#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
NMNAT1	64802	broad.mit.edu	37	1	10032236	10032236	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr1:10032236G>C	ENST00000377205.1	+	2	249	c.105G>C	c.(103-105)atG>atC	p.M35I	NMNAT1_ENST00000403197.1_Missense_Mutation_p.M35I|NMNAT1_ENST00000492735.1_3'UTR	NM_022787.3	NP_073624.2	Q9HAN9	NMNA1_HUMAN	nicotinamide nucleotide adenylyltransferase 1	35			M -> T (in LCA9). {ECO:0000269|PubMed:22842231}.		NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nicotinamide-nucleotide adenylyltransferase activity (GO:0000309)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)			large_intestine(2)|lung(2)|stomach(1)	5		all_lung(284;0.000407)|Renal(390;0.000469)|Lung NSC(185;0.000577)|Colorectal(325;0.0062)|Breast(348;0.00686)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.31e-08)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(185;0.00028)|BRCA - Breast invasive adenocarcinoma(304;0.00032)|KIRC - Kidney renal clear cell carcinoma(229;0.00101)|STAD - Stomach adenocarcinoma(132;0.00908)|READ - Rectum adenocarcinoma(331;0.0419)		AGGACTACATGAATGGAACAG	0.493																																						uc001aqp.2		NA																	0					0						c.(103-105)ATG>ATC		nicotinamide mononucleotide adenylyltransferase							159.0	156.0	157.0					1																	10032236		2203	4300	6503	SO:0001583	missense	64802				water-soluble vitamin metabolic process	nucleoplasm	ATP binding|nicotinamide-nucleotide adenylyltransferase activity|nicotinate-nucleotide adenylyltransferase activity|protein binding	g.chr1:10032236G>C	AF312734	CCDS108.1, CCDS72698.1	1p36.22	2014-01-28	2003-04-30	2003-05-02	ENSG00000173614	ENSG00000173614	2.7.7.1		17877	protein-coding gene	gene with protein product		608700	"""nicotinamide nucleotide adenylyltransferase"", ""Leber congenital amaurosis 9"", ""Leber's congenital amaurosis 9"""	LCA9		11248244, 11027696, 22842227	Standard	XR_244792		Approved	NMNAT, PNAT1	uc001aqp.3	Q9HAN9	OTTHUMG00000001799	ENST00000377205.1:c.105G>C	1.37:g.10032236G>C	ENSP00000366410:p.Met35Ile		Somatic					p.M35I	NM_022787	NP_073624	WXS	Illumina HiSeq	Unspecified	Q9HAN9	NMNA1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.31e-08)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(185;0.00028)|BRCA - Breast invasive adenocarcinoma(304;0.00032)|KIRC - Kidney renal clear cell carcinoma(229;0.00101)|STAD - Stomach adenocarcinoma(132;0.00908)|READ - Rectum adenocarcinoma(331;0.0419)	2	249	+		all_lung(284;0.000407)|Renal(390;0.000469)|Lung NSC(185;0.000577)|Colorectal(325;0.0062)|Breast(348;0.00686)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)	35					B1AN63|Q8TAE9|Q9H247|Q9H6B6	Missense_Mutation	SNP	ENST00000377205.1	37	c.105G>C	CCDS108.1	.	.	.	.	.	.	.	.	.	.	g	14.10	2.434484	0.43224	.	.	ENSG00000173614	ENST00000403197;ENST00000377205	D;D	0.96011	-3.88;-3.88	4.09	4.09	0.47781	Cytidylyltransferase (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.192522	0.46442	D	0.000292	D	0.90342	0.6978	N	0.16166	0.38	0.36418	D	0.864169	B	0.25206	0.12	B	0.30105	0.111	D	0.90150	0.4220	10	0.41790	T	0.15	-0.6097	14.2281	0.65873	0.0:0.1496:0.8504:0.0	.	35	Q9HAN9	NMNA1_HUMAN	I	35	ENSP00000385131:M35I;ENSP00000366410:M35I	ENSP00000366410:M35I	M	+	3	0	NMNAT1	9954823	1.000000	0.71417	0.974000	0.42286	0.994000	0.84299	3.231000	0.51294	2.268000	0.75426	0.580000	0.79431	ATG		0.493	NMNAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005029.1			29	150	0	0	0	0	29	150				
FBLIM1	54751	broad.mit.edu	37	1	16101195	16101195	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr1:16101195C>T	ENST00000375766.3	+	7	1434	c.794C>T	c.(793-795)tCc>tTc	p.S265F	FBLIM1_ENST00000441801.2_Missense_Mutation_p.S265F|FBLIM1_ENST00000332305.5_Missense_Mutation_p.S168F|FBLIM1_ENST00000375771.1_Missense_Mutation_p.S265F|FBLIM1_ENST00000400773.1_Missense_Mutation_p.S168F	NM_017556.2	NP_060026.2	Q8WUP2	FBLI1_HUMAN	filamin binding LIM protein 1	265	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell junction assembly (GO:0034329)|regulation of cell shape (GO:0008360)|regulation of integrin activation (GO:0033623)|single organismal cell-cell adhesion (GO:0016337)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|stress fiber (GO:0001725)	filamin binding (GO:0031005)|zinc ion binding (GO:0008270)			large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	16		Colorectal(325;0.000257)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.56e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|READ - Rectum adenocarcinoma(331;0.0649)|STAD - Stomach adenocarcinoma(313;0.138)		TTCCACCCCTCCTGCTTCACG	0.632																																						uc001axd.1		NA																	0				skin(1)	1						c.(793-795)TCC>TTC		filamin-binding LIM protein-1 isoform a							109.0	98.0	102.0					1																	16101195		2203	4300	6503	SO:0001583	missense	54751				cell adhesion|cell junction assembly|regulation of cell shape	cell cortex|cytoskeleton|cytosol|focal adhesion|intracellular membrane-bounded organelle	zinc ion binding	g.chr1:16101195C>T		CCDS163.1, CCDS30609.1, CCDS44064.1	1p36.13	2014-04-07			ENSG00000162458	ENSG00000162458			24686	protein-coding gene	gene with protein product		607747				12679033, 12496242	Standard	XM_005245900		Approved	FBLP-1, CAL, migfilin	uc001axe.1	Q8WUP2	OTTHUMG00000003079	ENST00000375766.3:c.794C>T	1.37:g.16101195C>T	ENSP00000364921:p.Ser265Phe		Somatic				FBLIM1_uc001axe.1_Missense_Mutation_p.S265F|FBLIM1_uc001axf.2_RNA|FBLIM1_uc001axg.1_Missense_Mutation_p.S265F|FBLIM1_uc001axh.1_Missense_Mutation_p.S168F|FBLIM1_uc001axi.1_Missense_Mutation_p.S168F	p.S265F	NM_017556	NP_060026	WXS	Illumina HiSeq	Unspecified	Q8WUP2	FBLI1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.56e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|READ - Rectum adenocarcinoma(331;0.0649)|STAD - Stomach adenocarcinoma(313;0.138)	8	1237	+		Colorectal(325;0.000257)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)	265			LIM zinc-binding 2.		B3KNY0|Q5VVE0|Q5VVE1|Q8IX23|Q96T00|Q9UFD6	Missense_Mutation	SNP	ENST00000375766.3	37	c.794C>T	CCDS163.1	.	.	.	.	.	.	.	.	.	.	C	16.91	3.251978	0.59212	.	.	ENSG00000162458	ENST00000375771;ENST00000375766;ENST00000400773;ENST00000441801;ENST00000332305	D;D;D;D;D	0.87809	-2.3;-2.3;-2.3;-2.3;-2.3	5.1	0.671	0.17929	Zinc finger, LIM-type (5);	1.233600	0.05315	N	0.525591	D	0.89079	0.6613	L	0.52905	1.665	0.09310	N	1	P;D;P	0.57571	0.771;0.98;0.831	B;P;P	0.56700	0.404;0.804;0.559	T	0.75701	-0.3226	10	0.56958	D	0.05	.	6.8845	0.24191	0.3847:0.2934:0.3219:0.0	.	168;265;265	Q8WUP2-3;Q8WUP2-2;Q8WUP2	.;.;FBLI1_HUMAN	F	265;265;168;265;168	ENSP00000364926:S265F;ENSP00000364921:S265F;ENSP00000383584:S168F;ENSP00000416387:S265F;ENSP00000364920:S168F	ENSP00000364920:S168F	S	+	2	0	FBLIM1	15973782	0.000000	0.05858	0.249000	0.24280	0.859000	0.49053	0.232000	0.17891	0.275000	0.22094	0.609000	0.83330	TCC		0.632	FBLIM1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008511.3	NM_001024215		10	95	0	0	0	0	10	95				
SPEN	23013	broad.mit.edu	37	1	16259153	16259153	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr1:16259153G>C	ENST00000375759.3	+	11	6622	c.6418G>C	c.(6418-6420)Gat>Cat	p.D2140H		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	2140	Interaction with MSX2. {ECO:0000250}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		GTTGAAAAGTGATCCAGTTGA	0.547																																						uc001axk.1		NA																	0				ovary(6)|breast(3)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15						c.(6418-6420)GAT>CAT		spen homolog, transcriptional regulator							96.0	100.0	98.0					1																	16259153		2203	4300	6503	SO:0001583	missense	23013				interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding	g.chr1:16259153G>C		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.6418G>C	1.37:g.16259153G>C	ENSP00000364912:p.Asp2140His		Somatic				SPEN_uc010obp.1_Missense_Mutation_p.D2099H	p.D2140H	NM_015001	NP_055816	WXS	Illumina HiSeq	Unspecified	Q96T58	MINT_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)	11	6622	+		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)	2140			Interaction with MSX2 (By similarity).		Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	ENST00000375759.3	37	c.6418G>C	CCDS164.1	.	.	.	.	.	.	.	.	.	.	G	4.406	0.075005	0.08485	.	.	ENSG00000065526	ENST00000375759	T	0.08896	3.04	5.16	3.99	0.46301	.	.	.	.	.	T	0.06508	0.0167	N	0.22421	0.69	0.09310	N	1	B	0.10296	0.003	B	0.11329	0.006	T	0.32534	-0.9903	9	0.62326	D	0.03	-1.3367	7.0555	0.25097	0.1173:0.158:0.7247:0.0	.	2140	Q96T58	MINT_HUMAN	H	2140	ENSP00000364912:D2140H	ENSP00000364912:D2140H	D	+	1	0	SPEN	16131740	0.999000	0.42202	0.003000	0.11579	0.845000	0.48019	3.309000	0.51903	0.843000	0.35070	0.462000	0.41574	GAT		0.547	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001		26	115	0	0	0	0	26	115				
IFNLR1	163702	broad.mit.edu	37	1	24484051	24484051	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr1:24484051C>T	ENST00000327535.1	-	7	1144	c.1132G>A	c.(1132-1134)Gaa>Aaa	p.E378K	IFNLR1_ENST00000374421.3_Missense_Mutation_p.E349K|IFNLR1_ENST00000327575.2_3'UTR	NM_170743.3|NM_173064.2	NP_734464.1|NP_775087.1	Q8IU57	INLR1_HUMAN	interferon, lambda receptor 1	378					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|mucosal immune response (GO:0002385)|negative regulation of cell proliferation (GO:0008285)|regulation of defense response to virus by host (GO:0050691)|response to type III interferon (GO:0034342)	integral component of membrane (GO:0016021)|interleukin-28 receptor complex (GO:0032002)											GAGGAGCCTTCGCTTGGGACC	0.627																																						uc001bis.2		NA																	0					0						c.(1132-1134)GAA>AAA		interleukin 28 receptor, alpha isoform 1							35.0	37.0	36.0					1																	24484051		2203	4300	6503	SO:0001583	missense	163702				cytokine-mediated signaling pathway|negative regulation of cell proliferation|regulation of defense response to virus by host	interleukin-28 receptor complex	protein binding|receptor activity	g.chr1:24484051C>T	AY129153	CCDS248.1, CCDS249.1, CCDS250.1	1p36.11	2012-11-27	2012-11-26	2012-11-26	ENSG00000185436	ENSG00000185436		"""Interferons"""	18584	protein-coding gene	gene with protein product	"""interferon lambda receptor 1"""	607404	"""interleukin 28 receptor, alpha"", ""interleukin 28 receptor, alpha (interferon, lambda receptor)"""	IL28RA			Standard	NM_173064		Approved	CRF2/12, IFNLR, IL-28R1	uc001bis.3	Q8IU57	OTTHUMG00000003036	ENST00000327535.1:c.1132G>A	1.37:g.24484051C>T	ENSP00000327824:p.Glu378Lys		Somatic				IL28RA_uc001bir.2_Missense_Mutation_p.E349K|IL28RA_uc001bit.2_3'UTR|IL28RA_uc001biu.2_Missense_Mutation_p.E294K	p.E378K	NM_170743	NP_734464	WXS	Illumina HiSeq	Unspecified	Q8IU57	I28RA_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;3.21e-24)|Colorectal(126;6.61e-08)|COAD - Colon adenocarcinoma(152;3.56e-06)|GBM - Glioblastoma multiforme(114;0.000132)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00918)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.185)	7	1145	-		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.00117)|all_lung(284;0.00151)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)	378			Cytoplasmic (Potential).		Q5VTX5|Q5VTX7|Q5VTX8|Q6ZML8|Q8IV66|Q8IZI7|Q8IZI8	Missense_Mutation	SNP	ENST00000327535.1	37	c.1132G>A	CCDS248.1	.	.	.	.	.	.	.	.	.	.	C	17.34	3.365390	0.61513	.	.	ENSG00000185436	ENST00000327535;ENST00000374421	.	.	.	5.52	1.41	0.22369	.	7.169420	0.00166	N	0.000000	T	0.39172	0.1068	L	0.56769	1.78	0.09310	N	1	B;B	0.27971	0.123;0.196	B;B	0.14578	0.005;0.011	T	0.14364	-1.0475	9	0.46703	T	0.11	0.0475	5.2643	0.15591	0.0:0.6019:0.1479:0.2503	.	378;349	Q8IU57;Q8IU57-2	I28RA_HUMAN;.	K	378;349	.	ENSP00000327824:E378K	E	-	1	0	IL28RA	24356638	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-0.136000	0.10405	0.073000	0.16731	-0.140000	0.14226	GAA		0.627	IFNLR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000008402.1	NM_170743		7	22	0	0	0	0	7	22				
SFN	2810	broad.mit.edu	37	1	27190100	27190100	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr1:27190100G>A	ENST00000339276.4	+	1	468	c.397G>A	c.(397-399)Gag>Aag	p.E133K		NM_006142.3	NP_006133.1	Q9Y3B8	ORN_HUMAN	stratifin	0	Exonuclease.				nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleobase-containing compound metabolic process (GO:0006139)|nucleotide metabolic process (GO:0009117)	focal adhesion (GO:0005925)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|nucleic acid binding (GO:0003676)	p.E133K(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|skin(2)	9		all_cancers(24;1.23e-26)|all_epithelial(13;1.19e-23)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Breast(348;0.00017)|Renal(390;0.0007)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.1e-52)|Epithelial(14;2.31e-52)|OV - Ovarian serous cystadenocarcinoma(117;8.22e-30)|Colorectal(126;1.31e-09)|COAD - Colon adenocarcinoma(152;3.45e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000501)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|READ - Rectum adenocarcinoma(331;0.0419)|GBM - Glioblastoma multiforme(114;0.0767)|Lung(427;0.215)		CTACCTGGCCGAGGTGGCCAC	0.622																																						uc001bnc.1		NA																	1	Substitution - Missense(1)		skin(1)		0						c.(397-399)GAG>AAG		stratifin							68.0	72.0	71.0					1																	27190100		2203	4300	6503	SO:0001583	missense	2810				DNA damage response, signal transduction resulting in induction of apoptosis|negative regulation of caspase activity|release of cytochrome c from mitochondria	cytoplasm|extracellular space|nucleus	protein domain specific binding|protein kinase C inhibitor activity	g.chr1:27190100G>A	BC023552	CCDS288.1	1p36.11	2008-02-05			ENSG00000175793	ENSG00000175793			10773	protein-coding gene	gene with protein product	"""14-3-3 sigma"""	601290				8515476	Standard	NM_006142		Approved	YWHAS	uc001bnc.1	P31947	OTTHUMG00000004093	ENST00000339276.4:c.397G>A	1.37:g.27190100G>A	ENSP00000340989:p.Glu133Lys		Somatic				uc010ofi.1_RNA	p.E133K	NM_006142	NP_006133	WXS	Illumina HiSeq	Unspecified	P31947	1433S_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.1e-52)|Epithelial(14;2.31e-52)|OV - Ovarian serous cystadenocarcinoma(117;8.22e-30)|Colorectal(126;1.31e-09)|COAD - Colon adenocarcinoma(152;3.45e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000501)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|READ - Rectum adenocarcinoma(331;0.0419)|GBM - Glioblastoma multiforme(114;0.0767)|Lung(427;0.215)	1	468	+		all_cancers(24;1.23e-26)|all_epithelial(13;1.19e-23)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Breast(348;0.00017)|Renal(390;0.0007)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)	133					B2R532|Q32Q18|Q53FT1|Q6FIC6|Q9UFY7	Missense_Mutation	SNP	ENST00000339276.4	37	c.397G>A	CCDS288.1	.	.	.	.	.	.	.	.	.	.	G	34	5.334630	0.95758	.	.	ENSG00000175793	ENST00000339276;ENST00000538651	T	0.65916	-0.18	5.96	5.96	0.96718	14-3-3 domain (4);	0.000000	0.85682	D	0.000000	D	0.88043	0.6331	H	0.98133	4.155	0.48395	D	0.999649	D	0.89917	1.0	D	0.97110	1.0	D	0.91652	0.5335	10	0.87932	D	0	-27.5872	20.0032	0.97426	0.0:0.0:1.0:0.0	.	133	P31947	1433S_HUMAN	K	133;101	ENSP00000340989:E133K	ENSP00000340989:E133K	E	+	1	0	SFN	27062687	1.000000	0.71417	0.988000	0.46212	0.932000	0.56968	9.864000	0.99589	2.813000	0.96785	0.655000	0.94253	GAG		0.622	SFN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011709.1	NM_006142		10	50	0	0	0	0	10	50				
SPOCD1	90853	broad.mit.edu	37	1	32257825	32257825	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr1:32257825C>T	ENST00000360482.2	-	15	3082	c.2953G>A	c.(2953-2955)Ggg>Agg	p.G985R	RP11-84A19.3_ENST00000527035.1_RNA|SPOCD1_ENST00000533231.1_Missense_Mutation_p.G985R|SPOCD1_ENST00000257100.3_Missense_Mutation_p.G478R|SPOCD1_ENST00000373648.2_3'UTR	NM_144569.4	NP_653170.3	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1	985					negative regulation of phosphatase activity (GO:0010923)|transcription, DNA-templated (GO:0006351)					NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(1)|lung(7)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	37		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		CCTGGGCCCCCCAAAGGGCGC	0.662																																						uc001bts.1		NA																	0				ovary(5)|breast(1)	6						c.(2953-2955)GGG>AGG		SPOC domain containing 1							17.0	18.0	17.0					1																	32257825		2198	4297	6495	SO:0001583	missense	90853				transcription, DNA-dependent			g.chr1:32257825C>T	AK058077	CCDS347.1, CCDS60066.1, CCDS72748.1	1p35.1	2014-06-13			ENSG00000134668	ENSG00000134668			26338	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 146"""					12477932	Standard	NM_144569		Approved	FLJ25348, PPP1R146	uc001bts.1	Q6ZMY3	OTTHUMG00000003879	ENST00000360482.2:c.2953G>A	1.37:g.32257825C>T	ENSP00000353670:p.Gly985Arg		Somatic				SPOCD1_uc001btr.1_Missense_Mutation_p.G73R|SPOCD1_uc001btt.2_Missense_Mutation_p.G290R|SPOCD1_uc001btu.2_Missense_Mutation_p.G985R|SPOCD1_uc001btv.2_Missense_Mutation_p.G478R	p.G985R	NM_144569	NP_653170	WXS	Illumina HiSeq	Unspecified	Q6ZMY3	SPOC1_HUMAN		STAD - Stomach adenocarcinoma(196;0.18)	15	3011	-		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)	985					Q24JU3|Q6PI90|Q8N869|Q8N8U0|Q8NBC6|Q96LN6	Missense_Mutation	SNP	ENST00000360482.2	37	c.2953G>A	CCDS347.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.961809	0.74016	.	.	ENSG00000134668	ENST00000257100;ENST00000360482;ENST00000452755;ENST00000533231	T;T;T;T	0.44482	0.92;1.83;0.93;1.89	5.42	4.44	0.53790	.	.	.	.	.	T	0.48259	0.1490	L	0.29908	0.895	0.80722	D	1	D;D;D;D	0.71674	0.995;0.996;0.996;0.998	D;P;D;D	0.68765	0.952;0.861;0.954;0.96	T	0.32295	-0.9912	9	0.39692	T	0.17	-2.5514	11.6313	0.51175	0.0:0.821:0.179:0.0	.	985;421;985;478	Q6ZMY3-2;E9PPM7;Q6ZMY3;Q6ZMY3-3	.;.;SPOC1_HUMAN;.	R	478;985;421;985	ENSP00000257100:G478R;ENSP00000353670:G985R;ENSP00000399778:G421R;ENSP00000435851:G985R	ENSP00000257100:G478R	G	-	1	0	SPOCD1	32030412	0.943000	0.32029	0.983000	0.44433	0.988000	0.76386	2.709000	0.47160	2.695000	0.91970	0.655000	0.94253	GGG		0.662	SPOCD1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000381912.1	NM_144569		3	7	0	0	0	0	3	7				
KPNA6	23633	broad.mit.edu	37	1	32622524	32622524	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr1:32622524C>G	ENST00000373625.3	+	3	302	c.209C>G	c.(208-210)tCt>tGt	p.S70C	KPNA6_ENST00000545542.1_Missense_Mutation_p.S75C|KPNA6_ENST00000469790.1_3'UTR|KPNA6_ENST00000537234.1_Missense_Mutation_p.S67C	NM_012316.4	NP_036448.1	O60684	IMA7_HUMAN	karyopherin alpha 6 (importin alpha 7)	70					maternal process involved in female pregnancy (GO:0060135)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			large_intestine(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				CTCATGGACTCTTATGTGAGC	0.458																																						uc001bug.2		NA																	0					0						c.(208-210)TCT>TGT		karyopherin alpha 6							136.0	126.0	130.0					1																	32622524		2203	4300	6503	SO:0001583	missense	23633				NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding	g.chr1:32622524C>G	AF060543	CCDS352.1	1p35.1	2013-02-14			ENSG00000025800	ENSG00000025800		"""Importins"", ""Armadillo repeat containing"""	6399	protein-coding gene	gene with protein product		610563				10523667	Standard	NM_012316		Approved	IPOA7, KPNA7, MGC17918, FLJ11249	uc001bug.3	O60684	OTTHUMG00000004333	ENST00000373625.3:c.209C>G	1.37:g.32622524C>G	ENSP00000362728:p.Ser70Cys		Somatic				KPNA6_uc001buh.2_5'UTR|KPNA6_uc010ogx.1_Missense_Mutation_p.S67C|KPNA6_uc010ogy.1_Missense_Mutation_p.S75C|KPNA6_uc009vtz.2_Missense_Mutation_p.S9C	p.S70C	NM_012316	NP_036448	WXS	Illumina HiSeq	Unspecified	O60684	IMA7_HUMAN			3	297	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)	70					B2RDC7|D3DPP5|Q5VVU3	Missense_Mutation	SNP	ENST00000373625.3	37	c.209C>G	CCDS352.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.995394	0.93167	.	.	ENSG00000025800	ENST00000373625;ENST00000373617;ENST00000537234;ENST00000545542;ENST00000446515	T;T;T;T	0.48522	0.81;0.81;0.81;2.35	5.39	5.39	0.77823	Importin-alpha, importin-beta-binding domain (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.052116	0.85682	D	0.000000	T	0.57666	0.2069	L	0.52573	1.65	0.80722	D	1	P;P;P	0.47677	0.531;0.586;0.899	P;P;P	0.51918	0.556;0.684;0.563	T	0.58741	-0.7583	10	0.62326	D	0.03	-9.9797	19.5354	0.95251	0.0:1.0:0.0:0.0	.	75;75;70	F5GYL8;B4DWX3;O60684	.;.;IMA7_HUMAN	C	70;44;67;75;21	ENSP00000362728:S70C;ENSP00000444930:S67C;ENSP00000440609:S75C;ENSP00000415677:S21C	ENSP00000362719:S44C	S	+	2	0	KPNA6	32395111	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.731000	0.84895	2.709000	0.92574	0.655000	0.94253	TCT		0.458	KPNA6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000012527.4	NM_012316		5	78	0	0	0	0	5	78				
DCDC2B	149069	broad.mit.edu	37	1	32678154	32678154	+	Silent	SNP	T	T	C	rs367842387		TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr1:32678154T>C	ENST00000409358.1	+	5	591	c.591T>C	c.(589-591)taT>taC	p.Y197Y		NM_001099434.1	NP_001092904.1	A2VCK2	DCD2B_HUMAN	doublecortin domain containing 2B	197	Doublecortin 2. {ECO:0000255|PROSITE- ProRule:PRU00072}.				intracellular signal transduction (GO:0035556)					breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)	11		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				GCCATTACTATGTGGCTGTCG	0.592																																						uc001bun.2		NA																	0					0						c.(589-591)TAT>TAC		doublecortin domain containing 2B		T		1,3981		0,1,1990	75.0	81.0	79.0		591	-7.4	0.8	1		79	0,8318		0,0,4159	no	coding-synonymous	DCDC2B	NM_001099434.1		0,1,6149	CC,CT,TT		0.0,0.0251,0.0081		197/350	32678154	1,12299	1991	4159	6150	SO:0001819	synonymous_variant	149069				intracellular signal transduction			g.chr1:32678154T>C	BC128073	CCDS44100.1	1p35.1	2008-05-13			ENSG00000222046	ENSG00000222046			32576	protein-coding gene	gene with protein product							Standard	NM_001099434		Approved		uc001bun.2	A2VCK2	OTTHUMG00000005741	ENST00000409358.1:c.591T>C	1.37:g.32678154T>C			Somatic					p.Y197Y	NM_001099434	NP_001092904	WXS	Illumina HiSeq	Unspecified	A2VCK2	DCD2B_HUMAN			5	591	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)	197			Doublecortin 2.		B7ZBC6	Silent	SNP	ENST00000409358.1	37	c.591T>C	CCDS44100.1																																																																																				0.592	DCDC2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328293.1	XM_940631		7	46	0	0	0	0	7	46				
MCOLN3	55283	broad.mit.edu	37	1	85488044	85488044	+	Missense_Mutation	SNP	T	T	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr1:85488044T>C	ENST00000370589.2	-	10	1187	c.1135A>G	c.(1135-1137)Act>Gct	p.T379A	MCOLN3_ENST00000474447.1_5'UTR|MCOLN3_ENST00000341115.4_Missense_Mutation_p.T323A|WDR63_ENST00000370596.1_Intron	NM_018298.10	NP_060768.8	Q8TDD5	MCLN3_HUMAN	mucolipin 3	379					auditory receptor cell differentiation (GO:0042491)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|locomotory behavior (GO:0007626)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T379P(1)		endometrium(6)|kidney(3)|large_intestine(9)|lung(12)|prostate(3)|skin(1)	34				all cancers(265;0.00957)|Epithelial(280;0.0254)		ATGGTAGAAGTCCCAAGAAGT	0.388																																						uc001dkp.2		NA																	1	Substitution - Missense(1)		large_intestine(1)	skin(1)	1						c.(1135-1137)ACT>GCT		mucolipin 3							87.0	82.0	83.0					1																	85488044		2203	4300	6503	SO:0001583	missense	55283					integral to membrane	ion channel activity	g.chr1:85488044T>C	AF475085	CCDS701.1, CCDS58009.1	1p22.3	2011-12-16			ENSG00000055732	ENSG00000055732		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13358	protein-coding gene	gene with protein product		607400				16382100	Standard	NM_018298		Approved	TRPML3, FLJ11006, TRP-ML3	uc001dkp.3	Q8TDD5	OTTHUMG00000009955	ENST00000370589.2:c.1135A>G	1.37:g.85488044T>C	ENSP00000359621:p.Thr379Ala		Somatic				MCOLN3_uc001dko.2_5'UTR|MCOLN3_uc001dkq.2_Missense_Mutation_p.T323A	p.T379A	NM_018298	NP_060768	WXS	Illumina HiSeq	Unspecified	Q8TDD5	MCLN3_HUMAN		all cancers(265;0.00957)|Epithelial(280;0.0254)	10	1228	-			379			Helical; (Potential).		Q5T4H5|Q5T4H6|Q9NV09	Missense_Mutation	SNP	ENST00000370589.2	37	c.1135A>G	CCDS701.1	.	.	.	.	.	.	.	.	.	.	T	17.32	3.359288	0.61403	.	.	ENSG00000055732	ENST00000370589;ENST00000302814;ENST00000370588;ENST00000341115	T;T	0.69435	-0.4;-0.4	5.73	5.73	0.89815	Polycystin cation channel, PKD1/PKD2 (1);	0.181563	0.64402	D	0.000016	T	0.60766	0.2294	M	0.84511	2.7	0.48975	D	0.999737	B;B	0.18968	0.026;0.032	B;B	0.26310	0.037;0.068	T	0.62305	-0.6882	10	0.25751	T	0.34	-1.9227	16.0087	0.80380	0.0:0.0:0.0:1.0	.	323;379	Q8TDD5-2;Q8TDD5	.;MCLN3_HUMAN	A	379;379;323;323	ENSP00000359621:T379A;ENSP00000342698:T323A	ENSP00000304843:T379A	T	-	1	0	MCOLN3	85260632	1.000000	0.71417	0.712000	0.30502	0.860000	0.49131	5.913000	0.69957	2.174000	0.68829	0.528000	0.53228	ACT		0.388	MCOLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027569.2	NM_018298		5	29	0	0	0	0	5	29				
COL11A1	1301	broad.mit.edu	37	1	103364318	103364318	+	Silent	SNP	A	A	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr1:103364318A>G	ENST00000370096.3	-	56	4464	c.4152T>C	c.(4150-4152)ggT>ggC	p.G1384G	COL11A1_ENST00000512756.1_Silent_p.G1268G|COL11A1_ENST00000353414.4_Silent_p.G1345G|COL11A1_ENST00000358392.2_Silent_p.G1396G	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1384	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		GACCTTCTGCACCTGCTTCCC	0.463																																						uc001dul.2		NA																	0				ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12						c.(4150-4152)GGT>GGC		alpha 1 type XI collagen isoform A							41.0	43.0	43.0					1																	103364318		2203	4300	6503	SO:0001819	synonymous_variant	1301				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging	g.chr1:103364318A>G	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.4152T>C	1.37:g.103364318A>G			Somatic				COL11A1_uc001duk.2_Silent_p.G580G|COL11A1_uc001dum.2_Silent_p.G1396G|COL11A1_uc001dun.2_Silent_p.G1345G|COL11A1_uc009weh.2_Silent_p.G1268G	p.G1384G	NM_001854	NP_001845	WXS	Illumina HiSeq	Unspecified	P12107	COBA1_HUMAN		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)	56	4470	-		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)	1384			Triple-helical region.		B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Silent	SNP	ENST00000370096.3	37	c.4152T>C	CCDS778.1																																																																																				0.463	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630		6	53	0	0	0	0	6	53				
NOTCH2	4853	broad.mit.edu	37	1	120462868	120462868	+	Silent	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr1:120462868C>G	ENST00000256646.2	-	30	5682	c.5463G>C	c.(5461-5463)gtG>gtC	p.V1821V	NOTCH2_ENST00000493703.1_5'Flank	NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	1821					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CACGGACATTCACATCTAACA	0.587			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																													uc001eik.2		NA		Dom	yes		1	1p13-p11	4853	N|F|Mis	Notch homolog 2			L			marginal zone lymphoma|DLBCL		0				lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27						c.(5461-5463)GTG>GTC		notch 2 preproprotein							107.0	78.0	88.0					1																	120462868		2203	4300	6503	SO:0001819	synonymous_variant	4853	Alagille_Syndrome	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity	g.chr1:120462868C>G	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.5463G>C	1.37:g.120462868C>G			Somatic					p.V1821V	NM_024408	NP_077719	WXS	Illumina HiSeq	Unspecified	Q04721	NOTC2_HUMAN		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)	30	5719	-	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)	1821			Cytoplasmic (Potential).		Q5T3X7|Q99734|Q9H240	Silent	SNP	ENST00000256646.2	37	c.5463G>C	CCDS908.1																																																																																				0.587	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408		4	28	0	0	0	0	4	28				
PSMD4	5710	broad.mit.edu	37	1	151234661	151234661	+	Silent	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr1:151234661G>A	ENST00000368884.3	+	2	131	c.51G>A	c.(49-51)cgG>cgA	p.R17R	PSMD4_ENST00000368881.4_Silent_p.R17R	NM_002810.2	NP_002801.1	P55036	PSMD4_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 4	17	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle, base subcomplex (GO:0008540)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(1)|lung(7)	11	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			AGTATATGCGGAATGGAGACT	0.493																																						uc001exl.2		NA																	0					0						c.(49-51)CGG>CGA		proteasome 26S non-ATPase subunit 4							109.0	101.0	104.0					1																	151234661		2203	4300	6503	SO:0001819	synonymous_variant	5710				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA repair|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of transcription, DNA-dependent|S phase of mitotic cell cycle|viral reproduction	proteasome complex	protein binding|zinc ion binding	g.chr1:151234661G>A	U51007	CCDS991.1	1q21.2	2008-05-22			ENSG00000159352	ENSG00000159352		"""Proteasome (prosome, macropain) subunits"""	9561	protein-coding gene	gene with protein product		601648				8641424	Standard	XM_005245354		Approved	S5A, AF-1, AF, Rpn10	uc001exl.3	P55036	OTTHUMG00000012349	ENST00000368884.3:c.51G>A	1.37:g.151234661G>A			Somatic				PSMD4_uc001exn.2_Silent_p.R17R	p.R17R	NM_002810	NP_002801	WXS	Illumina HiSeq	Unspecified	P55036	PSMD4_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)		2	113	+	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		17			VWFA.		D3DV16|Q5VWC5|Q9NS92	Silent	SNP	ENST00000368884.3	37	c.51G>A	CCDS991.1																																																																																				0.493	PSMD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034409.3	NM_002810		11	93	0	0	0	0	11	93				
CELF3	11189	broad.mit.edu	37	1	151680372	151680372	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr1:151680372C>G	ENST00000290583.4	-	6	1319	c.526G>C	c.(526-528)Gag>Cag	p.E176Q	CELF3_ENST00000392706.3_5'UTR|AL589765.1_ENST00000442233.2_5'Flank|RIIAD1_ENST00000326413.3_5'Flank|RP11-98D18.1_ENST00000457548.1_RNA|CELF3_ENST00000470688.1_5'UTR|CELF3_ENST00000290585.4_Missense_Mutation_p.E176Q	NM_001172648.1|NM_007185.4	NP_001166119.1|NP_009116.3	Q5SZQ8	CELF3_HUMAN	CUGBP, Elav-like family member 3	176					mRNA splicing, via spliceosome (GO:0000398)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	21						CGCTCCTTCTCAGTGTCAGCA	0.642																																						uc001eys.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(526-528)GAG>CAG		trinucleotide repeat containing 4							60.0	51.0	54.0					1																	151680372		2203	4300	6503	SO:0001583	missense	11189				nuclear mRNA splicing, via spliceosome|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	mRNA binding|nucleotide binding	g.chr1:151680372C>G	U80759	CCDS1002.1, CCDS53367.1	1q21	2013-02-12	2010-02-19	2010-02-19	ENSG00000159409	ENSG00000159409		"""Trinucleotide (CAG) repeat containing"", ""RNA binding motif (RRM) containing"""	11967	protein-coding gene	gene with protein product	"""expanded repeat domain, CAG/CTG 4"", ""CAG repeat domain"", ""CUG-BP and ETR-3 like factor 3"""	612678	"""trinucleotide repeat containing 4"""	TNRC4		9225980	Standard	XM_005244859		Approved	CAGH4, BRUNOL1, ERDA4, MGC57297	uc001eys.2	Q5SZQ8	OTTHUMG00000013064	ENST00000290583.4:c.526G>C	1.37:g.151680372C>G	ENSP00000290583:p.Glu176Gln		Somatic				CELF3_uc010pdh.1_5'UTR|CELF3_uc001eyr.2_Missense_Mutation_p.E175Q|CELF3_uc009wmy.2_Missense_Mutation_p.E176Q|CELF3_uc009wmx.1_Missense_Mutation_p.E176Q|CELF3_uc001eyt.2_Missense_Mutation_p.E99Q|C1orf230_uc001eyu.2_5'Flank	p.E176Q	NM_007185	NP_009116	WXS	Illumina HiSeq	Unspecified	Q5SZQ8	CELF3_HUMAN			6	1320	-			176					B7ZKK6|O15414|Q499Y6|Q5SZQ7|Q6NVK0|Q8IZ98|Q9BZC2|Q9HB30	Missense_Mutation	SNP	ENST00000290583.4	37	c.526G>C	CCDS1002.1	.	.	.	.	.	.	.	.	.	.	.	12.61	1.988826	0.35131	.	.	ENSG00000159409	ENST00000290585;ENST00000290583;ENST00000368833	T;T	0.05925	3.37;3.37	3.75	3.75	0.43078	Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	T	0.11324	0.0276	M	0.76727	2.345	0.80722	D	1	D;B;D;P;P	0.67145	0.983;0.313;0.996;0.687;0.545	P;B;D;B;B	0.66497	0.697;0.177;0.944;0.178;0.209	T	0.26052	-1.0114	10	0.12103	T	0.63	-12.4867	14.6626	0.68882	0.0:1.0:0.0:0.0	.	176;176;175;176;175	Q5SZQ7;Q5SZQ8-2;F8W6B7;Q5SZQ8;Q5SZQ8-3	.;.;.;CELF3_HUMAN;.	Q	176;176;175	ENSP00000290585:E176Q;ENSP00000290583:E176Q	ENSP00000290583:E176Q	E	-	1	0	CELF3	149946996	1.000000	0.71417	0.877000	0.34402	0.751000	0.42716	5.804000	0.69135	2.098000	0.63641	0.655000	0.94253	GAG		0.642	CELF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036663.2	NM_007185		4	27	0	0	0	0	4	27				
KIAA0907	22889	broad.mit.edu	37	1	155893435	155893435	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr1:155893435C>T	ENST00000368321.3	-	8	960	c.937G>A	c.(937-939)Gag>Aag	p.E313K	KIAA0907_ENST00000482337.1_5'UTR|KIAA0907_ENST00000368320.3_Missense_Mutation_p.E313K|SCARNA4_ENST00000516999.1_RNA|KIAA0907_ENST00000368319.3_Missense_Mutation_p.E313K	NM_014949.2	NP_055764.2	Q7Z7F0	K0907_HUMAN	KIAA0907	313							RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|urinary_tract(1)	21	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;8.82e-06)			AAAAGATTCTCACAAAGCTTC	0.388																																						uc001fmi.1		NA																	0					0						c.(937-939)GAG>AAG		hypothetical protein LOC22889							101.0	104.0	103.0					1																	155893435		2203	4300	6503	SO:0001583	missense	22889							g.chr1:155893435C>T	BC062637	CCDS30885.1	1q22	2012-11-30			ENSG00000132680	ENSG00000132680			29145	protein-coding gene	gene with protein product						10048485	Standard	NM_014949		Approved	BLOM7	uc001fmi.1	Q7Z7F0	OTTHUMG00000014103	ENST00000368321.3:c.937G>A	1.37:g.155893435C>T	ENSP00000357304:p.Glu313Lys		Somatic				KIAA0907_uc001fmj.1_Missense_Mutation_p.E313K|KIAA0907_uc009wrk.1_Missense_Mutation_p.E170K|KIAA0907_uc009wrl.1_RNA|KIAA0907_uc001fml.1_Missense_Mutation_p.E313K	p.E313K	NM_014949	NP_055764	WXS	Illumina HiSeq	Unspecified	Q7Z7F0	K0907_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;8.82e-06)		8	961	-	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		313					O94981|Q7L7Q2|Q7Z7E9|Q8TBQ0	Missense_Mutation	SNP	ENST00000368321.3	37	c.937G>A	CCDS30885.1	.	.	.	.	.	.	.	.	.	.	C	35	5.421043	0.96111	.	.	ENSG00000132680	ENST00000368321;ENST00000368320;ENST00000368319	T;T;T	0.47869	0.83;0.83;0.83	5.78	5.78	0.91487	.	0.051571	0.85682	D	0.000000	T	0.56247	0.1972	M	0.69358	2.11	0.80722	D	1	B;P;P	0.49090	0.19;0.919;0.704	B;P;P	0.54706	0.123;0.759;0.495	T	0.55515	-0.8129	10	0.52906	T	0.07	-12.3968	19.6068	0.95584	0.0:1.0:0.0:0.0	.	313;313;313	Q7Z7F0-3;Q7Z7F0-2;Q7Z7F0	.;.;K0907_HUMAN	K	313	ENSP00000357304:E313K;ENSP00000357303:E313K;ENSP00000357302:E313K	ENSP00000357302:E313K	E	-	1	0	KIAA0907	154160059	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	5.697000	0.68295	2.742000	0.94016	0.650000	0.86243	GAG		0.388	KIAA0907-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039583.1	NM_014949		13	56	0	0	0	0	13	56				
SMG5	23381	broad.mit.edu	37	1	156238112	156238112	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr1:156238112C>T	ENST00000361813.5	-	8	952	c.808G>A	c.(808-810)Gag>Aag	p.E270K	SMG5_ENST00000489907.2_5'Flank|SMG5_ENST00000368267.5_Missense_Mutation_p.E270K	NM_015327.2	NP_056142.2	Q9UPR3	SMG5_HUMAN	SMG5 nonsense mediated mRNA decay factor	270					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(3)|endometrium(8)|kidney(2)|large_intestine(7)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	48	Hepatocellular(266;0.158)					TTCCGAGTCTCACACTTCTTC	0.532																																						uc001foc.3		NA																	0				ovary(2)|skin(2)|pancreas(1)	5						c.(808-810)GAG>AAG		SMG5 homolog nonsense mediated mRNA decay							259.0	254.0	256.0					1																	156238112		2203	4300	6503	SO:0001583	missense	23381				mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation	cytoplasm|nucleus	protein phosphatase 2A binding	g.chr1:156238112C>T	AB029012	CCDS1137.1	1q21	2013-07-02	2013-07-02		ENSG00000198952	ENSG00000198952			24644	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog B (S. cerevisiae)"""	610962	"""smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)"""			12676087, 12699629	Standard	NM_015327		Approved	KIAA1089, LPTS-RP1, LPTSRP1, RP11-54H19.7, SMG-5, EST1B	uc001foc.4	Q9UPR3	OTTHUMG00000017491	ENST00000361813.5:c.808G>A	1.37:g.156238112C>T	ENSP00000355261:p.Glu270Lys		Somatic					p.E270K	NM_015327	NP_056142	WXS	Illumina HiSeq	Unspecified	Q9UPR3	SMG5_HUMAN			8	957	-	Hepatocellular(266;0.158)		270					D3DVB7|Q5QJE7|Q659C7|Q8IXC0|Q8IY09|Q96IJ7	Missense_Mutation	SNP	ENST00000361813.5	37	c.808G>A	CCDS1137.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.000054	0.74818	.	.	ENSG00000198952	ENST00000361813;ENST00000368267	T;T	0.33865	1.39;1.39	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.23806	0.0576	L	0.39020	1.185	0.80722	D	1	B	0.26258	0.145	B	0.34346	0.18	T	0.03148	-1.1067	10	0.36615	T	0.2	-34.7524	18.1308	0.89600	0.0:1.0:0.0:0.0	.	270	Q9UPR3	SMG5_HUMAN	K	270	ENSP00000355261:E270K;ENSP00000357250:E270K	ENSP00000355261:E270K	E	-	1	0	SMG5	154504736	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.271000	0.78506	2.865000	0.98341	0.655000	0.94253	GAG		0.532	SMG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046308.1	NM_015327		38	267	0	0	0	0	38	267				
BCAN	63827	broad.mit.edu	37	1	156618362	156618362	+	Missense_Mutation	SNP	G	G	C	rs561459726		TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr1:156618362G>C	ENST00000329117.5	+	6	1108	c.772G>C	c.(772-774)Gaa>Caa	p.E258Q	BCAN_ENST00000361588.5_Missense_Mutation_p.E258Q|RP11-284F21.7_ENST00000448869.1_RNA	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican	258	Link 2. {ECO:0000255|PROSITE- ProRule:PRU00323}.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					ccacCCAGGAGAACTGTTCCT	0.592																																						uc001fpp.2		NA																	0				ovary(1)|pancreas(1)	2						c.(772-774)GAA>CAA		brevican isoform 1							65.0	67.0	67.0					1																	156618362		2203	4300	6503	SO:0001583	missense	63827				cell adhesion	anchored to membrane|proteinaceous extracellular matrix	hyaluronic acid binding|sugar binding	g.chr1:156618362G>C	BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	ENST00000329117.5:c.772G>C	1.37:g.156618362G>C	ENSP00000331210:p.Glu258Gln		Somatic				BCAN_uc001fpo.2_Missense_Mutation_p.E258Q	p.E258Q	NM_021948	NP_068767	WXS	Illumina HiSeq	Unspecified	Q96GW7	PGCB_HUMAN			6	1108	+	all_hematologic(923;0.088)|Hepatocellular(266;0.158)		258			Link 2.		D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	Missense_Mutation	SNP	ENST00000329117.5	37	c.772G>C	CCDS1149.1	.	.	.	.	.	.	.	.	.	.	G	15.18	2.756966	0.49362	.	.	ENSG00000132692	ENST00000255029;ENST00000329117;ENST00000424639;ENST00000361588	T;T;T	0.11277	2.79;2.79;2.79	4.65	4.65	0.58169	C-type lectin fold (1);Link (3);	0.183568	0.32055	N	0.006647	T	0.20414	0.0491	L	0.53249	1.67	0.53005	D	0.999964	D;P	0.76494	0.999;0.88	D;P	0.79108	0.992;0.703	T	0.00668	-1.1618	10	0.62326	D	0.03	-17.1958	16.2642	0.82565	0.0:0.0:1.0:0.0	.	258;258	Q96GW7;Q96GW7-2	PGCB_HUMAN;.	Q	199;258;156;258	ENSP00000331210:E258Q;ENSP00000401709:E156Q;ENSP00000354925:E258Q	ENSP00000255029:E199Q	E	+	1	0	BCAN	154884986	1.000000	0.71417	1.000000	0.80357	0.032000	0.12392	6.468000	0.73551	2.415000	0.81967	0.555000	0.69702	GAA		0.592	BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081844.2	NM_021948		11	80	0	0	0	0	11	80				
NES	10763	broad.mit.edu	37	1	156641455	156641455	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr1:156641455G>C	ENST00000368223.3	-	4	2657	c.2525C>G	c.(2524-2526)tCt>tGt	p.S842C		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	842	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					AGTTTCTGGAGATTTCAGTGT	0.433																																						uc001fpq.2		NA																	0				ovary(6)	6						c.(2524-2526)TCT>TGT		nestin							121.0	119.0	120.0					1																	156641455		2203	4300	6503	SO:0001583	missense	10763				brain development|embryonic camera-type eye development|G2/M transition of mitotic cell cycle|negative regulation of apoptosis|positive regulation of intermediate filament depolymerization|positive regulation of neural precursor cell proliferation|stem cell proliferation	cytoplasm|intermediate filament	intermediate filament binding|structural molecule activity	g.chr1:156641455G>C	X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.2525C>G	1.37:g.156641455G>C	ENSP00000357206:p.Ser842Cys		Somatic					p.S842C	NM_006617	NP_006608	WXS	Illumina HiSeq	Unspecified	P48681	NEST_HUMAN			4	2658	-	all_hematologic(923;0.088)|Hepatocellular(266;0.158)		842			Tail.		O00552|Q3LIF5|Q5SYZ6	Missense_Mutation	SNP	ENST00000368223.3	37	c.2525C>G	CCDS1151.1	.	.	.	.	.	.	.	.	.	.	G	16.10	3.027382	0.54683	.	.	ENSG00000132688	ENST00000368223	D	0.87650	-2.28	5.1	3.2	0.36748	.	.	.	.	.	T	0.71634	0.3363	L	0.50333	1.59	0.09310	N	1	B	0.24186	0.099	B	0.25405	0.06	T	0.66536	-0.5899	9	0.87932	D	0	.	7.2761	0.26286	0.0928:0.1689:0.7384:0.0	.	842	P48681	NEST_HUMAN	C	842	ENSP00000357206:S842C	ENSP00000357206:S842C	S	-	2	0	NES	154908079	0.018000	0.18449	0.000000	0.03702	0.161000	0.22273	1.557000	0.36299	0.535000	0.28714	0.563000	0.77884	TCT		0.433	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082844.2	NM_006617		12	126	0	0	0	0	12	126				
IFI16	3428	broad.mit.edu	37	1	159019357	159019357	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr1:159019357C>G	ENST00000295809.7	+	9	1888	c.1633C>G	c.(1633-1635)Cca>Gca	p.P545A	IFI16_ENST00000368132.3_Missense_Mutation_p.P489A|IFI16_ENST00000448393.2_Intron|IFI16_ENST00000359709.3_Missense_Mutation_p.P489A|IFI16_ENST00000430894.2_Missense_Mutation_p.P493A|IFI16_ENST00000340979.6_Intron|IFI16_ENST00000368131.4_Intron			Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	545					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of innate immune response (GO:0002218)|autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular response to glucose starvation (GO:0042149)|cellular response to ionizing radiation (GO:0071479)|defense response to virus (GO:0051607)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|monocyte differentiation (GO:0030224)|myeloid cell differentiation (GO:0030099)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|negative regulation of DNA binding (GO:0043392)|negative regulation of innate immune response (GO:0045824)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|positive regulation of cytokine production (GO:0001819)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of autophagy (GO:0010506)|regulation of gene expression, epigenetic (GO:0040029)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0429)					TCAGATGCCTCCATCAACACC	0.493																																						uc001ftg.2		NA																	0				ovary(1)	1						c.(1465-1467)CCA>GCA		interferon, gamma-inducible protein 16							90.0	86.0	87.0					1																	159019357		692	1590	2282	SO:0001583	missense	3428				cell proliferation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|monocyte differentiation|negative regulation of transcription, DNA-dependent|response to virus|transcription, DNA-dependent	cytoplasm|nuclear speck|nucleolus	double-stranded DNA binding|protein binding	g.chr1:159019357C>G	M63838	CCDS1180.3, CCDS58039.1	1q22	2008-02-05			ENSG00000163565	ENSG00000163565			5395	protein-coding gene	gene with protein product		147586				1526658, 7959953	Standard	NM_005531		Approved	IFNGIP1, PYHIN2	uc010pis.2	Q16666	OTTHUMG00000037108	ENST00000295809.7:c.1633C>G	1.37:g.159019357C>G	ENSP00000295809:p.Pro545Ala		Somatic				IFI16_uc010pis.1_Missense_Mutation_p.P489A|IFI16_uc001fth.2_Intron|IFI16_uc010pit.1_Intron	p.P489A	NM_005531	NP_005522	WXS	Illumina HiSeq	Unspecified	Q16666	IF16_HUMAN			8	1755	+	all_hematologic(112;0.0429)		489					B4DJT8|H3BLV7|Q59GX0|Q5T3W7|Q5T3W8|Q5T3X0|Q5T3X1|Q5T3X2|Q8N9E5|Q8NEQ7|Q96AJ5|Q9UH78	Missense_Mutation	SNP	ENST00000295809.7	37	c.1465C>G		.	.	.	.	.	.	.	.	.	.	C	3.648	-0.072208	0.07228	.	.	ENSG00000163565	ENST00000295809;ENST00000368132;ENST00000430894	T;T;T	0.05025	3.51;3.52;3.51	2.4	0.414	0.16406	.	.	.	.	.	T	0.01254	0.0041	N	0.19112	0.55	0.09310	N	0.999998	P;P	0.40107	0.578;0.703	B;B	0.37731	0.217;0.257	T	0.45818	-0.9235	9	0.52906	T	0.07	.	3.9523	0.09374	0.0:0.6048:0.246:0.1493	.	493;489	E7EPR3;Q16666-2	.;.	A	545;489;493	ENSP00000295809:P545A;ENSP00000357114:P489A;ENSP00000394935:P493A	ENSP00000295809:P545A	P	+	1	0	IFI16	157285981	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	-0.704000	0.05058	0.107000	0.17824	-0.265000	0.10407	CCA		0.493	IFI16-013	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000421720.1	NM_005531		13	159	0	0	0	0	13	159				
USF1	7391	broad.mit.edu	37	1	161011934	161011934	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr1:161011934C>T	ENST00000368021.3	-	5	452	c.248G>A	c.(247-249)gGc>gAc	p.G83D	USF1_ENST00000368019.1_Missense_Mutation_p.G83D|USF1_ENST00000368020.1_Missense_Mutation_p.G83D|USF1_ENST00000435396.1_Missense_Mutation_p.G24D	NM_007122.3	NP_009053.1	P22415	USF1_HUMAN	upstream transcription factor 1	83					carbon catabolite regulation of transcription (GO:0045990)|cellular response to insulin stimulus (GO:0032869)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|late viral transcription (GO:0019086)|lipid homeostasis (GO:0055088)|negative regulation of fibrinolysis (GO:0051918)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by glucose (GO:0000432)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter by glucose (GO:0000430)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|large_intestine(3)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9	all_cancers(52;6.73e-18)|Breast(13;0.012)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			GGCAGGGTAGCCACTGATGGC	0.547																																						uc001fxi.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						c.(247-249)GGC>GAC		upstream stimulatory factor 1 isoform 1							67.0	60.0	62.0					1																	161011934		2203	4300	6503	SO:0001583	missense	7391				cellular response to insulin stimulus|glucose homeostasis|late viral mRNA transcription|lipid homeostasis|positive regulation of transcription from RNA polymerase II promoter by glucose|response to hypoxia|response to UV	transcription factor complex	bHLH transcription factor binding|histone deacetylase binding|protein heterodimerization activity|protein homodimerization activity|protein kinase binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity	g.chr1:161011934C>T	BC035505	CCDS1214.1	1q22-q23	2013-05-21			ENSG00000158773	ENSG00000158773		"""Basic helix-loop-helix proteins"""	12593	protein-coding gene	gene with protein product		191523				8486371	Standard	NM_007122		Approved	UEF, MLTFI, bHLHb11	uc031pqv.1	P22415	OTTHUMG00000031472	ENST00000368021.3:c.248G>A	1.37:g.161011934C>T	ENSP00000357000:p.Gly83Asp		Somatic				USF1_uc001fxj.2_Missense_Mutation_p.G24D	p.G83D	NM_007122	NP_009053	WXS	Illumina HiSeq	Unspecified	P22415	USF1_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00122)		5	443	-	all_cancers(52;6.73e-18)|Breast(13;0.012)|all_hematologic(112;0.093)		83					B2RBZ4|Q5SY46|Q7Z5Y1	Missense_Mutation	SNP	ENST00000368021.3	37	c.248G>A	CCDS1214.1	.	.	.	.	.	.	.	.	.	.	C	17.31	3.356019	0.61293	.	.	ENSG00000158773	ENST00000368020;ENST00000368021;ENST00000435396;ENST00000368019;ENST00000531842;ENST00000534633	D;D;D;D;D	0.93307	-3.17;-3.17;-3.2;-3.16;-2.79	4.91	4.91	0.64330	.	0.181621	0.47852	D	0.000213	D	0.89262	0.6665	M	0.64404	1.975	0.80722	D	1	B	0.17667	0.023	B	0.21708	0.036	D	0.86833	0.2012	10	0.44086	T	0.13	-9.3936	15.6393	0.76984	0.0:1.0:0.0:0.0	.	83	P22415	USF1_HUMAN	D	83;83;24;83;83;24	ENSP00000356999:G83D;ENSP00000357000:G83D;ENSP00000390109:G24D;ENSP00000356998:G83D;ENSP00000435005:G83D	ENSP00000356998:G83D	G	-	2	0	USF1	159278558	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.951000	0.49089	2.552000	0.86080	0.514000	0.50259	GGC		0.547	USF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077050.1	NM_007122		7	54	0	0	0	0	7	54				
PFDN2	5202	broad.mit.edu	37	1	161070553	161070553	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr1:161070553C>T	ENST00000368010.3	-	4	469	c.385G>A	c.(385-387)Gaa>Aaa	p.E129K	PFDN2_ENST00000468311.1_5'UTR	NM_012394.3	NP_036526.2	Q9UHV9	PFD2_HUMAN	prefoldin subunit 2	129					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	unfolded protein binding (GO:0051082)			lung(1)|skin(1)	2	all_cancers(52;1.84e-19)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			TTCTCATCTTCTCCCATGAGA	0.493																																						uc001fxu.2		NA																	0					0						c.(385-387)GAA>AAA		prefoldin subunit 2							148.0	137.0	141.0					1																	161070553		2203	4300	6503	SO:0001583	missense	5202				'de novo' posttranslational protein folding	prefoldin complex	unfolded protein binding	g.chr1:161070553C>T	AF165883	CCDS1217.1	1q23.3	2008-02-05	2006-02-24		ENSG00000143256	ENSG00000143256			8867	protein-coding gene	gene with protein product		613466	"""prefoldin 2"""			10051400	Standard	NM_012394		Approved		uc001fxu.3	Q9UHV9	OTTHUMG00000031481	ENST00000368010.3:c.385G>A	1.37:g.161070553C>T	ENSP00000356989:p.Glu129Lys		Somatic					p.E129K	NM_012394	NP_036526	WXS	Illumina HiSeq	Unspecified	Q9UHV9	PFD2_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00165)		4	435	-	all_cancers(52;1.84e-19)|Breast(13;0.00188)|all_hematologic(112;0.093)		129					Q9P0P7|Q9UN05	Missense_Mutation	SNP	ENST00000368010.3	37	c.385G>A	CCDS1217.1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.962955	0.92791	.	.	ENSG00000143256	ENST00000368010	.	.	.	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.73016	0.3533	M	0.69823	2.125	0.80722	D	1	D	0.65815	0.995	D	0.67231	0.95	T	0.74802	-0.3541	9	0.62326	D	0.03	-13.5507	16.3815	0.83462	0.0:1.0:0.0:0.0	.	129	Q9UHV9	PFD2_HUMAN	K	129	.	ENSP00000356989:E129K	E	-	1	0	PFDN2	159337177	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	6.289000	0.72696	2.724000	0.93272	0.561000	0.74099	GAA		0.493	PFDN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077100.1	NM_012394		11	94	0	0	0	0	11	94				
FCGR3A	2214	broad.mit.edu	37	1	161569462	161569462	+	Intron	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr1:161569462G>A	ENST00000540048.1	-	2	94				FCGR2B_ENST00000367960.5_Intron|FCGR2B_ENST00000403078.3_Intron|FCGR2C_ENST00000543859.1_RNA|RP11-25K21.6_ENST00000537821.2_RNA|FCGR2C_ENST00000466542.2_RNA|FCGR2B_ENST00000428605.2_Intron|FCGR2B_ENST00000367962.4_Intron			P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor (CD16a)						Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	gagacaacctgaagaaaccaa	0.453																																						uc001gav.2		NA																	0					0						c.(841-843)GAA>AAA		Fc fragment of IgG, low affinity IIc, receptor							89.0	89.0	89.0					1																	161569462		2190	4298	6488	SO:0001627	intron_variant	9103							g.chr1:161569462G>A	BC036723	CCDS1232.1, CCDS44266.1	1q23	2014-09-17	2005-02-02		ENSG00000203747	ENSG00000203747		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3619	protein-coding gene	gene with protein product		146740	"""Fc fragment of IgG, low affinity IIIa, receptor for (CD16)"""	FCGR3, FCG3		2139735	Standard	NM_001127592		Approved	CD16, CD16a	uc001gar.3	P08637	OTTHUMG00000034466	ENST00000540048.1:c.61+30695C>T	1.37:g.161569462G>A			Somatic					p.E281K	NM_201563	NP_963857	WXS	Illumina HiSeq	Unspecified			BRCA - Breast invasive adenocarcinoma(70;0.00376)		8	940	+	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)							A2N6W9|Q53FJ0|Q53FL6|Q5EBR4|Q65ZM6|Q6PIJ0	Missense_Mutation	SNP	ENST00000540048.1	37	c.841G>A																																																																																					0.453	FCGR3A-203	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_000569		5	68	0	0	0	0	5	68				
DDR2	4921	broad.mit.edu	37	1	162741855	162741855	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr1:162741855G>C	ENST00000367922.3	+	14	1984	c.1546G>C	c.(1546-1548)Gag>Cag	p.E516Q	DDR2_ENST00000367921.3_Missense_Mutation_p.E516Q	NM_001014796.1	NP_001014796.1	Q16832	DDR2_HUMAN	discoidin domain receptor tyrosine kinase 2	516					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|chondrocyte proliferation (GO:0035988)|collagen fibril organization (GO:0030199)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|endochondral bone growth (GO:0003416)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autophosphorylation (GO:0046777)|regulation of bone mineralization (GO:0030500)|regulation of extracellular matrix disassembly (GO:0010715)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(2)|kidney(1)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)		Regorafenib(DB08896)	CAGTGGCCCTGAGGGGGTGCC	0.587																																					NSCLC(161;314 2006 8283 19651 23192)	uc001gcf.2		NA																	0				lung(2)|central_nervous_system(2)|ovary(1)|kidney(1)	6						c.(1546-1548)GAG>CAG		discoidin domain receptor family, member 2							43.0	36.0	38.0					1																	162741855		2203	4300	6503	SO:0001583	missense	4921				cell adhesion	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr1:162741855G>C	AK095975	CCDS1241.1	1q12-q23	2009-07-10	2008-01-23		ENSG00000162733	ENSG00000162733	2.7.10.1		2731	protein-coding gene	gene with protein product		191311	"""discoidin domain receptor family, member 2"""	TYRO10, NTRKR3		9659899	Standard	XM_005245221		Approved	TKT	uc001gcg.3	Q16832	OTTHUMG00000034423	ENST00000367922.3:c.1546G>C	1.37:g.162741855G>C	ENSP00000356899:p.Glu516Gln		Somatic				DDR2_uc001gcg.2_Missense_Mutation_p.E516Q	p.E516Q	NM_001014796	NP_001014796	WXS	Illumina HiSeq	Unspecified	Q16832	DDR2_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.113)		14	2011	+	all_hematologic(112;0.115)		516			Cytoplasmic (Potential).		Q7Z730	Missense_Mutation	SNP	ENST00000367922.3	37	c.1546G>C	CCDS1241.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.1|24.1	4.496249|4.496249	0.85069|0.85069	.|.	.|.	ENSG00000162733|ENSG00000162733	ENST00000367922;ENST00000367921|ENST00000433757	D;D|.	0.83506|.	-1.73;-1.73|.	5.42|5.42	5.42|5.42	0.78866|0.78866	.|.	0.203157|.	0.51477|.	D|.	0.000093|.	T|.	0.27241|.	0.0668|.	N|N	0.08118|0.08118	0|0	0.31099|.	N|.	0.710612|.	P|.	0.34615|.	0.459|.	B|.	0.30943|.	0.122|.	T|.	0.22277|.	-1.0221|.	9|.	0.19147|.	T|.	0.46|.	.|.	17.7947|17.7947	0.88566|0.88566	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	516|.	Q16832|.	DDR2_HUMAN|.	Q|S	516|108	ENSP00000356899:E516Q;ENSP00000356898:E516Q|.	ENSP00000356898:E516Q|.	E|X	+|+	1|2	0|2	DDR2|DDR2	161008479|161008479	1.000000|1.000000	0.71417|0.71417	0.983000|0.983000	0.44433|0.44433	0.991000|0.991000	0.79684|0.79684	9.338000|9.338000	0.96553|0.96553	2.536000|2.536000	0.85505|0.85505	0.655000|0.655000	0.94253|0.94253	GAG|TGA		0.587	DDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083213.2	NM_006182		3	33	0	0	0	0	3	33				
UCK2	7371	broad.mit.edu	37	1	165872469	165872469	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr1:165872469C>G	ENST00000367879.4	+	5	853	c.550C>G	c.(550-552)Cag>Gag	p.Q184E	UCK2_ENST00000469256.2_Missense_Mutation_p.Q34E|UCK2_ENST00000470820.1_Missense_Mutation_p.Q34E|UCK2_ENST00000372212.4_3'UTR|RP11-525G13.2_ENST00000455257.2_RNA|UCK2_ENST00000462329.1_3'UTR	NM_012474.4	NP_036606.2	Q9BZX2	UCK2_HUMAN	uridine-cytidine kinase 2	184					cellular response to oxygen levels (GO:0071453)|CTP salvage (GO:0044211)|feeding behavior (GO:0007631)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|response to axon injury (GO:0048678)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)|nucleoside kinase activity (GO:0019206)|uridine kinase activity (GO:0004849)			breast(1)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	10	all_hematologic(923;0.048)|Acute lymphoblastic leukemia(8;0.155)					GATTTTATCTCAGTACATTAC	0.408																																						uc001gdp.2		NA																	0				ovary(1)	1						c.(550-552)CAG>GAG		uridine-cytidine kinase 2							250.0	217.0	228.0					1																	165872469		2203	4300	6503	SO:0001583	missense	7371				pyrimidine base metabolic process|pyrimidine nucleoside salvage	cytosol	ATP binding|phosphotransferase activity, alcohol group as acceptor|uridine kinase activity	g.chr1:165872469C>G	AF236637	CCDS1252.1	1p32	2012-10-02	2004-07-13	2004-07-14	ENSG00000143179	ENSG00000143179	2.7.1.48		12562	protein-coding gene	gene with protein product		609329	"""uridine monophosphate kinase"""	UMPK			Standard	NM_012474		Approved		uc001gdp.3	Q9BZX2	OTTHUMG00000040117	ENST00000367879.4:c.550C>G	1.37:g.165872469C>G	ENSP00000356853:p.Gln184Glu		Somatic				UCK2_uc010plb.1_Missense_Mutation_p.Q46E	p.Q184E	NM_012474	NP_036606	WXS	Illumina HiSeq	Unspecified	Q9BZX2	UCK2_HUMAN			5	731	+	all_hematologic(923;0.048)|Acute lymphoblastic leukemia(8;0.155)		184				Substrate.	Q5VV91|Q7KZV3|Q92528|Q96KG5|Q9BU42	Missense_Mutation	SNP	ENST00000367879.4	37	c.550C>G	CCDS1252.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.582162	0.86748	.	.	ENSG00000143179	ENST00000367879	.	.	.	4.83	4.83	0.62350	Phosphoribulokinase/uridine kinase (1);	0.000000	0.85682	D	0.000000	D	0.83275	0.5219	M	0.93106	3.38	0.80722	D	1.000000	D;D	0.89917	1.0;1.0	D;D	0.79108	0.986;0.992	D	0.87405	0.2372	8	0.87932	D	0	-25.1325	15.4787	0.75508	0.0:1.0:0.0:0.0	.	34;184	Q9BZX2-2;Q9BZX2	.;UCK2_HUMAN	E	184	.	ENSP00000356853:Q184E	Q	+	1	0	UCK2	164139093	1.000000	0.71417	0.965000	0.40720	0.931000	0.56810	7.404000	0.79996	2.511000	0.84671	0.655000	0.94253	CAG		0.408	UCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096753.1	NM_012474		7	124	0	0	0	0	7	124				
FMO2	2327	broad.mit.edu	37	1	171154965	171154965	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr1:171154965G>A	ENST00000209929.7	+	2	271	c.113G>A	c.(112-114)gGa>gAa	p.G38E	FMO2_ENST00000529935.1_Intron|FMO2_ENST00000441535.1_Missense_Mutation_p.G38E			P31512	FMO4_HUMAN	flavin containing monooxygenase 2 (non-functional)	38					drug catabolic process (GO:0042737)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	22	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					GAAGATATTGGAGGAGTGTGG	0.453																																						uc001ghk.1		NA																	0				skin(1)	1						c.(112-114)GGA>GAA		flavin containing monooxygenase 2							247.0	238.0	241.0					1																	171154965		2203	4300	6503	SO:0001583	missense	2327				drug metabolic process|NADPH oxidation|organic acid metabolic process|toxin metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|host cell microsome|integral to membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding	g.chr1:171154965G>A	BC005894	CCDS1293.1	1q24.3	2011-08-04	2006-07-17		ENSG00000094963	ENSG00000094963			3770	protein-coding gene	gene with protein product		603955	"""flavin containing monooxygenase 2"""			1417778, 9804831	Standard	XR_426768		Approved		uc001ghk.1	Q99518	OTTHUMG00000035504	ENST00000209929.7:c.113G>A	1.37:g.171154965G>A	ENSP00000209929:p.Gly38Glu		Somatic				FMO2_uc010pmd.1_Intron	p.G38E	NM_001460	NP_001451	WXS	Illumina HiSeq	Unspecified	Q99518	FMO2_HUMAN			2	230	+	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)		38					Q53XR0	Missense_Mutation	SNP	ENST00000209929.7	37	c.113G>A	CCDS1293.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.841384	0.91197	.	.	ENSG00000094963	ENST00000209929;ENST00000441535	D;D	0.88509	-2.39;-2.39	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	D	0.97564	0.9202	H	0.99838	4.83	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99429	1.0935	10	0.87932	D	0	-9.8469	18.5129	0.90923	0.0:0.0:1.0:0.0	.	38	Q99518	FMO2_HUMAN	E	38	ENSP00000209929:G38E;ENSP00000405905:G38E	ENSP00000209929:G38E	G	+	2	0	FMO2	169421589	1.000000	0.71417	0.840000	0.33206	0.884000	0.51177	9.347000	0.97059	2.656000	0.90262	0.655000	0.94253	GGA		0.453	FMO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086216.2	NM_001460		14	134	0	0	0	0	14	134				
RC3H1	149041	broad.mit.edu	37	1	173951999	173951999	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr1:173951999C>G	ENST00000367696.2	-	5	985	c.634G>C	c.(634-636)Gaa>Caa	p.E212Q	RC3H1_ENST00000367694.2_Missense_Mutation_p.E212Q|RC3H1_ENST00000258349.4_Missense_Mutation_p.E212Q			Q5TC82	RC3H1_HUMAN	ring finger and CCCH-type domains 1	212	ROQ.				B cell homeostasis (GO:0001782)|cytoplasmic mRNA processing body assembly (GO:0033962)|lymph node development (GO:0048535)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of germinal center formation (GO:0002635)|negative regulation of T-helper cell differentiation (GO:0045623)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|posttranscriptional regulation of gene expression (GO:0010608)|protein ubiquitination (GO:0016567)|regulation of germinal center formation (GO:0002634)|regulation of mRNA stability (GO:0043488)|regulation of T cell receptor signaling pathway (GO:0050856)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	50						GAACCATCTTCTAAGGCCAGC	0.403																																						uc001gju.3		NA																	0				ovary(2)	2						c.(634-636)GAA>CAA		roquin							114.0	115.0	115.0					1																	173951999		2203	4300	6503	SO:0001583	missense	149041				cytoplasmic mRNA processing body assembly|negative regulation of activated T cell proliferation|negative regulation of B cell proliferation|negative regulation of germinal center formation|negative regulation of T-helper cell differentiation|nuclear-transcribed mRNA catabolic process|regulation of mRNA stability|regulation of T cell receptor signaling pathway	cytoplasmic mRNA processing body|stress granule	mRNA 3'-UTR binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr1:173951999C>G	AK093501	CCDS30940.1, CCDS72987.1	1q25.1	2013-01-18	2010-09-15		ENSG00000135870	ENSG00000135870		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	29434	protein-coding gene	gene with protein product	"""KIAA2025 protein"""	609424	"""ring finger and CCCH-type zinc finger domains 1"""			15917799	Standard	XM_005244918		Approved	KIAA2025, roquin, RP5-1198E17.5, RNF198	uc001gju.4	Q5TC82	OTTHUMG00000037275	ENST00000367696.2:c.634G>C	1.37:g.173951999C>G	ENSP00000356669:p.Glu212Gln		Somatic				RC3H1_uc010pms.1_Missense_Mutation_p.E212Q|RC3H1_uc001gjv.2_Missense_Mutation_p.E212Q|RC3H1_uc010pmt.1_Missense_Mutation_p.E212Q	p.E212Q	NM_172071	NP_742068	WXS	Illumina HiSeq	Unspecified	Q5TC82	RC3H1_HUMAN			4	721	-			212					B3KVK1|Q5W180|Q5W181|Q8IVE6|Q8N9V1	Missense_Mutation	SNP	ENST00000367696.2	37	c.634G>C	CCDS30940.1	.	.	.	.	.	.	.	.	.	.	C	34	5.400945	0.96030	.	.	ENSG00000135870	ENST00000367696;ENST00000258349;ENST00000367694	D;D;D	0.95447	-3.71;-3.71;-3.71	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	D	0.97763	0.9266	M	0.79475	2.455	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;1.0;1.0	D;D;D;D	0.87578	0.994;0.994;0.997;0.998	D	0.98055	1.0390	10	0.87932	D	0	-19.2889	19.9855	0.97347	0.0:1.0:0.0:0.0	.	212;212;212;212	B9EGU6;B7ZMB3;Q5TC82-2;Q5TC82	.;.;.;RC3H1_HUMAN	Q	212	ENSP00000356669:E212Q;ENSP00000258349:E212Q;ENSP00000356667:E212Q	ENSP00000258349:E212Q	E	-	1	0	RC3H1	172218622	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	7.818000	0.86416	2.806000	0.96561	0.655000	0.94253	GAA		0.403	RC3H1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090733.2	NM_172071		10	131	0	0	0	0	10	131				
LAMC2	3918	broad.mit.edu	37	1	183209189	183209189	+	Silent	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr1:183209189G>A	ENST00000264144.4	+	21	3149	c.3084G>A	c.(3082-3084)ctG>ctA	p.L1028L	LAMC2_ENST00000461729.1_3'UTR|LAMC2_ENST00000493293.1_Silent_p.L1028L	NM_005562.2	NP_005553.2	Q13753	LAMC2_HUMAN	laminin, gamma 2	1028	Domain II and I.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	cell cortex (GO:0005938)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-2 complex (GO:0005607)|laminin-5 complex (GO:0005610)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	heparin binding (GO:0008201)			breast(2)|endometrium(6)|kidney(8)|large_intestine(11)|lung(18)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55						TTGGGAGTCTGAACTTGGAAG	0.493																																						uc001gqa.2		NA																	0				skin(2)|ovary(1)	3						c.(3082-3084)CTG>CTA		laminin, gamma 2 isoform a precursor							93.0	96.0	95.0					1																	183209189		2203	4300	6503	SO:0001819	synonymous_variant	3918				cell adhesion|epidermis development|hemidesmosome assembly		heparin binding	g.chr1:183209189G>A	Z15008	CCDS1352.1, CCDS44285.1	1q25-q31	2013-03-01	2002-08-29		ENSG00000058085	ENSG00000058085		"""Laminins"""	6493	protein-coding gene	gene with protein product		150292	"""laminin, gamma 2 (nicein (100kD), kalinin (105kD), BM600 (100kD), Herlitz junctional epidermolysis bullosa))"""	EBR2, LAMB2T, LAMNB2, EBR2A		1383240	Standard	NM_005562		Approved	nicein-100kDa, kalinin-105kDa, BM600-100kDa	uc001gqa.2	Q13753	OTTHUMG00000035520	ENST00000264144.4:c.3084G>A	1.37:g.183209189G>A			Somatic				LAMC2_uc001gpz.3_Silent_p.L1028L|LAMC2_uc010poa.1_Silent_p.L728L	p.L1028L	NM_005562	NP_005553	WXS	Illumina HiSeq	Unspecified	Q13753	LAMC2_HUMAN			21	3398	+			1028			Potential.|Domain II and I.		Q02536|Q02537|Q13752|Q14941|Q14DF7|Q2M1N2|Q5VYE8	Silent	SNP	ENST00000264144.4	37	c.3084G>A	CCDS1352.1																																																																																				0.493	LAMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086258.1	NM_005562		17	122	0	0	0	0	17	122				
HMCN1	83872	broad.mit.edu	37	1	186086731	186086731	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr1:186086731G>C	ENST00000271588.4	+	77	12053	c.11824G>C	c.(11824-11826)Gat>Cat	p.D3942H	HMCN1_ENST00000367492.2_Missense_Mutation_p.D3942H	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3942	Ig-like C2-type 38.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TCCCAGGGGAGATGGCTATAG	0.423																																						uc001grq.1		NA																	0				ovary(22)|skin(1)	23						c.(11824-11826)GAT>CAT		hemicentin 1 precursor							98.0	96.0	97.0					1																	186086731		2203	4300	6503	SO:0001583	missense	83872				response to stimulus|visual perception	basement membrane	calcium ion binding	g.chr1:186086731G>C	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.11824G>C	1.37:g.186086731G>C	ENSP00000271588:p.Asp3942His		Somatic					p.D3942H	NM_031935	NP_114141	WXS	Illumina HiSeq	Unspecified	Q96RW7	HMCN1_HUMAN			77	12053	+			3942			Ig-like C2-type 38.		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	c.11824G>C	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.022292	0.75275	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.78595	-1.19;-1.19	5.65	4.74	0.60224	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.435067	0.28021	N	0.016918	D	0.83843	0.5342	L	0.58354	1.805	0.45295	D	0.99829	D	0.55800	0.973	D	0.66084	0.941	D	0.83981	0.0332	10	0.52906	T	0.07	.	11.4184	0.49967	0.1438:0.0:0.8562:0.0	.	3942	Q96RW7	HMCN1_HUMAN	H	3942	ENSP00000271588:D3942H;ENSP00000356462:D3942H	ENSP00000271588:D3942H	D	+	1	0	HMCN1	184353354	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	2.991000	0.49409	1.386000	0.46466	0.655000	0.94253	GAT		0.423	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935		7	86	0	0	0	0	7	86				
KIF14	9928	broad.mit.edu	37	1	200522745	200522745	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr1:200522745G>C	ENST00000367350.4	-	30	5156	c.4718C>G	c.(4717-4719)tCt>tGt	p.S1573C		NM_014875.2	NP_055690.1	Q15058	KIF14_HUMAN	kinesin family member 14	1573	Required for CIT-binding.				ATP catabolic process (GO:0006200)|cytoskeleton-dependent intracellular transport (GO:0030705)|establishment of protein localization (GO:0045184)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of integrin activation (GO:0033624)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of Rap protein signal transduction (GO:0032487)|substrate adhesion-dependent cell spreading (GO:0034446)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|PDZ domain binding (GO:0030165)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(8)|kidney(8)|large_intestine(15)|lung(13)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	61						CTTAGCTAGAGATTCTAGTTC	0.398																																						uc010ppk.1		NA																	0				breast(3)|ovary(2)|skin(2)	7						c.(4717-4719)TCT>TGT		kinesin family member 14							110.0	103.0	106.0					1																	200522745		2203	4300	6503	SO:0001583	missense	9928				microtubule-based movement	cytoplasm|microtubule|nucleus|spindle	ATP binding|microtubule motor activity|protein binding	g.chr1:200522745G>C	D26361	CCDS30963.1	1q32.1	2008-03-03			ENSG00000118193	ENSG00000118193		"""Kinesins"""	19181	protein-coding gene	gene with protein product		611279				7584044	Standard	NM_014875		Approved	KIAA0042	uc010ppk.1	Q15058	OTTHUMG00000035723	ENST00000367350.4:c.4718C>G	1.37:g.200522745G>C	ENSP00000356319:p.Ser1573Cys		Somatic				KIF14_uc010ppj.1_Missense_Mutation_p.S1082C	p.S1573C	NM_014875	NP_055690	WXS	Illumina HiSeq	Unspecified	Q15058	KIF14_HUMAN			30	5157	-			1573			Required for CIT-binding.		Q14CI8|Q4G0A5|Q5T1W3	Missense_Mutation	SNP	ENST00000367350.4	37	c.4718C>G	CCDS30963.1	.	.	.	.	.	.	.	.	.	.	G	17.93	3.509843	0.64522	.	.	ENSG00000118193	ENST00000367350	T	0.81415	-1.49	5.74	5.74	0.90152	.	0.070542	0.64402	D	0.000016	D	0.88112	0.6349	M	0.65975	2.015	0.09310	N	0.999998	D	0.76494	0.999	D	0.65573	0.936	T	0.82192	-0.0579	10	0.87932	D	0	.	16.633	0.85039	0.0:0.0:1.0:0.0	.	1573	Q15058	KIF14_HUMAN	C	1573	ENSP00000356319:S1573C	ENSP00000356319:S1573C	S	-	2	0	KIF14	198789368	0.955000	0.32602	0.012000	0.15200	0.022000	0.10575	3.567000	0.53813	2.709000	0.92574	0.655000	0.94253	TCT		0.398	KIF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086878.1	NM_014875		9	48	0	0	0	0	9	48				
