSG00000188868	ENST00000293725	T	0.17854	2.25	1.0	-0.216	0.13153	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17238	0.0414	L	0.28344	0.845	0.09310	N	1	D	0.71674	0.998	D	0.71656	0.974	T	0.10405	-1.0631	9	0.02654	T	1	.	4.8105	0.13340	0.556:0.0:0.444:0.0	.	320	Q8TA94	ZN563_HUMAN	Y	320	ENSP00000293725:H320Y	ENSP00000293725:H320Y	H	-	1	0	ZNF563	12290881	0.000000	0.05858	0.001000	0.08648	0.481000	0.33189	-3.851000	0.00350	-0.111000	0.12001	0.313000	0.20887	CAT		0.438	ZNF563-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344114.1	NM_145276		23	134	0	0	0	0	23	134				
C19orf44	84167	broad.mit.edu	37	19	16611792	16611792	+	Silent	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr19:16611792C>G	ENST00000221671.3	+	2	345	c.189C>G	c.(187-189)ctC>ctG	p.L63L	CTD-3222D19.2_ENST00000409035.1_Intron|C19orf44_ENST00000594035.1_Silent_p.L63L	NM_032207.2	NP_115583.1	Q9H6X5	CS044_HUMAN	chromosome 19 open reading frame 44	63										endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	16						AACACTTACTCCTGAAAGAGA	0.478																																						uc002neh.1		NA																	0					0						c.(187-189)CTC>CTG		hypothetical protein LOC84167							106.0	120.0	115.0					19																	16611792		2203	4300	6503	SO:0001819	synonymous_variant	84167							g.chr19:16611792C>G	AK025395	CCDS12345.1, CCDS74306.1	19p13.11	2011-11-24			ENSG00000105072	ENSG00000105072			26141	protein-coding gene	gene with protein product						12477932	Standard	NM_032207		Approved	FLJ21742	uc002neh.1	Q9H6X5		ENST00000221671.3:c.189C>G	19.37:g.16611792C>G			Somatic				MED26_uc002nee.2_Intron|C19orf44_uc002nef.1_Silent_p.L63L|C19orf44_uc002neg.2_Silent_p.L63L|C19orf44_uc010eai.1_RNA	p.L63L	NM_032207	NP_115583	WXS	Illumina HiSeq	Unspecified	Q9H6X5	CS044_HUMAN			2	262	+			63					Q8N6Y7	Silent	SNP	ENST00000221671.3	37	c.189C>G	CCDS12345.1																																																																																				0.478	C19orf44-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461218.1	NM_032207		26	192	0	0	0	0	26	192				
NWD1	284434	broad.mit.edu	37	19	16875993	16875993	+	Silent	SNP	C	C	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr19:16875993C>A	ENST00000552788.1	+	8	2400	c.2400C>A	c.(2398-2400)ctC>ctA	p.L800L	NWD1_ENST00000549814.1_Silent_p.L800L|NWD1_ENST00000524140.2_Silent_p.L800L|NWD1_ENST00000379808.3_Silent_p.L800L|NWD1_ENST00000523826.1_Silent_p.L594L|NWD1_ENST00000339803.6_Silent_p.L665L			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	800							ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						CTGTGGAGCTCCGAGGCATGG	0.587																																						uc002neu.3		NA																	0				skin(3)|ovary(2)|pancreas(2)	7						c.(2398-2400)CTC>CTA		RecName: Full=NACHT and WD repeat domain-containing protein 1;							60.0	54.0	56.0					19																	16875993		2203	4300	6503	SO:0001819	synonymous_variant	284434						ATP binding	g.chr19:16875993C>A	BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.2400C>A	19.37:g.16875993C>A			Somatic				NWD1_uc002net.3_Silent_p.L665L|NWD1_uc002nev.3_Silent_p.L594L	p.L800L			WXS	Illumina HiSeq	Unspecified	Q149M9	NWD1_HUMAN			10	2822	+			800					C9J021|Q68CT3	Silent	SNP	ENST00000552788.1	37	c.2400C>A																																																																																					0.587	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000403569.1	NM_001007525		5	25	1	0	0.000602214	0.000618211	5	25				
COLGALT1	79709	broad.mit.edu	37	19	17691701	17691701	+	Missense_Mutation	SNP	G	G	A	rs543254139		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr19:17691701G>A	ENST00000252599.4	+	11	1708	c.1588G>A	c.(1588-1590)Gac>Aac	p.D530N		NM_024656.2	NP_078932.2	Q8NBJ5	GT251_HUMAN	collagen beta(1-O)galactosyltransferase 1	530					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)	procollagen galactosyltransferase activity (GO:0050211)										CGTCATGTTCGACAAACACCC	0.632																																						uc002nhc.1		NA																	0					0						c.(1588-1590)GAC>AAC		glycosyltransferase 25 domain containing 1							46.0	43.0	44.0					19																	17691701		2203	4300	6503	SO:0001583	missense	79709				lipopolysaccharide biosynthetic process	endoplasmic reticulum lumen	procollagen galactosyltransferase activity	g.chr19:17691701G>A	AK075541	CCDS12363.1	19p13.11	2013-02-27	2013-02-27	2013-02-27	ENSG00000130309	ENSG00000130309			26182	protein-coding gene	gene with protein product			"""glycosyltransferase 25 domain containing 1"""	GLT25D1		19075007	Standard	NM_024656		Approved	FLJ22329	uc002nhc.1	Q8NBJ5		ENST00000252599.4:c.1588G>A	19.37:g.17691701G>A	ENSP00000252599:p.Asp530Asn		Somatic				GLT25D1_uc010eax.1_Missense_Mutation_p.D258N|GLT25D1_uc010eay.1_Missense_Mutation_p.D59N	p.D530N	NM_024656	NP_078932	WXS	Illumina HiSeq	Unspecified	Q8NBJ5	GT251_HUMAN			11	1600	+			530					Q8NC64	Missense_Mutation	SNP	ENST00000252599.4	37	c.1588G>A	CCDS12363.1	.	.	.	.	.	.	.	.	.	.	G	11.87	1.769150	0.31320	.	.	ENSG00000130309	ENST00000252599	T	0.76448	-1.02	5.24	5.24	0.73138	.	0.047167	0.85682	D	0.000000	T	0.60650	0.2285	N	0.10874	0.06	0.51767	D	0.999938	B;B	0.14012	0.009;0.007	B;B	0.09377	0.003;0.004	T	0.56589	-0.7954	10	0.17369	T	0.5	-0.7924	16.2945	0.82763	0.0:0.0:1.0:0.0	.	59;530	B3KQ10;Q8NBJ5	.;GT251_HUMAN	N	530	ENSP00000252599:D530N	ENSP00000252599:D530N	D	+	1	0	GLT25D1	17552701	1.000000	0.71417	0.997000	0.53966	0.831000	0.47069	4.078000	0.57606	2.456000	0.83038	0.491000	0.48974	GAC		0.632	COLGALT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464216.1	NM_024656		6	35	0	0	0	0	6	35				
FCHO1	23149	broad.mit.edu	37	19	17875220	17875220	+	Silent	SNP	G	G	A	rs148025294		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr19:17875220G>A	ENST00000596536.1	+	6	439	c.156G>A	c.(154-156)gcG>gcA	p.A52A	FCHO1_ENST00000599236.1_3'UTR|FCHO1_ENST00000600676.1_Silent_p.A52A|FCHO1_ENST00000594202.1_Silent_p.A52A|FCHO1_ENST00000597512.1_Silent_p.A59A|FCHO1_ENST00000539407.1_Silent_p.A52A|FCHO1_ENST00000252771.7_Silent_p.A52A|FCHO1_ENST00000596951.1_Silent_p.A52A|FCHO1_ENST00000389133.4_Silent_p.A52A|FCHO1_ENST00000595033.1_Silent_p.A2A	NM_015122.2	NP_055937.1	O14526	FCHO1_HUMAN	FCH domain only 1	52	FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.|Mediates membrane-binding.				clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	AP-2 adaptor complex binding (GO:0035612)			NS(2)|breast(1)|large_intestine(6)|liver(1)|lung(12)	22						AGGCGATGGCGAAACTCTCCA	0.602																																						uc010ebb.2		NA																	0				breast(1)	1						c.(154-156)GCG>GCA		FCH domain only 1 isoform b		G	,,,	0,4406		0,0,2203	54.0	50.0	51.0		156,156,6,156	-10.3	0.7	19	dbSNP_134	51	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	FCHO1	NM_001161357.1,NM_001161358.1,NM_001161359.1,NM_015122.2	,,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,,	52/892,52/890,2/840,52/890	17875220	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	23149							g.chr19:17875220G>A	AB006628	CCDS32955.1, CCDS59365.1, CCDS59366.1	19p13.12	2008-02-05				ENSG00000130475			29002	protein-coding gene	gene with protein product		613437				12477932	Standard	NM_001161357		Approved	KIAA0290	uc002nhg.3	O14526		ENST00000596536.1:c.156G>A	19.37:g.17875220G>A			Somatic				FCHO1_uc002nhg.3_Silent_p.A52A|FCHO1_uc002nhh.2_Silent_p.A52A|FCHO1_uc010xpw.1_Silent_p.A2A|FCHO1_uc010ebc.1_Silent_p.A59A	p.A52A	NM_001161358	NP_001154830	WXS	Illumina HiSeq	Unspecified	O14526	FCHO1_HUMAN			5	345	+			52			FCH.		A6NHE6|A8K5U5|B4E120|Q05C93|Q8IW22	Silent	SNP	ENST00000596536.1	37	c.156G>A	CCDS32955.1																																																																																				0.602	FCHO1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466946.2	NM_015122		9	38	0	0	0	0	9	38				
GDF15	9518	broad.mit.edu	37	19	18497038	18497038	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr19:18497038G>C	ENST00000252809.3	+	1	71	c.39G>C	c.(37-39)caG>caC	p.Q13H	MIR3189_ENST00000578735.1_RNA	NM_004864.2	NP_004855.2	Q99988	GDF15_HUMAN	growth differentiation factor 15	13					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cytokine activity (GO:0005125)			kidney(2)|large_intestine(1)|liver(1)|lung(5)|prostate(2)|skin(1)	12						ATGGCTCTCAGATGCTCCTGG	0.647																																						uc002niv.2		NA																	0				central_nervous_system(1)	1						c.(37-39)CAG>CAC		growth differentiation factor 15							50.0	52.0	51.0					19																	18497038		2203	4300	6503	SO:0001583	missense	9518				cell-cell signaling|transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|growth factor activity	g.chr19:18497038G>C	BC008962	CCDS12376.1	19p13.11	2008-05-14				ENSG00000130513			30142	protein-coding gene	gene with protein product	"""prostate differentiation factor"""	605312				11895857, 9593718	Standard	NM_004864		Approved	PLAB, MIC-1, PDF, MIC1, NAG-1, PTGFB	uc002niv.2	Q99988		ENST00000252809.3:c.39G>C	19.37:g.18497038G>C	ENSP00000252809:p.Gln13His		Somatic				hsa-mir-3189|MI0014233_5'Flank	p.Q13H	NM_004864	NP_004855	WXS	Illumina HiSeq	Unspecified	Q99988	GDF15_HUMAN			1	71	+			13					O14629|P78360|Q9BWA0|Q9NRT0	Missense_Mutation	SNP	ENST00000252809.3	37	c.39G>C	CCDS12376.1	.	.	.	.	.	.	.	.	.	.	G	12.29	1.893859	0.33442	.	.	ENSG00000130513	ENST00000252809	D	0.81499	-1.5	4.17	-5.28	0.02755	.	4.517450	0.01149	N	0.006368	T	0.66107	0.2756	N	0.24115	0.695	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.53592	-0.8417	10	0.14656	T	0.56	-0.5647	10.0981	0.42488	0.1001:0.6468:0.2531:0.0	.	13	Q99988	GDF15_HUMAN	H	13	ENSP00000252809:Q13H	ENSP00000252809:Q13H	Q	+	3	2	GDF15	18358038	0.000000	0.05858	0.000000	0.03702	0.096000	0.18686	-2.686000	0.00834	-0.319000	0.08652	0.313000	0.20887	CAG		0.647	GDF15-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466340.2	NM_004864		5	39	0	0	0	0	5	39				
ZNF682	91120	broad.mit.edu	37	19	20117110	20117110	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr19:20117110C>T	ENST00000397165.2	-	4	1361	c.1201G>A	c.(1201-1203)Gaa>Aaa	p.E401K	ZNF682_ENST00000358523.5_Missense_Mutation_p.E369K|ZNF682_ENST00000397162.1_Missense_Mutation_p.E369K|ZNF682_ENST00000596019.1_Intron|ZNF682_ENST00000597972.1_Missense_Mutation_p.E407K|ZNF682_ENST00000595736.1_Missense_Mutation_p.E325K	NM_033196.2	NP_149973.1	O95780	ZN682_HUMAN	zinc finger protein 682	401					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	14						TTGCCACATTCTTCACATTTG	0.378																																						uc002noq.2		NA																	0				ovary(1)|pancreas(1)	2						c.(1201-1203)GAA>AAA		zinc finger protein 682 isoform 1							66.0	72.0	70.0					19																	20117110		2147	4268	6415	SO:0001583	missense	91120				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:20117110C>T	AC006539	CCDS42533.1, CCDS42534.1	19p12	2014-02-13			ENSG00000197124	ENSG00000197124		"""Zinc fingers, C2H2-type"", ""-"""	28857	protein-coding gene	gene with protein product							Standard	NM_033196		Approved	BC39498_3	uc002noq.3	O95780	OTTHUMG00000182650	ENST00000397165.2:c.1201G>A	19.37:g.20117110C>T	ENSP00000380351:p.Glu401Lys		Somatic				ZNF682_uc002noo.2_Missense_Mutation_p.E369K|ZNF682_uc002nop.2_Missense_Mutation_p.E369K|ZNF682_uc010eck.2_Missense_Mutation_p.E325K	p.E401K	NM_033196	NP_149973	WXS	Illumina HiSeq	Unspecified	O95780	ZN682_HUMAN			4	1324	-			401			C2H2-type 9.		B3KU64|E9PFJ5|Q96JV9	Missense_Mutation	SNP	ENST00000397165.2	37	c.1201G>A	CCDS42533.1	.	.	.	.	.	.	.	.	.	.	C	14.74	2.625598	0.46840	.	.	ENSG00000197124	ENST00000397165;ENST00000397162;ENST00000341262;ENST00000358523	T;T;T	0.41758	0.99;0.99;0.99	1.09	1.09	0.20402	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.35885	0.0947	N	0.26162	0.8	0.20307	N	0.999915	P	0.42483	0.781	P	0.47705	0.555	T	0.21552	-1.0242	9	0.72032	D	0.01	.	7.5768	0.27942	0.0:1.0:0.0:0.0	.	401	O95780	ZN682_HUMAN	K	401;369;70;369	ENSP00000380351:E401K;ENSP00000380348:E369K;ENSP00000351324:E369K	ENSP00000340236:E70K	E	-	1	0	ZNF682	19978110	0.000000	0.05858	0.954000	0.39281	0.947000	0.59692	-0.818000	0.04467	0.488000	0.27723	0.491000	0.48974	GAA		0.378	ZNF682-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462888.1	NM_033196		16	77	0	0	0	0	16	77				
ZNF536	9745	broad.mit.edu	37	19	31038871	31038871	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr19:31038871C>T	ENST00000355537.3	+	4	2492	c.2345C>T	c.(2344-2346)cCg>cTg	p.P782L		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	782					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					TACAAGTGTCCGCACTGTGAC	0.502																																						uc002nsu.1		NA																	0				ovary(7)|large_intestine(2)|skin(2)	11						c.(2344-2346)CCG>CTG		zinc finger protein 536							60.0	63.0	62.0					19																	31038871		2203	4300	6503	SO:0001583	missense	9745				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr19:31038871C>T		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.2345C>T	19.37:g.31038871C>T	ENSP00000347730:p.Pro782Leu		Somatic				ZNF536_uc010edd.1_Missense_Mutation_p.P782L	p.P782L	NM_014717	NP_055532	WXS	Illumina HiSeq	Unspecified	O15090	ZN536_HUMAN			4	2483	+	Esophageal squamous(110;0.0834)		782			C2H2-type 9.		A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	c.2345C>T	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.943166	0.73672	.	.	ENSG00000198597	ENST00000355537	T	0.07114	3.22	6.08	6.08	0.98989	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.23410	0.0566	L	0.35854	1.095	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.00067	-1.2143	10	0.48119	T	0.1	-30.3751	20.6721	0.99693	0.0:1.0:0.0:0.0	.	782;782	A7E228;O15090	.;ZN536_HUMAN	L	782	ENSP00000347730:P782L	ENSP00000347730:P782L	P	+	2	0	ZNF536	35730711	1.000000	0.71417	0.953000	0.39169	0.976000	0.68499	7.481000	0.81124	2.894000	0.99253	0.591000	0.81541	CCG		0.502	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		13	70	0	0	0	0	13	70				
HPN	3249	broad.mit.edu	37	19	35551551	35551551	+	Missense_Mutation	SNP	G	G	T	rs374894952		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr19:35551551G>T	ENST00000262626.2	+	9	1466	c.641G>T	c.(640-642)cGa>cTa	p.R214L	HPN-AS1_ENST00000392227.2_RNA|HPN_ENST00000392226.1_Missense_Mutation_p.R214L|HPN_ENST00000597419.1_Missense_Mutation_p.R56L	NM_182983.2	NP_892028.1	P05981	HEPS_HUMAN	hepsin	214	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				basement membrane disassembly (GO:0034769)|cholesterol homeostasis (GO:0042632)|cochlea morphogenesis (GO:0090103)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|epithelium development (GO:0060429)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pilomotor reflex (GO:0097195)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of cell growth (GO:0030307)|positive regulation of gene expression (GO:0010628)|positive regulation of hepatocyte proliferation (GO:2000347)|positive regulation of plasminogen activation (GO:0010756)|positive regulation of thyroid hormone generation (GO:2000611)|potassium ion transmembrane transport (GO:0071805)|proteolysis (GO:0006508)|regulation of cell shape (GO:0008360)|response to thyroid hormone (GO:0097066)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium-activated potassium channel activity (GO:0015269)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)|serine-type peptidase activity (GO:0008236)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|upper_aerodigestive_tract(2)	19	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)		Coagulation factor VIIa(DB00036)	GTCCTGTCCCGATGGCGAGTG	0.682																																						uc002nxq.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(640-642)CGA>CTA		hepsin	Coagulation factor VIIa(DB00036)						69.0	61.0	64.0					19																	35551551		2203	4300	6503	SO:0001583	missense	3249				cell growth|proteolysis	cytoplasm|integral to plasma membrane	scavenger receptor activity|serine-type endopeptidase activity	g.chr19:35551551G>T		CCDS32993.1	19q13.12	2013-04-25	2008-12-08		ENSG00000105707	ENSG00000105707		"""Serine peptidases / Transmembrane"""	5155	protein-coding gene	gene with protein product	"""transmembrane protease, serine 1"""	142440				2835076	Standard	NM_182983		Approved	TMPRSS1	uc002nxq.2	P05981	OTTHUMG00000182474	ENST00000262626.2:c.641G>T	19.37:g.35551551G>T	ENSP00000262626:p.Arg214Leu		Somatic				HPN_uc002nxr.1_Missense_Mutation_p.R214L|HPN_uc002nxs.1_Missense_Mutation_p.R56L|HPN_uc010xsh.1_Missense_Mutation_p.R183L|HPN_uc002nxt.1_Missense_Mutation_p.R98L|LOC100128675_uc010xsi.1_Intron	p.R214L	NM_002151	NP_002142	WXS	Illumina HiSeq	Unspecified	P05981	HEPS_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0849)		10	886	+	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		214			Extracellular (Potential).|Peptidase S1.		B2RDS4	Missense_Mutation	SNP	ENST00000262626.2	37	c.641G>T	CCDS32993.1	.	.	.	.	.	.	.	.	.	.	G	15.72	2.916329	0.52546	.	.	ENSG00000105707	ENST00000262626;ENST00000392226;ENST00000541345	D;D	0.88896	-2.44;-2.44	4.66	4.66	0.58398	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.199814	0.43579	D	0.000559	T	0.79106	0.4390	N	0.12502	0.225	0.25989	N	0.982278	D;P;D	0.53151	0.958;0.948;0.957	P;P;P	0.47673	0.448;0.554;0.454	T	0.69359	-0.5166	10	0.12430	T	0.62	.	8.6325	0.33928	0.1023:0.0:0.8977:0.0	.	186;214;214	B7Z1L4;B2ZDQ2;P05981	.;.;HEPS_HUMAN	L	214;214;186	ENSP00000262626:R214L;ENSP00000376060:R214L	ENSP00000262626:R214L	R	+	2	0	HPN	40243391	0.793000	0.28825	0.109000	0.21407	0.832000	0.47134	2.936000	0.48971	2.416000	0.81992	0.555000	0.69702	CGA		0.682	HPN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461573.1	NM_002151		10	39	1	0	3.07e-06	3.22e-06	10	39				
CD22	933	broad.mit.edu	37	19	35828818	35828818	+	Silent	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr19:35828818G>A	ENST00000085219.5	+	5	945	c.879G>A	c.(877-879)acG>acA	p.T293T	CD22_ENST00000341773.6_Intron|CD22_ENST00000536635.2_Silent_p.T293T|CD22_ENST00000544992.2_Silent_p.T293T|CD22_ENST00000270311.6_Silent_p.T173T|CD22_ENST00000594250.1_Intron|CD22_ENST00000419549.2_Silent_p.T121T	NM_001771.3	NP_001762.2	P20273	CD22_HUMAN	CD22 molecule	293	Ig-like C2-type 2.				cell adhesion (GO:0007155)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)	p.T293T(1)		breast(2)|endometrium(2)|kidney(3)|large_intestine(14)|lung(21)|ovary(5)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	54	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			ATACATTCACGCTAAACCTGC	0.567																																					Ovarian(42;1009 1133 23674 26041)	uc010edt.2		NA																	1	Substitution - coding silent(1)	p.T293T(1)	ovary(1)	ovary(5)|lung(3)|breast(1)	9						c.(877-879)ACG>ACA		CD22 molecule precursor	OspA lipoprotein(DB00045)						111.0	77.0	88.0					19																	35828818		2203	4300	6503	SO:0001819	synonymous_variant	933				cell adhesion		protein binding|sugar binding	g.chr19:35828818G>A	X52785	CCDS12457.1, CCDS54247.1, CCDS54248.1, CCDS54249.1, CCDS62634.1	19q13.1	2013-01-29	2006-03-28		ENSG00000012124	ENSG00000012124		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1643	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 2"""	107266	"""CD22 antigen"""			8496602, 1691828	Standard	NM_001185099		Approved	SIGLEC-2, SIGLEC2	uc010edt.3	P20273		ENST00000085219.5:c.879G>A	19.37:g.35828818G>A			Somatic				CD22_uc010xst.1_Silent_p.T121T|CD22_uc010edu.2_Silent_p.T293T|CD22_uc010edv.2_Silent_p.T293T|CD22_uc002nzb.3_Intron|CD22_uc010edx.2_RNA	p.T293T	NM_001771	NP_001762	WXS	Illumina HiSeq	Unspecified	P20273	CD22_HUMAN	Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)		5	956	+	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		293			Extracellular (Potential).|Ig-like C2-type 2.		F5GYU4|F5H7U3|O95699|O95701|O95702|O95703|Q01665|Q32M46|Q92872|Q92873|Q9UQA6|Q9UQA7|Q9UQA8|Q9UQA9|Q9UQB0|Q9Y2A6	Silent	SNP	ENST00000085219.5	37	c.879G>A	CCDS12457.1																																																																																				0.567	CD22-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466099.1	NM_001771		4	43	0	0	0	0	4	43				
GAPDHS	26330	broad.mit.edu	37	19	36033280	36033280	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr19:36033280C>G	ENST00000222286.4	+	5	625	c.509C>G	c.(508-510)aCa>aGa	p.T170R	AD000090.2_ENST00000589137.1_RNA|AD000090.2_ENST00000590125.1_RNA|AD000090.2_ENST00000588286.1_RNA|AD000090.2_ENST00000590717.1_RNA|AD000090.2_ENST00000444728.1_RNA	NM_014364.4	NP_055179.1	O14556	G3PT_HUMAN	glyceraldehyde-3-phosphate dehydrogenase, spermatogenic	170					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|positive regulation of glycolytic process (GO:0045821)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	cytosol (GO:0005829)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity (GO:0004365)|NAD binding (GO:0051287)|NADP binding (GO:0050661)			endometrium(1)|kidney(1)|large_intestine(1)|lung(8)	11	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			GTGGAGTCCACAGGCGTGTAC	0.637																																						uc002oaf.1		NA																	0					0						c.(508-510)ACA>AGA		glyceraldehyde-3-phosphate dehydrogenase,	NADH(DB00157)						52.0	50.0	51.0					19																	36033280		2203	4300	6503	SO:0001583	missense	26330				gluconeogenesis|glycolysis|positive regulation of glycolysis|sperm motility	cytosol	glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity|NAD binding|protein binding	g.chr19:36033280C>G	AJ005371	CCDS12465.1	19q13.1	2008-02-05		2005-05-06		ENSG00000105679			24864	protein-coding gene	gene with protein product		609169		GAPDS		10714828	Standard	NM_014364		Approved	GAPDH-2, GAPD2	uc002oaf.1	O14556		ENST00000222286.4:c.509C>G	19.37:g.36033280C>G	ENSP00000222286:p.Thr170Arg		Somatic				uc010eec.1_Intron|uc002oag.2_Intron	p.T170R	NM_014364	NP_055179	WXS	Illumina HiSeq	Unspecified	O14556	G3PT_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0724)		5	625	+	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		170					B2RC82|O60823|Q6JTT9|Q9HCU6	Missense_Mutation	SNP	ENST00000222286.4	37	c.509C>G	CCDS12465.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.663475	0.88251	.	.	ENSG00000105679	ENST00000222286	T	0.54071	0.59	5.24	5.24	0.73138	Glyceraldehyde 3-phosphate dehydrogenase, NAD(P) binding domain (2);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.82852	0.5127	H	0.98446	4.235	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88995	0.3417	10	0.87932	D	0	-22.1559	14.6698	0.68934	0.0:1.0:0.0:0.0	.	170	O14556	G3PT_HUMAN	R	170	ENSP00000222286:T170R	ENSP00000222286:T170R	T	+	2	0	GAPDHS	40725120	1.000000	0.71417	0.997000	0.53966	0.889000	0.51656	7.468000	0.80943	2.618000	0.88619	0.462000	0.41574	ACA		0.637	GAPDHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460423.1	NM_014364		8	38	0	0	0	0	8	38				
ZNF570	148268	broad.mit.edu	37	19	37975067	37975067	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr19:37975067G>C	ENST00000330173.1	+	5	1072	c.543G>C	c.(541-543)aaG>aaC	p.K181N	ZNF570_ENST00000586475.1_Missense_Mutation_p.K237N|ZNF570_ENST00000388801.3_5'UTR	NM_144694.1	NP_653295.1	Q96NI8	ZN570_HUMAN	zinc finger protein 570	181					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(1)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GTACACAAAAGATAATCCCCA	0.358																																						uc002ogk.1		NA																	0				ovary(1)	1						c.(541-543)AAG>AAC		zinc finger protein 570							107.0	120.0	115.0					19																	37975067		2201	4300	6501	SO:0001583	missense	148268				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:37975067G>C	AK055353	CCDS12504.1, CCDS74355.1	19q13.12	2013-09-20			ENSG00000171827	ENSG00000171827		"""Zinc fingers, C2H2-type"", ""-"""	26416	protein-coding gene	gene with protein product							Standard	XM_005258567		Approved	FLJ30791	uc002ogk.1	Q96NI8	OTTHUMG00000048176	ENST00000330173.1:c.543G>C	19.37:g.37975067G>C	ENSP00000331540:p.Lys181Asn		Somatic				ZNF570_uc010efl.1_Missense_Mutation_p.K237N|ZNF570_uc010xtr.1_5'UTR	p.K181N	NM_144694	NP_653295	WXS	Illumina HiSeq	Unspecified	Q96NI8	ZN570_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)		5	1072	+			181					A1L472|B4DMP1	Missense_Mutation	SNP	ENST00000330173.1	37	c.543G>C	CCDS12504.1	.	.	.	.	.	.	.	.	.	.	G	5.423	0.263207	0.10294	.	.	ENSG00000171827	ENST00000330173	T	0.04603	3.59	4.74	2.62	0.31277	.	3.155360	0.01121	N	0.005781	T	0.09555	0.0235	M	0.64170	1.965	0.80722	D	1	B	0.18166	0.026	B	0.14023	0.01	T	0.26573	-1.0099	10	0.72032	D	0.01	.	8.9229	0.35623	0.1825:0.0:0.8175:0.0	.	181	Q96NI8	ZN570_HUMAN	N	181	ENSP00000331540:K181N	ENSP00000331540:K181N	K	+	3	2	ZNF570	42666907	0.005000	0.15991	0.988000	0.46212	0.212000	0.24457	0.923000	0.28757	0.715000	0.32103	0.563000	0.77884	AAG		0.358	ZNF570-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109600.1	NM_144694		42	183	0	0	0	0	42	183				
FBXO17	115290	broad.mit.edu	37	19	39437135	39437135	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr19:39437135C>G	ENST00000292852.4	-	4	875	c.534G>C	c.(532-534)caG>caC	p.Q178H	SARS2_ENST00000448145.2_Missense_Mutation_p.Q13H|FBXO17_ENST00000595329.1_Missense_Mutation_p.Q178H|CTC-360G5.8_ENST00000599996.1_Missense_Mutation_p.D83H	NM_024907.5	NP_079183.4	Q96EF6	FBX17_HUMAN	F-box protein 17	178	FBA. {ECO:0000255|PROSITE- ProRule:PRU00482}.					SCF ubiquitin ligase complex (GO:0019005)	glycoprotein binding (GO:0001948)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)	7	all_cancers(60;8.37e-07)|all_lung(34;3.71e-07)|Lung NSC(34;4.17e-07)|all_epithelial(25;1.13e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			AGATCTCAATCTGGGCGCTGT	0.637																																						uc010xuq.1		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(37-39)CAG>CAC		seryl-tRNA synthetase 2 isoform b precursor							79.0	65.0	70.0					19																	39437135		2203	4300	6503	SO:0001583	missense	54938				seryl-tRNA aminoacylation	mitochondrial matrix	ATP binding|protein binding|serine-tRNA ligase activity	g.chr19:39437135C>G	AF386743	CCDS12526.1	19q13.2	2010-07-02	2004-06-15	2004-06-16		ENSG00000269190		"""F-boxes /  ""other"""""	18754	protein-coding gene	gene with protein product	"""F-box only protein 26"""	609094	"""F-box only protein 17"""	FBXO26			Standard	NM_148169		Approved	FBG4, FLJ25205, MGC9379, FLJ11798, Fbx17		Q96EF6		ENST00000292852.4:c.534G>C	19.37:g.39437135C>G	ENSP00000292852:p.Gln178His		Somatic				FBXO17_uc002okg.1_Missense_Mutation_p.Q178H|FBXO17_uc002okf.1_Missense_Mutation_p.Q187H	p.Q13H	NM_017827	NP_060297	WXS	Illumina HiSeq	Unspecified	Q9NP81	SYSM_HUMAN	Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)		3	247	-	all_cancers(60;2.74e-06)|all_epithelial(25;4.36e-06)|Ovarian(47;0.0454)		Error:Variant_position_missing_in_Q9NP81_after_alignment					Q96LQ4	Missense_Mutation	SNP	ENST00000292852.4	37	c.39G>C	CCDS12526.1	.	.	.	.	.	.	.	.	.	.	C	12.94	2.089340	0.36855	.	.	ENSG00000104835	ENST00000448145;ENST00000392076;ENST00000292852	T;T	0.36157	1.27;1.27	4.25	-0.408	0.12381	Galactose-binding domain-like (1);F-box associated (FBA) domain (2);	0.127127	0.34200	N	0.004174	T	0.48352	0.1495	M	0.73962	2.25	.	.	.	P;D	0.65815	0.918;0.995	P;P	0.60789	0.601;0.879	T	0.57505	-0.7800	9	0.62326	D	0.03	.	6.7022	0.23230	0.0:0.5834:0.0:0.4166	.	13;178	E7EX87;Q96EF6	.;FBX17_HUMAN	H	13;187;178	ENSP00000399330:Q13H;ENSP00000292852:Q178H	ENSP00000292852:Q178H	Q	-	3	2	FBXO17	44128975	0.000000	0.05858	0.995000	0.50966	0.971000	0.66376	-0.964000	0.03833	-0.044000	0.13491	0.455000	0.32223	CAG		0.637	FBXO17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463273.1	NM_024907		12	49	0	0	0	0	12	49				
CCDC97	90324	broad.mit.edu	37	19	41828509	41828509	+	Silent	SNP	C	C	T	rs143105404		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr19:41828509C>T	ENST00000269967.3	+	5	1043	c.921C>T	c.(919-921)gaC>gaT	p.D307D		NM_052848.1	NP_443080.1	Q96F63	CCD97_HUMAN	coiled-coil domain containing 97	307										biliary_tract(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)	17						GCACAGTAGACGACAACCCCG	0.612																																						uc002oqg.2		NA																	0					0						c.(919-921)GAC>GAT		coiled-coil domain containing 97				2,4404	4.2+/-10.8	0,2,2201	133.0	110.0	118.0		921	-3.4	1.0	19	dbSNP_134	118	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CCDC97	NM_052848.1		0,3,6500	TT,TC,CC		0.0116,0.0454,0.0231		307/344	41828509	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	90324							g.chr19:41828509C>T	BC011577	CCDS12578.1	19q13.2	2008-02-05							28289	protein-coding gene	gene with protein product						12477932	Standard	NM_052848		Approved	FLJ40267, MGC20255	uc002oqg.3	Q96F63		ENST00000269967.3:c.921C>T	19.37:g.41828509C>T			Somatic				CYP2F1_uc010xvw.1_Intron	p.D307D	NM_052848	NP_443080	WXS	Illumina HiSeq	Unspecified	Q96F63	CCD97_HUMAN			5	1043	+			307					Q658N6|Q96IF3	Silent	SNP	ENST00000269967.3	37	c.921C>T	CCDS12578.1																																																																																				0.612	CCDC97-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463293.1	NM_052848		9	88	0	0	0	0	9	88				
LIPE	3991	broad.mit.edu	37	19	42907160	42907160	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr19:42907160C>T	ENST00000244289.4	-	9	2842	c.2566G>A	c.(2566-2568)Gaa>Aaa	p.E856K	LIPE-AS1_ENST00000593491.2_RNA|LIPE-AS1_ENST00000594624.2_RNA|LIPE-AS1_ENST00000597203.1_RNA|LIPE-AS1_ENST00000599276.1_RNA	NM_005357.2	NP_005348.2	Q05469	LIPS_HUMAN	lipase, hormone-sensitive	856					cholesterol metabolic process (GO:0008203)|diacylglycerol catabolic process (GO:0046340)|lipid catabolic process (GO:0016042)|long-chain fatty acid catabolic process (GO:0042758)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)	hormone-sensitive lipase activity (GO:0033878)|triglyceride lipase activity (GO:0004806)			breast(2)|endometrium(4)|kidney(7)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	32		Prostate(69;0.00682)				AGTGCTGCTTCAGACACACTG	0.617																																						uc002otr.2		NA																	0				ovary(1)|breast(1)	2						c.(2566-2568)GAA>AAA		hormone-sensitive lipase							48.0	47.0	47.0					19																	42907160		2203	4300	6503	SO:0001583	missense	3991				cholesterol metabolic process|protein phosphorylation|triglyceride catabolic process	caveola|cytosol	hormone-sensitive lipase activity|protein binding	g.chr19:42907160C>T	L11706	CCDS12607.1	19q13.1-q13.2	2014-03-14			ENSG00000079435	ENSG00000079435	3.1.1.3		6621	protein-coding gene	gene with protein product		151750				8506334	Standard	NM_005357		Approved	HSL	uc002otr.3	Q05469	OTTHUMG00000182814	ENST00000244289.4:c.2566G>A	19.37:g.42907160C>T	ENSP00000244289:p.Glu856Lys		Somatic				uc010eif.1_Intron	p.E856K	NM_005357	NP_005348	WXS	Illumina HiSeq	Unspecified	Q05469	LIPS_HUMAN			9	2843	-		Prostate(69;0.00682)	856					Q3LRT2|Q6NSL7	Missense_Mutation	SNP	ENST00000244289.4	37	c.2566G>A	CCDS12607.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.878679	0.91740	.	.	ENSG00000079435	ENST00000244289	T	0.04758	3.56	5.23	5.23	0.72850	.	0.622315	0.14699	N	0.303670	T	0.08802	0.0218	M	0.69823	2.125	0.41919	D	0.990501	P	0.43094	0.799	B	0.38378	0.272	T	0.17349	-1.0372	10	0.37606	T	0.19	-18.6525	14.6702	0.68937	0.0:1.0:0.0:0.0	.	856	Q05469	LIPS_HUMAN	K	856	ENSP00000244289:E856K	ENSP00000244289:E856K	E	-	1	0	LIPE	47599000	0.896000	0.30565	0.888000	0.34837	0.995000	0.86356	3.957000	0.56730	2.609000	0.88269	0.591000	0.81541	GAA		0.617	LIPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463861.1	NM_005357		6	52	0	0	0	0	6	52				
FBXO46	23403	broad.mit.edu	37	19	46215859	46215859	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr19:46215859G>A	ENST00000317683.3	-	2	1028	c.895C>T	c.(895-897)Cga>Tga	p.R299*		NM_001080469.1	NP_001073938.1	Q6PJ61	FBX46_HUMAN	F-box protein 46	299										breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(2)|skin(1)	15		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00568)|GBM - Glioblastoma multiforme(486;0.0844)|Epithelial(262;0.201)		TCCTTGGCTCGGGCCCCAGGA	0.682																																						uc002pcy.2		NA																	0				ovary(1)|lung(1)|breast(1)	3						c.(895-897)CGA>TGA		F-box protein 46							29.0	33.0	32.0					19																	46215859		1986	4146	6132	SO:0001587	stop_gained	23403						protein binding	g.chr19:46215859G>A	BC021978	CCDS46116.1	19q13.3	2008-02-05	2004-06-15	2004-06-16		ENSG00000177051		"""F-boxes /  ""other"""""	25069	protein-coding gene	gene with protein product		609117	"""F-box only protein 34-like"""	FBXO34L		9585442	Standard	NM_001080469		Approved	20D7-FC4, Fbx46	uc002pcz.3	Q6PJ61		ENST00000317683.3:c.895C>T	19.37:g.46215859G>A	ENSP00000410007:p.Arg299*		Somatic				FBXO46_uc002pcz.2_Nonsense_Mutation_p.R299*	p.R299*	NM_001080469	NP_001073938	WXS	Illumina HiSeq	Unspecified	Q6PJ61	FBX46_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00568)|GBM - Glioblastoma multiforme(486;0.0844)|Epithelial(262;0.201)	2	1020	-		Ovarian(192;0.179)|all_neural(266;0.224)	299						Nonsense_Mutation	SNP	ENST00000317683.3	37	c.895C>T	CCDS46116.1	.	.	.	.	.	.	.	.	.	.	G	15.38	2.815402	0.50527	.	.	ENSG00000177051	ENST00000317683	.	.	.	4.06	2.99	0.34606	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.56	8.7078	0.34365	0.0:0.0:0.7731:0.2269	.	.	.	.	X	299	.	ENSP00000410007:R299X	R	-	1	2	FBXO46	50907699	1.000000	0.71417	0.597000	0.28824	0.212000	0.24457	1.302000	0.33459	0.887000	0.36136	0.563000	0.77884	CGA		0.682	FBXO46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459661.1	XM_371179		4	16	0	0	0	0	4	16				
PNMAL1	55228	broad.mit.edu	37	19	46973455	46973455	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr19:46973455C>T	ENST00000313683.10	-	2	1143	c.838G>A	c.(838-840)Gaa>Aaa	p.E280K	PNMAL1_ENST00000602246.1_Intron|PNMAL1_ENST00000438932.2_Missense_Mutation_p.E280K	NM_001103149.1|NM_018215.3	NP_001096619.1|NP_060685.2	Q86V59	PNML1_HUMAN	paraneoplastic Ma antigen family-like 1	280										cervix(1)|endometrium(2)|large_intestine(8)|lung(8)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25		Ovarian(192;0.00965)|all_neural(266;0.0459)		OV - Ovarian serous cystadenocarcinoma(262;0.000166)|all cancers(93;0.0014)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)		GCCATGCTTTCAGCATCACCC	0.517																																						uc002peq.3		NA																	0					0						c.(838-840)GAA>AAA		PNMA-like 1 isoform a							102.0	104.0	103.0					19																	46973455		2203	4300	6503	SO:0001583	missense	55228							g.chr19:46973455C>T	BC026026	CCDS33059.1, CCDS46124.1	19q13.32	2014-02-12	2012-02-09			ENSG00000182013		"""Paraneoplastic Ma antigens"""	25578	protein-coding gene	gene with protein product			"""PNMA-like 1"""			12477932	Standard	NM_018215		Approved	KIAA1183L, FLJ10781	uc002peq.4	Q86V59		ENST00000313683.10:c.838G>A	19.37:g.46973455C>T	ENSP00000318131:p.Glu280Lys		Somatic				PNMAL1_uc002per.3_Missense_Mutation_p.E280K	p.E280K	NM_018215	NP_060685	WXS	Illumina HiSeq	Unspecified	Q86V59	PNML1_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000166)|all cancers(93;0.0014)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)	2	1144	-		Ovarian(192;0.00965)|all_neural(266;0.0459)	280					A8K2F3|Q5U638|Q8N3H4|Q9NVE8	Missense_Mutation	SNP	ENST00000313683.10	37	c.838G>A	CCDS33059.1	.	.	.	.	.	.	.	.	.	.	C	11.39	1.625715	0.28889	.	.	ENSG00000182013	ENST00000438932;ENST00000313683	T;T	0.09630	2.96;2.96	3.94	1.75	0.24633	.	0.497868	0.16961	N	0.192503	T	0.05731	0.0150	N	0.17082	0.46	0.09310	N	1	B;B	0.22909	0.077;0.077	B;B	0.17098	0.017;0.017	T	0.34453	-0.9828	10	0.37606	T	0.19	.	5.3231	0.15891	0.0:0.6662:0.2192:0.1147	.	280;280	Q86V59-2;Q86V59	.;PNML1_HUMAN	K	280	ENSP00000410273:E280K;ENSP00000318131:E280K	ENSP00000318131:E280K	E	-	1	0	PNMAL1	51665295	0.000000	0.05858	0.001000	0.08648	0.018000	0.09664	0.191000	0.17076	0.604000	0.29930	0.655000	0.94253	GAA		0.517	PNMAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000403929.1	NM_018215		27	151	0	0	0	0	27	151				
LMTK3	114783	broad.mit.edu	37	19	49004553	49004553	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr19:49004553C>T	ENST00000600059.1	-	9	1215	c.988G>A	c.(988-990)Gag>Aag	p.E330K	LMTK3_ENST00000270238.3_Missense_Mutation_p.E359K			Q96Q04	LMTK3_HUMAN	lemur tyrosine kinase 3	330	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(9)|prostate(1)	16		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000114)|all cancers(93;0.000141)|Epithelial(262;0.00854)|GBM - Glioblastoma multiforme(486;0.0231)		ATGTTGCTCTCGCGGCTCTGG	0.662																																						uc002pjk.2		NA																	0				lung(5)|central_nervous_system(1)	6						c.(1075-1077)GAG>AAG		lemur tyrosine kinase 3							49.0	56.0	54.0					19																	49004553		1912	4120	6032	SO:0001583	missense	114783							g.chr19:49004553C>T	AB067470	CCDS46136.1	19q13.33	2014-06-12				ENSG00000142235			19295	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 101"""						Standard	NM_001080434		Approved	KIAA1883, LMR3, TYKLM3, PPP1R101	uc002pjk.3	Q96Q04		ENST00000600059.1:c.988G>A	19.37:g.49004553C>T	ENSP00000472020:p.Glu330Lys		Somatic					p.E359K	NM_001080434	NP_001073903	WXS	Illumina HiSeq	Unspecified				OV - Ovarian serous cystadenocarcinoma(262;0.000114)|all cancers(93;0.000141)|Epithelial(262;0.00854)|GBM - Glioblastoma multiforme(486;0.0231)	10	1075	-		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)						Q4G0U1	Missense_Mutation	SNP	ENST00000600059.1	37	c.1075G>A		.	.	.	.	.	.	.	.	.	.	C	17.77	3.471466	0.63737	.	.	ENSG00000142235	ENST00000270238	T	0.81330	-1.48	4.13	4.13	0.48395	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.178633	0.37012	N	0.002293	T	0.70037	0.3178	N	0.02539	-0.55	0.33647	D	0.608038	D	0.69078	0.997	P	0.57620	0.824	T	0.76030	-0.3108	10	0.23891	T	0.37	.	14.3066	0.66389	0.0:1.0:0.0:0.0	.	330	Q96Q04	LMTK3_HUMAN	K	359	ENSP00000270238:E359K	ENSP00000270238:E359K	E	-	1	0	LMTK3	53696365	1.000000	0.71417	0.920000	0.36463	0.968000	0.65278	4.375000	0.59549	2.044000	0.60594	0.449000	0.29647	GAG		0.662	LMTK3-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000466137.1	NM_052895		13	66	0	0	0	0	13	66				
PPFIA3	8541	broad.mit.edu	37	19	49652886	49652886	+	Nonsense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr19:49652886C>G	ENST00000334186.4	+	28	3786	c.3437C>G	c.(3436-3438)tCa>tGa	p.S1146*	PPFIA3_ENST00000602351.1_Nonsense_Mutation_p.S1137*	NM_003660.2	NP_003651.1	O75145	LIPA3_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3	1146					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|presynaptic active zone (GO:0048786)		p.S1146L(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(16)|pancreas(1)|prostate(1)|skin(4)|urinary_tract(1)	35		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)		ACTCCCGACTCAGCTGAGATG	0.647																																						uc002pmr.2		NA																	1	Substitution - Missense(1)		pancreas(1)	lung(1)	1						c.(3436-3438)TCA>TGA		PTPRF interacting protein alpha 3							38.0	38.0	38.0					19																	49652886		2203	4300	6503	SO:0001587	stop_gained	8541					cell surface|cytoplasm	protein binding	g.chr19:49652886C>G	AF034800	CCDS12758.1	19q13.33	2013-09-23			ENSG00000177380	ENSG00000177380		"""Sterile alpha motif (SAM) domain containing"""	9247	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase, receptor type, f polypeptide, alpha 3"", ""liprin-alpha 3"", ""liprin"""	603144				9624153, 9734811	Standard	NM_003660		Approved	KIAA0654, LPNA3, MGC126567, MGC126569	uc002pmr.3	O75145	OTTHUMG00000183213	ENST00000334186.4:c.3437C>G	19.37:g.49652886C>G	ENSP00000335614:p.Ser1146*		Somatic				PPFIA3_uc010yai.1_RNA|PPFIA3_uc002pms.2_Nonsense_Mutation_p.S1005*|PPFIA3_uc002pmt.2_Nonsense_Mutation_p.S285*|PPFIA3_uc002pmu.1_Nonsense_Mutation_p.S195*	p.S1146*	NM_003660	NP_003651	WXS	Illumina HiSeq	Unspecified	O75145	LIPA3_HUMAN		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)	28	3769	+		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)	1146					A8K142|Q3MJA0|Q9H8B5|Q9UEW4	Nonsense_Mutation	SNP	ENST00000334186.4	37	c.3437C>G	CCDS12758.1	.	.	.	.	.	.	.	.	.	.	C	45	11.325410	0.99547	.	.	ENSG00000177380	ENST00000334186	.	.	.	4.12	4.12	0.48240	.	0.000000	0.39759	U	0.001263	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-6.0542	15.6618	0.77193	0.0:1.0:0.0:0.0	.	.	.	.	X	1146	.	ENSP00000335614:S1146X	S	+	2	0	PPFIA3	54344698	1.000000	0.71417	0.999000	0.59377	0.978000	0.69477	7.243000	0.78219	2.299000	0.77371	0.462000	0.41574	TCA		0.647	PPFIA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465688.1	NM_003660		3	40	0	0	0	0	3	40				
MYH14	79784	broad.mit.edu	37	19	50780093	50780093	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr19:50780093G>A	ENST00000596571.1	+	26	3637	c.3637G>A	c.(3637-3639)Gag>Aag	p.E1213K	MYH14_ENST00000376970.2_Missense_Mutation_p.E1246K|MYH14_ENST00000440075.2_Missense_Mutation_p.E1254K|MYH14_ENST00000262269.8_Missense_Mutation_p.E1254K|MYH14_ENST00000425460.1_Missense_Mutation_p.E1221K|MYH14_ENST00000601313.1_Missense_Mutation_p.E1254K|MYH14_ENST00000598205.1_Missense_Mutation_p.E1221K			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	1213					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		GGCAGTGCAGGAGCTGAGGCA	0.677																																						uc002prr.1		NA																	0				central_nervous_system(1)	1						c.(3637-3639)GAG>AAG		myosin, heavy chain 14 isoform 2							31.0	36.0	35.0					19																	50780093		2130	4260	6390	SO:0001583	missense	79784				axon guidance|regulation of cell shape	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity	g.chr19:50780093G>A	AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.3637G>A	19.37:g.50780093G>A	ENSP00000472819:p.Glu1213Lys		Somatic				MYH14_uc010enu.1_Missense_Mutation_p.E1254K|MYH14_uc002prq.1_Missense_Mutation_p.E1221K	p.E1213K	NM_024729	NP_079005	WXS	Illumina HiSeq	Unspecified	Q7Z406	MYH14_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)	27	3684	+		all_neural(266;0.0571)|Ovarian(192;0.0728)	1213			Potential.		B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Missense_Mutation	SNP	ENST00000596571.1	37	c.3637G>A	CCDS59411.1	.	.	.	.	.	.	.	.	.	.	G	31	5.083815	0.94050	.	.	ENSG00000105357	ENST00000301415;ENST00000440075;ENST00000376970;ENST00000425460;ENST00000376965;ENST00000262269	D;T;T;D	0.82893	-1.66;-1.14;-1.14;-1.66	3.35	3.35	0.38373	Myosin tail (1);	.	.	.	.	D	0.87426	0.6174	M	0.74467	2.265	0.58432	D	0.999999	D;P;P	0.55800	0.973;0.887;0.862	P;P;P	0.56563	0.801;0.657;0.627	D	0.87771	0.2605	9	0.48119	T	0.1	.	12.5785	0.56378	0.0:0.0:1.0:0.0	.	1254;1213;1221	Q7Z406-2;Q7Z406;Q7Z406-6	.;MYH14_HUMAN;.	K	1213;1254;1246;1221;1213;1254	ENSP00000406273:E1254K;ENSP00000366169:E1246K;ENSP00000407879:E1221K;ENSP00000262269:E1254K	ENSP00000262269:E1254K	E	+	1	0	MYH14	55471905	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.236000	0.95360	1.895000	0.54865	0.462000	0.41574	GAG		0.677	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464710.2	NM_024729		14	51	0	0	0	0	14	51				
ZNF808	388558	broad.mit.edu	37	19	53058569	53058569	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr19:53058569C>T	ENST00000359798.4	+	5	2580	c.2400C>T	c.(2398-2400)ttC>ttT	p.F800F		NM_001039886.3	NP_001034975.2	Q8N4W9	ZN808_HUMAN	zinc finger protein 808	800					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(8)|kidney(3)|lung(12)|urinary_tract(1)	24				OV - Ovarian serous cystadenocarcinoma(262;0.00501)|GBM - Glioblastoma multiforme(134;0.0213)		ACAAGGCTTTCGTGCGTAATT	0.408																																						uc010epq.1		NA																	0					0						c.(2398-2400)TTC>TTT		zinc finger protein 808							163.0	168.0	166.0					19																	53058569		2203	4300	6503	SO:0001819	synonymous_variant	388558				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53058569C>T	CR749856	CCDS46167.1	19q13.41	2013-01-08			ENSG00000198482	ENSG00000198482		"""Zinc fingers, C2H2-type"", ""-"""	33230	protein-coding gene	gene with protein product							Standard	NM_001039886		Approved		uc010epq.1	Q8N4W9	OTTHUMG00000158230	ENST00000359798.4:c.2400C>T	19.37:g.53058569C>T			Somatic				ZNF808_uc002pzq.2_RNA|ZNF808_uc010epr.1_5'Flank	p.F800F	NM_001039886	NP_001034975	WXS	Illumina HiSeq	Unspecified	Q8N4W9	ZN808_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00501)|GBM - Glioblastoma multiforme(134;0.0213)	5	2577	+			800			C2H2-type 21.		Q68CN7	Silent	SNP	ENST00000359798.4	37	c.2400C>T	CCDS46167.1																																																																																				0.408	ZNF808-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350447.3	NM_001039886		24	190	0	0	0	0	24	190				
ZNF816	125893	broad.mit.edu	37	19	53454322	53454322	+	Missense_Mutation	SNP	T	T	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr19:53454322T>C	ENST00000357666.4	-	5	1006	c.706A>G	c.(706-708)Aaa>Gaa	p.K236E	ZNF816_ENST00000444460.2_Missense_Mutation_p.K236E|ZNF816_ENST00000434371.2_Intron|ZNF321P_ENST00000391777.3_Intron	NM_001031665.2	NP_001026835.1	Q0VGE8	ZN816_HUMAN	zinc finger protein 816	236					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(10)|lung(9)|stomach(1)|urinary_tract(2)	27						TTAAAGGCTTTGCCACACTCA	0.348																																						uc002qal.1		NA																	0					0						c.(706-708)AAA>GAA		zinc finger protein 816A							94.0	95.0	95.0					19																	53454322		2203	4300	6503	SO:0001583	missense	125893				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53454322T>C	BC063805	CCDS33096.1	19q13.41	2013-01-08	2010-07-23	2010-07-23		ENSG00000180257		"""Zinc fingers, C2H2-type"", ""-"""	26995	protein-coding gene	gene with protein product			"""zinc finger protein 816A"""	ZNF816A			Standard	NM_001031665		Approved		uc002qam.2	Q0VGE8		ENST00000357666.4:c.706A>G	19.37:g.53454322T>C	ENSP00000350295:p.Lys236Glu		Somatic				ZNF321_uc010eqj.2_Intron|ZNF321_uc002qak.1_Intron|ZNF816A_uc002qam.1_Missense_Mutation_p.K220E	p.K236E	NM_001031665	NP_001026835	WXS	Illumina HiSeq	Unspecified	Q0VGE8	ZN816_HUMAN		GBM - Glioblastoma multiforme(134;0.0313)	5	1007	-			236			C2H2-type 1.		A8K7H5|Q3KR39|Q659B3	Missense_Mutation	SNP	ENST00000357666.4	37	c.706A>G	CCDS33096.1	.	.	.	.	.	.	.	.	.	.	-	8.819	0.936991	0.18206	.	.	ENSG00000180257	ENST00000357666;ENST00000444460	T;T	0.21543	2.0;2.0	1.75	1.75	0.24633	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.44244	0.1284	M	0.86420	2.815	0.80722	D	1	D	0.59767	0.986	D	0.67725	0.953	T	0.40869	-0.9540	9	0.62326	D	0.03	.	7.1788	0.25760	0.0:0.0:0.0:1.0	.	236	Q0VGE8	ZN816_HUMAN	E	236	ENSP00000350295:K236E;ENSP00000403266:K236E	ENSP00000350295:K236E	K	-	1	0	ZNF816	58146134	0.775000	0.28604	0.603000	0.28903	0.092000	0.18411	3.151000	0.50670	0.796000	0.33947	0.163000	0.16589	AAA		0.348	ZNF816-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396132.1	NM_001031665		14	74	0	0	0	0	14	74				
SUV420H2	84787	broad.mit.edu	37	19	55857665	55857665	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr19:55857665G>A	ENST00000255613.3	+	7	903	c.655G>A	c.(655-657)Gag>Aag	p.E219K		NM_032701.3	NP_116090.2	Q86Y97	SV422_HUMAN	suppressor of variegation 4-20 homolog 2 (Drosophila)	219					histone H4-K20 trimethylation (GO:0034773)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	histone methyltransferase activity (H4-K20 specific) (GO:0042799)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)	4	Breast(117;0.191)		BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		CTTCTACGGCGAGGGCTTCTT	0.622																																						uc002qkj.3		NA																	0					0						c.(655-657)GAG>AAG		suppressor of variegation 4-20 homolog 2							120.0	99.0	106.0					19																	55857665		2203	4300	6503	SO:0001583	missense	84787				regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding	g.chr19:55857665G>A	BC005842	CCDS12922.1	19q13.42	2011-07-01			ENSG00000133247	ENSG00000133247		"""Chromatin-modifying enzymes / K-methyltransferases"""	28405	protein-coding gene	gene with protein product		613198				12477932	Standard	NM_032701		Approved	MGC2705, KMT5C	uc002qkj.4	Q86Y97	OTTHUMG00000150483	ENST00000255613.3:c.655G>A	19.37:g.55857665G>A	ENSP00000255613:p.Glu219Lys		Somatic				SUV420H2_uc002qkl.2_Missense_Mutation_p.E104K	p.E219K	NM_032701	NP_116090	WXS	Illumina HiSeq	Unspecified	Q86Y97	SV422_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)	7	903	+	Breast(117;0.191)		219			SET.		Q8WZ10|Q9BRZ6	Missense_Mutation	SNP	ENST00000255613.3	37	c.655G>A	CCDS12922.1	.	.	.	.	.	.	.	.	.	.	g	19.88	3.909878	0.72983	.	.	ENSG00000133247	ENST00000255613	D	0.85773	-2.03	3.87	3.87	0.44632	SET domain (2);	0.615744	0.14388	N	0.322718	D	0.82296	0.5006	L	0.54323	1.7	0.80722	D	1	B	0.18013	0.025	B	0.12156	0.007	T	0.78755	-0.2080	10	0.37606	T	0.19	-18.5454	15.1422	0.72620	0.0:0.0:1.0:0.0	.	219	Q86Y97	SV422_HUMAN	K	219	ENSP00000255613:E219K	ENSP00000255613:E219K	E	+	1	0	SUV420H2	60549477	1.000000	0.71417	0.080000	0.20451	0.925000	0.55904	7.082000	0.76851	2.151000	0.67156	0.609000	0.83330	GAG		0.622	SUV420H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318309.2	NM_032701		8	65	0	0	0	0	8	65				
USP29	57663	broad.mit.edu	37	19	57641988	57641988	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr19:57641988G>A	ENST00000254181.4	+	4	2399	c.1945G>A	c.(1945-1947)Gac>Aac	p.D649N	USP29_ENST00000598197.1_Missense_Mutation_p.D649N	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	649	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TCCAGTGGCTGACTCACTGAT	0.498																																						uc002qny.2		NA																	0				lung(6)|ovary(2)|breast(2)|pancreas(1)	11						c.(1945-1947)GAC>AAC		ubiquitin specific peptidase 29							69.0	65.0	66.0					19																	57641988		2203	4300	6503	SO:0001583	missense	57663				protein modification process|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity	g.chr19:57641988G>A		CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		ENST00000254181.4:c.1945G>A	19.37:g.57641988G>A	ENSP00000254181:p.Asp649Asn		Somatic					p.D649N	NM_020903	NP_065954	WXS	Illumina HiSeq	Unspecified	Q9HBJ7	UBP29_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)	4	2301	+		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)	649						Missense_Mutation	SNP	ENST00000254181.4	37	c.1945G>A	CCDS33124.1	.	.	.	.	.	.	.	.	.	.	G	10.53	1.375269	0.24857	.	.	ENSG00000131864	ENST00000254181	T	0.48201	0.82	3.0	3.0	0.34707	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	.	.	.	.	T	0.51041	0.1651	L	0.40543	1.245	0.09310	N	1	D	0.57571	0.98	P	0.60236	0.871	T	0.35847	-0.9772	9	0.11794	T	0.64	0.0609	12.2096	0.54371	0.0:0.0:1.0:0.0	.	649	Q9HBJ7	UBP29_HUMAN	N	649	ENSP00000254181:D649N	ENSP00000254181:D649N	D	+	1	0	USP29	62333800	0.993000	0.37304	0.027000	0.17364	0.006000	0.05464	1.192000	0.32150	1.947000	0.56498	0.467000	0.42956	GAC		0.498	USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465075.1			6	51	0	0	0	0	6	51				
MYT1L	23040	broad.mit.edu	37	2	1914020	1914020	+	Silent	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:1914020G>A	ENST00000399161.2	-	13	2556	c.1809C>T	c.(1807-1809)cgC>cgT	p.R603R	MYT1L_ENST00000428368.2_Silent_p.R601R	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	603					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		ACCTGAGCACGCGGTCCGAGG	0.637																																						uc002qxe.2		NA																	0				ovary(5)|central_nervous_system(1)	6						c.(1807-1809)CGC>CGT		myelin transcription factor 1-like							49.0	58.0	55.0					2																	1914020		2103	4207	6310	SO:0001819	synonymous_variant	23040				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr2:1914020G>A	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.1809C>T	2.37:g.1914020G>A			Somatic				MYT1L_uc002qxd.2_Silent_p.R601R|MYT1L_uc010ewl.1_RNA	p.R603R	NM_015025	NP_055840	WXS	Illumina HiSeq	Unspecified	Q9UL68	MYT1L_HUMAN		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)	13	2636	-	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)	603					A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Silent	SNP	ENST00000399161.2	37	c.1809C>T																																																																																					0.637	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025		5	37	0	0	0	0	5	37				
GRHL1	29841	broad.mit.edu	37	2	10136520	10136520	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:10136520G>C	ENST00000324907.9	+	14	1804	c.1668G>C	c.(1666-1668)ttG>ttC	p.L556F	GRHL1_ENST00000405379.2_Missense_Mutation_p.L556F|GRHL1_ENST00000480736.1_Missense_Mutation_p.L10F|GRHL1_ENST00000324883.5_Missense_Mutation_p.L367F	NM_198182.2	NP_937825.2	Q9NZI5	GRHL1_HUMAN	grainyhead-like 1 (Drosophila)	556					cellular lipid metabolic process (GO:0044255)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.246)		TGAAGGGCTTGATGGAAGCTG	0.413																																						uc002raa.2		NA																	0				pancreas(1)|skin(1)	2						c.(1666-1668)TTG>TTC		grainyhead-like 1							126.0	115.0	118.0					2																	10136520		2203	4300	6503	SO:0001583	missense	29841				cellular lipid metabolic process|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Golgi apparatus|nucleus	DNA binding	g.chr2:10136520G>C	AF198489	CCDS33144.1, CCDS33144.2	2p25.2	2008-02-05	2005-07-11	2005-07-11	ENSG00000134317	ENSG00000134317			17923	protein-coding gene	gene with protein product		609786	"""transcription factor CP2-like 2"""	TFCP2L2		10644752, 12393799	Standard	NM_198182		Approved	LBP-32, MGR	uc002raa.3	Q9NZI5	OTTHUMG00000151704	ENST00000324907.9:c.1668G>C	2.37:g.10136520G>C	ENSP00000324693:p.Leu556Phe		Somatic				GRHL1_uc002rab.2_RNA|GRHL1_uc002rad.2_Missense_Mutation_p.L367F|GRHL1_uc010yjb.1_Missense_Mutation_p.L405F	p.L556F	NM_198182	NP_937825	WXS	Illumina HiSeq	Unspecified	Q9NZI5	GRHL1_HUMAN		Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.246)	14	1839	+	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		556					A6NLA4|B2R7E4|B5MEC2|Q53T93|Q6NWN7|Q6NWN8|Q6NWN9|Q8NI33	Missense_Mutation	SNP	ENST00000324907.9	37	c.1668G>C	CCDS33144.2	.	.	.	.	.	.	.	.	.	.	G	18.79	3.698561	0.68386	.	.	ENSG00000134317	ENST00000405379;ENST00000324883;ENST00000324907;ENST00000480736	T;T;T	0.42131	1.31;0.98;1.31	5.73	2.91	0.33838	.	0.000000	0.85682	D	0.000000	T	0.57272	0.2042	M	0.76574	2.34	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.56631	-0.7947	10	0.59425	D	0.04	-6.9082	4.7517	0.13064	0.2945:0.1688:0.5367:0.0	.	367;556	Q9NZI5-2;Q9NZI5	.;GRHL1_HUMAN	F	556;367;556;10	ENSP00000384209:L556F;ENSP00000324494:L367F;ENSP00000324693:L556F	ENSP00000324494:L367F	L	+	3	2	GRHL1	10053971	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	0.719000	0.25881	0.876000	0.35872	0.655000	0.94253	TTG		0.413	GRHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323543.2	NM_014552		20	82	0	0	0	0	20	82				
ROCK2	9475	broad.mit.edu	37	2	11361348	11361348	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:11361348C>G	ENST00000315872.6	-	9	1683	c.1235G>C	c.(1234-1236)gGa>gCa	p.G412A	ROCK2_ENST00000401753.1_Missense_Mutation_p.G169A	NM_004850.3	NP_004841.2	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein kinase 2	412	AGC-kinase C-terminal.|Interaction with NPM1.|Interaction with PPP1R12A.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|neural tube closure (GO:0001843)|positive regulation of centrosome duplication (GO:0010825)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of circadian rhythm (GO:0042752)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|rhythmic process (GO:0048511)|smooth muscle contraction (GO:0006939)	centrosome (GO:0005813)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole centrosome (GO:0031616)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(10)|prostate(1)|skin(4)|stomach(3)|urinary_tract(2)	43	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		GTAGGTAAATCCGATGAAAGG	0.323																																						uc002rbd.1		NA																	0				stomach(2)|skin(2)	4						c.(1234-1236)GGA>GCA		Rho-associated, coiled-coil containing protein							115.0	112.0	113.0					2																	11361348		1822	4080	5902	SO:0001583	missense	9475				axon guidance|cytokinesis|intracellular signal transduction	cytosol|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|structural molecule activity	g.chr2:11361348C>G	D87931	CCDS42654.1	2p24	2013-01-10			ENSG00000134318	ENSG00000134318	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10252	protein-coding gene	gene with protein product		604002				9933571	Standard	NM_004850		Approved		uc002rbd.1	O75116	OTTHUMG00000149916	ENST00000315872.6:c.1235G>C	2.37:g.11361348C>G	ENSP00000317985:p.Gly412Ala		Somatic					p.G412A	NM_004850	NP_004841	WXS	Illumina HiSeq	Unspecified	O75116	ROCK2_HUMAN		Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)	9	1684	-	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		412			Interaction with NPM1.|AGC-kinase C-terminal.|Interaction with PPP1R12A.		Q53QZ0|Q53SJ7|Q9UQN5	Missense_Mutation	SNP	ENST00000315872.6	37	c.1235G>C	CCDS42654.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.824961	0.90955	.	.	ENSG00000134318	ENST00000315872;ENST00000401753	T;T	0.23348	1.91;1.91	5.38	5.38	0.77491	Protein kinase, C-terminal (1);AGC-kinase, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.66733	0.2819	H	0.96398	3.815	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.78753	-0.2081	10	0.87932	D	0	.	19.1367	0.93430	0.0:1.0:0.0:0.0	.	412	O75116	ROCK2_HUMAN	A	412;169	ENSP00000317985:G412A;ENSP00000385509:G169A	ENSP00000261535:G412A	G	-	2	0	ROCK2	11278799	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.817000	0.86213	2.521000	0.84997	0.585000	0.79938	GGA		0.323	ROCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313886.3			24	123	0	0	0	0	24	123				
E2F6	1876	broad.mit.edu	37	2	11605933	11605933	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:11605933G>A	ENST00000381525.3	-	1	342	c.73C>T	c.(73-75)Cgg>Tgg	p.R25W	E2F6_ENST00000362009.4_Missense_Mutation_p.R25W|E2F6_ENST00000546212.1_5'UTR|E2F6_ENST00000307236.4_5'UTR|E2F6_ENST00000542100.1_5'UTR|AC099344.1_ENST00000598929.1_Intron	NM_198256.2	NP_937987.2	O75461	E2F6_HUMAN	E2F transcription factor 6	25					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			cervix(1)|kidney(1)|lung(3)|prostate(1)|skin(2)	8	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.114)|OV - Ovarian serous cystadenocarcinoma(76;0.168)		TCTCGGCACCGACGGCGAACC	0.716																																						uc002rbh.2		NA																	0				skin(1)	1						c.(73-75)CGG>TGG		E2F transcription factor 6																																				SO:0001583	missense	1876				negative regulation of transcription from RNA polymerase II promoter	MLL1 complex|transcription factor complex	DNA binding|transcription corepressor activity	g.chr2:11605933G>A	AF041381	CCDS1680.2, CCDS62858.1, CCDS62859.1	2p25.1	2008-02-05			ENSG00000169016	ENSG00000169016			3120	protein-coding gene	gene with protein product		602944				9501179	Standard	NM_198256		Approved	E2F-6	uc002rbh.4	O75461	OTTHUMG00000090565	ENST00000381525.3:c.73C>T	2.37:g.11605933G>A	ENSP00000370936:p.Arg25Trp		Somatic				E2F6_uc002rbe.2_5'UTR|E2F6_uc002rbf.2_5'UTR|E2F6_uc002rbg.2_5'UTR|E2F6_uc002rbi.2_5'UTR|E2F6_uc010yjl.1_RNA|E2F6_uc002rbj.1_RNA	p.R25W	NM_198256	NP_937987	WXS	Illumina HiSeq	Unspecified	O75461	E2F6_HUMAN		Epithelial(75;0.114)|OV - Ovarian serous cystadenocarcinoma(76;0.168)	1	365	-	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		25					A8K2Z8|G5E936|O60544|Q53QY9|Q6Q9Z6|Q7Z2H6	Missense_Mutation	SNP	ENST00000381525.3	37	c.73C>T	CCDS1680.2	.	.	.	.	.	.	.	.	.	.	G	13.80	2.344610	0.41498	.	.	ENSG00000169016	ENST00000381525;ENST00000362009	D;D	0.85861	-2.04;-2.04	3.23	1.18	0.20946	.	0.621973	0.15939	N	0.237281	T	0.71617	0.3361	N	0.14661	0.345	0.09310	N	1	D	0.63880	0.993	P	0.47134	0.539	T	0.62973	-0.6740	10	0.38643	T	0.18	-16.5349	3.3407	0.07118	0.1432:0.0:0.6027:0.2541	.	25	O75461	E2F6_HUMAN	W	25	ENSP00000370936:R25W;ENSP00000355036:R25W	ENSP00000355036:R25W	R	-	1	2	E2F6	11523384	0.988000	0.35896	0.618000	0.29105	0.382000	0.30200	3.251000	0.51453	0.695000	0.31675	0.305000	0.20034	CGG		0.716	E2F6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207101.2	NM_001952		5	7	0	0	0	0	5	7				
NBAS	51594	broad.mit.edu	37	2	15417101	15417101	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:15417101C>T	ENST00000281513.5	-	43	5288	c.5263G>A	c.(5263-5265)Gat>Aat	p.D1755N	NBAS_ENST00000441750.1_Missense_Mutation_p.D1635N	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	1755					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						CTTTCGTGATCAAAGCCACCA	0.443																																						uc002rcc.1		NA																	0				ovary(2)|liver(1)|skin(1)	4						c.(5263-5265)GAT>AAT		neuroblastoma-amplified protein							94.0	89.0	91.0					2																	15417101		2203	4300	6503	SO:0001583	missense	51594							g.chr2:15417101C>T	BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.5263G>A	2.37:g.15417101C>T	ENSP00000281513:p.Asp1755Asn		Somatic				NBAS_uc010exl.1_Missense_Mutation_p.D827N|NBAS_uc002rcd.1_RNA	p.D1755N	NM_015909	NP_056993	WXS	Illumina HiSeq	Unspecified	A2RRP1	NBAS_HUMAN			43	5289	-			1755					O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	ENST00000281513.5	37	c.5263G>A	CCDS1685.1	.	.	.	.	.	.	.	.	.	.	C	34	5.384322	0.95967	.	.	ENSG00000151779	ENST00000441750;ENST00000281513	T;T	0.15487	2.42;2.64	5.61	5.61	0.85477	.	0.043398	0.85682	D	0.000000	T	0.36580	0.0972	M	0.62723	1.935	0.80722	D	1	D;D	0.69078	0.991;0.997	P;P	0.55965	0.785;0.788	T	0.03818	-1.1001	10	0.87932	D	0	.	20.0216	0.97506	0.0:1.0:0.0:0.0	.	1635;1755	A2RRP1-2;A2RRP1	.;NBAS_HUMAN	N	1635;1755	ENSP00000413201:D1635N;ENSP00000281513:D1755N	ENSP00000281513:D1755N	D	-	1	0	NBAS	15334552	1.000000	0.71417	0.745000	0.31077	0.965000	0.64279	7.209000	0.77916	2.826000	0.97356	0.655000	0.94253	GAT		0.443	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909		6	51	0	0	0	0	6	51				
IFT172	26160	broad.mit.edu	37	2	27685974	27685974	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:27685974G>T	ENST00000260570.3	-	19	2115	c.2012C>A	c.(2011-2013)tCc>tAc	p.S671Y		NM_015662.1	NP_056477.1	Q9UG01	IF172_HUMAN	intraflagellar transport 172	671					bone development (GO:0060348)|brain development (GO:0007420)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|epidermis development (GO:0008544)|heart looping (GO:0001947)|hindgut development (GO:0061525)|left/right axis specification (GO:0070986)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube closure (GO:0001843)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)	axoneme (GO:0005930)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)|vesicle (GO:0031982)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(17)|lung(17)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	43	Acute lymphoblastic leukemia(172;0.155)					ATATTCCCGGGATACTTGATC	0.438																																						uc002rku.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(2011-2013)TCC>TAC		selective LIM binding factor homolog							126.0	121.0	123.0					2																	27685974		2203	4300	6503	SO:0001583	missense	26160				cilium assembly	cilium	binding	g.chr2:27685974G>T	AB033005	CCDS1755.1	2p23.3	2014-07-03	2014-07-03		ENSG00000138002	ENSG00000138002		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	30391	protein-coding gene	gene with protein product	"""wimple homolog"""	607386	"""intraflagellar transport 172 homolog (Chlamydomonas)"""			10788441, 10574461, 24140113	Standard	XM_005264254		Approved	SLB, wim, osm-1, NPHP17	uc002rku.3	Q9UG01	OTTHUMG00000128425	ENST00000260570.3:c.2012C>A	2.37:g.27685974G>T	ENSP00000260570:p.Ser671Tyr		Somatic					p.S671Y	NM_015662	NP_056477	WXS	Illumina HiSeq	Unspecified	Q9UG01	IF172_HUMAN			19	2063	-	Acute lymphoblastic leukemia(172;0.155)		671					A5PKZ0|B2RNU5|Q86X44|Q96HW4|Q9UFJ9|Q9ULP1	Missense_Mutation	SNP	ENST00000260570.3	37	c.2012C>A	CCDS1755.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.494514	0.85069	.	.	ENSG00000138002	ENST00000260570	T	0.64438	-0.1	5.54	5.54	0.83059	.	0.119316	0.64402	D	0.000018	T	0.66538	0.2799	L	0.36672	1.1	0.80722	D	1	D	0.53885	0.963	P	0.53809	0.735	T	0.68746	-0.5327	10	0.62326	D	0.03	-13.1415	18.0587	0.89370	0.0:0.0:1.0:0.0	.	671	Q9UG01	IF172_HUMAN	Y	671	ENSP00000260570:S671Y	ENSP00000260570:S671Y	S	-	2	0	IFT172	27539478	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	9.084000	0.94076	2.601000	0.87937	0.655000	0.94253	TCC		0.438	IFT172-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250213.2	NM_015662		8	58	1	0	5.49e-09	5.83e-09	8	58				
LCLAT1	253558	broad.mit.edu	37	2	30756062	30756062	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:30756062C>G	ENST00000309052.4	+	4	569	c.360C>G	c.(358-360)atC>atG	p.I120M	LCLAT1_ENST00000540623.1_Missense_Mutation_p.I82M|LCLAT1_ENST00000491680.2_3'UTR|LCLAT1_ENST00000319406.4_Missense_Mutation_p.I120M|LCLAT1_ENST00000379509.3_Missense_Mutation_p.I82M|LCLAT1_ENST00000359433.1_Missense_Mutation_p.I120M	NM_182551.3	NP_872357.2	Q6UWP7	LCLT1_HUMAN	lysocardiolipin acyltransferase 1	120					cardiolipin acyl-chain remodeling (GO:0035965)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|multicellular organismal development (GO:0007275)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)	19						GTGTCATTATCATGAACCATC	0.403																																						uc002rnj.2		NA																	0				ovary(2)	2						c.(358-360)ATC>ATG		lysocardiolipin acyltransferase 1 isoform 1							199.0	191.0	194.0					2																	30756062		2203	4300	6503	SO:0001583	missense	253558				multicellular organismal development|phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity	g.chr2:30756062C>G	AK095284	CCDS1772.1, CCDS42670.1	2p23.1	2008-12-15	2008-12-15	2008-12-15	ENSG00000172954	ENSG00000172954			26756	protein-coding gene	gene with protein product		614241	"""lysocardiolipin acyltransferase"""	LYCAT		18931347, 15152008, 16620771, 17675553	Standard	NM_001002257		Approved	FLJ37965, ALCAT1, AGPAT8	uc002rnl.3	Q6UWP7	OTTHUMG00000099349	ENST00000309052.4:c.360C>G	2.37:g.30756062C>G	ENSP00000310551:p.Ile120Met		Somatic				LCLAT1_uc010ymp.1_Translation_Start_Site|LCLAT1_uc002rnk.1_Missense_Mutation_p.I120M|LCLAT1_uc002rnl.2_Missense_Mutation_p.I82M|LCLAT1_uc010ymq.1_Missense_Mutation_p.I82M	p.I120M	NM_182551	NP_872357	WXS	Illumina HiSeq	Unspecified	Q6UWP7	LCLT1_HUMAN			4	569	+			120					A6H8Z7|Q8N1Q7	Missense_Mutation	SNP	ENST00000309052.4	37	c.360C>G	CCDS1772.1	.	.	.	.	.	.	.	.	.	.	C	11.14	1.550374	0.27739	.	.	ENSG00000172954	ENST00000466477;ENST00000465200;ENST00000379509;ENST00000444270;ENST00000319406;ENST00000488144;ENST00000465538;ENST00000309052;ENST00000359433;ENST00000540623;ENST00000476038;ENST00000497423;ENST00000476535	D;D;D;D;D;D;D;D;D;D;D;D	0.97906	-4.6;-4.6;-4.6;-4.6;-4.6;-4.6;-4.6;-4.6;-4.6;-4.6;-4.6;-4.6	5.41	0.947	0.19555	Phospholipid/glycerol acyltransferase (2);	0.048107	0.85682	D	0.000000	D	0.97324	0.9125	L	0.53671	1.685	0.46901	D	0.999245	P;D	0.76494	0.92;0.999	P;D	0.74348	0.7;0.983	D	0.95066	0.8200	10	0.51188	T	0.08	-24.8298	6.6537	0.22977	0.225:0.5606:0.0:0.2143	.	120;120	Q6UWP7-2;Q6UWP7	.;LCLT1_HUMAN	M	82;82;82;82;120;82;82;120;120;82;82;120;82	ENSP00000419966:I82M;ENSP00000420481:I82M;ENSP00000368823:I82M;ENSP00000368826:I120M;ENSP00000417951:I82M;ENSP00000417565:I82M;ENSP00000310551:I120M;ENSP00000352406:I120M;ENSP00000442857:I82M;ENSP00000419646:I82M;ENSP00000417875:I120M;ENSP00000419444:I82M	ENSP00000310551:I120M	I	+	3	3	LCLAT1	30609566	0.450000	0.25697	0.998000	0.56505	0.091000	0.18340	-0.193000	0.09573	0.077000	0.16863	-2.051000	0.00406	ATC		0.403	LCLAT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000216780.1	NM_182551		13	133	0	0	0	0	13	133				
BIRC6	57448	broad.mit.edu	37	2	32626362	32626362	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:32626362C>G	ENST00000421745.2	+	7	1300	c.1166C>G	c.(1165-1167)tCt>tGt	p.S389C		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	389					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					GACAGAATATCTTGCTTTGGG	0.453																																					Pancreas(94;175 1509 16028 18060 45422)	uc010ezu.2		NA																	0				ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14						c.(1165-1167)TCT>TGT		baculoviral IAP repeat-containing 6							205.0	201.0	202.0					2																	32626362		2203	4300	6503	SO:0001583	missense	57448				anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding	g.chr2:32626362C>G	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.1166C>G	2.37:g.32626362C>G	ENSP00000393596:p.Ser389Cys		Somatic					p.S389C	NM_016252	NP_057336	WXS	Illumina HiSeq	Unspecified	Q9NR09	BIRC6_HUMAN			7	1300	+	Acute lymphoblastic leukemia(172;0.155)		389					Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	37	c.1166C>G	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	C	14.87	2.664781	0.47572	.	.	ENSG00000115760	ENST00000421745	T	0.75154	-0.91	5.42	5.42	0.78866	WD40/YVTN repeat-like-containing domain (1);	0.386862	0.26594	N	0.023507	T	0.67429	0.2892	L	0.34521	1.04	0.29555	N	0.851072	B	0.28512	0.214	B	0.34873	0.191	T	0.66093	-0.6009	10	0.42905	T	0.14	.	13.5095	0.61504	0.0:0.925:0.0:0.075	.	389	Q9NR09	BIRC6_HUMAN	C	389	ENSP00000393596:S389C	ENSP00000393596:S389C	S	+	2	0	BIRC6	32479866	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.896000	0.63222	2.550000	0.86006	0.491000	0.48974	TCT		0.453	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252		41	230	0	0	0	0	41	230				
CDKL4	344387	broad.mit.edu	37	2	39411779	39411779	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:39411779C>G	ENST00000395035.3	-	7	744	c.745G>C	c.(745-747)Gag>Cag	p.E249Q	CDKL4_ENST00000378803.1_Missense_Mutation_p.E249Q			Q5MAI5	CDKL4_HUMAN	cyclin-dependent kinase-like 4	249	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)	p.E249Q(1)		breast(1)|large_intestine(2)|liver(1)|lung(7)|ovary(1)	12		all_hematologic(82;0.248)				AACTTTTCCTCAAGAGTTTCC	0.323																																						uc002rrm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(745-747)GAG>CAG		cyclin-dependent kinase-like 4							66.0	66.0	66.0					2																	39411779		2203	4300	6503	SO:0001583	missense	344387					cytoplasm	ATP binding|cyclin-dependent protein kinase activity	g.chr2:39411779C>G		CCDS33184.1	2p22.3	2011-11-04			ENSG00000205111	ENSG00000205111		"""Cyclin-dependent kinases"""	19287	protein-coding gene	gene with protein product							Standard	NM_001009565		Approved		uc002rrm.3	Q5MAI5	OTTHUMG00000133574	ENST00000395035.3:c.745G>C	2.37:g.39411779C>G	ENSP00000378476:p.Glu249Gln		Somatic				CDKL4_uc010fal.1_Missense_Mutation_p.E249Q	p.E249Q	NM_001009565	NP_001009565	WXS	Illumina HiSeq	Unspecified	Q5MAI5	CDKL4_HUMAN			7	745	-		all_hematologic(82;0.248)	249			Protein kinase.		Q2NME9	Missense_Mutation	SNP	ENST00000395035.3	37	c.745G>C		.	.	.	.	.	.	.	.	.	.	C	15.24	2.774884	0.49786	.	.	ENSG00000205111	ENST00000451199;ENST00000378803;ENST00000395035	T;T;T	0.43294	2.78;0.95;0.95	4.6	4.6	0.57074	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.111082	0.40222	N	0.001159	T	0.33789	0.0875	L	0.35487	1.065	0.47511	D	0.999444	B;B	0.34200	0.441;0.019	B;B	0.31751	0.135;0.025	T	0.29336	-1.0015	10	0.56958	D	0.05	-20.1468	15.3261	0.74164	0.0:1.0:0.0:0.0	.	249;249	Q2NME9;Q5MAI5	.;CDKL4_HUMAN	Q	31;249;249	ENSP00000389833:E31Q;ENSP00000368080:E249Q;ENSP00000378476:E249Q	ENSP00000368080:E249Q	E	-	1	0	CDKL4	39265283	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	5.624000	0.67764	2.300000	0.77407	0.655000	0.94253	GAG		0.323	CDKL4-002	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000331655.1	XM_293029		3	40	0	0	0	0	3	40				
LRPPRC	10128	broad.mit.edu	37	2	44116941	44116941	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:44116941G>C	ENST00000260665.7	-	37	4117	c.4060C>G	c.(4060-4062)Ctg>Gtg	p.L1354V	RNU6-1048P_ENST00000364054.1_RNA	NM_133259.3	NP_573566.2	P42704	LPPRC_HUMAN	leucine-rich pentatricopeptide repeat containing	1354	RNA-binding.				mitochondrion transport along microtubule (GO:0047497)|mRNA transport (GO:0051028)|negative regulation of mitochondrial RNA catabolic process (GO:0000961)|regulation of mitochondrial translation (GO:0070129)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(3)|endometrium(3)|kidney(5)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|skin(2)	41		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				TTTAGAAACAGATCATCCAAT	0.358																																						uc002rtr.2		NA																	0				ovary(2)|skin(1)	3						c.(4060-4062)CTG>GTG		leucine-rich PPR motif-containing protein							111.0	105.0	107.0					2																	44116941		2203	4300	6503	SO:0001583	missense	10128				mitochondrion transport along microtubule|mRNA transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	condensed nuclear chromosome|cytoskeleton|mitochondrial nucleoid|nuclear inner membrane|nuclear outer membrane|nucleoplasm|perinuclear region of cytoplasm	beta-tubulin binding|microtubule binding|RNA binding	g.chr2:44116941G>C	M92439	CCDS33189.1	2p21	2012-02-24	2012-02-24		ENSG00000138095	ENSG00000138095			15714	protein-coding gene	gene with protein product		607544	"""Leigh syndrome, French-Canadian type (cytochrome oxidase deficiency)"""	LSFC		8012652, 8619474, 22045337	Standard	NM_133259		Approved	GP130, LRP130	uc002rtr.2	P42704	OTTHUMG00000152782	ENST00000260665.7:c.4060C>G	2.37:g.44116941G>C	ENSP00000260665:p.Leu1354Val		Somatic					p.L1354V	NM_133259	NP_573566	WXS	Illumina HiSeq	Unspecified	P42704	LPPRC_HUMAN			37	4118	-		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	1354			RNA-binding.		A0PJE3|A8K1V1|Q53PC0|Q53QN7|Q6ZUD8|Q7Z7A6|Q96D84	Missense_Mutation	SNP	ENST00000260665.7	37	c.4060C>G	CCDS33189.1	.	.	.	.	.	.	.	.	.	.	G	10.81	1.456097	0.26161	.	.	ENSG00000138095	ENST00000260665	T	0.68765	-0.35	5.73	0.0225	0.14133	.	0.183599	0.36555	N	0.002523	T	0.49321	0.1550	M	0.68593	2.085	0.32131	N	0.586697	P	0.43287	0.802	B	0.34489	0.184	T	0.57219	-0.7849	10	0.08599	T	0.76	-21.197	5.6929	0.17839	0.2467:0.0:0.3711:0.3822	.	1354	P42704	LPPRC_HUMAN	V	1354	ENSP00000260665:L1354V	ENSP00000260665:L1354V	L	-	1	2	LRPPRC	43970445	0.033000	0.19621	0.003000	0.11579	0.106000	0.19336	-0.467000	0.06664	0.059000	0.16252	0.655000	0.94253	CTG		0.358	LRPPRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327823.1	NM_133259		11	74	0	0	0	0	11	74				
CAMKMT	79823	broad.mit.edu	37	2	44970813	44970813	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:44970813G>A	ENST00000378494.3	+	8	720	c.676G>A	c.(676-678)Gac>Aac	p.D226N		NM_024766.4	NP_079042.1	Q7Z624	CMKMT_HUMAN	calmodulin-lysine N-methyltransferase	226						Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	calmodulin-lysine N-methyltransferase activity (GO:0018025)			breast(2)|large_intestine(3)|lung(5)	10						AGGACATTTTGACATTGTTAT	0.343																																						uc002rum.2		NA																	0					0						c.(676-678)GAC>AAC		hypothetical protein LOC79823							60.0	64.0	63.0					2																	44970813		2203	4300	6503	SO:0001583	missense	79823					cytoplasm	calmodulin-lysine N-methyltransferase activity	g.chr2:44970813G>A		CCDS1820.1	2p21	2011-06-22	2011-03-10	2011-03-10	ENSG00000143919	ENSG00000143919	2.1.1.60		26276	protein-coding gene	gene with protein product	"""CaM KMT"""	609559	"""chromosome 2 open reading frame 34"""	C2orf34		20975703	Standard	NM_024766		Approved	CLNMT	uc002rum.3	Q7Z624	OTTHUMG00000128761	ENST00000378494.3:c.676G>A	2.37:g.44970813G>A	ENSP00000367755:p.Asp226Asn		Somatic					p.D226N	NM_024766	NP_079042	WXS	Illumina HiSeq	Unspecified	Q7Z624	CMKMT_HUMAN			8	780	+		all_hematologic(82;0.0892)|Acute lymphoblastic leukemia(82;0.17)	226					Q4ZG15|Q53SS6|Q8N6P5|Q9H5G8	Missense_Mutation	SNP	ENST00000378494.3	37	c.676G>A	CCDS1820.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.957750	0.73902	.	.	ENSG00000143919	ENST00000378494	T	0.47869	0.83	5.66	5.66	0.87406	.	0.046027	0.85682	D	0.000000	T	0.57301	0.2044	M	0.81682	2.555	0.80722	D	1	B	0.31193	0.312	B	0.34489	0.184	T	0.58973	-0.7541	10	0.49607	T	0.09	-7.8347	19.7554	0.96287	0.0:0.0:1.0:0.0	.	226	Q7Z624	CMKMT_HUMAN	N	226	ENSP00000367755:D226N	ENSP00000367755:D226N	D	+	1	0	CAMKMT	44824317	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.045000	0.76585	2.665000	0.90641	0.563000	0.77884	GAC		0.343	CAMKMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250678.2	NM_024766		7	26	0	0	0	0	7	26				
SOCS5	9655	broad.mit.edu	37	2	46986106	46986106	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:46986106G>A	ENST00000306503.5	+	2	609	c.437G>A	c.(436-438)cGa>cAa	p.R146Q	SOCS5_ENST00000394861.2_Missense_Mutation_p.R146Q	NM_014011.4	NP_054730.1	O75159	SOCS5_HUMAN	suppressor of cytokine signaling 5	146					cell growth (GO:0016049)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|JAK-STAT cascade (GO:0007259)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of signal transduction (GO:0009968)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)		receptor tyrosine kinase binding (GO:0030971)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(9)|ovary(2)	22		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.114)			GGTAGAACTCGAAGTGGACTT	0.468																																						uc002rvf.2		NA																	0				ovary(1)|lung(1)|central_nervous_system(1)	3						c.(436-438)CGA>CAA		suppressor of cytokine signaling 5							70.0	68.0	69.0					2																	46986106		2203	4300	6503	SO:0001583	missense	9655				cell growth|cytokine-mediated signaling pathway|intracellular signal transduction|negative regulation of signal transduction|negative regulation of T-helper 2 cell differentiation|positive regulation of T-helper 1 cell differentiation|regulation of growth			g.chr2:46986106G>A	AB014571	CCDS1830.1	2p21	2013-02-14			ENSG00000171150	ENSG00000171150		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16852	protein-coding gene	gene with protein product		607094				9734811, 11230166	Standard	NM_014011		Approved	KIAA0671, SOCS-5, CIS6, CISH6, Cish5	uc002rvf.3	O75159	OTTHUMG00000128852	ENST00000306503.5:c.437G>A	2.37:g.46986106G>A	ENSP00000305133:p.Arg146Gln		Somatic				SOCS5_uc010yoe.1_Missense_Mutation_p.R115Q|SOCS5_uc002rvg.2_Missense_Mutation_p.R146Q	p.R146Q	NM_014011	NP_054730	WXS	Illumina HiSeq	Unspecified	O75159	SOCS5_HUMAN	LUSC - Lung squamous cell carcinoma(58;0.114)		2	601	+		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	146					Q53SD4|Q8IYZ4	Missense_Mutation	SNP	ENST00000306503.5	37	c.437G>A	CCDS1830.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.878061	0.91664	.	.	ENSG00000171150	ENST00000306503;ENST00000394861	T;T	0.31510	1.49;1.49	5.55	5.55	0.83447	.	0.126603	0.51477	D	0.000087	T	0.46328	0.1387	L	0.32530	0.975	0.80722	D	1	D	0.71674	0.998	D	0.76575	0.988	T	0.12426	-1.0548	10	0.33940	T	0.23	-13.4119	19.2868	0.94082	0.0:0.0:1.0:0.0	.	146	O75159	SOCS5_HUMAN	Q	146	ENSP00000305133:R146Q;ENSP00000378330:R146Q	ENSP00000305133:R146Q	R	+	2	0	SOCS5	46839610	1.000000	0.71417	0.993000	0.49108	0.974000	0.67602	7.525000	0.81892	2.885000	0.99019	0.655000	0.94253	CGA		0.468	SOCS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250791.2			16	67	0	0	0	0	16	67				
SPTBN1	6711	broad.mit.edu	37	2	54876298	54876298	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:54876298G>A	ENST00000356805.4	+	25	5454	c.5173G>A	c.(5173-5175)Gaa>Aaa	p.E1725K	SPTBN1_ENST00000333896.5_Missense_Mutation_p.E1712K	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	1725	Interaction with ANK2.				actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			AGGGTCCCATGAACTGGGACA	0.552																																						uc002rxu.2		NA																	0				ovary(3)|breast(2)|central_nervous_system(2)|skin(1)	8						c.(5173-5175)GAA>AAA		spectrin, beta, non-erythrocytic 1 isoform 1							85.0	74.0	78.0					2																	54876298		2203	4300	6503	SO:0001583	missense	6711				actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton	g.chr2:54876298G>A		CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.5173G>A	2.37:g.54876298G>A	ENSP00000349259:p.Glu1725Lys		Somatic				SPTBN1_uc002rxx.2_Missense_Mutation_p.E1712K	p.E1725K	NM_003128	NP_003119	WXS	Illumina HiSeq	Unspecified	Q01082	SPTB2_HUMAN	Lung(47;0.24)		25	5422	+			1725			Interaction with ANK2.|Spectrin 14.		B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Missense_Mutation	SNP	ENST00000356805.4	37	c.5173G>A	CCDS33198.1	.	.	.	.	.	.	.	.	.	.	G	36	5.742348	0.96873	.	.	ENSG00000115306	ENST00000356805;ENST00000333896	T;T	0.49432	0.78;1.2	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.80391	0.4614	H	0.96111	3.77	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.987;0.995	D	0.85776	0.1358	10	0.87932	D	0	.	20.221	0.98325	0.0:0.0:1.0:0.0	.	1712;1725	Q01082-3;Q01082	.;SPTB2_HUMAN	K	1725;1712	ENSP00000349259:E1725K;ENSP00000334156:E1712K	ENSP00000334156:E1712K	E	+	1	0	SPTBN1	54729802	1.000000	0.71417	0.131000	0.22000	0.957000	0.61999	9.807000	0.99171	2.792000	0.96026	0.555000	0.69702	GAA		0.552	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3			12	64	0	0	0	0	12	64				
PNO1	56902	broad.mit.edu	37	2	68389791	68389791	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:68389791G>A	ENST00000263657.2	+	5	707	c.616G>A	c.(616-618)Gat>Aat	p.D206N	RP11-474G23.1_ENST00000406334.3_Intron	NM_020143.2	NP_064528.1	Q9NRX1	PNO1_HUMAN	partner of NOB1 homolog (S. cerevisiae)	206	KH.					nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|lung(2)	4						AGTTTTGGCTGATGTGTAAGT	0.353																																					NSCLC(83;642 1410 13044 32832 40058)	uc002seh.2		NA																	0					0						c.(616-618)GAT>AAT		partner of NOB1							103.0	103.0	103.0					2																	68389791		2203	4300	6503	SO:0001583	missense	56902					nucleolus	RNA binding	g.chr2:68389791G>A	AF164799	CCDS1885.1	2p14	2010-07-06			ENSG00000115946	ENSG00000115946			32790	protein-coding gene	gene with protein product	"""RNA binding protein"""		"""KH-type RNA binding protein 1"", ""KH-type RNA-binding protein 1"""	KHRBP1		15497447	Standard	NM_020143		Approved	RRP20	uc002seh.3	Q9NRX1	OTTHUMG00000129563	ENST00000263657.2:c.616G>A	2.37:g.68389791G>A	ENSP00000263657:p.Asp206Asn		Somatic					p.D206N	NM_020143	NP_064528	WXS	Illumina HiSeq	Unspecified	Q9NRX1	PNO1_HUMAN			5	678	+			206			KH.		A8K6Q0|Q53G13|Q8WVB8	Missense_Mutation	SNP	ENST00000263657.2	37	c.616G>A	CCDS1885.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.633256	0.87660	.	.	ENSG00000115946	ENST00000263657	T	0.31510	1.49	5.45	5.45	0.79879	K Homology (1);K Homology, type 1, subgroup (1);	0.046613	0.85682	D	0.000000	T	0.44582	0.1300	M	0.81942	2.565	0.80722	D	1	B	0.27700	0.186	B	0.33121	0.158	T	0.42565	-0.9444	10	0.49607	T	0.09	-3.583	19.6597	0.95861	0.0:0.0:1.0:0.0	.	206	Q9NRX1	PNO1_HUMAN	N	206	ENSP00000263657:D206N	ENSP00000263657:D206N	D	+	1	0	PNO1	68243295	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.560000	0.98139	2.708000	0.92522	0.650000	0.86243	GAT		0.353	PNO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251756.1	NM_020143		13	65	0	0	0	0	13	65				
HK2	3099	broad.mit.edu	37	2	75061710	75061710	+	Start_Codon_SNP	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:75061710G>A	ENST00000290573.2	+	1	603	c.3G>A	c.(1-3)atG>atA	p.M1I	HK2_ENST00000409174.1_5'Flank|RP11-259N19.1_ENST00000610008.1_lincRNA	NM_000189.4	NP_000180.2	P52789	HXK2_HUMAN	hexokinase 2	1	Hydrophobic.				apoptotic mitochondrial changes (GO:0008637)|carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose transport (GO:0008645)|lactation (GO:0007595)|regulation of glucose import (GO:0046324)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|glucose binding (GO:0005536)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	43						GCGGCAGGATGATTGCCTCGC	0.677																																						uc002snd.2		NA																	0				ovary(1)|lung(1)	2						c.(1-3)ATG>ATA		hexokinase 2							57.0	53.0	54.0					2																	75061710		2203	4300	6503	SO:0001582	initiator_codon_variant	3099				apoptotic mitochondrial changes|glucose transport|glycolysis|transmembrane transport	cytosol|mitochondrial outer membrane	ATP binding|glucokinase activity	g.chr2:75061710G>A		CCDS1956.1	2p13	2010-03-19			ENSG00000159399	ENSG00000159399	2.7.1.1		4923	protein-coding gene	gene with protein product		601125					Standard	NM_000189		Approved		uc002snd.3	P52789	OTTHUMG00000129972	ENST00000290573.2:c.3G>A	2.37:g.75061710G>A	ENSP00000290573:p.Met1Ile		Somatic					p.M1I	NM_000189	NP_000180	WXS	Illumina HiSeq	Unspecified	P52789	HXK2_HUMAN			1	1929	+			1			Hydrophobic.		D6W5J2|Q8WU87|Q9UN82	Missense_Mutation	SNP	ENST00000290573.2	37	c.3G>A	CCDS1956.1	.	.	.	.	.	.	.	.	.	.	G	16.76	3.213615	0.58452	.	.	ENSG00000159399	ENST00000290573;ENST00000535740	D	0.97256	-4.31	3.97	3.97	0.46021	.	0.000000	0.85682	D	0.000000	D	0.95893	0.8663	.	.	.	0.80722	D	1	P	0.35872	0.525	B	0.42214	0.38	D	0.95939	0.8945	9	0.72032	D	0.01	-30.5448	11.3902	0.49809	0.0:0.0:1.0:0.0	.	1	P52789	HXK2_HUMAN	I	1	ENSP00000290573:M1I	ENSP00000290573:M1I	M	+	3	0	HK2	74915218	1.000000	0.71417	0.998000	0.56505	0.599000	0.36880	4.672000	0.61597	2.026000	0.59711	0.643000	0.83706	ATG		0.677	HK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252238.2	NM_000189	Missense_Mutation	6	42	0	0	0	0	6	42				
VAMP5	10791	broad.mit.edu	37	2	85818887	85818887	+	Missense_Mutation	SNP	G	G	A	rs375756032		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:85818887G>A	ENST00000306384.4	+	2	126	c.43G>A	c.(43-45)Gag>Aag	p.E15K		NM_006634.2	NP_006625.1	O95183	VAMP5_HUMAN	vesicle-associated membrane protein 5	15	v-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00290}.				cell differentiation (GO:0030154)|Golgi to plasma membrane protein transport (GO:0043001)|muscle organ development (GO:0007517)|skeletal muscle tissue development (GO:0007519)	cell surface (GO:0009986)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|integral component of organelle membrane (GO:0031301)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|late endosome (GO:0005770)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|large_intestine(3)|lung(1)	5						GCAGGCGAACGAGGTGACGGA	0.602																																						uc002spu.1		NA																	0					0						c.(43-45)GAG>AAG		vesicle-associated membrane protein 5		G	LYS/GLU	0,4406		0,0,2203	135.0	116.0	122.0		43	4.0	0.9	2		122	1,8599	1.2+/-3.3	0,1,4299	no	missense	VAMP5	NM_006634.2	56	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	15/117	85818887	1,13005	2203	4300	6503	SO:0001583	missense	10791				cell differentiation|vesicle-mediated transport	endomembrane system		g.chr2:85818887G>A	AF054825	CCDS1980.1	2p11.2	2013-02-13	2012-10-17		ENSG00000168899	ENSG00000168899		"""Vesicle-associated membrane proteins"""	12646	protein-coding gene	gene with protein product	"""myobrevin"""	607029				9725904	Standard	NM_006634		Approved		uc002spu.1	O95183	OTTHUMG00000130169	ENST00000306384.4:c.43G>A	2.37:g.85818887G>A	ENSP00000305647:p.Glu15Lys		Somatic					p.E15K	NM_006634	NP_006625	WXS	Illumina HiSeq	Unspecified	O95183	VAMP5_HUMAN			2	126	+			15			v-SNARE coiled-coil homology.|Cytoplasmic (Potential).		Q9P0T2	Missense_Mutation	SNP	ENST00000306384.4	37	c.43G>A	CCDS1980.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.329266	0.81690	0.0	1.16E-4	ENSG00000168899	ENST00000306384	T	0.35973	1.28	4.84	3.95	0.45737	Synaptobrevin (3);	0.078143	0.48286	D	0.000199	T	0.63803	0.2542	H	0.94620	3.56	0.38334	D	0.943873	D	0.71674	0.998	P	0.58780	0.845	T	0.75706	-0.3224	10	0.87932	D	0	.	11.2668	0.49114	0.0:0.1844:0.8156:0.0	.	15	O95183	VAMP5_HUMAN	K	15	ENSP00000305647:E15K	ENSP00000305647:E15K	E	+	1	0	VAMP5	85672398	1.000000	0.71417	0.881000	0.34555	0.969000	0.65631	3.787000	0.55439	1.009000	0.39289	0.561000	0.74099	GAG		0.602	VAMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252484.2	NM_006634		21	80	0	0	0	0	21	80				