CSRP1	1465	broad.mit.edu	37	1	201465408	201465408	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr1:201465408C>G	ENST00000367306.1	-	3	387	c.24G>C	c.(22-24)aaG>aaC	p.K8N	CSRP1_ENST00000531916.1_Missense_Mutation_p.K8N|CSRP1_ENST00000458271.2_5'UTR|CSRP1_ENST00000526723.1_Missense_Mutation_p.K8N|CSRP1_ENST00000340006.2_Missense_Mutation_p.K8N|CSRP1_ENST00000533432.1_Missense_Mutation_p.K8N|CSRP1_ENST00000532460.1_Missense_Mutation_p.K8N			P21291	CSRP1_HUMAN	cysteine and glycine-rich protein 1	8					platelet aggregation (GO:0070527)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			large_intestine(3)|lung(2)|ovary(1)	6						CCCCACATTTCTTGCCTCCTC	0.483																																						uc001gws.2		NA																	0				ovary(1)	1						c.(22-24)AAG>AAC		cysteine and glycine-rich protein 1 isoform 1							192.0	178.0	183.0					1																	201465408		2203	4300	6503	SO:0001583	missense	1465					nucleus	zinc ion binding	g.chr1:201465408C>G	M33146	CCDS1413.1	1q32	2008-02-05			ENSG00000159176	ENSG00000159176			2469	protein-coding gene	gene with protein product		123876		CYRP		2115670, 9925910	Standard	NM_004078		Approved	CSRP, D1S181E	uc021phh.1	P21291	OTTHUMG00000035773	ENST00000367306.1:c.24G>C	1.37:g.201465408C>G	ENSP00000356275:p.Lys8Asn		Somatic				CSRP1_uc010ppr.1_Missense_Mutation_p.K8N|CSRP1_uc010pps.1_Missense_Mutation_p.K8N	p.K8N	NM_004078	NP_004069	WXS	Illumina HiSeq	Unspecified	P21291	CSRP1_HUMAN			2	215	-			8					A8K268|Q5U0J2	Missense_Mutation	SNP	ENST00000367306.1	37	c.24G>C	CCDS1413.1	.	.	.	.	.	.	.	.	.	.	C	3.603	-0.081077	0.07141	.	.	ENSG00000159176	ENST00000367306;ENST00000545649;ENST00000340006;ENST00000531916;ENST00000532460;ENST00000533432;ENST00000526723	T;T;T;T;T;T	0.72051	-0.12;-0.12;-0.62;-0.12;-0.12;-0.2	5.1	4.17	0.49024	Zinc finger, LIM-type (2);	0.145912	0.64402	D	0.000012	T	0.40791	0.1131	N	0.02708	-0.52	0.43417	D	0.995561	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.003;0.002;0.002	T	0.38693	-0.9649	10	0.08599	T	0.76	-14.7033	10.338	0.43860	0.0:0.8501:0.0:0.1499	.	8;8;8	B4E2T4;B4DY28;P21291	.;.;CSRP1_HUMAN	N	8	ENSP00000356275:K8N;ENSP00000345079:K8N;ENSP00000432110:K8N;ENSP00000434147:K8N;ENSP00000436792:K8N;ENSP00000436491:K8N	ENSP00000345079:K8N	K	-	3	2	CSRP1	199732031	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.127000	0.42035	2.637000	0.89404	0.561000	0.74099	AAG		0.483	CSRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087027.1	NM_004078		20	116	0	0	0	0	20	116				
ATP2B4	493	broad.mit.edu	37	1	203708719	203708719	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr1:203708719C>G	ENST00000357681.5	+	21	4478	c.3355C>G	c.(3355-3357)Cag>Gag	p.Q1119E	ATP2B4_ENST00000367218.3_3'UTR|ATP2B4_ENST00000341360.2_3'UTR|ATP2B4_ENST00000367219.3_3'UTR|ATP2B4_ENST00000391954.2_3'UTR	NM_001684.4	NP_001675.3	P23634	AT2B4_HUMAN	ATPase, Ca++ transporting, plasma membrane 4	1155					blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion import across plasma membrane (GO:0098703)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|cellular response to epinephrine stimulus (GO:0071872)|ion transmembrane transport (GO:0034220)|negative regulation of adrenergic receptor signaling pathway involved in heart process (GO:1901205)|negative regulation of arginine catabolic process (GO:1900082)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of cardiac muscle hypertrophy in response to stress (GO:1903243)|negative regulation of citrulline biosynthetic process (GO:1903249)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of the force of heart contraction (GO:0098736)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to hydrostatic pressure (GO:0051599)|transmembrane transport (GO:0055085)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|nitric-oxide synthase binding (GO:0050998)|protein phosphatase 2B binding (GO:0030346)|scaffold protein binding (GO:0097110)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(20)|ovary(2)|prostate(6)|skin(1)|stomach(1)|urinary_tract(3)	56	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			CGAAAGCATTCAGAAACCCTA	0.488																																						uc001gzw.2		NA																	0				ovary(2)|skin(1)	3						c.(3355-3357)CAG>GAG		plasma membrane calcium ATPase 4 isoform 4b							128.0	122.0	124.0					1																	203708719		2203	4300	6503	SO:0001583	missense	493				ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding	g.chr1:203708719C>G	M25874	CCDS1440.1, CCDS30977.1	1q32.1	2010-04-20	2005-05-26		ENSG00000058668	ENSG00000058668	3.6.3.8	"""ATPases / P-type"""	817	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 4"""	108732	"""matrix-remodelling associated 1"""	ATP2B2, MXRA1		1674727	Standard	NM_001001396		Approved	PMCA4	uc001gzw.3	P23634	OTTHUMG00000035906	ENST00000357681.5:c.3355C>G	1.37:g.203708719C>G	ENSP00000350310:p.Gln1119Glu		Somatic				ATP2B4_uc001gzv.2_3'UTR|ATP2B4_uc001gzx.2_Missense_Mutation_p.Q186E|ATP2B4_uc009xar.2_3'UTR	p.Q1119E	NM_001684	NP_001675	WXS	Illumina HiSeq	Unspecified	P23634	AT2B4_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.109)		21	4239	+	all_cancers(21;0.071)|all_epithelial(62;0.228)		1155			Cytoplasmic (Potential).		B1APW5|B1APW6|Q13450|Q13452|Q13455|Q16817|Q7Z3S1	Missense_Mutation	SNP	ENST00000357681.5	37	c.3355C>G	CCDS1440.1	.	.	.	.	.	.	.	.	.	.	C	1.484	-0.556540	0.03967	.	.	ENSG00000058668	ENST00000357681	T	0.75050	-0.9	5.36	3.07	0.35406	.	1.573660	0.03806	N	0.265151	T	0.53722	0.1814	N	0.05078	-0.115	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.42361	-0.9456	10	0.02654	T	1	-1.3802	11.3165	0.49394	0.1225:0.637:0.2405:0.0	.	1119	P23634-6	.	E	1119	ENSP00000350310:Q1119E	ENSP00000350310:Q1119E	Q	+	1	0	ATP2B4	201975342	1.000000	0.71417	0.998000	0.56505	0.650000	0.38633	2.857000	0.48349	1.150000	0.42419	0.655000	0.94253	CAG		0.488	ATP2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087462.1	NM_001001396		16	101	0	0	0	0	16	101				
RPS6KC1	26750	broad.mit.edu	37	1	213414696	213414696	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr1:213414696C>A	ENST00000366960.3	+	11	2027	c.1877C>A	c.(1876-1878)tCa>tAa	p.S626*	RPS6KC1_ENST00000543354.1_Nonsense_Mutation_p.S329*|RPS6KC1_ENST00000366959.3_Nonsense_Mutation_p.S614*|RPS6KC1_ENST00000543470.1_Nonsense_Mutation_p.S414*|RPS6KC1_ENST00000490299.1_3'UTR	NM_012424.3	NP_036556.2	Q96S38	KS6C1_HUMAN	ribosomal protein S6 kinase, 52kDa, polypeptide 1	626					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(6)|kidney(4)|large_intestine(8)|liver(2)|lung(15)|ovary(3)|prostate(1)|urinary_tract(3)	43				OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)		AGTCTAAAATCAGAACCTTTG	0.388																																						uc010ptr.1		NA																	0				lung(4)|ovary(3)|breast(1)	8						c.(1876-1878)TCA>TAA		ribosomal protein S6 kinase, 52kDa, polypeptide							52.0	56.0	54.0					1																	213414696		2203	4300	6503	SO:0001587	stop_gained	26750				cell communication|signal transduction	early endosome|membrane	ATP binding|phosphatidylinositol binding|protein binding|protein serine/threonine kinase activity	g.chr1:213414696C>A	AF037447	CCDS1513.1, CCDS44317.1, CCDS73028.1, CCDS73029.1, CCDS73030.1	1q41	2011-04-05	2002-08-29		ENSG00000136643	ENSG00000136643			10439	protein-coding gene	gene with protein product			"""ribosomal protein S6 kinase, 52kD, polypeptide 1"""			10552933	Standard	XM_005273095		Approved	humS6PKh1	uc010ptr.2	Q96S38	OTTHUMG00000036926	ENST00000366960.3:c.1877C>A	1.37:g.213414696C>A	ENSP00000355927:p.Ser626*		Somatic				RPS6KC1_uc001hkd.2_Nonsense_Mutation_p.S614*|RPS6KC1_uc010pts.1_Nonsense_Mutation_p.S414*|RPS6KC1_uc010ptt.1_Nonsense_Mutation_p.S414*|RPS6KC1_uc010ptu.1_Nonsense_Mutation_p.S445*|RPS6KC1_uc010ptv.1_Nonsense_Mutation_p.S161*|RPS6KC1_uc001hke.2_Nonsense_Mutation_p.S445*	p.S626*	NM_012424	NP_036556	WXS	Illumina HiSeq	Unspecified	Q96S38	KS6C1_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)	11	2036	+			626					B1APS8|B3KVM4|D3DTA4|Q8TDD3|Q9NSF4|Q9UL66	Nonsense_Mutation	SNP	ENST00000366960.3	37	c.1877C>A	CCDS1513.1	.	.	.	.	.	.	.	.	.	.	C	38	7.271385	0.98179	.	.	ENSG00000136643	ENST00000543470;ENST00000366960;ENST00000366959;ENST00000543354	.	.	.	5.19	5.19	0.71726	.	0.503070	0.21555	N	0.072676	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-39.5066	18.7447	0.91788	0.0:1.0:0.0:0.0	.	.	.	.	X	414;626;614;329	.	ENSP00000355926:S614X	S	+	2	0	RPS6KC1	211481319	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.942000	0.56614	2.416000	0.81992	0.557000	0.71058	TCA		0.388	RPS6KC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089690.3	NM_012424		4	42	1	0	2.56e-06	2.77e-06	4	42				
MIA3	375056	broad.mit.edu	37	1	222803432	222803432	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr1:222803432C>T	ENST00000344922.5	+	4	2895	c.2870C>T	c.(2869-2871)tCa>tTa	p.S957L	MIA3_ENST00000344441.6_Missense_Mutation_p.S957L|MIA3_ENST00000344507.1_Intron|MIA3_ENST00000470521.1_3'UTR	NM_198551.2	NP_940953.2	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	957					chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|exocytosis (GO:0006887)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|positive regulation of bone mineralization (GO:0030501)|positive regulation of leukocyte migration (GO:0002687)|protein transport (GO:0015031)|wound healing (GO:0042060)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(5)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(15)|lung(37)|ovary(5)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|urinary_tract(1)	80				GBM - Glioblastoma multiforme(131;0.0199)		GAAATGTCATCAAAACTGAAG	0.428																																						uc001hnl.2		NA																	0				ovary(4)|central_nervous_system(1)	5						c.(2869-2871)TCA>TTA		melanoma inhibitory activity family, member 3							76.0	72.0	73.0					1																	222803432		1987	4184	6171	SO:0001583	missense	375056				exocytosis|negative regulation of cell adhesion|negative regulation of cell migration|positive regulation of leukocyte migration|protein transport|wound healing	endoplasmic reticulum membrane|integral to membrane	protein binding	g.chr1:222803432C>T		CCDS41470.1, CCDS73035.1	1p36.33	2012-12-13		2006-07-25	ENSG00000154305	ENSG00000154305			24008	protein-coding gene	gene with protein product	"""C219 reactive peptide"", ""transport and golgi organization"""	613455				15183315	Standard	XM_005273121		Approved	UNQ6077, FLJ39207, KIAA0268, TANGO	uc001hnl.3	Q5JRA6	OTTHUMG00000037543	ENST00000344922.5:c.2870C>T	1.37:g.222803432C>T	ENSP00000340900:p.Ser957Leu		Somatic				MIA3_uc009xea.1_Missense_Mutation_p.S793L	p.S957L	NM_198551	NP_940953	WXS	Illumina HiSeq	Unspecified	Q5JRA6	MIA3_HUMAN		GBM - Glioblastoma multiforme(131;0.0199)	4	2879	+			957			Extracellular (Potential).		A8K2S0|A8MT05|A8MT13|B7Z430|Q14083|Q3S4X3|Q5JRA5|Q5JRB0|Q5JRB1|Q5JRB2|Q6UVY8|Q86Y60|Q8N8M5|Q92580	Missense_Mutation	SNP	ENST00000344922.5	37	c.2870C>T	CCDS41470.1	.	.	.	.	.	.	.	.	.	.	C	0.013	-1.643360	0.00792	.	.	ENSG00000154305	ENST00000344922;ENST00000344441;ENST00000320831	T;T	0.03772	3.81;3.81	5.25	-5.92	0.02261	.	.	.	.	.	T	0.01976	0.0062	N	0.12182	0.205	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.49000	-0.8984	9	0.06365	T	0.9	.	7.158	0.25649	0.0:0.3539:0.3009:0.3452	.	957;957	Q5JRA6-2;Q5JRA6	.;MIA3_HUMAN	L	957	ENSP00000340900:S957L;ENSP00000340587:S957L	ENSP00000325973:S957L	S	+	2	0	MIA3	220870055	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-0.514000	0.06298	-0.575000	0.05982	-0.379000	0.06801	TCA		0.428	MIA3-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091489.4	NM_198551		8	58	0	0	0	0	8	58				
ZP4	57829	broad.mit.edu	37	1	238045807	238045807	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr1:238045807G>C	ENST00000366570.4	-	12	1696	c.1538C>G	c.(1537-1539)tCt>tGt	p.S513C	RP11-193H5.1_ENST00000450451.1_RNA	NM_021186.3	NP_067009.1	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4	513					acrosomal vesicle exocytosis (GO:0060478)|binding of sperm to zona pellucida (GO:0007339)|intracellular signal transduction (GO:0035556)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of humoral immune response (GO:0002922)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of T cell proliferation (GO:0042102)|protein kinase A signaling (GO:0010737)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	acrosin binding (GO:0032190)|signal transducer activity (GO:0004871)	p.S513fs*4(1)		breast(6)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(42)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	73	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			TAAGGTCCCAGAAAGGCCTGC	0.453																																					NSCLC(166;160 2029 11600 18754 19936)	uc001hym.2		NA																	1	Deletion - Frameshift(1)		upper_aerodigestive_tract(1)	ovary(2)|skin(1)	3						c.(1537-1539)TCT>TGT		zona pellucida glycoprotein 4 preproprotein							117.0	119.0	118.0					1																	238045807		2203	4300	6503	SO:0001583	missense	57829				acrosomal vesicle exocytosis|negative regulation of binding of sperm to zona pellucida|positive regulation of acrosome reaction|positive regulation of humoral immune response|positive regulation of protein kinase activity|positive regulation of T cell proliferation|protein kinase A signaling cascade|protein kinase C signaling cascade	integral to membrane|intracellular|plasma membrane|proteinaceous extracellular matrix	acrosin binding|receptor activity	g.chr1:238045807G>C	U05781	CCDS1615.1	1q43	2013-01-17			ENSG00000116996	ENSG00000116996		"""Zona pellucida glycoproteins"""	15770	protein-coding gene	gene with protein product		613514				7841460	Standard	NM_021186		Approved	ZPB	uc001hym.3	Q12836	OTTHUMG00000039586	ENST00000366570.4:c.1538C>G	1.37:g.238045807G>C	ENSP00000355529:p.Ser513Cys		Somatic				LOC100130331_uc010pyc.1_RNA	p.S513C	NM_021186	NP_067009	WXS	Illumina HiSeq	Unspecified	Q12836	ZP4_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		12	1538	-	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	513			Helical; (Potential).		B2RAE1	Missense_Mutation	SNP	ENST00000366570.4	37	c.1538C>G	CCDS1615.1	.	.	.	.	.	.	.	.	.	.	G	15.09	2.730190	0.48939	.	.	ENSG00000116996	ENST00000366570	T	0.75154	-0.91	3.7	2.78	0.32641	.	0.166425	0.28425	N	0.015388	T	0.61961	0.2389	L	0.36672	1.1	0.09310	N	1	P	0.52170	0.951	B	0.42692	0.395	T	0.55848	-0.8076	10	0.49607	T	0.09	-5.3101	7.2912	0.26366	0.1224:0.0:0.8776:0.0	.	513	Q12836	ZP4_HUMAN	C	513	ENSP00000355529:S513C	ENSP00000355529:S513C	S	-	2	0	ZP4	236112430	0.267000	0.24122	0.035000	0.18076	0.429000	0.31625	1.177000	0.31969	0.911000	0.36747	0.561000	0.74099	TCT		0.453	ZP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095476.1			15	75	0	0	0	0	15	75				
OR2T12	127064	broad.mit.edu	37	1	248458752	248458752	+	Missense_Mutation	SNP	C	C	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr1:248458752C>A	ENST00000317996.1	-	1	128	c.129G>T	c.(127-129)atG>atT	p.M43I		NM_001004692.1	NP_001004692.1	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T, member 12	43						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(3)|large_intestine(3)|lung(25)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			TCAGGAGAATCATGAGGGCAT	0.522																																						uc010pzj.1		NA																	0				skin(2)|ovary(1)	3						c.(127-129)ATG>ATT		olfactory receptor, family 2, subfamily T,							106.0	91.0	96.0					1																	248458752		2202	4300	6502	SO:0001583	missense	127064				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248458752C>A	BK004485	CCDS31110.1	1q44	2012-08-09			ENSG00000177201	ENSG00000177201		"""GPCR / Class A : Olfactory receptors"""	19592	protein-coding gene	gene with protein product							Standard	NM_001004692		Approved		uc010pzj.2	Q8NG77	OTTHUMG00000040457	ENST00000317996.1:c.129G>T	1.37:g.248458752C>A	ENSP00000324583:p.Met43Ile		Somatic					p.M43I	NM_001004692	NP_001004692	WXS	Illumina HiSeq	Unspecified	Q8NG77	O2T12_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0201)		1	129	-	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		43			Helical; Name=1; (Potential).			Missense_Mutation	SNP	ENST00000317996.1	37	c.129G>T	CCDS31110.1	.	.	.	.	.	.	.	.	.	.	c	8.403	0.842312	0.16963	.	.	ENSG00000177201	ENST00000317996	T	0.00330	8.08	1.55	-1.22	0.09494	GPCR, rhodopsin-like superfamily (1);	0.405038	0.18210	N	0.148236	T	0.00144	0.0004	N	0.16233	0.39	0.09310	N	1	B	0.14012	0.009	B	0.15052	0.012	T	0.48410	-0.9038	10	0.51188	T	0.08	.	0.1454	0.00088	0.2169:0.2421:0.215:0.326	.	43	Q8NG77	O2T12_HUMAN	I	43	ENSP00000324583:M43I	ENSP00000324583:M43I	M	-	3	0	OR2T12	246525375	0.000000	0.05858	0.040000	0.18447	0.232000	0.25224	-1.420000	0.02457	0.645000	0.30675	0.175000	0.17021	ATG		0.522	OR2T12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097353.1	NM_001004692		21	83	1	0	4.16e-05	4.45e-05	21	83				
OR2M7	391196	broad.mit.edu	37	1	248486993	248486993	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr1:248486993C>T	ENST00000317965.2	-	1	906	c.878G>A	c.(877-879)cGc>cAc	p.R293H		NM_001004691.1	NP_001004691.1	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M, member 7	293						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(6)|large_intestine(3)|lung(29)|skin(3)	42	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TTCCTTGTTGCGGAGGCTATA	0.428																																						uc010pzk.1		NA																	0				skin(2)	2						c.(877-879)CGC>CAC		olfactory receptor, family 2, subfamily M,							79.0	76.0	77.0					1																	248486993		2203	4300	6503	SO:0001583	missense	391196				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248486993C>T	BK004486	CCDS31111.1	1q44	2012-08-09			ENSG00000177186	ENSG00000177186		"""GPCR / Class A : Olfactory receptors"""	19594	protein-coding gene	gene with protein product							Standard	NM_001004691		Approved		uc010pzk.2	Q8NG81	OTTHUMG00000040461	ENST00000317965.2:c.878G>A	1.37:g.248486993C>T	ENSP00000324557:p.Arg293His		Somatic					p.R293H	NM_001004691	NP_001004691	WXS	Illumina HiSeq	Unspecified	Q8NG81	OR2M7_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	878	-	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		293			Cytoplasmic (Potential).		B2RNL0|Q6IEX6	Missense_Mutation	SNP	ENST00000317965.2	37	c.878G>A	CCDS31111.1	.	.	.	.	.	.	.	.	.	.	C	1.717	-0.497649	0.04291	.	.	ENSG00000177186	ENST00000317965	T	0.41065	1.01	1.55	0.572	0.17357	.	.	.	.	.	T	0.53302	0.1788	H	0.96970	3.915	0.09310	N	1	B	0.21905	0.062	B	0.18263	0.021	T	0.56105	-0.8034	9	0.72032	D	0.01	.	5.4646	0.16635	0.0:0.5486:0.0:0.4514	.	293	Q8NG81	OR2M7_HUMAN	H	293	ENSP00000324557:R293H	ENSP00000324557:R293H	R	-	2	0	OR2M7	246553616	0.000000	0.05858	0.936000	0.37596	0.044000	0.14063	0.161000	0.16481	0.012000	0.14892	-1.111000	0.02071	CGC		0.428	OR2M7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097357.1	NM_001004691		16	43	0	0	0	0	16	43				
FAM208B	54906	broad.mit.edu	37	10	5789019	5789019	+	Missense_Mutation	SNP	C	C	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr10:5789019C>A	ENST00000328090.5	+	15	4260	c.3635C>A	c.(3634-3636)tCt>tAt	p.S1212Y	RP11-336A10.2_ENST00000411512.2_RNA	NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	1212																	TCATCAGCCTCTACCACCTTG	0.473																																						uc001iij.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(3634-3636)TCT>TAT		hypothetical protein LOC54906							87.0	88.0	87.0					10																	5789019		2023	4197	6220	SO:0001583	missense	54906							g.chr10:5789019C>A	BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.3635C>A	10.37:g.5789019C>A	ENSP00000328426:p.Ser1212Tyr		Somatic				C10orf18_uc001iik.2_Missense_Mutation_p.S56Y	p.S1212Y	NM_017782	NP_060252	WXS	Illumina HiSeq	Unspecified	Q5VWN6	CJ018_HUMAN			15	4260	+			1212					Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Missense_Mutation	SNP	ENST00000328090.5	37	c.3635C>A	CCDS41485.1	.	.	.	.	.	.	.	.	.	.	C	6.406	0.443008	0.12164	.	.	ENSG00000108021	ENST00000328090;ENST00000442808	T	0.05649	3.41	5.55	3.37	0.38596	.	0.231704	0.30714	N	0.009035	T	0.08980	0.0222	L	0.55481	1.735	0.09310	N	1	P	0.43287	0.802	B	0.43889	0.435	T	0.10753	-1.0616	10	0.62326	D	0.03	.	8.8039	0.34925	0.0:0.7995:0.0:0.2005	.	1212	Q5VWN6	F208B_HUMAN	Y	1212;407	ENSP00000328426:S1212Y	ENSP00000328426:S1212Y	S	+	2	0	C10orf18	5829025	0.002000	0.14202	0.104000	0.21259	0.003000	0.03518	0.077000	0.14738	1.342000	0.45619	-0.216000	0.12614	TCT		0.473	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046571.2	NM_017782		8	81	1	0	0.00621372	0.00641564	8	81				
FAM208B	54906	broad.mit.edu	37	10	5789105	5789105	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr10:5789105C>T	ENST00000328090.5	+	15	4346	c.3721C>T	c.(3721-3723)Cac>Tac	p.H1241Y		NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	1241																	AAGGAAGAATCACAAGAATGG	0.423																																						uc001iij.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(3721-3723)CAC>TAC		hypothetical protein LOC54906							82.0	81.0	82.0					10																	5789105		1933	4142	6075	SO:0001583	missense	54906							g.chr10:5789105C>T	BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.3721C>T	10.37:g.5789105C>T	ENSP00000328426:p.His1241Tyr		Somatic				C10orf18_uc001iik.2_Missense_Mutation_p.H85Y	p.H1241Y	NM_017782	NP_060252	WXS	Illumina HiSeq	Unspecified	Q5VWN6	CJ018_HUMAN			15	4346	+			1241					Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Missense_Mutation	SNP	ENST00000328090.5	37	c.3721C>T	CCDS41485.1	.	.	.	.	.	.	.	.	.	.	C	4.193	0.034576	0.08101	.	.	ENSG00000108021	ENST00000328090;ENST00000442808	T	0.04275	3.66	5.55	2.71	0.32032	.	0.791217	0.11545	N	0.553346	T	0.02929	0.0087	N	0.08118	0	0.09310	N	1	B	0.18166	0.026	B	0.16722	0.016	T	0.44513	-0.9323	10	0.72032	D	0.01	.	5.8521	0.18699	0.1725:0.1593:0.6682:0.0	.	1241	Q5VWN6	F208B_HUMAN	Y	1241;436	ENSP00000328426:H1241Y	ENSP00000328426:H1241Y	H	+	1	0	C10orf18	5829111	0.000000	0.05858	0.003000	0.11579	0.037000	0.13140	0.195000	0.17155	0.305000	0.22832	-0.197000	0.12766	CAC		0.423	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046571.2	NM_017782		8	61	0	0	0	0	8	61				
ABI1	10006	broad.mit.edu	37	10	27048143	27048143	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr10:27048143G>A	ENST00000376142.2	-	9	997	c.926C>T	c.(925-927)tCc>tTc	p.S309F	ABI1_ENST00000355394.4_Missense_Mutation_p.S310F|ABI1_ENST00000376140.3_Missense_Mutation_p.S282F|ABI1_ENST00000490841.2_Intron|ABI1_ENST00000376139.2_Missense_Mutation_p.S277F|ABI1_ENST00000346832.5_Missense_Mutation_p.S326F|ABI1_ENST00000376166.1_Missense_Mutation_p.S276F|ABI1_ENST00000536334.1_Intron|ABI1_ENST00000376160.1_Missense_Mutation_p.S276F|ABI1_ENST00000376134.3_Missense_Mutation_p.S283F|ABI1_ENST00000376138.3_Missense_Mutation_p.S282F|ABI1_ENST00000359188.4_Missense_Mutation_p.S281F|ABI1_ENST00000376137.4_Intron|ABI1_ENST00000376170.4_Missense_Mutation_p.S281F	NM_005470.3	NP_005461.2	Q8IZP0	ABI1_HUMAN	abl-interactor 1	309	Pro-rich.				actin polymerization or depolymerization (GO:0008154)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|lamellipodium morphogenesis (GO:0072673)|megakaryocyte development (GO:0035855)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|SCAR complex (GO:0031209)	cytoskeletal protein binding (GO:0008092)|protein complex binding (GO:0032403)|protein tyrosine kinase activator activity (GO:0030296)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(9)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GCCATACTGGGAACCAGGAGC	0.483																																						uc001isx.2		NA																	0				central_nervous_system(1)	1						c.(925-927)TCC>TTC		abl-interactor 1 isoform a							106.0	100.0	102.0					10																	27048143		2203	4300	6503	SO:0001583	missense	10006				actin polymerization or depolymerization|cellular component movement|negative regulation of cell proliferation|peptidyl-tyrosine phosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	cell junction|cytoskeleton|cytosol|endoplasmic reticulum|filopodium|growth cone|lamellipodium|nucleus|soluble fraction|synapse|synaptosome	cytoskeletal protein binding	g.chr10:27048143G>A	U87166	CCDS7150.1, CCDS31169.1, CCDS31170.1, CCDS31171.1, CCDS53497.1, CCDS53498.1, CCDS53499.1, CCDS53500.1, CCDS53501.1, CCDS73077.1, CCDS73078.1	10p12.1	2009-05-29	2004-03-17	2004-03-19	ENSG00000136754	ENSG00000136754			11320	protein-coding gene	gene with protein product		603050	"""spectrin SH3 domain binding protein 1"""	SSH3BP1		9593709, 9010225	Standard	NM_005470		Approved	E3B1, ABI-1	uc001isx.3	Q8IZP0	OTTHUMG00000017848	ENST00000376142.2:c.926C>T	10.37:g.27048143G>A	ENSP00000365312:p.Ser309Phe		Somatic				ABI1_uc001ite.2_Missense_Mutation_p.S276F|ABI1_uc010qdh.1_Intron|ABI1_uc010qdi.1_Intron|ABI1_uc001isy.2_Missense_Mutation_p.S282F|ABI1_uc001ita.2_Missense_Mutation_p.S282F|ABI1_uc001isz.2_Missense_Mutation_p.S277F|ABI1_uc001itb.2_Missense_Mutation_p.S326F|ABI1_uc001itc.2_Missense_Mutation_p.S281F|ABI1_uc010qdj.1_Intron|ABI1_uc001itd.2_Missense_Mutation_p.S281F|ABI1_uc010qdk.1_Intron|ABI1_uc010qdg.1_Missense_Mutation_p.S148F	p.S309F	NM_005470	NP_005461	WXS	Illumina HiSeq	Unspecified	Q8IZP0	ABI1_HUMAN			9	1093	-			309			Pro-rich.		A9Z1Y6|B3KX62|B4DQ58|H7BXI6|O15147|O76049|O95060|Q5T2R3|Q5T2R4|Q5T2R6|Q5T2R7|Q5T2R9|Q5W070|Q5W072|Q8TB63|Q96S81|Q9NXZ9|Q9NYB8	Missense_Mutation	SNP	ENST00000376142.2	37	c.926C>T	CCDS7150.1	.	.	.	.	.	.	.	.	.	.	G	18.49	3.634422	0.67130	.	.	ENSG00000136754	ENST00000376138;ENST00000376170;ENST00000376166;ENST00000376160;ENST00000376142;ENST00000359188;ENST00000376139;ENST00000355394;ENST00000346832;ENST00000376134;ENST00000376140	T;T;T;T;T;T;T;T;T;T;T	0.44083	1.09;1.09;1.08;1.05;1.04;1.02;1.03;1.15;1.14;0.93;1.03	5.67	5.67	0.87782	.	0.142677	0.64402	D	0.000003	T	0.58119	0.2100	L	0.47716	1.5	0.80722	D	1	B;B;D;B;P;B;B;D;D	0.76494	0.004;0.009;0.99;0.004;0.644;0.012;0.0;0.998;0.999	B;B;D;B;B;B;B;D;D	0.83275	0.008;0.01;0.974;0.029;0.234;0.015;0.005;0.935;0.996	T	0.44982	-0.9292	10	0.15952	T	0.53	-7.0621	19.774	0.96385	0.0:0.0:1.0:0.0	.	148;276;306;281;326;282;277;282;309	B4DKX2;Q5T2R9;Q59G41;Q8IZP0-6;B3KX62;Q8IZP0-3;Q8IZP0-5;Q8IZP0-9;Q8IZP0	.;.;.;.;.;.;.;.;ABI1_HUMAN	F	282;281;276;276;309;281;277;310;326;283;282	ENSP00000365308:S282F;ENSP00000365340:S281F;ENSP00000365336:S276F;ENSP00000365330:S276F;ENSP00000365312:S309F;ENSP00000352114:S281F;ENSP00000365309:S277F;ENSP00000347555:S310F;ENSP00000279599:S326F;ENSP00000365304:S283F;ENSP00000365310:S282F	ENSP00000279599:S326F	S	-	2	0	ABI1	27088149	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.845000	0.99498	2.679000	0.91253	0.591000	0.81541	TCC		0.483	ABI1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047287.1	NM_005470		14	56	0	0	0	0	14	56				
AGAP6	414189	broad.mit.edu	37	10	51749089	51749089	+	Intron	SNP	C	C	G	rs527938149	byFrequency	TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr10:51749089C>G	ENST00000374056.4	+	1	621				AGAP6_ENST00000412531.3_Missense_Mutation_p.A82G			Q5VW22	AGAP6_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 6						regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.A82G(1)		NS(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(1)|lung(8)|prostate(3)|skin(1)|stomach(2)	29						AACCTTTCTGCCAATCCAGAG	0.343													C|||	4	0.000798722	0.0008	0.0	5008	,	,		19062	0.001		0.001	False		,,,				2504	0.001					uc001jix.3		NA																	1	Substitution - Missense(1)		prostate(1)	skin(1)	1						c.(244-246)GCC>GGC		ArfGAP with GTPase domain, ankyrin repeat and PH																																				SO:0001627	intron_variant	414189				regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding	g.chr10:51749089C>G		CCDS44397.1	10q11.23	2013-01-10	2008-09-22	2008-09-22	ENSG00000204149	ENSG00000204149		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	23466	protein-coding gene	gene with protein product			"""centaurin, gamma-like family, member 3"""	CTGLF3			Standard	NM_001077665		Approved	bA324H6.1	uc001jix.4	Q5VW22	OTTHUMG00000018220	ENST00000374056.4:c.223+391C>G	10.37:g.51749089C>G			Somatic					p.A82G	NM_001077665	NP_001071133	WXS	Illumina HiSeq	Unspecified	Q5VW22	AGAP6_HUMAN			2	643	+			82						Missense_Mutation	SNP	ENST00000374056.4	37	c.245C>G		.	.	.	.	.	.	.	.	.	.	C	9.398	1.077299	0.20227	.	.	ENSG00000204149	ENST00000374056	D	0.88664	-2.41	0.945	-0.993	0.10228	.	.	.	.	.	T	0.80166	0.4573	L	0.36672	1.1	0.09310	N	1	P	0.38711	0.643	B	0.41691	0.364	T	0.67507	-0.5653	9	0.12103	T	0.63	.	3.7085	0.08410	0.5812:0.4188:0.0:0.0	.	82	C9IYN2	.	G	82	ENSP00000363168:A82G	ENSP00000363168:A82G	A	+	2	0	AGAP6	51419095	0.000000	0.05858	0.447000	0.26932	0.050000	0.14768	-0.315000	0.08081	-0.186000	0.10533	0.175000	0.17021	GCC		0.343	AGAP6-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_001077665		3	75	0	0	0	0	3	75				
DDX21	9188	broad.mit.edu	37	10	70737337	70737337	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr10:70737337G>A	ENST00000354185.4	+	12	1893	c.1795G>A	c.(1795-1797)Gag>Aag	p.E599K		NM_001256910.1|NM_004728.3	NP_001243839.1|NP_004719.2	Q9NR30	DDX21_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 21	599					ATP catabolic process (GO:0006200)|osteoblast differentiation (GO:0001649)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	20						ACAATCAGCTGAGAAGCTGAT	0.507																																						uc001jov.1		NA																	0				ovary(2)|kidney(1)	3						c.(1795-1797)GAG>AAG		DEAD (Asp-Glu-Ala-Asp) box polypeptide 21							121.0	119.0	120.0					10																	70737337		2203	4300	6503	SO:0001583	missense	9188					nucleolus	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding	g.chr10:70737337G>A	U41387	CCDS31211.1, CCDS73144.1	10q21	2013-05-13	2012-02-23		ENSG00000165732	ENSG00000165732		"""DEAD-boxes"""	2744	protein-coding gene	gene with protein product		606357	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 21"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 21"""			8614622, 18180292	Standard	NM_004728		Approved	RH-II/GU, GURDB	uc001jov.2	Q9NR30	OTTHUMG00000018366	ENST00000354185.4:c.1795G>A	10.37:g.70737337G>A	ENSP00000346120:p.Glu599Lys		Somatic				DDX21_uc001jow.1_Missense_Mutation_p.E531K	p.E599K	NM_004728	NP_004719	WXS	Illumina HiSeq	Unspecified	Q9NR30	DDX21_HUMAN			12	1885	+			599					B2RDL0|Q13436|Q5VX41|Q68D35	Missense_Mutation	SNP	ENST00000354185.4	37	c.1795G>A	CCDS31211.1	.	.	.	.	.	.	.	.	.	.	G	11.65	1.700710	0.30142	.	.	ENSG00000165732	ENST00000354185	T	0.17528	2.27	5.61	2.39	0.29439	.	0.254035	0.46442	D	0.000286	T	0.14960	0.0361	N	0.25286	0.73	0.26086	N	0.981025	B	0.24533	0.105	B	0.28991	0.097	T	0.17258	-1.0375	10	0.36615	T	0.2	-16.4893	19.2797	0.94048	0.0:0.4817:0.5183:0.0	.	599	Q9NR30	DDX21_HUMAN	K	599	ENSP00000346120:E599K	ENSP00000346120:E599K	E	+	1	0	DDX21	70407343	0.972000	0.33761	0.819000	0.32651	0.351000	0.29236	1.596000	0.36718	0.811000	0.34303	-0.165000	0.13383	GAG		0.507	DDX21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048374.1	NM_004728		16	117	0	0	0	0	16	117				
POLR3A	11128	broad.mit.edu	37	10	79742546	79742546	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr10:79742546G>C	ENST00000372371.3	-	27	3596	c.3459C>G	c.(3457-3459)atC>atG	p.I1153M		NM_007055.3	NP_008986.2	O14802	RPC1_HUMAN	polymerase (RNA) III (DNA directed) polypeptide A, 155kDa	1153					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|ribonucleoside binding (GO:0032549)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)			TGGATGTGCAGATGGAATATC	0.507																																						uc001jzn.2		NA																	0					0						c.(3457-3459)ATC>ATG		polymerase (RNA) III (DNA directed) polypeptide							128.0	103.0	112.0					10																	79742546		2203	4300	6503	SO:0001583	missense	11128				innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity|ribonucleoside binding|zinc ion binding	g.chr10:79742546G>C	AF021351	CCDS7354.1	10q22-q23	2013-01-21			ENSG00000148606	ENSG00000148606		"""RNA polymerase subunits"""	30074	protein-coding gene	gene with protein product		614258				9331371, 12391170	Standard	NM_007055		Approved	RPC1, RPC155, hRPC155	uc001jzn.3	O14802	OTTHUMG00000018550	ENST00000372371.3:c.3459C>G	10.37:g.79742546G>C	ENSP00000361446:p.Ile1153Met		Somatic					p.I1153M	NM_007055	NP_008986	WXS	Illumina HiSeq	Unspecified	O14802	RPC1_HUMAN	Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)		27	3553	-	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		1153					Q8IW34|Q8TCW5	Missense_Mutation	SNP	ENST00000372371.3	37	c.3459C>G	CCDS7354.1	.	.	.	.	.	.	.	.	.	.	G	12.45	1.940441	0.34283	.	.	ENSG00000148606	ENST00000372371;ENST00000540842	T	0.69040	-0.37	5.92	4.84	0.62591	RNA polymerase Rpb1, domain 5 (1);	0.000000	0.85682	D	0.000000	T	0.74261	0.3693	M	0.71206	2.165	0.58432	D	0.999999	D	0.59767	0.986	P	0.62813	0.907	T	0.74746	-0.3561	9	.	.	.	-31.4665	5.4123	0.16354	0.1361:0.0:0.6578:0.206	.	1153	O14802	RPC1_HUMAN	M	1153;1132	ENSP00000361446:I1153M	.	I	-	3	3	POLR3A	79412552	1.000000	0.71417	1.000000	0.80357	0.072000	0.16883	2.045000	0.41250	2.804000	0.96469	0.655000	0.94253	ATC		0.507	POLR3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048923.1	NM_007055		7	41	0	0	0	0	7	41				
LRIT2	340745	broad.mit.edu	37	10	85981835	85981835	+	Silent	SNP	G	G	A	rs140185624	byFrequency	TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr10:85981835G>A	ENST00000372113.4	-	3	1499	c.1494C>T	c.(1492-1494)cgC>cgT	p.R498R	LRIT2_ENST00000538192.1_Silent_p.R508R	NM_001017924.2	NP_001017924.1	A6NDA9	LRIT2_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 2	498						integral component of membrane (GO:0016021)		p.R498R(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(13)|ovary(3)|prostate(6)|urinary_tract(1)	32						GAAGACAGCCGCGCAGGACCC	0.632																																						uc001kcy.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(1492-1494)CGC>CGT		leucine rich repeat containing 22 precursor		G		1,4405		0,1,2202	36.0	43.0	41.0		1494	2.8	0.0	10	dbSNP_134	41	2,8596		0,2,4297	no	coding-synonymous	LRIT2	NM_001017924.2		0,3,6499	AA,AG,GG		0.0233,0.0227,0.0231		498/551	85981835	3,13001	2203	4299	6502	SO:0001819	synonymous_variant	340745					integral to membrane		g.chr10:85981835G>A		CCDS31234.1, CCDS60581.1	10q23.2	2013-01-11	2007-06-19	2007-06-19	ENSG00000204033	ENSG00000204033		"""Immunoglobulin superfamily / I-set domain containing"""	23443	protein-coding gene	gene with protein product			"""leucine rich repeat containing 22"""	LRRC22			Standard	NM_001017924		Approved	AC022389.4	uc001kcy.3	A6NDA9	OTTHUMG00000018633	ENST00000372113.4:c.1494C>T	10.37:g.85981835G>A			Somatic				LRIT2_uc010qmc.1_Silent_p.R508R	p.R498R	NM_001017924	NP_001017924	WXS	Illumina HiSeq	Unspecified	A6NDA9	LRIT2_HUMAN			3	1502	-			498					B7ZME6	Silent	SNP	ENST00000372113.4	37	c.1494C>T	CCDS31234.1																																																																																				0.632	LRIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049110.4	XM_291697		18	65	0	0	0	0	18	65				
KIF20B	9585	broad.mit.edu	37	10	91505671	91505671	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr10:91505671C>G	ENST00000371728.3	+	23	4116	c.4051C>G	c.(4051-4053)Cag>Gag	p.Q1351E	KIF20B_ENST00000416354.1_Missense_Mutation_p.Q1381E|KIF20B_ENST00000260753.4_Missense_Mutation_p.Q1311E|KIF20B_ENST00000478929.1_3'UTR|KIF20B_ENST00000394289.2_Missense_Mutation_p.Q1351E	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	1351					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						GTTAAATAATCAGAAAGTGGA	0.338																																						uc001kgs.1		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(4051-4053)CAG>GAG		M-phase phosphoprotein 1							80.0	82.0	81.0					10																	91505671		2203	4300	6503	SO:0001583	missense	9585				cell cycle arrest|cell division|microtubule-based movement|mitosis|regulation of mitosis	centrosome|microtubule|nucleolus|nucleoplasm|spindle	ATP binding|ATPase activity|microtubule motor activity|WW domain binding	g.chr10:91505671C>G	L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.4051C>G	10.37:g.91505671C>G	ENSP00000360793:p.Gln1351Glu		Somatic				KIF20B_uc001kgr.1_Missense_Mutation_p.Q1311E|KIF20B_uc001kgt.1_Missense_Mutation_p.Q562E|KIF20B_uc009xtw.1_RNA	p.Q1351E	NM_016195	NP_057279	WXS	Illumina HiSeq	Unspecified	Q96Q89	KI20B_HUMAN			23	4123	+			1351					A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Missense_Mutation	SNP	ENST00000371728.3	37	c.4051C>G		.	.	.	.	.	.	.	.	.	.	C	14.39	2.520633	0.44866	.	.	ENSG00000138182	ENST00000260753;ENST00000416354;ENST00000394289;ENST00000371728	T;T;T;T	0.66638	-0.16;-0.16;-0.22;-0.16	5.31	4.35	0.52113	.	0.000000	0.46758	D	0.000272	T	0.67116	0.2859	L	0.39898	1.24	0.27215	N	0.959818	D;B	0.54964	0.969;0.004	D;B	0.64877	0.93;0.007	T	0.57665	-0.7772	10	0.02654	T	1	-3.6054	11.7874	0.52049	0.0:0.7304:0.2696:0.0	.	1351;1311	Q96Q89;Q96Q89-3	KI20B_HUMAN;.	E	1311;1381;1351;1351	ENSP00000260753:Q1311E;ENSP00000411545:Q1381E;ENSP00000377830:Q1351E;ENSP00000360793:Q1351E	ENSP00000260753:Q1311E	Q	+	1	0	KIF20B	91495651	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.064000	0.49986	2.489000	0.83994	0.591000	0.81541	CAG		0.338	KIF20B-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049330.1	NM_016195		3	30	0	0	0	0	3	30				
PKD2L1	9033	broad.mit.edu	37	10	102048203	102048203	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr10:102048203C>G	ENST00000318222.3	-	16	2750	c.2368G>C	c.(2368-2370)Gag>Cag	p.E790Q	BLOC1S2_ENST00000370372.2_5'Flank|PKD2L1_ENST00000353274.3_Nonstop_Mutation_p.*761Y|PKD2L1_ENST00000338519.3_Missense_Mutation_p.E715Q|BLOC1S2_ENST00000441611.1_5'Flank|BLOC1S2_ENST00000361832.2_5'Flank	NM_001253837.1|NM_016112.2	NP_001240766.1|NP_057196.2	Q9P0L9	PK2L1_HUMAN	polycystic kidney disease 2-like 1	790					cation transport (GO:0006812)|cellular response to acidic pH (GO:0071468)|detection of chemical stimulus involved in sensory perception of sour taste (GO:0001581)|detection of mechanical stimulus (GO:0050982)|potassium ion transmembrane transport (GO:0071805)|protein homotrimerization (GO:0070207)|sensory perception of sour taste (GO:0050915)|smoothened signaling pathway (GO:0007224)|sodium ion transmembrane transport (GO:0035725)	calcium channel complex (GO:0034704)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	alpha-actinin binding (GO:0051393)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-activated potassium channel activity (GO:0015269)|cation channel activity (GO:0005261)|cytoskeletal protein binding (GO:0008092)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|sodium channel activity (GO:0005272)|sour taste receptor activity (GO:0033040)			NS(2)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	43		Colorectal(252;0.117)		Epithelial(162;6.15e-10)|all cancers(201;5.14e-08)		CTCCTCTCCTCTAAGGCTTCC	0.488																																						uc001kqx.1		NA																	0				ovary(4)	4						c.(2368-2370)GAG>CAG		polycystic kidney disease 2-like 1							129.0	137.0	134.0					10																	102048203		2203	4300	6503	SO:0001583	missense	9033				signal transduction	integral to membrane	calcium activated cation channel activity|calcium ion binding|cytoskeletal protein binding	g.chr10:102048203C>G	AF094827	CCDS7492.1	10q24.31	2011-12-16			ENSG00000107593	ENSG00000107593		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9011	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 3"""	604532		PKD2L, PKDL		9878261, 9748274	Standard	NM_016112		Approved	PCL, TRPP3	uc001kqx.1	Q9P0L9	OTTHUMG00000018910	ENST00000318222.3:c.2368G>C	10.37:g.102048203C>G	ENSP00000325296:p.Glu790Gln		Somatic				BLOC1S2_uc001kqv.1_5'Flank|BLOC1S2_uc001kqw.1_5'Flank|PKD2L1_uc009xwm.1_Missense_Mutation_p.E743Q	p.E790Q	NM_016112	NP_057196	WXS	Illumina HiSeq	Unspecified	Q9P0L9	PK2L1_HUMAN		Epithelial(162;6.15e-10)|all cancers(201;5.14e-08)	16	2751	-		Colorectal(252;0.117)	790			Cytoplasmic (Potential).		O75972|Q5W039|Q9UP35|Q9UPA2	Missense_Mutation	SNP	ENST00000318222.3	37	c.2368G>C	CCDS7492.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	9.460|9.460|9.460	1.092968|1.092968|1.092968	0.20471|0.20471|0.20471	.|.|.	.|.|.	ENSG00000107593|ENSG00000107593|ENSG00000107593	ENST00000338519;ENST00000318222|ENST00000465680|ENST00000353274	T;T|.|.	0.60920|.|.	0.26;0.15|.|.	3.97|3.97|3.97	0.792|0.792|0.792	0.18625|0.18625|0.18625	.|.|.	1.482380|.|.	0.04646|.|.	N|.|.	0.406071|.|.	T|T|.	0.20414|0.20414|.	0.0491|0.0491|.	N|N|N	0.24115|0.24115|0.24115	0.695|0.695|0.695	0.09310|0.09310|0.09310	N|N|N	1|1|1	B;B|.|.	0.27498|.|.	0.079;0.18|.|.	B;B|.|.	0.21546|.|.	0.035;0.035|.|.	T|T|.	0.22382|0.22382|.	-1.0218|-1.0218|.	10|5|.	0.54805|.|.	T|.|.	0.06|.|.	-0.2313|-0.2313|-0.2313	2.3588|2.3588|2.3588	0.04302|0.04302|0.04302	0.2728:0.43:0.0:0.2972|0.2728:0.43:0.0:0.2972|0.2728:0.43:0.0:0.2972	.|.|.	743;790|.|.	Q1L4F0;Q9P0L9|.|.	.;PK2L1_HUMAN|.|.	Q|T|Y	715;790|46|761	ENSP00000345068:E715Q;ENSP00000325296:E790Q|.|.	ENSP00000325296:E790Q|.|.	E|R|X	-|-|-	1|2|3	0|0|2	PKD2L1|PKD2L1|PKD2L1	102038193|102038193|102038193	0.000000|0.000000|0.000000	0.05858|0.05858|0.05858	0.001000|0.001000|0.001000	0.08648|0.08648|0.08648	0.043000|0.043000|0.043000	0.13939|0.13939|0.13939	-0.250000|-0.250000|-0.250000	0.08830|0.08830|0.08830	0.156000|0.156000|0.156000	0.19299|0.19299|0.19299	0.555000|0.555000|0.555000	0.69702|0.69702|0.69702	GAG|AGA|TAG		0.488	PKD2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049863.2	NM_016112		24	132	0	0	0	0	24	132				
DPCD	25911	broad.mit.edu	37	10	103360965	103360965	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr10:103360965C>G	ENST00000370151.4	+	4	325	c.276C>G	c.(274-276)atC>atG	p.I92M	DPCD_ENST00000370147.1_Missense_Mutation_p.I92M|MIR3158-1_ENST00000583596.1_RNA|DPCD_ENST00000370148.2_Missense_Mutation_p.I92M	NM_015448.1	NP_056263.1	Q9BVM2	DPCD_HUMAN	deleted in primary ciliary dyskinesia homolog (mouse)	92					determination of left/right symmetry (GO:0007368)|epithelial cilium movement (GO:0003351)|lateral ventricle development (GO:0021670)|left/right pattern formation (GO:0060972)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)	nucleus (GO:0005634)				endometrium(1)|large_intestine(1)|lung(2)|skin(1)	5						TGCAGCCTATCTTCATGCGCA	0.552																																						uc001ktn.2		NA																	0				skin(1)	1						c.(274-276)ATC>ATG		DPCD protein							144.0	111.0	122.0					10																	103360965		2203	4300	6503	SO:0001583	missense	25911						protein binding	g.chr10:103360965C>G		CCDS7514.1	10q24.32	2012-05-03			ENSG00000166171	ENSG00000166171			24542	protein-coding gene	gene with protein product						14630615	Standard	NM_015448		Approved	DKFZP566F084, RP11-529I10.4	uc001ktn.3	Q9BVM2	OTTHUMG00000018934	ENST00000370151.4:c.276C>G	10.37:g.103360965C>G	ENSP00000359170:p.Ile92Met		Somatic				hsa-mir-3158-1|MI0014186_5'Flank	p.I92M	NM_015448	NP_056263	WXS	Illumina HiSeq	Unspecified	Q9BVM2	DPCD_HUMAN			4	281	+			92					A8K289|Q6QNL3|Q8N5R1|Q9UFY6	Missense_Mutation	SNP	ENST00000370151.4	37	c.276C>G	CCDS7514.1	.	.	.	.	.	.	.	.	.	.	C	16.63	3.175808	0.57692	.	.	ENSG00000166171	ENST00000370151;ENST00000370147;ENST00000370148;ENST00000370149;ENST00000434727	T;T;T;T	0.32753	1.44;1.44;1.44;1.44	5.95	4.08	0.47627	.	0.254678	0.38959	N	0.001511	T	0.35158	0.0922	M	0.74258	2.255	0.35439	D	0.794751	P	0.42203	0.773	B	0.41764	0.366	T	0.50127	-0.8864	10	0.52906	T	0.07	-8.6835	9.0611	0.36436	0.2671:0.6668:0.0:0.066	.	92	Q9BVM2	DPCD_HUMAN	M	92;92;92;57;56	ENSP00000359170:I92M;ENSP00000359166:I92M;ENSP00000359167:I92M;ENSP00000403505:I56M	ENSP00000359166:I92M	I	+	3	3	DPCD	103350955	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	0.646000	0.24797	0.836000	0.34901	0.650000	0.86243	ATC		0.552	DPCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049958.2			10	72	0	0	0	0	10	72				
LDB1	8861	broad.mit.edu	37	10	103871248	103871248	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr10:103871248G>A	ENST00000425280.1	-	2	413	c.71C>T	c.(70-72)cCg>cTg	p.P24L	LDB1_ENST00000490751.1_5'UTR|LDB1_ENST00000361198.5_5'UTR	NM_001113407.1	NP_001106878.1	Q86U70	LDB1_HUMAN	LIM domain binding 1	24					anterior/posterior axis specification (GO:0009948)|cellular component assembly (GO:0022607)|cerebellar Purkinje cell differentiation (GO:0021702)|epithelial structure maintenance (GO:0010669)|gastrulation with mouth forming second (GO:0001702)|hair follicle development (GO:0001942)|head development (GO:0060322)|histone H3-K4 acetylation (GO:0043973)|multicellular organismal development (GO:0007275)|negative regulation of erythrocyte differentiation (GO:0045647)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron differentiation (GO:0030182)|positive regulation of cell adhesion (GO:0045785)|positive regulation of hemoglobin biosynthetic process (GO:0046985)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription, DNA-templated (GO:0006355)|somatic stem cell maintenance (GO:0035019)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|transcription-dependent tethering of RNA polymerase II gene DNA at nuclear periphery (GO:0000972)|Wnt signaling pathway (GO:0016055)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|enzyme binding (GO:0019899)|LIM domain binding (GO:0030274)|protein homodimerization activity (GO:0042803)|RNA polymerase II activating transcription factor binding (GO:0001102)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(1)|skin(1)	21		Colorectal(252;0.122)		Epithelial(162;1.11e-07)|all cancers(201;1.82e-06)		GTTGCCGTTCGGGGGCTCCTT	0.557																																						uc009xwz.2		NA																	0				large_intestine(1)	1						c.(70-72)CCG>CTG		LIM domain binding 1 isoform 1							49.0	46.0	47.0					10																	103871248		2203	4300	6503	SO:0001583	missense	8861				histone H3-K4 acetylation|negative regulation of erythrocyte differentiation|negative regulation of transcription, DNA-dependent|positive regulation of hemoglobin biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription elongation, DNA-dependent|transcription, DNA-dependent|transcription-dependent tethering of RNA polymerase II gene DNA at nuclear periphery	nuclear chromatin|protein complex	LIM domain binding|protein homodimerization activity|transcription corepressor activity	g.chr10:103871248G>A	AF068652	CCDS7528.1, CCDS44472.1	10q24-q25	2008-08-01			ENSG00000198728	ENSG00000198728			6532	protein-coding gene	gene with protein product	"""carboxy terminal LIM domain protein 2"""	603451				9503020, 9799849	Standard	NM_003893		Approved	NLI, CLIM2	uc009xwz.3	Q86U70	OTTHUMG00000018950	ENST00000425280.1:c.71C>T	10.37:g.103871248G>A	ENSP00000392466:p.Pro24Leu		Somatic				LDB1_uc001kuk.3_5'UTR|LDB1_uc001kul.3_5'UTR	p.P24L	NM_001113407	NP_001106878	WXS	Illumina HiSeq	Unspecified	Q86U70	LDB1_HUMAN		Epithelial(162;1.11e-07)|all cancers(201;1.82e-06)	2	414	-		Colorectal(252;0.122)	24					B4DUC4|O75479|O96010|Q1EQX1|Q9UGM4	Missense_Mutation	SNP	ENST00000425280.1	37	c.71C>T	CCDS44472.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.279075	0.80692	.	.	ENSG00000198728	ENST00000425280	.	.	.	5.5	4.6	0.57074	.	.	.	.	.	T	0.43743	0.1261	N	0.19112	0.55	0.58432	D	0.999993	B	0.02656	0.0	B	0.01281	0.0	T	0.34800	-0.9814	8	0.62326	D	0.03	-18.4248	13.4339	0.61073	0.0774:0.0:0.9226:0.0	.	24	Q86U70	LDB1_HUMAN	L	24	.	ENSP00000392466:P24L	P	-	2	0	LDB1	103861238	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	9.274000	0.95731	1.314000	0.45095	0.561000	0.74099	CCG		0.557	LDB1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001113407		7	34	0	0	0	0	7	34				
AFAP1L2	84632	broad.mit.edu	37	10	116057054	116057054	+	Silent	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr10:116057054C>G	ENST00000304129.4	-	17	2261	c.2232G>C	c.(2230-2232)ctG>ctC	p.L744L	AFAP1L2_ENST00000545353.1_Silent_p.L797L|AFAP1L2_ENST00000369271.3_Silent_p.L744L|AFAP1L2_ENST00000491814.1_5'UTR			Q8N4X5	AF1L2_HUMAN	actin filament associated protein 1-like 2	744					inflammatory response (GO:0006954)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of interleukin-6 production (GO:0032675)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)	protein tyrosine kinase activator activity (GO:0030296)|SH2 domain binding (GO:0042169)|SH3 domain binding (GO:0017124)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|prostate(2)	21		Colorectal(252;0.175)|Breast(234;0.231)		Epithelial(162;0.0219)|all cancers(201;0.0561)		CAGCCTTCTTCAGGTTGTCCT	0.627																																						uc001lbn.2		NA																	0				ovary(1)|breast(1)	2						c.(2230-2232)CTG>CTC		KIAA1914 protein isoform 1							57.0	47.0	50.0					10																	116057054		2203	4300	6503	SO:0001819	synonymous_variant	84632				inflammatory response|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of interleukin-8 production|positive regulation of transcription, DNA-dependent|regulation of interleukin-6 production|regulation of mitotic cell cycle	cytoplasm	protein tyrosine kinase activator activity|SH2 domain binding|SH3 domain binding	g.chr10:116057054C>G	BC024314	CCDS31286.1, CCDS31287.1	10q26.11	2013-01-10	2007-02-07	2007-02-07	ENSG00000169129	ENSG00000169129		"""Pleckstrin homology (PH) domain containing"""	25901	protein-coding gene	gene with protein product		612420	"""KIAA1914"""	KIAA1914		11572484, 17412687	Standard	XM_005270239		Approved	FLJ14564, Em:AC005383.4, XB130	uc001lbn.3	Q8N4X5	OTTHUMG00000019086	ENST00000304129.4:c.2232G>C	10.37:g.116057054C>G			Somatic				AFAP1L2_uc001lbo.2_Silent_p.L744L|AFAP1L2_uc010qse.1_Silent_p.L797L|AFAP1L2_uc001lbp.2_Silent_p.L772L|AFAP1L2_uc001lbm.2_Silent_p.L183L|AFAP1L2_uc010qsd.1_Silent_p.L310L|AFAP1L2_uc001lbq.1_Silent_p.L266L	p.L744L	NM_001001936	NP_001001936	WXS	Illumina HiSeq	Unspecified	Q8N4X5	AF1L2_HUMAN		Epithelial(162;0.0219)|all cancers(201;0.0561)	17	2533	-		Colorectal(252;0.175)|Breast(234;0.231)	744			Potential.		A8K6P7|B3KVQ8|Q2UZW3|Q8TB54|Q96PX4|Q96SY5	Silent	SNP	ENST00000304129.4	37	c.2232G>C	CCDS31286.1																																																																																				0.627	AFAP1L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050462.1	NM_032550		6	34	0	0	0	0	6	34				
INPP5F	22876	broad.mit.edu	37	10	121556365	121556365	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr10:121556365G>C	ENST00000361976.2	+	7	974	c.808G>C	c.(808-810)Gat>Cat	p.D270H	INPP5F_ENST00000369083.3_Missense_Mutation_p.D270H	NM_014937.3	NP_055752.1	Q01968	OCRL_HUMAN	inositol polyphosphate-5-phosphatase F	0	5-phosphatase.				cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			breast(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(9)|lung(5)|ovary(5)|pancreas(1)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00205)|BRCA - Breast invasive adenocarcinoma(275;0.158)		CACCTGTGTAGATGATATTCA	0.468																																						uc001leo.2		NA																	0				ovary(2)	2						c.(808-810)GAT>CAT		inositol polyphosphate-5-phosphatase F							76.0	71.0	73.0					10																	121556365		2203	4300	6503	SO:0001583	missense	22876						phosphoric ester hydrolase activity	g.chr10:121556365G>C	AB023183	CCDS7616.1, CCDS58098.1	10q26.13	2009-02-03			ENSG00000198825	ENSG00000198825			17054	protein-coding gene	gene with protein product		609389				10231032, 11274189	Standard	NM_014937		Approved	SAC2, KIAA0966, hSac2	uc001leo.3	Q9Y2H2	OTTHUMG00000019158	ENST00000361976.2:c.808G>C	10.37:g.121556365G>C	ENSP00000354519:p.Asp270His		Somatic					p.D270H	NM_014937	NP_055752	WXS	Illumina HiSeq	Unspecified	Q9Y2H2	SAC2_HUMAN		all cancers(201;0.00205)|BRCA - Breast invasive adenocarcinoma(275;0.158)	7	974	+		Lung NSC(174;0.109)|all_lung(145;0.142)	270			SAC.		A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Missense_Mutation	SNP	ENST00000361976.2	37	c.808G>C	CCDS7616.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.669112	0.88348	.	.	ENSG00000198825	ENST00000361976;ENST00000369083	T;T	0.56444	1.05;0.46	5.8	4.9	0.64082	Synaptojanin, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.70334	0.3212	M	0.70595	2.14	0.80722	D	1	D	0.89917	1.0	D	0.69479	0.964	T	0.74019	-0.3799	10	0.62326	D	0.03	-11.4103	15.0665	0.71999	0.0683:0.0:0.9317:0.0	.	270	Q9Y2H2	SAC2_HUMAN	H	270	ENSP00000354519:D270H;ENSP00000358079:D270H	ENSP00000354519:D270H	D	+	1	0	INPP5F	121546355	1.000000	0.71417	0.999000	0.59377	0.984000	0.73092	9.013000	0.93629	1.460000	0.47911	0.655000	0.94253	GAT		0.468	INPP5F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050679.1	NM_014937		4	60	0	0	0	0	4	60				
EDRF1	26098	broad.mit.edu	37	10	127429586	127429586	+	Silent	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr10:127429586C>G	ENST00000356792.4	+	17	2419	c.2187C>G	c.(2185-2187)ctC>ctG	p.L729L	C10orf137_ENST00000337623.3_Silent_p.L695L	NM_001202438.1	NP_001189367.1	Q3B7T1	EDRF1_HUMAN		729					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(20)|ovary(8)|pancreas(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	61		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				ATTGCTGCCTCTGCACCAATA	0.363																																						uc001liq.1		NA																	0				ovary(5)|large_intestine(3)|lung(2)	10						c.(2185-2187)CTC>CTG		erythroid differentiation-related factor 1							143.0	145.0	144.0					10																	127429586		2203	4300	6503	SO:0001819	synonymous_variant	26098				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	binding	g.chr10:127429586C>G																												ENST00000356792.4:c.2187C>G	10.37:g.127429586C>G			Somatic				C10orf137_uc001lin.2_Silent_p.L695L|C10orf137_uc001lio.1_Silent_p.L695L|C10orf137_uc001lip.1_Silent_p.L433L|C10orf137_uc001lir.2_Silent_p.L223L|C10orf137_uc001lis.1_Silent_p.L55L	p.L729L	NM_015608	NP_056423	WXS	Illumina HiSeq	Unspecified	Q3B7T1	EDRF1_HUMAN			17	2480	+		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)	729					B2RC65|Q3KR40|Q4G190|Q5VZQ4|Q8IZ74|Q9Y3W4	Silent	SNP	ENST00000356792.4	37	c.2187C>G	CCDS55733.1																																																																																				0.363	C10orf137-007	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388539.1			29	103	0	0	0	0	29	103				
MGMT	4255	broad.mit.edu	37	10	131557595	131557595	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr10:131557595G>A	ENST00000306010.7	+	4	529	c.497G>A	c.(496-498)aGa>aAa	p.R166K		NM_002412.3	NP_002403.2	P16455	MGMT_HUMAN	O-6-methylguanine-DNA methyltransferase	135			E -> D (in dbSNP:rs2308320).		cellular response to ionizing radiation (GO:0071479)|cellular response to organic cyclic compound (GO:0071407)|cellular response to oxidative stress (GO:0034599)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA ligation (GO:0006266)|DNA methylation (GO:0006306)|DNA repair (GO:0006281)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell death (GO:0060548)|positive regulation of DNA repair (GO:0045739)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|response to toxic substance (GO:0009636)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methylated-DNA-[protein]-cysteine S-methyltransferase activity (GO:0003908)|methyltransferase activity (GO:0008168)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	10		all_cancers(35;9.44e-09)|all_epithelial(44;6.98e-08)|Lung NSC(174;0.0157)|all_lung(145;0.0201)|all_neural(114;0.0732)|Colorectal(57;0.0792)|Breast(234;0.167)		OV - Ovarian serous cystadenocarcinoma(35;0.00291)	L-Cysteine(DB00151)	GGAGCAATGAGAGGCAATCCT	0.577								Direct reversal of damage																														uc001lkh.2		NA																	0				ovary(1)|breast(1)	2						c.(496-498)AGA>AAA	Direct_reversal_of_damage	O-6-methylguanine-DNA methyltransferase							95.0	96.0	95.0					10																	131557595		2203	4300	6503	SO:0001583	missense	4255							g.chr10:131557595G>A	M29971	CCDS7660.2	10q26	2005-10-06			ENSG00000170430	ENSG00000170430			7059	protein-coding gene	gene with protein product		156569					Standard	NM_002412		Approved		uc001lkh.2	P16455	OTTHUMG00000019261	ENST00000306010.7:c.497G>A	10.37:g.131557595G>A	ENSP00000302111:p.Arg166Lys		Somatic					p.R166K	NM_002412	NP_002403	WXS	Illumina HiSeq	Unspecified	P16455	MGMT_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;0.00291)	4	523	+		all_cancers(35;9.44e-09)|all_epithelial(44;6.98e-08)|Lung NSC(174;0.0157)|all_lung(145;0.0201)|all_neural(114;0.0732)|Colorectal(57;0.0792)|Breast(234;0.167)	135					Q5VY78	Missense_Mutation	SNP	ENST00000306010.7	37	c.497G>A	CCDS7660.2	.	.	.	.	.	.	.	.	.	.	G	7.785	0.710271	0.15239	.	.	ENSG00000170430	ENST00000306010	T	0.15834	2.39	5.53	4.62	0.57501	.	0.099914	0.64402	N	0.000002	T	0.11922	0.0290	N	0.17379	0.485	0.44780	D	0.997782	B	0.17667	0.023	B	0.23275	0.045	T	0.10405	-1.0631	10	0.26408	T	0.33	.	14.0784	0.64905	0.0731:0.0:0.9268:0.0	.	166	B4DEE8	.	K	166	ENSP00000302111:R166K	ENSP00000302111:R166K	R	+	2	0	MGMT	131447585	1.000000	0.71417	0.421000	0.26609	0.056000	0.15407	5.812000	0.69194	1.475000	0.48197	0.650000	0.86243	AGA		0.577	MGMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051009.3	NM_002412		11	46	0	0	0	0	11	46				
PHRF1	57661	broad.mit.edu	37	11	609574	609574	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr11:609574C>G	ENST00000264555.5	+	14	4246	c.4118C>G	c.(4117-4119)tCt>tGt	p.S1373C	PHRF1_ENST00000533464.1_Missense_Mutation_p.S1369C|PHRF1_ENST00000413872.2_Missense_Mutation_p.S1371C|PHRF1_ENST00000416188.2_Missense_Mutation_p.S1372C	NM_020901.2	NP_065952.2	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	1373					mRNA processing (GO:0006397)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)	RNA polymerase binding (GO:0070063)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|urinary_tract(2)	28						GACAGCCCCTCTGCGAGTGGG	0.682																																						uc001lqe.2		NA																	0					0						c.(4117-4119)TCT>TGT		PHD and ring finger domains 1							16.0	22.0	20.0					11																	609574		2040	4172	6212	SO:0001583	missense	57661						RNA polymerase binding|zinc ion binding	g.chr11:609574C>G	BC004950	CCDS44507.1, CCDS65987.1, CCDS65988.1, CCDS65989.1	11p15.5	2014-06-13			ENSG00000070047	ENSG00000070047		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	24351	protein-coding gene	gene with protein product	"""CTD binding SR like protein rA9"", ""protein phosphatase 1, regulatory subunit 125"""	611780		RNF221			Standard	XM_005253027		Approved	KIAA1542, PPP1R125	uc010qwc.2	Q9P1Y6	OTTHUMG00000165141	ENST00000264555.5:c.4118C>G	11.37:g.609574C>G	ENSP00000264555:p.Ser1373Cys		Somatic				PHRF1_uc010qwc.1_Missense_Mutation_p.S1372C|PHRF1_uc010qwd.1_Missense_Mutation_p.S1371C|PHRF1_uc010qwe.1_Missense_Mutation_p.S1369C|PHRF1_uc009ybz.1_Missense_Mutation_p.S1163C|PHRF1_uc009yca.1_RNA	p.S1373C	NM_020901	NP_065952	WXS	Illumina HiSeq	Unspecified	Q9P1Y6	PHRF1_HUMAN			14	4249	+			1373					A6H8W1|B7ZM64|B9EGP0|C9JS82|Q6PJP2|Q8IVY2|Q8N2Y7|Q9BSM2	Missense_Mutation	SNP	ENST00000264555.5	37	c.4118C>G		.	.	.	.	.	.	.	.	.	.	C	12.68	2.009701	0.35415	.	.	ENSG00000070047	ENST00000264555;ENST00000413872;ENST00000416188;ENST00000533464	T;T;T;T	0.79033	-1.23;-1.23;-1.23;-1.23	3.16	-2.03	0.07365	.	3.284380	0.01221	N	0.008117	T	0.74997	0.3790	L	0.27053	0.805	0.09310	N	1	D;D;D;D	0.56521	0.976;0.976;0.976;0.96	P;P;P;P	0.53146	0.528;0.719;0.719;0.528	T	0.64398	-0.6417	10	0.49607	T	0.09	1.8966	8.1033	0.30870	0.0:0.3634:0.0:0.6366	.	1369;1371;1372;1373	E9PJ24;F8WEF5;Q9P1Y6-3;Q9P1Y6	.;.;.;PHRF1_HUMAN	C	1373;1371;1372;1369	ENSP00000264555:S1373C;ENSP00000388589:S1371C;ENSP00000410626:S1372C;ENSP00000431870:S1369C	ENSP00000264555:S1373C	S	+	2	0	PHRF1	599574	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.252000	0.01185	-0.412000	0.07519	0.561000	0.74099	TCT		0.682	PHRF1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000382133.1	NM_020901		3	13	0	0	0	0	3	13				
SLC25A22	79751	broad.mit.edu	37	11	799973	799973	+	5'Flank	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr11:799973G>C	ENST00000531214.1	-	0	0				PIDD_ENST00000411829.2_Silent_p.L755L|PIDD_ENST00000347755.5_Silent_p.L772L	NM_001191060.1	NP_001177989.1	Q9H936	GHC1_HUMAN	solute carrier family 25 (mitochondrial carrier: glutamate), member 22						L-glutamate transport (GO:0015813)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			endometrium(1)|kidney(1)|lung(2)|urinary_tract(1)	5		all_cancers(49;4.75e-06)|all_epithelial(84;0.00204)|Breast(177;0.00234)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;6.27e-26)|Epithelial(43;4.84e-25)|OV - Ovarian serous cystadenocarcinoma(40;2.72e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GTGCCAAGGAGAGGCCAGCCC	0.632																																					Colon(93;848 1468 3270 23355 49636)	uc001lro.1		NA																	0					0						c.(2314-2316)CTC>CTG		leucine rich repeat and death domain containing							26.0	34.0	32.0					11																	799973		2200	4292	6492	SO:0001631	upstream_gene_variant	55367				apoptosis|signal transduction	cytoplasm|nucleus	death receptor binding	g.chr11:799973G>C	AJ428202	CCDS7715.1	11p15.5	2013-05-22			ENSG00000177542	ENSG00000177542		"""Solute carriers"""	19954	protein-coding gene	gene with protein product		609302				11897791	Standard	NM_024698		Approved	GC1, FLJ13044, NET44, EIEE3	uc001lrj.3	Q9H936	OTTHUMG00000133310		11.37:g.799973G>C	Exception_encountered		Somatic				SLC25A22_uc009yci.2_5'Flank|SLC25A22_uc001lrj.2_5'Flank|LRDD_uc009yck.1_RNA|LRDD_uc001lrk.1_Silent_p.L755L|LRDD_uc001lrl.1_Silent_p.L615L|LRDD_uc001lrm.1_Silent_p.L459L|LRDD_uc001lrn.1_Silent_p.L615L|LRDD_uc001lrp.1_Missense_Mutation_p.S456C	p.L772L	NM_145886	NP_665893	WXS	Illumina HiSeq	Unspecified	Q9HB75	PIDD_HUMAN		all cancers(45;1.45e-25)|Epithelial(43;1.17e-24)|OV - Ovarian serous cystadenocarcinoma(40;6.76e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	15	2458	-		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)	772					A8K366|C9J1H6|E9PJD3|E9PKB2|E9PL68|E9PN26|E9PNQ3|E9PP01|E9PR97|Q8TBU8	Silent	SNP	ENST00000531214.1	37	c.2316C>G	CCDS7715.1																																																																																				0.632	SLC25A22-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384124.1			9	42	0	0	0	0	9	42				
KRTAP5-3	387266	broad.mit.edu	37	11	1629200	1629200	+	Nonsense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr11:1629200G>C	ENST00000399685.1	-	1	493	c.416C>G	c.(415-417)tCa>tGa	p.S139*		NM_001012708.2	NP_001012726.1	Q6L8H2	KRA53_HUMAN	keratin associated protein 5-3	139	11 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	8		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000618)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)		CCCACAGCCTGAGGAGCAGCA	0.627																																						uc001ltw.1		NA																	0				ovary(2)	2						c.(415-417)TCA>TGA		keratin associated protein 5-3							83.0	101.0	95.0					11																	1629200		2200	4295	6495	SO:0001587	stop_gained	387266					keratin filament		g.chr11:1629200G>C	AB126072	CCDS41591.1	11p15.5	2008-02-05			ENSG00000196224	ENSG00000196224		"""Keratin associated proteins"""	23598	protein-coding gene	gene with protein product						15144888	Standard	NM_001012708		Approved	KRTAP5.3, KRTAP5-9	uc001ltw.1	Q6L8H2	OTTHUMG00000057559	ENST00000399685.1:c.416C>G	11.37:g.1629200G>C	ENSP00000382592:p.Ser139*		Somatic					p.S139*	NM_001012708	NP_001012726	WXS	Illumina HiSeq	Unspecified	Q6L8H2	KRA53_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.000618)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)	1	494	-		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	139			11 X 4 AA repeats of C-C-X-P.		Q6PL44|Q701N3	Nonsense_Mutation	SNP	ENST00000399685.1	37	c.416C>G	CCDS41591.1	.	.	.	.	.	.	.	.	.	.	G	14.19	2.461890	0.43736	.	.	ENSG00000196224	ENST00000399685	.	.	.	3.2	-6.4	0.01944	.	.	.	.	.	.	.	.	.	.	.	0.28902	N	0.893203	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	.	9.9265	0.41496	0.0:0.2654:0.6298:0.1048	.	.	.	.	X	139	.	ENSP00000382592:S139X	S	-	2	0	KRTAP5-3	1585776	0.001000	0.12720	0.000000	0.03702	0.696000	0.40369	0.781000	0.26774	-0.564000	0.06070	0.298000	0.19748	TCA		0.627	KRTAP5-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127924.1			26	156	0	0	0	0	26	156				
TNNT3	7140	broad.mit.edu	37	11	1956113	1956113	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr11:1956113C>G	ENST00000397301.1	+	15	686	c.678C>G	c.(676-678)ttC>ttG	p.F226L	TNNT3_ENST00000381549.3_Missense_Mutation_p.F207L|TNNT3_ENST00000381548.3_Missense_Mutation_p.F217L|TNNT3_ENST00000493234.1_3'UTR|TNNT3_ENST00000381561.4_Missense_Mutation_p.F218L|TNNT3_ENST00000381589.3_Missense_Mutation_p.F213L|TNNT3_ENST00000381579.3_Missense_Mutation_p.F207L|TNNT3_ENST00000397304.2_Missense_Mutation_p.F196L|TNNT3_ENST00000360603.3_Missense_Mutation_p.F209L|TNNT3_ENST00000446240.1_Missense_Mutation_p.F196L|TNNT3_ENST00000381558.1_Missense_Mutation_p.F207L|TNNT3_ENST00000278317.6_Missense_Mutation_p.F215L			P45378	TNNT3_HUMAN	troponin T type 3 (skeletal, fast)	226					ATP catabolic process (GO:0006200)|muscle filament sliding (GO:0030049)|regulation of ATPase activity (GO:0043462)|regulation of striated muscle contraction (GO:0006942)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|troponin complex (GO:0005861)	calcium-dependent protein binding (GO:0048306)|tropomyosin binding (GO:0005523)|troponin C binding (GO:0030172)|troponin I binding (GO:0031013)			breast(2)|endometrium(1)|kidney(1)|lung(8)|ovary(1)|prostate(1)|skin(4)|stomach(1)	19		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00253)|Lung(200;0.0333)|LUSC - Lung squamous cell carcinoma(625;0.0826)		TTGACAAGTTCGAGTTTGGGG	0.597																																						uc001luu.3		NA																	0				ovary(1)	1						c.(643-645)TTC>TTG		troponin T3, skeletal, fast isoform 1							138.0	146.0	143.0					11																	1956113		2202	4299	6501	SO:0001583	missense	7140				muscle filament sliding|regulation of ATPase activity|regulation of striated muscle contraction|skeletal muscle contraction	cytosol|troponin complex	calcium-dependent protein binding|tropomyosin binding|troponin C binding|troponin I binding	g.chr11:1956113C>G	M21984	CCDS7727.1, CCDS41594.1, CCDS41595.1, CCDS41596.1	11p15.5	2014-09-17	2005-09-12		ENSG00000130595	ENSG00000130595			11950	protein-coding gene	gene with protein product	"""troponin-T3, skeletal, fast"""	600692	"""troponin T3, skeletal, fast"""			8172653	Standard	NM_001042782		Approved	AMCD2B, DA2B, FSSV, DKFZp779M2348	uc001lup.4	P45378	OTTHUMG00000012475	ENST00000397301.1:c.678C>G	11.37:g.1956113C>G	ENSP00000380468:p.Phe226Leu		Somatic				TNNT3_uc001lun.2_Missense_Mutation_p.F111L|TNNT3_uc001luw.3_Missense_Mutation_p.F207L|TNNT3_uc001luo.3_Missense_Mutation_p.F207L|TNNT3_uc001lup.3_Missense_Mutation_p.F213L|TNNT3_uc001luq.3_Missense_Mutation_p.F207L|TNNT3_uc001lur.2_Missense_Mutation_p.F207L|TNNT3_uc010qxf.1_Missense_Mutation_p.F213L|TNNT3_uc010qxg.1_Missense_Mutation_p.F147L	p.F215L	NM_006757	NP_006748	WXS	Illumina HiSeq	Unspecified	P45378	TNNT3_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00253)|Lung(200;0.0333)|LUSC - Lung squamous cell carcinoma(625;0.0826)	14	857	+		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	226					A8MQ76|A8MSW1|B3KPX3|B7WP64|B7ZL26|B7ZVV9|Q12975|Q12976|Q12977|Q12978|Q17RG9|Q6FH29|Q6N056|Q86TH6	Missense_Mutation	SNP	ENST00000397301.1	37	c.645C>G		.	.	.	.	.	.	.	.	.	.	.	11.65	1.701326	0.30142	.	.	ENSG00000130595	ENST00000278317;ENST00000397309;ENST00000381561;ENST00000381548;ENST00000360603;ENST00000381549;ENST00000381589;ENST00000381579;ENST00000381557;ENST00000453458;ENST00000381563;ENST00000344578;ENST00000381558;ENST00000397301;ENST00000397304;ENST00000446240	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.91464	-2.85;-2.85;-2.85;-2.85;-2.85;-2.85;-2.85;-2.85;-2.85;-2.85;-2.85;-2.85;-2.85;-2.85;-2.85	4.28	-6.19	0.02078	.	0.210963	0.49916	D	0.000140	D	0.92648	0.7664	M	0.84219	2.685	0.50467	D	0.999874	D;P;D;D;P	0.53619	0.961;0.929;0.961;0.961;0.934	P;P;P;P;P	0.57152	0.814;0.748;0.748;0.745;0.656	D	0.91890	0.5523	10	0.54805	T	0.06	-1.9598	15.2622	0.73634	0.0:0.249:0.0:0.751	.	215;207;213;207;226	P45378-2;P45378-7;P45378-6;P45378-4;P45378	.;.;.;.;TNNT3_HUMAN	L	215;227;218;217;209;207;213;207;201;196;218;202;207;226;196;196	ENSP00000278317:F215L;ENSP00000370973:F218L;ENSP00000370960:F217L;ENSP00000353815:F209L;ENSP00000370961:F207L;ENSP00000371001:F213L;ENSP00000370991:F207L;ENSP00000370969:F201L;ENSP00000415614:F196L;ENSP00000370975:F218L;ENSP00000344870:F202L;ENSP00000370970:F207L;ENSP00000380468:F226L;ENSP00000380471:F196L;ENSP00000413203:F196L	ENSP00000278317:F215L	F	+	3	2	TNNT3	1912689	0.001000	0.12720	0.667000	0.29798	0.223000	0.24884	-2.010000	0.01454	-1.388000	0.02092	-0.657000	0.03884	TTC		0.597	TNNT3-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000142920.3	NM_006757		32	135	0	0	0	0	32	135				
Unknown	0	broad.mit.edu	37	11	5988969	5988969	+	IGR	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr11:5988969G>C								OR56A3 (19378 upstream) : OR52L1 (18152 downstream)																							TGGTGAAGAAGAGGATGAGGA	0.478																																						uc010qzu.1		NA																	0					0						c.(754-756)CTC>CTG		olfactory receptor, family 56, subfamily A,							152.0	149.0	150.0					11																	5988969		692	1591	2283	SO:0001628	intergenic_variant	390084					integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5988969G>C																													11.37:g.5988969G>C			Somatic					p.L252L	NM_001146033	NP_001139505	WXS	Illumina HiSeq	Unspecified	P0C7T3	O56A5_HUMAN			1	756	-			252			Helical; Name=6; (Potential).			Silent	SNP		37	c.756C>G																																																																																				0	0.478									5	20	0	0	0	0	5	20				
OR6A2	8590	broad.mit.edu	37	11	6816674	6816674	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr11:6816674G>A	ENST00000332601.3	-	1	454	c.266C>T	c.(265-267)tCc>tTc	p.S89F		NM_003696.2	NP_003687.2	O95222	OR6A2_HUMAN	olfactory receptor, family 6, subfamily A, member 2	89					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(4)|pancreas(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	29		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		ATCCTGTTTGGATCCAACAAA	0.458																																						uc001mes.1		NA																	0				ovary(3)|central_nervous_system(1)|pancreas(1)	5						c.(265-267)TCC>TTC		olfactory receptor, family 6, subfamily A,							149.0	140.0	143.0					11																	6816674		2201	4296	6497	SO:0001583	missense	8590				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6816674G>A	AB065822	CCDS7772.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184933	ENSG00000184933		"""GPCR / Class A : Olfactory receptors"""	15301	protein-coding gene	gene with protein product		608495		OR6A2P, OR6A1			Standard	NM_003696		Approved	OR11-55	uc001mes.1	O95222	OTTHUMG00000165736	ENST00000332601.3:c.266C>T	11.37:g.6816674G>A	ENSP00000330384:p.Ser89Phe		Somatic					p.S89F	NM_003696	NP_003687	WXS	Illumina HiSeq	Unspecified	O95222	OR6A2_HUMAN		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)	1	466	-		Medulloblastoma(188;0.0523)|all_neural(188;0.236)	89			Extracellular (Potential).		Q3MJC7|Q6IF35|Q9H206	Missense_Mutation	SNP	ENST00000332601.3	37	c.266C>T	CCDS7772.1	.	.	.	.	.	.	.	.	.	.	G	4.099	0.016420	0.07959	.	.	ENSG00000184933	ENST00000332601	T	0.03152	4.03	4.8	0.505	0.16953	GPCR, rhodopsin-like superfamily (1);	1.702050	0.02986	N	0.146224	T	0.06325	0.0163	M	0.68952	2.095	0.09310	N	1	B	0.28470	0.213	B	0.26614	0.071	T	0.40001	-0.9586	10	0.59425	D	0.04	.	4.3346	0.11080	0.2736:0.0:0.5297:0.1967	.	89	O95222	OR6A2_HUMAN	F	89	ENSP00000330384:S89F	ENSP00000330384:S89F	S	-	2	0	OR6A2	6773250	0.000000	0.05858	0.000000	0.03702	0.216000	0.24613	0.020000	0.13466	0.227000	0.20999	0.563000	0.77884	TCC		0.458	OR6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385981.1	NM_003696		12	62	0	0	0	0	12	62				
HIPK3	10114	broad.mit.edu	37	11	33363124	33363124	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr11:33363124G>A	ENST00000303296.4	+	8	2094	c.1789G>A	c.(1789-1791)Gct>Act	p.A597T	HIPK3_ENST00000525975.1_Missense_Mutation_p.A597T|HIPK3_ENST00000456517.1_Missense_Mutation_p.A597T|HIPK3_ENST00000379016.3_Missense_Mutation_p.A597T	NM_005734.3	NP_005725.3	Q9H422	HIPK3_HUMAN	homeodomain interacting protein kinase 3	597					apoptotic process (GO:0006915)|mRNA transcription (GO:0009299)|negative regulation of apoptotic process (GO:0043066)|negative regulation of JUN kinase activity (GO:0043508)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(3)|kidney(3)|large_intestine(9)|liver(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	39						GACCACATCTGCTCATTCAGT	0.413																																						uc001mul.1		NA																	0				large_intestine(1)|skin(1)|stomach(1)|ovary(1)|pancreas(1)	5						c.(1789-1791)GCT>ACT		homeodomain interacting protein kinase 3 isoform							247.0	219.0	228.0					11																	33363124		2202	4298	6500	SO:0001583	missense	10114				anti-apoptosis|apoptosis|negative regulation of JUN kinase activity|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm	ATP binding|protein serine/threonine kinase activity	g.chr11:33363124G>A	AF004849	CCDS7884.1, CCDS41634.1	11p13	2008-07-18	2001-11-29		ENSG00000110422	ENSG00000110422			4915	protein-coding gene	gene with protein product		604424	"""homeodomain-interacting protein kinase 3"""			9373137, 9748262	Standard	NM_005734		Approved	PKY, DYRK6, YAK1, FIST3	uc031pzm.1	Q9H422	OTTHUMG00000132269	ENST00000303296.4:c.1789G>A	11.37:g.33363124G>A	ENSP00000304226:p.Ala597Thr		Somatic				HIPK3_uc001mum.1_Missense_Mutation_p.A597T|HIPK3_uc009yjv.1_Missense_Mutation_p.A597T	p.A597T	NM_005734	NP_005725	WXS	Illumina HiSeq	Unspecified	Q9H422	HIPK3_HUMAN			8	2059	+			597					O14632|Q2PBG4|Q2PBG5|Q92632|Q9HAS2	Missense_Mutation	SNP	ENST00000303296.4	37	c.1789G>A	CCDS7884.1	.	.	.	.	.	.	.	.	.	.	G	13.54	2.267042	0.40095	.	.	ENSG00000110422	ENST00000525975;ENST00000303296;ENST00000379016;ENST00000456517	T;T;T;T	0.54675	0.59;0.56;0.59;0.59	5.91	5.0	0.66597	.	0.000000	0.64402	D	0.000019	T	0.34077	0.0885	N	0.14661	0.345	0.53688	D	0.999971	B;B	0.09022	0.002;0.001	B;B	0.12837	0.008;0.003	T	0.11767	-1.0574	10	0.21014	T	0.42	.	11.8401	0.52348	0.1394:0.0:0.8606:0.0	.	597;597	Q9H422-2;Q9H422	.;HIPK3_HUMAN	T	597	ENSP00000431710:A597T;ENSP00000304226:A597T;ENSP00000368301:A597T;ENSP00000398241:A597T	ENSP00000304226:A597T	A	+	1	0	HIPK3	33319700	1.000000	0.71417	0.981000	0.43875	0.562000	0.35680	3.175000	0.50855	1.501000	0.48654	0.650000	0.86243	GCT		0.413	HIPK3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255358.1	NM_005734		39	318	0	0	0	0	39	318				
PDHX	8050	broad.mit.edu	37	11	34982054	34982054	+	Missense_Mutation	SNP	A	A	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr11:34982054A>G	ENST00000227868.4	+	5	714	c.630A>G	c.(628-630)atA>atG	p.I210M	PDHX_ENST00000448838.3_Missense_Mutation_p.I195M|PDHX_ENST00000430469.2_Intron			O00330	ODPX_HUMAN	pyruvate dehydrogenase complex, component X	210	Interaction with DLD.				cellular metabolic process (GO:0044237)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	transferase activity, transferring acyl groups (GO:0016746)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|upper_aerodigestive_tract(1)	16	all_epithelial(35;0.115)|Lung NSC(22;0.218)|all_lung(20;0.242)	all_hematologic(20;0.124)	STAD - Stomach adenocarcinoma(6;0.00113)			CTCGGGGGATATTCACTAAAG	0.378																																						uc001mvt.2		NA																	0				kidney(1)	1						c.(628-630)ATA>ATG		pyruvate dehydrogenase complex, component X							59.0	67.0	64.0					11																	34982054		2202	4298	6500	SO:0001583	missense	8050				pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	acyltransferase activity	g.chr11:34982054A>G	U82328	CCDS7896.1, CCDS44569.1, CCDS53616.1	11p13	2008-02-05			ENSG00000110435	ENSG00000110435			21350	protein-coding gene	gene with protein product		608769				9467010, 12372595	Standard	NM_003477		Approved	E3BP, proX, PDX1, OPDX, DLDBP	uc001mvt.3	O00330	OTTHUMG00000166491	ENST00000227868.4:c.630A>G	11.37:g.34982054A>G	ENSP00000227868:p.Ile210Met		Somatic				PDHX_uc010rep.1_Missense_Mutation_p.I195M|PDHX_uc010req.1_Intron	p.I210M	NM_003477	NP_003468	WXS	Illumina HiSeq	Unspecified	O00330	ODPX_HUMAN	STAD - Stomach adenocarcinoma(6;0.00113)		5	1156	+	all_epithelial(35;0.115)|Lung NSC(22;0.218)|all_lung(20;0.242)	all_hematologic(20;0.124)	210	I->A: Strongly decreased DLD binding.		Interaction with DLD.		B4DW62|D3DR11|E9PB14|E9PBP7|O60221|Q96FV8|Q99783	Missense_Mutation	SNP	ENST00000227868.4	37	c.630A>G	CCDS7896.1	.	.	.	.	.	.	.	.	.	.	A	17.36	3.369024	0.61624	.	.	ENSG00000110435	ENST00000533550;ENST00000448838;ENST00000227868	T;T;T	0.21932	2.65;2.57;1.98	5.99	0.263	0.15602	E3 binding (3);	0.176840	0.64402	D	0.000011	T	0.27205	0.0667	L	0.49455	1.56	0.80722	D	1	P;B	0.49307	0.922;0.152	P;B	0.55615	0.78;0.217	T	0.01776	-1.1276	10	0.33141	T	0.24	-16.6359	8.324	0.32145	0.2477:0.4679:0.0:0.2844	.	195;210	E9PB14;O00330	.;ODPX_HUMAN	M	150;195;210	ENSP00000431281:I150M;ENSP00000389404:I195M;ENSP00000227868:I210M	ENSP00000227868:I210M	I	+	3	3	PDHX	34938630	0.633000	0.27181	0.997000	0.53966	0.840000	0.47671	-0.221000	0.09202	0.067000	0.16545	0.524000	0.50904	ATA		0.378	PDHX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390017.1	NM_003477		8	125	0	0	0	0	8	125				
LDLRAD3	143458	broad.mit.edu	37	11	36250750	36250750	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr11:36250750G>C	ENST00000315571.5	+	6	862	c.841G>C	c.(841-843)Gac>Cac	p.D281H	LDLRAD3_ENST00000528989.1_Missense_Mutation_p.D232H|LDLRAD3_ENST00000524419.1_Missense_Mutation_p.D271H	NM_174902.2	NP_777562.1	Q86YD5	LRAD3_HUMAN	low density lipoprotein receptor class A domain containing 3	281					receptor-mediated endocytosis (GO:0006898)|regulation of protein processing (GO:0070613)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(14)|prostate(7)|skin(1)	28	all_lung(20;0.089)|Lung NSC(22;0.175)|all_epithelial(35;0.177)	all_hematologic(20;0.124)				CTACTCTTCTGACACGGAATC	0.627																																						uc001mwk.1		NA																	0				central_nervous_system(1)	1						c.(841-843)GAC>CAC		low density lipoprotein receptor class A domain							141.0	145.0	144.0					11																	36250750		2202	4298	6500	SO:0001583	missense	143458					integral to membrane	receptor activity	g.chr11:36250750G>C	AK075546	CCDS31462.1	11p13	2014-06-05			ENSG00000179241	ENSG00000179241			27046	protein-coding gene	gene with protein product						21795536	Standard	NM_174902		Approved	LRAD3	uc001mwk.1	Q86YD5	OTTHUMG00000166313	ENST00000315571.5:c.841G>C	11.37:g.36250750G>C	ENSP00000318607:p.Asp281His		Somatic				LDLRAD3_uc010rey.1_Missense_Mutation_p.D232H|LDLRAD3_uc010rez.1_Missense_Mutation_p.D160H|LDLRAD3_uc010rfa.1_RNA	p.D281H	NM_174902	NP_777562	WXS	Illumina HiSeq	Unspecified	Q86YD5	LRAD3_HUMAN			6	878	+	all_lung(20;0.089)|Lung NSC(22;0.175)|all_epithelial(35;0.177)	all_hematologic(20;0.124)	281			Cytoplasmic (Potential).		B7Z1U3|B9EG81|Q8NBJ0	Missense_Mutation	SNP	ENST00000315571.5	37	c.841G>C	CCDS31462.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.714216	0.89112	.	.	ENSG00000179241	ENST00000528989;ENST00000524419;ENST00000315571	D;D;D	0.94330	-3.4;-3.26;-3.15	5.22	5.22	0.72569	.	0.234090	0.38058	N	0.001834	D	0.94032	0.8088	N	0.19112	0.55	0.53688	D	0.999976	D;D;D	0.89917	1.0;0.987;0.987	D;P;P	0.83275	0.996;0.579;0.67	D	0.95236	0.8347	10	0.66056	D	0.02	.	18.7822	0.91939	0.0:0.0:1.0:0.0	.	271;232;281	E9PR86;B7Z1U3;Q86YD5	.;.;LRAD3_HUMAN	H	232;271;281	ENSP00000433954:D232H;ENSP00000434313:D271H;ENSP00000318607:D281H	ENSP00000318607:D281H	D	+	1	0	LDLRAD3	36207326	1.000000	0.71417	0.943000	0.38184	0.954000	0.61252	5.358000	0.66064	2.428000	0.82296	0.563000	0.77884	GAC		0.627	LDLRAD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389085.1	NM_174902		21	867	0	0	0	0	21	867				
COMMD9	29099	broad.mit.edu	37	11	36300091	36300091	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr11:36300091G>A	ENST00000263401.5	-	3	269	c.253C>T	c.(253-255)Ctc>Ttc	p.L85F	COMMD9_ENST00000532705.1_Missense_Mutation_p.L85F|COMMD9_ENST00000452374.2_Missense_Mutation_p.L43F	NM_014186.3	NP_054905.2	Q9P000	COMD9_HUMAN	COMM domain containing 9	85										kidney(1)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	5	all_lung(20;0.211)	all_hematologic(20;0.107)				TCTGGAAAGAGAGCCAGAATT	0.483																																						uc001mwn.3		NA																	0				ovary(1)	1						c.(253-255)CTC>TTC		COMM domain containing 9 isoform 1							105.0	103.0	104.0					11																	36300091		2202	4298	6500	SO:0001583	missense	29099							g.chr11:36300091G>A	AY542164	CCDS7900.1, CCDS44571.1	11p13	2008-02-05			ENSG00000110442	ENSG00000110442			25014	protein-coding gene	gene with protein product		612299				15799966	Standard	NM_014186		Approved	HSPC166, FLJ31106	uc001mwn.4	Q9P000	OTTHUMG00000166333	ENST00000263401.5:c.253C>T	11.37:g.36300091G>A	ENSP00000263401:p.Leu85Phe		Somatic				COMMD9_uc009ykj.2_Missense_Mutation_p.L43F|COMMD9_uc010rfb.1_Missense_Mutation_p.L85F	p.L85F	NM_014186	NP_054905	WXS	Illumina HiSeq	Unspecified	Q9P000	COMD9_HUMAN			3	290	-	all_lung(20;0.211)	all_hematologic(20;0.107)	85					E9PAN2|Q96FI2|Q9H0R0	Missense_Mutation	SNP	ENST00000263401.5	37	c.253C>T	CCDS7900.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.348382	0.82132	.	.	ENSG00000110442	ENST00000263401;ENST00000537683;ENST00000452374;ENST00000532705	T;T;T	0.33438	1.41;1.41;1.41	5.91	5.91	0.95273	.	0.181436	0.49916	D	0.000140	T	0.53642	0.1809	M	0.73962	2.25	0.46317	D	0.998982	D;D;D	0.62365	0.991;0.985;0.96	D;P;P	0.64877	0.93;0.79;0.776	T	0.51293	-0.8724	10	0.48119	T	0.1	-23.9287	14.6543	0.68823	0.0:0.1454:0.8546:0.0	.	85;43;85	B4DIH0;Q9P000-2;Q9P000	.;.;COMD9_HUMAN	F	85;85;43;85	ENSP00000263401:L85F;ENSP00000392510:L43F;ENSP00000435599:L85F	ENSP00000263401:L85F	L	-	1	0	COMMD9	36256667	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	2.389000	0.44407	2.793000	0.96121	0.655000	0.94253	CTC		0.483	COMMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389196.1	NM_014186		11	350	0	0	0	0	11	350				
ATG13	9776	broad.mit.edu	37	11	46687010	46687010	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr11:46687010G>C	ENST00000434074.1	+	12	1667	c.978G>C	c.(976-978)gaG>gaC	p.E326D	ATG13_ENST00000312040.4_Missense_Mutation_p.E326D|ATG13_ENST00000451945.1_Missense_Mutation_p.E289D|ATG13_ENST00000359513.4_Missense_Mutation_p.E326D|ATG13_ENST00000529655.1_Missense_Mutation_p.E289D|ATG13_ENST00000530500.1_Missense_Mutation_p.E210D|ATG13_ENST00000526508.1_Missense_Mutation_p.E326D|ATG13_ENST00000528494.1_Missense_Mutation_p.E359D|ATG13_ENST00000524625.1_Missense_Mutation_p.E289D	NM_001205120.1	NP_001192049.1	O75143	ATG13_HUMAN	autophagy related 13	326					autophagic vacuole assembly (GO:0000045)	ATG1/UKL1 signaling complex (GO:0034273)|cytosol (GO:0005829)|pre-autophagosomal structure (GO:0000407)|ULK1-ATG13-FIP200 complex (GO:0070969)	protein kinase binding (GO:0019901)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|prostate(1)|skin(1)	15						CTGACCAGGAGAGACTGGCAA	0.562																																						uc009yld.2		NA																	0					0						c.(976-978)GAG>GAC		autophagy-related protein 13 isoform 1							100.0	83.0	89.0					11																	46687010		2201	4299	6500	SO:0001583	missense	9776				autophagic vacuole assembly	cytosol|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	protein binding	g.chr11:46687010G>C	AB014552	CCDS7921.1, CCDS44582.1, CCDS55760.1, CCDS55761.1	11p11.2	2014-02-12	2012-06-06	2010-06-29	ENSG00000175224	ENSG00000175224			29091	protein-coding gene	gene with protein product		615088	"""KIAA0652"", ""ATG13 autophagy related 13 homolog (S. cerevisiae)"""	KIAA0652		15169610, 18339812, 17204848	Standard	NM_001205120		Approved		uc001nda.3	O75143	OTTHUMG00000166538	ENST00000434074.1:c.978G>C	11.37:g.46687010G>C	ENSP00000400642:p.Glu326Asp		Somatic				KIAA0652_uc001nda.2_Missense_Mutation_p.E359D|KIAA0652_uc001ndb.2_Missense_Mutation_p.E326D|KIAA0652_uc001ncz.2_Missense_Mutation_p.E289D|KIAA0652_uc001ndc.2_Missense_Mutation_p.E289D|KIAA0652_uc010rgv.1_Missense_Mutation_p.E210D	p.E326D	NM_001142673	NP_001136145	WXS	Illumina HiSeq	Unspecified	O75143	ATG13_HUMAN		GBM - Glioblastoma multiforme(35;0.226)	13	1662	+			326					B4DFI4|D3DQQ1|D3DQQ2|E9PQZ8|Q53EN6|Q9BRL3|Q9H8B0	Missense_Mutation	SNP	ENST00000434074.1	37	c.978G>C	CCDS44582.1	.	.	.	.	.	.	.	.	.	.	G	15.29	2.788297	0.49997	.	.	ENSG00000175224	ENST00000395549;ENST00000434074;ENST00000312040;ENST00000451945;ENST00000529655;ENST00000530500;ENST00000526508;ENST00000524625;ENST00000359513;ENST00000528494;ENST00000525009	.	.	.	5.7	5.7	0.88788	.	0.196552	0.53938	D	0.000043	T	0.40119	0.1104	N	0.19112	0.55	0.39274	D	0.964431	B;B;B;B	0.09022	0.0;0.0;0.0;0.002	B;B;B;B	0.08055	0.002;0.001;0.001;0.003	T	0.32161	-0.9917	9	0.15499	T	0.54	-18.1342	12.3433	0.55105	0.0769:0.0:0.9231:0.0	.	210;326;359;289	B4DFI4;O75143;E9PQZ8;O75143-2	.;ATG13_HUMAN;.;.	D	289;326;326;289;289;210;326;289;326;359;58	.	ENSP00000310321:E326D	E	+	3	2	ATG13	46643586	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.654000	0.37334	2.683000	0.91414	0.655000	0.94253	GAG		0.562	ATG13-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390300.2	NM_014741		9	64	0	0	0	0	9	64				
ARFGAP2	84364	broad.mit.edu	37	11	47189775	47189775	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr11:47189775C>G	ENST00000524782.1	-	11	1197	c.969G>C	c.(967-969)gaG>gaC	p.E323D	RP11-390K5.6_ENST00000524412.1_RNA|ARFGAP2_ENST00000426335.2_Missense_Mutation_p.E187D|ARFGAP2_ENST00000419701.2_Missense_Mutation_p.E216D|ARFGAP2_ENST00000395449.3_5'UTR|ARFGAP2_ENST00000319543.6_Missense_Mutation_p.E54D	NM_001242832.1|NM_032389.4	NP_001229761.1|NP_115765.2	Q8N6H7	ARFG2_HUMAN	ADP-ribosylation factor GTPase activating protein 2	323	Required for interaction with coatomer.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			breast(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						TCACCTGCATCTCAGACAGCA	0.552																																						uc001ndt.2		NA																	0				ovary(1)	1						c.(967-969)GAG>GAC		ADP-ribosylation factor GTPase activating							104.0	93.0	97.0					11																	47189775		2201	4299	6500	SO:0001583	missense	84364				protein transport|regulation of ARF GTPase activity|vesicle-mediated transport	Golgi membrane|nucleolus|plasma membrane	ARF GTPase activator activity|zinc ion binding	g.chr11:47189775C>G	AK027482	CCDS7926.1, CCDS73283.1	11p11.2-p11.12	2012-10-05	2008-01-09	2008-01-09	ENSG00000149182	ENSG00000149182		"""ADP-ribosylation factor GTPase activating proteins"""	13504	protein-coding gene	gene with protein product		606908	"""zinc finger protein 289, ID1 regulated"""	ZNF289		11278321, 14690497	Standard	NM_032389		Approved	IRZ, Zfp289, FLJ14576	uc001ndt.3	Q8N6H7	OTTHUMG00000166773	ENST00000524782.1:c.969G>C	11.37:g.47189775C>G	ENSP00000434442:p.Glu323Asp		Somatic				ARFGAP2_uc010rha.1_Missense_Mutation_p.E54D|ARFGAP2_uc010rhb.1_Missense_Mutation_p.E295D|ARFGAP2_uc001ndu.2_Missense_Mutation_p.E187D|ARFGAP2_uc010rhc.1_Missense_Mutation_p.E54D	p.E323D	NM_032389	NP_115765	WXS	Illumina HiSeq	Unspecified	Q8N6H7	ARFG2_HUMAN			11	984	-			323			Required for interaction with coatomer.		B4DX29|B7Z9M7|D3DQQ9|Q3LIF2|Q8N3I1|Q96SX7	Missense_Mutation	SNP	ENST00000524782.1	37	c.969G>C	CCDS7926.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.36|10.36	1.329056|1.329056	0.24167|0.24167	.|.	.|.	ENSG00000149182|ENSG00000149182	ENST00000527776|ENST00000426335;ENST00000524782;ENST00000319543;ENST00000419701;ENST00000527927	.|T;T;T;T;T	.|0.41400	.|1.0;1.0;1.0;1.0;1.0	6.17|6.17	4.33|4.33	0.51752|0.51752	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.42223|0.42223	0.1193|0.1193	N|N	0.25144|0.25144	0.715|0.715	0.58432|0.58432	D|D	0.999998|0.999998	.|D;B;D	.|0.67145	.|0.996;0.018;0.972	.|D;B;P	.|0.65987	.|0.94;0.028;0.785	T|T	0.28170|0.28170	-1.0052|-1.0052	5|10	.|0.02654	.|T	.|1	-23.0206|-23.0206	13.3799|13.3799	0.60761|0.60761	0.0:0.8728:0.0:0.1272|0.0:0.8728:0.0:0.1272	.|.	.|216;187;323	.|B4DX29;G5E9L0;Q8N6H7	.|.;.;ARFG2_HUMAN	H|D	45|187;323;54;216;187	.|ENSP00000400226:E187D;ENSP00000434442:E323D;ENSP00000327309:E54D;ENSP00000389264:E216D;ENSP00000434433:E187D	.|ENSP00000327309:E54D	D|E	-|-	1|3	0|2	ARFGAP2|ARFGAP2	47146351|47146351	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.489000|1.489000	0.35562|0.35562	0.951000|0.951000	0.37770|0.37770	0.655000|0.655000	0.94253|0.94253	GAT|GAG		0.552	ARFGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391425.1	NM_032389		8	55	0	0	0	0	8	55				
MADD	8567	broad.mit.edu	37	11	47295502	47295502	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr11:47295502G>C	ENST00000311027.5	+	2	202	c.37G>C	c.(37-39)Gac>Cac	p.D13H	RP11-17G12.3_ENST00000543925.1_RNA|MADD_ENST00000407859.3_Missense_Mutation_p.D13H|MADD_ENST00000406482.1_Missense_Mutation_p.D13H|MADD_ENST00000342922.4_Missense_Mutation_p.D13H|MADD_ENST00000402192.2_Missense_Mutation_p.D13H|MADD_ENST00000395344.3_Missense_Mutation_p.D13H|MADD_ENST00000395336.3_Missense_Mutation_p.D13H|MADD_ENST00000349238.3_Missense_Mutation_p.D13H|MADD_ENST00000402799.1_Missense_Mutation_p.D13H|RP11-17G12.3_ENST00000545474.1_RNA	NM_003682.3	NP_003673.3			MAP-kinase activating death domain											breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		TCGGTTACTTGACTATCTAGT	0.443																																						uc001ner.1		NA																	0				ovary(5)|skin(4)|central_nervous_system(2)	11						c.(37-39)GAC>CAC		MAP-kinase activating death domain-containing							113.0	97.0	103.0					11																	47295502		2201	4298	6499	SO:0001583	missense	8567				activation of MAPK activity|apoptosis|cell surface receptor linked signaling pathway|regulation of apoptosis|regulation of cell cycle	cytoplasm|integral to membrane|plasma membrane	death receptor binding|protein kinase activator activity|Rab guanyl-nucleotide exchange factor activity	g.chr11:47295502G>C	AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.37G>C	11.37:g.47295502G>C	ENSP00000310933:p.Asp13His		Somatic				MADD_uc001neq.2_Missense_Mutation_p.D13H|MADD_uc001nev.1_Missense_Mutation_p.D13H|MADD_uc001nes.1_Missense_Mutation_p.D13H|MADD_uc001net.1_Missense_Mutation_p.D13H|MADD_uc009yln.1_Missense_Mutation_p.D13H|MADD_uc001neu.1_Missense_Mutation_p.D13H|MADD_uc001nex.2_Missense_Mutation_p.D13H|MADD_uc001nez.2_Missense_Mutation_p.D13H|MADD_uc001new.2_Missense_Mutation_p.D13H	p.D13H	NM_003682	NP_003673	WXS	Illumina HiSeq	Unspecified	Q8WXG6	MADD_HUMAN		Lung(87;0.182)	2	228	+			13						Missense_Mutation	SNP	ENST00000311027.5	37	c.37G>C	CCDS7930.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.953235	0.92660	.	.	ENSG00000110514	ENST00000453571;ENST00000342922;ENST00000395342;ENST00000402799;ENST00000406482;ENST00000349238;ENST00000311027;ENST00000407859;ENST00000395344;ENST00000444117;ENST00000395336;ENST00000402192;ENST00000422579	T;T;T;T;T;T;T;T;T	0.21191	2.12;2.03;2.02;2.1;2.12;2.04;2.03;2.1;2.12	5.8	5.8	0.92144	uDENN (2);	0.000000	0.85682	D	0.000000	T	0.38506	0.1043	L	0.29908	0.895	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D	0.97110	0.999;1.0;1.0;1.0;1.0;1.0;1.0;0.999;0.999;1.0	T	0.09907	-1.0653	10	0.62326	D	0.03	-25.2546	20.0585	0.97663	0.0:0.0:1.0:0.0	.	13;13;13;13;13;13;13;13;13;13	B5MEE5;A8K8S7;Q8WXG6-7;F8W9P9;Q8WXG6-6;Q8WXG6-5;Q8WXG6-2;Q8WXG6-4;Q8WXG6;Q8WXG6-3	.;.;.;.;.;.;.;.;MADD_HUMAN;.	H	13	ENSP00000343902:D13H;ENSP00000385585:D13H;ENSP00000384435:D13H;ENSP00000304505:D13H;ENSP00000310933:D13H;ENSP00000384204:D13H;ENSP00000378753:D13H;ENSP00000378745:D13H;ENSP00000384287:D13H	ENSP00000310933:D13H	D	+	1	0	MADD	47252078	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.113000	0.89568	2.753000	0.94483	0.453000	0.30009	GAC		0.443	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317746.1			8	37	0	0	0	0	8	37				
OR8K5	219453	broad.mit.edu	37	11	55927105	55927105	+	Missense_Mutation	SNP	G	G	A	rs573633126		TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr11:55927105G>A	ENST00000313447.1	-	1	688	c.689C>T	c.(688-690)tCt>tTt	p.S230F		NM_001004058.2	NP_001004058.2	Q8NH50	OR8K5_HUMAN	olfactory receptor, family 8, subfamily K, member 5	230						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(24)|ovary(2)|pancreas(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	34	Esophageal squamous(21;0.00693)	Lung NSC(402;0.197)|all_epithelial(135;0.236)				GCCCTCTGCAGAATGCATTTG	0.398																																						uc010rja.1		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(688-690)TCT>TTT		olfactory receptor, family 8, subfamily K,							76.0	73.0	74.0					11																	55927105		2201	4296	6497	SO:0001583	missense	219453				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55927105G>A	BK004347	CCDS31521.1	11q11	2012-08-09			ENSG00000181752	ENSG00000181752		"""GPCR / Class A : Olfactory receptors"""	15315	protein-coding gene	gene with protein product							Standard	NM_001004058		Approved		uc010rja.2	Q8NH50	OTTHUMG00000166820	ENST00000313447.1:c.689C>T	11.37:g.55927105G>A	ENSP00000323853:p.Ser230Phe		Somatic					p.S230F	NM_001004058	NP_001004058	WXS	Illumina HiSeq	Unspecified	Q8NH50	OR8K5_HUMAN			1	689	-	Esophageal squamous(21;0.00693)	Lung NSC(402;0.197)|all_epithelial(135;0.236)	230			Cytoplasmic (Potential).		Q6IFB5	Missense_Mutation	SNP	ENST00000313447.1	37	c.689C>T	CCDS31521.1	.	.	.	.	.	.	.	.	.	.	G	12.28	1.889923	0.33348	.	.	ENSG00000181752	ENST00000313447	T	0.00340	8.04	3.98	3.98	0.46160	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000032	T	0.01222	0.0040	H	0.96833	3.89	0.28887	N	0.894098	D	0.89917	1.0	D	0.74674	0.984	T	0.02860	-1.1101	10	0.87932	D	0	.	10.5593	0.45135	0.0:0.198:0.802:0.0	.	230	Q8NH50	OR8K5_HUMAN	F	230	ENSP00000323853:S230F	ENSP00000323853:S230F	S	-	2	0	OR8K5	55683681	0.713000	0.27926	0.960000	0.40013	0.137000	0.21094	2.460000	0.45031	2.202000	0.70862	0.465000	0.42564	TCT		0.398	OR8K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391543.1	NM_001004058		8	40	0	0	0	0	8	40				
LRRC55	219527	broad.mit.edu	37	11	56954823	56954823	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr11:56954823G>A	ENST00000497933.1	+	2	1042	c.895G>A	c.(895-897)Gat>Aat	p.D299N		NM_001005210.2	NP_001005210.1	Q6ZSA7	LRC55_HUMAN	leucine rich repeat containing 55	269					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(13)|ovary(2)|skin(2)	25						CCTGACCCTGGATGATTACCT	0.607																																						uc001njl.1		NA																	0					0						c.(895-897)GAT>AAT		leucine rich repeat containing 55							161.0	110.0	127.0					11																	56954823		2201	4296	6497	SO:0001583	missense	219527					integral to membrane		g.chr11:56954823G>A		CCDS31539.1	11q12.1	2008-02-05			ENSG00000183908	ENSG00000183908			32324	protein-coding gene	gene with protein product		615213					Standard	NM_001005210		Approved	FLJ45686	uc001njl.2	Q6ZSA7	OTTHUMG00000159309	ENST00000497933.1:c.895G>A	11.37:g.56954823G>A	ENSP00000419542:p.Asp299Asn		Somatic				LRRC55_uc001njm.1_5'Flank	p.D299N	NM_001005210	NP_001005210	WXS	Illumina HiSeq	Unspecified	Q6ZSA7	LRC55_HUMAN			2	1042	+			269					A7E2U7|B2RN81	Missense_Mutation	SNP	ENST00000497933.1	37	c.895G>A	CCDS31539.1	.	.	.	.	.	.	.	.	.	.	G	18.85	3.711783	0.68730	.	.	ENSG00000183908	ENST00000497933	T	0.22134	1.97	5.74	5.74	0.90152	.	0.000000	0.64402	D	0.000010	T	0.16257	0.0391	N	0.08118	0	0.33048	D	0.532406	P	0.44776	0.843	P	0.45232	0.474	T	0.09037	-1.0693	10	0.44086	T	0.13	.	16.8401	0.85966	0.0:0.0:1.0:0.0	.	269	Q6ZSA7	LRC55_HUMAN	N	299	ENSP00000419542:D299N	ENSP00000419542:D299N	D	+	1	0	LRRC55	56711399	1.000000	0.71417	0.992000	0.48379	0.812000	0.45895	6.498000	0.73679	2.712000	0.92718	0.563000	0.77884	GAT		0.607	LRRC55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354503.2	NM_001005210		9	77	0	0	0	0	9	77				
FAM111A	63901	broad.mit.edu	37	11	58920371	58920371	+	Silent	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr11:58920371G>A	ENST00000528737.1	+	5	4048	c.1230G>A	c.(1228-1230)gtG>gtA	p.V410V	FAM111A_ENST00000361723.3_Silent_p.V410V|FAM111A_ENST00000531147.1_Silent_p.V410V|FAM111A_ENST00000420244.1_Silent_p.V410V|FAM111A_ENST00000533703.1_Silent_p.V410V			Q96PZ2	F111A_HUMAN	family with sequence similarity 111, member A	410	Interaction with SV40 large T antigen.				defense response to virus (GO:0051607)|DNA replication (GO:0006260)|negative regulation of viral genome replication (GO:0045071)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22		all_epithelial(135;0.139)				GTGTAAGGGTGACATTTGGTT	0.383																																						uc010rkp.1		NA																	0				ovary(3)	3						c.(1228-1230)GTG>GTA		hypothetical protein LOC63901							145.0	145.0	145.0					11																	58920371		2201	4295	6496	SO:0001819	synonymous_variant	63901				proteolysis		serine-type endopeptidase activity	g.chr11:58920371G>A	AK092953	CCDS7973.1	11q12.1	2014-03-13				ENSG00000166801			24725	protein-coding gene	gene with protein product		615292				11572484, 23996431, 23684011	Standard	NM_022074		Approved	FLJ22794, KIAA1895	uc001nnq.3	Q96PZ2		ENST00000528737.1:c.1230G>A	11.37:g.58920371G>A			Somatic				FAM111A_uc010rkq.1_Silent_p.V410V|FAM111A_uc010rkr.1_Silent_p.V410V|FAM111A_uc001nno.2_Silent_p.V410V|FAM111A_uc001nnp.2_Silent_p.V410V|FAM111A_uc001nnq.2_Silent_p.V410V	p.V410V	NM_001142521	NP_001135993	WXS	Illumina HiSeq	Unspecified	Q96PZ2	F111A_HUMAN			5	1457	+		all_epithelial(135;0.139)	410					A8K5Y8|Q5RKS9|Q5XKM2|Q68DK9|Q6IPR7|Q9H5Y1	Silent	SNP	ENST00000528737.1	37	c.1230G>A	CCDS7973.1																																																																																				0.383	FAM111A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393975.1	NM_022074		14	80	0	0	0	0	14	80				
GAL3ST3	89792	broad.mit.edu	37	11	65810464	65810464	+	Silent	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr11:65810464G>A	ENST00000312006.4	-	3	1091	c.810C>T	c.(808-810)cgC>cgT	p.R270R	GAL3ST3_ENST00000527878.1_Silent_p.R270R	NM_033036.2	NP_149025.1	Q96A11	G3ST3_HUMAN	galactose-3-O-sulfotransferase 3	270					monosaccharide metabolic process (GO:0005996)|oligosaccharide metabolic process (GO:0009311)|poly-N-acetyllactosamine metabolic process (GO:0030309)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|carbohydrate binding (GO:0030246)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)			kidney(1)|lung(9)|ovary(2)|skin(2)	14						AGCTGGCGGCGCGCGCGTTGA	0.711																																						uc001ogv.2		NA																	0				ovary(1)	1						c.(808-810)CGC>CGT		galactose-3-O-sulfotransferase 3							10.0	11.0	10.0					11																	65810464		2186	4267	6453	SO:0001819	synonymous_variant	89792				monosaccharide metabolic process|oligosaccharide metabolic process|poly-N-acetyllactosamine metabolic process|proteoglycan biosynthetic process|sulfur compound metabolic process	Golgi cisterna membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|carbohydrate binding|galactosylceramide sulfotransferase activity|proteoglycan sulfotransferase activity	g.chr11:65810464G>A	AY026481	CCDS8128.1	11q13.1	2014-08-12			ENSG00000175229	ENSG00000175229		"""Sulfotransferases, membrane-bound"""	24144	protein-coding gene	gene with protein product		608234				11323440, 11356829	Standard	NM_033036		Approved	GAL3ST2	uc001ogw.3	Q96A11	OTTHUMG00000166667	ENST00000312006.4:c.810C>T	11.37:g.65810464G>A			Somatic				GAL3ST3_uc001ogw.2_Silent_p.R270R	p.R270R	NM_033036	NP_149025	WXS	Illumina HiSeq	Unspecified	Q96A11	G3ST3_HUMAN			2	970	-			270			Lumenal (Potential).		Q14D05	Silent	SNP	ENST00000312006.4	37	c.810C>T	CCDS8128.1																																																																																				0.711	GAL3ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391052.1	NM_033036		4	17	0	0	0	0	4	17				
RIN1	9610	broad.mit.edu	37	11	66102285	66102285	+	Missense_Mutation	SNP	C	C	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr11:66102285C>A	ENST00000311320.4	-	6	1111	c.985G>T	c.(985-987)Ggg>Tgg	p.G329W	RIN1_ENST00000424433.2_Missense_Mutation_p.G224W|RIN1_ENST00000524804.1_5'Flank|RIN1_ENST00000530056.1_Missense_Mutation_p.G224W|RP11-867G23.12_ENST00000526655.1_RNA	NM_004292.2	NP_004283.2	Q13671	RIN1_HUMAN	Ras and Rab interactor 1	329	Ras and 14-3-3 protein binding region.				associative learning (GO:0008306)|endocytosis (GO:0006897)|memory (GO:0007613)|negative regulation of synaptic plasticity (GO:0031914)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|ovary(1)	14						CCCCGGGACCCTGGCACCCCC	0.721																																						uc001ohn.1		NA																	0				lung(2)|breast(1)	3						c.(985-987)GGG>TGG		ras inhibitor RIN1							3.0	4.0	4.0					11																	66102285		2008	3962	5970	SO:0001583	missense	9610				endocytosis|signal transduction	cytoplasm|cytoskeleton|plasma membrane	GTPase activator activity|protein binding	g.chr11:66102285C>A	L36463	CCDS31614.1	11q13.2	2005-09-18				ENSG00000174791			18749	protein-coding gene	gene with protein product		605965				9144171, 1849280	Standard	NM_004292		Approved		uc001ohn.1	Q13671		ENST00000311320.4:c.985G>T	11.37:g.66102285C>A	ENSP00000310406:p.Gly329Trp		Somatic				RIN1_uc010roy.1_Missense_Mutation_p.G22W|RIN1_uc009yrd.1_Missense_Mutation_p.G22W|RIN1_uc010roz.1_Missense_Mutation_p.G224W|RIN1_uc010rpa.1_Missense_Mutation_p.G224W	p.G329W	NM_004292	NP_004283	WXS	Illumina HiSeq	Unspecified	Q13671	RIN1_HUMAN			6	1112	-			329			Ras and 14-3-3 protein binding region.		O15010|Q00427|Q96CC8	Missense_Mutation	SNP	ENST00000311320.4	37	c.985G>T	CCDS31614.1	.	.	.	.	.	.	.	.	.	.	C	9.735	1.163278	0.21538	.	.	ENSG00000174791	ENST00000311320;ENST00000424433;ENST00000530056	T;T;T	0.16457	2.93;2.77;2.34	3.86	1.93	0.25924	.	0.876908	0.09620	N	0.777651	T	0.24699	0.0599	N	0.22421	0.69	0.09310	N	1	D;D;D	0.76494	0.999;0.998;0.975	D;D;P	0.74023	0.982;0.941;0.748	T	0.19549	-1.0302	10	0.72032	D	0.01	-7.571	6.8825	0.24181	0.0:0.7672:0.0:0.2328	.	224;22;329	E9PNR2;B4DW96;Q13671	.;.;RIN1_HUMAN	W	329;224;224	ENSP00000310406:G329W;ENSP00000400560:G224W;ENSP00000432798:G224W	ENSP00000310406:G329W	G	-	1	0	RIN1	65858861	0.000000	0.05858	0.001000	0.08648	0.093000	0.18481	0.265000	0.18515	0.374000	0.24650	0.462000	0.41574	GGG		0.721	RIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392980.2	NM_004292		2	2	1	0	0.0016	0.00166925	2	2				
CARNS1	57571	broad.mit.edu	37	11	67191490	67191490	+	Silent	SNP	G	G	C	rs193103057		TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr11:67191490G>C	ENST00000307823.3	+	9	2354	c.1902G>C	c.(1900-1902)ctG>ctC	p.L634L	CARNS1_ENST00000445895.2_Silent_p.L757L|CARNS1_ENST00000423745.2_Silent_p.L634L|CARNS1_ENST00000531040.1_Silent_p.L731L	NM_020811.1	NP_065862.1	A5YM72	CRNS1_HUMAN	carnosine synthase 1	634	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.				ATP catabolic process (GO:0006200)|carnosine biosynthetic process (GO:0035499)		ATP binding (GO:0005524)|ATPase activity (GO:0016887)|carnosine synthase activity (GO:0047730)|metal ion binding (GO:0046872)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)	11						CTACGAGGCTGCCTGGCTTCA	0.642																																						uc009yrp.2		NA																	0					0						c.(1900-1902)CTG>CTC		ATP-grasp domain containing 1							83.0	91.0	89.0					11																	67191490		2103	4206	6309	SO:0001819	synonymous_variant	57571				carnosine biosynthetic process		ATP binding|carnosine synthase activity|metal ion binding	g.chr11:67191490G>C		CCDS44658.1, CCDS53667.1	11q13.1	2010-03-25	2010-03-25	2010-03-25	ENSG00000172508	ENSG00000172508			29268	protein-coding gene	gene with protein product		613368	"""ATP-grasp domain containing 1"""	ATPGD1		20097752	Standard	NM_020811		Approved	KIAA1394	uc010rpr.2	A5YM72		ENST00000307823.3:c.1902G>C	11.37:g.67191490G>C			Somatic				PPP1CA_uc001okx.1_5'Flank|CARNS1_uc001olc.3_Silent_p.L773L	p.L634L	NM_020811	NP_065862	WXS	Illumina HiSeq	Unspecified	A5YM72	CRNS1_HUMAN			9	2354	+			634			ATP-grasp.		A8K1M3|B4DFC6|E9PK38|F5H427|Q8N467|Q9P2F3	Silent	SNP	ENST00000307823.3	37	c.1902G>C	CCDS44658.1																																																																																				0.642	CARNS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395501.1	NM_020811		5	20	0	0	0	0	5	20				
PPFIA1	8500	broad.mit.edu	37	11	70218613	70218613	+	Silent	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr11:70218613G>C	ENST00000253925.7	+	23	3287	c.3072G>C	c.(3070-3072)ctG>ctC	p.L1024L	AP000487.5_ENST00000500185.2_RNA|AP000487.5_ENST00000530690.1_RNA|PPFIA1_ENST00000389547.3_Silent_p.L1024L|PPFIA1_ENST00000530548.1_3'UTR	NM_003626.3	NP_003617.1	Q13136	LIPA1_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1	1024	SAM 2. {ECO:0000255|PROSITE- ProRule:PRU00184}.				cell-matrix adhesion (GO:0007160)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of stress fiber assembly (GO:0051497)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|presynaptic active zone (GO:0048786)	signal transducer activity (GO:0004871)			breast(3)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	65			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			TTATGTGCCTGAGAAGGTTAA	0.328																																						uc001opo.2		NA																	0				lung(2)|ovary(1)	3						c.(3070-3072)CTG>CTC		PTPRF interacting protein alpha 1 isoform b							86.0	92.0	90.0					11																	70218613		2200	4294	6494	SO:0001819	synonymous_variant	8500				cell-matrix adhesion	cytoplasm	protein binding|signal transducer activity	g.chr11:70218613G>C	U22816	CCDS31627.1, CCDS31628.1	11q13.3	2013-01-10			ENSG00000131626	ENSG00000131626		"""Sterile alpha motif (SAM) domain containing"""	9245	protein-coding gene	gene with protein product	"""Liprin-alpha1"""	611054				7796809, 9624153	Standard	NM_003626		Approved	LIP.1, LIPRIN	uc001opo.3	Q13136	OTTHUMG00000167266	ENST00000253925.7:c.3072G>C	11.37:g.70218613G>C			Somatic				PPFIA1_uc001opn.1_Silent_p.L1024L|PPFIA1_uc001opp.2_RNA|PPFIA1_uc001opr.2_Silent_p.L163L|PPFIA1_uc001ops.2_Silent_p.L63L	p.L1024L	NM_003626	NP_003617	WXS	Illumina HiSeq	Unspecified	Q13136	LIPA1_HUMAN	BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)		23	3270	+			1024			Potential.|SAM 2.		A6NLE3|Q13135|Q14567|Q8N4I2	Silent	SNP	ENST00000253925.7	37	c.3072G>C	CCDS31627.1																																																																																				0.328	PPFIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393905.1	NM_003626		7	45	0	0	0	0	7	45				
ARHGEF17	9828	broad.mit.edu	37	11	73074301	73074301	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr11:73074301G>C	ENST00000263674.3	+	15	5397	c.5047G>C	c.(5047-5049)Gag>Cag	p.E1683Q		NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	1683					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						CACCAGCTCAGAGGAGGAGCA	0.637																																						uc001otu.2		NA																	0					0						c.(5047-5049)GAG>CAG		Rho guanine nucleotide exchange factor (GEF) 17							24.0	22.0	23.0					11																	73074301		2199	4291	6490	SO:0001583	missense	9828				actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity	g.chr11:73074301G>C	AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.5047G>C	11.37:g.73074301G>C	ENSP00000263674:p.Glu1683Gln		Somatic					p.E1683Q	NM_014786	NP_055601	WXS	Illumina HiSeq	Unspecified	Q96PE2	ARHGH_HUMAN			15	5068	+			1683					B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Missense_Mutation	SNP	ENST00000263674.3	37	c.5047G>C	CCDS8221.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.931266	0.92389	.	.	ENSG00000110237	ENST00000263674	T	0.60171	0.21	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.67896	0.2942	L	0.38531	1.155	0.58432	D	0.999999	D	0.89917	1.0	D	0.71184	0.972	T	0.69034	-0.5252	10	0.54805	T	0.06	-23.5654	17.684	0.88251	0.0:0.0:1.0:0.0	.	1683	Q96PE2	ARHGH_HUMAN	Q	1683	ENSP00000263674:E1683Q	ENSP00000263674:E1683Q	E	+	1	0	ARHGEF17	72751949	1.000000	0.71417	0.973000	0.42090	0.988000	0.76386	9.781000	0.99029	2.597000	0.87782	0.650000	0.86243	GAG		0.637	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397365.1	NM_014786		3	14	0	0	0	0	3	14				
ARHGEF17	9828	broad.mit.edu	37	11	73074384	73074384	+	Silent	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr11:73074384G>C	ENST00000263674.3	+	15	5480	c.5130G>C	c.(5128-5130)ggG>ggC	p.G1710G		NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	1710					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						CAATGGATGGGAGAGCCCTTC	0.667																																						uc001otu.2		NA																	0					0						c.(5128-5130)GGG>GGC		Rho guanine nucleotide exchange factor (GEF) 17							24.0	25.0	25.0					11																	73074384		2199	4293	6492	SO:0001819	synonymous_variant	9828				actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity	g.chr11:73074384G>C	AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.5130G>C	11.37:g.73074384G>C			Somatic					p.G1710G	NM_014786	NP_055601	WXS	Illumina HiSeq	Unspecified	Q96PE2	ARHGH_HUMAN			15	5151	+			1710					B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Silent	SNP	ENST00000263674.3	37	c.5130G>C	CCDS8221.1																																																																																				0.667	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397365.1	NM_014786		3	14	0	0	0	0	3	14				
FDX1	2230	broad.mit.edu	37	11	110327657	110327657	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr11:110327657C>G	ENST00000260270.2	+	3	564	c.326C>G	c.(325-327)aCc>aGc	p.T109S		NM_004109.4	NP_004100.1	P10109	ADX_HUMAN	ferredoxin 1	109	2Fe-2S ferredoxin-type. {ECO:0000255|PROSITE-ProRule:PRU00465}.				cholesterol metabolic process (GO:0008203)|hormone biosynthetic process (GO:0042446)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|iron ion binding (GO:0005506)			lung(2)	2		all_cancers(61;1.59e-12)|all_epithelial(67;8.38e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.01e-06)|BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|all cancers(92;5.27e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0384)|Colorectal(284;0.228)	Mitotane(DB00648)	TGTGAGGGAACCCTGGCTTGT	0.418																																						uc001pkx.2		NA																	0					0						c.(325-327)ACC>AGC		ferredoxin 1 precursor	Mitotane(DB00648)						349.0	287.0	308.0					11																	110327657		2201	4298	6499	SO:0001583	missense	2230				electron transport chain|transport	mitochondrial matrix	2 iron, 2 sulfur cluster binding|electron carrier activity|iron ion binding	g.chr11:110327657C>G	M23668	CCDS8344.1	11q22.3	2008-02-01			ENSG00000137714	ENSG00000137714			3638	protein-coding gene	gene with protein product	"""adrenodoxin"""	103260		FDX		2969697	Standard	NM_004109		Approved	ADX	uc001pkx.3	P10109	OTTHUMG00000166589	ENST00000260270.2:c.326C>G	11.37:g.110327657C>G	ENSP00000260270:p.Thr109Ser		Somatic					p.T109S	NM_004109	NP_004100	WXS	Illumina HiSeq	Unspecified	P10109	ADX_HUMAN		Epithelial(105;1.01e-06)|BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|all cancers(92;5.27e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0384)|Colorectal(284;0.228)	3	577	+		all_cancers(61;1.59e-12)|all_epithelial(67;8.38e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)	109			2Fe-2S ferredoxin-type.		B0YJ14|Q53YD6	Missense_Mutation	SNP	ENST00000260270.2	37	c.326C>G	CCDS8344.1	.	.	.	.	.	.	.	.	.	.	C	18.90	3.722274	0.68959	.	.	ENSG00000137714	ENST00000260270	.	.	.	5.36	5.36	0.76844	Beta-grasp fold, ferredoxin-type (1);Ferredoxin (3);	0.000000	0.85682	D	0.000000	T	0.50803	0.1637	N	0.17248	0.465	0.80722	D	1	B	0.18461	0.028	B	0.30105	0.111	T	0.42565	-0.9444	9	0.20046	T	0.44	-21.784	18.6798	0.91543	0.0:1.0:0.0:0.0	.	109	P10109	ADX_HUMAN	S	109	.	ENSP00000260270:T109S	T	+	2	0	FDX1	109832867	1.000000	0.71417	0.998000	0.56505	0.542000	0.35054	7.485000	0.81204	2.509000	0.84616	0.561000	0.74099	ACC		0.418	FDX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390590.1	NM_004109		27	144	0	0	0	0	27	144				
DIXDC1	85458	broad.mit.edu	37	11	111844775	111844775	+	Silent	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr11:111844775C>T	ENST00000529225.1	+	5	622	c.342C>T	c.(340-342)atC>atT	p.I114I	DIXDC1_ENST00000389821.4_3'UTR|DIXDC1_ENST00000531396.1_Silent_p.I115I|DIXDC1_ENST00000440460.2_Silent_p.I115I	NM_001278542.1	NP_001265471.1	Q155Q3	DIXC1_HUMAN	DIX domain containing 1	115	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				camera-type eye development (GO:0043010)|cell cycle (GO:0007049)|cerebellar cortex development (GO:0021695)|cerebral cortex radially oriented cell migration (GO:0021799)|forebrain development (GO:0030900)|forebrain ventricular zone progenitor cell division (GO:0021869)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of axonogenesis (GO:0050772)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of JNK cascade (GO:0046330)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of JNK cascade (GO:0046328)|regulation of microtubule cytoskeleton organization (GO:0070507)|Wnt signaling pathway (GO:0016055)	axon terminus (GO:0043679)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytosol (GO:0005829)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	gamma-tubulin binding (GO:0043015)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)			cervix(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)	17		all_cancers(61;7.58e-15)|all_epithelial(67;5.42e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;2.99e-07)|BRCA - Breast invasive adenocarcinoma(274;6.72e-07)|all cancers(92;6.25e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0548)		TGAAGTCTATCATGAGGCTGG	0.512																																						uc001pml.2		NA																	0				ovary(1)	1						c.(343-345)ATC>ATT		DIX domain containing 1 isoform a							68.0	66.0	67.0					11																	111844775		1961	4152	6113	SO:0001819	synonymous_variant	85458				multicellular organismal development|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytosol|focal adhesion	actin binding|gamma-tubulin binding|signal transducer activity	g.chr11:111844775C>T	AB051522	CCDS60957.1, CCDS73381.1, CCDS73382.1	11q23.1	2014-03-20			ENSG00000150764	ENSG00000150764			23695	protein-coding gene	gene with protein product		610493				12792787	Standard	NM_001037954		Approved	KIAA1735, Dixin	uc001pmm.3	Q155Q3	OTTHUMG00000166912	ENST00000529225.1:c.342C>T	11.37:g.111844775C>T			Somatic				DIXDC1_uc001pmj.2_Silent_p.I108I|DIXDC1_uc001pmk.2_Silent_p.I115I	p.I115I	NM_001037954	NP_001033043	WXS	Illumina HiSeq	Unspecified	Q155Q3	DIXC1_HUMAN		Epithelial(105;2.99e-07)|BRCA - Breast invasive adenocarcinoma(274;6.72e-07)|all cancers(92;6.25e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0548)	4	642	+		all_cancers(61;7.58e-15)|all_epithelial(67;5.42e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)	115			CH.		A1A5D8|E9PRV4|Q6P2J8|Q6PIK4|Q86SR7|Q8IVY4|Q96N69|Q9C0C8	Silent	SNP	ENST00000529225.1	37	c.345C>T																																																																																					0.512	DIXDC1-002	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000391831.1	NM_001037954		8	37	0	0	0	0	8	37				
DIXDC1	85458	broad.mit.edu	37	11	111889689	111889689	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr11:111889689G>A	ENST00000440460.2	+	21	2275	c.1978G>A	c.(1978-1980)Gat>Aat	p.D660N	DIXDC1_ENST00000389821.4_3'UTR|DIXDC1_ENST00000315253.5_Missense_Mutation_p.D449N|RP11-708L7.6_ENST00000530733.1_RNA	NM_001037954.2	NP_001033043.1	Q155Q3	DIXC1_HUMAN	DIX domain containing 1	661	DIX. {ECO:0000255|PROSITE- ProRule:PRU00069}.				camera-type eye development (GO:0043010)|cell cycle (GO:0007049)|cerebellar cortex development (GO:0021695)|cerebral cortex radially oriented cell migration (GO:0021799)|forebrain development (GO:0030900)|forebrain ventricular zone progenitor cell division (GO:0021869)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of axonogenesis (GO:0050772)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of JNK cascade (GO:0046330)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of JNK cascade (GO:0046328)|regulation of microtubule cytoskeleton organization (GO:0070507)|Wnt signaling pathway (GO:0016055)	axon terminus (GO:0043679)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytosol (GO:0005829)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	gamma-tubulin binding (GO:0043015)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)			cervix(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)	17		all_cancers(61;7.58e-15)|all_epithelial(67;5.42e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;2.99e-07)|BRCA - Breast invasive adenocarcinoma(274;6.72e-07)|all cancers(92;6.25e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0548)		GATTTTCCATGATGATGATGC	0.388																																						uc001pml.2		NA																	0				ovary(1)	1						c.(1981-1983)GAT>AAT		DIX domain containing 1 isoform a							114.0	106.0	108.0					11																	111889689		1825	4082	5907	SO:0001583	missense	85458				multicellular organismal development|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytosol|focal adhesion	actin binding|gamma-tubulin binding|signal transducer activity	g.chr11:111889689G>A	AB051522	CCDS60957.1, CCDS73381.1, CCDS73382.1	11q23.1	2014-03-20			ENSG00000150764	ENSG00000150764			23695	protein-coding gene	gene with protein product		610493				12792787	Standard	NM_001037954		Approved	KIAA1735, Dixin	uc001pmm.3	Q155Q3	OTTHUMG00000166912	ENST00000440460.2:c.1978G>A	11.37:g.111889689G>A	ENSP00000394352:p.Asp660Asn		Somatic				DIXDC1_uc001pmm.2_Missense_Mutation_p.D450N|DIXDC1_uc001pmn.2_Missense_Mutation_p.D367N|DIXDC1_uc010rwq.1_Missense_Mutation_p.D326N	p.D661N	NM_001037954	NP_001033043	WXS	Illumina HiSeq	Unspecified	Q155Q3	DIXC1_HUMAN		Epithelial(105;2.99e-07)|BRCA - Breast invasive adenocarcinoma(274;6.72e-07)|all cancers(92;6.25e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0548)	21	2278	+		all_cancers(61;7.58e-15)|all_epithelial(67;5.42e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)	661			DIX.		A1A5D8|E9PRV4|Q6P2J8|Q6PIK4|Q86SR7|Q8IVY4|Q96N69|Q9C0C8	Missense_Mutation	SNP	ENST00000440460.2	37	c.1981G>A		.	.	.	.	.	.	.	.	.	.	G	24.7	4.565084	0.86439	.	.	ENSG00000150764	ENST00000440460;ENST00000315253	T;T	0.66638	-0.22;-0.22	5.58	5.58	0.84498	DIX (2);	0.000000	0.85682	D	0.000000	D	0.83755	0.5323	.	.	.	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	1.0;1.0;0.998	D	0.85068	0.0938	9	0.87932	D	0	-10.7461	19.922	0.97089	0.0:0.0:1.0:0.0	.	326;449;661	B4DH68;E7EQ17;Q155Q3	.;.;DIXC1_HUMAN	N	660;449	ENSP00000394352:D660N;ENSP00000314068:D449N	ENSP00000314068:D449N	D	+	1	0	DIXDC1	111394899	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.160000	0.94734	2.780000	0.95670	0.655000	0.94253	GAT		0.388	DIXDC1-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001037954		10	77	0	0	0	0	10	77				
BSX	390259	broad.mit.edu	37	11	122848536	122848536	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr11:122848536C>T	ENST00000343035.2	-	3	571	c.523G>A	c.(523-525)Gaa>Aaa	p.E175K		NM_001098169.1	NP_001091639.1	Q3C1V8	BSH_HUMAN	brain-specific homeobox	175					eating behavior (GO:0042755)|locomotory behavior (GO:0007626)|mammary gland involution (GO:0060056)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(2)	10		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0361)		GCTTTGGGTTCGTCTTGGCTT	0.592																																						uc010rzs.1		NA																	0					0						c.(523-525)GAA>AAA		brain specific homeobox							62.0	64.0	63.0					11																	122848536		1893	4127	6020	SO:0001583	missense	390259							g.chr11:122848536C>T		CCDS41728.1	11q24.1	2011-07-19			ENSG00000188909	ENSG00000188909		"""Homeoboxes / ANTP class : NKL subclass"""	20450	protein-coding gene	gene with protein product		611074					Standard	NM_001098169		Approved	BSX1	uc010rzs.2	Q3C1V8	OTTHUMG00000150247	ENST00000343035.2:c.523G>A	11.37:g.122848536C>T	ENSP00000344285:p.Glu175Lys		Somatic					p.E175K	NM_001098169	NP_001091639	WXS	Illumina HiSeq	Unspecified	Q3C1V8	BSH_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0361)	3	523	-		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	175						Missense_Mutation	SNP	ENST00000343035.2	37	c.523G>A	CCDS41728.1	.	.	.	.	.	.	.	.	.	.	C	19.89	3.911559	0.72983	.	.	ENSG00000188909	ENST00000343035	D	0.92965	-3.14	5.4	5.4	0.78164	Homeodomain-like (1);	0.101925	0.64402	D	0.000006	D	0.84696	0.5529	N	0.14661	0.345	0.58432	D	0.999996	B	0.20261	0.043	B	0.11329	0.006	T	0.80216	-0.1474	10	0.10111	T	0.7	.	19.1718	0.93581	0.0:1.0:0.0:0.0	.	175	Q3C1V8	BSH_HUMAN	K	175	ENSP00000344285:E175K	ENSP00000344285:E175K	E	-	1	0	BSX	122353746	1.000000	0.71417	1.000000	0.80357	0.550000	0.35303	7.219000	0.78000	2.516000	0.84829	0.561000	0.74099	GAA		0.592	BSX-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317076.1	NM_001098169		14	47	0	0	0	0	14	47				
KCNJ5	3762	broad.mit.edu	37	11	128781747	128781747	+	Silent	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr11:128781747C>G	ENST00000338350.4	+	3	931	c.579C>G	c.(577-579)ccC>ccG	p.P193P	KCNJ5_ENST00000533599.1_Silent_p.P193P|KCNJ5_ENST00000529694.1_Silent_p.P193P			P48544	KCNJ5_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 5	193					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)			NS(1)|breast(1)|endometrium(4)|large_intestine(4)|liver(2)|lung(9)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	26	all_hematologic(175;0.0641)	Lung NSC(97;0.00038)|all_lung(97;0.000817)|Breast(109;0.00123)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0059)|LUSC - Lung squamous cell carcinoma(976;0.021)|Lung(977;0.0215)	Glyburide(DB01016)	TCAGCCAGCCCAAGAAGAGAG	0.562																																					Pancreas(108;2548 5082)|Esophageal Squamous(165;4544 6231)	uc001qet.2		NA																	0				skin(1)	1						c.(577-579)CCC>CCG		potassium inwardly-rectifying channel J5	Glibenclamide(DB01016)						141.0	140.0	140.0					11																	128781747		2201	4297	6498	SO:0001819	synonymous_variant	3762				synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding	g.chr11:128781747C>G	D50134	CCDS8479.1	11q24	2014-09-17				ENSG00000120457		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6266	protein-coding gene	gene with protein product		600734				16382105	Standard	NM_000890		Approved	Kir3.4, CIR, KATP1, GIRK4, LQT13	uc001qet.3	P48544		ENST00000338350.4:c.579C>G	11.37:g.128781747C>G			Somatic				KCNJ5_uc009zck.2_Silent_p.P193P|KCNJ5_uc001qew.2_Silent_p.P193P	p.P193P	NM_000890	NP_000881	WXS	Illumina HiSeq	Unspecified	P48544	IRK5_HUMAN		OV - Ovarian serous cystadenocarcinoma(99;0.0059)|LUSC - Lung squamous cell carcinoma(976;0.021)|Lung(977;0.0215)	2	893	+	all_hematologic(175;0.0641)	Lung NSC(97;0.00038)|all_lung(97;0.000817)|Breast(109;0.00123)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)	193			Cytoplasmic (By similarity).		B2R744|Q6DK13|Q6DK14|Q92807	Silent	SNP	ENST00000338350.4	37	c.579C>G	CCDS8479.1																																																																																				0.562	KCNJ5-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386239.1	NM_000890		14	97	0	0	0	0	14	97				
KCNA6	3742	broad.mit.edu	37	12	4919508	4919508	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr12:4919508C>T	ENST00000280684.3	+	1	1167	c.301C>T	c.(301-303)Cag>Tag	p.Q101*	RP11-234B24.4_ENST00000542988.1_lincRNA|KCNA6_ENST00000433855.1_Nonsense_Mutation_p.Q101*			P17658	KCNA6_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 6	101					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|endometrium(5)|large_intestine(6)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(5)	49					Dalfampridine(DB06637)	CTACTACTACCAGTCTGGGGG	0.657										HNSCC(72;0.22)																												uc001qng.2		NA																	0				skin(2)|ovary(1)	3						c.(301-303)CAG>TAG		potassium voltage-gated channel, shaker-related							45.0	51.0	49.0					12																	4919508		2203	4298	6501	SO:0001587	stop_gained	3742					voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr12:4919508C>T	X17622	CCDS8534.1	12p13	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6225	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 96"""	176257				16382104	Standard	NM_002235		Approved	Kv1.6, HBK2, PPP1R96	uc001qng.3	P17658		ENST00000280684.3:c.301C>T	12.37:g.4919508C>T	ENSP00000280684:p.Gln101*	HNSCC(72;0.22)	Somatic					p.Q101*	NM_002235	NP_002226	WXS	Illumina HiSeq	Unspecified	P17658	KCNA6_HUMAN			1	1167	+			101						Nonsense_Mutation	SNP	ENST00000280684.3	37	c.301C>T	CCDS8534.1	.	.	.	.	.	.	.	.	.	.	C	44	11.262106	0.99538	.	.	ENSG00000151079	ENST00000433855;ENST00000280684	.	.	.	4.45	4.45	0.53987	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	16.2613	0.82549	0.0:1.0:0.0:0.0	.	.	.	.	X	101	.	ENSP00000280684:Q101X	Q	+	1	0	KCNA6	4789769	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.522000	0.81844	2.291000	0.77112	0.462000	0.41574	CAG		0.657	KCNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398909.1	NM_002235		17	69	0	0	0	0	17	69				
SPSB2	84727	broad.mit.edu	37	12	6980429	6980429	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr12:6980429C>T	ENST00000524270.1	-	3	905	c.719G>A	c.(718-720)gGg>gAg	p.G240E	SPSB2_ENST00000523102.1_Missense_Mutation_p.G240E|LRRC23_ENST00000433346.1_5'Flank|RPL13P5_ENST00000412023.1_RNA	NM_032641.3	NP_116030.1	Q99619	SPSB2_HUMAN	splA/ryanodine receptor domain and SOCS box containing 2	240	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				kidney(2)|lung(2)|upper_aerodigestive_tract(1)	5						CCGGGTATCCCCCAGGTTGTG	0.627																																						uc001qrl.2		NA																	0				kidney(1)	1						c.(718-720)GGG>GAG		splA/ryanodine receptor domain and SOCS box							54.0	43.0	47.0					12																	6980429		2203	4300	6503	SO:0001583	missense	84727				intracellular signal transduction	cytoplasm	protein binding	g.chr12:6980429C>T	AF403027	CCDS8567.1	12p13.31	2008-02-05				ENSG00000111671			29522	protein-coding gene	gene with protein product		611658				8723724, 12076535	Standard	NM_001146316		Approved	GRCC9, SSB-2	uc001qrl.3	Q99619		ENST00000524270.1:c.719G>A	12.37:g.6980429C>T	ENSP00000428338:p.Gly240Glu		Somatic				SPSB2_uc001qrm.2_Missense_Mutation_p.G240E|LRRC23_uc001qrn.1_5'Flank	p.G240E	NM_001146316	NP_001139788	WXS	Illumina HiSeq	Unspecified	Q99619	SPSB2_HUMAN			3	875	-			240			SOCS box.		B7Z4W1|D3DUT0	Missense_Mutation	SNP	ENST00000524270.1	37	c.719G>A	CCDS8567.1	.	.	.	.	.	.	.	.	.	.	C	16.20	3.056591	0.55325	.	.	ENSG00000111671	ENST00000523102;ENST00000524270	T;T	0.55052	0.54;0.54	4.51	2.61	0.31194	SOCS protein, C-terminal (3);	0.084010	0.46145	U	0.000319	T	0.63414	0.2509	M	0.72479	2.2	0.80722	D	1	D	0.59767	0.986	P	0.61722	0.893	T	0.60005	-0.7347	10	0.37606	T	0.19	.	8.9248	0.35634	0.1686:0.6686:0.1628:0.0	.	240	Q99619	SPSB2_HUMAN	E	240	ENSP00000430872:G240E;ENSP00000428338:G240E	ENSP00000430872:G240E	G	-	2	0	SPSB2	6850690	1.000000	0.71417	0.985000	0.45067	0.877000	0.50540	7.540000	0.82074	0.494000	0.27859	0.585000	0.79938	GGG		0.627	SPSB2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375721.1	NM_032641		6	25	0	0	0	0	6	25				
LRP6	4040	broad.mit.edu	37	12	12274061	12274061	+	Nonstop_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr12:12274061C>G	ENST00000261349.4	-	23	4917	c.4841G>C	c.(4840-4842)tGa>tCa	p.*1614S	LRP6_ENST00000543091.1_Nonstop_Mutation_p.*1569S|BCL2L14_ENST00000396369.1_Intron	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	0					anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				GGCCCCTCCTCAGGAGGAGTC	0.517																																						uc001rah.3		NA																	0				lung(4)|skin(4)|ovary(2)|kidney(1)|central_nervous_system(1)	12						c.(4840-4842)TGA>TCA		low density lipoprotein receptor-related protein							66.0	57.0	60.0					12																	12274061		2203	4300	6503	SO:0001578	stop_lost	4040				cellular response to cholesterol|negative regulation of protein phosphorylation|negative regulation of protein serine/threonine kinase activity|negative regulation of smooth muscle cell apoptosis|neural crest formation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell cycle|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	cell surface|cytoplasmic vesicle|endoplasmic reticulum|integral to membrane|plasma membrane	coreceptor activity|frizzled binding|kinase inhibitor activity|low-density lipoprotein receptor activity|protein homodimerization activity|toxin transporter activity|Wnt-protein binding	g.chr12:12274061C>G	AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.4841G>C	12.37:g.12274061C>G			Somatic				BCL2L14_uc001raf.1_Intron|LRP6_uc010shl.1_Nonstop_Mutation_p.*1569S	p.*1614S	NM_002336	NP_002327	WXS	Illumina HiSeq	Unspecified	O75581	LRP6_HUMAN			23	4983	-		Prostate(47;0.0865)	1614					Q17RZ2	Nonstop_Mutation	SNP	ENST00000261349.4	37	c.4841G>C	CCDS8647.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.383049	0.82792	.	.	ENSG00000070018	ENST00000261349;ENST00000543091	.	.	.	5.85	5.85	0.93711	.	.	.	.	.	.	.	.	.	.	.	0.23010	N	0.998439	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1576	0.98120	0.0:1.0:0.0:0.0	.	.	.	.	S	1614;1569	.	.	X	-	2	2	LRP6	12165328	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.773000	0.95371	0.650000	0.86243	TGA		0.517	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400137.1			5	24	0	0	0	0	5	24				
ATF7IP	55729	broad.mit.edu	37	12	14589102	14589102	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr12:14589102C>T	ENST00000540793.1	+	3	1863	c.1708C>T	c.(1708-1710)Cgt>Tgt	p.R570C	ATF7IP_ENST00000536444.1_Missense_Mutation_p.R569C|ATF7IP_ENST00000541654.1_3'UTR|ATF7IP_ENST00000544627.1_Missense_Mutation_p.R578C|ATF7IP_ENST00000543189.1_Missense_Mutation_p.R569C|ATF7IP_ENST00000261168.4_Missense_Mutation_p.R570C			Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting protein	570	Glu-rich.|Interaction with SETDB1.				DNA methylation (GO:0006306)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045898)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)				cervix(1)|endometrium(7)|kidney(5)|large_intestine(10)|liver(2)|lung(22)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	54						GTCTAAACGTCGTCGATATAT	0.353																																						uc001rbw.2		NA																	0				lung(3)|ovary(1)|skin(1)	5						c.(1708-1710)CGT>TGT		activating transcription factor 7 interacting							119.0	119.0	119.0					12																	14589102		2203	4300	6503	SO:0001583	missense	55729				DNA methylation|interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|regulation of RNA polymerase II transcriptional preinitiation complex assembly|transcription, DNA-dependent		protein binding	g.chr12:14589102C>T	AJ242978	CCDS8663.1, CCDS66326.1, CCDS66327.1, CCDS73449.1	12p13.1	2005-11-18				ENSG00000171681			20092	protein-coding gene	gene with protein product		613644				10976766, 10777215	Standard	XM_005253424		Approved	FLJ10688, p621	uc001rbw.3	Q6VMQ6		ENST00000540793.1:c.1708C>T	12.37:g.14589102C>T	ENSP00000444589:p.Arg570Cys		Somatic				ATF7IP_uc010shs.1_Missense_Mutation_p.R569C|ATF7IP_uc001rbu.2_Missense_Mutation_p.R570C|ATF7IP_uc001rbv.1_Missense_Mutation_p.R569C|ATF7IP_uc001rbx.2_Missense_Mutation_p.R569C|ATF7IP_uc010sht.1_Missense_Mutation_p.R570C|ATF7IP_uc001rby.3_Missense_Mutation_p.R570C|ATF7IP_uc001rca.2_Missense_Mutation_p.R570C	p.R570C	NM_018179	NP_060649	WXS	Illumina HiSeq	Unspecified	Q6VMQ6	MCAF1_HUMAN			4	1866	+			570			Interaction with SETDB1.|Glu-rich.|Nuclear localization signal (By similarity).		F5GX74|G3V1U0|Q4G0T9|Q6P3T3|Q86XW5|Q9NVJ9|Q9NWC2|Q9Y4X8	Missense_Mutation	SNP	ENST00000540793.1	37	c.1708C>T	CCDS8663.1	.	.	.	.	.	.	.	.	.	.	C	16.37	3.105391	0.56291	.	.	ENSG00000171681	ENST00000261168;ENST00000538511;ENST00000543189;ENST00000536444;ENST00000544627;ENST00000540793	T;T;T;T;T	0.20463	2.08;2.07;2.08;2.08;2.08	5.48	5.48	0.80851	.	0.000000	0.64402	D	0.000005	T	0.28200	0.0696	M	0.61703	1.905	0.80722	D	1	D;D;B;B;P;P	0.55800	0.973;0.968;0.247;0.247;0.72;0.877	P;B;B;B;B;B	0.46110	0.504;0.398;0.035;0.035;0.191;0.276	T	0.01484	-1.1343	10	0.48119	T	0.1	-11.9531	13.6215	0.62140	0.0:0.9243:0.0:0.0757	.	578;569;569;570;569;181	B4E2A2;B4DRL6;G3V1U0;Q6VMQ6;Q6VMQ6-2;B3KQF8	.;.;.;MCAF1_HUMAN;.;.	C	570;9;569;569;578;570	ENSP00000261168:R570C;ENSP00000443179:R569C;ENSP00000445955:R569C;ENSP00000440440:R578C;ENSP00000444589:R570C	ENSP00000261168:R570C	R	+	1	0	ATF7IP	14480369	0.984000	0.35163	0.946000	0.38457	0.993000	0.82548	2.638000	0.46562	2.728000	0.93425	0.585000	0.79938	CGT		0.353	ATF7IP-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401400.1	NM_018179		24	67	0	0	0	0	24	67				
WNT1	7471	broad.mit.edu	37	12	49373291	49373291	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr12:49373291G>A	ENST00000293549.3	+	2	181	c.145G>A	c.(145-147)Gac>Aac	p.D49N		NM_005430.3	NP_005421.1	P04628	WNT1_HUMAN	wingless-type MMTV integration site family, member 1	49					bone development (GO:0060348)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to peptide hormone stimulus (GO:0071375)|central nervous system morphogenesis (GO:0021551)|cerebellum formation (GO:0021588)|diencephalon development (GO:0021536)|embryonic axis specification (GO:0000578)|forebrain anterior/posterior pattern specification (GO:0021797)|hematopoietic stem cell proliferation (GO:0071425)|hepatocyte differentiation (GO:0070365)|inner ear morphogenesis (GO:0042472)|midbrain development (GO:0030901)|midbrain-hindbrain boundary maturation during brain development (GO:0022004)|myoblast fusion (GO:0007520)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell aging (GO:0090344)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron differentiation (GO:0030182)|neuron fate determination (GO:0048664)|organ regeneration (GO:0031100)|positive regulation of cell proliferation (GO:0008284)|positive regulation of dermatome development (GO:0061184)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to wounding (GO:0009611)|signal transduction in response to DNA damage (GO:0042770)|Spemann organizer formation (GO:0060061)|spinal cord association neuron differentiation (GO:0021527)|T cell differentiation in thymus (GO:0033077)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)	11				BRCA - Breast invasive adenocarcinoma(357;0.244)		CCTGCTTACAGACTCCAAGAG	0.557																																						uc001rsu.2		NA																	0				kidney(1)	1						c.(145-147)GAC>AAC		wingless-type MMTV integration site family,							89.0	86.0	87.0					12																	49373291		2203	4300	6503	SO:0001583	missense	7471				brain segmentation|canonical Wnt receptor signaling pathway involved in negative regulation of apoptosis|central nervous system morphogenesis|cerebellum formation|dermatome development|diencephalon development|embryonic axis specification|forebrain anterior/posterior pattern formation|fourth ventricle development|hemopoietic stem cell proliferation|hepatocyte differentiation|inner ear morphogenesis|mesoderm morphogenesis|midbrain development|midbrain-hindbrain boundary maturation during brain development|negative regulation of cell-cell adhesion|negative regulation of cell-substrate adhesion|negative regulation of DNA damage checkpoint|negative regulation of fat cell differentiation|neuron fate determination|positive regulation of fibroblast proliferation|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of lamellipodium assembly|positive regulation of Notch signaling pathway|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|response to wounding|signal transduction in response to DNA damage|Spemann organizer formation|T cell differentiation in thymus|Wnt receptor signaling pathway, calcium modulating pathway	early endosome|extracellular space|late endosome|membrane raft|plasma membrane|proteinaceous extracellular matrix	cytokine activity|frizzled-2 binding|transcription regulatory region DNA binding	g.chr12:49373291G>A	X03072	CCDS8776.1	12q13	2013-02-28				ENSG00000125084		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12774	protein-coding gene	gene with protein product		164820		INT1		2998762, 3281802	Standard	NM_005430		Approved		uc001rsu.3	P04628	OTTHUMG00000170403	ENST00000293549.3:c.145G>A	12.37:g.49373291G>A	ENSP00000293549:p.Asp49Asn		Somatic					p.D49N	NM_005430	NP_005421	WXS	Illumina HiSeq	Unspecified	P04628	WNT1_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.244)	2	343	+			49					Q5U0N2	Missense_Mutation	SNP	ENST00000293549.3	37	c.145G>A	CCDS8776.1	.	.	.	.	.	.	.	.	.	.	G	11.61	1.691023	0.30052	.	.	ENSG00000125084	ENST00000293549	T	0.75821	-0.97	4.84	4.84	0.62591	.	0.890862	0.09644	N	0.774548	T	0.56031	0.1958	N	0.04508	-0.205	0.48236	D	0.999612	B	0.09022	0.002	B	0.04013	0.001	T	0.40720	-0.9548	10	0.14656	T	0.56	.	16.8853	0.86074	0.0:0.0:1.0:0.0	.	49	P04628	WNT1_HUMAN	N	49	ENSP00000293549:D49N	ENSP00000293549:D49N	D	+	1	0	WNT1	47659558	1.000000	0.71417	0.997000	0.53966	0.907000	0.53573	5.665000	0.68052	2.501000	0.84356	0.655000	0.94253	GAC		0.557	WNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408937.1			19	101	0	0	0	0	19	101				
KMT2D	8085	broad.mit.edu	37	12	49436420	49436420	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr12:49436420G>T	ENST00000301067.7	-	27	5790	c.5791C>A	c.(5791-5793)Cct>Act	p.P1931T		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	1931					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										TTGCCCAAAGGGAGTCCACCT	0.552																																						uc001rta.3		NA								N|F|Mis							medulloblastoma|renal		0				kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						c.(5791-5793)CCT>ACT		myeloid/lymphoid or mixed-lineage leukemia 2							73.0	77.0	75.0					12																	49436420		2013	4177	6190	SO:0001583	missense	8085				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding	g.chr12:49436420G>T	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.5791C>A	12.37:g.49436420G>T	ENSP00000301067:p.Pro1931Thr	HNSCC(34;0.089)	Somatic					p.P1931T	NM_003482	NP_003473	WXS	Illumina HiSeq	Unspecified	O14686	MLL2_HUMAN			27	5791	-			1931					O14687	Missense_Mutation	SNP	ENST00000301067.7	37	c.5791C>A	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	G	9.218	1.032550	0.19590	.	.	ENSG00000167548	ENST00000301067	T	0.81247	-1.47	5.22	3.36	0.38483	.	0.246880	0.21413	N	0.074949	T	0.71160	0.3307	L	0.42245	1.32	0.21064	N	0.999797	B	0.24258	0.1	B	0.15870	0.014	T	0.63457	-0.6633	10	0.87932	D	0	.	8.0962	0.30829	0.0878:0.1656:0.7466:0.0	.	1931	O14686	MLL2_HUMAN	T	1931	ENSP00000301067:P1931T	ENSP00000301067:P1931T	P	-	1	0	MLL2	47722687	0.998000	0.40836	1.000000	0.80357	0.972000	0.66771	1.356000	0.34079	0.562000	0.29204	0.561000	0.74099	CCT		0.552	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2			21	38	1	0	4.97e-08	5.41e-08	21	38				