PROM2	150696	broad.mit.edu	37	2	95953210	95953210	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:95953210G>T	ENST00000317620.9	+	20	2375	c.2242G>T	c.(2242-2244)Gag>Tag	p.E748*	PROM2_ENST00000403131.2_Nonsense_Mutation_p.E748*|PROM2_ENST00000317668.4_Nonsense_Mutation_p.E748*|PROM2_ENST00000542147.1_Nonsense_Mutation_p.E699*	NM_001165978.1	NP_001159450.1	Q8N271	PROM2_HUMAN	prominin 2	748					negative regulation of caveolin-mediated endocytosis (GO:2001287)|negative regulation of pinocytosis (GO:0048550)|positive regulation of cell projection organization (GO:0031346)|positive regulation of protein phosphorylation (GO:0001934)|regulation of Cdc42 GTPase activity (GO:0043088)	cell projection (GO:0042995)|cell surface (GO:0009986)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|microspike (GO:0044393)|microvillus (GO:0005902)|prominosome (GO:0071914)	cholesterol binding (GO:0015485)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	32						GGTGAGAGAGGAGGTGAGTGG	0.642																																						uc002suh.1		NA																	0				ovary(1)	1						c.(2242-2244)GAG>TAG		prominin 2 precursor							100.0	91.0	94.0					2																	95953210		2203	4300	6503	SO:0001587	stop_gained	150696					apical plasma membrane|basolateral plasma membrane|cilium membrane|integral to membrane|microvillus membrane		g.chr2:95953210G>T	AF245303	CCDS2012.1	2q11.1	2008-02-05			ENSG00000155066	ENSG00000155066			20685	protein-coding gene	gene with protein product						12514187	Standard	NM_001165978		Approved		uc002sui.3	Q8N271	OTTHUMG00000130393	ENST00000317620.9:c.2242G>T	2.37:g.95953210G>T	ENSP00000318270:p.Glu748*		Somatic				PROM2_uc002sui.2_Nonsense_Mutation_p.E748*|PROM2_uc002suj.2_Nonsense_Mutation_p.E402*|PROM2_uc002suk.2_Nonsense_Mutation_p.E748*|PROM2_uc002sul.2_Nonsense_Mutation_p.E274*|PROM2_uc002sum.2_RNA	p.E748*	NM_144707	NP_653308	WXS	Illumina HiSeq	Unspecified	Q8N271	PROM2_HUMAN			20	2375	+			748			Extracellular (Potential).		A8K2V1|Q2HIX6|Q8NB84|Q8TAE2	Nonsense_Mutation	SNP	ENST00000317620.9	37	c.2242G>T	CCDS2012.1	.	.	.	.	.	.	.	.	.	.	G	38	7.212361	0.98139	.	.	ENSG00000155066	ENST00000403131;ENST00000317668;ENST00000317620;ENST00000542147	.	.	.	5.26	4.27	0.50696	.	0.401288	0.23275	N	0.049963	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	-29.6712	5.8737	0.18816	0.1653:0.0:0.8347:0.0	.	.	.	.	X	748;748;748;699	.	ENSP00000318270:E748X	E	+	1	0	PROM2	95316937	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	2.339000	0.43965	2.470000	0.83445	0.561000	0.74099	GAG		0.642	PROM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252771.1	NM_144707		5	40	1	0	0.000602214	0.000618211	5	40				
AFF3	3899	broad.mit.edu	37	2	100203693	100203693	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:100203693C>G	ENST00000409236.2	-	14	2626	c.2514G>C	c.(2512-2514)gaG>gaC	p.E838D	AFF3_ENST00000356421.2_Missense_Mutation_p.E863D|AFF3_ENST00000409579.1_Missense_Mutation_p.E863D|AFF3_ENST00000317233.4_Missense_Mutation_p.E838D			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	838					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)			NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						AGCTGTCTTTCTCTCCCTGGG	0.453																																						uc002tag.2		NA																	0				ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6						c.(2512-2514)GAG>GAC		AF4/FMR2 family, member 3 isoform 1							313.0	265.0	281.0					2																	100203693		2203	4300	6503	SO:0001583	missense	3899				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr2:100203693C>G	U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.2514G>C	2.37:g.100203693C>G	ENSP00000387207:p.Glu838Asp		Somatic				AFF3_uc002taf.2_Missense_Mutation_p.E863D|AFF3_uc010fiq.1_Missense_Mutation_p.E838D|AFF3_uc010yvr.1_Missense_Mutation_p.E991D|AFF3_uc002tah.1_Missense_Mutation_p.E863D	p.E838D	NM_002285	NP_002276	WXS	Illumina HiSeq	Unspecified	P51826	AFF3_HUMAN			15	2750	-			838					B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Missense_Mutation	SNP	ENST00000409236.2	37	c.2514G>C	CCDS42723.1	.	.	.	.	.	.	.	.	.	.	C	10.83	1.461604	0.26248	.	.	ENSG00000144218	ENST00000317233;ENST00000356421;ENST00000409579;ENST00000409236;ENST00000433370;ENST00000444786	T;T;T;T	0.70164	-0.46;-0.46;-0.46;-0.46	5.92	-1.83	0.07833	.	0.444320	0.20798	N	0.085495	T	0.48114	0.1482	L	0.38175	1.15	0.20764	N	0.99986	B;B;B	0.13145	0.006;0.007;0.001	B;B;B	0.16289	0.015;0.003;0.004	T	0.28870	-1.0030	10	0.39692	T	0.17	.	6.088	0.19978	0.0:0.3461:0.3314:0.3225	.	991;838;863	B7Z4I6;P51826;P51826-2	.;AFF3_HUMAN;.	D	838;863;863;838;838;991	ENSP00000317421:E838D;ENSP00000348793:E863D;ENSP00000386834:E863D;ENSP00000387207:E838D	ENSP00000317421:E838D	E	-	3	2	AFF3	99570125	0.979000	0.34478	0.114000	0.21550	0.781000	0.44180	0.008000	0.13197	-0.338000	0.08413	-0.783000	0.03347	GAG		0.453	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328982.3	NM_002285		32	148	0	0	0	0	32	148				
NMS	129521	broad.mit.edu	37	2	101096984	101096984	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:101096984C>T	ENST00000376865.1	+	7	370	c.363C>T	c.(361-363)ttC>ttT	p.F121F		NM_001011717.1	NP_001011717.1	Q5H8A3	NMS_HUMAN	neuromedin S	121					neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				breast(1)|large_intestine(4)|lung(7)|ovary(1)|stomach(1)	14						CAGTGGACTTCACCAAGAAGG	0.562																																						uc002tan.1		NA																	0				ovary(1)	1						c.(361-363)TTC>TTT		neuromedin S precursor							112.0	104.0	107.0					2																	101096984		2203	4300	6503	SO:0001819	synonymous_variant	129521				neuropeptide signaling pathway|regulation of smooth muscle contraction	extracellular region		g.chr2:101096984C>T	AB164464	CCDS33259.1	2q11.2	2013-02-26			ENSG00000204640	ENSG00000204640		"""Endogenous ligands"""	32203	protein-coding gene	gene with protein product	"""prepro-NMS"""					15635449	Standard	NM_001011717		Approved		uc002tan.1	Q5H8A3	OTTHUMG00000153142	ENST00000376865.1:c.363C>T	2.37:g.101096984C>T			Somatic					p.F121F	NM_001011717	NP_001011717	WXS	Illumina HiSeq	Unspecified	Q5H8A3	NMS_HUMAN			7	370	+			121						Silent	SNP	ENST00000376865.1	37	c.363C>T	CCDS33259.1																																																																																				0.562	NMS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329737.1	NM_001011717		8	52	0	0	0	0	8	52				
C1QL2	165257	broad.mit.edu	37	2	119915802	119915802	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:119915802G>T	ENST00000272520.3	-	1	663	c.44C>A	c.(43-45)gCg>gAg	p.A15E		NM_182528.3	NP_872334.2	Q7Z5L3	C1QL2_HUMAN	complement component 1, q subcomponent-like 2	15					protein oligomerization (GO:0051259)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)				NS(1)|endometrium(1)|large_intestine(3)|pancreas(1)|prostate(1)	7						TCGGGGCGCCGCCTGCAGCAG	0.741										HNSCC(49;0.14)																												uc002tlo.2		NA																	0				pancreas(1)	1						c.(43-45)GCG>GAG		complement component 1, q subcomponent-like 2							6.0	7.0	7.0					2																	119915802		1162	2837	3999	SO:0001583	missense	165257					collagen		g.chr2:119915802G>T	AF525315	CCDS42737.1	2q14.2	2009-05-20			ENSG00000144119	ENSG00000144119			24181	protein-coding gene	gene with protein product	"""C1q and tumor necrosis factor related protein 10"""	614330				18783346	Standard	NM_182528		Approved	CTRP10, C1QTNF10	uc002tlo.2	Q7Z5L3	OTTHUMG00000153271	ENST00000272520.3:c.44C>A	2.37:g.119915802G>T	ENSP00000272520:p.Ala15Glu	HNSCC(49;0.14)	Somatic					p.A15E	NM_182528	NP_872334	WXS	Illumina HiSeq	Unspecified	Q7Z5L3	C1QL2_HUMAN			1	670	-			15						Missense_Mutation	SNP	ENST00000272520.3	37	c.44C>A	CCDS42737.1	.	.	.	.	.	.	.	.	.	.	G	16.03	3.007301	0.54361	.	.	ENSG00000144119	ENST00000272520	T	0.79653	-1.29	3.96	3.96	0.45880	.	2.159690	0.02387	N	0.079318	T	0.63745	0.2537	N	0.14661	0.345	0.27338	N	0.956573	P	0.38677	0.642	B	0.25291	0.059	T	0.59915	-0.7364	9	.	.	.	.	7.3962	0.26938	0.1193:0.0:0.8807:0.0	.	15	Q7Z5L3	C1QL2_HUMAN	E	15	ENSP00000272520:A15E	.	A	-	2	0	C1QL2	119632272	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.504000	0.66968	2.032000	0.59987	0.561000	0.74099	GCG		0.741	C1QL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330527.2	NM_182528		4	5	1	0	1.24e-05	1.29e-05	4	5				
CNTNAP5	129684	broad.mit.edu	37	2	124783248	124783248	+	Silent	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:124783248G>A	ENST00000431078.1	+	1	385	c.21G>A	c.(19-21)ctG>ctA	p.L7L	CNTNAP5_ENST00000423939.2_3'UTR|AC079154.1_ENST00000438816.1_RNA	NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	7					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		TACCACGGCTGACCAGCGTTT	0.547																																						uc002tno.2		NA																	0				ovary(10)	10						c.(19-21)CTG>CTA		contactin associated protein-like 5 precursor							124.0	129.0	127.0					2																	124783248		1999	4165	6164	SO:0001819	synonymous_variant	129684				cell adhesion|signal transduction	integral to membrane	receptor binding	g.chr2:124783248G>A	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.21G>A	2.37:g.124783248G>A			Somatic				CNTNAP5_uc010flu.2_Silent_p.L7L	p.L7L	NM_130773	NP_570129	WXS	Illumina HiSeq	Unspecified	Q8WYK1	CNTP5_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.248)	1	385	+			7					Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Silent	SNP	ENST00000431078.1	37	c.21G>A	CCDS46401.1																																																																																				0.547	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3			8	71	0	0	0	0	8	71				
DARS	1615	broad.mit.edu	37	2	136740989	136740989	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:136740989C>G	ENST00000264161.4	-	2	317	c.102G>C	c.(100-102)atG>atC	p.M34I	AC093391.2_ENST00000446492.1_RNA|AC093391.2_ENST00000419808.1_RNA|DARS_ENST00000463008.1_5'Flank|DARS_ENST00000537273.1_Intron|AC093391.2_ENST00000444406.1_RNA|AC093391.2_ENST00000438432.1_RNA	NM_001349.2	NP_001340.2	P14868	SYDC_HUMAN	aspartyl-tRNA synthetase	34					aspartyl-tRNA aminoacylation (GO:0006422)|gene expression (GO:0010467)|protein complex assembly (GO:0006461)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	aminoacylase activity (GO:0004046)|aspartate-tRNA ligase activity (GO:0004815)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|urinary_tract(2)	15				BRCA - Breast invasive adenocarcinoma(221;0.168)	L-Aspartic Acid(DB00128)	GTGATTGTATCATTGAAGATA	0.299																																						uc002tux.1		NA																	0				ovary(1)	1						c.(100-102)ATG>ATC		aspartyl-tRNA synthetase	L-Aspartic Acid(DB00128)						84.0	78.0	80.0					2																	136740989		2200	4291	6491	SO:0001583	missense	1615				aspartyl-tRNA aminoacylation|protein complex assembly	cytosol|nuclear membrane|plasma membrane|soluble fraction	aminoacylase activity|aspartate-tRNA ligase activity|ATP binding|nucleic acid binding|protein binding	g.chr2:136740989C>G	J05032	CCDS2180.1	2q21.3	2011-07-01			ENSG00000115866	ENSG00000115866	6.1.1.12	"""Aminoacyl tRNA synthetases / Class II"""	2678	protein-coding gene	gene with protein product	"""aspartate tRNA ligase 1, cytoplasmic"""	603084				2674137	Standard	NM_001349		Approved		uc002tux.1	P14868	OTTHUMG00000131741	ENST00000264161.4:c.102G>C	2.37:g.136740989C>G	ENSP00000264161:p.Met34Ile		Somatic				DARS_uc010fnj.1_Intron	p.M34I	NM_001349	NP_001340	WXS	Illumina HiSeq	Unspecified	P14868	SYDC_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.168)	2	286	-			34					A8K3J2|D3DP77|Q2TNI3|Q32Q69|Q53HV4|Q53YC5|Q68CR9|Q9BW52	Missense_Mutation	SNP	ENST00000264161.4	37	c.102G>C	CCDS2180.1	.	.	.	.	.	.	.	.	.	.	C	15.90	2.969855	0.53614	.	.	ENSG00000115866	ENST00000264161;ENST00000441323;ENST00000456565;ENST00000449218	D	0.82081	-1.57	5.94	5.94	0.96194	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	0.034840	0.85682	D	0.000000	T	0.70824	0.3268	N	0.08118	0	0.80722	D	1	B	0.06786	0.001	B	0.10450	0.005	T	0.65425	-0.6171	10	0.46703	T	0.11	-16.5384	17.2904	0.87154	0.0:1.0:0.0:0.0	.	34	P14868	SYDC_HUMAN	I	34;1;1;1	ENSP00000264161:M34I	ENSP00000264161:M34I	M	-	3	0	DARS	136457459	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.774000	0.47694	2.820000	0.97059	0.650000	0.86243	ATG		0.299	DARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254660.5	NM_001349		2	8	0	0	0	0	2	8				
NMI	9111	broad.mit.edu	37	2	152132175	152132175	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:152132175C>G	ENST00000243346.5	-	6	927	c.457G>C	c.(457-459)Gaa>Caa	p.E153Q		NM_004688.2	NP_004679.2	Q13287	NMI_HUMAN	N-myc (and STAT) interactor	153					inflammatory response (GO:0006954)|JAK-STAT cascade (GO:0007259)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription cofactor activity (GO:0003712)			endometrium(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	11				BRCA - Breast invasive adenocarcinoma(221;0.0571)		TTAGAAACTTCTACATAAACC	0.343																																						uc002txi.2		NA																	0					0						c.(457-459)GAA>CAA		N-myc and STAT interactor							72.0	77.0	75.0					2																	152132175		2203	4300	6503	SO:0001583	missense	9111				inflammatory response|JAK-STAT cascade|transcription from RNA polymerase II promoter	cytoplasm|nucleus	nucleotide binding|protein binding|transcription cofactor activity	g.chr2:152132175C>G	U32849	CCDS2192.1	2q23	2008-05-23			ENSG00000123609	ENSG00000123609			7854	protein-coding gene	gene with protein product		603525				8668343, 9989503	Standard	NM_004688		Approved		uc002txi.2	Q13287	OTTHUMG00000131867	ENST00000243346.5:c.457G>C	2.37:g.152132175C>G	ENSP00000243346:p.Glu153Gln		Somatic				NMI_uc010zbx.1_3'UTR	p.E153Q	NM_004688	NP_004679	WXS	Illumina HiSeq	Unspecified	Q13287	NMI_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0571)	6	787	-			153					B5BU69|Q53TI8|Q9BVE5	Missense_Mutation	SNP	ENST00000243346.5	37	c.457G>C	CCDS2192.1	.	.	.	.	.	.	.	.	.	.	C	7.071	0.568354	0.13560	.	.	ENSG00000123609	ENST00000243346	T	0.42131	0.98	5.33	3.12	0.35913	Nmi/IFP 35 (1);Nucleotide-binding, alpha-beta plait (1);	0.753274	0.13847	N	0.358644	T	0.21921	0.0528	N	0.15975	0.35	0.09310	N	1	B	0.16603	0.018	B	0.17722	0.019	T	0.13361	-1.0512	10	0.23302	T	0.38	-2.9384	4.7632	0.13118	0.0:0.6172:0.2401:0.1427	.	153	Q13287	NMI_HUMAN	Q	153	ENSP00000243346:E153Q	ENSP00000243346:E153Q	E	-	1	0	NMI	151840421	0.011000	0.17503	0.150000	0.22450	0.817000	0.46193	1.326000	0.33735	1.378000	0.46305	0.591000	0.81541	GAA		0.343	NMI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254817.2	NM_004688		6	73	0	0	0	0	6	73				
PKP4	8502	broad.mit.edu	37	2	159530188	159530188	+	Splice_Site	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:159530188G>A	ENST00000389759.3	+	18	3036		c.e18-1		PKP4_ENST00000389757.3_Splice_Site|AC005042.4_ENST00000342892.4_RNA	NM_003628.3	NP_003619.2	Q99569	PKP4_HUMAN	plakophilin 4						cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|positive regulation of cytokinesis (GO:0032467)|positive regulation of gene expression (GO:0010628)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell adhesion (GO:0030155)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|desmosome (GO:0030057)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)				breast(2)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(21)|ovary(6)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	61						TCTCTACCTAGATCATCTCTG	0.478										HNSCC(62;0.18)																												uc002tzv.2		NA																	0				ovary(5)|skin(2)	7						c.e18-1		plakophilin 4 isoform a							93.0	88.0	90.0					2																	159530188		2203	4300	6503	SO:0001630	splice_region_variant	8502				cell adhesion	desmosome	protein binding	g.chr2:159530188G>A	X81889	CCDS33305.1, CCDS33306.1	2q24.1	2013-02-14			ENSG00000144283	ENSG00000144283		"""Armadillo repeat containing"""	9026	protein-coding gene	gene with protein product		604276				9342840, 8937994	Standard	NM_003628		Approved	p0071	uc002tzv.3	Q99569	OTTHUMG00000153969	ENST00000389759.3:c.2925-1G>A	2.37:g.159530188G>A		HNSCC(62;0.18)	Somatic				PKP4_uc002tzw.2_Splice_Site_p.R975_splice|PKP4_uc002tzx.2_Splice_Site_p.R632_splice|PKP4_uc002uaa.2_Splice_Site_p.R827_splice|uc002uab.1_Intron|PKP4_uc002uac.2_Splice_Site_p.R156_splice|PKP4_uc002uad.2_Splice_Site|PKP4_uc002uae.1_Splice_Site_p.R62_splice	p.R975_splice	NM_003628	NP_003619	WXS	Illumina HiSeq	Unspecified	Q99569	PKP4_HUMAN			18	3185	+								Q86W91	Splice_Site	SNP	ENST00000389759.3	37	c.2925_splice	CCDS33305.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.769066	0.90020	.	.	ENSG00000144283	ENST00000389757;ENST00000389759	.	.	.	5.93	5.93	0.95920	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3539	0.98825	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PKP4	159238434	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.476000	0.97823	2.826000	0.97356	0.655000	0.94253	.		0.478	PKP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333250.1		Intron	11	53	0	0	0	0	11	53				
WDSUB1	151525	broad.mit.edu	37	2	160092614	160092614	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:160092614G>A	ENST00000409990.3	-	11	1617	c.1361C>T	c.(1360-1362)tCa>tTa	p.S454L	WDSUB1_ENST00000358147.4_Missense_Mutation_p.S362L|WDSUB1_ENST00000409124.1_Missense_Mutation_p.S407L|WDSUB1_ENST00000392796.3_Missense_Mutation_p.S454L|WDSUB1_ENST00000359774.4_Missense_Mutation_p.S454L	NM_001128213.1	NP_001121685	Q8N9V3	WSDU1_HUMAN	WD repeat, sterile alpha motif and U-box domain containing 1	454	U-box.						ubiquitin-protein transferase activity (GO:0004842)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(3)|prostate(1)|stomach(3)	16						AAGTACCGCTGAAGGAAGAAC	0.333																																						uc002uaj.3		NA																	0					0						c.(1360-1362)TCA>TTA		WD repeat, sterile alpha motif and U-box domain							111.0	105.0	107.0					2																	160092614		2203	4300	6503	SO:0001583	missense	151525					ubiquitin ligase complex	ubiquitin-protein ligase activity	g.chr2:160092614G>A	AK093494	CCDS2208.1	2q24.2	2013-01-28	2006-02-17	2005-03-25	ENSG00000196151	ENSG00000196151		"""WD repeat domain containing"", ""Sterile alpha motif (SAM) domain containing"", ""U-box domain containing"""	26697	protein-coding gene	gene with protein product			"""WD repeat and SAM domain containing 1"", ""WD repeat, SAM and U-box domain containing 1"""	WDSAM1		12477932	Standard	NM_152528		Approved	UBOX6, FLJ36175	uc002ual.4	Q8N9V3	OTTHUMG00000132028	ENST00000409990.3:c.1361C>T	2.37:g.160092614G>A	ENSP00000387078:p.Ser454Leu		Somatic				WDSUB1_uc002uak.3_Missense_Mutation_p.S454L|WDSUB1_uc002ual.3_Missense_Mutation_p.S454L|WDSUB1_uc002uam.3_Missense_Mutation_p.S407L|WDSUB1_uc010foo.2_Missense_Mutation_p.S362L	p.S454L	NM_152528	NP_689741	WXS	Illumina HiSeq	Unspecified	Q8N9V3	WSDU1_HUMAN			11	1510	-			454			U-box.		Q53TI9|Q8N6N8	Missense_Mutation	SNP	ENST00000409990.3	37	c.1361C>T	CCDS2208.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.285006	0.80803	.	.	ENSG00000196151	ENST00000359774;ENST00000358147;ENST00000392796;ENST00000409990;ENST00000409124	T;T;T;T;T	0.59772	0.58;0.24;0.58;0.58;0.61	5.99	5.99	0.97316	Zinc finger, RING/FYVE/PHD-type (1);U box domain (2);	0.122077	0.53938	D	0.000049	T	0.69815	0.3153	L	0.46819	1.47	0.38052	D	0.935819	D;D;D	0.61080	0.986;0.989;0.97	P;D;P	0.64595	0.843;0.927;0.659	T	0.72766	-0.4194	10	0.72032	D	0.01	.	17.1044	0.86658	0.0:0.189:0.811:0.0	.	362;407;454	Q8N9V3-2;B8ZZF2;Q8N9V3	.;.;WSDU1_HUMAN	L	454;362;454;454;407	ENSP00000352820:S454L;ENSP00000350866:S362L;ENSP00000376545:S454L;ENSP00000387078:S454L;ENSP00000386891:S407L	ENSP00000350866:S362L	S	-	2	0	WDSUB1	159800860	1.000000	0.71417	0.985000	0.45067	0.823000	0.46562	6.055000	0.71103	2.840000	0.97914	0.655000	0.94253	TCA		0.333	WDSUB1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333339.1	NM_152528		10	36	0	0	0	0	10	36				
SCN3A	6328	broad.mit.edu	37	2	166011139	166011139	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:166011139C>T	ENST00000360093.3	-	11	1694	c.1203G>A	c.(1201-1203)atG>atA	p.M401I	SCN3A_ENST00000283254.7_Missense_Mutation_p.M401I|SCN3A_ENST00000409101.3_Missense_Mutation_p.M401I	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	401				M -> T (in Ref. 4; AAC29514/AAC29515). {ECO:0000305}.	membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CAAAAAATATCATGTATGTTT	0.413																																						uc002ucx.2		NA																	0				ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10						c.(1201-1203)ATG>ATA		sodium channel, voltage-gated, type III, alpha	Lamotrigine(DB00555)						64.0	65.0	65.0					2																	166011139		2203	4300	6503	SO:0001583	missense	6328					voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:166011139C>T	AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.1203G>A	2.37:g.166011139C>T	ENSP00000353206:p.Met401Ile		Somatic				SCN3A_uc002ucy.2_Missense_Mutation_p.M401I|SCN3A_uc002ucz.2_Missense_Mutation_p.M401I|SCN3A_uc002uda.1_Missense_Mutation_p.M270I|SCN3A_uc002udb.1_Missense_Mutation_p.M270I	p.M401I	NM_006922	NP_008853	WXS	Illumina HiSeq	Unspecified	Q9NY46	SCN3A_HUMAN			11	1695	-			401	M -> T (in Ref. 4; AAC29514/AAC29515).		Helical; Name=S6 of repeat I; (Potential).		Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	ENST00000360093.3	37	c.1203G>A		.	.	.	.	.	.	.	.	.	.	C	21.1	4.094705	0.76870	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000440431	D;D;D;D	0.98381	-4.9;-4.9;-4.9;-4.9	5.74	5.74	0.90152	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98757	0.9582	M	0.69358	2.11	0.80722	D	1	P;P;P;P;P	0.49862	0.925;0.596;0.541;0.929;0.908	D;P;B;P;D	0.67900	0.954;0.512;0.433;0.834;0.922	D	0.99785	1.1029	10	0.66056	D	0.02	.	19.9265	0.97104	0.0:1.0:0.0:0.0	.	401;401;401;401;401	Q9NY46;E7EUE6;Q9NY46-2;Q9NY46-4;Q9NY46-3	SCN3A_HUMAN;.;.;.;.	I	401	ENSP00000353206:M401I;ENSP00000283254:M401I;ENSP00000386726:M401I;ENSP00000403348:M401I	ENSP00000283254:M401I	M	-	3	0	SCN3A	165719385	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.818000	0.86416	2.723000	0.93209	0.591000	0.81541	ATG		0.413	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922		17	65	0	0	0	0	17	65				
SCN7A	6332	broad.mit.edu	37	2	167262119	167262119	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:167262119C>A	ENST00000409855.1	-	25	5146	c.5020G>T	c.(5020-5022)Gaa>Taa	p.E1674*		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	1674					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.E1674K(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	GGTGACTTTTCCTTAGCTTTG	0.353																																						uc002udu.1		NA																	1	Substitution - Missense(1)	p.E1674K(1)	ovary(1)	large_intestine(1)	1						c.(5020-5022)GAA>TAA		sodium channel, voltage-gated, type VII, alpha							244.0	230.0	234.0					2																	167262119		1846	4097	5943	SO:0001587	stop_gained	6332				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:167262119C>A	M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.5020G>T	2.37:g.167262119C>A	ENSP00000386796:p.Glu1674*		Somatic					p.E1674*	NM_002976	NP_002967	WXS	Illumina HiSeq	Unspecified	Q01118	SCN7A_HUMAN			25	5147	-			1674						Nonsense_Mutation	SNP	ENST00000409855.1	37	c.5020G>T	CCDS46442.1	.	.	.	.	.	.	.	.	.	.	C	43	9.897503	0.99290	.	.	ENSG00000136546	ENST00000409855;ENST00000259060	.	.	.	4.75	4.75	0.60458	.	0.521196	0.17591	N	0.168756	.	.	.	.	.	.	0.41630	D	0.989016	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	15.1315	0.72527	0.0:1.0:0.0:0.0	.	.	.	.	X	1674	.	ENSP00000259060:E1674X	E	-	1	0	SCN7A	166970365	0.639000	0.27234	0.220000	0.23810	0.217000	0.24651	2.927000	0.48900	2.630000	0.89119	0.655000	0.94253	GAA		0.353	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333745.1			38	189	1	0	3.09e-21	3.33e-21	38	189				
ABCB11	8647	broad.mit.edu	37	2	169869909	169869909	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:169869909C>G	ENST00000263817.6	-	5	386	c.262G>C	c.(262-264)Gat>Cat	p.D88H		NM_003742.2	NP_003733.2	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 11	88	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|canalicular bile acid transport (GO:0015722)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|bile acid-exporting ATPase activity (GO:0015432)|canalicular bile acid transmembrane transporter activity (GO:0015126)|sodium-exporting ATPase activity, phosphorylative mechanism (GO:0008554)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(16)|lung(26)|ovary(3)|stomach(1)	57					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Chlorpromazine(DB00477)|Cimetidine(DB00501)|Clofazimine(DB00845)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Digoxin(DB00390)|Doxorubicin(DB00997)|Ethinyl Estradiol(DB00977)|Fluorescein(DB00693)|Fusidic Acid(DB02703)|Glyburide(DB01016)|Ketoconazole(DB01026)|Novobiocin(DB01051)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Ponatinib(DB08901)|Pravastatin(DB00175)|Progesterone(DB00396)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Tamoxifen(DB00675)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	ATAAAAACATCTGTCATTGTG	0.423																																						uc002ueo.1		NA																	0				ovary(2)|large_intestine(2)|breast(1)	5						c.(262-264)GAT>CAT		ATP-binding cassette, sub-family B (MDR/TAP),	Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Glibenclamide(DB01016)						186.0	177.0	180.0					2																	169869909		1895	4135	6030	SO:0001583	missense	8647				bile acid biosynthetic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|bile acid-exporting ATPase activity|canalicular bile acid transmembrane transporter activity|sodium-exporting ATPase activity, phosphorylative mechanism	g.chr2:169869909C>G	AF091582	CCDS46444.1	2q24	2012-03-14			ENSG00000073734	ENSG00000073734		"""ATP binding cassette transporters / subfamily B"""	42	protein-coding gene	gene with protein product	"""ABC member 16, MDR/TAP subfamily"""	603201	"""progressive familial intrahepatic cholestasis 2"", ""bile salt export pump"""	BSEP, PFIC2		9806540	Standard	NM_003742		Approved	ABC16, SPGP, PFIC-2, PGY4	uc002ueo.1	O95342	OTTHUMG00000154039	ENST00000263817.6:c.262G>C	2.37:g.169869909C>G	ENSP00000263817:p.Asp88His		Somatic					p.D88H	NM_003742	NP_003733	WXS	Illumina HiSeq	Unspecified	O95342	ABCBB_HUMAN			5	388	-			88			ABC transmembrane type-1 1.|Extracellular (Potential).		Q53TL2|Q9UNB2	Missense_Mutation	SNP	ENST00000263817.6	37	c.262G>C	CCDS46444.1	.	.	.	.	.	.	.	.	.	.	C	19.31	3.803024	0.70682	.	.	ENSG00000073734	ENST00000263817	D	0.91295	-2.82	5.41	5.41	0.78517	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.96065	0.8718	M	0.87269	2.87	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.96505	0.9374	10	0.87932	D	0	.	19.2026	0.93717	0.0:1.0:0.0:0.0	.	88	O95342	ABCBB_HUMAN	H	88	ENSP00000263817:D88H	ENSP00000263817:D88H	D	-	1	0	ABCB11	169578155	1.000000	0.71417	1.000000	0.80357	0.785000	0.44390	4.116000	0.57871	2.526000	0.85167	0.555000	0.69702	GAT		0.423	ABCB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333616.2	NM_003742		34	192	0	0	0	0	34	192				
TTN	7273	broad.mit.edu	37	2	179497295	179497295	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:179497295C>G	ENST00000591111.1	-	185	38739	c.38515G>C	c.(38515-38517)Gaa>Caa	p.E12839Q	TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E14480Q|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E11912Q|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E5540Q|TTN_ENST00000460472.2_Missense_Mutation_p.E5415Q|TTN_ENST00000342175.6_Missense_Mutation_p.E5607Q|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12839	Ig-like 85.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTTCAGCTTCAAACATGTAT	0.348																																						uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(35734-35736)GAA>CAA		titin isoform N2-A							119.0	116.0	117.0					2																	179497295		1918	4120	6038	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179497295C>G	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.38515G>C	2.37:g.179497295C>G	ENSP00000465570:p.Glu12839Gln		Somatic				TTN_uc010zfh.1_Missense_Mutation_p.E5607Q|TTN_uc010zfi.1_Missense_Mutation_p.E5540Q|TTN_uc010zfj.1_Missense_Mutation_p.E5415Q	p.E11912Q	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		184	35958	-			12839					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.35734G>C		.	.	.	.	.	.	.	.	.	.	C	13.72	2.320045	0.41096	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17	6.1	6.1	0.99115	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.75125	0.3807	L	0.41824	1.3	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	T	0.75107	-0.3434	9	0.87932	D	0	.	20.7146	0.99709	0.0:1.0:0.0:0.0	.	5415;5540;5607;12839	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	Q	11912;5415;5607;5540;5415	ENSP00000343764:E11912Q;ENSP00000434586:E5415Q;ENSP00000340554:E5607Q;ENSP00000352154:E5540Q	ENSP00000340554:E5607Q	E	-	1	0	TTN	179205540	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	7.770000	0.85390	2.902000	0.99343	0.650000	0.86243	GAA		0.348	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		25	104	0	0	0	0	25	104				
TTN	7273	broad.mit.edu	37	2	179497313	179497313	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:179497313C>T	ENST00000591111.1	-	185	38721	c.38497G>A	c.(38497-38499)Gaa>Aaa	p.E12833K	TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E14474K|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E11906K|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E5534K|TTN_ENST00000460472.2_Missense_Mutation_p.E5409K|TTN_ENST00000342175.6_Missense_Mutation_p.E5601K|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12833	Ig-like 85.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TATTTTGCTTCATCTTCAAAA	0.373																																						uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(35716-35718)GAA>AAA		titin isoform N2-A							139.0	137.0	137.0					2																	179497313		1925	4125	6050	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179497313C>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.38497G>A	2.37:g.179497313C>T	ENSP00000465570:p.Glu12833Lys		Somatic				TTN_uc010zfh.1_Missense_Mutation_p.E5601K|TTN_uc010zfi.1_Missense_Mutation_p.E5534K|TTN_uc010zfj.1_Missense_Mutation_p.E5409K	p.E11906K	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		184	35940	-			12833					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.35716G>A		.	.	.	.	.	.	.	.	.	.	C	16.22	3.061339	0.55432	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31	6.1	6.1	0.99115	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.83681	0.5307	M	0.78801	2.425	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.83275	0.996;0.996;0.996;0.996	D	0.83894	0.0286	9	0.87932	D	0	.	20.7146	0.99709	0.0:1.0:0.0:0.0	.	5409;5534;5601;12833	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	K	11906;5409;5601;5534;5409	ENSP00000343764:E11906K;ENSP00000434586:E5409K;ENSP00000340554:E5601K;ENSP00000352154:E5534K	ENSP00000340554:E5601K	E	-	1	0	TTN	179205558	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.770000	0.85390	2.902000	0.99343	0.650000	0.86243	GAA		0.373	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		30	144	0	0	0	0	30	144				
TTN	7273	broad.mit.edu	37	2	179547472	179547472	+	Missense_Mutation	SNP	C	C	T	rs188482293		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:179547472C>T	ENST00000591111.1	-	133	32319	c.32095G>A	c.(32095-32097)Gag>Aag	p.E10699K	TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E11016K|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E9772K|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	0	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCCCGCTCCTCGTATTCTTCA	0.358													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18319	0.0		0.0	False		,,,				2504	0.0					uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(29314-29316)GAG>AAG		titin isoform N2-A		C	,,,LYS/GLU	1,3767		0,1,1883	301.0	283.0	288.0		,,,29314	4.6	0.4	2		288	0,8204		0,0,4102	no	intron,intron,intron,missense	TTN	NM_003319.4,NM_133432.3,NM_133437.3,NM_133378.4	,,,56	0,1,5985	TT,TC,CC		0.0,0.0265,0.0084	,,,benign	,,,9772/33424	179547472	1,11971	1884	4102	5986	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179547472C>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.32095G>A	2.37:g.179547472C>T	ENSP00000465570:p.Glu10699Lys		Somatic				TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.E6433K|TTN_uc010fre.1_Missense_Mutation_p.E619K	p.E9772K	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		132	29538	-			10699					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.29314G>A		1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	8.915	0.959553	0.18507	2.65E-4	0.0	ENSG00000155657	ENST00000342992;ENST00000414766	T;T	0.71461	-0.57;-0.09	5.45	4.57	0.56435	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.56834	0.2012	N	0.19112	0.55	0.80722	D	1	B;B	0.16396	0.0;0.017	B;B	0.12156	0.0;0.007	T	0.56486	-0.7971	9	0.87932	D	0	.	12.7145	0.57107	0.0:0.9226:0.0:0.0774	.	10699;10435	Q8WZ42;Q8WZ42-5	TITIN_HUMAN;.	K	9772;630	ENSP00000343764:E9772K;ENSP00000401501:E630K	ENSP00000343764:E9772K	E	-	1	0	TTN	179255717	0.001000	0.12720	0.426000	0.26672	0.136000	0.21042	1.197000	0.32211	1.442000	0.47568	0.655000	0.94253	GAG		0.358	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		30	216	0	0	0	0	30	216				
DUSP19	142679	broad.mit.edu	37	2	183960237	183960237	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:183960237G>A	ENST00000354221.4	+	4	680	c.505G>A	c.(505-507)Gaa>Aaa	p.E169K	DUSP19_ENST00000342619.6_Missense_Mutation_p.E118K|AC064871.3_ENST00000413954.1_RNA|AC064871.3_ENST00000444562.1_RNA|DUSP19_ENST00000469344.1_3'UTR	NM_080876.3	NP_543152.1	Q8WTR2	DUS19_HUMAN	dual specificity phosphatase 19	169	Tyrosine-protein phosphatase.				inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase activity (GO:0045860)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)	JUN kinase phosphatase activity (GO:0008579)|MAP-kinase scaffold activity (GO:0005078)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein kinase activator activity (GO:0030295)|protein kinase inhibitor activity (GO:0004860)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/threonine phosphatase activity (GO:0008330)			breast(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(4)|pancreas(1)	17						GATGAATTCTGAACAAACCTC	0.388																																						uc002upd.2		NA																	0				ovary(4)|pancreas(1)	5						c.(505-507)GAA>AAA		dual specificity phosphatase 19 isoform 1							145.0	150.0	148.0					2																	183960237		2203	4300	6503	SO:0001583	missense	142679				JNK cascade|negative regulation of JNK cascade|negative regulation of JUN kinase activity|positive regulation of JNK cascade|positive regulation of JUN kinase activity	cytoplasm	JUN kinase phosphatase activity|MAP-kinase scaffold activity|mitogen-activated protein kinase kinase kinase binding|protein kinase activator activity|protein kinase inhibitor activity|protein tyrosine phosphatase activity	g.chr2:183960237G>A	AB038770	CCDS2289.1, CCDS46469.1	2q32.1	2011-06-09			ENSG00000162999	ENSG00000162999		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	18894	protein-coding gene	gene with protein product		611437					Standard	NM_080876		Approved	SKRP1, DUSP17	uc002upd.3	Q8WTR2	OTTHUMG00000132622	ENST00000354221.4:c.505G>A	2.37:g.183960237G>A	ENSP00000346160:p.Glu169Lys		Somatic				DUSP19_uc010frp.2_Missense_Mutation_p.E118K|DUSP19_uc010zfr.1_RNA|DUSP19_uc002upe.2_3'UTR	p.E169K	NM_080876	NP_543152	WXS	Illumina HiSeq	Unspecified	Q8WTR2	DUS19_HUMAN			4	880	+			169			Tyrosine-protein phosphatase.		B2RA79|Q547H4|Q8WYN4	Missense_Mutation	SNP	ENST00000354221.4	37	c.505G>A	CCDS2289.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.298551	0.81025	.	.	ENSG00000162999	ENST00000342619;ENST00000354221	T;T	0.60299	0.2;0.2	5.8	5.8	0.92144	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.186334	0.56097	D	0.000028	T	0.48750	0.1517	N	0.20445	0.575	0.80722	D	1	B;B	0.13145	0.004;0.007	B;B	0.29440	0.025;0.102	T	0.34453	-0.9828	10	0.22706	T	0.39	.	20.0544	0.97645	0.0:0.0:1.0:0.0	.	118;169	Q8WTR2-2;Q8WTR2	.;DUS19_HUMAN	K	118;169	ENSP00000343905:E118K;ENSP00000346160:E169K	ENSP00000343905:E118K	E	+	1	0	DUSP19	183668482	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	8.835000	0.92100	2.746000	0.94184	0.591000	0.81541	GAA		0.388	DUSP19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255866.1			19	130	0	0	0	0	19	130				
DUSP19	142679	broad.mit.edu	37	2	183960345	183960345	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:183960345G>A	ENST00000354221.4	+	4	788	c.613G>A	c.(613-615)Gaa>Aaa	p.E205K	DUSP19_ENST00000342619.6_Missense_Mutation_p.E154K|AC064871.3_ENST00000413954.1_RNA|AC064871.3_ENST00000444562.1_RNA|DUSP19_ENST00000469344.1_3'UTR	NM_080876.3	NP_543152.1	Q8WTR2	DUS19_HUMAN	dual specificity phosphatase 19	205					inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase activity (GO:0045860)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)	JUN kinase phosphatase activity (GO:0008579)|MAP-kinase scaffold activity (GO:0005078)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein kinase activator activity (GO:0030295)|protein kinase inhibitor activity (GO:0004860)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/threonine phosphatase activity (GO:0008330)			breast(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(4)|pancreas(1)	17						AGAGGGCAAAGAAAGCAATAA	0.398																																						uc002upd.2		NA																	0				ovary(4)|pancreas(1)	5						c.(613-615)GAA>AAA		dual specificity phosphatase 19 isoform 1							108.0	105.0	106.0					2																	183960345		2203	4300	6503	SO:0001583	missense	142679				JNK cascade|negative regulation of JNK cascade|negative regulation of JUN kinase activity|positive regulation of JNK cascade|positive regulation of JUN kinase activity	cytoplasm	JUN kinase phosphatase activity|MAP-kinase scaffold activity|mitogen-activated protein kinase kinase kinase binding|protein kinase activator activity|protein kinase inhibitor activity|protein tyrosine phosphatase activity	g.chr2:183960345G>A	AB038770	CCDS2289.1, CCDS46469.1	2q32.1	2011-06-09			ENSG00000162999	ENSG00000162999		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	18894	protein-coding gene	gene with protein product		611437					Standard	NM_080876		Approved	SKRP1, DUSP17	uc002upd.3	Q8WTR2	OTTHUMG00000132622	ENST00000354221.4:c.613G>A	2.37:g.183960345G>A	ENSP00000346160:p.Glu205Lys		Somatic				DUSP19_uc010frp.2_Missense_Mutation_p.E154K|DUSP19_uc010zfr.1_RNA|DUSP19_uc002upe.2_3'UTR	p.E205K	NM_080876	NP_543152	WXS	Illumina HiSeq	Unspecified	Q8WTR2	DUS19_HUMAN			4	988	+			205					B2RA79|Q547H4|Q8WYN4	Missense_Mutation	SNP	ENST00000354221.4	37	c.613G>A	CCDS2289.1	.	.	.	.	.	.	.	.	.	.	G	13.93	2.383143	0.42207	.	.	ENSG00000162999	ENST00000342619;ENST00000354221	T;T	0.13778	2.56;3.79	5.57	4.68	0.58851	Dual specificity phosphatase, subgroup, catalytic domain (1);	0.338413	0.25506	N	0.030215	T	0.05502	0.0145	N	0.04297	-0.235	0.25205	N	0.990027	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.0	T	0.33574	-0.9863	10	0.06236	T	0.91	.	11.625	0.51139	0.1406:0.0:0.8594:0.0	.	154;205	Q8WTR2-2;Q8WTR2	.;DUS19_HUMAN	K	154;205	ENSP00000343905:E154K;ENSP00000346160:E205K	ENSP00000343905:E154K	E	+	1	0	DUSP19	183668590	0.997000	0.39634	0.879000	0.34478	0.987000	0.75469	2.680000	0.46918	2.777000	0.95525	0.591000	0.81541	GAA		0.398	DUSP19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255866.1			10	50	0	0	0	0	10	50				
ZNF804A	91752	broad.mit.edu	37	2	185800988	185800988	+	Missense_Mutation	SNP	G	G	C	rs201293895		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:185800988G>C	ENST00000302277.6	+	4	1459	c.865G>C	c.(865-867)Gaa>Caa	p.E289Q		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	289							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						CAGAGACAAAGAAACTGTTCA	0.363																																						uc002uph.2		NA																	0				ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						c.(865-867)GAA>CAA		zinc finger protein 804A							49.0	47.0	47.0					2																	185800988		2203	4299	6502	SO:0001583	missense	91752					intracellular	zinc ion binding	g.chr2:185800988G>C	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.865G>C	2.37:g.185800988G>C	ENSP00000303252:p.Glu289Gln		Somatic					p.E289Q	NM_194250	NP_919226	WXS	Illumina HiSeq	Unspecified	Q7Z570	Z804A_HUMAN			4	1459	+			289					A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	37	c.865G>C	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	G	10.26	1.301582	0.23736	.	.	ENSG00000170396	ENST00000302277	T	0.49432	0.78	5.57	5.57	0.84162	.	0.209202	0.33382	N	0.004980	T	0.46795	0.1411	M	0.62723	1.935	0.24263	N	0.995275	P	0.38195	0.622	B	0.36885	0.235	T	0.52034	-0.8629	10	0.51188	T	0.08	-13.8533	14.1819	0.65580	0.0:0.1495:0.8505:0.0	.	289	Q7Z570	Z804A_HUMAN	Q	289	ENSP00000303252:E289Q	ENSP00000303252:E289Q	E	+	1	0	ZNF804A	185509233	1.000000	0.71417	0.974000	0.42286	0.396000	0.30629	2.358000	0.44134	2.609000	0.88269	0.591000	0.81541	GAA		0.363	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250		9	52	0	0	0	0	9	52				
ZSWIM2	151112	broad.mit.edu	37	2	187702178	187702178	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:187702178C>G	ENST00000295131.2	-	5	637	c.598G>C	c.(598-600)Gag>Cag	p.E200Q		NM_182521.2	NP_872327.2	Q8NEG5	ZSWM2_HUMAN	zinc finger, SWIM-type containing 2	200					apoptotic process (GO:0006915)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|protein polyubiquitination (GO:0000209)		ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(28)|ovary(2)|prostate(4)|skin(6)|urinary_tract(1)	52			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)			GGTGCAAACTCTTTCCTGCAC	0.383																																						uc002upu.1		NA																	0				ovary(2)|skin(1)	3						c.(598-600)GAG>CAG		zinc finger, SWIM domain containing 2							103.0	102.0	102.0					2																	187702178		2203	4300	6503	SO:0001583	missense	151112				apoptosis		zinc ion binding	g.chr2:187702178C>G	AK128006	CCDS33348.1	2q32.2	2008-02-05			ENSG00000163012	ENSG00000163012		"""Zinc fingers, SWIM-type"", ""Zinc fingers, ZZ-type"""	30990	protein-coding gene	gene with protein product						12477932	Standard	NM_182521		Approved	MGC33890, ZZZ2	uc002upu.1	Q8NEG5	OTTHUMG00000154259	ENST00000295131.2:c.598G>C	2.37:g.187702178C>G	ENSP00000295131:p.Glu200Gln		Somatic					p.E200Q	NM_182521	NP_872327	WXS	Illumina HiSeq	Unspecified	Q8NEG5	ZSWM2_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)		5	638	-			200					B3KXV6|Q53SI3|Q57ZY3	Missense_Mutation	SNP	ENST00000295131.2	37	c.598G>C	CCDS33348.1	.	.	.	.	.	.	.	.	.	.	C	15.91	2.973141	0.53614	.	.	ENSG00000163012	ENST00000295131	T	0.63096	-0.02	5.97	5.09	0.68999	Zinc finger, RING/FYVE/PHD-type (1);	0.612251	0.15446	N	0.261933	T	0.54870	0.1885	M	0.64997	1.995	0.33232	D	0.555993	P	0.42827	0.791	B	0.35240	0.198	T	0.68473	-0.5399	10	0.52906	T	0.07	-0.7482	8.5968	0.33721	0.0:0.7655:0.1548:0.0797	.	200	Q8NEG5	ZSWM2_HUMAN	Q	200	ENSP00000295131:E200Q	ENSP00000295131:E200Q	E	-	1	0	ZSWIM2	187410423	0.998000	0.40836	0.975000	0.42487	0.979000	0.70002	2.313000	0.43735	1.523000	0.49018	0.591000	0.81541	GAG		0.383	ZSWIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334565.1	NM_182521		10	85	0	0	0	0	10	85				
MPP4	58538	broad.mit.edu	37	2	202550741	202550741	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:202550741C>T	ENST00000409474.3	-	6	600	c.393G>A	c.(391-393)caG>caA	p.Q131Q	MPP4_ENST00000409143.1_Silent_p.Q104Q|MPP4_ENST00000447335.2_Silent_p.Q131Q|MPP4_ENST00000359962.5_Silent_p.Q131Q|MPP4_ENST00000428900.2_Silent_p.Q131Q|MPP4_ENST00000315506.7_Silent_p.Q131Q|MPP4_ENST00000396886.3_Intron	NM_033066.2	NP_149055	Q96JB8	MPP4_HUMAN	membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)	131	L27 2. {ECO:0000255|PROSITE- ProRule:PRU00365}.				protein localization to synapse (GO:0035418)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|presynaptic membrane (GO:0042734)				kidney(1)|lung(11)	12						CAAAATCTTTCTGAGCTATCG	0.493																																						uc002uyk.3		NA																	0					0						c.(391-393)CAG>CAA		membrane protein, palmitoylated 4							138.0	133.0	134.0					2																	202550741		1949	4151	6100	SO:0001819	synonymous_variant	58538					cytoplasm	protein binding	g.chr2:202550741C>T	AF316032	CCDS46491.1	2q33.2	2008-05-15			ENSG00000082126	ENSG00000082126			13680	protein-coding gene	gene with protein product		606575		DLG6		11414766	Standard	NM_033066		Approved		uc002uyk.4	Q96JB8	OTTHUMG00000154525	ENST00000409474.3:c.393G>A	2.37:g.202550741C>T			Somatic				MPP4_uc010ftj.2_Silent_p.Q131Q|MPP4_uc010zhq.1_Silent_p.Q131Q|MPP4_uc010zhr.1_Silent_p.Q131Q|MPP4_uc010zhs.1_Intron|MPP4_uc002uyj.3_Intron|MPP4_uc010zht.1_Silent_p.Q104Q|MPP4_uc002uyl.3_RNA|MPP4_uc010ftk.2_Silent_p.Q131Q|MPP4_uc002uym.1_Intron|MPP4_uc002uyn.2_Intron	p.Q131Q	NM_033066	NP_149055	WXS	Illumina HiSeq	Unspecified	Q96JB8	MPP4_HUMAN			6	601	-			131			L27 2.		C9IZK4|Q53TT3|Q6ZNH6|Q96Q43|Q96Q44	Silent	SNP	ENST00000409474.3	37	c.393G>A	CCDS46491.1																																																																																				0.493	MPP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335748.2			29	137	0	0	0	0	29	137				
ICOS	29851	broad.mit.edu	37	2	204820605	204820605	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:204820605C>T	ENST00000316386.6	+	2	372	c.305C>T	c.(304-306)tCt>tTt	p.S102F	ICOS_ENST00000435193.1_Missense_Mutation_p.S102F	NM_012092.3	NP_036224.1	Q9Y6W8	ICOS_HUMAN	inducible T-cell co-stimulator	102	Ig-like V-type.				immune response (GO:0006955)|single organismal cell-cell adhesion (GO:0016337)|T cell costimulation (GO:0031295)|T cell tolerance induction (GO:0002517)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|large_intestine(1)|lung(4)	6						TTGGACCATTCTCATGCCAAC	0.358																																						uc002vam.2		NA																	0					0						c.(304-306)TCT>TTT		inducible T-cell co-stimulator precursor							136.0	130.0	132.0					2																	204820605		2203	4300	6503	SO:0001583	missense	29851				immune response|T cell costimulation	extracellular region		g.chr2:204820605C>T	AB023135	CCDS2363.1	2q33	2014-09-17			ENSG00000163600	ENSG00000163600		"""CD molecules"""	5351	protein-coding gene	gene with protein product	"""activation-inducible lymphocyte immunomediatory molecule"""	604558				9930702, 10617205	Standard	NM_012092		Approved	AILIM, CD278	uc002vam.3	Q9Y6W8	OTTHUMG00000132880	ENST00000316386.6:c.305C>T	2.37:g.204820605C>T	ENSP00000319476:p.Ser102Phe		Somatic				ICOS_uc010zip.1_Missense_Mutation_p.S102F|ICOS_uc010fua.2_Missense_Mutation_p.S102F	p.S102F	NM_012092	NP_036224	WXS	Illumina HiSeq	Unspecified	Q9Y6W8	ICOS_HUMAN			2	372	+			102			Ig-like V-type.|Extracellular (Potential).		Q8N6W8	Missense_Mutation	SNP	ENST00000316386.6	37	c.305C>T	CCDS2363.1	.	.	.	.	.	.	.	.	.	.	C	15.67	2.901723	0.52227	.	.	ENSG00000163600	ENST00000316386;ENST00000435193	T;T	0.34472	1.36;1.36	5.45	3.5	0.40072	Immunoglobulin-like fold (1);	0.456851	0.21219	N	0.078177	T	0.53594	0.1806	M	0.70595	2.14	0.21147	N	0.999772	D;D;D	0.67145	0.995;0.996;0.995	D;D;D	0.70016	0.924;0.967;0.924	T	0.39375	-0.9617	10	0.59425	D	0.04	-7.0791	8.428	0.32739	0.1757:0.6546:0.1697:0.0	.	102;102;102	Q53QY6;Q9Y6W8-2;Q9Y6W8	.;.;ICOS_HUMAN	F	102	ENSP00000319476:S102F;ENSP00000415951:S102F	ENSP00000319476:S102F	S	+	2	0	ICOS	204528850	0.294000	0.24380	0.848000	0.33437	0.786000	0.44442	1.532000	0.36029	1.407000	0.46875	0.655000	0.94253	TCT		0.358	ICOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256369.1	NM_012092		9	69	0	0	0	0	9	69				
ERBB4	2066	broad.mit.edu	37	2	212566850	212566850	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:212566850G>C	ENST00000342788.4	-	12	1641	c.1331C>G	c.(1330-1332)tCt>tGt	p.S444C	ERBB4_ENST00000402597.1_Missense_Mutation_p.S444C|ERBB4_ENST00000436443.1_Missense_Mutation_p.S444C	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	444					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	GAACTGTAGAGAGGTGATGCC	0.458										TSP Lung(8;0.080)																												uc002veg.1		NA																	0				lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33						c.(1330-1332)TCT>TGT		v-erb-a erythroblastic leukemia viral oncogene							140.0	128.0	132.0					2																	212566850		2203	4300	6503	SO:0001583	missense	2066				cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity	g.chr2:212566850G>C	L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.1331C>G	2.37:g.212566850G>C	ENSP00000342235:p.Ser444Cys	TSP Lung(8;0.080)	Somatic				ERBB4_uc002veh.1_Missense_Mutation_p.S444C|ERBB4_uc010zji.1_Missense_Mutation_p.S444C|ERBB4_uc010zjj.1_Missense_Mutation_p.S444C|ERBB4_uc010fut.1_Missense_Mutation_p.S444C	p.S444C	NM_005235	NP_005226	WXS	Illumina HiSeq	Unspecified	Q15303	ERBB4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	12	1429	-		Renal(323;0.06)|Lung NSC(271;0.197)	444			Extracellular (Potential).		B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	ENST00000342788.4	37	c.1331C>G	CCDS2394.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.6|25.6	4.658782|4.658782	0.88154|0.88154	.|.	.|.	ENSG00000178568|ENSG00000178568	ENST00000260943|ENST00000342788;ENST00000436443;ENST00000402597	.|T;T;T	.|0.48201	.|0.82;0.82;0.82	5.71|5.71	5.71|5.71	0.89125|0.89125	.|EGF receptor, L domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.77075|0.77075	0.4077|0.4077	M|M	0.91612|0.91612	3.225|3.225	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D	.|0.97110	.|0.999;1.0;1.0;1.0;1.0	T|T	0.81081|0.81081	-0.1094|-0.1094	5|10	.|0.62326	.|D	.|0.03	.|.	19.8769|19.8769	0.96880|0.96880	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|444;444;303;444;444	.|Q15303-4;Q15303-2;Q53QS8;Q15303-3;Q15303	.|.;.;.;.;ERBB4_HUMAN	V|C	444|444	.|ENSP00000342235:S444C;ENSP00000403204:S444C;ENSP00000385565:S444C	.|ENSP00000342235:S444C	L|S	-|-	1|2	0|0	ERBB4|ERBB4	212275095|212275095	1.000000|1.000000	0.71417|0.71417	0.988000|0.988000	0.46212|0.46212	0.990000|0.990000	0.78478|0.78478	9.837000|9.837000	0.99465|0.99465	2.712000|2.712000	0.92718|0.92718	0.650000|0.650000	0.86243|0.86243	CTC|TCT		0.458	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599		13	83	0	0	0	0	13	83				
TNS1	7145	broad.mit.edu	37	2	218749773	218749773	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:218749773C>G	ENST00000171887.4	-	14	1308	c.856G>C	c.(856-858)Gat>Cat	p.D286H	TNS1_ENST00000419504.1_Missense_Mutation_p.D286H|TNS1_ENST00000430930.1_Missense_Mutation_p.D286H|TNS1_ENST00000310858.6_Missense_Mutation_p.D317H	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	286	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		AAAGCATCATCAAGGTCCTCC	0.577																																						uc002vgt.2		NA																	0				ovary(3)|breast(1)	4						c.(856-858)GAT>CAT		tensin							121.0	100.0	107.0					2																	218749773		2203	4300	6503	SO:0001583	missense	7145					cytoplasm|cytoskeleton|focal adhesion	actin binding	g.chr2:218749773C>G	AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.856G>C	2.37:g.218749773C>G	ENSP00000171887:p.Asp286His		Somatic				TNS1_uc002vgr.2_Missense_Mutation_p.D286H|TNS1_uc002vgs.2_Missense_Mutation_p.D286H|TNS1_uc010zjv.1_Missense_Mutation_p.D286H|TNS1_uc010fvj.1_Missense_Mutation_p.D354H|TNS1_uc010fvk.1_Missense_Mutation_p.D411H|TNS1_uc002vgu.3_Missense_Mutation_p.D317H|TNS1_uc010fvi.1_5'UTR	p.D286H	NM_022648	NP_072174	WXS	Illumina HiSeq	Unspecified	Q9HBL0	TENS1_HUMAN		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)	14	1254	-		Renal(207;0.0483)|Lung NSC(271;0.213)	286			C2 tensin-type.		Q4ZG71|Q6IPI5	Missense_Mutation	SNP	ENST00000171887.4	37	c.856G>C	CCDS2407.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.1|23.1	4.371886|4.371886	0.82573|0.82573	.|.	.|.	ENSG00000079308|ENSG00000079308	ENST00000171887;ENST00000419504;ENST00000430930;ENST00000446903;ENST00000413554;ENST00000310858|ENST00000453356	D;D;D;D;D;D|.	0.97553|.	-4.43;-4.43;-4.43;-4.43;-4.43;-4.43|.	4.82|4.82	4.82|4.82	0.62117|0.62117	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);|.	0.107621|.	0.64402|.	D|.	0.000009|.	D|.	0.86003|.	0.5829|.	M|M	0.92691|0.92691	3.335|3.335	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D|.	0.97110|.	1.0;0.999;0.99;1.0;0.999;1.0|.	D|.	0.89663|.	0.3878|.	10|.	0.87932|.	D|.	0|.	.|.	17.7353|17.7353	0.88391|0.88391	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	286;340;317;286;286;286|.	B2RU35;A1L0S7;Q6IPI5;Q9HBL0;E9PGF5;E9PF55|.	.;.;.;TENS1_HUMAN;.;.|.	H|S	286;286;286;411;354;317|61	ENSP00000171887:D286H;ENSP00000408724:D286H;ENSP00000406016:D286H;ENSP00000405460:D411H;ENSP00000400383:D354H;ENSP00000308321:D317H|.	ENSP00000171887:D286H|.	D|X	-|-	1|2	0|2	TNS1|TNS1	218458018|218458018	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.988000|0.988000	0.76386|0.76386	7.499000|7.499000	0.81566|0.81566	2.491000|2.491000	0.84063|0.84063	0.557000|0.557000	0.71058|0.71058	GAT|TGA		0.577	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2	NM_022648		4	52	0	0	0	0	4	52				
ATG9A	79065	broad.mit.edu	37	2	220085575	220085575	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:220085575C>T	ENST00000409618.1	-	15	2847	c.2408G>A	c.(2407-2409)cGg>cAg	p.R803Q	ABCB6_ENST00000265316.3_5'Flank|ATG9A_ENST00000361242.4_Missense_Mutation_p.R803Q|ATG9A_ENST00000396761.2_Missense_Mutation_p.R803Q|ABCB6_ENST00000439002.2_5'Flank|ATG9A_ENST00000409422.1_Missense_Mutation_p.R742Q			Q7Z3C6	ATG9A_HUMAN	autophagy related 9A	803					autophagic vacuole assembly (GO:0000045)|late nucleophagy (GO:0044805)|mitochondrion degradation (GO:0000422)|piecemeal microautophagy of nucleus (GO:0034727)|protein localization to pre-autophagosomal structure (GO:0034497)|protein transport (GO:0015031)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)				endometrium(2)|large_intestine(5)|lung(3)|prostate(1)|skin(1)|stomach(1)	13		Renal(207;0.0474)		Epithelial(149;1.37e-06)|all cancers(144;0.000222)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AAGAGGCAGCCGAGAGAAATG	0.577																																						uc002vke.1		NA																	0				skin(1)	1						c.(2407-2409)CGG>CAG		APG9 autophagy 9-like 1							38.0	40.0	40.0					2																	220085575		1930	4125	6055	SO:0001583	missense	79065				autophagic vacuole assembly|protein transport	autophagic vacuole membrane|cytoplasmic vesicle|Golgi apparatus|integral to membrane|late endosome membrane		g.chr2:220085575C>T	AK021732	CCDS42820.1	2q35	2014-02-12	2012-06-06	2005-09-11	ENSG00000198925	ENSG00000198925			22408	protein-coding gene	gene with protein product		612204	"""APG9 autophagy 9-like 1 (S. cerevisiae)"", ""ATG9 autophagy related 9 homolog A (S. cerevisiae)"""	APG9L1			Standard	NM_024085		Approved	FLJ22169	uc002vkf.1	Q7Z3C6	OTTHUMG00000154557	ENST00000409618.1:c.2408G>A	2.37:g.220085575C>T	ENSP00000386710:p.Arg803Gln		Somatic				ABCB6_uc002vkc.1_5'Flank|ABCB6_uc010fwe.1_5'Flank|ABCB6_uc010zku.1_5'Flank|ATG9A_uc002vkd.1_RNA|ATG9A_uc002vkf.1_Missense_Mutation_p.R803Q	p.R803Q	NM_001077198	NP_001070666	WXS	Illumina HiSeq	Unspecified	Q7Z3C6	ATG9A_HUMAN		Epithelial(149;1.37e-06)|all cancers(144;0.000222)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	15	2594	-		Renal(207;0.0474)	803			Cytoplasmic (By similarity).		Q3ZAQ6|Q6P0N7|Q7Z317|Q7Z320|Q8NDK6|Q8WU65|Q9BVL5|Q9H6L1|Q9HAG7	Missense_Mutation	SNP	ENST00000409618.1	37	c.2408G>A	CCDS42820.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.950014	0.73787	.	.	ENSG00000198925	ENST00000396761;ENST00000409618;ENST00000361242;ENST00000409422	T;T;T;T	0.71222	-0.55;-0.55;-0.55;-0.55	5.06	5.06	0.68205	.	0.267397	0.36200	N	0.002729	T	0.57917	0.2086	L	0.29908	0.895	0.44711	D	0.997707	P	0.47545	0.897	B	0.35278	0.199	T	0.63341	-0.6659	10	0.41790	T	0.15	-15.666	18.6114	0.91286	0.0:1.0:0.0:0.0	.	803	Q7Z3C6	ATG9A_HUMAN	Q	803;803;803;742	ENSP00000379983:R803Q;ENSP00000386710:R803Q;ENSP00000355173:R803Q;ENSP00000386535:R742Q	ENSP00000355173:R803Q	R	-	2	0	ATG9A	219793819	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.504000	0.66968	2.627000	0.88993	0.655000	0.94253	CGG		0.577	ATG9A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335930.1	NM_024085		11	44	0	0	0	0	11	44				
COL4A4	1286	broad.mit.edu	37	2	227958967	227958967	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:227958967G>C	ENST00000396625.3	-	20	1450	c.1243C>G	c.(1243-1245)Ctt>Gtt	p.L415V	COL4A4_ENST00000329662.7_Missense_Mutation_p.L415V	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	415	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		AGCCCAGGAAGACCAGGAAAT	0.502																																						uc010zlt.1		NA																	0				ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11						c.(1243-1245)CTT>GTT		alpha 4 type IV collagen precursor							38.0	40.0	39.0					2																	227958967		1843	4087	5930	SO:0001583	missense	1286				axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding	g.chr2:227958967G>C		CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.1243C>G	2.37:g.227958967G>C	ENSP00000379866:p.Leu415Val		Somatic					p.L415V	NM_000092	NP_000083	WXS	Illumina HiSeq	Unspecified	P53420	CO4A4_HUMAN		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)	20	1897	-		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)	415			Triple-helical region.		A8MTZ1|Q53RW9|Q53S42|Q53WR1	Missense_Mutation	SNP	ENST00000396625.3	37	c.1243C>G	CCDS42828.1	.	.	.	.	.	.	.	.	.	.	G	5.828	0.337021	0.11013	.	.	ENSG00000081052	ENST00000396625;ENST00000329662	D;D	0.93547	-3.24;-3.24	5.31	-0.262	0.12958	.	.	.	.	.	D	0.86435	0.5932	L	0.41079	1.255	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.69982	-0.4997	9	0.11485	T	0.65	.	6.854	0.24030	0.2193:0.2017:0.579:0.0	.	415	P53420	CO4A4_HUMAN	V	415	ENSP00000379866:L415V;ENSP00000328553:L415V	ENSP00000328553:L415V	L	-	1	0	COL4A4	227667211	0.032000	0.19561	0.323000	0.25347	0.504000	0.33889	0.341000	0.19909	0.221000	0.20879	0.563000	0.77884	CTT		0.502	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313770.1	NM_000092		5	33	0	0	0	0	5	33				
COL4A3	1285	broad.mit.edu	37	2	228109061	228109061	+	Missense_Mutation	SNP	C	C	T	rs377136253	byFrequency	TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:228109061C>T	ENST00000396578.3	+	4	422	c.260C>T	c.(259-261)aCg>aTg	p.T87M	AC097662.2_ENST00000437673.1_RNA|AC097662.2_ENST00000606119.1_RNA|AC097662.2_ENST00000439598.2_RNA|AC097662.2_ENST00000396588.2_RNA	NM_000091.4	NP_000082.2	Q01955	CO4A3_HUMAN	collagen, type IV, alpha 3 (Goodpasture antigen)	87	Triple-helical region.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|blood circulation (GO:0008015)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|collagen catabolic process (GO:0030574)|endothelial cell apoptotic process (GO:0072577)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|sensory perception of sound (GO:0007605)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metalloendopeptidase inhibitor activity (GO:0008191)|structural molecule activity (GO:0005198)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		CCAGGACTCACGGGTTCCAAA	0.403													C|||	2	0.000399361	0.0008	0.0	5008	,	,		20784	0.0		0.0	False		,,,				2504	0.001					uc002vom.1		NA																	0				skin(2)|ovary(1)	3						c.(259-261)ACG>ATG		alpha 3 type IV collagen isoform 1 precursor		C	MET/THR	1,3687		0,1,1843	108.0	100.0	102.0		260	1.1	0.9	2		102	0,8166		0,0,4083	no	missense	COL4A3	NM_000091.4	81	0,1,5926	TT,TC,CC		0.0,0.0271,0.0084	probably-damaging	87/1671	228109061	1,11853	1844	4083	5927	SO:0001583	missense	1285				activation of caspase activity|axon guidance|blood circulation|cell adhesion|cell proliferation|cell surface receptor linked signaling pathway|glomerular basement membrane development|induction of apoptosis|negative regulation of angiogenesis|negative regulation of cell proliferation|sensory perception of sound	collagen type IV	extracellular matrix structural constituent|integrin binding|metalloendopeptidase inhibitor activity	g.chr2:228109061C>T		CCDS42829.1	2q36-q37	2014-09-17			ENSG00000169031	ENSG00000169031		"""Collagens"""	2204	protein-coding gene	gene with protein product	"""tumstatin"""	120070				1737849	Standard	NM_000091		Approved		uc002vom.2	Q01955	OTTHUMG00000149891	ENST00000396578.3:c.260C>T	2.37:g.228109061C>T	ENSP00000379823:p.Thr87Met		Somatic				COL4A3_uc002von.1_Missense_Mutation_p.T87M|COL4A3_uc002voo.1_Missense_Mutation_p.T87M|COL4A3_uc002vop.1_Missense_Mutation_p.T87M|uc002voq.1_Intron	p.T87M	NM_000091	NP_000082	WXS	Illumina HiSeq	Unspecified	Q01955	CO4A3_HUMAN		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)	4	422	+		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)	87			Triple-helical region.		Q53QQ1|Q53R14|Q53RW8|Q9BQT2|Q9NYC4|Q9UDJ9|Q9UDK9|Q9UDL0|Q9UDL1	Missense_Mutation	SNP	ENST00000396578.3	37	c.260C>T	CCDS42829.1	.	.	.	.	.	.	.	.	.	.	C	9.554	1.116568	0.20795	2.71E-4	0.0	ENSG00000169031	ENST00000396578	D	0.92752	-3.1	5.42	1.08	0.20341	.	.	.	.	.	D	0.84660	0.5521	L	0.28458	0.855	0.09310	N	0.999999	P;P;P;P	0.48016	0.808;0.746;0.904;0.84	B;B;B;B	0.39738	0.226;0.199;0.308;0.251	T	0.74269	-0.3720	9	0.44086	T	0.13	.	7.666	0.28432	0.0:0.6239:0.1271:0.249	.	87;87;87;87	Q01955-5;Q01955-4;Q01955-2;Q01955	.;.;.;CO4A3_HUMAN	M	87	ENSP00000379823:T87M	ENSP00000379823:T87M	T	+	2	0	COL4A3	227817305	0.021000	0.18746	0.941000	0.38009	0.560000	0.35617	-0.094000	0.11094	0.027000	0.15297	-0.795000	0.03280	ACG		0.403	COL4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331409.2	NM_000091		13	73	0	0	0	0	13	73				
GIGYF2	26058	broad.mit.edu	37	2	233671258	233671258	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:233671258C>G	ENST00000409547.1	+	17	2008	c.1697C>G	c.(1696-1698)tCt>tGt	p.S566C	GIGYF2_ENST00000409196.3_Missense_Mutation_p.S560C|GIGYF2_ENST00000409480.1_Missense_Mutation_p.S588C|GIGYF2_ENST00000452341.2_Missense_Mutation_p.S397C|GIGYF2_ENST00000373563.4_Missense_Mutation_p.S566C|GIGYF2_ENST00000409451.3_Missense_Mutation_p.S587C|GIGYF2_ENST00000373566.3_Missense_Mutation_p.S588C	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	566	GYF. {ECO:0000255|PROSITE- ProRule:PRU00101}.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		TTTACTATGTCTTTATTGGTG	0.438																																						uc002vti.3		NA																	0				ovary(4)|central_nervous_system(3)	7						c.(1696-1698)TCT>TGT		GRB10 interacting GYF protein 2 isoform b							196.0	191.0	193.0					2																	233671258		2203	4300	6503	SO:0001583	missense	26058				cell death		protein binding	g.chr2:233671258C>G	U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.1697C>G	2.37:g.233671258C>G	ENSP00000386537:p.Ser566Cys		Somatic				GIGYF2_uc010zmj.1_Missense_Mutation_p.S566C|GIGYF2_uc002vtg.2_Missense_Mutation_p.S560C|GIGYF2_uc002vtj.3_Missense_Mutation_p.S587C|GIGYF2_uc002vtk.3_Missense_Mutation_p.S566C|GIGYF2_uc002vth.3_Missense_Mutation_p.S560C|GIGYF2_uc010zmk.1_RNA|GIGYF2_uc010zml.1_Missense_Mutation_p.S397C	p.S566C	NM_015575	NP_056390	WXS	Illumina HiSeq	Unspecified	Q6Y7W6	PERQ2_HUMAN		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)	17	2034	+		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)	566			GYF.		A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Missense_Mutation	SNP	ENST00000409547.1	37	c.1697C>G	CCDS33401.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.866972	0.91511	.	.	ENSG00000204120	ENST00000373566;ENST00000414511;ENST00000373563;ENST00000409480;ENST00000409547;ENST00000535418;ENST00000423659;ENST00000409196;ENST00000409451;ENST00000440945;ENST00000452341	T;T;T;T;T;T;T;T;T	0.75938	-0.82;-0.82;-0.82;-0.82;-0.96;-0.82;-0.82;-0.98;-0.67	5.84	5.84	0.93424	GYF (4);	0.060357	0.64402	D	0.000002	D	0.86611	0.5974	M	0.72894	2.215	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.994;0.993;0.969;0.997	D	0.86886	0.2045	10	0.87932	D	0	-12.3884	20.1551	0.98106	0.0:1.0:0.0:0.0	.	397;587;566;560	E9PC50;A6H8W4;Q6Y7W6;E9PBB0	.;.;PERQ2_HUMAN;.	C	588;509;566;588;566;566;509;560;587;560;397	ENSP00000362667:S588C;ENSP00000362664:S566C;ENSP00000386765:S588C;ENSP00000386537:S566C;ENSP00000404195:S509C;ENSP00000387070:S560C;ENSP00000387170:S587C;ENSP00000410297:S560C;ENSP00000411505:S397C	ENSP00000362664:S566C	S	+	2	0	GIGYF2	233379502	1.000000	0.71417	0.999000	0.59377	0.982000	0.71751	6.018000	0.70811	2.760000	0.94817	0.655000	0.94253	TCT		0.438	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000330316.2	NM_001103146		33	147	0	0	0	0	33	147				
NEU2	4759	broad.mit.edu	37	2	233899032	233899032	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:233899032G>A	ENST00000233840.3	+	2	408	c.408G>A	c.(406-408)tgG>tgA	p.W136*		NM_005383.2	NP_005374.2	Q9Y3R4	NEUR2_HUMAN	sialidase 2 (cytosolic sialidase)	136					ganglioside catabolic process (GO:0006689)|glycosphingolipid metabolic process (GO:0006687)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)			endometrium(3)|large_intestine(2)|lung(10)|skin(2)|urinary_tract(1)	18		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0271)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0839)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000311)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)|GBM - Glioblastoma multiforme(43;0.0488)	Oseltamivir(DB00198)|Zanamivir(DB00558)	GGAGGACCTGGAGCTCCCCCA	0.637																																						uc010zmn.1		NA																	0					0						c.(406-408)TGG>TGA		neuraminidase 2							58.0	58.0	58.0					2																	233899032		2203	4300	6503	SO:0001587	stop_gained	4759						exo-alpha-sialidase activity	g.chr2:233899032G>A	Y16535	CCDS2501.1	2q37	2008-05-27			ENSG00000115488	ENSG00000115488			7759	protein-coding gene	gene with protein product	"""N-acetyl-alpha-neuraminidase 2"""	605528				10191093, 14613940	Standard	NM_005383		Approved	SIAL2	uc010zmn.2	Q9Y3R4	OTTHUMG00000133274	ENST00000233840.3:c.408G>A	2.37:g.233899032G>A	ENSP00000233840:p.Trp136*		Somatic					p.W136*	NM_005383	NP_005374	WXS	Illumina HiSeq	Unspecified	Q9Y3R4	NEUR2_HUMAN		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000311)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)|GBM - Glioblastoma multiforme(43;0.0488)	2	408	+		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0271)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0839)	136			BNR 1.		Q3KNW4|Q6NTB4	Nonsense_Mutation	SNP	ENST00000233840.3	37	c.408G>A	CCDS2501.1	.	.	.	.	.	.	.	.	.	.	G	33	5.254947	0.95336	.	.	ENSG00000115488	ENST00000233840	.	.	.	4.88	4.88	0.63580	.	0.000000	0.56097	D	0.000021	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-22.5646	17.0459	0.86502	0.0:0.0:1.0:0.0	.	.	.	.	X	136	.	ENSP00000233840:W136X	W	+	3	0	NEU2	233607276	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	9.544000	0.98092	2.243000	0.73865	0.561000	0.74099	TGG		0.637	NEU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257053.2	NM_005383		10	37	0	0	0	0	10	37				
SH3BP4	23677	broad.mit.edu	37	2	235950502	235950502	+	Silent	SNP	G	G	A	rs377177002		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr2:235950502G>A	ENST00000409212.1	+	4	1596	c.1089G>A	c.(1087-1089)ccG>ccA	p.P363P	SH3BP4_ENST00000344528.4_Silent_p.P363P|SH3BP4_ENST00000392011.2_Silent_p.P363P			Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4	363					cellular response to amino acid stimulus (GO:0071230)|endocytosis (GO:0006897)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of GTPase activity (GO:0034260)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|protein localization to lysosome (GO:0061462)|regulation of catalytic activity (GO:0050790)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	GDP-dissociation inhibitor activity (GO:0005092)|identical protein binding (GO:0042802)|Ras GTPase binding (GO:0017016)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(6)|stomach(3)|urinary_tract(2)	44		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		TGGACCCCCCGCTGGAGCTCA	0.597																																						uc002vvp.2		NA																	0				skin(3)|ovary(1)	4						c.(1087-1089)CCG>CCA		SH3-domain binding protein 4		G		1,4405		0,1,2202	25.0	26.0	25.0		1089	-8.8	0.1	2		25	1,8599		0,1,4299	no	coding-synonymous	SH3BP4	NM_014521.2		0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154		363/964	235950502	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	23677				endocytosis	clathrin-coated vesicle|coated pit|nucleus	protein binding	g.chr2:235950502G>A	AF147747	CCDS2513.1	2q37.1-q37.2	2008-05-15			ENSG00000130147	ENSG00000130147			10826	protein-coding gene	gene with protein product		605611				10644451	Standard	NM_014521		Approved		uc002vvp.3	Q9P0V3	OTTHUMG00000133292	ENST00000409212.1:c.1089G>A	2.37:g.235950502G>A			Somatic				SH3BP4_uc010fym.2_Silent_p.P363P|SH3BP4_uc002vvq.2_Silent_p.P363P	p.P363P	NM_014521	NP_055336	WXS	Illumina HiSeq	Unspecified	Q9P0V3	SH3B4_HUMAN		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)	4	1482	+		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)	363					O95082|Q309A3|Q53QD0|Q53TD1	Silent	SNP	ENST00000409212.1	37	c.1089G>A	CCDS2513.1																																																																																				0.597	SH3BP4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329763.1			6	45	0	0	0	0	6	45				
LBP	3929	broad.mit.edu	37	20	36992685	36992685	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr20:36992685C>T	ENST00000217407.2	+	7	870	c.709C>T	c.(709-711)Cgg>Tgg	p.R237W		NM_004139.3	NP_004130.2	P18428	LBP_HUMAN	lipopolysaccharide binding protein	237					acute-phase response (GO:0006953)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of molecule of bacterial origin (GO:0032490)|innate immune response (GO:0045087)|leukocyte chemotaxis involved in inflammatory response (GO:0002232)|lipopolysaccharide transport (GO:0015920)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation involved in immune response (GO:0002281)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of tumor necrosis factor production (GO:0032720)|opsonization (GO:0008228)|positive regulation of chemokine production (GO:0032722)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of macrophage activation (GO:0043032)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of respiratory burst involved in inflammatory response (GO:0060265)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|response to lipopolysaccharide (GO:0032496)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	lipopolysaccharide binding (GO:0001530)|lipoteichoic acid binding (GO:0070891)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(16)|ovary(2)|prostate(1)|urinary_tract(1)	28		Myeloproliferative disorder(115;0.00878)				GGAAGCCCCTCGGGCAACAGC	0.547																																						uc002xic.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(709-711)CGG>TGG		lipopolysaccharide-binding protein precursor							73.0	71.0	72.0					20																	36992685		2203	4300	6503	SO:0001583	missense	3929				acute-phase response|cellular defense response|cellular response to lipoteichoic acid|defense response to Gram-negative bacterium|defense response to Gram-positive bacterium|detection of molecule of bacterial origin|innate immune response|lipid transport|lipopolysaccharide transport|lipopolysaccharide-mediated signaling pathway|macrophage activation involved in immune response|negative regulation of tumor necrosis factor production|opsonization|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of macrophage activation|positive regulation of respiratory burst involved in inflammatory response|positive regulation of toll-like receptor 4 signaling pathway|positive regulation of tumor necrosis factor production|Toll signaling pathway	extracellular space	Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|lipid binding|lipopolysaccharide binding|lipoteichoic acid binding|receptor binding	g.chr20:36992685C>T		CCDS13304.1	20q11.23	2011-08-16	2001-11-28		ENSG00000129988	ENSG00000129988		"""BPI fold containing"""	6517	protein-coding gene	gene with protein product	"""BPI fold containing family D, member 2"""	151990	"""lipopolysaccharide-binding protein"""			8432532	Standard	NM_004139		Approved	BPIFD2	uc002xic.2	P18428	OTTHUMG00000032447	ENST00000217407.2:c.709C>T	20.37:g.36992685C>T	ENSP00000217407:p.Arg237Trp		Somatic					p.R237W	NM_004139	NP_004130	WXS	Illumina HiSeq	Unspecified	P18428	LBP_HUMAN			7	744	+		Myeloproliferative disorder(115;0.00878)	237					B2R938|O43438|Q92672|Q9H403|Q9UD66	Missense_Mutation	SNP	ENST00000217407.2	37	c.709C>T	CCDS13304.1	.	.	.	.	.	.	.	.	.	.	C	14.07	2.424385	0.43020	.	.	ENSG00000129988	ENST00000217407;ENST00000538599	T	0.04706	3.57	5.2	5.2	0.72013	Lipid-binding serum glycoprotein, N-terminal (1);Bactericidal permeability-increasing protein, alpha/beta domain (1);	0.889200	0.09748	N	0.760962	T	0.12305	0.0299	M	0.64997	1.995	0.09310	N	1	D	0.69078	0.997	P	0.51657	0.676	T	0.21348	-1.0248	10	0.66056	D	0.02	-4.494	9.6198	0.39714	0.0:0.9076:0.0:0.0924	.	237	P18428	LBP_HUMAN	W	237	ENSP00000217407:R237W	ENSP00000217407:R237W	R	+	1	2	LBP	36426099	0.002000	0.14202	0.497000	0.27552	0.152000	0.21847	0.253000	0.18296	2.700000	0.92200	0.591000	0.81541	CGG		0.547	LBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079174.2	NM_004139		9	37	0	0	0	0	9	37				
SRSF6	6431	broad.mit.edu	37	20	42089355	42089355	+	Silent	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr20:42089355G>C	ENST00000244020.3	+	6	793	c.687G>C	c.(685-687)cgG>cgC	p.R229R		NM_006275.5	NP_006266.2	Q13247	SRSF6_HUMAN	serine/arginine-rich splicing factor 6	229	Arg/Ser-rich (RS domain).				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splice site selection (GO:0006376)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell death (GO:0060548)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of keratinocyte proliferation (GO:0010837)|regulation of wound healing (GO:0061041)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA binding (GO:0003723)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|upper_aerodigestive_tract(2)	5						CCAGGTCGCGGAGCAAAGGTC	0.438																																						uc010zwg.1		NA																	0					0						c.(685-687)CGG>CGC		arginine/serine-rich splicing factor 6							61.0	55.0	57.0					20																	42089355		2203	4300	6503	SO:0001819	synonymous_variant	6431				mRNA 3'-end processing|mRNA export from nucleus|mRNA splice site selection|termination of RNA polymerase II transcription	nucleoplasm	nucleotide binding|protein binding|RNA binding	g.chr20:42089355G>C	U30883	CCDS13318.1	20q12-q13.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000124193	ENSG00000124193		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10788	protein-coding gene	gene with protein product	"""pre-mRNA splicing factor SRP55"", ""SR splicing factor 6"""	601944	"""splicing factor, arginine/serine-rich 6"""	SFRS6		7556075, 20516191	Standard	NM_006275		Approved	SRP55, B52	uc010zwg.2	Q13247	OTTHUMG00000032502	ENST00000244020.3:c.687G>C	20.37:g.42089355G>C			Somatic				SFRS6_uc002xki.2_Silent_p.R100R|SFRS6_uc002xkk.2_Intron	p.R229R	NM_006275	NP_006266	WXS	Illumina HiSeq	Unspecified	Q13247	SRSF6_HUMAN	COAD - Colon adenocarcinoma(18;0.0031)		6	857	+		Myeloproliferative disorder(115;0.00452)	229			Arg/Ser-rich (RS domain).		B7Z6J3|E1P5W6|Q13244|Q13245|Q96J06|Q9UJB8|Q9Y3N7	Silent	SNP	ENST00000244020.3	37	c.687G>C	CCDS13318.1																																																																																				0.438	SRSF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079292.1	NM_006275		7	36	0	0	0	0	7	36				
ARFGEF2	10564	broad.mit.edu	37	20	47649614	47649614	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr20:47649614G>C	ENST00000371917.4	+	39	5236	c.5236G>C	c.(5236-5238)Gac>Cac	p.D1746H		NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)	1746					endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)			breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			TATGCAGTTTGACCTGATCCC	0.418																																					Esophageal Squamous(176;1738 1974 26285 33069 35354)	uc002xtx.3		NA																	0				breast(3)|upper_aerodigestive_tract(1)	4						c.(5236-5238)GAC>CAC		ADP-ribosylation factor guanine							90.0	77.0	81.0					20																	47649614		2203	4300	6503	SO:0001583	missense	10564				exocytosis|intracellular signal transduction|regulation of ARF protein signal transduction	cytosol|Golgi membrane	ARF guanyl-nucleotide exchange factor activity	g.chr20:47649614G>C	AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.5236G>C	20.37:g.47649614G>C	ENSP00000360985:p.Asp1746His		Somatic				ARFGEF2_uc010zyf.1_Missense_Mutation_p.D1039H	p.D1746H	NM_006420	NP_006411	WXS	Illumina HiSeq	Unspecified	Q9Y6D5	BIG2_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)		39	5388	+			1746					Q5TFT9|Q9NTS1	Missense_Mutation	SNP	ENST00000371917.4	37	c.5236G>C	CCDS13411.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.834605	0.91036	.	.	ENSG00000124198	ENST00000371917	T	0.67171	-0.25	5.66	5.66	0.87406	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.83945	0.5364	M	0.82323	2.585	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	D	0.85682	0.1301	10	0.87932	D	0	.	19.7417	0.96234	0.0:0.0:1.0:0.0	.	1746	Q9Y6D5	BIG2_HUMAN	H	1746	ENSP00000360985:D1746H	ENSP00000360985:D1746H	D	+	1	0	ARFGEF2	47083021	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.869000	0.99810	2.661000	0.90470	0.655000	0.94253	GAC		0.418	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079627.1	NM_006420		9	57	0	0	0	0	9	57				
ZNF217	7764	broad.mit.edu	37	20	52199332	52199332	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr20:52199332G>A	ENST00000371471.2	-	2	459	c.34C>T	c.(34-36)Caa>Taa	p.Q12*	ZNF217_ENST00000302342.3_Nonsense_Mutation_p.Q12*|ZNF217_ENST00000540425.1_5'Flank			O75362	ZN217_HUMAN	zinc finger protein 217	12					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)			AAGAGGGATTGAGTTGGCATG	0.468																																						uc002xwq.3		NA																	0				skin(2)|ovary(1)|large_intestine(1)|lung(1)|breast(1)	6						c.(34-36)CAA>TAA		zinc finger protein 217							98.0	95.0	96.0					20																	52199332		2203	4300	6503	SO:0001587	stop_gained	7764				negative regulation of transcription, DNA-dependent	histone deacetylase complex	protein binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr20:52199332G>A	AF041259	CCDS13443.1	20q13.2	2013-01-08			ENSG00000171940	ENSG00000171940		"""Zinc fingers, C2H2-type"""	13009	protein-coding gene	gene with protein product		602967				9671742	Standard	NM_006526		Approved	ZABC1	uc002xwq.4	O75362	OTTHUMG00000032764	ENST00000371471.2:c.34C>T	20.37:g.52199332G>A	ENSP00000360526:p.Gln12*		Somatic				ZNF217_uc010gij.1_Nonsense_Mutation_p.Q4*	p.Q12*	NM_006526	NP_006517	WXS	Illumina HiSeq	Unspecified	O75362	ZN217_HUMAN	BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)		1	305	-	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		12					E1P5Y6|Q14DB8	Nonsense_Mutation	SNP	ENST00000371471.2	37	c.34C>T	CCDS13443.1	.	.	.	.	.	.	.	.	.	.	G	36	5.887148	0.97068	.	.	ENSG00000171940	ENST00000371471;ENST00000302342;ENST00000431687	.	.	.	5.66	5.66	0.87406	.	0.063488	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-34.0977	19.3348	0.94312	0.0:0.0:1.0:0.0	.	.	.	.	X	12	.	ENSP00000304308:Q12X	Q	-	1	0	ZNF217	51632739	1.000000	0.71417	0.243000	0.24186	0.593000	0.36681	8.113000	0.89568	2.665000	0.90641	0.561000	0.74099	CAA		0.468	ZNF217-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079757.2	NM_006526		15	97	0	0	0	0	15	97				
DOK5	55816	broad.mit.edu	37	20	53208154	53208154	+	Splice_Site	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr20:53208154G>C	ENST00000262593.5	+	5	759		c.e5-1		DOK5_ENST00000395939.1_Splice_Site	NM_018431.3	NP_060901.2	Q9P104	DOK5_HUMAN	docking protein 5						MAPK cascade (GO:0000165)|nervous system development (GO:0007399)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)		receptor signaling protein activity (GO:0005057)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(2)|skin(1)	19			Colorectal(105;0.202)			TTTTCTCCCAGAGAGATTCAA	0.368																																						uc002xwy.2		NA																	0				ovary(1)	1						c.e5-1		docking protein 5							111.0	113.0	112.0					20																	53208154		2203	4300	6503	SO:0001630	splice_region_variant	55816						insulin receptor binding	g.chr20:53208154G>C	AF132732	CCDS13446.1, CCDS13447.1	20q13.2	2013-01-10	2002-11-28	2002-11-29	ENSG00000101134	ENSG00000101134		"""Pleckstrin homology (PH) domain containing"""	16173	protein-coding gene	gene with protein product		608334	"""chromosome 20 open reading frame 180"""	C20orf180		11470823	Standard	XM_005260451		Approved	dJ805C22.1	uc002xwy.3	Q9P104	OTTHUMG00000032778	ENST00000262593.5:c.410-1G>C	20.37:g.53208154G>C			Somatic				DOK5_uc010gin.2_Splice_Site_p.E29_splice|DOK5_uc002xwz.2_Intron	p.E137_splice	NM_018431	NP_060901	WXS	Illumina HiSeq	Unspecified	Q9P104	DOK5_HUMAN	Colorectal(105;0.202)		5	630	+								Q5T7Y0|Q5TE53|Q8TEW7|Q96H13|Q9BZ24|Q9NQF4|Q9Y411	Splice_Site	SNP	ENST00000262593.5	37	c.410_splice	CCDS13446.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.557686	0.86231	.	.	ENSG00000101134	ENST00000262593;ENST00000395939	.	.	.	5.66	5.66	0.87406	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.3134	0.90208	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DOK5	52641561	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.795000	0.99099	2.668000	0.90789	0.650000	0.86243	.		0.368	DOK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079777.2		Intron	5	72	0	0	0	0	5	72				
DIDO1	11083	broad.mit.edu	37	20	61525058	61525058	+	Missense_Mutation	SNP	C	C	T	rs571096023		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr20:61525058C>T	ENST00000266070.4	-	12	3386	c.3061G>A	c.(3061-3063)Gac>Aac	p.D1021N	DIDO1_ENST00000395340.1_Missense_Mutation_p.D1021N|DIDO1_ENST00000395335.2_Missense_Mutation_p.D1021N|DIDO1_ENST00000395343.1_Missense_Mutation_p.D1021N	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	1021					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					TATCTTGGGTCAGGAGATGAG	0.483													C|||	1	0.000199681	0.0	0.0	5008	,	,		19262	0.0		0.001	False		,,,				2504	0.0				Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	uc002ydr.1		NA																	0				ovary(3)|skin(3)	6						c.(3061-3063)GAC>AAC		death inducer-obliterator 1 isoform c							106.0	89.0	95.0					20																	61525058		2203	4300	6503	SO:0001583	missense	11083				apoptosis|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding	g.chr20:61525058C>T	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.3061G>A	20.37:g.61525058C>T	ENSP00000266070:p.Asp1021Asn		Somatic				DIDO1_uc002yds.1_Missense_Mutation_p.D1021N|DIDO1_uc002ydt.1_Missense_Mutation_p.D1021N|DIDO1_uc002ydu.1_Missense_Mutation_p.D1021N	p.D1021N	NM_033081	NP_149072	WXS	Illumina HiSeq	Unspecified	Q9BTC0	DIDO1_HUMAN			12	3325	-	Breast(26;5.68e-08)		1021					A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	ENST00000266070.4	37	c.3061G>A	CCDS33506.1	.	.	.	.	.	.	.	.	.	.	C	17.99	3.523656	0.64747	.	.	ENSG00000101191	ENST00000266070;ENST00000395343;ENST00000395340;ENST00000395335	T;T;T;T	0.13307	2.93;2.93;2.6;2.6	5.95	5.95	0.96441	.	0.171984	0.26654	U	0.023195	T	0.25269	0.0614	L	0.46157	1.445	0.80722	D	1	D;P	0.53312	0.959;0.877	P;P	0.50659	0.647;0.494	T	0.00075	-1.2120	10	0.66056	D	0.02	-31.1223	20.3932	0.98965	0.0:1.0:0.0:0.0	.	1021;1021	Q9BTC0-1;Q9BTC0	.;DIDO1_HUMAN	N	1021	ENSP00000266070:D1021N;ENSP00000378752:D1021N;ENSP00000378749:D1021N;ENSP00000378744:D1021N	ENSP00000266070:D1021N	D	-	1	0	DIDO1	60995503	1.000000	0.71417	0.908000	0.35775	0.050000	0.14768	6.234000	0.72326	2.824000	0.97209	0.655000	0.94253	GAC		0.483	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796		18	87	0	0	0	0	18	87				
DIDO1	11083	broad.mit.edu	37	20	61525160	61525160	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr20:61525160C>T	ENST00000266070.4	-	12	3284	c.2959G>A	c.(2959-2961)Gac>Aac	p.D987N	DIDO1_ENST00000395340.1_Missense_Mutation_p.D987N|DIDO1_ENST00000395335.2_Missense_Mutation_p.D987N|DIDO1_ENST00000395343.1_Missense_Mutation_p.D987N	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	987					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					TGGGTGCTGTCTGGGCGGGAT	0.622																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	uc002ydr.1		NA																	0				ovary(3)|skin(3)	6						c.(2959-2961)GAC>AAC		death inducer-obliterator 1 isoform c							100.0	88.0	92.0					20																	61525160		2203	4300	6503	SO:0001583	missense	11083				apoptosis|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding	g.chr20:61525160C>T	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.2959G>A	20.37:g.61525160C>T	ENSP00000266070:p.Asp987Asn		Somatic				DIDO1_uc002yds.1_Missense_Mutation_p.D987N|DIDO1_uc002ydt.1_Missense_Mutation_p.D987N|DIDO1_uc002ydu.1_Missense_Mutation_p.D987N	p.D987N	NM_033081	NP_149072	WXS	Illumina HiSeq	Unspecified	Q9BTC0	DIDO1_HUMAN			12	3223	-	Breast(26;5.68e-08)		987					A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	ENST00000266070.4	37	c.2959G>A	CCDS33506.1	.	.	.	.	.	.	.	.	.	.	C	16.87	3.242420	0.58995	.	.	ENSG00000101191	ENST00000266070;ENST00000395343;ENST00000395340;ENST00000395335	T;T;T;T	0.11712	3.07;3.07;2.75;2.75	6.17	6.17	0.99709	.	0.476878	0.17451	N	0.173761	T	0.21307	0.0513	L	0.56769	1.78	0.80722	D	1	D;P	0.53462	0.96;0.799	P;B	0.52856	0.711;0.395	T	0.00749	-1.1582	10	0.19147	T	0.46	-37.1382	15.581	0.76439	0.1377:0.8623:0.0:0.0	.	987;987	Q9BTC0-1;Q9BTC0	.;DIDO1_HUMAN	N	987	ENSP00000266070:D987N;ENSP00000378752:D987N;ENSP00000378749:D987N;ENSP00000378744:D987N	ENSP00000266070:D987N	D	-	1	0	DIDO1	60995605	0.973000	0.33851	0.043000	0.18650	0.005000	0.04900	3.288000	0.51739	2.941000	0.99782	0.655000	0.94253	GAC		0.622	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796		16	86	0	0	0	0	16	86				