RHEBL1	121268	broad.mit.edu	37	12	49462888	49462888	+	Splice_Site	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr12:49462888C>T	ENST00000301068.6	-	2	293	c.54G>A	c.(52-54)ggG>ggA	p.G18G		NM_144593.1	NP_653194.1	Q8TAI7	REBL1_HUMAN	Ras homolog enriched in brain like 1	18					GTP catabolic process (GO:0006184)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|small GTPase mediated signal transduction (GO:0007264)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)			breast(2)|large_intestine(2)|lung(5)	9						AAGATGTCTTCCCTGTGGGGA	0.502																																						uc001rtc.1		NA																	0				lung(1)|breast(1)	2						c.(52-54)GGG>GGA		Ras homolog enriched in brain like 1 precursor							235.0	176.0	196.0					12																	49462888		2203	4300	6503	SO:0001630	splice_region_variant	121268				positive regulation of NF-kappaB transcription factor activity|small GTPase mediated signal transduction|TOR signaling cascade	cytoplasm|plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:49462888C>T	AK098663	CCDS8778.1	12q13.12	2014-05-09				ENSG00000167550			21166	protein-coding gene	gene with protein product						12477932	Standard	NM_144593		Approved	MGC34869, FLJ25797	uc001rtc.1	Q8TAI7	OTTHUMG00000170407	ENST00000301068.6:c.53-1G>A	12.37:g.49462888C>T			Somatic				RHEBL1_uc001rtd.1_Silent_p.G14G|RHEBL1_uc009zlc.1_RNA	p.G18G	NM_144593	NP_653194	WXS	Illumina HiSeq	Unspecified	Q8TAI7	REBL1_HUMAN			2	261	-			18			GTP (By similarity).		Q56VH8	Silent	SNP	ENST00000301068.6	37	c.54G>A	CCDS8778.1																																																																																				0.502	RHEBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408969.1	NM_144593	Silent	26	69	0	0	0	0	26	69				
KCNH3	23416	broad.mit.edu	37	12	49943272	49943272	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr12:49943272G>A	ENST00000257981.6	+	9	1777	c.1517G>A	c.(1516-1518)cGc>cAc	p.R506H		NM_012284.1	NP_036416.1	Q9ULD8	KCNH3_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 3	506					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36						ATCATCCAGCGCATGTACGCC	0.667																																						uc001ruh.1		NA																	0					0						c.(1516-1518)CGC>CAC		potassium voltage-gated channel, subfamily H							79.0	68.0	72.0					12																	49943272		2203	4300	6503	SO:0001583	missense	23416				regulation of transcription, DNA-dependent	integral to membrane	two-component sensor activity|voltage-gated potassium channel activity	g.chr12:49943272G>A	AB022696	CCDS8786.1	12q13	2012-07-05				ENSG00000135519		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6252	protein-coding gene	gene with protein product		604527				10455180, 16382104	Standard	NM_012284		Approved	Kv12.2, BEC1, elk2	uc001ruh.1	Q9ULD8	OTTHUMG00000169517	ENST00000257981.6:c.1517G>A	12.37:g.49943272G>A	ENSP00000257981:p.Arg506His		Somatic				KCNH3_uc010smj.1_Missense_Mutation_p.R446H	p.R506H	NM_012284	NP_036416	WXS	Illumina HiSeq	Unspecified	Q9ULD8	KCNH3_HUMAN			9	1777	+			506			Cytoplasmic (Potential).		Q9UQ06	Missense_Mutation	SNP	ENST00000257981.6	37	c.1517G>A	CCDS8786.1	.	.	.	.	.	.	.	.	.	.	G	36	5.759333	0.96898	.	.	ENSG00000135519	ENST00000257981	D	0.98044	-4.68	4.89	4.89	0.63831	.	0.000000	0.49305	D	0.000155	D	0.98839	0.9608	M	0.90542	3.125	0.53688	D	0.999977	D	0.89917	1.0	D	0.73708	0.981	D	0.99331	1.0909	10	0.87932	D	0	.	15.9387	0.79736	0.0:0.0:1.0:0.0	.	506	Q9ULD8	KCNH3_HUMAN	H	506	ENSP00000257981:R506H	ENSP00000257981:R506H	R	+	2	0	KCNH3	48229539	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.657000	0.98554	2.719000	0.93026	0.655000	0.94253	CGC		0.667	KCNH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404571.2	NM_012284		10	49	0	0	0	0	10	49				
DIP2B	57609	broad.mit.edu	37	12	51138607	51138607	+	Silent	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr12:51138607G>A	ENST00000301180.5	+	38	4750	c.4716G>A	c.(4714-4716)gtG>gtA	p.V1572V	Y_RNA_ENST00000363558.1_RNA	NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)	1572						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						CCATCTACGTGGCTTATAACA	0.517																																						uc001rwv.2		NA																	0				ovary(4)|breast(1)|pancreas(1)	6						c.(4714-4716)GTG>GTA		DIP2 disco-interacting protein 2 homolog B							107.0	98.0	101.0					12																	51138607		2203	4300	6503	SO:0001819	synonymous_variant	57609					nucleus	catalytic activity|transcription factor binding	g.chr12:51138607G>A	AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.4716G>A	12.37:g.51138607G>A			Somatic				DIP2B_uc009zlt.2_Silent_p.V1002V	p.V1572V	NM_173602	NP_775873	WXS	Illumina HiSeq	Unspecified	Q9P265	DIP2B_HUMAN			38	4872	+			1572					Q6B011|Q8N1L5|Q8NB38	Silent	SNP	ENST00000301180.5	37	c.4716G>A	CCDS31799.1																																																																																				0.517	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404243.1	NM_173602		20	62	0	0	0	0	20	62				
NR4A1	3164	broad.mit.edu	37	12	52448880	52448880	+	Silent	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr12:52448880G>C	ENST00000243050.1	+	3	1082	c.768G>C	c.(766-768)cgG>cgC	p.R256R	NR4A1_ENST00000394825.1_Silent_p.R256R|NR4A1_ENST00000360284.3_Silent_p.R269R|NR4A1_ENST00000545748.1_Silent_p.R310R|NR4A1_ENST00000394824.2_Silent_p.R256R|NR4A1_ENST00000548232.1_Silent_p.R256R|NR4A1_ENST00000550082.1_Silent_p.R269R	NM_002135.4	NP_002126.2	P22736	NR4A1_HUMAN	nuclear receptor subfamily 4, group A, member 1	256					cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial cell chemotaxis (GO:0035767)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(2)	16				BRCA - Breast invasive adenocarcinoma(357;0.0967)		CCAAGGCCCGGAGCGGGGCCC	0.612																																						uc001rzs.2		NA																	0					0						c.(766-768)CGG>CGC		nuclear receptor subfamily 4, group A, member 1							63.0	69.0	67.0					12																	52448880		2203	4300	6503	SO:0001819	synonymous_variant	3164				nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor		steroid hormone receptor activity|zinc ion binding	g.chr12:52448880G>C	L13740	CCDS8818.1, CCDS55828.1, CCDS73471.1	12q13	2013-01-16			ENSG00000123358	ENSG00000123358		"""Nuclear hormone receptors"""	7980	protein-coding gene	gene with protein product		139139		HMR, GFRP1		2626032	Standard	NM_002135		Approved	TR3, N10, NAK-1, NGFIB, NUR77	uc001rzt.3	P22736	OTTHUMG00000150393	ENST00000243050.1:c.768G>C	12.37:g.52448880G>C			Somatic				NR4A1_uc010sno.1_Silent_p.R269R|NR4A1_uc001rzr.2_Silent_p.R256R|NR4A1_uc009zmb.1_Silent_p.R256R|NR4A1_uc001rzt.2_Silent_p.R256R|NR4A1_uc009zmc.2_5'Flank	p.R256R	NM_002135	NP_002126	WXS	Illumina HiSeq	Unspecified	P22736	NR4A1_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.0967)	3	1082	+			256					B4DML7|Q15627|Q53Y00|Q6IBU8	Silent	SNP	ENST00000243050.1	37	c.768G>C	CCDS8818.1																																																																																				0.612	NR4A1-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000317922.2			13	117	0	0	0	0	13	117				
AAAS	8086	broad.mit.edu	37	12	53709522	53709522	+	Nonsense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr12:53709522G>C	ENST00000209873.4	-	3	461	c.296C>G	c.(295-297)tCa>tGa	p.S99*	AAAS_ENST00000549983.1_5'UTR|AAAS_ENST00000394384.3_Nonsense_Mutation_p.S99*|AAAS_ENST00000550286.1_Missense_Mutation_p.Q6E	NM_015665.5	NP_056480.1	Q9NRG9	AAAS_HUMAN	achalasia, adrenocortical insufficiency, alacrimia	99					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|learning (GO:0007612)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nucleocytoplasmic transport (GO:0006913)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|regulation of nucleocytoplasmic transport (GO:0046822)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(2)	20						CTCTTCTTCTGAGTTTGCAAT	0.483																																						uc001scr.3		NA																	0				ovary(1)	1						c.(295-297)TCA>TGA		achalasia, adrenocortical insufficiency,							81.0	74.0	76.0					12																	53709522		2203	4300	6503	SO:0001587	stop_gained	8086				carbohydrate metabolic process|glucose transport|nucleocytoplasmic transport|regulation of glucose transport|regulation of nucleocytoplasmic transport|transmembrane transport|viral reproduction	nuclear pore		g.chr12:53709522G>C	AJ289841	CCDS8856.1, CCDS53797.1	12q13	2013-06-27	2010-06-24		ENSG00000094914	ENSG00000094914		"""WD repeat domain containing"""	13666	protein-coding gene	gene with protein product	"""aladin"", ""Allgrove, triple-A"""	605378	"""achalasia, adrenocortical insufficiency, alacrimia (Allgrove, triple-A)"""			11062474	Standard	NM_015665		Approved		uc001scr.4	Q9NRG9	OTTHUMG00000169729	ENST00000209873.4:c.296C>G	12.37:g.53709522G>C	ENSP00000209873:p.Ser99*		Somatic				AAAS_uc001scs.3_Nonsense_Mutation_p.S99*	p.S99*	NM_015665	NP_056480	WXS	Illumina HiSeq	Unspecified	Q9NRG9	AAAS_HUMAN			3	459	-			99					Q5JB47|Q9NWI6|Q9UG19	Nonsense_Mutation	SNP	ENST00000209873.4	37	c.296C>G	CCDS8856.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.372071|5.372071	0.95923|0.95923	.|.	.|.	ENSG00000094914|ENSG00000094914	ENST00000550286|ENST00000209873;ENST00000394384;ENST00000547757;ENST00000552161	D|.	0.82893|.	-1.66|.	5.3|5.3	5.3|5.3	0.74995|0.74995	.|.	.|0.232394	.|0.36703	.|N	.|0.002441	T|.	0.30417|.	0.0764|.	.|.	.|.	.|.	0.26830|0.26830	N|N	0.968596|0.968596	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.12268|.	-1.0554|.	6|.	0.13470|0.08179	T|T	0.59|0.78	-5.0661|-5.0661	16.8207|16.8207	0.85745|0.85745	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	E|X	6|99	ENSP00000446885:Q6E|.	ENSP00000446885:Q6E|ENSP00000209873:S99X	Q|S	-|-	1|2	0|0	AAAS|AAAS	51995789|51995789	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.976000|0.976000	0.68499|0.68499	6.599000|6.599000	0.74127|0.74127	2.655000|2.655000	0.90218|0.90218	0.637000|0.637000	0.83480|0.83480	CAG|TCA		0.483	AAAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405632.1			9	16	0	0	0	0	9	16				
MAP3K12	7786	broad.mit.edu	37	12	53876597	53876597	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr12:53876597C>T	ENST00000267079.2	-	12	2116	c.1891G>A	c.(1891-1893)Gat>Aat	p.D631N	MAP3K12_ENST00000547488.1_Missense_Mutation_p.D664N|MAP3K12_ENST00000547035.1_Missense_Mutation_p.D664N	NM_001193511.1|NM_006301.3	NP_001180440.1|NP_006292.3	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase 12	631					histone phosphorylation (GO:0016572)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	37						GAGCCAGGATCCCCAGCTCCG	0.667																																						uc001sdm.1		NA																	0				lung(2)|ovary(1)|breast(1)|skin(1)	5						c.(1891-1893)GAT>AAT		mitogen-activated protein kinase kinase kinase							24.0	30.0	28.0					12																	53876597		2199	4292	6491	SO:0001583	missense	7786				histone phosphorylation|JNK cascade|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|protein autophosphorylation	cytosol|membrane fraction|plasma membrane	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein kinase binding	g.chr12:53876597C>T	U07358	CCDS8860.1, CCDS55831.1	12q13.13	2013-10-30			ENSG00000139625	ENSG00000139625		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6851	protein-coding gene	gene with protein product	"""dual leucine zipper kinase DLK"""	600447		ZPK		8037767	Standard	NM_006301		Approved	MUK, DLK, ZPKP1, MEKK12	uc001sdn.2	Q12852	OTTHUMG00000169854	ENST00000267079.2:c.1891G>A	12.37:g.53876597C>T	ENSP00000267079:p.Asp631Asn		Somatic				MAP3K12_uc001sdn.1_Missense_Mutation_p.D664N	p.D631N	NM_006301	NP_006292	WXS	Illumina HiSeq	Unspecified	Q12852	M3K12_HUMAN			12	1989	-			631					B3KSS9|G3V1Y2|Q86VQ5|Q8WY25	Missense_Mutation	SNP	ENST00000267079.2	37	c.1891G>A	CCDS8860.1	.	.	.	.	.	.	.	.	.	.	C	15.42	2.828297	0.50845	.	.	ENSG00000139625	ENST00000267079;ENST00000547488;ENST00000547035	T;T;T	0.75260	-0.92;-0.92;-0.92	4.14	4.14	0.48551	.	0.000000	0.47455	D	0.000237	T	0.58308	0.2113	N	0.19112	0.55	0.29703	N	0.840012	B;B	0.22604	0.072;0.043	B;B	0.21546	0.035;0.015	T	0.52056	-0.8626	10	0.24483	T	0.36	.	12.598	0.56481	0.0:0.8309:0.1691:0.0	.	664;631	G3V1Y2;Q12852	.;M3K12_HUMAN	N	631;664;664	ENSP00000267079:D631N;ENSP00000449038:D664N;ENSP00000448689:D664N	ENSP00000267079:D631N	D	-	1	0	MAP3K12	52162864	0.935000	0.31712	1.000000	0.80357	0.908000	0.53690	4.186000	0.58337	2.604000	0.88044	0.491000	0.48974	GAT		0.667	MAP3K12-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406267.1	NM_006301		16	41	0	0	0	0	16	41				
MYL6B	140465	broad.mit.edu	37	12	56547847	56547847	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr12:56547847G>A	ENST00000553066.1	+	2	567	c.145G>A	c.(145-147)Gag>Aag	p.E49K	MYL6B_ENST00000207437.5_Missense_Mutation_p.E49K|MYL6B_ENST00000550152.1_3'UTR|MYL6B_ENST00000550443.1_Missense_Mutation_p.E49K|MYL6B_ENST00000552568.1_Missense_Mutation_p.E49K|RP11-603J24.14_ENST00000548731.1_RNA			P14649	MYL6B_HUMAN	myosin, light chain 6B, alkali, smooth muscle and non-muscle	49					metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle tissue development (GO:0007519)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|unconventional myosin complex (GO:0016461)	calcium ion binding (GO:0005509)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			endometrium(2)|kidney(1)|large_intestine(4)	7			OV - Ovarian serous cystadenocarcinoma(18;0.0979)			GAAAACCCAGGAGCCTCCAGT	0.572																																						uc001sjs.2		NA																	0					0						c.(145-147)GAG>AAG		smooth muscle and non-muscle myosin alkali light							35.0	43.0	40.0					12																	56547847		2203	4300	6503	SO:0001583	missense	140465				muscle filament sliding|skeletal muscle tissue development	cytosol|muscle myosin complex|unconventional myosin complex	calcium ion binding|motor activity|protein binding|structural constituent of muscle	g.chr12:56547847G>A	M31211	CCDS8905.1	12q13.2	2013-01-10	2006-09-29			ENSG00000196465		"""Myosins / Light chain"", ""EF-hand domain containing"""	29823	protein-coding gene	gene with protein product	"""myosin light chain 1 slow a"""	609930	"""myosin, light polypeptide 6B, alkali, smooth muscle and non-muscle"""			2602161, 2304459	Standard	NM_002475		Approved	MLC1SA	uc001sjs.3	P14649		ENST00000553066.1:c.145G>A	12.37:g.56547847G>A	ENSP00000450385:p.Glu49Lys		Somatic				MYL6B_uc009zoo.2_Missense_Mutation_p.E49K|MYL6B_uc001sjt.2_Missense_Mutation_p.E49K|MYL6B_uc001sju.1_Missense_Mutation_p.E49K	p.E49K	NM_002475	NP_002466	WXS	Illumina HiSeq	Unspecified	P14649	MYL6B_HUMAN	OV - Ovarian serous cystadenocarcinoma(18;0.0979)		2	272	+			49						Missense_Mutation	SNP	ENST00000553066.1	37	c.145G>A	CCDS8905.1	.	.	.	.	.	.	.	.	.	.	G	17.25	3.340769	0.60963	.	.	ENSG00000196465	ENST00000553066;ENST00000550443;ENST00000207437;ENST00000552568	D;D;D;D	0.87103	-2.21;-2.21;-2.21;-2.21	5.22	5.22	0.72569	.	0.239996	0.32593	N	0.005881	D	0.83036	0.5167	L	0.47716	1.5	0.36799	D	0.885277	P;B	0.34522	0.455;0.053	B;B	0.30105	0.111;0.01	D	0.86167	0.1597	10	0.54805	T	0.06	-20.1356	16.0834	0.81020	0.0:0.0:1.0:0.0	.	49;49	B4E368;P14649	.;MYL6B_HUMAN	K	49	ENSP00000450385:E49K;ENSP00000446643:E49K;ENSP00000207437:E49K;ENSP00000446965:E49K	ENSP00000207437:E49K	E	+	1	0	MYL6B	54834114	1.000000	0.71417	0.998000	0.56505	0.824000	0.46624	4.353000	0.59411	2.608000	0.88229	0.561000	0.74099	GAG		0.572	MYL6B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407920.2	NM_002475		3	28	0	0	0	0	3	28				
MYL6B	140465	broad.mit.edu	37	12	56548600	56548600	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr12:56548600G>A	ENST00000553066.1	+	3	600	c.178G>A	c.(178-180)Gag>Aag	p.E60K	MYL6B_ENST00000207437.5_Missense_Mutation_p.E60K|MYL6B_ENST00000550152.1_3'UTR|MYL6B_ENST00000550443.1_Missense_Mutation_p.E60K|MYL6B_ENST00000552568.1_Missense_Mutation_p.E60K|RP11-603J24.14_ENST00000548731.1_RNA			P14649	MYL6B_HUMAN	myosin, light chain 6B, alkali, smooth muscle and non-muscle	60					metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle tissue development (GO:0007519)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|unconventional myosin complex (GO:0016461)	calcium ion binding (GO:0005509)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			endometrium(2)|kidney(1)|large_intestine(4)	7			OV - Ovarian serous cystadenocarcinoma(18;0.0979)			TCCACAGATCGAGTTTAACAA	0.532																																						uc001sjs.2		NA																	0					0						c.(178-180)GAG>AAG		smooth muscle and non-muscle myosin alkali light							196.0	194.0	195.0					12																	56548600		2203	4300	6503	SO:0001583	missense	140465				muscle filament sliding|skeletal muscle tissue development	cytosol|muscle myosin complex|unconventional myosin complex	calcium ion binding|motor activity|protein binding|structural constituent of muscle	g.chr12:56548600G>A	M31211	CCDS8905.1	12q13.2	2013-01-10	2006-09-29			ENSG00000196465		"""Myosins / Light chain"", ""EF-hand domain containing"""	29823	protein-coding gene	gene with protein product	"""myosin light chain 1 slow a"""	609930	"""myosin, light polypeptide 6B, alkali, smooth muscle and non-muscle"""			2602161, 2304459	Standard	NM_002475		Approved	MLC1SA	uc001sjs.3	P14649		ENST00000553066.1:c.178G>A	12.37:g.56548600G>A	ENSP00000450385:p.Glu60Lys		Somatic				MYL6B_uc009zoo.2_Missense_Mutation_p.E60K|MYL6B_uc001sjt.2_Missense_Mutation_p.E60K|MYL6B_uc001sju.1_Missense_Mutation_p.E60K	p.E60K	NM_002475	NP_002466	WXS	Illumina HiSeq	Unspecified	P14649	MYL6B_HUMAN	OV - Ovarian serous cystadenocarcinoma(18;0.0979)		3	305	+			60						Missense_Mutation	SNP	ENST00000553066.1	37	c.178G>A	CCDS8905.1	.	.	.	.	.	.	.	.	.	.	G	14.48	2.549050	0.45383	.	.	ENSG00000196465	ENST00000553066;ENST00000550443;ENST00000207437;ENST00000552568	D;D;D;D	0.85955	-2.05;-2.05;-2.05;-2.05	4.08	3.16	0.36331	.	0.372052	0.29059	N	0.013270	T	0.78451	0.4285	L	0.49126	1.545	0.43907	D	0.996548	P;B	0.38922	0.651;0.256	B;B	0.31245	0.126;0.024	T	0.79067	-0.1955	10	0.72032	D	0.01	-19.8264	11.6215	0.51121	0.0:0.182:0.818:0.0	.	60;60	B4E368;P14649	.;MYL6B_HUMAN	K	60	ENSP00000450385:E60K;ENSP00000446643:E60K;ENSP00000207437:E60K;ENSP00000446965:E60K	ENSP00000207437:E60K	E	+	1	0	MYL6B	54834867	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.257000	0.72480	1.016000	0.39470	0.491000	0.48974	GAG		0.532	MYL6B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407920.2	NM_002475		29	198	0	0	0	0	29	198				
MYL6B	140465	broad.mit.edu	37	12	56548975	56548975	+	Silent	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr12:56548975G>A	ENST00000553066.1	+	4	761	c.339G>A	c.(337-339)aaG>aaA	p.K113K	MYL6B_ENST00000207437.5_Silent_p.K113K|MYL6_ENST00000550697.1_5'Flank|MYL6B_ENST00000550152.1_3'UTR|MYL6B_ENST00000550443.1_Silent_p.K113K|MYL6B_ENST00000552568.1_Silent_p.K113K|RP11-603J24.14_ENST00000548731.1_RNA			P14649	MYL6B_HUMAN	myosin, light chain 6B, alkali, smooth muscle and non-muscle	113					metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle tissue development (GO:0007519)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|unconventional myosin complex (GO:0016461)	calcium ion binding (GO:0005509)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			endometrium(2)|kidney(1)|large_intestine(4)	7			OV - Ovarian serous cystadenocarcinoma(18;0.0979)			GGAACCCCAAGAGTGATGGTG	0.522																																						uc001sjs.2		NA																	0					0						c.(337-339)AAG>AAA		smooth muscle and non-muscle myosin alkali light							72.0	78.0	76.0					12																	56548975		2203	4300	6503	SO:0001819	synonymous_variant	140465				muscle filament sliding|skeletal muscle tissue development	cytosol|muscle myosin complex|unconventional myosin complex	calcium ion binding|motor activity|protein binding|structural constituent of muscle	g.chr12:56548975G>A	M31211	CCDS8905.1	12q13.2	2013-01-10	2006-09-29			ENSG00000196465		"""Myosins / Light chain"", ""EF-hand domain containing"""	29823	protein-coding gene	gene with protein product	"""myosin light chain 1 slow a"""	609930	"""myosin, light polypeptide 6B, alkali, smooth muscle and non-muscle"""			2602161, 2304459	Standard	NM_002475		Approved	MLC1SA	uc001sjs.3	P14649		ENST00000553066.1:c.339G>A	12.37:g.56548975G>A			Somatic				MYL6B_uc009zoo.2_Silent_p.K113K|MYL6B_uc001sjt.2_Silent_p.K113K|MYL6B_uc001sju.1_Silent_p.K113K	p.K113K	NM_002475	NP_002466	WXS	Illumina HiSeq	Unspecified	P14649	MYL6B_HUMAN	OV - Ovarian serous cystadenocarcinoma(18;0.0979)		4	466	+			113						Silent	SNP	ENST00000553066.1	37	c.339G>A	CCDS8905.1																																																																																				0.522	MYL6B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407920.2	NM_002475		23	116	0	0	0	0	23	116				
TIMELESS	8914	broad.mit.edu	37	12	56818549	56818549	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr12:56818549G>A	ENST00000553532.1	-	15	2015	c.1865C>T	c.(1864-1866)gCt>gTt	p.A622V	TIMELESS_ENST00000229201.4_Missense_Mutation_p.A621V|TIMELESS_ENST00000554616.1_Intron					timeless circadian clock											NS(1)|breast(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(8)|lung(14)|ovary(7)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	49						TTCTTACCGAGCAGACCTCAG	0.587																																						uc001slf.2		NA																	0				ovary(5)|breast(2)|pancreas(1)	8						c.(1864-1866)GCT>GTT		timeless homolog							65.0	63.0	64.0					12																	56818549		2203	4300	6503	SO:0001583	missense	8914				cell division|circadian rhythm|detection of abiotic stimulus|mitosis|morphogenesis of an epithelium|negative regulation of transcription, DNA-dependent|regulation of S phase|response to DNA damage stimulus|transcription, DNA-dependent	nuclear chromatin		g.chr12:56818549G>A	AF098162	CCDS8918.1	12q13.3	2012-12-14	2012-12-14		ENSG00000111602	ENSG00000111602			11813	protein-coding gene	gene with protein product	"""Tof1 homolog (S. cerevisiae)"", ""timeless circadian clock 1"""	603887	"""timeless (Drosophila) homolog"", ""timeless homolog (Drosophila)"""			9856465	Standard	NM_003920		Approved	hTIM, TIM, TIM1	uc001slf.2	Q9UNS1	OTTHUMG00000170600	ENST00000553532.1:c.1865C>T	12.37:g.56818549G>A	ENSP00000450607:p.Ala622Val		Somatic					p.A622V	NM_003920	NP_003911	WXS	Illumina HiSeq	Unspecified	Q9UNS1	TIM_HUMAN			15	2033	-			622						Missense_Mutation	SNP	ENST00000553532.1	37	c.1865C>T	CCDS8918.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.380116	0.82682	.	.	ENSG00000111602	ENST00000229201;ENST00000553532	T;T	0.09445	2.98;2.98	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.38374	0.1038	M	0.81112	2.525	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.09079	-1.0691	10	0.72032	D	0.01	.	18.933	0.92574	0.0:0.0:1.0:0.0	.	622	Q9UNS1	TIM_HUMAN	V	621;622	ENSP00000229201:A621V;ENSP00000450607:A622V	ENSP00000229201:A622V	A	-	2	0	TIMELESS	55104816	1.000000	0.71417	1.000000	0.80357	0.117000	0.20001	9.027000	0.93706	2.848000	0.98002	0.655000	0.94253	GCT		0.587	TIMELESS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409771.1	NM_003920		5	85	0	0	0	0	5	85				
TSPAN31	6302	broad.mit.edu	37	12	58140808	58140808	+	Missense_Mutation	SNP	A	A	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr12:58140808A>G	ENST00000257910.3	+	5	726	c.452A>G	c.(451-453)aAg>aGg	p.K151R	TSPAN31_ENST00000547472.1_Missense_Mutation_p.K68R|CDK4_ENST00000551888.1_5'Flank|TSPAN31_ENST00000553221.1_3'UTR|TSPAN31_ENST00000547992.1_Missense_Mutation_p.K67R	NM_005981.3	NP_005972.1	Q12999	TSN31_HUMAN	tetraspanin 31	151					positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				endometrium(1)|kidney(1)|lung(5)	7	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)			CAGATCTGCAAGAGCCAGAGC	0.423																																						uc001spt.2		NA																	0					0						c.(451-453)AAG>AGG		sarcoma amplified sequence							107.0	114.0	111.0					12																	58140808		2203	4300	6503	SO:0001583	missense	6302				positive regulation of cell proliferation	integral to plasma membrane|membrane fraction		g.chr12:58140808A>G		CCDS8952.1	12q13-q14	2013-02-14	2005-08-16	2005-08-16		ENSG00000135452		"""Tetraspanins"""	10539	protein-coding gene	gene with protein product		181035	"""sarcoma amplified sequence"""	SAS			Standard	NM_005981		Approved		uc001spt.3	Q12999		ENST00000257910.3:c.452A>G	12.37:g.58140808A>G	ENSP00000257910:p.Lys151Arg		Somatic				TSPAN31_uc009zqb.2_Missense_Mutation_p.K67R|TSPAN31_uc010ssa.1_Missense_Mutation_p.K73R	p.K151R	NM_005981	NP_005972	WXS	Illumina HiSeq	Unspecified	Q12999	TSN31_HUMAN	GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)		5	606	+	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		151			Extracellular (Potential).		O00577|Q53X76	Missense_Mutation	SNP	ENST00000257910.3	37	c.452A>G	CCDS8952.1	.	.	.	.	.	.	.	.	.	.	A	7.287	0.610245	0.14066	.	.	ENSG00000135452	ENST00000257910;ENST00000547992;ENST00000547472;ENST00000548167	T;T;D	0.87334	-1.25;-1.25;-2.24	5.03	-0.0468	0.13846	.	0.488985	0.21034	N	0.081283	T	0.77922	0.4203	L	0.54323	1.7	0.27082	N	0.963054	B;B	0.06786	0.0;0.001	B;B	0.10450	0.001;0.005	T	0.58148	-0.7687	10	0.11794	T	0.64	-9.0041	4.5546	0.12130	0.5853:0.1585:0.2562:0.0	.	67;151	F8VS78;Q12999	.;TSN31_HUMAN	R	151;67;68;73	ENSP00000257910:K151R;ENSP00000449199:K68R;ENSP00000449131:K73R	ENSP00000257910:K151R	K	+	2	0	TSPAN31	56427075	0.190000	0.23276	0.186000	0.23195	0.966000	0.64601	0.583000	0.23849	-0.076000	0.12775	0.459000	0.35465	AAG		0.423	TSPAN31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408778.1			4	164	0	0	0	0	4	164				
TMTC2	160335	broad.mit.edu	37	12	83455572	83455572	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr12:83455572G>C	ENST00000321196.3	+	11	3000	c.2293G>C	c.(2293-2295)Gag>Cag	p.E765Q	TMTC2_ENST00000549919.1_Missense_Mutation_p.E759Q	NM_152588.1	NP_689801.1	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat containing 2	765					calcium ion homeostasis (GO:0055074)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|urinary_tract(1)	39						TGAAGCAGCTGAGAAGTATTA	0.353																																						uc001szt.2		NA																	0				ovary(2)	2						c.(2293-2295)GAG>CAG		transmembrane and tetratricopeptide repeat							114.0	111.0	112.0					12																	83455572		2203	4300	6503	SO:0001583	missense	160335					endoplasmic reticulum|integral to membrane	binding	g.chr12:83455572G>C	AK074634	CCDS9025.1	12q21.31	2014-06-09			ENSG00000179104	ENSG00000179104		"""Tetratricopeptide (TTC) repeat domain containing"""	25440	protein-coding gene	gene with protein product		615856				24764305	Standard	NM_152588		Approved	DKFZp762A217	uc001szt.3	Q8N394	OTTHUMG00000169736	ENST00000321196.3:c.2293G>C	12.37:g.83455572G>C	ENSP00000322300:p.Glu765Gln		Somatic				TMTC2_uc010suk.1_Missense_Mutation_p.E520Q	p.E765Q	NM_152588	NP_689801	WXS	Illumina HiSeq	Unspecified	Q8N394	TMTC2_HUMAN			11	2725	+			765			TPR 9.		B2RCU7|Q8N2K8	Missense_Mutation	SNP	ENST00000321196.3	37	c.2293G>C	CCDS9025.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.112409	0.77210	.	.	ENSG00000179104	ENST00000321196;ENST00000549919;ENST00000546590	T;T	0.60797	0.16;0.16	5.74	5.74	0.90152	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.76442	0.3988	M	0.79805	2.47	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.73307	-0.4024	10	0.26408	T	0.33	-16.4163	16.6338	0.85041	0.0:0.0:1.0:0.0	.	765	Q8N394	TMTC2_HUMAN	Q	765;759;520	ENSP00000322300:E765Q;ENSP00000447609:E759Q	ENSP00000322300:E765Q	E	+	1	0	TMTC2	81979703	1.000000	0.71417	0.963000	0.40424	0.791000	0.44710	7.206000	0.77891	2.709000	0.92574	0.655000	0.94253	GAG		0.353	TMTC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405663.1	NM_152588		13	73	0	0	0	0	13	73				
APAF1	317	broad.mit.edu	37	12	99093306	99093306	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr12:99093306G>A	ENST00000551964.1	+	17	3161	c.2425G>A	c.(2425-2427)Gat>Aat	p.D809N	APAF1_ENST00000359972.2_Missense_Mutation_p.D798N|APAF1_ENST00000547045.1_Missense_Mutation_p.D809N|APAF1_ENST00000550527.1_Missense_Mutation_p.D798N|APAF1_ENST00000552268.1_Intron|APAF1_ENST00000549007.1_Missense_Mutation_p.D809N|APAF1_ENST00000339433.3_Missense_Mutation_p.D809N|APAF1_ENST00000333991.1_Intron|APAF1_ENST00000357310.1_Missense_Mutation_p.D809N	NM_181861.1	NP_863651.1	O14727	APAF_HUMAN	apoptotic peptidase activating factor 1	809					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway (GO:0097193)|nervous system development (GO:0007399)|neural tube closure (GO:0001843)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|response to G1 DNA damage checkpoint signaling (GO:0072432)	apoptosome (GO:0043293)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(1)	42					Adenosine triphosphate(DB00171)	GTGGTCTGCTGATGGTGCAAG	0.358																																						uc001tfz.2		NA																	0				ovary(2)|lung(1)	3						c.(2425-2427)GAT>AAT		apoptotic peptidase activating factor 1 isoform	Adenosine triphosphate(DB00171)						122.0	120.0	120.0					12																	99093306		2203	4300	6503	SO:0001583	missense	317				activation of caspase activity by cytochrome c|defense response|induction of apoptosis by intracellular signals|nervous system development	cytosol|Golgi apparatus|nucleus	ATP binding|caspase activator activity|protein binding	g.chr12:99093306G>A	AF013263	CCDS9069.1, CCDS9070.1, CCDS9071.1, CCDS55862.1, CCDS55863.1	12q23	2013-01-10	2006-10-23			ENSG00000120868		"""WD repeat domain containing"""	576	protein-coding gene	gene with protein product		602233	"""apoptotic protease activating factor"", ""apoptotic peptidase activating factor"""			9267021, 10702682	Standard	NM_181861		Approved	CED4, APAF-1	uc001tfz.3	O14727	OTTHUMG00000170214	ENST00000551964.1:c.2425G>A	12.37:g.99093306G>A	ENSP00000448165:p.Asp809Asn		Somatic				APAF1_uc001tfy.2_Missense_Mutation_p.D798N|APAF1_uc001tga.2_Missense_Mutation_p.D798N|APAF1_uc001tgb.2_Missense_Mutation_p.D809N|APAF1_uc001tgc.2_Intron|APAF1_uc009zto.2_Missense_Mutation_p.D218N	p.D809N	NM_181861	NP_863651	WXS	Illumina HiSeq	Unspecified	O14727	APAF_HUMAN			17	3002	+			809			WD 5.		B2RMX8|O43297|Q7Z438|Q9BXZ6|Q9UBZ5|Q9UGN8|Q9UGN9|Q9UGP0|Q9UJ58|Q9UJ59|Q9UJ60|Q9UJ61|Q9UJ62|Q9UJ63|Q9UJ64|Q9UJ65|Q9UJ66|Q9UJ67|Q9UNC9	Missense_Mutation	SNP	ENST00000551964.1	37	c.2425G>A	CCDS9069.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.049301	0.93740	.	.	ENSG00000120868	ENST00000551964;ENST00000359972;ENST00000357310;ENST00000339433;ENST00000550527;ENST00000547045;ENST00000549007	T;T;T;T;T;T;T	0.64618	1.31;-0.11;1.95;0.61;1.31;1.95;0.61	5.89	5.89	0.94794	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.086903	0.85682	D	0.000000	D	0.82912	0.5140	M	0.89214	3.015	0.80722	D	1	B;B;B;B;D	0.69078	0.076;0.174;0.148;0.039;0.997	B;B;B;B;D	0.74348	0.071;0.22;0.222;0.038;0.983	D	0.84352	0.0533	10	0.54805	T	0.06	-14.4271	19.0291	0.92948	0.0:0.0:1.0:0.0	.	809;809;798;809;798	C9JLV4;O14727-4;O14727-3;O14727;O14727-2	.;.;.;APAF_HUMAN;.	N	809;798;809;809;798;809;809	ENSP00000448165:D809N;ENSP00000353059:D798N;ENSP00000349862:D809N;ENSP00000341830:D809N;ENSP00000448449:D798N;ENSP00000449791:D809N;ENSP00000448161:D809N	ENSP00000341830:D809N	D	+	1	0	APAF1	97617437	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	3.786000	0.55431	2.783000	0.95769	0.655000	0.94253	GAT		0.358	APAF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408006.1	NM_181861.1		10	49	0	0	0	0	10	49				
MICU2	221154	broad.mit.edu	37	13	22113514	22113514	+	Silent	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr13:22113514G>A	ENST00000382374.4	-	4	458	c.393C>T	c.(391-393)gaC>gaT	p.D131D		NM_152726.2	NP_689939.1	Q8IYU8	MICU2_HUMAN	mitochondrial calcium uptake 2	131					mitochondrial calcium ion transport (GO:0006851)|negative regulation of mitochondrial calcium ion concentration (GO:0051562)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)	calcium channel complex (GO:0034704)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|uniplex complex (GO:1990246)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)										TATCCTCGATGTCCTTTGAAT	0.383																																						uc001uof.2		NA																	0					0						c.(391-393)GAC>GAT		EF-hand domain family, member A1							51.0	51.0	51.0					13																	22113514		2203	4300	6503	SO:0001819	synonymous_variant	221154						calcium ion binding	g.chr13:22113514G>A	AK091907	CCDS9297.1	13q12.11	2013-03-13	2013-03-13	2013-03-13	ENSG00000165487	ENSG00000165487		"""EF-hand domain containing"""	31830	protein-coding gene	gene with protein product		610632	"""EF hand domain family A1"", ""EF-hand domain family, member A1"""	EFHA1		23409044	Standard	NM_152726		Approved		uc001uof.3	Q8IYU8	OTTHUMG00000067414	ENST00000382374.4:c.393C>T	13.37:g.22113514G>A			Somatic					p.D131D	NM_152726	NP_689939	WXS	Illumina HiSeq	Unspecified	Q8IYU8	EFHA1_HUMAN		all cancers(112;0.000171)|Epithelial(112;0.000398)|OV - Ovarian serous cystadenocarcinoma(117;0.00641)|Lung(94;0.189)	4	415	-		all_cancers(29;1.24e-15)|all_epithelial(30;5.4e-14)|all_lung(29;2.04e-13)|Lung SC(185;0.0367)	131					Q8N0T6|Q8NAX8	Silent	SNP	ENST00000382374.4	37	c.393C>T	CCDS9297.1																																																																																				0.383	MICU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000144355.1	NM_152726		16	22	0	0	0	0	16	22				
SACS	26278	broad.mit.edu	37	13	23913992	23913992	+	Silent	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr13:23913992G>C	ENST00000382292.3	-	9	4296	c.4023C>G	c.(4021-4023)ctC>ctG	p.L1341L	SACS_ENST00000402364.1_Silent_p.L591L|SACS_ENST00000382298.3_Silent_p.L1341L			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	1341					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		GGTCACTTTTGAGATATATCT	0.358																																						uc001uon.2		NA																	0				ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12						c.(4021-4023)CTC>CTG		sacsin							100.0	91.0	94.0					13																	23913992		2203	4300	6503	SO:0001819	synonymous_variant	26278				cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding	g.chr13:23913992G>C	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.4023C>G	13.37:g.23913992G>C			Somatic				SACS_uc001uoo.2_Silent_p.L1194L|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	p.L1341L	NM_014363	NP_055178	WXS	Illumina HiSeq	Unspecified	Q9NZJ4	SACS_HUMAN		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)	10	4612	-		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)	1341					O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Silent	SNP	ENST00000382292.3	37	c.4023C>G	CCDS9300.2																																																																																				0.358	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363		12	40	0	0	0	0	12	40				
FLT1	2321	broad.mit.edu	37	13	28913326	28913326	+	Missense_Mutation	SNP	C	C	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr13:28913326C>A	ENST00000282397.4	-	17	2718	c.2467G>T	c.(2467-2469)Gcc>Tcc	p.A823S	FLT1_ENST00000540678.1_Missense_Mutation_p.A41S	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1	823					blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CTCTCCCGGGCAAACTCCCAC	0.418																																						uc001usb.3		NA																	0				lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24						c.(2467-2469)GCC>TCC		fms-related tyrosine kinase 1 isoform 1	Sunitinib(DB01268)						80.0	78.0	79.0					13																	28913326		2203	4300	6503	SO:0001583	missense	2321				cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity	g.chr13:28913326C>A	AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.2467G>T	13.37:g.28913326C>A	ENSP00000282397:p.Ala823Ser		Somatic				FLT1_uc001usa.3_Missense_Mutation_p.A41S	p.A823S	NM_002019	NP_002010	WXS	Illumina HiSeq	Unspecified	P17948	VGFR1_HUMAN	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	17	2752	-	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	823			Cytoplasmic (Potential).		A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Missense_Mutation	SNP	ENST00000282397.4	37	c.2467G>T	CCDS9330.1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.974120	0.92919	.	.	ENSG00000102755	ENST00000282397;ENST00000540678	D;D	0.89617	-2.54;-2.54	5.52	5.52	0.82312	Protein kinase-like domain (1);	0.112115	0.64402	D	0.000008	D	0.88738	0.6518	N	0.19112	0.55	0.80722	D	1	D	0.67145	0.996	P	0.60286	0.872	D	0.90005	0.4117	10	0.72032	D	0.01	.	15.2972	0.73919	0.0:0.8604:0.1395:0.0	.	823	P17948	VGFR1_HUMAN	S	823;41	ENSP00000282397:A823S;ENSP00000443311:A41S	ENSP00000282397:A823S	A	-	1	0	FLT1	27811326	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.384000	0.66225	2.761000	0.94854	0.655000	0.94253	GCC		0.418	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044322.1			4	54	1	0	0.000602214	0.000632054	4	54				
VWA8	23078	broad.mit.edu	37	13	42352181	42352181	+	Silent	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr13:42352181C>T	ENST00000379310.3	-	20	2357	c.2289G>A	c.(2287-2289)gtG>gtA	p.V763V	VWA8_ENST00000281496.6_Silent_p.V763V	NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	763						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)										TATCTTCCATCACTATCACAT	0.323																																						uc001uyj.2		NA																	0				ovary(3)|upper_aerodigestive_tract(1)|kidney(1)|skin(1)	6						c.(2287-2289)GTG>GTA		hypothetical protein LOC23078 isoform a							117.0	115.0	116.0					13																	42352181		2203	4300	6503	SO:0001819	synonymous_variant	23078					extracellular region	ATP binding|ATPase activity	g.chr13:42352181C>T	AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.2289G>A	13.37:g.42352181C>T			Somatic				KIAA0564_uc001uyk.2_Silent_p.V763V	p.V763V	NM_015058	NP_055873	WXS	Illumina HiSeq	Unspecified	A3KMH1	K0564_HUMAN		OV - Ovarian serous cystadenocarcinoma(117;0.000368)|GBM - Glioblastoma multiforme(144;0.0033)|BRCA - Breast invasive adenocarcinoma(63;0.0969)	20	2359	-		Lung NSC(96;4.61e-06)|Prostate(109;0.0167)|Lung SC(185;0.0262)|Breast(139;0.0854)|Hepatocellular(98;0.114)	763					O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Silent	SNP	ENST00000379310.3	37	c.2289G>A	CCDS41881.1																																																																																				0.323	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354828.2	NM_015058		14	128	0	0	0	0	14	128				
LRCH1	23143	broad.mit.edu	37	13	47303005	47303005	+	Silent	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr13:47303005C>T	ENST00000389798.3	+	17	1985	c.1788C>T	c.(1786-1788)gtC>gtT	p.V596V	LRCH1_ENST00000389797.3_Silent_p.V631V|LRCH1_ENST00000311191.6_Silent_p.V596V	NM_015116.2	NP_055931	Q9Y2L9	LRCH1_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 1	596	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.									breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)		GATTGAAGGTCAGTCTACACG	0.488																																						uc001vbj.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1786-1788)GTC>GTT		leucine-rich repeats and calponin homology (CH)							146.0	132.0	137.0					13																	47303005		2203	4300	6503	SO:0001819	synonymous_variant	23143							g.chr13:47303005C>T	AB023233	CCDS31972.1, CCDS53865.1, CCDS53866.1	13q14.11	2008-02-05	2004-05-27	2004-05-28	ENSG00000136141	ENSG00000136141			20309	protein-coding gene	gene with protein product		610368	"""calponin homology (CH) domain containing 1"""	CHDC1		10231032	Standard	NM_015116		Approved	KIAA1016	uc001vbk.3	Q9Y2L9	OTTHUMG00000016877	ENST00000389798.3:c.1788C>T	13.37:g.47303005C>T			Somatic				LRCH1_uc001vbk.2_Silent_p.V631V|LRCH1_uc001vbl.3_Silent_p.V596V	p.V596V	NM_015116	NP_055931	WXS	Illumina HiSeq	Unspecified	Q9Y2L9	LRCH1_HUMAN	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)	17	2024	+		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	596			CH.		B7ZLL5|F8W6F0|Q17R43|Q2KHR1|Q5TBU9|Q7Z5F6|Q7Z5F7	Silent	SNP	ENST00000389798.3	37	c.1788C>T	CCDS31972.1																																																																																				0.488	LRCH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044824.2	NM_015116		18	117	0	0	0	0	18	117				
OLFM4	10562	broad.mit.edu	37	13	53603067	53603067	+	Silent	SNP	C	C	G	rs140749392		TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr13:53603067C>G	ENST00000219022.2	+	1	174	c.96C>G	c.(94-96)ccC>ccG	p.P32P		NM_006418.4	NP_006409.3	Q6UX06	OLFM4_HUMAN	olfactomedin 4	32	Ser-rich.				cell adhesion (GO:0007155)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein homooligomerization (GO:0051260)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	cadherin binding (GO:0045296)|catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)	p.P32P(2)		breast(2)|endometrium(4)|kidney(4)|large_intestine(5)|lung(20)|skin(3)|urinary_tract(1)	39		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.13e-08)		TTCCCAGCCCCGGCTTCAGCT	0.607																																						uc001vhl.2		NA																	2	Substitution - coding silent(2)		lung(1)|breast(1)	skin(1)	1						c.(94-96)CCC>CCG		olfactomedin 4 precursor							99.0	105.0	103.0					13																	53603067		2203	4300	6503	SO:0001819	synonymous_variant	10562				cell adhesion	extracellular space		g.chr13:53603067C>G	AY358567	CCDS9440.1	13q14	2004-06-25			ENSG00000102837	ENSG00000102837			17190	protein-coding gene	gene with protein product		614061					Standard	NM_006418		Approved	OlfD, GW112, GC1	uc001vhl.3	Q6UX06	OTTHUMG00000016981	ENST00000219022.2:c.96C>G	13.37:g.53603067C>G			Somatic				OLFM4_uc001vhk.1_Silent_p.P32P	p.P32P	NM_006418	NP_006409	WXS	Illumina HiSeq	Unspecified	Q6UX06	OLFM4_HUMAN		GBM - Glioblastoma multiforme(99;3.13e-08)	1	96	+		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)	32			Ser-rich.		O95362|Q5VWG0|Q86T22	Silent	SNP	ENST00000219022.2	37	c.96C>G	CCDS9440.1																																																																																				0.607	OLFM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045112.2	NM_006418		9	165	0	0	0	0	9	165				
HECTD1	25831	broad.mit.edu	37	14	31637671	31637671	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr14:31637671C>G	ENST00000399332.1	-	10	1943	c.1455G>C	c.(1453-1455)tgG>tgC	p.W485C	HECTD1_ENST00000553700.1_Missense_Mutation_p.W485C	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	485					neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		CTGGACACATCCAATCACCTA	0.308																																						uc001wrc.1		NA																	0				ovary(3)|large_intestine(1)|lung(1)	5						c.(1453-1455)TGG>TGC		HECT domain containing 1							161.0	155.0	157.0					14																	31637671		1801	4071	5872	SO:0001583	missense	25831				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	metal ion binding|protein binding|ubiquitin-protein ligase activity	g.chr14:31637671C>G	AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.1455G>C	14.37:g.31637671C>G	ENSP00000382269:p.Trp485Cys		Somatic				HECTD1_uc001wrd.1_5'UTR	p.W485C	NM_015382	NP_056197	WXS	Illumina HiSeq	Unspecified	Q9ULT8	HECD1_HUMAN	LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)	10	1944	-	Hepatocellular(127;0.0877)|Breast(36;0.176)		485			ANK 3.		D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Missense_Mutation	SNP	ENST00000399332.1	37	c.1455G>C	CCDS41939.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.962226	0.74016	.	.	ENSG00000092148	ENST00000553700;ENST00000261312;ENST00000399332;ENST00000556224	T;T;T	0.33216	1.42;1.42;1.42	5.23	5.23	0.72850	Ankyrin repeat-containing domain (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.56093	0.1962	M	0.65975	2.015	0.80722	D	1	D	0.69078	0.997	D	0.72338	0.977	T	0.58896	-0.7555	10	0.87932	D	0	-5.3264	19.1631	0.93543	0.0:1.0:0.0:0.0	.	485	Q9ULT8	HECD1_HUMAN	C	485	ENSP00000450697:W485C;ENSP00000382269:W485C;ENSP00000452015:W485C	ENSP00000261312:W485C	W	-	3	0	HECTD1	30707422	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.583000	0.82559	2.585000	0.87301	0.467000	0.42956	TGG		0.308	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409942.1			19	145	0	0	0	0	19	145				
PNN	5411	broad.mit.edu	37	14	39650613	39650613	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr14:39650613G>C	ENST00000216832.4	+	9	1767	c.1700G>C	c.(1699-1701)aGa>aCa	p.R567T	PNN_ENST00000557680.1_Intron	NM_002687.3	NP_002678	Q9H307	PININ_HUMAN	pinin, desmosome associated protein	567	Ser-rich.				cell adhesion (GO:0007155)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			breast(2)|endometrium(5)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(2)|stomach(1)	27	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0119)		GGTCGAGCTAGAAATAAAACA	0.453																																						uc001wuw.3		NA																	0				ovary(1)	1						c.(1699-1701)AGA>ACA		pinin, desmosome associated protein							103.0	104.0	104.0					14																	39650613		2203	4300	6503	SO:0001583	missense	5411				cell adhesion|regulation of transcription, DNA-dependent|transcription, DNA-dependent	catalytic step 2 spliceosome|desmosome|intermediate filament|nuclear speck	DNA binding|protein binding|structural molecule activity	g.chr14:39650613G>C	U77718	CCDS9671.1	14q21.1	2010-07-02			ENSG00000100941	ENSG00000100941			9162	protein-coding gene	gene with protein product		603154				8922384	Standard	NM_002687		Approved	memA	uc001wuw.4	Q9H307	OTTHUMG00000028821	ENST00000216832.4:c.1700G>C	14.37:g.39650613G>C	ENSP00000216832:p.Arg567Thr		Somatic					p.R567T	NM_002687	NP_002678	WXS	Illumina HiSeq	Unspecified	Q9H307	PININ_HUMAN	LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0119)	9	1797	+	Hepatocellular(127;0.213)		567			Ser-rich.		B4DZX8|O60899|Q53EM7|Q6P5X4|Q7KYL1|Q99738|Q9UHZ9|Q9UQR9	Missense_Mutation	SNP	ENST00000216832.4	37	c.1700G>C	CCDS9671.1	.	.	.	.	.	.	.	.	.	.	G	12.29	1.892787	0.33442	.	.	ENSG00000100941	ENST00000216832	T	0.58060	0.36	6.16	6.16	0.99307	.	0.152137	0.64402	D	0.000017	T	0.52141	0.1716	M	0.81112	2.525	0.80722	D	1	P	0.42827	0.791	B	0.32677	0.15	T	0.60687	-0.7214	10	0.54805	T	0.06	-16.0926	13.9788	0.64291	0.0686:0.0:0.9314:0.0	.	567	Q9H307	PININ_HUMAN	T	567	ENSP00000216832:R567T	ENSP00000216832:R567T	R	+	2	0	PNN	38720364	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.137000	0.50562	2.937000	0.99478	0.650000	0.86243	AGA		0.453	PNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276776.2	NM_002687		4	52	0	0	0	0	4	52				
SAV1	60485	broad.mit.edu	37	14	51102087	51102087	+	Silent	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr14:51102087C>T	ENST00000324679.4	-	5	1329	c.966G>A	c.(964-966)ctG>ctA	p.L322L	RN7SL452P_ENST00000482923.2_RNA	NM_021818.3	NP_068590.1	Q9H4B6	SAV1_HUMAN	salvador family WW domain containing protein 1	322	SARAH. {ECO:0000255|PROSITE- ProRule:PRU00310}.				hair follicle development (GO:0001942)|hippo signaling (GO:0035329)|intestinal epithelial cell differentiation (GO:0060575)|keratinocyte differentiation (GO:0030216)|lung epithelial cell differentiation (GO:0060487)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of epithelial cell proliferation (GO:0050680)|positive regulation of apoptotic process (GO:0043065)|regulation of stem cell maintenance (GO:2000036)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)				breast(1)|kidney(2)|lung(2)|prostate(1)	6	all_epithelial(31;0.000611)|Breast(41;0.0333)					GTTCCCACTTCAGAATGTGGT	0.343																																						uc001wyg.1		NA																	0				breast(1)	1						c.(964-966)CTG>CTA		WW45 protein							75.0	70.0	72.0					14																	51102087		2203	4300	6503	SO:0001819	synonymous_variant	60485				hippo signaling cascade	cytoplasm|nucleus	identical protein binding	g.chr14:51102087C>T	AK023071	CCDS9701.1	14q13-q23	2014-04-14	2014-04-14		ENSG00000151748	ENSG00000151748			17795	protein-coding gene	gene with protein product	"""WW domain-containing adaptor 45"""	607203	"""salvador homolog 1 (Drosophila)"""			12202036, 11027580	Standard	NM_021818		Approved	WW45, WWP4, salvador	uc001wyh.2	Q9H4B6	OTTHUMG00000140293	ENST00000324679.4:c.966G>A	14.37:g.51102087C>T			Somatic				SAV1_uc001wyh.1_Silent_p.L322L	p.L322L	NM_021818	NP_068590	WXS	Illumina HiSeq	Unspecified	Q9H4B6	SAV1_HUMAN			6	1127	-	all_epithelial(31;0.000611)|Breast(41;0.0333)		322			SARAH.		A8K4B8|D3DSB6|Q6IA58|Q9H949|Q9HAK9	Silent	SNP	ENST00000324679.4	37	c.966G>A	CCDS9701.1	.	.	.	.	.	.	.	.	.	.	C	7.979	0.750683	0.15778	.	.	ENSG00000151748	ENST00000557458	.	.	.	5.85	3.99	0.46301	.	.	.	.	.	T	0.62282	0.2415	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60762	-0.7199	4	.	.	.	-5.9884	11.1516	0.48462	0.0:0.8027:0.1274:0.07	.	.	.	.	K	28	.	.	E	-	1	0	SAV1	50171837	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	2.118000	0.41949	1.437000	0.47472	0.655000	0.94253	GAA		0.343	SAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276879.1			11	30	0	0	0	0	11	30				
PPM1A	5494	broad.mit.edu	37	14	60749451	60749451	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr14:60749451G>A	ENST00000395076.4	+	2	460	c.30G>A	c.(28-30)atG>atA	p.M10I	PPM1A_ENST00000529574.1_Missense_Mutation_p.M10I|PPM1A_ENST00000325658.3_Missense_Mutation_p.M10I|PPM1A_ENST00000325642.3_Missense_Mutation_p.M83I	NM_021003.4	NP_066283.1	P35813	PPM1A_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1A	10					cell cycle arrest (GO:0007050)|dephosphorylation (GO:0016311)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|N-terminal protein myristoylation (GO:0006499)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-threonine dephosphorylation (GO:0035970)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|protein dephosphorylation (GO:0006470)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|voltage-gated calcium channel complex (GO:0005891)	calmodulin-dependent protein phosphatase activity (GO:0033192)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)|R-SMAD binding (GO:0070412)|signal transducer activity (GO:0004871)	p.M10I(1)|p.M83I(1)		cervix(1)|endometrium(1)|large_intestine(8)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(108;0.046)		AGCCAAAGATGGAAAAGCATA	0.443																																						uc010apn.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(28-30)ATG>ATA		protein phosphatase 1A isoform 1							183.0	181.0	182.0					14																	60749451		2203	4300	6503	SO:0001583	missense	5494				cell cycle arrest|insulin receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription, DNA-dependent|positive regulation of Wnt receptor signaling pathway|protein dephosphorylation|Wnt receptor signaling pathway	cytosol|nucleus|protein serine/threonine phosphatase complex	magnesium ion binding|manganese ion binding|protein serine/threonine phosphatase activity|signal transducer activity	g.chr14:60749451G>A	S87759	CCDS9744.1, CCDS9745.1, CCDS45120.1	14q23.1	2013-01-24	2010-03-05		ENSG00000100614	ENSG00000100614	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9275	protein-coding gene	gene with protein product	"""phosphatase 2C alpha"", ""protein phosphatase 2C, alpha isoform"""	606108	"""protein phosphatase 1A (formerly 2C), magnesium-dependent, alpha isoform"""			1311954	Standard	NM_177952		Approved	MGC9201, PP2Calpha, PP2CA	uc001xew.4	P35813	OTTHUMG00000140333	ENST00000395076.4:c.30G>A	14.37:g.60749451G>A	ENSP00000378514:p.Met10Ile		Somatic				PPM1A_uc001xew.3_Missense_Mutation_p.M83I|PPM1A_uc001xex.3_Missense_Mutation_p.M10I|PPM1A_uc001xey.3_Missense_Mutation_p.M10I	p.M10I	NM_021003	NP_066283	WXS	Illumina HiSeq	Unspecified	P35813	PPM1A_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.046)	3	432	+			10					B5BU11|J3KNM0|O75551	Missense_Mutation	SNP	ENST00000395076.4	37	c.30G>A	CCDS9744.1	.	.	.	.	.	.	.	.	.	.	G	17.19	3.326570	0.60743	.	.	ENSG00000100614	ENST00000325642;ENST00000529574;ENST00000395076;ENST00000325658;ENST00000528241;ENST00000525399;ENST00000531937	T;T;T;T;T;T;T	0.08634	3.07;3.07;3.07;3.07;3.07;3.07;3.07	5.75	5.75	0.90469	Protein phosphatase 2C-like (2);	0.000000	0.85682	D	0.000000	T	0.06962	0.0177	N	0.10972	0.075	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.40813	-0.9543	10	0.46703	T	0.11	-4.3181	19.9233	0.97095	0.0:0.0:1.0:0.0	.	10;10;10	P35813;P35813-2;B2R8E4	PPM1A_HUMAN;.;.	I	83;10;10;10;10;10;10	ENSP00000327255:M83I;ENSP00000432966:M10I;ENSP00000378514:M10I;ENSP00000314850:M10I;ENSP00000431453:M10I;ENSP00000435398:M10I;ENSP00000435575:M10I	ENSP00000327255:M83I	M	+	3	0	PPM1A	59819204	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.704000	0.92352	0.591000	0.81541	ATG		0.443	PPM1A-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276949.2	NM_021003		15	164	0	0	0	0	15	164				
PRKCH	5583	broad.mit.edu	37	14	61952289	61952289	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr14:61952289C>T	ENST00000332981.5	+	10	1733	c.1348C>T	c.(1348-1350)Cgt>Tgt	p.R450C	PRKCH_ENST00000555082.1_Missense_Mutation_p.R289C	NM_006255.3	NP_006246.2	P24723	KPCL_HUMAN	protein kinase C, eta	450	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|negative regulation of glial cell apoptotic process (GO:0034351)|platelet activation (GO:0030168)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein kinase C signaling (GO:0070528)|protein phosphorylation (GO:0006468)|regulation of tight junction assembly (GO:2000810)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(4)|ovary(2)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25				OV - Ovarian serous cystadenocarcinoma(108;0.045)|BRCA - Breast invasive adenocarcinoma(234;0.0906)|KIRC - Kidney renal clear cell carcinoma(182;0.182)		GAAGTCTCGTCGTTTTGATGA	0.443																																					Melanoma(135;863 1779 8064 14443 26348)	uc001xfn.2		NA																	0				ovary(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|large_intestine(1)|skin(1)	6						c.(1348-1350)CGT>TGT		protein kinase C, eta							272.0	262.0	265.0					14																	61952289		2203	4300	6503	SO:0001583	missense	5583				intracellular signal transduction|platelet activation	cytosol|plasma membrane	ATP binding|enzyme binding|metal ion binding|protein kinase C activity	g.chr14:61952289C>T	M55284	CCDS9752.1	14q23.1	2009-07-10			ENSG00000027075	ENSG00000027075	2.7.11.1		9403	protein-coding gene	gene with protein product		605437		PRKCL		1986216, 1545821	Standard	NM_006255		Approved	PKC-L, PKCL	uc001xfn.3	P24723	OTTHUMG00000152341	ENST00000332981.5:c.1348C>T	14.37:g.61952289C>T	ENSP00000329127:p.Arg450Cys		Somatic				PRKCH_uc010tsa.1_Missense_Mutation_p.R289C|PRKCH_uc010tsb.1_Missense_Mutation_p.R18C	p.R450C	NM_006255	NP_006246	WXS	Illumina HiSeq	Unspecified	P24723	KPCL_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.045)|BRCA - Breast invasive adenocarcinoma(234;0.0906)|KIRC - Kidney renal clear cell carcinoma(182;0.182)	10	1653	+			450			Protein kinase.		B4DJN5|Q16246|Q8NE03	Missense_Mutation	SNP	ENST00000332981.5	37	c.1348C>T	CCDS9752.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.372941	0.82573	.	.	ENSG00000027075	ENST00000555185;ENST00000332981;ENST00000555082	T;T;T	0.66280	-0.2;1.76;1.76	5.35	5.35	0.76521	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	T	0.74527	0.3728	L	0.46819	1.47	0.80722	D	1	D	0.89917	1.0	D	0.66716	0.946	T	0.75473	-0.3305	10	0.87932	D	0	.	19.6142	0.95626	0.0:1.0:0.0:0.0	.	450	P24723	KPCL_HUMAN	C	18;450;289	ENSP00000451871:R18C;ENSP00000329127:R450C;ENSP00000450981:R289C	ENSP00000329127:R450C	R	+	1	0	PRKCH	61022042	1.000000	0.71417	0.881000	0.34555	0.915000	0.54546	3.737000	0.55060	2.941000	0.99782	0.655000	0.94253	CGT		0.443	PRKCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276974.2	NM_006255		37	273	0	0	0	0	37	273				
FCF1	51077	broad.mit.edu	37	14	75200790	75200790	+	Silent	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr14:75200790C>T	ENST00000341162.4	+	7	519	c.465C>T	c.(463-465)taC>taT	p.Y155Y	FCF1_ENST00000534938.2_Silent_p.Y143Y|FCF1_ENST00000553615.1_Silent_p.Y140Y	NM_015962.4	NP_057046.1	Q9Y324	FCF1_HUMAN	FCF1 rRNA-processing protein	155	PINc.				rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)	8				BRCA - Breast invasive adenocarcinoma(234;0.0037)		ATAAGTGTTACATTGTGGCCA	0.443																																						uc001xqh.2		NA																	0				ovary(1)	1						c.(463-465)TAC>TAT		FCF1 small subunit							133.0	99.0	111.0					14																	75200790		2203	4300	6503	SO:0001819	synonymous_variant	51077				rRNA processing	nucleolus		g.chr14:75200790C>T	AF132969	CCDS9832.1	14q24.2	2013-05-03	2013-05-03	2007-01-30	ENSG00000119616	ENSG00000119616			20220	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 111"", ""FCF1 small subunit (SSU) processome component homolog (S. cerevisiae)"""	C14orf111		16762320	Standard	XR_245690		Approved	CGI-35, Bka, UTP24	uc001xqh.3	Q9Y324		ENST00000341162.4:c.465C>T	14.37:g.75200790C>T			Somatic				FCF1_uc001xqf.1_Silent_p.Y140Y|FCF1_uc001xqg.2_RNA|FCF1_uc001xqi.2_RNA	p.Y155Y	NM_015962	NP_057046	WXS	Illumina HiSeq	Unspecified	Q9Y324	FCF1_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0037)	7	516	+			155			PINc.		Q86TW8|Q8TBL8	Silent	SNP	ENST00000341162.4	37	c.465C>T	CCDS9832.1																																																																																				0.443	FCF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413622.1	NM_015962		10	41	0	0	0	0	10	41				
OTUB2	78990	broad.mit.edu	37	14	94511037	94511037	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr14:94511037C>G	ENST00000203664.5	+	5	618	c.409C>G	c.(409-411)Ctg>Gtg	p.L137V		NM_023112.3	NP_075601.1	Q96DC9	OTUB2_HUMAN	OTU deubiquitinase, ubiquitin aldehyde binding 2	137	OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.				cellular amino acid metabolic process (GO:0006520)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)	nucleus (GO:0005634)	omega peptidase activity (GO:0008242)|ubiquitin-specific protease activity (GO:0004843)			kidney(1)|large_intestine(1)|lung(2)|ovary(1)	5		all_cancers(154;0.12)		Epithelial(152;0.124)|all cancers(159;0.21)|COAD - Colon adenocarcinoma(157;0.215)		GTTCCTGCGCCTGCTCACGTC	0.552																																						uc001yci.2		NA																	0					0						c.(409-411)CTG>GTG		OTU domain, ubiquitin aldehyde binding 2							117.0	91.0	100.0					14																	94511037		2203	4300	6503	SO:0001583	missense	78990				cellular amino acid metabolic process|protein K48-linked deubiquitination|protein K63-linked deubiquitination		omega peptidase activity|protein binding|ubiquitin-specific protease activity	g.chr14:94511037C>G	AF318378	CCDS9917.1	14q32.13-q32.2	2014-02-24	2014-02-24	2004-05-28		ENSG00000089723		"""OTU domain containing"""	20351	protein-coding gene	gene with protein product		608338	"""chromosome 14 open reading frame 137"", ""OTU domain, ubiquitin aldehyde binding 2"""	C14orf137		12704427, 19996094	Standard	NM_023112		Approved	FLJ21916, MGC3102	uc001ych.4	Q96DC9		ENST00000203664.5:c.409C>G	14.37:g.94511037C>G	ENSP00000203664:p.Leu137Val		Somatic					p.L137V	NM_023112	NP_075601	WXS	Illumina HiSeq	Unspecified	Q96DC9	OTUB2_HUMAN		Epithelial(152;0.124)|all cancers(159;0.21)|COAD - Colon adenocarcinoma(157;0.215)	5	569	+		all_cancers(154;0.12)	137			OTU.		Q6IA10|Q9H6T1	Missense_Mutation	SNP	ENST00000203664.5	37	c.409C>G	CCDS9917.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.937761	0.92458	.	.	ENSG00000089723	ENST00000203664	T	0.48522	0.81	5.63	5.63	0.86233	Ovarian tumour, otubain (1);	0.000000	0.64402	D	0.000001	T	0.73450	0.3588	M	0.86343	2.81	0.80722	D	1	D	0.64830	0.994	D	0.79784	0.993	T	0.77233	-0.2663	10	0.62326	D	0.03	-1.0253	17.1763	0.86842	0.0:1.0:0.0:0.0	.	137	Q96DC9	OTUB2_HUMAN	V	137	ENSP00000203664:L137V	ENSP00000203664:L137V	L	+	1	2	OTUB2	93580790	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	3.395000	0.52558	2.659000	0.90383	0.561000	0.74099	CTG		0.552	OTUB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412855.1			3	35	0	0	0	0	3	35				
EML1	2009	broad.mit.edu	37	14	100363569	100363569	+	Silent	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr14:100363569G>A	ENST00000262233.6	+	7	904	c.765G>A	c.(763-765)gtG>gtA	p.V255V	EML1_ENST00000334192.4_Silent_p.V274V|EML1_ENST00000327921.9_Silent_p.V243V	NM_004434.2	NP_004425.2	O00423	EMAL1_HUMAN	echinoderm microtubule associated protein like 1	255	Tandem atypical propeller in EMLs.				brain development (GO:0007420)|hematopoietic progenitor cell differentiation (GO:0002244)|microtubule cytoskeleton organization (GO:0000226)|mitotic spindle organization (GO:0007052)|neuroblast proliferation (GO:0007405)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	calcium ion binding (GO:0005509)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Melanoma(154;0.0879)|all_epithelial(191;0.216)				CCGTGGTGGTGTTATACAACG	0.532																																						uc001ygs.2		NA																	0				large_intestine(2)|pancreas(1)|ovary(1)|skin(1)	5						c.(763-765)GTG>GTA		echinoderm microtubule associated protein like 1							151.0	121.0	131.0					14																	100363569		2203	4300	6503	SO:0001819	synonymous_variant	2009					cytoplasm|microtubule|microtubule associated complex	calcium ion binding|protein binding	g.chr14:100363569G>A	AK023861	CCDS32154.1, CCDS32155.1	14q32	2013-01-10		2002-02-15		ENSG00000066629		"""WD repeat domain containing"""	3330	protein-coding gene	gene with protein product		602033		EMAPL		9226380, 10521658	Standard	XM_005267397		Approved	EMAP, HuEMAP, ELP79	uc001ygr.3	O00423		ENST00000262233.6:c.765G>A	14.37:g.100363569G>A			Somatic				EML1_uc010avt.1_Silent_p.V242V|EML1_uc010tww.1_Silent_p.V243V|EML1_uc001ygq.2_Silent_p.V274V|EML1_uc001ygr.2_Silent_p.V274V	p.V255V	NM_004434	NP_004425	WXS	Illumina HiSeq	Unspecified	O00423	EMAL1_HUMAN			7	834	+		Melanoma(154;0.0879)|all_epithelial(191;0.216)	255					Q86U15|Q8N536|Q8N5C4|Q8WWL6	Silent	SNP	ENST00000262233.6	37	c.765G>A	CCDS32155.1																																																																																				0.532	EML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413943.1	NM_001008707		9	57	0	0	0	0	9	57				
RYR3	6263	broad.mit.edu	37	15	33955886	33955886	+	Missense_Mutation	SNP	C	C	T	rs374539101		TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr15:33955886C>T	ENST00000389232.4	+	36	5637	c.5567C>T	c.(5566-5568)gCg>gTg	p.A1856V	RYR3_ENST00000415757.3_Missense_Mutation_p.A1856V	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	1856	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AACATGTCTGCGGCCCTGACT	0.552																																						uc001zhi.2		NA																	0				ovary(5)|central_nervous_system(4)|lung(1)	10						c.(5566-5568)GCG>GTG		ryanodine receptor 3		C	VAL/ALA	0,4018		0,0,2009	41.0	41.0	41.0		5567	5.3	1.0	15		41	1,8343		0,1,4171	no	missense	RYR3	NM_001036.3	64	0,1,6180	TT,TC,CC		0.012,0.0,0.0081	probably-damaging	1856/4871	33955886	1,12361	2009	4172	6181	SO:0001583	missense	6263				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr15:33955886C>T		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.5567C>T	15.37:g.33955886C>T	ENSP00000373884:p.Ala1856Val		Somatic				RYR3_uc010bar.2_Missense_Mutation_p.A1856V	p.A1856V	NM_001036	NP_001027	WXS	Illumina HiSeq	Unspecified	Q15413	RYR3_HUMAN		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)	36	5637	+		all_lung(180;7.18e-09)	1856			4 X approximate repeats.|Cytoplasmic (By similarity).		O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	c.5567C>T	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	C	34	5.408122	0.96051	0.0	1.2E-4	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	T;T	0.74209	-0.82;-0.82	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	D	0.84009	0.5378	L	0.56124	1.755	0.80722	D	1	P;D	0.89917	0.912;1.0	P;D	0.91635	0.551;0.999	T	0.83198	-0.0080	10	0.46703	T	0.11	.	19.0812	0.93182	0.0:1.0:0.0:0.0	.	1856;1856	Q15413-2;Q15413	.;RYR3_HUMAN	V	1856	ENSP00000373884:A1856V;ENSP00000399610:A1856V	ENSP00000354735:A1856V	A	+	2	0	RYR3	31743178	1.000000	0.71417	0.991000	0.47740	0.982000	0.71751	7.604000	0.82830	2.729000	0.93468	0.561000	0.74099	GCG		0.552	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1			3	15	0	0	0	0	3	15				
PAK6	56924	broad.mit.edu	37	15	40565875	40565875	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr15:40565875G>T	ENST00000542403.2	+	7	1852	c.1741G>T	c.(1741-1743)Gag>Tag	p.E581*	PAK6_ENST00000260404.4_Nonsense_Mutation_p.E581*|PAK6_ENST00000560346.1_Nonsense_Mutation_p.E581*|PAK6_ENST00000455577.2_Nonsense_Mutation_p.E581*|PAK6_ENST00000453867.1_Nonsense_Mutation_p.E581*|RP11-133K1.2_ENST00000558658.1_3'UTR|PAK6_ENST00000441369.1_Nonsense_Mutation_p.E581*	NM_001276717.1	NP_001263646.1	Q9NQU5	PAK6_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 6	581	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cytoskeleton organization (GO:0007010)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|endometrium(3)|large_intestine(2)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(2)	24		all_cancers(109;1.13e-18)|all_epithelial(112;1.62e-15)|Lung NSC(122;5.67e-11)|all_lung(180;1.41e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0823)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.51e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0544)		GTATGCCACTGAGGTAACCGT	0.572																																						uc010bbl.2		NA																	0				lung(5)|large_intestine(1)|ovary(1)|skin(1)	8						c.(1741-1743)GAG>TAG		p21-activated kinase 6							91.0	84.0	86.0					15																	40565875		2203	4300	6503	SO:0001587	stop_gained	56924						ATP binding|protein binding|protein serine/threonine kinase activity	g.chr15:40565875G>T	AF276893	CCDS10054.1, CCDS61590.1	15q14	2008-06-17	2008-06-17		ENSG00000137843	ENSG00000137843			16061	protein-coding gene	gene with protein product		608110	"""p21(CDKN1A)-activated kinase 6"""			11278661	Standard	NM_020168		Approved	PAK5	uc001zlb.3	Q9NQU5	OTTHUMG00000129921	ENST00000542403.2:c.1741G>T	15.37:g.40565875G>T	ENSP00000439597:p.Glu581*		Somatic				PAK6_uc010bbm.2_Nonsense_Mutation_p.E581*|PAK6_uc001zky.3_Nonsense_Mutation_p.E581*|PAK6_uc010bbn.2_Nonsense_Mutation_p.E581*|PAK6_uc001zlb.2_Nonsense_Mutation_p.E581*	p.E581*	NM_001128628	NP_001122100	WXS	Illumina HiSeq	Unspecified	Q9NQU5	PAK6_HUMAN		GBM - Glioblastoma multiforme(113;1.51e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0544)	9	2181	+		all_cancers(109;1.13e-18)|all_epithelial(112;1.62e-15)|Lung NSC(122;5.67e-11)|all_lung(180;1.41e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0823)|Colorectal(260;0.117)	581			Protein kinase.		A8K2G2|B3KYB0|G5E9R2	Nonsense_Mutation	SNP	ENST00000542403.2	37	c.1741G>T	CCDS10054.1	.	.	.	.	.	.	.	.	.	.	G	44	10.685025	0.99450	.	.	ENSG00000137843	ENST00000441369;ENST00000453867;ENST00000455577;ENST00000260404;ENST00000542403	.	.	.	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	.	18.3062	0.90182	0.0:0.0:1.0:0.0	.	.	.	.	X	581	.	ENSP00000260404:E581X	E	+	1	0	PAK6	38353167	1.000000	0.71417	0.993000	0.49108	0.927000	0.56198	9.790000	0.99075	2.326000	0.78906	0.462000	0.41574	GAG		0.572	PAK6-004	NOVEL	alternative_3_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000418355.1			7	43	1	0	8.13e-05	8.62e-05	7	43				
PLCB2	5330	broad.mit.edu	37	15	40582261	40582261	+	Missense_Mutation	SNP	A	A	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr15:40582261A>G	ENST00000260402.3	-	30	3481	c.3232T>C	c.(3232-3234)Tcc>Ccc	p.S1078P	PLCB2_ENST00000456256.2_Missense_Mutation_p.S1063P|PLCB2_ENST00000557821.1_Missense_Mutation_p.S1074P	NM_001284297.1|NM_004573.2	NP_001271226.1|NP_004564.2	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	1078					activation of phospholipase C activity (GO:0007202)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|sensory perception of bitter taste (GO:0050913)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(3)	39		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		TGGATGTGGGAGTTGTTAATC	0.468																																						uc001zld.2		NA																	0				ovary(3)|breast(3)|kidney(1)|pancreas(1)	8						c.(3232-3234)TCC>CCC		phospholipase C, beta 2							180.0	170.0	173.0					15																	40582261		2038	4203	6241	SO:0001583	missense	5330				activation of phospholipase C activity|intracellular signal transduction|lipid catabolic process|phospholipid metabolic process|synaptic transmission	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity	g.chr15:40582261A>G		CCDS42020.1, CCDS61591.1, CCDS61592.1, CCDS73704.1	15q15.1	2012-01-23			ENSG00000137841	ENSG00000137841	3.1.4.11		9055	protein-coding gene	gene with protein product		604114				1644792, 9925923	Standard	XM_005254448		Approved	FLJ38135	uc001zld.3	Q00722	OTTHUMG00000172412	ENST00000260402.3:c.3232T>C	15.37:g.40582261A>G	ENSP00000260402:p.Ser1078Pro		Somatic				PLCB2_uc001zlc.2_Missense_Mutation_p.S62P|PLCB2_uc010bbo.2_Missense_Mutation_p.S1074P|PLCB2_uc010ucm.1_Missense_Mutation_p.S1063P	p.S1078P	NM_004573	NP_004564	WXS	Illumina HiSeq	Unspecified	Q00722	PLCB2_HUMAN		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)	30	3533	-		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)	1078			Potential.		A8K6J2|B9EGH5	Missense_Mutation	SNP	ENST00000260402.3	37	c.3232T>C	CCDS42020.1	.	.	.	.	.	.	.	.	.	.	A	27.2	4.805095	0.90623	.	.	ENSG00000137841	ENST00000260402;ENST00000456256	T;T	0.51817	0.69;0.69	5.56	5.56	0.83823	PLC-beta, C-terminal (1);	0.280458	0.35207	N	0.003363	T	0.59770	0.2218	L	0.54323	1.7	0.80722	D	1	D;D;D	0.59767	0.986;0.981;0.984	P;P;P	0.57960	0.693;0.749;0.83	T	0.63242	-0.6681	10	0.72032	D	0.01	.	14.8936	0.70627	1.0:0.0:0.0:0.0	.	1063;1074;1078	B9EGH5;Q00722-2;Q00722	.;.;PLCB2_HUMAN	P	1078;1063	ENSP00000260402:S1078P;ENSP00000411991:S1063P	ENSP00000260402:S1078P	S	-	1	0	PLCB2	38369553	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.154000	0.58125	2.108000	0.64289	0.533000	0.62120	TCC		0.468	PLCB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418430.1			4	101	0	0	0	0	4	101				