CRYZL1	9946	broad.mit.edu	37	21	34994360	34994360	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr21:34994360C>T	ENST00000381554.3	-	4	244	c.159G>A	c.(157-159)atG>atA	p.M53I	CRYZL1_ENST00000361534.2_Missense_Mutation_p.M77I|CRYZL1_ENST00000445393.1_Missense_Mutation_p.M53I|AP000304.12_ENST00000429238.1_Intron|CRYZL1_ENST00000290244.5_Missense_Mutation_p.M53I|CRYZL1_ENST00000413017.2_Missense_Mutation_p.M53I|CRYZL1_ENST00000381540.3_Missense_Mutation_p.M53I	NM_145858.2	NP_665857.2	O95825	QORL1_HUMAN	crystallin, zeta (quinone reductase)-like 1	53					quinone metabolic process (GO:1901661)	cytosol (GO:0005829)	NADP binding (GO:0050661)|NADPH:quinone reductase activity (GO:0003960)|zinc ion binding (GO:0008270)			lung(1)|prostate(1)|urinary_tract(1)	3						TTTTCATCTTCATTTCTGCCA	0.338																																						uc011adw.1		NA																	0					0						c.(157-159)ATG>ATA		crystallin, zeta-like 1							79.0	84.0	83.0					21																	34994360		2202	4298	6500	SO:0001583	missense	9946				quinone cofactor metabolic process	cytosol	NADP binding|NADPH:quinone reductase activity|zinc ion binding	g.chr21:34994360C>T	AF029689	CCDS13633.2	21q22.1	2008-07-31			ENSG00000205758	ENSG00000205758			2420	protein-coding gene	gene with protein product	"""quinone reductase-like 1"""	603920				10191096	Standard	NM_145858		Approved	QOH-1, 4P11	uc021wio.1	O95825	OTTHUMG00000065954	ENST00000381554.3:c.159G>A	21.37:g.34994360C>T	ENSP00000370966:p.Met53Ile		Somatic				DONSON_uc002ysn.1_Intron|CRYZL1_uc002ysr.1_Missense_Mutation_p.M77I|CRYZL1_uc002yss.1_RNA|CRYZL1_uc002yst.1_RNA|CRYZL1_uc002ysu.2_Missense_Mutation_p.M53I	p.M53I	NM_145858	NP_665857	WXS	Illumina HiSeq	Unspecified	O95825	QORL1_HUMAN			4	339	-			53					B2RDX1|B3KQ77|Q96DY0|Q9NVY7	Missense_Mutation	SNP	ENST00000381554.3	37	c.159G>A	CCDS13633.2	.	.	.	.	.	.	.	.	.	.	C	12.86	2.064129	0.36373	.	.	ENSG00000205758	ENST00000381554;ENST00000290244;ENST00000381540;ENST00000445393;ENST00000361534;ENST00000452332;ENST00000426935;ENST00000431177;ENST00000417979;ENST00000413017	T;T;T;T;T;T;T;T	0.40476	3.58;1.03;3.58;1.03;3.58;1.67;3.58;3.58	4.95	3.12	0.35913	GroES-like (1);Alcohol dehydrogenase GroES-like (1);	0.305199	0.38326	N	0.001730	T	0.25494	0.0620	N	0.25332	0.735	0.80722	D	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.09377	0.003;0.004;0.004	T	0.05683	-1.0870	10	0.25751	T	0.34	-15.4995	6.8956	0.24255	0.0:0.7954:0.0:0.2046	.	53;53;77	O95825;A6NND8;A6NHJ8	QORL1_HUMAN;.;.	I	53;53;53;53;77;53;1;53;1;53	ENSP00000370966:M53I;ENSP00000290244:M53I;ENSP00000370951:M53I;ENSP00000399730:M53I;ENSP00000355075:M77I;ENSP00000387660:M1I;ENSP00000405510:M53I;ENSP00000389209:M53I	ENSP00000290244:M53I	M	-	3	0	CRYZL1	33916230	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	2.064000	0.41432	1.086000	0.41228	0.467000	0.42956	ATG		0.338	CRYZL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141282.2	NM_145858		28	119	0	0	0	0	28	119				
ITSN1	6453	broad.mit.edu	37	21	35166702	35166702	+	Missense_Mutation	SNP	G	G	A	rs373408649		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr21:35166702G>A	ENST00000381318.3	+	17	2170	c.1882G>A	c.(1882-1884)Gaa>Aaa	p.E628K	ITSN1_ENST00000381285.4_Missense_Mutation_p.E628K|ITSN1_ENST00000399355.2_Missense_Mutation_p.E628K|ITSN1_ENST00000379960.5_Missense_Mutation_p.E628K|ITSN1_ENST00000399352.1_Missense_Mutation_p.E628K|ITSN1_ENST00000399338.4_Missense_Mutation_p.E628K|ITSN1_ENST00000399326.3_Missense_Mutation_p.E628K|ITSN1_ENST00000399353.1_Missense_Mutation_p.E591K|ITSN1_ENST00000437442.2_Missense_Mutation_p.E628K|ITSN1_ENST00000399349.1_Missense_Mutation_p.E628K|ITSN1_ENST00000399367.3_Missense_Mutation_p.E628K|AP000304.12_ENST00000429238.1_Intron|ITSN1_ENST00000381291.4_Missense_Mutation_p.E628K	NM_003024.2	NP_003015.2	Q15811	ITSN1_HUMAN	intersectin 1 (SH3 domain protein)	628	KLERQ.				apoptotic signaling pathway (GO:0097190)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|kinase activator activity (GO:0019209)|proline-rich region binding (GO:0070064)|protein complex scaffold (GO:0032947)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(26)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	67						CATGGAGGCTGAACGACTGAA	0.383																																						uc002yta.1		NA																	0				ovary(3)|skin(1)	4						c.(1882-1884)GAA>AAA		intersectin 1 isoform ITSN-l		G	LYS/GLU,LYS/GLU	0,4406		0,0,2203	86.0	85.0	85.0		1882,1882	5.8	0.7	21		85	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ITSN1	NM_001001132.1,NM_003024.2	56,56	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	628/1221,628/1722	35166702	1,13005	2203	4300	6503	SO:0001583	missense	6453				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic vesicle endocytosis	cell junction|coated pit|cytosol|lamellipodium|synapse|synaptosome	calcium ion binding|proline-rich region binding|protein complex scaffold|Rho guanyl-nucleotide exchange factor activity	g.chr21:35166702G>A	AF064244	CCDS33545.1, CCDS33546.1	21q22.1-q22.2	2013-01-10			ENSG00000205726	ENSG00000205726		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	6183	protein-coding gene	gene with protein product	"""SH3 domain protein-1A"", ""human intersectin-SH3 domain-containing protein SH3P17"", ""Src homology 3 domain-containing protein"", ""intersectin 1 short form variant, 11"", ""intersectin 1 short form variant 3"", ""intersectin short variant 12"""	602442		SH3D1A, ITSN		9799604, 9813051	Standard	NM_003024		Approved	SH3P17, MGC134948, MGC134949	uc002yta.1	Q15811	OTTHUMG00000065284	ENST00000381318.3:c.1882G>A	21.37:g.35166702G>A	ENSP00000370719:p.Glu628Lys		Somatic				DONSON_uc002ysn.1_Intron|ITSN1_uc002yth.3_RNA|ITSN1_uc002ysz.2_Missense_Mutation_p.E628K|ITSN1_uc010gmg.2_Missense_Mutation_p.E591K|ITSN1_uc010gmh.2_RNA|ITSN1_uc002ysw.2_Missense_Mutation_p.E628K|ITSN1_uc010gmi.2_Missense_Mutation_p.E591K|ITSN1_uc010gmj.2_Missense_Mutation_p.E512K|ITSN1_uc002ysy.2_Missense_Mutation_p.E628K|ITSN1_uc002ysx.2_Missense_Mutation_p.E591K|ITSN1_uc002ytb.1_Missense_Mutation_p.E628K|ITSN1_uc002ytc.1_Missense_Mutation_p.E628K|ITSN1_uc002ytd.2_RNA|ITSN1_uc010gmk.2_Missense_Mutation_p.E591K|ITSN1_uc010gml.2_RNA|ITSN1_uc002ytj.2_Missense_Mutation_p.E628K|ITSN1_uc010gmm.1_RNA|ITSN1_uc002yte.2_Missense_Mutation_p.E562K	p.E628K	NM_003024	NP_003015	WXS	Illumina HiSeq	Unspecified	Q15811	ITSN1_HUMAN			17	2150	+			628			Potential.|KLERQ.		A7Y322|A8CTX8|A8CTY3|A8CTY7|A8D7D0|A8DCP3|B4DTM2|E7ERJ1|E9PE44|E9PG01|E9PHV2|O95216|Q0PW94|Q0PW95|Q0PW97|Q14BD3|Q1ED40|Q20BK3|Q9UET5|Q9UK60|Q9UNK1|Q9UNK2|Q9UQ92	Missense_Mutation	SNP	ENST00000381318.3	37	c.1882G>A	CCDS33545.1	.	.	.	.	.	.	.	.	.	.	G	16.22	3.060571	0.55432	0.0	1.16E-4	ENSG00000205726	ENST00000399353;ENST00000381318;ENST00000381291;ENST00000381285;ENST00000381288;ENST00000381289;ENST00000399367;ENST00000399352;ENST00000399355;ENST00000399349;ENST00000399338;ENST00000437442;ENST00000399326;ENST00000379960	T;T;T;T;T;T;T;T;T;T;T;T	0.29397	2.6;2.6;2.6;2.6;2.6;2.6;2.6;2.6;1.57;2.6;2.6;1.57	5.76	5.76	0.90799	.	0.158264	0.56097	D	0.000038	T	0.37046	0.0989	N	0.25201	0.72	0.51482	D	0.999929	D;P;B;P;D;P;P;P;B;D	0.71674	0.996;0.947;0.023;0.773;0.998;0.546;0.947;0.947;0.072;0.973	P;P;B;B;D;B;B;B;B;P	0.63488	0.872;0.638;0.015;0.445;0.915;0.073;0.445;0.445;0.122;0.585	T	0.03112	-1.1071	10	0.02654	T	1	.	19.9759	0.97304	0.0:0.0:1.0:0.0	.	591;591;591;628;628;628;628;628;628;591	A8D7D0;A7XZY7;A8CTY7;A8CTY3;F8W7U0;E7ERJ1;A8CTX8;Q15811;Q15811-3;E7ERJ0	.;.;.;.;.;.;.;ITSN1_HUMAN;.;.	K	591;628;628;628;628;628;628;628;628;628;628;628;628;628	ENSP00000382290:E591K;ENSP00000370719:E628K;ENSP00000370691:E628K;ENSP00000370685:E628K;ENSP00000382301:E628K;ENSP00000382289:E628K;ENSP00000382292:E628K;ENSP00000382286:E628K;ENSP00000382275:E628K;ENSP00000387377:E628K;ENSP00000382265:E628K;ENSP00000369294:E628K	ENSP00000369294:E628K	E	+	1	0	ITSN1	34088572	1.000000	0.71417	0.737000	0.30932	0.987000	0.75469	7.139000	0.77314	2.713000	0.92767	0.655000	0.94253	GAA		0.383	ITSN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000140070.4	NM_003024		12	67	0	0	0	0	12	67				
RRP1	8568	broad.mit.edu	37	21	45219458	45219458	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr21:45219458C>T	ENST00000497547.1	+	9	936	c.819C>T	c.(817-819)atC>atT	p.I273I	RRP1_ENST00000471909.1_3'UTR	NM_003683.5	NP_003674.1	P05386	RLA1_HUMAN	ribosomal RNA processing 1	0					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|kidney(1)|lung(4)|stomach(2)	8				COAD - Colon adenocarcinoma(84;0.00753)|Colorectal(79;0.0157)|STAD - Stomach adenocarcinoma(101;0.171)		CAGGCTCCATCTGCAGGGCTG	0.647																																						uc002zds.2		NA																	0					0						c.(817-819)ATC>ATT		ribosomal RNA processing 1 homolog							69.0	86.0	80.0					21																	45219458		2093	4228	6321	SO:0001819	synonymous_variant	8568				rRNA processing	nucleolus|preribosome, small subunit precursor		g.chr21:45219458C>T	U79775	CCDS42951.1	21q22.3	2013-07-02	2013-07-02		ENSG00000160214	ENSG00000160214			18785	protein-coding gene	gene with protein product	"""DNA segment on chromosome 21 (unique) 2056 expressed sequence"", ""Nnp1 homolog, nucleolar protein (Drosophila)"""	610653	"""ribosomal RNA processing 1 homolog (S. cerevisiae)"""			10830953, 10341208	Standard	NM_003683		Approved	NNP-1, Nop52, NOP52, RRP1A, D21S2056E	uc002zds.2	P56182	OTTHUMG00000086884	ENST00000497547.1:c.819C>T	21.37:g.45219458C>T			Somatic				RRP1_uc011aez.1_Silent_p.I273I|RRP1_uc010gpk.1_Silent_p.I123I|RRP1_uc010gpl.1_Silent_p.I171I|RRP1_uc010gpm.1_Silent_p.I140I	p.I273I	NM_003683	NP_003674	WXS	Illumina HiSeq	Unspecified	P56182	RRP1_HUMAN		COAD - Colon adenocarcinoma(84;0.00753)|Colorectal(79;0.0157)|STAD - Stomach adenocarcinoma(101;0.171)	9	912	+			273					A6NIB2	Silent	SNP	ENST00000497547.1	37	c.819C>T	CCDS42951.1																																																																																				0.647	RRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195680.1	NM_003683		5	45	0	0	0	0	5	45				
CECR5	27440	broad.mit.edu	37	22	17630458	17630458	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr22:17630458C>T	ENST00000336737.4	-	2	329	c.304G>A	c.(304-306)Gag>Aag	p.E102K	CECR5_ENST00000480451.1_5'UTR|CECR5_ENST00000155674.5_Missense_Mutation_p.E72K|CECR5_ENST00000399852.3_Intron	NM_033070.2	NP_149061.1	Q9BXW7	CECR5_HUMAN	cat eye syndrome chromosome region, candidate 5	102						mitochondrion (GO:0005739)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|liver(1)|lung(10)|pancreas(1)|prostate(1)	21		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)				GCTGACAGCTCCTGGGCTTTG	0.597																																						uc002zmf.2		NA																	0					0						c.(304-306)GAG>AAG		cat eye syndrome chromosome region, candidate 5							101.0	99.0	100.0					22																	17630458		2203	4300	6503	SO:0001583	missense	27440						hydrolase activity	g.chr22:17630458C>T	AF273270	CCDS13741.1, CCDS33595.1	22q11.2	2008-06-12			ENSG00000069998	ENSG00000069998			1843	protein-coding gene	gene with protein product						11381032	Standard	NM_017829		Approved		uc002zmf.3	Q9BXW7	OTTHUMG00000150071	ENST00000336737.4:c.304G>A	22.37:g.17630458C>T	ENSP00000337358:p.Glu102Lys		Somatic				CECR5_uc002zme.2_5'Flank|CECR5_uc002zmg.2_Intron|CECR5_uc002zmh.2_Missense_Mutation_p.E72K	p.E102K	NM_033070	NP_149061	WXS	Illumina HiSeq	Unspecified	Q9BXW7	CECR5_HUMAN			2	332	-		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)	102					B2RCK5|Q9BXW8|Q9NWA8|Q9NX41	Missense_Mutation	SNP	ENST00000336737.4	37	c.304G>A	CCDS33595.1	.	.	.	.	.	.	.	.	.	.	C	15.64	2.893836	0.52121	.	.	ENSG00000069998	ENST00000155674;ENST00000336737	T;T	0.25912	1.77;1.77	4.6	4.6	0.57074	HAD-like domain (2);	0.106561	0.64402	D	0.000005	T	0.21761	0.0524	N	0.25332	0.735	0.80722	D	1	P;P	0.37370	0.537;0.592	B;B	0.41135	0.155;0.348	T	0.02632	-1.1131	10	0.11485	T	0.65	-34.9769	17.5609	0.87906	0.0:1.0:0.0:0.0	.	72;102	Q9BXW7-2;Q9BXW7	.;CECR5_HUMAN	K	72;102	ENSP00000155674:E72K;ENSP00000337358:E102K	ENSP00000155674:E72K	E	-	1	0	CECR5	16010458	1.000000	0.71417	1.000000	0.80357	0.619000	0.37552	3.812000	0.55628	2.544000	0.85801	0.561000	0.74099	GAG		0.597	CECR5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316100.1	NM_017829		14	95	0	0	0	0	14	95				
TXNRD2	10587	broad.mit.edu	37	22	19868160	19868160	+	Silent	SNP	C	C	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr22:19868160C>A	ENST00000400521.1	-	13	1173	c.1167G>T	c.(1165-1167)ctG>ctT	p.L389L	TXNRD2_ENST00000400518.1_Silent_p.L359L|TXNRD2_ENST00000542719.1_Silent_p.L359L|TXNRD2_ENST00000535882.1_Silent_p.L388L|TXNRD2_ENST00000400519.1_Silent_p.L388L	NM_006440.3	NP_006431.2	Q9NNW7	TRXR2_HUMAN	thioredoxin reductase 2	389					cell redox homeostasis (GO:0045454)|heart development (GO:0007507)|hemopoiesis (GO:0030097)|response to oxygen radical (GO:0000305)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|NADP binding (GO:0050661)|thioredoxin-disulfide reductase activity (GO:0004791)			breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|urinary_tract(2)	30	Colorectal(54;0.0993)					CGTAGTCCATCAGATCTGAGG	0.632																																						uc011ahc.1		NA																	0				ovary(2)	2						c.(1165-1167)CTG>CTT		thioredoxin reductase 2 precursor							43.0	51.0	48.0					22																	19868160		2142	4245	6387	SO:0001819	synonymous_variant	10587				cell redox homeostasis|response to oxygen radical	mitochondrion	flavin adenine dinucleotide binding|NADP binding|thioredoxin-disulfide reductase activity	g.chr22:19868160C>A	AF106697	CCDS42981.1, CCDS63402.1	22q11.21	2014-09-17			ENSG00000184470	ENSG00000184470			18155	protein-coding gene	gene with protein product	"""thioredoxin reductase beta"", ""selenoprotein Z"""	606448				9923614, 10215850, 11012661	Standard	NM_006440		Approved	TR, TRXR2, TR3	uc021wlj.1	Q9NNW7	OTTHUMG00000149975	ENST00000400521.1:c.1167G>T	22.37:g.19868160C>A			Somatic				TXNRD2_uc002zql.1_Silent_p.L143L|TXNRD2_uc002zqm.1_RNA|TXNRD2_uc002zqn.1_RNA|TXNRD2_uc002zqo.1_RNA|TXNRD2_uc002zqp.1_RNA|TXNRD2_uc002zqr.1_Silent_p.L388L|TXNRD2_uc002zqj.1_RNA|TXNRD2_uc002zqq.1_Silent_p.L39L	p.L389L	NM_006440	NP_006431	WXS	Illumina HiSeq	Unspecified	Q9NNW7	TRXR2_HUMAN			13	1200	-	Colorectal(54;0.0993)		389					O95840|Q96IJ2|Q9H2Z5|Q9NZV3|Q9NZV4|Q9P2Y0|Q9P2Y1|Q9UQU8	Silent	SNP	ENST00000400521.1	37	c.1167G>T	CCDS42981.1																																																																																				0.632	TXNRD2-003	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000314903.3	NM_006440		4	48	1	0	0.00909568	0.00925056	4	48				
GGA1	26088	broad.mit.edu	37	22	38028118	38028118	+	Silent	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr22:38028118G>A	ENST00000343632.4	+	15	2030	c.1644G>A	c.(1642-1644)ctG>ctA	p.L548L	GGA1_ENST00000381756.5_Silent_p.L565L|GGA1_ENST00000325180.8_Silent_p.L461L|GGA1_ENST00000406772.1_Silent_p.L475L|GGA1_ENST00000337437.4_Silent_p.L515L	NM_001172687.1|NM_013365.4	NP_001166158.1|NP_037497.1	Q9UJY5	GGA1_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 1	548	GAE. {ECO:0000255|PROSITE- ProRule:PRU00093}.				intracellular protein transport (GO:0006886)|positive regulation of protein catabolic process (GO:0045732)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|urinary_tract(1)	10	Melanoma(58;0.0574)					TTTCCATGCTGAGCACCGCCC	0.627																																						uc003atc.2		NA																	0				breast(2)|ovary(1)	3						c.(1642-1644)CTG>CTA		golgi associated, gamma adaptin ear containing,							82.0	67.0	72.0					22																	38028118		2203	4300	6503	SO:0001819	synonymous_variant	26088				intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|endosome membrane|Golgi apparatus part	protein binding	g.chr22:38028118G>A	AF190862	CCDS13951.1, CCDS33643.1, CCDS54526.1	22q13.31	2010-02-12	2010-02-12		ENSG00000100083	ENSG00000100083			17842	protein-coding gene	gene with protein product		606004				10747088, 10747089, 16407204	Standard	NM_013365		Approved		uc003atc.3	Q9UJY5	OTTHUMG00000030985	ENST00000343632.4:c.1644G>A	22.37:g.38028118G>A			Somatic				GGA1_uc003atd.2_Silent_p.L461L|GGA1_uc003ate.2_Silent_p.L544L|GGA1_uc003atf.2_Silent_p.L475L|SH3BP1_uc003atg.1_5'Flank	p.L548L	NM_013365	NP_037497	WXS	Illumina HiSeq	Unspecified	Q9UJY5	GGA1_HUMAN			15	2009	+	Melanoma(58;0.0574)		548			GAE.		A8K3D3|B0QYR7|Q5TG07|Q86YA9|Q8NCS6|Q9BW94|Q9UG00|Q9UGW0|Q9UGW1	Silent	SNP	ENST00000343632.4	37	c.1644G>A	CCDS13951.1																																																																																				0.627	GGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075873.3	NM_013365		3	21	0	0	0	0	3	21				
ST13	6767	broad.mit.edu	37	22	41240869	41240869	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr22:41240869G>A	ENST00000216218.3	-	4	770	c.289C>T	c.(289-291)Caa>Taa	p.Q97*		NM_003932.3	NP_003923.2	P50502	F10A1_HUMAN	suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein)	97					chaperone cofactor-dependent protein refolding (GO:0070389)|negative regulation of protein refolding (GO:0061084)|protein folding (GO:0006457)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	dATP binding (GO:0032564)|protein binding, bridging (GO:0030674)			cervix(1)|large_intestine(1)|lung(3)|skin(1)	6						CCCATTTCTTGAGGAGCATCA	0.408																																						uc003aze.2		NA																	0					0						c.(289-291)CAA>TAA		heat shock 70kD protein binding protein							99.0	85.0	90.0					22																	41240869		2203	4300	6503	SO:0001587	stop_gained	6767						protein binding, bridging	g.chr22:41240869G>A		CCDS14006.1	22q13.2	2013-01-10	2001-11-29		ENSG00000100380	ENSG00000100380		"""Tetratricopeptide (TTC) repeat domain containing"""	11343	protein-coding gene	gene with protein product	"""progesterone receptor-associated p48 protein"""	606796	"""suppression of tumorigenicity 13 (colon carcinoma) (Hsp70-interacting protein)"""			9925927, 8721986	Standard	NM_003932		Approved	SNC6, HSPABP1, HIP, P48, FAM10A1	uc003aze.3	P50502	OTTHUMG00000151201	ENST00000216218.3:c.289C>T	22.37:g.41240869G>A	ENSP00000216218:p.Gln97*		Somatic				ST13_uc011aow.1_Nonsense_Mutation_p.Q87*	p.Q97*	NM_003932	NP_003923	WXS	Illumina HiSeq	Unspecified	P50502	F10A1_HUMAN			4	432	-			97					O14999|Q2TU77	Nonsense_Mutation	SNP	ENST00000216218.3	37	c.289C>T	CCDS14006.1	.	.	.	.	.	.	.	.	.	.	G	37	6.240550	0.97403	.	.	ENSG00000100380	ENST00000216218;ENST00000542699;ENST00000401032;ENST00000411695	.	.	.	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	.	19.7902	0.96453	0.0:0.0:1.0:0.0	.	.	.	.	X	97;97;97;60	.	ENSP00000216218:Q97X	Q	-	1	0	ST13	39570815	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	6.352000	0.73027	2.780000	0.95670	0.585000	0.79938	CAA		0.408	ST13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321759.1	NM_003932		5	18	0	0	0	0	5	18				
WBP2NL	164684	broad.mit.edu	37	22	42423140	42423140	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr22:42423140C>T	ENST00000328823.9	+	6	916	c.885C>T	c.(883-885)aaC>aaT	p.N295N	WBP2NL_ENST00000543212.1_Silent_p.N221N	NM_152613.2	NP_689826.2	Q6ICG8	WBP2L_HUMAN	WBP2 N-terminal like	295					egg activation (GO:0007343)|male pronucleus assembly (GO:0035039)|meiotic nuclear division (GO:0007126)	perinuclear theca (GO:0033011)	WW domain binding (GO:0050699)			breast(2)|large_intestine(3)|lung(5)|ovary(3)|prostate(1)	14						CTCCTGAAAACGAGGCTTCTC	0.527																																						uc011ape.1		NA																	0				ovary(2)	2						c.(883-885)AAC>AAT		WBP2 N-terminal like							65.0	71.0	69.0					22																	42423140		2203	4300	6503	SO:0001819	synonymous_variant	164684				egg activation|male pronucleus assembly|meiosis	perinuclear theca	WW domain binding	g.chr22:42423140C>T	BC022546	CCDS14029.1	22q13.2	2007-07-18			ENSG00000183066	ENSG00000183066			28389	protein-coding gene	gene with protein product	"""postacrosomal sheath WW domain-binding protein"""	610981				17289678	Standard	NM_152613		Approved	FLJ26145, MGC26816, PAWP	uc003bbt.3	Q6ICG8	OTTHUMG00000151270	ENST00000328823.9:c.885C>T	22.37:g.42423140C>T			Somatic				WBP2NL_uc003bbt.2_Silent_p.N295N|WBP2NL_uc011apk.1_Silent_p.N167N|WBP2NL_uc003bbu.2_RNA|WBP2NL_uc003bbv.1_RNA	p.N295N	NM_152613	NP_689826	WXS	Illumina HiSeq	Unspecified	Q6ICG8	WBP2L_HUMAN			7	901	+			295					A3KFF7|A8MSG5|B3KXX4|Q8TBF0|Q8TBF3	Silent	SNP	ENST00000328823.9	37	c.885C>T	CCDS14029.1																																																																																				0.527	WBP2NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322037.1	NM_152613		19	83	0	0	0	0	19	83				
NUP50	10762	broad.mit.edu	37	22	45571788	45571788	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr22:45571788G>T	ENST00000347635.4	+	4	633	c.167G>T	c.(166-168)gGa>gTa	p.G56V	NUP50_ENST00000486184.1_3'UTR|NUP50_ENST00000425733.2_Intron|NUP50_ENST00000407019.2_Missense_Mutation_p.G28V|NUP50_ENST00000396096.2_Missense_Mutation_p.G28V	NM_007172.3	NP_009103.2	Q9UKX7	NUP50_HUMAN	nucleoporin 50kDa	56	Gly-rich.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|intracellular transport (GO:0046907)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	9		Ovarian(80;0.00965)|all_neural(38;0.0244)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		GACACTGGAGGAGCCTTTAAA	0.463																																						uc003bfr.2		NA																	0					0						c.(166-168)GGA>GTA		nucleoporin 50kDa isoform b							77.0	77.0	77.0					22																	45571788		2203	4300	6503	SO:0001583	missense	10762				carbohydrate metabolic process|glucose transport|intracellular transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore|nucleoplasm	protein binding	g.chr22:45571788G>T	AF107840	CCDS14062.1, CCDS14063.1	22q13.3	2007-01-22	2002-08-29		ENSG00000093000	ENSG00000093000			8065	protein-coding gene	gene with protein product		604646	"""nucleoporin 50kD"""	NPAP60L		10449902	Standard	XM_005261312		Approved		uc003bfr.3	Q9UKX7	OTTHUMG00000151265	ENST00000347635.4:c.167G>T	22.37:g.45571788G>T	ENSP00000345895:p.Gly56Val		Somatic				NUP50_uc003bfs.2_Missense_Mutation_p.G28V|NUP50_uc011aqn.1_Intron|NUP50_uc003bft.2_Missense_Mutation_p.G28V|NUP50_uc011aqo.1_5'Flank	p.G56V	NM_007172	NP_009103	WXS	Illumina HiSeq	Unspecified	Q9UKX7	NUP50_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)	4	629	+		Ovarian(80;0.00965)|all_neural(38;0.0244)	56			Gly-rich.		B1AHA4|B2RB15|O75644|Q8N6V5|Q9NPM9|Q9NPR6|Q9P1K5	Missense_Mutation	SNP	ENST00000347635.4	37	c.167G>T	CCDS14062.1	.	.	.	.	.	.	.	.	.	.	G	19.77	3.889907	0.72524	.	.	ENSG00000093000	ENST00000347635;ENST00000407019;ENST00000396096;ENST00000422489	.	.	.	5.25	3.15	0.36227	Nuclear pore complex, NUP2/50/61 (1);	0.096419	0.64402	D	0.000001	T	0.77465	0.4134	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.78861	-0.2037	9	0.87932	D	0	-20.5597	11.0374	0.47808	0.0701:0.1295:0.8004:0.0	.	56	Q9UKX7	NUP50_HUMAN	V	56;28;28;56	.	ENSP00000345895:G56V	G	+	2	0	NUP50	43950452	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	7.707000	0.84623	0.705000	0.31890	0.650000	0.86243	GGA		0.463	NUP50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321993.2			15	95	1	0	0.000422831	0.000435765	15	95				
FAM118A	55007	broad.mit.edu	37	22	45728405	45728405	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr22:45728405G>A	ENST00000216214.3	+	7	1585	c.751G>A	c.(751-753)Gtg>Atg	p.V251M	FAM118A_ENST00000441876.2_Missense_Mutation_p.V251M|FAM118A_ENST00000405548.3_Missense_Mutation_p.V69M	NM_001104595.1	NP_001098065.1	Q9NWS6	F118A_HUMAN	family with sequence similarity 118, member A	251						integral component of membrane (GO:0016021)				endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)	11		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		TCTTTACTCCGTGCCGAATAA	0.478																																						uc003bfz.3		NA																	0					0						c.(751-753)GTG>ATG		hypothetical protein LOC55007							114.0	115.0	115.0					22																	45728405		2203	4300	6503	SO:0001583	missense	55007					integral to membrane		g.chr22:45728405G>A	BC013696	CCDS14065.1	22q13.3	2006-04-26	2006-04-26	2006-04-26	ENSG00000100376	ENSG00000100376			1313	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 8"""	C22orf8		12477932	Standard	NM_001104595		Approved	FLJ20635, bK268H5.C22.4	uc003bga.4	Q9NWS6	OTTHUMG00000151338	ENST00000216214.3:c.751G>A	22.37:g.45728405G>A	ENSP00000216214:p.Val251Met		Somatic				FAM118A_uc003bga.3_Missense_Mutation_p.V251M|FAM118A_uc011aqr.1_Missense_Mutation_p.V69M	p.V251M	NM_001104595	NP_001098065	WXS	Illumina HiSeq	Unspecified	Q9NWS6	F118A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)	7	1367	+		Ovarian(80;0.00965)|all_neural(38;0.0416)	251					B3KWG4|B4DY02|Q5TII5|Q96CY3	Missense_Mutation	SNP	ENST00000216214.3	37	c.751G>A	CCDS14065.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.574557	0.86542	.	.	ENSG00000100376	ENST00000216214;ENST00000441876;ENST00000405548	T;T;T	0.33654	1.4;1.4;1.4	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.55081	0.1898	L	0.44542	1.39	0.46954	D	0.999261	D	0.89917	1.0	D	0.91635	0.999	T	0.49969	-0.8882	10	0.48119	T	0.1	-0.8602	19.514	0.95155	0.0:0.0:1.0:0.0	.	251	Q9NWS6	F118A_HUMAN	M	251;251;69	ENSP00000216214:V251M;ENSP00000395892:V251M;ENSP00000384836:V69M	ENSP00000216214:V251M	V	+	1	0	FAM118A	44107069	1.000000	0.71417	0.964000	0.40570	0.956000	0.61745	7.405000	0.80007	2.706000	0.92434	0.655000	0.94253	GTG		0.478	FAM118A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322260.1	NM_017911		22	138	0	0	0	0	22	138				
GADL1	339896	broad.mit.edu	37	3	30885930	30885930	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:30885930G>C	ENST00000282538.5	-	7	830	c.680C>G	c.(679-681)tCt>tGt	p.S227C	GADL1_ENST00000454381.3_Missense_Mutation_p.S227C	NM_207359.2	NP_997242.2	Q6ZQY3	GADL1_HUMAN	glutamate decarboxylase-like 1	227					carboxylic acid metabolic process (GO:0019752)		aspartate 1-decarboxylase activity (GO:0004068)|pyridoxal phosphate binding (GO:0030170)|sulfinoalanine decarboxylase activity (GO:0004782)			breast(2)|endometrium(3)|kidney(2)|lung(17)|upper_aerodigestive_tract(1)	25						CCCAAGAAAAGAGGCTGCCTT	0.433																																						uc003cep.2		NA																	0					0						c.(679-681)TCT>TGT		glutamate decarboxylase-like 1	Pyridoxal Phosphate(DB00114)						156.0	155.0	156.0					3																	30885930		2203	4300	6503	SO:0001583	missense	339896				carboxylic acid metabolic process		carboxy-lyase activity|pyridoxal phosphate binding	g.chr3:30885930G>C	AK128643	CCDS2649.2	3p23-p22	2009-01-14			ENSG00000144644	ENSG00000144644			27949	protein-coding gene	gene with protein product		615601					Standard	NM_207359		Approved		uc003cep.2	Q6ZQY3	OTTHUMG00000130621	ENST00000282538.5:c.680C>G	3.37:g.30885930G>C	ENSP00000282538:p.Ser227Cys		Somatic				GADL1_uc003ceq.1_Missense_Mutation_p.S227C	p.S227C	NM_207359	NP_997242	WXS	Illumina HiSeq	Unspecified	Q6ZQY3	GADL1_HUMAN			7	727	-			227						Missense_Mutation	SNP	ENST00000282538.5	37	c.680C>G	CCDS2649.2	.	.	.	.	.	.	.	.	.	.	G	26.3	4.726758	0.89298	.	.	ENSG00000144644	ENST00000282538;ENST00000454381	T;T	0.38401	1.14;1.14	5.95	5.95	0.96441	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.063203	0.64402	D	0.000006	T	0.63885	0.2549	M	0.79805	2.47	0.49130	D	0.999754	P	0.48834	0.916	P	0.61874	0.895	T	0.63980	-0.6514	10	0.62326	D	0.03	-22.9169	20.4024	0.99000	0.0:0.0:1.0:0.0	.	227	Q6ZQY3	GADL1_HUMAN	C	227	ENSP00000282538:S227C;ENSP00000427059:S227C	ENSP00000282538:S227C	S	-	2	0	GADL1	30860934	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.145000	0.77365	2.827000	0.97445	0.650000	0.86243	TCT		0.433	GADL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253106.2	NM_207359		35	150	0	0	0	0	35	150				
CLASP2	23122	broad.mit.edu	37	3	33585011	33585011	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:33585011C>T	ENST00000468888.2	-	32	3388	c.3342G>A	c.(3340-3342)ttG>ttA	p.L1114L	CLASP2_ENST00000359576.5_Silent_p.L1105L|CLASP2_ENST00000307312.7_Silent_p.L595L|CLASP2_ENST00000539981.1_Silent_p.L883L|CLASP2_ENST00000461133.3_Silent_p.L873L|CLASP2_ENST00000399362.4_Silent_p.L1113L|CLASP2_ENST00000480013.1_Silent_p.L893L			O75122	CLAP2_HUMAN	cytoplasmic linker associated protein 2	894	Interaction with RSN and localization to the Golgi and kinetochores.|Required for cortical localization.				axon guidance (GO:0007411)|establishment or maintenance of cell polarity (GO:0007163)|fucosylation (GO:0036065)|microtubule anchoring (GO:0034453)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)|regulation of microtubule polymerization or depolymerization (GO:0031110)|regulation of microtubule-based process (GO:0032886)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)|microtubule plus-end binding (GO:0051010)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	48						TTGGTCTTGTCAAAGGACTCC	0.393																																						uc003cfu.2		NA																	0				ovary(3)|central_nervous_system(1)	4						c.(3316-3318)TTG>TTA		CLIP-associating protein 2							147.0	143.0	144.0					3																	33585011		1881	4122	6003	SO:0001819	synonymous_variant	23122							g.chr3:33585011C>T	AB014527		3p24.3	2013-01-18			ENSG00000163539	ENSG00000163539			17078	protein-coding gene	gene with protein product		605853				9734811, 10899121	Standard	NM_015097		Approved	KIAA0627	uc021wvc.1	O75122	OTTHUMG00000156489	ENST00000468888.2:c.3342G>A	3.37:g.33585011C>T			Somatic				CLASP2_uc003cfs.2_Silent_p.L313L|CLASP2_uc003cft.2_RNA|CLASP2_uc010hgb.2_RNA|CLASP2_uc011axt.1_Silent_p.L706L	p.L1106L	NM_015097	NP_055912	WXS	Illumina HiSeq	Unspecified	B2RTR1	B2RTR1_HUMAN			31	3672	-			1115					Q7L8F6|Q8N6R6|Q9BQT3|Q9BQT4|Q9H7A3|Q9NSZ2	Silent	SNP	ENST00000468888.2	37	c.3318G>A		.	.	.	.	.	.	.	.	.	.	C	9.159	1.018186	0.19355	.	.	ENSG00000163539	ENST00000480385	.	.	.	5.74	4.86	0.63082	.	.	.	.	.	T	0.60038	0.2238	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56908	-0.7901	4	.	.	.	-10.0449	9.0451	0.36341	0.0:0.8157:0.0:0.1843	.	.	.	.	N	170	.	.	D	-	1	0	CLASP2	33560015	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.376000	0.34306	2.702000	0.92279	0.591000	0.81541	GAC		0.393	CLASP2-001	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000344320.4	NM_001207044		13	80	0	0	0	0	13	80				
SCN5A	6331	broad.mit.edu	37	3	38645426	38645426	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:38645426C>T	ENST00000333535.4	-	12	1816	c.1667G>A	c.(1666-1668)aGc>aAc	p.S556N	SCN5A_ENST00000443581.1_Missense_Mutation_p.S556N|SCN5A_ENST00000414099.2_Missense_Mutation_p.S556N|SCN5A_ENST00000425664.1_Missense_Mutation_p.S556N|SCN5A_ENST00000450102.2_Missense_Mutation_p.S556N|SCN5A_ENST00000449557.2_Missense_Mutation_p.S556N|SCN5A_ENST00000451551.2_Missense_Mutation_p.S556N|SCN5A_ENST00000413689.1_Missense_Mutation_p.S556N|SCN5A_ENST00000423572.2_Missense_Mutation_p.S556N|SCN5A_ENST00000455624.2_Missense_Mutation_p.S556N			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	556					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	TGTGTGGTGGCTCTCGCTCTC	0.642																																						uc003cio.2		NA																	0				ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9						c.(1666-1668)AGC>AAC		voltage-gated sodium channel type V alpha	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)						48.0	54.0	52.0					3																	38645426		2093	4216	6309	SO:0001583	missense	6331				blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity	g.chr3:38645426C>T	AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.1667G>A	3.37:g.38645426C>T	ENSP00000328968:p.Ser556Asn		Somatic				SCN5A_uc003cin.2_Missense_Mutation_p.S556N|SCN5A_uc003cil.3_Missense_Mutation_p.S556N|SCN5A_uc010hhi.2_Missense_Mutation_p.S556N|SCN5A_uc010hhk.2_Missense_Mutation_p.S556N|SCN5A_uc011ayr.1_Missense_Mutation_p.S556N|SCN5A_uc010hhj.1_Missense_Mutation_p.S167N	p.S556N	NM_198056	NP_932173	WXS	Illumina HiSeq	Unspecified	Q14524	SCN5A_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	12	1861	-	Medulloblastoma(35;0.163)		556					A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	ENST00000333535.4	37	c.1667G>A	CCDS46796.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.255226	0.80135	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.91351	-2.83;-2.83;-2.83;-2.83;-2.83;-2.83;-2.83;-2.83;-2.83;-2.83	4.27	4.27	0.50696	Domain of unknown function DUF3451 (1);	0.166731	0.51477	D	0.000092	D	0.95557	0.8556	M	0.85630	2.765	0.49051	D	0.999747	P;D;D;P;D;D;D	0.69078	0.856;0.997;0.986;0.856;0.997;0.981;0.996	P;D;P;P;D;P;D	0.79108	0.723;0.992;0.797;0.723;0.992;0.763;0.986	D	0.96356	0.9262	10	0.72032	D	0.01	.	16.8835	0.86069	0.0:1.0:0.0:0.0	.	556;556;556;556;556;556;556	E9PEF3;E9PHB6;Q14524-6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;.;SCN5A_HUMAN;.;.	N	556	ENSP00000398962:S556N;ENSP00000398266:S556N;ENSP00000410257:S556N;ENSP00000388797:S556N;ENSP00000397915:S556N;ENSP00000416634:S556N;ENSP00000328968:S556N;ENSP00000399524:S556N;ENSP00000403355:S556N;ENSP00000413996:S556N	ENSP00000328968:S556N	S	-	2	0	SCN5A	38620430	1.000000	0.71417	1.000000	0.80357	0.716000	0.41182	3.195000	0.51013	2.205000	0.71048	0.561000	0.74099	AGC		0.642	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	NM_198056		7	41	0	0	0	0	7	41				
ULK4	54986	broad.mit.edu	37	3	41973352	41973352	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:41973352C>T	ENST00000301831.4	-	5	987	c.525G>A	c.(523-525)atG>atA	p.M175I	ULK4_ENST00000420927.1_Missense_Mutation_p.M175I	NM_017886.2	NP_060356.2	Q96C45	ULK4_HUMAN	unc-51 like kinase 4	175	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cilium morphogenesis (GO:0060271)|epithelial cilium movement (GO:0003351)|microtubule cytoskeleton organization (GO:0000226)|regulation of JNK cascade (GO:0046328)|regulation of MAPK cascade (GO:0043408)|regulation of neuron migration (GO:2001222)|regulation of neuron projection development (GO:0010975)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase C signaling (GO:0090036)|ventricular system development (GO:0021591)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|large_intestine(6)|lung(7)|prostate(5)|skin(1)	22				KIRC - Kidney renal clear cell carcinoma(284;0.214)		CTCTACTTTTCATGCTTTTCT	0.423																																						uc003ckv.3		NA																	0					0						c.(523-525)ATG>ATA		unc-51-like kinase 4							303.0	292.0	296.0					3																	41973352		1911	4126	6037	SO:0001583	missense	54986						ATP binding|protein serine/threonine kinase activity	g.chr3:41973352C>T	AK000581	CCDS43071.1	3p22.1	2013-07-02	2013-07-02		ENSG00000168038	ENSG00000168038			15784	protein-coding gene	gene with protein product			"""unc-51-like kinase 4 (C. elegans)"""			12477932	Standard	NM_017886		Approved	FLJ20574, REC01035, FAM7C1	uc003ckv.4	Q96C45	OTTHUMG00000156210	ENST00000301831.4:c.525G>A	3.37:g.41973352C>T	ENSP00000301831:p.Met175Ile		Somatic				ULK4_uc003ckw.2_Missense_Mutation_p.M175I|ULK4_uc003ckx.1_Missense_Mutation_p.M175I	p.M175I	NM_017886	NP_060356	WXS	Illumina HiSeq	Unspecified	Q96C45	ULK4_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.214)	5	726	-			175			Protein kinase.		A6NF15|Q8IW79|Q9NWV6|Q9UF96	Missense_Mutation	SNP	ENST00000301831.4	37	c.525G>A	CCDS43071.1	.	.	.	.	.	.	.	.	.	.	C	9.150	1.016100	0.19355	.	.	ENSG00000168038	ENST00000301831;ENST00000420927	T;T	0.64991	-0.13;-0.13	5.64	3.77	0.43336	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.565407	0.22117	N	0.064396	T	0.46190	0.1380	L	0.31578	0.945	0.27762	N	0.943774	B;B	0.02656	0.0;0.0	B;B	0.10450	0.005;0.003	T	0.37174	-0.9717	10	0.42905	T	0.14	.	6.682	0.23125	0.0:0.6901:0.1463:0.1636	.	175;175	B4E2M4;Q96C45	.;ULK4_HUMAN	I	175	ENSP00000301831:M175I;ENSP00000412187:M175I	ENSP00000301831:M175I	M	-	3	0	ULK4	41948356	0.902000	0.30710	0.295000	0.24960	0.924000	0.55760	0.860000	0.27871	0.785000	0.33685	0.557000	0.71058	ATG		0.423	ULK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343490.1	XM_929989		22	185	0	0	0	0	22	185				
SLC26A6	65010	broad.mit.edu	37	3	48669702	48669702	+	Silent	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:48669702G>A	ENST00000395550.2	-	5	608	c.561C>T	c.(559-561)ctC>ctT	p.L187L	SLC26A6_ENST00000482282.1_5'UTR|SLC26A6_ENST00000358747.6_Silent_p.L166L|SLC26A6_ENST00000337000.8_Intron|SLC26A6_ENST00000420764.2_Silent_p.L187L|SLC26A6_ENST00000383733.3_Silent_p.L187L|SLC26A6_ENST00000455886.2_Intron			Q9BXS9	S26A6_HUMAN	solute carrier family 26 (anion exchanger), member 6	187					angiotensin-activated signaling pathway (GO:0038166)|anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular response to cAMP (GO:0071320)|cellular response to fructose stimulus (GO:0071332)|cellular response to interferon-gamma (GO:0071346)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|epithelial fluid transport (GO:0042045)|formate transport (GO:0015724)|intestinal absorption (GO:0050892)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|mannitol transport (GO:0015797)|oxalate transport (GO:0019532)|oxalic acid secretion (GO:0046724)|positive regulation of dipeptide transmembrane transport (GO:2001150)|protein kinase C signaling (GO:0070528)|regulation of intracellular pH (GO:0051453)|sperm capacitation (GO:0048240)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transepithelial chloride transport (GO:0030321)|transepithelial transport (GO:0070633)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|chloride channel complex (GO:0034707)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane-bounded vesicle (GO:0031988)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)|vesicle membrane (GO:0012506)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|chloride transmembrane transporter activity (GO:0015108)|efflux transmembrane transporter activity (GO:0015562)|formate efflux transmembrane transporter activity (GO:0015660)|formate transmembrane transporter activity (GO:0015499)|formate uptake transmembrane transporter activity (GO:0015659)|oxalate transmembrane transporter activity (GO:0019531)|PDZ domain binding (GO:0030165)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)		SLC26A6/PRKAR2A(2)	NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(11)|ovary(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00609)		CCAGGACACTGAGTGTGGAGG	0.602																																					NSCLC(13;369 479 28271 30152 44026)	uc003cuf.1		NA																	0				ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11						c.(10774-10776)CTC>CTT		cadherin EGF LAG seven-pass G-type receptor 3							70.0	80.0	76.0					3																	48669702		2145	4235	6380	SO:0001819	synonymous_variant	1951				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding	g.chr3:48669702G>A	AF279265	CCDS43087.1, CCDS46824.1, CCDS46825.1, CCDS46826.1, CCDS63627.1, CCDS63628.1	3p21.31	2013-08-05	2013-07-18		ENSG00000225697	ENSG00000225697		"""Solute carriers"""	14472	protein-coding gene	gene with protein product	"""pendrin-like protein 1"", ""pendrin L1"", ""sulfate anion transporter"", ""anion transporter 1"""	610068	"""solute carrier family 26, member 6"""			11087667, 11247665	Standard	NM_022911		Approved	DKFZp586E1422		Q9BXS9	OTTHUMG00000186381	ENST00000395550.2:c.561C>T	3.37:g.48669702G>A			Somatic				SLC26A6_uc003cug.2_Silent_p.L166L|SLC26A6_uc003cuh.2_Silent_p.L187L|SLC26A6_uc010hke.2_Silent_p.L38L|SLC26A6_uc003cuk.2_Intron|SLC26A6_uc003cui.2_Silent_p.L187L|SLC26A6_uc003cuj.2_Silent_p.L187L|SLC26A6_uc011bbp.1_Intron	p.L3592L	NM_001407	NP_001398	WXS	Illumina HiSeq	Unspecified	Q9NYQ7	CELR3_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)	41	10776	-			Error:Variant_position_missing_in_Q9NYQ7_after_alignment					B4DMZ1|Q548A7|Q96Q90|Q9NQU1	Silent	SNP	ENST00000395550.2	37	c.10776C>T	CCDS43087.1																																																																																				0.602	SLC26A6-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345040.1	NM_022911		15	55	0	0	0	0	15	55				
QARS	5859	broad.mit.edu	37	3	49136368	49136368	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:49136368G>C	ENST00000306125.6	-	19	2150	c.1813C>G	c.(1813-1815)Cag>Gag	p.Q605E	QARS_ENST00000414533.1_Missense_Mutation_p.Q594E|QARS_ENST00000470225.1_5'Flank			P47897	SYQ_HUMAN	glutaminyl-tRNA synthetase	605					brain development (GO:0007420)|gene expression (GO:0010467)|glutaminyl-tRNA aminoacylation (GO:0006425)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|glutamine-tRNA ligase activity (GO:0004819)			breast(1)|endometrium(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	L-Glutamine(DB00130)	AAGGGAACCTGATGGAAGCCT	0.517																																						uc003cvx.2		NA																	0				ovary(1)	1						c.(1813-1815)CAG>GAG		glutaminyl-tRNA synthetase	L-Glutamine(DB00130)						109.0	109.0	109.0					3																	49136368		2203	4300	6503	SO:0001583	missense	5859				glutaminyl-tRNA aminoacylation	cytosol|mitochondrial matrix	ATP binding|glutamine-tRNA ligase activity|protein binding	g.chr3:49136368G>C	X76013	CCDS2788.1, CCDS63633.1	3p21.31	2011-07-01			ENSG00000172053	ENSG00000172053	6.1.1.18	"""Aminoacyl tRNA synthetases / Class I"""	9751	protein-coding gene	gene with protein product	"""glutamine tRNA ligase"""	603727				8078941, 10393422	Standard	NM_005051		Approved		uc003cvx.4	P47897	OTTHUMG00000156774	ENST00000306125.6:c.1813C>G	3.37:g.49136368G>C	ENSP00000307567:p.Gln605Glu		Somatic				QARS_uc011bcc.1_Missense_Mutation_p.Q58E|QARS_uc011bcd.1_Missense_Mutation_p.Q460E|QARS_uc003cvy.2_Missense_Mutation_p.Q460E|QARS_uc011bce.1_Missense_Mutation_p.Q594E	p.Q605E	NM_005051	NP_005042	WXS	Illumina HiSeq	Unspecified	P47897	SYQ_HUMAN		BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	19	1818	-			605					B4DWJ2	Missense_Mutation	SNP	ENST00000306125.6	37	c.1813C>G	CCDS2788.1	.	.	.	.	.	.	.	.	.	.	G	3.442	-0.113818	0.06881	.	.	ENSG00000172053	ENST00000453392;ENST00000306125;ENST00000414533	T;T	0.20598	2.06;2.06	5.76	5.76	0.90799	Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding domain (1);Ribosomal protein L25/Gln-tRNA synthetase, beta-barrel domain (1);Glutamyl/glutaminyl-tRNA synthetase, class Ib, anti-codon binding domain (1);	0.510245	0.23587	N	0.046588	T	0.12178	0.0296	N	0.13168	0.305	0.80722	D	1	B;B	0.16396	0.017;0.017	B;B	0.21360	0.034;0.034	T	0.21075	-1.0256	10	0.20046	T	0.44	-7.8219	9.9726	0.41763	0.0:0.1234:0.6883:0.1883	.	594;605	B4DWJ2;P47897	.;SYQ_HUMAN	E	125;605;594	ENSP00000307567:Q605E;ENSP00000390015:Q594E	ENSP00000307567:Q605E	Q	-	1	0	QARS	49111372	1.000000	0.71417	0.997000	0.53966	0.946000	0.59487	2.780000	0.47742	2.735000	0.93741	0.561000	0.74099	CAG		0.517	QARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345689.2	NM_005051		12	50	0	0	0	0	12	50				
MON1A	84315	broad.mit.edu	37	3	49947847	49947847	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:49947847C>T	ENST00000417270.1	-	5	1801	c.1108G>A	c.(1108-1110)Gag>Aag	p.E370K	MON1A_ENST00000483022.1_5'Flank|CTD-2330K9.3_ENST00000419183.1_Intron|MON1A_ENST00000455683.2_Missense_Mutation_p.E297K|MON1A_ENST00000296473.3_Missense_Mutation_p.E459K			Q86VX9	MON1A_HUMAN	MON1 secretory trafficking family member A	362										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)	13				BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		GTCCAGGCCTCGCCCTCGCGA	0.597																																						uc003cxz.2		NA																	0				ovary(2)	2						c.(1375-1377)GAG>AAG		MON1 homolog A isoform a							62.0	58.0	60.0					3																	49947847		2203	4300	6503	SO:0001583	missense	84315						protein binding	g.chr3:49947847C>T	AK074404	CCDS2808.2, CCDS46830.1	3p21.31	2013-08-21	2013-08-21		ENSG00000164077	ENSG00000164077			28207	protein-coding gene	gene with protein product		611464	"""MON1 homolog A (yeast)"""			12477932	Standard	NM_032355		Approved	MGC13272, SAND1	uc003cxz.3	Q86VX9	OTTHUMG00000156737	ENST00000417270.1:c.1108G>A	3.37:g.49947847C>T	ENSP00000399613:p.Glu370Lys		Somatic				MON1A_uc003cya.2_Missense_Mutation_p.E297K|MON1A_uc003cyb.2_Missense_Mutation_p.E297K	p.E459K	NM_032355	NP_115731	WXS	Illumina HiSeq	Unspecified	Q86VX9	MON1A_HUMAN		BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)	4	1501	-			362					B2RDQ1|G5E9N1|Q8NAV7|Q9BRF3	Missense_Mutation	SNP	ENST00000417270.1	37	c.1375G>A		.	.	.	.	.	.	.	.	.	.	C	35	5.586542	0.96578	.	.	ENSG00000164077	ENST00000296473;ENST00000417270;ENST00000455683	.	.	.	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	D	0.87763	0.6259	H	0.94264	3.515	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.997;1.0	D	0.90425	0.4420	8	.	.	.	-26.1423	19.9058	0.97007	0.0:1.0:0.0:0.0	.	200;297;362	Q86VX9-3;G5E9N1;Q86VX9	.;.;MON1A_HUMAN	K	459;370;297	.	.	E	-	1	0	MON1A	49922851	1.000000	0.71417	0.982000	0.44146	0.930000	0.56654	7.773000	0.85462	2.716000	0.92895	0.561000	0.74099	GAG		0.597	MON1A-005	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000345538.2	NM_032355		6	44	0	0	0	0	6	44				
HEMK1	51409	broad.mit.edu	37	3	50608743	50608743	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:50608743C>T	ENST00000232854.4	+	2	760	c.208C>T	c.(208-210)Cat>Tat	p.H70Y	C3orf18_ENST00000449241.1_5'Flank|HEMK1_ENST00000455834.1_Missense_Mutation_p.H70Y|HEMK1_ENST00000434410.1_Missense_Mutation_p.H70Y	NM_016173.3	NP_057257.1	Q9Y5R4	HEMK1_HUMAN	HemK methyltransferase family member 1	70					DNA methylation (GO:0006306)	mitochondrion (GO:0005739)	DNA binding (GO:0003677)|N-methyltransferase activity (GO:0008170)|protein methyltransferase activity (GO:0008276)			lung(3)	3				BRCA - Breast invasive adenocarcinoma(193;0.000283)|KIRC - Kidney renal clear cell carcinoma(197;0.0179)|Kidney(197;0.0212)		CATCGTGGCTCATGTCCTTGG	0.522																																						uc003dau.2		NA																	0				lung(1)	1						c.(208-210)CAT>TAT		HemK methyltransferase family member 1							69.0	71.0	70.0					3																	50608743		2203	4300	6503	SO:0001583	missense	51409				DNA methylation		DNA binding|N-methyltransferase activity|protein methyltransferase activity	g.chr3:50608743C>T	AF172244	CCDS2830.1	3p21	2008-02-05			ENSG00000114735	ENSG00000114735			24923	protein-coding gene	gene with protein product						10690633	Standard	XM_005265218		Approved	MTQ1	uc003dav.3	Q9Y5R4	OTTHUMG00000156849	ENST00000232854.4:c.208C>T	3.37:g.50608743C>T	ENSP00000232854:p.His70Tyr		Somatic				C3orf18_uc003dat.2_5'Flank|HEMK1_uc003dav.2_Missense_Mutation_p.H70Y|HEMK1_uc003daw.2_Missense_Mutation_p.H70Y	p.H70Y	NM_016173	NP_057257	WXS	Illumina HiSeq	Unspecified	Q9Y5R4	HEMK1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000283)|KIRC - Kidney renal clear cell carcinoma(197;0.0179)|Kidney(197;0.0212)	2	504	+			70						Missense_Mutation	SNP	ENST00000232854.4	37	c.208C>T	CCDS2830.1	.	.	.	.	.	.	.	.	.	.	C	15.33	2.800742	0.50315	.	.	ENSG00000114735	ENST00000434410;ENST00000232854;ENST00000455834	T;T;T	0.14022	2.54;2.54;2.54	5.72	5.72	0.89469	.	0.210963	0.39909	N	0.001232	T	0.15652	0.0377	L	0.58810	1.83	0.46376	D	0.999012	B	0.29085	0.232	B	0.31686	0.134	T	0.03112	-1.1071	10	0.28530	T	0.3	-12.7154	10.8349	0.46681	0.0:0.9144:0.0:0.0856	.	70	Q9Y5R4	HEMK1_HUMAN	Y	70	ENSP00000404843:H70Y;ENSP00000232854:H70Y;ENSP00000404334:H70Y	ENSP00000232854:H70Y	H	+	1	0	HEMK1	50583747	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.103000	0.57783	2.711000	0.92665	0.655000	0.94253	CAT		0.522	HEMK1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346231.1	NM_016173		5	39	0	0	0	0	5	39				
PCBP4	57060	broad.mit.edu	37	3	51992917	51992917	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:51992917G>A	ENST00000461554.1	-	13	1143	c.812C>T	c.(811-813)tCa>tTa	p.S271L	PCBP4_ENST00000395013.3_Missense_Mutation_p.S111L|RP11-155D18.12_ENST00000488257.1_RNA|PCBP4_ENST00000355852.2_Missense_Mutation_p.S271L|PCBP4_ENST00000428823.2_Missense_Mutation_p.S228L|PCBP4_ENST00000395014.2_Missense_Mutation_p.S292L|PCBP4_ENST00000471622.1_Missense_Mutation_p.S271L|PCBP4_ENST00000322099.7_Missense_Mutation_p.S271L|PCBP4_ENST00000484633.1_Missense_Mutation_p.S228L	NM_001174100.1	NP_001167571.1	P57723	PCBP4_HUMAN	poly(rC) binding protein 4	271	KH 3. {ECO:0000255|PROSITE- ProRule:PRU00117}.					cytoplasm (GO:0005737)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(2)|large_intestine(2)|lung(2)|prostate(1)|stomach(1)	8				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		ATGTGCCCCTGACATCTGCCG	0.612																																						uc003dcd.1		NA																	0					0						c.(811-813)TCA>TTA		poly(rC) binding protein 4 isoform c							132.0	121.0	125.0					3																	51992917		2203	4300	6503	SO:0001583	missense	57060					cytoplasm|ribonucleoprotein complex	DNA binding|RNA binding	g.chr3:51992917G>A	AF176330	CCDS2839.1, CCDS2840.1, CCDS2840.2	3p21	2013-07-16	2001-11-28		ENSG00000090097	ENSG00000090097			8652	protein-coding gene	gene with protein product	"""RNA binding protein MCG10"", ""LYST-interacting protein"", ""alphaCP-4 protein"""	608503	"""poly(rC)-binding protein 4"""			10936052	Standard	NM_033008		Approved	MCG10, LIP4	uc003dch.2	P57723	OTTHUMG00000157366	ENST00000461554.1:c.812C>T	3.37:g.51992917G>A	ENSP00000417196:p.Ser271Leu		Somatic				PCBP4_uc003dcb.1_Missense_Mutation_p.S237L|PCBP4_uc003dcc.1_Missense_Mutation_p.S292L|PCBP4_uc003dce.1_Silent_p.V272V|PCBP4_uc003dcf.1_Missense_Mutation_p.S271L|PCBP4_uc003dcg.1_Missense_Mutation_p.S237L|PCBP4_uc003dch.1_Missense_Mutation_p.S271L|PCBP4_uc003dci.1_Missense_Mutation_p.S111L|PCBP4_uc003dcj.1_Missense_Mutation_p.S271L|PCBP4_uc003dck.1_Missense_Mutation_p.S228L|PCBP4_uc003dcl.1_Missense_Mutation_p.S271L	p.S271L	NM_033010	NP_127503	WXS	Illumina HiSeq	Unspecified	P57723	PCBP4_HUMAN		BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	11	1208	-			271			KH 3.		Q96AH7	Missense_Mutation	SNP	ENST00000461554.1	37	c.812C>T	CCDS2839.1	.	.	.	.	.	.	.	.	.	.	G	35	5.492822	0.96339	.	.	ENSG00000090097	ENST00000355852;ENST00000322099;ENST00000461554;ENST00000484633;ENST00000395013;ENST00000428823;ENST00000395014;ENST00000471622;ENST00000294192	T;T;T;T;T;T;T;T	0.34859	1.34;1.34;1.34;1.34;1.34;1.34;1.34;1.34	5.12	5.12	0.69794	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.000000	0.85682	D	0.000000	T	0.73273	0.3566	H	0.96301	3.8	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.996;1.0;0.997;0.998;1.0	D;D;D;D;D;D	0.97110	0.997;0.99;1.0;0.994;0.997;1.0	T	0.83341	-0.0008	10	0.87932	D	0	-7.6922	18.1582	0.89700	0.0:0.0:1.0:0.0	.	271;228;111;271;292;237	C9J0A4;P57723-2;B3KM64;P57723;Q9GZT1;Q9HCU2	.;.;.;PCBP4_HUMAN;.;.	L	271;271;271;228;111;228;292;271;271	ENSP00000348111:S271L;ENSP00000322341:S271L;ENSP00000417196:S271L;ENSP00000417100:S228L;ENSP00000378460:S111L;ENSP00000395030:S228L;ENSP00000378461:S292L;ENSP00000418925:S271L	ENSP00000294192:S271L	S	-	2	0	PCBP4	51967957	1.000000	0.71417	0.999000	0.59377	0.973000	0.67179	9.860000	0.99555	2.360000	0.80028	0.462000	0.41574	TCA		0.612	PCBP4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348597.1	NM_020418		21	95	0	0	0	0	21	95				
DUSP7	1849	broad.mit.edu	37	3	52087966	52087966	+	Missense_Mutation	SNP	G	G	C	rs568629136		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:52087966G>C	ENST00000495880.1	-	2	1125	c.942C>G	c.(940-942)atC>atG	p.I314M	DUSP7_ENST00000296483.6_Missense_Mutation_p.I263M			Q16829	DUS7_HUMAN	dual specificity phosphatase 7	314	Tyrosine-protein phosphatase.				inactivation of MAPK activity (GO:0000188)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of MAP kinase activity (GO:0043407)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)	17				BRCA - Breast invasive adenocarcinoma(193;5.14e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		CAATGAAGCTGATGGCCTCAG	0.612																																						uc003dct.2		NA																	0				ovary(1)	1						c.(940-942)ATC>ATG		dual specificity phosphatase 7							110.0	111.0	110.0					3																	52087966		2203	4300	6503	SO:0001583	missense	1849				inactivation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	MAP kinase tyrosine/serine/threonine phosphatase activity|protein binding|protein tyrosine phosphatase activity	g.chr3:52087966G>C	X93921	CCDS33766.1, CCDS33766.2	3p21	2011-06-09			ENSG00000164086	ENSG00000164086		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3073	protein-coding gene	gene with protein product		602749				8626780, 9205128	Standard	NM_001947		Approved	MKP-X, PYST2	uc003dct.3	Q16829	OTTHUMG00000157819	ENST00000495880.1:c.942C>G	3.37:g.52087966G>C	ENSP00000417183:p.Ile314Met		Somatic				DUSP7_uc010hma.2_Missense_Mutation_p.I314M	p.I314M	NM_001947	NP_001938	WXS	Illumina HiSeq	Unspecified	Q16829	DUS7_HUMAN		BRCA - Breast invasive adenocarcinoma(193;5.14e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	2	1021	-			314			Tyrosine-protein phosphatase.		Q2M3J7|Q8NFJ0	Missense_Mutation	SNP	ENST00000495880.1	37	c.942C>G	CCDS33766.2	.	.	.	.	.	.	.	.	.	.	G	18.35	3.605200	0.66445	.	.	ENSG00000164086	ENST00000495880;ENST00000296483;ENST00000469623	T;T;T	0.62105	0.05;0.05;0.05	5.26	4.37	0.52481	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.000000	0.85682	D	0.000000	T	0.75384	0.3842	M	0.81497	2.545	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.77205	-0.2673	10	0.87932	D	0	.	5.5946	0.17319	0.2771:0.0:0.7229:0.0	.	263;314	Q16829-2;Q16829	.;DUS7_HUMAN	M	314;263;247	ENSP00000417183:I314M;ENSP00000296483:I263M;ENSP00000418566:I247M	ENSP00000296483:I263M	I	-	3	3	DUSP7	52063006	0.999000	0.42202	1.000000	0.80357	0.993000	0.82548	0.757000	0.26433	2.608000	0.88229	0.549000	0.68633	ATC		0.612	DUSP7-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000349697.1	NM_001947		11	62	0	0	0	0	11	62				
CACNA1D	776	broad.mit.edu	37	3	53531326	53531326	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:53531326C>G	ENST00000350061.5	+	2	726	c.215C>G	c.(214-216)tCt>tGt	p.S72C	CACNA1D_ENST00000288139.4_Missense_Mutation_p.S72C|CACNA1D_ENST00000422281.2_Missense_Mutation_p.S72C	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	72					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	ATGAGCACCTCTGCACCCCCA	0.547																																						uc003dgv.3		NA																	0				ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11						c.(214-216)TCT>TGT		calcium channel, voltage-dependent, L type,	Verapamil(DB00661)						121.0	135.0	130.0					3																	53531326		2203	4300	6503	SO:0001583	missense	776				axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr3:53531326C>G	AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.215C>G	3.37:g.53531326C>G	ENSP00000288133:p.Ser72Cys		Somatic				CACNA1D_uc003dgu.3_Missense_Mutation_p.S72C|CACNA1D_uc003dgy.3_Missense_Mutation_p.S72C	p.S72C	NM_001128840	NP_001122312	WXS	Illumina HiSeq	Unspecified	Q01668	CAC1D_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	2	378	+			72			Cytoplasmic (Potential).		B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Missense_Mutation	SNP	ENST00000350061.5	37	c.215C>G	CCDS46848.1	.	.	.	.	.	.	.	.	.	.	C	19.95	3.921519	0.73213	.	.	ENSG00000157388	ENST00000350061;ENST00000288139;ENST00000422281	D;D;D	0.96200	-3.92;-3.94;-3.93	5.61	5.61	0.85477	.	0.112361	0.40728	N	0.001039	D	0.93419	0.7901	N	0.08118	0	0.80722	D	1	P;P;P	0.49358	0.874;0.832;0.923	P;B;P	0.53401	0.535;0.401;0.725	D	0.95016	0.8156	10	0.87932	D	0	.	19.6372	0.95737	0.0:1.0:0.0:0.0	.	72;72;72	B0FYA3;Q01668;Q01668-2	.;CAC1D_HUMAN;.	C	72	ENSP00000288133:S72C;ENSP00000288139:S72C;ENSP00000409174:S72C	ENSP00000288139:S72C	S	+	2	0	CACNA1D	53506366	0.998000	0.40836	0.977000	0.42913	0.976000	0.68499	2.793000	0.47845	2.642000	0.89623	0.561000	0.74099	TCT		0.547	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	NM_000720		4	74	0	0	0	0	4	74				
ERC2	26059	broad.mit.edu	37	3	56173588	56173588	+	Silent	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:56173588G>C	ENST00000288221.6	-	6	1677	c.1422C>G	c.(1420-1422)ctC>ctG	p.L474L		NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2	474						cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)				breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		GTGACTCTTTGAGCACTTCAA	0.428																																						uc003dhr.1		NA																	0				ovary(2)	2						c.(1420-1422)CTC>CTG		cytomatrix protein p110							149.0	131.0	137.0					3																	56173588		1914	4151	6065	SO:0001819	synonymous_variant	26059					cell junction|cytoplasm|cytoskeleton|growth cone|presynaptic membrane|synaptosome	protein binding	g.chr3:56173588G>C	AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.1422C>G	3.37:g.56173588G>C			Somatic					p.L474L	NM_015576	NP_056391	WXS	Illumina HiSeq	Unspecified	O15083	ERC2_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)	6	1678	-			474			Potential.		Q2T9F6|Q86TK4	Silent	SNP	ENST00000288221.6	37	c.1422C>G	CCDS46851.1	.	.	.	.	.	.	.	.	.	.	G	7.839	0.721574	0.15372	.	.	ENSG00000187672	ENST00000492584	.	.	.	5.99	0.816	0.18768	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-5.3024	8.0757	0.30716	0.7652:0.0:0.1308:0.104	.	.	.	.	X	113	.	.	S	-	2	0	ERC2	56148628	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	1.021000	0.30040	0.521000	0.28445	-1.084000	0.02203	TCA		0.428	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350884.2	NM_015576		11	48	0	0	0	0	11	48				
EPHA3	2042	broad.mit.edu	37	3	89259517	89259517	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:89259517C>T	ENST00000336596.2	+	3	886	c.661C>T	c.(661-663)Cag>Tag	p.Q221*	EPHA3_ENST00000452448.2_Nonsense_Mutation_p.Q221*|EPHA3_ENST00000494014.1_Nonsense_Mutation_p.Q221*	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	221	Cys-rich.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		CATGGACTCCCAGTCCCTGGT	0.478										TSP Lung(6;0.00050)																												uc003dqy.2		NA																	0				lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33						c.(661-663)CAG>TAG		ephrin receptor EphA3 isoform a precursor							138.0	133.0	134.0					3																	89259517		2203	4300	6503	SO:0001587	stop_gained	2042					extracellular region|integral to plasma membrane	ATP binding	g.chr3:89259517C>T	M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.661C>T	3.37:g.89259517C>T	ENSP00000337451:p.Gln221*	TSP Lung(6;0.00050)	Somatic				EPHA3_uc003dqx.1_Nonsense_Mutation_p.Q221*|EPHA3_uc010hon.1_RNA	p.Q221*	NM_005233	NP_005224	WXS	Illumina HiSeq	Unspecified	P29320	EPHA3_HUMAN		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)	3	886	+	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)	221			Extracellular (Potential).|Cys-rich.		Q9H2V3|Q9H2V4	Nonsense_Mutation	SNP	ENST00000336596.2	37	c.661C>T	CCDS2922.1	.	.	.	.	.	.	.	.	.	.	C	37	5.994828	0.97184	.	.	ENSG00000044524	ENST00000336596;ENST00000452448;ENST00000494014	.	.	.	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3465	0.98790	0.0:1.0:0.0:0.0	.	.	.	.	X	221	.	.	Q	+	1	0	EPHA3	89342207	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.943000	0.63554	2.798000	0.96311	0.655000	0.94253	CAG		0.478	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233		18	137	0	0	0	0	18	137				
DIRC2	84925	broad.mit.edu	37	3	122545833	122545833	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:122545833C>T	ENST00000261038.5	+	3	1022	c.624C>T	c.(622-624)ccC>ccT	p.P208P		NM_032839.2	NP_116228.1	Q96SL1	DIRC2_HUMAN	disrupted in renal carcinoma 2	208					transport (GO:0006810)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)				endometrium(2)|large_intestine(1)|lung(14)|prostate(1)	18				GBM - Glioblastoma multiforme(114;0.0614)		TTCCAGCTCCCAATGGGACAT	0.458																																						uc003efw.3		NA																	0					0						c.(622-624)CCC>CCT		disrupted in renal carcinoma 2							150.0	133.0	139.0					3																	122545833		2203	4300	6503	SO:0001819	synonymous_variant	84925				transport	integral to membrane		g.chr3:122545833C>T	AK027690	CCDS3018.1	3q21.1	2013-05-22			ENSG00000138463	ENSG00000138463		"""Solute carriers"""	16628	protein-coding gene	gene with protein product	"""renal cell carcinoma 4"", ""disrupted in renal cancer protein 2"""	602773				11912179	Standard	NM_032839		Approved	FLJ14784, RCC4	uc003efw.4	Q96SL1	OTTHUMG00000159553	ENST00000261038.5:c.624C>T	3.37:g.122545833C>T			Somatic				DIRC2_uc010hrl.2_RNA|DIRC2_uc010hrm.2_Silent_p.P46P	p.P208P	NM_032839	NP_116228	WXS	Illumina HiSeq	Unspecified	Q96SL1	DIRC2_HUMAN		GBM - Glioblastoma multiforme(114;0.0614)	3	763	+			208					A8K561|Q8NBX9	Silent	SNP	ENST00000261038.5	37	c.624C>T	CCDS3018.1																																																																																				0.458	DIRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356180.2	NM_032839		22	125	0	0	0	0	22	125				
MYLK	4638	broad.mit.edu	37	3	123419491	123419491	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:123419491C>T	ENST00000475616.1	-	15	2823	c.2824G>A	c.(2824-2826)Gag>Aag	p.E942K	MYLK_ENST00000359169.1_Missense_Mutation_p.E942K|MYLK_ENST00000360304.3_Missense_Mutation_p.E942K|MYLK_ENST00000360772.3_Missense_Mutation_p.E942K|MYLK_ENST00000510775.1_5'Flank|MYLK_ENST00000346322.5_Missense_Mutation_p.E873K			Q15746	MYLK_HUMAN	myosin light chain kinase	942	5 X 28 AA approximate tandem repeats.|Actin-binding (calcium/calmodulin- sensitive). {ECO:0000250}.				actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		ACCTTCCTCTCTTCCTCAGAC	0.587																																						uc003ego.2		NA																	0				ovary(6)|skin(2)|stomach(1)	9						c.(2824-2826)GAG>AAG		myosin light chain kinase isoform 1							72.0	64.0	66.0					3																	123419491		2203	4300	6503	SO:0001583	missense	4638				aorta smooth muscle tissue morphogenesis|muscle contraction	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity	g.chr3:123419491C>T	X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.2824G>A	3.37:g.123419491C>T	ENSP00000418335:p.Glu942Lys		Somatic				MYLK_uc011bjw.1_Missense_Mutation_p.E942K|MYLK_uc003egp.2_Missense_Mutation_p.E873K|MYLK_uc003egq.2_Missense_Mutation_p.E942K|MYLK_uc003egr.2_Missense_Mutation_p.E873K|MYLK_uc003egs.2_Missense_Mutation_p.E766K|MYLK_uc003egt.2_Missense_Mutation_p.E133K	p.E942K	NM_053025	NP_444253	WXS	Illumina HiSeq	Unspecified	Q15746	MYLK_HUMAN		GBM - Glioblastoma multiforme(114;0.0736)	18	3106	-		Lung NSC(201;0.0496)	942			Actin-binding (calcium/calmodulin- sensitive) (By similarity).|5 X 28 AA approximate tandem repeats.|1-3.		B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Missense_Mutation	SNP	ENST00000475616.1	37	c.2824G>A	CCDS46896.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.968458	0.74131	.	.	ENSG00000065534	ENST00000360772;ENST00000360304;ENST00000359169;ENST00000346322;ENST00000475616	T;T;T;T;T	0.68765	-0.35;-0.29;-0.35;-0.29;-0.29	4.94	4.94	0.65067	.	.	.	.	.	T	0.72771	0.3502	L	0.39898	1.24	0.80722	D	1	D;D;D;D;D;D	0.71674	0.991;0.993;0.995;0.998;0.984;0.985	D;P;D;D;P;P	0.65987	0.919;0.834;0.919;0.94;0.857;0.873	T	0.66850	-0.5819	9	0.13470	T	0.59	.	18.224	0.89911	0.0:1.0:0.0:0.0	.	942;20;873;942;873;942	Q15746-6;Q15746-7;Q15746-4;Q15746-3;Q15746-2;Q15746	.;.;.;.;.;MYLK_HUMAN	K	942;942;942;873;942	ENSP00000354004:E942K;ENSP00000353452:E942K;ENSP00000352088:E942K;ENSP00000320622:E873K;ENSP00000418335:E942K	ENSP00000320622:E873K	E	-	1	0	MYLK	124902181	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.703000	0.68340	2.309000	0.77851	0.549000	0.68633	GAG		0.587	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356464.1	NM_053025		11	70	0	0	0	0	11	70				
TMCC1	23023	broad.mit.edu	37	3	129389903	129389903	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:129389903C>T	ENST00000393238.3	-	4	1121	c.781G>A	c.(781-783)Gaa>Aaa	p.E261K	TMCC1_ENST00000426664.2_Missense_Mutation_p.E147K|TMCC1_ENST00000432054.2_5'UTR|TMCC1_ENST00000329333.5_Missense_Mutation_p.E82K	NM_001017395.3	NP_001017395.2	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	261						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)			PLXND1/TMCC1(4)	breast(1)|endometrium(3)|large_intestine(8)|lung(12)|skin(1)	25						TTCAAGTATTCAGCAACGTTG	0.498																																						uc003emz.3		NA																	0				skin(1)	1						c.(781-783)GAA>AAA		transmembrane and coiled-coil domain family 1							225.0	220.0	221.0					3																	129389903		2203	4300	6503	SO:0001583	missense	23023					integral to membrane		g.chr3:129389903C>T	AB018322	CCDS33855.1	3q21.3	2010-04-19	2005-07-13		ENSG00000172765	ENSG00000172765		"""Transmembrane and coiled-coil domain containing"""	29116	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 1"""			9872452	Standard	NR_033361		Approved	KIAA0779	uc021xdy.1	O94876	OTTHUMG00000159579	ENST00000393238.3:c.781G>A	3.37:g.129389903C>T	ENSP00000376930:p.Glu261Lys		Somatic				TMCC1_uc003emy.3_5'UTR|TMCC1_uc011blc.1_Missense_Mutation_p.E82K|TMCC1_uc010htg.2_Missense_Mutation_p.E147K	p.E261K	NM_001017395	NP_001017395	WXS	Illumina HiSeq	Unspecified	O94876	TMCC1_HUMAN			5	1282	-			261			Potential.		A8K5Y3|B4DE04|Q68E06|Q8IXM8	Missense_Mutation	SNP	ENST00000393238.3	37	c.781G>A	CCDS33855.1	.	.	.	.	.	.	.	.	.	.	C	35	5.486265	0.96323	.	.	ENSG00000172765	ENST00000393238;ENST00000426664;ENST00000329333	T;T;T	0.47869	0.83;0.83;0.83	5.56	5.56	0.83823	.	0.095586	0.64402	D	0.000001	T	0.71719	0.3373	M	0.86953	2.85	0.80722	D	1	D;P	0.55800	0.973;0.856	P;P	0.62491	0.903;0.652	T	0.70472	-0.4862	10	0.32370	T	0.25	-6.2165	19.8814	0.96900	0.0:1.0:0.0:0.0	.	82;261	B4DE04;O94876	.;TMCC1_HUMAN	K	261;147;82	ENSP00000376930:E261K;ENSP00000389892:E147K;ENSP00000327349:E82K	ENSP00000327349:E82K	E	-	1	0	TMCC1	130872593	1.000000	0.71417	0.982000	0.44146	0.996000	0.88848	7.745000	0.85046	2.778000	0.95560	0.591000	0.81541	GAA		0.498	TMCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356418.2	NM_015008		45	214	0	0	0	0	45	214				
RAB6B	51560	broad.mit.edu	37	3	133553479	133553479	+	Nonsense_Mutation	SNP	G	G	A	rs147187493		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:133553479G>A	ENST00000285208.4	-	7	851	c.502C>T	c.(502-504)Cga>Tga	p.R168*	RAB6B_ENST00000486858.1_Nonsense_Mutation_p.R155*|RAB6B_ENST00000543906.1_Nonsense_Mutation_p.R168*|RAB6B_ENST00000469959.1_Intron	NM_016577.3	NP_057661.3	Q9NRW1	RAB6B_HUMAN	RAB6B, member RAS oncogene family	168					GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)	11						GCCACACGTCGAAAAAGCTGG	0.522																																						uc003epy.2		NA																	0				pancreas(1)	1						c.(502-504)CGA>TGA		RAB6B, member RAS oncogene family		G	stop/ARG	1,4405	2.1+/-5.4	0,1,2202	102.0	107.0	105.0		502	4.2	1.0	3	dbSNP_134	105	0,8600		0,0,4300	no	stop-gained	RAB6B	NM_016577.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		168/209	133553479	1,13005	2203	4300	6503	SO:0001587	stop_gained	51560				protein transport|retrograde vesicle-mediated transport, Golgi to ER|small GTPase mediated signal transduction	cytoplasmic membrane-bounded vesicle|Golgi membrane	GTP binding|GTPase activity|protein binding	g.chr3:133553479G>A	AF166492	CCDS3082.1	3q22.1	2008-05-15			ENSG00000154917	ENSG00000154917		"""RAB, member RAS oncogene"""	14902	protein-coding gene	gene with protein product		615852					Standard	NM_016577		Approved		uc003epy.3	Q9NRW1	OTTHUMG00000159749	ENST00000285208.4:c.502C>T	3.37:g.133553479G>A	ENSP00000285208:p.Arg168*		Somatic				RAB6B_uc011blu.1_Nonsense_Mutation_p.R155*	p.R168*	NM_016577	NP_057661	WXS	Illumina HiSeq	Unspecified	Q9NRW1	RAB6B_HUMAN			7	883	-			168					B2R5Z9|B7Z337|D3DND3|Q92929	Nonsense_Mutation	SNP	ENST00000285208.4	37	c.502C>T	CCDS3082.1	.	.	.	.	.	.	.	.	.	.	G	37	6.082632	0.97267	2.27E-4	0.0	ENSG00000154917	ENST00000285208;ENST00000543906;ENST00000486858	.	.	.	5.15	4.25	0.50352	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.7267	13.8357	0.63408	0.0:0.0:0.8456:0.1544	.	.	.	.	X	168;168;155	.	ENSP00000285208:R168X	R	-	1	2	RAB6B	135036169	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.626000	0.67777	1.358000	0.45922	0.561000	0.74099	CGA		0.522	RAB6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357152.1			16	70	0	0	0	0	16	70				
A4GNT	51146	broad.mit.edu	37	3	137843367	137843367	+	Silent	SNP	G	G	A	rs369495396		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:137843367G>A	ENST00000236709.3	-	3	963	c.762C>T	c.(760-762)ttC>ttT	p.F254F		NM_016161.2	NP_057245.1	Q9UNA3	A4GCT_HUMAN	alpha-1,4-N-acetylglucosaminyltransferase	254					carbohydrate metabolic process (GO:0005975)|glycoprotein biosynthetic process (GO:0009101)|negative regulation of epithelial cell proliferation (GO:0050680)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylglucosaminyltransferase activity (GO:0008375)	p.F254F(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)	16						GGGGGTGTAAGAAGGATATGT	0.493																																						uc003ers.2		NA																	1	Substitution - coding silent(1)		breast(1)	central_nervous_system(1)	1						c.(760-762)TTC>TTT		alpha-1,4-N-acetylglucosaminyltransferase		G		1,4405	2.1+/-5.4	0,1,2202	81.0	82.0	81.0		762	4.3	1.0	3		81	0,8600		0,0,4300	no	coding-synonymous	A4GNT	NM_016161.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		254/341	137843367	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	51146				protein O-linked glycosylation	Golgi membrane|Golgi stack|integral to membrane|membrane fraction	acetylglucosaminyltransferase activity|galactosyltransferase activity	g.chr3:137843367G>A	AF141315	CCDS3097.1	3p14.3	2010-12-14			ENSG00000118017	ENSG00000118017			17968	protein-coding gene	gene with protein product						10430883	Standard	NM_016161		Approved	alpha4GnT	uc003ers.2	Q9UNA3	OTTHUMG00000159820	ENST00000236709.3:c.762C>T	3.37:g.137843367G>A			Somatic					p.F254F	NM_016161	NP_057245	WXS	Illumina HiSeq	Unspecified	Q9UNA3	A4GCT_HUMAN			3	964	-			254			Lumenal (Potential).		Q0VDK1|Q0VDK2	Silent	SNP	ENST00000236709.3	37	c.762C>T	CCDS3097.1																																																																																				0.493	A4GNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357557.1	NM_016161		21	73	0	0	0	0	21	73				
CLSTN2	64084	broad.mit.edu	37	3	140277609	140277609	+	Missense_Mutation	SNP	G	G	C	rs192974178	byFrequency	TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:140277609G>C	ENST00000458420.3	+	12	2141	c.1951G>C	c.(1951-1953)Gaa>Caa	p.E651Q		NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	651					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						TGCCCAGTTTGAAAGTGCCAG	0.582										HNSCC(16;0.037)			G|||	2	0.000399361	0.0	0.0029	5008	,	,		18584	0.0		0.0	False		,,,				2504	0.0				GBM(45;858 913 3709 36904 37282)	uc003etn.2		NA																	0				skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						c.(1951-1953)GAA>CAA		calsyntenin 2 precursor							64.0	63.0	63.0					3																	140277609		2203	4300	6503	SO:0001583	missense	64084				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding	g.chr3:140277609G>C	AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.1951G>C	3.37:g.140277609G>C	ENSP00000402460:p.Glu651Gln	HNSCC(16;0.037)	Somatic					p.E651Q	NM_022131	NP_071414	WXS	Illumina HiSeq	Unspecified	Q9H4D0	CSTN2_HUMAN			12	2141	+			651			Extracellular (Potential).		B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	ENST00000458420.3	37	c.1951G>C	CCDS3112.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	13.26	2.185432	0.38609	.	.	ENSG00000158258	ENST00000458420	T	0.32515	1.45	5.41	1.38	0.22167	.	0.392015	0.31323	N	0.007857	T	0.27594	0.0678	M	0.62723	1.935	0.09310	N	1	P	0.44734	0.842	B	0.39531	0.302	T	0.12192	-1.0557	9	.	.	.	-15.1618	9.5324	0.39202	0.0775:0.4088:0.5137:0.0	.	651	Q9H4D0	CSTN2_HUMAN	Q	651	ENSP00000402460:E651Q	.	E	+	1	0	CLSTN2	141760299	1.000000	0.71417	0.430000	0.26722	0.942000	0.58702	2.606000	0.46291	-0.029000	0.13827	0.650000	0.86243	GAA		0.582	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359393.3	NM_022131		8	50	0	0	0	0	8	50				
ATP1B3	483	broad.mit.edu	37	3	141626075	141626075	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:141626075C>T	ENST00000286371.3	+	3	493	c.305C>T	c.(304-306)tCg>tTg	p.S102L	ATP1B3_ENST00000462082.1_Intron|ATP1B3_ENST00000539728.1_Missense_Mutation_p.S88L	NM_001679.2	NP_001670.1	P54709	AT1B3_HUMAN	ATPase, Na+/K+ transporting, beta 3 polypeptide	102					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|leukocyte migration (GO:0050900)|membrane repolarization (GO:0086009)|positive regulation of ATP catabolic process (GO:1903291)|positive regulation of ATPase activity (GO:0032781)|positive regulation of potassium ion import (GO:1903288)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of sodium ion export from cell (GO:1903278)|potassium ion import (GO:0010107)|protein localization to plasma membrane (GO:0072659)|protein stabilization (GO:0050821)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)|transport (GO:0006810)	caveola (GO:0005901)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|sodium:potassium-exchanging ATPase activity (GO:0005391)	p.S102L(1)		cervix(1)|endometrium(1)|lung(2)	4						GATCCAACTTCGTATGCAGGG	0.343																																						uc003eug.1		NA																	1	Substitution - Missense(1)		cervix(1)		0						c.(304-306)TCG>TTG		Na+/K+ -ATPase beta 3 subunit							90.0	90.0	90.0					3																	141626075		2203	4300	6503	SO:0001583	missense	483				ATP biosynthetic process|blood coagulation|leukocyte migration	melanosome|sodium:potassium-exchanging ATPase complex	protein binding|sodium:potassium-exchanging ATPase activity	g.chr3:141626075C>T	BC011835	CCDS3121.1	3q23	2012-10-22			ENSG00000069849	ENSG00000069849		"""CD molecules"", ""ATPases / P-type"""	806	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit beta-3"", ""sodium pump subunit beta-3"", ""sodium-potassium ATPase subunit beta 3 (non-catalytic)"""	601867				8798450, 9457675	Standard	NM_001679		Approved	FLJ29027, CD298	uc003eug.1	P54709	OTTHUMG00000159081	ENST00000286371.3:c.305C>T	3.37:g.141626075C>T	ENSP00000286371:p.Ser102Leu		Somatic				ATP1B3_uc011bne.1_RNA|ATP1B3_uc003euh.1_Missense_Mutation_p.S88L	p.S102L	NM_001679	NP_001670	WXS	Illumina HiSeq	Unspecified	P54709	AT1B3_HUMAN			3	479	+			102			Extracellular (Potential).		B7Z1N7	Missense_Mutation	SNP	ENST00000286371.3	37	c.305C>T	CCDS3121.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.338630	0.81911	.	.	ENSG00000069849	ENST00000475483;ENST00000286371;ENST00000539728;ENST00000495216	T;T;T;T	0.34859	1.34;1.34;1.34;1.34	5.52	5.52	0.82312	.	0.429185	0.27821	N	0.017704	T	0.57873	0.2083	M	0.92507	3.315	0.43622	D	0.996006	D;D	0.58970	0.984;0.969	P;P	0.47075	0.536;0.536	T	0.71017	-0.4714	10	0.72032	D	0.01	-6.0312	17.9788	0.89134	0.0:1.0:0.0:0.0	.	88;102	D3DNF9;P54709	.;AT1B3_HUMAN	L	45;102;88;88	ENSP00000417522:S45L;ENSP00000286371:S102L;ENSP00000440307:S88L;ENSP00000419962:S88L	ENSP00000286371:S102L	S	+	2	0	ATP1B3	143108765	0.118000	0.22208	0.152000	0.22495	0.033000	0.12548	3.157000	0.50716	2.767000	0.95098	0.655000	0.94253	TCG		0.343	ATP1B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353218.1	NM_001679		8	52	0	0	0	0	8	52				
PLOD2	5352	broad.mit.edu	37	3	145789109	145789109	+	Silent	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:145789109G>A	ENST00000360060.3	-	17	2064	c.1887C>T	c.(1885-1887)ttC>ttT	p.F629F	RP11-274H2.3_ENST00000490375.1_RNA|PLOD2_ENST00000494950.1_Silent_p.F595F|PLOD2_ENST00000461497.1_Silent_p.F310F|PLOD2_ENST00000282903.5_Silent_p.F650F|RP11-274H2.2_ENST00000480247.1_RNA	NM_000935.2	NP_000926.2	O00469	PLOD2_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2	629					cellular protein modification process (GO:0006464)|extracellular matrix organization (GO:0030198)|response to hypoxia (GO:0001666)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29					Vitamin C(DB00126)	CTGGTGCAATGAACTCCCGGA	0.418																																						uc003evs.1		NA																	0				ovary(1)|skin(1)	2						c.(1885-1887)TTC>TTT		procollagen-lysine, 2-oxoglutarate 5-dioxygenase	Vitamin C(DB00126)						128.0	111.0	117.0					3																	145789109		2203	4300	6503	SO:0001819	synonymous_variant	5352				protein modification process|response to hypoxia	rough endoplasmic reticulum membrane	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-lysine 5-dioxygenase activity|protein binding	g.chr3:145789109G>A	U84573	CCDS3131.1, CCDS3132.1	3q24	2011-08-24	2005-01-04		ENSG00000152952	ENSG00000152952			9082	protein-coding gene	gene with protein product	"""lysyl hydroxlase 2"""	601865	"""procollagen-lysine, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase) 2"""			9054364	Standard	XM_005247535		Approved	LH2	uc003evr.1	O00469	OTTHUMG00000159417	ENST00000360060.3:c.1887C>T	3.37:g.145789109G>A			Somatic				PLOD2_uc003evq.1_Silent_p.F310F|PLOD2_uc011bnm.1_Silent_p.F595F|PLOD2_uc003evr.1_Silent_p.F650F	p.F629F	NM_000935	NP_000926	WXS	Illumina HiSeq	Unspecified	O00469	PLOD2_HUMAN			17	2393	-			629					B3KWS3|Q59ED2|Q8N170	Silent	SNP	ENST00000360060.3	37	c.1887C>T	CCDS3131.1																																																																																				0.418	PLOD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355185.1	NM_000935		9	77	0	0	0	0	9	77				
AADAC	13	broad.mit.edu	37	3	151545802	151545802	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:151545802G>A	ENST00000232892.7	+	5	1168	c.1042G>A	c.(1042-1044)Gat>Aat	p.D348N	RP11-454C18.2_ENST00000483843.2_RNA|RP11-454C18.2_ENST00000475855.1_RNA	NM_001086.2	NP_001077.2	P22760	AAAD_HUMAN	arylacetamide deacetylase	348					positive regulation of triglyceride catabolic process (GO:0010898)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)|deacetylase activity (GO:0019213)|lipase activity (GO:0016298)|serine hydrolase activity (GO:0017171)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(5)|skin(2)	19		Myeloproliferative disorder(1037;0.0255)|all_neural(597;0.112)	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			CTTAAGAGATGATGGACTCAT	0.468																																					Ovarian(30;839 841 2699 32801 46334)	uc003eze.2		NA																	0				skin(2)	2						c.(1042-1044)GAT>AAT		arylacetamide deacetylase							102.0	94.0	96.0					3																	151545802		2203	4300	6503	SO:0001583	missense	13				positive regulation of triglyceride catabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	carboxylesterase activity|deacetylase activity|serine hydrolase activity|triglyceride lipase activity	g.chr3:151545802G>A	L32179	CCDS33877.1	3q25.1	2014-03-18	2012-07-13		ENSG00000114771	ENSG00000114771	3.1.1.3		17	protein-coding gene	gene with protein product		600338	"""arylacetamide deacetylase (esterase)"""			8063807	Standard	XM_005247103		Approved	DAC, CES5A1	uc003eze.3	P22760	OTTHUMG00000159876	ENST00000232892.7:c.1042G>A	3.37:g.151545802G>A	ENSP00000232892:p.Asp348Asn		Somatic					p.D348N	NM_001086	NP_001077	WXS	Illumina HiSeq	Unspecified	P22760	AAAD_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)		5	1132	+		Myeloproliferative disorder(1037;0.0255)|all_neural(597;0.112)	348			Lumenal (Potential).		A8K3L3|D3DNJ6|Q8N1A9	Missense_Mutation	SNP	ENST00000232892.7	37	c.1042G>A	CCDS33877.1	.	.	.	.	.	.	.	.	.	.	G	31	5.090633	0.94149	.	.	ENSG00000114771	ENST00000232892	T	0.58797	0.31	4.91	4.91	0.64330	Alpha/beta hydrolase fold-3 (1);	0.000000	0.85682	D	0.000000	D	0.83571	0.5283	H	0.95328	3.655	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89209	0.3563	10	0.87932	D	0	-34.8336	18.0885	0.89466	0.0:0.0:1.0:0.0	.	348	P22760	AAAD_HUMAN	N	348	ENSP00000232892:D348N	ENSP00000232892:D348N	D	+	1	0	AADAC	153028492	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	8.778000	0.91785	2.255000	0.74692	0.591000	0.81541	GAT		0.468	AADAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357883.2	NM_001086		13	87	0	0	0	0	13	87				
MME	4311	broad.mit.edu	37	3	154860103	154860103	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:154860103G>C	ENST00000460393.1	+	12	1292	c.1172G>C	c.(1171-1173)aGa>aCa	p.R391T	MME_ENST00000360490.2_Missense_Mutation_p.R391T|MME_ENST00000462745.1_Missense_Mutation_p.R391T|MME_ENST00000493237.1_Missense_Mutation_p.R391T|MME_ENST00000492661.1_Missense_Mutation_p.R391T	NM_000902.3|NM_007287.2	NP_000893.2|NP_009218.2	P08473	NEP_HUMAN	membrane metallo-endopeptidase	391					angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cellular protein metabolic process (GO:0044267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to UV-A (GO:0071492)|cellular response to UV-B (GO:0071493)|creatinine metabolic process (GO:0046449)|kidney development (GO:0001822)|peptide metabolic process (GO:0006518)|proteolysis (GO:0006508)|replicative senescence (GO:0090399)|sensory perception of pain (GO:0019233)	axon (GO:0030424)|brush border (GO:0005903)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(31)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)|Liraglutide(DB06655)	AAGGAGTCCAGAAATGCTTTC	0.393																																						uc010hvr.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(1171-1173)AGA>ACA		membrane metallo-endopeptidase	Candoxatril(DB00616)						68.0	71.0	70.0					3																	154860103		2203	4300	6503	SO:0001583	missense	4311				cell-cell signaling|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding	g.chr3:154860103G>C		CCDS3172.1	3q25.2	2012-01-31	2007-02-21		ENSG00000196549	ENSG00000196549	3.4.24.11	"""CD molecules"""	7154	protein-coding gene	gene with protein product	"""neutral endopeptidase"", ""enkephalinase"", ""neprilysin"""	120520					Standard	NM_007287		Approved	CALLA, CD10, NEP	uc003fad.1	P08473	OTTHUMG00000158455	ENST00000460393.1:c.1172G>C	3.37:g.154860103G>C	ENSP00000418525:p.Arg391Thr		Somatic				MME_uc003fab.1_Missense_Mutation_p.R391T|MME_uc003fac.1_Missense_Mutation_p.R391T|MME_uc003fad.1_Missense_Mutation_p.R391T|MME_uc003fae.1_Missense_Mutation_p.R391T	p.R391T	NM_007289	NP_009220	WXS	Illumina HiSeq	Unspecified	P08473	NEP_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		12	1383	+		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	391			Extracellular (Potential).		A8K6U6|D3DNJ9|Q3MIX4	Missense_Mutation	SNP	ENST00000460393.1	37	c.1172G>C	CCDS3172.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.223018	0.79464	.	.	ENSG00000196549	ENST00000492661;ENST00000460393;ENST00000462745;ENST00000493237;ENST00000360490	T;T;T;T;T	0.74632	-0.86;-0.86;-0.86;-0.86;-0.86	5.93	5.93	0.95920	Peptidase M13 (1);Metallopeptidase, catalytic domain (1);	0.091768	0.64402	D	0.000001	D	0.87497	0.6192	M	0.79475	2.455	0.58432	D	0.999995	D	0.89917	1.0	D	0.83275	0.996	D	0.87729	0.2578	10	0.87932	D	0	-17.0471	20.3397	0.98756	0.0:0.0:1.0:0.0	.	391	P08473	NEP_HUMAN	T	391	ENSP00000420389:R391T;ENSP00000418525:R391T;ENSP00000419653:R391T;ENSP00000417079:R391T;ENSP00000353679:R391T	ENSP00000353679:R391T	R	+	2	0	MME	156342797	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.353000	0.90077	2.803000	0.96430	0.585000	0.79938	AGA		0.393	MME-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351076.1	NM_000902		14	87	0	0	0	0	14	87				
PLCH1	23007	broad.mit.edu	37	3	155199669	155199669	+	Silent	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:155199669G>C	ENST00000340059.7	-	23	4169	c.4170C>G	c.(4168-4170)ctC>ctG	p.L1390L	PLCH1_ENST00000460012.1_Silent_p.L1352L|PLCH1_ENST00000414191.1_Silent_p.L1352L|PLCH1_ENST00000447496.2_3'UTR|PLCH1_ENST00000334686.6_Silent_p.L1352L|PLCH1_ENST00000494598.1_Intron	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1	1390					inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			GATTGTACTTGAGTTTTAAAG	0.418																																						uc011bok.1		NA																	0				skin(3)|ovary(1)	4						c.(4168-4170)CTC>CTG		phospholipase C eta 1 isoform a							64.0	66.0	65.0					3																	155199669		2203	4300	6503	SO:0001819	synonymous_variant	23007				lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity	g.chr3:155199669G>C	AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.4170C>G	3.37:g.155199669G>C			Somatic				PLCH1_uc011boj.1_3'UTR|PLCH1_uc011bol.1_Silent_p.L1352L	p.L1390L	NM_001130960	NP_001124432	WXS	Illumina HiSeq	Unspecified	Q4KWH8	PLCH1_HUMAN	Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)		23	4447	-			1390					Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Silent	SNP	ENST00000340059.7	37	c.4170C>G	CCDS46939.1																																																																																				0.418	PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351125.1	NM_014996		6	75	0	0	0	0	6	75				
MECOM	2122	broad.mit.edu	37	3	168834418	168834418	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:168834418G>C	ENST00000464456.1	-	7	1878	c.678C>G	c.(676-678)ttC>ttG	p.F226L	MECOM_ENST00000468789.1_Missense_Mutation_p.F226L|MECOM_ENST00000472280.1_Missense_Mutation_p.F227L|MECOM_ENST00000460814.1_Missense_Mutation_p.F226L|MECOM_ENST00000494292.1_Missense_Mutation_p.F414L|MECOM_ENST00000433243.2_Missense_Mutation_p.F227L|MECOM_ENST00000264674.3_Missense_Mutation_p.F291L|MECOM_ENST00000392736.3_Missense_Mutation_p.F226L	NM_001164000.1	NP_001157472.1	Q13465	MDS1_HUMAN	MDS1 and EVI1 complex locus	0					regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	85						ACGTAGTGCTGAACATTTGTC	0.438																																						uc003ffi.3		NA																	0				lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14						c.(676-678)TTC>TTG		MDS1 and EVI1 complex locus isoform b							480.0	398.0	426.0					3																	168834418		2203	4300	6503	SO:0001583	missense	2122				apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr3:168834418G>C	S82592, AF164154	CCDS3205.1, CCDS54669.1, CCDS54670.1	3q26.2	2013-01-08	2009-08-07	2009-08-07	ENSG00000085276	ENSG00000085276		"""Zinc fingers, C2H2-type"""	3498	protein-coding gene	gene with protein product		165215	"""myelodysplasia syndrome 1"", ""ecotropic viral integration site 1"""	MDS1, EVI1		2115646, 8171026, 8643684	Standard	NM_001105077		Approved	MDS1-EVI1, PRDM3	uc011bpj.1	Q03112	OTTHUMG00000158596	ENST00000464456.1:c.678C>G	3.37:g.168834418G>C	ENSP00000419770:p.Phe226Leu		Somatic				MECOM_uc010hwk.1_Missense_Mutation_p.F249L|MECOM_uc003ffj.3_Missense_Mutation_p.F291L|MECOM_uc011bpi.1_Missense_Mutation_p.F227L|MECOM_uc003ffn.3_Missense_Mutation_p.F226L|MECOM_uc003ffk.2_Missense_Mutation_p.F226L|MECOM_uc003ffl.2_Missense_Mutation_p.F386L|MECOM_uc011bpj.1_Missense_Mutation_p.F414L|MECOM_uc011bpk.1_Missense_Mutation_p.F216L|MECOM_uc010hwn.2_Missense_Mutation_p.F414L	p.F226L	NM_005241	NP_005232	WXS	Illumina HiSeq	Unspecified	Q03112	EVI1_HUMAN			7	947	-			226			Interaction with MAPK9, SMAD3 and probably SUV39H1.|C2H2-type 7.		Q13466|Q6FH90	Missense_Mutation	SNP	ENST00000464456.1	37	c.678C>G	CCDS54669.1	.	.	.	.	.	.	.	.	.	.	G	18.45	3.626559	0.66901	.	.	ENSG00000085276	ENST00000264674;ENST00000392736;ENST00000464456;ENST00000472280;ENST00000494292;ENST00000468789;ENST00000460814;ENST00000433243	T;T;T;T;T;T;T;T	0.73258	-0.73;-0.73;-0.73;-0.73;-0.73;-0.73;-0.73;-0.73	5.88	5.88	0.94601	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.64402	D	0.000002	D	0.89343	0.6688	H	0.94306	3.52	0.80722	D	1	D;D;D;D;D	0.76494	0.998;0.998;0.998;0.998;0.999	D;D;D;D;D	0.79108	0.987;0.987;0.992;0.987;0.992	D	0.91387	0.5132	10	0.87932	D	0	-11.0658	20.2441	0.98394	0.0:0.0:1.0:0.0	.	414;227;414;291;226	Q03112-3;Q03112-6;E7EQ57;Q03112-4;Q03112	.;.;.;.;EVI1_HUMAN	L	291;226;226;227;414;226;226;227	ENSP00000264674:F291L;ENSP00000376493:F226L;ENSP00000419770:F226L;ENSP00000420048:F227L;ENSP00000417899:F414L;ENSP00000419995:F226L;ENSP00000420466:F226L;ENSP00000394302:F227L	ENSP00000264674:F291L	F	-	3	2	MECOM	170317112	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.457000	0.66672	2.774000	0.95407	0.655000	0.94253	TTC		0.438	MECOM-020	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351519.1	NM_005241, NM_004991		14	126	0	0	0	0	14	126				
SAMD7	344658	broad.mit.edu	37	3	169644598	169644598	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:169644598G>A	ENST00000428432.2	+	6	937	c.548G>A	c.(547-549)cGa>cAa	p.R183Q	SAMD7_ENST00000335556.3_Missense_Mutation_p.R183Q	NM_182610.2	NP_872416.1	Q7Z3H4	SAMD7_HUMAN	sterile alpha motif domain containing 7	183										NS(1)|biliary_tract(1)|breast(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	31	all_cancers(22;1.55e-22)|all_epithelial(15;2.41e-27)|all_lung(20;3.52e-17)|Lung NSC(18;1.44e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0106)			AGATGTCGTCGACTCAGGAAA	0.478																																						uc003fgd.2		NA																	0				skin(1)	1						c.(547-549)CGA>CAA		sterile alpha motif domain containing 7							61.0	65.0	64.0					3																	169644598		2203	4300	6503	SO:0001583	missense	344658							g.chr3:169644598G>A	BX537903	CCDS3209.1	3q26.31	2013-01-10			ENSG00000187033	ENSG00000187033		"""Sterile alpha motif (SAM) domain containing"""	25394	protein-coding gene	gene with protein product							Standard	NM_182610		Approved	DKFZp686E1583	uc003fgd.3	Q7Z3H4	OTTHUMG00000158730	ENST00000428432.2:c.548G>A	3.37:g.169644598G>A	ENSP00000391299:p.Arg183Gln		Somatic				SAMD7_uc003fge.2_Missense_Mutation_p.R183Q|SAMD7_uc011bpo.1_Missense_Mutation_p.R84Q	p.R183Q	NM_182610	NP_872416	WXS	Illumina HiSeq	Unspecified	Q7Z3H4	SAMD7_HUMAN	Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0106)		6	815	+	all_cancers(22;1.55e-22)|all_epithelial(15;2.41e-27)|all_lung(20;3.52e-17)|Lung NSC(18;1.44e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		183						Missense_Mutation	SNP	ENST00000428432.2	37	c.548G>A	CCDS3209.1	.	.	.	.	.	.	.	.	.	.	G	16.79	3.219926	0.58560	.	.	ENSG00000187033	ENST00000428432;ENST00000335556	T;T	0.70869	-0.52;-0.52	6.16	3.46	0.39613	.	0.110405	0.64402	N	0.000015	T	0.57110	0.2031	L	0.50333	1.59	0.36433	D	0.865043	P	0.42556	0.783	B	0.27887	0.084	T	0.62627	-0.6814	10	0.48119	T	0.1	-7.3424	11.5226	0.50560	0.187:0.0:0.813:0.0	.	183	Q7Z3H4	SAMD7_HUMAN	Q	183	ENSP00000391299:R183Q;ENSP00000334668:R183Q	ENSP00000334668:R183Q	R	+	2	0	SAMD7	171127292	0.958000	0.32768	0.414000	0.26521	0.627000	0.37826	2.053000	0.41326	0.499000	0.27970	0.650000	0.86243	CGA		0.478	SAMD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351959.1	NM_182610		10	75	0	0	0	0	10	75				
KLHL24	54800	broad.mit.edu	37	3	183368194	183368194	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:183368194G>A	ENST00000454652.2	+	4	436	c.50G>A	c.(49-51)cGt>cAt	p.R17H	KLHL24_ENST00000242810.6_Missense_Mutation_p.R17H|KLHL24_ENST00000476808.1_Missense_Mutation_p.R17H	NM_017644.3	NP_060114.2	Q6TFL4	KLH24_HUMAN	kelch-like family member 24	17						cell projection (GO:0042995)|cytoplasm (GO:0005737)				NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(10)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;2.88e-10)|Ovarian(172;0.0303)		all cancers(12;1.43e-42)|Epithelial(37;1.73e-36)|OV - Ovarian serous cystadenocarcinoma(80;8.75e-22)			CTTGGGGTGCGTGATTCCCCA	0.408																																						uc003flv.2		NA																	0				ovary(1)	1						c.(49-51)CGT>CAT		DRE1 protein							55.0	58.0	57.0					3																	183368194		2203	4300	6503	SO:0001583	missense	54800					axon|cytoplasm|perikaryon		g.chr3:183368194G>A		CCDS3246.1	3q27.1	2013-02-22	2013-02-22		ENSG00000114796	ENSG00000114796		"""Kelch-like"", ""BTB/POZ domain containing"""	25947	protein-coding gene	gene with protein product		611295	"""kelch-like 24 (Drosophila)"""				Standard	XM_005247552		Approved	DRE1, FLJ20059	uc003flv.3	Q6TFL4	OTTHUMG00000156911	ENST00000454652.2:c.50G>A	3.37:g.183368194G>A	ENSP00000395012:p.Arg17His		Somatic				KLHL24_uc003flw.2_Missense_Mutation_p.R17H|KLHL24_uc003flx.2_Missense_Mutation_p.R17H	p.R17H	NM_017644	NP_060114	WXS	Illumina HiSeq	Unspecified	Q6TFL4	KLH24_HUMAN	all cancers(12;1.43e-42)|Epithelial(37;1.73e-36)|OV - Ovarian serous cystadenocarcinoma(80;8.75e-22)		3	345	+	all_cancers(143;2.88e-10)|Ovarian(172;0.0303)		17					A5PLN8|Q9H620|Q9NXT9	Missense_Mutation	SNP	ENST00000454652.2	37	c.50G>A	CCDS3246.1	.	.	.	.	.	.	.	.	.	.	G	18.95	3.731914	0.69189	.	.	ENSG00000114796	ENST00000242810;ENST00000493074;ENST00000437402;ENST00000454495;ENST00000473045;ENST00000468101;ENST00000427201;ENST00000482138;ENST00000454652;ENST00000468001;ENST00000476808	T;D;T;T;D;T;D;T	0.83250	-0.46;-1.7;-0.56;-0.56;-1.7;-0.46;-1.7;-0.41	5.59	5.59	0.84812	.	0.046005	0.85682	D	0.000000	T	0.76983	0.4064	L	0.27053	0.805	0.58432	D	0.999997	D;D	0.57899	0.981;0.968	P;B	0.45474	0.482;0.375	T	0.80241	-0.1464	10	0.66056	D	0.02	.	13.8378	0.63419	0.0732:0.0:0.9268:0.0	.	17;17	Q6TFL4-2;Q6TFL4	.;KLH24_HUMAN	H	17	ENSP00000242810:R17H;ENSP00000417347:R17H;ENSP00000416836:R17H;ENSP00000408567:R17H;ENSP00000417275:R17H;ENSP00000395012:R17H;ENSP00000418922:R17H;ENSP00000419010:R17H	ENSP00000242810:R17H	R	+	2	0	KLHL24	184850888	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.127000	0.64727	2.641000	0.89580	0.460000	0.39030	CGT		0.408	KLHL24-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346586.2	NM_017644		7	59	0	0	0	0	7	59				
ECE2	9718	broad.mit.edu	37	3	183996310	183996310	+	Silent	SNP	C	C	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:183996310C>A	ENST00000402825.3	+	7	1135	c.1135C>A	c.(1135-1137)Cgg>Agg	p.R379R	ECE2_ENST00000359140.4_Silent_p.R232R|EIF2B5_ENST00000444495.1_Intron|ECE2_ENST00000357474.5_Silent_p.R307R|ECE2_ENST00000404464.3_Silent_p.R261R	NM_014693.3	NP_055508.3	O60344	ECE2_HUMAN	endothelin converting enzyme 2	379	Endothelin-converting enzyme 2 region.				brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|cell-cell signaling (GO:0007267)|heart development (GO:0007507)|peptide hormone processing (GO:0016486)	cytoplasmic vesicle membrane (GO:0030659)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|methyltransferase activity (GO:0008168)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(13)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(4)	49	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TCTGCCCTCTCGGGATTACTA	0.552																																						uc003fni.3		NA																	0				ovary(2)|skin(2)	4						c.(1135-1137)CGG>AGG		endothelin converting enzyme 2 isoform A							90.0	86.0	88.0					3																	183996310		2203	4300	6503	SO:0001819	synonymous_variant	9718				brain development|cardioblast differentiation|cell-cell signaling|peptide hormone processing	cytoplasmic vesicle membrane|Golgi membrane|integral to membrane	metal ion binding|metalloendopeptidase activity|methyltransferase activity	g.chr3:183996310C>A	AF428263	CCDS3255.1, CCDS33899.1, CCDS3256.2, CCDS43179.1, CCDS46969.1	3q27.1	2007-07-26			ENSG00000145194	ENSG00000145194			13275	protein-coding gene	gene with protein product		610145				11718899	Standard	NM_032331		Approved	KIAA0604, MGC2408	uc003fni.4	O60344	OTTHUMG00000150551	ENST00000402825.3:c.1135C>A	3.37:g.183996310C>A			Somatic				ECE2_uc011brg.1_Silent_p.R307R|ECE2_uc011brh.1_Silent_p.R232R|ECE2_uc003fnl.3_Silent_p.R307R|ECE2_uc003fnm.3_Silent_p.R261R|ECE2_uc003fnk.3_Silent_p.R232R|ECE2_uc011bri.1_Silent_p.R294R|ECE2_uc010hxv.2_Intron	p.R379R	NM_014693	NP_055508	WXS	Illumina HiSeq	Unspecified	O60344	ECE2_HUMAN	Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		7	1173	+	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		379			Lumenal (Potential).|Endothelin-converting enzyme 2 region.		A5PLK8|Q6NTG7|Q6UW36|Q8NFD7|Q96NX3|Q96NX4|Q9BRZ8	Silent	SNP	ENST00000402825.3	37	c.1135C>A	CCDS3256.2																																																																																				0.552	ECE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318874.3	NM_014693		21	113	1	0	7.45e-12	7.96e-12	21	113				
PSMD2	5708	broad.mit.edu	37	3	184022098	184022098	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:184022098C>T	ENST00000310118.4	+	12	2016	c.1458C>T	c.(1456-1458)ggC>ggT	p.G486G	PSMD2_ENST00000435761.1_Silent_p.G327G|EIF2B5_ENST00000444495.1_Intron|PSMD2_ENST00000439383.1_Silent_p.G356G	NM_002808.3	NP_002799.3	Q13200	PSMD2_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 2	486					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|liver(1)|lung(12)|prostate(3)|upper_aerodigestive_tract(2)	27	all_cancers(143;1.54e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Bortezomib(DB00188)	GCAGGCTAGGCTTGGCTTATG	0.483																																					Colon(24;313 636 6917 9932 15554)	uc003fnn.1		NA																	0					0						c.(1456-1458)GGC>GGT		proteasome 26S non-ATPase subunit 2	Bortezomib(DB00188)						185.0	172.0	176.0					3																	184022098		2203	4300	6503	SO:0001819	synonymous_variant	5708				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	enzyme regulator activity|protein binding	g.chr3:184022098C>T	AK095245	CCDS3258.1, CCDS63853.1, CCDS63854.1	3q27.3	2008-05-22			ENSG00000175166	ENSG00000175166		"""Proteasome (prosome, macropain) subunits"""	9559	protein-coding gene	gene with protein product		606223				8774743	Standard	NM_002808		Approved	S2, P97, TRAP2, MGC14274, Rpn1	uc003fnn.1	Q13200	OTTHUMG00000156796	ENST00000310118.4:c.1458C>T	3.37:g.184022098C>T			Somatic				PSMD2_uc011brj.1_Silent_p.G327G|PSMD2_uc011brk.1_Silent_p.G356G	p.G486G	NM_002808	NP_002799	WXS	Illumina HiSeq	Unspecified	Q13200	PSMD2_HUMAN	Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		12	1491	+	all_cancers(143;1.54e-10)|Ovarian(172;0.0339)		486			PC 3.		B4DX07|B4DXY1|E7EW34|E9PCS3|Q12932|Q15321|Q53XQ4|Q96I12	Silent	SNP	ENST00000310118.4	37	c.1458C>T	CCDS3258.1																																																																																				0.483	PSMD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345843.1	NM_002808		51	137	0	0	0	0	51	137				
EIF4G1	1981	broad.mit.edu	37	3	184046444	184046444	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:184046444G>A	ENST00000346169.2	+	27	4250	c.3979G>A	c.(3979-3981)Gag>Aag	p.E1327K	SNORD66_ENST00000390856.1_RNA|EIF4G1_ENST00000427845.1_Missense_Mutation_p.E1241K|EIF4G1_ENST00000382330.3_Missense_Mutation_p.E1334K|EIF4G1_ENST00000319274.6_Missense_Mutation_p.E1327K|EIF4G1_ENST00000441154.1_Missense_Mutation_p.E1164K|EIF4G1_ENST00000434061.2_Missense_Mutation_p.E1132K|EIF4G1_ENST00000411531.1_Missense_Mutation_p.E1288K|EIF4G1_ENST00000352767.3_Missense_Mutation_p.E1334K|EIF4G1_ENST00000414031.1_Missense_Mutation_p.E1287K|EIF4G1_ENST00000392537.2_Missense_Mutation_p.E1240K|EIF2B5_ENST00000444495.1_Intron|EIF4G1_ENST00000350481.5_Missense_Mutation_p.E1163K|EIF4G1_ENST00000342981.4_Missense_Mutation_p.E1328K|EIF4G1_ENST00000435046.2_Missense_Mutation_p.E1131K|EIF4G1_ENST00000424196.1_Missense_Mutation_p.E1334K	NM_198241.2	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4 gamma, 1	1327	MI. {ECO:0000255|PROSITE- ProRule:PRU00698}.				cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|lung development (GO:0030324)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|response to ethanol (GO:0045471)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(5)|large_intestine(14)|lung(41)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	75	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GGAATTGGCTGAGGACATGGA	0.537																																						uc003fnp.2		NA																	0				lung(2)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7						c.(3979-3981)GAG>AAG		eukaryotic translation initiation factor 4							186.0	189.0	188.0					3																	184046444		2203	4300	6503	SO:0001583	missense	1981				insulin receptor signaling pathway|interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity	g.chr3:184046444G>A	D12686	CCDS3259.1, CCDS3260.1, CCDS3261.1, CCDS46970.1, CCDS46970.2, CCDS54687.1, CCDS54688.1	3q27.1	2013-09-19			ENSG00000114867	ENSG00000114867		"""Parkinson disease"""	3296	protein-coding gene	gene with protein product		600495		EIF4G, EIF4F		1429670, 9372926, 21907011	Standard	NM_182917		Approved	p220, PARK18	uc010hxy.3	Q04637	OTTHUMG00000156784	ENST00000346169.2:c.3979G>A	3.37:g.184046444G>A	ENSP00000316879:p.Glu1327Lys		Somatic				EIF4G1_uc003fnt.2_Missense_Mutation_p.E1038K|EIF4G1_uc003fnq.2_Missense_Mutation_p.E1240K|EIF4G1_uc003fnr.2_Missense_Mutation_p.E1163K|EIF4G1_uc010hxx.2_Missense_Mutation_p.E1334K|EIF4G1_uc003fns.2_Missense_Mutation_p.E1287K|EIF4G1_uc010hxy.2_Missense_Mutation_p.E1334K|EIF4G1_uc003fnv.3_Missense_Mutation_p.E1328K|EIF4G1_uc003fnu.3_Missense_Mutation_p.E1327K|EIF4G1_uc003fnw.2_Missense_Mutation_p.E1334K|EIF4G1_uc003fnx.2_Missense_Mutation_p.E1132K|EIF4G1_uc003fny.3_Missense_Mutation_p.E1131K|EIF4G1_uc003foa.2_5'UTR	p.E1327K	NM_198241	NP_937884	WXS	Illumina HiSeq	Unspecified	Q04637	IF4G1_HUMAN	Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		27	4177	+	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		1327			MI.		D3DNT2|D3DNT4|D3DNT5|E9PFM1|G5E9S1|O43177|O95066|Q5HYG0|Q6ZN21|Q8N102	Missense_Mutation	SNP	ENST00000346169.2	37	c.3979G>A	CCDS3259.1	.	.	.	.	.	.	.	.	.	.	G	36	5.597867	0.96602	.	.	ENSG00000114867	ENST00000346169;ENST00000414031;ENST00000392537;ENST00000382330;ENST00000350481;ENST00000352767;ENST00000427845;ENST00000342981;ENST00000319274;ENST00000424196;ENST00000411531;ENST00000441154;ENST00000434061;ENST00000435046	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86	5.69	5.69	0.88448	Initiation factor eIF-4 gamma, MA3 (3);Armadillo-type fold (1);	0.047553	0.85682	D	0.000000	T	0.69378	0.3104	M	0.79258	2.445	0.80722	D	1	D;D;D	0.67145	0.996;0.996;0.996	D;D;D	0.65323	0.934;0.934;0.934	T	0.67417	-0.5676	10	0.38643	T	0.18	-16.9308	19.812	0.96551	0.0:0.0:1.0:0.0	.	1334;1328;1327	E9PFM1;D3DNT2;Q04637	.;.;IF4G1_HUMAN	K	1327;1287;1240;1334;1163;1334;1241;1328;1327;1334;1288;1164;1132;1131	ENSP00000316879:E1327K;ENSP00000391935:E1287K;ENSP00000376320:E1240K;ENSP00000371767:E1334K;ENSP00000317600:E1163K;ENSP00000338020:E1334K;ENSP00000407682:E1241K;ENSP00000343450:E1328K;ENSP00000323737:E1327K;ENSP00000416255:E1334K;ENSP00000395974:E1288K;ENSP00000399858:E1164K;ENSP00000411826:E1132K;ENSP00000404754:E1131K	ENSP00000323737:E1327K	E	+	1	0	EIF4G1	185529138	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.476000	0.97823	2.685000	0.91497	0.655000	0.94253	GAG		0.537	EIF4G1-007	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000345733.1	NM_182917		31	187	0	0	0	0	31	187				
ETV5	2119	broad.mit.edu	37	3	185823423	185823423	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:185823423C>T	ENST00000306376.5	-	3	370	c.124G>A	c.(124-126)Gat>Aat	p.D42N	ETV5_ENST00000434744.1_Missense_Mutation_p.D42N|DGKG_ENST00000447054.1_5'Flank|ETV5_ENST00000537818.1_Missense_Mutation_p.D84N	NM_004454.2	NP_004445.1	P41161	ETV5_HUMAN	ets variant 5	42					cell differentiation (GO:0030154)|cellular response to oxidative stress (GO:0034599)|locomotory behavior (GO:0007626)|male germ-line stem cell asymmetric division (GO:0048133)|neuromuscular synaptic transmission (GO:0007274)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of synapse organization (GO:0050807)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|cervix(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	28	all_cancers(143;4.06e-12)|Ovarian(172;0.0386)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.62e-24)			CCTTCAGAATCGTGAGCCAGA	0.478			T	"""TMPRSS2, SCL45A3"""	Prostate																																	uc003fpz.2		NA		Dom	yes		3	3q28	2119	T	ets variant gene 5			E	TMPRSS2|SCL45A3		Prostate 		0				ovary(2)|skin(2)|breast(1)	5						c.(124-126)GAT>AAT		ets variant gene 5 (ets-related molecule)							129.0	122.0	124.0					3																	185823423		2203	4300	6503	SO:0001583	missense	2119				cellular response to oxidative stress	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding	g.chr3:185823423C>T	BC007333	CCDS33906.1	3q28	2008-09-12	2008-09-12		ENSG00000244405	ENSG00000244405			3494	protein-coding gene	gene with protein product	"""ets-related molecule"""	601600	"""ets variant gene 5 (ets-related molecule)"""			8152800	Standard	NM_004454		Approved	ERM	uc003fpz.3	P41161	OTTHUMG00000156639	ENST00000306376.5:c.124G>A	3.37:g.185823423C>T	ENSP00000306894:p.Asp42Asn		Somatic				ETV5_uc003fpy.2_Missense_Mutation_p.D84N	p.D42N	NM_004454	NP_004445	WXS	Illumina HiSeq	Unspecified	P41161	ETV5_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;1.62e-24)		3	371	-	all_cancers(143;4.06e-12)|Ovarian(172;0.0386)|Breast(254;0.247)		42					A6NH46|B7Z7D7|Q6IBN5	Missense_Mutation	SNP	ENST00000306376.5	37	c.124G>A	CCDS33906.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.047301	0.93740	.	.	ENSG00000244405	ENST00000306376;ENST00000434744;ENST00000537818;ENST00000440773;ENST00000421809;ENST00000413301;ENST00000422039	T;T;T;T;T;T;T	0.36520	1.25;1.25;1.25;1.25;1.25;1.25;1.25	5.71	5.71	0.89125	PEA3-type ETS-domain transcription factor, N-terminal (1);	0.424693	0.25538	N	0.029993	T	0.62925	0.2468	M	0.78456	2.415	0.54753	D	0.999986	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.65726	-0.6098	10	0.87932	D	0	.	16.7708	0.85537	0.0:1.0:0.0:0.0	.	42;84	P41161;B7Z7D7	ETV5_HUMAN;.	N	42;42;84;42;42;42;42	ENSP00000306894:D42N;ENSP00000413755:D42N;ENSP00000441737:D84N;ENSP00000389707:D42N;ENSP00000412171:D42N;ENSP00000405157:D42N;ENSP00000388737:D42N	ENSP00000306894:D42N	D	-	1	0	ETV5	187306117	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	6.885000	0.75606	2.699000	0.92147	0.462000	0.41574	GAT		0.478	ETV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344947.1	NM_004454		9	106	0	0	0	0	9	106				
KNG1	3827	broad.mit.edu	37	3	186450325	186450325	+	Silent	SNP	C	C	T	rs201943382		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:186450325C>T	ENST00000265023.4	+	7	1004	c.792C>T	c.(790-792)tgC>tgT	p.C264C	RP11-573D15.8_ENST00000354642.2_RNA|KNG1_ENST00000287611.2_Silent_p.C264C|RP11-573D15.8_ENST00000599314.1_RNA|KNG1_ENST00000447445.1_Silent_p.C228C	NM_001102416.2	NP_001095886.1	P01042	KNG1_HUMAN	kininogen 1	264					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|inflammatory response (GO:0006954)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteolysis (GO:0045861)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|smooth muscle contraction (GO:0006939)|vasodilation (GO:0042311)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|heparin binding (GO:0008201)|receptor binding (GO:0005102)|zinc ion binding (GO:0008270)			endometrium(1)|lung(15)|prostate(1)|skin(2)|stomach(2)	21	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)		CCAAGATTTGCGTGGGCTGCC	0.488													C|||	1	0.000199681	0.0	0.0	5008	,	,		21829	0.0		0.001	False		,,,				2504	0.0					uc011bsa.1		NA																	0				skin(1)	1						c.(790-792)TGC>TGT		kininogen 1 isoform 1	Ouabain(DB01092)						100.0	99.0	99.0					3																	186450325		2203	4300	6503	SO:0001819	synonymous_variant	3827				blood coagulation, intrinsic pathway|elevation of cytosolic calcium ion concentration|inflammatory response|negative regulation of blood coagulation|negative regulation of cell adhesion|platelet activation|platelet degranulation|positive regulation of apoptosis|positive regulation of renal sodium excretion|positive regulation of urine volume|smooth muscle contraction|vasodilation	extracellular space|plasma membrane|platelet alpha granule lumen	cysteine-type endopeptidase inhibitor activity|heparin binding|receptor binding|zinc ion binding	g.chr3:186450325C>T		CCDS3281.1, CCDS43183.1, CCDS54695.1	3q27.3	2014-05-15	2004-05-21	2004-05-26	ENSG00000113889	ENSG00000113889		"""Endogenous ligands"""	6383	protein-coding gene	gene with protein product	"""alpha-2-thiol proteinase inhibitor"", ""bradykinin"""	612358	"""kininogen"""	KNG, BDK		1733668	Standard	NM_000893		Approved	BK	uc011bsa.2	P01042	OTTHUMG00000150348	ENST00000265023.4:c.792C>T	3.37:g.186450325C>T			Somatic				KNG1_uc003fqr.2_Silent_p.C264C	p.C264C	NM_001102416	NP_001095886	WXS	Illumina HiSeq	Unspecified	P01042	KNG1_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)	7	1004	+	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		264			Cystatin 3.		A8K474|B2RCR2|C9JEX1|P01043|Q53EQ0|Q6PAU9|Q7M4P1	Silent	SNP	ENST00000265023.4	37	c.792C>T	CCDS43183.1																																																																																				0.488	KNG1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317738.1	NM_001102416		21	127	0	0	0	0	21	127				
ATP13A4	84239	broad.mit.edu	37	3	193185238	193185238	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:193185238C>T	ENST00000342695.4	-	10	1303	c.981G>A	c.(979-981)aaG>aaA	p.K327K	ATP13A4_ENST00000392443.3_Silent_p.K327K|ATP13A4_ENST00000295548.3_Silent_p.K327K	NM_032279.2	NP_115655.2	Q4VNC1	AT134_HUMAN	ATPase type 13A4	327						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(27)|ovary(2)|prostate(3)|skin(11)|upper_aerodigestive_tract(2)	71	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		AGCTATCCATCTTGGGTAACG	0.478																																						uc003ftd.2		NA																	0				ovary(2)	2						c.(979-981)AAG>AAA		ATPase type 13A4							138.0	128.0	131.0					3																	193185238		2203	4300	6503	SO:0001819	synonymous_variant	84239				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding	g.chr3:193185238C>T	AK095277	CCDS3304.2	3q29	2010-04-20			ENSG00000127249	ENSG00000127249		"""ATPases / P-type"""	25422	protein-coding gene	gene with protein product		609556				14702039, 12975309	Standard	XM_005247829		Approved	DKFZp761I1011, FLJ37958	uc003ftd.3	Q4VNC1	OTTHUMG00000074067	ENST00000342695.4:c.981G>A	3.37:g.193185238C>T			Somatic				ATP13A4_uc003fte.1_Silent_p.K327K|ATP13A4_uc011bsr.1_5'UTR|ATP13A4_uc010hzi.2_RNA|ATP13A4_uc003ftf.3_Silent_p.K33K	p.K327K	NM_032279	NP_115655	WXS	Illumina HiSeq	Unspecified	Q4VNC1	AT134_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)	10	1089	-	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		327			Extracellular (Potential).		B7WPC7|Q6UY23|Q8N1Q9|Q9H043	Silent	SNP	ENST00000342695.4	37	c.981G>A	CCDS3304.2																																																																																				0.478	ATP13A4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157244.4	NM_032279		15	137	0	0	0	0	15	137				
APOD	347	broad.mit.edu	37	3	195306307	195306307	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:195306307G>A	ENST00000343267.3	-	2	387	c.26C>T	c.(25-27)tCc>tTc	p.S9F		NM_001647.3	NP_001638.1	P05090	APOD_HUMAN	apolipoprotein D	9					aging (GO:0007568)|angiogenesis (GO:0001525)|brain development (GO:0007420)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|negative regulation of cytokine production involved in inflammatory response (GO:1900016)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of lipoprotein lipid oxidation (GO:0060588)|negative regulation of monocyte chemotactic protein-1 production (GO:0071638)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein import into nucleus (GO:0042308)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of smooth muscle cell-matrix adhesion (GO:2000098)|negative regulation of T cell migration (GO:2000405)|peripheral nervous system axon regeneration (GO:0014012)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to reactive oxygen species (GO:0000302)|tissue regeneration (GO:0042246)	cytosolic ribosome (GO:0022626)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)	cholesterol binding (GO:0015485)|lipid transporter activity (GO:0005319)			breast(1)|endometrium(1)|large_intestine(1)|lung(1)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	9	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		AGCCAGTGCGGAAAGCAGCAG	0.577																																						uc003fur.2		NA																	0				ovary(2)	2						c.(25-27)TCC>TTC		apolipoprotein D precursor							35.0	37.0	37.0					3																	195306307		2198	4292	6490	SO:0001583	missense	347				lipid metabolic process	extracellular space	lipid binding|lipid transporter activity|protein binding	g.chr3:195306307G>A		CCDS33925.1	3q29	2013-09-19			ENSG00000189058	ENSG00000189058		"""Lipocalins"", ""Apolipoproteins"""	612	protein-coding gene	gene with protein product		107740				2439269, 3453108	Standard	NM_001647		Approved		uc003fur.2	P05090	OTTHUMG00000155854	ENST00000343267.3:c.26C>T	3.37:g.195306307G>A	ENSP00000345179:p.Ser9Phe		Somatic				APOD_uc011bsx.1_Missense_Mutation_p.S9F	p.S9F	NM_001647	NP_001638	WXS	Illumina HiSeq	Unspecified	P05090	APOD_HUMAN	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)	2	388	-	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	9					B2R579|D3DNW6|Q6IBG6	Missense_Mutation	SNP	ENST00000343267.3	37	c.26C>T	CCDS33925.1	.	.	.	.	.	.	.	.	.	.	G	4.927	0.172275	0.09391	.	.	ENSG00000189058	ENST00000343267;ENST00000421243;ENST00000453131	T;T;T	0.20738	2.05;2.05;2.05	5.68	4.81	0.61882	Calycin (1);	1.160920	0.05856	N	0.622163	T	0.16642	0.0400	L	0.29908	0.895	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.001;0.002	T	0.32561	-0.9902	10	0.07325	T	0.83	-1.0019	10.8201	0.46599	0.0877:0.0:0.9123:0.0	.	9;9	B4DGC3;P05090	.;APOD_HUMAN	F	9;37;9	ENSP00000345179:S9F;ENSP00000415235:S37F;ENSP00000393076:S9F	ENSP00000345179:S9F	S	-	2	0	APOD	196787596	0.061000	0.20836	0.002000	0.10522	0.024000	0.10985	2.848000	0.48278	1.406000	0.46857	-0.137000	0.14449	TCC		0.577	APOD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342004.1	NM_001647		6	55	0	0	0	0	6	55				
MUC4	4585	broad.mit.edu	37	3	195505836	195505836	+	Missense_Mutation	SNP	G	G	C	rs369326402	byFrequency	TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:195505836G>C	ENST00000463781.3	-	2	13074	c.12615C>G	c.(12613-12615)caC>caG	p.H4205Q	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.H4205Q	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.H4205Q(10)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGGGTGGCGTGACCTGTGG	0.597																																						uc011bto.1		NA																	10	Substitution - Missense(10)		kidney(4)|prostate(3)|urinary_tract(2)|endometrium(1)		0						c.(12229-12231)CAC>CAG		mucin 4 isoform a							15.0	14.0	14.0					3																	195505836		687	1573	2260	SO:0001583	missense	4585				cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity	g.chr3:195505836G>C	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12615C>G	3.37:g.195505836G>C	ENSP00000417498:p.His4205Gln		Somatic				MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	p.H4077Q	NM_018406	NP_060876	WXS	Illumina HiSeq	Unspecified	Q99102	MUC4_HUMAN	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)	3	12691	-	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	c.12231C>G	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	0.099	-1.155501	0.01686	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30448	1.55;1.53	.	.	.	.	.	.	.	.	T	0.17619	0.0423	N	0.19112	0.55	0.21950	N	0.999454	P	0.35208	0.49	B	0.40038	0.317	T	0.24368	-1.0162	6	.	.	.	.	.	.	.	.	4077	E7ESK3	.	Q	4205	ENSP00000417498:H4205Q;ENSP00000420243:H4205Q	.	H	-	3	2	MUC4	196990615	.	.	0.016000	0.15963	0.046000	0.14306	.	.	-0.849000	0.04158	0.074000	0.15403	CAC		0.597	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406		5	5	0	0	0	0	5	5				
MUC4	4585	broad.mit.edu	37	3	195511937	195511937	+	Missense_Mutation	SNP	C	C	T	rs201509113	byFrequency	TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:195511937C>T	ENST00000463781.3	-	2	6973	c.6514G>A	c.(6514-6516)Ggt>Agt	p.G2172S	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.G2172S	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTGGCGTGACCTGTGGATGCT	0.577																																						uc011bto.1		NA																	0					0						c.(6514-6516)GGT>AGT		mucin 4 isoform a							12.0	15.0	14.0					3																	195511937		652	1533	2185	SO:0001583	missense	4585				cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity	g.chr3:195511937C>T	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6514G>A	3.37:g.195511937C>T	ENSP00000417498:p.Gly2172Ser		Somatic				MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	p.G2172S	NM_018406	NP_060876	WXS	Illumina HiSeq	Unspecified	Q99102	MUC4_HUMAN	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)	2	6974	-	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	c.6514G>A	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	C	7.497	0.651958	0.14516	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.28666	1.6;1.67	.	.	.	.	.	.	.	.	T	0.29976	0.0750	N	0.19112	0.55	0.09310	N	0.999998	D	0.56746	0.977	D	0.63488	0.915	T	0.11084	-1.0602	7	.	.	.	.	3.4513	0.07499	0.4478:0.552:1.0E-4:1.0E-4	.	2172	E7ESK3	.	S	2172	ENSP00000417498:G2172S;ENSP00000420243:G2172S	.	G	-	1	0	MUC4	196996332	0.229000	0.23729	0.002000	0.10522	0.068000	0.16541	1.016000	0.29976	0.488000	0.27723	0.064000	0.15345	GGT		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406		2	0	0	0	0	0	2	0				
WDR53	348793	broad.mit.edu	37	3	196288262	196288262	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:196288262C>G	ENST00000332629.5	-	3	652	c.85G>C	c.(85-87)Gag>Cag	p.E29Q	WDR53_ENST00000433160.1_Intron|WDR53_ENST00000429115.1_Intron	NM_182627.1	NP_872433.1	Q7Z5U6	WDR53_HUMAN	WD repeat domain 53	29										breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	13	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.6e-23)|all cancers(36;1.54e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.29e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)		TCTCCGCCCTCTGCTCCAGAA	0.542																																						uc003fwt.2		NA																	0				breast(1)|skin(1)	2						c.(85-87)GAG>CAG		WD repeat domain 53							62.0	61.0	61.0					3																	196288262		2203	4300	6503	SO:0001583	missense	348793							g.chr3:196288262C>G	BC054030	CCDS3318.1	3q29	2013-01-09			ENSG00000185798	ENSG00000185798		"""WD repeat domain containing"""	28786	protein-coding gene	gene with protein product		615110				12477932	Standard	NM_182627		Approved	MGC64882, MGC12928	uc003fwt.3	Q7Z5U6	OTTHUMG00000155572	ENST00000332629.5:c.85G>C	3.37:g.196288262C>G	ENSP00000328079:p.Glu29Gln		Somatic					p.E29Q	NM_182627	NP_872433	WXS	Illumina HiSeq	Unspecified	Q7Z5U6	WDR53_HUMAN	Epithelial(36;1.6e-23)|all cancers(36;1.54e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.29e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)	3	556	-	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		29			WD 1.		A0MNP1	Missense_Mutation	SNP	ENST00000332629.5	37	c.85G>C	CCDS3318.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.405793	0.83230	.	.	ENSG00000185798	ENST00000332629;ENST00000456677;ENST00000425888	T;T;T	0.73897	-0.79;0.62;0.62	6.02	6.02	0.97574	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.82834	0.5123	M	0.68593	2.085	0.80722	D	1	D	0.67145	0.996	P	0.58013	0.831	T	0.77461	-0.2579	10	0.22109	T	0.4	-15.7231	20.6011	0.99457	0.0:1.0:0.0:0.0	.	29	Q7Z5U6	WDR53_HUMAN	Q	29	ENSP00000328079:E29Q;ENSP00000408087:E29Q;ENSP00000396248:E29Q	ENSP00000328079:E29Q	E	-	1	0	WDR53	197772659	1.000000	0.71417	1.000000	0.80357	0.292000	0.27327	7.057000	0.76669	2.878000	0.98634	0.650000	0.86243	GAG		0.542	WDR53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340689.1	NM_182627		7	38	0	0	0	0	7	38				
WDR53	348793	broad.mit.edu	37	3	196288299	196288299	+	Silent	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:196288299C>G	ENST00000332629.5	-	3	615	c.48G>C	c.(46-48)ctG>ctC	p.L16L	WDR53_ENST00000433160.1_Intron|WDR53_ENST00000429115.1_Intron	NM_182627.1	NP_872433.1	Q7Z5U6	WDR53_HUMAN	WD repeat domain 53	16										breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	13	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.6e-23)|all cancers(36;1.54e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.29e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)		TACTTGCATTCAGGCAGAGGA	0.532																																						uc003fwt.2		NA																	0				breast(1)|skin(1)	2						c.(46-48)CTG>CTC		WD repeat domain 53							61.0	62.0	62.0					3																	196288299		2203	4299	6502	SO:0001819	synonymous_variant	348793							g.chr3:196288299C>G	BC054030	CCDS3318.1	3q29	2013-01-09			ENSG00000185798	ENSG00000185798		"""WD repeat domain containing"""	28786	protein-coding gene	gene with protein product		615110				12477932	Standard	NM_182627		Approved	MGC64882, MGC12928	uc003fwt.3	Q7Z5U6	OTTHUMG00000155572	ENST00000332629.5:c.48G>C	3.37:g.196288299C>G			Somatic					p.L16L	NM_182627	NP_872433	WXS	Illumina HiSeq	Unspecified	Q7Z5U6	WDR53_HUMAN	Epithelial(36;1.6e-23)|all cancers(36;1.54e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.29e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)	3	519	-	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		16			WD 1.		A0MNP1	Silent	SNP	ENST00000332629.5	37	c.48G>C	CCDS3318.1																																																																																				0.532	WDR53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340689.1	NM_182627		9	45	0	0	0	0	9	45				
CEP19	84984	broad.mit.edu	37	3	196434703	196434703	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:196434703C>T	ENST00000399942.4	-	2	400	c.106G>A	c.(106-108)Gag>Aag	p.E36K	CEP19_ENST00000409690.3_Missense_Mutation_p.E75K|RNU6-646P_ENST00000364571.1_RNA			Q96LK0	CEP19_HUMAN	centrosomal protein 19kDa	71						centriole (GO:0005814)|ciliary basal body (GO:0036064)|spindle pole (GO:0000922)		p.E71Q(1)		NS(1)|breast(2)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	10						AATAGCTTCTCTAGCTGCCTC	0.438																																						uc011btw.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(223-225)GAG>AAG		hypothetical protein LOC84984							142.0	135.0	137.0					3																	196434703		1886	4115	6001	SO:0001583	missense	84984					centriole|spindle pole		g.chr3:196434703C>T	BC007827	CCDS43193.2	3q29	2014-02-20	2011-05-06	2011-05-06	ENSG00000174007	ENSG00000174007			28209	protein-coding gene	gene with protein product		615586	"""chromosome 3 open reading frame 34"""	C3orf34		21399614	Standard	XM_005269370		Approved	MGC14126	uc011btw.2	Q96LK0	OTTHUMG00000153933	ENST00000399942.4:c.106G>A	3.37:g.196434703C>T	ENSP00000382823:p.Glu36Lys		Somatic					p.E75K	NM_032898	NP_116287	WXS	Illumina HiSeq	Unspecified	Q96LK0	CEP19_HUMAN	Epithelial(36;1.07e-23)|all cancers(36;1.08e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00301)	3	605	-	all_cancers(143;1.48e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		71					B2RA74|Q96I48	Missense_Mutation	SNP	ENST00000399942.4	37	c.223G>A		.	.	.	.	.	.	.	.	.	.	C	15.72	2.917082	0.52546	.	.	ENSG00000174007	ENST00000409690;ENST00000399942	.	.	.	5.56	4.7	0.59300	.	0.135029	0.64402	N	0.000003	T	0.45518	0.1346	L	0.37850	1.14	0.48341	D	0.999635	B	0.10296	0.003	B	0.13407	0.009	T	0.42666	-0.9438	9	0.56958	D	0.05	-18.5479	8.1786	0.31296	0.0:0.6639:0.1932:0.1429	.	71	Q96LK0	CEP19_HUMAN	K	75;36	.	ENSP00000382823:E36K	E	-	1	0	CEP19	197919100	0.807000	0.29009	0.982000	0.44146	0.935000	0.57460	1.471000	0.35365	1.492000	0.48499	0.655000	0.94253	GAG		0.438	CEP19-002	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000333081.1	NM_032898		32	155	0	0	0	0	32	155				
PAK2	5062	broad.mit.edu	37	3	196534686	196534686	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:196534686G>A	ENST00000327134.3	+	7	932	c.610G>A	c.(610-612)Gca>Aca	p.A204T		NM_002577.4	NP_002568.2	Q13177	PAK2_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 2	204					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in execution phase of apoptosis (GO:2001271)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of defense response to virus by virus (GO:0050690)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activator activity (GO:0030296)			breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	12	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)		CCCTGTTCCTGCACCAGTTGG	0.393																																						uc003fwy.3		NA																	0				ovary(1)|lung(1)	2						c.(610-612)GCA>ACA		p21-activated kinase 2							120.0	110.0	113.0					3																	196534686		2203	4300	6503	SO:0001583	missense	5062				axon guidance|cellular component disassembly involved in apoptosis|interspecies interaction between organisms|negative regulation of protein kinase activity|peptidyl-serine phosphorylation|positive regulation of peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of apoptosis|regulation of defense response to virus by virus|regulation of growth|T cell costimulation|T cell receptor signaling pathway|viral reproduction	cytosol|nucleus|perinuclear region of cytoplasm|plasma membrane	ATP binding|identical protein binding|protein kinase binding|protein serine/threonine kinase activity|protein tyrosine kinase activator activity	g.chr3:196534686G>A	U24153	CCDS3321.1	3q29	2008-06-17	2008-06-17			ENSG00000180370	2.7.11.1		8591	protein-coding gene	gene with protein product	"""S6/H4 kinase"""	605022	"""p21 (CDKN1A)-activated kinase 2"""			7744004, 7618083	Standard	NM_002577		Approved	PAK65, PAKgamma	uc003fwy.4	Q13177		ENST00000327134.3:c.610G>A	3.37:g.196534686G>A	ENSP00000314067:p.Ala204Thr		Somatic					p.A204T	NM_002577	NP_002568	WXS	Illumina HiSeq	Unspecified	Q13177	PAK2_HUMAN	Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)	7	932	+	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		204					Q13154|Q6ISC3	Missense_Mutation	SNP	ENST00000327134.3	37	c.610G>A	CCDS3321.1	.	.	.	.	.	.	.	.	.	.	G	14.69	2.611861	0.46631	.	.	ENSG00000180370	ENST00000327134	T	0.69040	-0.37	5.62	4.72	0.59763	.	0.144593	0.64402	D	0.000007	T	0.55625	0.1932	L	0.42245	1.32	0.51767	D	0.999939	B	0.02656	0.0	B	0.06405	0.002	T	0.49615	-0.8921	10	0.19590	T	0.45	.	11.3064	0.49338	0.0:0.1375:0.7196:0.1429	.	204	Q13177	PAK2_HUMAN	T	204	ENSP00000314067:A204T	ENSP00000314067:A204T	A	+	1	0	PAK2	198019083	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	4.129000	0.57957	1.335000	0.45486	0.563000	0.77884	GCA		0.393	PAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340548.1	NM_002577		8	90	0	0	0	0	8	90				
SENP5	205564	broad.mit.edu	37	3	196626904	196626904	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr3:196626904C>G	ENST00000323460.5	+	4	1978	c.1729C>G	c.(1729-1731)Ctg>Gtg	p.L577V	SENP5_ENST00000445299.2_Missense_Mutation_p.L577V|SENP5_ENST00000419026.1_Missense_Mutation_p.L67V	NM_152699.4	NP_689912.2	Q96HI0	SENP5_HUMAN	SUMO1/sentrin specific peptidase 5	577	Protease.				cell cycle (GO:0007049)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein sumoylation (GO:0016925)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)			NS(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(14)|skin(1)	32	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.14e-24)|all cancers(36;2.1e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.004)		CCTGGCGACTCTGGATGGTCA	0.383																																					Ovarian(47;891 1095 11174 13858 51271)	uc003fwz.3		NA																	0				breast(2)|lung(1)	3						c.(1729-1731)CTG>GTG		SUMO1/sentrin specific peptidase 5							83.0	85.0	85.0					3																	196626904		2203	4300	6503	SO:0001583	missense	205564				cell cycle|cell division|proteolysis	nucleolus	cysteine-type peptidase activity	g.chr3:196626904C>G	BC030705	CCDS3322.1	3q29	2005-08-17	2005-08-17		ENSG00000119231	ENSG00000119231			28407	protein-coding gene	gene with protein product		612845	"""SUMO1/sentrin specific protease 5"""			12477932	Standard	NM_152699		Approved	MGC27076	uc003fwz.4	Q96HI0	OTTHUMG00000155527	ENST00000323460.5:c.1729C>G	3.37:g.196626904C>G	ENSP00000327197:p.Leu577Val		Somatic				SENP5_uc011bty.1_Missense_Mutation_p.L577V	p.L577V	NM_152699	NP_689912	WXS	Illumina HiSeq	Unspecified	Q96HI0	SENP5_HUMAN	Epithelial(36;3.14e-24)|all cancers(36;2.1e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.004)	4	1978	+	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		577			Protease.		B4DY82|Q96SA5	Missense_Mutation	SNP	ENST00000323460.5	37	c.1729C>G	CCDS3322.1	.	.	.	.	.	.	.	.	.	.	C	18.52	3.641587	0.67244	.	.	ENSG00000119231	ENST00000323460;ENST00000445299;ENST00000419026	T;T;T	0.60920	0.15;0.18;0.15	5.84	4.04	0.47022	.	0.000000	0.85682	D	0.000000	T	0.67859	0.2938	L	0.54323	1.7	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.68198	-0.5472	10	0.87932	D	0	-5.517	7.9109	0.29789	0.0:0.7535:0.0:0.2465	.	577;577	B4DY82;Q96HI0	.;SENP5_HUMAN	V	577;577;67	ENSP00000327197:L577V;ENSP00000390231:L577V;ENSP00000396927:L67V	ENSP00000327197:L577V	L	+	1	2	SENP5	198111301	0.738000	0.28186	0.990000	0.47175	0.923000	0.55619	1.361000	0.34136	0.918000	0.36919	0.650000	0.86243	CTG		0.383	SENP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340524.1	NM_152699		13	70	0	0	0	0	13	70				
FGFR3	2261	broad.mit.edu	37	4	1803568	1803568	+	Missense_Mutation	SNP	C	C	G	rs121913483		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr4:1803568C>G	ENST00000260795.2	+	6	848	c.746C>G	c.(745-747)tCc>tGc	p.S249C	FGFR3_ENST00000412135.2_Missense_Mutation_p.S249C|FGFR3_ENST00000440486.2_Missense_Mutation_p.S249C|FGFR3_ENST00000474521.1_3'UTR|FGFR3_ENST00000340107.4_Missense_Mutation_p.S249C|FGFR3_ENST00000481110.2_Missense_Mutation_p.S249C|FGFR3_ENST00000352904.1_Missense_Mutation_p.S249C			P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3	249			S -> C (in KERSEB, bladder cancer, cervical cancer and TD1). {ECO:0000269|PubMed:10360402, ECO:0000269|PubMed:10471491, ECO:0000269|PubMed:15772091, ECO:0000269|PubMed:8589699, ECO:0000269|PubMed:8845844}.		alveolar secondary septum development (GO:0061144)|axonogenesis involved in innervation (GO:0060385)|bone maturation (GO:0070977)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cell-cell signaling (GO:0007267)|central nervous system myelination (GO:0022010)|chondrocyte differentiation (GO:0002062)|chondrocyte proliferation (GO:0035988)|cochlea development (GO:0090102)|digestive tract morphogenesis (GO:0048546)|endochondral bone growth (GO:0003416)|endochondral ossification (GO:0001958)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell fate commitment (GO:0072148)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor apoptotic signaling pathway (GO:1902178)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear receptor cell differentiation (GO:0060113)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade (GO:0007259)|lens fiber cell development (GO:0070307)|lens morphogenesis in camera-type eye (GO:0002089)|MAPK cascade (GO:0000165)|morphogenesis of an epithelium (GO:0002009)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of developmental growth (GO:0048640)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|protein tyrosine kinase activity (GO:0004713)	p.S249C(1204)|p.R248_S249del(1)		NS(1)|central_nervous_system(5)|cervix(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(40)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(9)|skin(339)|soft_tissue(4)|testis(2)|upper_aerodigestive_tract(58)|urinary_tract(2607)	3091		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)|Pazopanib(DB06589)|Ponatinib(DB08901)	ACAGAGCGCTCCCCGCACCGG	0.736		1	"""Mis, T"""	"""IGH@, ETV6"""	"""bladder, MM, T-cell lymphoma"""		"""Hypochondroplasia, Thanatophoric dysplasia"""		Saethre-Chotzen syndrome;Muenke syndrome																													uc003gdr.3		1		Dom	yes		4	4p16.3	2261	Mis|T	fibroblast growth factor receptor 3	yes	Hypochondroplasia|Thanatophoric dysplasia	"""L, E"""	IGH@|ETV6		bladder|MM|T-cell lymphoma		1205	Substitution - Missense(1204)|Deletion - In frame(1)	p.S249C(1368)|p.R248_S249insC(2)|p.S249T(1)|p.R248_S249del(1)	urinary_tract(1168)|skin(27)|cervix(5)|lung(4)|upper_aerodigestive_tract(1)	urinary_tract(2177)|skin(314)|upper_aerodigestive_tract(57)|haematopoietic_and_lymphoid_tissue(24)|prostate(9)|cervix(6)|central_nervous_system(4)|large_intestine(3)|lung(3)|testis(2)|pancreas(1)	2600	GRCh37	CM950470	FGFR3	M	rs121913483	c.(745-747)TCC>TGC		fibroblast growth factor receptor 3 isoform 1	Palifermin(DB00039)						13.0	16.0	15.0					4																	1803568		2180	4267	6447	SO:0001583	missense	2261	Muenke_syndrome|Saethre-Chotzen_syndrome	Familial Cancer Database	Acrocephalosyndactyly type III;Muenke Nonsyndromic Coronal Craniosynostosis, FGFR3-related Craniosynostosis	bone maturation|cell growth|insulin receptor signaling pathway|JAK-STAT cascade|MAPKKK cascade|negative regulation of developmental growth|positive regulation of cell proliferation	integral to plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor receptor activity|identical protein binding	g.chr4:1803568C>G	M64347	CCDS3353.1, CCDS3354.1, CCDS54706.1	4p16.3	2013-01-11	2008-08-01		ENSG00000068078	ENSG00000068078		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3690	protein-coding gene	gene with protein product		134934	"""achondroplasia, thanatophoric dwarfism"""	ACH		1847508	Standard	NM_000142		Approved	CEK2, JTK4, CD333	uc003gdu.2	P22607	OTTHUMG00000121148	ENST00000260795.2:c.746C>G	4.37:g.1803568C>G	ENSP00000260795:p.Ser249Cys		Somatic				FGFR3_uc003gdu.2_Missense_Mutation_p.S249C|FGFR3_uc003gds.3_Missense_Mutation_p.S249C|FGFR3_uc003gdq.3_Missense_Mutation_p.S249C|FGFR3_uc010icb.1_Missense_Mutation_p.S91C|FGFR3_uc003gdt.1_Missense_Mutation_p.S91C	p.S249C	NM_000142	NP_000133	WXS	Illumina HiSeq	Unspecified	P22607	FGFR3_HUMAN	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		7	1002	+		Breast(71;0.212)|all_epithelial(65;0.241)	249		S -> C (in KERSEB, bladder cancer, cervical cancer and TD1).	Extracellular (Potential).		D3DVP9|D3DVQ0|Q14308|Q16294|Q16608|Q59FL9	Missense_Mutation	SNP	ENST00000260795.2	37	c.746C>G	CCDS3353.1	.	.	.	.	.	.	.	.	.	.	c	18.75	3.690127	0.68271	.	.	ENSG00000068078	ENST00000481110;ENST00000340107;ENST00000440486;ENST00000412135;ENST00000260795;ENST00000352904;ENST00000507588	D;T;T;T;T;T;T	0.82081	-1.57;-1.35;-1.33;-1.33;-1.33;-1.33;-1.32	3.94	3.94	0.45596	.	0.000000	0.85682	D	0.000000	D	0.92808	0.7713	M	0.92412	3.305	0.30597	A	0.239052	D;D;D;D;D;D	0.89917	0.998;0.997;1.0;1.0;1.0;1.0	P;D;D;D;D;D	0.80764	0.906;0.978;0.983;0.994;0.968;0.993	D	0.94822	0.7988	9	0.72032	D	0.01	.	16.2883	0.82736	0.0:1.0:0.0:0.0	.	212;249;249;249;249;249	Q8NI15;P22607-2;P22607-4;P22607-3;P22607;F8W9L4	.;.;.;.;FGFR3_HUMAN;.	C	249;249;249;249;249;249;69	ENSP00000420533:S249C;ENSP00000339824:S249C;ENSP00000414914:S249C;ENSP00000412903:S249C;ENSP00000260795:S249C;ENSP00000231803:S249C;ENSP00000427289:S69C	ENSP00000260795:S249C	S	+	2	0	FGFR3	1773366	1.000000	0.71417	1.000000	0.80357	0.445000	0.32107	7.424000	0.80242	1.903000	0.55091	0.436000	0.28706	TCC		0.736	FGFR3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000241632.2	NM_000142		4	16	0	0	0	0	4	16				
TNIP2	79155	broad.mit.edu	37	4	2746559	2746559	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr4:2746559C>T	ENST00000315423.7	-	4	857	c.771G>A	c.(769-771)atG>atA	p.M257I	TNIP2_ENST00000510267.1_Missense_Mutation_p.M150I|TNIP2_ENST00000505186.1_5'UTR|TNIP2_ENST00000503235.1_Intron	NM_024309.3	NP_077285.3			TNFAIP3 interacting protein 2											breast(2)|central_nervous_system(1)|large_intestine(4)|lung(6)|prostate(1)	14				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TCTCCTTCCTCATCAGCTCGG	0.612																																						uc003gfg.2		NA																	0				central_nervous_system(1)	1						c.(769-771)ATG>ATA		A20-binding inhibitor of NF-kappaB activation 2							60.0	65.0	63.0					4																	2746559		2203	4300	6503	SO:0001583	missense	79155					cytosol	protein binding	g.chr4:2746559C>T	BC002740	CCDS3362.1, CCDS54714.1, CCDS75093.1	4p16.3	2008-08-01			ENSG00000168884	ENSG00000168884			19118	protein-coding gene	gene with protein product		610669				11390377, 12933576	Standard	NM_024309		Approved	ABIN-2, MGC4289, KLIP, FLIP1	uc003gfg.2	Q8NFZ5	OTTHUMG00000090267	ENST00000315423.7:c.771G>A	4.37:g.2746559C>T	ENSP00000321203:p.Met257Ile		Somatic				TNIP2_uc003gff.2_Missense_Mutation_p.M150I|TNIP2_uc003gfh.2_Intron	p.M257I	NM_024309	NP_077285	WXS	Illumina HiSeq	Unspecified	Q8NFZ5	TNIP2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (64;0.168)	4	858	-			257			Potential.			Missense_Mutation	SNP	ENST00000315423.7	37	c.771G>A	CCDS3362.1	.	.	.	.	.	.	.	.	.	.	C	14.65	2.598011	0.46318	.	.	ENSG00000168884	ENST00000510267;ENST00000315423	T;T	0.45276	0.91;0.9	5.66	3.9	0.45041	.	0.148106	0.64402	D	0.000009	T	0.45216	0.1331	M	0.75264	2.295	0.80722	D	1	B	0.26318	0.146	B	0.24974	0.057	T	0.37731	-0.9693	10	0.37606	T	0.19	-14.4563	15.3577	0.74440	0.0:0.7375:0.2625:0.0	.	257	Q8NFZ5	TNIP2_HUMAN	I	150;257	ENSP00000427613:M150I;ENSP00000321203:M257I	ENSP00000321203:M257I	M	-	3	0	TNIP2	2716357	1.000000	0.71417	0.159000	0.22649	0.985000	0.73830	1.203000	0.32284	0.715000	0.32103	0.555000	0.69702	ATG		0.612	TNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206589.5	NM_024309		19	72	0	0	0	0	19	72				
LAP3	51056	broad.mit.edu	37	4	17583385	17583385	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr4:17583385C>T	ENST00000226299.4	+	3	495	c.221C>T	c.(220-222)tCt>tTt	p.S74F	LAP3_ENST00000606142.1_Missense_Mutation_p.S43F	NM_015907.2	NP_056991.2	P28838	AMPL_HUMAN	leucine aminopeptidase 3	74					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	aminopeptidase activity (GO:0004177)|manganese ion binding (GO:0030145)|metalloexopeptidase activity (GO:0008235)			endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|urinary_tract(1)	20						TGTTTTAGATCTGGACCACCT	0.418																																						uc003gph.1		NA																	0					0						c.(220-222)TCT>TTT		leucine aminopeptidase 3							183.0	173.0	176.0					4																	17583385		2203	4300	6503	SO:0001583	missense	51056				proteolysis	nucleus	aminopeptidase activity|magnesium ion binding|manganese ion binding|metalloexopeptidase activity|zinc ion binding	g.chr4:17583385C>T	AF061738	CCDS3422.1	4p15.33	2012-07-25	2003-09-12		ENSG00000002549	ENSG00000002549	3.4.11.1		18449	protein-coding gene	gene with protein product		170250	"""peptidase S"""	PEPS		6350155, 689684	Standard	NM_015907		Approved	LAPEP, LAP	uc003gph.1	P28838	OTTHUMG00000048214	ENST00000226299.4:c.221C>T	4.37:g.17583385C>T	ENSP00000226299:p.Ser74Phe		Somatic				LAP3_uc010ieg.2_Missense_Mutation_p.S74F	p.S74F	NM_015907	NP_056991	WXS	Illumina HiSeq	Unspecified	P28838	AMPL_HUMAN			3	383	+			74					B3KMQ3|Q6IAM6|Q6P0L6|Q9UQE3	Missense_Mutation	SNP	ENST00000226299.4	37	c.221C>T	CCDS3422.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.878964	0.91740	.	.	ENSG00000002549	ENST00000226299	T	0.46819	0.86	5.87	5.87	0.94306	Peptidase M17, leucyl aminopeptidase, N-terminal (1);	0.047372	0.85682	D	0.000000	T	0.60457	0.2270	L	0.60904	1.88	0.80722	D	1	D;P	0.53885	0.963;0.935	P;P	0.56648	0.781;0.803	T	0.54814	-0.8237	10	0.39692	T	0.17	-20.5261	17.0084	0.86399	0.0:0.8649:0.1351:0.0	.	43;74	P28838-2;P28838	.;AMPL_HUMAN	F	74	ENSP00000226299:S74F	ENSP00000226299:S74F	S	+	2	0	LAP3	17192483	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.440000	0.66563	2.941000	0.99782	0.655000	0.94253	TCT		0.418	LAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250365.1			12	74	0	0	0	0	12	74				
GABRB1	2560	broad.mit.edu	37	4	47427752	47427752	+	Missense_Mutation	SNP	C	C	T	rs539587921		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr4:47427752C>T	ENST00000295454.3	+	9	1434	c.1142C>T	c.(1141-1143)tCg>tTg	p.S381L	GABRB1_ENST00000538619.1_Missense_Mutation_p.S311L	NM_000812.3	NP_000803.2	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 1	381					cellular response to histamine (GO:0071420)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|ligand-gated ion channel activity (GO:0015276)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Gamma Hydroxybutyric Acid(DB01440)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lindane(DB00431)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	ACGAGTGGCTCGGAAGTGCTC	0.597													C|||	1	0.000199681	0.0	0.0	5008	,	,		16678	0.0		0.0	False		,,,				2504	0.001					uc003gxh.2		NA																	0				ovary(2)	2						c.(1141-1143)TCG>TTG		gamma-aminobutyric acid (GABA) A receptor, beta	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)						64.0	66.0	66.0					4																	47427752		2203	4300	6503	SO:0001583	missense	2560				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr4:47427752C>T		CCDS3474.1	4p12	2012-06-22			ENSG00000163288	ENSG00000163288		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4081	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 1"""	137190					Standard	NM_000812		Approved		uc003gxh.3	P18505	OTTHUMG00000044269	ENST00000295454.3:c.1142C>T	4.37:g.47427752C>T	ENSP00000295454:p.Ser381Leu		Somatic				GABRB1_uc011bze.1_Missense_Mutation_p.S311L	p.S381L	NM_000812	NP_000803	WXS	Illumina HiSeq	Unspecified	P18505	GBRB1_HUMAN			9	1516	+			381			Cytoplasmic (Probable).		B2R6U7|D6REL3|Q16166|Q8TBK3	Missense_Mutation	SNP	ENST00000295454.3	37	c.1142C>T	CCDS3474.1	.	.	.	.	.	.	.	.	.	.	C	12.57	1.976578	0.34848	.	.	ENSG00000163288	ENST00000295454;ENST00000538619	D;D	0.84370	-1.84;-1.84	5.48	4.64	0.57946	Neurotransmitter-gated ion-channel transmembrane domain (2);	1.455620	0.05312	U	0.524982	T	0.80199	0.4579	N	0.21097	0.63	0.47441	D	0.999423	B;B	0.18013	0.025;0.004	B;B	0.13407	0.009;0.003	T	0.56105	-0.8034	10	0.40728	T	0.16	-5.7084	14.2643	0.66107	0.0:0.9292:0.0:0.0708	.	311;381	F5GXV5;P18505	.;GBRB1_HUMAN	L	381;311	ENSP00000295454:S381L;ENSP00000440330:S311L	ENSP00000295454:S381L	S	+	2	0	GABRB1	47122509	0.997000	0.39634	0.890000	0.34922	0.042000	0.13812	3.301000	0.51842	1.558000	0.49541	0.650000	0.86243	TCG		0.597	GABRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216896.1			10	59	0	0	0	0	10	59				
CWH43	80157	broad.mit.edu	37	4	49034613	49034613	+	Silent	SNP	G	G	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr4:49034613G>T	ENST00000226432.4	+	12	1722	c.1539G>T	c.(1537-1539)gtG>gtT	p.V513V	CWH43_ENST00000513409.1_Silent_p.V486V	NM_025087.2	NP_079363.2	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)	513					GPI anchor biosynthetic process (GO:0006506)	integral component of membrane (GO:0016021)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(26)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43						ACCCAATTGTGAAATCTGAGC	0.468																																						uc003gyv.2		NA																	0				skin(2)|ovary(1)	3						c.(1537-1539)GTG>GTT		cell wall biogenesis 43 C-terminal homolog							271.0	236.0	248.0					4																	49034613		2203	4300	6503	SO:0001819	synonymous_variant	80157				GPI anchor biosynthetic process	integral to membrane		g.chr4:49034613G>T		CCDS3486.1, CCDS68697.1	4p12-p11	2010-09-21			ENSG00000109182	ENSG00000109182			26133	protein-coding gene	gene with protein product						17714445, 17761529	Standard	NM_025087		Approved	FLJ21511, CWH43-C	uc003gyv.3	Q9H720	OTTHUMG00000128627	ENST00000226432.4:c.1539G>T	4.37:g.49034613G>T			Somatic				CWH43_uc011bzl.1_Silent_p.V486V	p.V513V	NM_025087	NP_079363	WXS	Illumina HiSeq	Unspecified	Q9H720	PG2IP_HUMAN			12	1721	+			513					B2RPD7	Silent	SNP	ENST00000226432.4	37	c.1539G>T	CCDS3486.1																																																																																				0.468	CWH43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250496.2	NM_025087		38	204	1	0	2.41e-17	2.58e-17	38	204				
AASDH	132949	broad.mit.edu	37	4	57244556	57244556	+	Silent	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr4:57244556G>A	ENST00000205214.6	-	4	606	c.426C>T	c.(424-426)ttC>ttT	p.F142F	AASDH_ENST00000502617.1_Silent_p.F142F|AASDH_ENST00000434343.2_Intron|AASDH_ENST00000510762.1_5'UTR|AASDH_ENST00000451613.1_Silent_p.F142F|AASDH_ENST00000513376.1_Silent_p.F42F|AASDH_ENST00000602986.1_5'UTR	NM_181806.2	NP_861522.2	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	142					fatty acid metabolic process (GO:0006631)		acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)			endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	40	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				AGTGAAGTCTGAAGAGCACTA	0.313																																						uc003hbn.2		NA																	0				ovary(4)	4						c.(424-426)TTC>TTT		aminoadipate-semialdehyde dehydrogenase							80.0	78.0	79.0					4																	57244556		2203	4299	6502	SO:0001819	synonymous_variant	132949				fatty acid metabolic process		acid-thiol ligase activity|acyl carrier activity|ATP binding|cofactor binding	g.chr4:57244556G>A	AF516672	CCDS3504.1, CCDS68705.1, CCDS68706.1, CCDS75126.1, CCDS75127.1	4q12	2010-12-14			ENSG00000157426	ENSG00000157426	1.2.1.31	"""Acyl-CoA synthetase family"""	23993	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 4"""	614365				15865210, 12712191, 17762044	Standard	XM_005265721		Approved	NRPS998, LYS2, ACSF4	uc003hbn.3	Q4L235	OTTHUMG00000128841	ENST00000205214.6:c.426C>T	4.37:g.57244556G>A			Somatic				AASDH_uc010ihb.2_5'UTR|AASDH_uc011caa.1_5'UTR|AASDH_uc003hbo.2_Silent_p.F42F|AASDH_uc011cab.1_Intron|AASDH_uc010ihc.2_Silent_p.F142F|AASDH_uc003hbp.2_Silent_p.F142F	p.F142F	NM_181806	NP_861522	WXS	Illumina HiSeq	Unspecified	Q4L235	ACSF4_HUMAN			4	579	-	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)	142					A5D8V3|A5PL22|Q63HK2|Q63HR7|Q6IPP8|Q6TFZ6|Q7Z5Y3|Q96BW4|Q9P064	Silent	SNP	ENST00000205214.6	37	c.426C>T	CCDS3504.1																																																																																				0.313	AASDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250780.1	NM_181806		6	49	0	0	0	0	6	49				
YTHDC1	91746	broad.mit.edu	37	4	69203024	69203024	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr4:69203024C>T	ENST00000344157.4	-	4	939	c.604G>A	c.(604-606)Gag>Aag	p.E202K	YTHDC1_ENST00000355665.3_Missense_Mutation_p.E202K|YTHDC1_ENST00000579690.1_Missense_Mutation_p.E202K	NM_001031732.2	NP_001026902.1	Q96MU7	YTDC1_HUMAN	YTH domain containing 1	202	Glu-rich.				mRNA splice site selection (GO:0006376)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	30						actccttcctcctcATTCTCA	0.463																																						uc003hdx.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(604-606)GAG>AAG		splicing factor YT521-B isoform 1							98.0	87.0	91.0					4																	69203024		2203	4300	6503	SO:0001583	missense	91746							g.chr4:69203024C>T	AK098515	CCDS3522.2, CCDS33992.1	4q13.3	2009-01-14			ENSG00000083896	ENSG00000083896			30626	protein-coding gene	gene with protein product						12368078, 10564280	Standard	XM_005265706		Approved	YT521, KIAA1966, YT521-B	uc003hdx.3	Q96MU7	OTTHUMG00000129306	ENST00000344157.4:c.604G>A	4.37:g.69203024C>T	ENSP00000339245:p.Glu202Lys		Somatic				YTHDC1_uc003hdy.2_Missense_Mutation_p.E202K	p.E202K	NM_001031732	NP_001026902	WXS	Illumina HiSeq	Unspecified	Q96MU7	YTDC1_HUMAN			4	957	-			202			Glu-rich.		Q4W5Q3|Q7Z622|Q8TF35	Missense_Mutation	SNP	ENST00000344157.4	37	c.604G>A	CCDS33992.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.992420	0.74703	.	.	ENSG00000083896	ENST00000344157;ENST00000355665	T;T	0.31510	1.84;1.49	5.69	5.69	0.88448	.	0.121832	0.52532	D	0.000066	T	0.24812	0.0602	N	0.14661	0.345	0.58432	D	0.999998	P;P	0.50528	0.936;0.895	P;B	0.46975	0.533;0.332	T	0.02603	-1.1135	10	0.08837	T	0.75	.	19.8091	0.96540	0.0:1.0:0.0:0.0	.	202;202	Q96MU7-2;Q96MU7	.;YTDC1_HUMAN	K	202	ENSP00000339245:E202K;ENSP00000347888:E202K	ENSP00000339245:E202K	E	-	1	0	YTHDC1	68885619	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.607000	0.74163	2.684000	0.91462	0.460000	0.39030	GAG		0.463	YTHDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251437.1	NM_133370		5	35	0	0	0	0	5	35				
FRAS1	80144	broad.mit.edu	37	4	79328882	79328882	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr4:79328882G>C	ENST00000325942.6	+	31	4635	c.4195G>C	c.(4195-4197)Gat>Cat	p.D1399H	FRAS1_ENST00000264895.6_Missense_Mutation_p.D1399H	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	1399					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						GCACCTGCCTGATGGGAGGAC	0.587																																						uc003hlb.2		NA																	0				large_intestine(5)	5						c.(4195-4197)GAT>CAT		Fraser syndrome 1							82.0	88.0	86.0					4																	79328882		2100	4220	6320	SO:0001583	missense	80144				cell communication	integral to membrane|plasma membrane	metal ion binding	g.chr4:79328882G>C	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.4195G>C	4.37:g.79328882G>C	ENSP00000326330:p.Asp1399His		Somatic				FRAS1_uc003hkw.2_Missense_Mutation_p.D1399H	p.D1399H	NM_025074	NP_079350	WXS	Illumina HiSeq	Unspecified	Q86XX4	FRAS1_HUMAN			31	4635	+			1398			CSPG 3.|Extracellular (Potential).		A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000325942.6	37	c.4195G>C	CCDS54772.1	.	.	.	.	.	.	.	.	.	.	G	19.72	3.879497	0.72294	.	.	ENSG00000138759	ENST00000325942;ENST00000264895	T;T	0.53640	0.61;0.61	5.67	5.67	0.87782	.	0.191129	0.44688	D	0.000433	T	0.53190	0.1781	M	0.70595	2.14	0.80722	D	1	P;P	0.48764	0.82;0.915	B;B	0.42495	0.222;0.389	T	0.59757	-0.7394	10	0.56958	D	0.05	.	18.7528	0.91821	0.0:0.0:1.0:0.0	.	1399;1399	E9PHH6;A2RRR8	.;.	H	1399	ENSP00000326330:D1399H;ENSP00000264895:D1399H	ENSP00000264895:D1399H	D	+	1	0	FRAS1	79547906	1.000000	0.71417	0.998000	0.56505	0.962000	0.63368	5.998000	0.70653	2.671000	0.90904	0.585000	0.79938	GAT		0.587	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362706.2			8	56	0	0	0	0	8	56				
FRAS1	80144	broad.mit.edu	37	4	79461904	79461904	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr4:79461904G>A	ENST00000264895.6	+	74	12105	c.11665G>A	c.(11665-11667)Gag>Aag	p.E3889K		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	3885					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						CCTGAATCTGGAGATGCAAGA	0.517																																						uc003hlb.2		NA																	0				large_intestine(5)	5						c.(11665-11667)GAG>AAG		Fraser syndrome 1							48.0	52.0	51.0					4																	79461904		2020	4195	6215	SO:0001583	missense	80144				cell communication	integral to membrane|plasma membrane	metal ion binding	g.chr4:79461904G>A	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.11665G>A	4.37:g.79461904G>A	ENSP00000264895:p.Glu3889Lys		Somatic					p.E3889K	NM_025074	NP_079350	WXS	Illumina HiSeq	Unspecified	Q86XX4	FRAS1_HUMAN			74	12105	+			3884			Extracellular (Potential).		A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000264895.6	37	c.11665G>A	CCDS54771.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.99|16.99	3.274499|3.274499	0.59649|0.59649	.|.	.|.	ENSG00000138759|ENSG00000138759	ENST00000264895|ENST00000512123	T|.	0.54675|.	0.56|.	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	0.222111|.	0.45126|.	D|.	0.000389|.	T|T	0.74291|0.74291	0.3697|0.3697	L|L	0.56769|0.56769	1.78|1.78	0.80722|0.80722	D|D	1|1	P|.	0.50066|.	0.931|.	B|.	0.43867|.	0.434|.	T|T	0.68100|0.68100	-0.5498|-0.5498	10|5	0.72032|.	D|.	0.01|.	.|.	20.8794|20.8794	0.99867|0.99867	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	3889|.	E9PHH6|.	.|.	K|E	3889|2117	ENSP00000264895:E3889K|.	ENSP00000264895:E3889K|.	E|G	+|+	1|2	0|0	FRAS1|FRAS1	79680928|79680928	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.401000|0.401000	0.30781|0.30781	7.414000|7.414000	0.80117|0.80117	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GAG|GGA		0.517	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				4	22	0	0	0	0	4	22				
ABCG2	9429	broad.mit.edu	37	4	89052248	89052248	+	Missense_Mutation	SNP	G	G	C	rs1061017		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr4:89052248G>C	ENST00000237612.3	-	5	1041	c.496C>G	c.(496-498)Caa>Gaa	p.Q166E	ABCG2_ENST00000515655.1_Missense_Mutation_p.Q166E	NM_004827.2	NP_004818.2	Q9UNQ0	ABCG2_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 2 (Junior blood group)	166	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.		Q -> E (in dbSNP:rs1061017). {ECO:0000269|PubMed:12958161, ECO:0000269|PubMed:9850061}.		cellular iron ion homeostasis (GO:0006879)|drug export (GO:0046618)|drug transmembrane transport (GO:0006855)|embryonic process involved in female pregnancy (GO:0060136)|heme transport (GO:0015886)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|urate metabolic process (GO:0046415)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(13)|lung(10)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;7.02e-05)	Afatinib(DB08916)|Apixaban(DB06605)|Buprenorphine(DB00921)|Cabazitaxel(DB06772)|Carboplatin(DB00958)|Cisplatin(DB00515)|Cladribine(DB00242)|Clofarabine(DB00631)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Diethylstilbestrol(DB00255)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gefitinib(DB00317)|Glyburide(DB01016)|Hesperetin(DB01094)|Hydrocortisone(DB00741)|Imatinib(DB00619)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Lansoprazole(DB00448)|Leflunomide(DB01097)|Methotrexate(DB00563)|Mitoxantrone(DB01204)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Nilotinib(DB04868)|Nitrofurantoin(DB00698)|Novobiocin(DB01051)|Omeprazole(DB00338)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Pitavastatin(DB08860)|Ponatinib(DB08901)|Pravastatin(DB00175)|Prazosin(DB00457)|Rabeprazole(DB01129)|Regorafenib(DB08896)|Rilpivirine(DB08864)|Riluzole(DB00740)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Sorafenib(DB00398)|Sulfasalazine(DB00795)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Teniposide(DB00444)|Teriflunomide(DB08880)|Testosterone(DB00624)|Topotecan(DB01030)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vincristine(DB00541)|Vismodegib(DB08828)|Zafirlukast(DB00549)|Zidovudine(DB00495)	CCTAACTCTTGAATGACCCTG	0.418																																						uc003hrg.2		NA																	0				central_nervous_system(1)	1						c.(496-498)CAA>GAA		ATP-binding cassette, sub-family G, member 2	Imatinib(DB00619)|Mitoxantrone(DB01204)|Nicardipine(DB00622)|Nitrendipine(DB01054)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Topotecan(DB01030)						258.0	231.0	240.0					4																	89052248		2203	4300	6503	SO:0001583	missense	9429				cellular iron ion homeostasis|urate metabolic process	integral to membrane|plasma membrane	ATP binding|heme transporter activity|protein homodimerization activity|xenobiotic-transporting ATPase activity	g.chr4:89052248G>C	AF103796	CCDS3628.1, CCDS58910.1	4q22.1	2014-08-27	2014-08-27		ENSG00000118777	ENSG00000118777		"""CD molecules"", ""ATP binding cassette transporters / subfamily G"""	74	protein-coding gene	gene with protein product		603756	"""ATP-binding cassette, sub-family G (WHITE), member 2"""			8894702, 9861027	Standard	NM_001257386		Approved	EST157481, MXR, BCRP, ABCP, CD338	uc003hrg.3	Q9UNQ0	OTTHUMG00000130601	ENST00000237612.3:c.496C>G	4.37:g.89052248G>C	ENSP00000237612:p.Gln166Glu		Somatic				ABCG2_uc003hrh.2_Missense_Mutation_p.Q166E|ABCG2_uc003hrf.2_Missense_Mutation_p.Q36E	p.Q166E	NM_004827	NP_004818	WXS	Illumina HiSeq	Unspecified	Q9UNQ0	ABCG2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;7.02e-05)	5	989	-		Hepatocellular(203;0.114)	166			ABC transporter.|Cytoplasmic (Potential).		A0A1W3|A8K1T5|O95374|Q4W5I3|Q53ZQ1|Q569L4|Q5YLG4|Q86V64|Q8IX16|Q96LD6|Q96TA8|Q9BY73|Q9NUS0	Missense_Mutation	SNP	ENST00000237612.3	37	c.496C>G	CCDS3628.1	.	.	.	.	.	.	.	.	.	.	G	0.832	-0.744871	0.03065	.	.	ENSG00000118777	ENST00000515655;ENST00000237612	T;T	0.38887	1.11;1.11	5.22	1.67	0.24075	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.850354	0.10788	N	0.634087	T	0.16342	0.0393	N	0.02142	-0.665	0.23056	N	0.998363	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.06405	0.002;0.002;0.002	T	0.11397	-1.0589	10	0.02654	T	1	-1.7515	13.5197	0.61561	0.0:0.0:0.2303:0.7697	rs1061017;rs61674446	166;166;166	Q9UNQ0-2;Q9UNQ0;Q4W5I3	.;ABCG2_HUMAN;.	E	166	ENSP00000426917:Q166E;ENSP00000237612:Q166E	ENSP00000237612:Q166E	Q	-	1	0	ABCG2	89271272	0.999000	0.42202	1.000000	0.80357	0.639000	0.38242	0.716000	0.25836	0.572000	0.29383	0.655000	0.94253	CAA		0.418	ABCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253051.1	NM_004827		27	161	0	0	0	0	27	161				
LRIT3	345193	broad.mit.edu	37	4	110791623	110791623	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr4:110791623G>A	ENST00000594814.1	+	4	1718	c.1718G>A	c.(1717-1719)aGa>aAa	p.R573K	LRIT3_ENST00000409621.2_Missense_Mutation_p.R390K|LRIT3_ENST00000327908.3_Missense_Mutation_p.R390K|LRIT3_ENST00000379920.3_Missense_Mutation_p.R528K	NM_198506.3	NP_940908.3	Q3SXY7	LRIT3_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 3	573	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				cervix(1)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)|skin(1)	16				OV - Ovarian serous cystadenocarcinoma(123;0.0011)		TCTACTGAAAGAGTTGAAGGA	0.453																																						uc003hzx.3		NA																	0					0						c.(1582-1584)AGA>AAA		leucine-rich repeat, immunoglobulin-like and							160.0	153.0	155.0					4																	110791623		2203	4300	6503	SO:0001583	missense	345193					integral to membrane		g.chr4:110791623G>A	AK126648	CCDS3688.2, CCDS3688.3	4q25	2014-01-28	2007-06-19		ENSG00000183423	ENSG00000183423		"""Immunoglobulin superfamily / I-set domain containing"""	24783	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 4"""	615004					Standard	NM_198506		Approved	FLJ44691, FIGLER4, CSNB1F	uc031sgv.1	Q3SXY7	OTTHUMG00000132043	ENST00000594814.1:c.1718G>A	4.37:g.110791623G>A	ENSP00000469759:p.Arg573Lys		Somatic				LRIT3_uc003hzw.3_Missense_Mutation_p.R390K	p.R528K	NM_198506	NP_940908	WXS	Illumina HiSeq	Unspecified	Q3SXY7	LRIT3_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.0011)	3	1776	+			528			Fibronectin type-III.		C9J1C2|Q6ZTG1	Missense_Mutation	SNP	ENST00000594814.1	37	c.1583G>A	CCDS3688.3	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.083527	0.00371	.	.	ENSG00000183423	ENST00000327908;ENST00000379920;ENST00000409621	T;T;T	0.56941	0.43;0.61;0.43	5.16	-2.29	0.06805	.	1.160920	0.05822	N	0.615995	T	0.38772	0.1053	L	0.47716	1.5	0.09310	N	1	B;B	0.10296	0.001;0.003	B;B	0.08055	0.001;0.003	T	0.12553	-1.0543	10	0.19147	T	0.46	.	3.0655	0.06213	0.1726:0.3428:0.3141:0.1705	.	528;390	Q3SXY7;Q3SXY7-2	LRIT3_HUMAN;.	K	390;528;390	ENSP00000328222:R390K;ENSP00000369252:R528K;ENSP00000386734:R390K	ENSP00000328222:R390K	R	+	2	0	LRIT3	111011072	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.112000	0.15479	-1.058000	0.03197	-0.795000	0.03280	AGA		0.453	LRIT3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335270.2	NM_198506		17	65	0	0	0	0	17	65				
KIAA1109	84162	broad.mit.edu	37	4	123161431	123161431	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr4:123161431C>T	ENST00000264501.4	+	29	4967	c.4594C>T	c.(4594-4596)Cgt>Tgt	p.R1532C	KIAA1109_ENST00000388738.3_Missense_Mutation_p.R1532C|KIAA1109_ENST00000455637.1_Missense_Mutation_p.R1532C			Q2LD37	K1109_HUMAN	KIAA1109	1532					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						CTCATTGCATCGTCCCCTTGA	0.383																																						uc003ieh.2		NA																	0				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						c.(4594-4596)CGT>TGT		fragile site-associated protein							130.0	123.0	125.0					4																	123161431		1894	4117	6011	SO:0001583	missense	84162				regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus		g.chr4:123161431C>T	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.4594C>T	4.37:g.123161431C>T	ENSP00000264501:p.Arg1532Cys		Somatic				KIAA1109_uc003iei.1_Missense_Mutation_p.R1285C|KIAA1109_uc010ins.1_Missense_Mutation_p.R875C|KIAA1109_uc003iek.2_Missense_Mutation_p.R151C	p.R1532C	NM_015312	NP_056127	WXS	Illumina HiSeq	Unspecified	Q2LD37	K1109_HUMAN			27	4639	+			1532					Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	37	c.4594C>T	CCDS43267.1	.	.	.	.	.	.	.	.	.	.	C	19.64	3.866364	0.72065	.	.	ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000455637	T;T;T	0.26067	2.36;2.36;1.76	5.39	4.53	0.55603	.	0.000000	0.44902	U	0.000407	T	0.33265	0.0857	N	0.12182	0.205	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.99	T	0.32161	-0.9917	10	0.48119	T	0.1	.	15.6533	0.77115	0.1383:0.8617:0.0:0.0	.	1531;1532	Q2LD37-2;Q2LD37	.;K1109_HUMAN	C	1532	ENSP00000264501:R1532C;ENSP00000373390:R1532C;ENSP00000389925:R1532C	ENSP00000264501:R1532C	R	+	1	0	KIAA1109	123380881	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	5.584000	0.67490	1.354000	0.45846	0.650000	0.86243	CGT		0.383	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797		15	77	0	0	0	0	15	77				
RNF150	57484	broad.mit.edu	37	4	142053860	142053860	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr4:142053860C>G	ENST00000515673.2	-	1	136	c.103G>C	c.(103-105)Gag>Cag	p.E35Q	RNF150_ENST00000306799.3_Missense_Mutation_p.E35Q|RNF150_ENST00000507500.1_Missense_Mutation_p.E35Q|RNF150_ENST00000420921.2_Intron			Q9ULK6	RN150_HUMAN	ring finger protein 150	35						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)|large_intestine(10)|lung(7)|ovary(1)	19	all_hematologic(180;0.162)					TCCTCCTTCTCGGCCACGGTA	0.647																																						uc003iio.1		NA																	0				ovary(1)	1						c.(103-105)GAG>CAG		ring finger protein 150 precursor							72.0	60.0	64.0					4																	142053860		2203	4300	6503	SO:0001583	missense	57484					integral to membrane	zinc ion binding	g.chr4:142053860C>G	AB033040	CCDS34065.1	4q31.1	2013-01-09			ENSG00000170153	ENSG00000170153		"""RING-type (C3HC4) zinc fingers"""	23138	protein-coding gene	gene with protein product						10574462	Standard	XM_005263150		Approved	KIAA1214	uc003iio.1	Q9ULK6	OTTHUMG00000161380	ENST00000515673.2:c.103G>C	4.37:g.142053860C>G	ENSP00000425840:p.Glu35Gln		Somatic				RNF150_uc010iok.1_Missense_Mutation_p.E35Q|RNF150_uc003iip.1_Missense_Mutation_p.E35Q	p.E35Q	NM_020724	NP_065775	WXS	Illumina HiSeq	Unspecified	Q9ULK6	RN150_HUMAN			1	757	-	all_hematologic(180;0.162)		35			Extracellular (Potential).		Q3T1D0|Q6ZNW6	Missense_Mutation	SNP	ENST00000515673.2	37	c.103G>C	CCDS34065.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.192423	0.78902	.	.	ENSG00000170153	ENST00000306799;ENST00000515673;ENST00000507500	T;T;T	0.14893	2.47;3.43;3.45	3.4	3.4	0.38934	.	0.143100	0.45867	D	0.000337	T	0.08714	0.0216	N	0.03608	-0.345	0.80722	D	1	P;B;P	0.38800	0.648;0.182;0.524	B;B;B	0.37650	0.255;0.066;0.13	T	0.38308	-0.9667	10	0.32370	T	0.25	.	15.6897	0.77439	0.0:1.0:0.0:0.0	.	35;35;35	Q9ULK6-2;Q9ULK6-3;Q9ULK6	.;.;RN150_HUMAN	Q	35	ENSP00000304321:E35Q;ENSP00000425840:E35Q;ENSP00000425568:E35Q	ENSP00000304321:E35Q	E	-	1	0	RNF150	142273310	1.000000	0.71417	1.000000	0.80357	0.760000	0.43138	7.206000	0.77891	1.858000	0.53909	0.305000	0.20034	GAG		0.647	RNF150-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364739.2	XM_291090		8	44	0	0	0	0	8	44				
NR3C2	4306	broad.mit.edu	37	4	149357542	149357542	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr4:149357542C>T	ENST00000358102.3	-	2	833	c.471G>A	c.(469-471)gtG>gtA	p.V157V	NR3C2_ENST00000344721.4_Silent_p.V157V|NR3C2_ENST00000511528.1_Silent_p.V157V|NR3C2_ENST00000355292.3_Silent_p.V157V|NR3C2_ENST00000512865.1_Silent_p.V157V	NM_000901.4|NM_001166104.1	NP_000892.2|NP_001159576.1	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	157	Modulating.				gene expression (GO:0010467)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|receptor complex (GO:0043235)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Drospirenone(DB01395)|Eplerenone(DB00700)|Felodipine(DB01023)|Fludrocortisone(DB00687)|Fluticasone Propionate(DB00588)|Nimodipine(DB00393)|Progesterone(DB00396)|Spironolactone(DB00421)	AGGGCGTGTTCACACAACTTA	0.448																																					Melanoma(27;428 957 40335 51025 51111)	uc003ilj.3		NA																	0				large_intestine(1)	1						c.(469-471)GTG>GTA		nuclear receptor subfamily 3, group C, member 2	Desoxycorticosterone Pivalate(DB01134)|Eplerenone(DB00700)|Fludrocortisone(DB00687)|Spironolactone(DB00421)						105.0	103.0	104.0					4																	149357542		2203	4300	6503	SO:0001819	synonymous_variant	4306				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	endoplasmic reticulum membrane|nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding	g.chr4:149357542C>T	M16801	CCDS3772.1, CCDS54811.1	4q31	2013-01-16			ENSG00000151623	ENSG00000151623		"""Nuclear hormone receptors"""	7979	protein-coding gene	gene with protein product		600983		MLR		2558856	Standard	NM_000901		Approved	MR	uc003ilj.4	P08235	OTTHUMG00000161455	ENST00000358102.3:c.471G>A	4.37:g.149357542C>T			Somatic				NR3C2_uc003ilk.3_Silent_p.V157V|NR3C2_uc010iph.2_RNA	p.V157V	NM_000901	NP_000892	WXS	Illumina HiSeq	Unspecified	P08235	MCR_HUMAN		GBM - Glioblastoma multiforme(119;0.0614)	2	805	-	all_hematologic(180;0.151)		157			Modulating.		B0ZBF5|B0ZBF7|Q2NKL1|Q96KQ8|Q96KQ9	Silent	SNP	ENST00000358102.3	37	c.471G>A	CCDS3772.1																																																																																				0.448	NR3C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364986.1			16	132	0	0	0	0	16	132				
KIAA0922	23240	broad.mit.edu	37	4	154553947	154553947	+	Missense_Mutation	SNP	G	G	A	rs376883381		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr4:154553947G>A	ENST00000409663.3	+	32	4334	c.4282G>A	c.(4282-4284)Ggc>Agc	p.G1428S	KIAA0922_ENST00000440693.1_Missense_Mutation_p.G1345S|KIAA0922_ENST00000409959.3_Missense_Mutation_p.G1429S	NM_015196.3	NP_056011.3	A2VDJ0	T131L_HUMAN	KIAA0922	1428						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(16)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	63	all_hematologic(180;0.093)	Renal(120;0.118)				CCTGGAGAACGGCGTGCCTTG	0.532																																						uc003inm.3		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(4282-4284)GGC>AGC		hypothetical protein LOC23240 isoform 2		G	SER/GLY,SER/GLY	0,4406		0,0,2203	135.0	103.0	114.0		4282,4285	-10.2	0.0	4		114	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	KIAA0922	NM_015196.3,NM_001131007.1	56,56	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	1428/1610,1429/1611	154553947	1,13005	2203	4300	6503	SO:0001583	missense	23240					integral to membrane		g.chr4:154553947G>A	AK096538	CCDS3783.2, CCDS47148.1	4q31.3	2008-02-05			ENSG00000121210	ENSG00000121210			29146	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_015196		Approved	DKFZp586H1322, TMEM131L	uc010ipp.3	A2VDJ0	OTTHUMG00000153244	ENST00000409663.3:c.4282G>A	4.37:g.154553947G>A	ENSP00000386574:p.Gly1428Ser		Somatic				KIAA0922_uc010ipp.2_Missense_Mutation_p.G1429S|KIAA0922_uc010ipq.2_Missense_Mutation_p.G1197S	p.G1428S	NM_015196	NP_056011	WXS	Illumina HiSeq	Unspecified	A2VDJ0	T131L_HUMAN			32	4334	+	all_hematologic(180;0.093)	Renal(120;0.118)	1428			Cytoplasmic (Potential).		B3KRV3|Q7LGA7|Q86Y92|Q8WU56|Q9H065|Q9Y2D7	Missense_Mutation	SNP	ENST00000409663.3	37	c.4282G>A	CCDS3783.2	.	.	.	.	.	.	.	.	.	.	G	2.711	-0.268709	0.05716	0.0	1.16E-4	ENSG00000121210	ENST00000409663;ENST00000440693;ENST00000409959;ENST00000240487	T;T;T;T	0.15372	2.7;2.43;2.7;2.43	5.09	-10.2	0.00374	.	1.225170	0.05287	N	0.520345	T	0.05273	0.0140	N	0.10874	0.06	0.09310	N	1	B;B;B	0.11235	0.004;0.003;0.002	B;B;B	0.08055	0.003;0.003;0.001	T	0.23797	-1.0178	10	0.02654	T	1	2.2294	5.4351	0.16476	0.3482:0.1027:0.4491:0.1	.	1345;1429;1428	A2VDJ0-3;A2VDJ0-5;A2VDJ0	.;.;T131L_HUMAN	S	1428;1345;1429;1206	ENSP00000386574:G1428S;ENSP00000409663:G1345S;ENSP00000386787:G1429S;ENSP00000240487:G1206S	ENSP00000240487:G1206S	G	+	1	0	KIAA0922	154773397	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.327000	0.07955	-2.722000	0.00388	-1.119000	0.02030	GGC		0.532	KIAA0922-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330370.1	NM_015196		11	51	0	0	0	0	11	51				
FNIP2	57600	broad.mit.edu	37	4	159790180	159790180	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr4:159790180G>C	ENST00000264433.6	+	13	2467	c.2392G>C	c.(2392-2394)Gac>Cac	p.D798H	FNIP2_ENST00000379346.3_Missense_Mutation_p.D821H	NM_020840.1	NP_065891.1	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2	798	Interaction with PRKAA1.				intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|regulation of protein phosphorylation (GO:0001932)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	9	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		TTTTGCAGAGGACAGAGGCAG	0.562																																						uc003iqe.3		NA																	0					0						c.(2392-2394)GAC>CAC		folliculin interacting protein 2							90.0	95.0	94.0					4																	159790180		2128	4246	6374	SO:0001583	missense	57600				DNA damage response, signal transduction resulting in induction of apoptosis|protein phosphorylation|regulation of protein phosphorylation	cytoplasm	protein binding	g.chr4:159790180G>C	AB040883	CCDS47155.1	4q32.1	2012-10-31			ENSG00000052795	ENSG00000052795			29280	protein-coding gene	gene with protein product	"""O6-methylguanine-induced apoptosis 1"""	612768				18403135	Standard	NM_020840		Approved	KIAA1450, FNIPL, MAPO1	uc003iqe.4	Q9P278	OTTHUMG00000161983	ENST00000264433.6:c.2392G>C	4.37:g.159790180G>C	ENSP00000264433:p.Asp798His		Somatic					p.D798H	NM_020840	NP_065891	WXS	Illumina HiSeq	Unspecified	Q9P278	FNIP2_HUMAN		COAD - Colon adenocarcinoma(41;0.00936)	13	2575	+	all_hematologic(180;0.24)		798			Interaction with PRKAA1.		Q05DC3|Q96I31|Q9H994	Missense_Mutation	SNP	ENST00000264433.6	37	c.2392G>C	CCDS47155.1	.	.	.	.	.	.	.	.	.	.	G	17.76	3.468954	0.63625	.	.	ENSG00000052795	ENST00000264433;ENST00000379346	T;T	0.28666	1.61;1.6	5.59	2.86	0.33363	.	0.502966	0.22740	N	0.056216	T	0.33673	0.0871	M	0.70275	2.135	0.28760	N	0.900931	P	0.48503	0.911	P	0.45610	0.487	T	0.24512	-1.0158	9	.	.	.	.	6.2465	0.20820	0.2652:0.1338:0.601:0.0	.	798	Q9P278	FNIP2_HUMAN	H	798;821	ENSP00000264433:D798H;ENSP00000368651:D821H	.	D	+	1	0	FNIP2	160009630	0.948000	0.32251	0.764000	0.31436	0.834000	0.47266	0.960000	0.29253	0.364000	0.24374	0.655000	0.94253	GAC		0.562	FNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366602.1	NM_020840		13	143	0	0	0	0	13	143				
CDH10	1008	broad.mit.edu	37	5	24537725	24537725	+	Missense_Mutation	SNP	C	C	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr5:24537725C>A	ENST00000264463.4	-	3	797	c.290G>T	c.(289-291)gGa>gTa	p.G97V		NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	97	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		AGTACCAGCTCCATCTCCAGA	0.363										HNSCC(23;0.051)																												uc003jgr.1		NA																	0				ovary(6)|pancreas(4)|breast(2)	12						c.(289-291)GGA>GTA		cadherin 10, type 2 preproprotein							82.0	80.0	81.0					5																	24537725		2203	4300	6503	SO:0001583	missense	1008				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:24537725C>A	AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.290G>T	5.37:g.24537725C>A	ENSP00000264463:p.Gly97Val	HNSCC(23;0.051)	Somatic				CDH10_uc011cnu.1_RNA	p.G97V	NM_006727	NP_006718	WXS	Illumina HiSeq	Unspecified	Q9Y6N8	CAD10_HUMAN		STAD - Stomach adenocarcinoma(35;0.0556)	3	622	-			97			Cadherin 1.|Extracellular (Potential).		Q9ULB3	Missense_Mutation	SNP	ENST00000264463.4	37	c.290G>T	CCDS3892.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.612364	0.87258	.	.	ENSG00000040731	ENST00000264463	T	0.61510	0.1	5.88	5.88	0.94601	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.79499	0.4456	M	0.82323	2.585	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80843	-0.1201	10	0.66056	D	0.02	.	19.2219	0.93801	0.0:1.0:0.0:0.0	.	97	Q9Y6N8	CAD10_HUMAN	V	97	ENSP00000264463:G97V	ENSP00000264463:G97V	G	-	2	0	CDH10	24573482	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.486000	0.81215	2.791000	0.96007	0.563000	0.77884	GGA		0.363	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	NM_006727		9	58	1	0	7.48e-07	7.87e-07	9	58				
RXFP3	51289	broad.mit.edu	37	5	33938124	33938124	+	Missense_Mutation	SNP	G	G	A	rs138975968		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr5:33938124G>A	ENST00000330120.3	+	1	1634	c.1279G>A	c.(1279-1281)Gag>Aag	p.E427K		NM_016568.3	NP_057652.1	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3	427					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled peptide receptor activity (GO:0008528)|G-protein coupled receptor activity (GO:0004930)	p.E427*(1)		endometrium(4)|large_intestine(9)|lung(24)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)	42						GCCGGAGCACGAGGATCAGGG	0.706																																						uc003jic.1		NA																	1	Substitution - Nonsense(1)		endometrium(1)	upper_aerodigestive_tract(1)	1						c.(1279-1281)GAG>AAG		relaxin/insulin-like family peptide receptor 3							18.0	21.0	20.0					5																	33938124		2180	4268	6448	SO:0001583	missense	51289					integral to plasma membrane	N-formyl peptide receptor activity	g.chr5:33938124G>A	D88437	CCDS3900.1	5p15.1-p14	2012-08-08	2006-05-09	2006-03-15	ENSG00000182631	ENSG00000182631		"""GPCR / Class A : Relaxin family peptide receptors"""	24883	protein-coding gene	gene with protein product		609445	"""relaxin 3 receptor 1"", ""relaxin family peptide receptor 3"""	RLN3R1		15956688, 16507880	Standard	NM_016568		Approved	SALPR, GPCR135, RXFPR3	uc003jic.2	Q9NSD7	OTTHUMG00000090685	ENST00000330120.3:c.1279G>A	5.37:g.33938124G>A	ENSP00000328708:p.Glu427Lys		Somatic					p.E427K	NM_016568	NP_057652	WXS	Illumina HiSeq	Unspecified	Q9NSD7	RL3R1_HUMAN			1	1636	+			427			Cytoplasmic (Potential).		Q14DA5	Missense_Mutation	SNP	ENST00000330120.3	37	c.1279G>A	CCDS3900.1	.	.	.	.	.	.	.	.	.	.	G	16.53	3.148443	0.57151	.	.	ENSG00000182631	ENST00000330120	T	0.70045	-0.45	5.64	4.75	0.60458	.	0.493058	0.18403	N	0.142287	T	0.47340	0.1440	N	0.19112	0.55	0.43977	D	0.996662	P	0.35628	0.513	B	0.17722	0.019	T	0.41070	-0.9529	10	0.20519	T	0.43	-8.8938	16.4496	0.83976	0.0:0.1314:0.8686:0.0	.	427	Q9NSD7	RL3R1_HUMAN	K	427	ENSP00000328708:E427K	ENSP00000328708:E427K	E	+	1	0	RXFP3	33973881	1.000000	0.71417	0.866000	0.34008	0.857000	0.48899	4.538000	0.60650	1.326000	0.45319	0.655000	0.94253	GAG		0.706	RXFP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207369.1	NM_016568		6	23	0	0	0	0	6	23				