INO80	54617	broad.mit.edu	37	15	41387980	41387980	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr15:41387980G>A	ENST00000361937.3	-	3	714	c.290C>T	c.(289-291)tCt>tTt	p.S97F	INO80_ENST00000401393.3_Missense_Mutation_p.S97F			Q9ULG1	INO80_HUMAN	INO80 complex subunit	97	Assembles INO80 complex module with putative regulatory components INO80E, INO80F, UCHL5, NFRKB, MCRS1 and IN80D.				ATP catabolic process (GO:0006200)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|mitotic sister chromatid segregation (GO:0000070)|positive regulation of cell growth (GO:0030307)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|spindle assembly (GO:0051225)|UV-damage excision repair (GO:0070914)	Ino80 complex (GO:0031011)|microtubule (GO:0005874)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			NS(1)|breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						TCCATTCAGAGAATATGTGTT	0.418																																						uc001zni.2		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(289-291)TCT>TTT		INO80 complex homolog 1							69.0	75.0	73.0					15																	41387980		2203	4300	6503	SO:0001583	missense	54617				cell division|cellular response to ionizing radiation|cellular response to UV|chromatin remodeling|double-strand break repair via homologous recombination|mitotic sister chromatid segregation|positive regulation of cell growth|positive regulation of DNA replication involved in S phase|positive regulation of transcription from RNA polymerase II promoter|regulation of G1/S transition of mitotic cell cycle|spindle assembly|UV-damage excision repair	Ino80 complex|microtubule	actin binding|alpha-tubulin binding|ATP binding|ATPase activity|DNA binding|DNA helicase activity	g.chr15:41387980G>A	AB033085	CCDS10071.1	15q15.1	2013-08-21	2013-08-21	2008-08-07	ENSG00000128908	ENSG00000128908	3.6.1.3	"""INO80 complex subunits"""	26956	protein-coding gene	gene with protein product	"""INO80 complex subunit A"""	610169	"""INO80 complex homolog 1 (S. cerevisiae)"", ""INO80 homolog (S. cerevisiae)"""	INOC1		16298340, 16230350, 20237820	Standard	NM_017553		Approved	KIAA1259, Ino80, hINO80, INO80A	uc001zni.3	Q9ULG1	OTTHUMG00000130209	ENST00000361937.3:c.290C>T	15.37:g.41387980G>A	ENSP00000355205:p.Ser97Phe		Somatic				INO80_uc010ucu.1_RNA	p.S97F	NM_017553	NP_060023	WXS	Illumina HiSeq	Unspecified	Q9ULG1	INO80_HUMAN			3	503	-			97			Assembles INO80 complex module with putative regulatory components INO80E, INO80F, UCHL5, NFRKB, MCRS1 and IN80D.		A6H8X4|Q9NTG6	Missense_Mutation	SNP	ENST00000361937.3	37	c.290C>T	CCDS10071.1	.	.	.	.	.	.	.	.	.	.	G	15.78	2.933950	0.52866	.	.	ENSG00000128908	ENST00000361937;ENST00000401393	D;D	0.90955	-2.76;-2.76	5.67	5.67	0.87782	.	0.316332	0.30311	N	0.009914	D	0.84224	0.5425	N	0.12182	0.205	0.40003	D	0.97519	B	0.09022	0.002	B	0.04013	0.001	T	0.78666	-0.2115	10	0.52906	T	0.07	.	19.774	0.96385	0.0:0.0:1.0:0.0	.	97	Q9ULG1	INO80_HUMAN	F	97	ENSP00000355205:S97F;ENSP00000384686:S97F	ENSP00000355205:S97F	S	-	2	0	INO80	39175272	1.000000	0.71417	0.962000	0.40283	0.935000	0.57460	7.565000	0.82337	2.679000	0.91253	0.591000	0.81541	TCT		0.418	INO80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252527.2	NM_017553		6	73	0	0	0	0	6	73				
OIP5	11339	broad.mit.edu	37	15	41624610	41624610	+	Silent	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr15:41624610G>C	ENST00000220514.3	-	1	209	c.150C>G	c.(148-150)ctC>ctG	p.L50L	NUSAP1_ENST00000560747.1_5'Flank|NUSAP1_ENST00000450592.2_5'Flank|NUSAP1_ENST00000559596.1_5'Flank|NUSAP1_ENST00000450318.1_5'Flank|NUSAP1_ENST00000560177.1_5'Flank|NUSAP1_ENST00000260359.6_5'Flank|NUSAP1_ENST00000414849.2_5'Flank	NM_007280.1	NP_009211.1	O43482	MS18B_HUMAN	Opa interacting protein 5	50					cell communication (GO:0007154)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)	Cajal body (GO:0015030)|chromatin (GO:0000785)|chromocenter (GO:0010369)|chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(3)|lung(1)|urinary_tract(1)	5		all_cancers(109;4.16e-14)|all_epithelial(112;7.09e-12)|Lung NSC(122;1.14e-09)|all_lung(180;2.56e-08)|Melanoma(134;0.091)|Colorectal(260;0.175)		OV - Ovarian serous cystadenocarcinoma(18;1.49e-16)|GBM - Glioblastoma multiforme(113;1.29e-06)|BRCA - Breast invasive adenocarcinoma(123;0.163)		CTGCGGGGCCGAGCGGCGAGG	0.662																																						uc001znp.2		NA																	0					0						c.(148-150)CTC>CTG		Opa interacting protein 5							38.0	48.0	45.0					15																	41624610		2200	4292	6492	SO:0001819	synonymous_variant	11339				cell communication|cell division|CenH3-containing nucleosome assembly at centromere|mitosis	Cajal body|chromatin|chromosome, centromeric region	protein binding	g.chr15:41624610G>C	AF025441	CCDS10074.1	15q14	2011-02-23			ENSG00000104147	ENSG00000104147			20300	protein-coding gene	gene with protein product	"""MIS18 kinetochore protein homolog B (S. pombe)"", ""cancer/testis antigen 86"""	606020				9466265, 17199038	Standard	NM_007280		Approved	MIS18B, hMIS18beta, CT86	uc001znp.3	O43482	OTTHUMG00000130251	ENST00000220514.3:c.150C>G	15.37:g.41624610G>C			Somatic				NUSAP1_uc001znq.3_5'Flank|NUSAP1_uc001znr.3_5'Flank|NUSAP1_uc001zns.3_5'Flank|NUSAP1_uc010bce.2_5'Flank|NUSAP1_uc001znt.3_5'Flank|NUSAP1_uc001znv.3_5'Flank|NUSAP1_uc001znu.3_5'Flank|NUSAP1_uc010ucw.1_5'Flank	p.L50L	NM_007280	NP_009211	WXS	Illumina HiSeq	Unspecified	O43482	MS18B_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;1.49e-16)|GBM - Glioblastoma multiforme(113;1.29e-06)|BRCA - Breast invasive adenocarcinoma(123;0.163)	1	210	-		all_cancers(109;4.16e-14)|all_epithelial(112;7.09e-12)|Lung NSC(122;1.14e-09)|all_lung(180;2.56e-08)|Melanoma(134;0.091)|Colorectal(260;0.175)	50					Q96BX7	Silent	SNP	ENST00000220514.3	37	c.150C>G	CCDS10074.1																																																																																				0.662	OIP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252576.2	NM_007280		13	58	0	0	0	0	13	58				
LTK	4058	broad.mit.edu	37	15	41804373	41804373	+	Silent	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr15:41804373G>C	ENST00000263800.6	-	4	546	c.450C>G	c.(448-450)ctC>ctG	p.L150L	LTK_ENST00000453182.2_Silent_p.L150L|LTK_ENST00000355166.5_Silent_p.L150L|LTK_ENST00000561619.1_Intron	NM_002344.5	NP_002335.2	P29376	LTK_HUMAN	leukocyte receptor tyrosine kinase	150					cell proliferation (GO:0008283)|cellular response to retinoic acid (GO:0071300)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of neuron projection development (GO:0010976)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(16)|skin(3)|urinary_tract(1)	26		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)		OV - Ovarian serous cystadenocarcinoma(18;2.1e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)		CCCCGAGACCGAGGGAGAAGA	0.697										TSP Lung(18;0.14)																												uc001zoa.3		NA																	0				lung(6)|central_nervous_system(1)	7						c.(448-450)CTC>CTG		leukocyte receptor tyrosine kinase isoform 1							37.0	40.0	39.0					15																	41804373		2203	4299	6502	SO:0001819	synonymous_variant	4058				apoptosis|cell proliferation|phosphatidylinositol 3-kinase cascade|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane|soluble fraction	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr15:41804373G>C	D16105	CCDS10077.1, CCDS10078.1, CCDS45237.1	15q15.1-q21.1	2009-07-10	2008-01-23		ENSG00000062524	ENSG00000062524	2.7.10.1		6721	protein-coding gene	gene with protein product		151520	"""leukocyte tyrosine kinase"""			2320375	Standard	NM_206961		Approved	TYK1	uc001zoa.3	P29376	OTTHUMG00000130339	ENST00000263800.6:c.450C>G	15.37:g.41804373G>C		TSP Lung(18;0.14)	Somatic				LTK_uc001zob.3_Silent_p.L150L|LTK_uc010ucx.1_Silent_p.L150L|LTK_uc010bcg.2_Intron	p.L150L	NM_002344	NP_002335	WXS	Illumina HiSeq	Unspecified	P29376	LTK_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;2.1e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)	4	628	-		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)	150			Extracellular (Potential).		A6NNJ8|B4DL89|E9PFX4	Silent	SNP	ENST00000263800.6	37	c.450C>G	CCDS10077.1																																																																																				0.697	LTK-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252690.2			3	29	0	0	0	0	3	29				
PYGO1	26108	broad.mit.edu	37	15	55838571	55838571	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr15:55838571G>A	ENST00000302000.6	-	3	1004	c.910C>T	c.(910-912)Cag>Tag	p.Q304*	PYGO1_ENST00000563719.1_Nonsense_Mutation_p.Q304*	NM_015617.1	NP_056432.1	Q9Y3Y4	PYGO1_HUMAN	pygopus family PHD finger 1	304	Asn-rich.				hematopoietic progenitor cell differentiation (GO:0002244)|kidney development (GO:0001822)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein localization to nucleus (GO:0034504)|spermatid nucleus differentiation (GO:0007289)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(4)|kidney(2)|large_intestine(6)|lung(6)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	27				all cancers(107;0.0131)|GBM - Glioblastoma multiforme(80;0.18)		GGCTTATTCTGCGTCCCATTT	0.433																																						uc010bfl.1		NA																	0				ovary(1)|skin(1)	2						c.(910-912)CAG>TAG		pygopus homolog 1							315.0	310.0	312.0					15																	55838571		2193	4292	6485	SO:0001587	stop_gained	26108				Wnt receptor signaling pathway	nucleus	zinc ion binding	g.chr15:55838571G>A	AF457207	CCDS10155.1	15q21.1	2013-10-09	2013-10-09		ENSG00000171016	ENSG00000171016		"""Zinc fingers, PHD-type"""	30256	protein-coding gene	gene with protein product		606902	"""pygopus homolog 1 (Drosophila)"""			11988739	Standard	NM_015617		Approved		uc002adf.1	Q9Y3Y4	OTTHUMG00000132009	ENST00000302000.6:c.910C>T	15.37:g.55838571G>A	ENSP00000302327:p.Gln304*		Somatic				PYGO1_uc002adf.1_Nonsense_Mutation_p.Q304*	p.Q304*	NM_015617	NP_056432	WXS	Illumina HiSeq	Unspecified	Q9Y3Y4	PYGO1_HUMAN		all cancers(107;0.0131)|GBM - Glioblastoma multiforme(80;0.18)	3	966	-			304			Asn-rich.		A7Y2D6	Nonsense_Mutation	SNP	ENST00000302000.6	37	c.910C>T	CCDS10155.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.724708	0.89298	.	.	ENSG00000171016	ENST00000302000;ENST00000401688	.	.	.	5.24	5.24	0.73138	.	0.210290	0.41605	D	0.000846	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	-1.1787	18.1934	0.89813	0.0:0.0:1.0:0.0	.	.	.	.	X	304	.	ENSP00000302327:Q304X	Q	-	1	0	PYGO1	53625863	1.000000	0.71417	0.997000	0.53966	0.826000	0.46750	5.162000	0.64942	2.605000	0.88082	0.591000	0.81541	CAG		0.433	PYGO1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254977.2	NM_015617		49	323	0	0	0	0	49	323				
TLN2	83660	broad.mit.edu	37	15	62993361	62993361	+	Silent	SNP	T	T	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr15:62993361T>C	ENST00000561311.1	+	16	1874	c.1644T>C	c.(1642-1644)tcT>tcC	p.S548S	TLN2_ENST00000306829.6_Silent_p.S548S			Q9Y4G6	TLN2_HUMAN	talin 2	548					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						AAATCCATTCTCAAGTTGATG	0.468																																						uc002alb.3		NA																	0				ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						c.(1642-1644)TCT>TCC		talin 2							109.0	91.0	97.0					15																	62993361		2203	4300	6503	SO:0001819	synonymous_variant	83660				cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton	g.chr15:62993361T>C	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.1644T>C	15.37:g.62993361T>C			Somatic					p.S548S	NM_015059	NP_055874	WXS	Illumina HiSeq	Unspecified	Q9Y4G6	TLN2_HUMAN			14	1644	+			548					A6NLB8	Silent	SNP	ENST00000561311.1	37	c.1644T>C	CCDS32261.1																																																																																				0.468	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2			7	78	0	0	0	0	7	78				
RASL12	51285	broad.mit.edu	37	15	65350896	65350896	+	Silent	SNP	G	G	A	rs147666289		TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr15:65350896G>A	ENST00000220062.4	-	4	570	c.294C>T	c.(292-294)taC>taT	p.Y98Y	RASL12_ENST00000434605.2_Silent_p.Y87Y|RASL12_ENST00000421977.3_Silent_p.Y79Y	NM_016563.2	NP_057647.1	Q9NYN1	RASLC_HUMAN	RAS-like, family 12	98					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)			lung(1)|ovary(1)|skin(1)|urinary_tract(1)	4						TGTCGACGCTGTACACCACCA	0.652																																						uc002aoi.1		NA																	0				skin(1)	1						c.(292-294)TAC>TAT		RAS-like, family 12 protein							59.0	54.0	56.0					15																	65350896		2202	4299	6501	SO:0001819	synonymous_variant	51285				small GTPase mediated signal transduction	membrane	GTP binding|GTPase activity	g.chr15:65350896G>A	AF233588	CCDS10200.1	15q11.2-q22.33	2014-05-09			ENSG00000103710	ENSG00000103710			30289	protein-coding gene	gene with protein product	"""Ras family member Ris"""					12107412	Standard	NM_016563		Approved	RIS	uc002aoi.1	Q9NYN1	OTTHUMG00000133115	ENST00000220062.4:c.294C>T	15.37:g.65350896G>A			Somatic				RASL12_uc002aoj.1_Silent_p.Y79Y|RASL12_uc010uir.1_Silent_p.Y87Y	p.Y98Y	NM_016563	NP_057647	WXS	Illumina HiSeq	Unspecified	Q9NYN1	RASLC_HUMAN			4	509	-			98					B2RC29|B4DJW2|B4DU82	Silent	SNP	ENST00000220062.4	37	c.294C>T	CCDS10200.1																																																																																				0.652	RASL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256782.2	NM_016563		10	43	0	0	0	0	10	43				
EDC3	80153	broad.mit.edu	37	15	74967310	74967310	+	Silent	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr15:74967310G>A	ENST00000315127.4	-	2	337	c.156C>T	c.(154-156)gtC>gtT	p.V52V	EDC3_ENST00000426797.3_Silent_p.V52V|EDC3_ENST00000568176.1_Silent_p.V52V	NM_001142444.1|NM_025083.3	NP_001135916.1|NP_079359.2	Q96F86	EDC3_HUMAN	enhancer of mRNA decapping 3	52	Required for P-body targeting and interaction with DCP1A. {ECO:0000250}.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)|membrane (GO:0016020)	identical protein binding (GO:0042802)|RNA binding (GO:0003723)			breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	16						ACCTGAAGGTGACTTCTGGAA	0.498																																						uc002ayn.2		NA																	0				ovary(1)	1						c.(154-156)GTC>GTT		enhancer of mRNA decapping 3							146.0	137.0	140.0					15																	74967310		2197	4296	6493	SO:0001819	synonymous_variant	80153				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay	cytoplasmic mRNA processing body|cytosol	protein binding|RNA binding	g.chr15:74967310G>A	BC011534	CCDS10267.1	15q24.1	2013-05-02	2013-05-02	2006-07-07	ENSG00000179151	ENSG00000179151			26114	protein-coding gene	gene with protein product		609842	"""yjeF domain containing (E.coli)"", ""LSM16 homolog (EDC3, S. cerevisiae)"", ""enhancer of mRNA decapping 3 homolog (S. cerevisiae)"""	YJDC, LSM16		15225602, 17533573, 22483619	Standard	NM_025083		Approved	FLJ21128, hYjeF_N2-15q23, YJEFN2	uc002aym.3	Q96F86	OTTHUMG00000142815	ENST00000315127.4:c.156C>T	15.37:g.74967310G>A			Somatic				EDC3_uc002ayo.2_Silent_p.V52V|EDC3_uc002aym.2_Silent_p.V52V	p.V52V	NM_001142443	NP_001135915	WXS	Illumina HiSeq	Unspecified	Q96F86	EDC3_HUMAN			5	644	-			52			Required for P-body targeting and interaction with DCP1A (By similarity).		B3KPH0|D3DW61|Q9H797	Silent	SNP	ENST00000315127.4	37	c.156C>T	CCDS10267.1																																																																																				0.498	EDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286399.1	NM_025083		29	176	0	0	0	0	29	176				
CEMIP	57214	broad.mit.edu	37	15	81181841	81181841	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr15:81181841G>C	ENST00000394685.3	+	10	1413	c.994G>C	c.(994-996)Gat>Cat	p.D332H	KIAA1199_ENST00000356249.5_Missense_Mutation_p.D332H|KIAA1199_ENST00000220244.3_Missense_Mutation_p.D332H			Q8WUJ3	CEMIP_HUMAN		332	Necessary for its endoplasmic reticulum (ER) retention and interaction with HSPA5.				hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						GTTCGATCATGATAAAGTATC	0.463																																						uc002bfw.1		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.(994-996)GAT>CAT		KIAA1199 precursor							133.0	118.0	123.0					15																	81181841		2203	4300	6503	SO:0001583	missense	57214							g.chr15:81181841G>C																												ENST00000394685.3:c.994G>C	15.37:g.81181841G>C	ENSP00000378177:p.Asp332His		Somatic				KIAA1199_uc010unn.1_Missense_Mutation_p.D332H	p.D332H	NM_018689	NP_061159	WXS	Illumina HiSeq	Unspecified	Q8WUJ3	K1199_HUMAN			9	1254	+			332					Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Missense_Mutation	SNP	ENST00000394685.3	37	c.994G>C	CCDS10315.1	.	.	.	.	.	.	.	.	.	.	G	4.956	0.177644	0.09443	.	.	ENSG00000103888	ENST00000220244;ENST00000394685;ENST00000356249;ENST00000394683	T;T;T	0.48201	0.82;0.82;0.82	5.84	2.89	0.33648	.	0.812690	0.11267	N	0.581918	T	0.42698	0.1214	M	0.81341	2.54	0.09310	N	1	B	0.11235	0.004	B	0.12837	0.008	T	0.41928	-0.9481	10	0.13470	T	0.59	-17.836	2.3336	0.04241	0.1843:0.2587:0.4402:0.1169	.	332	Q8WUJ3	K1199_HUMAN	H	332	ENSP00000220244:D332H;ENSP00000378177:D332H;ENSP00000348583:D332H	ENSP00000220244:D332H	D	+	1	0	KIAA1199	78968896	0.960000	0.32886	0.003000	0.11579	0.008000	0.06430	2.351000	0.44071	0.823000	0.34589	0.650000	0.86243	GAT		0.463	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291389.1			3	87	0	0	0	0	3	87				
MEX3B	84206	broad.mit.edu	37	15	82336881	82336881	+	Silent	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr15:82336881G>C	ENST00000329713.4	-	2	765	c.330C>G	c.(328-330)gtC>gtG	p.V110V	MEX3B_ENST00000558133.1_3'UTR|AC026956.1_ENST00000410589.1_RNA	NM_032246.4	NP_115622.2	Q6ZN04	MEX3B_HUMAN	mex-3 RNA binding family member B	110	KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.				protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|upper_aerodigestive_tract(1)	19						TCACAACAAAGACAGGCTCCT	0.577																																						uc002bgq.1		NA																	0				breast(1)|kidney(1)	2						c.(328-330)GTC>GTG		mex-3 homolog B							51.0	55.0	54.0					15																	82336881		2203	4300	6503	SO:0001819	synonymous_variant	84206				protein autophosphorylation	cytoplasmic mRNA processing body|nucleus	calcium ion binding|RNA binding|zinc ion binding	g.chr15:82336881G>C	AK131424	CCDS10319.1	15q25.1	2013-08-21	2013-08-21	2007-07-18	ENSG00000183496	ENSG00000183496		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	25297	protein-coding gene	gene with protein product		611008	"""ring finger and KH domain containing 3"", ""mex-3 homolog B (C. elegans)"""	RKHD3		11230166, 17267406	Standard	NM_032246		Approved	DKFZp434J0617, RNF195	uc002bgq.2	Q6ZN04	OTTHUMG00000147356	ENST00000329713.4:c.330C>G	15.37:g.82336881G>C			Somatic					p.V110V	NM_032246	NP_115622	WXS	Illumina HiSeq	Unspecified	Q6ZN04	MEX3B_HUMAN			2	645	-			110			KH 1.		Q4G0W1|Q8IVG2|Q9H0J0	Silent	SNP	ENST00000329713.4	37	c.330C>G	CCDS10319.1																																																																																				0.577	MEX3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304000.1	XM_290645		11	51	0	0	0	0	11	51				
CPEB1	64506	broad.mit.edu	37	15	83226644	83226644	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr15:83226644C>G	ENST00000562019.1	-	4	788	c.472G>C	c.(472-474)Gac>Cac	p.D158H	CPEB1_ENST00000450751.2_Missense_Mutation_p.D83H|CPEB1_ENST00000261723.6_Missense_Mutation_p.D161H|CPEB1_ENST00000568128.1_Missense_Mutation_p.D158H|CPEB1_ENST00000564522.1_Missense_Mutation_p.D83H|RP11-152F13.10_ENST00000562833.1_5'Flank|CPEB1_ENST00000398592.2_Intron|CPEB1_ENST00000563800.1_Missense_Mutation_p.D185H|CPEB1_ENST00000423133.2_Missense_Mutation_p.D83H|CPEB1_ENST00000398591.2_Missense_Mutation_p.D83H|RP11-379H8.1_ENST00000568285.1_Intron|CPEB1_ENST00000568757.1_Missense_Mutation_p.D83H			Q9BZB8	CPEB1_HUMAN	cytoplasmic polyadenylation element binding protein 1	158					cellular response to amino acid stimulus (GO:0071230)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|mRNA processing (GO:0006397)|negative regulation of cytoplasmic translation (GO:2000766)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|ribonucleoprotein complex (GO:0030529)	metal ion binding (GO:0046872)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|nucleotide binding (GO:0000166)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(1)|lung(9)|ovary(1)|skin(1)	28			BRCA - Breast invasive adenocarcinoma(143;0.229)			GGAAACTTGTCCACCAAGTCA	0.567																																						uc002bit.2		NA																	0				ovary(1)|breast(1)	2						c.(652-654)GAC>CAC		cytoplasmic polyadenylation element binding							76.0	78.0	77.0					15																	83226644		1939	4130	6069	SO:0001583	missense	64506				mRNA processing|regulation of translation	cell junction|cytoplasmic mRNA processing body|dendrite|postsynaptic density|postsynaptic membrane	nucleotide binding|RNA binding	g.chr15:83226644C>G	AF329402	CCDS42072.1, CCDS45329.1, CCDS45330.1, CCDS42072.2, CCDS45329.2, CCDS45330.2	15q25.1	2008-02-05				ENSG00000214575			21744	protein-coding gene	gene with protein product		607342				11223249	Standard	NM_001079533		Approved	FLJ13203, CPEB	uc002biv.3	Q9BZB8		ENST00000562019.1:c.472G>C	15.37:g.83226644C>G	ENSP00000457836:p.Asp158His		Somatic				CPEB1_uc002biq.2_Missense_Mutation_p.D83H|CPEB1_uc002bir.2_Missense_Mutation_p.D83H|CPEB1_uc002bis.2_Missense_Mutation_p.D83H|CPEB1_uc010uod.1_Intron|CPEB1_uc010uoe.1_Missense_Mutation_p.D161H|CPEB1_uc002biu.2_Missense_Mutation_p.D185H|CPEB1_uc010uof.1_Missense_Mutation_p.D83H|CPEB1_uc002biv.2_Missense_Mutation_p.D158H|CPEB1_uc002bip.2_5'Flank	p.D218H	NM_001079533	NP_001073001	WXS	Illumina HiSeq	Unspecified	Q9BZB8	CPEB1_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.229)		4	789	-			158					B7Z6C6|Q86W46|Q8IV41|Q9BZB7|Q9H8V5	Missense_Mutation	SNP	ENST00000562019.1	37	c.652G>C		.	.	.	.	.	.	.	.	.	.	C	23.8	4.454210	0.84209	.	.	ENSG00000214575	ENST00000450751;ENST00000398593;ENST00000423133;ENST00000398591;ENST00000261723	.	.	.	4.51	4.51	0.55191	.	0.267496	0.35805	U	0.002974	T	0.49098	0.1537	N	0.08118	0	0.80722	D	1	P;P;P;D	0.53885	0.911;0.514;0.937;0.963	P;B;P;P	0.55999	0.717;0.189;0.694;0.789	T	0.62263	-0.6891	9	0.87932	D	0	-12.6764	17.2242	0.86965	0.0:1.0:0.0:0.0	.	161;158;158;158	B7Z237;Q9BZB8-3;Q9BZB8;E7ET70	.;.;CPEB1_HUMAN;.	H	158;158;83;83;161	.	ENSP00000261723:D161H	D	-	1	0	CPEB1	81023699	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.810000	0.62598	2.076000	0.62316	0.411000	0.27672	GAC		0.567	CPEB1-006	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000421102.1	NM_030594		9	87	0	0	0	0	9	87				
ABHD2	11057	broad.mit.edu	37	15	89738457	89738457	+	Splice_Site	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr15:89738457G>C	ENST00000352732.5	+	11	1601		c.e11-1		ABHD2_ENST00000355100.3_Splice_Site|ABHD2_ENST00000565973.1_Splice_Site	NM_152924.4	NP_690888.1	P08910	ABHD2_HUMAN	abhydrolase domain containing 2						negative regulation of cell migration (GO:0030336)|response to wounding (GO:0009611)	integral component of membrane (GO:0016021)	carboxylic ester hydrolase activity (GO:0052689)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|soft_tissue(1)	23	Lung NSC(78;0.0472)|all_lung(78;0.089)					TTCCCCTGCAGAGAAACGAGA	0.582																																					Colon(11;252 417 24570 33239 41878)	uc002bnj.2		NA																	0				ovary(1)|lung(1)	2						c.e16-1		alpha/beta hydrolase domain containing protein							125.0	109.0	115.0					15																	89738457		2200	4299	6499	SO:0001630	splice_region_variant	11057					integral to membrane	carboxylesterase activity	g.chr15:89738457G>C	X12433	CCDS10348.1	15q26.1	2006-10-06			ENSG00000140526	ENSG00000140526		"""Abhydrolase domain containing"""	18717	protein-coding gene	gene with protein product		612196					Standard	NM_152924		Approved	LABH2	uc002bnk.2	P08910	OTTHUMG00000148684	ENST00000352732.5:c.1082-1G>C	15.37:g.89738457G>C			Somatic				ABHD2_uc002bnk.2_Splice_Site_p.E361_splice	p.E361_splice	NM_007011	NP_008942	WXS	Illumina HiSeq	Unspecified	P08910	ABHD2_HUMAN			16	1999	+	Lung NSC(78;0.0472)|all_lung(78;0.089)							Q53G48|Q53GU0|Q5FVD9|Q8TC79	Splice_Site	SNP	ENST00000352732.5	37	c.1082_splice	CCDS10348.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.658269	0.88154	.	.	ENSG00000140526	ENST00000352732;ENST00000355100	.	.	.	5.75	5.75	0.90469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9522	0.97203	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ABHD2	87539461	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.476000	0.97823	2.725000	0.93324	0.655000	0.94253	.		0.582	ABHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309074.2		Intron	19	81	0	0	0	0	19	81				
PLIN1	5346	broad.mit.edu	37	15	90210983	90210983	+	Silent	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr15:90210983C>T	ENST00000300055.5	-	7	978	c.813G>A	c.(811-813)gcG>gcA	p.A271A	PLIN1_ENST00000430628.2_Silent_p.A271A	NM_002666.4	NP_002657.3	O60240	PLIN1_HUMAN	perilipin 1	271			A -> V (in dbSNP:rs58361219).		lipid metabolic process (GO:0006629)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|lipid particle (GO:0005811)	lipid binding (GO:0008289)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|skin(2)	13						GCCGGGACACCGCCTGCATGG	0.677																																						uc010upx.1		NA																	0				central_nervous_system(1)|skin(1)	2						c.(811-813)GCG>GCA		perilipin 1							60.0	41.0	48.0					15																	90210983		2182	4275	6457	SO:0001819	synonymous_variant	5346				triglyceride catabolic process	lipid particle	lipid binding	g.chr15:90210983C>T	AB005293	CCDS10353.1	15q26	2009-08-12	2009-08-12	2009-08-12	ENSG00000166819	ENSG00000166819		"""Perilipins"""	9076	protein-coding gene	gene with protein product		170290	"""perilipin"""	PLIN		9521880, 19638644	Standard	NM_002666		Approved		uc010upx.1	O60240	OTTHUMG00000149813	ENST00000300055.5:c.813G>A	15.37:g.90210983C>T			Somatic				PLIN1_uc002boh.2_Silent_p.A271A	p.A271A	NM_001145311	NP_001138783	WXS	Illumina HiSeq	Unspecified	O60240	PLIN1_HUMAN			7	923	-			271					Q8N5Y6	Silent	SNP	ENST00000300055.5	37	c.813G>A	CCDS10353.1																																																																																				0.677	PLIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313424.2	NM_002666		3	6	0	0	0	0	3	6				
ITFG3	83986	broad.mit.edu	37	16	313748	313748	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr16:313748G>C	ENST00000399932.3	+	10	1613	c.1162G>C	c.(1162-1164)Gaa>Caa	p.E388Q	ITFG3_ENST00000442458.2_Missense_Mutation_p.E388Q|ITFG3_ENST00000600536.1_Missense_Mutation_p.E388Q|ITFG3_ENST00000301678.3_Missense_Mutation_p.E388Q|ITFG3_ENST00000450082.2_Missense_Mutation_p.E388Q|ITFG3_ENST00000301679.2_Missense_Mutation_p.E388Q	NM_001284497.1	NP_001271426.1	Q9H0X4	ITFG3_HUMAN	integrin alpha FG-GAP repeat containing 3	388						cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(3)|endometrium(2)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	16		all_cancers(16;0.000129)|all_epithelial(16;0.000206)|Hepatocellular(16;0.00264)|Lung NSC(18;0.0626)|all_lung(18;0.13)				TGTAGCCGTTGAAAACGGAAC	0.537																																						uc002cgf.2		NA																	0				central_nervous_system(1)	1						c.(1162-1164)GAA>CAA		integrin alpha FG-GAP repeat containing 3							74.0	81.0	79.0					16																	313748		1996	4167	6163	SO:0001583	missense	83986					integral to membrane		g.chr16:313748G>C	AL136542	CCDS10402.1	16p13.3	2006-03-31	2006-03-31	2006-03-31	ENSG00000167930	ENSG00000167930			14163	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 9"""	C16orf9			Standard	XM_005255622		Approved	DKFZP761D0211, FLJ32603	uc002cgf.3	Q9H0X4	OTTHUMG00000060728	ENST00000399932.3:c.1162G>C	16.37:g.313748G>C	ENSP00000382814:p.Glu388Gln		Somatic				ITFG3_uc002cgg.2_Missense_Mutation_p.E388Q|ITFG3_uc010uud.1_RNA|ITFG3_uc002cgh.2_Missense_Mutation_p.E388Q	p.E388Q	NM_032039	NP_114428	WXS	Illumina HiSeq	Unspecified	Q9H0X4	ITFG3_HUMAN			10	1357	+		all_cancers(16;0.000129)|all_epithelial(16;0.000206)|Hepatocellular(16;0.00264)|Lung NSC(18;0.0626)|all_lung(18;0.13)	388			Extracellular (Potential).		D3DU45|Q7L416|Q96FR1|Q96MC7|Q96S30	Missense_Mutation	SNP	ENST00000399932.3	37	c.1162G>C	CCDS10402.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.10|15.10	2.732995|2.732995	0.48939|0.48939	.|.	.|.	ENSG00000167930|ENSG00000167930	ENST00000399932;ENST00000301679;ENST00000442458;ENST00000301678;ENST00000450082|ENST00000424016	T;T;T;T;T|.	0.57752|.	0.38;0.38;0.38;0.38;0.38|.	5.29|5.29	4.33|4.33	0.51752|0.51752	Quinonprotein alcohol dehydrogenase-like (1);|.	0.047096|.	0.85682|.	N|.	0.000000|.	T|T	0.61664|0.61664	0.2365|0.2365	L|L	0.51853|0.51853	1.615|1.615	0.58432|0.58432	D|D	0.999991|0.999991	D;D|.	0.56035|.	0.974;0.974|.	P;P|.	0.49999|.	0.628;0.478|.	T|T	0.59134|0.59134	-0.7511|-0.7511	10|5	0.56958|.	D|.	0.05|.	-8.1335|-8.1335	13.4653|13.4653	0.61249|0.61249	0.0:0.1566:0.8434:0.0|0.0:0.1566:0.8434:0.0	.|.	388;388|.	Q9H0X4-2;Q9H0X4|.	.;ITFG3_HUMAN|.	Q|F	388|79	ENSP00000382814:E388Q;ENSP00000301679:E388Q;ENSP00000397477:E388Q;ENSP00000301678:E388Q;ENSP00000411394:E388Q|.	ENSP00000301678:E388Q|.	E|L	+|+	1|3	0|2	ITFG3|ITFG3	253749|253749	1.000000|1.000000	0.71417|0.71417	0.270000|0.270000	0.24601|0.24601	0.031000|0.031000	0.12232|0.12232	5.471000|5.471000	0.66762|0.66762	1.218000|1.218000	0.43458|0.43458	0.561000|0.561000	0.74099|0.74099	GAA|TTG		0.537	ITFG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134227.2	NM_032039		12	58	0	0	0	0	12	58				
IFT140	9742	broad.mit.edu	37	16	1621494	1621494	+	Silent	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr16:1621494C>T	ENST00000426508.2	-	14	1929	c.1566G>A	c.(1564-1566)ggG>ggA	p.G522G	IFT140_ENST00000439987.2_5'UTR	NM_014714.3	NP_055529.2	Q96RY7	IF140_HUMAN	intraflagellar transport 140	522			G -> E (in SRTD9). {ECO:0000269|PubMed:22503633, ECO:0000269|PubMed:23418020}.		cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)|protein localization to cilium (GO:0061512)|regulation of cilium assembly (GO:1902017)|renal system development (GO:0072001)|retina development in camera-type eye (GO:0060041)|skeletal system morphogenesis (GO:0048705)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)|photoreceptor connecting cilium (GO:0032391)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(12)|lung(10)|ovary(5)|pancreas(1)|prostate(4)|skin(4)|stomach(2)|urinary_tract(1)	53		Hepatocellular(780;0.219)				AGCAGGGATTCCCCTCAGTCT	0.413																																						uc002cmb.2		NA																	0				ovary(3)|pancreas(1)|skin(1)	5						c.(1564-1566)GGG>GGA		intraflagellar transport 140							71.0	67.0	68.0					16																	1621494		2199	4300	6499	SO:0001819	synonymous_variant	9742							g.chr16:1621494C>T	AB011162	CCDS10439.1	16p13.3	2014-07-03	2014-07-03	2005-11-02	ENSG00000187535	ENSG00000187535		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29077	protein-coding gene	gene with protein product		614620	"""WD and tetratricopeptide repeats 2"", ""intraflagellar transport 140 homolog (Chlamydomonas)"""	WDTC2		9628581	Standard	NM_014714		Approved	gs114, KIAA0590	uc002cmb.3	Q96RY7	OTTHUMG00000128585	ENST00000426508.2:c.1566G>A	16.37:g.1621494C>T			Somatic				IFT140_uc002clz.2_Silent_p.G173G	p.G522G	NM_014714	NP_055529	WXS	Illumina HiSeq	Unspecified	Q96RY7	IF140_HUMAN			14	1928	-		Hepatocellular(780;0.219)	522					A2A2A8|D3DU75|O60332|Q9UG52	Silent	SNP	ENST00000426508.2	37	c.1566G>A	CCDS10439.1																																																																																				0.413	IFT140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250438.2	NM_014714		3	43	0	0	0	0	3	43				
RNF151	146310	broad.mit.edu	37	16	2017315	2017315	+	Missense_Mutation	SNP	A	A	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr16:2017315A>G	ENST00000569714.1	+	2	52	c.44A>G	c.(43-45)gAc>gGc	p.D15G	SNHG9_ENST00000459373.1_lincRNA|RPS2_ENST00000343262.4_5'Flank|RNF151_ENST00000321392.3_Missense_Mutation_p.D14G|RPS2_ENST00000530225.1_5'Flank|RPS2_ENST00000529806.1_5'Flank|RPS2_ENST00000526522.1_5'Flank|RNF151_ENST00000569210.2_Missense_Mutation_p.D15G	NM_174903.4	NP_777563.2	Q2KHN1	RN151_HUMAN	ring finger protein 151	15					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			kidney(1)|lung(1)	2						AGCCCTCCTGACAGCAACTTC	0.582																																						uc002cnt.1		NA																	0					0						c.(43-45)GAC>GGC		ring finger protein 151							50.0	55.0	53.0					16																	2017315		2046	4196	6242	SO:0001583	missense	146310				cell differentiation|spermatogenesis	cytoplasm|nucleus	ubiquitin-protein ligase activity|zinc ion binding	g.chr16:2017315A>G	BC029501	CCDS58405.1	16p13.3	2013-01-09			ENSG00000179580	ENSG00000179580		"""RING-type (C3HC4) zinc fingers"""	23235	protein-coding gene	gene with protein product						12477932	Standard	NM_174903		Approved		uc002cnt.1	Q2KHN1	OTTHUMG00000176852	ENST00000569714.1:c.44A>G	16.37:g.2017315A>G	ENSP00000456566:p.Asp15Gly		Somatic				RPS2_uc010bsa.1_5'Flank|RPS2_uc002cnl.2_5'Flank|RPS2_uc002cnm.2_5'Flank|RPS2_uc002cnn.2_5'Flank|RPS2_uc002cno.2_5'Flank	p.D15G	NM_174903	NP_777563	WXS	Illumina HiSeq	Unspecified	Q2KHN1	RN151_HUMAN			2	52	+			15					Q8NHS5	Missense_Mutation	SNP	ENST00000569714.1	37	c.44A>G	CCDS58405.1	.	.	.	.	.	.	.	.	.	.	a	13.39	2.223556	0.39300	.	.	ENSG00000179580	ENST00000321392	D	0.87650	-2.28	4.26	3.16	0.36331	Zinc finger, RING/FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.77798	0.4184	L	0.27053	0.805	0.51233	D	0.999912	B	0.14012	0.009	B	0.16289	0.015	T	0.70781	-0.4779	10	0.62326	D	0.03	-31.1349	8.1906	0.31366	0.9003:0.0:0.0997:0.0	.	15	Q2KHN1	RN151_HUMAN	G	14	ENSP00000325794:D14G	ENSP00000325794:D14G	D	+	2	0	RNF151	1957316	1.000000	0.71417	0.994000	0.49952	0.849000	0.48306	5.203000	0.65174	0.609000	0.30018	-0.411000	0.06167	GAC		0.582	RNF151-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434030.1	NM_174903		8	50	0	0	0	0	8	50				
ITPRIPL2	162073	broad.mit.edu	37	16	19126188	19126188	+	Silent	SNP	C	C	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr16:19126188C>A	ENST00000381440.3	+	1	935	c.405C>A	c.(403-405)cgC>cgA	p.R135R	CTD-2349B8.1_ENST00000564808.2_3'UTR	NM_001034841.3	NP_001030013.1	Q3MIP1	IPIL2_HUMAN	inositol 1,4,5-trisphosphate receptor interacting protein-like 2	135						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						GGGCTGGCCGCGCCCGGGGGT	0.667																																						uc002dfu.3		NA																	0				skin(2)	2						c.(403-405)CGC>CGA		inositol 1,4,5-triphosphate receptor interacting							7.0	7.0	7.0					16																	19126188		2145	4166	6311	SO:0001819	synonymous_variant	162073					integral to membrane		g.chr16:19126188C>A		CCDS32395.1	16p12.3	2011-04-28	2011-04-28		ENSG00000205730	ENSG00000205730			27257	protein-coding gene	gene with protein product			"""inositol 1,4,5-triphosphate receptor interacting protein-like 2"""				Standard	NM_001034841		Approved	FLJ22994, MGC126798, MGC126800, LOC162073	uc002dfu.4	Q3MIP1		ENST00000381440.3:c.405C>A	16.37:g.19126188C>A			Somatic				ITPRIPL2_uc002dft.2_5'UTR	p.R135R	NM_001034841	NP_001030013	WXS	Illumina HiSeq	Unspecified	Q3MIP1	IPIL2_HUMAN			1	935	+			135			Cytoplasmic (Potential).			Silent	SNP	ENST00000381440.3	37	c.405C>A	CCDS32395.1																																																																																				0.667	ITPRIPL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435827.3	NM_001034841		3	6	1	0	6.4e-05	6.84e-05	3	6				
ANKS4B	257629	broad.mit.edu	37	16	21261527	21261527	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr16:21261527G>C	ENST00000311620.5	+	2	713	c.640G>C	c.(640-642)Gat>Cat	p.D214H		NM_145865.2	NP_665872.2	Q8N8V4	ANS4B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 4B	214					response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|lung(11)|ovary(2)	20				GBM - Glioblastoma multiforme(48;0.0565)		GAAGAACAAAGATACAGCAGA	0.478																																						uc010bwp.1		NA																	0				ovary(2)	2						c.(640-642)GAT>CAT		harmonin-interacting ankyrin-repeat containing							97.0	105.0	102.0					16																	21261527		1998	4171	6169	SO:0001583	missense	257629							g.chr16:21261527G>C	AK096138	CCDS42130.1	16p12.2	2013-01-10				ENSG00000175311		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	26795	protein-coding gene	gene with protein product		609901					Standard	NM_145865		Approved	FLJ38819, HARP	uc010bwp.1	Q8N8V4		ENST00000311620.5:c.640G>C	16.37:g.21261527G>C	ENSP00000308772:p.Asp214His		Somatic				CRYM_uc010bwq.1_Intron	p.D214H	NM_145865	NP_665872	WXS	Illumina HiSeq	Unspecified	Q8N8V4	ANS4B_HUMAN		GBM - Glioblastoma multiforme(48;0.0565)	2	683	+			214						Missense_Mutation	SNP	ENST00000311620.5	37	c.640G>C	CCDS42130.1	.	.	.	.	.	.	.	.	.	.	G	10.17	1.275410	0.23307	.	.	ENSG00000175311	ENST00000311620	T	0.47869	0.83	5.77	1.67	0.24075	.	0.284905	0.37095	N	0.002260	T	0.42404	0.1201	M	0.66939	2.045	0.80722	D	1	P	0.49961	0.93	B	0.42214	0.38	T	0.40572	-0.9556	10	0.59425	D	0.04	-15.4792	7.1332	0.25512	0.4515:0.0:0.5485:0.0	.	214	Q8N8V4	ANS4B_HUMAN	H	214	ENSP00000308772:D214H	ENSP00000308772:D214H	D	+	1	0	ANKS4B	21169028	1.000000	0.71417	1.000000	0.80357	0.031000	0.12232	4.545000	0.60698	0.806000	0.34183	-0.189000	0.12847	GAT		0.478	ANKS4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436535.1	NM_145865		8	72	0	0	0	0	8	72				
ANKS4B	257629	broad.mit.edu	37	16	21261721	21261721	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr16:21261721G>T	ENST00000311620.5	+	2	907	c.834G>T	c.(832-834)agG>agT	p.R278S		NM_145865.2	NP_665872.2	Q8N8V4	ANS4B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 4B	278					response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|lung(11)|ovary(2)	20				GBM - Glioblastoma multiforme(48;0.0565)		TTTTTAGAAGGAACAGGATAT	0.453																																						uc010bwp.1		NA																	0				ovary(2)	2						c.(832-834)AGG>AGT		harmonin-interacting ankyrin-repeat containing							85.0	89.0	87.0					16																	21261721		1991	4189	6180	SO:0001583	missense	257629							g.chr16:21261721G>T	AK096138	CCDS42130.1	16p12.2	2013-01-10				ENSG00000175311		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	26795	protein-coding gene	gene with protein product		609901					Standard	NM_145865		Approved	FLJ38819, HARP	uc010bwp.1	Q8N8V4		ENST00000311620.5:c.834G>T	16.37:g.21261721G>T	ENSP00000308772:p.Arg278Ser		Somatic				CRYM_uc010bwq.1_Intron	p.R278S	NM_145865	NP_665872	WXS	Illumina HiSeq	Unspecified	Q8N8V4	ANS4B_HUMAN		GBM - Glioblastoma multiforme(48;0.0565)	2	877	+			278						Missense_Mutation	SNP	ENST00000311620.5	37	c.834G>T	CCDS42130.1	.	.	.	.	.	.	.	.	.	.	G	6.967	0.548357	0.13312	.	.	ENSG00000175311	ENST00000311620	T	0.60171	0.21	5.77	0.0865	0.14446	.	0.355970	0.30185	N	0.010202	T	0.43389	0.1245	L	0.45051	1.395	0.45502	D	0.998465	B	0.24258	0.1	B	0.24541	0.054	T	0.26467	-1.0102	10	0.62326	D	0.03	-1.2873	6.0424	0.19742	0.4523:0.1325:0.4151:0.0	.	278	Q8N8V4	ANS4B_HUMAN	S	278	ENSP00000308772:R278S	ENSP00000308772:R278S	R	+	3	2	ANKS4B	21169222	0.999000	0.42202	0.003000	0.11579	0.107000	0.19398	0.587000	0.23909	0.133000	0.18654	0.591000	0.81541	AGG		0.453	ANKS4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436535.1	NM_145865		8	81	1	0	1.26e-09	1.38e-09	8	81				
ANKS4B	257629	broad.mit.edu	37	16	21261982	21261982	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr16:21261982G>T	ENST00000311620.5	+	2	1168	c.1095G>T	c.(1093-1095)aaG>aaT	p.K365N		NM_145865.2	NP_665872.2	Q8N8V4	ANS4B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 4B	365	SAM.				response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|lung(11)|ovary(2)	20				GBM - Glioblastoma multiforme(48;0.0565)		CTATCTTCAAGAGAGAGCAGA	0.502																																						uc010bwp.1		NA																	0				ovary(2)	2						c.(1093-1095)AAG>AAT		harmonin-interacting ankyrin-repeat containing							90.0	95.0	93.0					16																	21261982		2001	4183	6184	SO:0001583	missense	257629							g.chr16:21261982G>T	AK096138	CCDS42130.1	16p12.2	2013-01-10				ENSG00000175311		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	26795	protein-coding gene	gene with protein product		609901					Standard	NM_145865		Approved	FLJ38819, HARP	uc010bwp.1	Q8N8V4		ENST00000311620.5:c.1095G>T	16.37:g.21261982G>T	ENSP00000308772:p.Lys365Asn		Somatic				CRYM_uc010bwq.1_Intron	p.K365N	NM_145865	NP_665872	WXS	Illumina HiSeq	Unspecified	Q8N8V4	ANS4B_HUMAN		GBM - Glioblastoma multiforme(48;0.0565)	2	1138	+			365			SAM.			Missense_Mutation	SNP	ENST00000311620.5	37	c.1095G>T	CCDS42130.1	.	.	.	.	.	.	.	.	.	.	G	2.480	-0.319864	0.05386	.	.	ENSG00000175311	ENST00000311620	T	0.50277	0.75	5.81	3.87	0.44632	Sterile alpha motif domain (1);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.498586	0.24587	N	0.037259	T	0.40171	0.1106	L	0.52905	1.665	0.43494	D	0.995735	B	0.17667	0.023	B	0.24541	0.054	T	0.17561	-1.0365	10	0.28530	T	0.3	-0.6305	7.1697	0.25712	0.1485:0.1404:0.7111:0.0	.	365	Q8N8V4	ANS4B_HUMAN	N	365	ENSP00000308772:K365N	ENSP00000308772:K365N	K	+	3	2	ANKS4B	21169483	0.958000	0.32768	0.528000	0.27938	0.001000	0.01503	1.076000	0.30729	0.820000	0.34516	0.650000	0.86243	AAG		0.502	ANKS4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436535.1	NM_145865		9	69	1	0	0.000274275	0.000289168	9	69				
ANKS4B	257629	broad.mit.edu	37	16	21261991	21261991	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr16:21261991G>T	ENST00000311620.5	+	2	1177	c.1104G>T	c.(1102-1104)caG>caT	p.Q368H		NM_145865.2	NP_665872.2	Q8N8V4	ANS4B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 4B	368	SAM.				response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|lung(11)|ovary(2)	20				GBM - Glioblastoma multiforme(48;0.0565)		AGAGAGAGCAGATTGATCTAG	0.502																																						uc010bwp.1		NA																	0				ovary(2)	2						c.(1102-1104)CAG>CAT		harmonin-interacting ankyrin-repeat containing							88.0	93.0	91.0					16																	21261991		1999	4180	6179	SO:0001583	missense	257629							g.chr16:21261991G>T	AK096138	CCDS42130.1	16p12.2	2013-01-10				ENSG00000175311		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	26795	protein-coding gene	gene with protein product		609901					Standard	NM_145865		Approved	FLJ38819, HARP	uc010bwp.1	Q8N8V4		ENST00000311620.5:c.1104G>T	16.37:g.21261991G>T	ENSP00000308772:p.Gln368His		Somatic				CRYM_uc010bwq.1_Intron	p.Q368H	NM_145865	NP_665872	WXS	Illumina HiSeq	Unspecified	Q8N8V4	ANS4B_HUMAN		GBM - Glioblastoma multiforme(48;0.0565)	2	1147	+			368			SAM.			Missense_Mutation	SNP	ENST00000311620.5	37	c.1104G>T	CCDS42130.1	.	.	.	.	.	.	.	.	.	.	G	10.29	1.310739	0.23821	.	.	ENSG00000175311	ENST00000311620	T	0.50277	0.75	5.81	4.67	0.58626	Sterile alpha motif domain (1);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.178508	0.49305	D	0.000160	T	0.38983	0.1061	L	0.45228	1.405	0.80722	D	1	B	0.13145	0.007	B	0.10450	0.005	T	0.17961	-1.0352	10	0.38643	T	0.18	-11.5236	11.2958	0.49277	0.1268:0.0:0.8732:0.0	.	368	Q8N8V4	ANS4B_HUMAN	H	368	ENSP00000308772:Q368H	ENSP00000308772:Q368H	Q	+	3	2	ANKS4B	21169492	1.000000	0.71417	1.000000	0.80357	0.069000	0.16628	0.826000	0.27407	2.757000	0.94681	0.650000	0.86243	CAG		0.502	ANKS4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436535.1	NM_145865		11	78	1	0	0.000673444	0.000705753	11	78				
METTL9	51108	broad.mit.edu	37	16	21624068	21624068	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr16:21624068G>A	ENST00000358154.3	+	2	526	c.268G>A	c.(268-270)Gag>Aag	p.E90K	METTL9_ENST00000396014.4_Missense_Mutation_p.E90K	NM_001077180.1|NM_016025.3	NP_001070648.1|NP_057109.3	Q9H1A3	METL9_HUMAN	methyltransferase like 9	90										endometrium(1)|kidney(3)|large_intestine(1)|lung(1)|ovary(1)	7				GBM - Glioblastoma multiforme(48;0.0759)		CAACAGCATTGAGAAATCGGG	0.373																																						uc002dje.2		NA																	0				ovary(1)	1						c.(268-270)GAG>AAG		methyltransferase like 9 isoform 1							206.0	184.0	191.0					16																	21624068		2199	4300	6499	SO:0001583	missense	51108							g.chr16:21624068G>A	NM_016025, AF151839	CCDS10598.2, CCDS45440.1	16p12.2	2008-11-06			ENSG00000197006	ENSG00000197006			24586	protein-coding gene	gene with protein product	"""DORA reverse strand protein 1"""	609388				10810093, 11132146	Standard	NM_001077180		Approved	DREV1	uc002dje.3	Q9H1A3	OTTHUMG00000131584	ENST00000358154.3:c.268G>A	16.37:g.21624068G>A	ENSP00000350874:p.Glu90Lys		Somatic				uc002diq.3_Intron|METTL9_uc002djf.2_Missense_Mutation_p.E90K	p.E90K	NM_016025	NP_057109	WXS	Illumina HiSeq	Unspecified	Q9H1A3	METL9_HUMAN		GBM - Glioblastoma multiforme(48;0.0759)	2	467	+			90					Q8NBT8|Q9BWJ7|Q9H1A2|Q9Y390	Missense_Mutation	SNP	ENST00000358154.3	37	c.268G>A	CCDS10598.2	.	.	.	.	.	.	.	.	.	.	G	22.8	4.330919	0.81690	.	.	ENSG00000197006	ENST00000358154;ENST00000396014;ENST00000540294	.	.	.	6.02	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.66416	0.2787	L	0.51853	1.615	0.54753	D	0.999981	B;D	0.56287	0.008;0.975	B;P	0.59761	0.009;0.863	T	0.67577	-0.5635	9	0.51188	T	0.08	-14.7917	12.8463	0.57831	0.0781:0.0:0.9219:0.0	.	90;90	Q9H1A3-2;Q9H1A3	.;METL9_HUMAN	K	90;90;54	.	ENSP00000350874:E90K	E	+	1	0	METTL9	21531569	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.445000	0.97587	1.562000	0.49601	0.655000	0.94253	GAG		0.373	METTL9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254465.1	NM_016025		6	73	0	0	0	0	6	73				
BCL7C	9274	broad.mit.edu	37	16	30904177	30904177	+	Silent	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr16:30904177G>A	ENST00000215115.4	-	3	1279	c.264C>T	c.(262-264)atC>atT	p.I88I	AC106782.20_ENST00000572471.1_RNA|MIR4519_ENST00000564901.1_RNA|BCL7C_ENST00000380317.4_Silent_p.I88I|MIR4519_ENST00000565573.1_RNA|MIR4519_ENST00000570025.1_RNA|MIR762_ENST00000390236.1_RNA	NM_004765.2	NP_004756.2	Q8WUZ0	BCL7C_HUMAN	B-cell CLL/lymphoma 7C	88					apoptotic process (GO:0006915)					large_intestine(1)|lung(3)|prostate(1)|skin(1)	6			Colorectal(24;0.198)			GATCCAGCAGGATGAGAGGGC	0.662																																						uc002dzv.2		NA																	0					0						c.(262-264)ATC>ATT		B-cell CLL/lymphoma 7C							69.0	83.0	78.0					16																	30904177		2197	4298	6495	SO:0001819	synonymous_variant	9274				apoptosis			g.chr16:30904177G>A	AJ223980	CCDS10693.1, CCDS67012.1	16p11	2012-11-19			ENSG00000099385	ENSG00000099385			1006	protein-coding gene	gene with protein product		605847				9931421	Standard	NM_004765		Approved		uc002dzv.3	Q8WUZ0	OTTHUMG00000177719	ENST00000215115.4:c.264C>T	16.37:g.30904177G>A			Somatic				BCL7C_uc002dzt.1_Silent_p.I88I|uc002dzu.2_Intron|MIR762_hsa-mir-762|MI0003892_5'Flank	p.I88I	NM_004765	NP_004756	WXS	Illumina HiSeq	Unspecified	Q8WUZ0	BCL7C_HUMAN	Colorectal(24;0.198)		3	398	-			88					O43770|Q6PD89	Silent	SNP	ENST00000215115.4	37	c.264C>T	CCDS10693.1																																																																																				0.662	BCL7C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255547.3	NM_004765		18	105	0	0	0	0	18	105				
PRSS53	339105	broad.mit.edu	37	16	31095655	31095655	+	Splice_Site	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr16:31095655C>T	ENST00000280606.6	-	10	1580	c.1427G>A	c.(1426-1428)gGc>gAc	p.G476D		NM_001039503.2	NP_001034592.1	Q2L4Q9	PRS53_HUMAN	protease, serine, 53	476	Peptidase S1 2. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			large_intestine(1)|lung(3)	4						CCCAGACAGGCCCTGTCAGGG	0.632																																						uc002eaq.2		NA																	0					0						c.(1426-1428)GGC>GAC		polyserase 3 precursor							16.0	19.0	18.0					16																	31095655		1952	4141	6093	SO:0001630	splice_region_variant	339105				proteolysis	extracellular region	serine-type endopeptidase activity	g.chr16:31095655C>T		CCDS42153.1	16p11.2	2010-05-07			ENSG00000151006	ENSG00000151006		"""Serine peptidases / Serine peptidases"""	34407	protein-coding gene	gene with protein product	"""polyserase 3"""	610561				16566820	Standard	NM_001039503		Approved	POL3S	uc002eaq.3	Q2L4Q9	OTTHUMG00000047358	ENST00000280606.6:c.1426-1G>A	16.37:g.31095655C>T			Somatic				PRSS53_uc002ear.2_Missense_Mutation_p.G270D	p.G476D	NM_001039503	NP_001034592	WXS	Illumina HiSeq	Unspecified	Q2L4Q9	PRS53_HUMAN			10	1427	-			476			Peptidase S1 2.			Missense_Mutation	SNP	ENST00000280606.6	37	c.1427G>A	CCDS42153.1	.	.	.	.	.	.	.	.	.	.	C	18.86	3.713194	0.68730	.	.	ENSG00000151006	ENST00000280606	D	0.98028	-4.67	5.46	3.36	0.38483	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.229124	0.21899	U	0.067474	D	0.98372	0.9459	M	0.91872	3.25	0.35455	D	0.796033	D	0.53151	0.958	P	0.56612	0.802	D	0.99958	1.1665	10	0.87932	D	0	.	10.0877	0.42428	0.1536:0.6977:0.1486:0.0	.	476	Q2L4Q9	PRS53_HUMAN	D	476	ENSP00000280606:G476D	ENSP00000280606:G476D	G	-	2	0	PRSS53	31003156	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	1.790000	0.38734	1.286000	0.44565	0.491000	0.48974	GGC		0.632	PRSS53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000108580.4	NM_001081268	Missense_Mutation	3	32	0	0	0	0	3	32				
CCDC102A	92922	broad.mit.edu	37	16	57555060	57555060	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr16:57555060C>T	ENST00000258214.2	-	4	1087	c.841G>A	c.(841-843)Gag>Aag	p.E281K		NM_033212.3	NP_149989.2	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A	281										endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8						TCTAGCTTCTCAATGTTCCTG	0.572																																						uc002elw.2		NA																	0				ovary(1)	1						c.(841-843)GAG>AAG		coiled-coil domain containing 102A							159.0	133.0	142.0					16																	57555060		2198	4300	6498	SO:0001583	missense	92922							g.chr16:57555060C>T	BC008285	CCDS10784.1	16q13	2008-02-05			ENSG00000135736	ENSG00000135736			28097	protein-coding gene	gene with protein product						12477932	Standard	NM_033212		Approved	MGC10992	uc002elw.3	Q96A19	OTTHUMG00000133472	ENST00000258214.2:c.841G>A	16.37:g.57555060C>T	ENSP00000258214:p.Glu281Lys		Somatic					p.E281K	NM_033212	NP_149989	WXS	Illumina HiSeq	Unspecified	Q96A19	C102A_HUMAN			4	1054	-			281			Potential.		Q9BT74	Missense_Mutation	SNP	ENST00000258214.2	37	c.841G>A	CCDS10784.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.312757	0.81358	.	.	ENSG00000135736	ENST00000258214	T	0.56941	0.43	4.73	4.73	0.59995	.	0.056686	0.64402	D	0.000001	T	0.57286	0.2043	M	0.78456	2.415	0.80722	D	1	D	0.55605	0.972	P	0.44561	0.453	T	0.60409	-0.7269	10	0.22706	T	0.39	-33.0964	17.1005	0.86648	0.0:1.0:0.0:0.0	.	281	Q96A19	C102A_HUMAN	K	281	ENSP00000258214:E281K	ENSP00000258214:E281K	E	-	1	0	CCDC102A	56112561	1.000000	0.71417	0.999000	0.59377	0.615000	0.37417	5.375000	0.66173	2.347000	0.79759	0.455000	0.32223	GAG		0.572	CCDC102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257348.1	NM_033212		8	73	0	0	0	0	8	73				
DRC7	84229	broad.mit.edu	37	16	57741450	57741450	+	Missense_Mutation	SNP	G	G	A	rs116219187	byFrequency	TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr16:57741450G>A	ENST00000360716.3	+	8	1158	c.937G>A	c.(937-939)Gag>Aag	p.E313K	CCDC135_ENST00000336825.8_Missense_Mutation_p.E248K|CCDC135_ENST00000394337.4_Missense_Mutation_p.E313K			Q8IY82	CC135_HUMAN		313					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)				breast(1)|central_nervous_system(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30						GGGGAAGCGCGAGGTGCCTGA	0.587													g|||	3	0.000599042	0.0	0.0	5008	,	,		20324	0.002		0.0	False		,,,				2504	0.001					uc002emi.2		NA																	0				central_nervous_system(1)	1						c.(937-939)GAG>AAG		coiled-coil domain containing 135							78.0	71.0	73.0					16																	57741450		2198	4300	6498	SO:0001583	missense	84229					cytoplasm		g.chr16:57741450G>A																												ENST00000360716.3:c.937G>A	16.37:g.57741450G>A	ENSP00000353942:p.Glu313Lys		Somatic				CCDC135_uc002emj.2_Missense_Mutation_p.E313K|CCDC135_uc002emk.2_Missense_Mutation_p.E248K	p.E313K	NM_032269	NP_115645	WXS	Illumina HiSeq	Unspecified	Q8IY82	CC135_HUMAN			7	1026	+			313					A8K943|Q8NAA0|Q9H080	Missense_Mutation	SNP	ENST00000360716.3	37	c.937G>A	CCDS10787.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	.	24.6	4.546153	0.86022	.	.	ENSG00000159625	ENST00000394337;ENST00000336825;ENST00000360716	T;T;T	0.77358	2.03;-1.09;2.03	5.03	5.03	0.67393	.	0.281734	0.39020	N	0.001488	D	0.87997	0.6319	M	0.84683	2.71	0.46609	D	0.99912	D;D	0.89917	1.0;1.0	D;P	0.85130	0.997;0.901	D	0.87922	0.2704	10	0.40728	T	0.16	-38.674	12.7884	0.57520	0.0819:0.0:0.9181:0.0	.	248;313	Q8IY82-2;Q8IY82	.;CC135_HUMAN	K	313;248;313	ENSP00000377869:E313K;ENSP00000338938:E248K;ENSP00000353942:E313K	ENSP00000338938:E248K	E	+	1	0	CCDC135	56298951	1.000000	0.71417	0.936000	0.37596	0.873000	0.50193	6.008000	0.70739	2.332000	0.79248	0.637000	0.83480	GAG		0.587	CCDC135-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433323.2			4	35	0	0	0	0	4	35				
KCTD19	146212	broad.mit.edu	37	16	67328549	67328549	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr16:67328549G>C	ENST00000304372.5	-	11	1579	c.1524C>G	c.(1522-1524)atC>atG	p.I508M		NM_001100915.1	NP_001094385.1	Q17RG1	KCD19_HUMAN	potassium channel tetramerization domain containing 19	508					protein homooligomerization (GO:0051260)					endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)	23		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0311)|Epithelial(162;0.0906)		GCAGCCTCCTGATGGAAAAAG	0.488																																						uc002esu.2		NA																	0				skin(1)	1						c.(1522-1524)ATC>ATG		potassium channel tetramerisation domain							111.0	115.0	114.0					16																	67328549		2003	4181	6184	SO:0001583	missense	146212					voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr16:67328549G>C	AK097481	CCDS42179.1	16q22.1	2013-06-20	2013-06-20			ENSG00000168676			24753	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 19"""				Standard	NM_001100915		Approved	FLJ40162	uc002esu.2	Q17RG1		ENST00000304372.5:c.1524C>G	16.37:g.67328549G>C	ENSP00000305702:p.Ile508Met		Somatic				KCTD19_uc002est.2_Missense_Mutation_p.I280M|KCTD19_uc010vjj.1_Missense_Mutation_p.I251M	p.I508M	NM_001100915	NP_001094385	WXS	Illumina HiSeq	Unspecified	Q17RG1	KCD19_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0311)|Epithelial(162;0.0906)	11	1575	-		Ovarian(137;0.192)	508					B4DZ49|Q8N804	Missense_Mutation	SNP	ENST00000304372.5	37	c.1524C>G	CCDS42179.1	.	.	.	.	.	.	.	.	.	.	G	17.59	3.427739	0.62733	.	.	ENSG00000168676	ENST00000304372	T	0.59638	0.25	5.09	4.13	0.48395	.	0.194550	0.36519	N	0.002544	T	0.52741	0.1753	N	0.24115	0.695	0.30157	N	0.802559	D	0.61697	0.99	P	0.56700	0.804	T	0.52215	-0.8605	10	0.37606	T	0.19	-18.9503	8.4532	0.32884	0.1059:0.0:0.8941:0.0	.	508	Q17RG1	KCD19_HUMAN	M	508	ENSP00000305702:I508M	ENSP00000305702:I508M	I	-	3	3	KCTD19	65886050	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.286000	0.43496	1.365000	0.46057	0.650000	0.86243	ATC		0.488	KCTD19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422061.1	XM_085367		3	128	0	0	0	0	3	128				
SLC12A4	6560	broad.mit.edu	37	16	67985892	67985892	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr16:67985892G>C	ENST00000316341.3	-	8	1106	c.966C>G	c.(964-966)atC>atG	p.I322M	SLC12A4_ENST00000541864.2_Missense_Mutation_p.I291M|SLC12A4_ENST00000576616.1_Missense_Mutation_p.I322M|SLC12A4_ENST00000537830.2_Missense_Mutation_p.I316M|SLC12A4_ENST00000572010.1_5'Flank|SLC12A4_ENST00000338335.3_Missense_Mutation_p.I322M|SLC12A4_ENST00000572037.1_Missense_Mutation_p.I274M|SLC12A4_ENST00000422611.2_Missense_Mutation_p.I324M	NM_001145961.1|NM_005072.4	NP_001139433.1|NP_005063.1	Q9UP95	S12A4_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 4	322					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|prostate(4)|skin(2)|urinary_tract(3)	29		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	TCTTGGCACAGATGTCAAACT	0.587																																						uc002euz.2		NA																	0				ovary(1)	1						c.(964-966)ATC>ATG		solute carrier family 12, member 4 isoform a	Bumetanide(DB00887)|Potassium Chloride(DB00761)						104.0	73.0	83.0					16																	67985892		2198	4300	6498	SO:0001583	missense	6560				cell volume homeostasis|potassium ion transport|sodium ion transport	integral to plasma membrane|membrane fraction	potassium:chloride symporter activity	g.chr16:67985892G>C		CCDS10855.1, CCDS54030.1, CCDS54031.1, CCDS54032.1	16q22.1	2013-07-18	2013-07-18		ENSG00000124067	ENSG00000124067		"""Solute carriers"""	10913	protein-coding gene	gene with protein product		604119				8663127	Standard	NM_005072		Approved	KCC1	uc010ceu.2	Q9UP95	OTTHUMG00000137535	ENST00000316341.3:c.966C>G	16.37:g.67985892G>C	ENSP00000318557:p.Ile322Met		Somatic				SLC12A4_uc010ceu.2_Missense_Mutation_p.I316M|SLC12A4_uc010vkh.1_Missense_Mutation_p.I291M|SLC12A4_uc010vki.1_Missense_Mutation_p.I322M|SLC12A4_uc010vkj.1_Missense_Mutation_p.I324M|SLC12A4_uc002eva.2_Missense_Mutation_p.I322M|SLC12A4_uc002evb.2_RNA	p.I322M	NM_005072	NP_005063	WXS	Illumina HiSeq	Unspecified	Q9UP95	S12A4_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	8	1107	-		Ovarian(137;0.192)	322					B4DF69|B4DR04|B4DZ82|B7ZAV0|F5H066|F5H0S9|F5H3C0|O60632|O75893|Q13953|Q96LD5	Missense_Mutation	SNP	ENST00000316341.3	37	c.966C>G	CCDS10855.1	.	.	.	.	.	.	.	.	.	.	G	9.140	1.013591	0.19277	.	.	ENSG00000124067	ENST00000422611;ENST00000541864;ENST00000537830;ENST00000338335;ENST00000316341	T;T;T;T;T	0.62788	-0.0;-0.0;-0.0;-0.0;-0.0	5.0	4.05	0.47172	.	0.496370	0.23300	N	0.049693	T	0.57607	0.2065	L	0.46157	1.445	0.31068	N	0.713332	B;B;B;B;B;B	0.33135	0.399;0.129;0.358;0.066;0.204;0.129	B;B;B;B;B;B	0.43575	0.424;0.125;0.309;0.163;0.246;0.125	T	0.58607	-0.7607	10	0.26408	T	0.33	.	6.4615	0.21958	0.3212:0.0:0.6788:0.0	.	324;322;291;316;322;322	F5H3C0;B4DF30;F5H066;F5H0S9;Q9UP95-2;Q9UP95	.;.;.;.;.;S12A4_HUMAN	M	324;291;316;322;322	ENSP00000395983:I324M;ENSP00000438334:I291M;ENSP00000445962:I316M;ENSP00000343374:I322M;ENSP00000318557:I322M	ENSP00000318557:I322M	I	-	3	3	SLC12A4	66543393	0.100000	0.21855	0.983000	0.44433	0.642000	0.38348	-0.386000	0.07370	1.258000	0.44101	0.467000	0.42956	ATC		0.587	SLC12A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268864.4	NM_005072		4	28	0	0	0	0	4	28				
IST1	9798	broad.mit.edu	37	16	71961649	71961649	+	Nonsense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr16:71961649C>G	ENST00000378799.6	+	10	1390	c.1034C>G	c.(1033-1035)tCa>tGa	p.S345*	IST1_ENST00000535424.1_Nonsense_Mutation_p.S358*|RP11-498D10.6_ENST00000573861.1_RNA|PKD1L3_ENST00000534738.1_RNA|IST1_ENST00000538850.1_Nonsense_Mutation_p.S197*|IST1_ENST00000541571.2_Nonsense_Mutation_p.S345*|IST1_ENST00000378798.5_Nonsense_Mutation_p.S314*|IST1_ENST00000606369.1_Nonsense_Mutation_p.S197*|RP11-498D10.5_ENST00000567146.1_RNA|IST1_ENST00000544564.1_Nonsense_Mutation_p.S345*|IST1_ENST00000329908.8_Missense_Mutation_p.Q344E|IST1_ENST00000538565.1_3'UTR			P53990	IST1_HUMAN	increased sodium tolerance 1 homolog (yeast)	343	Interaction with VTA1.				abscission (GO:0009838)|cell division (GO:0051301)|cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of proteolysis (GO:0045862)|protein localization (GO:0008104)|viral capsid secondary envelopment (GO:0046745)|viral release from host cell (GO:0019076)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Flemming body (GO:0090543)|midbody (GO:0030496)	MIT domain binding (GO:0090541)|protein complex binding (GO:0032403)|protein domain specific binding (GO:0019904)										GCCAGCACCTCAGCATCTGAA	0.463																																						uc002fbj.1		NA																	0				ovary(1)	1						c.(1072-1074)TCA>TGA		SubName: Full=cDNA FLJ32696 fis, clone TESTI2000358; SubName: Full=cDNA FLJ77725;							200.0	205.0	203.0					16																	71961649		2198	4300	6498	SO:0001587	stop_gained	9798				cell cycle|cell division	cytoplasmic membrane-bounded vesicle|ER-Golgi intermediate compartment	protein binding	g.chr16:71961649C>G	BC004359	CCDS10905.1, CCDS59271.1, CCDS59272.1, CCDS59273.1, CCDS59274.1	16q22.2	2011-08-18	2011-08-18	2011-08-18	ENSG00000182149	ENSG00000182149			28977	protein-coding gene	gene with protein product			"""KIAA0174"""	KIAA0174		8724849, 19129480	Standard	NM_001270975		Approved		uc002fbm.2	P53990	OTTHUMG00000137597	ENST00000378799.6:c.1034C>G	16.37:g.71961649C>G	ENSP00000368076:p.Ser345*		Somatic				KIAA0174_uc010cgh.1_Nonsense_Mutation_p.S358*|KIAA0174_uc002fbk.1_Missense_Mutation_p.Q344E|KIAA0174_uc002fbm.1_Nonsense_Mutation_p.S345*|KIAA0174_uc002fbl.1_Nonsense_Mutation_p.S314*|KIAA0174_uc002fbn.1_Nonsense_Mutation_p.S197*|KIAA0174_uc010cgi.1_Nonsense_Mutation_p.S116*|KIAA0174_uc010cgj.1_Nonsense_Mutation_p.S262*|KIAA0174_uc010vml.1_RNA	p.S358*			WXS	Illumina HiSeq	Unspecified	P53990	IST1_HUMAN			12	1356	+			343			Interaction with VTA1.		A8KAH5|J3QLU7|Q3SYM4|Q9BQ81|Q9BWN2	Nonsense_Mutation	SNP	ENST00000378799.6	37	c.1073C>G	CCDS59272.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.4|23.4	4.409650|4.409650	0.83340|0.83340	.|.	.|.	ENSG00000182149|ENSG00000182149	ENST00000329908|ENST00000535424;ENST00000378799;ENST00000538963;ENST00000538850;ENST00000378798;ENST00000456820	.|.	.|.	.|.	5.65|5.65	5.65|5.65	0.86999|0.86999	.|.	.|0.165678	.|0.53938	.|D	.|0.000049	T|.	0.75693|.	0.3884|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	B|.	0.14012|.	0.009|.	B|.	0.15870|.	0.014|.	T|.	0.72388|.	-0.4309|.	7|.	0.52906|0.39692	T|T	0.07|0.17	-16.4121|-16.4121	20.0845|20.0845	0.97795|0.97795	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	344|.	P53990-3|.	.|.	E|X	344|358;345;334;197;314;268	.|.	ENSP00000330408:Q344E|ENSP00000368075:S314X	Q|S	+|+	1|2	0|0	KIAA0174|KIAA0174	70519150|70519150	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.564000|5.564000	0.67359|0.67359	2.821000|2.821000	0.97095|0.97095	0.650000|0.650000	0.86243|0.86243	CAG|TCA		0.463	IST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269005.2	NM_014761		10	253	0	0	0	0	10	253				
DHODH	1723	broad.mit.edu	37	16	72057137	72057137	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr16:72057137C>G	ENST00000219240.4	+	7	914	c.893C>G	c.(892-894)tCt>tGt	p.S298C	DHODH_ENST00000573922.1_3'UTR|DHODH_ENST00000572887.1_Missense_Mutation_p.S298C	NM_001361.4	NP_001352.2	Q02127	PYRD_HUMAN	dihydroorotate dehydrogenase (quinone)	298					'de novo' pyrimidine nucleobase biosynthetic process (GO:0006207)|'de novo' UMP biosynthetic process (GO:0044205)|female pregnancy (GO:0007565)|lactation (GO:0007595)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of apoptotic process (GO:0043065)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside biosynthetic process (GO:0046134)|regulation of mitochondrial fission (GO:0090140)|response to caffeine (GO:0031000)|response to drug (GO:0042493)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|neuronal cell body (GO:0043025)	dihydroorotate dehydrogenase activity (GO:0004152)|dihydroorotate oxidase activity (GO:0004158)|drug binding (GO:0008144)|FMN binding (GO:0010181)|ubiquinone binding (GO:0048039)			breast(1)|endometrium(2)|large_intestine(4)|ovary(1)|skin(1)|stomach(1)	10		Ovarian(137;0.125)			Atovaquone(DB01117)|Leflunomide(DB01097)|Teriflunomide(DB08880)	GCCCTGCGCTCTGAAACAGGA	0.562																																						uc002fbp.2		NA																	0					0						c.(892-894)TCT>TGT		dihydroorotate dehydrogenase precursor	Atovaquone(DB01117)|Leflunomide(DB01097)						45.0	46.0	46.0					16																	72057137		1920	4134	6054	SO:0001583	missense	1723				'de novo' pyrimidine base biosynthetic process|pyrimidine nucleoside biosynthetic process|UMP biosynthetic process	integral to membrane|mitochondrial inner membrane	dihydroorotate oxidase activity	g.chr16:72057137C>G		CCDS42192.1	16q22.2	2012-10-02	2011-09-05		ENSG00000102967	ENSG00000102967	1.3.5.2		2867	protein-coding gene	gene with protein product		126064	"""dihydroorotate dehydrogenase"""			8211381	Standard	NM_001361		Approved		uc002fbp.3	Q02127	OTTHUMG00000178093	ENST00000219240.4:c.893C>G	16.37:g.72057137C>G	ENSP00000219240:p.Ser298Cys		Somatic				DHODH_uc010cgk.2_RNA	p.S298C	NM_001361	NP_001352	WXS	Illumina HiSeq	Unspecified	Q02127	PYRD_HUMAN			7	914	+		Ovarian(137;0.125)	298			Mitochondrial intermembrane (By similarity).		A8K8C8|Q6P176	Missense_Mutation	SNP	ENST00000219240.4	37	c.893C>G	CCDS42192.1	.	.	.	.	.	.	.	.	.	.	C	19.37	3.814653	0.70912	.	.	ENSG00000102967	ENST00000219240	D	0.85484	-1.99	5.59	4.62	0.57501	Aldolase-type TIM barrel (1);	0.482631	0.24991	N	0.033992	D	0.85822	0.5786	L	0.55017	1.72	0.26616	N	0.972746	D	0.63880	0.993	P	0.56648	0.803	T	0.78974	-0.1992	10	0.62326	D	0.03	-3.8618	5.3985	0.16283	0.2567:0.5493:0.1245:0.0695	.	298	Q02127	PYRD_HUMAN	C	298	ENSP00000219240:S298C	ENSP00000219240:S298C	S	+	2	0	DHODH	70614638	0.001000	0.12720	0.997000	0.53966	0.922000	0.55478	0.592000	0.23984	1.456000	0.47831	0.561000	0.74099	TCT		0.562	DHODH-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_001361		8	51	0	0	0	0	8	51				
TXNL4B	54957	broad.mit.edu	37	16	72124582	72124582	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr16:72124582C>G	ENST00000268483.3	-	2	388	c.67G>C	c.(67-69)Gag>Cag	p.E23Q	TXNL4B_ENST00000423037.1_Missense_Mutation_p.E23Q|DHX38_ENST00000268482.3_5'Flank|TXNL4B_ENST00000426362.2_Missense_Mutation_p.E23Q	NM_001142318.1|NM_017853.2	NP_001135790.1|NP_060323.1	Q9NX01	TXN4B_HUMAN	thioredoxin-like 4B	23					mitotic nuclear division (GO:0007067)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	spliceosomal complex (GO:0005681)				cervix(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(2)	8						AACACCTTCTCAGCAGTACTT	0.398																																						uc002fca.2		NA																	0				ovary(1)	1						c.(67-69)GAG>CAG		thioredoxin-like 4B							206.0	175.0	186.0					16																	72124582		2198	4300	6498	SO:0001583	missense	54957				mitosis|mRNA processing|RNA splicing	spliceosomal complex		g.chr16:72124582C>G	BC009646	CCDS10906.1	16q22.2	2012-11-19			ENSG00000140830	ENSG00000140830			26041	protein-coding gene	gene with protein product						15161931	Standard	NM_017853		Approved	FLJ20511, DLP, Dim2	uc010vmn.2	Q9NX01	OTTHUMG00000173453	ENST00000268483.3:c.67G>C	16.37:g.72124582C>G	ENSP00000268483:p.Glu23Gln		Somatic				TXNL4B_uc010cgl.2_RNA|TXNL4B_uc010vmn.1_Missense_Mutation_p.E23Q|TXNL4B_uc010vmo.1_Missense_Mutation_p.E23Q	p.E23Q	NM_017853	NP_060323	WXS	Illumina HiSeq	Unspecified	Q9NX01	TXN4B_HUMAN			2	378	-			23					D3DWS6	Missense_Mutation	SNP	ENST00000268483.3	37	c.67G>C	CCDS10906.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.084996	0.76642	.	.	ENSG00000140830	ENST00000268483;ENST00000426362;ENST00000423037	.	.	.	5.66	5.66	0.87406	Thioredoxin-like fold (2);	0.000000	0.85682	D	0.000000	T	0.60881	0.2303	M	0.64567	1.98	0.80722	D	1	B	0.31241	0.315	B	0.26693	0.072	T	0.62572	-0.6826	9	0.56958	D	0.05	.	17.2441	0.87022	0.0:1.0:0.0:0.0	.	23	Q9NX01	TXN4B_HUMAN	Q	23	.	ENSP00000268483:E23Q	E	-	1	0	TXNL4B	70682083	1.000000	0.71417	0.986000	0.45419	0.969000	0.65631	7.601000	0.82783	2.648000	0.89879	0.655000	0.94253	GAG		0.398	TXNL4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269007.2	NM_017853		10	61	0	0	0	0	10	61				
CNTNAP4	85445	broad.mit.edu	37	16	76572114	76572114	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr16:76572114G>A	ENST00000476707.1	+	18	3245	c.3106G>A	c.(3106-3108)Ggt>Agt	p.G1036S	CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000377504.4_Missense_Mutation_p.G984S|CNTNAP4_ENST00000307431.8_Missense_Mutation_p.G1032S|CNTNAP4_ENST00000478060.1_Missense_Mutation_p.G960S			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	1033					cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)				breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						TTCATTTCATGGTGATATGAA	0.373																																						uc002feu.1		NA																	0				ovary(1)|pancreas(1)	2						c.(3097-3099)GGT>AGT		cell recognition protein CASPR4 isoform 1							74.0	70.0	71.0					16																	76572114		1827	4097	5924	SO:0001583	missense	85445				cell adhesion|signal transduction	integral to membrane	receptor binding	g.chr16:76572114G>A	AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.3106G>A	16.37:g.76572114G>A	ENSP00000417628:p.Gly1036Ser		Somatic				CNTNAP4_uc002fev.1_Missense_Mutation_p.G897S|CNTNAP4_uc010chb.1_Missense_Mutation_p.G960S|CNTNAP4_uc002fex.1_Missense_Mutation_p.G1036S	p.G1033S	NM_033401	NP_207837	WXS	Illumina HiSeq	Unspecified	Q9C0A0	CNTP4_HUMAN			21	3482	+			1033			Extracellular (Potential).		E9PFZ6|Q86YZ7	Missense_Mutation	SNP	ENST00000476707.1	37	c.3097G>A		.	.	.	.	.	.	.	.	.	.	G	7.898	0.733706	0.15574	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	T;T;T;T	0.37752	1.18;1.18;1.18;1.18	5.35	5.35	0.76521	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.000000	0.42548	D	0.000697	T	0.24084	0.0583	.	.	.	0.39769	D	0.972142	B;B;B	0.34241	0.007;0.049;0.444	B;B;B	0.36719	0.004;0.016;0.231	T	0.05037	-1.0910	9	0.08179	T	0.78	.	14.2746	0.66173	0.0:0.2673:0.7327:0.0	.	960;1036;1033	E9PFZ6;E9PDN6;Q9C0A0	.;.;CNTP4_HUMAN	S	1032;984;960;1036	ENSP00000306893:G1032S;ENSP00000439733:G984S;ENSP00000418741:G960S;ENSP00000417628:G1036S	ENSP00000306893:G1032S	G	+	1	0	CNTNAP4	75129615	1.000000	0.71417	0.985000	0.45067	0.985000	0.73830	2.213000	0.42844	2.769000	0.95229	0.655000	0.94253	GGT		0.373	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1	NM_033401		9	84	0	0	0	0	9	84				
ZNF232	7775	broad.mit.edu	37	17	5012863	5012863	+	Silent	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr17:5012863C>T	ENST00000250076.3	-	3	978	c.324G>A	c.(322-324)ctG>ctA	p.L108L	ZNF232_ENST00000575538.1_Intron|AC012146.7_ENST00000571138.1_RNA|AC012146.7_ENST00000413077.1_RNA|ZNF232_ENST00000416429.2_Silent_p.L81L|ZNF232_ENST00000575898.1_Silent_p.L108L	NM_014519.2	NP_055334.2	Q9UNY5	ZN232_HUMAN	zinc finger protein 232	81	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(2)|liver(1)|lung(4)|ovary(1)|prostate(2)	11						TCTCTGGCCTCAGCCACTCAC	0.582																																						uc002gas.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(241-243)CTG>CTA		zinc finger protein 232							92.0	85.0	88.0					17																	5012863		2203	4300	6503	SO:0001819	synonymous_variant	7775				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr17:5012863C>T	AF080169	CCDS11068.1	17p13.2	2013-01-09			ENSG00000167840	ENSG00000167840		"""-"", ""Zinc fingers, C2H2-type"""	13026	protein-coding gene	gene with protein product						11311944	Standard	NM_014519		Approved	ZSCAN11	uc002gat.3	Q9UNY5	OTTHUMG00000099450	ENST00000250076.3:c.324G>A	17.37:g.5012863C>T			Somatic				ZNF232_uc002gar.1_Silent_p.L108L|ZNF232_uc002gat.2_Silent_p.L108L|ZNF232_uc010vsv.1_Silent_p.L108L	p.L81L	NM_014519	NP_055334	WXS	Illumina HiSeq	Unspecified	Q9UNY5	ZN232_HUMAN			3	997	-			81			SCAN box.			Silent	SNP	ENST00000250076.3	37	c.243G>A	CCDS11068.1																																																																																				0.582	ZNF232-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216915.1	NM_014519		16	53	0	0	0	0	16	53				
GPS2	2874	broad.mit.edu	37	17	7216603	7216603	+	Silent	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr17:7216603G>C	ENST00000380728.2	-	9	1032	c.732C>G	c.(730-732)ctC>ctG	p.L244L	GPS2_ENST00000389167.5_Silent_p.L244L|GPS2_ENST00000391950.3_Silent_p.L244L|RP11-542C16.2_ENST00000575474.1_3'UTR			Q13227	GPS2_HUMAN	G protein pathway suppressor 2	244					cell cycle (GO:0007049)|inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	GTPase inhibitor activity (GO:0005095)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(4)	24		Prostate(122;0.157)				CACCAGGCTGGAGGAAACCTA	0.557											OREG0024133	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										uc002gfv.1		NA																	0				ovary(2)|pancreas(1)	3						c.(730-732)CTC>CTG		G protein pathway suppressor 2							109.0	110.0	109.0					17																	7216603		2203	4300	6503	SO:0001819	synonymous_variant	2874				cell cycle|inactivation of MAPK activity|JNK cascade|negative regulation of JNK cascade|negative regulation of transcription from RNA polymerase II promoter	transcriptional repressor complex	GTPase inhibitor activity|protein binding|transcription corepressor activity	g.chr17:7216603G>C	U28963	CCDS11100.1	17p13.1	2006-04-29			ENSG00000132522	ENSG00000132522			4550	protein-coding gene	gene with protein product		601935				8943324	Standard	NM_004489		Approved		uc002gfx.1	Q13227	OTTHUMG00000102198	ENST00000380728.2:c.732C>G	17.37:g.7216603G>C			Somatic	OREG0024133	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	640	GPS2_uc002gfw.1_Silent_p.L206L|GPS2_uc002gfx.1_Silent_p.L244L|NEURL4_uc002gfy.1_RNA|GPS2_uc002gfz.1_Silent_p.L244L	p.L244L	NM_004489	NP_004480	WXS	Illumina HiSeq	Unspecified	Q13227	GPS2_HUMAN			8	995	-		Prostate(122;0.157)	244					B4DXA1|Q6FHM8	Silent	SNP	ENST00000380728.2	37	c.732C>G	CCDS11100.1																																																																																				0.557	GPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220048.4	NM_004489		16	73	0	0	0	0	16	73				
TP53	7157	broad.mit.edu	37	17	7578263	7578263	+	Nonsense_Mutation	SNP	G	G	A	rs397516435		TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr17:7578263G>A	ENST00000269305.4	-	6	775	c.586C>T	c.(586-588)Cga>Tga	p.R196*	TP53_ENST00000359597.4_Nonsense_Mutation_p.R196*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R196*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R196*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R196*|TP53_ENST00000445888.2_Nonsense_Mutation_p.R196*|TP53_ENST00000574684.1_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	196	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R196*(167)|p.R64*(14)|p.R103*(14)|p.0?(8)|p.R196fs*51(7)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.R196R(2)|p.I195fs*50(1)|p.R64fs*>27(1)|p.R103fs*51(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I195fs*12(1)|p.P59_E66>Q(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCTTCCACTCGGATAAGATGC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		232	Substitution - Nonsense(195)|Deletion - Frameshift(11)|Whole gene deletion(8)|Deletion - In frame(5)|Complex - deletion inframe(5)|Unknown(5)|Substitution - coding silent(2)|Complex - frameshift(1)	p.R196*(125)|p.R196P(12)|p.0?(7)|p.R196R(5)|p.R196fs*51(4)|p.A189_V197delAPPQHLIRV(4)|p.R196Q(3)|p.K164_P219del(1)|p.R196L(1)|p.I195fs*50(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.R64*(1)|p.I195fs*12(1)|p.R103*(1)	large_intestine(54)|breast(29)|upper_aerodigestive_tract(22)|lung(22)|haematopoietic_and_lymphoid_tissue(17)|skin(17)|biliary_tract(11)|central_nervous_system(11)|oesophagus(11)|ovary(11)|stomach(8)|urinary_tract(7)|bone(4)|liver(3)|pancreas(3)|eye(1)|kidney(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245	GRCh37	CM941329	TP53	M		c.(586-588)CGA>TGA	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							102.0	91.0	94.0					17																	7578263		2203	4300	6503	SO:0001587	stop_gained	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7578263G>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.586C>T	17.37:g.7578263G>A	ENSP00000269305:p.Arg196*	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)	Somatic				TP53_uc002gig.1_Nonsense_Mutation_p.R196*|TP53_uc002gih.2_Nonsense_Mutation_p.R196*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Nonsense_Mutation_p.R64*|TP53_uc010cng.1_Nonsense_Mutation_p.R64*|TP53_uc002gii.1_Nonsense_Mutation_p.R64*|TP53_uc010cnh.1_Nonsense_Mutation_p.R196*|TP53_uc010cni.1_Nonsense_Mutation_p.R196*|TP53_uc002gij.2_Nonsense_Mutation_p.R196*|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Nonsense_Mutation_p.R103*|TP53_uc002gio.2_Nonsense_Mutation_p.R64*|TP53_uc010vug.1_Nonsense_Mutation_p.R157*	p.R196*	NM_001126112	NP_001119584	WXS	Illumina HiSeq	Unspecified	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	6	780	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	196		R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	c.586C>T	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	14.02	2.409843	0.42715	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.41	4.44	0.53790	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.9531	12.3046	0.54895	0.0827:0.0:0.9173:0.0	.	.	.	.	X	196;196;196;196;196;196;185;103;64;103;64	.	ENSP00000269305:R196X	R	-	1	2	TP53	7518988	1.000000	0.71417	0.997000	0.53966	0.023000	0.10783	2.166000	0.42406	1.427000	0.47276	-0.140000	0.14226	CGA		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		7	24	0	0	0	0	7	24				
CHD3	1107	broad.mit.edu	37	17	7810759	7810759	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr17:7810759G>C	ENST00000330494.7	+	32	5027	c.4877G>C	c.(4876-4878)gGa>gCa	p.G1626A	SCARNA21_ENST00000517026.1_RNA|CHD3_ENST00000380358.4_Missense_Mutation_p.G1685A|CHD3_ENST00000358181.4_Missense_Mutation_p.G1626A	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	1626	Required for interaction with PCNT.				centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				GGGGTGCCTGGAGAGATGGAG	0.592																																						uc002gje.2		NA																	0				breast(1)	1						c.(4876-4878)GGA>GCA		chromodomain helicase DNA binding protein 3							74.0	69.0	71.0					17																	7810759		2203	4300	6503	SO:0001583	missense	1107				chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|zinc ion binding	g.chr17:7810759G>C	U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.4877G>C	17.37:g.7810759G>C	ENSP00000332628:p.Gly1626Ala		Somatic				CHD3_uc002gjd.2_Missense_Mutation_p.G1685A|CHD3_uc002gjf.2_Missense_Mutation_p.G1626A|CHD3_uc002gjh.2_Missense_Mutation_p.G202A|CHD3_uc002gjj.2_5'Flank	p.G1626A	NM_001005273	NP_001005273	WXS	Illumina HiSeq	Unspecified	Q12873	CHD3_HUMAN			32	5027	+		Prostate(122;0.202)	1626			Required for interaction with PCNT.		D3DTQ9|E9PG89|Q9Y4I0	Missense_Mutation	SNP	ENST00000330494.7	37	c.4877G>C	CCDS32554.1	.	.	.	.	.	.	.	.	.	.	G	7.281	0.609036	0.14066	.	.	ENSG00000170004	ENST00000380358;ENST00000358181;ENST00000330494	D;D;D	0.89552	-2.53;-2.48;-2.46	4.28	3.3	0.37823	.	0.000000	0.42053	D	0.000766	T	0.73024	0.3534	N	0.08118	0	0.42316	D	0.992231	B;B;B;B	0.12013	0.005;0.0;0.0;0.0	B;B;B;B	0.09377	0.004;0.001;0.001;0.001	T	0.63097	-0.6713	10	0.19590	T	0.45	-4.8298	6.4818	0.22067	0.1007:0.0:0.7164:0.1829	.	202;1626;1626;1685	B3KWV4;Q12873-2;Q12873;E9PG89	.;.;CHD3_HUMAN;.	A	1685;1626;1626	ENSP00000369716:G1685A;ENSP00000350907:G1626A;ENSP00000332628:G1626A	ENSP00000332628:G1626A	G	+	2	0	CHD3	7751484	0.995000	0.38212	1.000000	0.80357	0.988000	0.76386	1.152000	0.31663	1.124000	0.41980	0.561000	0.74099	GGA		0.592	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318050.1	NM_001005273		3	27	0	0	0	0	3	27				
TMEM107	84314	broad.mit.edu	37	17	8077524	8077524	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr17:8077524G>C	ENST00000437139.2	-	5	507	c.420C>G	c.(418-420)ttC>ttG	p.F140L	TMEM107_ENST00000533070.1_Missense_Mutation_p.F139L|TMEM107_ENST00000431792.2_Missense_Mutation_p.F74L|TMEM107_ENST00000316425.5_Missense_Mutation_p.F146L|TMEM107_ENST00000532998.1_3'UTR|SNORD118_ENST00000363593.1_RNA|TMEM107_ENST00000449985.2_3'UTR|RP11-599B13.7_ENST00000581248.1_lincRNA	NM_183065.2	NP_898888.1	Q6UX40	TM107_HUMAN	transmembrane protein 107	140					cilium assembly (GO:0042384)|embryonic digit morphogenesis (GO:0042733)|neural tube patterning (GO:0021532)	integral component of membrane (GO:0016021)				large_intestine(1)|lung(4)|ovary(1)	6						AAGGTAATCAGAAGGGTTTCT	0.502																																						uc002gkg.3		NA																	0					0						c.(418-420)TTC>TTG		transmembrane protein 107 isoform 2							69.0	69.0	69.0					17																	8077524		2203	4300	6503	SO:0001583	missense	84314					integral to membrane		g.chr17:8077524G>C	AF311338	CCDS11132.1, CCDS45607.1	17p13.1	2005-12-19				ENSG00000179029			28128	protein-coding gene	gene with protein product						12477932	Standard	NM_032354		Approved	MGC10744	uc002gkh.4	Q6UX40		ENST00000437139.2:c.420C>G	17.37:g.8077524G>C	ENSP00000402732:p.Phe140Leu		Somatic				TMEM107_uc002gkh.3_Missense_Mutation_p.F146L|TMEM107_uc002gki.3_Missense_Mutation_p.F139L|TMEM107_uc002gkj.3_RNA|TMEM107_uc002gkk.2_3'UTR	p.F140L	NM_183065	NP_898888	WXS	Illumina HiSeq	Unspecified	Q6UX40	TM107_HUMAN			5	530	-			140					A0PJV7|Q6NSE3|Q6ZRX9|Q96T82	Missense_Mutation	SNP	ENST00000437139.2	37	c.420C>G	CCDS45607.1	.	.	.	.	.	.	.	.	.	.	G	7.930	0.740368	0.15642	.	.	ENSG00000179029	ENST00000437139;ENST00000533070;ENST00000316425;ENST00000431792	.	.	.	6.05	2.79	0.32731	.	2.679310	0.01432	N	0.014785	T	0.12902	0.0313	N	0.00419	-1.52	0.22737	N	0.998794	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.25222	-1.0138	9	0.15499	T	0.54	.	8.9415	0.35733	0.0:0.3511:0.5003:0.1486	.	139;146;140	Q6UX40-3;Q6UX40-4;Q6UX40	.;.;TM107_HUMAN	L	140;139;146;74	.	ENSP00000314116:F146L	F	-	3	2	TMEM107	8018249	1.000000	0.71417	1.000000	0.80357	0.301000	0.27625	0.917000	0.28665	0.863000	0.35553	0.637000	0.83480	TTC		0.502	TMEM107-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388844.1	NM_032354		10	66	0	0	0	0	10	66				
PFAS	5198	broad.mit.edu	37	17	8157504	8157504	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr17:8157504G>A	ENST00000314666.6	+	3	296	c.163G>A	c.(163-165)Gag>Aag	p.E55K	PFAS_ENST00000545834.1_5'UTR	NM_012393.2	NP_036525.1	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase	55					'de novo' IMP biosynthetic process (GO:0006189)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|phosphoribosylformylglycinamidine synthase activity (GO:0004642)			central_nervous_system(3)|endometrium(8)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35					L-Glutamine(DB00130)	CCCCAGTGCTGAGGAGACAAA	0.587																																						uc002gkr.2		NA																	0				ovary(2)|central_nervous_system(2)|pancreas(1)	5						c.(163-165)GAG>AAG		phosphoribosylformylglycinamidine synthase	L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)						121.0	99.0	107.0					17																	8157504		2203	4300	6503	SO:0001583	missense	5198				'de novo' IMP biosynthetic process|glutamine metabolic process|purine base metabolic process	cytosol	ATP binding|phosphoribosylformylglycinamidine synthase activity|protein binding	g.chr17:8157504G>A	AB002359	CCDS11136.1	17p13.1	2008-07-31	2008-07-31		ENSG00000178921	ENSG00000178921	6.3.5.3		8863	protein-coding gene	gene with protein product	"""FGAR amidotransferase"""	602133				8110788	Standard	NM_012393		Approved	PURL, FGARAT, KIAA0361	uc002gkr.3	O15067	OTTHUMG00000108188	ENST00000314666.6:c.163G>A	17.37:g.8157504G>A	ENSP00000313490:p.Glu55Lys		Somatic				PFAS_uc010vuv.1_5'UTR	p.E55K	NM_012393	NP_036525	WXS	Illumina HiSeq	Unspecified	O15067	PUR4_HUMAN			3	304	+			55					A6H8V8	Missense_Mutation	SNP	ENST00000314666.6	37	c.163G>A	CCDS11136.1	.	.	.	.	.	.	.	.	.	.	G	12.55	1.970150	0.34754	.	.	ENSG00000178921	ENST00000314666	T	0.46451	0.87	5.55	1.01	0.19927	.	0.318671	0.32518	N	0.005997	T	0.30039	0.0752	L	0.45470	1.425	0.80722	D	1	B	0.02656	0.0	B	0.09377	0.004	T	0.06899	-1.0801	10	0.31617	T	0.26	-13.7607	6.6042	0.22716	0.1705:0.3905:0.439:0.0	.	55	O15067	PUR4_HUMAN	K	55	ENSP00000313490:E55K	ENSP00000313490:E55K	E	+	1	0	PFAS	8098229	0.177000	0.23109	0.426000	0.26672	0.990000	0.78478	0.412000	0.21131	0.428000	0.26173	0.655000	0.94253	GAG		0.587	PFAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226994.2			7	47	0	0	0	0	7	47				
MYOCD	93649	broad.mit.edu	37	17	12656083	12656083	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr17:12656083C>T	ENST00000343344.4	+	10	1478	c.1478C>T	c.(1477-1479)aCg>aTg	p.T493M	MYOCD_ENST00000395988.1_3'UTR|AC005358.1_ENST00000609971.1_Missense_Mutation_p.T397M|MYOCD_ENST00000425538.1_Missense_Mutation_p.T493M			Q8IZQ8	MYCD_HUMAN	myocardin	493	Ser-rich.				cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.T493M(1)		breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		CACGTGTGCACGGAGGAAAGT	0.612																																						uc002gnn.2		NA																	1	Substitution - Missense(1)		upper_aerodigestive_tract(1)	central_nervous_system(2)|skin(2)|ovary(1)	5						c.(1477-1479)ACG>ATG		myocardin isoform 2							51.0	50.0	50.0					17																	12656083		2203	4300	6503	SO:0001583	missense	93649				cardiac muscle cell differentiation|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|positive regulation of smooth muscle cell differentiation|positive regulation of smooth muscle contraction|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation|regulation of histone acetylation|smooth muscle cell differentiation	nucleus	nucleic acid binding|RNA polymerase II transcription factor binding transcription factor activity|transcription factor binding	g.chr17:12656083C>T	AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.1478C>T	17.37:g.12656083C>T	ENSP00000341835:p.Thr493Met		Somatic				MYOCD_uc002gno.2_Missense_Mutation_p.T493M|MYOCD_uc002gnp.1_Missense_Mutation_p.T397M|MYOCD_uc002gnq.2_Missense_Mutation_p.T212M	p.T493M	NM_153604	NP_705832	WXS	Illumina HiSeq	Unspecified	Q8IZQ8	MYCD_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)	10	1777	+			493			Ser-rich.		Q5UBU5|Q8N7Q1	Missense_Mutation	SNP	ENST00000343344.4	37	c.1478C>T	CCDS11163.1	.	.	.	.	.	.	.	.	.	.	C	7.959	0.746526	0.15710	.	.	ENSG00000141052	ENST00000395982;ENST00000425538;ENST00000343344;ENST00000395988;ENST00000443061	T;T	0.45668	0.89;0.89	5.66	5.66	0.87406	.	0.553706	0.20636	N	0.088493	T	0.32615	0.0835	L	0.33485	1.01	0.25058	N	0.991089	B;B;B;B	0.28584	0.152;0.134;0.216;0.082	B;B;B;B	0.21546	0.009;0.021;0.035;0.015	T	0.18777	-1.0326	10	0.37606	T	0.19	-0.5973	14.0667	0.64834	0.1515:0.8485:0.0:0.0	.	212;397;493;493	E9PEP9;Q8IZQ8-2;Q8IZQ8-3;Q8IZQ8	.;.;.;MYCD_HUMAN	M	212;493;493;397;198	ENSP00000341835:T493M;ENSP00000400148:T198M	ENSP00000341835:T493M	T	+	2	0	MYOCD	12596808	0.566000	0.26618	0.039000	0.18376	0.051000	0.14879	3.933000	0.56545	2.672000	0.90937	0.591000	0.81541	ACG		0.612	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129950.1	NM_153604		8	19	0	0	0	0	8	19				
SLC6A4	6532	broad.mit.edu	37	17	28530257	28530257	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr17:28530257G>T	ENST00000401766.2	-	13	2263	c.1751C>A	c.(1750-1752)tCa>tAa	p.S584*	RP11-354P11.4_ENST00000581633.1_RNA|SLC6A4_ENST00000261707.3_Nonsense_Mutation_p.S584*			P31645	SC6A4_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 4	584					brain morphogenesis (GO:0048854)|cellular response to cGMP (GO:0071321)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|memory (GO:0007613)|monoamine transport (GO:0015844)|negative regulation of cerebellar granule cell precursor proliferation (GO:0021941)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of organ growth (GO:0046621)|negative regulation of synaptic transmission, dopaminergic (GO:0032227)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein homooligomerization (GO:0051260)|protein oligomerization (GO:0051259)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to toxic substance (GO:0009636)|serotonin transport (GO:0006837)|serotonin uptake (GO:0051610)|social behavior (GO:0035176)|sperm ejaculation (GO:0042713)|thalamus development (GO:0021794)|vasoconstriction (GO:0042310)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|cocaine binding (GO:0019811)|monoamine transmembrane transporter activity (GO:0008504)|Rab GTPase binding (GO:0017137)|serotonin transmembrane transporter activity (GO:0015222)|serotonin:sodium symporter activity (GO:0005335)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(4)	25					Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexfenfluramine(DB01191)|Dexmethylphenidate(DB06701)|Dextromethorphan(DB00514)|Dopamine(DB00988)|Doxepin(DB01142)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fluoxetine(DB00472)|Fluvoxamine(DB00176)|Imipramine(DB00458)|Levomilnacipran(DB08918)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Pethidine(DB00454)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vilazodone(DB06684)	AATGAAAGATGAGGTTCCTAT	0.398																																						uc002hey.3		NA																	0				skin(3)|ovary(1)	4						c.(1750-1752)TCA>TAA		solute carrier family 6 member 4	Amineptine(DB04836)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Dextromethorphan(DB00514)|Doxepin(DB01142)|Duloxetine(DB00476)|Escitalopram(DB01175)|Fluoxetine(DB00472)|Fluvoxamine(DB00176)|Imipramine(DB00458)|Methylphenidate(DB00422)|Milnacipran(DB04896)|Minaprine(DB00805)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Phentermine(DB00191)|Protriptyline(DB00344)|Sertraline(DB01104)|Sibutramine(DB01105)|Tegaserod(DB01079)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)|Zimelidine(DB04832)						188.0	183.0	185.0					17																	28530257		2203	4300	6503	SO:0001587	stop_gained	6532				response to toxin|serotonin uptake|thalamus development	cytosol|endomembrane system|endosome membrane|membrane raft	actin filament binding|Rab GTPase binding|serotonin transmembrane transporter activity|serotonin:sodium symporter activity	g.chr17:28530257G>T	L05568	CCDS11256.1	17q11.2	2014-01-30	2013-07-19		ENSG00000108576	ENSG00000108576		"""Solute carriers"""	11050	protein-coding gene	gene with protein product	"""serotonin transporter 1"""	182138	"""solute carrier family 6 (neurotransmitter transporter, serotonin), member 4"", ""5-hydroxytryptamine (serotonin) transporter"", ""obsessive-compulsive disorder 1"""	HTT, OCD1		7681602, 19806148	Standard	NM_001045		Approved	5-HTT, SERT1	uc002hey.5	P31645	OTTHUMG00000132751	ENST00000401766.2:c.1751C>A	17.37:g.28530257G>T	ENSP00000385822:p.Ser584*		Somatic				SLC6A4_uc010csg.2_RNA	p.S584*	NM_001045	NP_001036	WXS	Illumina HiSeq	Unspecified	P31645	SC6A4_HUMAN			14	2295	-			584			Helical; Name=12; (Potential).		Q5EE02	Nonsense_Mutation	SNP	ENST00000401766.2	37	c.1751C>A	CCDS11256.1	.	.	.	.	.	.	.	.	.	.	G	44	11.090471	0.99514	.	.	ENSG00000108576	ENST00000394821;ENST00000401766;ENST00000261707	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.8676	0.96824	0.0:0.0:1.0:0.0	.	.	.	.	X	626;584;584	.	ENSP00000261707:S584X	S	-	2	0	SLC6A4	25554383	1.000000	0.71417	0.551000	0.28230	0.854000	0.48673	9.804000	0.99143	2.941000	0.99782	0.655000	0.94253	TCA		0.398	SLC6A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256115.3	NM_001045		9	100	1	0	3.07e-06	3.32e-06	9	100				
TNS4	84951	broad.mit.edu	37	17	38633892	38633892	+	Missense_Mutation	SNP	G	G	A	rs372382060		TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr17:38633892G>A	ENST00000254051.6	-	13	2254	c.2096C>T	c.(2095-2097)tCg>tTg	p.S699L		NM_032865.5	NP_116254.4	Q8IZW8	TENS4_HUMAN	tensin 4	699	Phosphatase tensin-type.				apoptotic process (GO:0006915)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	30		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			GATGACCTGCGAGGCTGGCTG	0.587																																						uc010cxb.2		NA																	0				large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4						c.(2095-2097)TCG>TTG		tensin 4 precursor		G	LEU/SER	0,4406		0,0,2203	126.0	100.0	109.0		2096	5.3	0.9	17		109	1,8599	1.2+/-3.3	0,1,4299	no	missense	TNS4	NM_032865.5	145	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	699/716	38633892	1,13005	2203	4300	6503	SO:0001583	missense	84951				apoptosis|protein localization	cytoplasm|cytoskeleton|focal adhesion	actin binding	g.chr17:38633892G>A	AF417488	CCDS11368.1	17q21.2	2013-02-14			ENSG00000131746	ENSG00000131746		"""SH2 domain containing"""	24352	protein-coding gene	gene with protein product	"""C terminal tensin like"""	608385				12154022, 12711115	Standard	NM_032865		Approved	CTEN	uc010cxb.3	Q8IZW8	OTTHUMG00000133330	ENST00000254051.6:c.2096C>T	17.37:g.38633892G>A	ENSP00000254051:p.Ser699Leu		Somatic				TNS4_uc002huu.3_Missense_Mutation_p.S112L	p.S699L	NM_032865	NP_116254	WXS	Illumina HiSeq	Unspecified	Q8IZW8	TENS4_HUMAN	STAD - Stomach adenocarcinoma(5;5.91e-05)		13	2260	-		Breast(137;0.000496)	699			Phosphatase tensin-type.		A6NMJ7|Q71RB7|Q8WV64|Q96JV4	Missense_Mutation	SNP	ENST00000254051.6	37	c.2096C>T	CCDS11368.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.260634	0.80246	0.0	1.16E-4	ENSG00000131746	ENST00000377816;ENST00000394072;ENST00000254051	T	0.32753	1.44	5.27	5.27	0.74061	Pleckstrin homology-type (1);Tensin phosphotyrosine-binding domain (1);	0.136627	0.33938	N	0.004415	T	0.53190	0.1781	M	0.67700	2.07	0.44899	D	0.997916	D;D	0.76494	0.999;0.994	P;P	0.61874	0.895;0.878	T	0.56245	-0.8011	10	0.72032	D	0.01	-13.2116	18.4999	0.90877	0.0:0.0:1.0:0.0	.	699;112	Q8IZW8;F2Z318	TENS4_HUMAN;.	L	699;112;699	ENSP00000254051:S699L	ENSP00000254051:S699L	S	-	2	0	TNS4	35887418	0.998000	0.40836	0.925000	0.36789	0.939000	0.58152	4.708000	0.61859	2.478000	0.83669	0.561000	0.74099	TCG		0.587	TNS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257154.3	NM_032865		9	72	0	0	0	0	9	72				
KRT12	3859	broad.mit.edu	37	17	39019596	39019596	+	Splice_Site	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr17:39019596C>T	ENST00000251643.4	-	6	1119		c.e6-1		RP5-1110E20.1_ENST00000579136.1_RNA	NM_000223.3	NP_000214.1	Q99456	K1C12_HUMAN	keratin 12						visual perception (GO:0007601)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	15		Breast(137;0.000301)			Griseofulvin(DB00400)	GGGATTTCTTCTGCACGTGGG	0.552																																						uc002hvk.2		NA																	0				ovary(1)	1						c.e6-1		keratin 12							19.0	17.0	18.0					17																	39019596		2197	4284	6481	SO:0001630	splice_region_variant	3859				visual perception	intermediate filament	structural molecule activity	g.chr17:39019596C>T		CCDS11378.1	17q21.2	2013-06-20	2008-08-01		ENSG00000187242	ENSG00000187242		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6414	protein-coding gene	gene with protein product	"""Meesmann corneal dystrophy"""	601687				9171831, 16831889	Standard	NM_000223		Approved	K12	uc002hvk.2	Q99456	OTTHUMG00000133369	ENST00000251643.4:c.1096-1G>A	17.37:g.39019596C>T			Somatic					p.K366_splice	NM_000223	NP_000214	WXS	Illumina HiSeq	Unspecified	Q99456	K1C12_HUMAN			6	1120	-		Breast(137;0.000301)						B2R9E0	Splice_Site	SNP	ENST00000251643.4	37	c.1096_splice	CCDS11378.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.512683	0.85389	.	.	ENSG00000187242	ENST00000251643	.	.	.	4.87	4.87	0.63330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1864	0.89795	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KRT12	36273122	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	7.293000	0.78740	2.537000	0.85549	0.491000	0.48974	.		0.552	KRT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257214.2	NM_000223	Intron	3	12	0	0	0	0	3	12				
SPPL2C	162540	broad.mit.edu	37	17	43924109	43924109	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr17:43924109G>A	ENST00000329196.5	+	1	1854	c.1837G>A	c.(1837-1839)Gag>Aag	p.E613K	MAPT-AS1_ENST00000579244.1_RNA|MAPT-AS1_ENST00000579599.1_RNA|MAPT-AS1_ENST00000581125.1_RNA	NM_175882.2	NP_787078.2	Q8IUH8	SPP2C_HUMAN	signal peptide peptidase like 2C	613						endoplasmic reticulum membrane (GO:0005789)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)	aspartic-type endopeptidase activity (GO:0004190)|protein homodimerization activity (GO:0042803)										GGATCCTAATGAGCTGCCCTT	0.592																																						uc010wka.1		NA																	0				pancreas(2)	2						c.(1837-1839)GAG>AAG		intramembrane protease 5 precursor							102.0	87.0	92.0					17																	43924109		2203	4300	6503	SO:0001583	missense	162540					integral to membrane	aspartic-type endopeptidase activity	g.chr17:43924109G>A		CCDS32673.1	17q21.31	2014-02-12			ENSG00000185294	ENSG00000185294			28902	protein-coding gene	gene with protein product	"""intramembrane protease 5"""	608284				12139484	Standard	NM_175882		Approved	IMP5	uc010wka.2	Q8IUH8		ENST00000329196.5:c.1837G>A	17.37:g.43924109G>A	ENSP00000332488:p.Glu613Lys		Somatic				LOC100128977_uc010wjz.1_Intron	p.E613K	NM_175882	NP_787078	WXS	Illumina HiSeq	Unspecified	Q8IUH8	IMP5_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.148)	1	1837	+	Colorectal(2;0.0416)		613			Extracellular (Potential).		Q8TC67|Q8WVZ6	Missense_Mutation	SNP	ENST00000329196.5	37	c.1837G>A	CCDS32673.1	.	.	.	.	.	.	.	.	.	.	G	14.27	2.485998	0.44147	.	.	ENSG00000185294	ENST00000329196	T	0.06608	3.28	4.79	3.82	0.43975	.	0.156884	0.29624	N	0.011638	T	0.05777	0.0151	L	0.29908	0.895	0.23050	N	0.998379	P	0.40970	0.734	B	0.40329	0.326	T	0.30765	-0.9967	10	0.41790	T	0.15	-20.1666	9.0647	0.36455	0.0995:0.0:0.9005:0.0	.	613	Q8IUH8	IMP5_HUMAN	K	613	ENSP00000332488:E613K	ENSP00000332488:E613K	E	+	1	0	AC217771.1	41279889	0.997000	0.39634	0.090000	0.20809	0.001000	0.01503	4.320000	0.59203	1.373000	0.46208	-0.136000	0.14681	GAG		0.592	SPPL2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441156.1	NM_175882		13	44	0	0	0	0	13	44				
HELZ	9931	broad.mit.edu	37	17	65083187	65083187	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr17:65083187C>G	ENST00000358691.5	-	32	5418	c.5252G>C	c.(5251-5253)aGa>aCa	p.R1751T	HELZ_ENST00000580168.1_Missense_Mutation_p.R1752T	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	1751						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					ACCAGGTCCTCTGGGCTCATA	0.428																																						uc010wqk.1		NA																	0				ovary(1)|pancreas(1)	2						c.(5254-5256)AGA>ACA		helicase with zinc finger domain							60.0	58.0	59.0					17																	65083187		1887	4100	5987	SO:0001583	missense	9931							g.chr17:65083187C>G	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.5252G>C	17.37:g.65083187C>G	ENSP00000351524:p.Arg1751Thr		Somatic				HELZ_uc002jfv.3_RNA|HELZ_uc002jfx.3_Missense_Mutation_p.R1751T	p.R1752T	NM_014877	NP_055692	WXS	Illumina HiSeq	Unspecified					32	5442	-	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)							I6L9H4	Missense_Mutation	SNP	ENST00000358691.5	37	c.5255G>C	CCDS42374.1	.	.	.	.	.	.	.	.	.	.	C	11.84	1.758611	0.31137	.	.	ENSG00000198265	ENST00000358691	D	0.91011	-2.77	5.89	4.93	0.64822	.	0.000000	0.85682	D	0.000000	D	0.92260	0.7545	L	0.32530	0.975	0.58432	D	0.999995	D;D	0.63880	0.993;0.993	D;D	0.72338	0.977;0.977	D	0.93202	0.6592	10	0.72032	D	0.01	-17.53	15.0135	0.71567	0.0:0.9319:0.0:0.0681	.	1752;1751	B7ZLW2;P42694	.;HELZ_HUMAN	T	1751	ENSP00000351524:R1751T	ENSP00000351524:R1751T	R	-	2	0	HELZ	62513649	1.000000	0.71417	1.000000	0.80357	0.651000	0.38670	7.168000	0.77570	1.498000	0.48600	-0.154000	0.13518	AGA		0.428	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	NM_014877		8	36	0	0	0	0	8	36				
CANT1	124583	broad.mit.edu	37	17	76989755	76989755	+	Silent	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr17:76989755G>C	ENST00000302345.2	-	4	1577	c.1083C>G	c.(1081-1083)ctC>ctG	p.L361L	CANT1_ENST00000591773.1_Silent_p.L361L|CANT1_ENST00000392446.5_Silent_p.L361L	NM_001159773.1|NM_138793.3	NP_001153245.1|NP_620148.1	Q8WVQ1	CANT1_HUMAN	calcium activated nucleotidase 1	361					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|proteoglycan biosynthetic process (GO:0030166)|signal transduction (GO:0007165)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|signal transducer activity (GO:0004871)|uridine-diphosphatase activity (GO:0045134)		CANT1/ETV4(3)	cervix(1)|endometrium(1)|large_intestine(2)|lung(10)|prostate(1)|skin(1)	16			BRCA - Breast invasive adenocarcinoma(99;0.0362)|OV - Ovarian serous cystadenocarcinoma(97;0.139)			CCTCGGATTTGAGGGCCACAA	0.607			T	ETV4	prostate						OREG0024788	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										uc002jwn.2		NA		Dom	yes		17	17q25	124583	T	calcium activated nucleotidase 1			E	ETV4		prostate		0					0						c.(1081-1083)CTC>CTG		calcium activated nucleotidase 1							103.0	86.0	92.0					17																	76989755		2203	4300	6503	SO:0001819	synonymous_variant	124583				positive regulation of I-kappaB kinase/NF-kappaB cascade	endoplasmic reticulum membrane|Golgi cisterna membrane|integral to membrane	calcium ion binding|nucleoside-diphosphatase activity|signal transducer activity	g.chr17:76989755G>C	AJ312208	CCDS11760.1	17q25.3	2008-02-05	2004-10-12	2004-10-15		ENSG00000171302			19721	protein-coding gene	gene with protein product	"""Soluble Ca-Activated Nucleotidase, isozyme 1"""	613165				12167635	Standard	NM_138793		Approved	SHAPY, SCAN-1	uc002jwk.3	Q8WVQ1		ENST00000302345.2:c.1083C>G	17.37:g.76989755G>C			Somatic	OREG0024788	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1172	CANT1_uc002jwk.2_Silent_p.L361L|CANT1_uc002jwj.2_Silent_p.L361L|CANT1_uc002jwl.2_Intron|CANT1_uc002jwm.1_RNA	p.L361L	NM_001159772	NP_001153244	WXS	Illumina HiSeq	Unspecified	Q8WVQ1	CANT1_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0362)|OV - Ovarian serous cystadenocarcinoma(97;0.139)		6	1522	-			361			Lumenal (Potential).		B4DJ54|Q7Z2J7|Q8NG05|Q8NHP0|Q9BSD5	Silent	SNP	ENST00000302345.2	37	c.1083C>G	CCDS11760.1																																																																																				0.607	CANT1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437723.2	NM_138793		9	55	0	0	0	0	9	55				
SMAD2	4087	broad.mit.edu	37	18	45374862	45374862	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr18:45374862C>G	ENST00000402690.2	-	8	1375	c.981G>C	c.(979-981)atG>atC	p.M327I	SMAD2_ENST00000586040.1_Missense_Mutation_p.M297I|SMAD2_ENST00000262160.6_Missense_Mutation_p.M327I|SMAD2_ENST00000591214.1_Missense_Mutation_p.M297I|SMAD2_ENST00000356825.4_Missense_Mutation_p.M297I	NM_001003652.3	NP_001003652.1	Q15796	SMAD2_HUMAN	SMAD family member 2	327	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|cell fate commitment (GO:0045165)|common-partner SMAD protein phosphorylation (GO:0007182)|developmental growth (GO:0048589)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic foregut morphogenesis (GO:0048617)|endoderm formation (GO:0001706)|gastrulation (GO:0007369)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|insulin secretion (GO:0030073)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|mesoderm formation (GO:0001707)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|nodal signaling pathway (GO:0038092)|organ growth (GO:0035265)|palate development (GO:0060021)|pancreas development (GO:0031016)|paraxial mesoderm morphogenesis (GO:0048340)|pericardium development (GO:0060039)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900224)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|primary miRNA processing (GO:0031053)|regulation of binding (GO:0051098)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to cholesterol (GO:0070723)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein complex assembly (GO:0007183)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|zygotic specification of dorsal/ventral axis (GO:0007352)	activin responsive factor complex (GO:0032444)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|SMAD2-SMAD3 protein complex (GO:0071144)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|co-SMAD binding (GO:0070410)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|phosphatase binding (GO:0019902)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|type I transforming growth factor beta receptor binding (GO:0034713)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(21)|liver(1)|lung(8)|prostate(2)|urinary_tract(1)	43						GCCTTCTTGTCATTTCTACCG	0.398																																						uc002lcy.2		NA																	0				large_intestine(3)|lung(1)|central_nervous_system(1)	5						c.(979-981)ATG>ATC		Sma- and Mad-related protein 2 isoform 1							112.0	107.0	109.0					18																	45374862		2203	4300	6503	SO:0001583	missense	4087				anterior/posterior pattern formation|cell fate commitment|common-partner SMAD protein phosphorylation|intracellular signal transduction|mesoderm formation|negative regulation of transcription, DNA-dependent|palate development|paraxial mesoderm morphogenesis|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription from RNA polymerase II promoter|primary miRNA processing|regulation of binding|regulation of transforming growth factor beta receptor signaling pathway|response to cholesterol|SMAD protein complex assembly|transforming growth factor beta receptor signaling pathway|zygotic specification of dorsal/ventral axis	activin responsive factor complex|cytosol	activating transcription factor binding|co-SMAD binding|double-stranded DNA binding|I-SMAD binding|R-SMAD binding|sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity|type I transforming growth factor beta receptor binding|ubiquitin protein ligase binding	g.chr18:45374862C>G	U65019	CCDS11934.1	18q21	2006-11-06	2006-11-06	2004-05-26	ENSG00000175387	ENSG00000175387		"""SMADs"""	6768	protein-coding gene	gene with protein product		601366	"""MAD, mothers against decapentaplegic homolog 2 (Drosophila)"", ""SMAD, mothers against DPP homolog 2 (Drosophila)"""	MADH2		8752209, 8673135	Standard	NM_001003652		Approved	MADR2, JV18-1	uc002lcz.4	Q15796	OTTHUMG00000132652	ENST00000402690.2:c.981G>C	18.37:g.45374862C>G	ENSP00000384449:p.Met327Ile		Somatic				SMAD2_uc002lcz.2_Missense_Mutation_p.M327I|SMAD2_uc010xdc.1_Missense_Mutation_p.M297I|SMAD2_uc010xdd.1_Missense_Mutation_p.M297I	p.M327I	NM_005901	NP_005892	WXS	Illumina HiSeq	Unspecified	Q15796	SMAD2_HUMAN			8	1229	-			327			MH2.			Missense_Mutation	SNP	ENST00000402690.2	37	c.981G>C	CCDS11934.1	.	.	.	.	.	.	.	.	.	.	C	16.66	3.183953	0.57800	.	.	ENSG00000175387	ENST00000262160;ENST00000356825;ENST00000402690	D;D;D	0.98701	-5.08;-5.08;-5.08	5.81	5.81	0.92471	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.96713	0.8927	L	0.29908	0.895	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	D	0.92860	0.6305	10	0.46703	T	0.11	.	20.0912	0.97820	0.0:1.0:0.0:0.0	.	297;297;327	B7Z5N5;Q15796-2;Q15796	.;.;SMAD2_HUMAN	I	327;297;327	ENSP00000262160:M327I;ENSP00000349282:M297I;ENSP00000384449:M327I	ENSP00000262160:M327I	M	-	3	0	SMAD2	43628860	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.818000	0.86416	2.746000	0.94184	0.591000	0.81541	ATG		0.398	SMAD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450571.1	NM_005901		7	64	0	0	0	0	7	64				
RPS15	6209	broad.mit.edu	37	19	1440120	1440120	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr19:1440120G>C	ENST00000586686.2	+	3	231	c.192G>C	c.(190-192)aaG>aaC	p.K64N	RPS15_ENST00000593052.1_Missense_Mutation_p.K71N|RPS15_ENST00000591804.2_Missense_Mutation_p.K31N|AC027307.3_ENST00000594262.1_5'Flank|RPS15_ENST00000586096.2_Missense_Mutation_p.K64N|RPS15_ENST00000585665.1_Missense_Mutation_p.K31N|RPS15_ENST00000233609.4_Missense_Mutation_p.K37N|RPS15_ENST00000589656.2_Missense_Mutation_p.K64N|RPS15_ENST00000591032.1_Missense_Mutation_p.K31N			P62841	RS15_HUMAN	ribosomal protein S15	64					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|osteoblast differentiation (GO:0001649)|ribosomal small subunit biogenesis (GO:0042274)|ribosomal small subunit export from nucleus (GO:0000056)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.K64K(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCAAGGCCAAGAAGGAGGCGC	0.662																																					Ovarian(170;79 2680 5719 44260)	uc002lsp.1		NA																	1	Substitution - coding silent(1)		urinary_tract(1)		0						c.(190-192)AAG>AAC		ribosomal protein S15							11.0	15.0	14.0					19																	1440120		2188	4283	6471	SO:0001583	missense	6209				endocrine pancreas development|ribosomal small subunit export from nucleus|rRNA processing|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleoplasm	DNA binding|protein binding|RNA binding	g.chr19:1440120G>C		CCDS12067.1	19p13.3	2012-12-20			ENSG00000115268	ENSG00000115268		"""S ribosomal proteins"""	10388	protein-coding gene	gene with protein product	"""40S ribosomal protein S15"", ""homolog of rat insulinoma"", ""insulinoma protein"""	180535				2159154	Standard	NM_001018		Approved	RIG, MGC111130, S15	uc002lsp.1	P62841	OTTHUMG00000140099	ENST00000586686.2:c.192G>C	19.37:g.1440120G>C	ENSP00000467676:p.Lys64Asn		Somatic				RPS15_uc002lsq.1_Missense_Mutation_p.K71N	p.K64N	NM_001018	NP_001009	WXS	Illumina HiSeq	Unspecified	P62841	RS15_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	3	254	+		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)	64					A5D8V9|P11174|Q3KRA1|Q9UDC2	Missense_Mutation	SNP	ENST00000586686.2	37	c.192G>C	CCDS12067.1	.	.	.	.	.	.	.	.	.	.	G	16.95	3.263552	0.59431	.	.	ENSG00000115268	ENST00000233609	.	.	.	4.4	0.867	0.19085	Ribosomal protein S19, superfamily (2);	0.000000	0.85682	U	0.000000	T	0.68668	0.3026	M	0.66378	2.025	0.80722	D	1	D	0.61080	0.989	D	0.71184	0.972	T	0.67417	-0.5676	9	0.72032	D	0.01	-24.0352	9.4845	0.38922	0.2374:0.0:0.7626:0.0	.	64	P62841	RS15_HUMAN	N	64	.	ENSP00000233609:K64N	K	+	3	2	RPS15	1391120	1.000000	0.71417	0.999000	0.59377	0.416000	0.31233	1.559000	0.36320	0.065000	0.16485	0.609000	0.83330	AAG		0.662	RPS15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449609.4	NM_001018		3	17	0	0	0	0	3	17				
LMNB2	84823	broad.mit.edu	37	19	2444431	2444431	+	Silent	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr19:2444431C>G	ENST00000582871.1	-	2	398	c.312G>C	c.(310-312)ctG>ctC	p.L104L	LMNB2_ENST00000325327.3_Silent_p.L124L	NM_032737.3	NP_116126.3	Q03252	LMNB2_HUMAN	lamin B2	104	Coil 1B.|Rod.					lamin filament (GO:0005638)|nuclear inner membrane (GO:0005637)	structural molecule activity (GO:0005198)			NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACTCTGCCCTCAGCTTCCCAA	0.652																																						uc002lvy.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(310-312)CTG>CTC		lamin B2							178.0	109.0	133.0					19																	2444431		2203	4300	6503	SO:0001819	synonymous_variant	84823					nuclear inner membrane	structural molecule activity	g.chr19:2444431C>G	M94362	CCDS12090.1, CCDS12090.2	19p13.3	2013-01-16			ENSG00000176619	ENSG00000176619		"""Intermediate filaments type V, lamins"""	6638	protein-coding gene	gene with protein product		150341		LMN2		1630457	Standard	NM_032737		Approved		uc002lvy.4	Q03252	OTTHUMG00000150626	ENST00000582871.1:c.312G>C	19.37:g.2444431C>G			Somatic				LMNB2_uc002lwa.1_Silent_p.L124L	p.L104L	NM_032737	NP_116126	WXS	Illumina HiSeq	Unspecified	Q03252	LMNB2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	2	399	-		Hepatocellular(1079;0.137)	104			Rod.|Coil 1B.		O75292|Q14734|Q96DF6	Silent	SNP	ENST00000582871.1	37	c.312G>C																																																																																					0.652	LMNB2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_032737		6	41	0	0	0	0	6	41				
LRG1	116844	broad.mit.edu	37	19	4538721	4538721	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr19:4538721G>C	ENST00000306390.6	-	2	735	c.275C>G	c.(274-276)tCt>tGt	p.S92C	CTB-50L17.14_ENST00000586020.1_Intron|LRG1_ENST00000586883.1_5'UTR	NM_052972.2	NP_443204.1	P02750	A2GL_HUMAN	leucine-rich alpha-2-glycoprotein 1	92					brown fat cell differentiation (GO:0050873)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				NS(1)|endometrium(2)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	13		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		TTGGAGCTTAGAGGCGCCCTG	0.627																																						uc002mau.2		NA																	0				ovary(1)	1						c.(274-276)TCT>TGT		leucine-rich alpha-2-glycoprotein 1 precursor							38.0	36.0	37.0					19																	4538721		2203	4300	6503	SO:0001583	missense	116844					extracellular region|membrane		g.chr19:4538721G>C		CCDS12130.1	19p13.3	2013-09-20			ENSG00000171236	ENSG00000171236			29480	protein-coding gene	gene with protein product	"""leucine rich alpha 2 glycoprotein"""	611289				3856868, 12223515	Standard	NM_052972		Approved	LRG	uc002mau.3	P02750	OTTHUMG00000182010	ENST00000306390.6:c.275C>G	19.37:g.4538721G>C	ENSP00000302621:p.Ser92Cys		Somatic				PLIN5_uc002mat.1_Intron	p.S92C	NM_052972	NP_443204	WXS	Illumina HiSeq	Unspecified	P02750	A2GL_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)	2	286	-		Hepatocellular(1079;0.137)	92					Q8N4F5|Q96QZ4	Missense_Mutation	SNP	ENST00000306390.6	37	c.275C>G	CCDS12130.1	.	.	.	.	.	.	.	.	.	.	.	13.52	2.263217	0.39995	.	.	ENSG00000171236	ENST00000306390;ENST00000538589	T	0.02709	4.19	4.71	4.71	0.59529	.	1.319620	0.05535	N	0.564580	T	0.11196	0.0273	M	0.84511	2.7	0.09310	N	1	D	0.53151	0.958	P	0.46339	0.513	T	0.37572	-0.9700	10	0.62326	D	0.03	-2.2987	13.0078	0.58715	0.0:0.0:1.0:0.0	.	92	P02750	A2GL_HUMAN	C	92	ENSP00000302621:S92C	ENSP00000302621:S92C	S	-	2	0	LRG1	4489721	0.001000	0.12720	0.004000	0.12327	0.095000	0.18619	0.839000	0.27586	2.446000	0.82766	0.655000	0.94253	TCT		0.627	LRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458654.2	NM_052972		6	29	0	0	0	0	6	29				
COL5A3	50509	broad.mit.edu	37	19	10080263	10080263	+	Silent	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr19:10080263G>A	ENST00000264828.3	-	56	4171	c.4086C>T	c.(4084-4086)atC>atT	p.I1362I		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	1362	Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			CAGGGCCAGGGATCCCTCGAA	0.672																																						uc002mmq.1		NA																	0				ovary(7)|lung(1)|central_nervous_system(1)|skin(1)	10						c.(4084-4086)ATC>ATT		collagen, type V, alpha 3 preproprotein							23.0	27.0	25.0					19																	10080263		2203	4297	6500	SO:0001819	synonymous_variant	50509				collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent	g.chr19:10080263G>A	AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.4086C>T	19.37:g.10080263G>A			Somatic					p.I1362I	NM_015719	NP_056534	WXS	Illumina HiSeq	Unspecified	P25940	CO5A3_HUMAN	Epithelial(33;7.11e-05)		56	4172	-			1362			Triple-helical region.		Q9NZQ6	Silent	SNP	ENST00000264828.3	37	c.4086C>T	CCDS12222.1																																																																																				0.672	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315788.1	NM_015719		3	23	0	0	0	0	3	23				
DOCK6	57572	broad.mit.edu	37	19	11333759	11333759	+	Silent	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr19:11333759G>C	ENST00000294618.7	-	25	2990	c.2979C>G	c.(2977-2979)ctC>ctG	p.L993L	DOCK6_ENST00000319867.7_Silent_p.L332L	NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	993					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						GGCTGGCGTTGAGGTGCTCGG	0.617																																						uc002mqs.3		NA																	0				ovary(2)|skin(1)	3						c.(2977-2979)CTC>CTG		dedicator of cytokinesis 6							45.0	52.0	50.0					19																	11333759		2111	4226	6337	SO:0001819	synonymous_variant	57572				blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity	g.chr19:11333759G>C		CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.2979C>G	19.37:g.11333759G>C			Somatic				DOCK6_uc010xlq.1_Silent_p.L332L	p.L993L	NM_020812	NP_065863	WXS	Illumina HiSeq	Unspecified	Q96HP0	DOCK6_HUMAN			25	3020	-			993					A6H8X5|Q7Z7P4|Q9P2F2	Silent	SNP	ENST00000294618.7	37	c.2979C>G	CCDS45975.1																																																																																				0.617	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453155.1	NM_020812		6	74	0	0	0	0	6	74				
DNAJB1	3337	broad.mit.edu	37	19	14627500	14627500	+	Silent	SNP	T	T	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr19:14627500T>C	ENST00000254322.2	-	2	640	c.570A>G	c.(568-570)ctA>ctG	p.L190L	DNAJB1_ENST00000396969.4_Silent_p.L90L	NM_006145.1	NP_006136.1	P25685	DNJB1_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 1	190					chaperone cofactor-dependent protein refolding (GO:0070389)|chaperone mediated protein folding requiring cofactor (GO:0051085)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of ATPase activity (GO:0032781)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|unfolded protein binding (GO:0051082)	p.L190L(1)		NS(1)|breast(1)|cervix(3)|endometrium(1)|kidney(1)|lung(7)|prostate(1)|urinary_tract(1)	16				GBM - Glioblastoma multiforme(1328;0.0476)		CGTCGGGGTTTAGCCGCTTGT	0.483																																						uc002myz.1		NA																	1	Substitution - coding silent(1)		prostate(1)		0						c.(568-570)CTA>CTG		DnaJ (Hsp40) homolog, subfamily B, member 1							168.0	167.0	168.0					19																	14627500		2203	4300	6503	SO:0001819	synonymous_variant	3337				chaperone cofactor-dependent protein refolding|response to unfolded protein	cytoplasm|nucleolus	heat shock protein binding|unfolded protein binding	g.chr19:14627500T>C	D49547	CCDS12312.1, CCDS74295.1	19p13.12	2014-08-12			ENSG00000132002	ENSG00000132002		"""Heat shock proteins / DNAJ (HSP40)"""	5270	protein-coding gene	gene with protein product	"""radial spoke 16 homolog B (Chlamydomonas)"""	604572		HSPF1		8975727, 8250930	Standard	XM_006722733		Approved	Hsp40, Sis1, RSPH16B	uc002myz.1	P25685	OTTHUMG00000183289	ENST00000254322.2:c.570A>G	19.37:g.14627500T>C			Somatic				DNAJB1_uc010xnr.1_Silent_p.L90L	p.L190L	NM_006145	NP_006136	WXS	Illumina HiSeq	Unspecified	P25685	DNJB1_HUMAN		GBM - Glioblastoma multiforme(1328;0.0476)	2	610	-			190					B4DX52	Silent	SNP	ENST00000254322.2	37	c.570A>G	CCDS12312.1																																																																																				0.483	DNAJB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465987.1	NM_006145		4	302	0	0	0	0	4	302				
C19orf44	84167	broad.mit.edu	37	19	16614078	16614078	+	Nonsense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr19:16614078C>G	ENST00000221671.3	+	3	1118	c.962C>G	c.(961-963)tCa>tGa	p.S321*	C19orf44_ENST00000594035.1_Nonsense_Mutation_p.S321*|CTD-3222D19.2_ENST00000409035.1_Intron	NM_032207.2	NP_115583.1	Q9H6X5	CS044_HUMAN	chromosome 19 open reading frame 44	321										endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	16						GGCGCCTTTTCAAACTCAGTG	0.552																																						uc002neh.1		NA																	0					0						c.(961-963)TCA>TGA		hypothetical protein LOC84167							89.0	89.0	89.0					19																	16614078		2203	4300	6503	SO:0001587	stop_gained	84167							g.chr19:16614078C>G	AK025395	CCDS12345.1, CCDS74306.1	19p13.11	2011-11-24			ENSG00000105072	ENSG00000105072			26141	protein-coding gene	gene with protein product						12477932	Standard	NM_032207		Approved	FLJ21742	uc002neh.1	Q9H6X5		ENST00000221671.3:c.962C>G	19.37:g.16614078C>G	ENSP00000221671:p.Ser321*		Somatic				MED26_uc002nee.2_Intron|C19orf44_uc002nef.1_Nonsense_Mutation_p.S321*|C19orf44_uc002neg.2_Nonsense_Mutation_p.S321*|C19orf44_uc010eai.1_RNA	p.S321*	NM_032207	NP_115583	WXS	Illumina HiSeq	Unspecified	Q9H6X5	CS044_HUMAN			3	1035	+			321					Q8N6Y7	Nonsense_Mutation	SNP	ENST00000221671.3	37	c.962C>G	CCDS12345.1	.	.	.	.	.	.	.	.	.	.	C	19.54	3.846357	0.71603	.	.	ENSG00000105072	ENST00000221671	.	.	.	4.34	-0.468	0.12146	.	1.074830	0.07249	N	0.865592	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-0.0126	4.0939	0.09982	0.0:0.5185:0.1736:0.3079	.	.	.	.	X	321	.	ENSP00000221671:S321X	S	+	2	0	C19orf44	16475078	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.020000	0.12525	-0.263000	0.09378	0.655000	0.94253	TCA		0.552	C19orf44-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461218.1	NM_032207		12	111	0	0	0	0	12	111				
NXNL1	115861	broad.mit.edu	37	19	17571473	17571473	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr19:17571473C>T	ENST00000301944.2	-	1	290	c.206G>A	c.(205-207)cGg>cAg	p.R69Q	CTD-2521M24.10_ENST00000594663.1_5'UTR	NM_138454.1	NP_612463.1	Q96CM4	NXNL1_HUMAN	nucleoredoxin-like 1	69	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				photoreceptor cell maintenance (GO:0045494)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	6						CTGAGCCGCCCGCAGTACATA	0.587																																						uc002ngs.2		NA																	0					0						c.(205-207)CGG>CAG		nucleoredoxin-like 1							77.0	71.0	73.0					19																	17571473		2203	4300	6503	SO:0001583	missense	115861				cell redox homeostasis	nuclear outer membrane		g.chr19:17571473C>T	BC014127	CCDS12360.1	19p13.11	2014-05-21	2007-08-16	2007-08-16	ENSG00000171773	ENSG00000171773			25179	protein-coding gene	gene with protein product		608791	"""thioredoxin-like 6"""	TXNL6		12477932	Standard	NM_138454		Approved	RDCVF	uc002ngs.3	Q96CM4	OTTHUMG00000182798	ENST00000301944.2:c.206G>A	19.37:g.17571473C>T	ENSP00000305631:p.Arg69Gln		Somatic					p.R69Q	NM_138454	NP_612463	WXS	Illumina HiSeq	Unspecified	Q96CM4	NXNL1_HUMAN			1	253	-			69			Thioredoxin.		Q0QD37	Missense_Mutation	SNP	ENST00000301944.2	37	c.206G>A	CCDS12360.1	.	.	.	.	.	.	.	.	.	.	c	13.84	2.358295	0.41801	.	.	ENSG00000171773	ENST00000301944	D	0.85171	-1.95	3.92	3.92	0.45320	Thioredoxin-like fold (3);	0.125624	0.53938	D	0.000043	D	0.88858	0.6551	L	0.55990	1.75	0.26621	N	0.972649	D	0.89917	1.0	D	0.72625	0.978	T	0.81031	-0.1117	10	0.27082	T	0.32	-32.2419	13.4448	0.61134	0.0:1.0:0.0:0.0	.	69	Q96CM4	NXNL1_HUMAN	Q	69	ENSP00000305631:R69Q	ENSP00000305631:R69Q	R	-	2	0	NXNL1	17432473	1.000000	0.71417	0.987000	0.45799	0.216000	0.24613	4.537000	0.60643	2.018000	0.59344	0.467000	0.42956	CGG		0.587	NXNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463803.1	NM_138454		15	59	0	0	0	0	15	59				
UPF1	5976	broad.mit.edu	37	19	18943117	18943117	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr19:18943117C>G	ENST00000599848.1	+	1	308	c.99C>G	c.(97-99)ttC>ttG	p.F33L	UPF1_ENST00000262803.5_Missense_Mutation_p.F33L			Q92900	RENT1_HUMAN	UPF1 regulator of nonsense transcripts homolog (yeast)	33	Sufficient for interaction with RENT2.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|dosage compensation by inactivation of X chromosome (GO:0009048)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40						GCTCCGAGTTCGAGTTCACCG	0.731																																						uc002nkg.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(97-99)TTC>TTG		regulator of nonsense transcripts 1							52.0	54.0	54.0					19																	18943117		2203	4300	6503	SO:0001583	missense	5976				cell cycle|DNA repair|DNA replication|histone mRNA catabolic process|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational termination	chromatin|cytoplasmic mRNA processing body|exon-exon junction complex	ATP binding|ATP-dependent RNA helicase activity|chromatin binding|DNA binding|protein binding|protein binding|RNA binding|zinc ion binding	g.chr19:18943117C>G	AF074016	CCDS12386.1, CCDS74315.1	19p13.2-p13.11	2012-02-29	2006-02-07	2006-02-07	ENSG00000005007	ENSG00000005007			9962	protein-coding gene	gene with protein product	"""UP Frameshift 1"", ""smg-2 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	601430	"""regulator of nonsense transcripts 1"""	RENT1		8855285, 9064659	Standard	XM_005260015		Approved	HUPF1, KIAA0221, NORF1, pNORF1, smg-2	uc002nkf.3	Q92900		ENST00000599848.1:c.99C>G	19.37:g.18943117C>G	ENSP00000470142:p.Phe33Leu		Somatic				UPF1_uc002nkf.2_Missense_Mutation_p.F33L	p.F33L	NM_002911	NP_002902	WXS	Illumina HiSeq	Unspecified	Q92900	RENT1_HUMAN			1	374	+			33			Sufficient for interaction with RENT2.		O00239|O43343|Q86Z25|Q92842	Missense_Mutation	SNP	ENST00000599848.1	37	c.99C>G		.	.	.	.	.	.	.	.	.	.	C	13.52	2.260410	0.39995	.	.	ENSG00000005007	ENST00000262803	D	0.91740	-2.9	3.92	1.74	0.24563	.	0.409080	0.26646	U	0.023229	D	0.84110	0.5400	N	0.24115	0.695	0.48452	D	0.999653	B;B	0.32160	0.154;0.358	B;B	0.33846	0.056;0.171	T	0.77485	-0.2570	10	0.72032	D	0.01	-12.0367	6.8017	0.23754	0.0:0.7004:0.0:0.2996	.	33;33	Q92900;Q92900-2	RENT1_HUMAN;.	L	33	ENSP00000262803:F33L	ENSP00000262803:F33L	F	+	3	2	UPF1	18804117	1.000000	0.71417	0.995000	0.50966	0.127000	0.20565	1.064000	0.30579	0.176000	0.19873	0.499000	0.49734	TTC		0.731	UPF1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000464684.1	NM_002911		21	69	0	0	0	0	21	69				
ZNF90	7643	broad.mit.edu	37	19	20229332	20229332	+	Silent	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr19:20229332G>A	ENST00000418063.2	+	4	1081	c.969G>A	c.(967-969)aaG>aaA	p.K323K	ZNF90_ENST00000474284.1_Intron	NM_007138.1	NP_009069.1	Q03938	ZNF90_HUMAN	zinc finger protein 90	323					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|lung(2)|ovary(1)|skin(1)	5						AAGCCTTCAAGCTCTCCTCAA	0.418																																						uc002nor.2		NA																	0				ovary(1)|skin(1)	2						c.(967-969)AAG>AAA		zinc finger protein 90							34.0	32.0	33.0					19																	20229332		692	1591	2283	SO:0001819	synonymous_variant	7643					Golgi apparatus|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:20229332G>A	M61870	CCDS46028.1	19p12	2013-01-08	2006-02-01		ENSG00000213988	ENSG00000213988		"""Zinc fingers, C2H2-type"", ""-"""	13165	protein-coding gene	gene with protein product		603973	"""zinc finger protein 90 (HTF9)"""			8467795	Standard	NM_007138		Approved	HTF9	uc002nor.2	Q03938	OTTHUMG00000158057	ENST00000418063.2:c.969G>A	19.37:g.20229332G>A			Somatic				ZNF90_uc002nos.1_Intron|ZNF90_uc002not.1_Intron	p.K323K	NM_007138	NP_009069	WXS	Illumina HiSeq	Unspecified	Q03938	ZNF90_HUMAN			4	1108	+			323			C2H2-type 6.		B9EH87	Silent	SNP	ENST00000418063.2	37	c.969G>A	CCDS46028.1																																																																																				0.418	ZNF90-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350101.1	NM_007138		5	36	0	0	0	0	5	36				
ZNF429	353088	broad.mit.edu	37	19	21720644	21720644	+	Missense_Mutation	SNP	G	G	C	rs568675273		TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr19:21720644G>C	ENST00000358491.4	+	4	1997	c.1789G>C	c.(1789-1791)Gaa>Caa	p.E597Q	ZNF429_ENST00000597078.1_Intron	NM_001001415.2	NP_001001415.2	Q86V71	ZN429_HUMAN	zinc finger protein 429	597					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(13)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	34						CAAATGTGAAGAATGTGGCAA	0.358																																						uc002nqd.1		NA																	0				ovary(2)	2						c.(1789-1791)GAA>CAA		zinc finger protein 429							51.0	56.0	54.0					19																	21720644		2091	4257	6348	SO:0001583	missense	353088				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:21720644G>C	AY269786	CCDS42537.1	19p12	2014-02-14			ENSG00000197013	ENSG00000197013		"""Zinc fingers, C2H2-type"", ""-"""	20817	protein-coding gene	gene with protein product							Standard	NM_001001415		Approved		uc002nqd.1	Q86V71	OTTHUMG00000182848	ENST00000358491.4:c.1789G>C	19.37:g.21720644G>C	ENSP00000351280:p.Glu597Gln		Somatic				ZNF429_uc010ecu.1_Intron	p.E597Q	NM_001001415	NP_001001415	WXS	Illumina HiSeq	Unspecified	Q86V71	ZN429_HUMAN			4	1926	+			597			C2H2-type 17.		A6NLV7|Q9BZE6	Missense_Mutation	SNP	ENST00000358491.4	37	c.1789G>C	CCDS42537.1	.	.	.	.	.	.	.	.	.	.	.	5.880	0.346422	0.11126	.	.	ENSG00000197013	ENST00000358491	T	0.07444	3.19	1.09	-2.18	0.07037	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05364	0.0142	N	0.26042	0.785	0.09310	N	1	B	0.15473	0.013	B	0.12156	0.007	T	0.38845	-0.9642	9	0.45353	T	0.12	.	5.2753	0.15645	0.0:0.211:0.5778:0.2112	.	597	Q86V71	ZN429_HUMAN	Q	597	ENSP00000351280:E597Q	ENSP00000351280:E597Q	E	+	1	0	ZNF429	21512484	0.000000	0.05858	0.002000	0.10522	0.147000	0.21601	-0.406000	0.07187	-0.458000	0.07023	0.298000	0.19748	GAA		0.358	ZNF429-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463981.1	NM_001001415		6	58	0	0	0	0	6	58				
ZNF681	148213	broad.mit.edu	37	19	23927132	23927132	+	Nonsense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr19:23927132G>C	ENST00000402377.3	-	4	1361	c.1220C>G	c.(1219-1221)tCa>tGa	p.S407*	ZNF681_ENST00000395385.3_Nonsense_Mutation_p.S338*	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	407					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S338L(1)|p.S407L(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				AGTAAGGTGTGAGGACTTGTT	0.398																																						uc002nrk.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1219-1221)TCA>TGA		zinc finger protein 681							67.0	71.0	70.0					19																	23927132		2203	4300	6503	SO:0001587	stop_gained	148213				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:23927132G>C	AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.1220C>G	19.37:g.23927132G>C	ENSP00000384000:p.Ser407*		Somatic				ZNF681_uc002nrl.3_Nonsense_Mutation_p.S338*|ZNF681_uc002nrj.3_Nonsense_Mutation_p.S338*	p.S407*	NM_138286	NP_612143	WXS	Illumina HiSeq	Unspecified	Q96N22	ZN681_HUMAN			4	1362	-		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)	407			C2H2-type 9.		B3KVF7	Nonsense_Mutation	SNP	ENST00000402377.3	37	c.1220C>G	CCDS12414.2	.	.	.	.	.	.	.	.	.	.	.	14.60	2.584528	0.46110	.	.	ENSG00000196172	ENST00000402377;ENST00000395385	.	.	.	1.51	1.51	0.23008	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	8.4797	0.33034	0.0:0.0:1.0:0.0	.	.	.	.	X	407;338	.	ENSP00000378783:S338X	S	-	2	0	ZNF681	23718972	0.009000	0.17119	0.004000	0.12327	0.003000	0.03518	0.622000	0.24433	0.798000	0.33994	0.313000	0.20887	TCA		0.398	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320248.2	NM_138286		8	71	0	0	0	0	8	71				
ZNF536	9745	broad.mit.edu	37	19	31039498	31039498	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr19:31039498C>G	ENST00000355537.3	+	4	3119	c.2972C>G	c.(2971-2973)tCg>tGg	p.S991W		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	991					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					CCGGGCTCCTCGGTAACTGTG	0.577																																						uc002nsu.1		NA																	0				ovary(7)|large_intestine(2)|skin(2)	11						c.(2971-2973)TCG>TGG		zinc finger protein 536							70.0	72.0	71.0					19																	31039498		2203	4300	6503	SO:0001583	missense	9745				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr19:31039498C>G		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.2972C>G	19.37:g.31039498C>G	ENSP00000347730:p.Ser991Trp		Somatic				ZNF536_uc010edd.1_Missense_Mutation_p.S991W	p.S991W	NM_014717	NP_055532	WXS	Illumina HiSeq	Unspecified	O15090	ZN536_HUMAN			4	3110	+	Esophageal squamous(110;0.0834)		991					A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	c.2972C>G	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	C	15.51	2.854332	0.51270	.	.	ENSG00000198597	ENST00000355537	T	0.11712	2.75	5.67	4.62	0.57501	.	0.180834	0.50627	D	0.000108	T	0.13628	0.0330	N	0.19112	0.55	0.80722	D	1	D;D	0.61697	0.99;0.99	P;P	0.51453	0.67;0.67	T	0.03739	-1.1008	10	0.87932	D	0	-6.2601	15.8772	0.79173	0.1367:0.8632:0.0:0.0	.	991;991	A7E228;O15090	.;ZN536_HUMAN	W	991	ENSP00000347730:S991W	ENSP00000347730:S991W	S	+	2	0	ZNF536	35731338	0.999000	0.42202	0.490000	0.27465	0.933000	0.57130	4.524000	0.60552	1.353000	0.45828	0.561000	0.74099	TCG		0.577	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		10	68	0	0	0	0	10	68				
GPATCH1	55094	broad.mit.edu	37	19	33592477	33592477	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr19:33592477G>C	ENST00000170564.2	+	9	1391	c.1077G>C	c.(1075-1077)aaG>aaC	p.K359N		NM_018025.2	NP_060495.2	Q9BRR8	GPTC1_HUMAN	G patch domain containing 1	359					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	nucleic acid binding (GO:0003676)			breast(4)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|prostate(4)|skin(4)	40	Esophageal squamous(110;0.137)					TATCTTCTAAGAAAGTAAGAA	0.303																																					Pancreas(67;88 1713 4567 18227)	uc002nug.1		NA																	0				skin(1)	1						c.(1075-1077)AAG>AAC		G patch domain containing 1							89.0	86.0	87.0					19																	33592477		2203	4299	6502	SO:0001583	missense	55094					catalytic step 2 spliceosome	nucleic acid binding	g.chr19:33592477G>C	AF434677	CCDS12428.1	19q13.12	2013-01-28		2006-12-13		ENSG00000076650		"""G patch domain containing"""	24658	protein-coding gene	gene with protein product	"""evolutionarily conserved G patch domain containing"""			GPATC1		12477932	Standard	NM_018025		Approved	ECGP, FLJ10206, FLJ38686	uc002nug.1	Q9BRR8		ENST00000170564.2:c.1077G>C	19.37:g.33592477G>C	ENSP00000170564:p.Lys359Asn		Somatic					p.K359N	NM_018025	NP_060495	WXS	Illumina HiSeq	Unspecified	Q9BRR8	GPTC1_HUMAN			9	1391	+	Esophageal squamous(110;0.137)		359					Q8IZV6|Q8N3B7|Q9NW94	Missense_Mutation	SNP	ENST00000170564.2	37	c.1077G>C	CCDS12428.1	.	.	.	.	.	.	.	.	.	.	G	13.50	2.255082	0.39896	.	.	ENSG00000076650	ENST00000170564	T	0.13420	2.59	5.64	3.51	0.40186	.	0.084763	0.85682	D	0.000000	T	0.10165	0.0249	L	0.39692	1.235	0.80722	D	1	B	0.20671	0.047	B	0.17098	0.017	T	0.15321	-1.0441	10	0.16896	T	0.51	-24.5679	8.2958	0.31984	0.1476:0.1376:0.7147:0.0	.	359	Q9BRR8	GPTC1_HUMAN	N	359	ENSP00000170564:K359N	ENSP00000170564:K359N	K	+	3	2	GPATCH1	38284317	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.407000	0.34657	0.854000	0.35336	0.643000	0.83706	AAG		0.303	GPATCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450834.1	NM_018025		9	48	0	0	0	0	9	48				
PDCD2L	84306	broad.mit.edu	37	19	34912556	34912556	+	Silent	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr19:34912556C>G	ENST00000246535.3	+	6	977	c.930C>G	c.(928-930)ctC>ctG	p.L310L	RN7SL154P_ENST00000578043.1_RNA|PDCD2L_ENST00000587065.2_Silent_p.L8L	NM_032346.1	NP_115722.1	Q9BRP1	PDD2L_HUMAN	programmed cell death 2-like	310					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|membrane (GO:0016020)				breast(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			TCAGCATGCTCAAGAGTGCTA	0.408																																						uc002nvj.2		NA																	0				ovary(1)	1						c.(928-930)CTC>CTG		programmed cell death 2-like							117.0	120.0	119.0					19																	34912556		2203	4300	6503	SO:0001819	synonymous_variant	84306					cytoplasm		g.chr19:34912556C>G	BC006146	CCDS12438.1	19q13.11	2008-02-05				ENSG00000126249			28194	protein-coding gene	gene with protein product		615661				16311922	Standard	NM_032346		Approved	MGC13096	uc002nvj.3	Q9BRP1		ENST00000246535.3:c.930C>G	19.37:g.34912556C>G			Somatic					p.L310L	NM_032346	NP_115722	WXS	Illumina HiSeq	Unspecified	Q9BRP1	PDD2L_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.211)		6	963	+	Esophageal squamous(110;0.162)		310						Silent	SNP	ENST00000246535.3	37	c.930C>G	CCDS12438.1																																																																																				0.408	PDCD2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459251.3	NM_032346		13	102	0	0	0	0	13	102				
WDR62	284403	broad.mit.edu	37	19	36594781	36594781	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr19:36594781C>G	ENST00000270301.7	+	30	4036	c.4036C>G	c.(4036-4038)Cct>Gct	p.P1346A	WDR62_ENST00000401500.2_Missense_Mutation_p.P1351A			O43379	WDR62_HUMAN	WD repeat domain 62	1346					cerebral cortex development (GO:0021987)|neurogenesis (GO:0022008)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle pole (GO:0000922)				cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(15)|prostate(4)|stomach(2)|urinary_tract(3)	43	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			TCTCCCAGCTCCTGAGTCCCC	0.687																																						uc002odc.2		NA																	0					0						c.(4036-4038)CCT>GCT		WD repeat domain 62 isoform 2							47.0	49.0	48.0					19																	36594781		2203	4300	6503	SO:0001583	missense	284403				cerebral cortex development	nucleus		g.chr19:36594781C>G	BX647726	CCDS33001.1, CCDS46059.1	19q13.12	2013-01-09	2005-05-09	2005-05-09	ENSG00000075702	ENSG00000075702		"""WD repeat domain containing"""	24502	protein-coding gene	gene with protein product		613583	"""chromosome 19 open reading frame 14"", ""microcephaly, primary autosomal recessive 2"""	C19orf14, MCPH2		19910486, 20729831, 20890278, 21496009	Standard	NM_001083961		Approved	DKFZP434J046, FLJ33298	uc002odd.2	O43379	OTTHUMG00000048139	ENST00000270301.7:c.4036C>G	19.37:g.36594781C>G	ENSP00000270301:p.Pro1346Ala		Somatic				WDR62_uc002odd.2_Missense_Mutation_p.P1351A	p.P1346A	NM_173636	NP_775907	WXS	Illumina HiSeq	Unspecified	O43379	WDR62_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.06)		30	4127	+	Esophageal squamous(110;0.162)		1346					Q63HP9|Q659D7|Q8NBF7|Q96AD9	Missense_Mutation	SNP	ENST00000270301.7	37	c.4036C>G	CCDS33001.1	.	.	.	.	.	.	.	.	.	.	C	5.625	0.300076	0.10622	.	.	ENSG00000075702	ENST00000401500;ENST00000270301	T;T	0.42900	1.05;0.96	4.96	-2.9	0.05648	.	0.618704	0.15355	N	0.266733	T	0.19167	0.0460	L	0.32530	0.975	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.27157	-1.0082	10	0.07644	T	0.81	0.2338	1.2322	0.01946	0.1445:0.3539:0.1415:0.3601	.	1351;1346	O43379-4;O43379	.;WDR62_HUMAN	A	1351;1346	ENSP00000384792:P1351A;ENSP00000270301:P1346A	ENSP00000270301:P1346A	P	+	1	0	WDR62	41286621	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.892000	0.04131	-0.574000	0.05990	-0.474000	0.04947	CCT		0.687	WDR62-006	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457436.1	NM_015671		8	60	0	0	0	0	8	60				
ZNF574	64763	broad.mit.edu	37	19	42584276	42584276	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr19:42584276G>C	ENST00000600245.1	+	2	2173	c.1518G>C	c.(1516-1518)aaG>aaC	p.K506N	ZNF574_ENST00000359044.4_Missense_Mutation_p.K506N|ZNF574_ENST00000222339.7_Missense_Mutation_p.K596N|CTB-59C6.3_ENST00000594531.1_RNA			Q6ZN55	ZN574_HUMAN	zinc finger protein 574	506					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20		Prostate(69;0.059)				TGTTCAAGAAGAAGTCTCACG	0.582																																						uc002osm.3		NA																	0					0						c.(1516-1518)AAG>AAC		zinc finger protein 574							157.0	174.0	168.0					19																	42584276		2203	4300	6503	SO:0001583	missense	64763				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:42584276G>C	AK074788	CCDS12596.1	19q13.2	2013-09-20			ENSG00000105732	ENSG00000105732		"""Zinc fingers, C2H2-type"""	26166	protein-coding gene	gene with protein product						12477932	Standard	NM_022752		Approved	FLJ22059	uc002osm.4	Q6ZN55	OTTHUMG00000182751	ENST00000600245.1:c.1518G>C	19.37:g.42584276G>C	ENSP00000469029:p.Lys506Asn		Somatic				ZNF574_uc002osk.3_Missense_Mutation_p.K596N	p.K506N	NM_022752	NP_073589	WXS	Illumina HiSeq	Unspecified	Q6ZN55	ZN574_HUMAN			2	1687	+		Prostate(69;0.059)	506			C2H2-type 10; degenerate.		Q6IPE0|Q6ZN10|Q7L5Z5|Q8NCE3|Q9H6N0	Missense_Mutation	SNP	ENST00000600245.1	37	c.1518G>C	CCDS12596.1	.	.	.	.	.	.	.	.	.	.	G	10.81	1.454715	0.26161	.	.	ENSG00000105732	ENST00000222339;ENST00000359044;ENST00000535775	T;T	0.07444	3.19;3.19	4.5	4.5	0.54988	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.13841	0.0335	N	0.26092	0.79	0.38665	D	0.952175	D;D	0.89917	1.0;1.0	D;D	0.74348	0.979;0.983	T	0.14671	-1.0464	10	0.23891	T	0.37	-24.5803	9.8352	0.40965	0.096:0.0:0.904:0.0	.	506;595	Q6ZN55;Q6ZN55-2	ZN574_HUMAN;.	N	596;506;113	ENSP00000222339:K596N;ENSP00000351939:K506N	ENSP00000222339:K596N	K	+	3	2	ZNF574	47276116	1.000000	0.71417	1.000000	0.80357	0.212000	0.24457	2.159000	0.42339	2.340000	0.79590	0.650000	0.86243	AAG		0.582	ZNF574-002	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463458.1	NM_022752		32	222	0	0	0	0	32	222				