LMBRD2	92255	broad.mit.edu	37	5	36122457	36122457	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr5:36122457G>A	ENST00000296603.4	-	9	1507	c.1045C>T	c.(1045-1047)Cat>Tat	p.H349Y		NM_001007527.1	NP_001007528.1	Q68DH5	LMBD2_HUMAN	LMBR1 domain containing 2	349						integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(12)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_lung(31;0.000146)		Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ACAAACTGATGAGTAGCACTA	0.333																																						uc003jkb.1		NA																	0					0						c.(1045-1047)CAT>TAT		LMBR1 domain containing 2							107.0	105.0	106.0					5																	36122457		2203	4300	6503	SO:0001583	missense	92255					integral to membrane		g.chr5:36122457G>A		CCDS34145.1	5p13.2	2008-02-05			ENSG00000164187	ENSG00000164187			25287	protein-coding gene	gene with protein product							Standard	NM_001007527		Approved	DKFZp434H2226	uc003jkb.1	Q68DH5	OTTHUMG00000162150	ENST00000296603.4:c.1045C>T	5.37:g.36122457G>A	ENSP00000296603:p.His349Tyr		Somatic					p.H349Y	NM_001007527	NP_001007528	WXS	Illumina HiSeq	Unspecified	Q68DH5	LMBD2_HUMAN	Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		9	1460	-	all_lung(31;0.000146)		349			Cytoplasmic (Potential).		B3KRB6|Q9NTC7	Missense_Mutation	SNP	ENST00000296603.4	37	c.1045C>T	CCDS34145.1	.	.	.	.	.	.	.	.	.	.	G	14.17	2.454198	0.43634	.	.	ENSG00000164187	ENST00000296603;ENST00000546130	.	.	.	5.69	4.81	0.61882	LMBR1-like membrane protein (1);	0.862308	0.10459	N	0.672199	T	0.29783	0.0744	L	0.38175	1.15	0.23126	N	0.998255	B	0.24576	0.106	B	0.26969	0.075	T	0.34900	-0.9810	9	0.02654	T	1	-0.3193	8.5089	0.33204	0.0785:0.0:0.7697:0.1519	.	349	Q68DH5	LMBD2_HUMAN	Y	349;243	.	ENSP00000296603:H349Y	H	-	1	0	LMBRD2	36158214	1.000000	0.71417	0.344000	0.25628	0.960000	0.62799	6.288000	0.72679	1.342000	0.45619	0.650000	0.86243	CAT		0.333	LMBRD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367552.1	NM_001007527		10	41	0	0	0	0	10	41				
GDNF	2668	broad.mit.edu	37	5	37815932	37815932	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr5:37815932C>G	ENST00000326524.2	-	3	656	c.457G>C	c.(457-459)Gag>Cag	p.E153Q	GDNF_ENST00000427982.1_Missense_Mutation_p.E170Q|GDNF_ENST00000515058.1_Missense_Mutation_p.E127Q|GDNF_ENST00000381826.4_Missense_Mutation_p.E144Q|GDNF_ENST00000344622.4_Missense_Mutation_p.E127Q	NM_000514.3	NP_000505.1	P39905	GDNF_HUMAN	glial cell derived neurotrophic factor	153					adult locomotory behavior (GO:0008344)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|enteric nervous system development (GO:0048484)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|metanephros development (GO:0001656)|mRNA stabilization (GO:0048255)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neuron projection development (GO:0031175)|organ induction (GO:0001759)|peristalsis (GO:0030432)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0072108)|positive regulation of monooxygenase activity (GO:0032770)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of ureteric bud formation (GO:0072107)|postganglionic parasympathetic nervous system development (GO:0021784)|postsynaptic membrane organization (GO:0001941)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of morphogenesis of a branching structure (GO:0060688)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|ureteric bud formation (GO:0060676)	extracellular region (GO:0005576)	protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			NS(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(8)|skin(2)	15	all_lung(31;0.00118)					TACGTTGTCTCAGCTGCATCG	0.443																																						uc011cpi.1		NA																	0					0						c.(457-459)GAG>CAG		glial cell derived neurotrophic factor isoform 1							119.0	117.0	117.0					5																	37815932		2203	4300	6503	SO:0001583	missense	2668				adult locomotory behavior|anti-apoptosis|axon guidance|branching involved in ureteric bud morphogenesis|enteric nervous system development|mRNA stabilization|negative regulation of neuron apoptosis|neural crest cell migration|peristalsis|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of dopamine secretion|positive regulation of monooxygenase activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of ureteric bud formation|postganglionic parasympathetic nervous system development|regulation of dopamine uptake|signal transduction|sympathetic nervous system development	extracellular region	growth factor activity|protein homodimerization activity	g.chr5:37815932C>G		CCDS3922.1, CCDS3923.1, CCDS54845.1, CCDS54846.1, CCDS75237.1	5p13.1-p12	2014-01-30			ENSG00000168621	ENSG00000168621		"""Endogenous ligands"""	4232	protein-coding gene	gene with protein product	"""astrocyte-derived trophic factor"", ""glial cell line derived neurotrophic factor"", ""glial derived neurotrophic factor"""	600837				8493557	Standard	NM_199231		Approved	ATF1, ATF2, HFB1-GDNF	uc011cpg.2	P39905	OTTHUMG00000090809	ENST00000326524.2:c.457G>C	5.37:g.37815932C>G	ENSP00000317145:p.Glu153Gln		Somatic				GDNF_uc011cpc.1_Missense_Mutation_p.E75Q|GDNF_uc011cpd.1_Missense_Mutation_p.E101Q|GDNF_uc011cpe.1_Missense_Mutation_p.E127Q|GDNF_uc011cpf.1_Missense_Mutation_p.E127Q|GDNF_uc011cpg.1_Missense_Mutation_p.E170Q|GDNF_uc011cph.1_Missense_Mutation_p.E144Q	p.E153Q	NM_000514	NP_000505	WXS	Illumina HiSeq	Unspecified	P39905	GDNF_HUMAN			3	657	-	all_lung(31;0.00118)		153					B7WPK7|O95448|O95449|O95986|Q6FH33|Q96L44|Q9UD32|Q9UD33|Q9UMV2|Q9UP67|Q9UP97	Missense_Mutation	SNP	ENST00000326524.2	37	c.457G>C	CCDS3922.1	.	.	.	.	.	.	.	.	.	.	C	15.67	2.901584	0.52227	.	.	ENSG00000168621	ENST00000326524;ENST00000344622;ENST00000515058;ENST00000427982;ENST00000381826	D;D;D;D;D	0.83755	-1.76;-1.76;-1.76;-1.76;-1.76	5.76	5.76	0.90799	Transforming growth factor-beta, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.80959	0.4724	L	0.36672	1.1	0.80722	D	1	B;D;B;B	0.54047	0.053;0.964;0.218;0.379	B;P;B;B	0.47162	0.022;0.54;0.041;0.068	T	0.76887	-0.2793	10	0.19590	T	0.45	-8.0905	19.9576	0.97228	0.0:1.0:0.0:0.0	.	153;144;170;127	P39905;P39905-4;P39905-3;P39905-2	GDNF_HUMAN;.;.;.	Q	153;127;127;170;144	ENSP00000317145:E153Q;ENSP00000339703:E127Q;ENSP00000425928:E127Q;ENSP00000409007:E170Q;ENSP00000371248:E144Q	ENSP00000317145:E153Q	E	-	1	0	GDNF	37851689	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	7.487000	0.81328	2.736000	0.93811	0.655000	0.94253	GAG		0.443	GDNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207606.1	NM_000514		10	86	0	0	0	0	10	86				
OSMR	9180	broad.mit.edu	37	5	38883988	38883988	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr5:38883988G>A	ENST00000274276.3	+	5	880	c.478G>A	c.(478-480)Gaa>Aaa	p.E160K	OSMR_ENST00000502536.1_Missense_Mutation_p.E160K	NM_003999.2	NP_003990.1	Q99650	OSMR_HUMAN	oncostatin M receptor	160					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	oncostatin-M receptor complex (GO:0005900)	growth factor binding (GO:0019838)|oncostatin-M receptor activity (GO:0004924)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	46	all_lung(31;0.000365)					GCTGGTGGAAGAAGGCACCAA	0.363																																						uc003jln.1		NA																	0				ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						c.(478-480)GAA>AAA		oncostatin M receptor precursor							106.0	98.0	101.0					5																	38883988		2203	4300	6503	SO:0001583	missense	9180				cell proliferation|positive regulation of cell proliferation	oncostatin-M receptor complex	growth factor binding|oncostatin-M receptor activity	g.chr5:38883988G>A	U60805	CCDS3928.1, CCDS54847.1	5p13.2	2013-02-11			ENSG00000145623	ENSG00000145623		"""Fibronectin type III domain containing"""	8507	protein-coding gene	gene with protein product		601743				8999038	Standard	NM_001168355		Approved	OSMRB	uc003jln.2	Q99650	OTTHUMG00000090811	ENST00000274276.3:c.478G>A	5.37:g.38883988G>A	ENSP00000274276:p.Glu160Lys		Somatic				OSMR_uc003jlm.1_Missense_Mutation_p.E160K	p.E160K	NM_003999	NP_003990	WXS	Illumina HiSeq	Unspecified	Q99650	OSMR_HUMAN			5	845	+	all_lung(31;0.000365)		160			Extracellular (Potential).		Q6P4E8|Q96QJ6	Missense_Mutation	SNP	ENST00000274276.3	37	c.478G>A	CCDS3928.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.293245	0.80914	.	.	ENSG00000145623	ENST00000502536;ENST00000274276	T;T	0.56776	0.44;0.98	5.14	5.14	0.70334	.	0.050992	0.85682	D	0.000000	T	0.68476	0.3005	M	0.70275	2.135	0.39057	D	0.960457	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	T	0.65471	-0.6160	10	0.16896	T	0.51	.	14.457	0.67423	0.0:0.0:1.0:0.0	.	160;160	Q99650;Q99650-2	OSMR_HUMAN;.	K	160	ENSP00000422023:E160K;ENSP00000274276:E160K	ENSP00000274276:E160K	E	+	1	0	OSMR	38919745	1.000000	0.71417	0.999000	0.59377	0.878000	0.50629	4.900000	0.63252	2.547000	0.85894	0.655000	0.94253	GAA		0.363	OSMR-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000207609.2	NM_003999		8	90	0	0	0	0	8	90				
PARP8	79668	broad.mit.edu	37	5	50091252	50091252	+	Splice_Site	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr5:50091252G>A	ENST00000281631.5	+	12	1586		c.e12+1		PARP8_ENST00000514067.2_Splice_Site|PARP8_ENST00000503750.2_Splice_Site|PARP8_ENST00000505554.1_Splice_Site|PARP8_ENST00000514342.2_Splice_Site|PARP8_ENST00000505697.2_Splice_Site|PARP8_ENST00000511363.2_Splice_Site	NM_001178056.1|NM_024615.3	NP_001171527.1|NP_078891.2	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8							intracellular (GO:0005622)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Lung NSC(810;0.0305)|Breast(144;0.222)				TCAGCTTGCTGTGCGTAAATA	0.393																																						uc003jon.3		NA																	0				lung(3)|large_intestine(1)|ovary(1)	5						c.e13+1		poly (ADP-ribose) polymerase family, member 8							39.0	41.0	40.0					5																	50091252		2203	4299	6502	SO:0001630	splice_region_variant	79668					intracellular	NAD+ ADP-ribosyltransferase activity	g.chr5:50091252G>A	AL834477	CCDS3954.1, CCDS54849.1	5q11.2	2010-02-16			ENSG00000151883	ENSG00000151883		"""Poly (ADP-ribose) polymerases"""	26124	protein-coding gene	gene with protein product						15273990	Standard	NM_001178055		Approved	FLJ21308, pART16	uc003joo.3	Q8N3A8	OTTHUMG00000096969	ENST00000281631.5:c.1428+1G>A	5.37:g.50091252G>A			Somatic				PARP8_uc011cpz.1_Splice_Site_p.A368_splice|PARP8_uc003joo.2_Splice_Site_p.A476_splice|PARP8_uc003jop.2_Splice_Site_p.A476_splice	p.A476_splice	NM_024615	NP_078891	WXS	Illumina HiSeq	Unspecified	Q8N3A8	PARP8_HUMAN			13	1610	+		Lung NSC(810;0.0305)|Breast(144;0.222)						Q3KRB7|Q6DHZ1|Q9H754	Splice_Site	SNP	ENST00000281631.5	37	c.1428_splice	CCDS3954.1	.	.	.	.	.	.	.	.	.	.	G	19.24	3.789905	0.70337	.	.	ENSG00000151883	ENST00000505697;ENST00000503750;ENST00000514342;ENST00000281631;ENST00000514067;ENST00000505554;ENST00000503561;ENST00000423185	.	.	.	5.29	5.29	0.74685	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.29	0.94095	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PARP8	50127009	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.702000	0.68332	2.601000	0.87937	0.655000	0.94253	.		0.393	PARP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214035.3	NM_024615	Intron	10	53	0	0	0	0	10	53				
MAST4	375449	broad.mit.edu	37	5	66458527	66458527	+	Missense_Mutation	SNP	C	C	T	rs371063642		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr5:66458527C>T	ENST00000403625.2	+	28	4173	c.3878C>T	c.(3877-3879)tCg>tTg	p.S1293L	MAST4_ENST00000261569.7_Missense_Mutation_p.S1099L|MAST4_ENST00000403666.1_Missense_Mutation_p.S1104L|MAST4_ENST00000405643.1_Missense_Mutation_p.S1114L|MAST4_ENST00000404260.3_Missense_Mutation_p.S1296L	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	1296	Ser-rich.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		TCCCTGTCATCGGGTGAGAGC	0.542																																						uc003jut.1		NA																	0				lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13						c.(3310-3312)TCG>TTG		microtubule associated serine/threonine kinase		C	LEU/SER,LEU/SER	0,3794		0,0,1897	86.0	89.0	88.0		3878,3311	6.1	0.2	5		88	1,8209		0,1,4104	no	missense,missense	MAST4	NM_001164664.1,NM_015183.2	145,145	0,1,6001	TT,TC,CC		0.0122,0.0,0.0083	probably-damaging,probably-damaging	1293/2624,1104/2435	66458527	1,12003	1897	4105	6002	SO:0001583	missense	375449					cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr5:66458527C>T	AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.3878C>T	5.37:g.66458527C>T	ENSP00000385727:p.Ser1293Leu		Somatic				MAST4_uc003juw.2_Missense_Mutation_p.S1032L	p.S1104L	NM_015183	NP_055998	WXS	Illumina HiSeq	Unspecified	O15021	MAST4_HUMAN		Lung(70;0.011)	27	3379	+		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)	1296			Ser-rich.		A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Missense_Mutation	SNP	ENST00000403625.2	37	c.3311C>T	CCDS54861.1	.	.	.	.	.	.	.	.	.	.	C	31	5.086101	0.94100	0.0	1.22E-4	ENSG00000069020	ENST00000404260;ENST00000403625;ENST00000403666;ENST00000405643;ENST00000380908;ENST00000261569	T;T;T;T;T	0.39592	1.07;1.07;1.07;1.07;1.07	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.72922	0.3521	M	0.88105	2.93	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	T	0.76179	-0.3054	10	0.87932	D	0	-15.1613	20.6439	0.99570	0.0:1.0:0.0:0.0	.	1296;1104	O15021;O15021-3	MAST4_HUMAN;.	L	1296;1293;1104;1114;1114;1099	ENSP00000385048:S1296L;ENSP00000385727:S1293L;ENSP00000384313:S1104L;ENSP00000384099:S1114L;ENSP00000261569:S1099L	ENSP00000261569:S1099L	S	+	2	0	MAST4	66494283	1.000000	0.71417	0.172000	0.22920	0.612000	0.37316	7.776000	0.85560	2.890000	0.99128	0.650000	0.86243	TCG		0.542	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326324.2			11	86	0	0	0	0	11	86				
MAST4	375449	broad.mit.edu	37	5	66460113	66460113	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr5:66460113C>T	ENST00000403625.2	+	29	5401	c.5106C>T	c.(5104-5106)ctC>ctT	p.L1702L	MAST4_ENST00000261569.7_Silent_p.L1508L|MAST4_ENST00000403666.1_Silent_p.L1513L|MAST4_ENST00000405643.1_Silent_p.L1523L|MAST4_ENST00000404260.3_Silent_p.L1705L	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	1705						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		AGGACAACCTCTGCCCTGTGC	0.577																																						uc003jut.1		NA																	0				lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13						c.(4537-4539)CTC>CTT		microtubule associated serine/threonine kinase							43.0	46.0	45.0					5																	66460113		2011	4181	6192	SO:0001819	synonymous_variant	375449					cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr5:66460113C>T	AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.5106C>T	5.37:g.66460113C>T			Somatic				MAST4_uc003juw.2_Silent_p.L1441L|MAST4_uc003jux.2_5'Flank	p.L1513L	NM_015183	NP_055998	WXS	Illumina HiSeq	Unspecified	O15021	MAST4_HUMAN		Lung(70;0.011)	28	4607	+		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)	1705					A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Silent	SNP	ENST00000403625.2	37	c.4539C>T	CCDS54861.1																																																																																				0.577	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326324.2			7	24	0	0	0	0	7	24				
RAD17	5884	broad.mit.edu	37	5	68669684	68669684	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr5:68669684G>C	ENST00000509734.1	+	4	748	c.70G>C	c.(70-72)Gat>Cat	p.D24H	RAD17_ENST00000358030.2_5'UTR|RAD17_ENST00000345306.6_Missense_Mutation_p.D13H|RAD17_ENST00000361732.2_Missense_Mutation_p.D13H|RAD17_ENST00000282891.6_Intron|RAD17_ENST00000354868.5_Missense_Mutation_p.D13H|RAD17_ENST00000354312.3_Missense_Mutation_p.D13H|RAD17_ENST00000504177.1_Intron|RAD17_ENST00000380774.3_Missense_Mutation_p.D24H|RAD17_ENST00000521422.1_5'UTR|RAD17_ENST00000305138.4_Missense_Mutation_p.D13H			O75943	RAD17_HUMAN	RAD17 homolog (S. pombe)	24					cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of DNA replication (GO:0008156)|regulation of phosphorylation (GO:0042325)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)						Lung NSC(167;5.19e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;9.36e-57)|Epithelial(20;1.21e-52)|all cancers(19;3.34e-48)|Lung(70;0.0183)		CCCATCATTTGATGATTTTCT	0.358								Other conserved DNA damage response genes																														uc003jwo.2		NA																	0					0						c.(70-72)GAT>CAT	Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes	RAD17 homolog isoform 2							83.0	80.0	81.0					5																	68669684		2203	4300	6503	SO:0001583	missense	5884				cell cycle|DNA damage checkpoint|DNA repair|DNA replication|DNA replication checkpoint|mitotic cell cycle checkpoint|negative regulation of DNA replication|regulation of phosphorylation	nucleoplasm	ATP binding|nucleoside-triphosphatase activity|protein binding	g.chr5:68669684G>C	AF085736	CCDS4003.1, CCDS4004.1, CCDS4005.1, CCDS47226.1	5q13	2010-09-24	2001-11-28		ENSG00000152942	ENSG00000152942			9807	protein-coding gene	gene with protein product		603139	"""RAD1 (S. pombe) homolog"""			9869296, 9660800	Standard	NM_133343		Approved	Rad24, RAD17Sp, CCYC	uc003jwo.3	O75943	OTTHUMG00000099357	ENST00000509734.1:c.70G>C	5.37:g.68669684G>C	ENSP00000426191:p.Asp24His		Somatic				RAD17_uc003jwg.2_Missense_Mutation_p.D13H|RAD17_uc003jwh.2_Missense_Mutation_p.D13H|RAD17_uc003jwi.2_Missense_Mutation_p.D13H|RAD17_uc003jwj.2_Missense_Mutation_p.D13H|RAD17_uc003jwk.2_Missense_Mutation_p.D13H|RAD17_uc003jwl.2_Missense_Mutation_p.D13H|RAD17_uc003jwm.2_5'UTR|RAD17_uc003jwn.2_Intron	p.D24H	NM_133339	NP_579917	WXS	Illumina HiSeq	Unspecified	O75943	RAD17_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;9.36e-57)|Epithelial(20;1.21e-52)|all cancers(19;3.34e-48)|Lung(70;0.0183)	2	132	+		Lung NSC(167;5.19e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)	24					A8K8X2|D3DWA5|O75714|Q7Z3S4|Q9UNK7|Q9UNR7|Q9UNR8|Q9UPF5	Missense_Mutation	SNP	ENST00000509734.1	37	c.70G>C	CCDS4003.1	.	.	.	.	.	.	.	.	.	.	G	17.87	3.494561	0.64186	.	.	ENSG00000152942	ENST00000361732;ENST00000507927;ENST00000509734;ENST00000354868;ENST00000354312;ENST00000345306;ENST00000506564;ENST00000305138;ENST00000380774	T;T;T;T;T;T;T;T;T	0.81330	2.1;-1.48;2.04;2.1;2.1;2.1;0.74;2.1;2.04	5.38	4.5	0.54988	.	0.347769	0.37219	N	0.002198	D	0.82273	0.5001	L	0.60455	1.87	0.80722	D	1	P;P	0.49783	0.883;0.928	P;P	0.53360	0.534;0.724	T	0.83029	-0.0163	10	0.66056	D	0.02	0.3042	9.7748	0.40612	0.1509:0.0:0.8491:0.0	.	24;13	O75943;O75943-2	RAD17_HUMAN;.	H	13;13;24;13;13;13;13;13;24	ENSP00000355226:D13H;ENSP00000423060:D13H;ENSP00000426191:D24H;ENSP00000346938:D13H;ENSP00000346271:D13H;ENSP00000311227:D13H;ENSP00000424696:D13H;ENSP00000303134:D13H;ENSP00000370151:D24H	ENSP00000303134:D13H	D	+	1	0	RAD17	68705440	1.000000	0.71417	1.000000	0.80357	0.813000	0.45954	3.198000	0.51035	2.679000	0.91253	0.563000	0.77884	GAT		0.358	RAD17-008	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369171.1	NM_133344		13	73	0	0	0	0	13	73				
RAD17	5884	broad.mit.edu	37	5	68669849	68669849	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr5:68669849G>C	ENST00000509734.1	+	4	913	c.235G>C	c.(235-237)Gaa>Caa	p.E79Q	RAD17_ENST00000358030.2_5'UTR|RAD17_ENST00000345306.6_Missense_Mutation_p.E68Q|RAD17_ENST00000361732.2_Missense_Mutation_p.E68Q|RAD17_ENST00000282891.6_Intron|RAD17_ENST00000354868.5_Missense_Mutation_p.E68Q|RAD17_ENST00000354312.3_Missense_Mutation_p.E68Q|RAD17_ENST00000504177.1_Intron|RAD17_ENST00000380774.3_Missense_Mutation_p.E79Q|RAD17_ENST00000521422.1_5'UTR|RAD17_ENST00000305138.4_Missense_Mutation_p.E68Q			O75943	RAD17_HUMAN	RAD17 homolog (S. pombe)	79					cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of DNA replication (GO:0008156)|regulation of phosphorylation (GO:0042325)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)						Lung NSC(167;5.19e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;9.36e-57)|Epithelial(20;1.21e-52)|all cancers(19;3.34e-48)|Lung(70;0.0183)		TTATGGTTTAGAAAATTCAAA	0.333								Other conserved DNA damage response genes																														uc003jwo.2		NA																	0					0						c.(235-237)GAA>CAA	Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes	RAD17 homolog isoform 2							70.0	78.0	75.0					5																	68669849		2202	4300	6502	SO:0001583	missense	5884				cell cycle|DNA damage checkpoint|DNA repair|DNA replication|DNA replication checkpoint|mitotic cell cycle checkpoint|negative regulation of DNA replication|regulation of phosphorylation	nucleoplasm	ATP binding|nucleoside-triphosphatase activity|protein binding	g.chr5:68669849G>C	AF085736	CCDS4003.1, CCDS4004.1, CCDS4005.1, CCDS47226.1	5q13	2010-09-24	2001-11-28		ENSG00000152942	ENSG00000152942			9807	protein-coding gene	gene with protein product		603139	"""RAD1 (S. pombe) homolog"""			9869296, 9660800	Standard	NM_133343		Approved	Rad24, RAD17Sp, CCYC	uc003jwo.3	O75943	OTTHUMG00000099357	ENST00000509734.1:c.235G>C	5.37:g.68669849G>C	ENSP00000426191:p.Glu79Gln		Somatic				RAD17_uc003jwg.2_Missense_Mutation_p.E68Q|RAD17_uc003jwh.2_Missense_Mutation_p.E68Q|RAD17_uc003jwi.2_Missense_Mutation_p.E68Q|RAD17_uc003jwj.2_Missense_Mutation_p.E68Q|RAD17_uc003jwk.2_Missense_Mutation_p.E68Q|RAD17_uc003jwl.2_Missense_Mutation_p.E68Q|RAD17_uc003jwm.2_5'UTR|RAD17_uc003jwn.2_Intron	p.E79Q	NM_133339	NP_579917	WXS	Illumina HiSeq	Unspecified	O75943	RAD17_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;9.36e-57)|Epithelial(20;1.21e-52)|all cancers(19;3.34e-48)|Lung(70;0.0183)	2	297	+		Lung NSC(167;5.19e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)	79					A8K8X2|D3DWA5|O75714|Q7Z3S4|Q9UNK7|Q9UNR7|Q9UNR8|Q9UPF5	Missense_Mutation	SNP	ENST00000509734.1	37	c.235G>C	CCDS4003.1	.	.	.	.	.	.	.	.	.	.	G	13.03	2.114592	0.37339	.	.	ENSG00000152942	ENST00000361732;ENST00000509734;ENST00000354868;ENST00000354312;ENST00000345306;ENST00000506564;ENST00000305138;ENST00000380774	T;T;T;T;T;T;T;T	0.44482	2.24;2.24;2.24;2.24;2.24;0.92;2.24;2.24	5.49	4.57	0.56435	.	0.446985	0.26231	N	0.025575	T	0.36552	0.0971	L	0.57536	1.79	0.80722	D	1	B;P	0.35714	0.382;0.517	B;B	0.34652	0.091;0.187	T	0.07790	-1.0754	10	0.22109	T	0.4	-17.6684	11.0801	0.48055	0.0:0.0:0.8154:0.1846	.	79;68	O75943;O75943-2	RAD17_HUMAN;.	Q	68;79;68;68;68;68;68;79	ENSP00000355226:E68Q;ENSP00000426191:E79Q;ENSP00000346938:E68Q;ENSP00000346271:E68Q;ENSP00000311227:E68Q;ENSP00000424696:E68Q;ENSP00000303134:E68Q;ENSP00000370151:E79Q	ENSP00000303134:E68Q	E	+	1	0	RAD17	68705605	0.869000	0.29996	1.000000	0.80357	0.924000	0.55760	1.754000	0.38369	2.750000	0.94351	0.563000	0.77884	GAA		0.333	RAD17-008	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369171.1	NM_133344		8	77	0	0	0	0	8	77				
GPR98	84059	broad.mit.edu	37	5	90041440	90041440	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr5:90041440G>C	ENST00000405460.2	+	52	10898	c.10802G>C	c.(10801-10803)aGa>aCa	p.R3601T		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	3601	Calx-beta 23. {ECO:0000305|PubMed:11606593}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		CCTGGTGAGAGAGAAGCTACA	0.333																																						uc003kju.2		NA																	0				ovary(11)|central_nervous_system(3)|pancreas(2)	16						c.(10801-10803)AGA>ACA		G protein-coupled receptor 98 precursor							70.0	66.0	67.0					5																	90041440		1830	4080	5910	SO:0001583	missense	84059				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity	g.chr5:90041440G>C	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.10802G>C	5.37:g.90041440G>C	ENSP00000384582:p.Arg3601Thr		Somatic				GPR98_uc003kjt.2_Missense_Mutation_p.R1307T|GPR98_uc003kjv.2_Missense_Mutation_p.R1201T	p.R3601T	NM_032119	NP_115495	WXS	Illumina HiSeq	Unspecified	Q8WXG9	GPR98_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)	52	10898	+		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)	3601			Calx-beta 23.|Extracellular (Potential).		O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	c.10802G>C	CCDS47246.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.00|11.00	1.510277|1.510277	0.27036|0.27036	.|.	.|.	ENSG00000164199|ENSG00000164199	ENST00000509621|ENST00000405460;ENST00000296619	.|T	.|0.22134	.|1.97	5.83|5.83	1.76|1.76	0.24704|0.24704	.|Na-Ca exchanger/integrin-beta4 (1);	.|0.528124	.|0.24016	.|N	.|0.042333	T|T	0.06554|0.06554	0.0168|0.0168	N|N	0.02674|0.02674	-0.535|-0.535	0.80722|0.80722	D|D	1|1	.|B;B	.|0.09022	.|0.002;0.002	.|B;B	.|0.11329	.|0.006;0.003	T|T	0.23547|0.23547	-1.0185|-1.0185	5|10	.|0.30854	.|T	.|0.27	.|.	3.1029|3.1029	0.06331|0.06331	0.2673:0.1025:0.5146:0.1156|0.2673:0.1025:0.5146:0.1156	.|.	.|3601;3601	.|E7ETI5;Q8WXG9	.|.;GPR98_HUMAN	Q|T	1167|3601	.|ENSP00000384582:R3601T	.|ENSP00000296619:R3601T	E|R	+|+	1|2	0|0	GPR98|GPR98	90077196|90077196	0.972000|0.972000	0.33761|0.33761	0.985000|0.985000	0.45067|0.45067	0.941000|0.941000	0.58515|0.58515	0.302000|0.302000	0.19192|0.19192	0.295000|0.295000	0.22570|0.22570	0.563000|0.563000	0.77884|0.77884	GAG|AGA		0.333	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119		12	56	0	0	0	0	12	56				
TTC37	9652	broad.mit.edu	37	5	94849302	94849302	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr5:94849302G>C	ENST00000358746.2	-	27	3049	c.2751C>G	c.(2749-2751)ttC>ttG	p.F917L	TTC37_ENST00000515176.1_5'UTR	NM_014639.3	NP_055454.1	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37	917						cytoplasm (GO:0005737)|nucleus (GO:0005634)|Ski complex (GO:0055087)|transcriptionally active chromatin (GO:0035327)				breast(2)|endometrium(6)|kidney(3)|large_intestine(13)|liver(1)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	47						TAGTGTGCCTGAAGAGATCCA	0.338																																						uc003klb.2		NA																	0				ovary(3)|pancreas(1)	4						c.(2749-2751)TTC>TTG		tetratricopeptide repeat domain 37							115.0	111.0	112.0					5																	94849302		2203	4300	6503	SO:0001583	missense	9652						binding	g.chr5:94849302G>C	AB002370	CCDS4072.1	5q15	2014-09-17	2008-06-11	2008-06-11	ENSG00000198677	ENSG00000198677		"""Tetratricopeptide (TTC) repeat domain containing"""	23639	protein-coding gene	gene with protein product		614589	"""KIAA0372"""	KIAA0372		9205841	Standard	NM_014639		Approved		uc003klb.3	Q6PGP7	OTTHUMG00000121165	ENST00000358746.2:c.2751C>G	5.37:g.94849302G>C	ENSP00000351596:p.Phe917Leu		Somatic					p.F917L	NM_014639	NP_055454	WXS	Illumina HiSeq	Unspecified	Q6PGP7	TTC37_HUMAN			27	3021	-			917					O15077|Q6PJI3	Missense_Mutation	SNP	ENST00000358746.2	37	c.2751C>G	CCDS4072.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.018428	0.75275	.	.	ENSG00000198677	ENST00000358746	T	0.55052	0.54	5.54	-2.77	0.05877	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.54967	0.1891	M	0.78637	2.42	0.54753	D	0.999987	D	0.54397	0.966	P	0.48815	0.591	T	0.61262	-0.7098	10	0.33141	T	0.24	.	12.8046	0.57605	0.471:0.0:0.529:0.0	.	917	Q6PGP7	TTC37_HUMAN	L	917	ENSP00000351596:F917L	ENSP00000351596:F917L	F	-	3	2	TTC37	94875058	1.000000	0.71417	0.955000	0.39395	0.947000	0.59692	1.098000	0.31000	-0.367000	0.08052	0.484000	0.47621	TTC		0.338	TTC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241651.1	NM_014639		11	116	0	0	0	0	11	116				
FBN2	2201	broad.mit.edu	37	5	127653955	127653955	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr5:127653955C>G	ENST00000508053.1	-	42	5577	c.4603G>C	c.(4603-4605)Gag>Cag	p.E1535Q	FBN2_ENST00000262464.4_Missense_Mutation_p.E1535Q			P35556	FBN2_HUMAN	fibrillin 2	1535	EGF-like 26; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TCTGCACACTCATCAATATCT	0.423																																						uc003kuu.2		NA																	0				ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15						c.(4603-4605)GAG>CAG		fibrillin 2 precursor							212.0	206.0	208.0					5																	127653955		2203	4300	6503	SO:0001583	missense	2201				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent	g.chr5:127653955C>G	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.4603G>C	5.37:g.127653955C>G	ENSP00000424571:p.Glu1535Gln		Somatic					p.E1535Q	NM_001999	NP_001990	WXS	Illumina HiSeq	Unspecified	P35556	FBN2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)	36	5042	-		all_cancers(142;0.0216)|Prostate(80;0.0551)	1535			EGF-like 26; calcium-binding.		B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	c.4603G>C	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.939282	0.92526	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	D;D	0.98862	-5.19;-5.19	5.16	5.16	0.70880	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	D	0.000006	D	0.99351	0.9772	M	0.93106	3.38	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	D	0.98891	1.0773	10	0.87932	D	0	.	18.82	0.92092	0.0:1.0:0.0:0.0	.	1535	P35556	FBN2_HUMAN	Q	1535	ENSP00000262464:E1535Q;ENSP00000424571:E1535Q	ENSP00000262464:E1535Q	E	-	1	0	FBN2	127681854	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.609000	0.82925	2.840000	0.97914	0.655000	0.94253	GAG		0.423	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999		23	131	0	0	0	0	23	131				
RAPGEF6	51735	broad.mit.edu	37	5	130857157	130857157	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr5:130857157G>A	ENST00000509018.1	-	7	758	c.553C>T	c.(553-555)Cat>Tat	p.H185Y	RAPGEF6_ENST00000308008.6_Missense_Mutation_p.H185Y|CTC-432M15.3_ENST00000514667.1_Missense_Mutation_p.H235Y|RAPGEF6_ENST00000510071.1_Missense_Mutation_p.H185Y|RAPGEF6_ENST00000307984.5_Missense_Mutation_p.H185Y|RAPGEF6_ENST00000507093.1_Missense_Mutation_p.H185Y|RAPGEF6_ENST00000296859.6_Missense_Mutation_p.H185Y	NM_001164386.1|NM_016340.5	NP_001157858.1|NP_057424.3	Q8TEU7	RPGF6_HUMAN	Rap guanine nucleotide exchange factor (GEF) 6	185					positive regulation of GTPase activity (GO:0043547)|Ras protein signal transduction (GO:0007265)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTP-dependent protein binding (GO:0030742)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|skin(1)|stomach(1)	31			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		GAAGACACATGAGTCACCTGT	0.383																																					Melanoma(168;435 1955 13113 13877 23213)	uc003kvn.1		NA																	0				ovary(1)|lung(1)|central_nervous_system(1)	3						c.(553-555)CAT>TAT		PDZ domain-containing guanine nucleotide							109.0	102.0	105.0					5																	130857157		2203	4300	6503	SO:0001583	missense	51735				Ras protein signal transduction|regulation of GTPase activity|regulation of small GTPase mediated signal transduction	cytoplasm|plasma membrane	GTP-dependent protein binding|guanyl-nucleotide exchange factor activity|Ras GTPase binding	g.chr5:130857157G>A	AF117947	CCDS34225.1, CCDS54897.1, CCDS54898.1, CCDS54899.1, CCDS54900.1	5q31.1	2008-02-05	2004-03-01	2004-03-02	ENSG00000158987	ENSG00000158987			20655	protein-coding gene	gene with protein product		610499	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 2"""	PDZGEF2		11524421, 12095257	Standard	NM_016340		Approved	RA-GEF-2, PDZ-GEF2	uc010jdi.2	Q8TEU7	OTTHUMG00000162683	ENST00000509018.1:c.553C>T	5.37:g.130857157G>A	ENSP00000421684:p.His185Tyr		Somatic				RAPGEF6_uc003kvp.1_Missense_Mutation_p.H235Y|RAPGEF6_uc003kvo.1_Missense_Mutation_p.H185Y|RAPGEF6_uc010jdi.1_Missense_Mutation_p.H185Y|RAPGEF6_uc010jdj.1_Missense_Mutation_p.H185Y|RAPGEF6_uc003kvr.2_Missense_Mutation_p.H185Y|RAPGEF6_uc011cxe.1_RNA|RAPGEF6_uc010jdk.2_Missense_Mutation_p.H185Y	p.H185Y	NM_016340	NP_057424	WXS	Illumina HiSeq	Unspecified	Q8TEU7	RPGF6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)	7	759	-			185					A3KN82|A5PLL6|B7ZML2|E9PDV7|Q8NI21|Q8TEU6|Q96PC1	Missense_Mutation	SNP	ENST00000509018.1	37	c.553C>T	CCDS34225.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.983224	0.93044	.	.	ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000217128	ENST00000509018;ENST00000307984;ENST00000507093;ENST00000296859;ENST00000358714;ENST00000308008;ENST00000510071;ENST00000513227;ENST00000504575;ENST00000504039;ENST00000514667	T;T;T;T;T;T;T;T	0.56611	1.65;1.57;1.58;1.65;1.52;2.11;0.45;1.76	5.95	5.95	0.96441	.	0.123358	0.53938	D	0.000043	T	0.73806	0.3634	M	0.72118	2.19	0.80722	D	1	D;D;D;D;D;D	0.89917	0.996;0.999;0.997;0.999;1.0;0.999	D;D;D;D;D;D	0.87578	0.988;0.995;0.989;0.995;0.998;0.99	T	0.71951	-0.4437	10	0.49607	T	0.09	.	20.3931	0.98965	0.0:0.0:1.0:0.0	.	185;185;185;235;185;185	A3KN82;B7ZML2;Q8TEU7-2;E9PCH4;Q8TEU7-3;Q8TEU7	.;.;.;.;.;RPGF6_HUMAN	Y	185;185;185;185;185;185;185;13;38;38;235	ENSP00000421684:H185Y;ENSP00000309298:H185Y;ENSP00000426081:H185Y;ENSP00000296859:H185Y;ENSP00000311419:H185Y;ENSP00000425389:H185Y;ENSP00000424574:H13Y;ENSP00000426948:H235Y	ENSP00000426948:H235Y	H	-	1	0	RAPGEF6;FNIP1	130885056	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.476000	0.97823	2.824000	0.97209	0.655000	0.94253	CAT		0.383	RAPGEF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370059.1	NM_016340		8	59	0	0	0	0	8	59				
SLC22A4	6583	broad.mit.edu	37	5	131679482	131679482	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr5:131679482C>T	ENST00000200652.3	+	10	1784	c.1610C>T	c.(1609-1611)tCa>tTa	p.S537L	AC034220.3_ENST00000437091.1_RNA|AC034220.3_ENST00000417795.1_RNA	NM_003059.2	NP_003050.2	Q9H015	S22A4_HUMAN	solute carrier family 22 (organic cation/zwitterion transporter), member 4	537					body fluid secretion (GO:0007589)|carnitine metabolic process (GO:0009437)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cation transmembrane transport (GO:0098655)|organic cation transport (GO:0015695)|quaternary ammonium group transport (GO:0015697)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|triglyceride metabolic process (GO:0006641)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|carnitine transmembrane transporter activity (GO:0015226)|cation:cation antiporter activity (GO:0015491)|nucleotide binding (GO:0000166)|PDZ domain binding (GO:0030165)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|secondary active organic cation transmembrane transporter activity (GO:0008513)|symporter activity (GO:0015293)			endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|urinary_tract(1)	16		all_cancers(142;0.0752)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Amiloride(DB00594)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Desipramine(DB01151)|Guanidine(DB00536)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|L-Arginine(DB00125)|L-Carnitine(DB00583)|L-Lysine(DB00123)|Levofloxacin(DB01137)|Mepyramine(DB06691)|Nicotine(DB00184)|Ofloxacin(DB01165)|Procainamide(DB01035)|Quinidine(DB00908)|Quinine(DB00468)|Spermine(DB00127)|Testosterone(DB00624)|Tiotropium(DB01409)|Verapamil(DB00661)	ACAAGAGACTCAATGGAGACA	0.343																																						uc003kwq.2		NA																	0					0						c.(1609-1611)TCA>TTA		solute carrier family 22 member 4	L-Carnitine(DB00583)						65.0	66.0	66.0					5																	131679482		2203	4300	6503	SO:0001583	missense	6583				body fluid secretion|sodium ion transport	apical plasma membrane|integral to plasma membrane|mitochondrion	ATP binding|carnitine transporter activity|cation:cation antiporter activity|PDZ domain binding|secondary active organic cation transmembrane transporter activity|symporter activity	g.chr5:131679482C>T	AB007448	CCDS4153.1	5q23.3	2013-07-18	2013-07-18		ENSG00000197208	ENSG00000197208		"""Solute carriers"""	10968	protein-coding gene	gene with protein product		604190	"""solute carrier family 22 (organic cation/ergothioneine transporter), member 4"""			9426230, 15795384	Standard	NM_003059		Approved	OCTN1, MGC34546	uc003kwq.3	Q9H015	OTTHUMG00000059648	ENST00000200652.3:c.1610C>T	5.37:g.131679482C>T	ENSP00000200652:p.Ser537Leu		Somatic				uc003kwr.3_Intron	p.S537L	NM_003059	NP_003050	WXS	Illumina HiSeq	Unspecified	Q9H015	S22A4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		10	1775	+		all_cancers(142;0.0752)|Breast(839;0.198)	537			Cytoplasmic (Potential).		O14546	Missense_Mutation	SNP	ENST00000200652.3	37	c.1610C>T	CCDS4153.1	.	.	.	.	.	.	.	.	.	.	C	10.20	1.283485	0.23392	.	.	ENSG00000197208	ENST00000200652	T	0.73469	-0.75	5.48	4.61	0.57282	.	1.272430	0.05267	N	0.516892	T	0.66973	0.2844	L	0.35487	1.065	0.09310	N	1	B	0.14438	0.01	B	0.17098	0.017	T	0.51466	-0.8702	10	0.26408	T	0.33	.	10.2225	0.43205	0.0:0.9077:0.0:0.0923	.	537	Q9H015	S22A4_HUMAN	L	537	ENSP00000200652:S537L	ENSP00000200652:S537L	S	+	2	0	SLC22A4	131707381	0.003000	0.15002	0.002000	0.10522	0.897000	0.52465	1.653000	0.37323	1.325000	0.45301	0.460000	0.39030	TCA		0.343	SLC22A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132661.1	NM_003059		6	26	0	0	0	0	6	26				
PKD2L2	27039	broad.mit.edu	37	5	137271509	137271509	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr5:137271509G>A	ENST00000508883.1	+	13	1721	c.1695G>A	c.(1693-1695)atG>atA	p.M565I	PKD2L2_ENST00000502810.1_Missense_Mutation_p.M543I|PKD2L2_ENST00000290431.5_Missense_Mutation_p.M565I|PKD2L2_ENST00000508638.1_Missense_Mutation_p.M464I|PKD2L2_ENST00000350250.4_Missense_Mutation_p.M531I			Q9NZM6	PK2L2_HUMAN	polycystic kidney disease 2-like 2	565					calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)	integral component of membrane (GO:0016021)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			breast(1)|endometrium(7)|kidney(4)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	28			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			CAGAGCAGATGAAAAAATGGA	0.398																																						uc003lby.2		NA																	0					0						c.(1693-1695)ATG>ATA		polycystic kidney disease 2-like 2							75.0	73.0	74.0					5																	137271509		1844	4111	5955	SO:0001583	missense	27039					integral to membrane	calcium ion binding|ion channel activity	g.chr5:137271509G>A	AF118125	CCDS43367.1, CCDS58971.1, CCDS58972.1	5q31	2011-12-16			ENSG00000078795	ENSG00000078795		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9012	protein-coding gene	gene with protein product		604669				10602361	Standard	NM_014386		Approved	TRPP5	uc003lbw.1	Q9NZM6	OTTHUMG00000163306	ENST00000508883.1:c.1695G>A	5.37:g.137271509G>A	ENSP00000424725:p.Met565Ile		Somatic				PKD2L2_uc003lbw.1_Missense_Mutation_p.M565I|PKD2L2_uc003lbx.2_Missense_Mutation_p.M464I|PKD2L2_uc011cyi.1_Missense_Mutation_p.M173I	p.M565I	NM_014386	NP_055201	WXS	Illumina HiSeq	Unspecified	Q9NZM6	PK2L2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)		13	1751	+			565			Cytoplasmic (Potential).|Potential.		A6NK98|B4DXD2|E9PC91|E9PDG4|Q86YB4|Q9UNJ0	Missense_Mutation	SNP	ENST00000508883.1	37	c.1695G>A		.	.	.	.	.	.	.	.	.	.	G	11.82	1.753936	0.31046	.	.	ENSG00000078795	ENST00000350250;ENST00000508638;ENST00000502810;ENST00000508883;ENST00000290431	T;T;T;T;T	0.71817	-0.23;0.27;-0.6;-0.15;-0.19	5.63	4.76	0.60689	.	0.410669	0.25765	N	0.028447	T	0.67683	0.2919	M	0.62723	1.935	0.31131	N	0.707672	B;B;P	0.34757	0.046;0.001;0.467	B;B;B	0.38500	0.045;0.001;0.275	T	0.66712	-0.5854	10	0.17832	T	0.49	-11.6326	12.2867	0.54795	0.0:0.0:0.8306:0.1694	.	565;464;565	Q9NZM6;E9PC91;Q9NZM6-5	PK2L2_HUMAN;.;.	I	531;464;543;565;565	ENSP00000344177:M531I;ENSP00000423382:M464I;ENSP00000425513:M543I;ENSP00000424725:M565I;ENSP00000290431:M565I	ENSP00000290431:M565I	M	+	3	0	PKD2L2	137299408	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.850000	0.48294	1.512000	0.48834	0.655000	0.94253	ATG		0.398	PKD2L2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000372521.1	NM_014386		6	44	0	0	0	0	6	44				
ETF1	2107	broad.mit.edu	37	5	137847221	137847221	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr5:137847221C>G	ENST00000360541.5	-	7	1026	c.805G>C	c.(805-807)Gag>Cag	p.E269Q	ETF1_ENST00000503014.1_Missense_Mutation_p.E255Q|ETF1_ENST00000499810.2_Missense_Mutation_p.E236Q	NM_004730.3	NP_004721.1	P62495	ERF1_HUMAN	eukaryotic translation termination factor 1	269					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein methylation (GO:0006479)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational termination (GO:0006415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|RNA binding (GO:0003723)|translation release factor activity (GO:0003747)|translation release factor activity, codon specific (GO:0016149)|translation termination factor activity (GO:0008079)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)|urinary_tract(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GTAGATAACTCAATAGCTTGG	0.303																																						uc003ldc.3		NA																	0				ovary(2)	2						c.(805-807)GAG>CAG		eukaryotic translation termination factor 1							77.0	75.0	75.0					5																	137847221		2202	4300	6502	SO:0001583	missense	2107				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|protein methylation|regulation of translational termination	cytoplasm	protein binding|ribosome binding|translation release factor activity, codon specific	g.chr5:137847221C>G	AF095901	CCDS4207.1, CCDS75313.1, CCDS75314.1	5q31.2	2008-02-05			ENSG00000120705	ENSG00000120705			3477	protein-coding gene	gene with protein product	"""sup45 (yeast omnipotent suppressor 45) homolog-like 1"", ""polypeptide chain release factor 1"""	600285		SUP45L1, ERF1, ERF		1546371, 7990965	Standard	NM_004730		Approved	eRF1, TB3-1, RF1	uc003ldc.5	P62495	OTTHUMG00000129199	ENST00000360541.5:c.805G>C	5.37:g.137847221C>G	ENSP00000353741:p.Glu269Gln		Somatic				ETF1_uc011cyv.1_Missense_Mutation_p.E255Q|ETF1_uc010jex.2_RNA|ETF1_uc003ldd.3_Missense_Mutation_p.E236Q|ETF1_uc010jey.1_Missense_Mutation_p.E75Q	p.E269Q	NM_004730	NP_004721	WXS	Illumina HiSeq	Unspecified	P62495	ERF1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		7	970	-			269					B2R6B4|D3DQC1|P46055|Q5M7Z7|Q96CG1	Missense_Mutation	SNP	ENST00000360541.5	37	c.805G>C	CCDS4207.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.814243	0.90790	.	.	ENSG00000120705	ENST00000499810;ENST00000360541;ENST00000503014	T;T;T	0.48522	0.81;0.81;0.81	5.6	5.6	0.85130	eRF1 domain 2 (1);	0.000000	0.85682	D	0.000000	T	0.73305	0.3570	M	0.88377	2.95	0.80722	D	1	D;B;P	0.71674	0.998;0.451;0.486	D;P;B	0.64042	0.921;0.453;0.306	T	0.77297	-0.2640	10	0.54805	T	0.06	-8.7965	19.1894	0.93658	0.0:1.0:0.0:0.0	.	255;236;269	B7Z7P8;Q96CG1;P62495	.;.;ERF1_HUMAN	Q	236;269;255	ENSP00000421288:E236Q;ENSP00000353741:E269Q;ENSP00000422203:E255Q	ENSP00000353741:E269Q	E	-	1	0	ETF1	137875120	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.731000	0.84895	2.634000	0.89283	0.655000	0.94253	GAG		0.303	ETF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251276.2	NM_004730		8	41	0	0	0	0	8	41				
SLC4A9	83697	broad.mit.edu	37	5	139745140	139745140	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr5:139745140G>C	ENST00000230993.6	+	12	1794	c.1759G>C	c.(1759-1761)Gac>Cac	p.D587H	SLC4A9_ENST00000507527.1_Missense_Mutation_p.D587H|SLC4A9_ENST00000506757.2_Missense_Mutation_p.D563H|SLC4A9_ENST00000506545.1_Missense_Mutation_p.D563H|SLC4A9_ENST00000432095.2_Missense_Mutation_p.D552H	NM_001258428.1	NP_001245357.1	Q96Q91	B3A4_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 9	587	Membrane (anion exchange).				bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			endometrium(4)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAGGCCAAAAGACAGAGACGA	0.507																																						uc003lfm.2		NA																	0				large_intestine(1)	1						c.(1759-1761)GAC>CAC		solute carrier family 4, sodium bicarbonate							85.0	92.0	90.0					5																	139745140		1977	4167	6144	SO:0001583	missense	83697					integral to membrane|plasma membrane	inorganic anion exchanger activity|sodium:bicarbonate symporter activity	g.chr5:139745140G>C	AF313465	CCDS47278.1, CCDS58973.1, CCDS58974.1, CCDS58975.1	5q31.3	2013-05-22			ENSG00000113073	ENSG00000113073		"""Solute carriers"""	11035	protein-coding gene	gene with protein product		610207				11305939	Standard	NM_031467		Approved	AE4	uc003lfk.2	Q96Q91	OTTHUMG00000163352	ENST00000230993.6:c.1759G>C	5.37:g.139745140G>C	ENSP00000230993:p.Asp587His		Somatic				SLC4A9_uc003lfj.2_Missense_Mutation_p.D563H|SLC4A9_uc011czg.1_Missense_Mutation_p.D563H|SLC4A9_uc003lfl.2_Missense_Mutation_p.D563H|SLC4A9_uc003lfk.2_Missense_Mutation_p.D552H	p.D587H	NM_031467	NP_113655	WXS	Illumina HiSeq	Unspecified	Q96Q91	B3A4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		12	1794	+			587			Extracellular (Potential).|Membrane (anion exchange).		B7ZL63|D3DQD4|D3DQD5|D3DQD6|E9PDK1|Q96RM5|Q9BXF2|Q9BXN3	Missense_Mutation	SNP	ENST00000230993.6	37	c.1759G>C	CCDS58973.1	.	.	.	.	.	.	.	.	.	.	G	13.87	2.366918	0.41902	.	.	ENSG00000113073	ENST00000230993;ENST00000506757;ENST00000432095;ENST00000506545;ENST00000507527	T;T;T;T;T	0.79352	-1.26;-1.15;-1.19;-0.93;-1.26	4.36	2.56	0.30785	Bicarbonate transporter, C-terminal (1);	0.484779	0.19623	N	0.109869	T	0.75576	0.3868	L	0.34521	1.04	0.09310	N	1	D;B;B;B	0.60160	0.987;0.005;0.003;0.003	P;B;B;B	0.58520	0.84;0.007;0.003;0.002	T	0.64296	-0.6441	10	0.54805	T	0.06	.	7.0085	0.24849	0.2042:0.0:0.7958:0.0	.	563;587;552;563	E9PDK1;Q96Q91;Q96Q91-2;Q96Q91-3	.;B3A4_HUMAN;.;.	H	587;563;552;563;587	ENSP00000230993:D587H;ENSP00000424424:D563H;ENSP00000410056:D552H;ENSP00000422855:D563H;ENSP00000427661:D587H	ENSP00000230993:D587H	D	+	1	0	SLC4A9	139725324	0.529000	0.26322	0.004000	0.12327	0.870000	0.49936	1.402000	0.34600	0.759000	0.33084	0.561000	0.74099	GAC		0.507	SLC4A9-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000372823.1	NM_031467		7	20	0	0	0	0	7	20				
PCDHA1	56147	broad.mit.edu	37	5	140167978	140167978	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr5:140167978C>T	ENST00000504120.2	+	1	2103	c.2103C>T	c.(2101-2103)atC>atT	p.I701I	PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000378133.3_Silent_p.I701I	NM_018900.2	NP_061723.1	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1	701					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGTACCTGATCATCGCCATCT	0.682																																						uc003lhb.2		NA																	0				skin(1)	1						c.(2101-2103)ATC>ATT		protocadherin alpha 1 isoform 1 precursor							60.0	57.0	58.0					5																	140167978		2203	4299	6502	SO:0001819	synonymous_variant	56147				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140167978C>T	AF152479	CCDS54912.1, CCDS54913.1	5q31	2010-11-26				ENSG00000204970		"""Cadherins / Protocadherins : Clustered"""	8663	other	complex locus constituent	"""KIAA0345-like 13"""	606307				10380929	Standard	NM_018900		Approved			Q9Y5I3		ENST00000504120.2:c.2103C>T	5.37:g.140167978C>T			Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lgz.2_Silent_p.I701I	p.I701I	NM_018900	NP_061723	WXS	Illumina HiSeq	Unspecified	Q9Y5I3	PCDA1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2103	+			701			Helical; (Potential).		O75288|Q9NRT7	Silent	SNP	ENST00000504120.2	37	c.2103C>T	CCDS54913.1																																																																																				0.682	PCDHA1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389127.1	NM_018900		19	78	0	0	0	0	19	78				
PCDHA6	56142	broad.mit.edu	37	5	140208515	140208515	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr5:140208515C>G	ENST00000529310.1	+	1	953	c.839C>G	c.(838-840)tCt>tGt	p.S280C	PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Missense_Mutation_p.S280C|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA5_ENST00000529619.1_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	280	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATTTCATATTCTTTTAATAGC	0.388																																						uc003lho.2		NA																	0				haematopoietic_and_lymphoid_tissue(1)|skin(1)	2						c.(838-840)TCT>TGT		protocadherin alpha 6 isoform 1 precursor							108.0	108.0	108.0					5																	140208515		2203	4300	6503	SO:0001583	missense	56142				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140208515C>G	AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.839C>G	5.37:g.140208515C>G	ENSP00000433378:p.Ser280Cys		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Missense_Mutation_p.S280C|PCDHA6_uc011dab.1_Missense_Mutation_p.S280C	p.S280C	NM_018909	NP_061732	WXS	Illumina HiSeq	Unspecified	Q9UN73	PCDA6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	866	+			280			Cadherin 3.|Extracellular (Potential).		O75283|Q9NRT8	Missense_Mutation	SNP	ENST00000529310.1	37	c.839C>G	CCDS47281.1	.	.	.	.	.	.	.	.	.	.	C	5.668	0.307800	0.10733	.	.	ENSG00000081842	ENST00000529310;ENST00000527624	T;T	0.03181	4.02;4.02	3.7	3.7	0.42460	Cadherin (4);Cadherin-like (1);	0.000000	0.34223	U	0.004155	T	0.28134	0.0694	H	0.98466	4.24	0.09310	N	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.74023	0.955;0.982;0.951	T	0.39702	-0.9601	10	0.87932	D	0	.	9.707	0.40222	0.0:0.8398:0.0:0.1602	.	280;280;280	Q9UN73-3;Q9UN73;Q9UN73-2	.;PCDA6_HUMAN;.	C	280	ENSP00000433378:S280C;ENSP00000434113:S280C	ENSP00000434113:S280C	S	+	2	0	PCDHA6	140188699	0.000000	0.05858	0.102000	0.21198	0.063000	0.16089	1.154000	0.31688	2.055000	0.61198	0.313000	0.20887	TCT		0.388	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372829.3	NM_018909		20	92	0	0	0	0	20	92				
PCDHGA6	56109	broad.mit.edu	37	5	140754586	140754586	+	Silent	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr5:140754586G>C	ENST00000517434.1	+	1	936	c.936G>C	c.(934-936)tcG>tcC	p.S312S	PCDHGB3_ENST00000576222.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	312	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATGAGGACTCGAGTTTTTATG	0.393																																						uc003ljy.1		NA																	0				breast(1)	1						c.(934-936)TCG>TCC		protocadherin gamma subfamily A, 6 isoform 1							108.0	112.0	111.0					5																	140754586		1840	4084	5924	SO:0001819	synonymous_variant	56109				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140754586G>C	AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.936G>C	5.37:g.140754586G>C			Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc011dau.1_Silent_p.S312S	p.S312S	NM_018919	NP_061742	WXS	Illumina HiSeq	Unspecified	Q9Y5G7	PCDG6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	936	+			312			Cadherin 3.|Extracellular (Potential).		A6H8K7|B2RN55|Q9Y5D1	Silent	SNP	ENST00000517434.1	37	c.936G>C	CCDS54926.1																																																																																				0.393	PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374743.1	NM_018919		32	148	0	0	0	0	32	148				
FAT2	2196	broad.mit.edu	37	5	150897219	150897219	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr5:150897219G>A	ENST00000261800.5	-	19	11437	c.11425C>T	c.(11425-11427)Ctt>Ttt	p.L3809F		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	3809	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GTGAATAGAAGAATGGCCTGT	0.552																																						uc003lue.3		NA																	0				ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6						c.(11425-11427)CTT>TTT		FAT tumor suppressor 2 precursor							115.0	116.0	116.0					5																	150897219		2203	4300	6503	SO:0001583	missense	2196				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding	g.chr5:150897219G>A	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.11425C>T	5.37:g.150897219G>A	ENSP00000261800:p.Leu3809Phe		Somatic				GM2A_uc011dcs.1_Intron|FAT2_uc003lud.3_Missense_Mutation_p.L502F	p.L3809F	NM_001447	NP_001438	WXS	Illumina HiSeq	Unspecified	Q9NYQ8	FAT2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		19	11438	-		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	3809			Extracellular (Potential).|Laminin G-like.		O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	37	c.11425C>T	CCDS4317.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.09|16.09	3.024322|3.024322	0.54683|0.54683	.|.	.|.	ENSG00000086570|ENSG00000086570	ENST00000261800|ENST00000520200	D|.	0.88975|.	-2.45|.	5.09|5.09	0.125|0.125	0.14718|0.14718	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);|.	0.453272|.	0.18833|.	N|.	0.129909|.	T|T	0.41766|0.41766	0.1173|0.1173	M|M	0.70275|0.70275	2.135|2.135	0.09310|0.09310	N|N	1|1	P;P|.	0.47841|.	0.901;0.883|.	P;P|.	0.52386|.	0.697;0.621|.	T|T	0.39603|0.39603	-0.9606|-0.9606	10|5	0.72032|.	D|.	0.01|.	.|.	2.1191|2.1191	0.03721|0.03721	0.1396:0.3208:0.2638:0.2759|0.1396:0.3208:0.2638:0.2759	.|.	3809;1000|.	Q9NYQ8;E9PDJ8|.	FAT2_HUMAN;.|.	F|F	3809|667	ENSP00000261800:L3809F|.	ENSP00000261800:L3809F|.	L|S	-|-	1|2	0|0	FAT2|FAT2	150877412|150877412	0.043000|0.043000	0.20138|0.20138	0.032000|0.032000	0.17829|0.17829	0.938000|0.938000	0.57974|0.57974	0.137000|0.137000	0.15995|0.15995	0.015000|0.015000	0.14971|0.14971	-0.133000|-0.133000	0.14855|0.14855	CTT|TCT		0.552	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447		10	65	0	0	0	0	10	65				
KIF4B	285643	broad.mit.edu	37	5	154393878	154393878	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr5:154393878C>A	ENST00000435029.4	+	1	619	c.459C>A	c.(457-459)tgC>tgA	p.C153*		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	153	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			ATCTTCTATGCCCATCTCGTG	0.358																																						uc010jih.1		NA																	0				ovary(1)	1						c.(457-459)TGC>TGA		kinesin family member 4B							149.0	152.0	151.0					5																	154393878		2203	4300	6503	SO:0001587	stop_gained	285643				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity	g.chr5:154393878C>A	AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.459C>A	5.37:g.154393878C>A	ENSP00000387875:p.Cys153*		Somatic					p.C153*	NM_001099293	NP_001092763	WXS	Illumina HiSeq	Unspecified	Q2VIQ3	KIF4B_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)		1	619	+	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	153			Kinesin-motor.			Nonsense_Mutation	SNP	ENST00000435029.4	37	c.459C>A	CCDS47324.1	.	.	.	.	.	.	.	.	.	.	c	14.93	2.683392	0.47991	.	.	ENSG00000226650	ENST00000435029	.	.	.	1.73	0.83	0.18854	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	.	3.902	0.09166	0.0:0.5871:0.0:0.4129	.	.	.	.	X	153	.	ENSP00000387875:C153X	C	+	3	2	KIF4B	154374071	0.000000	0.05858	0.445000	0.26908	0.556000	0.35491	-0.860000	0.04272	0.304000	0.22809	0.655000	0.94253	TGC		0.358	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377478.1			22	145	1	0	1.98e-07	2.09e-07	22	145				
CREBRF	153222	broad.mit.edu	37	5	172560701	172560701	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr5:172560701C>T	ENST00000296953.2	+	9	2192	c.1873C>T	c.(1873-1875)Ccc>Tcc	p.P625S	CREBRF_ENST00000540014.1_Missense_Mutation_p.P627S	NM_153607.2	NP_705835.2	Q8IUR6	CRERF_HUMAN	CREB3 regulatory factor	625					negative regulation of endoplasmic reticulum unfolded protein response (GO:1900102)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of intracellular transport (GO:0032388)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein transport (GO:0051222)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)										AGAAGGGAATCCCACTGGAGG	0.443																																						uc003mch.2		NA																	0					0						c.(1873-1875)CCC>TCC		luman-recruiting factor							80.0	80.0	80.0					5																	172560701		2203	4300	6503	SO:0001583	missense	153222						protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr5:172560701C>T	AY139008	CCDS34293.1, CCDS54948.1	5q35.2	2012-03-06	2012-03-06	2012-03-06	ENSG00000164463	ENSG00000164463			24050	protein-coding gene	gene with protein product	"""luman/CREB3 recruitment factor"""		"""chromosome 5 open reading frame 41"""	C5orf41		18391022	Standard	NM_153607		Approved	LRF	uc003mch.3	Q8IUR6	OTTHUMG00000163322	ENST00000296953.2:c.1873C>T	5.37:g.172560701C>T	ENSP00000296953:p.Pro625Ser		Somatic				C5orf41_uc011dfd.1_Missense_Mutation_p.P625S	p.P625S	NM_153607	NP_705835	WXS	Illumina HiSeq	Unspecified	Q8IUR6	CE041_HUMAN	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)		9	2177	+	Renal(175;0.000159)|Lung NSC(126;0.00223)|all_lung(126;0.00391)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	625					B3DFH2|B3KW49|D3DQM2|F5GXN3|Q5HYG4|Q5HYK0|Q86YR3|Q8IZG1	Missense_Mutation	SNP	ENST00000296953.2	37	c.1873C>T	CCDS34293.1	.	.	.	.	.	.	.	.	.	.	C	12.75	2.032227	0.35893	.	.	ENSG00000164463	ENST00000296953;ENST00000540014;ENST00000538538;ENST00000393776	T;T	0.49139	0.79;0.8	5.42	5.42	0.78866	.	0.051859	0.85682	D	0.000000	T	0.36524	0.0970	N	0.24115	0.695	0.80722	D	1	P	0.40180	0.705	B	0.38327	0.271	T	0.29181	-1.0020	10	0.54805	T	0.06	.	15.1109	0.72355	0.0:0.8588:0.1412:0.0	.	625	Q8IUR6	CE041_HUMAN	S	625;627;625;625	ENSP00000296953:P625S;ENSP00000440075:P627S	ENSP00000296953:P625S	P	+	1	0	C5orf41	172493307	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.298000	0.59067	2.710000	0.92621	0.585000	0.79938	CCC		0.443	CREBRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372667.1	NM_153607		10	40	0	0	0	0	10	40				
NKX2-5	1482	broad.mit.edu	37	5	172660137	172660137	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr5:172660137C>G	ENST00000329198.4	-	2	683	c.410G>C	c.(409-411)cGg>cCg	p.R137P	NKX2-5_ENST00000521848.1_3'UTR|NKX2-5_ENST00000424406.2_3'UTR	NM_001166175.1|NM_001166176.1|NM_004387.3	NP_001159647.1|NP_001159648.1|NP_004378.1	P52952	NKX25_HUMAN	NK2 homeobox 5	137					adult heart development (GO:0007512)|apoptotic process involved in heart morphogenesis (GO:0003278)|atrial cardiac muscle cell development (GO:0055014)|atrial septum morphogenesis (GO:0060413)|atrioventricular node cell development (GO:0060928)|atrioventricular node cell fate commitment (GO:0060929)|BMP signaling pathway (GO:0030509)|bundle of His development (GO:0003166)|canonical Wnt signaling pathway (GO:0060070)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac ventricle formation (GO:0003211)|cell differentiation (GO:0030154)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|hemopoiesis (GO:0030097)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|pharyngeal system development (GO:0060037)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart contraction (GO:0045823)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription via serum response element binding (GO:0010735)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of voltage-gated calcium channel activity (GO:1901387)|proepicardium development (GO:0003342)|pulmonary myocardium development (GO:0003350)|Purkinje myocyte differentiation (GO:0003168)|regulation of cardiac muscle cell proliferation (GO:0060043)|regulation of cardiac muscle contraction (GO:0055117)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|sarcomere organization (GO:0045214)|septum secundum development (GO:0003285)|spleen development (GO:0048536)|thyroid gland development (GO:0030878)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|serum response element binding (GO:0010736)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(7)|prostate(1)	12	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			CTTCCTCCGCCGTCGCGCCCG	0.692																																					Esophageal Squamous(72;810 1219 2387 13420 44943)	uc003mcm.1		NA																	0				central_nervous_system(1)	1						c.(409-411)CGG>CCG		NK2 transcription factor related, locus 5							9.0	10.0	10.0					5																	172660137		2193	4290	6483	SO:0001583	missense	1482				adult heart development|atrial cardiac muscle cell development|atrial septum morphogenesis|heart looping|hemopoiesis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cardiac muscle cell apoptosis|negative regulation of myotube differentiation|negative regulation of transcription from RNA polymerase II promoter|outflow tract septum morphogenesis|pharyngeal system development|positive regulation of calcium ion transport via voltage-gated calcium channel activity|positive regulation of cardioblast differentiation|positive regulation of cell proliferation|positive regulation of heart contraction|positive regulation of neuron differentiation|positive regulation of sodium ion transport|positive regulation of survival gene product expression|positive regulation of transcription initiation from RNA polymerase II promoter|positive regulation of transcription via serum response element binding|regulation of cardiac muscle contraction|right ventricular cardiac muscle tissue morphogenesis|septum secundum development|spleen development|thyroid gland development|vasculogenesis|ventricular septum morphogenesis		chromatin binding|protein heterodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|serum response element binding|transcription factor binding	g.chr5:172660137C>G	AB021133	CCDS4387.1, CCDS54949.1, CCDS54950.1	5q34	2014-09-17	2011-06-01	2002-10-04	ENSG00000183072	ENSG00000183072		"""Homeoboxes / ANTP class : NKL subclass"""	2488	protein-coding gene	gene with protein product	"""tinman paralog (Drosophila)"""	600584	"""cardiac-specific homeo box"", ""NK2 transcription factor related, locus 5 (Drosophila)"""	CSX, NKX2E		7665173, 8900537	Standard	NM_004387		Approved	CSX1, NKX2.5, NKX4-1	uc003mcm.2	P52952	OTTHUMG00000130522	ENST00000329198.4:c.410G>C	5.37:g.172660137C>G	ENSP00000327758:p.Arg137Pro		Somatic				NKX2-5_uc011dfe.1_3'UTR|NKX2-5_uc010jjt.1_3'UTR	p.R137P	NM_004387	NP_004378	WXS	Illumina HiSeq	Unspecified	P52952	NKX25_HUMAN	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)		2	586	-	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	137					A8K3K0|B4DNB6|E9PBU6	Missense_Mutation	SNP	ENST00000329198.4	37	c.410G>C	CCDS4387.1	.	.	.	.	.	.	.	.	.	.	C	14.80	2.643567	0.47258	.	.	ENSG00000183072	ENST00000329198	D	0.95821	-3.82	4.21	3.33	0.38152	Homeodomain-related (1);Homeobox (1);Homeodomain-like (1);	0.299193	0.24256	N	0.040126	D	0.87633	0.6226	N	0.21508	0.67	0.80722	D	1	P	0.43578	0.811	B	0.36719	0.231	D	0.85125	0.0971	10	0.46703	T	0.11	.	3.8712	0.09038	0.0:0.6604:0.0:0.3396	.	137	P52952	NKX25_HUMAN	P	137	ENSP00000327758:R137P	ENSP00000327758:R137P	R	-	2	0	NKX2-5	172592743	0.998000	0.40836	0.984000	0.44739	0.423000	0.31445	3.761000	0.55242	2.354000	0.79902	0.462000	0.41574	CGG		0.692	NKX2-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252942.2			3	11	0	0	0	0	3	11				
NSD1	64324	broad.mit.edu	37	5	176673765	176673765	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr5:176673765G>A	ENST00000439151.2	+	10	4510	c.4465G>A	c.(4465-4467)Gat>Aat	p.D1489N	NSD1_ENST00000354179.4_Missense_Mutation_p.D1220N|NSD1_ENST00000361032.4_Missense_Mutation_p.D1386N|NSD1_ENST00000347982.4_Missense_Mutation_p.D1220N	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	1489					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		AGTGAAAAATGATGACTCGTC	0.438			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																												uc003mfr.3		NA		Dom	yes		5	5q35	64324	T	nuclear receptor binding SET domain protein 1	yes	Sotos Syndrome	L	NUP98		AML		0				ovary(2)|kidney(1)	3						c.(4465-4467)GAT>AAT		nuclear receptor binding SET domain protein 1							98.0	94.0	96.0					5																	176673765		2203	4300	6503	SO:0001583	missense	64324	Beckwith-Wiedemann_syndrome|Sotos_syndrome|Weaver_syndrome	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	androgen receptor binding|chromatin binding|estrogen receptor binding|histone methyltransferase activity (H3-K36 specific)|histone methyltransferase activity (H4-K20 specific)|ligand-dependent nuclear receptor binding|retinoid X receptor binding|thyroid hormone receptor binding|transcription corepressor activity|zinc ion binding	g.chr5:176673765G>A	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.4465G>A	5.37:g.176673765G>A	ENSP00000395929:p.Asp1489Asn	HNSCC(47;0.14)	Somatic				NSD1_uc003mft.3_Missense_Mutation_p.D1220N|NSD1_uc003mfs.1_Missense_Mutation_p.D1386N|NSD1_uc011dfx.1_Missense_Mutation_p.D1137N	p.D1489N	NM_022455	NP_071900	WXS	Illumina HiSeq	Unspecified	Q96L73	NSD1_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)	10	4603	+	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	1489					Q96PD8|Q96RN7	Missense_Mutation	SNP	ENST00000439151.2	37	c.4465G>A	CCDS4412.1	.	.	.	.	.	.	.	.	.	.	G	12.68	2.010502	0.35511	.	.	ENSG00000165671	ENST00000354179;ENST00000439151;ENST00000347982;ENST00000361032	D;D;D;D	0.92965	-3.03;-3.03;-3.03;-3.14	5.65	4.76	0.60689	.	0.680726	0.14552	N	0.312640	D	0.82268	0.5000	N	0.14661	0.345	0.24412	N	0.99465	B;B;B	0.30973	0.302;0.302;0.09	B;B;B	0.27500	0.05;0.08;0.023	T	0.71048	-0.4705	10	0.24483	T	0.36	.	7.505	0.27540	0.0834:0.0:0.7494:0.1672	.	1220;1386;1489	Q96L73-2;Q96L73-3;Q96L73	.;.;NSD1_HUMAN	N	1220;1489;1220;1386	ENSP00000346111:D1220N;ENSP00000395929:D1489N;ENSP00000343209:D1220N;ENSP00000354310:D1386N	ENSP00000343209:D1220N	D	+	1	0	NSD1	176606371	1.000000	0.71417	0.875000	0.34327	0.257000	0.26127	2.801000	0.47908	1.479000	0.48272	0.650000	0.86243	GAT		0.438	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253412.2	NM_172349		13	54	0	0	0	0	13	54				
TBC1D9B	23061	broad.mit.edu	37	5	179302008	179302008	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr5:179302008C>T	ENST00000356834.3	-	12	2117	c.2080G>A	c.(2080-2082)Gag>Aag	p.E694K	TBC1D9B_ENST00000355235.3_Missense_Mutation_p.E694K	NM_198868.2	NP_942568.2	Q66K14	TBC9B_HUMAN	TBC1 domain family, member 9B (with GRAM domain)	694	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.					integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	28	all_cancers(89;0.000197)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0236)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TTGATGCCCTCATAGAAAAAG	0.622																																						uc003mlh.2		NA																	0				breast(1)|skin(1)	2						c.(2080-2082)GAG>AAG		TBC1 domain family, member 9B (with GRAM domain)							85.0	79.0	81.0					5																	179302008		2203	4300	6503	SO:0001583	missense	23061					integral to membrane|intracellular	calcium ion binding|Rab GTPase activator activity	g.chr5:179302008C>T	AB014576	CCDS4450.1, CCDS43408.1	5q35.3	2013-01-10			ENSG00000197226	ENSG00000197226		"""EF-hand domain containing"""	29097	protein-coding gene	gene with protein product						9734811	Standard	NM_198868		Approved	KIAA0676	uc003mlh.3	Q66K14	OTTHUMG00000130911	ENST00000356834.3:c.2080G>A	5.37:g.179302008C>T	ENSP00000349291:p.Glu694Lys		Somatic				TBC1D9B_uc003mli.2_Missense_Mutation_p.E694K|TBC1D9B_uc003mlj.2_Missense_Mutation_p.E694K|TBC1D9B_uc011dgv.1_5'Flank	p.E694K	NM_198868	NP_942568	WXS	Illumina HiSeq	Unspecified	Q66K14	TBC9B_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		12	2117	-	all_cancers(89;0.000197)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0236)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	694			Rab-GAP TBC.		D3DWQ5|D3DWQ6|O75163|Q53EY0|Q6MZI2|Q96H49	Missense_Mutation	SNP	ENST00000356834.3	37	c.2080G>A	CCDS43408.1	.	.	.	.	.	.	.	.	.	.	C	34	5.334323	0.95758	.	.	ENSG00000197226	ENST00000356834;ENST00000355235	T;T	0.14391	2.51;2.51	5.29	5.29	0.74685	Rab-GAP/TBC domain (4);	0.124793	0.53938	D	0.000042	T	0.46521	0.1397	M	0.88906	2.99	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.999	D;D;D	0.75484	0.986;0.976;0.981	T	0.55667	-0.8105	10	0.72032	D	0.01	-33.9273	18.9379	0.92594	0.0:1.0:0.0:0.0	.	694;694;694	A1L3A9;Q66K14-2;Q66K14	.;.;TBC9B_HUMAN	K	694	ENSP00000349291:E694K;ENSP00000347375:E694K	ENSP00000347375:E694K	E	-	1	0	TBC1D9B	179234614	1.000000	0.71417	0.999000	0.59377	0.729000	0.41735	7.743000	0.85020	2.469000	0.83416	0.491000	0.48974	GAG		0.622	TBC1D9B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253501.3	NM_015043		10	49	0	0	0	0	10	49				
DSP	1832	broad.mit.edu	37	6	7559514	7559514	+	Missense_Mutation	SNP	C	C	G	rs397516943		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr6:7559514C>G	ENST00000379802.3	+	4	819	c.478C>G	c.(478-480)Cga>Gga	p.R160G	DSP_ENST00000418664.2_Missense_Mutation_p.R160G	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	160	Globular 1.|Interacts with plakophilin 1 and junction plakoglobin.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.R160G(1)		biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		CAGTGTCCCTCGAGTCCGCAG	0.507																																						uc003mxp.1		NA																	1	Substitution - Missense(1)		upper_aerodigestive_tract(1)	central_nervous_system(6)|ovary(2)|skin(1)	9						c.(478-480)CGA>GGA		desmoplakin isoform I							134.0	142.0	140.0					6																	7559514		2203	4300	6503	SO:0001583	missense	1832				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton	g.chr6:7559514C>G	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.478C>G	6.37:g.7559514C>G	ENSP00000369129:p.Arg160Gly		Somatic				DSP_uc003mxq.1_Missense_Mutation_p.R160G	p.R160G	NM_004415	NP_004406	WXS	Illumina HiSeq	Unspecified	P15924	DESP_HUMAN		OV - Ovarian serous cystadenocarcinoma(45;0.000508)	4	757	+	Ovarian(93;0.0584)	all_hematologic(90;0.236)	160			Globular 1.|Interacts with plakophilin 1 and junction plakoglobin.		B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Missense_Mutation	SNP	ENST00000379802.3	37	c.478C>G	CCDS4501.1	.	.	.	.	.	.	.	.	.	.	C	18.57	3.651547	0.67472	.	.	ENSG00000096696	ENST00000379802;ENST00000418664	T;T	0.76316	-0.66;-1.01	5.66	3.81	0.43845	.	0.000000	0.56097	D	0.000022	T	0.71584	0.3357	N	0.24115	0.695	0.40516	D	0.980788	D;D	0.63880	0.993;0.993	D;D	0.74023	0.982;0.982	T	0.71560	-0.4556	10	0.27082	T	0.32	.	15.3128	0.74048	0.2706:0.7294:0.0:0.0	.	207;160	Q4LE79;P15924	.;DESP_HUMAN	G	160	ENSP00000369129:R160G;ENSP00000396591:R160G	ENSP00000369129:R160G	R	+	1	2	DSP	7504513	0.985000	0.35326	0.173000	0.22940	0.995000	0.86356	2.744000	0.47450	0.780000	0.33566	-0.181000	0.13052	CGA		0.507	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415		25	157	0	0	0	0	25	157				
DSP	1832	broad.mit.edu	37	6	7566622	7566622	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr6:7566622C>T	ENST00000379802.3	+	8	1293	c.952C>T	c.(952-954)Caa>Taa	p.Q318*	DSP_ENST00000418664.2_Nonsense_Mutation_p.Q318*	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	318	Globular 1.|Interacts with plakophilin 1 and junction plakoglobin.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		ACGCATGAGTCAACTGGAAGT	0.373																																						uc003mxp.1		NA																	0				central_nervous_system(6)|ovary(2)|skin(1)	9						c.(952-954)CAA>TAA		desmoplakin isoform I							112.0	110.0	110.0					6																	7566622		2203	4300	6503	SO:0001587	stop_gained	1832				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton	g.chr6:7566622C>T	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.952C>T	6.37:g.7566622C>T	ENSP00000369129:p.Gln318*		Somatic				DSP_uc003mxq.1_Nonsense_Mutation_p.Q318*	p.Q318*	NM_004415	NP_004406	WXS	Illumina HiSeq	Unspecified	P15924	DESP_HUMAN		OV - Ovarian serous cystadenocarcinoma(45;0.000508)	8	1231	+	Ovarian(93;0.0584)	all_hematologic(90;0.236)	318			Globular 1.|Interacts with plakophilin 1 and junction plakoglobin.		B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Nonsense_Mutation	SNP	ENST00000379802.3	37	c.952C>T	CCDS4501.1	.	.	.	.	.	.	.	.	.	.	C	40	7.937885	0.98571	.	.	ENSG00000096696	ENST00000379802;ENST00000418664;ENST00000397483	.	.	.	5.4	4.52	0.55395	.	0.206543	0.34002	N	0.004346	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	15.717	0.77674	0.0:0.6134:0.3866:0.0	.	.	.	.	X	318;318;123	.	ENSP00000369129:Q318X	Q	+	1	0	DSP	7511621	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.843000	0.55865	1.388000	0.46506	-0.176000	0.13171	CAA		0.373	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415		9	63	0	0	0	0	9	63				
DSP	1832	broad.mit.edu	37	6	7570715	7570715	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr6:7570715C>T	ENST00000379802.3	+	13	1961	c.1620C>T	c.(1618-1620)ctC>ctT	p.L540L	DSP_ENST00000418664.2_Silent_p.L540L	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	540	Globular 1.|Interacts with plakophilin 1 and junction plakoglobin.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		GGAACCAGCTCTACATCAACA	0.498																																						uc003mxp.1		NA																	0				central_nervous_system(6)|ovary(2)|skin(1)	9						c.(1618-1620)CTC>CTT		desmoplakin isoform I							165.0	151.0	156.0					6																	7570715		2203	4300	6503	SO:0001819	synonymous_variant	1832				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton	g.chr6:7570715C>T	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.1620C>T	6.37:g.7570715C>T			Somatic				DSP_uc003mxq.1_Silent_p.L540L	p.L540L	NM_004415	NP_004406	WXS	Illumina HiSeq	Unspecified	P15924	DESP_HUMAN		OV - Ovarian serous cystadenocarcinoma(45;0.000508)	13	1899	+	Ovarian(93;0.0584)	all_hematologic(90;0.236)	540			Globular 1.|Interacts with plakophilin 1 and junction plakoglobin.		B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Silent	SNP	ENST00000379802.3	37	c.1620C>T	CCDS4501.1																																																																																				0.498	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415		24	114	0	0	0	0	24	114				
HIST1H2AC	8334	broad.mit.edu	37	6	26124697	26124697	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr6:26124697C>T	ENST00000602637.1	+	1	267	c.237C>T	c.(235-237)atC>atT	p.I79I	HIST1H2BC_ENST00000314332.5_5'Flank|HIST1H2BC_ENST00000396984.1_5'Flank|HIST1H2AC_ENST00000377791.2_Silent_p.I79I			Q93077	H2A1C_HUMAN	histone cluster 1, H2ac	79						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(5)	12						AGACTCGCATCATCCCGCGCC	0.642																																						uc003ngm.2		NA																	0					0						c.(235-237)ATC>ATT		histone cluster 1, H2ac							103.0	99.0	100.0					6																	26124697		2203	4300	6503	SO:0001819	synonymous_variant	8334				nucleosome assembly	nucleosome|nucleus	DNA binding	g.chr6:26124697C>T	Z80778	CCDS4585.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000180573	ENSG00000180573		"""Histones / Replication-dependent"""	4733	protein-coding gene	gene with protein product		602794	"""H2A histone family, member L"", ""histone 1, H2ac"""	H2AFL		9119399, 12408966	Standard	NM_003512		Approved		uc003ngm.3	Q93077	OTTHUMG00000014428	ENST00000602637.1:c.237C>T	6.37:g.26124697C>T			Somatic				HIST1H2BC_uc003ngk.3_5'Flank|HIST1H2BC_uc003ngl.2_5'Flank|HIST1H2AC_uc003ngn.2_RNA|HIST1H2AC_uc003ngo.2_RNA|HIST1H2AC_uc003ngp.2_Silent_p.I79I	p.I79I	NM_003512	NP_003503	WXS	Illumina HiSeq	Unspecified	Q93077	H2A1C_HUMAN			1	325	+			79					B2R4F7|O00775|O00776|O00777|O00778|Q540R1	Silent	SNP	ENST00000602637.1	37	c.237C>T	CCDS4585.1																																																																																				0.642	HIST1H2AC-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000468023.1	NM_003512		21	109	0	0	0	0	21	109				
BTN3A1	11119	broad.mit.edu	37	6	26413881	26413881	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr6:26413881G>C	ENST00000289361.6	+	10	1871	c.1503G>C	c.(1501-1503)ttG>ttC	p.L501F	BTN3A1_ENST00000414912.2_Missense_Mutation_p.L449F	NM_001145008.1|NM_001145009.1|NM_007048.5	NP_001138480.1|NP_001138481.1|NP_008979.3	O00481	BT3A1_HUMAN	butyrophilin, subfamily 3, member A1	501	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				activated T cell proliferation (GO:0050798)|cytokine secretion (GO:0050663)|interferon-gamma secretion (GO:0072643)|T cell receptor signaling pathway (GO:0050852)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28						TCAGAATTTTGACCTTGGAGC	0.463																																						uc003nhv.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(1501-1503)TTG>TTC		butyrophilin, subfamily 3, member A1 isoform a							117.0	110.0	112.0					6																	26413881		2203	4300	6503	SO:0001583	missense	11119				lipid metabolic process	integral to membrane		g.chr6:26413881G>C	U90552	CCDS4608.1, CCDS4609.1, CCDS47388.1, CCDS47389.1	6p22.1	2014-01-14			ENSG00000026950	ENSG00000026950		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1138	protein-coding gene	gene with protein product		613593				9149941	Standard	NM_007048		Approved	BT3.1, BTF5, CD277, BTN3.1	uc003nhv.3	O00481	OTTHUMG00000014449	ENST00000289361.6:c.1503G>C	6.37:g.26413881G>C	ENSP00000289361:p.Leu501Phe		Somatic				BTN3A1_uc011dkj.1_3'UTR|BTN3A1_uc011dkk.1_Missense_Mutation_p.L449F|BTN3A1_uc010jqj.2_3'UTR	p.L501F	NM_007048	NP_008979	WXS	Illumina HiSeq	Unspecified	O00481	BT3A1_HUMAN			10	1871	+			501			Cytoplasmic (Potential).|B30.2/SPRY.		A2A278|A8K2C8|B4DIQ1|B4DRM2|E9PGB4|E9PHG8|Q0P515|Q147X5|Q53F15|Q99420|Q9HCY1	Missense_Mutation	SNP	ENST00000289361.6	37	c.1503G>C	CCDS4608.1	.	.	.	.	.	.	.	.	.	.	.	13.07	2.126382	0.37533	.	.	ENSG00000026950	ENST00000289361;ENST00000414912	T;T	0.61627	0.09;0.09	2.31	-1.71	0.08133	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);	.	.	.	.	T	0.36771	0.0979	L	0.38175	1.15	0.09310	N	1	P;D	0.60575	0.901;0.988	P;P	0.59288	0.707;0.855	T	0.14587	-1.0467	9	0.54805	T	0.06	.	2.2408	0.04019	0.3135:0.0:0.3505:0.336	.	449;501	E9PGB4;O00481	.;BT3A1_HUMAN	F	501;449	ENSP00000289361:L501F;ENSP00000406667:L449F	ENSP00000289361:L501F	L	+	3	2	BTN3A1	26521860	0.005000	0.15991	0.000000	0.03702	0.478000	0.33099	1.480000	0.35464	-0.462000	0.06984	-0.888000	0.02935	TTG		0.463	BTN3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040112.3			18	121	0	0	0	0	18	121				
BTN2A1	11120	broad.mit.edu	37	6	26463541	26463541	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr6:26463541C>T	ENST00000312541.5	+	4	748	c.500C>T	c.(499-501)tCt>tTt	p.S167F	BTN2A1_ENST00000469185.1_Missense_Mutation_p.S167F|BTN2A1_ENST00000429381.1_Missense_Mutation_p.S167F|BTN2A1_ENST00000541522.1_Missense_Mutation_p.S106F	NM_007049.3|NM_078476.2	NP_008980.1|NP_510961.1	Q7KYR7	BT2A1_HUMAN	butyrophilin, subfamily 2, member A1	167					lipid metabolic process (GO:0006629)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)|skin(3)|urinary_tract(3)	27						GAGTGCATATCTAGAGGGTGG	0.587																																						uc003nib.1		NA																	0				ovary(1)|skin(1)	2						c.(499-501)TCT>TTT		butyrophilin, subfamily 2, member A1 isoform 1							75.0	72.0	73.0					6																	26463541		2203	4300	6503	SO:0001583	missense	11120				lipid metabolic process	integral to plasma membrane		g.chr6:26463541C>T	U90543	CCDS4613.1, CCDS47390.1, CCDS56404.1, CCDS56405.1	6p22.1	2014-01-14			ENSG00000112763	ENSG00000112763		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1136	protein-coding gene	gene with protein product		613590				9382921, 9149941	Standard	NM_007049		Approved	BT2.1, BTF1, BTN2.1	uc003nib.2	Q7KYR7	OTTHUMG00000014457	ENST00000312541.5:c.500C>T	6.37:g.26463541C>T	ENSP00000312158:p.Ser167Phe		Somatic				BTN2A1_uc003nic.1_Missense_Mutation_p.S167F|BTN2A1_uc003nid.1_Missense_Mutation_p.S15F|BTN2A1_uc011dko.1_Missense_Mutation_p.S106F|BTN2A1_uc010jqk.1_5'Flank	p.S167F	NM_007049	NP_008980	WXS	Illumina HiSeq	Unspecified	Q7KYR7	BT2A1_HUMAN			4	712	+			167			Extracellular (Potential).		B4DLP9|E9PGR4|O00475|P78408|Q59EN4|Q7KYQ7|Q7Z386|Q96AV7|Q9NU62	Missense_Mutation	SNP	ENST00000312541.5	37	c.500C>T	CCDS4613.1	.	.	.	.	.	.	.	.	.	.	C	15.49	2.849294	0.51270	.	.	ENSG00000112763	ENST00000312541;ENST00000541522;ENST00000429381;ENST00000265424;ENST00000469185	D;D;D;D	0.81908	-1.55;-1.55;-1.55;-1.55	2.88	2.88	0.33553	CD80-like, immunoglobulin C2-set (1);	0.000000	0.52532	D	0.000061	D	0.91680	0.7370	H	0.95328	3.655	0.35266	D	0.779994	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92968	0.6395	10	0.87932	D	0	.	11.9438	0.52915	0.0:1.0:0.0:0.0	.	167;167	Q96AV7;Q7KYR7	.;BT2A1_HUMAN	F	167;106;167;167;167	ENSP00000312158:S167F;ENSP00000443909:S106F;ENSP00000416945:S167F;ENSP00000419043:S167F	ENSP00000265424:S167F	S	+	2	0	BTN2A1	26571520	0.860000	0.29831	0.799000	0.32177	0.481000	0.33189	4.218000	0.58554	1.896000	0.54893	0.561000	0.74099	TCT		0.587	BTN2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040122.2	NM_007049		9	74	0	0	0	0	9	74				
HIST1H3I	8354	broad.mit.edu	37	6	27839889	27839889	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr6:27839889G>A	ENST00000328488.2	-	1	210	c.205C>T	c.(205-207)Cag>Tag	p.Q69*		NM_003533.2	NP_003524.1	P68431	H31_HUMAN	histone cluster 1, H3i	69					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			endometrium(2)|kidney(1)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						ACCAAGCGCTGAAAAGGTAGC	0.637																																						uc003njy.2		NA																	0				ovary(1)	1						c.(205-207)CAG>TAG		histone cluster 1, H3i							78.0	83.0	81.0					6																	27839889		2203	4300	6503	SO:0001587	stop_gained	8354				blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding	g.chr6:27839889G>A	X83550	CCDS4636.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000182572	ENSG00000275379		"""Histones / Replication-dependent"""	4771	protein-coding gene	gene with protein product		602814	"""H3 histone family, member F"", ""histone 1, H3i"""	H3FF		9031620, 9439656, 12408966	Standard	NM_003533		Approved	H3/f, H3.f	uc003njy.3	P68431	OTTHUMG00000016184	ENST00000328488.2:c.205C>T	6.37:g.27839889G>A	ENSP00000329554:p.Gln69*		Somatic					p.Q69*	NM_003533	NP_003524	WXS	Illumina HiSeq	Unspecified	P68431	H31_HUMAN			1	211	-			69					A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Nonsense_Mutation	SNP	ENST00000328488.2	37	c.205C>T	CCDS4636.1	.	.	.	.	.	.	.	.	.	.	G	13.98	2.400028	0.42613	.	.	ENSG00000182572	ENST00000328488	.	.	.	4.12	4.12	0.48240	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	16.6345	0.85043	0.0:0.0:1.0:0.0	.	.	.	.	X	69	.	ENSP00000329554:Q69X	Q	-	1	0	HIST1H3I	27947868	1.000000	0.71417	1.000000	0.80357	0.034000	0.12701	9.224000	0.95209	2.580000	0.87095	0.650000	0.86243	CAG		0.637	HIST1H3I-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043452.1	NM_003533		32	92	0	0	0	0	32	92				
PSORS1C1	170679	broad.mit.edu	37	6	31084503	31084503	+	Intron	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr6:31084503C>T	ENST00000259881.9	+	1	61				CDSN_ENST00000376288.2_Missense_Mutation_p.E297K|PSORS1C1_ENST00000467107.1_3'UTR	NM_014068.2	NP_054787.2	Q9UIG5	PS1C1_HUMAN	psoriasis susceptibility 1 candidate 1											kidney(1)|ovary(2)|prostate(1)|skin(1)	5						CCCACCACCTCGTAGCCACCA	0.547																																						uc003nsm.1		NA																	0				ovary(1)|pancreas(1)	2						c.(889-891)GAG>AAG		corneodesmosin precursor							34.0	33.0	33.0					6																	31084503		1922	3847	5769	SO:0001627	intron_variant	1041				cell-cell adhesion|keratinocyte differentiation|skin morphogenesis	cornified envelope|desmosome|extracellular region	protein homodimerization activity	g.chr6:31084503C>T	AB031479	CCDS34390.1	6p21.3	2014-01-28	2003-06-12		ENSG00000204540	ENSG00000204540			17202	protein-coding gene	gene with protein product		613525	"""chromosome 6 open reading frame 16"""	C6orf16			Standard	NM_014068		Approved	SEEK1	uc003nsl.2	Q9UIG5	OTTHUMG00000031077	ENST00000259881.9:c.-229+1835C>T	6.37:g.31084503C>T			Somatic				PSORS1C1_uc003nsl.1_Intron|PSORS1C1_uc010jsj.1_Intron	p.E297K	NM_001264	NP_001255	WXS	Illumina HiSeq	Unspecified	Q15517	CDSN_HUMAN			2	916	-			297			Ser-rich.		B0V083|Q5ST21|Q86WJ8|Q86WJ9|Q96QC3	Missense_Mutation	SNP	ENST00000259881.9	37	c.889G>A	CCDS34390.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.313699	0.81358	.	.	ENSG00000204539	ENST00000376288	T	0.12569	2.67	4.76	4.76	0.60689	.	0.000000	0.51477	D	0.000093	T	0.16685	0.0401	L	0.36672	1.1	0.32404	N	0.551573	D	0.76494	0.999	D	0.78314	0.991	T	0.01152	-1.1435	10	0.62326	D	0.03	-21.441	13.2439	0.60012	0.0:1.0:0.0:0.0	.	297	Q15517	CDSN_HUMAN	K	297	ENSP00000365465:E297K	ENSP00000365465:E297K	E	-	1	0	CDSN	31192482	0.972000	0.33761	1.000000	0.80357	0.983000	0.72400	2.162000	0.42367	2.192000	0.70111	0.549000	0.68633	GAG		0.547	PSORS1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076110.3	NM_014068		5	41	0	0	0	0	5	41				
HLA-B	3106	broad.mit.edu	37	6	31324665	31324665	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr6:31324665G>T	ENST00000412585.2	-	2	171	c.143C>A	c.(142-144)tCa>tAa	p.S48*		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	48	Alpha-1.		S -> A (in dbSNP:rs713031).|S -> P (in dbSNP:rs713031).|S -> T (in dbSNP:rs713031).		antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)			endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						GTAGCCCACTGAGATGAAGCG	0.697									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of																													uc003nth.2		NA																	0					0						c.(142-144)TCA>TAA		major histocompatibility complex, class I, B							28.0	22.0	24.0					6																	31324665		2122	4121	6243	SO:0001587	stop_gained	3106	Melanoma_Familial_Clustering_of|Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of	Familial Cancer Database	;Lichen Sclerosis, Familial	antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to plasma membrane|MHC class I protein complex	MHC class I receptor activity	g.chr6:31324665G>T	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.143C>A	6.37:g.31324665G>T	ENSP00000399168:p.Ser48*		Somatic				HLA-C_uc003ntb.2_5'Flank|HLA-C_uc003ntc.1_5'Flank|HLA-B_uc010jsm.1_5'Flank|HLA-B_uc011dnk.1_5'Flank|HLA-B_uc003ntf.2_Nonsense_Mutation_p.S48*|HLA-B_uc003ntg.1_5'Flank|HLA-B_uc003nti.1_5'Flank|HLA-B_uc010jsn.1_5'Flank|HLA-B_uc010jso.2_Nonsense_Mutation_p.S20*	p.S48*	NM_005514	NP_005505	WXS	Illumina HiSeq	Unspecified	P01889	1B07_HUMAN			2	197	-			48			Alpha-1.|Extracellular (Potential).		Q29764	Nonsense_Mutation	SNP	ENST00000412585.2	37	c.143C>A	CCDS34394.1	.	.	.	.	.	.	.	.	.	.	N	10.47	1.358338	0.24598	.	.	ENSG00000234745	ENST00000412585;ENST00000434333	.	.	.	3.2	-5.04	0.02964	.	2.396650	0.02953	U	0.141997	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	.	2.4307	0.04470	0.1602:0.1085:0.3972:0.3341	.	.	.	.	X	48;59	.	ENSP00000399168:S48X	S	-	2	0	HLA-B	31432644	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.652000	0.05366	-2.165000	0.00781	-3.149000	0.00058	TCA		0.697	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076280.4	NM_005514		8	24	1	0	5.18e-06	5.43e-06	8	24				
C6orf47	57827	broad.mit.edu	37	6	31627496	31627496	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr6:31627496C>T	ENST00000375911.1	-	1	1053	c.229G>A	c.(229-231)Gag>Aag	p.E77K	C6orf47-AS1_ENST00000422049.1_RNA	NM_021184.3	NP_067007.3	O95873	CF047_HUMAN	chromosome 6 open reading frame 47	77						cytoplasm (GO:0005737)				NS(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	9						ACTTGGGGCTCCTCCTTGCTT	0.562																																						uc003nvm.1		NA																	0				ovary(1)	1						c.(229-231)GAG>AAG		G4 protein							65.0	67.0	66.0					6																	31627496		1511	2709	4220	SO:0001583	missense	57827							g.chr6:31627496C>T	AF129756	CCDS34399.1	6p21.3	2011-12-13			ENSG00000204439	ENSG00000204439			19076	protein-coding gene	gene with protein product						2477242	Standard	NM_021184		Approved	D6S53E, G4	uc003nvm.1	O95873	OTTHUMG00000031172	ENST00000375911.1:c.229G>A	6.37:g.31627496C>T	ENSP00000365076:p.Glu77Lys		Somatic					p.E77K	NM_021184	NP_067007	WXS	Illumina HiSeq	Unspecified	O95873	CF047_HUMAN			1	1054	-			77					B0UXA1|B0UZ50|Q5SSS6|Q95IG0	Missense_Mutation	SNP	ENST00000375911.1	37	c.229G>A	CCDS34399.1	.	.	.	.	.	.	.	.	.	.	C	0.008	-1.870139	0.00542	.	.	ENSG00000204439	ENST00000375911;ENST00000538106	T	0.31247	1.5	.	.	.	.	0.741988	0.11669	N	0.541074	T	0.07818	0.0196	L	0.51422	1.61	0.09310	N	1	P	0.34934	0.476	B	0.36186	0.219	T	0.34551	-0.9824	8	0.06891	T	0.86	-1.4625	.	.	.	.	77	O95873	CF047_HUMAN	K	77	ENSP00000365076:E77K	ENSP00000365076:E77K	E	-	1	0	C6orf47	31735475	0.001000	0.12720	0.001000	0.08648	0.014000	0.08584	0.076000	0.14712	0.088000	0.17205	0.089000	0.15464	GAG		0.562	C6orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076324.1	NM_021184		4	48	0	0	0	0	4	48				
EHMT2	10919	broad.mit.edu	37	6	31856391	31856391	+	Missense_Mutation	SNP	C	C	G	rs547949077		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr6:31856391C>G	ENST00000375537.4	-	11	1356	c.1350G>C	c.(1348-1350)gaG>gaC	p.E450D	EHMT2_ENST00000375528.4_Missense_Mutation_p.E473D|EHMT2_ENST00000395728.3_Missense_Mutation_p.E507D|EHMT2_ENST00000375530.4_Missense_Mutation_p.E416D|EHMT2_ENST00000480912.1_5'UTR	NM_006709.3	NP_006700.3	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2	450					DNA methylation (GO:0006306)|DNA methylation on cytosine within a CG sequence (GO:0010424)|fertilization (GO:0009566)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ growth (GO:0035265)|peptidyl-lysine dimethylation (GO:0018027)|regulation of DNA replication (GO:0006275)|spermatid development (GO:0007286)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	21						CGTCCACACTCTCAGTGGCCA	0.662													c|||	1	0.000199681	0.0	0.0014	5008	,	,		17429	0.0		0.0	False		,,,				2504	0.0					uc003nxz.1		NA																	0				ovary(1)	1						c.(1348-1350)GAG>GAC		euchromatic histone-lysine N-methyltransferase 2							65.0	59.0	61.0					6																	31856391		2203	4300	6503	SO:0001583	missense	10919				DNA methylation|peptidyl-lysine dimethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding	g.chr6:31856391C>G	AF134726	CCDS4725.1, CCDS4726.1, CCDS75425.1	6p21.3	2013-01-10	2004-03-22	2005-06-09	ENSG00000204371	ENSG00000204371	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	14129	protein-coding gene	gene with protein product		604599	"""chromosome 6 open reading frame 30"", ""HLA-B associated transcript 8"""	C6orf30, BAT8		8457211, 11316813	Standard	XM_005274833		Approved	G9A, Em:AF134726.3, NG36/G9a, KMT1C	uc003nxz.1	Q96KQ7	OTTHUMG00000031180	ENST00000375537.4:c.1350G>C	6.37:g.31856391C>G	ENSP00000364687:p.Glu450Asp		Somatic				EHMT2_uc003nxy.1_Missense_Mutation_p.E241D|EHMT2_uc011don.1_Missense_Mutation_p.E473D|EHMT2_uc003nya.1_Missense_Mutation_p.E416D	p.E450D	NM_006709	NP_006700	WXS	Illumina HiSeq	Unspecified	Q96KQ7	EHMT2_HUMAN			11	1360	-			450					B0UZY2|Q14349|Q5JP83|Q5JQ92|Q5JQA1|Q5JQG3|Q6PK06|Q96MH5|Q96QD0|Q9UQL8|Q9Y331	Missense_Mutation	SNP	ENST00000375537.4	37	c.1350G>C	CCDS4725.1	.	.	.	.	.	.	.	.	.	.	c	10.27	1.304114	0.23736	.	.	ENSG00000204371	ENST00000395728;ENST00000375528;ENST00000375530;ENST00000375537;ENST00000442298	T;T;T;T	0.70986	-0.53;-0.33;-0.27;-0.5	4.97	2.19	0.27852	.	0.000000	0.85682	D	0.000000	T	0.31104	0.0786	N	0.25380	0.74	0.33021	D	0.528813	B;B;P;P	0.35745	0.167;0.257;0.518;0.518	B;B;B;B	0.32533	0.07;0.147;0.124;0.124	T	0.06698	-1.0812	10	0.18710	T	0.47	.	8.8004	0.34905	0.0:0.6791:0.0:0.3209	.	473;416;450;264	A2ABF8;Q96KQ7-2;Q96KQ7;Q59FM7	.;.;EHMT2_HUMAN;.	D	507;473;416;450;264	ENSP00000379078:E507D;ENSP00000364678:E473D;ENSP00000364680:E416D;ENSP00000364687:E450D	ENSP00000364678:E473D	E	-	3	2	EHMT2	31964370	1.000000	0.71417	0.995000	0.50966	0.912000	0.54170	1.050000	0.30404	0.277000	0.22141	0.550000	0.68814	GAG		0.662	EHMT2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076355.5	NM_006709		4	31	0	0	0	0	4	31				
TNXB	7148	broad.mit.edu	37	6	32050002	32050002	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr6:32050002C>T	ENST00000375244.3	-	9	3748	c.3547G>A	c.(3547-3549)Gag>Aag	p.E1183K	TNXB_ENST00000375247.2_Missense_Mutation_p.E1183K			P22105	TENX_HUMAN	tenascin XB	1270	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						AACTGGCCCTCAGGGACAGTC	0.602																																						uc003nzl.2		NA																	0					0						c.(3547-3549)GAG>AAG		tenascin XB isoform 1 precursor							78.0	64.0	68.0					6																	32050002		1239	2537	3776	SO:0001583	missense	7148				actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding	g.chr6:32050002C>T	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.3547G>A	6.37:g.32050002C>T	ENSP00000364393:p.Glu1183Lys		Somatic					p.E1183K	NM_019105	NP_061978	WXS	Illumina HiSeq	Unspecified	P22105	TENX_HUMAN			9	3749	-			1270			Fibronectin type-III 5.		P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000375244.3	37	c.3547G>A		.	.	.	.	.	.	.	.	.	.	C	14.87	2.664660	0.47572	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.53423	0.62;0.62	4.83	3.96	0.45880	.	0.285351	0.24766	N	0.035769	T	0.34600	0.0903	M	0.88241	2.94	0.18873	N	0.999981	P	0.38617	0.64	P	0.44772	0.46	T	0.46775	-0.9167	10	0.08179	T	0.78	.	7.079	0.25221	0.0:0.8023:0.0:0.1977	.	1183	P22105-3	.	K	1183	ENSP00000364393:E1183K;ENSP00000364396:E1183K	ENSP00000364393:E1183K	E	-	1	0	TNXB	32157980	0.000000	0.05858	0.894000	0.35097	0.919000	0.55068	0.210000	0.17455	1.257000	0.44085	0.407000	0.27541	GAG		0.602	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105		5	47	0	0	0	0	5	47				
ITPR3	3710	broad.mit.edu	37	6	33660549	33660549	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr6:33660549C>T	ENST00000374316.5	+	56	8563	c.7503C>T	c.(7501-7503)ttC>ttT	p.F2501F	ITPR3_ENST00000605930.1_Silent_p.F2501F			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	2501					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	TCCTGTTCTTCTTCATCGTCA	0.547																																						uc011drk.1		NA																	0				ovary(6)|lung(5)|central_nervous_system(5)|breast(2)|kidney(1)	19						c.(7501-7503)TTC>TTT		inositol 1,4,5-triphosphate receptor, type 3							200.0	162.0	175.0					6																	33660549		2203	4300	6503	SO:0001819	synonymous_variant	3710				activation of phospholipase C activity|calcium ion transport into cytosol|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|protein heterooligomerization|protein homooligomerization|regulation of insulin secretion|response to calcium ion	apical part of cell|brush border|endoplasmic reticulum membrane|integral to plasma membrane|myelin sheath|neuronal cell body|nuclear outer membrane|platelet dense tubular network membrane	inositol 1,3,4,5 tetrakisphosphate binding|inositol 1,4,5 trisphosphate binding|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|inositol hexakisphosphate binding|intracellular ligand-gated calcium channel activity|protein binding	g.chr6:33660549C>T	D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.7503C>T	6.37:g.33660549C>T			Somatic				ITPR3_uc003oey.2_Silent_p.F588F	p.F2501F	NM_002224	NP_002215	WXS	Illumina HiSeq	Unspecified	Q14573	ITPR3_HUMAN			55	7722	+			2501			Helical; (Potential).		Q14649|Q5TAQ2	Silent	SNP	ENST00000374316.5	37	c.7503C>T	CCDS4783.1																																																																																				0.547	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2	NM_002224		17	87	0	0	0	0	17	87				
UHRF1BP1	54887	broad.mit.edu	37	6	34839420	34839420	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr6:34839420G>A	ENST00000192788.5	+	19	4212	c.4041G>A	c.(4039-4041)atG>atA	p.M1347I	UHRF1BP1_ENST00000452449.2_Missense_Mutation_p.M1347I	NM_017754.3	NP_060224.3	Q6BDS2	URFB1_HUMAN	UHRF1 binding protein 1	1347							histone deacetylase binding (GO:0042826)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(24)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	54						CTCTGGCCATGGAACATGTTG	0.522																																						uc003oju.3		NA																	0				ovary(3)	3						c.(4039-4041)ATG>ATA		ICBP90 binding protein 1							137.0	132.0	133.0					6																	34839420		2011	4171	6182	SO:0001583	missense	54887							g.chr6:34839420G>A	AB126777	CCDS43455.1	6p21.31	2008-10-28	2008-08-15	2007-11-27	ENSG00000065060	ENSG00000065060			21216	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 107"""	C6orf107			Standard	NM_017754		Approved	FLJ20302, dJ349A12.1, ICBP90	uc003oju.4	Q6BDS2	OTTHUMG00000014557	ENST00000192788.5:c.4041G>A	6.37:g.34839420G>A	ENSP00000192788:p.Met1347Ile		Somatic				UHRF1BP1_uc010jvm.1_RNA|UHRF1BP1_uc010jvn.2_RNA|UHRF1BP1_uc010jvo.2_RNA	p.M1347I	NM_017754	NP_060224	WXS	Illumina HiSeq	Unspecified	Q6BDS2	URFB1_HUMAN			19	4275	+			1347					Q9NXE0	Missense_Mutation	SNP	ENST00000192788.5	37	c.4041G>A	CCDS43455.1	.	.	.	.	.	.	.	.	.	.	G	5.295	0.239890	0.10023	.	.	ENSG00000065060	ENST00000192788;ENST00000452449	T;T	0.04454	3.69;3.62	6.08	6.08	0.98989	.	0.325376	0.36972	N	0.002312	T	0.00608	0.0020	N	0.02158	-0.66	0.30650	N	0.755476	B	0.06786	0.001	B	0.01281	0.0	T	0.46693	-0.9173	10	0.02654	T	1	-10.1788	11.2111	0.48799	0.0678:0.1277:0.8045:0.0	.	1347	Q6BDS2	URFB1_HUMAN	I	1347	ENSP00000192788:M1347I;ENSP00000400628:M1347I	ENSP00000192788:M1347I	M	+	3	0	UHRF1BP1	34947398	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.260000	0.32968	2.894000	0.99253	0.655000	0.94253	ATG		0.522	UHRF1BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040260.1	NM_017754		10	53	0	0	0	0	10	53				
MTCH1	23787	broad.mit.edu	37	6	36938202	36938202	+	Silent	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr6:36938202G>A	ENST00000373627.5	-	10	1126	c.1002C>T	c.(1000-1002)ctC>ctT	p.L334L	MTCH1_ENST00000373616.5_Silent_p.L317L|MTCH1_ENST00000471737.1_5'UTR|MTCH1_ENST00000538808.1_Silent_p.L161L	NM_001271641.1	NP_001258570.1	Q9NZJ7	MTCH1_HUMAN	mitochondrial carrier 1	334					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|neuronal ion channel clustering (GO:0045161)|positive regulation of apoptotic process (GO:0043065)|regulation of signal transduction (GO:0009966)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	6						TCACAGCCATGAGGTCGCCAA	0.622																																						uc003ond.1		NA																	0					0						c.(1000-1002)CTC>CTT		mitochondrial carrier homolog 1							93.0	84.0	87.0					6																	36938202		2203	4300	6503	SO:0001819	synonymous_variant	23787				activation of caspase activity|neuronal ion channel clustering|positive regulation of apoptosis|regulation of signal transduction|transport	integral to membrane|mitochondrial inner membrane	protein binding	g.chr6:36938202G>A	AF151822	CCDS4828.1, CCDS64411.1	6p21.2	2013-05-22	2011-05-19		ENSG00000137409	ENSG00000137409		"""Solute carriers"""	17586	protein-coding gene	gene with protein product	"""solute carrier family 25, member 49"""	610449	"""mitochondrial carrier homolog 1 (C. elegans)"""			12377771	Standard	NM_014341		Approved	CGI-64, PSAP, SLC25A49	uc003ond.2	Q9NZJ7	OTTHUMG00000014614	ENST00000373627.5:c.1002C>T	6.37:g.36938202G>A			Somatic				MTCH1_uc003onc.1_Silent_p.L317L|MTCH1_uc010jwo.1_RNA|MTCH1_uc003one.3_Silent_p.L334L|MTCH1_uc011dtt.1_Silent_p.L149L	p.L334L	NM_014341	NP_055156	WXS	Illumina HiSeq	Unspecified	Q9NZJ7	MTCH1_HUMAN			10	1002	-			334			Helical; (Potential).		A8KAX5|B2RCE3|Q6PK60|Q6UX45|Q7L465|Q9BW23|Q9NZR6|Q9UJZ5	Silent	SNP	ENST00000373627.5	37	c.1002C>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.38|16.38	3.108168|3.108168	0.56291|0.56291	.|.	.|.	ENSG00000137409|ENSG00000137409	ENST00000373550|ENST00000418541	.|.	.|.	.|.	5.52|5.52	5.52|5.52	0.82312|0.82312	.|.	.|.	.|.	.|.	.|.	T|T	0.68063|0.68063	0.2960|0.2960	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.66392|0.66392	-0.5935|-0.5935	5|4	0.72032|.	D|.	0.01|.	-11.1256|-11.1256	17.631|17.631	0.88108|0.88108	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	Y|L	255|148	.|.	ENSP00000362651:H255Y|.	H|S	-|-	1|2	0|0	MTCH1|MTCH1	37046180|37046180	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.957000|0.957000	0.61999|0.61999	2.999000|2.999000	0.49473|0.49473	2.597000|2.597000	0.87782|0.87782	0.655000|0.655000	0.94253|0.94253	CAT|TCA		0.622	MTCH1-008	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000040396.1	NM_014341		10	52	0	0	0	0	10	52				
PTK7	5754	broad.mit.edu	37	6	43098331	43098331	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr6:43098331C>T	ENST00000230419.4	+	5	965	c.744C>T	c.(742-744)ttC>ttT	p.F248F	PTK7_ENST00000352931.2_Silent_p.F248F|PTK7_ENST00000349241.2_Silent_p.F248F|PTK7_ENST00000481273.1_Silent_p.F256F|PTK7_ENST00000345201.2_Silent_p.F248F|PTK7_ENST00000471863.1_Silent_p.F248F	NM_002821.4	NP_002812.2	Q13308	PTK7_HUMAN	protein tyrosine kinase 7	248	Ig-like C2-type 3.				actin cytoskeleton reorganization (GO:0031532)|axis elongation (GO:0003401)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|establishment of epithelial cell apical/basal polarity (GO:0045198)|establishment of planar polarity (GO:0001736)|lung-associated mesenchyme development (GO:0060484)|neural tube closure (GO:0001843)|peptidyl-tyrosine phosphorylation (GO:0018108)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of neuron projection development (GO:0010976)|signal transduction (GO:0007165)|wound healing (GO:0042060)	cell-cell junction (GO:0005911)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(12)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			ATTGCCAGTTCTCAGCCCAGC	0.582																																						uc003oub.1		NA																	0				ovary(2)|large_intestine(1)	3						c.(742-744)TTC>TTT		PTK7 protein tyrosine kinase 7 isoform a							102.0	83.0	89.0					6																	43098331		2203	4300	6503	SO:0001819	synonymous_variant	5754				actin cytoskeleton reorganization|canonical Wnt receptor signaling pathway|cell adhesion|cell migration	cell-cell junction|integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr6:43098331C>T	AF447176	CCDS4884.1, CCDS4885.1, CCDS4886.1, CCDS4887.1, CCDS59021.1	6p21.1-p12.2	2013-02-18	2013-02-18		ENSG00000112655	ENSG00000112655	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9618	protein-coding gene	gene with protein product		601890	"""PTK7 protein tyrosine kinase 7"""			7478540	Standard	NM_002821		Approved	CCK4	uc011dve.2	Q13308	OTTHUMG00000014721	ENST00000230419.4:c.744C>T	6.37:g.43098331C>T			Somatic				PTK7_uc003ouc.1_Silent_p.F248F|PTK7_uc003oud.1_Silent_p.F248F|PTK7_uc003oue.1_Silent_p.F248F|PTK7_uc003ouf.1_RNA|PTK7_uc003oug.1_RNA|PTK7_uc011dve.1_Silent_p.F256F|PTK7_uc010jyj.1_5'Flank|PTK7_uc003oua.2_Silent_p.F248F	p.F248F	NM_002821	NP_002812	WXS	Illumina HiSeq	Unspecified	Q13308	PTK7_HUMAN	Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)		5	942	+			248			Ig-like C2-type 3.|Extracellular (Potential).		A8K974|B7Z477|E9PFZ5|Q13417|Q5T650|Q6IQ54|Q8NFA5|Q8NFA6|Q8NFA7|Q8NFA8	Silent	SNP	ENST00000230419.4	37	c.744C>T	CCDS4884.1																																																																																				0.582	PTK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040580.2			3	32	0	0	0	0	3	32				
MUT	4594	broad.mit.edu	37	6	49415427	49415427	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr6:49415427C>T	ENST00000274813.3	-	8	1643	c.1516G>A	c.(1516-1518)Gat>Aat	p.D506N		NM_000255.3	NP_000246.2	P22033	MUTA_HUMAN	methylmalonyl CoA mutase	506					cellular lipid metabolic process (GO:0044255)|cobalamin metabolic process (GO:0009235)|fatty acid beta-oxidation (GO:0006635)|homocysteine metabolic process (GO:0050667)|post-embryonic development (GO:0009791)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	cobalamin binding (GO:0031419)|metal ion binding (GO:0046872)|methylmalonyl-CoA mutase activity (GO:0004494)|modified amino acid binding (GO:0072341)			endometrium(2)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	30	Lung NSC(77;0.0376)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GAAGTATTATCAATTGCCAGA	0.318																																						uc003ozg.3		NA																	0					0						c.(1516-1518)GAT>AAT		methylmalonyl Coenzyme A mutase precursor	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)						112.0	115.0	114.0					6																	49415427		2203	4296	6499	SO:0001583	missense	4594				fatty acid beta-oxidation	mitochondrial matrix	cobalamin binding|metal ion binding|methylmalonyl-CoA mutase activity	g.chr6:49415427C>T		CCDS4924.1	6p21	2012-10-02	2010-04-30		ENSG00000146085	ENSG00000146085	5.4.99.2		7526	protein-coding gene	gene with protein product		609058	"""methylmalonyl Coenzyme A mutase"""			2907507, 9503014	Standard	NM_000255		Approved		uc003ozg.4	P22033	OTTHUMG00000014814	ENST00000274813.3:c.1516G>A	6.37:g.49415427C>T	ENSP00000274813:p.Asp506Asn		Somatic					p.D506N	NM_000255	NP_000246	WXS	Illumina HiSeq	Unspecified	P22033	MUTA_HUMAN			8	1771	-	Lung NSC(77;0.0376)		506					A8K953|Q5SYZ3|Q96B11|Q9UD64	Missense_Mutation	SNP	ENST00000274813.3	37	c.1516G>A	CCDS4924.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.195292	0.78902	.	.	ENSG00000146085	ENST00000274813	D	0.98419	-4.92	5.24	5.24	0.73138	Cobalamin (vitamin B12)-dependent enzyme, catalytic (1);Cobalamin (vitamin B12)-dependent enzyme, catalytic subdomain (1);Methylmalonyl-CoA mutase, alpha/beta chain, catalytic (1);Methylmalonyl-CoA mutase, alpha chain, catalytic (1);	0.000000	0.85682	D	0.000000	D	0.98947	0.9642	M	0.85197	2.74	0.80722	D	1	B	0.28820	0.224	P	0.53062	0.717	D	0.99395	1.0926	10	0.62326	D	0.03	-0.073	18.1667	0.89731	0.0:1.0:0.0:0.0	.	506	P22033	MUTA_HUMAN	N	506	ENSP00000274813:D506N	ENSP00000274813:D506N	D	-	1	0	MUT	49523386	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.438000	0.80431	2.612000	0.88384	0.484000	0.47621	GAT		0.318	MUT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040854.1			13	70	0	0	0	0	13	70				
C6orf165	154313	broad.mit.edu	37	6	88144769	88144769	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr6:88144769C>T	ENST00000507897.1	+	11	1575	c.1492C>T	c.(1492-1494)Cag>Tag	p.Q498*	C6ORF165_ENST00000369562.4_Nonsense_Mutation_p.Q498*			Q8IYR0	CF165_HUMAN	chromosome 6 open reading frame 165	498										NS(1)|central_nervous_system(1)|large_intestine(5)|lung(8)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0419)		TCCATATTCTCAGGTAAGCAG	0.284																																						uc003plv.2		NA																	0				central_nervous_system(1)	1						c.(1492-1494)CAG>TAG		hypothetical protein LOC154313 isoform 1							66.0	71.0	69.0					6																	88144769		2202	4297	6499	SO:0001587	stop_gained	154313							g.chr6:88144769C>T	BC035083	CCDS34498.1	6q15	2012-02-07			ENSG00000213204	ENSG00000213204			21405	protein-coding gene	gene with protein product							Standard	NM_001031743		Approved	FLJ25974, dJ382I10.1	uc003plv.3	Q8IYR0	OTTHUMG00000015173	ENST00000507897.1:c.1492C>T	6.37:g.88144769C>T	ENSP00000426769:p.Gln498*		Somatic				SLC35A1_uc003plx.2_5'Flank|C6orf165_uc003plw.2_Nonsense_Mutation_p.Q310*|C6orf165_uc010kbv.1_RNA|C6orf165_uc003plu.1_Nonsense_Mutation_p.Q498*	p.Q498*	NM_001031743	NP_001026913	WXS	Illumina HiSeq	Unspecified	Q8IYR0	CF165_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0419)	11	1584	+		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)	498					A8K969|E1P507|Q8N9U4	Nonsense_Mutation	SNP	ENST00000507897.1	37	c.1492C>T	CCDS34498.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.195023	0.78902	.	.	ENSG00000213204	ENST00000369562	.	.	.	5.34	3.42	0.39159	.	0.186994	0.47093	D	0.000244	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	.	11.4077	0.49908	0.1418:0.7215:0.1367:0.0	.	.	.	.	X	498	.	ENSP00000358575:Q498X	Q	+	1	0	C6orf165	88201488	0.999000	0.42202	1.000000	0.80357	0.437000	0.31866	1.835000	0.39181	1.206000	0.43276	0.491000	0.48974	CAG		0.284	C6orf165-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000470406.1	NM_178823		6	56	0	0	0	0	6	56				
MDN1	23195	broad.mit.edu	37	6	90472197	90472197	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr6:90472197C>G	ENST00000369393.3	-	16	2312	c.2197G>C	c.(2197-2199)Gag>Cag	p.E733Q	MDN1_ENST00000428876.1_Missense_Mutation_p.E733Q			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	733					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		AAGAGTTCCTCAAATGCCTCC	0.423																																						uc003pnn.1		NA																	0				ovary(8)|skin(2)	10						c.(2197-2199)GAG>CAG		MDN1, midasin homolog							108.0	99.0	102.0					6																	90472197		2203	4300	6503	SO:0001583	missense	23195				protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding	g.chr6:90472197C>G	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.2197G>C	6.37:g.90472197C>G	ENSP00000358400:p.Glu733Gln		Somatic				MDN1_uc003pno.1_Missense_Mutation_p.E151Q	p.E733Q	NM_014611	NP_055426	WXS	Illumina HiSeq	Unspecified	Q9NU22	MDN1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0193)	16	2313	-		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)	733					O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	37	c.2197G>C	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.185781	0.78789	.	.	ENSG00000112159	ENST00000369393;ENST00000428876;ENST00000439638	T;T;T	0.53423	0.62;0.62;0.62	5.86	5.86	0.93980	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	0.000000	0.85682	D	0.000000	T	0.63379	0.2506	M	0.76574	2.34	0.80722	D	1	D;P	0.76494	0.999;0.766	D;P	0.75484	0.986;0.808	T	0.55302	-0.8162	10	0.26408	T	0.33	.	20.1859	0.98214	0.0:1.0:0.0:0.0	.	660;733	Q5T795;Q9NU22	.;MDN1_HUMAN	Q	733;733;660	ENSP00000358400:E733Q;ENSP00000413970:E733Q;ENSP00000409664:E660Q	ENSP00000358400:E733Q	E	-	1	0	MDN1	90528918	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.487000	0.81328	2.777000	0.95525	0.591000	0.81541	GAG		0.423	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2			4	75	0	0	0	0	4	75				
FBXL4	26235	broad.mit.edu	37	6	99347183	99347183	+	Silent	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr6:99347183G>A	ENST00000369244.2	-	7	1706	c.1278C>T	c.(1276-1278)tgC>tgT	p.C426C	FBXL4_ENST00000229971.1_Silent_p.C426C	NM_001278716.1	NP_001265645.1	Q9UKA2	FBXL4_HUMAN	F-box and leucine-rich repeat protein 4	426					ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(4)|prostate(3)|skin(2)	18		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0413)		GTTTAAGGCTGCATAACTTGG	0.378																																						uc003ppf.1		NA																	0				skin(2)	2						c.(1276-1278)TGC>TGT		F-box and leucine-rich repeat protein 4							160.0	144.0	150.0					6																	99347183		2203	4300	6503	SO:0001819	synonymous_variant	26235				ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex		g.chr6:99347183G>A	AF176699	CCDS5041.1	6q16.1-q16.3	2011-06-09			ENSG00000112234	ENSG00000112234		"""F-boxes / Leucine-rich repeats"""	13601	protein-coding gene	gene with protein product		605654				10531035	Standard	NM_012160		Approved	FBL4, FBL5	uc003ppf.1	Q9UKA2	OTTHUMG00000015259	ENST00000369244.2:c.1278C>T	6.37:g.99347183G>A			Somatic				FBXL4_uc003ppg.1_Silent_p.C426C|FBXL4_uc003pph.1_Silent_p.C28C|FBXL4_uc010kcp.2_Silent_p.C28C	p.C426C	NM_012160	NP_036292	WXS	Illumina HiSeq	Unspecified	Q9UKA2	FBXL4_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0413)	6	1636	-		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)	426					B2R7Q5|E1P530|O95919|Q5BJH0|Q9UJU0	Silent	SNP	ENST00000369244.2	37	c.1278C>T	CCDS5041.1																																																																																				0.378	FBXL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041587.2			14	78	0	0	0	0	14	78				
AIM1	202	broad.mit.edu	37	6	106999740	106999740	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr6:106999740G>A	ENST00000369066.3	+	12	4589	c.4102G>A	c.(4102-4104)Gaa>Aaa	p.E1368K	AIM1_ENST00000535438.1_Missense_Mutation_p.E187K|AIM1_ENST00000487681.1_3'UTR	NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		GGTAGCCTATGAAAATCCTGA	0.338																																						uc003prh.2		NA																	0				breast(4)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	9						c.(4102-4104)GAA>AAA		absent in melanoma 1							87.0	97.0	94.0					6																	106999740		2203	4297	6500	SO:0001583	missense	202						sugar binding	g.chr6:106999740G>A	U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.4102G>A	6.37:g.106999740G>A	ENSP00000358062:p.Glu1368Lys		Somatic				AIM1_uc003pri.2_Missense_Mutation_p.E172K	p.E1368K	NM_001624	NP_001615	WXS	Illumina HiSeq	Unspecified	Q9Y4K1	AIM1_HUMAN	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)	12	4589	+	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	1368			Beta/gamma crystallin 'Greek key' 8.		Q6P2P0|Q9BTM3	Missense_Mutation	SNP	ENST00000369066.3	37	c.4102G>A	CCDS34506.1	.	.	.	.	.	.	.	.	.	.	G	34	5.390742	0.95988	.	.	ENSG00000112297	ENST00000369066;ENST00000457437;ENST00000535438	T;T;T	0.79454	-1.27;-1.27;-1.27	5.9	5.9	0.94986	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.042463	0.85682	D	0.000000	D	0.92057	0.7483	H	0.96239	3.79	0.80722	D	1	D;D	0.89917	1.0;0.991	D;D	0.97110	1.0;0.968	D	0.93578	0.6910	10	0.87932	D	0	.	20.2723	0.98479	0.0:0.0:1.0:0.0	.	187;1368	B4DU04;Q9Y4K1	.;AIM1_HUMAN	K	1368;187;187	ENSP00000358062:E1368K;ENSP00000391419:E187K;ENSP00000439183:E187K	ENSP00000358062:E1368K	E	+	1	0	AIM1	107106433	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.642000	0.83385	2.793000	0.96121	0.563000	0.77884	GAA		0.338	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1			25	159	0	0	0	0	25	159				
FAM26D	221301	broad.mit.edu	37	6	116879267	116879267	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr6:116879267C>G	ENST00000368596.3	+	2	882	c.838C>G	c.(838-840)Ctt>Gtt	p.L280V	FAM26D_ENST00000405399.1_Missense_Mutation_p.L137V|FAM26D_ENST00000368597.2_Missense_Mutation_p.L94V|FAM26D_ENST00000416171.2_Missense_Mutation_p.L136V			Q5JW98	FA26D_HUMAN	family with sequence similarity 26, member D	280					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				endometrium(1)|lung(5)	6		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0458)|OV - Ovarian serous cystadenocarcinoma(136;0.0694)|Epithelial(106;0.222)		AGTACCCACTCTTTTATGCAT	0.423																																						uc003pxa.2		NA																	0					0						c.(409-411)CTT>GTT		hypothetical protein LOC221301							125.0	123.0	124.0					6																	116879267		2203	4300	6503	SO:0001583	missense	221301					integral to membrane		g.chr6:116879267C>G	AK056801	CCDS5109.1, CCDS59032.1	6q22.31	2008-02-05	2007-03-19	2007-03-19	ENSG00000164451	ENSG00000164451			21094	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 78"""	C6orf78			Standard	NM_153036		Approved	FLJ32239	uc010ked.4	Q5JW98	OTTHUMG00000015443	ENST00000368596.3:c.838C>G	6.37:g.116879267C>G	ENSP00000357585:p.Leu280Val		Somatic				FAM26D_uc003pwz.2_Missense_Mutation_p.L94V|FAM26D_uc010ked.2_Missense_Mutation_p.L136V	p.L137V	NM_153036	NP_694581	WXS	Illumina HiSeq	Unspecified	Q5JW98	FA26D_HUMAN		GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0458)|OV - Ovarian serous cystadenocarcinoma(136;0.0694)|Epithelial(106;0.222)	4	708	+		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)	280					B0QZ25|B0QZ27|B4DTQ0|Q96MK0	Missense_Mutation	SNP	ENST00000368596.3	37	c.409C>G		.	.	.	.	.	.	.	.	.	.	C	7.600	0.672630	0.14776	.	.	ENSG00000164451	ENST00000416171;ENST00000368597;ENST00000452373;ENST00000405399;ENST00000368596	T;T;T;T;T	0.47869	0.83;0.85;0.87;0.86;2.21	5.66	0.365	0.16131	.	0.753644	0.12124	N	0.497447	T	0.23886	0.0578	M	0.69823	2.125	0.09310	N	1	P;P	0.45902	0.72;0.868	B;B	0.41510	0.275;0.359	T	0.27673	-1.0067	10	0.15952	T	0.53	-51.3993	10.0812	0.42391	0.0:0.4981:0.0:0.5019	.	136;280	B4DTQ0;Q5JW98	.;FA26D_HUMAN	V	136;94;94;137;280	ENSP00000416976:L136V;ENSP00000357586:L94V;ENSP00000409556:L94V;ENSP00000385836:L137V;ENSP00000357585:L280V	ENSP00000357585:L280V	L	+	1	0	FAM26D	116985960	0.048000	0.20356	0.032000	0.17829	0.260000	0.26232	0.199000	0.17237	-0.236000	0.09753	0.655000	0.94253	CTT		0.423	FAM26D-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000041958.1	NM_153036		16	113	0	0	0	0	16	113				
ZUFSP	221302	broad.mit.edu	37	6	116988128	116988128	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr6:116988128C>T	ENST00000368576.3	-	2	471	c.228G>A	c.(226-228)aaG>aaA	p.K76K	ZUFSP_ENST00000471919.1_Intron|ZUFSP_ENST00000368573.1_Silent_p.K76K	NM_145062.2	NP_659499.2	Q96AP4	ZUFSP_HUMAN	zinc finger with UFM1-specific peptidase domain	76							metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(6)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	21				GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0368)|OV - Ovarian serous cystadenocarcinoma(136;0.0464)|Epithelial(106;0.186)		TGTTGTCTTTCTTGTTATCTG	0.338																																						uc003pxf.1		NA																	0				skin(1)	1						c.(226-228)AAG>AAA		zinc finger with UFM1-specific peptidase domain							207.0	187.0	194.0					6																	116988128		2203	4300	6503	SO:0001819	synonymous_variant	221302					intracellular	zinc ion binding	g.chr6:116988128C>T	AK054582	CCDS5110.1	6q22.31	2013-01-28	2008-03-25	2008-03-25	ENSG00000153975	ENSG00000153975		"""Zinc fingers, C2H2-type"""	21224	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 113"""	C6orf113			Standard	NM_145062		Approved	dJ412I7.3	uc003pxf.2	Q96AP4	OTTHUMG00000015445	ENST00000368576.3:c.228G>A	6.37:g.116988128C>T			Somatic				ZUFSP_uc010kef.1_Intron	p.K76K	NM_145062	NP_659499	WXS	Illumina HiSeq	Unspecified	Q96AP4	ZUFSP_HUMAN		GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0368)|OV - Ovarian serous cystadenocarcinoma(136;0.0464)|Epithelial(106;0.186)	2	474	-			76					Q5TD92|Q6PJH7|Q96NV6	Silent	SNP	ENST00000368576.3	37	c.228G>A	CCDS5110.1																																																																																				0.338	ZUFSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041961.1	NM_145062		15	83	0	0	0	0	15	83				
EYA4	2070	broad.mit.edu	37	6	133783787	133783787	+	Silent	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr6:133783787G>A	ENST00000367895.5	+	9	1073	c.609G>A	c.(607-609)aaG>aaA	p.K203K	EYA4_ENST00000531901.1_Silent_p.K203K|EYA4_ENST00000525849.1_Silent_p.K180K|EYA4_ENST00000431403.2_Silent_p.K203K|EYA4_ENST00000430974.2_Silent_p.K149K|EYA4_ENST00000452339.2_Silent_p.K149K|EYA4_ENST00000355167.3_Silent_p.K203K|EYA4_ENST00000355286.6_Silent_p.K180K	NM_004100.4	NP_004091.3	O95677	EYA4_HUMAN	EYA transcriptional coactivator and phosphatase 4	203					anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA repair (GO:0006281)|inner ear development (GO:0048839)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|skin(1)	48	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		CAGCCATCAAGACAGAGAGTG	0.438																																					Melanoma(57;398 1237 3528 4702 7415)	uc003qec.3		NA																	0				large_intestine(2)	2						c.(607-609)AAG>AAA		eyes absent 4 isoform a							96.0	91.0	93.0					6																	133783787		2203	4300	6503	SO:0001819	synonymous_variant	2070				anatomical structure morphogenesis|chromatin modification|DNA repair|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent|visual perception	cytoplasm|nucleus	metal ion binding|protein tyrosine phosphatase activity	g.chr6:133783787G>A	Y17114	CCDS5165.1, CCDS5166.1, CCDS43506.1, CCDS75521.1, CCDS75523.1	6q23	2014-09-17	2014-06-19		ENSG00000112319	ENSG00000112319		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3522	protein-coding gene	gene with protein product		603550	"""eyes absent (Drosophila) homolog 4"", ""eyes absent homolog 4 (Drosophila)"""	DFNA10, CMD1J		9887327, 11159937	Standard	NM_004100		Approved		uc003qed.4	O95677	OTTHUMG00000015602	ENST00000367895.5:c.609G>A	6.37:g.133783787G>A			Somatic				EYA4_uc011ecq.1_Silent_p.K149K|EYA4_uc011ecr.1_Silent_p.K149K|EYA4_uc003qed.3_Silent_p.K203K|EYA4_uc003qee.3_Silent_p.K180K|EYA4_uc011ecs.1_Silent_p.K203K|uc003qef.1_Intron	p.K203K	NM_004100	NP_004091	WXS	Illumina HiSeq	Unspecified	O95677	EYA4_HUMAN		GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)	9	1067	+	Colorectal(23;0.221)		203					B7Z7F7|O95464|O95679|Q8IW39|Q9NTR7	Silent	SNP	ENST00000367895.5	37	c.609G>A	CCDS5165.1																																																																																				0.438	EYA4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000042282.2	NM_004100		9	56	0	0	0	0	9	56				
IFNGR1	3459	broad.mit.edu	37	6	137527279	137527279	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr6:137527279G>A	ENST00000367739.4	-	3	488	c.367C>T	c.(367-369)Cga>Tga	p.R123*	IFNGR1_ENST00000367735.2_Nonsense_Mutation_p.R113*|IFNGR1_ENST00000543628.1_Nonsense_Mutation_p.R95*|IFNGR1_ENST00000478333.1_5'Flank	NM_000416.2	NP_000407.1	P15260	INGR1_HUMAN	interferon gamma receptor 1	123					cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to virus (GO:0009615)|signal transduction (GO:0007165)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|vesicle (GO:0031982)	interferon-gamma receptor activity (GO:0004906)			central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	18	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000829)|OV - Ovarian serous cystadenocarcinoma(155;0.00389)	Interferon gamma-1b(DB00033)	TCACCATCTCGGCATACAGCA	0.348																																						uc003qho.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(367-369)CGA>TGA		interferon gamma receptor 1 precursor	Interferon gamma-1b(DB00033)						103.0	100.0	101.0					6																	137527279		2203	4300	6503	SO:0001587	stop_gained	3459				regulation of interferon-gamma-mediated signaling pathway|response to virus	integral to plasma membrane	interferon-gamma receptor activity	g.chr6:137527279G>A		CCDS5185.1	6q23-q24	2014-09-17			ENSG00000027697	ENSG00000027697		"""Interferons"", ""CD molecules"""	5439	protein-coding gene	gene with protein product		107470		IFNGR			Standard	NM_000416		Approved	CD119	uc003qho.2	P15260	OTTHUMG00000015656	ENST00000367739.4:c.367C>T	6.37:g.137527279G>A	ENSP00000356713:p.Arg123*		Somatic				IFNGR1_uc011edm.1_Nonsense_Mutation_p.R95*|IFNGR1_uc011edn.1_Nonsense_Mutation_p.R113*	p.R123*	NM_000416	NP_000407	WXS	Illumina HiSeq	Unspecified	P15260	INGR1_HUMAN		GBM - Glioblastoma multiforme(68;0.000829)|OV - Ovarian serous cystadenocarcinoma(155;0.00389)	3	470	-	Colorectal(23;0.24)		123			Extracellular (Potential).		B4DFT7|E1P587|Q53Y96	Nonsense_Mutation	SNP	ENST00000367739.4	37	c.367C>T	CCDS5185.1	.	.	.	.	.	.	.	.	.	.	G	12.49	1.953742	0.34471	.	.	ENSG00000027697	ENST00000367739;ENST00000418947;ENST00000543628;ENST00000458076;ENST00000367735;ENST00000414770	.	.	.	5.67	-11.3	0.00108	.	0.976147	0.08408	N	0.950396	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	0.7541	14.6163	0.68552	0.0:0.1159:0.2051:0.6789	.	.	.	.	X	123;123;95;89;113;113	.	ENSP00000356709:R113X	R	-	1	2	IFNGR1	137568972	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-4.153000	0.00284	-2.245000	0.00705	-0.182000	0.12963	CGA		0.348	IFNGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042401.1			14	76	0	0	0	0	14	76				
TNFAIP3	7128	broad.mit.edu	37	6	138202334	138202334	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr6:138202334G>A	ENST00000237289.4	+	9	2317	c.2251G>A	c.(2251-2253)Gag>Aag	p.E751K		NM_001270507.1|NM_001270508.1|NM_006290.3	NP_001257436.1|NP_001257437.1|NP_006281.1	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	751	Interaction with TNIP1. {ECO:0000250}.|Required for lysosomal localization and for TRAF2 lysosomal degradation.|Sufficient for inhibitory activity of TNF-induced NF-kappa-B activity. {ECO:0000250}.				apoptotic process (GO:0006915)|B-1 B cell homeostasis (GO:0001922)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of B cell activation (GO:0050869)|negative regulation of bone resorption (GO:0045779)|negative regulation of CD40 signaling pathway (GO:2000349)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast proliferation (GO:0090291)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 3 signaling pathway (GO:0034140)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of protein catabolic process (GO:0045732)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked deubiquitination (GO:0070536)|protein oligomerization (GO:0051259)|regulation of defense response to virus by host (GO:0050691)|regulation of germinal center formation (GO:0002634)|regulation of vascular wound healing (GO:0061043)|response to molecule of bacterial origin (GO:0002237)|tolerance induction to lipopolysaccharide (GO:0072573)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|protease binding (GO:0002020)|protein self-association (GO:0043621)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.0?(25)|p.E751K(1)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(196)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	225	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		CCACCGGGGTGAGCCTGCCCC	0.647			"""D, N, F"""		"""marginal zone B-cell lymphomas, Hodgkin's lymphoma, primary mediastinal B cell lymphoma"""																																GBM(130;153 1739 22295 28918 47987)	uc003qhr.2		NA		Rec	yes		6	6q23	7128	D|N|F	"""tumor necrosis factor, alpha-induced protein 3"""			L			marginal zone B-cell lymphomas|Hodgkin's lymphoma|primary mediastinal B cell lymphoma		26	Whole gene deletion(25)|Substitution - Missense(1)	p.0?(22)|p.E751K(1)	haematopoietic_and_lymphoid_tissue(26)	haematopoietic_and_lymphoid_tissue(133)|lung(3)|ovary(1)	137						c.(2251-2253)GAG>AAG		tumor necrosis factor, alpha-induced protein 3							43.0	52.0	49.0					6																	138202334		2203	4300	6503	SO:0001583	missense	7128				anti-apoptosis|apoptosis|B-1 B cell homeostasis|negative regulation of B cell activation|negative regulation of bone resorption|negative regulation of CD40 signaling pathway|negative regulation of endothelial cell apoptosis|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of inflammatory response|negative regulation of interleukin-2 production|negative regulation of interleukin-6 production|negative regulation of NF-kappaB transcription factor activity|negative regulation of osteoclast proliferation|negative regulation of protein ubiquitination|negative regulation of smooth muscle cell proliferation|negative regulation of toll-like receptor 2 signaling pathway|negative regulation of toll-like receptor 3 signaling pathway|negative regulation of tumor necrosis factor production|negative regulation of type I interferon production|positive regulation of protein catabolic process|protein K48-linked ubiquitination|protein K63-linked deubiquitination|protein oligomerization|regulation of defense response to virus by host|regulation of germinal center formation|regulation of vascular wound healing|tolerance induction to lipopolysaccharide	centrosome|cytosol|nucleus	caspase inhibitor activity|DNA binding|protease binding|protein self-association|ubiquitin binding|ubiquitin thiolesterase activity|ubiquitin-protein ligase activity|ubiquitin-specific protease activity|zinc ion binding	g.chr6:138202334G>A	M59465	CCDS5187.1	6q23-q25	2013-01-21			ENSG00000118503	ENSG00000118503		"""OTU domain containing"""	11896	protein-coding gene	gene with protein product		191163				2118515	Standard	NM_006290		Approved	A20, OTUD7C	uc031spw.1	P21580	OTTHUMG00000015664	ENST00000237289.4:c.2251G>A	6.37:g.138202334G>A	ENSP00000237289:p.Glu751Lys		Somatic				TNFAIP3_uc003qhs.2_Missense_Mutation_p.E751K	p.E751K	NM_006290	NP_006281	WXS	Illumina HiSeq	Unspecified	P21580	TNAP3_HUMAN		GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)	9	2317	+	Breast(32;0.135)|Colorectal(23;0.24)		751			Interaction with NAF1 (By similarity).		B2R767|E1P588|Q2HIX9|Q5VXQ7|Q9NSR6	Missense_Mutation	SNP	ENST00000237289.4	37	c.2251G>A	CCDS5187.1	.	.	.	.	.	.	.	.	.	.	G	15.44	2.834230	0.50951	.	.	ENSG00000118503	ENST00000237289	T	0.23552	1.9	5.66	5.66	0.87406	.	0.332766	0.30159	N	0.010262	T	0.18215	0.0437	L	0.59436	1.845	0.54753	D	0.999988	B	0.20368	0.044	B	0.19148	0.024	T	0.01578	-1.1320	10	0.42905	T	0.14	-5.7851	17.9235	0.88975	0.0:0.0:1.0:0.0	.	751	P21580	TNAP3_HUMAN	K	751	ENSP00000237289:E751K	ENSP00000237289:E751K	E	+	1	0	TNFAIP3	138244027	1.000000	0.71417	0.074000	0.20217	0.015000	0.08874	7.289000	0.78701	2.668000	0.90789	0.557000	0.71058	GAG		0.647	TNFAIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042414.1			5	64	0	0	0	0	5	64				
PRPS1L1	221823	broad.mit.edu	37	7	18066763	18066763	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr7:18066763C>T	ENST00000506618.2	-	1	723	c.643G>A	c.(643-645)Gtg>Atg	p.V215M		NM_175886.2	NP_787082	P21108	PRPS3_HUMAN	phosphoribosyl pyrophosphate synthetase 1-like 1	215	Binding of phosphoribosylpyrophosphate. {ECO:0000255}.				5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|nucleotide biosynthetic process (GO:0009165)|ribonucleoside monophosphate biosynthetic process (GO:0009156)		ATP binding (GO:0005524)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)|ribose phosphate diphosphokinase activity (GO:0004749)			endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(3)	18	Lung NSC(10;0.0385)|all_lung(11;0.0736)					AGGATAGCCACACGATCATTC	0.453																																						uc003stz.2		NA																	0				ovary(1)	1						c.(643-645)GTG>ATG		phosphoribosyl pyrophosphate synthetase 1-like							126.0	122.0	123.0					7																	18066763		2203	4300	6503	SO:0001583	missense	221823				nucleoside metabolic process|ribonucleoside monophosphate biosynthetic process		ATP binding|kinase activity|magnesium ion binding|protein homodimerization activity|ribose phosphate diphosphokinase activity	g.chr7:18066763C>T	M57423	CCDS47552.1	7p21.1	2010-12-10			ENSG00000229937	ENSG00000229937			9463	protein-coding gene	gene with protein product		611566		PRPSL		2168892	Standard	NM_175886		Approved	PRPS3	uc003stz.3	P21108	OTTHUMG00000152742	ENST00000506618.2:c.643G>A	7.37:g.18066763C>T	ENSP00000424595:p.Val215Met		Somatic					p.V215M	NM_175886	NP_787082	WXS	Illumina HiSeq	Unspecified	P21108	PRPS3_HUMAN			1	724	-	Lung NSC(10;0.0385)|all_lung(11;0.0736)		215			Binding of phosphoribosylpyrophosphate (Potential).		Q6P5P6	Missense_Mutation	SNP	ENST00000506618.2	37	c.643G>A	CCDS47552.1	.	.	.	.	.	.	.	.	.	.	C	13.02	2.111789	0.37242	.	.	ENSG00000229937	ENST00000506618	T	0.73789	-0.78	4.4	2.57	0.30868	Phosphoribosyltransferase (1);	.	.	.	.	T	0.75766	0.3894	M	0.82323	2.585	.	.	.	P	0.35050	0.482	B	0.39094	0.29	T	0.81097	-0.1087	8	0.54805	T	0.06	.	8.6466	0.34009	0.0:0.804:0.0:0.196	.	215	P21108	PRPS3_HUMAN	M	215	ENSP00000424595:V215M	ENSP00000424595:V215M	V	-	1	0	PRPS1L1	18033288	1.000000	0.71417	0.693000	0.30195	0.966000	0.64601	5.375000	0.66173	1.210000	0.43336	0.650000	0.86243	GTG		0.453	PRPS1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327667.1	NM_175886		23	99	0	0	0	0	23	99				
DNAH11	8701	broad.mit.edu	37	7	21781778	21781778	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr7:21781778C>T	ENST00000409508.3	+	49	8179	c.8148C>T	c.(8146-8148)gtC>gtT	p.V2716V	DNAH11_ENST00000328843.6_Silent_p.V2723V	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2723	AAA 3. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						TATCAAACGTCTTCCAGGTAC	0.358									Kartagener syndrome																													uc003svc.2		NA																	0				ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						c.(8167-8169)GTC>GTT		dynein, axonemal, heavy chain 11							89.0	82.0	84.0					7																	21781778		1839	4098	5937	SO:0001819	synonymous_variant	8701	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr7:21781778C>T	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.8148C>T	7.37:g.21781778C>T			Somatic					p.V2723V	NM_003777	NP_003768	WXS	Illumina HiSeq	Unspecified	Q96DT5	DYH11_HUMAN			50	8200	+			2723			AAA 3 (By similarity).		Q9UJ82	Silent	SNP	ENST00000409508.3	37	c.8169C>T																																																																																					0.358	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777		13	45	0	0	0	0	13	45				
EPDR1	54749	broad.mit.edu	37	7	37989863	37989863	+	Silent	SNP	C	C	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr7:37989863C>A	ENST00000199448.4	+	3	919	c.540C>A	c.(538-540)acC>acA	p.T180T	EPDR1_ENST00000425345.1_Silent_p.T119T|EPDR1_ENST00000559325.1_Silent_p.T300T|EPDR1_ENST00000476620.1_Silent_p.T78T|EPDR1_ENST00000423717.1_3'UTR	NM_017549.4	NP_060019.2	Q9UM22	EPDR1_HUMAN	ependymin related 1	180					cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	calcium ion binding (GO:0005509)			breast(1)|endometrium(1)|large_intestine(2)|lung(9)|ovary(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	22						AAACCTTTACCATAAACTACA	0.428																																						uc003tfp.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(898-900)ACC>ACA		ependymin related protein 1 precursor							65.0	66.0	66.0					7																	37989863		2203	4300	6503	SO:0001819	synonymous_variant	54749				cell-matrix adhesion	extracellular region	calcium ion binding	g.chr7:37989863C>A	BC018299	CCDS5454.1, CCDS5454.2, CCDS59051.1, CCDS59052.1	7p14.1	2013-07-31	2013-07-31		ENSG00000086289	ENSG00000086289			17572	protein-coding gene	gene with protein product			"""ependymin related protein 1 (zebrafish)"""			11749721, 11248421	Standard	NM_001242946		Approved	MERP-1, MERP1, UCC1, EPDR	uc003tfp.4	Q9UM22	OTTHUMG00000102187	ENST00000199448.4:c.540C>A	7.37:g.37989863C>A			Somatic				EPDR1_uc003tfq.2_3'UTR|EPDR1_uc010kxh.2_Silent_p.T119T	p.T300T	NM_017549	NP_060019	WXS	Illumina HiSeq	Unspecified	Q9UM22	EPDR1_HUMAN			3	919	+			180					A8K4C0|C9JYS3|Q06BL0|Q99M77	Silent	SNP	ENST00000199448.4	37	c.900C>A	CCDS5454.2																																																																																				0.428	EPDR1-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220037.3	NM_017549		4	41	1	0	0.00116845	0.00119389	4	41				
VPS41	27072	broad.mit.edu	37	7	38796440	38796440	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr7:38796440C>G	ENST00000310301.4	-	19	1747	c.1693G>C	c.(1693-1695)Gag>Cag	p.E565Q	VPS41_ENST00000395969.2_Missense_Mutation_p.E540Q	NM_014396.3	NP_055211.2	P49754	VPS41_HUMAN	vacuolar protein sorting 41 homolog (S. cerevisiae)	565					Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	cytosol (GO:0005829)|early endosome (GO:0005769)|Golgi-associated vesicle (GO:0005798)|HOPS complex (GO:0030897)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(5)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	44						CACATTACCTCTGAATCAAAA	0.269																																						uc003tgy.2		NA																	0				skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4						c.(1693-1695)GAG>CAG		vacuolar protein sorting 41 isoform 1							69.0	68.0	68.0					7																	38796440		2200	4295	6495	SO:0001583	missense	27072				Golgi vesicle transport|intracellular protein transport|vesicle-mediated transport	cytosol|Golgi-associated vesicle|HOPS complex|membrane fraction	zinc ion binding	g.chr7:38796440C>G	U87309	CCDS5457.1, CCDS5458.2	7p14.1-p13	2009-05-08	2006-12-19		ENSG00000006715	ENSG00000006715			12713	protein-coding gene	gene with protein product		605485	"""vacuolar protein sorting 41 (yeast homolog)"", ""vacuolar protein sorting 41 (yeast)"""			9159129	Standard	NM_080631		Approved	HVSP41	uc003tgy.3	P49754	OTTHUMG00000023629	ENST00000310301.4:c.1693G>C	7.37:g.38796440C>G	ENSP00000309457:p.Glu565Gln		Somatic				VPS41_uc003tgz.2_Missense_Mutation_p.E540Q|VPS41_uc010kxn.2_Missense_Mutation_p.E476Q	p.E565Q	NM_014396	NP_055211	WXS	Illumina HiSeq	Unspecified	P49754	VPS41_HUMAN			19	1719	-			565					E9PF36|Q86TP8|Q99851|Q99852	Missense_Mutation	SNP	ENST00000310301.4	37	c.1693G>C	CCDS5457.1	.	.	.	.	.	.	.	.	.	.	C	19.93	3.918749	0.73098	.	.	ENSG00000006715	ENST00000310301;ENST00000395969	T;T	0.21932	1.98;1.98	5.55	5.55	0.83447	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.42494	0.1205	M	0.68952	2.095	0.80722	D	1	D;D;D	0.71674	0.996;0.998;0.998	P;P;P	0.59115	0.806;0.852;0.852	T	0.04551	-1.0943	10	0.33141	T	0.24	-30.3743	19.8764	0.96873	0.0:1.0:0.0:0.0	.	565;540;565	B2RB94;E9PF36;P49754	.;.;VPS41_HUMAN	Q	565;540	ENSP00000309457:E565Q;ENSP00000379297:E540Q	ENSP00000309457:E565Q	E	-	1	0	VPS41	38762965	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.776000	0.85560	2.768000	0.95171	0.655000	0.94253	GAG		0.269	VPS41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226986.3			3	20	0	0	0	0	3	20				
ZNF713	349075	broad.mit.edu	37	7	56007242	56007242	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr7:56007242G>A	ENST00000429591.2	+	4	874	c.836G>A	c.(835-837)gGa>gAa	p.G279E	MRPS17_ENST00000426595.1_Intron	NM_182633.1	NP_872439.1	Q8N859	ZN713_HUMAN	zinc finger protein 713	279					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	25	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			GATGAATGTGGAAAAAGATTC	0.458																																						uc003trc.1		NA																	0				ovary(2)	2						c.(835-837)GGA>GAA		zinc finger protein 713							74.0	77.0	76.0					7																	56007242		2203	4300	6503	SO:0001583	missense	349075				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:56007242G>A	AK097282	CCDS34639.1	7p11.2	2013-01-08			ENSG00000178665	ENSG00000178665		"""Zinc fingers, C2H2-type"", ""-"""	22043	protein-coding gene	gene with protein product							Standard	NM_182633		Approved	FLJ39963	uc003trc.1	Q8N859	OTTHUMG00000156175	ENST00000429591.2:c.836G>A	7.37:g.56007242G>A	ENSP00000416662:p.Gly279Glu		Somatic				ZNF713_uc003tra.1_Missense_Mutation_p.G292E|MRPS17_uc003trb.2_Intron	p.G279E	NM_182633	NP_872439	WXS	Illumina HiSeq	Unspecified	Q8N859	ZN713_HUMAN	Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)		4	874	+	Breast(14;0.214)		279			C2H2-type 1.			Missense_Mutation	SNP	ENST00000429591.2	37	c.836G>A	CCDS34639.1	.	.	.	.	.	.	.	.	.	.	G	13.53	2.265585	0.40095	.	.	ENSG00000178665	ENST00000429591	T	0.20463	2.07	3.27	1.41	0.22369	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.40144	N	0.001161	T	0.17492	0.0420	L	0.47716	1.5	0.29647	N	0.844288	B	0.21688	0.059	B	0.27262	0.078	T	0.11591	-1.0581	10	0.56958	D	0.05	.	6.5608	0.22485	0.1096:0.184:0.7064:0.0	.	279	Q8N859	ZN713_HUMAN	E	279	ENSP00000416662:G279E	ENSP00000416662:G279E	G	+	2	0	ZNF713	55974736	1.000000	0.71417	0.999000	0.59377	0.773000	0.43773	2.975000	0.49281	0.383000	0.24910	-1.210000	0.01631	GGA		0.458	ZNF713-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343297.1	NM_182633		8	52	0	0	0	0	8	52				
PTPN12	5782	broad.mit.edu	37	7	77256781	77256781	+	Silent	SNP	C	C	T	rs371650087		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr7:77256781C>T	ENST00000248594.6	+	13	2057	c.1785C>T	c.(1783-1785)ctC>ctT	p.L595L	PTPN12_ENST00000435495.2_Silent_p.L465L|PTPN12_ENST00000415482.2_Silent_p.L476L	NM_002835.3	NP_002826.3	Q05209	PTN12_HUMAN	protein tyrosine phosphatase, non-receptor type 12	595					protein dephosphorylation (GO:0006470)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|podosome (GO:0002102)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|SH3 domain binding (GO:0017124)			breast(2)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(12)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	39						GAACACCCCTCAGTTTTACTA	0.403																																						uc003ugh.2		NA																	0				ovary(1)|breast(1)|pancreas(1)	3						c.(1783-1785)CTC>CTT		protein tyrosine phosphatase, non-receptor type		C	,,	0,4406		0,0,2203	153.0	146.0	148.0		1428,1395,1785	0.6	1.0	7		148	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	PTPN12	NM_001131008.1,NM_001131009.1,NM_002835.3	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	476/662,465/651,595/781	77256781	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	5782					soluble fraction	non-membrane spanning protein tyrosine phosphatase activity|SH3 domain binding	g.chr7:77256781C>T		CCDS5592.1, CCDS47619.1, CCDS47620.1	7q11.23	2011-06-09			ENSG00000127947	ENSG00000127947		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9645	protein-coding gene	gene with protein product		600079				7509295	Standard	NM_002835		Approved	PTPG1, PTP-PEST	uc003ugh.2	Q05209	OTTHUMG00000023501	ENST00000248594.6:c.1785C>T	7.37:g.77256781C>T			Somatic				PTPN12_uc011kgp.1_Silent_p.L476L|PTPN12_uc011kgq.1_Silent_p.L465L|PTPN12_uc010lds.2_Silent_p.L327L	p.L595L	NM_002835	NP_002826	WXS	Illumina HiSeq	Unspecified	Q05209	PTN12_HUMAN			13	1876	+			595					A4D1C5|B4DKY2|E9PBR5|E9PEH9|Q16130|Q59FD6|Q75MN8|Q86XU4	Silent	SNP	ENST00000248594.6	37	c.1785C>T	CCDS5592.1																																																																																				0.403	PTPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253183.3			19	160	0	0	0	0	19	160				
STEAP2	261729	broad.mit.edu	37	7	89856767	89856767	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr7:89856767G>C	ENST00000287908.3	+	3	1368	c.975G>C	c.(973-975)atG>atC	p.M325I	STEAP2_ENST00000394621.2_Missense_Mutation_p.M325I|STEAP2_ENST00000402625.2_Missense_Mutation_p.M325I|STEAP2_ENST00000394629.2_Missense_Mutation_p.M325I|STEAP2_ENST00000394632.1_Missense_Mutation_p.M325I|STEAP2_ENST00000394622.2_Missense_Mutation_p.M325I|STEAP2_ENST00000394626.1_Missense_Mutation_p.M325I	NM_001244944.1|NM_152999.3	NP_001231873.1|NP_694544.2	Q8NFT2	STEA2_HUMAN	STEAP family member 2, metalloreductase	325	Ferric oxidoreductase.				copper ion import (GO:0015677)|endocytosis (GO:0006897)|ferric iron import into cell (GO:0097461)|Golgi to plasma membrane transport (GO:0006893)|iron ion homeostasis (GO:0055072)|regulated secretory pathway (GO:0045055)|response to hormone (GO:0009725)	cytosol (GO:0005829)|early endosome (GO:0005769)|integral component of Golgi membrane (GO:0030173)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|trans-Golgi network transport vesicle (GO:0030140)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|metal ion binding (GO:0046872)|transporter activity (GO:0005215)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)	15	all_hematologic(106;0.112)					GCTTACCGATGAGAAGGTCAG	0.383																																						uc003ujz.2		NA																	0				ovary(2)	2						c.(973-975)ATG>ATC		six transmembrane epithelial antigen of the							64.0	64.0	64.0					7																	89856767		2202	4298	6500	SO:0001583	missense	261729				electron transport chain|endocytosis|Golgi to plasma membrane transport|ion transport|iron ion homeostasis|regulated secretory pathway|response to hormone stimulus	cytosol|early endosome|endosome membrane|integral to Golgi membrane|plasma membrane|trans-Golgi network transport vesicle|vesicular fraction	electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|oxidoreductase activity|transporter activity	g.chr7:89856767G>C	AF455138	CCDS5615.1, CCDS43612.1, CCDS59064.1	7q21.13	2011-09-30	2011-09-30		ENSG00000157214	ENSG00000157214			17885	protein-coding gene	gene with protein product		605094	"""prostate cancer associated protein 1"", ""six transmembrane epithelial antigen of the prostate 2"""	PCANAP1		10613842, 12095985	Standard	NM_001040665		Approved	IPCA-1, STAMP1, STMP	uc003ujz.3	Q8NFT2	OTTHUMG00000023341	ENST00000287908.3:c.975G>C	7.37:g.89856767G>C	ENSP00000287908:p.Met325Ile		Somatic				STEAP2_uc003ujy.2_Missense_Mutation_p.M367I|STEAP2_uc010len.2_Missense_Mutation_p.M325I|STEAP2_uc003uka.2_Missense_Mutation_p.M325I|STEAP2_uc003ukb.2_Missense_Mutation_p.M325I|STEAP2_uc003ukc.2_Missense_Mutation_p.M325I|STEAP2_uc003ukd.2_Missense_Mutation_p.M325I	p.M325I	NM_152999	NP_694544	WXS	Illumina HiSeq	Unspecified	Q8NFT2	STEA2_HUMAN			3	1368	+	all_hematologic(106;0.112)		325			Ferric oxidoreductase.|Helical; (Potential).		A4D1F1|G5E9C6|Q6UXN6|Q6YPB1|Q8IUE7	Missense_Mutation	SNP	ENST00000287908.3	37	c.975G>C	CCDS5615.1	.	.	.	.	.	.	.	.	.	.	G	10.91	1.484813	0.26598	.	.	ENSG00000157214	ENST00000287908;ENST00000394626;ENST00000394622;ENST00000394632;ENST00000394624;ENST00000394621;ENST00000402625;ENST00000394629	D;D;D;D;D;D;D	0.89875	-2.58;-2.58;-2.58;-2.58;-2.58;-2.58;-2.58	6.04	6.04	0.98038	Flavoprotein transmembrane component (1);	0.074998	0.85682	D	0.000000	D	0.85788	0.5778	N	0.16708	0.43	0.53005	D	0.999967	P;P;P;P	0.41420	0.749;0.566;0.571;0.571	B;B;P;B	0.46208	0.228;0.338;0.507;0.403	T	0.83056	-0.0150	9	.	.	.	-29.8979	20.5948	0.99439	0.0:0.0:1.0:0.0	.	325;325;325;325	G5E9C6;Q6YPB2;Q8NFT2;B5MC02	.;.;STEA2_HUMAN;.	I	325	ENSP00000287908:M325I;ENSP00000378123:M325I;ENSP00000378120:M325I;ENSP00000378128:M325I;ENSP00000378119:M325I;ENSP00000384191:M325I;ENSP00000378125:M325I	.	M	+	3	0	STEAP2	89694703	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	6.573000	0.74009	2.873000	0.98535	0.563000	0.77884	ATG		0.383	STEAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059662.4	NM_152999		10	40	0	0	0	0	10	40				
HEPACAM2	253012	broad.mit.edu	37	7	92838091	92838091	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr7:92838091C>T	ENST00000394468.2	-	4	891	c.814G>A	c.(814-816)Gct>Act	p.A272T	HEPACAM2_ENST00000453812.2_Missense_Mutation_p.A295T|HEPACAM2_ENST00000440868.1_Missense_Mutation_p.A260T|HEPACAM2_ENST00000341723.4_Missense_Mutation_p.A260T	NM_001039372.1	NP_001034461.1	A8MVW5	HECA2_HUMAN	HEPACAM family member 2	272	Ig-like C2-type 2.				centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|midbody (GO:0030496)|spindle (GO:0005819)				breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|ovary(4)|skin(1)	28						TGAGAATCAGCAGAACAATCA	0.433																																						uc003umm.2		NA																	0				ovary(3)|breast(1)|kidney(1)	5						c.(814-816)GCT>ACT		HEPACAM family member 2 isoform 1							143.0	137.0	139.0					7																	92838091		2203	4300	6503	SO:0001583	missense	253012					integral to membrane		g.chr7:92838091C>T	AK096002	CCDS5629.1, CCDS43616.1, CCDS75631.1, CCDS75632.1	7q21.3	2013-01-29	2008-07-11		ENSG00000188175	ENSG00000188175		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27364	protein-coding gene	gene with protein product		614133				12975309	Standard	NM_001288804		Approved	FLJ38683	uc003umm.3	A8MVW5	OTTHUMG00000131732	ENST00000394468.2:c.814G>A	7.37:g.92838091C>T	ENSP00000377980:p.Ala272Thr		Somatic				HEPACAM2_uc003uml.2_Missense_Mutation_p.A260T|HEPACAM2_uc010lff.2_Missense_Mutation_p.A260T|HEPACAM2_uc011khy.1_Missense_Mutation_p.A295T	p.A272T	NM_001039372	NP_001034461	WXS	Illumina HiSeq	Unspecified	A8MVW5	HECA2_HUMAN			4	837	-			272			Ig-like C2-type 2.|Extracellular (Potential).		B3KTT4|B4DPJ1|B9EG93|E9PDV5|Q6UXI0	Missense_Mutation	SNP	ENST00000394468.2	37	c.814G>A	CCDS43616.1	.	.	.	.	.	.	.	.	.	.	C	29.5	5.013654	0.93404	.	.	ENSG00000188175	ENST00000394468;ENST00000341723;ENST00000440868;ENST00000453812	T;T;T;T	0.15603	2.41;2.41;2.41;2.41	5.23	5.23	0.72850	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.34308	0.0893	L	0.36672	1.1	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.97110	1.0;0.999;1.0;0.987	T	0.01004	-1.1484	10	0.38643	T	0.18	-21.6247	19.6959	0.96026	0.0:1.0:0.0:0.0	.	295;260;272;260	E9PDV5;C9JN07;A8MVW5;A8MVW5-2	.;.;HECA2_HUMAN;.	T	272;260;260;295	ENSP00000377980:A272T;ENSP00000340532:A260T;ENSP00000389592:A260T;ENSP00000390204:A295T	ENSP00000340532:A260T	A	-	1	0	HEPACAM2	92676027	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	6.817000	0.75252	2.826000	0.97356	0.655000	0.94253	GCT		0.433	HEPACAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254651.1	NM_198151		14	78	0	0	0	0	14	78				
ZAN	7455	broad.mit.edu	37	7	100344231	100344231	+	RNA	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr7:100344231G>A	ENST00000348028.3	+	0	1002				ZAN_ENST00000546213.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000449052.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			TGAGCCCCGTGAGCCTGTCCT	0.572																																						uc003uwj.2		NA																	0				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11						c.(835-837)GTG>GTA		zonadhesin isoform 3							83.0	93.0	89.0					7																	100344231		2024	4177	6201			7455				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane		g.chr7:100344231G>A	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100344231G>A			Somatic				ZAN_uc003uwk.2_Silent_p.V279V|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA	p.V279V	NM_003386	NP_003377	WXS	Illumina HiSeq	Unspecified	Q9Y493	ZAN_HUMAN	STAD - Stomach adenocarcinoma(171;0.19)		8	1002	+	Lung NSC(181;0.041)|all_lung(186;0.0581)		279			MAM 2.|Extracellular (Potential).		A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Silent	SNP	ENST00000348028.3	37	c.837G>A																																																																																					0.572	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386		9	95	0	0	0	0	9	95				
NAT16	375607	broad.mit.edu	37	7	100816658	100816658	+	Silent	SNP	C	C	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr7:100816658C>A	ENST00000300303.2	-	3	694	c.456G>T	c.(454-456)ccG>ccT	p.P152P	NAT16_ENST00000455377.1_Silent_p.P152P	NM_198571.2	NP_940973.2	Q8N8M0	NAT16_HUMAN	N-acetyltransferase 16 (GCN5-related, putative)	152	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.						N-acetyltransferase activity (GO:0008080)										CCTTGACCCCCGGGTGCTGTC	0.687																																						uc003uxy.1		NA																	0				ovary(1)	1						c.(454-456)CCG>CCT		hypothetical protein LOC375607							31.0	33.0	32.0					7																	100816658		2202	4298	6500	SO:0001819	synonymous_variant	375607						N-acetyltransferase activity	g.chr7:100816658C>A	AK096556	CCDS5713.1	7q22.1	2011-11-25	2011-11-25	2011-11-25	ENSG00000167011	ENSG00000167011			22030	protein-coding gene	gene with protein product		615783	"""chromosome 7 open reading frame 52"""	C7orf52			Standard	NM_198571		Approved	FLJ39237	uc003uxy.2	Q8N8M0	OTTHUMG00000157110	ENST00000300303.2:c.456G>T	7.37:g.100816658C>A			Somatic				C7orf52_uc003uxz.1_Silent_p.P152P	p.P152P	NM_198571	NP_940973	WXS	Illumina HiSeq	Unspecified	Q8N8M0	CG052_HUMAN			3	695	-	Lung NSC(181;0.168)|all_lung(186;0.215)		152			N-acetyltransferase.		B3KRS2|Q8NDR1	Silent	SNP	ENST00000300303.2	37	c.456G>T	CCDS5713.1																																																																																				0.687	NAT16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347465.1	NM_198571		14	42	1	0	7.93e-07	8.34e-07	14	42				
CUX1	1523	broad.mit.edu	37	7	101844841	101844841	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr7:101844841C>G	ENST00000292535.7	+	18	2302	c.2264C>G	c.(2263-2265)tCc>tGc	p.S755C	CUX1_ENST00000393824.3_Intron|CUX1_ENST00000546411.2_Missense_Mutation_p.S653C|CUX1_ENST00000437600.4_Intron|CUX1_ENST00000549414.2_Missense_Mutation_p.S733C|CUX1_ENST00000547394.2_Intron|CUX1_ENST00000556210.1_Missense_Mutation_p.S597C|CUX1_ENST00000292538.4_Intron|CUX1_ENST00000360264.3_Missense_Mutation_p.S766C|CUX1_ENST00000560541.1_Intron|CUX1_ENST00000550008.2_Missense_Mutation_p.S699C|CUX1_ENST00000425244.2_Intron	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	755					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						CCCACCGTGTCCAGCTACCCA	0.647																																						uc003uyx.3		NA																	0				ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						c.(2263-2265)TCC>TGC		cut-like homeobox 1 isoform a							125.0	133.0	130.0					7																	101844841		2203	4300	6503	SO:0001583	missense	1523				negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:101844841C>G	M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.2264C>G	7.37:g.101844841C>G	ENSP00000292535:p.Ser755Cys		Somatic				CUX1_uc003uys.3_Missense_Mutation_p.S766C|CUX1_uc003uyt.2_Intron|CUX1_uc011kkn.1_Intron|CUX1_uc003uyw.2_Intron|CUX1_uc003uyv.2_Intron|CUX1_uc003uyu.2_Intron	p.S755C	NM_181552	NP_853530	WXS	Illumina HiSeq	Unspecified	P39880	CUX1_HUMAN			18	2302	+			755					B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Missense_Mutation	SNP	ENST00000292535.7	37	c.2264C>G	CCDS5721.1	.	.	.	.	.	.	.	.	.	.	C	13.51	2.259068	0.39896	.	.	ENSG00000257923	ENST00000360264;ENST00000292535;ENST00000549414;ENST00000550008;ENST00000546411;ENST00000556210	T;T;T;T;T;T	0.65178	-0.11;-0.14;-0.13;-0.13;-0.11;-0.14	5.44	5.44	0.79542	.	0.260438	0.39407	N	0.001364	T	0.69913	0.3164	M	0.65975	2.015	0.80722	D	1	B;P	0.36315	0.412;0.547	B;B	0.43331	0.237;0.416	T	0.72763	-0.4195	10	0.72032	D	0.01	-4.5589	19.279	0.94044	0.0:1.0:0.0:0.0	.	755;766	P39880;P39880-3	CUX1_HUMAN;.	C	766;755;733;699;653;597	ENSP00000353401:S766C;ENSP00000292535:S755C;ENSP00000446630:S733C;ENSP00000447373:S699C;ENSP00000450125:S653C;ENSP00000451558:S597C	ENSP00000292535:S755C	S	+	2	0	CUX1	101631561	0.900000	0.30661	0.012000	0.15200	0.044000	0.14063	7.209000	0.77916	2.560000	0.86352	0.655000	0.94253	TCC		0.647	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347535.1	NM_001913		21	110	0	0	0	0	21	110				
NRCAM	4897	broad.mit.edu	37	7	107822288	107822288	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr7:107822288C>T	ENST00000425651.2	-	21	2623	c.2624G>A	c.(2623-2625)cGa>cAa	p.R875Q	NRCAM_ENST00000351718.4_Missense_Mutation_p.R859Q|NRCAM_ENST00000379024.4_Missense_Mutation_p.R856Q|NRCAM_ENST00000379022.4_Missense_Mutation_p.R875Q|NRCAM_ENST00000413765.2_Missense_Mutation_p.R856Q|NRCAM_ENST00000379028.3_Missense_Mutation_p.R875Q	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	875	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						TAGGTGTCCTCGGATGCTTTT	0.527																																						uc003vfb.2		NA																	0				ovary(3)|breast(2)	5						c.(2623-2625)CGA>CAA		neuronal cell adhesion molecule isoform A							105.0	88.0	94.0					7																	107822288		2203	4300	6503	SO:0001583	missense	4897				angiogenesis|axon guidance|axonal fasciculation|cell-cell adhesion|central nervous system development|clustering of voltage-gated sodium channels|neuron migration|positive regulation of neuron differentiation|regulation of axon extension|synapse assembly	external side of plasma membrane|integral to plasma membrane	ankyrin binding	g.chr7:107822288C>T		CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.2624G>A	7.37:g.107822288C>T	ENSP00000401244:p.Arg875Gln		Somatic				NRCAM_uc003vfc.2_Missense_Mutation_p.R859Q|NRCAM_uc011kmk.1_Missense_Mutation_p.R870Q|NRCAM_uc003vfd.2_Missense_Mutation_p.R851Q|NRCAM_uc003vfe.2_Missense_Mutation_p.R851Q	p.R875Q	NM_001037132	NP_001032209	WXS	Illumina HiSeq	Unspecified	Q92823	NRCAM_HUMAN			24	3095	-			875			Fibronectin type-III 3.|Extracellular (Potential).		A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Missense_Mutation	SNP	ENST00000425651.2	37	c.2624G>A	CCDS47686.1	.	.	.	.	.	.	.	.	.	.	C	16.85	3.235989	0.58886	.	.	ENSG00000091129	ENST00000379032;ENST00000379028;ENST00000413765;ENST00000537765;ENST00000351718;ENST00000379024;ENST00000425651;ENST00000379022	T;T;T;T;T;T	0.53640	0.61;0.61;0.61;0.61;0.61;0.61	5.36	5.36	0.76844	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.53045	0.1772	L	0.55834	1.745	0.80722	D	1	B;P;B;B;P	0.49862	0.425;0.729;0.037;0.01;0.929	B;B;B;B;P	0.48227	0.142;0.368;0.043;0.082;0.571	T	0.45160	-0.9280	10	0.26408	T	0.33	.	19.4436	0.94836	0.0:1.0:0.0:0.0	.	875;856;856;859;875	Q92823-5;Q92823-3;E9PDA4;Q92823-4;Q92823	.;.;.;.;NRCAM_HUMAN	Q	875;875;856;875;859;856;875;875	ENSP00000368314:R875Q;ENSP00000407858:R856Q;ENSP00000325269:R859Q;ENSP00000368310:R856Q;ENSP00000401244:R875Q;ENSP00000368308:R875Q	ENSP00000325269:R859Q	R	-	2	0	NRCAM	107609524	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.684000	0.61686	2.652000	0.90054	0.655000	0.94253	CGA		0.527	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337942.2	NM_001037132		11	38	0	0	0	0	11	38				
EXOC4	60412	broad.mit.edu	37	7	133041328	133041328	+	Splice_Site	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr7:133041328G>A	ENST00000253861.4	+	6	1036		c.e6+1		EXOC4_ENST00000539845.1_Splice_Site|EXOC4_ENST00000393161.2_Splice_Site	NM_021807.3	NP_068579.3	Q96A65	EXOC4_HUMAN	exocyst complex component 4						cellular protein metabolic process (GO:0044267)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(16)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	50		Esophageal squamous(399;0.129)				ACCAACCAAGGTAGGTGGGAG	0.448																																						uc003vrk.2		NA																	0				ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9						c.e6+1		SEC8 protein isoform a							50.0	55.0	53.0					7																	133041328		2203	4300	6503	SO:0001630	splice_region_variant	60412				vesicle docking involved in exocytosis	exocyst	protein N-terminus binding	g.chr7:133041328G>A	AL831989	CCDS5829.1, CCDS43648.1	7q31	2013-01-22	2005-11-01	2005-11-01	ENSG00000131558	ENSG00000131558			30389	protein-coding gene	gene with protein product		608185	"""SEC8-like 1 (S. cerevisiae)"""	SEC8L1		11214970, 12687004	Standard	XM_005250523		Approved	KIAA1699, MGC27170, SEC8, Sec8p	uc003vrk.3	Q96A65	OTTHUMG00000155259	ENST00000253861.4:c.1007+1G>A	7.37:g.133041328G>A			Somatic				EXOC4_uc011kpo.1_Splice_Site_p.R235_splice|EXOC4_uc003vri.2_Splice_Site_p.R336_splice|EXOC4_uc003vrj.2_Splice_Site_p.R336_splice	p.R336_splice	NM_021807	NP_068579	WXS	Illumina HiSeq	Unspecified	Q96A65	EXOC4_HUMAN			6	1042	+		Esophageal squamous(399;0.129)						E9PED2|Q541U8|Q9C0G4|Q9H9K0|Q9P102	Splice_Site	SNP	ENST00000253861.4	37	c.1007_splice	CCDS5829.1	.	.	.	.	.	.	.	.	.	.	G	14.27	2.484634	0.44147	.	.	ENSG00000131558	ENST00000253861;ENST00000393161;ENST00000539845	.	.	.	5.25	5.25	0.73442	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2215	0.93799	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	EXOC4	132691868	1.000000	0.71417	0.998000	0.56505	0.286000	0.27126	9.034000	0.93747	2.603000	0.88011	0.655000	0.94253	.		0.448	EXOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339182.1	NM_021807	Intron	3	32	0	0	0	0	3	32				
WEE2	494551	broad.mit.edu	37	7	141422958	141422958	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr7:141422958C>T	ENST00000397541.2	+	6	1311	c.905C>T	c.(904-906)tCt>tTt	p.S302F	WEE2-AS1_ENST00000488785.1_RNA|WEE2-AS1_ENST00000462383.1_RNA|WEE2-AS1_ENST00000465110.1_RNA|WEE2-AS1_ENST00000478332.1_RNA|WEE2-AS1_ENST00000484172.1_RNA|WEE2-AS1_ENST00000471512.1_RNA|WEE2-AS1_ENST00000495800.1_RNA|WEE2-AS1_ENST00000486906.1_RNA|WEE2-AS1_ENST00000459753.1_RNA	NM_001105558.1	NP_001099028.1	P0C1S8	WEE2_HUMAN	WEE1 homolog 2 (S. pombe)	302	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				female meiotic division (GO:0007143)|female pronucleus assembly (GO:0035038)|mitotic nuclear division (GO:0007067)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of oocyte maturation (GO:1900194)|regulation of meiosis I (GO:0060631)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(2)|stomach(1)	31	Melanoma(164;0.0171)					GCTGCTATATCTGAAAACACT	0.418																																						uc003vwn.2		NA																	0				ovary(1)|stomach(1)	2						c.(904-906)TCT>TTT		WEE1 homolog 2							163.0	151.0	154.0					7																	141422958		1876	4116	5992	SO:0001583	missense	494551				egg activation|female meiosis|female pronucleus assembly|meiotic metaphase II|meiotic prophase I|mitosis|negative regulation of oocyte development|regulation of meiosis I	centrosome|nucleus	ATP binding|magnesium ion binding|non-membrane spanning protein tyrosine kinase activity|protein serine/threonine kinase activity	g.chr7:141422958C>T	AK131218	CCDS43660.1	7q32	2008-07-02			ENSG00000214102	ENSG00000214102			19684	protein-coding gene	gene with protein product		614084					Standard	NM_001105558		Approved	FLJ16107	uc003vwn.2	P0C1S8	OTTHUMG00000157536	ENST00000397541.2:c.905C>T	7.37:g.141422958C>T	ENSP00000380675:p.Ser302Phe		Somatic				FLJ40852_uc011krh.1_Intron|FLJ40852_uc010lnm.2_Intron|FLJ40852_uc010lnn.2_Intron|FLJ40852_uc003vwm.3_Intron|FLJ40852_uc010lno.2_Intron	p.S302F	NM_001105558	NP_001099028	WXS	Illumina HiSeq	Unspecified	P0C1S8	WEE2_HUMAN			6	1311	+	Melanoma(164;0.0171)		302			Protein kinase.			Missense_Mutation	SNP	ENST00000397541.2	37	c.905C>T	CCDS43660.1	.	.	.	.	.	.	.	.	.	.	C	11.55	1.673210	0.29693	.	.	ENSG00000214102	ENST00000397541;ENST00000493845	T;T	0.67345	-0.26;-0.26	5.65	4.77	0.60923	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.821953	0.10722	U	0.641621	T	0.58524	0.2128	L	0.38953	1.18	0.29768	N	0.834998	B	0.27140	0.169	B	0.35727	0.209	T	0.56486	-0.7971	10	0.51188	T	0.08	.	5.3914	0.16245	0.0:0.7295:0.0:0.2705	.	302	P0C1S8	WEE2_HUMAN	F	302;77	ENSP00000380675:S302F;ENSP00000420388:S77F	ENSP00000380675:S302F	S	+	2	0	WEE2	141069427	0.849000	0.29639	0.997000	0.53966	0.333000	0.28666	1.173000	0.31920	2.653000	0.90120	0.650000	0.86243	TCT		0.418	WEE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349091.1	NM_001105558		20	105	0	0	0	0	20	105				
SMARCD3	6604	broad.mit.edu	37	7	150936782	150936782	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr7:150936782G>C	ENST00000262188.8	-	11	1634	c.1224C>G	c.(1222-1224)ttC>ttG	p.F408L	SMARCD3_ENST00000392811.2_Missense_Mutation_p.F395L|MIR671_ENST00000390183.1_RNA|SMARCD3_ENST00000356800.2_Missense_Mutation_p.F395L|SMARCD3_ENST00000477169.1_5'Flank|RP4-548D19.3_ENST00000607902.1_RNA	NM_001003801.1	NP_001003801.1	Q6STE5	SMRD3_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3	408					cardiac right ventricle formation (GO:0003219)|cellular lipid metabolic process (GO:0044255)|chromatin remodeling (GO:0006338)|muscle cell differentiation (GO:0042692)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of protein binding (GO:0043393)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|secondary heart field specification (GO:0003139)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|receptor binding (GO:0005102)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(6)|ovary(2)	15			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		AGCTTAGCATGAAGTCCCTCT	0.532																																						uc003wjs.2		NA																	0				ovary(1)|lung(1)	2						c.(1222-1224)TTC>TTG		SWI/SNF related, matrix associated, actin							130.0	127.0	128.0					7																	150936782		2203	4300	6503	SO:0001583	missense	6604				cellular lipid metabolic process|chromatin modification|nervous system development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	nuclear hormone receptor binding|protein binding|transcription coactivator activity|transcription factor binding	g.chr7:150936782G>C	U66619	CCDS5924.1, CCDS34780.1	7q35-q36	2008-07-18			ENSG00000082014	ENSG00000082014			11108	protein-coding gene	gene with protein product	"""mammalian chromatin remodeling complex BRG1-associated factor 60C"", ""Swp73-like protein"", ""SWI/SNF complex 60 kDa subunit C"", ""60kDa BRG-1/Brm associated factor subunit c"""	601737				8804307, 9693044	Standard	NM_001003801		Approved	BAF60C, Rsc6p, CRACD3	uc003wjs.3	Q6STE5	OTTHUMG00000157431	ENST00000262188.8:c.1224C>G	7.37:g.150936782G>C	ENSP00000262188:p.Phe408Leu		Somatic				SMARCD3_uc003wjt.2_Missense_Mutation_p.F395L|SMARCD3_uc003wju.2_Missense_Mutation_p.F395L	p.F408L	NM_001003801	NP_001003801	WXS	Illumina HiSeq	Unspecified	Q6STE5	SMRD3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	11	1325	-			408					D3DX10|Q2YD86|Q75MJ2|Q75MR8|Q92926|Q9BUH1	Missense_Mutation	SNP	ENST00000262188.8	37	c.1224C>G	CCDS34780.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.515036	0.85389	.	.	ENSG00000082014	ENST00000262188;ENST00000392811;ENST00000356800;ENST00000347683	T;T;T	0.60299	0.2;0.21;0.21	5.33	4.45	0.53987	.	0.045544	0.85682	N	0.000000	T	0.81772	0.4893	H	0.95187	3.635	0.80722	D	1	B;D	0.89917	0.002;1.0	B;D	0.91635	0.001;0.999	D	0.86138	0.1579	10	0.87932	D	0	-20.9573	12.0824	0.53677	0.0842:0.0:0.9158:0.0	.	395;408	Q6STE5-2;Q6STE5	.;SMRD3_HUMAN	L	408;395;395;360	ENSP00000262188:F408L;ENSP00000376558:F395L;ENSP00000349254:F395L	ENSP00000262188:F408L	F	-	3	2	SMARCD3	150567715	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.810000	0.69179	1.244000	0.43870	0.655000	0.94253	TTC		0.532	SMARCD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348825.1	NM_001003801		21	98	0	0	0	0	21	98				
CSMD1	64478	broad.mit.edu	37	8	2836257	2836257	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr8:2836257C>T	ENST00000520002.1	-	56	9001	c.8446G>A	c.(8446-8448)Gag>Aag	p.E2816K	CSMD1_ENST00000537824.1_Missense_Mutation_p.E2815K|CSMD1_ENST00000602723.1_Missense_Mutation_p.E2758K|CSMD1_ENST00000400186.3_Missense_Mutation_p.E2758K|CSMD1_ENST00000542608.1_Missense_Mutation_p.E2757K|CSMD1_ENST00000602557.1_Missense_Mutation_p.E2816K			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2816	Sushi 20. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TCAAAACTCTCAGGGAAGTTC	0.423																																						uc011kwk.1		NA																	0				breast(20)|large_intestine(5)	25						c.(8446-8448)GAG>AAG		CUB and Sushi multiple domains 1 precursor							78.0	72.0	74.0					8																	2836257		1873	4114	5987	SO:0001583	missense	64478					integral to membrane		g.chr8:2836257C>T			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.8446G>A	8.37:g.2836257C>T	ENSP00000430733:p.Glu2816Lys		Somatic				CSMD1_uc011kwj.1_Missense_Mutation_p.E2145K|CSMD1_uc010lrg.2_Missense_Mutation_p.E826K	p.E2816K	NM_033225	NP_150094	WXS	Illumina HiSeq	Unspecified	Q96PZ7	CSMD1_HUMAN		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)	55	8836	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	2816			Extracellular (Potential).|Sushi 20.		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37	c.8446G>A		.	.	.	.	.	.	.	.	.	.	C	11.33	1.605897	0.28623	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608	T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18	5.08	5.08	0.68730	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	T	0.69351	0.3101	L	0.31578	0.945	0.80722	D	1	D;P;D	0.76494	0.992;0.797;0.999	D;P;D	0.85130	0.987;0.602;0.997	T	0.65034	-0.6266	10	0.21540	T	0.41	.	18.4932	0.90855	0.0:1.0:0.0:0.0	.	2816;2816;2757	E5RIG2;Q96PZ7;F5H2I8	.;CSMD1_HUMAN;.	K	2758;2816;2677;2815;2757	ENSP00000383047:E2758K;ENSP00000430733:E2816K;ENSP00000441462:E2815K;ENSP00000446243:E2757K	ENSP00000320445:E2677K	E	-	1	0	CSMD1	2823664	0.995000	0.38212	0.840000	0.33206	0.354000	0.29330	2.992000	0.49417	2.354000	0.79902	0.563000	0.77884	GAG		0.423	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225		3	16	0	0	0	0	3	16				
RP1L1	94137	broad.mit.edu	37	8	10470341	10470341	+	Missense_Mutation	SNP	G	G	A	rs375440665		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr8:10470341G>A	ENST00000382483.3	-	4	1490	c.1267C>T	c.(1267-1269)Cgg>Tgg	p.R423W		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	423					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		CACCTCTTCCGAGCTGCCACT	0.667																																						uc003wtc.2		NA																	0				ovary(4)|breast(3)|central_nervous_system(1)	8						c.(1267-1269)CGG>TGG		retinitis pigmentosa 1-like 1		G	TRP/ARG	0,3940		0,0,1970	31.0	37.0	35.0		1267	-6.3	0.0	8		35	1,8283		0,1,4141	no	missense	RP1L1	NM_178857.5	101	0,1,6111	AA,AG,GG		0.0121,0.0,0.0082	probably-damaging	423/2401	10470341	1,12223	1970	4142	6112	SO:0001583	missense	94137				intracellular signal transduction			g.chr8:10470341G>A	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.1267C>T	8.37:g.10470341G>A	ENSP00000371923:p.Arg423Trp		Somatic					p.R423W	NM_178857	NP_849188	WXS	Illumina HiSeq	Unspecified	Q8IWN7	RP1L1_HUMAN		COAD - Colon adenocarcinoma(149;0.0811)	4	1496	-			423					Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	c.1267C>T	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	G	11.77	1.736947	0.30774	0.0	1.21E-4	ENSG00000183638	ENST00000382483	T	0.05382	3.45	4.77	-6.29	0.02013	.	1.694760	0.04018	N	0.299272	T	0.05318	0.0141	L	0.46157	1.445	0.09310	N	1	B	0.26363	0.147	B	0.17979	0.02	T	0.40136	-0.9579	10	0.87932	D	0	0.7481	1.9976	0.03459	0.3708:0.2505:0.2742:0.1045	.	423	A6NKC6	.	W	423	ENSP00000371923:R423W	ENSP00000371923:R423W	R	-	1	2	RP1L1	10507751	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-2.238000	0.01199	-1.003000	0.03425	0.561000	0.74099	CGG		0.667	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			13	38	0	0	0	0	13	38				
SLC35G5	83650	broad.mit.edu	37	8	11188898	11188898	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr8:11188898C>T	ENST00000382435.4	+	1	502	c.283C>T	c.(283-285)Ctg>Ttg	p.L95L		NM_001282300.1|NM_054028.1	NP_001269229.1|NP_473369.1	Q96KT7	S35G5_HUMAN	solute carrier family 35, member G5	95	EamA 1.					integral component of membrane (GO:0016021)											CGACCCCCTTCTGGGACCTCC	0.602																																						uc003wtp.1		NA																	0					0						c.(283-285)CTG>TTG		acyl-malonyl condensing enzyme							185.0	192.0	190.0					8																	11188898		2203	4300	6503	SO:0001819	synonymous_variant	83650					integral to membrane		g.chr8:11188898C>T	AJ291677	CCDS5980.1	8p23.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000177710	ENSG00000177710		"""Solute carriers"""	15546	protein-coding gene	gene with protein product		615199	"""acyl-malonyl condensing enzyme 1-like 2"""	AMAC, AMAC1L2			Standard	NM_054028		Approved		uc003wtp.1	Q96KT7	OTTHUMG00000090653	ENST00000382435.4:c.283C>T	8.37:g.11188898C>T			Somatic					p.L95L	NM_054028	NP_473369	WXS	Illumina HiSeq	Unspecified	Q96KT7	AMCL2_HUMAN	STAD - Stomach adenocarcinoma(15;0.00676)	COAD - Colon adenocarcinoma(149;0.0563)	1	404	+			95			DUF6 1.		A2RRL6	Silent	SNP	ENST00000382435.4	37	c.283C>T	CCDS5980.1																																																																																				0.602	SLC35G5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207313.2	NM_054028		35	237	0	0	0	0	35	237				
SLC7A2	6542	broad.mit.edu	37	8	17419529	17419529	+	Silent	SNP	C	C	T	rs139462829	byFrequency	TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr8:17419529C>T	ENST00000494857.1	+	11	1799	c.1581C>T	c.(1579-1581)ctC>ctT	p.L527L	SLC7A2_ENST00000398090.3_Silent_p.L566L|SLC7A2_ENST00000470360.1_Silent_p.L566L|SLC7A2_ENST00000522656.1_Silent_p.L527L|SLC7A2_ENST00000004531.10_Silent_p.L567L	NM_001008539.3	NP_001008539.3	P52569	CTR2_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 2	527					amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|macrophage activation (GO:0042116)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide production involved in inflammatory response (GO:0002537)|regulation of inflammatory response (GO:0050727)|regulation of macrophage activation (GO:0043030)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	basic amino acid transmembrane transporter activity (GO:0015174)|high-affinity arginine transmembrane transporter activity (GO:0005289)|L-lysine transmembrane transporter activity (GO:0015189)|L-ornithine transmembrane transporter activity (GO:0000064)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|stomach(1)	25				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	L-Lysine(DB00123)|L-Ornithine(DB00129)	CCTGGAGCCTCGCTCTCCTCG	0.532													C|||	12	0.00239617	0.0	0.0	5008	,	,		16550	0.0		0.0	False		,,,				2504	0.0123					uc011kyc.1		NA																	0				ovary(2)|skin(1)	3						c.(1579-1581)CTC>CTT		solute carrier family 7, member 2 isoform 2	L-Lysine(DB00123)|L-Ornithine(DB00129)	C	,,	0,4406		0,0,2203	148.0	126.0	133.0		1581,1701,1698	-9.9	0.0	8	dbSNP_134	133	6,8594	5.0+/-18.6	0,6,4294	no	coding-synonymous,coding-synonymous,coding-synonymous	SLC7A2	NM_001008539.3,NM_001164771.1,NM_003046.5	,,	0,6,6497	TT,TC,CC		0.0698,0.0,0.0461	,,	527/659,567/699,566/698	17419529	6,13000	2203	4300	6503	SO:0001819	synonymous_variant	6542				cellular amino acid metabolic process|ion transport	cytoplasm|integral to plasma membrane|membrane fraction	basic amino acid transmembrane transporter activity	g.chr8:17419529C>T	D29990	CCDS6002.2, CCDS34852.1, CCDS55203.1	8p22	2013-05-22			ENSG00000003989	ENSG00000003989		"""Solute carriers"""	11060	protein-coding gene	gene with protein product		601872		ATRC2		8954799	Standard	NM_001164771		Approved	CAT-2, HCAT2	uc011kye.2	P52569	OTTHUMG00000130819	ENST00000494857.1:c.1581C>T	8.37:g.17419529C>T			Somatic				SLC7A2_uc011kyd.1_Silent_p.L566L|SLC7A2_uc011kye.1_Silent_p.L567L|SLC7A2_uc011kyf.1_Silent_p.L527L	p.L527L	NM_001008539	NP_001008539	WXS	Illumina HiSeq	Unspecified	P52569	CTR2_HUMAN		Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	10	1750	+			527			Helical; (Potential).		B7ZL54|O15291|O15292|Q14CQ6|Q6NSZ7|Q86TC6	Silent	SNP	ENST00000494857.1	37	c.1581C>T	CCDS34852.1																																																																																				0.532	SLC7A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253367.3	NM_003046		21	70	0	0	0	0	21	70				
MTUS1	57509	broad.mit.edu	37	8	17613142	17613142	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr8:17613142C>G	ENST00000262102.6	-	2	399	c.175G>C	c.(175-177)Gaa>Caa	p.E59Q	MTUS1_ENST00000381862.3_Missense_Mutation_p.E59Q|MTUS1_ENST00000519263.1_Missense_Mutation_p.E59Q|MTUS1_ENST00000381869.3_Missense_Mutation_p.E59Q	NM_001001924.2	NP_001001924.1	Q9ULD2	MTUS1_HUMAN	microtubule associated tumor suppressor 1	59					cellular response to peptide hormone stimulus (GO:0071375)|regulation of macrophage chemotaxis (GO:0010758)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(14)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	36				Colorectal(111;0.0778)		GGGTCAGTTTCATAATCAACC	0.403																																						uc003wxv.2		NA																	0				ovary(1)|skin(1)	2						c.(175-177)GAA>CAA		mitochondrial tumor suppressor 1 isoform 1							162.0	151.0	154.0					8																	17613142		1880	4116	5996	SO:0001583	missense	57509					Golgi apparatus|microtubule|microtubule organizing center|mitochondrion|nucleus|plasma membrane|spindle		g.chr8:17613142C>G	AL096842	CCDS43716.1, CCDS43717.1, CCDS43718.1, CCDS43719.1, CCDS55204.1	8p22	2013-01-17	2009-10-20		ENSG00000129422	ENSG00000129422			29789	protein-coding gene	gene with protein product	"""AT2 receptor-interacting protein"", ""AT2R binding protein"", ""mitochondrial tumor suppressor gene 1"""	609589	"""mitochondrial tumor suppressor 1"""			10574462, 12692079	Standard	NM_001001931		Approved	MTSG1, KIAA1288, DKFZp586D1519, FLJ14295, ATIP1, MP44, ATBP, ICIS	uc003wxv.3	Q9ULD2	OTTHUMG00000163756	ENST00000262102.6:c.175G>C	8.37:g.17613142C>G	ENSP00000262102:p.Glu59Gln		Somatic				MTUS1_uc010lsy.2_RNA|MTUS1_uc003wxw.2_Missense_Mutation_p.E59Q|MTUS1_uc010lsz.2_Missense_Mutation_p.E59Q	p.E59Q	NM_001001924	NP_001001924	WXS	Illumina HiSeq	Unspecified	Q9ULD2	MTUS1_HUMAN		Colorectal(111;0.0778)	2	649	-			59					A8K135|B2RBJ6|B3KWJ9|B4DH03|B9EGA1|D3DSP8|Q63HJ6|Q659F4|Q6PK49|Q6URW7|Q8N4M6|Q8WTT9|Q9H7T2	Missense_Mutation	SNP	ENST00000262102.6	37	c.175G>C	CCDS43717.1	.	.	.	.	.	.	.	.	.	.	c	11.34	1.610858	0.28712	.	.	ENSG00000129422	ENST00000381869;ENST00000262102;ENST00000519263;ENST00000381862	T;T;T;T	0.21932	2.96;2.99;2.96;1.98	3.82	2.94	0.34122	.	0.248699	0.26855	N	0.022146	T	0.15046	0.0363	L	0.29908	0.895	0.20764	N	0.999852	P;P;P	0.46277	0.875;0.498;0.498	P;B;B	0.44811	0.461;0.262;0.262	T	0.10337	-1.0634	10	0.72032	D	0.01	-9.7633	3.6054	0.08041	0.1975:0.5957:0.0:0.2068	.	59;59;59	Q9ULD2-5;Q9ULD2-2;Q9ULD2	.;.;MTUS1_HUMAN	Q	59	ENSP00000371293:E59Q;ENSP00000262102:E59Q;ENSP00000430167:E59Q;ENSP00000371286:E59Q	ENSP00000262102:E59Q	E	-	1	0	MTUS1	17657422	0.083000	0.21467	0.429000	0.26710	0.294000	0.27393	1.435000	0.34969	1.184000	0.42957	-0.251000	0.11542	GAA		0.403	MTUS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000375247.1	XM_372031		28	168	0	0	0	0	28	168				