CIC	23152	broad.mit.edu	37	19	42797308	42797308	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr19:42797308G>C	ENST00000575354.2	+	15	3710	c.3670G>C	c.(3670-3672)Gag>Cag	p.E1224Q	CIC_ENST00000572681.2_Missense_Mutation_p.E2131Q|CIC_ENST00000160740.3_Missense_Mutation_p.E1222Q	NM_015125.3	NP_055940.3	Q96RK0	CIC_HUMAN	capicua transcriptional repressor	1224	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(5)|central_nervous_system(32)|endometrium(10)|kidney(2)|large_intestine(7)|lung(9)|ovary(7)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	82		Prostate(69;0.00682)				GTCTGAGCTTGAGGGGCAGCC	0.716			"""Mis, F, S"""		oligodendroglioma																																	uc002otf.1		NA		Rec	yes		19	19q13.2	23152	T	capicua homolog			O	DUX4		soft tissue sarcoma		0				ovary(4)|breast(4)|lung(1)|central_nervous_system(1)|skin(1)	11						c.(3670-3672)GAG>CAG		capicua homolog							11.0	13.0	12.0					19																	42797308		2188	4285	6473	SO:0001583	missense	23152				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding	g.chr19:42797308G>C	AB002304	CCDS12601.1	19q13.2	2013-03-15	2013-03-15		ENSG00000079432	ENSG00000079432			14214	protein-coding gene	gene with protein product		612082	"""capicua (Drosophila) homolog"", ""capicua homolog (Drosophila)"""			12393275, 15981098	Standard	NM_015125		Approved	KIAA0306	uc002otf.1	Q96RK0		ENST00000575354.2:c.3670G>C	19.37:g.42797308G>C	ENSP00000458663:p.Glu1224Gln		Somatic					p.E1224Q	NM_015125	NP_055940	WXS	Illumina HiSeq	Unspecified	Q96RK0	CIC_HUMAN			15	3710	+		Prostate(69;0.00682)	1224			Pro-rich.		Q7LGI1|Q9UEG5|Q9Y6T1	Missense_Mutation	SNP	ENST00000575354.2	37	c.3670G>C	CCDS12601.1	.	.	.	.	.	.	.	.	.	.	G	14.03	2.413940	0.42817	.	.	ENSG00000079432	ENST00000160740	.	.	.	4.54	4.54	0.55810	.	.	.	.	.	T	0.24160	0.0585	N	0.24115	0.695	0.24730	N	0.9931	P	0.37466	0.596	B	0.29176	0.099	T	0.17471	-1.0368	8	0.87932	D	0	-21.1478	12.9884	0.58604	0.0:0.0:1.0:0.0	.	1224	Q96RK0	CIC_HUMAN	Q	1224	.	ENSP00000160740:E1224Q	E	+	1	0	CIC	47489148	0.984000	0.35163	1.000000	0.80357	0.976000	0.68499	2.393000	0.44442	2.537000	0.85549	0.491000	0.48974	GAG		0.716	CIC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438532.2			3	15	0	0	0	0	3	15				
ZC3H4	23211	broad.mit.edu	37	19	47570821	47570821	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr19:47570821C>T	ENST00000253048.5	-	15	2741	c.2704G>A	c.(2704-2706)Gaa>Aaa	p.E902K	ZC3H4_ENST00000594019.1_Intron	NM_015168.1	NP_055983.1	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4	902							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	41		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)		AGGCTGCCTTCGGGCTTGGAG	0.697																																						uc002pga.3		NA																	0				skin(4)|ovary(2)	6						c.(2704-2706)GAA>AAA		zinc finger CCCH-type containing 4							16.0	21.0	19.0					19																	47570821		1894	4103	5997	SO:0001583	missense	23211						nucleic acid binding|zinc ion binding	g.chr19:47570821C>T	AB028987	CCDS42582.1	19q13.33	2012-07-05	2007-10-18	2007-10-18		ENSG00000130749		"""Zinc fingers, CCCH-type domain containing"""	17808	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 7"""	C19orf7			Standard	NM_015168		Approved	KIAA1064	uc002pga.4	Q9UPT8		ENST00000253048.5:c.2704G>A	19.37:g.47570821C>T	ENSP00000253048:p.Glu902Lys		Somatic				ZC3H4_uc002pgb.1_Intron	p.E902K	NM_015168	NP_055983	WXS	Illumina HiSeq	Unspecified	Q9UPT8	ZC3H4_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)	15	2742	-		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)	902					Q9Y420	Missense_Mutation	SNP	ENST00000253048.5	37	c.2704G>A	CCDS42582.1	.	.	.	.	.	.	.	.	.	.	C	6.174	0.400257	0.11696	.	.	ENSG00000130749	ENST00000253048	T	0.16897	2.31	5.52	5.52	0.82312	.	1.004470	0.08010	N	0.990216	T	0.07503	0.0189	N	0.03608	-0.345	0.47153	D	0.999338	B	0.32203	0.36	B	0.15052	0.012	T	0.31833	-0.9929	10	0.14656	T	0.56	.	12.0048	0.53252	0.0:0.9192:0.0:0.0808	.	902	Q9UPT8	ZC3H4_HUMAN	K	902	ENSP00000253048:E902K	ENSP00000253048:E902K	E	-	1	0	ZC3H4	52262661	1.000000	0.71417	0.124000	0.21820	0.270000	0.26580	3.003000	0.49505	2.757000	0.94681	0.655000	0.94253	GAA		0.697	ZC3H4-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466667.1			5	22	0	0	0	0	5	22				
PRR12	57479	broad.mit.edu	37	19	50099779	50099779	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr19:50099779G>C	ENST00000418929.2	+	4	2199	c.2187G>C	c.(2185-2187)aaG>aaC	p.K729N		NM_020719.1	NP_065770.1	Q9ULL5	PRR12_HUMAN	proline rich 12	0							DNA binding (GO:0003677)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)|prostate(2)	11		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		AGGAGAAGAAGAAAGGGCCAG	0.652																																						uc002poo.3		NA																	0				central_nervous_system(1)|pancreas(1)	2						c.(2185-2187)AAG>AAC		proline rich 12							12.0	14.0	13.0					19																	50099779		1952	4130	6082	SO:0001583	missense	57479						DNA binding	g.chr19:50099779G>C	AB033031	CCDS46143.1	19q13.33	2008-07-02	2006-02-06	2006-02-06		ENSG00000126464			29217	protein-coding gene	gene with protein product			"""KIAA1205"""	KIAA1205		10574462	Standard	NM_020719		Approved		uc002poo.4	Q9ULL5		ENST00000418929.2:c.2187G>C	19.37:g.50099779G>C	ENSP00000394510:p.Lys729Asn		Somatic					p.K729N	NM_020719	NP_065770	WXS	Illumina HiSeq	Unspecified	Q9ULL5	PRR12_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)	4	2187	+		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					E9PB06|Q8N4J6	Missense_Mutation	SNP	ENST00000418929.2	37	c.2187G>C	CCDS46143.1	.	.	.	.	.	.	.	.	.	.	G	5.237	0.229192	0.09916	.	.	ENSG00000126464	ENST00000418929	.	.	.	3.56	1.38	0.22167	.	.	.	.	.	T	0.52853	0.1760	.	.	.	0.32939	D	0.518178	D	0.65815	0.995	P	0.61003	0.882	T	0.57946	-0.7723	7	0.27785	T	0.31	.	6.9207	0.24387	0.3111:0.0:0.6889:0.0	.	729	Q9ULL5-3	.	N	729	.	ENSP00000394510:K729N	K	+	3	2	PRR12	54791591	0.998000	0.40836	0.994000	0.49952	0.768000	0.43524	2.001000	0.40825	0.325000	0.23359	-0.657000	0.03884	AAG		0.652	PRR12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465915.1	NM_020719		5	15	0	0	0	0	5	15				
IL4I1	259307	broad.mit.edu	37	19	50394716	50394716	+	Silent	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr19:50394716G>C	ENST00000391826.2	-	6	724	c.582C>G	c.(580-582)ctC>ctG	p.L194L	IL4I1_ENST00000595948.1_Silent_p.L216L|IL4I1_ENST00000341114.3_Silent_p.L216L	NM_152899.1	NP_690863.1	Q96RQ9	OXLA_HUMAN	interleukin 4 induced 1	194						extracellular region (GO:0005576)|lysosome (GO:0005764)	L-amino-acid oxidase activity (GO:0001716)			endometrium(3)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	16		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00245)|OV - Ovarian serous cystadenocarcinoma(262;0.0169)	Flavin adenine dinucleotide(DB03147)	CCAGTGCCTTGAGGTCTTTGA	0.587																																						uc002pqt.1		NA																	0				lung(1)|ovary(1)|prostate(1)	3						c.(580-582)CTC>CTG		interleukin 4 induced 1 isoform 1 precursor							210.0	168.0	182.0					19																	50394716		2203	4300	6503	SO:0001819	synonymous_variant	259307					lysosome	L-amino-acid oxidase activity	g.chr19:50394716G>C	AF293462	CCDS12786.1, CCDS12787.1	19q13.3-q13.4	2014-06-26				ENSG00000104951			19094	protein-coding gene	gene with protein product		609742				12031486	Standard	NM_152899		Approved	FIG1	uc002pqt.1	Q96RQ9		ENST00000391826.2:c.582C>G	19.37:g.50394716G>C			Somatic				IL4I1_uc002pqv.1_Silent_p.L203L|IL4I1_uc010eno.1_Silent_p.L202L|IL4I1_uc002pqw.1_Silent_p.L202L|IL4I1_uc002pqu.1_Silent_p.L216L	p.L194L	NM_152899	NP_690863	WXS	Illumina HiSeq	Unspecified	Q96RQ9	OXLA_HUMAN		GBM - Glioblastoma multiforme(134;0.00245)|OV - Ovarian serous cystadenocarcinoma(262;0.0169)	6	660	-		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)	194					Q1WMJ3|Q4GZN1|Q4GZN2|Q6P2Q3|Q8TEM5|Q96RQ8	Silent	SNP	ENST00000391826.2	37	c.582C>G	CCDS12787.1																																																																																				0.587	IL4I1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466413.1			17	116	0	0	0	0	17	116				
POLD1	5424	broad.mit.edu	37	19	50902122	50902122	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr19:50902122G>A	ENST00000440232.2	+	2	67	c.14G>A	c.(13-15)cGg>cAg	p.R5Q	POLD1_ENST00000599857.1_Missense_Mutation_p.R5Q|RN7SL324P_ENST00000577945.1_RNA|POLD1_ENST00000595904.1_Missense_Mutation_p.R5Q	NM_001256849.1|NM_002691.3	NP_001243778.1|NP_002682.2	P28340	DPOD1_HUMAN	polymerase (DNA directed), delta 1, catalytic subunit	5			R -> W (in dbSNP:rs9282830).		base-excision repair (GO:0006284)|base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA synthesis involved in DNA repair (GO:0000731)|fatty acid homeostasis (GO:0055089)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)|response to UV (GO:0009411)|small molecule metabolic process (GO:0044281)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|delta DNA polymerase complex (GO:0043625)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_neural(266;0.0571)		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)		GATGGCAAGCGGCGGCCAGGC	0.647								DNA polymerases (catalytic subunits)																														uc002psb.3		NA																	0				upper_aerodigestive_tract(1)|central_nervous_system(1)	2						c.(13-15)CGG>CAG	DNA_polymerases_(catalytic_subunits)	DNA-directed DNA polymerase delta 1							9.0	12.0	11.0					19																	50902122		2188	4279	6467	SO:0001583	missense	5424				base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|DNA synthesis involved in DNA repair|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|response to UV|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	delta DNA polymerase complex|nucleoplasm|nucleotide-excision repair complex	3'-5'-exodeoxyribonuclease activity|chromatin binding|DNA binding|DNA-directed DNA polymerase activity|metal ion binding|nucleotide binding|protein binding	g.chr19:50902122G>A		CCDS12795.1	19q13.3	2014-09-17	2012-05-18		ENSG00000062822	ENSG00000062822		"""DNA polymerases"""	9175	protein-coding gene	gene with protein product	"""CDC2 homolog (S. cerevisiae)"""	174761	"""polymerase (DNA directed), delta 1, catalytic subunit (125kD)"""	POLD		1722322	Standard	NM_001256849		Approved	CDC2	uc002psc.5	P28340		ENST00000440232.2:c.14G>A	19.37:g.50902122G>A	ENSP00000406046:p.Arg5Gln		Somatic				POLD1_uc002psc.3_Missense_Mutation_p.R5Q|POLD1_uc010enx.2_RNA|POLD1_uc010eny.2_Missense_Mutation_p.R5Q	p.R5Q	NM_002691	NP_002682	WXS	Illumina HiSeq	Unspecified	P28340	DPOD1_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)	2	70	+		all_neural(266;0.0571)	5			Nuclear localization signal (Potential).		Q8NER3|Q96H98	Missense_Mutation	SNP	ENST00000440232.2	37	c.14G>A	CCDS12795.1	.	.	.	.	.	.	.	.	.	.	g	18.34	3.603513	0.66445	.	.	ENSG00000062822	ENST00000440232;ENST00000376930	T	0.18502	2.21	3.12	3.12	0.35913	.	0.463445	0.14734	U	0.301554	T	0.23171	0.0560	M	0.62723	1.935	0.46631	D	0.999131	D;D	0.65815	0.995;0.962	P;B	0.44673	0.457;0.194	T	0.25433	-1.0132	10	0.66056	D	0.02	-34.3179	14.181	0.65574	0.0:0.0:1.0:0.0	.	5;5	E7EVW0;P28340	.;DPOD1_HUMAN	Q	5;6	ENSP00000406046:R5Q	ENSP00000366129:R6Q	R	+	2	0	POLD1	55593934	0.998000	0.40836	0.994000	0.49952	0.999000	0.98932	2.887000	0.48586	2.057000	0.61298	0.651000	0.88453	CGG		0.647	POLD1-002	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464732.1			9	16	0	0	0	0	9	16				
ZNF614	80110	broad.mit.edu	37	19	52519444	52519444	+	Silent	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr19:52519444G>A	ENST00000270649.6	-	5	1951	c.1407C>T	c.(1405-1407)tgC>tgT	p.C469C	ZNF614_ENST00000356322.6_Intron	NM_025040.3	NP_079316.2	Q8N883	ZN614_HUMAN	zinc finger protein 614	469					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00513)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		GTTGTATGAGGCATATTTTCT	0.413																																						uc002pyj.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	5						c.(1405-1407)TGC>TGT		zinc finger protein 614							137.0	125.0	129.0					19																	52519444		2203	4300	6503	SO:0001819	synonymous_variant	80110				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:52519444G>A	BC022246	CCDS12847.1	19q13.41	2013-01-08				ENSG00000142556		"""Zinc fingers, C2H2-type"", ""-"""	24722	protein-coding gene	gene with protein product						12477932	Standard	NM_025040		Approved	FLJ21941	uc002pyj.3	Q8N883		ENST00000270649.6:c.1407C>T	19.37:g.52519444G>A			Somatic				ZNF614_uc002pyi.3_Intron|ZNF614_uc010epj.2_Silent_p.C172C	p.C469C	NM_025040	NP_079316	WXS	Illumina HiSeq	Unspecified	Q8N883	ZN614_HUMAN		GBM - Glioblastoma multiforme(134;0.00513)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)	5	1809	-		all_neural(266;0.0505)	469			C2H2-type 9.		Q494T8|Q8TCF4|Q9BSN8	Silent	SNP	ENST00000270649.6	37	c.1407C>T	CCDS12847.1																																																																																				0.413	ZNF614-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462407.1	NM_025040		4	137	0	0	0	0	4	137				
LILRB5	10990	broad.mit.edu	37	19	54758764	54758764	+	Silent	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr19:54758764G>A	ENST00000316219.5	-	6	1196	c.1089C>T	c.(1087-1089)ccC>ccT	p.P363P	LILRB5_ENST00000345866.6_Silent_p.P263P|LILRB5_ENST00000449561.2_Silent_p.P363P|LILRB5_ENST00000450632.1_Silent_p.P354P	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5	363	Ig-like C2-type 4.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GACACAGCGGGGGATGGGCTG	0.547																																						uc002qex.2		NA																	0				ovary(1)|pancreas(1)	2						c.(1087-1089)CCC>CCT		leukocyte immunoglobulin-like receptor,							71.0	70.0	70.0					19																	54758764		2203	4300	6503	SO:0001819	synonymous_variant	10990				cell surface receptor linked signaling pathway|defense response	integral to membrane	transmembrane receptor activity	g.chr19:54758764G>A	AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.1089C>T	19.37:g.54758764G>A			Somatic				LILRA6_uc002qew.1_Intron|LILRB5_uc010yer.1_Silent_p.P354P|LILRB5_uc002qey.2_Silent_p.P363P|LILRB5_uc002qez.2_Silent_p.P263P|LILRB5_uc002qfa.1_Silent_p.P253P|LILRB5_uc010yes.1_RNA	p.P363P	NM_006840	NP_006831	WXS	Illumina HiSeq	Unspecified	O75023	LIRB5_HUMAN		GBM - Glioblastoma multiforme(193;0.105)	6	1200	-	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)		363			Ig-like C2-type 4.|Extracellular (Potential).		Q8N760	Silent	SNP	ENST00000316219.5	37	c.1089C>T	CCDS12885.1																																																																																				0.547	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142877.2			5	53	0	0	0	0	5	53				
TMEM150B	284417	broad.mit.edu	37	19	55824272	55824272	+	Silent	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr19:55824272G>A	ENST00000326652.4	-	8	839	c.657C>T	c.(655-657)ctC>ctT	p.L219L	CTD-2105E13.14_ENST00000596786.1_RNA|TMEM150B_ENST00000438693.1_Silent_p.L219L	NM_001282011.1	NP_001268940.1	A6NC51	T150B_HUMAN	transmembrane protein 150B	219						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(1)	3						GCGGGGGGCTGAGGCTGGGCC	0.672																																						uc010esw.1		NA																	0					0						c.(655-657)CTC>CTT		transmembrane protein 150B precursor							12.0	16.0	15.0					19																	55824272		2078	4198	6276	SO:0001819	synonymous_variant	284417					integral to membrane		g.chr19:55824272G>A	BC020862	CCDS42629.1	19q13.42	2009-06-12	2009-06-12	2009-06-12		ENSG00000180061			34415	protein-coding gene	gene with protein product			"""transmembrane protein 224"""	TMEM224			Standard	XM_005258812		Approved		uc010esw.1	A6NC51		ENST00000326652.4:c.657C>T	19.37:g.55824272G>A			Somatic				TMEM150B_uc010yfu.1_Silent_p.L219L|TMEM150B_uc010yfv.1_RNA|TMEM150B_uc010yfw.1_RNA	p.L219L	NM_001085488	NP_001078957	WXS	Illumina HiSeq	Unspecified	A6NC51	T150B_HUMAN			8	830	-			219			Cytoplasmic (Potential).		B7ZW71	Silent	SNP	ENST00000326652.4	37	c.657C>T	CCDS42629.1																																																																																				0.672	TMEM150B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452685.1	NM_001085488		5	9	0	0	0	0	5	9				
EPN1	29924	broad.mit.edu	37	19	56204355	56204355	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr19:56204355G>C	ENST00000270460.6	+	9	1527	c.1216G>C	c.(1216-1218)Gac>Cac	p.D406H	AC010525.4_ENST00000585559.1_RNA|AC010525.6_ENST00000587937.1_lincRNA|EPN1_ENST00000085079.7_Missense_Mutation_p.D380H|EPN1_ENST00000411543.2_Missense_Mutation_p.D492H	NM_001130072.1	NP_001123544.1	Q9Y6I3	EPN1_HUMAN	epsin 1	406	Ala/Gly/Pro-rich.				embryonic organ development (GO:0048568)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|female pregnancy (GO:0007565)|in utero embryonic development (GO:0001701)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|Notch signaling pathway (GO:0007219)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|skin(1)	17		Colorectal(82;0.00244)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.112)		CGAGTTCTCTGACTTTGACCG	0.701																																						uc002qlw.2		NA																	0					0						c.(1216-1218)GAC>CAC		epsin 1 isoform b							72.0	89.0	84.0					19																	56204355		2092	4213	6305	SO:0001583	missense	29924				endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	coated pit|cytoplasm|nucleus|plasma membrane	lipid binding	g.chr19:56204355G>C	AF073727	CCDS46198.1, CCDS46199.1, CCDS46200.1	19q13.42	2014-08-12			ENSG00000063245	ENSG00000063245			21604	protein-coding gene	gene with protein product		607262				9723620, 10557078	Standard	NM_001130072		Approved		uc002qlx.3	Q9Y6I3	OTTHUMG00000180911	ENST00000270460.6:c.1216G>C	19.37:g.56204355G>C	ENSP00000270460:p.Asp406His		Somatic				EPN1_uc002qlv.2_Missense_Mutation_p.D380H|EPN1_uc010etd.2_Missense_Mutation_p.D405H|EPN1_uc002qlx.2_Missense_Mutation_p.D492H	p.D406H	NM_001130072	NP_001123544	WXS	Illumina HiSeq	Unspecified	Q9Y6I3	EPN1_HUMAN		GBM - Glioblastoma multiforme(193;0.112)	9	1558	+		Colorectal(82;0.00244)|Ovarian(87;0.133)	406			[DE]-X(1,2)-F-X-X-[FL]-X-X-X-R motif.|Ala/Gly/Pro-rich.		Q86ST3|Q9HA18	Missense_Mutation	SNP	ENST00000270460.6	37	c.1216G>C	CCDS46199.1	.	.	.	.	.	.	.	.	.	.	G	18.62	3.662398	0.67700	.	.	ENSG00000063245	ENST00000270460;ENST00000085079;ENST00000544375;ENST00000411543	T;T;T	0.15603	2.47;2.44;2.41	3.93	3.93	0.45458	.	0.534864	0.18606	N	0.136304	T	0.29749	0.0743	L	0.43152	1.355	0.80722	D	1	D;D;D;D	0.71674	0.992;0.998;0.992;0.998	P;P;P;P	0.61477	0.667;0.889;0.667;0.821	T	0.02126	-1.1209	10	0.56958	D	0.05	-26.5238	13.3347	0.60509	0.0:0.0:1.0:0.0	.	366;492;406;380	B4DU91;Q9Y6I3-1;Q9Y6I3;Q9Y6I3-3	.;.;EPN1_HUMAN;.	H	406;380;366;492	ENSP00000270460:D406H;ENSP00000085079:D380H;ENSP00000406209:D492H	ENSP00000085079:D380H	D	+	1	0	EPN1	60896167	1.000000	0.71417	0.967000	0.41034	0.728000	0.41692	5.803000	0.69129	2.202000	0.70862	0.462000	0.41574	GAC		0.701	EPN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453610.1	NM_013333		19	121	0	0	0	0	19	121				
NLRP13	126204	broad.mit.edu	37	19	56423845	56423845	+	Silent	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr19:56423845C>T	ENST00000342929.3	-	5	1337	c.1338G>A	c.(1336-1338)caG>caA	p.Q446Q	NLRP13_ENST00000588751.1_Silent_p.Q446Q	NM_176810.2	NP_789780.2	Q86W25	NAL13_HUMAN	NLR family, pyrin domain containing 13	446	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.						ATP binding (GO:0005524)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(58)|ovary(4)|pancreas(2)|prostate(2)|skin(13)|stomach(2)|urinary_tract(1)	109		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		GAGTGATTGACTGGAGATCGT	0.478																																						uc010ygg.1		NA																	0				skin(4)|ovary(3)|pancreas(1)|lung(1)	9						c.(1336-1338)CAG>CAA		NACHT, leucine rich repeat and PYD containing							99.0	100.0	100.0					19																	56423845		2203	4300	6503	SO:0001819	synonymous_variant	126204						ATP binding	g.chr19:56423845C>T	AY154468	CCDS33119.1	19q13.43	2008-02-05	2006-12-08	2006-12-08	ENSG00000173572	ENSG00000173572		"""Nucleotide-binding domain and leucine rich repeat containing"""	22937	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13"""	609660	"""NACHT, leucine rich repeat and PYD containing 13"""	NALP13		12563287	Standard	NM_176810		Approved	NOD14, PAN13, CLR19.7	uc010ygg.2	Q86W25	OTTHUMG00000167839	ENST00000342929.3:c.1338G>A	19.37:g.56423845C>T			Somatic					p.Q446Q	NM_176810	NP_789780	WXS	Illumina HiSeq	Unspecified	Q86W25	NAL13_HUMAN		GBM - Glioblastoma multiforme(193;0.0642)	5	1363	-		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)	446			NACHT.		Q7RTR5	Silent	SNP	ENST00000342929.3	37	c.1338G>A	CCDS33119.1																																																																																				0.478	NLRP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396560.1	NM_176810		13	108	0	0	0	0	13	108				
PDIA6	10130	broad.mit.edu	37	2	10931955	10931955	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr2:10931955C>G	ENST00000272227.3	-	6	697	c.550G>C	c.(550-552)Gag>Cag	p.E184Q	PDIA6_ENST00000404824.2_Missense_Mutation_p.E232Q|PDIA6_ENST00000404371.2_Missense_Mutation_p.E236Q|PDIA6_ENST00000540494.1_Missense_Mutation_p.E181Q|PDIA6_ENST00000381611.4_Missense_Mutation_p.E189Q	NM_001282707.1|NM_005742.2	NP_001269636.1|NP_005733.1	Q15084	PDIA6_HUMAN	protein disulfide isomerase family A, member 6	184	Thioredoxin 2. {ECO:0000255|PROSITE- ProRule:PRU00691}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic cell clearance (GO:0043277)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	protein disulfide isomerase activity (GO:0003756)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|prostate(2)	18	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.149)|OV - Ovarian serous cystadenocarcinoma(76;0.15)		GCATAGAACTCAACCATCCAA	0.398																																					GBM(73;509 1219 34219 41343 41551)	uc002rau.2		NA																	0					0						c.(550-552)GAG>CAG		protein disulfide isomerase A6 precursor							271.0	202.0	225.0					2																	10931955		2203	4300	6503	SO:0001583	missense	10130				cell redox homeostasis|glycerol ether metabolic process|protein folding	endoplasmic reticulum lumen|ER-Golgi intermediate compartment|melanosome|plasma membrane	electron carrier activity|protein binding|protein disulfide isomerase activity|protein disulfide oxidoreductase activity	g.chr2:10931955C>G	BC001312	CCDS1675.1, CCDS62852.1, CCDS62853.1, CCDS62854.1, CCDS62855.1	2p25.1	2009-11-20	2005-06-29	2005-03-03	ENSG00000143870	ENSG00000143870	5.3.4.1	"""Protein disulfide isomerases"""	30168	protein-coding gene	gene with protein product	"""protein disulfide isomerase-related protein"""	611099	"""thioredoxin domain containing 7 (protein disulfide isomerase)"", ""protein disulfide isomerase-associated 6"""	TXNDC7		7590364, 12204115	Standard	XM_005246145		Approved	P5, ERp5	uc002rau.3	Q15084	OTTHUMG00000090479	ENST00000272227.3:c.550G>C	2.37:g.10931955C>G	ENSP00000272227:p.Glu184Gln		Somatic				PDIA6_uc010yjg.1_Missense_Mutation_p.E181Q|PDIA6_uc002rav.2_Missense_Mutation_p.E236Q|PDIA6_uc010yjh.1_Missense_Mutation_p.E189Q|PDIA6_uc002raw.2_Missense_Mutation_p.E232Q	p.E184Q	NM_005742	NP_005733	WXS	Illumina HiSeq	Unspecified	Q15084	PDIA6_HUMAN		Epithelial(75;0.149)|OV - Ovarian serous cystadenocarcinoma(76;0.15)	6	688	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)		184			Thioredoxin 2.		B3KY95|B5MCQ5|B7Z254|B7Z4M8|F8WA83|Q53RC7|Q6ZSH5|Q99778	Missense_Mutation	SNP	ENST00000272227.3	37	c.550G>C	CCDS1675.1	.	.	.	.	.	.	.	.	.	.	C	34	5.312207	0.95655	.	.	ENSG00000143870	ENST00000272227;ENST00000404371;ENST00000404824;ENST00000540494;ENST00000381611	T;T;T;T;T	0.03860	3.78;3.78;3.78;3.78;3.78	5.63	5.63	0.86233	Thioredoxin domain (1);Thioredoxin, conserved site (1);Thioredoxin-like fold (3);Disulphide isomerase (1);	0.000000	0.85682	D	0.000000	T	0.28863	0.0716	M	0.87900	2.915	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;0.999	D;D;D;D	0.97110	1.0;0.998;0.997;0.991	T	0.02138	-1.1207	10	0.87932	D	0	.	20.0572	0.97657	0.0:1.0:0.0:0.0	.	181;232;236;184	B7Z254;B5MCQ5;Q15084-2;Q15084	.;.;.;PDIA6_HUMAN	Q	184;236;232;181;189	ENSP00000272227:E184Q;ENSP00000385385:E236Q;ENSP00000384459:E232Q;ENSP00000438778:E181Q;ENSP00000371024:E189Q	ENSP00000272227:E184Q	E	-	1	0	PDIA6	10849406	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.826000	0.97356	0.655000	0.94253	GAG		0.398	PDIA6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206933.1	NM_005742		8	45	0	0	0	0	8	45				
ROCK2	9475	broad.mit.edu	37	2	11364578	11364578	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr2:11364578G>T	ENST00000315872.6	-	7	1325	c.877C>A	c.(877-879)Cca>Aca	p.P293T	ROCK2_ENST00000401753.1_Missense_Mutation_p.P50T	NM_004850.3	NP_004841.2	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein kinase 2	293	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|neural tube closure (GO:0001843)|positive regulation of centrosome duplication (GO:0010825)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of circadian rhythm (GO:0042752)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|rhythmic process (GO:0048511)|smooth muscle contraction (GO:0006939)	centrosome (GO:0005813)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole centrosome (GO:0031616)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(10)|prostate(1)|skin(4)|stomach(3)|urinary_tract(2)	43	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		GCATAAAATGGAGTATCCCCT	0.318																																						uc002rbd.1		NA																	0				stomach(2)|skin(2)	4						c.(877-879)CCA>ACA		Rho-associated, coiled-coil containing protein							96.0	92.0	93.0					2																	11364578		1821	4081	5902	SO:0001583	missense	9475				axon guidance|cytokinesis|intracellular signal transduction	cytosol|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|structural molecule activity	g.chr2:11364578G>T	D87931	CCDS42654.1	2p24	2013-01-10			ENSG00000134318	ENSG00000134318	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10252	protein-coding gene	gene with protein product		604002				9933571	Standard	NM_004850		Approved		uc002rbd.1	O75116	OTTHUMG00000149916	ENST00000315872.6:c.877C>A	2.37:g.11364578G>T	ENSP00000317985:p.Pro293Thr		Somatic					p.P293T	NM_004850	NP_004841	WXS	Illumina HiSeq	Unspecified	O75116	ROCK2_HUMAN		Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)	7	1326	-	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		293			Protein kinase.		Q53QZ0|Q53SJ7|Q9UQN5	Missense_Mutation	SNP	ENST00000315872.6	37	c.877C>A	CCDS42654.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.697929	0.88830	.	.	ENSG00000134318	ENST00000315872;ENST00000401753;ENST00000431087	T;T;T	0.39787	1.06;1.06;1.06	5.71	5.71	0.89125	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.77558	0.4148	H	0.96333	3.805	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.84524	0.0629	10	0.87932	D	0	.	19.839	0.96675	0.0:0.0:1.0:0.0	.	293	O75116	ROCK2_HUMAN	T	293;50;120	ENSP00000317985:P293T;ENSP00000385509:P50T;ENSP00000395957:P120T	ENSP00000261535:P293T	P	-	1	0	ROCK2	11282029	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.869000	0.99810	2.682000	0.91365	0.491000	0.48974	CCA		0.318	ROCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313886.3			11	98	1	0	3.07e-06	3.32e-06	11	98				
ZNF513	130557	broad.mit.edu	37	2	27600989	27600989	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr2:27600989C>T	ENST00000323703.6	-	4	1247	c.1049G>A	c.(1048-1050)gGg>gAg	p.G350E	ZNF513_ENST00000491924.1_Intron|ZNF513_ENST00000407879.1_Missense_Mutation_p.G288E	NM_144631.5	NP_653232.3	Q8N8E2	ZN513_HUMAN	zinc finger protein 513	350					regulation of transcription, DNA-templated (GO:0006355)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)			endometrium(5)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)	17	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGGGGCCCCCCACTGGCACC	0.652																																						uc002rkk.2		NA																	0				ovary(1)	1						c.(1048-1050)GGG>GAG		zinc finger protein 513							39.0	52.0	47.0					2																	27600989		2203	4300	6503	SO:0001583	missense	130557				regulation of transcription, DNA-dependent|response to stimulus|retina development in camera-type eye|transcription, DNA-dependent|visual perception	nucleus	transcription regulatory region DNA binding|zinc ion binding	g.chr2:27600989C>T	AL833946	CCDS1751.1, CCDS56114.1	2p23.3	2014-01-28			ENSG00000163795	ENSG00000163795		"""Zinc fingers, C2H2-type"""	26498	protein-coding gene	gene with protein product		613598				12477932	Standard	NM_001201459		Approved	FLJ32203, RP58	uc002rkk.3	Q8N8E2	OTTHUMG00000097783	ENST00000323703.6:c.1049G>A	2.37:g.27600989C>T	ENSP00000318373:p.Gly350Glu		Somatic				ZNF513_uc002rkj.2_Missense_Mutation_p.G288E	p.G350E	NM_144631	NP_653232	WXS	Illumina HiSeq	Unspecified	Q8N8E2	ZN513_HUMAN			4	1249	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		350					A8K3S5|B7WP71|Q3ZCU1|Q68CJ1|Q86UZ3|Q8NDL8|Q96ML3	Missense_Mutation	SNP	ENST00000323703.6	37	c.1049G>A	CCDS1751.1	.	.	.	.	.	.	.	.	.	.	C	13.73	2.323236	0.41096	.	.	ENSG00000163795	ENST00000323703;ENST00000407879	T;T	0.07216	3.28;3.21	4.99	3.16	0.36331	.	0.248908	0.28809	N	0.014076	T	0.05686	0.0149	N	0.19112	0.55	0.24613	N	0.993711	B	0.29432	0.244	B	0.24701	0.055	T	0.30149	-0.9988	10	0.87932	D	0	-0.2674	9.3734	0.38268	0.0:0.7749:0.1449:0.0802	.	350	Q8N8E2	ZN513_HUMAN	E	350;288	ENSP00000318373:G350E;ENSP00000384874:G288E	ENSP00000318373:G350E	G	-	2	0	ZNF513	27454493	0.134000	0.22483	0.684000	0.30055	0.993000	0.82548	1.416000	0.34759	0.663000	0.31027	0.561000	0.74099	GGG		0.652	ZNF513-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215026.2	NM_144631		10	69	0	0	0	0	10	69				
IFT172	26160	broad.mit.edu	37	2	27695135	27695135	+	Silent	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr2:27695135G>A	ENST00000260570.3	-	15	1609	c.1506C>T	c.(1504-1506)ttC>ttT	p.F502F	IFT172_ENST00000416524.2_Silent_p.F481F|IFT172_ENST00000359466.6_Silent_p.F502F	NM_015662.1	NP_056477.1	Q9UG01	IF172_HUMAN	intraflagellar transport 172	502					bone development (GO:0060348)|brain development (GO:0007420)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|epidermis development (GO:0008544)|heart looping (GO:0001947)|hindgut development (GO:0061525)|left/right axis specification (GO:0070986)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube closure (GO:0001843)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)	axoneme (GO:0005930)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)|vesicle (GO:0031982)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(17)|lung(17)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	43	Acute lymphoblastic leukemia(172;0.155)					TCCGGTCCCTGAAGAGGAGCT	0.547																																						uc002rku.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(1504-1506)TTC>TTT		selective LIM binding factor homolog							147.0	131.0	136.0					2																	27695135		2203	4300	6503	SO:0001819	synonymous_variant	26160				cilium assembly	cilium	binding	g.chr2:27695135G>A	AB033005	CCDS1755.1	2p23.3	2014-07-03	2014-07-03		ENSG00000138002	ENSG00000138002		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	30391	protein-coding gene	gene with protein product	"""wimple homolog"""	607386	"""intraflagellar transport 172 homolog (Chlamydomonas)"""			10788441, 10574461, 24140113	Standard	XM_005264254		Approved	SLB, wim, osm-1, NPHP17	uc002rku.3	Q9UG01	OTTHUMG00000128425	ENST00000260570.3:c.1506C>T	2.37:g.27695135G>A			Somatic				IFT172_uc002rkw.2_Silent_p.F502F|IFT172_uc010yls.1_Silent_p.F481F|IFT172_uc010ezc.2_Silent_p.F502F|IFT172_uc002rkv.2_Silent_p.F476F	p.F502F	NM_015662	NP_056477	WXS	Illumina HiSeq	Unspecified	Q9UG01	IF172_HUMAN			15	1557	-	Acute lymphoblastic leukemia(172;0.155)		502			WD 8.		A5PKZ0|B2RNU5|Q86X44|Q96HW4|Q9UFJ9|Q9ULP1	Silent	SNP	ENST00000260570.3	37	c.1506C>T	CCDS1755.1																																																																																				0.547	IFT172-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250213.2	NM_015662		14	148	0	0	0	0	14	148				
GALNT14	79623	broad.mit.edu	37	2	31133797	31133797	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr2:31133797C>T	ENST00000349752.5	-	15	2268	c.1629G>A	c.(1627-1629)atG>atA	p.M543I	GALNT14_ENST00000486564.1_5'UTR|GALNT14_ENST00000406653.1_Missense_Mutation_p.M523I|GALNT14_ENST00000324589.5_Missense_Mutation_p.M548I|GALNT14_ENST00000420311.2_Missense_Mutation_p.M508I|GALNT14_ENST00000356174.3_Missense_Mutation_p.M510I	NM_024572.3	NP_078848.2	Q96FL9	GLT14_HUMAN	polypeptide N-acetylgalactosaminyltransferase 14	543	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			cervix(1)|endometrium(3)|large_intestine(10)|liver(1)|lung(21)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)	43	Acute lymphoblastic leukemia(172;0.155)					AGTGCTGGCTCATGAGTGAGG	0.567																																						uc002rnr.2		NA																	0				upper_aerodigestive_tract(2)|skin(1)	3						c.(1627-1629)ATG>ATA		N-acetylgalactosaminyltransferase 14							148.0	118.0	128.0					2																	31133797		2203	4300	6503	SO:0001583	missense	79623					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr2:31133797C>T	AB078144	CCDS1773.2, CCDS58705.1, CCDS58706.1	2p23.2	2014-03-13	2014-03-13		ENSG00000158089	ENSG00000158089	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	22946	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 14"""	608225	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)"""			12507512	Standard	NM_024572		Approved	GalNac-T10, FLJ12691, GalNac-T14	uc002rns.3	Q96FL9	OTTHUMG00000074077	ENST00000349752.5:c.1629G>A	2.37:g.31133797C>T	ENSP00000288988:p.Met543Ile		Somatic				GALNT14_uc002rnq.2_Missense_Mutation_p.M523I|GALNT14_uc002rns.2_Missense_Mutation_p.M548I|GALNT14_uc010ymr.1_Missense_Mutation_p.M508I	p.M543I	NM_024572	NP_078848	WXS	Illumina HiSeq	Unspecified	Q96FL9	GLT14_HUMAN			15	2248	-	Acute lymphoblastic leukemia(172;0.155)		543			Lumenal (Potential).|Ricin B-type lectin.		B3KV89|Q4ZG75|Q53SU1|Q53TJ0|Q8IVI4|Q9BRH1|Q9H827|Q9H9J8	Missense_Mutation	SNP	ENST00000349752.5	37	c.1629G>A	CCDS1773.2	.	.	.	.	.	.	.	.	.	.	C	9.882	1.201808	0.22121	.	.	ENSG00000158089	ENST00000349752;ENST00000324589;ENST00000406653;ENST00000356174;ENST00000420311	T;T;T;T;T	0.25912	1.77;1.77;1.77;1.77;1.77	5.26	4.37	0.52481	Ricin B-related lectin (1);Ricin B lectin (3);	0.255116	0.42420	D	0.000711	T	0.24314	0.0589	L	0.46157	1.445	0.36208	D	0.851205	B;B;B;B	0.18610	0.004;0.029;0.005;0.01	B;B;B;B	0.18263	0.009;0.017;0.021;0.012	T	0.13229	-1.0517	10	0.37606	T	0.19	.	13.3651	0.60678	0.0:0.6975:0.3025:0.0	.	508;548;543;523	F5H263;Q96FL9-3;Q96FL9;B3KV89	.;.;GLT14_HUMAN;.	I	543;548;523;510;508	ENSP00000288988:M543I;ENSP00000314500:M548I;ENSP00000385435:M523I;ENSP00000348497:M510I;ENSP00000415514:M508I	ENSP00000314500:M548I	M	-	3	0	GALNT14	30987301	1.000000	0.71417	0.999000	0.59377	0.891000	0.51852	2.060000	0.41394	1.199000	0.43173	0.655000	0.94253	ATG		0.567	GALNT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157264.1	NM_024572		8	67	0	0	0	0	8	67				
SPAST	6683	broad.mit.edu	37	2	32289083	32289083	+	Silent	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr2:32289083C>T	ENST00000315285.3	+	1	308	c.183C>T	c.(181-183)ttC>ttT	p.F61F	SPAST_ENST00000345662.1_Silent_p.F61F	NM_014946.3	NP_055761.2			spastin									p.F61L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(8)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					TTGTAGGCTTCGCGCTGCTGC	0.697																																						uc002roc.2		NA																	1	Substitution - Missense(1)		upper_aerodigestive_tract(1)	breast(1)	1						c.(181-183)TTC>TTT		spastin isoform 1							42.0	40.0	41.0					2																	32289083		2203	4300	6503	SO:0001819	synonymous_variant	6683				cell cycle|cell death|cell differentiation|cytokinesis, completion of separation|ER to Golgi vesicle-mediated transport|microtubule bundle formation|microtubule severing|nervous system development|protein hexamerization|protein homooligomerization	endoplasmic reticulum|endosome|integral to membrane|microtubule|microtubule organizing center|nucleus|perinuclear region of cytoplasm|spindle	alpha-tubulin binding|ATP binding|beta-tubulin binding|microtubule binding|microtubule-severing ATPase activity	g.chr2:32289083C>T	AJ246001	CCDS1778.1, CCDS1779.1	2p24-p21	2014-09-17	2005-03-15	2005-03-17	ENSG00000021574	ENSG00000021574		"""ATPases / AAA-type"""	11233	protein-coding gene	gene with protein product		604277	"""spastic paraplegia 4 (autosomal dominant; spastin)"""	SPG4		10493830, 10610178	Standard	NM_014946		Approved	FSP2, ADPSP, KIAA1083	uc002roc.3	Q9UBP0	OTTHUMG00000128455	ENST00000315285.3:c.183C>T	2.37:g.32289083C>T			Somatic				SPAST_uc002rod.2_Silent_p.F61F	p.F61F	NM_014946	NP_055761	WXS	Illumina HiSeq	Unspecified	Q9UBP0	SPAST_HUMAN			1	404	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)		61			Required for interaction with SSNA1 and microtubules.|Required for interaction with RTN1.|Nuclear export signal.|Required for interaction with ATL1.|Helical; (Potential).|Required for midbody localization.			Silent	SNP	ENST00000315285.3	37	c.183C>T	CCDS1778.1																																																																																				0.697	SPAST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250253.1	NM_199436		4	46	0	0	0	0	4	46				
ATL2	64225	broad.mit.edu	37	2	38537571	38537571	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr2:38537571C>T	ENST00000378954.4	-	8	824	c.823G>A	c.(823-825)Gaa>Aaa	p.E275K	ATL2_ENST00000406122.1_Missense_Mutation_p.E104K|ATL2_ENST00000402054.1_Missense_Mutation_p.E104K|ATL2_ENST00000546051.1_Missense_Mutation_p.E104K|ATL2_ENST00000332337.4_Missense_Mutation_p.E257K|ATL2_ENST00000452935.2_Missense_Mutation_p.E257K|ATL2_ENST00000539122.1_Missense_Mutation_p.E104K|ATL2_ENST00000419554.2_Missense_Mutation_p.E275K	NM_001135673.1|NM_022374.2	NP_001129145.1|NP_071769.2	Q8NHH9	ATLA2_HUMAN	atlastin GTPase 2	275	GB1/RHD3-type G.				endoplasmic reticulum organization (GO:0007029)|Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|protein homooligomerization (GO:0051260)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	22						TGAAGCTCTTCATGTTGATTT	0.378																																						uc002rqq.2		NA																	0				ovary(1)|kidney(1)|skin(1)	3						c.(823-825)GAA>AAA		atlastin GTPase 2 isoform 2							139.0	125.0	129.0					2																	38537571		2203	4300	6503	SO:0001583	missense	64225				endoplasmic reticulum organization|Golgi organization|protein homooligomerization	endoplasmic reticulum membrane|integral to membrane	GTP binding|GTPase activity|identical protein binding	g.chr2:38537571C>T		CCDS1795.1, CCDS46260.1	2p22.3	2008-09-17	2008-09-17	2008-09-17	ENSG00000119787	ENSG00000119787			24047	protein-coding gene	gene with protein product		609368	"""ADP-ribosylation factor-like 6 interacting protein 2"""	ARL6IP2		10508919, 18270207	Standard	NM_022374		Approved		uc002rqq.3	Q8NHH9	OTTHUMG00000102074	ENST00000378954.4:c.823G>A	2.37:g.38537571C>T	ENSP00000368237:p.Glu275Lys		Somatic				ATL2_uc010ynm.1_Missense_Mutation_p.E257K|ATL2_uc010ynn.1_Missense_Mutation_p.E257K|ATL2_uc010yno.1_Missense_Mutation_p.E104K|ATL2_uc002rqs.2_Missense_Mutation_p.E275K|ATL2_uc002rqr.2_Missense_Mutation_p.E104K	p.E275K	NM_001135673	NP_001129145	WXS	Illumina HiSeq	Unspecified	Q8NHH9	ATLA2_HUMAN			8	853	-			275			Potential.|Cytoplasmic.		B7Z1X2|B7Z7X8|Q4ZG30|Q7Z630|Q8NHH8|Q9H5M7	Missense_Mutation	SNP	ENST00000378954.4	37	c.823G>A	CCDS46260.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.5|20.5	4.007454|4.007454	0.75046|0.75046	.|.	.|.	ENSG00000119787|ENSG00000119787	ENST00000378954;ENST00000406122;ENST00000402054;ENST00000539122;ENST00000332337;ENST00000419554;ENST00000452935;ENST00000546051;ENST00000449130|ENST00000443098	T;T;T;T;T;T;T;T;T|.	0.61392|.	0.11;0.11;0.11;0.11;0.11;0.11;0.11;0.11;0.11|.	5.11|5.11	5.11|5.11	0.69529|0.69529	Guanylate-binding protein, N-terminal (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.71467|0.71467	0.3343|0.3343	L|L	0.58810|0.58810	1.83|1.83	0.80722|0.80722	D|D	1|1	P;B;B;B;B|.	0.48764|.	0.915;0.005;0.008;0.035;0.006|.	B;B;B;B;B|.	0.41271|.	0.352;0.006;0.005;0.025;0.025|.	T|T	0.70004|0.70004	-0.4991|-0.4991	10|5	0.32370|.	T|.	0.25|.	-19.8048|-19.8048	17.5415|17.5415	0.87849|0.87849	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	104;257;257;275;275|.	B5MCN0;B7Z7X8;Q8NHH9-4;Q8NHH9-2;Q8NHH9|.	.;.;.;.;ATLA2_HUMAN|.	K|I	275;104;104;104;257;275;257;104;93|193	ENSP00000368237:E275K;ENSP00000385446:E104K;ENSP00000384062:E104K;ENSP00000446192:E104K;ENSP00000333393:E257K;ENSP00000415336:E275K;ENSP00000390743:E257K;ENSP00000438938:E104K;ENSP00000409811:E93K|.	ENSP00000333393:E257K|.	E|M	-|-	1|3	0|0	ATL2|ATL2	38391075|38391075	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.978000|0.978000	0.69477|0.69477	7.669000|7.669000	0.83911|0.83911	2.365000|2.365000	0.80145|0.80145	0.557000|0.557000	0.71058|0.71058	GAA|ATG		0.378	ATL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219886.2	NM_022374		10	57	0	0	0	0	10	57				
PLEKHH2	130271	broad.mit.edu	37	2	43986079	43986079	+	Missense_Mutation	SNP	C	C	T	rs374815272		TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr2:43986079C>T	ENST00000282406.4	+	27	4092	c.3982C>T	c.(3982-3984)Cgg>Tgg	p.R1328W		NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2	1328	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				GATGGCCCTCCGGGGACACAG	0.423																																						uc010yny.1		NA																	0				skin(2)|central_nervous_system(1)	3						c.(3982-3984)CGG>TGG		pleckstrin homology domain containing, family H		C	TRP/ARG	0,4406		0,0,2203	58.0	54.0	56.0		3982	3.8	1.0	2		56	1,8599	1.2+/-3.3	0,1,4299	no	missense	PLEKHH2	NM_172069.3	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	1328/1494	43986079	1,13005	2203	4300	6503	SO:0001583	missense	130271					cytoplasm|cytoskeleton|integral to membrane	binding	g.chr2:43986079C>T	AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.3982C>T	2.37:g.43986079C>T	ENSP00000282406:p.Arg1328Trp		Somatic					p.R1328W	NM_172069	NP_742066	WXS	Illumina HiSeq	Unspecified	Q8IVE3	PKHH2_HUMAN			27	4065	+		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	1328			FERM.		Q5JPJ6|Q6P4Q1|Q8N3Q3	Missense_Mutation	SNP	ENST00000282406.4	37	c.3982C>T	CCDS1812.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.178785	0.78564	0.0	1.16E-4	ENSG00000152527	ENST00000282406	T	0.79749	-1.3	5.66	3.8	0.43715	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.000000	0.85682	D	0.000000	D	0.88474	0.6446	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.89048	0.3453	10	0.87932	D	0	-8.6468	14.7162	0.69272	0.2648:0.7352:0.0:0.0	.	1328	Q8IVE3	PKHH2_HUMAN	W	1328	ENSP00000282406:R1328W	ENSP00000282406:R1328W	R	+	1	2	PLEKHH2	43839583	0.971000	0.33674	0.997000	0.53966	0.968000	0.65278	2.398000	0.44486	0.693000	0.31634	0.655000	0.94253	CGG		0.423	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250537.1	NM_172069		3	29	0	0	0	0	3	29				
MDH1	4190	broad.mit.edu	37	2	63831977	63831977	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr2:63831977G>A	ENST00000233114.8	+	6	1081	c.646G>A	c.(646-648)Gac>Aac	p.D216N	MDH1_ENST00000539945.1_Missense_Mutation_p.D234N|MDH1_ENST00000394423.1_Missense_Mutation_p.D216N|MDH1_ENST00000409476.1_Missense_Mutation_p.D92N|MDH1_ENST00000409908.1_Missense_Mutation_p.D51N|MDH1_ENST00000544381.1_Missense_Mutation_p.D127N	NM_005917.3	NP_005908.1	P40925	MDHC_HUMAN	malate dehydrogenase 1, NAD (soluble)	216					carbohydrate metabolic process (GO:0005975)|cellular carbohydrate metabolic process (GO:0044262)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|malate metabolic process (GO:0006108)|NADH metabolic process (GO:0006734)|oxaloacetate metabolic process (GO:0006107)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	diiodophenylpyruvate reductase activity (GO:0047860)|L-malate dehydrogenase activity (GO:0030060)|malic enzyme activity (GO:0004470)|NAD binding (GO:0051287)			endometrium(2)|kidney(4)|large_intestine(1)|liver(2)|lung(4)	13						TCTGAAAGATGACAGCTGGCT	0.433																																						uc002scj.1		NA																	0				kidney(2)	2						c.(646-648)GAC>AAC		cytosolic malate dehydrogenase	NADH(DB00157)						114.0	110.0	111.0					2																	63831977		2203	4300	6503	SO:0001583	missense	4190				gluconeogenesis|tricarboxylic acid cycle	centrosome|cytosol	L-malate dehydrogenase activity|malic enzyme activity	g.chr2:63831977G>A		CCDS1874.1, CCDS56121.1, CCDS56122.1	2p23	2012-10-02			ENSG00000014641	ENSG00000014641	1.1.1.37		6970	protein-coding gene	gene with protein product		154200					Standard	NM_005917		Approved		uc010ypv.2	P40925	OTTHUMG00000129512	ENST00000233114.8:c.646G>A	2.37:g.63831977G>A	ENSP00000233114:p.Asp216Asn		Somatic				MDH1_uc010ypv.1_Missense_Mutation_p.D234N|MDH1_uc010ypw.1_Missense_Mutation_p.D121N	p.D216N	NM_005917	NP_005908	WXS	Illumina HiSeq	Unspecified	P40925	MDHC_HUMAN			6	702	+			216					B2R5V5|B4DUN2|B7Z3I7|F5H098|Q6I9V0	Missense_Mutation	SNP	ENST00000233114.8	37	c.646G>A	CCDS1874.1	.	.	.	.	.	.	.	.	.	.	G	36	5.658122	0.96734	.	.	ENSG00000014641	ENST00000233114;ENST00000409908;ENST00000409476;ENST00000539945;ENST00000544381;ENST00000394423	T;T;T;T;T;T	0.12879	2.64;2.64;2.64;2.64;2.64;2.64	5.73	5.73	0.89815	Lactate/malate dehydrogenase, C-terminal (1);Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (2);	0.130269	0.64402	D	0.000001	T	0.32704	0.0838	M	0.61703	1.905	0.80722	D	1	D;D	0.55605	0.966;0.972	P;P	0.57324	0.818;0.794	T	0.00159	-1.1974	10	0.41790	T	0.15	-27.2939	20.2699	0.98469	0.0:0.0:1.0:0.0	.	234;216	F5H098;P40925	.;MDHC_HUMAN	N	216;51;92;234;127;216	ENSP00000233114:D216N;ENSP00000386743:D51N;ENSP00000386719:D92N;ENSP00000438144:D234N;ENSP00000446395:D127N;ENSP00000377945:D216N	ENSP00000233114:D216N	D	+	1	0	MDH1	63685481	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.476000	0.97823	2.854000	0.98071	0.655000	0.94253	GAC		0.433	MDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251687.1			8	46	0	0	0	0	8	46				
ATP6V1B1	525	broad.mit.edu	37	2	71189955	71189955	+	Silent	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr2:71189955C>T	ENST00000234396.4	+	9	907	c.834C>T	c.(832-834)ttC>ttT	p.F278F	RN7SL160P_ENST00000468558.2_RNA|ATP6V1B1_ENST00000412314.1_Silent_p.F278F|AC007040.11_ENST00000606025.1_Intron	NM_001692.3	NP_001683.2	P15313	VATB1_HUMAN	ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1	278					ATP hydrolysis coupled proton transport (GO:0015991)|ATP metabolic process (GO:0046034)|calcium ion homeostasis (GO:0055074)|cellular iron ion homeostasis (GO:0006879)|excretion (GO:0007588)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|ossification (GO:0001503)|pH reduction (GO:0045851)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|regulation of pH (GO:0006885)|sensory perception of sound (GO:0007605)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lateral plasma membrane (GO:0016328)|microvillus (GO:0005902)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	ATP binding (GO:0005524)|hydrogen ion transmembrane transporter activity (GO:0015078)|hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances (GO:0016820)			endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|prostate(1)|skin(1)	19						CTGCTGAATTCCTTGCCTACC	0.582																																						uc002shj.2		NA																	0				skin(1)	1						c.(832-834)TTC>TTT		ATPase, H+ transporting, lysosomal 56/58kDa, V1							142.0	123.0	129.0					2																	71189955		2203	4300	6503	SO:0001819	synonymous_variant	525				ATP hydrolysis coupled proton transport|calcium ion homeostasis|cellular iron ion homeostasis|excretion|inner ear morphogenesis|insulin receptor signaling pathway|ossification|pH reduction|sensory perception of sound|transferrin transport	apical plasma membrane|basolateral plasma membrane|cytosol|endomembrane system|lateral plasma membrane|microvillus|proton-transporting V-type ATPase, V1 domain|vacuolar proton-transporting V-type ATPase complex	ATP binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism	g.chr2:71189955C>T	AF107466	CCDS1912.1	2p13	2010-04-21	2008-07-31	2002-05-10	ENSG00000116039	ENSG00000116039	3.6.3.14	"""ATPases / V-type"""	853	protein-coding gene	gene with protein product	"""Renal tubular acidosis with deafness"""	192132	"""vacuolar proton pump 3"""	VPP3, ATP6B1		9916796, 2527371	Standard	XM_005264368		Approved	VATB, RTA1B, Vma2	uc002shj.3	P15313	OTTHUMG00000129711	ENST00000234396.4:c.834C>T	2.37:g.71189955C>T			Somatic				ATP6V1B1_uc010fdv.2_Silent_p.F278F|ATP6V1B1_uc010fdw.2_RNA|ATP6V1B1_uc010fdx.2_Silent_p.F236F	p.F278F	NM_001692	NP_001683	WXS	Illumina HiSeq	Unspecified	P15313	VATB1_HUMAN			9	921	+			278					Q53FY0|Q6P4H6	Silent	SNP	ENST00000234396.4	37	c.834C>T	CCDS1912.1																																																																																				0.582	ATP6V1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251920.2	NM_001692		11	69	0	0	0	0	11	69				
TBC1D8	11138	broad.mit.edu	37	2	101655014	101655014	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr2:101655014C>T	ENST00000376840.4	-	7	1138	c.1139G>A	c.(1138-1140)cGa>cAa	p.R380Q	TBC1D8_ENST00000409318.1_Missense_Mutation_p.R395Q			O95759	TBCD8_HUMAN	TBC1 domain family, member 8 (with GRAM domain)	380					blood circulation (GO:0008015)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	32						CAGGCTGTCTCGGTCCCGGAG	0.587																																						uc010fiv.2		NA																	0				ovary(3)	3						c.(1138-1140)CGA>CAA		TBC1 domain family, member 8							136.0	147.0	143.0					2																	101655014		2142	4246	6388	SO:0001583	missense	11138				blood circulation|positive regulation of cell proliferation	intracellular|membrane	calcium ion binding|Rab GTPase activator activity	g.chr2:101655014C>T	AB024057	CCDS46375.1	2q12.1	2011-11-30			ENSG00000204634	ENSG00000204634			17791	protein-coding gene	gene with protein product	"""BUB2-like protein 1"", ""vascular Rab-GAP/TBC-containing protein"""					10373574	Standard	NM_001102426		Approved	HBLP1, VRP, AD3	uc010fiv.3	O95759	OTTHUMG00000153040	ENST00000376840.4:c.1139G>A	2.37:g.101655014C>T	ENSP00000366036:p.Arg380Gln		Somatic				TBC1D8_uc010yvw.1_Missense_Mutation_p.R395Q|TBC1D8_uc002tau.3_Missense_Mutation_p.R137Q	p.R380Q	NM_001102426	NP_001095896	WXS	Illumina HiSeq	Unspecified	O95759	TBCD8_HUMAN			7	1270	-			380					A6NDL4|A8K9W1|B9A6K4|Q53SQ4|Q9UQ32	Missense_Mutation	SNP	ENST00000376840.4	37	c.1139G>A	CCDS46375.1	.	.	.	.	.	.	.	.	.	.	C	34	5.331512	0.95733	.	.	ENSG00000204634	ENST00000376840;ENST00000409318	T;T	0.04234	3.67;3.67	5.09	5.09	0.68999	.	0.211701	0.31246	N	0.007981	T	0.23330	0.0564	M	0.79123	2.44	0.46798	D	0.999206	D;D	0.89917	1.0;0.999	D;P	0.83275	0.996;0.848	T	0.00738	-1.1587	10	0.42905	T	0.14	-14.8491	18.4969	0.90867	0.0:1.0:0.0:0.0	.	395;380	B7Z6L4;O95759	.;TBCD8_HUMAN	Q	380;395	ENSP00000366036:R380Q;ENSP00000386856:R395Q	ENSP00000366036:R380Q	R	-	2	0	TBC1D8	101021446	0.851000	0.29673	0.019000	0.16419	0.909000	0.53808	7.684000	0.84104	2.360000	0.80028	0.655000	0.94253	CGA		0.587	TBC1D8-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376092.1	NM_007063		20	135	0	0	0	0	20	135				
CNOT11	55571	broad.mit.edu	37	2	101874329	101874329	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr2:101874329C>G	ENST00000289382.3	+	2	754	c.591C>G	c.(589-591)ttC>ttG	p.F197L		NM_017546.4	NP_060016.3	Q9UKZ1	CNO11_HUMAN	CCR4-NOT transcription complex, subunit 11	197					cell proliferation (GO:0008283)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytosol (GO:0005829)|nucleus (GO:0005634)											GGGAACTCTTCAAAAAGACGC	0.473																																						uc002taw.3		NA																	0				ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						c.(589-591)TTC>TTG		hypothetical protein LOC55571							84.0	79.0	81.0					2																	101874329		2203	4300	6503	SO:0001583	missense	55571				cell proliferation|nuclear-transcribed mRNA poly(A) tail shortening	cytosol		g.chr2:101874329C>G	AF103798	CCDS2050.1	2q12.1	2013-01-24	2013-01-24	2013-01-24	ENSG00000158435	ENSG00000158435			25217	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 29"""	C2orf29		10497265, 23232451, 23303381	Standard	NM_017546		Approved	C40	uc002taw.4	Q9UKZ1	OTTHUMG00000130686	ENST00000289382.3:c.591C>G	2.37:g.101874329C>G	ENSP00000289382:p.Phe197Leu		Somatic					p.F197L	NM_017546	NP_060016	WXS	Illumina HiSeq	Unspecified	Q9UKZ1	CB029_HUMAN			2	673	+			197					Q6P2M9|Q8N681	Missense_Mutation	SNP	ENST00000289382.3	37	c.591C>G	CCDS2050.1	.	.	.	.	.	.	.	.	.	.	C	10.16	1.274537	0.23307	.	.	ENSG00000158435	ENST00000289382	T	0.26957	1.7	6.01	4.17	0.49024	.	0.145042	0.64402	D	0.000005	T	0.08714	0.0216	N	0.02539	-0.55	0.54753	D	0.999981	B	0.28055	0.199	B	0.25506	0.061	T	0.16897	-1.0387	10	0.10111	T	0.7	-13.0884	8.7033	0.34338	0.0:0.7066:0.0:0.2934	.	197	Q9UKZ1	CB029_HUMAN	L	197	ENSP00000289382:F197L	ENSP00000289382:F197L	F	+	3	2	C2orf29	101240761	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.245000	0.32790	0.836000	0.34901	0.558000	0.71614	TTC		0.473	CNOT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253181.1	NM_017546		11	92	0	0	0	0	11	92				
SLC5A7	60482	broad.mit.edu	37	2	108626898	108626898	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr2:108626898G>T	ENST00000264047.2	+	9	1600	c.1324G>T	c.(1324-1326)Ggc>Tgc	p.G442C	SLC5A7_ENST00000540517.1_Missense_Mutation_p.G337C|SLC5A7_ENST00000409059.1_Missense_Mutation_p.G442C	NM_021815.2	NP_068587.1	Q9GZV3	SC5A7_HUMAN	solute carrier family 5 (sodium/choline cotransporter), member 7	442					acetylcholine biosynthetic process (GO:0008292)|cell death (GO:0008219)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	choline binding (GO:0033265)|choline transmembrane transporter activity (GO:0015220)|choline:sodium symporter activity (GO:0005307)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	49					Choline(DB00122)	TTATGTTTCTGGCCTCTTCCT	0.453																																						uc002tdv.2		NA																	0				ovary(2)|central_nervous_system(1)|skin(1)	4						c.(1324-1326)GGC>TGC		solute carrier family 5 (choline transporter),	Choline(DB00122)						133.0	126.0	129.0					2																	108626898		2203	4300	6503	SO:0001583	missense	60482				acetylcholine biosynthetic process|neurotransmitter secretion	integral to membrane|plasma membrane	choline:sodium symporter activity	g.chr2:108626898G>T	AF276871	CCDS2074.1	2q12	2013-07-19	2013-07-19		ENSG00000115665	ENSG00000115665		"""Solute carriers"""	14025	protein-coding gene	gene with protein product		608761	"""solute carrier family 5 (choline transporter), member 7"""			11027560	Standard	NM_021815		Approved	hCHT, CHT1	uc002tdv.3	Q9GZV3	OTTHUMG00000130959	ENST00000264047.2:c.1324G>T	2.37:g.108626898G>T	ENSP00000264047:p.Gly442Cys		Somatic				SLC5A7_uc010ywm.1_Missense_Mutation_p.G195C|SLC5A7_uc010fjj.2_Missense_Mutation_p.G442C|SLC5A7_uc010ywn.1_Missense_Mutation_p.G329C	p.G442C	NM_021815	NP_068587	WXS	Illumina HiSeq	Unspecified	Q9GZV3	SC5A7_HUMAN			9	1600	+			442			Helical; (Potential).		Q53TF2	Missense_Mutation	SNP	ENST00000264047.2	37	c.1324G>T	CCDS2074.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.982229	0.93044	.	.	ENSG00000115665	ENST00000409059;ENST00000540517;ENST00000264047	D;D;D	0.97906	-4.6;-4.6;-4.6	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	D	0.99152	0.9707	M	0.93241	3.395	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99170	1.0864	10	0.87932	D	0	-17.0551	20.4024	0.99000	0.0:0.0:1.0:0.0	.	442	Q9GZV3	SC5A7_HUMAN	C	442;337;442	ENSP00000387346:G442C;ENSP00000445351:G337C;ENSP00000264047:G442C	ENSP00000264047:G442C	G	+	1	0	SLC5A7	107993330	1.000000	0.71417	0.987000	0.45799	0.989000	0.77384	9.869000	0.99810	2.827000	0.97445	0.650000	0.86243	GGC		0.453	SLC5A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253562.1			8	67	1	0	0.00307968	0.00320342	8	67				
ZC3H8	84524	broad.mit.edu	37	2	112994207	112994207	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr2:112994207G>A	ENST00000409573.2	-	4	565	c.436C>T	c.(436-438)Cga>Tga	p.R146*	ZC3H8_ENST00000272570.5_Nonsense_Mutation_p.R146*			Q8N5P1	ZC3H8_HUMAN	zinc finger CCCH-type containing 8	146					apoptotic process (GO:0006915)|negative regulation of T cell differentiation in thymus (GO:0033085)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|response to antibiotic (GO:0046677)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)|T cell homeostasis (GO:0043029)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)	7						GGCCATTTTCGCTTCATTTTC	0.353																																						uc002thp.2		NA																	0					0						c.(436-438)CGA>TGA		zinc finger CCCH-type containing 8							201.0	185.0	190.0					2																	112994207		1866	4103	5969	SO:0001587	stop_gained	84524				apoptosis|negative regulation of T cell differentiation in thymus|negative regulation of transcription, DNA-dependent|positive regulation of thymocyte apoptosis|response to antibiotic|T cell homeostasis	nucleus	RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr2:112994207G>A	AF334161	CCDS46392.1	2q13	2012-07-05	2005-06-02	2005-06-02	ENSG00000144161	ENSG00000144161		"""Zinc fingers, CCCH-type domain containing"""	30941	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 8"""	ZC3HDC8		12477932	Standard	NM_032494		Approved	Fliz1	uc021vmw.1	Q8N5P1	OTTHUMG00000153270	ENST00000409573.2:c.436C>T	2.37:g.112994207G>A	ENSP00000386488:p.Arg146*		Somatic					p.R146*	NM_032494	NP_115883	WXS	Illumina HiSeq	Unspecified	Q8N5P1	ZC3H8_HUMAN			4	542	-			146					Q9BZ75	Nonsense_Mutation	SNP	ENST00000409573.2	37	c.436C>T	CCDS46392.1	.	.	.	.	.	.	.	.	.	.	G	15.15	2.749097	0.49257	.	.	ENSG00000144161	ENST00000409573;ENST00000272570	.	.	.	4.28	0.35	0.16037	.	0.299670	0.25692	N	0.028939	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.2631	4.918	0.13856	0.2478:0.0:0.6049:0.1473	.	.	.	.	X	146	.	ENSP00000272570:R146X	R	-	1	2	ZC3H8	112710678	1.000000	0.71417	0.981000	0.43875	0.486000	0.33341	3.450000	0.52957	0.051000	0.15978	-0.140000	0.14226	CGA		0.353	ZC3H8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330521.3	NM_032494		11	66	0	0	0	0	11	66				
PSD4	23550	broad.mit.edu	37	2	113950670	113950670	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr2:113950670C>G	ENST00000245796.6	+	7	2079	c.1884C>G	c.(1882-1884)ttC>ttG	p.F628L	PSD4_ENST00000441564.3_Missense_Mutation_p.F600L	NM_012455.2	NP_036587.2	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4	628	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			cervix(1)|endometrium(2)|large_intestine(4)|lung(13)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TGTCCTTCTTCCAGTTTGGAG	0.622																																						uc002tjc.2		NA																	0				ovary(2)	2						c.(1882-1884)TTC>TTG		pleckstrin and Sec7 domain containing 4							82.0	70.0	74.0					2																	113950670		2203	4300	6503	SO:0001583	missense	23550				regulation of ARF protein signal transduction	cytoplasm|plasma membrane	ARF guanyl-nucleotide exchange factor activity	g.chr2:113950670C>G	U63127	CCDS33276.1	2q13	2013-01-10			ENSG00000125637	ENSG00000125637		"""Pleckstrin homology (PH) domain containing"""	19096	protein-coding gene	gene with protein product		614442				12082148	Standard	XM_005263634		Approved	TIC, EFA6B	uc002tjc.3	Q8NDX1	OTTHUMG00000153339	ENST00000245796.6:c.1884C>G	2.37:g.113950670C>G	ENSP00000245796:p.Phe628Leu		Somatic				PSD4_uc002tjd.2_Missense_Mutation_p.F249L|PSD4_uc002tje.2_Missense_Mutation_p.F599L|PSD4_uc002tjf.2_Missense_Mutation_p.F249L	p.F628L	NM_012455	NP_036587	WXS	Illumina HiSeq	Unspecified	Q8NDX1	PSD4_HUMAN			7	2067	+			628			SEC7.		A6NEG7|A8K1Y0|O95621|Q4ZG34|Q6GPH8|Q8IYP4	Missense_Mutation	SNP	ENST00000245796.6	37	c.1884C>G	CCDS33276.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.100995	0.76983	.	.	ENSG00000125637	ENST00000245796;ENST00000441564	T;T	0.59906	0.23;0.23	5.44	2.66	0.31614	SEC7-like (4);	0.000000	0.85682	D	0.000000	T	0.69415	0.3108	M	0.70595	2.14	0.80722	D	1	P;D;D	0.64830	0.87;0.984;0.994	D;D;D	0.72338	0.966;0.96;0.977	T	0.68754	-0.5325	10	0.87932	D	0	.	6.9083	0.24321	0.0:0.6519:0.0:0.3481	.	286;600;628	Q59HG0;Q8NDX1-2;Q8NDX1	.;.;PSD4_HUMAN	L	628;600	ENSP00000245796:F628L;ENSP00000413997:F600L	ENSP00000245796:F628L	F	+	3	2	PSD4	113667141	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.800000	0.38833	0.671000	0.31185	0.655000	0.94253	TTC		0.622	PSD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330789.1	NM_012455		4	68	0	0	0	0	4	68				
R3HDM1	23518	broad.mit.edu	37	2	136389447	136389447	+	Missense_Mutation	SNP	T	T	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr2:136389447T>A	ENST00000264160.4	+	9	944	c.574T>A	c.(574-576)Ttc>Atc	p.F192I	R3HDM1_ENST00000409478.1_Missense_Mutation_p.F148I|R3HDM1_ENST00000329971.3_Missense_Mutation_p.F148I|R3HDM1_ENST00000410054.1_Missense_Mutation_p.F136I|R3HDM1_ENST00000409606.1_Missense_Mutation_p.F192I	NM_001282798.1|NM_015361.2	NP_001269727.1|NP_056176.2	Q15032	R3HD1_HUMAN	R3H domain containing 1	192	R3H. {ECO:0000255|PROSITE- ProRule:PRU00382}.						poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(6)|kidney(5)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	38				BRCA - Breast invasive adenocarcinoma(221;0.127)		ACGTAAAAAATTCCCCCCAAT	0.398																																						uc002tuo.2		NA																	0				skin(1)	1						c.(574-576)TTC>ATC		R3H domain containing 1							127.0	125.0	126.0					2																	136389447		2203	4300	6503	SO:0001583	missense	23518						nucleic acid binding	g.chr2:136389447T>A	D21852	CCDS2177.1, CCDS63024.1, CCDS63025.1, CCDS63026.1	2q21.3	2012-09-20	2005-09-02	2005-09-02	ENSG00000048991	ENSG00000048991			9757	protein-coding gene	gene with protein product			"""R3H domain (binds single-stranded nucleic acids) containing"""	R3HDM		7584026	Standard	NM_001282798		Approved	KIAA0029	uc002tuo.3	Q15032	OTTHUMG00000131740	ENST00000264160.4:c.574T>A	2.37:g.136389447T>A	ENSP00000264160:p.Phe192Ile		Somatic				R3HDM1_uc010fni.2_Missense_Mutation_p.F190I|R3HDM1_uc002tup.2_Missense_Mutation_p.F136I|R3HDM1_uc010zbh.1_Missense_Mutation_p.F24I	p.F192I	NM_015361	NP_056176	WXS	Illumina HiSeq	Unspecified	Q15032	R3HD1_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.127)	9	944	+			192			R3H.		A8K1V0|B3KXQ9|E9PBB4|E9PG42|G5E9G8|Q8IW32	Missense_Mutation	SNP	ENST00000264160.4	37	c.574T>A	CCDS2177.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	33|33	5.283900|5.283900	0.95489|0.95489	.|.	.|.	ENSG00000048991|ENSG00000048991	ENST00000422577;ENST00000409478;ENST00000264160;ENST00000329971;ENST00000410054;ENST00000409606|ENST00000456040	T;T;T;T;T|.	0.53857|.	0.6;0.6;0.6;0.6;0.6|.	5.64|5.64	5.64|5.64	0.86602|0.86602	Single-stranded nucleic acid binding R3H (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.83834|0.83834	0.5340|0.5340	M|M	0.90019|0.90019	3.08|3.08	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	0.999;1.0;0.996;0.996|.	D;D;D;D|.	0.91635|.	0.998;0.999;0.997;0.997|.	D|D	0.87155|0.87155	0.2211|0.2211	10|5	0.87932|.	D|.	0|.	-9.2102|-9.2102	15.8579|15.8579	0.78994|0.78994	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	148;192;136;192|.	G5E9G8;E9PBB4;E9PG42;Q15032|.	.;.;.;R3HD1_HUMAN|.	I|K	148;148;192;148;136;192|174	ENSP00000386457:F148I;ENSP00000264160:F192I;ENSP00000331396:F148I;ENSP00000386877:F136I;ENSP00000387010:F192I|.	ENSP00000264160:F192I|.	F|N	+|+	1|3	0|2	R3HDM1|R3HDM1	136105917|136105917	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.303000|6.303000	0.72794|0.72794	2.151000|2.151000	0.67156|0.67156	0.528000|0.528000	0.53228|0.53228	TTC|AAT		0.398	R3HDM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254659.1	NM_015361		21	98	0	0	0	0	21	98				
BAZ2B	29994	broad.mit.edu	37	2	160194206	160194207	+	Missense_Mutation	DNP	GC	GC	AA	rs202012948		TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr2:160194206_160194207GC>AA	ENST00000392783.2	-	32	6026_6027	c.5531_5532GC>TT	c.(5530-5532)tGC>tTT	p.C1844F	BAZ2B_ENST00000392782.1_Missense_Mutation_p.C1808F|BAZ2B_ENST00000343439.5_Missense_Mutation_p.C1744F|BAZ2B_ENST00000355831.2_Missense_Mutation_p.C1810F	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	1844					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						CATGCTCCTTGCACAATTTAGT	0.426																																						uc002uao.2		NA																	0				ovary(3)|skin(1)	4						c.(5530-5532)TGC>TTT		bromodomain adjacent to zinc finger domain, 2B																																				SO:0001583	missense	29994				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr2:160194206_160194207GC>AA	AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.5531_5532delinsAA	2.37:g.160194206_160194207delinsAA	ENSP00000376534:p.Cys1844Phe		Somatic				BAZ2B_uc002uap.2_Missense_Mutation_p.C1808F	p.C1844F	NM_013450	NP_038478	WXS	Illumina HiSeq	Unspecified	Q9UIF8	BAZ2B_HUMAN			32	5883_5884	-			1844					D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	DNP	ENST00000392783.2	37	c.5531_5532GC>TT	CCDS2209.2																																																																																				0.426	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255037.2			14	80	0	0	0	0	14	80				
IFIH1	64135	broad.mit.edu	37	2	163163360	163163360	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr2:163163360C>G	ENST00000263642.2	-	3	1023	c.628G>C	c.(628-630)Gag>Cag	p.E210Q		NM_022168.3	NP_071451.2	Q9BYX4	IFIH1_HUMAN	interferon induced with helicase C domain 1	210					cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|protein sumoylation (GO:0016925)|regulation of apoptotic process (GO:0042981)|regulation of type III interferon production (GO:0034344)|response to virus (GO:0009615)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|ribonucleoprotein complex binding (GO:0043021)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	39						GATAAATTCTCAATCTCTGTG	0.368																																						uc002uce.2		NA																	0				ovary(1)	1						c.(628-630)GAG>CAG		interferon induced with helicase C domain 1							91.0	82.0	85.0					2																	163163360		2203	4300	6503	SO:0001583	missense	64135				detection of virus|innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|regulation of apoptosis	cytosol|nucleus	ATP binding|DNA binding|double-stranded RNA binding|helicase activity|protein binding|ribonucleoprotein binding|zinc ion binding	g.chr2:163163360C>G	AF095844	CCDS2217.1	2q24.2	2010-02-09			ENSG00000115267	ENSG00000115267			18873	protein-coding gene	gene with protein product	"""helicard"""	606951					Standard	NM_022168		Approved	MDA-5, Hlcd, MDA5, IDDM19	uc002uce.4	Q9BYX4	OTTHUMG00000132055	ENST00000263642.2:c.628G>C	2.37:g.163163360C>G	ENSP00000263642:p.Glu210Gln		Somatic					p.E210Q	NM_022168	NP_071451	WXS	Illumina HiSeq	Unspecified	Q9BYX4	IFIH1_HUMAN			3	850	-			210					Q2NKL6|Q6DC96|Q86X56|Q96MX8|Q9H3G6	Missense_Mutation	SNP	ENST00000263642.2	37	c.628G>C	CCDS2217.1	.	.	.	.	.	.	.	.	.	.	c	14.26	2.482923	0.44147	.	.	ENSG00000115267	ENST00000263642;ENST00000543192	T	0.05447	3.44	4.32	3.44	0.39384	.	0.986368	0.08265	N	0.972404	T	0.07593	0.0191	L	0.51422	1.61	0.09310	N	1	B	0.32245	0.361	B	0.29942	0.109	T	0.36407	-0.9749	10	0.28530	T	0.3	-0.2753	8.1817	0.31315	0.0:0.8905:0.0:0.1095	.	210	Q9BYX4	IFIH1_HUMAN	Q	210	ENSP00000263642:E210Q	ENSP00000263642:E210Q	E	-	1	0	IFIH1	162871606	0.868000	0.29978	0.003000	0.11579	0.789000	0.44602	1.133000	0.31430	1.169000	0.42739	0.556000	0.70494	GAG		0.368	IFIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255078.2	NM_022168		3	38	0	0	0	0	3	38				
TTN	7273	broad.mit.edu	37	2	179417226	179417226	+	Nonsense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr2:179417226G>C	ENST00000591111.1	-	285	85702	c.85478C>G	c.(85477-85479)tCa>tGa	p.S28493*	TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000589042.1_Nonsense_Mutation_p.S30134*|TTN_ENST00000342992.6_Nonsense_Mutation_p.S27566*|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000460472.2_Nonsense_Mutation_p.S21069*|RP11-65L3.2_ENST00000603415.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000359218.5_Nonsense_Mutation_p.S21194*|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Nonsense_Mutation_p.S21261*			Q8WZ42	TITIN_HUMAN	titin	28493	Ig-like 132.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGGGATATCTGACAGGTCAAC	0.423																																						uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(82696-82698)TCA>TGA		titin isoform N2-A							79.0	75.0	76.0					2																	179417226		1882	4117	5999	SO:0001587	stop_gained	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179417226G>C	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.85478C>G	2.37:g.179417226G>C	ENSP00000465570:p.Ser28493*		Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Nonsense_Mutation_p.S21261*|TTN_uc010zfi.1_Nonsense_Mutation_p.S21194*|TTN_uc010zfj.1_Nonsense_Mutation_p.S21069*	p.S27566*	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		284	82921	-			28493					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	ENST00000591111.1	37	c.82697C>G		.	.	.	.	.	.	.	.	.	.	G	66	95.844175	0.99997	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	.	.	.	5.76	5.76	0.90799	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.3242	0.98691	0.0:0.0:1.0:0.0	.	.	.	.	X	27566;21069;21261;21194;21066	.	ENSP00000340554:S21261X	S	-	2	0	TTN	179125472	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.076000	0.50081	2.882000	0.98803	0.655000	0.94253	TCA		0.423	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		6	35	0	0	0	0	6	35				