DOK2	9046	broad.mit.edu	37	8	21767244	21767244	+	Missense_Mutation	SNP	G	G	A	rs368473444		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr8:21767244G>A	ENST00000276420.4	-	5	1075	c.817C>T	c.(817-819)Cgg>Tgg	p.R273W	DOK2_ENST00000544659.1_Missense_Mutation_p.R119W	NM_003974.2	NP_003965.2	O60496	DOK2_HUMAN	docking protein 2, 56kDa	273	Pro-rich.				blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|leukocyte migration (GO:0050900)|Ras protein signal transduction (GO:0007265)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)	receptor signaling protein activity (GO:0005057)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(3)|skin(1)	26				Colorectal(74;0.0145)|COAD - Colon adenocarcinoma(73;0.0608)		TCATGCGGCCGAGAGTAGGGG	0.682																																						uc003wzy.1		NA																	0					0						c.(817-819)CGG>TGG		docking protein 2		G	TRP/ARG	0,4406		0,0,2203	49.0	56.0	53.0		817	3.6	1.0	8		53	1,8597	1.2+/-3.3	0,1,4298	no	missense	DOK2	NM_003974.2	101	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	273/413	21767244	1,13003	2203	4299	6502	SO:0001583	missense	9046				blood coagulation|leukocyte migration	cytosol	identical protein binding|insulin receptor binding	g.chr8:21767244G>A	AF034970	CCDS6016.1	8p21.3	2008-08-07	2002-08-29		ENSG00000147443	ENSG00000147443			2991	protein-coding gene	gene with protein product		604997	"""docking protein 2, 56kD"""			9478921, 14645010	Standard	NM_003974		Approved	p56dok-2, Dok-2	uc003wzy.1	O60496	OTTHUMG00000131075	ENST00000276420.4:c.817C>T	8.37:g.21767244G>A	ENSP00000276420:p.Arg273Trp		Somatic				DOK2_uc003wzx.1_Missense_Mutation_p.R273W|DOK2_uc003wzz.1_Missense_Mutation_p.R119W|DOK2_uc010lth.1_Missense_Mutation_p.R119W	p.R273W	NM_003974	NP_003965	WXS	Illumina HiSeq	Unspecified	O60496	DOK2_HUMAN		Colorectal(74;0.0145)|COAD - Colon adenocarcinoma(73;0.0608)	5	910	-			273			Pro-rich.		Q8N5A4	Missense_Mutation	SNP	ENST00000276420.4	37	c.817C>T	CCDS6016.1	.	.	.	.	.	.	.	.	.	.	G	15.19	2.758977	0.49468	0.0	1.16E-4	ENSG00000147443	ENST00000276420;ENST00000544659;ENST00000518197	T;T;T	0.47528	1.83;1.42;0.84	5.42	3.62	0.41486	.	0.631001	0.14032	N	0.346038	T	0.53126	0.1777	M	0.75447	2.3	0.34000	D	0.650173	D;D	0.69078	0.997;0.997	P;P	0.50490	0.642;0.642	T	0.64668	-0.6353	10	0.87932	D	0	-6.668	5.0901	0.14704	0.1714:0.0:0.6608:0.1678	.	273;273	O60496;A8K7W1	DOK2_HUMAN;.	W	273;119;119	ENSP00000276420:R273W;ENSP00000443602:R119W;ENSP00000430729:R119W	ENSP00000276420:R273W	R	-	1	2	DOK2	21823190	0.409000	0.25368	0.984000	0.44739	0.201000	0.24016	2.160000	0.42348	0.653000	0.30826	-0.169000	0.13324	CGG		0.682	DOK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253735.3	NM_003974		6	59	0	0	0	0	6	59				
LOXL2	4017	broad.mit.edu	37	8	23167319	23167319	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr8:23167319G>A	ENST00000389131.3	-	10	2111	c.1742C>T	c.(1741-1743)tCg>tTg	p.S581L		NM_002318.2	NP_002309.1	Q9Y4K0	LOXL2_HUMAN	lysyl oxidase-like 2	581	Lysyl-oxidase like.				aging (GO:0007568)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|collagen fibril organization (GO:0030199)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|epithelial to mesenchymal transition (GO:0001837)|histone modification (GO:0016570)|negative regulation of transcription, DNA-templated (GO:0045892)|oxidation-reduction process (GO:0055114)|positive regulation of chondrocyte differentiation (GO:0032332)|protein deamination (GO:0018277)|response to copper ion (GO:0046688)|response to hypoxia (GO:0001666)|sprouting angiogenesis (GO:0002040)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|chromosome (GO:0005694)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|methylated histone binding (GO:0035064)|oligosaccharide binding (GO:0070492)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(5)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(55;0.0453)|Breast(100;0.143)		Colorectal(74;0.0288)|COAD - Colon adenocarcinoma(73;0.096)		GGCTGAGGCCGAGAGGCAGTT	0.647																																						uc003xdh.1		NA																	0				breast(2)|ovary(1)	3						c.(1741-1743)TCG>TTG		lysyl oxidase-like 2 precursor							45.0	41.0	42.0					8																	23167319		2203	4300	6503	SO:0001583	missense	4017				aging|cell adhesion|protein modification process	extracellular space|membrane	copper ion binding|electron carrier activity|oxidoreductase activity, acting on the CH-NH2 group of donors, oxygen as acceptor|scavenger receptor activity	g.chr8:23167319G>A	U89942	CCDS34864.1	8p21.3	2008-05-15				ENSG00000134013			6666	protein-coding gene	gene with protein product		606663				9722957	Standard	NM_002318		Approved	WS9-14	uc003xdh.1	Q9Y4K0		ENST00000389131.3:c.1742C>T	8.37:g.23167319G>A	ENSP00000373783:p.Ser581Leu		Somatic				LOXL2_uc010lty.1_Missense_Mutation_p.S120L	p.S581L	NM_002318	NP_002309	WXS	Illumina HiSeq	Unspecified	Q9Y4K0	LOXL2_HUMAN		Colorectal(74;0.0288)|COAD - Colon adenocarcinoma(73;0.096)	10	2081	-		Prostate(55;0.0453)|Breast(100;0.143)	581			Lysyl-oxidase like.		B2R5Q0|Q53HV3|Q9BW70|Q9Y5Y8	Missense_Mutation	SNP	ENST00000389131.3	37	c.1742C>T	CCDS34864.1	.	.	.	.	.	.	.	.	.	.	G	34	5.410168	0.96072	.	.	ENSG00000134013	ENST00000389131	T	0.33438	1.41	5.67	5.67	0.87782	.	0.234561	0.43579	D	0.000550	T	0.64103	0.2568	M	0.89601	3.045	0.80722	D	1	D;D	0.64830	0.973;0.994	P;D	0.68353	0.756;0.957	T	0.70978	-0.4725	10	0.72032	D	0.01	.	18.3462	0.90322	0.0:0.0:1.0:0.0	.	581;581	B2R5Q0;Q9Y4K0	.;LOXL2_HUMAN	L	581	ENSP00000373783:S581L	ENSP00000373783:S581L	S	-	2	0	LOXL2	23223264	1.000000	0.71417	0.964000	0.40570	0.891000	0.51852	9.414000	0.97362	2.677000	0.91161	0.561000	0.74099	TCG		0.647	LOXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375603.1			5	25	0	0	0	0	5	25				
LOXL2	4017	broad.mit.edu	37	8	23174627	23174627	+	Splice_Site	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr8:23174627C>G	ENST00000389131.3	-	9	1840	c.1471G>C	c.(1471-1473)Gag>Cag	p.E491Q		NM_002318.2	NP_002309.1	Q9Y4K0	LOXL2_HUMAN	lysyl oxidase-like 2	491	SRCR 4. {ECO:0000255|PROSITE- ProRule:PRU00196}.				aging (GO:0007568)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|collagen fibril organization (GO:0030199)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|epithelial to mesenchymal transition (GO:0001837)|histone modification (GO:0016570)|negative regulation of transcription, DNA-templated (GO:0045892)|oxidation-reduction process (GO:0055114)|positive regulation of chondrocyte differentiation (GO:0032332)|protein deamination (GO:0018277)|response to copper ion (GO:0046688)|response to hypoxia (GO:0001666)|sprouting angiogenesis (GO:0002040)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|chromosome (GO:0005694)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|methylated histone binding (GO:0035064)|oligosaccharide binding (GO:0070492)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(5)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(55;0.0453)|Breast(100;0.143)		Colorectal(74;0.0288)|COAD - Colon adenocarcinoma(73;0.096)		TACCAGGTCTCCTGGAAGAAC	0.488																																						uc003xdh.1		NA																	0				breast(2)|ovary(1)	3						c.(1471-1473)GAG>CAG		lysyl oxidase-like 2 precursor							110.0	99.0	102.0					8																	23174627		2203	4300	6503	SO:0001630	splice_region_variant	4017				aging|cell adhesion|protein modification process	extracellular space|membrane	copper ion binding|electron carrier activity|oxidoreductase activity, acting on the CH-NH2 group of donors, oxygen as acceptor|scavenger receptor activity	g.chr8:23174627C>G	U89942	CCDS34864.1	8p21.3	2008-05-15				ENSG00000134013			6666	protein-coding gene	gene with protein product		606663				9722957	Standard	NM_002318		Approved	WS9-14	uc003xdh.1	Q9Y4K0		ENST00000389131.3:c.1471-1G>C	8.37:g.23174627C>G			Somatic				LOXL2_uc010lty.1_Missense_Mutation_p.E30Q	p.E491Q	NM_002318	NP_002309	WXS	Illumina HiSeq	Unspecified	Q9Y4K0	LOXL2_HUMAN		Colorectal(74;0.0288)|COAD - Colon adenocarcinoma(73;0.096)	9	1810	-		Prostate(55;0.0453)|Breast(100;0.143)	491			SRCR 4.		B2R5Q0|Q53HV3|Q9BW70|Q9Y5Y8	Missense_Mutation	SNP	ENST00000389131.3	37	c.1471G>C	CCDS34864.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.826857	0.90955	.	.	ENSG00000134013	ENST00000389131	T	0.35789	1.29	5.39	5.39	0.77823	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.000000	0.85682	D	0.000000	T	0.55513	0.1925	L	0.47016	1.485	0.80722	D	1	D;D	0.89917	1.0;0.989	D;D	0.97110	1.0;0.919	T	0.55755	-0.8091	10	0.72032	D	0.01	.	18.0971	0.89493	0.0:1.0:0.0:0.0	.	491;491	B2R5Q0;Q9Y4K0	.;LOXL2_HUMAN	Q	491	ENSP00000373783:E491Q	ENSP00000373783:E491Q	E	-	1	0	LOXL2	23230572	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	7.768000	0.85345	2.678000	0.91216	0.655000	0.94253	GAG		0.488	LOXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375603.1		Missense_Mutation	33	125	0	0	0	0	33	125				
HTRA4	203100	broad.mit.edu	37	8	38840029	38840029	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr8:38840029C>T	ENST00000302495.4	+	7	1227	c.1127C>T	c.(1126-1128)tCa>tTa	p.S376L		NM_153692.3	NP_710159.1	P83105	HTRA4_HUMAN	HtrA serine peptidase 4	376					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|upper_aerodigestive_tract(1)	11		all_lung(54;0.0344)|Hepatocellular(245;0.0512)|Lung NSC(58;0.0955)	LUSC - Lung squamous cell carcinoma(45;1.5e-07)			AAGGCGTTTTCAAATAAGAAA	0.423																																						uc003xmj.2		NA																	0					0						c.(1126-1128)TCA>TTA		HtrA serine peptidase 4 precursor							153.0	152.0	152.0					8																	38840029		2203	4300	6503	SO:0001583	missense	203100				proteolysis|regulation of cell growth	extracellular region	insulin-like growth factor binding|serine-type endopeptidase activity	g.chr8:38840029C>T	AK075205	CCDS6110.1	8p11.23	2008-02-05			ENSG00000169495	ENSG00000169495			26909	protein-coding gene	gene with protein product		610700					Standard	NM_153692		Approved	FLJ90724	uc003xmj.3	P83105	OTTHUMG00000164070	ENST00000302495.4:c.1127C>T	8.37:g.38840029C>T	ENSP00000305919:p.Ser376Leu		Somatic					p.S376L	NM_153692	NP_710159	WXS	Illumina HiSeq	Unspecified	P83105	HTRA4_HUMAN	LUSC - Lung squamous cell carcinoma(45;1.5e-07)		7	1242	+		all_lung(54;0.0344)|Hepatocellular(245;0.0512)|Lung NSC(58;0.0955)	376					Q542Z4|Q6PF13	Missense_Mutation	SNP	ENST00000302495.4	37	c.1127C>T	CCDS6110.1	.	.	.	.	.	.	.	.	.	.	C	6.669	0.492049	0.12702	.	.	ENSG00000169495	ENST00000302495	T	0.18810	2.19	5.21	1.95	0.26073	.	0.683800	0.13195	N	0.406432	T	0.15349	0.0370	L	0.41824	1.3	0.23113	N	0.998274	B	0.10296	0.003	B	0.04013	0.001	T	0.36986	-0.9725	10	0.09338	T	0.73	-0.9404	10.8498	0.46763	0.0:0.8546:0.0:0.1454	.	376	P83105	HTRA4_HUMAN	L	376	ENSP00000305919:S376L	ENSP00000305919:S376L	S	+	2	0	HTRA4	38959186	0.150000	0.22732	0.108000	0.21378	0.264000	0.26372	1.966000	0.40481	0.139000	0.18822	0.561000	0.74099	TCA		0.423	HTRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377077.1	NM_153692		6	56	0	0	0	0	6	56				
SFRP1	6422	broad.mit.edu	37	8	41161008	41161008	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr8:41161008G>C	ENST00000220772.3	-	2	931	c.594C>G	c.(592-594)atC>atG	p.I198M	SFRP1_ENST00000379845.3_Missense_Mutation_p.I62M	NM_003012.4	NP_003003.3	Q8N474	SFRP1_HUMAN	secreted frizzled-related protein 1	198	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				bone trabecula formation (GO:0060346)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to BMP stimulus (GO:0071773)|cellular response to estradiol stimulus (GO:0071392)|cellular response to estrogen stimulus (GO:0071391)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heparin (GO:0071504)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to prostaglandin E stimulus (GO:0071380)|cellular response to starvation (GO:0009267)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vitamin D (GO:0071305)|cellular response to X-ray (GO:0071481)|convergent extension involved in somitogenesis (GO:0090246)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral axis specification (GO:0009950)|female gonad development (GO:0008585)|gonad development (GO:0008406)|hematopoietic progenitor cell differentiation (GO:0002244)|hematopoietic stem cell differentiation (GO:0060218)|male gonad development (GO:0008584)|menstrual cycle phase (GO:0022601)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of bone remodeling (GO:0046851)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of canonical Wnt signaling pathway involved in controlling type B pancreatic cell proliferation (GO:2000080)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin secretion (GO:0046676)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of planar cell polarity pathway involved in axis elongation (GO:2000041)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|negative regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000054)|neural crest cell fate commitment (GO:0014034)|neural tube closure (GO:0001843)|osteoblast differentiation (GO:0001649)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of non-canonical Wnt signaling pathway (GO:2000052)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|proteolysis (GO:0006508)|regulation of angiogenesis (GO:0045765)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell cycle process (GO:0010564)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|somatic stem cell maintenance (GO:0035019)|stromal-epithelial cell signaling involved in prostate gland development (GO:0044345)|ureteric bud development (GO:0001657)|vasculature development (GO:0001944)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cysteine-type endopeptidase activity (GO:0004197)|drug binding (GO:0008144)|frizzled binding (GO:0005109)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|central_nervous_system(1)|large_intestine(2)|liver(1)|lung(1)|skin(1)	7	Breast(1;9.19e-13)|Ovarian(28;0.00769)|Colorectal(14;0.0305)|Lung SC(25;0.211)	all_lung(54;0.0034)|Lung NSC(58;0.0134)|Hepatocellular(245;0.023)|Esophageal squamous(32;0.0559)	BRCA - Breast invasive adenocarcinoma(1;1.11e-10)|LUSC - Lung squamous cell carcinoma(45;0.00894)|COAD - Colon adenocarcinoma(11;0.0174)			GATGTTCAATGATGGCCTCAG	0.527																																						uc003xnt.2		NA																	0				central_nervous_system(1)	1						c.(592-594)ATC>ATG		secreted frizzled-related protein 1 precursor							129.0	109.0	116.0					8																	41161008		2203	4300	6503	SO:0001583	missense	6422				brain development|canonical Wnt receptor signaling pathway|cellular response to BMP stimulus|cellular response to estradiol stimulus|cellular response to fibroblast growth factor stimulus|cellular response to heparin|cellular response to hypoxia|cellular response to interleukin-1|cellular response to prostaglandin E stimulus|cellular response to starvation|cellular response to transforming growth factor beta stimulus|cellular response to tumor necrosis factor|cellular response to vitamin D|DNA fragmentation involved in apoptotic nuclear change|dorsal/ventral axis specification|hemopoietic progenitor cell differentiation|hemopoietic stem cell differentiation|menstrual cycle phase|negative regulation of androgen receptor signaling pathway|negative regulation of B cell differentiation|negative regulation of bone remodeling|negative regulation of canonical Wnt receptor signaling pathway involved in controlling type B pancreatic cell proliferation|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cysteine-type endopeptidase activity|negative regulation of epithelial cell proliferation|negative regulation of epithelial to mesenchymal transition|negative regulation of fibroblast apoptosis|negative regulation of fibroblast proliferation|negative regulation of insulin secretion|negative regulation of ossification|negative regulation of osteoblast proliferation|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|osteoblast differentiation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell growth|positive regulation of epithelial cell proliferation|positive regulation of fat cell differentiation|positive regulation of fibroblast apoptosis|positive regulation of focal adhesion assembly|positive regulation of non-canonical Wnt receptor signaling pathway|positive regulation of Rac GTPase activity|positive regulation of smoothened signaling pathway|positive regulation of stress fiber assembly|positive regulation of transcription, DNA-dependent|regulation of angiogenesis|regulation of cell cycle process|response to drug|response to organic cyclic compound|vasculature development	cell surface|cytosol|extracellular space|plasma membrane|proteinaceous extracellular matrix	cysteine-type endopeptidase activity|drug binding|frizzled binding|heparin binding|identical protein binding|PDZ domain binding|Wnt receptor activity|Wnt-protein binding	g.chr8:41161008G>C	AF017987	CCDS34886.1	8p11.21	2006-12-15			ENSG00000104332	ENSG00000104332		"""Secreted frizzled-related proteins"""	10776	protein-coding gene	gene with protein product		604156				9391078, 9192640	Standard	NM_003012		Approved	SARP2, FRP, FRP-1	uc003xnt.3	Q8N474	OTTHUMG00000164074	ENST00000220772.3:c.594C>G	8.37:g.41161008G>C	ENSP00000220772:p.Ile198Met		Somatic					p.I198M	NM_003012	NP_003003	WXS	Illumina HiSeq	Unspecified	Q8N474	SFRP1_HUMAN	BRCA - Breast invasive adenocarcinoma(1;1.11e-10)|LUSC - Lung squamous cell carcinoma(45;0.00894)|COAD - Colon adenocarcinoma(11;0.0174)		2	896	-	Breast(1;9.19e-13)|Ovarian(28;0.00769)|Colorectal(14;0.0305)|Lung SC(25;0.211)	all_lung(54;0.0034)|Lung NSC(58;0.0134)|Hepatocellular(245;0.023)|Esophageal squamous(32;0.0559)	198			NTR.		O00546|O14779	Missense_Mutation	SNP	ENST00000220772.3	37	c.594C>G	CCDS34886.1	.	.	.	.	.	.	.	.	.	.	G	10.06	1.245613	0.22796	.	.	ENSG00000104332	ENST00000220772;ENST00000379845;ENST00000535263	T;T	0.29917	1.55;1.55	5.6	-2.86	0.05717	Tissue inhibitor of metalloproteinases-like, OB-fold (1);Netrin domain (1);	0.164918	0.53938	D	0.000054	T	0.15782	0.0380	N	0.22421	0.69	0.45108	D	0.998123	B	0.25563	0.129	B	0.20184	0.028	T	0.03384	-1.1042	10	0.37606	T	0.19	.	8.9659	0.35877	0.1318:0.0:0.4234:0.4448	.	198	Q8N474	SFRP1_HUMAN	M	198;62;198	ENSP00000220772:I198M;ENSP00000369174:I62M	ENSP00000220772:I198M	I	-	3	3	SFRP1	41280165	0.131000	0.22433	0.495000	0.27527	0.532000	0.34746	-0.547000	0.06055	-0.836000	0.04229	-0.457000	0.05445	ATC		0.527	SFRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377132.1	NM_003012		11	36	0	0	0	0	11	36				
ARFGEF1	10565	broad.mit.edu	37	8	68131668	68131668	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr8:68131668C>T	ENST00000262215.3	-	30	4725	c.4336G>A	c.(4336-4338)Gag>Aag	p.E1446K	ARFGEF1_ENST00000520381.1_Missense_Mutation_p.E900K|ARFGEF1_ENST00000518230.1_Missense_Mutation_p.E284K	NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	1446					endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)			breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			CCTCTTACCTCTGTCTGTTGT	0.308																																						uc003xxo.1		NA																	0				ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|kidney(1)	8						c.(4336-4338)GAG>AAG		brefeldin A-inhibited guanine							83.0	82.0	82.0					8																	68131668		2202	4298	6500	SO:0001583	missense	10565				exocytosis|regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity|myosin binding	g.chr8:68131668C>T	AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.4336G>A	8.37:g.68131668C>T	ENSP00000262215:p.Glu1446Lys		Somatic				ARFGEF1_uc003xxl.1_Missense_Mutation_p.E900K|ARFGEF1_uc003xxn.1_Missense_Mutation_p.E429K	p.E1446K	NM_006421	NP_006412	WXS	Illumina HiSeq	Unspecified	Q9Y6D6	BIG1_HUMAN	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)		30	4726	-	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	1446					Q9NV46|Q9UFV2|Q9UNL0	Missense_Mutation	SNP	ENST00000262215.3	37	c.4336G>A	CCDS6199.1	.	.	.	.	.	.	.	.	.	.	C	35	5.516711	0.96402	.	.	ENSG00000066777	ENST00000520381;ENST00000262215;ENST00000518230	T;T;T	0.58210	0.35;0.35;0.35	5.39	5.39	0.77823	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.75759	0.3893	M	0.81179	2.53	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.987	T	0.78585	-0.2147	10	0.87932	D	0	.	19.5154	0.95162	0.0:1.0:0.0:0.0	.	1446;924;900	Q9Y6D6;Q59FY5;E5RIF2	BIG1_HUMAN;.;.	K	900;1446;284	ENSP00000428429:E900K;ENSP00000262215:E1446K;ENSP00000430891:E284K	ENSP00000262215:E1446K	E	-	1	0	ARFGEF1	68294222	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.776000	0.85560	2.685000	0.91497	0.655000	0.94253	GAG		0.308	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379441.4	NM_006421		3	36	0	0	0	0	3	36				
PREX2	80243	broad.mit.edu	37	8	69058533	69058533	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr8:69058533C>G	ENST00000288368.4	+	34	4454	c.4177C>G	c.(4177-4179)Caa>Gaa	p.Q1393E		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	1393					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						ACAACTTCCTCAACGGCTGAA	0.338																																						uc003xxv.1		NA																	0				skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						c.(4177-4179)CAA>GAA		DEP domain containing 2 isoform a							95.0	95.0	95.0					8																	69058533		2203	4300	6503	SO:0001583	missense	80243				G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity	g.chr8:69058533C>G	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.4177C>G	8.37:g.69058533C>G	ENSP00000288368:p.Gln1393Glu		Somatic					p.Q1393E	NM_024870	NP_079146	WXS	Illumina HiSeq	Unspecified	Q70Z35	PREX2_HUMAN			34	4204	+			1393					B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	ENST00000288368.4	37	c.4177C>G	CCDS6201.1	.	.	.	.	.	.	.	.	.	.	C	10.80	1.451606	0.26074	.	.	ENSG00000046889	ENST00000288368	T	0.57273	0.41	5.62	3.81	0.43845	.	0.259015	0.39544	N	0.001330	T	0.34395	0.0896	N	0.19112	0.55	0.48901	D	0.999723	B	0.22480	0.07	B	0.22753	0.041	T	0.08027	-1.0742	10	0.09084	T	0.74	.	13.1486	0.59477	0.1283:0.7487:0.123:0.0	.	1393	Q70Z35	PREX2_HUMAN	E	1393	ENSP00000288368:Q1393E	ENSP00000288368:Q1393E	Q	+	1	0	PREX2	69221087	1.000000	0.71417	0.994000	0.49952	0.838000	0.47535	3.402000	0.52608	0.821000	0.34540	-0.156000	0.13503	CAA		0.338	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170		8	46	0	0	0	0	8	46				
KCNB2	9312	broad.mit.edu	37	8	73850115	73850115	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr8:73850115G>A	ENST00000523207.1	+	3	3113	c.2525G>A	c.(2524-2526)aGa>aAa	p.R842K		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	842					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	AGTGATGGGAGAGACCCTTTA	0.527																																						uc003xzb.2		NA																	0				skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7						c.(2524-2526)AGA>AAA		potassium voltage-gated channel, Shab-related							81.0	80.0	81.0					8																	73850115		2203	4300	6503	SO:0001583	missense	9312				regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding	g.chr8:73850115G>A	U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.2525G>A	8.37:g.73850115G>A	ENSP00000430846:p.Arg842Lys		Somatic					p.R842K	NM_004770	NP_004761	WXS	Illumina HiSeq	Unspecified	Q92953	KCNB2_HUMAN	Epithelial(68;0.105)		3	3113	+	Breast(64;0.137)		842			Cytoplasmic (Potential).		Q7Z7D0|Q9BXD3	Missense_Mutation	SNP	ENST00000523207.1	37	c.2525G>A	CCDS6209.1	.	.	.	.	.	.	.	.	.	.	G	5.850	0.341004	0.11069	.	.	ENSG00000182674	ENST00000523207	D	0.96940	-4.18	5.26	5.26	0.73747	.	1.936500	0.02949	U	0.141426	D	0.92149	0.7511	N	0.14661	0.345	0.26870	N	0.967778	B	0.24675	0.109	B	0.20767	0.031	T	0.81028	-0.1118	10	0.29301	T	0.29	.	9.7161	0.40276	0.0915:0.0:0.9085:0.0	.	842	Q92953	KCNB2_HUMAN	K	842	ENSP00000430846:R842K	ENSP00000430846:R842K	R	+	2	0	KCNB2	74012669	1.000000	0.71417	0.992000	0.48379	0.984000	0.73092	3.391000	0.52530	2.732000	0.93576	0.591000	0.81541	AGA		0.527	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1	NM_004770		10	71	0	0	0	0	10	71				
ZNF704	619279	broad.mit.edu	37	8	81577163	81577163	+	Missense_Mutation	SNP	C	C	G	rs375392857		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr8:81577163C>G	ENST00000327835.3	-	6	1045	c.814G>C	c.(814-816)Gat>Cat	p.D272H	ZNF704_ENST00000520336.1_5'Flank	NM_001033723.2	NP_001028895.1	Q6ZNC4	ZN704_HUMAN	zinc finger protein 704	272							metal ion binding (GO:0046872)			lung(9)|skin(1)|upper_aerodigestive_tract(1)	11	all_cancers(3;8.53e-08)|all_epithelial(4;4.59e-10)|Breast(3;2.56e-06)|Lung NSC(7;2.58e-06)|all_lung(9;9.4e-06)		BRCA - Breast invasive adenocarcinoma(6;0.00401)|Epithelial(68;0.00448)|all cancers(69;0.0277)			CGGCTTGAATCTGGGATGGGG	0.577																																						uc003yby.1		NA																	0					0						c.(814-816)GAT>CAT		zinc finger protein 704		C	HIS/ASP	1,4405	2.1+/-5.4	0,1,2202	134.0	117.0	123.0		814	6.1	0.8	8		123	0,8600		0,0,4300	no	missense	ZNF704	NM_001033723.2	81	0,1,6502	GG,GC,CC		0.0,0.0227,0.0077	possibly-damaging	272/413	81577163	1,13005	2203	4300	6503	SO:0001583	missense	619279					intracellular	zinc ion binding	g.chr8:81577163C>G	AK131274	CCDS34913.1	8q21.13	2008-05-02			ENSG00000164684	ENSG00000164684			32291	protein-coding gene	gene with protein product							Standard	NM_001033723		Approved	FLJ16218, Gig1	uc003yby.2	Q6ZNC4	OTTHUMG00000164733	ENST00000327835.3:c.814G>C	8.37:g.81577163C>G	ENSP00000331462:p.Asp272His		Somatic					p.D272H	NM_001033723	NP_001028895	WXS	Illumina HiSeq	Unspecified	Q6ZNC4	ZN704_HUMAN	BRCA - Breast invasive adenocarcinoma(6;0.00401)|Epithelial(68;0.00448)|all cancers(69;0.0277)		6	1046	-	all_cancers(3;8.53e-08)|all_epithelial(4;4.59e-10)|Breast(3;2.56e-06)|Lung NSC(7;2.58e-06)|all_lung(9;9.4e-06)		272					B2RNE6|B9EGW6	Missense_Mutation	SNP	ENST00000327835.3	37	c.814G>C	CCDS34913.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.451699	0.84209	2.27E-4	0.0	ENSG00000164684	ENST00000327835	D	0.83250	-1.7	6.07	6.07	0.98685	.	0.368557	0.33161	N	0.005218	D	0.83427	0.5252	L	0.43152	1.355	0.80722	D	1	B	0.29590	0.25	B	0.40038	0.317	T	0.77451	-0.2583	10	0.28530	T	0.3	-2.7173	20.6439	0.99570	0.0:1.0:0.0:0.0	.	272	Q6ZNC4	ZN704_HUMAN	H	272	ENSP00000331462:D272H	ENSP00000331462:D272H	D	-	1	0	ZNF704	81739718	0.974000	0.33945	0.841000	0.33234	0.966000	0.64601	2.874000	0.48483	2.890000	0.99128	0.650000	0.86243	GAT		0.577	ZNF704-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379964.2	NM_001033723		19	107	0	0	0	0	19	107				
VPS13B	157680	broad.mit.edu	37	8	100147838	100147838	+	Silent	SNP	C	C	T	rs141324814	byFrequency	TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr8:100147838C>T	ENST00000358544.2	+	11	1551	c.1440C>T	c.(1438-1440)ttC>ttT	p.F480F	VPS13B_ENST00000357162.2_Silent_p.F480F|VPS13B_ENST00000395996.1_Silent_p.F480F|VPS13B_ENST00000355155.1_Silent_p.F480F	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	480					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			CCTGTTTCTTCATTTGTGGTG	0.333													C|||	2	0.000399361	0.0	0.0	5008	,	,		18537	0.0		0.001	False		,,,				2504	0.001				Colon(161;2205 2542 7338 31318)	uc003yiv.2		NA																	0				ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20						c.(1438-1440)TTC>TTT		vacuolar protein sorting 13B isoform 5		C	,,	0,4404		0,0,2202	143.0	128.0	133.0		1440,1440,1440	3.5	1.0	8	dbSNP_134	133	4,8594	3.7+/-12.6	0,4,4295	no	coding-synonymous,coding-synonymous,coding-synonymous	VPS13B	NM_015243.2,NM_017890.3,NM_152564.3	,,	0,4,6497	TT,TC,CC		0.0465,0.0,0.0308	,,	480/864,480/4023,480/3998	100147838	4,12998	2202	4299	6501	SO:0001819	synonymous_variant	157680				protein transport			g.chr8:100147838C>T	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.1440C>T	8.37:g.100147838C>T			Somatic				VPS13B_uc003yiw.2_Silent_p.F480F|VPS13B_uc003yit.2_Silent_p.F480F|VPS13B_uc003yiu.1_Silent_p.F480F|VPS13B_uc003yix.1_5'Flank	p.F480F	NM_017890	NP_060360	WXS	Illumina HiSeq	Unspecified	Q7Z7G8	VP13B_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.00636)		11	1551	+	Breast(36;3.73e-07)		480					C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Silent	SNP	ENST00000358544.2	37	c.1440C>T	CCDS6280.1																																																																																				0.333	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042		6	39	0	0	0	0	6	39				
VPS13B	157680	broad.mit.edu	37	8	100523503	100523503	+	Nonsense_Mutation	SNP	G	G	T	rs386834087|rs120074151		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr8:100523503G>T	ENST00000358544.2	+	29	4582	c.4471G>T	c.(4471-4473)Gaa>Taa	p.E1491*	VPS13B_ENST00000357162.2_Nonsense_Mutation_p.E1466*|VPS13B_ENST00000395996.1_3'UTR	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	1491					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			TTTTCTTCATGAAATTCTTCT	0.333																																					Colon(161;2205 2542 7338 31318)	uc003yiv.2		NA																	0				ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	GRCh37	CM041273	VPS13B	M	rs120074151	c.(4471-4473)GAA>TAA		vacuolar protein sorting 13B isoform 5							135.0	134.0	134.0					8																	100523503		2203	4300	6503	SO:0001587	stop_gained	157680				protein transport			g.chr8:100523503G>T	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.4471G>T	8.37:g.100523503G>T	ENSP00000351346:p.Glu1491*		Somatic				VPS13B_uc003yiw.2_Nonsense_Mutation_p.E1466*|VPS13B_uc003yix.1_Nonsense_Mutation_p.E961*	p.E1491*	NM_017890	NP_060360	WXS	Illumina HiSeq	Unspecified	Q7Z7G8	VP13B_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.00636)		29	4582	+	Breast(36;3.73e-07)		1491					C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Nonsense_Mutation	SNP	ENST00000358544.2	37	c.4471G>T	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	G	44	11.049266	0.99508	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	.	.	.	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.4366	0.94798	0.0:0.0:1.0:0.0	.	.	.	.	X	1466;1491	.	ENSP00000349685:E1466X	E	+	1	0	VPS13B	100592679	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.452000	0.73485	2.669000	0.90835	0.585000	0.79938	GAA		0.333	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042		12	62	1	0	0.000978159	0.00100257	12	62				
NCALD	83988	broad.mit.edu	37	8	102731491	102731491	+	Missense_Mutation	SNP	C	C	G	rs530185576		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr8:102731491C>G	ENST00000311028.3	-	5	745	c.367G>C	c.(367-369)Gag>Cag	p.E123Q	NCALD_ENST00000220931.6_Missense_Mutation_p.E123Q|NCALD_ENST00000522951.1_Missense_Mutation_p.E123Q|NCALD_ENST00000519508.2_Missense_Mutation_p.E123Q|NCALD_ENST00000521599.1_Missense_Mutation_p.E123Q|NCALD_ENST00000395923.1_Missense_Mutation_p.E123Q	NM_001040624.1|NM_001040626.1	NP_001035714.1|NP_001035716.1	P61601	NCALD_HUMAN	neurocalcin delta	123	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.			E -> V (in Ref. 2; CAB66547). {ECO:0000305}.	calcium-mediated signaling (GO:0019722)|regulation of systemic arterial blood pressure (GO:0003073)|synaptic transmission (GO:0007268)|vesicle-mediated transport (GO:0016192)	clathrin coat of trans-Golgi network vesicle (GO:0030130)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|clathrin binding (GO:0030276)|tubulin binding (GO:0015631)			endometrium(1)|large_intestine(2)|lung(4)|prostate(1)	8	all_cancers(14;8.94e-08)|all_epithelial(15;7.03e-10)|Lung NSC(17;1.36e-05)|all_lung(17;2.7e-05)		all cancers(13;1.09e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000699)			TGCACGATCTCTAGCATCTCT	0.493													C|||	1	0.000199681	0.0	0.0	5008	,	,		19832	0.0		0.0	False		,,,				2504	0.001					uc003yke.2		NA																	0					0						c.(367-369)GAG>CAG		neurocalcin delta							116.0	106.0	110.0					8																	102731491		2203	4300	6503	SO:0001583	missense	83988				synaptic transmission|vesicle-mediated transport	clathrin coat of trans-Golgi network vesicle|cytosol	actin binding|calcium ion binding|clathrin binding|tubulin binding	g.chr8:102731491C>G	AF052142	CCDS6292.1	8q22.3	2014-08-12			ENSG00000104490	ENSG00000104490		"""EF-hand domain containing"""	7655	protein-coding gene	gene with protein product		606722				11267673	Standard	XM_006716672		Approved		uc003ykk.3	P61601	OTTHUMG00000164876	ENST00000311028.3:c.367G>C	8.37:g.102731491C>G	ENSP00000310587:p.Glu123Gln		Somatic				NCALD_uc003ykf.2_Missense_Mutation_p.E123Q|NCALD_uc003ykg.2_Missense_Mutation_p.E123Q|NCALD_uc003ykh.2_Missense_Mutation_p.E123Q|NCALD_uc003yki.2_Missense_Mutation_p.E123Q|NCALD_uc003ykj.2_Missense_Mutation_p.E123Q|NCALD_uc003ykk.2_Missense_Mutation_p.E123Q|NCALD_uc003ykl.2_Missense_Mutation_p.E123Q	p.E123Q	NM_032041	NP_114430	WXS	Illumina HiSeq	Unspecified	P61601	NCALD_HUMAN	all cancers(13;1.09e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000699)		2	736	-	all_cancers(14;8.94e-08)|all_epithelial(15;7.03e-10)|Lung NSC(17;1.36e-05)|all_lung(17;2.7e-05)		123	E -> V (in Ref. 2; CAB66547).		EF-hand 3.		P29554|Q8IYC3|Q9H0W2	Missense_Mutation	SNP	ENST00000311028.3	37	c.367G>C	CCDS6292.1	.	.	.	.	.	.	.	.	.	.	C	17.35	3.366947	0.61513	.	.	ENSG00000104490	ENST00000395923;ENST00000311028;ENST00000220931;ENST00000521599;ENST00000519508;ENST00000522951;ENST00000522448;ENST00000520690	T;T;T;T;T;T;T;T	0.71579	-0.58;-0.58;-0.58;-0.58;-0.58;-0.58;-0.1;-0.1	5.13	5.13	0.70059	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.66086	0.2754	L	0.45228	1.405	0.80722	D	1	P	0.43314	0.803	B	0.39660	0.306	T	0.68447	-0.5406	10	0.42905	T	0.14	.	18.5707	0.91135	0.0:1.0:0.0:0.0	.	123	P61601	NCALD_HUMAN	Q	123	ENSP00000379256:E123Q;ENSP00000310587:E123Q;ENSP00000220931:E123Q;ENSP00000428105:E123Q;ENSP00000430476:E123Q;ENSP00000428781:E123Q;ENSP00000429466:E123Q;ENSP00000429255:E123Q	ENSP00000220931:E123Q	E	-	1	0	NCALD	102800667	1.000000	0.71417	0.991000	0.47740	0.969000	0.65631	7.731000	0.84895	2.359000	0.80004	0.557000	0.71058	GAG		0.493	NCALD-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380732.2			17	100	0	0	0	0	17	100				
ABRA	137735	broad.mit.edu	37	8	107782097	107782097	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr8:107782097C>G	ENST00000311955.3	-	1	376	c.322G>C	c.(322-324)Gag>Cag	p.E108Q		NM_139166.4	NP_631905.1			actin-binding Rho activating protein											breast(1)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)	27			OV - Ovarian serous cystadenocarcinoma(57;3.83e-09)			TTGGACACCTCTTTCTTTTTG	0.552																																						uc003ymm.3		NA																	0				ovary(2)	2						c.(322-324)GAG>CAG		actin-binding Rho activating protein							130.0	125.0	127.0					8																	107782097		2203	4300	6503	SO:0001583	missense	137735				positive regulation of Rho protein signal transduction|positive regulation of sequence-specific DNA binding transcription factor activity|transcription, DNA-dependent|transmembrane transport	actin cytoskeleton|plasma membrane|sarcomere	actin binding	g.chr8:107782097C>G	AF503617	CCDS6305.1	8q23.1	2012-02-06			ENSG00000174429	ENSG00000174429			30655	protein-coding gene	gene with protein product	"""striated muscle activator of Rho-dependent signaling"""	609747				11983702	Standard	NM_139166		Approved	STARS	uc003ymm.4	Q8N0Z2	OTTHUMG00000164809	ENST00000311955.3:c.322G>C	8.37:g.107782097C>G	ENSP00000311436:p.Glu108Gln		Somatic					p.E108Q	NM_139166	NP_631905	WXS	Illumina HiSeq	Unspecified	Q8N0Z2	ABRA_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;3.83e-09)		1	376	-			108						Missense_Mutation	SNP	ENST00000311955.3	37	c.322G>C	CCDS6305.1	.	.	.	.	.	.	.	.	.	.	C	18.71	3.683034	0.68157	.	.	ENSG00000174429	ENST00000311955	D	0.93133	-3.17	6.07	6.07	0.98685	.	0.420020	0.28790	N	0.014136	D	0.91126	0.7206	M	0.64997	1.995	0.33429	D	0.580811	B	0.33940	0.433	B	0.29598	0.104	D	0.93193	0.6585	10	0.49607	T	0.09	-27.1038	13.7909	0.63140	0.0:0.9305:0.0:0.0695	.	108	Q8N0Z2	ABRA_HUMAN	Q	108	ENSP00000311436:E108Q	ENSP00000311436:E108Q	E	-	1	0	ABRA	107851273	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.015000	0.57152	2.884000	0.98904	0.655000	0.94253	GAG		0.552	ABRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380416.1	NM_139166		6	137	0	0	0	0	6	137				
NUDCD1	84955	broad.mit.edu	37	8	110293297	110293297	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr8:110293297G>A	ENST00000239690.4	-	6	1302	c.928C>T	c.(928-930)Cac>Tac	p.H310Y	NUDCD1_ENST00000427660.2_Missense_Mutation_p.H281Y	NM_032869.3	NP_116258.2			NudC domain containing 1											breast(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(1)|prostate(2)|skin(1)	25	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;1.56e-12)			ATGTTGATGTGATCAGGCAAA	0.363																																						uc003ynb.3		NA																	0				ovary(1)|breast(1)	2						c.(928-930)CAC>TAC		NudC domain containing 1 isoform 1							129.0	109.0	116.0					8																	110293297		2203	4300	6503	SO:0001583	missense	84955							g.chr8:110293297G>A	AF283302	CCDS6312.1, CCDS47910.1	8q23	2005-02-07			ENSG00000120526	ENSG00000120526			24306	protein-coding gene	gene with protein product		606109				11416219	Standard	NM_032869		Approved	CML66, FLJ14991	uc003ynb.4	Q96RS6	OTTHUMG00000164931	ENST00000239690.4:c.928C>T	8.37:g.110293297G>A	ENSP00000239690:p.His310Tyr		Somatic				NUDCD1_uc003yna.2_Missense_Mutation_p.H281Y|NUDCD1_uc010mcl.2_Missense_Mutation_p.H223Y|NUDCD1_uc010mcm.1_Missense_Mutation_p.H223Y	p.H310Y	NM_032869	NP_116258	WXS	Illumina HiSeq	Unspecified	Q96RS6	NUDC1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;1.56e-12)		6	1039	-	all_neural(195;0.219)		310			CS.			Missense_Mutation	SNP	ENST00000239690.4	37	c.928C>T	CCDS6312.1	.	.	.	.	.	.	.	.	.	.	G	11.81	1.749853	0.30955	.	.	ENSG00000120526	ENST00000239690;ENST00000427660	T;T	0.14766	2.48;2.48	5.15	2.22	0.28083	CS-like domain (1);CS domain (1);HSP20-like chaperone (1);	0.703054	0.15236	N	0.273177	T	0.10766	0.0263	L	0.41236	1.265	0.09310	N	1	B;B;B	0.29378	0.208;0.243;0.205	B;B;B	0.33750	0.169;0.129;0.126	T	0.32955	-0.9887	10	0.30854	T	0.27	-11.6181	3.8958	0.09139	0.0805:0.1238:0.3542:0.4416	.	223;310;281	Q96RS6-3;Q96RS6;Q96RS6-2	.;NUDC1_HUMAN;.	Y	310;281	ENSP00000239690:H310Y;ENSP00000410707:H281Y	ENSP00000239690:H310Y	H	-	1	0	NUDCD1	110362473	0.002000	0.14202	0.458000	0.27068	0.998000	0.95712	0.380000	0.20602	0.142000	0.18901	0.650000	0.86243	CAC		0.363	NUDCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380996.1	NM_032869		10	45	0	0	0	0	10	45				
PKHD1L1	93035	broad.mit.edu	37	8	110497290	110497290	+	Silent	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr8:110497290G>C	ENST00000378402.5	+	58	9698	c.9594G>C	c.(9592-9594)gtG>gtC	p.V3198V		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	3198					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AAGAGATTGTGATAACAACCA	0.294										HNSCC(38;0.096)																												uc003yne.2		NA																	0				ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14						c.(9592-9594)GTG>GTC		fibrocystin L precursor							69.0	65.0	66.0					8																	110497290		1815	4066	5881	SO:0001819	synonymous_variant	93035				immune response	cytosol|extracellular space|integral to membrane	receptor activity	g.chr8:110497290G>C	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.9594G>C	8.37:g.110497290G>C		HNSCC(38;0.096)	Somatic					p.V3198V	NM_177531	NP_803875	WXS	Illumina HiSeq	Unspecified	Q86WI1	PKHL1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)		58	9698	+			3198			Extracellular (Potential).		Q567P2|Q9UF27	Silent	SNP	ENST00000378402.5	37	c.9594G>C	CCDS47911.1																																																																																				0.294	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531		9	48	0	0	0	0	9	48				
RAD21	5885	broad.mit.edu	37	8	117874120	117874120	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr8:117874120C>A	ENST00000297338.2	-	4	621	c.334G>T	c.(334-336)Gaa>Taa	p.E112*	RAD21_ENST00000523547.1_5'UTR	NM_006265.2	NP_006256.1	O60216	RAD21_HUMAN	RAD21 homolog (S. pombe)	112					apoptotic process (GO:0006915)|chromosome segregation (GO:0007059)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|protein localization to chromatin (GO:0071168)|reciprocal meiotic recombination (GO:0007131)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|stomach(1)	32	all_cancers(13;1.21e-21)|Lung NSC(37;0.000134)|Ovarian(258;0.0172)					TGAAATTCTTCAGGTAAAGTA	0.378																																						uc003yod.2		NA																	0				lung(1)|skin(1)	2						c.(334-336)GAA>TAA		RAD21 homolog							152.0	153.0	152.0					8																	117874120		2203	4300	6503	SO:0001587	stop_gained	5885				apoptosis|cell division|chromosome segregation|double-strand break repair|mitotic metaphase/anaphase transition|mitotic prometaphase|protein localization to chromatin|reciprocal meiotic recombination|regulation of transcription from RNA polymerase II promoter	chromosome, centromeric region|cohesin complex|nuclear chromosome|nucleoplasm	protein binding	g.chr8:117874120C>A	BC050381	CCDS6321.1	8q24.11	2014-09-17	2001-11-28		ENSG00000164754	ENSG00000164754			9811	protein-coding gene	gene with protein product	"""sister chromatid cohesion 1"""	606462	"""RAD21 (S. pombe) homolog"""			8812457	Standard	NM_006265		Approved	KIAA0078, hHR21, SCC1	uc003yod.3	O60216	OTTHUMG00000164959	ENST00000297338.2:c.334G>T	8.37:g.117874120C>A	ENSP00000297338:p.Glu112*		Somatic					p.E112*	NM_006265	NP_006256	WXS	Illumina HiSeq	Unspecified	O60216	RAD21_HUMAN			4	622	-	all_cancers(13;1.21e-21)|Lung NSC(37;0.000134)|Ovarian(258;0.0172)		112					A8K0E0|Q15001|Q99568	Nonsense_Mutation	SNP	ENST00000297338.2	37	c.334G>T	CCDS6321.1	.	.	.	.	.	.	.	.	.	.	C	32	5.188106	0.94923	.	.	ENSG00000164754	ENST00000297338;ENST00000520992;ENST00000517485;ENST00000519837;ENST00000522699	.	.	.	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	-13.6616	19.8041	0.96521	0.0:1.0:0.0:0.0	.	.	.	.	X	112	.	ENSP00000297338:E112X	E	-	1	0	RAD21	117943301	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.814000	0.86154	2.683000	0.91414	0.585000	0.79938	GAA		0.378	RAD21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381184.1	NM_006265		29	144	1	0	8.58e-18	9.21e-18	29	144				
SLC30A8	169026	broad.mit.edu	37	8	118183390	118183390	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr8:118183390C>T	ENST00000456015.2	+	7	947	c.947C>T	c.(946-948)tCa>tTa	p.S316L	SLC30A8_ENST00000519688.1_Missense_Mutation_p.S267L|SLC30A8_ENST00000521243.1_Missense_Mutation_p.S267L|SLC30A8_ENST00000427715.2_Missense_Mutation_p.S267L	NM_173851.2	NP_776250.2	Q8IWU4	ZNT8_HUMAN	solute carrier family 30 (zinc transporter), member 8	316					cellular zinc ion homeostasis (GO:0006882)|insulin secretion (GO:0030073)|positive regulation of insulin secretion (GO:0032024)|regulation of sequestering of zinc ion (GO:0061088)|regulation of vesicle-mediated transport (GO:0060627)|response to glucose (GO:0009749)|response to interferon-gamma (GO:0034341)|response to interleukin-1 (GO:0070555)|sequestering of zinc ion (GO:0032119)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)			breast(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(18)|ovary(2)|pancreas(2)|skin(5)	41	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)			GTAATTCTCTCAGCTCATGTT	0.423																																					Ovarian(162;1202 1922 6011 16223 52092)	uc003yoh.2		NA																	0				ovary(2)|skin(2)	4						c.(946-948)TCA>TTA		solute carrier family 30 member 8							186.0	172.0	177.0					8																	118183390		2203	4300	6503	SO:0001583	missense	169026				insulin secretion|positive regulation of insulin secretion|regulation of sequestering of zinc ion|regulation of vesicle-mediated transport|response to glucose stimulus|sequestering of zinc ion	integral to membrane|plasma membrane|secretory granule membrane|transport vesicle membrane	protein homodimerization activity|zinc ion transmembrane transporter activity	g.chr8:118183390C>T		CCDS6322.1, CCDS55272.1	8q24.11	2014-08-12			ENSG00000164756			"""Solute carriers"""	20303	protein-coding gene	gene with protein product		611145					Standard	NM_001172811		Approved		uc003yoh.3	Q8IWU4	OTTHUMG00000164962	ENST00000456015.2:c.947C>T	8.37:g.118183390C>T	ENSP00000415011:p.Ser316Leu		Somatic				SLC30A8_uc010mcz.2_Missense_Mutation_p.S267L|SLC30A8_uc011lia.1_Missense_Mutation_p.S267L|SLC30A8_uc003yog.2_Missense_Mutation_p.S267L	p.S316L	NM_173851	NP_776250	WXS	Illumina HiSeq	Unspecified	Q8IWU4	ZNT8_HUMAN	STAD - Stomach adenocarcinoma(47;0.203)		7	1177	+	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		316			Cytoplasmic (Potential).		A0AVP9|A5YM39|B4DPE0|Q8TCL3	Missense_Mutation	SNP	ENST00000456015.2	37	c.947C>T	CCDS6322.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.382618	0.82792	.	.	ENSG00000164756	ENST00000521243;ENST00000427715;ENST00000519688;ENST00000456015	T;T;T;T	0.57752	0.38;0.38;0.38;0.38	4.97	4.09	0.47781	.	0.199287	0.44097	N	0.000481	T	0.72598	0.3480	M	0.85542	2.76	0.54753	D	0.999987	D	0.69078	0.997	D	0.73380	0.98	T	0.76691	-0.2866	10	0.87932	D	0	-9.5441	11.2179	0.48838	0.0:0.9094:0.0:0.0906	.	316	Q8IWU4	ZNT8_HUMAN	L	267;267;267;316	ENSP00000428545:S267L;ENSP00000407505:S267L;ENSP00000431069:S267L;ENSP00000415011:S316L	ENSP00000407505:S267L	S	+	2	0	SLC30A8	118252571	1.000000	0.71417	0.845000	0.33349	0.988000	0.76386	4.609000	0.61148	1.231000	0.43661	0.655000	0.94253	TCA		0.423	SLC30A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381205.1	NM_173851		15	85	0	0	0	0	15	85				
COLEC10	10584	broad.mit.edu	37	8	120118062	120118062	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr8:120118062G>A	ENST00000332843.2	+	6	507	c.466G>A	c.(466-468)Gaa>Aaa	p.E156K		NM_006438.3	NP_006429.2	Q9Y6Z7	COL10_HUMAN	collectin sub-family member 10 (C-type lectin)	156	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					collagen trimer (GO:0005581)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)	mannose binding (GO:0005537)			endometrium(2)|kidney(3)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	21	all_cancers(13;4.13e-26)|Lung NSC(37;1.36e-07)|Ovarian(258;0.018)|Hepatocellular(40;0.234)		STAD - Stomach adenocarcinoma(47;0.00113)			TAGGGAAACTGAAGAGAAATT	0.428																																						uc003yoo.2		NA																	0				ovary(2)|skin(1)	3						c.(466-468)GAA>AAA		collectin sub-family member 10 precursor							57.0	46.0	50.0					8																	120118062		2203	4300	6503	SO:0001583	missense	10584					collagen|cytoplasm	mannose binding	g.chr8:120118062G>A	AB002631	CCDS6327.1	8q23-q24.1	2007-12-19				ENSG00000184374		"""Collectins"""	2220	protein-coding gene	gene with protein product		607620				10224141	Standard	NM_006438		Approved	CL-L1	uc003yoo.3	Q9Y6Z7		ENST00000332843.2:c.466G>A	8.37:g.120118062G>A	ENSP00000332723:p.Glu156Lys		Somatic					p.E156K	NM_006438	NP_006429	WXS	Illumina HiSeq	Unspecified	Q9Y6Z7	COL10_HUMAN	STAD - Stomach adenocarcinoma(47;0.00113)		6	563	+	all_cancers(13;4.13e-26)|Lung NSC(37;1.36e-07)|Ovarian(258;0.018)|Hepatocellular(40;0.234)		156			C-type lectin.		Q3SYH6|Q6UW19	Missense_Mutation	SNP	ENST00000332843.2	37	c.466G>A	CCDS6327.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.025456	0.93518	.	.	ENSG00000184374	ENST00000332843	T	0.17213	2.29	5.39	5.39	0.77823	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (2);	0.168354	0.51477	D	0.000087	T	0.14960	0.0361	L	0.29908	0.895	0.58432	D	0.999998	P	0.46395	0.877	B	0.37731	0.257	T	0.02064	-1.1220	10	0.41790	T	0.15	-24.9869	19.5182	0.95174	0.0:0.0:1.0:0.0	.	156	Q9Y6Z7	COL10_HUMAN	K	156	ENSP00000332723:E156K	ENSP00000332723:E156K	E	+	1	0	COLEC10	120187243	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.622000	0.98378	2.692000	0.91855	0.555000	0.69702	GAA		0.428	COLEC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381225.1			4	26	0	0	0	0	4	26				
ZHX2	22882	broad.mit.edu	37	8	123965799	123965799	+	Silent	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr8:123965799G>A	ENST00000314393.4	+	3	2884	c.2049G>A	c.(2047-2049)ctG>ctA	p.L683L		NM_014943.3	NP_055758.1	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	683					mRNA catabolic process (GO:0006402)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	45	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			GATGCTTGCTGAAAACGGGAA	0.557																																					Esophageal Squamous(94;1056 1388 11767 13799 49639)	uc003ypk.1		NA																	0				ovary(1)|skin(1)	2						c.(2047-2049)CTG>CTA		zinc fingers and homeoboxes 2							99.0	88.0	92.0					8																	123965799		2203	4300	6503	SO:0001819	synonymous_variant	22882					cytoplasm|nucleus|plasma membrane	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:123965799G>A	AB020661	CCDS6336.1	8q24.13	2012-03-09	2004-01-23		ENSG00000178764	ENSG00000178764		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	18513	protein-coding gene	gene with protein product		609185	"""zinc-fingers and homeoboxes 2"""			10048485, 12741956	Standard	XM_005250837		Approved	KIAA0854	uc003ypk.1	Q9Y6X8	OTTHUMG00000165077	ENST00000314393.4:c.2049G>A	8.37:g.123965799G>A			Somatic					p.L683L	NM_014943	NP_055758	WXS	Illumina HiSeq	Unspecified	Q9Y6X8	ZHX2_HUMAN	STAD - Stomach adenocarcinoma(47;0.00527)		3	2616	+	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		683			Homeobox 4.			Silent	SNP	ENST00000314393.4	37	c.2049G>A	CCDS6336.1																																																																																				0.557	ZHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381709.1	NM_014943		5	51	0	0	0	0	5	51				
ZHX2	22882	broad.mit.edu	37	8	123965807	123965807	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr8:123965807G>C	ENST00000314393.4	+	3	2892	c.2057G>C	c.(2056-2058)gGa>gCa	p.G686A		NM_014943.3	NP_055758.1	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	686					mRNA catabolic process (GO:0006402)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	45	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			CTGAAAACGGGAACCGTGAAG	0.557																																					Esophageal Squamous(94;1056 1388 11767 13799 49639)	uc003ypk.1		NA																	0				ovary(1)|skin(1)	2						c.(2056-2058)GGA>GCA		zinc fingers and homeoboxes 2							98.0	87.0	91.0					8																	123965807		2203	4300	6503	SO:0001583	missense	22882					cytoplasm|nucleus|plasma membrane	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:123965807G>C	AB020661	CCDS6336.1	8q24.13	2012-03-09	2004-01-23		ENSG00000178764	ENSG00000178764		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	18513	protein-coding gene	gene with protein product		609185	"""zinc-fingers and homeoboxes 2"""			10048485, 12741956	Standard	XM_005250837		Approved	KIAA0854	uc003ypk.1	Q9Y6X8	OTTHUMG00000165077	ENST00000314393.4:c.2057G>C	8.37:g.123965807G>C	ENSP00000314709:p.Gly686Ala		Somatic					p.G686A	NM_014943	NP_055758	WXS	Illumina HiSeq	Unspecified	Q9Y6X8	ZHX2_HUMAN	STAD - Stomach adenocarcinoma(47;0.00527)		3	2624	+	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		686			Homeobox 4.			Missense_Mutation	SNP	ENST00000314393.4	37	c.2057G>C	CCDS6336.1	.	.	.	.	.	.	.	.	.	.	G	19.39	3.817825	0.71028	.	.	ENSG00000178764	ENST00000314393	D	0.91577	-2.87	5.94	5.07	0.68467	Homeodomain-related (1);Homeobox (2);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.90518	0.7029	L	0.27053	0.805	0.80722	D	1	D	0.61080	0.989	P	0.58331	0.837	D	0.91543	0.5251	10	0.59425	D	0.04	-15.6108	15.2083	0.73198	0.0673:0.0:0.9327:0.0	.	686	Q9Y6X8	ZHX2_HUMAN	A	686	ENSP00000314709:G686A	ENSP00000314709:G686A	G	+	2	0	ZHX2	124034988	1.000000	0.71417	0.338000	0.25549	0.332000	0.28634	9.476000	0.97823	1.536000	0.49237	0.561000	0.74099	GGA		0.557	ZHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381709.1	NM_014943		5	52	0	0	0	0	5	52				
EPPK1	83481	broad.mit.edu	37	8	144941998	144941998	+	Silent	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr8:144941998G>A	ENST00000525985.1	-	2	5495	c.5424C>T	c.(5422-5424)gaC>gaT	p.D1808D				P58107	EPIPL_HUMAN	epiplakin 1	1808						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCCGCTTCCTGTCCTCTGTGA	0.527																																						uc003zaa.1		NA																	0				pancreas(1)|skin(1)	2						c.(5422-5424)GAC>GAT		epiplakin 1							126.0	123.0	124.0					8																	144941998		1951	4140	6091	SO:0001819	synonymous_variant	83481					cytoplasm|cytoskeleton	protein binding|structural molecule activity	g.chr8:144941998G>A	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.5424C>T	8.37:g.144941998G>A			Somatic					p.D1808D	NM_031308	NP_112598	WXS	Illumina HiSeq	Unspecified	P58107	EPIPL_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)		1	5437	-	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		1808					Q76E58|Q9NSU9	Silent	SNP	ENST00000525985.1	37	c.5424C>T																																																																																					0.527	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308		16	71	0	0	0	0	16	71				
SPATC1	375686	broad.mit.edu	37	8	145096263	145096263	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr8:145096263G>C	ENST00000377470.3	+	4	1539	c.1437G>C	c.(1435-1437)aaG>aaC	p.K479N	SPATC1_ENST00000447830.2_Intron	NM_198572.2	NP_940974.2	Q76KD6	SPERI_HUMAN	spermatogenesis and centriole associated 1	479						centrosome (GO:0005813)|cytoplasm (GO:0005737)				NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;3.67e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TCCCAGAGAAGATCATCCAGG	0.632																																						uc011lkw.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1435-1437)AAG>AAC		spermatogenesis and centriole associated 1							53.0	41.0	45.0					8																	145096263		2203	4299	6502	SO:0001583	missense	375686							g.chr8:145096263G>C	BC053547	CCDS6413.2, CCDS47937.1	8q24.3	2005-01-11			ENSG00000186583	ENSG00000186583			30510	protein-coding gene	gene with protein product		610874				15280373	Standard	NM_198572		Approved	MGC61633, SPATA15, SPERIOLIN	uc011lkw.2	Q76KD6	OTTHUMG00000156976	ENST00000377470.3:c.1437G>C	8.37:g.145096263G>C	ENSP00000366690:p.Lys479Asn		Somatic				SPATC1_uc011lkx.1_Intron	p.K479N	NM_198572	NP_940974	WXS	Illumina HiSeq	Unspecified	Q76KD6	SPERI_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;3.67e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)		4	1539	+	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		479					B4DWW9|Q5U5I8|Q7Z6L7	Missense_Mutation	SNP	ENST00000377470.3	37	c.1437G>C	CCDS6413.2	.	.	.	.	.	.	.	.	.	.	G	18.26	3.584279	0.65992	.	.	ENSG00000186583	ENST00000377470	T	0.52295	0.67	4.48	3.58	0.41010	.	0.154449	0.40640	N	0.001059	T	0.63780	0.2540	M	0.74881	2.28	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.66921	-0.5801	10	0.87932	D	0	-17.6302	8.9474	0.35767	0.1123:0.0:0.8877:0.0	.	479	Q76KD6	SPERI_HUMAN	N	479	ENSP00000366690:K479N	ENSP00000366690:K479N	K	+	3	2	SPATC1	145168251	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	1.547000	0.36190	2.212000	0.71576	0.462000	0.41574	AAG		0.632	SPATC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346926.1	NM_198572		6	25	0	0	0	0	6	25				
UHRF2	115426	broad.mit.edu	37	9	6506134	6506134	+	Silent	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr9:6506134G>A	ENST00000276893.5	+	16	2532	c.2364G>A	c.(2362-2364)caG>caA	p.Q788Q	UHRF2_ENST00000485617.2_3'UTR	NM_152896.2	NP_690856.1	Q96PU4	UHRF2_HUMAN	ubiquitin-like with PHD and ring finger domains 2, E3 ubiquitin protein ligase	788					cell cycle (GO:0007049)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|positive regulation of cell cycle arrest (GO:0071158)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|ubiquitin-dependent protein catabolic process (GO:0006511)	nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)	17		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0392)|Lung(218;0.129)		AGATTCTGCAGACTCTACTTG	0.463																																						uc003zjy.2		NA																	0				large_intestine(2)|ovary(1)	3						c.(2362-2364)CAG>CAA		ubiquitin-like with PHD and ring finger domains							170.0	141.0	151.0					9																	6506134		2203	4300	6503	SO:0001819	synonymous_variant	115426				cell cycle|cell differentiation|cell proliferation|protein autoubiquitination|regulation of cell cycle|ubiquitin-dependent protein catabolic process	nucleus	DNA binding|histone binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr9:6506134G>A	AF274049	CCDS6469.1	9p24.1	2013-01-28	2012-02-23		ENSG00000147854	ENSG00000147854		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	12557	protein-coding gene	gene with protein product	"""Np95-like ring finger protein"""	615211	"""ubiquitin-like with PHD and ring finger domains 2"""			12176013	Standard	NM_152896		Approved	RNF107, NIRF, URF2, MGC33463	uc003zjy.3	Q96PU4	OTTHUMG00000019521	ENST00000276893.5:c.2364G>A	9.37:g.6506134G>A			Somatic				UHRF2_uc003zjz.2_RNA|UHRF2_uc003zkb.2_RNA	p.Q788Q	NM_152896	NP_690856	WXS	Illumina HiSeq	Unspecified	Q96PU4	UHRF2_HUMAN		GBM - Glioblastoma multiforme(50;0.0392)|Lung(218;0.129)	16	2704	+		Acute lymphoblastic leukemia(23;0.158)	788					Q5VYR1|Q5VYR3|Q659C8|Q8TAG7	Silent	SNP	ENST00000276893.5	37	c.2364G>A	CCDS6469.1																																																																																				0.463	UHRF2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051665.3	NM_152306		5	100	0	0	0	0	5	100				
MTAP	4507	broad.mit.edu	37	9	21854777	21854777	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr9:21854777C>T	ENST00000460874.2	+	6	874	c.649C>T	c.(649-651)Cca>Tca	p.P217S	RP11-145E5.5_ENST00000404796.2_Intron|MTAP_ENST00000580900.1_Missense_Mutation_p.P200S|MTAP_ENST00000380172.4_Missense_Mutation_p.P200S					methylthioadenosine phosphorylase									p.0(1)|p.0?(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|lung(3)|pancreas(1)	10		all_cancers(5;0)|Hepatocellular(5;0.00162)|Colorectal(97;0.173)		GBM - Glioblastoma multiforme(3;0)|Lung(24;2.24e-57)|LUSC - Lung squamous cell carcinoma(38;1.97e-36)|STAD - Stomach adenocarcinoma(4;3.26e-05)|OV - Ovarian serous cystadenocarcinoma(39;0.00931)|COAD - Colon adenocarcinoma(8;0.15)		GACCACAGTTCCAGAGGTGGT	0.537																																						uc003zph.2		NA																	2	Whole gene deletion(2)		lung(2)	central_nervous_system(1)	1						c.(598-600)CCA>TCA		5'-methylthioadenosine phosphorylase	Adenine(DB00173)						83.0	80.0	81.0					9																	21854777		2203	4300	6503	SO:0001583	missense	4507				nucleoside metabolic process	cytoplasm	phosphorylase activity|S-methyl-5-thioadenosine phosphorylase activity	g.chr9:21854777C>T	AB062485	CCDS6509.1	9p21	2013-05-29			ENSG00000099810	ENSG00000099810	2.4.2.28		7413	protein-coding gene	gene with protein product	"""S-methyl-5'-thioadenosine phosphorylase"""	156540				11126361	Standard	NM_002451		Approved	MSAP, c86fus	uc003zph.3	Q13126	OTTHUMG00000019690	ENST00000460874.2:c.649C>T	9.37:g.21854777C>T	ENSP00000461932:p.Pro217Ser		Somatic				MTAP_uc003zpi.1_Intron|MTAP_uc010mit.2_RNA|MTAP_uc011lnk.1_Missense_Mutation_p.P217S|MTAP_uc011lnl.1_Missense_Mutation_p.P133S	p.P200S	NM_002451	NP_002442	WXS	Illumina HiSeq	Unspecified	Q13126	MTAP_HUMAN		GBM - Glioblastoma multiforme(3;0)|Lung(24;2.24e-57)|LUSC - Lung squamous cell carcinoma(38;1.97e-36)|STAD - Stomach adenocarcinoma(4;3.26e-05)|OV - Ovarian serous cystadenocarcinoma(39;0.00931)|COAD - Colon adenocarcinoma(8;0.15)	6	711	+		all_cancers(5;0)|Hepatocellular(5;0.00162)|Colorectal(97;0.173)	200						Missense_Mutation	SNP	ENST00000460874.2	37	c.598C>T		.	.	.	.	.	.	.	.	.	.	C	15.29	2.789971	0.50102	.	.	ENSG00000099810	ENST00000380172	D	0.88354	-2.37	5.3	5.3	0.74995	Nucleoside phosphorylase domain (1);	0.000000	0.85682	D	0.000000	D	0.95743	0.8615	M	0.93062	3.375	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.70716	0.968;0.97	D	0.96581	0.9430	10	0.72032	D	0.01	-10.8797	17.7411	0.88407	0.0:1.0:0.0:0.0	.	217;200	B4DUC8;Q13126	.;MTAP_HUMAN	S	200	ENSP00000369519:P200S	ENSP00000347923:P32S	P	+	1	0	MTAP	21844777	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.298000	0.78815	2.491000	0.84063	0.655000	0.94253	CCA		0.537	MTAP-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000051929.2	NM_002451		9	58	0	0	0	0	9	58				
GBA2	57704	broad.mit.edu	37	9	35739738	35739738	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr9:35739738C>G	ENST00000378103.3	-	9	1992	c.1469G>C	c.(1468-1470)gGa>gCa	p.G490A	GBA2_ENST00000467252.1_5'UTR|GBA2_ENST00000378088.1_5'Flank|GBA2_ENST00000378094.4_Missense_Mutation_p.G490A|GBA2_ENST00000545786.1_Missense_Mutation_p.G496A	NM_020944.2	NP_065995.1	Q9HCG7	GBA2_HUMAN	glucosidase, beta (bile acid) 2	490					bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|central nervous system neuron development (GO:0021954)|glucosylceramide catabolic process (GO:0006680)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-glucosidase activity (GO:0008422)|glucosylceramidase activity (GO:0004348)			NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CACTGTGCCTCCATCAGCCAG	0.532																																						uc003zxw.2		NA																	0				ovary(3)|skin(1)	4						c.(1468-1470)GGA>GCA		bile acid beta-glucosidase							75.0	68.0	70.0					9																	35739738		2203	4300	6503	SO:0001583	missense	57704				bile acid metabolic process|glucosylceramide catabolic process|O-glycoside catabolic process	integral to membrane|microsome|plasma membrane|smooth endoplasmic reticulum	beta-glucosidase activity|glucosylceramidase activity	g.chr9:35739738C>G	AJ309567	CCDS6589.1	9p13.2	2013-09-11			ENSG00000070610	ENSG00000070610			18986	protein-coding gene	gene with protein product	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	609471	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46		11489889, 23332916, 23332917	Standard	NM_020944		Approved	KIAA1605, AD035, DKFZp762K054	uc003zxw.3	Q9HCG7	OTTHUMG00000021024	ENST00000378103.3:c.1469G>C	9.37:g.35739738C>G	ENSP00000367343:p.Gly490Ala		Somatic				GBA2_uc003zxx.1_5'Flank|GBA2_uc011lpb.1_Missense_Mutation_p.G490A|GBA2_uc011lpc.1_Missense_Mutation_p.G490A|GBA2_uc011lpd.1_Missense_Mutation_p.G496A|GBA2_uc003zxy.1_Missense_Mutation_p.G203A	p.G490A	NM_020944	NP_065995	WXS	Illumina HiSeq	Unspecified	Q9HCG7	GBA2_HUMAN	Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)		9	1993	-	all_epithelial(49;0.167)		490			Extracellular (Potential).		D3DRP2|Q5TCV6|Q96A51|Q96LY1|Q96SJ2|Q9H2L8	Missense_Mutation	SNP	ENST00000378103.3	37	c.1469G>C	CCDS6589.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.856499	0.91355	.	.	ENSG00000070610	ENST00000378103;ENST00000378094;ENST00000545786	.	.	.	6.03	6.03	0.97812	Six-hairpin glycosidase-like (1);	0.000000	0.85682	D	0.000000	D	0.84465	0.5478	M	0.83692	2.655	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.991;0.998	D	0.85282	0.1062	9	0.87932	D	0	-9.9988	20.1672	0.98154	0.0:1.0:0.0:0.0	.	496;490;490	F5H7P6;Q9HCG7-2;Q9HCG7	.;.;GBA2_HUMAN	A	490;490;496	.	ENSP00000367334:G490A	G	-	2	0	GBA2	35729738	1.000000	0.71417	0.998000	0.56505	0.947000	0.59692	7.659000	0.83766	2.861000	0.98227	0.655000	0.94253	GGA		0.532	GBA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055456.1	NM_020944		7	41	0	0	0	0	7	41				
GBA2	57704	broad.mit.edu	37	9	35741858	35741858	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr9:35741858C>G	ENST00000378103.3	-	4	1120	c.597G>C	c.(595-597)caG>caC	p.Q199H	GBA2_ENST00000467252.1_5'UTR|GBA2_ENST00000378094.4_Missense_Mutation_p.Q199H|GBA2_ENST00000545786.1_Missense_Mutation_p.Q205H	NM_020944.2	NP_065995.1	Q9HCG7	GBA2_HUMAN	glucosidase, beta (bile acid) 2	199					bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|central nervous system neuron development (GO:0021954)|glucosylceramide catabolic process (GO:0006680)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-glucosidase activity (GO:0008422)|glucosylceramidase activity (GO:0004348)			NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GGTACACAGTCTGCCCTTCCC	0.567																																						uc003zxw.2		NA																	0				ovary(3)|skin(1)	4						c.(595-597)CAG>CAC		bile acid beta-glucosidase							77.0	67.0	70.0					9																	35741858		2203	4300	6503	SO:0001583	missense	57704				bile acid metabolic process|glucosylceramide catabolic process|O-glycoside catabolic process	integral to membrane|microsome|plasma membrane|smooth endoplasmic reticulum	beta-glucosidase activity|glucosylceramidase activity	g.chr9:35741858C>G	AJ309567	CCDS6589.1	9p13.2	2013-09-11			ENSG00000070610	ENSG00000070610			18986	protein-coding gene	gene with protein product	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	609471	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46		11489889, 23332916, 23332917	Standard	NM_020944		Approved	KIAA1605, AD035, DKFZp762K054	uc003zxw.3	Q9HCG7	OTTHUMG00000021024	ENST00000378103.3:c.597G>C	9.37:g.35741858C>G	ENSP00000367343:p.Gln199His		Somatic				GBA2_uc011lpb.1_Missense_Mutation_p.Q199H|GBA2_uc011lpc.1_Missense_Mutation_p.Q199H|GBA2_uc011lpd.1_Missense_Mutation_p.Q205H|GBA2_uc003zxy.1_5'UTR	p.Q199H	NM_020944	NP_065995	WXS	Illumina HiSeq	Unspecified	Q9HCG7	GBA2_HUMAN	Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)		4	1121	-	all_epithelial(49;0.167)		199			Extracellular (Potential).		D3DRP2|Q5TCV6|Q96A51|Q96LY1|Q96SJ2|Q9H2L8	Missense_Mutation	SNP	ENST00000378103.3	37	c.597G>C	CCDS6589.1	.	.	.	.	.	.	.	.	.	.	C	17.11	3.306521	0.60305	.	.	ENSG00000070610	ENST00000378103;ENST00000378094;ENST00000545786	.	.	.	5.68	3.81	0.43845	Beta-glucosidase, GBA2 type, N-terminal (1);	0.400235	0.28151	N	0.016416	T	0.73837	0.3638	M	0.80183	2.485	0.44036	D	0.996764	P;P;P	0.42203	0.731;0.755;0.773	P;B;P	0.53988	0.621;0.444;0.739	T	0.73300	-0.4026	9	0.48119	T	0.1	-0.7386	11.0265	0.47748	0.0:0.8005:0.1302:0.0693	.	205;199;199	F5H7P6;Q9HCG7-2;Q9HCG7	.;.;GBA2_HUMAN	H	199;199;205	.	ENSP00000367334:Q199H	Q	-	3	2	GBA2	35731858	1.000000	0.71417	0.158000	0.22627	0.981000	0.71138	2.564000	0.45931	0.728000	0.32382	0.563000	0.77884	CAG		0.567	GBA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055456.1	NM_020944		3	38	0	0	0	0	3	38				
NPR2	4882	broad.mit.edu	37	9	35806507	35806507	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr9:35806507G>A	ENST00000342694.2	+	16	2746	c.2491G>A	c.(2491-2493)Gaa>Aaa	p.E831K		NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2	831					bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	ACGCAAGGCTGAAGCTCTGCT	0.517																																						uc003zyd.2		NA																	0				ovary(2)|stomach(1)	3						c.(2491-2493)GAA>AAA		natriuretic peptide receptor B precursor	Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)						119.0	106.0	111.0					9																	35806507		2203	4300	6503	SO:0001583	missense	4882				intracellular signal transduction|ossification|receptor guanylyl cyclase signaling pathway|regulation of blood pressure	integral to membrane|plasma membrane	GTP binding|guanylate cyclase activity|natriuretic peptide receptor activity|protein kinase activity|transmembrane receptor activity	g.chr9:35806507G>A	AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871	ENST00000342694.2:c.2491G>A	9.37:g.35806507G>A	ENSP00000341083:p.Glu831Lys		Somatic				NPR2_uc010mlb.2_Missense_Mutation_p.E807K	p.E831K	NM_003995	NP_003986	WXS	Illumina HiSeq	Unspecified	P20594	ANPRB_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		16	2491	+	all_epithelial(49;0.161)		831			Cytoplasmic (Potential).		B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Missense_Mutation	SNP	ENST00000342694.2	37	c.2491G>A	CCDS6590.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.962053	0.92791	.	.	ENSG00000159899	ENST00000342694;ENST00000447210	D;D	0.88431	-1.68;-2.38	6.17	6.17	0.99709	Adenylyl cyclase class-3/4/guanylyl cyclase (1);	0.000000	0.45867	D	0.000337	D	0.96103	0.8730	M	0.92219	3.285	0.80722	D	1	D;D	0.89917	1.0;0.995	D;D	0.87578	0.998;0.913	D	0.95932	0.8939	10	0.62326	D	0.03	.	19.4575	0.94900	0.0:0.0:1.0:0.0	.	831;831	P20594-2;P20594	.;ANPRB_HUMAN	K	831;90	ENSP00000341083:E831K;ENSP00000393029:E90K	ENSP00000341083:E831K	E	+	1	0	NPR2	35796507	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.753000	0.98904	2.941000	0.99782	0.655000	0.94253	GAA		0.517	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052345.1			17	78	0	0	0	0	17	78				
OR13J1	392309	broad.mit.edu	37	9	35870019	35870019	+	Missense_Mutation	SNP	C	C	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr9:35870019C>A	ENST00000377981.2	-	1	442	c.380G>T	c.(379-381)tGc>tTc	p.C127F		NM_001004487.1	NP_001004487.1	Q8NGT2	O13J1_HUMAN	olfactory receptor, family 13, subfamily J, member 1	127						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|large_intestine(1)|lung(3)|skin(1)	6	all_epithelial(49;0.169)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00494)|STAD - Stomach adenocarcinoma(86;0.194)			GAGTGGCTGGCAGATGGCCAG	0.617																																						uc011lph.1		NA																	0				central_nervous_system(1)	1						c.(379-381)TGC>TTC		olfactory receptor, family 13, subfamily J,							47.0	56.0	53.0					9																	35870019		2203	4300	6503	SO:0001583	missense	392309				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:35870019C>A		CCDS35011.1	9p13.3	2013-09-24			ENSG00000168828	ENSG00000168828		"""GPCR / Class A : Olfactory receptors"""	15108	protein-coding gene	gene with protein product							Standard	NM_001004487		Approved		uc011lph.2	Q8NGT2	OTTHUMG00000019879	ENST00000377981.2:c.380G>T	9.37:g.35870019C>A	ENSP00000367219:p.Cys127Phe		Somatic					p.C127F	NM_001004487	NP_001004487	WXS	Illumina HiSeq	Unspecified	Q8NGT2	O13J1_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00494)|STAD - Stomach adenocarcinoma(86;0.194)		1	380	-	all_epithelial(49;0.169)		127			Cytoplasmic (Potential).		B2RN66|Q6IF20|Q96R40	Missense_Mutation	SNP	ENST00000377981.2	37	c.380G>T	CCDS35011.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.550450	0.86127	.	.	ENSG00000168828	ENST00000377981	T	0.07216	3.21	4.68	4.68	0.58851	GPCR, rhodopsin-like superfamily (1);	0.099777	0.45361	D	0.000362	T	0.44477	0.1295	H	0.97340	3.985	0.58432	D	0.999999	D	0.76494	0.999	D	0.83275	0.996	T	0.62558	-0.6829	10	0.87932	D	0	.	15.9177	0.79535	0.0:1.0:0.0:0.0	.	127	Q8NGT2	O13J1_HUMAN	F	127	ENSP00000367219:C127F	ENSP00000367219:C127F	C	-	2	0	OR13J1	35860019	1.000000	0.71417	0.999000	0.59377	0.956000	0.61745	5.864000	0.69575	2.890000	0.99128	0.650000	0.86243	TGC		0.617	OR13J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052381.1			10	42	1	0	7.48e-07	7.87e-07	10	42				
CLTA	1211	broad.mit.edu	37	9	36211652	36211652	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr9:36211652G>A	ENST00000242285.6	+	7	748	c.628G>A	c.(628-630)Gag>Aag	p.E210K	CLTA_ENST00000540080.1_Missense_Mutation_p.E128K|CLTA_ENST00000396603.2_Missense_Mutation_p.E198K|CLTA_ENST00000433436.2_Missense_Mutation_p.E210K|CLTA_ENST00000466396.1_Missense_Mutation_p.E158K|CLTA_ENST00000470744.1_Missense_Mutation_p.E192K|CLTA_ENST00000538225.1_Missense_Mutation_p.E192K|CLTA_ENST00000345519.5_Missense_Mutation_p.E180K			P09496	CLCA_HUMAN	clathrin, light chain A	210					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-Golgi vesicle-mediated transport (GO:0006892)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	clathrin heavy chain binding (GO:0032050)|peptide binding (GO:0042277)|structural molecule activity (GO:0005198)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(1)	6			STAD - Stomach adenocarcinoma(86;0.228)			CCCAGGCACTGAGTGGGAACG	0.527																																						uc003zzc.2		NA																	0				central_nervous_system(1)	1						c.(628-630)GAG>AAG		clathrin, light polypeptide A isoform b							103.0	97.0	99.0					9																	36211652		2203	4300	6503	SO:0001583	missense	1211				axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|cytosol	structural molecule activity	g.chr9:36211652G>A		CCDS6600.1, CCDS6601.1, CCDS43802.1, CCDS55306.1, CCDS55307.1	9p13.3	2010-05-11	2010-05-11		ENSG00000122705	ENSG00000122705			2090	protein-coding gene	gene with protein product		118960	"""clathrin, light polypeptide (Lca)"""			7713494	Standard	NM_007096		Approved	Lca	uc003zzc.3	P09496	OTTHUMG00000019896	ENST00000242285.6:c.628G>A	9.37:g.36211652G>A	ENSP00000242285:p.Glu210Lys		Somatic				CLTA_uc003zzd.2_Missense_Mutation_p.E198K|CLTA_uc003zze.2_Missense_Mutation_p.E180K|CLTA_uc011lpk.1_Missense_Mutation_p.E192K|CLTA_uc003zzf.1_Intron	p.E210K	NM_007096	NP_009027	WXS	Illumina HiSeq	Unspecified	P09496	CLCA_HUMAN	STAD - Stomach adenocarcinoma(86;0.228)		7	790	+			210					A8K4W3|B4DIN1|F5H6N3|Q2XPN5|Q53XZ1	Missense_Mutation	SNP	ENST00000242285.6	37	c.628G>A	CCDS6601.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.725997	0.89298	.	.	ENSG00000122705	ENST00000433436;ENST00000538225;ENST00000540080;ENST00000345519;ENST00000470744;ENST00000242285;ENST00000466396;ENST00000396603	.	.	.	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	D	0.84642	0.5517	M	0.88842	2.985	0.80722	D	1	D;D;P;D	0.89917	0.988;0.959;0.938;1.0	D;P;P;D	0.97110	0.954;0.882;0.881;1.0	D	0.85007	0.0903	9	0.42905	T	0.14	-12.831	17.5355	0.87829	0.0:0.0:1.0:0.0	.	192;180;198;210	B4DIN1;P09496-2;P09496-3;P09496	.;.;.;CLCA_HUMAN	K	210;192;128;180;192;210;158;198	.	ENSP00000242285:E210K	E	+	1	0	CLTA	36201652	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.807000	0.99171	2.736000	0.93811	0.655000	0.94253	GAG		0.527	CLTA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052405.1	NM_007096		14	115	0	0	0	0	14	115				
TRPM6	140803	broad.mit.edu	37	9	77354768	77354768	+	Silent	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr9:77354768G>A	ENST00000360774.1	-	34	5595	c.5358C>T	c.(5356-5358)gtC>gtT	p.V1786V	TRPM6_ENST00000376872.3_Silent_p.V741V|TRPM6_ENST00000449912.2_Silent_p.V1781V|TRPM6_ENST00000451710.3_Silent_p.V1790V|TRPM6_ENST00000376871.3_Silent_p.V623V|TRPM6_ENST00000376864.4_Silent_p.V1790V|TRPM6_ENST00000361255.3_Silent_p.V1781V	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	1786	Alpha-type protein kinase. {ECO:0000255|PROSITE-ProRule:PRU00501}.				calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						ACCAAGTGCTGACGACTCTCA	0.512																																						uc004ajl.1		NA																	0				lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						c.(5356-5358)GTC>GTT		transient receptor potential cation channel,							115.0	103.0	107.0					9																	77354768		2203	4300	6503	SO:0001819	synonymous_variant	140803				response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity	g.chr9:77354768G>A	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.5358C>T	9.37:g.77354768G>A			Somatic				TRPM6_uc004ajk.1_Silent_p.V1781V|TRPM6_uc010mpb.1_RNA|TRPM6_uc010mpc.1_Silent_p.V737V|TRPM6_uc010mpd.1_Silent_p.V619V|TRPM6_uc010mpe.1_Silent_p.V333V|TRPM6_uc004ajj.1_Silent_p.V742V	p.V1786V	NM_017662	NP_060132	WXS	Illumina HiSeq	Unspecified	Q9BX84	TRPM6_HUMAN			34	5596	-			1786			Alpha-type protein kinase.|Cytoplasmic (Potential).		Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Silent	SNP	ENST00000360774.1	37	c.5358C>T	CCDS6647.1																																																																																				0.512	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662		20	109	0	0	0	0	20	109				
AGTPBP1	23287	broad.mit.edu	37	9	88193845	88193845	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr9:88193845C>T	ENST00000357081.3	-	24	3476	c.3332G>A	c.(3331-3333)gGa>gAa	p.G1111E	AGTPBP1_ENST00000337006.4_3'UTR|AGTPBP1_ENST00000376109.3_Missense_Mutation_p.G1123E|AGTPBP1_ENST00000376083.3_Missense_Mutation_p.G1071E|AGTPBP1_ENST00000432218.1_Intron			Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1	1111					adult walking behavior (GO:0007628)|C-terminal protein deglutamylation (GO:0035609)|cerebellar Purkinje cell differentiation (GO:0021702)|eye photoreceptor cell differentiation (GO:0001754)|mitochondrion organization (GO:0007005)|neuromuscular process (GO:0050905)|neurotransmitter metabolic process (GO:0042133)|olfactory bulb development (GO:0021772)|protein side chain deglutamylation (GO:0035610)|retina development in camera-type eye (GO:0060041)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(12)|ovary(5)|skin(2)|urinary_tract(3)	44						CTTGTATTTTCCCTGATCACA	0.323																																						uc011ltd.1		NA																	0				ovary(4)|large_intestine(2)|skin(1)	7						c.(3331-3333)GGA>GAA		ATP/GTP binding protein 1							146.0	148.0	147.0					9																	88193845		2203	4300	6503	SO:0001583	missense	23287				C-terminal protein deglutamylation|cerebellar Purkinje cell differentiation|eye photoreceptor cell differentiation|mitochondrion organization|neuromuscular process|olfactory bulb development|protein side chain deglutamylation|proteolysis	cytosol|mitochondrion|nucleus	metallocarboxypeptidase activity|tubulin binding|zinc ion binding	g.chr9:88193845C>T	AB028958	CCDS6672.1, CCDS75854.1	9q21.33	2014-06-23			ENSG00000135049	ENSG00000135049			17258	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 1"", ""tubulinyl-Tyr carboxypeptidase"", ""carboxypeptidase-tubulin"", ""tyrosine carboxypeptidase"", ""soluble carboxypeptidase"""	606830				11083920	Standard	NM_015239		Approved	KIAA1035, Nna1, CCP1	uc010mqc.3	Q9UPW5	OTTHUMG00000020124	ENST00000357081.3:c.3332G>A	9.37:g.88193845C>T	ENSP00000349592:p.Gly1111Glu		Somatic				AGTPBP1_uc004aod.3_Missense_Mutation_p.G737E|AGTPBP1_uc011ltc.1_Intron|AGTPBP1_uc010mqc.2_Missense_Mutation_p.G1071E|AGTPBP1_uc011lte.1_Missense_Mutation_p.G1123E	p.G1111E	NM_015239	NP_056054	WXS	Illumina HiSeq	Unspecified	Q9UPW5	CBPC1_HUMAN			23	3365	-			1111					B4DIT6|B4DRZ8|Q5VV80|Q63HM7|Q658P5|Q6P9D6|Q9H8U6|Q9H9W8|Q9NVK1	Missense_Mutation	SNP	ENST00000357081.3	37	c.3332G>A		.	.	.	.	.	.	.	.	.	.	C	27.3	4.815777	0.90790	.	.	ENSG00000135049	ENST00000357081;ENST00000376083;ENST00000376109	T;T;T	0.24151	1.87;1.89;1.87	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.61714	0.2369	M	0.90759	3.145	0.80722	D	1	D;D;D	0.89917	0.995;1.0;1.0	D;D;D	0.97110	0.969;1.0;0.999	T	0.68891	-0.5289	10	0.87932	D	0	-19.7312	19.8254	0.96616	0.0:1.0:0.0:0.0	.	1123;1111;1071	Q9UPW5-3;Q9UPW5;Q9UPW5-2	.;CBPC1_HUMAN;.	E	1111;1071;1123	ENSP00000349592:G1111E;ENSP00000365251:G1071E;ENSP00000365277:G1123E	ENSP00000349592:G1111E	G	-	2	0	AGTPBP1	87383665	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.786000	0.85741	2.773000	0.95371	0.650000	0.86243	GGA		0.323	AGTPBP1-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000052893.1	NM_015239		18	126	0	0	0	0	18	126				
C9orf3	84909	broad.mit.edu	37	9	97844977	97844977	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr9:97844977G>T	ENST00000375315.2	+	15	2440	c.2440G>T	c.(2440-2442)Gtg>Ttg	p.V814L	MIR23B_ENST00000384832.1_RNA|C9orf3_ENST00000433691.2_Missense_Mutation_p.V155L|MIR27B_ENST00000385129.1_RNA|C9orf3_ENST00000297979.5_Missense_Mutation_p.V715L|C9orf3_ENST00000425634.2_Missense_Mutation_p.V176L	NM_001193329.1	NP_001180258.1	Q8N6M6	AMPO_HUMAN	chromosome 9 open reading frame 3	814					leukotriene biosynthetic process (GO:0019370)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(323;0.000275)		AGCCCAGGTGGTGGCCGAAAT	0.517																																						uc004ava.2		NA																	0				ovary(1)	1						c.(2440-2442)GTG>TTG		aminopeptidase O							153.0	126.0	135.0					9																	97844977		2203	4300	6503	SO:0001583	missense	84909				leukotriene biosynthetic process|proteolysis	cytoplasm	aminopeptidase activity|metallopeptidase activity|zinc ion binding	g.chr9:97844977G>T	AF043896	CCDS6713.1, CCDS55327.1, CCDS55328.1	9q22	2013-06-27			ENSG00000148120	ENSG00000148120			1361	protein-coding gene	gene with protein product	aminopeptidase O					15687497	Standard	NM_001193329		Approved	C90RF3, FLJ14675, APO, AOPEP, AP-O	uc004ava.3	Q8N6M6	OTTHUMG00000020276	ENST00000375315.2:c.2440G>T	9.37:g.97844977G>T	ENSP00000364464:p.Val814Leu		Somatic				C9orf3_uc004auy.2_Missense_Mutation_p.V715L|C9orf3_uc004avc.2_Intron|C9orf3_uc011luj.1_Missense_Mutation_p.V176L|C9orf3_uc011luk.1_Missense_Mutation_p.V155L|C9orf3_uc004avd.2_Missense_Mutation_p.V176L|MIR23B_hsa-mir-23b|MI0000439_5'Flank|uc004avg.3_5'Flank|MIR27B_hsa-mir-27b|MI0000440_5'Flank	p.V814L	NM_032823	NP_116212	WXS	Illumina HiSeq	Unspecified	Q8N6M6	AMPO_HUMAN		OV - Ovarian serous cystadenocarcinoma(323;0.000275)	15	2575	+			814					Q5T9B1|Q5T9B3|Q5T9B4|Q8WUL6|Q96M23|Q96SS1	Missense_Mutation	SNP	ENST00000375315.2	37	c.2440G>T	CCDS55328.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.3|26.3	4.722086|4.722086	0.89298|0.89298	.|.	.|.	ENSG00000148120|ENSG00000148120	ENST00000445181|ENST00000297979;ENST00000375315;ENST00000428313;ENST00000425634;ENST00000433691;ENST00000375314	.|T;T;T;T;T	.|0.59906	.|0.23;0.23;0.23;0.23;0.23	5.33|5.33	5.33|5.33	0.75918|0.75918	.|Peptidase M1, leukotriene A4 hydrolase, aminopeptidase C-terminal (1);Armadillo-type fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.76300|0.76300	0.3968|0.3968	M|M	0.72894|0.72894	2.215|2.215	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|0.998;0.997;1.0;0.999	.|D;D;D;D	.|0.91635	.|0.996;0.994;0.999;0.995	T|T	0.75944|0.75944	-0.3139|-0.3139	5|10	.|0.48119	.|T	.|0.1	-15.9126|-15.9126	19.3858|19.3858	0.94555|0.94555	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|155;176;814;715	.|B4DU39;B4DQU3;Q8N6M6;Q8N6M6-2	.|.;.;AMPO_HUMAN;.	V|L	178|715;814;596;176;155;178	.|ENSP00000297979:V715L;ENSP00000364464:V814L;ENSP00000401854:V596L;ENSP00000411815:V176L;ENSP00000399365:V155L	.|ENSP00000297979:V715L	G|V	+|+	2|1	0|0	C9orf3|C9orf3	96884798|96884798	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.541000|0.541000	0.35023|0.35023	9.378000|9.378000	0.97191|0.97191	2.659000|2.659000	0.90383|0.90383	0.561000|0.561000	0.74099|0.74099	GGT|GTG		0.517	C9orf3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_032823		13	50	1	0	4.38e-07	4.62e-07	13	50				
PTCH1	5727	broad.mit.edu	37	9	98242295	98242295	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr9:98242295C>G	ENST00000331920.6	-	7	1322	c.1023G>C	c.(1021-1023)ttG>ttC	p.L341F	PTCH1_ENST00000437951.1_Missense_Mutation_p.L275F|PTCH1_ENST00000430669.2_Missense_Mutation_p.L275F|PTCH1_ENST00000375274.2_Missense_Mutation_p.L340F|PTCH1_ENST00000418258.1_Missense_Mutation_p.L190F|PTCH1_ENST00000421141.1_Missense_Mutation_p.L190F|PTCH1_ENST00000429896.2_Missense_Mutation_p.L190F|PTCH1_ENST00000548379.1_5'Flank	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	341					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)	p.L341F(1)		NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				CACCCACAATCAACTCCTCCT	0.458																																						uc004avk.3		NA																	1	Substitution - Missense(1)	p.L341F(1)	lung(1)	skin(242)|central_nervous_system(72)|bone(33)|upper_aerodigestive_tract(11)|lung(6)|large_intestine(4)|breast(4)|oesophagus(3)|ovary(3)|vulva(1)	379						c.(1021-1023)TTG>TTC		patched isoform L							156.0	141.0	146.0					9																	98242295		2203	4300	6503	SO:0001583	missense	5727	Basal_Cell_Nevus_syndrome			embryonic limb morphogenesis|negative regulation of multicellular organism growth|protein processing|regulation of smoothened signaling pathway|smoothened signaling pathway	integral to plasma membrane	hedgehog receptor activity	g.chr9:98242295C>G	AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.1023G>C	9.37:g.98242295C>G	ENSP00000332353:p.Leu341Phe		Somatic				PTCH1_uc010mro.2_Missense_Mutation_p.L190F|PTCH1_uc010mrp.2_Missense_Mutation_p.L190F|PTCH1_uc010mrq.2_Missense_Mutation_p.L190F|PTCH1_uc004avl.3_Missense_Mutation_p.L190F|PTCH1_uc010mrr.2_Missense_Mutation_p.L275F|PTCH1_uc004avm.3_Missense_Mutation_p.L340F|PTCH1_uc010mrs.1_Missense_Mutation_p.L61F	p.L341F	NM_000264	NP_000255	WXS	Illumina HiSeq	Unspecified	Q13635	PTC1_HUMAN			7	1211	-		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)	341			Extracellular (Potential).		A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Missense_Mutation	SNP	ENST00000331920.6	37	c.1023G>C	CCDS6714.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.136469	0.77662	.	.	ENSG00000185920	ENST00000331920;ENST00000437951;ENST00000421141;ENST00000418258;ENST00000430669;ENST00000429896;ENST00000375274;ENST00000375271;ENST00000548420	D;D;D;D;D;D;D;D;D	0.95853	-3.79;-3.76;-3.77;-3.77;-3.76;-3.77;-3.83;-3.65;-1.97	5.97	5.03	0.67393	.	0.000000	0.85682	D	0.000000	D	0.97458	0.9168	M	0.87456	2.885	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.998;1.0;0.996	D	0.96866	0.9636	10	0.56958	D	0.05	-17.0151	9.5875	0.39526	0.0:0.7579:0.1326:0.1095	.	190;275;340;341	Q13635-4;Q13635-3;Q13635-2;Q13635	.;.;.;PTC1_HUMAN	F	341;275;190;190;275;190;340;58;61	ENSP00000332353:L341F;ENSP00000389744:L275F;ENSP00000399981:L190F;ENSP00000396135:L190F;ENSP00000410287:L275F;ENSP00000414823:L190F;ENSP00000364423:L340F;ENSP00000364420:L58F;ENSP00000449078:L61F	ENSP00000332353:L341F	L	-	3	2	PTCH1	97282116	0.990000	0.36364	0.998000	0.56505	0.983000	0.72400	0.336000	0.19823	2.836000	0.97738	0.655000	0.94253	TTG		0.458	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053229.2	NM_000264		30	110	0	0	0	0	30	110				
FOXE1	2304	broad.mit.edu	37	9	100616544	100616544	+	Silent	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr9:100616544C>G	ENST00000375123.3	+	1	1009	c.348C>G	c.(346-348)cgC>cgG	p.R116R		NM_004473.3	NP_004464.2	O00358	FOXE1_HUMAN	forkhead box E1 (thyroid transcription factor 2)	116					anatomical structure morphogenesis (GO:0009653)|cell migration (GO:0016477)|embryonic organ morphogenesis (GO:0048562)|hair follicle morphogenesis (GO:0031069)|hard palate development (GO:0060022)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pharynx development (GO:0060465)|positive regulation of transcription, DNA-templated (GO:0045893)|soft palate development (GO:0060023)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|lung(2)|upper_aerodigestive_tract(1)	5		Acute lymphoblastic leukemia(62;0.158)				AGATCCCGCGCGAGGCCGGCC	0.637																																						uc004axu.2		NA																	0					0						c.(346-348)CGC>CGG		forkhead box E1							39.0	41.0	40.0					9																	100616544		2201	4300	6501	SO:0001819	synonymous_variant	2304				cell migration|embryonic organ morphogenesis|hair follicle morphogenesis|hard palate development|lens morphogenesis in camera-type eye|negative regulation of transcription from RNA polymerase II promoter|pattern specification process|peripheral nervous system development|pharynx development|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|soft palate development|thymus development|thyroid gland development|thyroid hormone generation	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	g.chr9:100616544C>G	U89995	CCDS35078.1	9q22	2008-09-05			ENSG00000178919	ENSG00000178919		"""Forkhead boxes"""	3806	protein-coding gene	gene with protein product		602617	"""forkhead box E2"""	FKHL15, TITF2, FOXE2		9169137, 9697705	Standard	NM_004473		Approved	TTF-2, HFKH4	uc004axu.3	O00358	OTTHUMG00000020333	ENST00000375123.3:c.348C>G	9.37:g.100616544C>G			Somatic					p.R116R	NM_004473	NP_004464	WXS	Illumina HiSeq	Unspecified	O00358	FOXE1_HUMAN			1	1008	+		Acute lymphoblastic leukemia(62;0.158)	116			Fork-head.		O75765|Q5T109|Q99526	Silent	SNP	ENST00000375123.3	37	c.348C>G	CCDS35078.1																																																																																				0.637	FOXE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053341.1			8	64	0	0	0	0	8	64				
TRIM14	9830	broad.mit.edu	37	9	100872212	100872212	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr9:100872212C>T	ENST00000341469.2	-	2	271	c.262G>A	c.(262-264)Gac>Aac	p.D88N	TRIM14_ENST00000342043.3_Missense_Mutation_p.D88N|TRIM14_ENST00000375098.3_Missense_Mutation_p.D88N	NM_014788.2	NP_055603.2	Q14142	TRI14_HUMAN	tripartite motif containing 14	88					innate immune response (GO:0045087)|negative regulation of viral transcription (GO:0032897)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)	cytoplasm (GO:0005737)|intracellular (GO:0005622)	zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	9		Acute lymphoblastic leukemia(62;0.0559)				GTTATGTTGTCAATGTGCTGC	0.448																																					Colon(14;460 597 13826 51781)	uc004ayd.2		NA																	0				central_nervous_system(1)	1						c.(262-264)GAC>AAC		tripartite motif protein TRIM14 isoform alpha							328.0	292.0	304.0					9																	100872212		2203	4300	6503	SO:0001583	missense	9830					cytoplasm|intracellular	zinc ion binding	g.chr9:100872212C>T	AF220130	CCDS6734.1	9q31.1	2011-04-20	2011-01-25		ENSG00000106785	ENSG00000106785		"""Tripartite motif containing / Tripartite motif containing"""	16283	protein-coding gene	gene with protein product		606556	"""tripartite motif-containing 14"""			11331580	Standard	XM_005252320		Approved	KIAA0129	uc004ayd.2	Q14142	OTTHUMG00000020339	ENST00000341469.2:c.262G>A	9.37:g.100872212C>T	ENSP00000344208:p.Asp88Asn		Somatic				TRIM14_uc004ayf.1_5'UTR|TRIM14_uc004ayg.1_Missense_Mutation_p.D88N|TRIM14_uc004ayh.1_Missense_Mutation_p.D88N|TRIM14_uc004ayi.1_Missense_Mutation_p.D88N|TRIM14_uc004ayj.1_5'UTR	p.D88N	NM_033220	NP_150089	WXS	Illumina HiSeq	Unspecified	Q14142	TRI14_HUMAN			2	280	-		Acute lymphoblastic leukemia(62;0.0559)	88			Potential.		A8K9W0|E7EQC4|F8W956|Q548W9|Q5TBQ8|Q6ZWL7|Q9BRD8|Q9C020	Missense_Mutation	SNP	ENST00000341469.2	37	c.262G>A	CCDS6734.1	.	.	.	.	.	.	.	.	.	.	C	5.077	0.199772	0.09652	.	.	ENSG00000106785	ENST00000375098;ENST00000341469;ENST00000342043;ENST00000375084;ENST00000375092	T;T;T	0.57436	0.4;0.4;0.4	4.76	4.76	0.60689	.	0.487663	0.19816	N	0.105431	T	0.37073	0.0990	N	0.22421	0.69	0.58432	D	0.999998	P;B	0.36535	0.557;0.309	B;B	0.33042	0.157;0.055	T	0.21552	-1.0242	10	0.33141	T	0.24	.	13.4535	0.61184	0.0:1.0:0.0:0.0	.	88;88	Q14142-2;Q14142	.;TRI14_HUMAN	N	88	ENSP00000364239:D88N;ENSP00000344208:D88N;ENSP00000343990:D88N	ENSP00000344208:D88N	D	-	1	0	TRIM14	99912033	0.285000	0.24296	0.069000	0.20011	0.468000	0.32798	2.191000	0.42640	2.633000	0.89246	0.455000	0.32223	GAC		0.448	TRIM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053350.1	NM_014788		25	207	0	0	0	0	25	207				
ERP44	23071	broad.mit.edu	37	9	102784444	102784444	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr9:102784444C>T	ENST00000262455.6	-	5	550	c.351G>A	c.(349-351)atG>atA	p.M117I		NM_015051.1	NP_055866.1	Q9BS26	ERP44_HUMAN	endoplasmic reticulum protein 44	117	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|glycoprotein metabolic process (GO:0009100)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)	protein disulfide isomerase activity (GO:0003756)			NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|prostate(2)	19						TCTTCATCATCATCCCATTAC	0.393																																						uc004bam.2		NA																	0					0						c.(349-351)ATG>ATA		thioredoxin domain containing 4 (endoplasmic							162.0	150.0	154.0					9																	102784444		2203	4300	6503	SO:0001583	missense	23071				cell redox homeostasis|glycoprotein metabolic process|protein folding|response to unfolded protein	endoplasmic reticulum lumen|endoplasmic reticulum membrane|ER-Golgi intermediate compartment	protein binding|protein disulfide isomerase activity	g.chr9:102784444C>T	AB011145	CCDS35082.1	9q22.33	2011-10-19	2009-02-23	2009-02-23	ENSG00000023318	ENSG00000023318		"""Protein disulfide isomerases"""	18311	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 10"""	609170	"""thioredoxin domain containing 4 (endoplasmic reticulum)"""	TXNDC4		11847130	Standard	NM_015051		Approved	KIAA0573, PDIA10	uc004bam.3	Q9BS26	OTTHUMG00000020363	ENST00000262455.6:c.351G>A	9.37:g.102784444C>T	ENSP00000262455:p.Met117Ile		Somatic				ERP44_uc010msy.2_RNA|ERP44_uc010msz.2_Missense_Mutation_p.M117I	p.M117I	NM_015051	NP_055866	WXS	Illumina HiSeq	Unspecified	Q9BS26	ERP44_HUMAN			5	559	-			117			Thioredoxin.		O60319|Q4VXC1|Q5VWZ7|Q6UW14|Q8WX67	Missense_Mutation	SNP	ENST00000262455.6	37	c.351G>A	CCDS35082.1	.	.	.	.	.	.	.	.	.	.	C	15.80	2.941735	0.53079	.	.	ENSG00000023318	ENST00000262455	T	0.03242	4.0	5.81	5.81	0.92471	Thioredoxin domain (1);Thioredoxin-like fold (3);	0.000000	0.85682	D	0.000000	T	0.03053	0.0090	N	0.04508	-0.205	0.80722	D	1	B	0.16166	0.016	B	0.19666	0.026	T	0.60188	-0.7312	10	0.36615	T	0.2	-6.9362	20.089	0.97809	0.0:1.0:0.0:0.0	.	117	Q9BS26	ERP44_HUMAN	I	117	ENSP00000262455:M117I	ENSP00000262455:M117I	M	-	3	0	ERP44	101824265	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.699000	0.68310	2.752000	0.94435	0.557000	0.71058	ATG		0.393	ERP44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053402.1	XM_088476		12	115	0	0	0	0	12	115				
AKNA	80709	broad.mit.edu	37	9	117120255	117120255	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr9:117120255G>C	ENST00000307564.4	-	12	2846	c.2685C>G	c.(2683-2685)atC>atG	p.I895M	AKNA_ENST00000223791.3_Missense_Mutation_p.I355M|AKNA_ENST00000374088.3_Missense_Mutation_p.I895M|AKNA_ENST00000374075.5_Missense_Mutation_p.I814M	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	895					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						GGCGCTCAGAGATGCCGCTTC	0.642																																						uc004biq.3		NA																	0				ovary(4)|central_nervous_system(2)	6						c.(2683-2685)ATC>ATG		AT-hook transcription factor							56.0	55.0	56.0					9																	117120255		2203	4300	6503	SO:0001583	missense	80709				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr9:117120255G>C	AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.2685C>G	9.37:g.117120255G>C	ENSP00000303769:p.Ile895Met		Somatic				AKNA_uc004bin.3_Missense_Mutation_p.I142M|AKNA_uc004bio.3_Missense_Mutation_p.I355M|AKNA_uc004bip.3_Missense_Mutation_p.I814M|AKNA_uc004bir.3_Missense_Mutation_p.I895M|AKNA_uc004bis.3_Missense_Mutation_p.I895M|AKNA_uc010mve.2_Missense_Mutation_p.I776M	p.I895M	NM_030767	NP_110394	WXS	Illumina HiSeq	Unspecified	Q7Z591	AKNA_HUMAN			11	2820	-			895					Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	Missense_Mutation	SNP	ENST00000307564.4	37	c.2685C>G	CCDS6805.1	.	.	.	.	.	.	.	.	.	.	G	12.86	2.064174	0.36373	.	.	ENSG00000106948	ENST00000307564;ENST00000374088;ENST00000223791;ENST00000374075	T;T;T;T	0.16597	2.55;2.55;2.33;2.55	3.79	1.96	0.26148	.	1.389010	0.04520	N	0.384488	T	0.13243	0.0321	L	0.27053	0.805	0.26044	N	0.981573	P;P	0.39157	0.531;0.662	B;B	0.36845	0.081;0.234	T	0.27191	-1.0081	10	0.46703	T	0.11	-0.1758	6.5569	0.22466	0.2056:0.0:0.7944:0.0	.	895;814	Q7Z591;Q7Z591-2	AKNA_HUMAN;.	M	895;895;355;814	ENSP00000303769:I895M;ENSP00000363201:I895M;ENSP00000223791:I355M;ENSP00000363188:I814M	ENSP00000223791:I355M	I	-	3	3	AKNA	116160076	0.852000	0.29690	0.277000	0.24703	0.352000	0.29268	1.194000	0.32174	0.593000	0.29745	-0.741000	0.03529	ATC		0.642	AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053767.2	NM_030767		10	65	0	0	0	0	10	65				
OR1L3	26735	broad.mit.edu	37	9	125438029	125438029	+	Silent	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr9:125438029G>A	ENST00000304820.2	+	1	715	c.621G>A	c.(619-621)gtG>gtA	p.V207V		NM_001005234.1	NP_001005234.1	Q8NH93	OR1L3_HUMAN	olfactory receptor, family 1, subfamily L, member 3	207						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(1)|large_intestine(2)|lung(6)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	16						TGGCCTCTGTGATGGCTCCAT	0.453																																						uc011lzb.1		NA																	0				skin(1)	1						c.(619-621)GTG>GTA		olfactory receptor, family 1, subfamily L,							153.0	147.0	149.0					9																	125438029		2203	4300	6503	SO:0001819	synonymous_variant	26735				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:125438029G>A		CCDS35128.1	9q33.2	2013-09-20			ENSG00000171481	ENSG00000171481		"""GPCR / Class A : Olfactory receptors"""	8215	protein-coding gene	gene with protein product							Standard	NM_001005234		Approved	OR9-D	uc011lzb.2	Q8NH93	OTTHUMG00000020619	ENST00000304820.2:c.621G>A	9.37:g.125438029G>A			Somatic					p.V207V	NM_001005234	NP_001005234	WXS	Illumina HiSeq	Unspecified	Q8NH93	OR1L3_HUMAN			1	621	+			207			Helical; Name=5; (Potential).		B2RNF4|Q6IFN1	Silent	SNP	ENST00000304820.2	37	c.621G>A	CCDS35128.1																																																																																				0.453	OR1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053950.1			29	120	0	0	0	0	29	120				
RABGAP1	23637	broad.mit.edu	37	9	125865491	125865491	+	Silent	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr9:125865491G>A	ENST00000373647.4	+	26	3343	c.3209G>A	c.(3208-3210)tGa>tAa	p.*1070*	RABGAP1_ENST00000373643.5_Silent_p.*409*	NM_012197.3	NP_036329.3	Q9Y3P9	RBGP1_HUMAN	RAB GTPase activating protein 1	0					cell cycle (GO:0007049)|positive regulation of GTPase activity (GO:0043547)|regulation of GTP catabolic process (GO:0033124)	centrosome (GO:0005813)|cytosol (GO:0005829)|microtubule associated complex (GO:0005875)	DNA binding (GO:0003677)|GTPase activator activity (GO:0005096)|Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)|tubulin binding (GO:0015631)			breast(3)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|prostate(4)|stomach(3)|upper_aerodigestive_tract(1)	41						GAGACTTGCTGAGAGCAGCTG	0.522											OREG0019466	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										uc011lzh.1		NA																	0				ovary(3)|kidney(2)	5						c.(3208-3210)TGA>TAA		RAB GTPase activating protein 1							112.0	107.0	108.0					9																	125865491		2203	4300	6503	SO:0001819	synonymous_variant	23637				cell cycle	centrosome|cytosol|microtubule associated complex	Rab GTPase activator activity|tubulin binding	g.chr9:125865491G>A	AJ011679	CCDS6848.2	9q34.11	2013-07-09			ENSG00000011454	ENSG00000011454			17155	protein-coding gene	gene with protein product	"""rab6 GTPase activating protein (GAP and centrosome-associated)"", ""TBC1 domain family, member 11"""	615882				10202141	Standard	NM_012197		Approved	GAPCenA, TBC1D11	uc011lzh.2	Q9Y3P9	OTTHUMG00000020633	ENST00000373647.4:c.3209G>A	9.37:g.125865491G>A			Somatic	OREG0019466	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1545	RABGAP1_uc004bnl.3_RNA|RABGAP1_uc011lzj.1_Silent_p.*409*	p.*1070*	NM_012197	NP_036329	WXS	Illumina HiSeq	Unspecified	Q9Y3P9	RBGP1_HUMAN			26	3343	+			1070					B9A6L2|Q05CW2|Q6ZMY1|Q9HA28|Q9P0E2|Q9UG67	Silent	SNP	ENST00000373647.4	37	c.3209G>A	CCDS6848.2																																																																																				0.522	RABGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053976.3	NM_012197		15	73	0	0	0	0	15	73				
HSPA5	3309	broad.mit.edu	37	9	127999008	127999008	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr9:127999008C>T	ENST00000324460.6	-	8	2031	c.1828G>A	c.(1828-1830)Gat>Aat	p.D610N		NM_005347.4	NP_005338.1	P11021	GRP78_HUMAN	heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)	610					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular response to antibiotic (GO:0071236)|cellular response to glucose starvation (GO:0042149)|cellular response to interleukin-4 (GO:0071353)|cerebellar Purkinje cell layer development (GO:0021680)|cerebellum structural organization (GO:0021589)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|maintenance of protein localization in endoplasmic reticulum (GO:0035437)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell migration (GO:0030335)|positive regulation of protein ubiquitination (GO:0031398)|regulation of protein folding in endoplasmic reticulum (GO:0060904)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|chaperone binding (GO:0051087)|enzyme binding (GO:0019899)|glycoprotein binding (GO:0001948)|misfolded protein binding (GO:0051787)|protein domain specific binding (GO:0019904)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(4)|prostate(2)|skin(1)	23					Acetylsalicylic acid(DB00945)|Antihemophilic Factor(DB00025)	ATGTCAGCATCTTGGTGGCTT	0.423										Prostate(1;0.17)																												uc004bpn.2		NA																	0				ovary(3)|skin(1)	4						c.(1828-1830)GAT>AAT		heat shock 70kDa protein 5	Antihemophilic Factor(DB00025)						115.0	111.0	112.0					9																	127999008		2203	4300	6503	SO:0001583	missense	3309				anti-apoptosis|cellular response to glucose starvation|ER-associated protein catabolic process|platelet activation|platelet degranulation|regulation of protein folding in endoplasmic reticulum	cell surface|endoplasmic reticulum chaperone complex|endoplasmic reticulum lumen|ER-Golgi intermediate compartment|integral to endoplasmic reticulum membrane|melanosome|midbody|nucleus|perinuclear region of cytoplasm	ATP binding|ATPase activity|calcium ion binding|caspase inhibitor activity|chaperone binding|misfolded protein binding|protein binding, bridging|protein domain specific binding|ubiquitin protein ligase binding|unfolded protein binding	g.chr9:127999008C>T		CCDS6863.1	9q33.3	2011-09-02	2002-08-29		ENSG00000044574	ENSG00000044574		"""Heat shock proteins / HSP70"""	5238	protein-coding gene	gene with protein product		138120	"""heat shock 70kD protein 5 (glucose-regulated protein, 78kD)"""	GRP78			Standard	NM_005347		Approved	BiP	uc004bpn.3	P11021	OTTHUMG00000020672	ENST00000324460.6:c.1828G>A	9.37:g.127999008C>T	ENSP00000324173:p.Asp610Asn	Prostate(1;0.17)	Somatic					p.D610N	NM_005347	NP_005338	WXS	Illumina HiSeq	Unspecified	P11021	GRP78_HUMAN			8	2084	-			610					B0QZ61|Q2EF78|Q9NPF1|Q9UK02	Missense_Mutation	SNP	ENST00000324460.6	37	c.1828G>A	CCDS6863.1	.	.	.	.	.	.	.	.	.	.	C	15.43	2.830488	0.50845	.	.	ENSG00000044574	ENST00000324460	T	0.01015	5.44	4.87	4.87	0.63330	.	0.104211	0.64402	D	0.000005	T	0.01092	0.0036	N	0.21508	0.67	0.80722	D	1	B	0.09022	0.002	B	0.15052	0.012	T	0.69386	-0.5159	10	0.33141	T	0.24	-18.9998	17.3707	0.87376	0.0:1.0:0.0:0.0	.	610	P11021	GRP78_HUMAN	N	610	ENSP00000324173:D610N	ENSP00000324173:D610N	D	-	1	0	HSPA5	127038829	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.039000	0.70972	2.414000	0.81942	0.585000	0.79938	GAT		0.423	HSPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054062.1			16	127	0	0	0	0	16	127				
HSPA5	3309	broad.mit.edu	37	9	128001040	128001040	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr9:128001040C>T	ENST00000324460.6	-	6	1266	c.1063G>A	c.(1063-1065)Gat>Aat	p.D355N	RP11-65N13.8_ENST00000468244.1_RNA	NM_005347.4	NP_005338.1	P11021	GRP78_HUMAN	heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)	355					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular response to antibiotic (GO:0071236)|cellular response to glucose starvation (GO:0042149)|cellular response to interleukin-4 (GO:0071353)|cerebellar Purkinje cell layer development (GO:0021680)|cerebellum structural organization (GO:0021589)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|maintenance of protein localization in endoplasmic reticulum (GO:0035437)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell migration (GO:0030335)|positive regulation of protein ubiquitination (GO:0031398)|regulation of protein folding in endoplasmic reticulum (GO:0060904)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|chaperone binding (GO:0051087)|enzyme binding (GO:0019899)|glycoprotein binding (GO:0001948)|misfolded protein binding (GO:0051787)|protein domain specific binding (GO:0019904)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(4)|prostate(2)|skin(1)	23					Acetylsalicylic acid(DB00945)|Antihemophilic Factor(DB00025)	TCATCAATATCAGACTTCTTC	0.418										Prostate(1;0.17)																												uc004bpn.2		NA																	0				ovary(3)|skin(1)	4						c.(1063-1065)GAT>AAT		heat shock 70kDa protein 5	Antihemophilic Factor(DB00025)						86.0	82.0	83.0					9																	128001040		2203	4300	6503	SO:0001583	missense	3309				anti-apoptosis|cellular response to glucose starvation|ER-associated protein catabolic process|platelet activation|platelet degranulation|regulation of protein folding in endoplasmic reticulum	cell surface|endoplasmic reticulum chaperone complex|endoplasmic reticulum lumen|ER-Golgi intermediate compartment|integral to endoplasmic reticulum membrane|melanosome|midbody|nucleus|perinuclear region of cytoplasm	ATP binding|ATPase activity|calcium ion binding|caspase inhibitor activity|chaperone binding|misfolded protein binding|protein binding, bridging|protein domain specific binding|ubiquitin protein ligase binding|unfolded protein binding	g.chr9:128001040C>T		CCDS6863.1	9q33.3	2011-09-02	2002-08-29		ENSG00000044574	ENSG00000044574		"""Heat shock proteins / HSP70"""	5238	protein-coding gene	gene with protein product		138120	"""heat shock 70kD protein 5 (glucose-regulated protein, 78kD)"""	GRP78			Standard	NM_005347		Approved	BiP	uc004bpn.3	P11021	OTTHUMG00000020672	ENST00000324460.6:c.1063G>A	9.37:g.128001040C>T	ENSP00000324173:p.Asp355Asn	Prostate(1;0.17)	Somatic					p.D355N	NM_005347	NP_005338	WXS	Illumina HiSeq	Unspecified	P11021	GRP78_HUMAN			6	1319	-			355					B0QZ61|Q2EF78|Q9NPF1|Q9UK02	Missense_Mutation	SNP	ENST00000324460.6	37	c.1063G>A	CCDS6863.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.893399	0.91889	.	.	ENSG00000044574	ENST00000324460	T	0.01145	5.27	4.47	4.47	0.54385	.	0.095743	0.64402	D	0.000001	T	0.06005	0.0156	M	0.90019	3.08	0.80722	D	1	P	0.43542	0.81	P	0.49301	0.606	T	0.02596	-1.1136	10	0.72032	D	0.01	-19.1614	16.1357	0.81487	0.0:1.0:0.0:0.0	.	355	P11021	GRP78_HUMAN	N	355	ENSP00000324173:D355N	ENSP00000324173:D355N	D	-	1	0	HSPA5	127040861	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.076000	0.71267	2.003000	0.58678	0.563000	0.77884	GAT		0.418	HSPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054062.1			15	57	0	0	0	0	15	57				
HSPA5	3309	broad.mit.edu	37	9	128001050	128001050	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr9:128001050C>T	ENST00000324460.6	-	6	1256	c.1053G>A	c.(1051-1053)ttG>ttA	p.L351L	RP11-65N13.8_ENST00000468244.1_RNA	NM_005347.4	NP_005338.1	P11021	GRP78_HUMAN	heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)	351					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular response to antibiotic (GO:0071236)|cellular response to glucose starvation (GO:0042149)|cellular response to interleukin-4 (GO:0071353)|cerebellar Purkinje cell layer development (GO:0021680)|cerebellum structural organization (GO:0021589)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|maintenance of protein localization in endoplasmic reticulum (GO:0035437)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell migration (GO:0030335)|positive regulation of protein ubiquitination (GO:0031398)|regulation of protein folding in endoplasmic reticulum (GO:0060904)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|chaperone binding (GO:0051087)|enzyme binding (GO:0019899)|glycoprotein binding (GO:0001948)|misfolded protein binding (GO:0051787)|protein domain specific binding (GO:0019904)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(4)|prostate(2)|skin(1)	23					Acetylsalicylic acid(DB00945)|Antihemophilic Factor(DB00025)	CAGACTTCTTCAAATCAGAAT	0.393										Prostate(1;0.17)																												uc004bpn.2		NA																	0				ovary(3)|skin(1)	4						c.(1051-1053)TTG>TTA		heat shock 70kDa protein 5	Antihemophilic Factor(DB00025)						82.0	79.0	80.0					9																	128001050		2203	4300	6503	SO:0001819	synonymous_variant	3309				anti-apoptosis|cellular response to glucose starvation|ER-associated protein catabolic process|platelet activation|platelet degranulation|regulation of protein folding in endoplasmic reticulum	cell surface|endoplasmic reticulum chaperone complex|endoplasmic reticulum lumen|ER-Golgi intermediate compartment|integral to endoplasmic reticulum membrane|melanosome|midbody|nucleus|perinuclear region of cytoplasm	ATP binding|ATPase activity|calcium ion binding|caspase inhibitor activity|chaperone binding|misfolded protein binding|protein binding, bridging|protein domain specific binding|ubiquitin protein ligase binding|unfolded protein binding	g.chr9:128001050C>T		CCDS6863.1	9q33.3	2011-09-02	2002-08-29		ENSG00000044574	ENSG00000044574		"""Heat shock proteins / HSP70"""	5238	protein-coding gene	gene with protein product		138120	"""heat shock 70kD protein 5 (glucose-regulated protein, 78kD)"""	GRP78			Standard	NM_005347		Approved	BiP	uc004bpn.3	P11021	OTTHUMG00000020672	ENST00000324460.6:c.1053G>A	9.37:g.128001050C>T		Prostate(1;0.17)	Somatic					p.L351L	NM_005347	NP_005338	WXS	Illumina HiSeq	Unspecified	P11021	GRP78_HUMAN			6	1309	-			351					B0QZ61|Q2EF78|Q9NPF1|Q9UK02	Silent	SNP	ENST00000324460.6	37	c.1053G>A	CCDS6863.1																																																																																				0.393	HSPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054062.1			16	51	0	0	0	0	16	51				
SPTAN1	6709	broad.mit.edu	37	9	131388879	131388879	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr9:131388879G>C	ENST00000372731.4	+	48	6584	c.6474G>C	c.(6472-6474)aaG>aaC	p.K2158N	SPTAN1_ENST00000372739.3_Missense_Mutation_p.K2163N|SPTAN1_ENST00000358161.5_Missense_Mutation_p.K2163N	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	2158					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						GCCAGATCAAGAGCTTCCGCG	0.597																																					NSCLC(120;833 1744 2558 35612 37579)	uc004bvl.3		NA																	0				breast(5)|ovary(4)|pancreas(1)	10						c.(6472-6474)AAG>AAC		spectrin, alpha, non-erythrocytic 1							39.0	40.0	40.0					9																	131388879		2203	4300	6503	SO:0001583	missense	6709				actin filament capping|axon guidance|cellular component disassembly involved in apoptosis	cytosol|intracellular membrane-bounded organelle|membrane fraction|microtubule cytoskeleton|spectrin	actin binding|calcium ion binding|calmodulin binding|structural constituent of cytoskeleton	g.chr9:131388879G>C	M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.6474G>C	9.37:g.131388879G>C	ENSP00000361816:p.Lys2158Asn		Somatic				SPTAN1_uc004bvm.3_Missense_Mutation_p.K2163N|SPTAN1_uc004bvn.3_Missense_Mutation_p.K2138N|SPTAN1_uc010mye.1_5'UTR|SPTAN1_uc010myf.1_5'UTR	p.K2158N	NM_003127	NP_003118	WXS	Illumina HiSeq	Unspecified	Q13813	SPTA2_HUMAN			48	6587	+			2158			Spectrin 22.		Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Missense_Mutation	SNP	ENST00000372731.4	37	c.6474G>C	CCDS6905.1	.	.	.	.	.	.	.	.	.	.	G	18.26	3.583998	0.65992	.	.	ENSG00000197694	ENST00000358161;ENST00000372731;ENST00000372739;ENST00000372719;ENST00000372721	T;T;T	0.68025	-0.3;-0.3;-0.3	5.53	3.7	0.42460	.	0.000000	0.85682	D	0.000000	T	0.81380	0.4810	M	0.82517	2.595	0.80722	D	1	D;D;D	0.76494	0.997;0.989;0.999	D;D;D	0.77557	0.933;0.978;0.99	T	0.82462	-0.0445	10	0.62326	D	0.03	.	12.2962	0.54847	0.1382:0.0:0.8618:0.0	.	2138;2163;2158	Q13813-3;Q13813-2;Q13813	.;.;SPTA2_HUMAN	N	2163;2158;2163;2138;407	ENSP00000350882:K2163N;ENSP00000361816:K2158N;ENSP00000361824:K2163N	ENSP00000350882:K2163N	K	+	3	2	SPTAN1	130428700	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.582000	0.60957	0.701000	0.31803	0.563000	0.77884	AAG		0.597	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054472.1	NM_003127		9	32	0	0	0	0	9	32				
NCS1	23413	broad.mit.edu	37	9	132984969	132984969	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr9:132984969C>G	ENST00000372398.3	+	5	434	c.348C>G	c.(346-348)atC>atG	p.I116M	NCS1_ENST00000458469.1_Missense_Mutation_p.I98M	NM_014286.3	NP_055101.2	P62166	NCS1_HUMAN	neuronal calcium sensor 1	116	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				calcium ion transmembrane transport (GO:0070588)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of exocytosis (GO:0045921)|regulation of neuron projection development (GO:0010975)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)|magnesium ion binding (GO:0000287)|voltage-gated calcium channel activity (GO:0005245)			large_intestine(1)|lung(4)|stomach(1)	6						ATGGCTACATCACCAGGAATG	0.562																																					Melanoma(30;182 1162 22581 33240)	uc004bzi.2		NA																	0					0						c.(346-348)ATC>ATG		frequenin homolog isoform 1							158.0	124.0	135.0					9																	132984969		2203	4300	6503	SO:0001583	missense	23413				negative regulation of calcium ion transport via voltage-gated calcium channel activity|regulation of neuron projection development	cell junction|Golgi cisterna membrane|perinuclear region of cytoplasm|postsynaptic density|postsynaptic membrane	calcium ion binding|protein binding	g.chr9:132984969C>G	AF186409	CCDS6932.1	9q34.11	2013-01-10	2010-01-27	2010-01-27	ENSG00000107130	ENSG00000107130		"""EF-hand domain containing"""	3953	protein-coding gene	gene with protein product		603315	"""frequenin (Drosophila) homolog"", ""frequenin homolog (Drosophila)"""	FREQ		11092894	Standard	NM_014286		Approved	NCS-1	uc004bzi.2	P62166	OTTHUMG00000020801	ENST00000372398.3:c.348C>G	9.37:g.132984969C>G	ENSP00000361475:p.Ile116Met		Somatic				NCS1_uc010myz.1_Missense_Mutation_p.I98M	p.I116M	NM_014286	NP_055101	WXS	Illumina HiSeq	Unspecified	P62166	NCS1_HUMAN			5	434	+			116			EF-hand 3.|2.		E9PAY3|P36610|Q9UK26	Missense_Mutation	SNP	ENST00000372398.3	37	c.348C>G	CCDS6932.1	.	.	.	.	.	.	.	.	.	.	C	12.55	1.971436	0.34754	.	.	ENSG00000107130	ENST00000372398;ENST00000458469	T;T	0.77750	-1.12;-1.12	5.23	0.256	0.15567	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.88720	0.6513	H	0.95917	3.74	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.84403	0.0561	10	0.87932	D	0	.	4.4888	0.11803	0.1434:0.4763:0.0:0.3804	.	98;116	E9PAY3;P62166	.;NCS1_HUMAN	M	116;98	ENSP00000361475:I116M;ENSP00000404103:I98M	ENSP00000361475:I116M	I	+	3	3	NCS1	132024790	1.000000	0.71417	0.998000	0.56505	0.297000	0.27493	1.028000	0.30128	-0.006000	0.14370	-1.138000	0.01928	ATC		0.562	NCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054637.1	NM_014286		11	57	0	0	0	0	11	57				
RAPGEF1	2889	broad.mit.edu	37	9	134473643	134473643	+	Silent	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr9:134473643G>A	ENST00000372189.3	-	13	2121	c.1998C>T	c.(1996-1998)gaC>gaT	p.D666D	RAPGEF1_ENST00000372190.3_Silent_p.D684D|RAPGEF1_ENST00000372195.1_Silent_p.D683D	NM_005312.2	NP_005303.2	Q13905	RPGF1_HUMAN	Rap guanine nucleotide exchange factor (GEF) 1	666					activation of MAPKK activity (GO:0000186)|blood vessel development (GO:0001568)|cellular response to cAMP (GO:0071320)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of Ras protein signal transduction (GO:0046580)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of neuron projection development (GO:0010976)|positive regulation of Rap GTPase activity (GO:0032854)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)	Rap guanyl-nucleotide exchange factor activity (GO:0017034)			NS(2)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	39		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)		GGGACAGCTCGTCCACTTCCT	0.592																																						uc004cbc.2		NA																	0				lung(3)|ovary(2)|breast(1)|skin(1)	7						c.(1996-1998)GAC>GAT		guanine nucleotide-releasing factor 2 isoform a							61.0	65.0	64.0					9																	134473643		2003	4175	6178	SO:0001819	synonymous_variant	2889				activation of MAPKK activity|nerve growth factor receptor signaling pathway|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|endosome	guanyl-nucleotide exchange factor activity|SH3 domain binding	g.chr9:134473643G>A	BC041710	CCDS48047.1	9q34.3	2008-02-05	2004-03-01	2004-03-02	ENSG00000107263	ENSG00000107263			4568	protein-coding gene	gene with protein product		600303	"""guanine nucleotide-releasing factor 2 (specific for crk proto-oncogene)"""	GRF2		7959692, 7512734	Standard	NM_005312		Approved	C3G	uc022bos.1	Q13905	OTTHUMG00000020829	ENST00000372189.3:c.1998C>T	9.37:g.134473643G>A			Somatic				RAPGEF1_uc004cbb.2_Silent_p.D684D|RAPGEF1_uc010mzm.2_RNA|RAPGEF1_uc010mzn.2_Silent_p.D841D|RAPGEF1_uc004cbd.2_Silent_p.D671D|RAPGEF1_uc010mzs.1_Silent_p.D198D|RAPGEF1_uc010mzl.1_Silent_p.D164D|RAPGEF1_uc010mzo.1_3'UTR|RAPGEF1_uc010mzp.1_Silent_p.D143D|RAPGEF1_uc010mzq.1_Silent_p.D250D|RAPGEF1_uc010mzr.1_Silent_p.D251D	p.D666D	NM_005312	NP_005303	WXS	Illumina HiSeq	Unspecified	Q13905	RPGF1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)	13	2128	-		Myeloproliferative disorder(178;0.204)	666					Q5JUE4|Q8IV73	Silent	SNP	ENST00000372189.3	37	c.1998C>T	CCDS48047.1	.	.	.	.	.	.	.	.	.	.	G	8.693	0.907999	0.17833	.	.	ENSG00000107263	ENST00000414781	.	.	.	4.69	-4.03	0.04021	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.0924	0.59172	0.7525:0.0:0.2475:0.0	.	.	.	.	X	94	.	.	R	-	1	2	RAPGEF1	133463464	0.094000	0.21725	0.894000	0.35097	0.829000	0.46940	-0.451000	0.06795	-0.840000	0.04206	-0.379000	0.06801	CGA		0.592	RAPGEF1-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054759.2	NM_005312		8	22	0	0	0	0	8	22				
NTNG2	84628	broad.mit.edu	37	9	135073644	135073644	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr9:135073644G>A	ENST00000393229.3	+	3	1281	c.505G>A	c.(505-507)Gag>Aag	p.E169K	NTNG2_ENST00000372179.3_Missense_Mutation_p.E169K|NTNG2_ENST00000393228.4_Missense_Mutation_p.E169K|NTNG2_ENST00000360670.3_Missense_Mutation_p.E169K	NM_032536.2	NP_115925.2	Q96CW9	NTNG2_HUMAN	netrin G2	169	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)|axon (GO:0030424)				central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	29				OV - Ovarian serous cystadenocarcinoma(145;1.23e-05)|Epithelial(140;0.000173)		GTTCTACGCCGAGGACTGCAT	0.672																																						uc004cbh.2		NA																	0					0						c.(505-507)GAG>AAG		netrin G2 precursor							42.0	33.0	36.0					9																	135073644		2203	4299	6502	SO:0001583	missense	84628				axonogenesis	anchored to plasma membrane		g.chr9:135073644G>A	AB058760	CCDS6946.1	9q34	2013-03-01	2003-12-02	2003-12-03	ENSG00000196358	ENSG00000196358		"""Netrins"""	14288	protein-coding gene	gene with protein product	"""Netrin-G2"""		"""netrin G1"""	NTNG1			Standard	NM_032536		Approved	KIAA1857, Lmnt2	uc004cbh.2	Q96CW9	OTTHUMG00000020835	ENST00000393229.3:c.505G>A	9.37:g.135073644G>A	ENSP00000376921:p.Glu169Lys		Somatic					p.E169K	NM_032536	NP_115925	WXS	Illumina HiSeq	Unspecified	Q96CW9	NTNG2_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.23e-05)|Epithelial(140;0.000173)	3	1281	+			169			Laminin N-terminal.		Q5JUJ2|Q6UXY0|Q96JH0	Missense_Mutation	SNP	ENST00000393229.3	37	c.505G>A	CCDS6946.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.106134	0.77096	.	.	ENSG00000196358	ENST00000393229;ENST00000393228;ENST00000360670;ENST00000372179	T;T;T;T	0.74947	-0.89;0.95;0.95;-0.89	5.22	5.22	0.72569	Laminin, N-terminal (3);	0.064517	0.64402	D	0.000010	T	0.61615	0.2361	L	0.29908	0.895	0.58432	D	0.999993	P	0.52577	0.954	B	0.40199	0.322	T	0.61642	-0.7021	10	0.09590	T	0.72	.	17.7699	0.88489	0.0:0.0:1.0:0.0	.	169	Q96CW9	NTNG2_HUMAN	K	169	ENSP00000376921:E169K;ENSP00000376920:E169K;ENSP00000353888:E169K;ENSP00000361252:E169K	ENSP00000353888:E169K	E	+	1	0	NTNG2	134063465	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	7.984000	0.88150	2.417000	0.82017	0.561000	0.74099	GAG		0.672	NTNG2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054779.1	NM_032536		6	19	0	0	0	0	6	19				
ADAMTS13	11093	broad.mit.edu	37	9	136323096	136323096	+	Silent	SNP	G	G	A	rs369087803		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr9:136323096G>A	ENST00000371929.3	+	28	4401	c.3957G>A	c.(3955-3957)acG>acA	p.T1319T	ADAMTS13_ENST00000371910.1_Silent_p.T115T|ADAMTS13_ENST00000485925.1_Intron|CACFD1_ENST00000542192.1_5'Flank|CACFD1_ENST00000540581.1_5'Flank|ADAMTS13_ENST00000356589.2_Silent_p.T1232T|ADAMTS13_ENST00000355699.2_Silent_p.T1263T|CACFD1_ENST00000316948.4_5'Flank|ADAMTS13_ENST00000371916.1_3'UTR|CACFD1_ENST00000291722.7_5'Flank	NM_139025.3|NM_139027.3	NP_620594.1|NP_620596.2	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 13	1319	CUB 2.				cell-matrix adhesion (GO:0007160)|glycoprotein metabolic process (GO:0009100)|integrin-mediated signaling pathway (GO:0007229)|peptide catabolic process (GO:0043171)|platelet activation (GO:0030168)|protein processing (GO:0016485)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to interleukin-4 (GO:0070670)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(4)	36				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		GTCCAGCCACGAGTAATGCAG	0.607																																						uc004cdv.3		NA																	0				central_nervous_system(2)|skin(2)|ovary(1)|kidney(1)	6						c.(3955-3957)ACG>ACA		ADAM metallopeptidase with thrombospondin type 1		G	,,	0,4406		0,0,2203	61.0	61.0	61.0		3957,3696,3789	0.6	0.0	9		61	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	ADAMTS13	NM_139025.3,NM_139026.3,NM_139027.3	,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,	1319/1428,1232/1341,1263/1372	136323096	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	11093				cell-matrix adhesion|glycoprotein metabolic process|integrin-mediated signaling pathway|peptide catabolic process|platelet activation|protein processing|proteolysis	cell surface|proteinaceous extracellular matrix	calcium ion binding|integrin binding|metalloendopeptidase activity|zinc ion binding	g.chr9:136323096G>A	AJ011374	CCDS6970.1, CCDS6971.1, CCDS6972.1	9q34	2008-07-21	2005-08-19	2001-09-21	ENSG00000160323	ENSG00000160323		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	1366	protein-coding gene	gene with protein product		604134	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13"""	C9orf8		11557746, 11535495	Standard	NM_139025		Approved	VWFCP, TTP, vWF-CP, FLJ42993, MGC118899, MGC118900, DKFZp434C2322	uc004cdv.4	Q76LX8	OTTHUMG00000020876	ENST00000371929.3:c.3957G>A	9.37:g.136323096G>A			Somatic				ADAMTS13_uc004cdp.3_Intron|ADAMTS13_uc004cdt.1_Silent_p.T1263T|ADAMTS13_uc004cdu.1_Silent_p.T1232T|ADAMTS13_uc004cdw.3_Silent_p.T1263T|ADAMTS13_uc004cdx.3_Silent_p.T1232T|ADAMTS13_uc004cdz.3_Silent_p.T989T|ADAMTS13_uc004cea.1_3'UTR|ADAMTS13_uc004ceb.3_Silent_p.T115T|C9orf7_uc011mdg.1_5'Flank|C9orf7_uc004cec.2_5'Flank|C9orf7_uc011mdh.1_5'Flank|C9orf7_uc011mdi.1_5'Flank|C9orf7_uc010nan.2_5'Flank	p.T1319T	NM_139025	NP_620594	WXS	Illumina HiSeq	Unspecified	Q76LX8	ATS13_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)	28	4401	+			1319			CUB 2.		Q6UY16|Q710F6|Q711T8|Q96L37|Q9H0G3|Q9UGQ1	Silent	SNP	ENST00000371929.3	37	c.3957G>A	CCDS6970.1																																																																																				0.607	ADAMTS13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054920.1	NM_139025		4	69	0	0	0	0	4	69				
VAV2	7410	broad.mit.edu	37	9	136629201	136629201	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr9:136629201C>T	ENST00000371850.3	-	30	2651	c.2620G>A	c.(2620-2622)Gag>Aag	p.E874K	VAV2_ENST00000371851.1_Missense_Mutation_p.E864K|VAV2_ENST00000406606.3_Missense_Mutation_p.E835K	NM_001134398.1	NP_001127870.1	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor	874	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(3)|endometrium(1)|kidney(3)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(1)	35				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		ATGCCCTCCTCTTCTACGTAC	0.498																																						uc004ces.2		NA																	0				central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8						c.(2620-2622)GAG>AAG		vav 2 guanine nucleotide exchange factor isoform							166.0	122.0	137.0					9																	136629201		2203	4300	6503	SO:0001583	missense	7410				angiogenesis|apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	metal ion binding|Rho guanyl-nucleotide exchange factor activity	g.chr9:136629201C>T		CCDS6979.1, CCDS48053.1	9q34.1	2013-02-14	2007-07-25		ENSG00000160293	ENSG00000160293		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12658	protein-coding gene	gene with protein product		600428	"""vav 2 oncogene"""			7762982	Standard	NM_003371		Approved		uc004ces.3	P52735	OTTHUMG00000020882	ENST00000371850.3:c.2620G>A	9.37:g.136629201C>T	ENSP00000360916:p.Glu874Lys		Somatic				VAV2_uc004cer.2_Missense_Mutation_p.E835K	p.E874K	NM_001134398	NP_001127870	WXS	Illumina HiSeq	Unspecified	P52735	VAV2_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)	30	2666	-			874			SH3 2.		A2RUM4|A8MQ12|B6ZDF5|Q5SYV3|Q5SYV4|Q5SYV5|Q6N012|Q6PIJ9|Q6Q317	Missense_Mutation	SNP	ENST00000371850.3	37	c.2620G>A	CCDS48053.1	.	.	.	.	.	.	.	.	.	.	C	34	5.391897	0.95988	.	.	ENSG00000160293	ENST00000371850;ENST00000371851;ENST00000406606;ENST00000325440	T;T;D	0.85629	2.92;2.92;-2.01	5.12	5.12	0.69794	Src homology-3 domain (4);Variant SH3 (1);	0.000000	0.85682	D	0.000000	D	0.87489	0.6190	N	0.17764	0.52	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.987	D	0.89704	0.3907	10	0.72032	D	0.01	.	18.1595	0.89704	0.0:1.0:0.0:0.0	.	874;835	P52735;P52735-3	VAV2_HUMAN;.	K	874;864;835;864	ENSP00000360916:E874K;ENSP00000360917:E864K;ENSP00000385362:E835K	ENSP00000317258:E864K	E	-	1	0	VAV2	135619022	1.000000	0.71417	1.000000	0.80357	0.838000	0.47535	5.585000	0.67497	2.360000	0.80028	0.655000	0.94253	GAG		0.498	VAV2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054939.1			5	42	0	0	0	0	5	42				
NOTCH1	4851	broad.mit.edu	37	9	139391123	139391123	+	Silent	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr9:139391123G>A	ENST00000277541.6	-	34	7143	c.7068C>T	c.(7066-7068)gcC>gcT	p.A2356A		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	2356					anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		ACAGGGCGCTGGCAGCAAGGC	0.672			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																												uc004chz.2		NA		Dom	yes		9	9q34.3	4851	T|Mis|O	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""			L	TRB@		T-ALL		0				haematopoietic_and_lymphoid_tissue(791)|upper_aerodigestive_tract(29)|lung(13)|central_nervous_system(10)|breast(9)|large_intestine(1)|skin(1)|oesophagus(1)|pancreas(1)	856						c.(7066-7068)GCC>GCT		notch1 preproprotein							41.0	47.0	45.0					9																	139391123		2030	4177	6207	SO:0001819	synonymous_variant	4851				aortic valve morphogenesis|immune response|negative regulation of BMP signaling pathway|negative regulation of cell-substrate adhesion|negative regulation of myoblast differentiation|negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|Notch receptor processing	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity	g.chr9:139391123G>A	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.7068C>T	9.37:g.139391123G>A		HNSCC(8;0.001)	Somatic					p.A2356A	NM_017617	NP_060087	WXS	Illumina HiSeq	Unspecified	P46531	NOTC1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)	34	7068	-	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)	2356			Cytoplasmic (Potential).		Q59ED8|Q5SXM3	Silent	SNP	ENST00000277541.6	37	c.7068C>T	CCDS43905.1																																																																																				0.672	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617		10	62	0	0	0	0	10	62				
FAM166A	401565	broad.mit.edu	37	9	140139845	140139845	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr9:140139845C>T	ENST00000344774.4	-	3	490	c.436G>A	c.(436-438)Gac>Aac	p.D146N	FAM166A_ENST00000388932.2_Missense_Mutation_p.D146N	NM_001001710.1	NP_001001710.1	Q6J272	F166A_HUMAN	family with sequence similarity 166, member A	146						nucleus (GO:0005634)				kidney(3)|lung(7)|ovary(2)|prostate(1)|urinary_tract(2)	15						TCTCTGGAGTCTCCCTTCCTG	0.652																																						uc004cmi.1		NA																	0				ovary(1)	1						c.(436-438)GAC>AAC		hypothetical protein LOC401565							77.0	83.0	81.0					9																	140139845		2203	4300	6503	SO:0001583	missense	401565							g.chr9:140139845C>T	BC132916	CCDS35186.1	9q34.3	2008-08-08			ENSG00000188163	ENSG00000188163			33818	protein-coding gene	gene with protein product							Standard	XR_245332		Approved		uc004cmi.1	Q6J272	OTTHUMG00000159545	ENST00000344774.4:c.436G>A	9.37:g.140139845C>T	ENSP00000344729:p.Asp146Asn		Somatic					p.D146N	NM_001001710	NP_001001710	WXS	Illumina HiSeq	Unspecified	Q6J272	F166A_HUMAN			3	491	-			146					A6NND9|Q8N830	Missense_Mutation	SNP	ENST00000344774.4	37	c.436G>A	CCDS35186.1	.	.	.	.	.	.	.	.	.	.	C	3.691	-0.063447	0.07273	.	.	ENSG00000188163	ENST00000344774;ENST00000388932;ENST00000484720	.	.	.	4.06	2.13	0.27403	.	0.894155	0.09742	N	0.761703	T	0.33527	0.0866	L	0.46157	1.445	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.27123	-1.0083	9	0.39692	T	0.17	-10.4017	5.6348	0.17530	0.1916:0.7003:0.0:0.1082	.	146	Q6J272	F166A_HUMAN	N	146;146;173	.	ENSP00000344729:D146N	D	-	1	0	FAM166A	139259666	0.000000	0.05858	0.032000	0.17829	0.024000	0.10985	-0.184000	0.09698	0.414000	0.25790	0.561000	0.74099	GAC		0.652	FAM166A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356125.1	NM_001001710		7	74	0	0	0	0	7	74				
NELFB	25920	broad.mit.edu	37	9	140150496	140150496	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr9:140150496C>G	ENST00000343053.4	+	2	577	c.240C>G	c.(238-240)atC>atG	p.I80M		NM_015456.3	NP_056271.2	Q8WX92	NELFB_HUMAN	negative elongation factor complex member B	80					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											TGTCAGCCATCGCTTCGGAGG	0.642																																						uc004cmm.3		NA																	0					0						c.(238-240)ATC>ATG		cofactor of BRCA1							65.0	67.0	66.0					9																	140150496		2203	4300	6503	SO:0001583	missense	25920				negative regulation of transcription, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	cytoplasm|nucleoplasm	protein binding	g.chr9:140150496C>G	AF464935	CCDS7040.1	9q34	2013-01-31	2013-01-31	2013-01-31	ENSG00000188986	ENSG00000188986			24324	protein-coding gene	gene with protein product		611180	"""cofactor of BRCA1"""	COBRA1		11230166, 10574461, 17910036, 17659869	Standard	NM_015456		Approved	KIAA1182, NELF-B	uc004cmm.4	Q8WX92	OTTHUMG00000131778	ENST00000343053.4:c.240C>G	9.37:g.140150496C>G	ENSP00000339495:p.Ile80Met		Somatic					p.I80M	NM_015456	NP_056271	WXS	Illumina HiSeq	Unspecified	Q8WX92	NELFB_HUMAN	STAD - Stomach adenocarcinoma(284;0.137)	OV - Ovarian serous cystadenocarcinoma(145;9.42e-05)|Epithelial(140;0.000766)	2	443	+	all_cancers(76;0.0926)		80					A2BFA3|Q96EW5|Q9H9R4|Q9ULN8|Q9Y3W0	Missense_Mutation	SNP	ENST00000343053.4	37	c.240C>G	CCDS7040.1	.	.	.	.	.	.	.	.	.	.	C	15.50	2.852484	0.51270	.	.	ENSG00000188986	ENST00000343053	.	.	.	4.74	-9.48	0.00591	.	0.109382	0.64402	D	0.000007	T	0.47488	0.1448	L	0.37630	1.12	0.39515	D	0.968422	P	0.46621	0.881	P	0.46975	0.533	T	0.72171	-0.4371	9	0.51188	T	0.08	-20.7916	17.8528	0.88752	0.0989:0.7749:0.0:0.1262	.	80	Q8WX92	NELFB_HUMAN	M	80	.	ENSP00000339495:I80M	I	+	3	3	COBRA1	139270317	0.001000	0.12720	0.006000	0.13384	0.628000	0.37860	-1.596000	0.02091	-2.510000	0.00504	-0.367000	0.07326	ATC		0.642	NELFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254710.1	NM_015456		14	81	0	0	0	0	14	81				
ARSE	415	broad.mit.edu	37	X	2878422	2878422	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chrX:2878422G>A	ENST00000381134.3	-	2	86	c.20C>T	c.(19-21)tCt>tTt	p.S7F	ARSE_ENST00000545496.1_5'UTR|ARSE_ENST00000540563.1_Missense_Mutation_p.S16F|ARSE_ENST00000496095.1_5'UTR	NM_000047.2	NP_000038.2	P51690	ARSE_HUMAN	arylsulfatase E (chondrodysplasia punctata 1)	7					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				ATCTTACCAAGAATGGTGCAG	0.333																																						uc004crc.3		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(19-21)TCT>TTT		arylsulfatase E precursor							188.0	155.0	167.0					X																	2878422		2203	4299	6502	SO:0001583	missense	415				skeletal system development	Golgi stack	arylsulfatase activity|metal ion binding	g.chrX:2878422G>A	X83573	CCDS14122.1, CCDS75948.1, CCDS75949.1	Xp22.33	2013-02-14			ENSG00000157399	ENSG00000157399		"""Arylsulfatase family"""	719	protein-coding gene	gene with protein product		300180		CDPX, CDPX1		7720070	Standard	NM_000047		Approved		uc004crc.4	P51690	OTTHUMG00000137358	ENST00000381134.3:c.20C>T	X.37:g.2878422G>A	ENSP00000370526:p.Ser7Phe		Somatic				ARSE_uc011mhi.1_Missense_Mutation_p.S7F|ARSE_uc011mhh.1_5'UTR	p.S7F	NM_000047	NP_000038	WXS	Illumina HiSeq	Unspecified	P51690	ARSE_HUMAN			2	270	-		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	7					Q53FT2|Q53FU8	Missense_Mutation	SNP	ENST00000381134.3	37	c.20C>T	CCDS14122.1	.	.	.	.	.	.	.	.	.	.	g	0.012	-1.676115	0.00751	.	.	ENSG00000157399	ENST00000540563;ENST00000381134;ENST00000438544	D;D;D	0.99499	-3.25;-3.78;-6.02	2.01	-1.4	0.08968	.	10.698900	0.00714	U	0.000855	D	0.96506	0.8860	N	0.08118	0	0.23227	N	0.998087	B;B	0.06786	0.001;0.001	B;B	0.01281	0.0;0.0	D	0.94555	0.7757	10	0.54805	T	0.06	.	2.84	0.05526	0.3497:0.2421:0.4082:0.0	.	16;7	F5H324;P51690	.;ARSE_HUMAN	F	16;7;7	ENSP00000438198:S16F;ENSP00000370526:S7F;ENSP00000406528:S7F	ENSP00000370526:S7F	S	-	2	0	ARSE	2888422	0.015000	0.18098	0.001000	0.08648	0.004000	0.04260	0.089000	0.15002	-0.749000	0.04747	-0.381000	0.06696	TCT		0.333	ARSE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055643.1	NM_000047		11	21	0	0	0	0	11	21				
PHKA2	5256	broad.mit.edu	37	X	18956826	18956826	+	Silent	SNP	G	G	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chrX:18956826G>T	ENST00000379942.4	-	10	1625	c.960C>A	c.(958-960)ctC>ctA	p.L320L		NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	320					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					TGTTTTCGAAGAGCTTGAGTT	0.383																																						uc004cyv.3		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(958-960)CTC>CTA		phosphorylase kinase, alpha 2 (liver)							118.0	103.0	108.0					X																	18956826		2203	4300	6503	SO:0001819	synonymous_variant	5256				glucose metabolic process|glycogen catabolic process	cytosol|phosphorylase kinase complex|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity	g.chrX:18956826G>T		CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.960C>A	X.37:g.18956826G>T			Somatic					p.L320L	NM_000292	NP_000283	WXS	Illumina HiSeq	Unspecified	P46019	KPB2_HUMAN			10	1390	-	Hepatocellular(33;0.183)		320					A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Silent	SNP	ENST00000379942.4	37	c.960C>A	CCDS14190.1																																																																																				0.383	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055960.1	NM_000292		15	35	1	0	1.03e-11	1.1e-11	15	35				
DDX3X	1654	broad.mit.edu	37	X	41206168	41206168	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chrX:41206168G>C	ENST00000399959.2	+	15	2527	c.1672G>C	c.(1672-1674)Gat>Cat	p.D558H	DDX3X_ENST00000478993.1_3'UTR|DDX3X_ENST00000441189.2_Intron|DDX3X_ENST00000457138.2_Missense_Mutation_p.D542H|RN7SL15P_ENST00000582825.1_RNA	NM_001193416.1|NM_001193417.1|NM_001356.3	NP_001180345.1|NP_001180346.1|NP_001347.3	O00571	DDX3X_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked	558	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Interaction with GSK3B.				ATP catabolic process (GO:0006200)|cellular response to arsenic-containing substance (GO:0071243)|cellular response to osmotic stress (GO:0071470)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|mature ribosome assembly (GO:0042256)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell growth (GO:0030307)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of translation (GO:0045727)|positive regulation of translational initiation (GO:0045948)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|stress granule assembly (GO:0034063)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 5'-UTR binding (GO:0048027)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|transcription factor binding (GO:0008134)|translation initiation factor binding (GO:0031369)			NS(3)|breast(8)|central_nervous_system(36)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84						GGATTTGTTGGATCTTCTTGT	0.393										HNSCC(61;0.18)																												uc004dfe.2		NA																	0				ovary(2)|breast(2)|central_nervous_system(1)|skin(1)	6						c.(1672-1674)GAT>CAT		DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3							93.0	90.0	91.0					X																	41206168		2170	4270	6440	SO:0001583	missense	1654				interspecies interaction between organisms	cytoplasm|nuclear speck	ATP binding|ATP-dependent RNA helicase activity|DNA binding|protein binding|RNA binding	g.chrX:41206168G>C	U50553	CCDS43931.1, CCDS55404.1	Xp11.3-p11.23	2013-07-16	2013-07-16	2003-06-20	ENSG00000215301	ENSG00000215301		"""DEAD-boxes"""	2745	protein-coding gene	gene with protein product		300160	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked"""	DDX3		9381176, 9730595	Standard	NM_001193416		Approved	DBX, HLP2, DDX14	uc004dfe.3	O00571	OTTHUMG00000021369	ENST00000399959.2:c.1672G>C	X.37:g.41206168G>C	ENSP00000382840:p.Asp558His	HNSCC(61;0.18)	Somatic				DDX3X_uc004dff.2_Missense_Mutation_p.D558H|DDX3X_uc011mkq.1_Missense_Mutation_p.D542H|DDX3X_uc011mkr.1_Missense_Mutation_p.D428H|DDX3X_uc011mks.1_Intron|DDX3X_uc004dfg.2_RNA	p.D558H	NM_001356	NP_001347	WXS	Illumina HiSeq	Unspecified	O00571	DDX3X_HUMAN			15	2527	+			558			Helicase C-terminal.		A8K538|B4E3E8|O15536	Missense_Mutation	SNP	ENST00000399959.2	37	c.1672G>C	CCDS43931.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.061943	0.76187	.	.	ENSG00000215301	ENST00000399959;ENST00000457138	T;T	0.21734	1.99;1.99	5.28	5.28	0.74379	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.31231	0.0790	N	0.12637	0.245	0.80722	D	1	D;P;D;D	0.89917	1.0;0.571;1.0;1.0	D;B;D;D	0.83275	0.996;0.15;0.964;0.964	T	0.38993	-0.9635	10	0.87932	D	0	-22.771	18.0954	0.89488	0.0:0.0:1.0:0.0	.	428;542;570;558	B4DLU5;B4E3E8;Q59GX6;O00571	.;.;.;DDX3X_HUMAN	H	558;542	ENSP00000382840:D558H;ENSP00000392494:D542H	ENSP00000382840:D558H	D	+	1	0	DDX3X	41091112	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.820000	0.86633	2.209000	0.71365	0.529000	0.55759	GAT		0.393	DDX3X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056253.1	NM_024005		15	24	0	0	0	0	15	24				
DDX3X	1654	broad.mit.edu	37	X	41206210	41206210	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chrX:41206210G>C	ENST00000399959.2	+	15	2569	c.1714G>C	c.(1714-1716)Gaa>Caa	p.E572Q	DDX3X_ENST00000478993.1_3'UTR|DDX3X_ENST00000441189.2_Intron|DDX3X_ENST00000457138.2_Missense_Mutation_p.E556Q|RN7SL15P_ENST00000582825.1_RNA	NM_001193416.1|NM_001193417.1|NM_001356.3	NP_001180345.1|NP_001180346.1|NP_001347.3	O00571	DDX3X_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked	572	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Interaction with GSK3B.				ATP catabolic process (GO:0006200)|cellular response to arsenic-containing substance (GO:0071243)|cellular response to osmotic stress (GO:0071470)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|mature ribosome assembly (GO:0042256)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell growth (GO:0030307)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of translation (GO:0045727)|positive regulation of translational initiation (GO:0045948)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|stress granule assembly (GO:0034063)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 5'-UTR binding (GO:0048027)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|transcription factor binding (GO:0008134)|translation initiation factor binding (GO:0031369)			NS(3)|breast(8)|central_nervous_system(36)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84						GTCTTGGTTAGAAAACATGGC	0.403										HNSCC(61;0.18)																												uc004dfe.2		NA																	0				ovary(2)|breast(2)|central_nervous_system(1)|skin(1)	6						c.(1714-1716)GAA>CAA		DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3							93.0	89.0	90.0					X																	41206210		2169	4271	6440	SO:0001583	missense	1654				interspecies interaction between organisms	cytoplasm|nuclear speck	ATP binding|ATP-dependent RNA helicase activity|DNA binding|protein binding|RNA binding	g.chrX:41206210G>C	U50553	CCDS43931.1, CCDS55404.1	Xp11.3-p11.23	2013-07-16	2013-07-16	2003-06-20	ENSG00000215301	ENSG00000215301		"""DEAD-boxes"""	2745	protein-coding gene	gene with protein product		300160	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked"""	DDX3		9381176, 9730595	Standard	NM_001193416		Approved	DBX, HLP2, DDX14	uc004dfe.3	O00571	OTTHUMG00000021369	ENST00000399959.2:c.1714G>C	X.37:g.41206210G>C	ENSP00000382840:p.Glu572Gln	HNSCC(61;0.18)	Somatic				DDX3X_uc004dff.2_Missense_Mutation_p.E572Q|DDX3X_uc011mkq.1_Missense_Mutation_p.E556Q|DDX3X_uc011mkr.1_Missense_Mutation_p.E442Q|DDX3X_uc011mks.1_Intron|DDX3X_uc004dfg.2_RNA	p.E572Q	NM_001356	NP_001347	WXS	Illumina HiSeq	Unspecified	O00571	DDX3X_HUMAN			15	2569	+			572			Helicase C-terminal.		A8K538|B4E3E8|O15536	Missense_Mutation	SNP	ENST00000399959.2	37	c.1714G>C	CCDS43931.1	.	.	.	.	.	.	.	.	.	.	G	19.96	3.922764	0.73213	.	.	ENSG00000215301	ENST00000399959;ENST00000457138	T;T	0.22539	1.95;1.96	5.28	5.28	0.74379	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.14227	0.0344	N	0.12182	0.205	0.80722	D	1	B;B;P;P	0.49961	0.149;0.065;0.93;0.93	B;B;B;B	0.39027	0.055;0.017;0.288;0.215	T	0.05784	-1.0864	10	0.66056	D	0.02	-17.5658	18.0954	0.89488	0.0:0.0:1.0:0.0	.	442;556;584;572	B4DLU5;B4E3E8;Q59GX6;O00571	.;.;.;DDX3X_HUMAN	Q	572;556	ENSP00000382840:E572Q;ENSP00000392494:E556Q	ENSP00000382840:E572Q	E	+	1	0	DDX3X	41091154	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.810000	0.99221	2.209000	0.71365	0.529000	0.55759	GAA		0.403	DDX3X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056253.1	NM_024005		16	22	0	0	0	0	16	22				
NONO	4841	broad.mit.edu	37	X	70514197	70514197	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chrX:70514197C>T	ENST00000276079.8	+	5	674	c.469C>T	c.(469-471)Cag>Tag	p.Q157*	NONO_ENST00000373841.1_Nonsense_Mutation_p.Q157*|NONO_ENST00000490044.1_3'UTR|NONO_ENST00000535149.1_Nonsense_Mutation_p.Q68*|NONO_ENST00000373856.3_Nonsense_Mutation_p.Q157*	NM_007363.4	NP_031389.3	Q15233	NONO_HUMAN	non-POU domain containing, octamer-binding	157	DBHS.|RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				circadian rhythm (GO:0007623)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|mRNA processing (GO:0006397)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of circadian rhythm (GO:0042752)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)		NONO/TFE3(2)	endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	19	Renal(35;0.156)					AAACCTTCCTCAGTATGTGTC	0.517			T	TFE3	papillary renal cancer																																	uc004dzo.2		NA		Dom	yes		X	Xq13.1	4841	T	"""non-POU domain containing, octamer-binding"""			E	TFE3		papillary renal cancer	NONO/TFE3(2)	0				ovary(2)|kidney(2)	4						c.(469-471)CAG>TAG		non-POU domain containing, octamer-binding							136.0	96.0	110.0					X																	70514197		2203	4300	6503	SO:0001587	stop_gained	4841				DNA recombination|DNA repair|mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|transcription, DNA-dependent	nuclear matrix|paraspeckles	DNA binding|identical protein binding|nucleotide binding|RNA binding	g.chrX:70514197C>T	L14599	CCDS14410.1, CCDS55445.1	Xq13.1	2014-06-13	2002-01-14		ENSG00000147140	ENSG00000147140		"""RNA binding motif (RRM) containing"""	7871	protein-coding gene	gene with protein product	"""Nuclear RNA-binding protein, 54-kD"", ""non-Pou domain-containing octamer (ATGCAAAT) binding protein"", ""protein phosphatase 1, regulatory subunit 114"""	300084	"""non-POU-domain-containing, octamer-binding"""			8371983, 9360842	Standard	NM_007363		Approved	NRB54, NMT55, P54NRB, P54, PPP1R114	uc004dzp.3	Q15233	OTTHUMG00000021798	ENST00000276079.8:c.469C>T	X.37:g.70514197C>T	ENSP00000276079:p.Gln157*		Somatic				BCYRN1_uc011mpt.1_Intron|NONO_uc004dzn.2_Nonsense_Mutation_p.Q157*|NONO_uc004dzp.2_Nonsense_Mutation_p.Q157*|NONO_uc011mpv.1_Nonsense_Mutation_p.Q68*|NONO_uc004dzq.2_Nonsense_Mutation_p.Q26*	p.Q157*	NM_001145408	NP_001138880	WXS	Illumina HiSeq	Unspecified	Q15233	NONO_HUMAN			6	1179	+	Renal(35;0.156)		157			RRM 2.|DBHS.		B7Z4C2|D3DVV4|F5GYZ3|O00201|P30807|Q12786|Q9BQC5	Nonsense_Mutation	SNP	ENST00000276079.8	37	c.469C>T	CCDS14410.1	.	.	.	.	.	.	.	.	.	.	c	28.9	4.957591	0.92726	.	.	ENSG00000147140	ENST00000535149;ENST00000276079;ENST00000373856;ENST00000373841;ENST00000413858;ENST00000454976	.	.	.	4.66	4.66	0.58398	.	0.110323	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-9.9515	16.9271	0.86179	0.0:1.0:0.0:0.0	.	.	.	.	X	68;157;157;157;157;157	.	ENSP00000276079:Q157X	Q	+	1	0	NONO	70430922	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.118000	0.50414	2.173000	0.68751	0.529000	0.55759	CAG		0.517	NONO-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057138.1	NM_007363		16	41	0	0	0	0	16	41				
BRWD3	254065	broad.mit.edu	37	X	79980560	79980560	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chrX:79980560C>T	ENST00000373275.4	-	15	1609	c.1393G>A	c.(1393-1395)Gat>Aat	p.D465N	BRWD3_ENST00000473691.1_5'Flank	NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	465					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						ACTTCATCATCATGTCCCTAT	0.373																																						uc004edt.2		NA																	0				ovary(4)	4						c.(1393-1395)GAT>AAT		bromodomain and WD repeat domain containing 3							69.0	60.0	63.0					X																	79980560		2203	4299	6502	SO:0001583	missense	254065							g.chrX:79980560C>T		CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.1393G>A	X.37:g.79980560C>T	ENSP00000362372:p.Asp465Asn		Somatic				BRWD3_uc004edo.2_Missense_Mutation_p.D61N|BRWD3_uc004edp.2_Missense_Mutation_p.D294N|BRWD3_uc004edq.2_Missense_Mutation_p.D61N|BRWD3_uc010nmj.1_Missense_Mutation_p.D61N|BRWD3_uc004edr.2_Missense_Mutation_p.D135N|BRWD3_uc004eds.2_Missense_Mutation_p.D61N|BRWD3_uc004edu.2_Missense_Mutation_p.D135N|BRWD3_uc004edv.2_Missense_Mutation_p.D61N|BRWD3_uc004edw.2_Missense_Mutation_p.D61N|BRWD3_uc004edx.2_Missense_Mutation_p.D61N|BRWD3_uc004edy.2_Missense_Mutation_p.D61N|BRWD3_uc004edz.2_Missense_Mutation_p.D135N|BRWD3_uc004eea.2_Missense_Mutation_p.D135N|BRWD3_uc004eeb.2_Missense_Mutation_p.D61N	p.D465N	NM_153252	NP_694984	WXS	Illumina HiSeq	Unspecified	Q6RI45	BRWD3_HUMAN			15	1656	-			465			WD 8.		C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	ENST00000373275.4	37	c.1393G>A	CCDS14447.1	.	.	.	.	.	.	.	.	.	.	C	32	5.153840	0.94645	.	.	ENSG00000165288	ENST00000373275	T	0.59772	0.24	5.14	5.14	0.70334	WD40/YVTN repeat-like-containing domain (1);Quinoprotein amine dehydrogenase, beta chain-like (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.57681	0.2070	N	0.13003	0.285	0.80722	D	1	P	0.51057	0.941	P	0.59357	0.856	T	0.56902	-0.7902	9	.	.	.	-16.9719	17.7807	0.88522	0.0:1.0:0.0:0.0	.	465	Q6RI45	BRWD3_HUMAN	N	465	ENSP00000362372:D465N	.	D	-	1	0	BRWD3	79867216	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.320000	0.79064	2.386000	0.81285	0.600000	0.82982	GAT		0.373	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057344.1	NM_153252		11	21	0	0	0	0	11	21				
BRWD3	254065	broad.mit.edu	37	X	79989634	79989634	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chrX:79989634C>T	ENST00000373275.4	-	11	1285	c.1069G>A	c.(1069-1071)Gaa>Aaa	p.E357K		NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	357					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						GACTCTAATTCAGCAATTTTC	0.338																																						uc004edt.2		NA																	0				ovary(4)	4						c.(1069-1071)GAA>AAA		bromodomain and WD repeat domain containing 3							118.0	109.0	112.0					X																	79989634		2203	4298	6501	SO:0001583	missense	254065							g.chrX:79989634C>T		CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.1069G>A	X.37:g.79989634C>T	ENSP00000362372:p.Glu357Lys		Somatic				BRWD3_uc004edo.2_5'UTR|BRWD3_uc004edp.2_Missense_Mutation_p.E186K|BRWD3_uc004edq.2_5'UTR|BRWD3_uc010nmj.1_5'UTR|BRWD3_uc004edr.2_Missense_Mutation_p.E27K|BRWD3_uc004eds.2_5'UTR|BRWD3_uc004edu.2_Missense_Mutation_p.E27K|BRWD3_uc004edv.2_5'UTR|BRWD3_uc004edw.2_5'UTR|BRWD3_uc004edx.2_5'UTR|BRWD3_uc004edy.2_5'UTR|BRWD3_uc004edz.2_Missense_Mutation_p.E27K|BRWD3_uc004eea.2_Missense_Mutation_p.E27K|BRWD3_uc004eeb.2_5'UTR	p.E357K	NM_153252	NP_694984	WXS	Illumina HiSeq	Unspecified	Q6RI45	BRWD3_HUMAN			11	1332	-			357					C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	ENST00000373275.4	37	c.1069G>A	CCDS14447.1	.	.	.	.	.	.	.	.	.	.	C	33	5.195349	0.94960	.	.	ENSG00000165288	ENST00000373275	T	0.59906	0.23	5.34	5.34	0.76211	WD40/YVTN repeat-like-containing domain (1);Quinoprotein amine dehydrogenase, beta chain-like (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.60287	0.2257	N	0.14661	0.345	0.58432	D	0.999999	D	0.60575	0.988	D	0.66716	0.946	T	0.60063	-0.7336	9	.	.	.	-16.9539	18.1319	0.89604	0.0:1.0:0.0:0.0	.	357	Q6RI45	BRWD3_HUMAN	K	357	ENSP00000362372:E357K	.	E	-	1	0	BRWD3	79876290	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.541000	0.67212	2.475000	0.83589	0.544000	0.68410	GAA		0.338	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057344.1	NM_153252		20	46	0	0	0	0	20	46				
KLHL4	56062	broad.mit.edu	37	X	86890739	86890739	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chrX:86890739C>T	ENST00000373119.4	+	9	2034	c.1889C>T	c.(1888-1890)tCc>tTc	p.S630F	KLHL4_ENST00000373114.4_Missense_Mutation_p.S630F	NM_019117.4	NP_061990.2	Q9C0H6	KLHL4_HUMAN	kelch-like family member 4	630						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(29)|ovary(2)|prostate(1)|skin(1)	67						GCCCCTGCTTCCAACCATTGC	0.403																																						uc004efb.2		NA																	0				ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						c.(1888-1890)TCC>TTC		kelch-like 4 isoform 1							93.0	81.0	85.0					X																	86890739		2203	4300	6503	SO:0001583	missense	56062					cytoplasm|microtubule cytoskeleton|nucleolus	actin binding	g.chrX:86890739C>T	AF284765	CCDS14456.1, CCDS14457.1	Xq21.3	2013-01-30	2013-01-30		ENSG00000102271	ENSG00000102271		"""Kelch-like"", ""BTB/POZ domain containing"""	6355	protein-coding gene	gene with protein product		300348	"""kelch (Drosophila)-like 4"", ""kelch-like 4 (Drosophila)"""			11401425	Standard	NM_019117		Approved	KIAA1687, DKELCHL, KHL4	uc004efa.2	Q9C0H6	OTTHUMG00000021946	ENST00000373119.4:c.1889C>T	X.37:g.86890739C>T	ENSP00000362211:p.Ser630Phe		Somatic				KLHL4_uc004efa.2_Missense_Mutation_p.S630F	p.S630F	NM_019117	NP_061990	WXS	Illumina HiSeq	Unspecified	Q9C0H6	KLHL4_HUMAN			9	2071	+			630			Kelch 5.		B2RTW2|Q9Y3J5	Missense_Mutation	SNP	ENST00000373119.4	37	c.1889C>T	CCDS14457.1	.	.	.	.	.	.	.	.	.	.	C	11.74	1.727700	0.30593	.	.	ENSG00000102271	ENST00000373119;ENST00000373114	T;T	0.75938	-0.98;-0.92	4.23	3.37	0.38596	Galactose oxidase, beta-propeller (1);	.	.	.	.	T	0.76758	0.4032	L	0.35487	1.065	0.48975	D	0.999739	P;D	0.76494	0.908;0.999	D;D	0.65773	0.938;0.934	T	0.77584	-0.2533	9	0.87932	D	0	.	10.8622	0.46833	0.0:0.9048:0.0:0.0952	.	630;630	Q9C0H6;Q9C0H6-2	KLHL4_HUMAN;.	F	630	ENSP00000362211:S630F;ENSP00000362206:S630F	ENSP00000362206:S630F	S	+	2	0	KLHL4	86777395	1.000000	0.71417	0.005000	0.12908	0.003000	0.03518	5.390000	0.66261	0.925000	0.37094	-0.281000	0.10026	TCC		0.403	KLHL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057413.1			12	27	0	0	0	0	12	27				
BTK	695	broad.mit.edu	37	X	100604914	100604914	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chrX:100604914G>A	ENST00000308731.7	-	19	2102	c.1939C>T	c.(1939-1941)Ctt>Ttt	p.L647F	BTK_ENST00000372880.1_Missense_Mutation_p.L471F|TIMM8A_ENST00000480575.1_5'Flank|TIMM8A_ENST00000372902.3_5'Flank	NM_000061.2	NP_000052.1	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase	647	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		L -> P (in XLA).		adaptive immune response (GO:0002250)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|calcium-mediated signaling (GO:0019722)|cell maturation (GO:0048469)|Fc-epsilon receptor signaling pathway (GO:0038095)|histamine secretion by mast cell (GO:0002553)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell cytokine production (GO:0002721)|response to organic substance (GO:0010033)|response to reactive oxygen species (GO:0000302)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein tyrosine kinase activity (GO:0004713)			breast(4)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(25)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						TTGCTCAGAAGAATTTTGAAA	0.393									Agammaglobulinemia, X-linked																													uc004ehg.2		NA																	0				lung(3)|central_nervous_system(2)|ovary(1)	6						c.(1939-1941)CTT>TTT		Bruton agammaglobulinemia tyrosine kinase							135.0	136.0	136.0					X																	100604914		2203	4300	6503	SO:0001583	missense	695	Agammaglobulinemia_X-linked	Familial Cancer Database	Bruton Type Agammaglobulinemia	calcium-mediated signaling|induction of apoptosis by extracellular signals|mesoderm development	cytosol|membrane raft|nucleus|plasma membrane	ATP binding|identical protein binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|phosphatidylinositol-3,4,5-trisphosphate binding	g.chrX:100604914G>A	AK057105	CCDS14482.1, CCDS76002.1, CCDS76003.1	Xq21.33-q22	2014-09-17			ENSG00000010671	ENSG00000010671	2.7.10.1	"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1133	protein-coding gene	gene with protein product		300300		AGMX1, IMD1		8380905	Standard	NM_000061		Approved	ATK, XLA, PSCTK1	uc004ehg.2	Q06187	OTTHUMG00000022022	ENST00000308731.7:c.1939C>T	X.37:g.100604914G>A	ENSP00000308176:p.Leu647Phe		Somatic				TIMM8A_uc004ehd.2_5'Flank|TIMM8A_uc011mri.1_5'Flank|BTK_uc004ehf.2_Missense_Mutation_p.L147F|BTK_uc010nnh.2_RNA|BTK_uc010nni.2_RNA|BTK_uc004ehe.2_RNA|BTK_uc010nnj.2_RNA|BTK_uc010nnk.2_RNA|BTK_uc010nnl.2_Missense_Mutation_p.L123F|BTK_uc010nnm.2_Missense_Mutation_p.L206F|BTK_uc010nnn.2_Missense_Mutation_p.L471F|BTK_uc010nno.2_Missense_Mutation_p.L681F	p.L647F	NM_000061	NP_000052	WXS	Illumina HiSeq	Unspecified	Q06187	BTK_HUMAN			19	2132	-			647		L -> P (in XLA).	Protein kinase.		B2RAW1|Q32ML5	Missense_Mutation	SNP	ENST00000308731.7	37	c.1939C>T	CCDS14482.1	.	.	.	.	.	.	.	.	.	.	G	15.06	2.722612	0.48728	.	.	ENSG00000010671	ENST00000372880;ENST00000372855;ENST00000372859;ENST00000372860;ENST00000308731	D;D	0.91011	-2.09;-2.77	5.14	4.21	0.49690	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.073808	0.56097	D	0.000030	D	0.96861	0.8975	H	0.97918	4.105	0.80722	D	1	P;D;D;P	0.89917	0.886;1.0;1.0;0.939	P;D;D;P	0.83275	0.45;0.996;0.994;0.746	D	0.97398	0.9994	10	0.87932	D	0	.	12.0281	0.53382	0.0:0.1713:0.8287:0.0	.	471;307;222;647	Q5JY90;Q3MS96;Q572P5;Q06187	.;.;.;BTK_HUMAN	F	471;196;127;222;647	ENSP00000361971:L471F;ENSP00000308176:L647F	ENSP00000308176:L647F	L	-	1	0	BTK	100491570	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.003000	0.63959	2.288000	0.76882	0.523000	0.50628	CTT		0.393	BTK-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057532.2	NM_000061		32	80	0	0	0	0	32	80				
RNF113A	7737	broad.mit.edu	37	X	119005174	119005174	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chrX:119005174C>T	ENST00000371442.2	-	1	617	c.403G>A	c.(403-405)Gag>Aag	p.E135K	NDUFA1_ENST00000371437.4_5'Flank	NM_006978.2	NP_008909.1	O15541	R113A_HUMAN	ring finger protein 113A	135							zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(6)	15						TGGCTGCGCTCAAAGATGGCT	0.527																																						uc004esb.2		NA																	0				breast(2)	2						c.(403-405)GAG>AAG		ring finger protein 113A							320.0	302.0	308.0					X																	119005174		2203	4300	6503	SO:0001583	missense	7737						nucleic acid binding|zinc ion binding	g.chrX:119005174C>T	X98253	CCDS14589.1	Xq24	2013-10-22	2005-03-22	2005-03-22	ENSG00000125352	ENSG00000125352		"""RING-type (C3HC4) zinc fingers"""	12974	protein-coding gene	gene with protein product			"""zinc finger protein 183 (RING finger, C3HC4 type)"""	ZNF183		9224902	Standard	NM_006978		Approved	RNF113, Cwc24	uc004esb.3	O15541	OTTHUMG00000022283	ENST00000371442.2:c.403G>A	X.37:g.119005174C>T	ENSP00000360497:p.Glu135Lys		Somatic				NDUFA1_uc004esc.3_5'Flank	p.E135K	NM_006978	NP_008909	WXS	Illumina HiSeq	Unspecified	O15541	R113A_HUMAN			1	618	-			135					B2RBR7	Missense_Mutation	SNP	ENST00000371442.2	37	c.403G>A	CCDS14589.1	.	.	.	.	.	.	.	.	.	.	C	18.58	3.655553	0.67586	.	.	ENSG00000125352	ENST00000371442	T	0.35048	1.33	5.49	4.63	0.57726	.	0.000000	0.85682	D	0.000000	T	0.41743	0.1172	M	0.79926	2.475	0.80722	D	1	B	0.30542	0.284	B	0.31390	0.129	T	0.35574	-0.9783	10	0.49607	T	0.09	-4.0786	11.1227	0.48300	0.0:0.9083:0.0:0.0917	.	135	O15541	R113A_HUMAN	K	135	ENSP00000360497:E135K	ENSP00000360497:E135K	E	-	1	0	RNF113A	118889202	1.000000	0.71417	0.995000	0.50966	0.994000	0.84299	5.771000	0.68881	1.101000	0.41535	0.600000	0.82982	GAG		0.527	RNF113A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058071.1	NM_006978		18	253	0	0	0	0	18	253				
RNF113A	7737	broad.mit.edu	37	X	119005250	119005250	+	Silent	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chrX:119005250C>T	ENST00000371442.2	-	1	541	c.327G>A	c.(325-327)gtG>gtA	p.V109V	NDUFA1_ENST00000371437.4_5'Flank	NM_006978.2	NP_008909.1	O15541	R113A_HUMAN	ring finger protein 113A	109							zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(6)	15						CCTCTGGTCCCACGGGTTTCG	0.562																																						uc004esb.2		NA																	0				breast(2)	2						c.(325-327)GTG>GTA		ring finger protein 113A							178.0	179.0	178.0					X																	119005250		2203	4300	6503	SO:0001819	synonymous_variant	7737						nucleic acid binding|zinc ion binding	g.chrX:119005250C>T	X98253	CCDS14589.1	Xq24	2013-10-22	2005-03-22	2005-03-22	ENSG00000125352	ENSG00000125352		"""RING-type (C3HC4) zinc fingers"""	12974	protein-coding gene	gene with protein product			"""zinc finger protein 183 (RING finger, C3HC4 type)"""	ZNF183		9224902	Standard	NM_006978		Approved	RNF113, Cwc24	uc004esb.3	O15541	OTTHUMG00000022283	ENST00000371442.2:c.327G>A	X.37:g.119005250C>T			Somatic				NDUFA1_uc004esc.3_5'Flank	p.V109V	NM_006978	NP_008909	WXS	Illumina HiSeq	Unspecified	O15541	R113A_HUMAN			1	542	-			109					B2RBR7	Silent	SNP	ENST00000371442.2	37	c.327G>A	CCDS14589.1																																																																																				0.562	RNF113A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058071.1	NM_006978		14	181	0	0	0	0	14	181				
RNF113A	7737	broad.mit.edu	37	X	119005303	119005303	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chrX:119005303C>T	ENST00000371442.2	-	1	488	c.274G>A	c.(274-276)Gag>Aag	p.E92K	NDUFA1_ENST00000371437.4_5'Flank	NM_006978.2	NP_008909.1	O15541	R113A_HUMAN	ring finger protein 113A	92	Poly-Glu.						zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(6)	15						CTCTCGGGCTCATTTTCCTCT	0.547																																						uc004esb.2		NA																	0				breast(2)	2						c.(274-276)GAG>AAG		ring finger protein 113A							162.0	161.0	161.0					X																	119005303		2203	4300	6503	SO:0001583	missense	7737						nucleic acid binding|zinc ion binding	g.chrX:119005303C>T	X98253	CCDS14589.1	Xq24	2013-10-22	2005-03-22	2005-03-22	ENSG00000125352	ENSG00000125352		"""RING-type (C3HC4) zinc fingers"""	12974	protein-coding gene	gene with protein product			"""zinc finger protein 183 (RING finger, C3HC4 type)"""	ZNF183		9224902	Standard	NM_006978		Approved	RNF113, Cwc24	uc004esb.3	O15541	OTTHUMG00000022283	ENST00000371442.2:c.274G>A	X.37:g.119005303C>T	ENSP00000360497:p.Glu92Lys		Somatic				NDUFA1_uc004esc.3_5'Flank	p.E92K	NM_006978	NP_008909	WXS	Illumina HiSeq	Unspecified	O15541	R113A_HUMAN			1	489	-			92			Poly-Glu.		B2RBR7	Missense_Mutation	SNP	ENST00000371442.2	37	c.274G>A	CCDS14589.1	.	.	.	.	.	.	.	.	.	.	C	8.723	0.914831	0.17907	.	.	ENSG00000125352	ENST00000371442	T	0.31510	1.49	5.49	4.63	0.57726	.	0.582240	0.18241	N	0.147224	T	0.19167	0.0460	L	0.29908	0.895	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.26985	-1.0087	10	0.12430	T	0.62	-33.4748	7.7603	0.28948	0.0:0.808:0.0:0.192	.	92	O15541	R113A_HUMAN	K	92	ENSP00000360497:E92K	ENSP00000360497:E92K	E	-	1	0	RNF113A	118889331	0.001000	0.12720	0.002000	0.10522	0.308000	0.27856	0.639000	0.24690	1.108000	0.41662	0.600000	0.82982	GAG		0.547	RNF113A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058071.1	NM_006978		11	145	0	0	0	0	11	145				
RNF113A	7737	broad.mit.edu	37	X	119005408	119005408	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chrX:119005408C>T	ENST00000371442.2	-	1	383	c.169G>A	c.(169-171)Gaa>Aaa	p.E57K	NDUFA1_ENST00000371437.4_5'Flank	NM_006978.2	NP_008909.1	O15541	R113A_HUMAN	ring finger protein 113A	57							zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(6)	15						CGCTTCTTTTCCGGTCGAACC	0.602																																						uc004esb.2		NA																	0				breast(2)	2						c.(169-171)GAA>AAA		ring finger protein 113A							161.0	154.0	157.0					X																	119005408		2203	4300	6503	SO:0001583	missense	7737						nucleic acid binding|zinc ion binding	g.chrX:119005408C>T	X98253	CCDS14589.1	Xq24	2013-10-22	2005-03-22	2005-03-22	ENSG00000125352	ENSG00000125352		"""RING-type (C3HC4) zinc fingers"""	12974	protein-coding gene	gene with protein product			"""zinc finger protein 183 (RING finger, C3HC4 type)"""	ZNF183		9224902	Standard	NM_006978		Approved	RNF113, Cwc24	uc004esb.3	O15541	OTTHUMG00000022283	ENST00000371442.2:c.169G>A	X.37:g.119005408C>T	ENSP00000360497:p.Glu57Lys		Somatic				NDUFA1_uc004esc.3_5'Flank	p.E57K	NM_006978	NP_008909	WXS	Illumina HiSeq	Unspecified	O15541	R113A_HUMAN			1	384	-			57					B2RBR7	Missense_Mutation	SNP	ENST00000371442.2	37	c.169G>A	CCDS14589.1	.	.	.	.	.	.	.	.	.	.	C	12.71	2.020592	0.35606	.	.	ENSG00000125352	ENST00000371442	T	0.31510	1.49	5.49	3.62	0.41486	.	0.325103	0.31909	N	0.006878	T	0.27594	0.0678	L	0.56769	1.78	0.38805	D	0.955287	B	0.22276	0.067	B	0.15052	0.012	T	0.09487	-1.0672	10	0.20046	T	0.44	-26.3995	11.5882	0.50931	0.0:0.6663:0.3337:0.0	.	57	O15541	R113A_HUMAN	K	57	ENSP00000360497:E57K	ENSP00000360497:E57K	E	-	1	0	RNF113A	118889436	0.987000	0.35691	0.588000	0.28705	0.626000	0.37791	1.497000	0.35649	1.074000	0.40909	0.600000	0.82982	GAA		0.602	RNF113A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058071.1	NM_006978		6	133	0	0	0	0	6	133				
GRIA3	2892	broad.mit.edu	37	X	122537305	122537305	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chrX:122537305G>A	ENST00000371251.1	+	9	1280	c.1228G>A	c.(1228-1230)Gat>Aat	p.D410N	GRIA3_ENST00000264357.5_Missense_Mutation_p.D410N|GRIA3_ENST00000371256.5_Missense_Mutation_p.D410N|GRIA3_ENST00000541091.1_Missense_Mutation_p.D394N|GRIA3_ENST00000542149.1_Missense_Mutation_p.D410N			P42263	GRIA3_HUMAN	glutamate receptor, ionotropic, AMPA 3	410					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)			breast(2)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|pancreas(2)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	57					Lithium(DB01356)	GCCTTTCTCAGATCAGCAAAT	0.443																																						uc004etq.3		NA																	0				ovary(3)|central_nervous_system(1)|pancreas(1)	5						c.(1228-1230)GAT>AAT		glutamate receptor, ionotrophic, AMPA 3 isoform	L-Glutamic Acid(DB00142)						221.0	199.0	206.0					X																	122537305		2203	4300	6503	SO:0001583	missense	2892				glutamate signaling pathway|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity	g.chrX:122537305G>A	U10301	CCDS14604.1, CCDS14605.1, CCDS76017.1	Xq25	2012-08-29	2012-02-03		ENSG00000125675	ENSG00000125675		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4573	protein-coding gene	gene with protein product		305915	"""glutamate receptor, ionotrophic, AMPA 3"""	GLUR3		1319477, 10644433	Standard	NM_007325		Approved	GluA3, GLURC, MRX94	uc004etr.4	P42263	OTTHUMG00000022685	ENST00000371251.1:c.1228G>A	X.37:g.122537305G>A	ENSP00000360297:p.Asp410Asn		Somatic				GRIA3_uc004etr.3_Missense_Mutation_p.D410N|GRIA3_uc004ets.3_RNA|GRIA3_uc011muf.1_Missense_Mutation_p.D394N	p.D410N	NM_007325	NP_015564	WXS	Illumina HiSeq	Unspecified	P42263	GRIA3_HUMAN			10	1521	+			410			Extracellular (Potential).		D3DTF1|Q4VXD5|Q4VXD6|Q9HDA0|Q9HDA1|Q9HDA2|Q9P0H1	Missense_Mutation	SNP	ENST00000371251.1	37	c.1228G>A	CCDS14604.1	.	.	.	.	.	.	.	.	.	.	G	18.57	3.651741	0.67472	.	.	ENSG00000125675	ENST00000264357;ENST00000542149;ENST00000371256;ENST00000371251;ENST00000541091	T;T;T;T;T	0.14266	2.7;2.52;2.7;2.7;4.19	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.19005	0.0456	L	0.46885	1.475	0.80722	D	1	P;P;P	0.48503	0.911;0.682;0.787	P;B;B	0.44732	0.459;0.257;0.443	T	0.00405	-1.1760	10	0.41790	T	0.15	.	17.979	0.89134	0.0:0.0:1.0:0.0	.	394;410;410	B7Z4C0;P42263;P42263-2	.;GRIA3_HUMAN;.	N	410;410;410;410;394	ENSP00000264357:D410N;ENSP00000446146:D410N;ENSP00000360302:D410N;ENSP00000360297:D410N;ENSP00000446440:D394N	ENSP00000264357:D410N	D	+	1	0	GRIA3	122364986	1.000000	0.71417	0.992000	0.48379	0.996000	0.88848	9.476000	0.97823	2.466000	0.83321	0.594000	0.82650	GAT		0.443	GRIA3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058854.1	NM_000828		58	97	0	0	0	0	58	97				
IGSF1	3547	broad.mit.edu	37	X	130410218	130410218	+	Silent	SNP	G	G	A			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chrX:130410218G>A	ENST00000361420.3	-	15	2692	c.2613C>T	c.(2611-2613)ttC>ttT	p.F871F	IGSF1_ENST00000370904.1_Silent_p.F862F|IGSF1_ENST00000467244.1_5'UTR|IGSF1_ENST00000370910.1_Silent_p.F862F|IGSF1_ENST00000370903.3_Silent_p.F876F			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	871					regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						GTTTGGGGTAGAATTCTGAAA	0.473																																						uc004ewd.2		NA																	0				ovary(3)|lung(1)|central_nervous_system(1)	5						c.(2611-2613)TTC>TTT		immunoglobulin superfamily, member 1 isoform 1							39.0	40.0	40.0					X																	130410218		2201	4299	6500	SO:0001819	synonymous_variant	3547				regulation of transcription, DNA-dependent	extracellular region|integral to membrane	inhibin beta-A binding|inhibin beta-B binding	g.chrX:130410218G>A	AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.2613C>T	X.37:g.130410218G>A			Somatic				IGSF1_uc004ewe.3_Silent_p.F865F|IGSF1_uc004ewf.2_Silent_p.F851F	p.F871F	NM_001555	NP_001546	WXS	Illumina HiSeq	Unspecified	Q8N6C5	IGSF1_HUMAN			15	2851	-			871			Extracellular (Potential).		B5MEG2|H9KV64|O15070|Q9NTC8	Silent	SNP	ENST00000361420.3	37	c.2613C>T	CCDS14629.1																																																																																				0.473	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058288.1			11	20	0	0	0	0	11	20				
GABRA3	2556	broad.mit.edu	37	X	151366158	151366158	+	Nonsense_Mutation	SNP	G	G	C			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chrX:151366158G>C	ENST00000370314.4	-	8	1116	c.878C>G	c.(877-879)tCa>tGa	p.S293*	GABRA3_ENST00000535043.1_Nonsense_Mutation_p.S293*	NM_000808.3	NP_000799.1	P34903	GBRA3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 3	293					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(6)	37	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	CGACACTTGTGACAGAATGAC	0.453																																					NSCLC(142;2578 2613 10251 16743)	uc010ntk.1		NA																	0				ovary(1)	1						c.(877-879)TCA>TGA		gamma-aminobutyric acid A receptor, alpha 3	Alprazolam(DB00404)|Diazepam(DB00829)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)						199.0	143.0	162.0					X																	151366158		2203	4300	6503	SO:0001587	stop_gained	2556				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding	g.chrX:151366158G>C		CCDS14706.1	Xq28	2012-06-22			ENSG00000011677	ENSG00000011677		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4077	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 3"""	305660					Standard	NM_000808		Approved		uc010ntk.1	P34903	OTTHUMG00000024183	ENST00000370314.4:c.878C>G	X.37:g.151366158G>C	ENSP00000359337:p.Ser293*		Somatic					p.S293*	NM_000808	NP_000799	WXS	Illumina HiSeq	Unspecified	P34903	GBRA3_HUMAN			8	1118	-	Acute lymphoblastic leukemia(192;6.56e-05)		293			Helical; (Probable).		Q8TAF9	Nonsense_Mutation	SNP	ENST00000370314.4	37	c.878C>G	CCDS14706.1	.	.	.	.	.	.	.	.	.	.	G	39	7.303052	0.98200	.	.	ENSG00000011677	ENST00000370314;ENST00000370311;ENST00000535043	.	.	.	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	14.6645	0.68896	0.0:0.0:1.0:0.0	.	.	.	.	X	293	.	ENSP00000359334:S293X	S	-	2	0	GABRA3	151116814	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.807000	0.99171	2.043000	0.60533	0.538000	0.68166	TCA		0.453	GABRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060921.1	NM_000808		12	34	0	0	0	0	12	34				
CHD4	1108	broad.mit.edu	37	12	6711546	6711546	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr12:6711546delT	ENST00000357008.2	-	3	381	c.218delA	c.(217-219)aagfs	p.K73fs	CHD4_ENST00000309577.6_Frame_Shift_Del_p.K73fs|CHD4_ENST00000544040.1_Frame_Shift_Del_p.K73fs|CHD4_ENST00000544484.1_Frame_Shift_Del_p.K70fs	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	73					ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						ACTCACCTCCTTTTTTTGGCG	0.468																																					Colon(32;586 792 4568 16848 45314)	uc001qpo.2		NA																	0				central_nervous_system(2)	2						c.(217-219)AAGfs		chromodomain helicase DNA binding protein 4							229.0	232.0	231.0					12																	6711546		2203	4300	6503	SO:0001589	frameshift_variant	1108				chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|zinc ion binding	g.chr12:6711546delT	X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.218delA	12.37:g.6711546delT	ENSP00000349508:p.Lys73fs		Somatic				CHD4_uc001qpn.2_Frame_Shift_Del_p.K73fs|CHD4_uc001qpp.2_Frame_Shift_Del_p.K70fs	p.K73fs	NM_001273	NP_001264	WXS	Illumina HiSeq	Unspecified	Q14839	CHD4_HUMAN			3	382	-			73					Q8IXZ5	Frame_Shift_Del	DEL	ENST00000357008.2	37	c.218delA	CCDS8552.1																																																																																				0.468	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001273		7	393	NA	NA	NA	NA	7	393	---	---	---	---
SRRM2	23524	broad.mit.edu	37	16	2808519	2808519	+	Frame_Shift_Del	DEL	G	G	-	rs201016157		TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr16:2808519delG	ENST00000301740.8	+	5	1113	c.564delG	c.(562-564)aagfs	p.K194fs		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	194	Lys-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						CAaagcagaagaagaagaaaa	0.453																																						uc002crk.2		NA																	0				ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						c.(562-564)AAGfs		splicing coactivator subunit SRm300							132.0	137.0	135.0					16																	2808519		2198	4300	6498	SO:0001589	frameshift_variant	23524					Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding	g.chr16:2808519delG	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.564delG	16.37:g.2808519delG	ENSP00000301740:p.Lys194fs		Somatic				SRRM2_uc002crj.1_Frame_Shift_Del_p.K92fs|SRRM2_uc002crl.1_Frame_Shift_Del_p.K188fs|SRRM2_uc010bsu.1_Frame_Shift_Del_p.K92fs	p.K188fs	NM_016333	NP_057417	WXS	Illumina HiSeq	Unspecified	Q9UQ35	SRRM2_HUMAN			5	1113	+			188			Lys-rich.|Ser-rich.		A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Frame_Shift_Del	DEL	ENST00000301740.8	37	c.564delG	CCDS32373.1																																																																																				0.453	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1			25	207	NA	NA	NA	NA	25	207	---	---	---	---
PSG3	5671	broad.mit.edu	37	19	43243011	43243011	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CR-6481-01A-11D-1870-08	TCGA-CR-6481-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5e7d2531-81c1-48bb-9c0a-1867d1f83f92	a09784cf-42b3-40c9-b7d0-d54a56563b7b	g.chr19:43243011delC	ENST00000327495.5	-	2	479	c.295delG	c.(295-297)gaafs	p.E99fs	PSG3_ENST00000595140.1_Frame_Shift_Del_p.E99fs|PSG3_ENST00000490592.1_5'UTR	NM_021016.3	NP_066296.2	Q16557	PSG3_HUMAN	pregnancy specific beta-1-glycoprotein 3	99	Ig-like V-type.				defense response (GO:0006952)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36		Prostate(69;0.00682)				TATACTGTTTCTCGTCCACTG	0.453																																						uc002oue.2		NA																	0				ovary(1)|skin(1)	2						c.(295-297)GAAfs		pregnancy specific beta-1-glycoprotein 3							390.0	362.0	372.0					19																	43243011		2203	4300	6503	SO:0001589	frameshift_variant	5671				defense response|female pregnancy	extracellular region		g.chr19:43243011delC		CCDS12611.1	19q13.2	2013-01-29			ENSG00000221826	ENSG00000221826		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9520	protein-coding gene	gene with protein product		176392				2341148	Standard	NM_021016		Approved		uc002oue.3	Q16557	OTTHUMG00000151120	ENST00000327495.5:c.295delG	19.37:g.43243011delC	ENSP00000332215:p.Glu99fs		Somatic				PSG3_uc002ouf.2_RNA|PSG1_uc002oug.1_Intron|PSG3_uc010eil.2_Frame_Shift_Del_p.E121fs	p.E99fs	NM_021016	NP_066296	WXS	Illumina HiSeq	Unspecified	Q16557	PSG3_HUMAN			2	427	-		Prostate(69;0.00682)	99			Ig-like V-type.		Q08265|Q9BRW2|Q9UPL4|Q9UQ77	Frame_Shift_Del	DEL	ENST00000327495.5	37	c.295delG	CCDS12611.1																																																																																				0.453	PSG3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321423.2	NM_021016		69	541	NA	NA	NA	NA	69	541	---	---	---	---