MYO1B	4430	broad.mit.edu	37	2	192225422	192225422	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr2:192225422C>T	ENST00000392318.3	+	8	875	c.628C>T	c.(628-630)Cag>Tag	p.Q210*	MYO1B_ENST00000392316.1_Nonsense_Mutation_p.Q210*|MYO1B_ENST00000304164.4_Nonsense_Mutation_p.Q210*|MYO1B_ENST00000339514.4_Nonsense_Mutation_p.Q210*	NM_001130158.1	NP_001123630.1	O43795	MYO1B_HUMAN	myosin IB	210	Myosin motor.				actin filament bundle assembly (GO:0051017)|actin filament organization (GO:0007015)|actin filament-based movement (GO:0030048)|metabolic process (GO:0008152)|post-Golgi vesicle-mediated transport (GO:0006892)	actin filament (GO:0005884)|brush border (GO:0005903)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(1)|central_nervous_system(6)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(19)|ovary(1)	55			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			TGTGTTCTATCAGCTGCTCTC	0.408																																						uc010fsg.2		NA																	0				central_nervous_system(5)|large_intestine(2)|ovary(1)	8						c.(628-630)CAG>TAG		myosin IB isoform 1							209.0	202.0	205.0					2																	192225422		2203	4300	6503	SO:0001587	stop_gained	4430					myosin complex	actin binding|ATP binding|calmodulin binding|motor activity	g.chr2:192225422C>T	L29138	CCDS2311.1, CCDS46477.1	2q12-q34	2011-09-27			ENSG00000128641	ENSG00000128641		"""Myosins / Myosin superfamily : Class I"""	7596	protein-coding gene	gene with protein product		606537				8022818, 8449985	Standard	NM_012223		Approved	myr1	uc010fsg.2	O43795	OTTHUMG00000132718	ENST00000392318.3:c.628C>T	2.37:g.192225422C>T	ENSP00000376132:p.Gln210*		Somatic				MYO1B_uc002usq.2_Nonsense_Mutation_p.Q210*|MYO1B_uc002usr.2_Nonsense_Mutation_p.Q210*|MYO1B_uc002uss.1_Nonsense_Mutation_p.Q210*	p.Q210*	NM_001130158	NP_001123630	WXS	Illumina HiSeq	Unspecified	O43795	MYO1B_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)		8	883	+			210			Myosin head-like.		O43794|Q7Z6L5	Nonsense_Mutation	SNP	ENST00000392318.3	37	c.628C>T	CCDS46477.1	.	.	.	.	.	.	.	.	.	.	C	35	5.588463	0.96590	.	.	ENSG00000128641	ENST00000339514;ENST00000439452;ENST00000392318;ENST00000304164;ENST00000451437;ENST00000392316	.	.	.	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.0408	0.89318	0.0:1.0:0.0:0.0	.	.	.	.	X	210	.	ENSP00000306382:Q210X	Q	+	1	0	MYO1B	191933667	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.115000	0.77110	2.681000	0.91329	0.655000	0.94253	CAG		0.408	MYO1B-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334774.1	NM_012223		20	140	0	0	0	0	20	140				
PAX3	5077	broad.mit.edu	37	2	223066840	223066840	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr2:223066840G>C	ENST00000350526.4	-	8	1379	c.1243C>G	c.(1243-1245)Ctc>Gtc	p.L415V	PAX3_ENST00000392070.2_Missense_Mutation_p.L415V|PAX3_ENST00000392069.2_Missense_Mutation_p.L415V|PAX3_ENST00000344493.4_Intron|PAX3_ENST00000464706.1_5'UTR|PAX3_ENST00000409551.3_Missense_Mutation_p.L414V|PAX3_ENST00000336840.6_Intron	NM_181457.3	NP_852122.1	P23760	PAX3_HUMAN	paired box 3	415					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|developmental pigmentation (GO:0048066)|heart development (GO:0007507)|mammary gland specification (GO:0060594)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|neuron fate commitment (GO:0048663)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of somitogenesis (GO:0014807)|sensory perception of sound (GO:0007605)|spinal cord association neuron differentiation (GO:0021527)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)		PAX3/NCOA2(4)|PAX3/NCOA1(8)|PAX3/FOXO1(749)	NS(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(13)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	38		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCCCCGGTGAGAGGGGAGAGC	0.547			T	"""FOXO1A, NCOA1"""	alveolar rhabdomyosarcoma		Waardenburg syndrome; craniofacial-deafness-hand syndrome																															uc010fwo.2		NA		Dom	yes		2	2q35	5077	T	paired box gene 3	yes	Waardenburg syndrome; craniofacial-deafness-hand syndrome	M	FOXO1A|NCOA1		alveolar rhabdomyosarcoma	PAX3/FOXO1(749)|PAX3/NCOA1(8)|PAX3/NCOA2(4)	0				soft_tissue(761)|ovary(4)|skin(1)	766						c.(1243-1245)CTC>GTC		paired box 3 isoform PAX3							76.0	73.0	74.0					2																	223066840		2203	4300	6503	SO:0001583	missense	5077				apoptosis|organ morphogenesis|positive regulation of transcription from RNA polymerase II promoter|sensory perception of sound|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:223066840G>C		CCDS2449.1, CCDS2450.1, CCDS2451.1, CCDS42825.1, CCDS2448.1, CCDS42826.1, CCDS46522.1, CCDS46523.1	2q36.1	2011-06-20	2007-07-12		ENSG00000135903	ENSG00000135903		"""Paired boxes"", ""Homeoboxes / PRD class"""	8617	protein-coding gene	gene with protein product		606597	"""Waardenburg syndrome 1"", ""paired box gene 3 (Waardenburg syndrome 1)"""	WS1		1347149	Standard	NM_181461		Approved	HUP2	uc002vmt.2	P23760	OTTHUMG00000133157	ENST00000350526.4:c.1243C>G	2.37:g.223066840G>C	ENSP00000343052:p.Leu415Val		Somatic				PAX3_uc002vmt.1_Missense_Mutation_p.L415V|PAX3_uc002vmy.1_Missense_Mutation_p.L414V|PAX3_uc002vmv.1_Missense_Mutation_p.L415V|PAX3_uc002vmw.1_Intron|PAX3_uc002vmx.1_Intron	p.L415V	NM_181457	NP_852122	WXS	Illumina HiSeq	Unspecified	P23760	PAX3_HUMAN		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	8	1609	-		Renal(207;0.0183)	415					G5E9C1|Q16448|Q494Z3|Q494Z4|Q53T90|Q6GSJ9|Q86UQ2|Q86UQ3	Missense_Mutation	SNP	ENST00000350526.4	37	c.1243C>G	CCDS42826.1	.	.	.	.	.	.	.	.	.	.	G	19.23	3.788197	0.70337	.	.	ENSG00000135903	ENST00000392069;ENST00000350526;ENST00000392070;ENST00000409551;ENST00000464706	D;D;D;D	0.94613	-3.47;-3.45;-3.42;-3.43	5.81	5.81	0.92471	.	0.066388	0.64402	N	0.000010	D	0.95636	0.8581	L	0.58810	1.83	0.80722	D	1	D;D;D	0.71674	0.985;0.997;0.998	P;D;D	0.77557	0.859;0.978;0.99	D	0.93702	0.7016	10	0.31617	T	0.26	.	9.8258	0.40910	0.1874:0.0:0.8126:0.0	.	415;414;415	P23760;Q494Z4;G5E9C1	PAX3_HUMAN;.;.	V	415;415;415;414;132	ENSP00000375921:L415V;ENSP00000343052:L415V;ENSP00000375922:L415V;ENSP00000386750:L414V	ENSP00000343052:L415V	L	-	1	0	PAX3	222775084	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	3.555000	0.53727	2.736000	0.93811	0.655000	0.94253	CTC		0.547	PAX3-006	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328670.1			5	21	0	0	0	0	5	21				
WDFY1	57590	broad.mit.edu	37	2	224809972	224809972	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr2:224809972C>G	ENST00000233055.4	-	1	132	c.30G>C	c.(28-30)caG>caC	p.Q10H		NM_020830.3	NP_065881.1	Q8IWB7	WDFY1_HUMAN	WD repeat and FYVE domain containing 1	10						cytosol (GO:0005829)|early endosome (GO:0005769)|nucleus (GO:0005634)	1-phosphatidylinositol binding (GO:0005545)|zinc ion binding (GO:0008270)			NS(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(6)|prostate(2)	18		all_lung(227;0.00682)|Lung NSC(271;0.00859)|Renal(207;0.0112)|all_hematologic(139;0.189)		Epithelial(121;5.34e-10)|all cancers(144;1.67e-07)|Lung(261;0.00807)|LUSC - Lung squamous cell carcinoma(224;0.00843)		GGCGGCTGCTCTGCGGCCTGG	0.726																																						uc002vnq.2		NA																	0				lung(1)	1						c.(28-30)CAG>CAC		WD repeat and FYVE domain containing 1							15.0	17.0	17.0					2																	224809972		2184	4266	6450	SO:0001583	missense	57590					cytosol|early endosome|nucleus	1-phosphatidylinositol binding|zinc ion binding	g.chr2:224809972C>G	AB037856	CCDS33387.1	2q36.2	2013-01-09	2003-03-13		ENSG00000085449	ENSG00000085449		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20451	protein-coding gene	gene with protein product			"""WD40 and FYVE domain containing 1"""			11739631	Standard	NM_020830		Approved	KIAA1435, FENS-1, WDF1, ZFYVE17	uc002vnq.3	Q8IWB7	OTTHUMG00000153370	ENST00000233055.4:c.30G>C	2.37:g.224809972C>G	ENSP00000233055:p.Gln10His		Somatic					p.Q10H	NM_020830	NP_065881	WXS	Illumina HiSeq	Unspecified	Q8IWB7	WDFY1_HUMAN		Epithelial(121;5.34e-10)|all cancers(144;1.67e-07)|Lung(261;0.00807)|LUSC - Lung squamous cell carcinoma(224;0.00843)	1	81	-		all_lung(227;0.00682)|Lung NSC(271;0.00859)|Renal(207;0.0112)|all_hematologic(139;0.189)	10					Q53S17|Q9H9D5|Q9P2B3	Missense_Mutation	SNP	ENST00000233055.4	37	c.30G>C	CCDS33387.1	.	.	.	.	.	.	.	.	.	.	C	11.98	1.800896	0.31869	.	.	ENSG00000085449	ENST00000233055;ENST00000429915	T;T	0.67698	-0.28;0.85	4.25	4.25	0.50352	.	0.076530	0.53938	N	0.000060	T	0.63885	0.2549	L	0.58101	1.795	0.45676	D	0.998596	P	0.36438	0.553	B	0.35550	0.205	T	0.69232	-0.5199	10	0.51188	T	0.08	-15.6668	16.4467	0.83936	0.0:1.0:0.0:0.0	.	10	Q8IWB7	WDFY1_HUMAN	H	10	ENSP00000233055:Q10H;ENSP00000395416:Q10H	ENSP00000233055:Q10H	Q	-	3	2	WDFY1	224518216	1.000000	0.71417	1.000000	0.80357	0.226000	0.24999	2.792000	0.47837	2.183000	0.69458	0.655000	0.94253	CAG		0.726	WDFY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330908.1	NM_020830		4	27	0	0	0	0	4	27				
ARMC9	80210	broad.mit.edu	37	2	232146798	232146798	+	Silent	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr2:232146798G>A	ENST00000349938.4	+	17	1772	c.1578G>A	c.(1576-1578)ctG>ctA	p.L526L	ARMC9_ENST00000483477.1_3'UTR	NM_001271466.1|NM_025139.4	NP_001258395.1|NP_079415	Q7Z3E5	ARMC9_HUMAN	armadillo repeat containing 9	526						extracellular vesicular exosome (GO:0070062)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)		Epithelial(121;1.43e-10)|LUSC - Lung squamous cell carcinoma(224;0.017)|Lung(119;0.0189)		ATGGAGCTCTGTACAGCATCC	0.428																																						uc002vrq.3		NA																	0				ovary(1)	1						c.(1576-1578)CTG>CTA		armadillo repeat containing 9							159.0	155.0	157.0					2																	232146798		2203	4300	6503	SO:0001819	synonymous_variant	80210						binding	g.chr2:232146798G>A	BC004514	CCDS2484.1, CCDS74666.1	2q37.1	2013-02-14			ENSG00000135931	ENSG00000135931		"""Armadillo repeat containing"""	20730	protein-coding gene	gene with protein product						11347906	Standard	NM_025139		Approved	FLJ12584, KIAA1868, ARM, KU-MEL-1	uc031rrs.1	Q7Z3E5	OTTHUMG00000133229	ENST00000349938.4:c.1578G>A	2.37:g.232146798G>A			Somatic				ARMC9_uc002vrp.3_Silent_p.L526L|ARMC9_uc002vrr.1_RNA	p.L526L	NM_025139	NP_079415	WXS	Illumina HiSeq	Unspecified	Q7Z3E5	ARMC9_HUMAN		Epithelial(121;1.43e-10)|LUSC - Lung squamous cell carcinoma(224;0.017)|Lung(119;0.0189)	17	1690	+		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)	526					Q53TI3|Q6P162|Q7L594|Q86WG2|Q96JF9|Q9H9R8	Silent	SNP	ENST00000349938.4	37	c.1578G>A	CCDS2484.1																																																																																				0.428	ARMC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256966.3	NM_025139		16	143	0	0	0	0	16	143				
PTPRA	5786	broad.mit.edu	37	20	3007774	3007774	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr20:3007774C>G	ENST00000216877.6	+	18	2089	c.1689C>G	c.(1687-1689)ttC>ttG	p.F563L	PTPRA_ENST00000380393.3_Missense_Mutation_p.F572L|PTPRA_ENST00000356147.3_Missense_Mutation_p.F563L|PTPRA_ENST00000425918.2_Missense_Mutation_p.F583L|PTPRA_ENST00000318266.5_Missense_Mutation_p.F563L|PTPRA_ENST00000399903.2_Missense_Mutation_p.F572L|PTPRA_ENST00000358719.4_Missense_Mutation_p.F428L	NM_080840.2	NP_543030.1	P18433	PTPRA_HUMAN	protein tyrosine phosphatase, receptor type, A	572	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axon guidance (GO:0007411)|insulin receptor signaling pathway (GO:0008286)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein phosphorylation (GO:0006468)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						CAGATGAATTCAACAGAGTGA	0.493																																						uc010zqd.1		NA																	0				upper_aerodigestive_tract(1)	1						c.(1747-1749)TTC>TTG		protein tyrosine phosphatase, receptor type, A							184.0	171.0	175.0					20																	3007774		2203	4300	6503	SO:0001583	missense	5786				axon guidance|protein phosphorylation	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity	g.chr20:3007774C>G		CCDS13038.1, CCDS13039.1	20p13	2011-06-09			ENSG00000132670	ENSG00000132670		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9664	protein-coding gene	gene with protein product		176884		PTPRL2, PTPA		2172030, 2169617	Standard	NM_080840		Approved	LRP, HLPR, HPTPA, RPTPA	uc002whn.3	P18433	OTTHUMG00000031718	ENST00000216877.6:c.1689C>G	20.37:g.3007774C>G	ENSP00000216877:p.Phe563Leu		Somatic				PTPRA_uc002whj.2_Missense_Mutation_p.F572L|PTPRA_uc002whk.2_Missense_Mutation_p.F563L|PTPRA_uc002whl.2_Missense_Mutation_p.F563L|PTPRA_uc002whm.2_Missense_Mutation_p.F339L|PTPRA_uc002whn.2_Missense_Mutation_p.F563L|PTPRA_uc002who.2_Missense_Mutation_p.F235L	p.F583L	NM_002836	NP_002827	WXS	Illumina HiSeq	Unspecified	P18433	PTPRA_HUMAN			18	2066	+			572			Cytoplasmic (Potential).|Tyrosine-protein phosphatase 2.		A8K2G8|D3DVX5|Q14513|Q7Z2I2|Q96TD9	Missense_Mutation	SNP	ENST00000216877.6	37	c.1749C>G	CCDS13039.1	.	.	.	.	.	.	.	.	.	.	C	18.01	3.527340	0.64860	.	.	ENSG00000132670	ENST00000380393;ENST00000216877;ENST00000399903;ENST00000358719;ENST00000542217;ENST00000425918;ENST00000318266;ENST00000356147	T;T;T;T;T;T;T	0.10960	2.82;2.82;2.82;2.82;2.82;2.82;2.82	5.09	4.13	0.48395	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.85682	U	0.000000	T	0.23171	0.0560	L	0.54965	1.715	0.80722	D	1	B;D;D	0.64830	0.146;0.994;0.985	B;D;P	0.74348	0.119;0.983;0.806	T	0.05989	-1.0852	10	0.10636	T	0.68	.	12.8694	0.57957	0.0:0.9198:0.0:0.0802	.	583;572;563	B7Z2A4;P18433;P18433-4	.;PTPRA_HUMAN;.	L	572;563;572;428;182;583;563;563	ENSP00000369756:F572L;ENSP00000216877:F563L;ENSP00000382787:F572L;ENSP00000351559:F428L;ENSP00000393553:F583L;ENSP00000314568:F563L;ENSP00000348468:F563L	ENSP00000216877:F563L	F	+	3	2	PTPRA	2955774	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.067000	0.30616	1.262000	0.44165	0.561000	0.74099	TTC		0.493	PTPRA-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077682.3			9	107	0	0	0	0	9	107				
RNF24	11237	broad.mit.edu	37	20	3944599	3944599	+	Silent	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr20:3944599G>A	ENST00000336095.6	-	2	317	c.66C>T	c.(64-66)ctC>ctT	p.L22L	RNF24_ENST00000358395.6_Silent_p.L22L|RNF24_ENST00000432261.2_Silent_p.L43L|RNF24_ENST00000545616.2_Silent_p.L43L	NM_007219.3	NP_009150.1	Q9Y225	RNF24_HUMAN	ring finger protein 24	22						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			large_intestine(1)|upper_aerodigestive_tract(1)	2						TATATATGTTGAGAGGCAGAT	0.363																																						uc002wkh.2		NA																	0					0						c.(64-66)CTC>CTT		ring finger protein 24 isoform 1							93.0	88.0	90.0					20																	3944599		2203	4300	6503	SO:0001819	synonymous_variant	11237					Golgi membrane|integral to membrane	zinc ion binding	g.chr20:3944599G>A	AF151081	CCDS13074.1, CCDS46577.1	20p13	2013-01-09			ENSG00000101236	ENSG00000101236		"""RING-type (C3HC4) zinc fingers"""	13779	protein-coding gene	gene with protein product		612489					Standard	NM_007219		Approved	G1L	uc002wki.2	Q9Y225	OTTHUMG00000031770	ENST00000336095.6:c.66C>T	20.37:g.3944599G>A			Somatic				RNF24_uc002wki.2_Silent_p.L43L|RNF24_uc002wkj.2_Silent_p.L22L	p.L22L	NM_007219	NP_009150	WXS	Illumina HiSeq	Unspecified	Q9Y225	RNF24_HUMAN			2	336	-			22					D3DVZ2|D3DVZ3|Q9UMH1	Silent	SNP	ENST00000336095.6	37	c.66C>T	CCDS13074.1																																																																																				0.363	RNF24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077795.2			7	62	0	0	0	0	7	62				
RRBP1	6238	broad.mit.edu	37	20	17623689	17623689	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr20:17623689C>T	ENST00000377813.1	-	4	2299	c.1996G>A	c.(1996-1998)Gag>Aag	p.E666K	RRBP1_ENST00000360807.4_Missense_Mutation_p.E233K|RRBP1_ENST00000377807.2_Missense_Mutation_p.E233K|RRBP1_ENST00000246043.4_Missense_Mutation_p.E666K|RRBP1_ENST00000455029.2_Missense_Mutation_p.E7K			Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	666					osteoblast differentiation (GO:0001649)|protein transport (GO:0015031)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(6)	28						CGCTGGGCCTCGCCCTCGTTG	0.637																																						uc002wpv.1		NA																	0				ovary(1)	1						c.(697-699)GAG>AAG		ribosome binding protein 1							111.0	85.0	94.0					20																	17623689		2203	4300	6503	SO:0001583	missense	6238				protein transport|translation|transmembrane transport	integral to endoplasmic reticulum membrane|ribosome	receptor activity	g.chr20:17623689C>T	AB037819	CCDS13128.1	20p12	2012-12-07	2012-12-07		ENSG00000125844	ENSG00000125844			10448	protein-coding gene	gene with protein product		601418	"""ribosome binding protein 1 (dog 180kD homolog)"", ""ribosome binding protein 1 homolog 180kDa (dog)"""			8812507	Standard	NM_001042576		Approved	ES/130, hES	uc002wpw.1	Q9P2E9	OTTHUMG00000031945	ENST00000377813.1:c.1996G>A	20.37:g.17623689C>T	ENSP00000367044:p.Glu666Lys		Somatic				RRBP1_uc002wpu.2_Missense_Mutation_p.E7K|RRBP1_uc002wpw.1_Missense_Mutation_p.E233K|RRBP1_uc010gcl.1_Missense_Mutation_p.E7K	p.E233K	NM_001042576	NP_001036041	WXS	Illumina HiSeq	Unspecified	Q9P2E9	RRBP1_HUMAN			5	1051	-			666			Cytoplasmic (Potential).		A2A2S6|A6NCN6|O75300|O75301|Q5W165|Q96SB2|Q9BWP1|Q9H476	Missense_Mutation	SNP	ENST00000377813.1	37	c.697G>A		.	.	.	.	.	.	.	.	.	.	C	36	5.733866	0.96865	.	.	ENSG00000125844	ENST00000360807;ENST00000377813;ENST00000377807;ENST00000246043;ENST00000455029	T;T;T;T;T	0.40476	1.96;1.96;1.96;1.96;1.03	5.56	5.56	0.83823	.	0.000000	0.36519	N	0.002542	T	0.68449	0.3002	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.72200	-0.4362	10	0.87932	D	0	-43.107	18.5192	0.90945	0.0:1.0:0.0:0.0	.	233	Q9P2E9-3	.	K	233;666;233;666;7	ENSP00000354045:E233K;ENSP00000367044:E666K;ENSP00000367038:E233K;ENSP00000246043:E666K;ENSP00000401206:E7K	ENSP00000246043:E666K	E	-	1	0	RRBP1	17571689	1.000000	0.71417	0.958000	0.39756	0.937000	0.57800	7.768000	0.85345	2.628000	0.89032	0.591000	0.81541	GAG		0.637	RRBP1-002	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000078125.1	NM_001042576		8	44	0	0	0	0	8	44				
RIN2	54453	broad.mit.edu	37	20	19981362	19981362	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr20:19981362G>C	ENST00000255006.6	+	12	2766	c.2617G>C	c.(2617-2619)Gag>Cag	p.E873Q	RIN2_ENST00000484638.1_3'UTR|RIN2_ENST00000440354.2_Missense_Mutation_p.E391Q	NM_001242581.1|NM_018993.3	NP_001229510.1|NP_061866.1	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2	824	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	27						GATCTGCGCTGAGAAGTTCAA	0.517																																						uc002wro.1		NA																	0				lung(4)|ovary(1)	5						c.(2470-2472)GAG>CAG		Ras and Rab interactor 2							117.0	119.0	119.0					20																	19981362		2056	4206	6262	SO:0001583	missense	54453				endocytosis|small GTPase mediated signal transduction	cytoplasm	GTPase activator activity|Rab guanyl-nucleotide exchange factor activity	g.chr20:19981362G>C	AB060339	CCDS56182.1	20p11.22	2008-07-30			ENSG00000132669	ENSG00000132669			18750	protein-coding gene	gene with protein product		610222				11733506, 1849280, 16423831	Standard	NM_018993		Approved	RASSF4	uc002wro.2	Q8WYP3	OTTHUMG00000031996	ENST00000255006.6:c.2617G>C	20.37:g.19981362G>C	ENSP00000255006:p.Glu873Gln		Somatic				RIN2_uc010gcu.1_Missense_Mutation_p.E391Q|RIN2_uc010gcv.1_Missense_Mutation_p.E618Q	p.E824Q	NM_018993	NP_061866	WXS	Illumina HiSeq	Unspecified	Q8WYP3	RIN2_HUMAN			11	2506	+			824			Ras-associating.		Q00425|Q5TFT8|Q9BQL3|Q9H071	Missense_Mutation	SNP	ENST00000255006.6	37	c.2470G>C	CCDS56182.1	.	.	.	.	.	.	.	.	.	.	G	12.13	1.846821	0.32606	.	.	ENSG00000132669	ENST00000255006;ENST00000440354	T;T	0.18810	2.19;2.19	5.69	5.69	0.88448	Ras-association (3);	0.393472	0.29587	N	0.011739	T	0.15478	0.0373	L	0.27053	0.805	0.42521	D	0.993001	B;B	0.23249	0.065;0.082	B;B	0.24006	0.022;0.05	T	0.10245	-1.0638	9	.	.	.	-32.6387	12.7244	0.57162	0.0759:0.0:0.9241:0.0	.	391;824	E7EPJ1;Q8WYP3	.;RIN2_HUMAN	Q	873;391	ENSP00000255006:E873Q;ENSP00000391239:E391Q	.	E	+	1	0	RIN2	19929362	0.999000	0.42202	0.969000	0.41365	0.960000	0.62799	2.951000	0.49089	2.687000	0.91594	0.462000	0.41574	GAG		0.517	RIN2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078212.1			13	118	0	0	0	0	13	118				
CST9L	128821	broad.mit.edu	37	20	23546668	23546668	+	Silent	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr20:23546668C>G	ENST00000376979.3	-	2	595	c.297G>C	c.(295-297)ggG>ggC	p.G99G		NM_080610.2	NP_542177.1	Q9H4G1	CST9L_HUMAN	cystatin 9-like	99						extracellular region (GO:0005576)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	8	Colorectal(13;0.0431)|Lung NSC(19;0.235)					CTTCAAATTTCCCACACCTAG	0.468																																						uc002wtk.3		NA																	0					0						c.(295-297)GGG>GGC		cystatin 9-like precursor							259.0	215.0	230.0					20																	23546668		2203	4300	6503	SO:0001819	synonymous_variant	128821					extracellular region	cysteine-type endopeptidase inhibitor activity	g.chr20:23546668C>G		CCDS13157.1	20p11.21	2012-08-14	2008-03-06		ENSG00000101435	ENSG00000101435			16233	protein-coding gene	gene with protein product			"""cystatin 9 (mouse)-like"""			20565543	Standard	NM_080610		Approved	bA218C14.1, CTES7B	uc002wtk.4	Q9H4G1	OTTHUMG00000032073	ENST00000376979.3:c.297G>C	20.37:g.23546668C>G			Somatic					p.G99G	NM_080610	NP_542177	WXS	Illumina HiSeq	Unspecified	Q9H4G1	CST9L_HUMAN			2	596	-	Colorectal(13;0.0431)|Lung NSC(19;0.235)		99					B2R5A1	Silent	SNP	ENST00000376979.3	37	c.297G>C	CCDS13157.1																																																																																				0.468	CST9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078338.1	NM_080610		22	205	0	0	0	0	22	205				
CSE1L	1434	broad.mit.edu	37	20	47691914	47691914	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr20:47691914G>C	ENST00000262982.2	+	12	1315	c.1192G>C	c.(1192-1194)Gag>Cag	p.E398Q	CSE1L_ENST00000396192.3_Missense_Mutation_p.E342Q|CSE1L_ENST00000542325.1_Missense_Mutation_p.E181Q	NM_001256135.1|NM_001316.3	NP_001243064.1|NP_001307.2	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like (yeast)	398					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	importin-alpha export receptor activity (GO:0008262)			breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	35			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			CAAGTTTTTTGAGGGACCTGT	0.383																																						uc002xty.2		NA																	0				large_intestine(1)|skin(1)	2						c.(1192-1194)GAG>CAG		CSE1 chromosome segregation 1-like protein							135.0	131.0	132.0					20																	47691914		2203	4300	6503	SO:0001583	missense	1434				apoptosis|cell proliferation|intracellular protein transport	cytoplasm|nucleus	importin-alpha export receptor activity	g.chr20:47691914G>C	U33286	CCDS13412.1, CCDS58773.1	20q13	2013-05-01	2001-11-28		ENSG00000124207	ENSG00000124207		"""Exportins"""	2431	protein-coding gene	gene with protein product	"""cellular apoptosis susceptibility"""	601342	"""chromosome segregation 1 (yeast homolog)-like"""			8963895, 7479798	Standard	NM_001316		Approved	CAS, XPO2, CSE1	uc002xty.4	P55060	OTTHUMG00000033046	ENST00000262982.2:c.1192G>C	20.37:g.47691914G>C	ENSP00000262982:p.Glu398Gln		Somatic				CSE1L_uc010zyg.1_Missense_Mutation_p.E181Q|CSE1L_uc010ghx.2_Missense_Mutation_p.E342Q|CSE1L_uc010ghy.2_Missense_Mutation_p.E47Q|CSE1L_uc010zyh.1_Missense_Mutation_p.E47Q	p.E398Q	NM_001316	NP_001307	WXS	Illumina HiSeq	Unspecified	P55060	XPO2_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)		12	1326	+			398					A3RLL6|B2R5T4|E1P5Y0|F8W904|O75432|Q32M40|Q9H5B7|Q9NTS0|Q9UP98|Q9UP99|Q9UPA0	Missense_Mutation	SNP	ENST00000262982.2	37	c.1192G>C	CCDS13412.1	.	.	.	.	.	.	.	.	.	.	G	33	5.210884	0.95069	.	.	ENSG00000124207	ENST00000262982;ENST00000542325;ENST00000396192	T;T;T	0.67523	-0.27;-0.27;-0.27	5.68	5.68	0.88126	Armadillo-like helical (1);Armadillo-type fold (1);Exportin/Importin, Cse1-like (1);	0.000000	0.85682	D	0.000000	D	0.83422	0.5251	M	0.80982	2.52	0.80722	D	1	D;D;P;D;D	0.89917	1.0;1.0;0.95;0.972;1.0	D;D;P;P;D	0.91635	0.997;0.999;0.908;0.891;0.998	T	0.82932	-0.0212	10	0.45353	T	0.12	-16.095	19.7802	0.96413	0.0:0.0:1.0:0.0	.	87;181;342;342;398	F5GX54;B4DUC5;A3RLL6;F8W904;P55060	.;.;.;.;XPO2_HUMAN	Q	398;181;342	ENSP00000262982:E398Q;ENSP00000446477:E181Q;ENSP00000379495:E342Q	ENSP00000262982:E398Q	E	+	1	0	CSE1L	47125321	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.807000	0.99171	2.669000	0.90835	0.561000	0.74099	GAG		0.383	CSE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080345.2	NM_001316		7	97	0	0	0	0	7	97				
SRMS	6725	broad.mit.edu	37	20	62172623	62172623	+	Silent	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr20:62172623G>C	ENST00000217188.1	-	7	1246	c.1206C>G	c.(1204-1206)gtC>gtG	p.V402V		NM_080823.2	NP_543013.1	Q9H3Y6	SRMS_HUMAN	src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites	402	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				peptidyl-tyrosine autophosphorylation (GO:0038083)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|prostate(2)|stomach(1)	19	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)			TCTGGGAGAAGACACGATAAT	0.617																																						uc002yfi.1		NA																	0				stomach(1)|lung(1)	2						c.(1204-1206)GTC>GTG		src-related kinase lacking C-terminal regulatory							107.0	114.0	112.0					20																	62172623		2202	4300	6502	SO:0001819	synonymous_variant	6725						ATP binding|non-membrane spanning protein tyrosine kinase activity	g.chr20:62172623G>C		CCDS13525.1	20q13.33	2013-02-14	2003-08-22		ENSG00000125508	ENSG00000125508		"""SH2 domain containing"""	11298	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 148"""	C20orf148		7935409	Standard	NM_080823		Approved	SRM, dJ697K14.1	uc002yfi.1	Q9H3Y6	OTTHUMG00000032977	ENST00000217188.1:c.1206C>G	20.37:g.62172623G>C			Somatic					p.V402V	NM_080823	NP_543013	WXS	Illumina HiSeq	Unspecified	Q9H3Y6	SRMS_HUMAN	Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)		7	1247	-	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		402			Protein kinase.			Silent	SNP	ENST00000217188.1	37	c.1206C>G	CCDS13525.1																																																																																				0.617	SRMS-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080148.1	NM_080823		18	160	0	0	0	0	18	160				
RGS19	10287	broad.mit.edu	37	20	62705602	62705602	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr20:62705602G>C	ENST00000395042.1	-	5	623	c.357C>G	c.(355-357)ttC>ttG	p.F119L	RGS19_ENST00000493165.1_5'Flank|RGS19_ENST00000332298.5_Missense_Mutation_p.F119L	NM_005873.2	NP_005864.1	P49795	RGS19_HUMAN	regulator of G-protein signaling 19	119	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				autophagy (GO:0006914)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	brush border (GO:0005903)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			lung(1)|prostate(1)|skin(1)	3	all_cancers(38;3.45e-11)|all_epithelial(29;9.12e-13)|Lung NSC(23;2e-09)|all_lung(23;6.77e-09)					AGGCCAACCAGAAGAGCATGT	0.607																																						uc002yhy.2		NA																	0				skin(1)	1						c.(355-357)TTC>TTG		G protein signalling regulator 19							89.0	73.0	79.0					20																	62705602		2203	4300	6503	SO:0001583	missense	10287				autophagy|G-protein coupled receptor protein signaling pathway|negative regulation of signal transduction|small GTPase mediated signal transduction	Golgi apparatus|membrane fraction|plasma membrane	GTPase activator activity|protein binding|signal transducer activity	g.chr20:62705602G>C	X91809	CCDS13555.1	20q13.33	2007-08-14	2007-08-14		ENSG00000171700	ENSG00000171700		"""Regulators of G-protein signaling"""	13735	protein-coding gene	gene with protein product		605071	"""regulator of G-protein signalling 19"""			8524874	Standard	XM_005260183		Approved	GAIP, RGSGAIP	uc002yib.3	P49795	OTTHUMG00000033024	ENST00000395042.1:c.357C>G	20.37:g.62705602G>C	ENSP00000378483:p.Phe119Leu		Somatic				RGS19_uc002yhz.2_Missense_Mutation_p.F97L|RGS19_uc002yia.2_Missense_Mutation_p.F119L|RGS19_uc002yib.2_Missense_Mutation_p.F119L	p.F119L	NM_005873	NP_005864	WXS	Illumina HiSeq	Unspecified	P49795	RGS19_HUMAN			5	624	-	all_cancers(38;3.45e-11)|all_epithelial(29;9.12e-13)|Lung NSC(23;2e-09)|all_lung(23;6.77e-09)		119			RGS.		A8K216|E1P5G9|Q53XN0|Q8TD60	Missense_Mutation	SNP	ENST00000395042.1	37	c.357C>G	CCDS13555.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.529167	0.85706	.	.	ENSG00000171700	ENST00000395042;ENST00000332298	T;T	0.60171	0.21;0.21	4.91	3.96	0.45880	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);Regulator of G-protein signaling, domain 1 (1);	0.000000	0.85682	D	0.000000	T	0.81049	0.4742	H	0.97415	4	0.80722	D	1	D	0.55385	0.971	D	0.68621	0.959	T	0.82910	-0.0223	10	0.87932	D	0	.	6.978	0.24688	0.1646:0.1569:0.6785:0.0	.	119	P49795	RGS19_HUMAN	L	119	ENSP00000378483:F119L;ENSP00000333194:F119L	ENSP00000333194:F119L	F	-	3	2	RGS19	62176046	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.984000	0.49353	1.280000	0.44463	0.563000	0.77884	TTC		0.607	RGS19-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080273.1	NM_005873		4	29	0	0	0	0	4	29				
LTN1	26046	broad.mit.edu	37	21	30318479	30318479	+	Silent	SNP	G	G	A	rs201733218		TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr21:30318479G>A	ENST00000361371.5	-	20	3697	c.3618C>T	c.(3616-3618)ttC>ttT	p.F1206F	LTN1_ENST00000389194.2_Silent_p.F1252F			O94822	LTN1_HUMAN	listerin E3 ubiquitin protein ligase 1	1206					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(19)|ovary(5)|pancreas(1)|prostate(2)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)	60						CCTACCAACTGAAAAGAAAAA	0.308																																						uc002ymr.2		NA																	0					0						c.(3754-3756)TTC>TTT		zinc finger protein 294							89.0	99.0	95.0					21																	30318479		2202	4289	6491	SO:0001819	synonymous_variant	26046						ligase activity|zinc ion binding	g.chr21:30318479G>A	AK001915	CCDS33527.1, CCDS33527.2	21q21.3	2013-01-09	2010-09-17	2010-09-17	ENSG00000198862	ENSG00000198862		"""RING-type (C3HC4) zinc fingers"""	13082	protein-coding gene	gene with protein product	"""listerin"""	613083	"""chromosome 21 open reading frame 98"", ""zinc finger protein 294"", ""ring finger protein 160"""	C21orf98, C21orf10, ZNF294, RNF160		20835226, 19196968	Standard	NM_015565		Approved	KIAA0714, FLJ11053, LISTERIN	uc002ymr.2	O94822	OTTHUMG00000078803	ENST00000361371.5:c.3618C>T	21.37:g.30318479G>A			Somatic					p.F1252F	NM_015565	NP_056380	WXS	Illumina HiSeq	Unspecified	O94822	LTN1_HUMAN			20	3769	-			1206					A6NL41|A7E2D0|B2RTS0|C9J7U3|J3KPL4|Q05C47|Q9H8M4|Q9NUY5|Q9P0E9	Silent	SNP	ENST00000361371.5	37	c.3756C>T																																																																																					0.308	LTN1-008	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000472108.1	NM_015565		8	106	0	0	0	0	8	106				
HIRA	7290	broad.mit.edu	37	22	19384358	19384358	+	Silent	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr22:19384358C>T	ENST00000263208.5	-	7	862	c.606G>A	c.(604-606)agG>agA	p.R202R	HIRA_ENST00000541063.1_Silent_p.R158R|HIRA_ENST00000546308.1_Silent_p.R158R|HIRA_ENST00000340170.4_Silent_p.R202R|HIRA_ENST00000464189.1_5'Flank	NM_003325.3	NP_003316.3	P54198	HIRA_HUMAN	histone cell cycle regulator	202					anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|gastrulation (GO:0007369)|muscle cell differentiation (GO:0042692)|osteoblast differentiation (GO:0001649)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)|prostate(1)|skin(1)	37	Colorectal(54;0.0993)					AGTCCAGCGTCCTCCACACCT	0.557																																						uc002zpf.1		NA																	0				ovary(1)	1						c.(604-606)AGG>AGA		HIR histone cell cycle regulation defective							90.0	82.0	85.0					22																	19384358		2203	4300	6503	SO:0001819	synonymous_variant	7290				chromatin modification|regulation of transcription from RNA polymerase II promoter	PML body	chromatin binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity	g.chr22:19384358C>T	X75296	CCDS13759.1	22q11.2	2013-05-03	2013-05-03		ENSG00000100084	ENSG00000100084		"""WD repeat domain containing"""	4916	protein-coding gene	gene with protein product	"""DiGeorge critical region gene 1"""	600237	"""HIR (histone cell cycle regulation defective) homolog A (S. cerevisiae)"", ""HIR histone cell cycle regulation defective homolog A (S. cerevisiae)"""	TUPLE1		8111380, 7633437, 9731536	Standard	NM_003325		Approved	DGCR1, TUP1	uc002zpf.1	P54198	OTTHUMG00000150134	ENST00000263208.5:c.606G>A	22.37:g.19384358C>T			Somatic				HIRA_uc011agx.1_Silent_p.R68R|HIRA_uc010grn.1_Silent_p.R202R|HIRA_uc010gro.1_Silent_p.R158R|HIRA_uc010grp.2_RNA	p.R202R	NM_003325	NP_003316	WXS	Illumina HiSeq	Unspecified	P54198	HIRA_HUMAN			7	826	-	Colorectal(54;0.0993)		202			WD 4.		Q05BU9|Q8IXN2	Silent	SNP	ENST00000263208.5	37	c.606G>A	CCDS13759.1																																																																																				0.557	HIRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316488.2	NM_003325		8	79	0	0	0	0	8	79				
DGCR8	54487	broad.mit.edu	37	22	20094865	20094865	+	Missense_Mutation	SNP	A	A	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr22:20094865A>G	ENST00000351989.3	+	12	2497	c.2068A>G	c.(2068-2070)Aac>Gac	p.N690D	DGCR8_ENST00000383024.2_Missense_Mutation_p.N657D|DGCR8_ENST00000407755.1_Missense_Mutation_p.N657D	NM_022720.6	NP_073557.3	Q8WYQ5	DGCR8_HUMAN	DGCR8 microprocessor complex subunit	690	Necessary for heme-binding and pri-miRNA processing.|Necessary for interaction with DROSHA.				gene expression (GO:0010467)|primary miRNA processing (GO:0031053)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)			NS(2)|breast(1)|endometrium(5)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	22	Colorectal(54;0.0993)					ACATGTCAAGAACTGGGGGTC	0.537																																						uc002zri.2		NA																	0					0						c.(2068-2070)AAC>GAC		DiGeorge syndrome critical region gene 8							114.0	100.0	105.0					22																	20094865		2203	4300	6503	SO:0001583	missense	54487				primary miRNA processing	cytoplasm|cytoplasm|microtubule cytoskeleton|nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding	g.chr22:20094865A>G	AF165527, AB050770	CCDS13773.1, CCDS54501.1	22q11.2	2013-05-02	2013-05-02		ENSG00000128191	ENSG00000128191			2847	protein-coding gene	gene with protein product		609030	"""chromosome 22 open reading frame 12"", ""DiGeorge syndrome critical region gene 8"""	C22orf12		21454614	Standard	NM_001190326		Approved	DGCRK6, Gy1, pasha	uc002zri.3	Q8WYQ5	OTTHUMG00000150503	ENST00000351989.3:c.2068A>G	22.37:g.20094865A>G	ENSP00000263209:p.Asn690Asp		Somatic				DGCR8_uc010grz.2_Missense_Mutation_p.N657D|DGCR8_uc002zrj.2_Missense_Mutation_p.N333D	p.N690D	NM_022720	NP_073557	WXS	Illumina HiSeq	Unspecified	Q8WYQ5	DGCR8_HUMAN			12	2418	+	Colorectal(54;0.0993)		690			Necessary for heme-binding and pri-miRNA processing.|Necessary for interaction with DROSHA.		B2R8G1|Q6DCB2|Q6MZE9|Q6Y2L0|Q96G39|Q96GP8|Q9H6L8|Q9H6T7|Q9NRW2	Missense_Mutation	SNP	ENST00000351989.3	37	c.2068A>G	CCDS13773.1	.	.	.	.	.	.	.	.	.	.	A	31	5.090237	0.94149	.	.	ENSG00000128191	ENST00000351989;ENST00000383024;ENST00000407755	T;T;T	0.32272	1.46;1.54;1.54	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.41604	0.1166	N	0.22421	0.69	0.80722	D	1	D;D	0.67145	0.996;0.991	D;P	0.76071	0.987;0.755	T	0.38478	-0.9659	10	0.59425	D	0.04	-22.549	14.3783	0.66895	1.0:0.0:0.0:0.0	.	657;690	Q8WYQ5-3;Q8WYQ5	.;DGCR8_HUMAN	D	690;657;657	ENSP00000263209:N690D;ENSP00000372488:N657D;ENSP00000384726:N657D	ENSP00000263209:N690D	N	+	1	0	DGCR8	18474865	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	8.620000	0.90943	2.051000	0.60960	0.402000	0.26972	AAC		0.537	DGCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318654.1			6	108	0	0	0	0	6	108				
ZNF74	7625	broad.mit.edu	37	22	20755021	20755021	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr22:20755021G>C	ENST00000400451.2	+	3	734	c.220G>C	c.(220-222)Gag>Cag	p.E74Q	ZNF74_ENST00000405993.1_Missense_Mutation_p.E74Q|ZNF74_ENST00000357502.5_Missense_Mutation_p.G79A|ZNF74_ENST00000403682.3_Missense_Mutation_p.G45A|ZNF74_ENST00000356671.5_Missense_Mutation_p.E74Q	NM_003426.3	NP_003417.2	Q16587	ZNF74_HUMAN	zinc finger protein 74	74	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	19	Melanoma(16;0.000465)|Ovarian(15;0.0025)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)|all_lung(157;0.248)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			TGTGATGTTGGAGAACTACCA	0.542																																						uc010gsm.2		NA																	0				ovary(1)	1						c.(220-222)GAG>CAG		zinc finger protein 74							108.0	124.0	119.0					22																	20755021		2200	4297	6497	SO:0001583	missense	7625				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	actin cytoskeleton|nucleus	DNA binding|RNA binding|zinc ion binding	g.chr22:20755021G>C	X71623	CCDS42982.1, CCDS58794.1	22q11.2	2013-01-08	2006-05-12		ENSG00000185252	ENSG00000185252		"""Zinc fingers, C2H2-type"", ""-"""	13144	protein-coding gene	gene with protein product		194548	"""zinc finger protein 74 (Cos52)"""			1639391, 10591208	Standard	NM_003426		Approved	Cos52, Zfp520, ZNF520	uc010gsm.4	Q16587	OTTHUMG00000150687	ENST00000400451.2:c.220G>C	22.37:g.20755021G>C	ENSP00000383301:p.Glu74Gln		Somatic				ZNF74_uc002zsg.2_Missense_Mutation_p.E3Q|ZNF74_uc002zsh.2_Missense_Mutation_p.E74Q|ZNF74_uc002zsi.2_Missense_Mutation_p.E3Q|ZNF74_uc010gsn.2_Missense_Mutation_p.E3Q	p.E74Q	NM_003426	NP_003417	WXS	Illumina HiSeq	Unspecified	Q16587	ZNF74_HUMAN	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)		4	432	+	Melanoma(16;0.000465)|Ovarian(15;0.0025)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)|all_lung(157;0.248)	74			KRAB.		B5MCE3|B7Z5Y2|Q6IBV2|Q6PJP1|Q9UC04|Q9UF05|Q9UF06|Q9UF07	Missense_Mutation	SNP	ENST00000400451.2	37	c.220G>C	CCDS42982.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.82|16.82	3.227918|3.227918	0.58777|0.58777	.|.	.|.	ENSG00000185252|ENSG00000185252	ENST00000400451;ENST00000356671;ENST00000405993|ENST00000403682;ENST00000357502	T;T;T|.	0.04317|.	3.65;3.65;3.65|.	3.37|3.37	3.37|3.37	0.38596|0.38596	Krueppel-associated box (4);|.	0.000000|.	0.35525|.	N|.	0.003155|.	T|T	0.76047|0.76047	0.3933|0.3933	H|H	0.94306|0.94306	3.52|3.52	0.28452|0.28452	N|N	0.916276|0.916276	D|.	0.89917|.	1.0|.	D|.	0.72982|.	0.979|.	T|T	0.72214|0.72214	-0.4358|-0.4358	10|6	0.54805|0.87932	T|D	0.06|0	.|.	13.0253|13.0253	0.58812|0.58812	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	74|.	Q16587|.	ZNF74_HUMAN|.	Q|A	74|45;79	ENSP00000383301:E74Q;ENSP00000349098:E74Q;ENSP00000385855:E74Q|.	ENSP00000349098:E74Q|ENSP00000350101:G79A	E|G	+|+	1|2	0|0	ZNF74|ZNF74	19085021|19085021	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	4.673000|4.673000	0.61604|0.61604	2.178000|2.178000	0.69098|0.69098	0.655000|0.655000	0.94253|0.94253	GAG|GGA		0.542	ZNF74-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319648.2	NM_003426		9	134	0	0	0	0	9	134				
PITPNB	23760	broad.mit.edu	37	22	28293876	28293876	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr22:28293876C>G	ENST00000335272.5	-	4	278	c.202G>C	c.(202-204)Gtg>Ctg	p.V68L	PITPNB_ENST00000320996.10_Missense_Mutation_p.V68L|PITPNB_ENST00000455418.3_Missense_Mutation_p.V70L	NM_012399.3	NP_036531.1	P48739	PIPNB_HUMAN	phosphatidylinositol transfer protein, beta	68					glycerophospholipid biosynthetic process (GO:0046474)|in utero embryonic development (GO:0001701)|lipid metabolic process (GO:0006629)|phospholipid metabolic process (GO:0006644)|phospholipid transport (GO:0015914)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)	lipid binding (GO:0008289)			large_intestine(4)|lung(3)|skin(1)	8						AATGCAGGCACTTTGCTGGGA	0.458																																						uc003adk.2		NA																	0				skin(1)	1						c.(202-204)GTG>CTG		phosphatidylinositol transfer protein, beta							81.0	70.0	74.0					22																	28293876		2203	4300	6503	SO:0001583	missense	23760				lipid metabolic process|transport	Golgi apparatus	lipid binding	g.chr22:28293876C>G	D30037	CCDS13842.1, CCDS63433.1	22q12.1	2006-12-15			ENSG00000180957	ENSG00000180957			9002	protein-coding gene	gene with protein product		606876				10591208	Standard	NM_012399		Approved	VIB1B	uc003adk.3	P48739	OTTHUMG00000150976	ENST00000335272.5:c.202G>C	22.37:g.28293876C>G	ENSP00000334738:p.Val68Leu		Somatic				PITPNB_uc011akh.1_Missense_Mutation_p.V70L|PITPNB_uc003adl.2_Missense_Mutation_p.V68L	p.V68L	NM_012399	NP_036531	WXS	Illumina HiSeq	Unspecified	P48739	PIPNB_HUMAN			4	278	-			68					B3KYB8|B7Z7Q0|Q8N5W1	Missense_Mutation	SNP	ENST00000335272.5	37	c.202G>C	CCDS13842.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.593028	0.86953	.	.	ENSG00000180957	ENST00000335272;ENST00000320996;ENST00000455418;ENST00000436663	T;T;T;T	0.44881	0.91;0.91;0.91;0.91	5.95	5.95	0.96441	START-like domain (1);	0.000000	0.85682	D	0.000000	T	0.48114	0.1482	L	0.41906	1.305	0.80722	D	1	B;B;P	0.42161	0.407;0.099;0.772	B;B;P	0.50270	0.239;0.127;0.636	T	0.10042	-1.0647	10	0.20046	T	0.44	-11.0425	18.957	0.92662	0.0:1.0:0.0:0.0	.	70;68;68	B7Z7Q0;P48739-2;P48739	.;.;PIPNB_HUMAN	L	68;68;70;70	ENSP00000334738:V68L;ENSP00000321266:V68L;ENSP00000405179:V70L;ENSP00000403675:V70L	ENSP00000321266:V68L	V	-	1	0	PITPNB	26623876	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.511000	0.81718	2.824000	0.97209	0.655000	0.94253	GTG		0.458	PITPNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000320740.1			11	97	0	0	0	0	11	97				
NF2	4771	broad.mit.edu	37	22	30038255	30038255	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr22:30038255C>T	ENST00000338641.4	+	4	869	c.428C>T	c.(427-429)tCt>tTt	p.S143F	NF2_ENST00000334961.7_Missense_Mutation_p.S60F|NF2_ENST00000403999.3_Missense_Mutation_p.S143F|NF2_ENST00000353887.4_Missense_Mutation_p.S60F|NF2_ENST00000413209.2_Missense_Mutation_p.S143F|NF2_ENST00000361676.4_Missense_Mutation_p.S101F|NF2_ENST00000347330.5_Missense_Mutation_p.S60F|NF2_ENST00000361452.4_Missense_Mutation_p.S102F|NF2_ENST00000403435.1_Missense_Mutation_p.S143F|NF2_ENST00000397789.3_Missense_Mutation_p.S143F|NF2_ENST00000361166.4_Missense_Mutation_p.S143F	NM_000268.3|NM_016418.5|NM_181832.2	NP_000259.1|NP_057502.2|NP_861970.1	P35240	MERL_HUMAN	neurofibromin 2 (merlin)	143	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin cytoskeleton organization (GO:0030036)|cell-cell junction organization (GO:0045216)|ectoderm development (GO:0007398)|hippocampus development (GO:0021766)|lens fiber cell differentiation (GO:0070306)|mesoderm formation (GO:0001707)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of DNA replication (GO:0008156)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell differentiation (GO:0045597)|positive regulation of stress fiber assembly (GO:0051496)|regulation of hippo signaling (GO:0035330)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of protein localization to nucleus (GO:1900180)|regulation of protein stability (GO:0031647)|Schwann cell proliferation (GO:0014010)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|cleavage furrow (GO:0032154)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome (GO:0005769)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)		p.V122_K149del(5)|p.?(2)|p.Y144fs*5(1)|p.K123fs*2(1)|p.A142fs*8(1)		NS(1)|bone(2)|breast(5)|central_nervous_system(21)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(17)|large_intestine(9)|liver(1)|lung(9)|meninges(372)|ovary(2)|pituitary(1)|pleura(9)|prostate(1)|skin(7)|soft_tissue(303)|stomach(2)|thyroid(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	776						CTCCTGGCTTCTTACGCCGTC	0.458			"""D, Mis, N, F, S, O"""		"""meningioma, acoustic neuroma, renal """	"""meningioma, acoustic neuroma"""			Neurofibromatosis, type 2																													uc003age.3		NA	yes	Rec	yes	Neurofibromatosis type 2	22	22q12.2	4771	D|Mis|N|F|S|O	neurofibromatosis type 2 gene			O		meningioma|acoustic neuroma	meningioma|acoustic neuroma|renal 		10	Deletion - In frame(5)|Deletion - Frameshift(3)|Unknown(2)	p.V122_K149del(5)|p.Y144fs*5(1)|p.K123fs*2(1)|p.L127_D382del(1)|p.L140_P252del(1)|p.A142fs*8(1)	soft_tissue(8)|large_intestine(1)|stomach(1)	meninges(372)|soft_tissue(284)|central_nervous_system(20)|kidney(10)|pleura(9)|skin(7)|large_intestine(5)|breast(5)|urinary_tract(3)|thyroid(2)|endometrium(2)|ovary(2)|lung(2)|stomach(2)|bone(2)|pituitary(1)	728						c.(427-429)TCT>TTT		neurofibromin 2 isoform 1							80.0	77.0	79.0					22																	30038255		2203	4300	6503	SO:0001583	missense	4771	Neurofibromatosis_type_2	Familial Cancer Database	NF2, Central Neurofibromatosis, Bilateral Acoustic Neurofibromatosis	actin cytoskeleton organization|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of cell-cell adhesion|negative regulation of cell-matrix adhesion|negative regulation of DNA replication|negative regulation of tyrosine phosphorylation of Stat3 protein|negative regulation of tyrosine phosphorylation of Stat5 protein|positive regulation of stress fiber assembly|regulation of hippo signaling cascade|Schwann cell proliferation	cytoskeleton|early endosome|extrinsic to membrane|filopodium membrane|nucleolus|perinuclear region of cytoplasm|ruffle membrane	cytoskeletal protein binding|protein binding	g.chr22:30038255C>T	L11353	CCDS13861.1, CCDS13862.1, CCDS13863.1, CCDS13864.1, CCDS13865.1, CCDS54516.1	22q12.2	2014-09-17	2007-12-17		ENSG00000186575	ENSG00000186575		"""A-kinase anchor proteins"""	7773	protein-coding gene	gene with protein product	"""moesin-ezrin-radixin like"", ""schwannomin"""	607379	"""neurofibromin 2 (bilateral acoustic neuroma)"""			10591208	Standard	NM_000268		Approved	merlin	uc003age.4	P35240	OTTHUMG00000030727	ENST00000338641.4:c.428C>T	22.37:g.30038255C>T	ENSP00000344666:p.Ser143Phe		Somatic				NF2_uc003afy.3_Missense_Mutation_p.S143F|NF2_uc003afz.3_Missense_Mutation_p.S60F|NF2_uc003agf.3_Missense_Mutation_p.S143F|NF2_uc003agb.3_Missense_Mutation_p.S66F|NF2_uc003agc.3_Missense_Mutation_p.S105F|NF2_uc003agd.3_RNA|NF2_uc003agg.3_Missense_Mutation_p.S143F|NF2_uc003aga.3_Missense_Mutation_p.S101F|NF2_uc003agh.3_Missense_Mutation_p.S102F|NF2_uc003agi.3_Missense_Mutation_p.S60F|NF2_uc003agj.3_Missense_Mutation_p.S143F|NF2_uc003agk.3_Missense_Mutation_p.S105F	p.S143F	NM_000268	NP_000259	WXS	Illumina HiSeq	Unspecified	P35240	MERL_HUMAN			4	871	+			143			FERM.		O95683|Q8WUJ2|Q969N0|Q969Q3|Q96T30|Q96T31|Q96T32|Q96T33|Q9BTW3|Q9UNG9|Q9UNH3|Q9UNH4	Missense_Mutation	SNP	ENST00000338641.4	37	c.428C>T	CCDS13861.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.620660	0.87460	.	.	ENSG00000186575	ENST00000413209;ENST00000347330;ENST00000338641;ENST00000403435;ENST00000361452;ENST00000397822;ENST00000403999;ENST00000334961;ENST00000353887;ENST00000397789;ENST00000361676;ENST00000361166	T;D;D;D;D;D;T;T;D;D;D	0.94497	-1.27;-3.44;-2.01;-2.01;-2.01;-2.01;-1.27;-1.27;-2.01;-2.01;-2.01	5.24	5.24	0.73138	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.000000	0.85682	D	0.000000	D	0.98369	0.9458	H	0.96970	3.915	0.47341	D	0.99939	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.994;0.996;0.999;0.999;0.997;0.998;0.997	D	0.99701	1.1004	9	.	.	.	.	18.831	0.92139	0.0:1.0:0.0:0.0	.	143;102;143;143;101;60;143	P35240-9;P35240-5;P35240;P35240-2;P35240-6;P35240-4;P35240-3	.;.;MERL_HUMAN;.;.;.;.	F	143;60;143;143;102;143;143;60;60;143;101;143	ENSP00000409921:S143F;ENSP00000335160:S60F;ENSP00000344666:S143F;ENSP00000384029:S143F;ENSP00000354897:S102F;ENSP00000384797:S143F;ENSP00000335652:S60F;ENSP00000340626:S60F;ENSP00000380891:S143F;ENSP00000355183:S101F;ENSP00000354529:S143F	.	S	+	2	0	NF2	28368255	1.000000	0.71417	0.946000	0.38457	0.947000	0.59692	7.748000	0.85085	2.454000	0.82982	0.655000	0.94253	TCT		0.458	NF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075615.3	NM_000268		12	97	0	0	0	0	12	97				
SEC14L4	284904	broad.mit.edu	37	22	30891384	30891384	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr22:30891384C>T	ENST00000255858.7	-	5	363	c.280G>A	c.(280-282)Gaa>Aaa	p.E94K	SEC14L4_ENST00000540456.1_Missense_Mutation_p.E79K|SEC14L4_ENST00000392772.2_Missense_Mutation_p.E40K|RP4-539M6.14_ENST00000610156.1_RNA|SEC14L4_ENST00000381982.3_Missense_Mutation_p.E94K|RP4-539M6.14_ENST00000442126.1_RNA	NM_001161368.1|NM_174977.3	NP_001154840.1|NP_777637.1	Q9UDX3	S14L4_HUMAN	SEC14-like 4 (S. cerevisiae)	94	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.					integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(5)|pancreas(1)|skin(1)	21					Vitamin E(DB00163)	GGGCAGCCTTCGTAGTCGTAG	0.562																																						uc003aid.2		NA																	0				skin(1)	1						c.(280-282)GAA>AAA		SEC14p-like protein TAP3 isoform a	Vitamin E(DB00163)						96.0	86.0	89.0					22																	30891384		2203	4300	6503	SO:0001583	missense	284904					integral to membrane|intracellular	lipid binding|transporter activity	g.chr22:30891384C>T	AY158085	CCDS13878.1, CCDS54517.1	22q12.1	2003-03-10			ENSG00000133488	ENSG00000133488			20627	protein-coding gene	gene with protein product		612825					Standard	NM_174977		Approved	TAP3, dJ130H16.5	uc003aid.2	Q9UDX3	OTTHUMG00000151258	ENST00000255858.7:c.280G>A	22.37:g.30891384C>T	ENSP00000255858:p.Glu94Lys		Somatic				SEC14L4_uc011akz.1_Missense_Mutation_p.E94K|SEC14L4_uc003aie.2_Missense_Mutation_p.E79K|SEC14L4_uc003aif.2_Missense_Mutation_p.E40K	p.E94K	NM_174977	NP_777637	WXS	Illumina HiSeq	Unspecified	Q9UDX3	S14L4_HUMAN			5	380	-			94			CRAL-TRIO.		A5D6W7|A6NCV4	Missense_Mutation	SNP	ENST00000255858.7	37	c.280G>A	CCDS13878.1	.	.	.	.	.	.	.	.	.	.	c	19.53	3.845736	0.71603	.	.	ENSG00000133488	ENST00000255858;ENST00000540456;ENST00000392772;ENST00000381982	T;T;T;T	0.75154	-0.91;-0.91;-0.91;-0.91	4.9	3.89	0.44902	Cellular retinaldehyde-binding/triple function, C-terminal (4);	0.179734	0.47455	N	0.000223	T	0.75191	0.3816	M	0.80982	2.52	0.80722	D	1	P;P;P	0.44429	0.562;0.835;0.562	B;B;B	0.40444	0.327;0.329;0.219	T	0.78532	-0.2168	10	0.54805	T	0.06	-18.4933	13.4283	0.61039	0.0:0.9221:0.0:0.0779	.	40;79;94	B3KSF0;G3V1L4;Q9UDX3	.;.;S14L4_HUMAN	K	94;79;40;94	ENSP00000255858:E94K;ENSP00000440848:E79K;ENSP00000376525:E40K;ENSP00000371412:E94K	ENSP00000255858:E94K	E	-	1	0	SEC14L4	29221384	1.000000	0.71417	0.937000	0.37676	0.362000	0.29581	4.561000	0.60809	1.183000	0.42943	-0.126000	0.14955	GAA		0.562	SEC14L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321946.1	NM_174977		7	42	0	0	0	0	7	42				
SFI1	9814	broad.mit.edu	37	22	31927062	31927062	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr22:31927062C>G	ENST00000400288.2	+	4	390	c.285C>G	c.(283-285)ttC>ttG	p.F95L	SFI1_ENST00000432498.1_Missense_Mutation_p.F95L|SFI1_ENST00000400289.1_Intron|SFI1_ENST00000414585.1_Intron|SFI1_ENST00000443011.1_Intron|SFI1_ENST00000443326.1_Intron|SFI1_ENST00000540643.1_Intron	NM_001007467.2	NP_001007468.1	A8K8P3	SFI1_HUMAN	Sfi1 homolog, spindle assembly associated (yeast)	95					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(2)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)	38						CCAGAAAGTTCTTATATTTAT	0.358																																						uc003ale.2		NA																	0				central_nervous_system(1)	1						c.(283-285)TTC>TTG		spindle assembly associated Sfi1 homolog isoform							125.0	114.0	117.0					22																	31927062		1827	4079	5906	SO:0001583	missense	9814				G2/M transition of mitotic cell cycle	centriole|cytosol		g.chr22:31927062C>G	AB011114	CCDS43004.1, CCDS43005.1, CCDS58803.1, CCDS58804.1	22q12.2	2014-06-13			ENSG00000198089	ENSG00000198089			29064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 139"""	612765				14504268	Standard	NM_001007467		Approved	KIAA0542, PISD, PPP1R139	uc003ale.4	A8K8P3	OTTHUMG00000030249	ENST00000400288.2:c.285C>G	22.37:g.31927062C>G	ENSP00000383145:p.Phe95Leu		Somatic				SFI1_uc003ald.1_Intron|SFI1_uc003alf.2_Missense_Mutation_p.F95L|SFI1_uc003alg.2_Intron|SFI1_uc011alp.1_Intron|SFI1_uc011alq.1_Intron|SFI1_uc003alh.2_Intron	p.F95L	NM_001007467	NP_001007468	WXS	Illumina HiSeq	Unspecified	A8K8P3	SFI1_HUMAN			4	678	+			95					A1L373|A1L387|A2A2L2|B1AKL9|B5MDB7|B7Z1V6|B7Z8G3|B7ZBE2|B7ZBE3|O60289|Q2TAN8|Q5W1B5|Q86TK0|Q8N4U8|Q8N8C1|Q8WU14	Missense_Mutation	SNP	ENST00000400288.2	37	c.285C>G	CCDS43004.1	.	.	.	.	.	.	.	.	.	.	C	15.99	2.994154	0.54041	.	.	ENSG00000198089	ENST00000432498;ENST00000400288;ENST00000450787	T;T;T	0.48201	2.0;2.07;0.82	4.26	3.24	0.37175	.	0.068315	0.64402	D	0.000018	T	0.28034	0.0691	N	0.08118	0	0.80722	D	1	D;B	0.52996	0.957;0.356	P;B	0.44561	0.453;0.197	T	0.11941	-1.0567	10	0.72032	D	0.01	.	7.9723	0.30134	0.0:0.8875:0.0:0.1125	.	95;95	A8K8P3-2;A8K8P3	.;SFI1_HUMAN	L	95;95;46	ENSP00000402679:F95L;ENSP00000383145:F95L;ENSP00000389364:F46L	ENSP00000383145:F95L	F	+	3	2	SFI1	30257062	1.000000	0.71417	0.998000	0.56505	0.929000	0.56500	1.933000	0.40153	1.151000	0.42436	0.442000	0.29010	TTC		0.358	SFI1-023	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337180.3	NM_014775		5	85	0	0	0	0	5	85				
CNTN4	152330	broad.mit.edu	37	3	2908579	2908579	+	Missense_Mutation	SNP	G	G	A	rs377048968		TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr3:2908579G>A	ENST00000397461.1	+	7	982	c.598G>A	c.(598-600)Gtg>Atg	p.V200M	CNTN4_ENST00000358480.3_5'UTR|CNTN4_ENST00000427331.1_Missense_Mutation_p.V200M|CNTN4_ENST00000418658.1_Missense_Mutation_p.V200M	NM_001206955.1	NP_001193884.1	Q8IWV2	CNTN4_HUMAN	contactin 4	200	Ig-like C2-type 2.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|brain development (GO:0007420)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|neuron cell-cell adhesion (GO:0007158)|neuron projection development (GO:0031175)|regulation of synaptic plasticity (GO:0048167)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(19)|ovary(2)|pancreas(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		TACCAATACCGTGACAAACCA	0.398																																						uc003bpc.2		NA																	0				large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7						c.(598-600)GTG>ATG		contactin 4 isoform a precursor		G	MET/VAL,MET/VAL	0,3698		0,0,1849	110.0	103.0	105.0		598,598	4.5	0.3	3		105	1,8181		0,1,4090	no	missense,missense	CNTN4	NM_001206955.1,NM_175607.2	21,21	0,1,5939	AA,AG,GG		0.0122,0.0,0.0084	benign,benign	200/1027,200/1027	2908579	1,11879	1849	4091	5940	SO:0001583	missense	152330				axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding	g.chr3:2908579G>A	AW665944	CCDS2558.1, CCDS43041.1	3p26.3	2013-02-11			ENSG00000144619	ENSG00000144619		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2174	protein-coding gene	gene with protein product		607280				8586965, 12202991	Standard	NM_175607		Approved	BIG-2	uc003bpc.3	Q8IWV2	OTTHUMG00000119031	ENST00000397461.1:c.598G>A	3.37:g.2908579G>A	ENSP00000380602:p.Val200Met		Somatic				CNTN4_uc003bpb.1_Translation_Start_Site|CNTN4_uc003bpd.1_Missense_Mutation_p.V200M	p.V200M	NM_175607	NP_783200	WXS	Illumina HiSeq	Unspecified	Q8IWV2	CNTN4_HUMAN		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)	7	819	+		Ovarian(110;0.156)	200			Ig-like C2-type 2.		B2RAX3|Q8IX14|Q8TC35	Missense_Mutation	SNP	ENST00000397461.1	37	c.598G>A	CCDS43041.1	.	.	.	.	.	.	.	.	.	.	G	15.31	2.795366	0.50208	0.0	1.22E-4	ENSG00000144619	ENST00000418658;ENST00000397461;ENST00000427331	T;T;T	0.69040	-0.37;-0.37;-0.37	5.33	4.46	0.54185	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.079353	0.51477	D	0.000086	T	0.61788	0.2375	L	0.48218	1.51	0.80722	D	1	P;P	0.51449	0.794;0.945	B;B	0.44163	0.182;0.443	T	0.61187	-0.7113	10	0.34782	T	0.22	.	13.7258	0.62756	0.0737:0.0:0.9263:0.0	.	200;200	B3KTK4;Q8IWV2	.;CNTN4_HUMAN	M	200	ENSP00000396010:V200M;ENSP00000380602:V200M;ENSP00000413642:V200M	ENSP00000380602:V200M	V	+	1	0	CNTN4	2883579	1.000000	0.71417	0.341000	0.25589	0.899000	0.52679	5.529000	0.67135	1.247000	0.43917	0.655000	0.94253	GTG		0.398	CNTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239236.2			8	54	0	0	0	0	8	54				
WDR48	57599	broad.mit.edu	37	3	39104562	39104562	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr3:39104562G>C	ENST00000302313.5	+	2	98	c.70G>C	c.(70-72)Gaa>Caa	p.E24Q	WDR48_ENST00000544962.1_Intron|WDR48_ENST00000396258.3_5'UTR|WDR48_ENST00000418020.1_5'UTR	NM_020839.2	NP_065890.1	Q8TAF3	WDR48_HUMAN	WD repeat domain 48	24					double-strand break repair via homologous recombination (GO:0000724)|embryonic organ development (GO:0048568)|homeostasis of number of cells (GO:0048872)|multicellular organism growth (GO:0035264)|positive regulation of epithelial cell proliferation (GO:0050679)|protein deubiquitination (GO:0016579)|regulation of protein monoubiquitination (GO:1902525)|seminiferous tubule development (GO:0072520)|single fertilization (GO:0007338)|skeletal system morphogenesis (GO:0048705)|skin development (GO:0043588)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|nucleus (GO:0005634)				breast(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		TATTCGAGATGAAGTGGAGAA	0.388																																						uc003cit.2		NA																	0				ovary(1)|breast(1)	2						c.(70-72)GAA>CAA		WD repeat domain 48							98.0	97.0	97.0					3																	39104562		2203	4300	6503	SO:0001583	missense	57599				interspecies interaction between organisms|protein deubiquitination	lysosome|nucleus	protein binding	g.chr3:39104562G>C	AF468833	CCDS33738.1	3p21.33	2014-06-16			ENSG00000114742	ENSG00000114742		"""WD repeat domain containing"""	30914	protein-coding gene	gene with protein product		612167				10819331, 12196293, 24482476	Standard	NM_020839		Approved	KIAA1449, P80, SPG60	uc003cit.3	Q8TAF3	OTTHUMG00000155972	ENST00000302313.5:c.70G>C	3.37:g.39104562G>C	ENSP00000307491:p.Glu24Gln		Somatic				WDR48_uc011ayt.1_Missense_Mutation_p.E24Q|WDR48_uc011ayu.1_5'UTR|WDR48_uc011ayv.1_Intron|WDR48_uc003ciu.2_RNA	p.E24Q	NM_020839	NP_065890	WXS	Illumina HiSeq	Unspecified	Q8TAF3	WDR48_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)	2	80	+			24					B4DM86|B4DQI2|B4DY84|Q63HJ2|Q658Y1|Q8N3Z1|Q9NSK8|Q9P279	Missense_Mutation	SNP	ENST00000302313.5	37	c.70G>C	CCDS33738.1	.	.	.	.	.	.	.	.	.	.	G	35	5.432631	0.96150	.	.	ENSG00000114742	ENST00000302313	T	0.38722	1.12	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.62901	0.2466	M	0.68317	2.08	0.80722	D	1	D;D	0.76494	0.999;0.998	D;P	0.72982	0.979;0.894	T	0.54289	-0.8316	10	0.19147	T	0.46	-7.1834	19.8891	0.96923	0.0:0.0:1.0:0.0	.	24;24	Q8TAF3-3;Q8TAF3	.;WDR48_HUMAN	Q	24	ENSP00000307491:E24Q	ENSP00000307491:E24Q	E	+	1	0	WDR48	39079566	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.869000	0.99810	2.689000	0.91719	0.655000	0.94253	GAA		0.388	WDR48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342529.1	NM_020839		9	74	0	0	0	0	9	74				
CCDC36	339834	broad.mit.edu	37	3	49293924	49293924	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr3:49293924G>C	ENST00000438782.1	+	8	1230	c.994G>C	c.(994-996)Gaa>Caa	p.E332Q	CCDC36_ENST00000296449.5_Missense_Mutation_p.E332Q|CCDC36_ENST00000452691.2_Missense_Mutation_p.E332Q			Q8IYA8	CCD36_HUMAN	coiled-coil domain containing 36	332										endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(3)|ovary(1)|urinary_tract(3)	14				BRCA - Breast invasive adenocarcinoma(193;9.11e-05)|Kidney(197;0.00248)|KIRC - Kidney renal clear cell carcinoma(197;0.00262)		TGATCTCCAAGAAGAGGCTGC	0.512																																						uc003cwk.2		NA																	0				ovary(1)|kidney(1)	2						c.(994-996)GAA>CAA		coiled-coil domain containing 36							86.0	85.0	85.0					3																	49293924		2203	4300	6503	SO:0001583	missense	339834							g.chr3:49293924G>C	AK058049	CCDS33755.2	3p21.31	2009-08-06			ENSG00000173421	ENSG00000173421			27945	protein-coding gene	gene with protein product	"""cancer/testis antigen 74"""						Standard	NM_178173		Approved	FLJ25320, CT74	uc011bck.1	Q8IYA8	OTTHUMG00000155920	ENST00000438782.1:c.994G>C	3.37:g.49293924G>C	ENSP00000391788:p.Glu332Gln		Somatic				CCDC36_uc011bck.1_Missense_Mutation_p.E332Q	p.E332Q	NM_178173	NP_835467	WXS	Illumina HiSeq	Unspecified	Q8IYA8	CCD36_HUMAN		BRCA - Breast invasive adenocarcinoma(193;9.11e-05)|Kidney(197;0.00248)|KIRC - Kidney renal clear cell carcinoma(197;0.00262)	10	1381	+			332					C9JJL0|Q05DG9|Q96LP7	Missense_Mutation	SNP	ENST00000438782.1	37	c.994G>C	CCDS33755.2	.	.	.	.	.	.	.	.	.	.	G	14.41	2.526301	0.44969	.	.	ENSG00000173421	ENST00000296449;ENST00000438782;ENST00000452691;ENST00000309062	T;T;T	0.50277	0.75;0.75;0.75	5.06	0.854	0.19007	.	0.855784	0.10277	N	0.694047	T	0.40119	0.1104	L	0.29908	0.895	0.09310	N	0.999999	P	0.51351	0.944	P	0.47981	0.563	T	0.25606	-1.0127	10	0.62326	D	0.03	-1.6275	7.2578	0.26187	0.3951:0.0:0.6049:0.0	.	332	Q8IYA8	CCD36_HUMAN	Q	332;332;332;312	ENSP00000296449:E332Q;ENSP00000391788:E332Q;ENSP00000407837:E332Q	ENSP00000296449:E332Q	E	+	1	0	CCDC36	49268928	0.078000	0.21339	0.055000	0.19348	0.028000	0.11728	0.375000	0.20518	0.041000	0.15688	-0.373000	0.07131	GAA		0.512	CCDC36-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342332.1	NM_178173		19	82	0	0	0	0	19	82				
QTRTD1	79691	broad.mit.edu	37	3	113798799	113798799	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr3:113798799G>C	ENST00000493014.1	+	4	543	c.475G>C	c.(475-477)Gaa>Caa	p.E159Q	QTRTD1_ENST00000485050.1_Missense_Mutation_p.E277Q|QTRTD1_ENST00000479882.1_Missense_Mutation_p.E142Q|QTRTD1_ENST00000281273.4_Missense_Mutation_p.E265Q	NM_001256836.1	NP_001243765.1			queuine tRNA-ribosyltransferase domain containing 1											central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|skin(2)	10						CGAGTGTATTGAAAGAGGAGT	0.433																																						uc003eay.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(793-795)GAA>CAA		queuine tRNA-ribosyltransferase domain							204.0	195.0	198.0					3																	113798799		2203	4300	6503	SO:0001583	missense	79691				queuosine biosynthetic process	mitochondrion	metal ion binding|queuine tRNA-ribosyltransferase activity	g.chr3:113798799G>C	AK023022	CCDS33828.1, CCDS58846.1, CCDS58845.1, CCDS58844.1	3q13.31	2010-11-16			ENSG00000151576	ENSG00000151576			25771	protein-coding gene	gene with protein product						12477932	Standard	NM_024638		Approved	FLJ12960	uc003eaz.4	Q9H974	OTTHUMG00000159336	ENST00000493014.1:c.475G>C	3.37:g.113798799G>C	ENSP00000419169:p.Glu159Gln		Somatic				QTRTD1_uc003eaz.2_Missense_Mutation_p.E277Q|QTRTD1_uc011biq.1_Missense_Mutation_p.E142Q|QTRTD1_uc011bir.1_Missense_Mutation_p.E159Q	p.E265Q	NM_024638	NP_078914	WXS	Illumina HiSeq	Unspecified	Q9H974	QTRD1_HUMAN			8	1023	+			265						Missense_Mutation	SNP	ENST00000493014.1	37	c.793G>C	CCDS58845.1	.	.	.	.	.	.	.	.	.	.	G	18.67	3.674429	0.67928	.	.	ENSG00000151576	ENST00000485050;ENST00000281273;ENST00000479882;ENST00000493014	.	.	.	5.58	5.58	0.84498	.	0.158410	0.53938	D	0.000042	T	0.56558	0.1993	L	0.42245	1.32	0.48901	D	0.999729	P;B	0.46987	0.888;0.364	P;B	0.48598	0.583;0.3	T	0.49360	-0.8948	9	0.19590	T	0.45	-17.666	15.0889	0.72177	0.0:0.1413:0.8587:0.0	.	159;265	B7Z472;Q9H974	.;QTRD1_HUMAN	Q	277;265;142;159	.	ENSP00000281273:E265Q	E	+	1	0	QTRTD1	115281489	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.040000	0.70980	2.630000	0.89119	0.555000	0.69702	GAA		0.433	QTRTD1-004	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000354711.1	NM_024638		21	155	0	0	0	0	21	155				
CCDC58	131076	broad.mit.edu	37	3	122090639	122090639	+	Silent	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr3:122090639G>C	ENST00000291458.5	-	2	66	c.60C>G	c.(58-60)ctC>ctG	p.L20L	CCDC58_ENST00000497726.1_Intron|CCDC58_ENST00000479899.1_Silent_p.L6L	NM_001017928.2	NP_001017928.1	Q4VC31	CCD58_HUMAN	coiled-coil domain containing 58	20						mitochondrion (GO:0005739)				large_intestine(1)|lung(1)	2				GBM - Glioblastoma multiforme(114;0.148)		TCATCACCTTGAGTAATTCCT	0.318																																						uc003eey.2		NA																	0					0						c.(58-60)CTC>CTG		coiled-coil domain containing 58							68.0	66.0	66.0					3																	122090639		2203	4300	6503	SO:0001819	synonymous_variant	131076							g.chr3:122090639G>C	AK090592	CCDS33838.1	3q21.1	2006-01-17			ENSG00000160124	ENSG00000160124			31136	protein-coding gene	gene with protein product							Standard	XM_005247108		Approved	FLJ33273	uc003eey.3	Q4VC31	OTTHUMG00000159490	ENST00000291458.5:c.60C>G	3.37:g.122090639G>C			Somatic					p.L20L	NM_001017928	NP_001017928	WXS	Illumina HiSeq	Unspecified	Q4VC31	CCD58_HUMAN		GBM - Glioblastoma multiforme(114;0.148)	2	63	-			20					Q32LY6	Silent	SNP	ENST00000291458.5	37	c.60C>G	CCDS33838.1	.	.	.	.	.	.	.	.	.	.	G	7.712	0.695372	0.15106	.	.	ENSG00000160124	ENST00000479414	.	.	.	5.0	5.0	0.66597	.	.	.	.	.	T	0.65154	0.2664	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62315	-0.6880	4	.	.	.	.	13.5458	0.61702	0.0:0.156:0.844:0.0	.	.	.	.	E	17	.	.	Q	-	1	0	CCDC58	123573329	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.165000	0.42396	2.756000	0.94617	0.563000	0.77884	CAA		0.318	CCDC58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355754.1	NM_001017928		8	63	0	0	0	0	8	63				
PAQR9	344838	broad.mit.edu	37	3	142681168	142681168	+	Silent	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr3:142681168G>C	ENST00000340634.3	-	1	1010	c.1011C>G	c.(1009-1011)ctC>ctG	p.L337L	RP11-372E1.6_ENST00000497652.1_RNA|RP11-372E1.6_ENST00000607937.1_RNA|RP11-372E1.6_ENST00000598139.1_RNA|RP11-372E1.6_ENST00000478823.1_RNA|RP11-372E1.6_ENST00000595774.1_RNA|RP11-372E1.6_ENST00000593321.1_RNA|RP11-372E1.6_ENST00000608349.1_RNA|RP11-372E1.6_ENST00000608686.1_RNA|RP11-372E1.6_ENST00000594095.1_RNA|RP11-372E1.6_ENST00000595248.1_RNA|RP11-372E1.6_ENST00000493825.1_RNA|RP11-372E1.6_ENST00000598787.1_RNA	NM_198504.2	NP_940906.1	Q6ZVX9	PAQR9_HUMAN	progestin and adipoQ receptor family member IX	337						integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			endometrium(2)|large_intestine(7)|lung(12)|prostate(1)	22						GCGGCGCCTGGAGGAACTGGC	0.582																																						uc003evg.2		NA																	0					0						c.(1009-1011)CTC>CTG		progestin and adipoQ receptor family member IX							68.0	80.0	76.0					3																	142681168		2203	4300	6503	SO:0001819	synonymous_variant	344838					integral to membrane	receptor activity	g.chr3:142681168G>C	AY424287	CCDS3128.1	3q23	2008-05-02			ENSG00000188582	ENSG00000188582			30131	protein-coding gene	gene with protein product		614580					Standard	NM_198504		Approved	FLJ41938	uc003evg.3	Q6ZVX9	OTTHUMG00000159313	ENST00000340634.3:c.1011C>G	3.37:g.142681168G>C			Somatic				PAQR9_uc003evf.1_RNA	p.L337L	NM_198504	NP_940906	WXS	Illumina HiSeq	Unspecified	Q6ZVX9	PAQR9_HUMAN			1	1011	-			337			Cytoplasmic (Potential).		Q147T6	Silent	SNP	ENST00000340634.3	37	c.1011C>G	CCDS3128.1	.	.	.	.	.	.	.	.	.	.	G	6.571	0.473754	0.12521	.	.	ENSG00000188582	ENST00000492509	.	.	.	5.09	2.27	0.28462	.	.	.	.	.	T	0.55673	0.1935	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46005	-0.9222	4	.	.	.	-49.2847	7.8176	0.29269	0.1384:0.2498:0.6118:0.0	.	.	.	.	A	78	.	.	P	-	1	0	PAQR9	144163858	0.812000	0.29077	0.992000	0.48379	0.976000	0.68499	0.099000	0.15210	0.292000	0.22492	0.650000	0.86243	CCA		0.582	PAQR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354538.1	NM_198504		17	123	0	0	0	0	17	123				
PLSCR5	389158	broad.mit.edu	37	3	146307603	146307603	+	Splice_Site	SNP	T	T	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr3:146307603T>A	ENST00000443512.1	-	6	1619		c.e6-2		PLSCR5_ENST00000482567.1_Splice_Site|PLSCR5-AS1_ENST00000473817.1_RNA|PLSCR5_ENST00000492200.1_Splice_Site	NM_001085420.1	NP_001078889.1	A0PG75	PLS5_HUMAN	phospholipid scramblase family, member 5											endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|urinary_tract(1)	12						GGTTTTCACCTTTAGAAAGAA	0.299																																						uc003ewb.2		NA																	0					0						c.e6-1		phospholipid scramblase family, member 5							76.0	76.0	76.0					3																	146307603		1801	4060	5861	SO:0001630	splice_region_variant	389158							g.chr3:146307603T>A	AY436642	CCDS46931.1	3q24	2004-06-28			ENSG00000231213	ENSG00000231213			19952	protein-coding gene	gene with protein product							Standard	NM_001085420		Approved		uc010hvc.3	A0PG75	OTTHUMG00000159437	ENST00000443512.1:c.616-2A>T	3.37:g.146307603T>A			Somatic				PLSCR5_uc010hvb.2_Splice_Site_p.V194_splice|PLSCR5_uc010hvc.2_Splice_Site_p.V206_splice	p.V206_splice	NM_001085420	NP_001078889	WXS	Illumina HiSeq	Unspecified	A0PG75	PLS5_HUMAN			6	1620	-								B2RXK5	Splice_Site	SNP	ENST00000443512.1	37	c.616_splice	CCDS46931.1	.	.	.	.	.	.	.	.	.	.	T	10.65	1.409365	0.25378	.	.	ENSG00000231213	ENST00000492200;ENST00000482567;ENST00000443512	.	.	.	5.13	5.13	0.70059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6544	0.77121	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PLSCR5	147790293	1.000000	0.71417	0.672000	0.29872	0.320000	0.28249	7.096000	0.76960	2.237000	0.73441	0.528000	0.53228	.		0.299	PLSCR5-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355365.1	XM_371670	Intron	4	110	0	0	0	0	4	110				
TM4SF18	116441	broad.mit.edu	37	3	149039271	149039271	+	Silent	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr3:149039271G>A	ENST00000296059.2	-	6	865	c.600C>T	c.(598-600)atC>atT	p.I200I	TM4SF18_ENST00000470080.1_Silent_p.I200I|RP11-206M11.7_ENST00000489011.1_RNA	NM_138786.3	NP_620141.1	Q96CE8	T4S18_HUMAN	transmembrane 4 L six family member 18	200						integral component of membrane (GO:0016021)				lung(1)|ovary(1)|prostate(1)	3			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			TTATTCAAATGATTCCAGGCT	0.303																																						uc003exa.2		NA																	0				ovary(1)	1						c.(598-600)ATC>ATT		transmembrane 4 L six family member 18							82.0	86.0	85.0					3																	149039271		2203	4297	6500	SO:0001819	synonymous_variant	116441					integral to membrane		g.chr3:149039271G>A	BC014339	CCDS3142.1	3q25.1	2005-08-09			ENSG00000163762	ENSG00000163762			25181	protein-coding gene	gene with protein product						10975581	Standard	NM_001184723		Approved	L6D	uc021xfl.1	Q96CE8	OTTHUMG00000159582	ENST00000296059.2:c.600C>T	3.37:g.149039271G>A			Somatic					p.I200I	NM_138786	NP_620141	WXS	Illumina HiSeq	Unspecified	Q96CE8	T4S18_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)		6	737	-			200			Cytoplasmic (Potential).		B2R8K0|D3DNH5	Silent	SNP	ENST00000296059.2	37	c.600C>T	CCDS3142.1																																																																																				0.303	TM4SF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356326.1	NM_138786		13	109	0	0	0	0	13	109				
PTX3	5806	broad.mit.edu	37	3	157160249	157160249	+	Silent	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr3:157160249C>T	ENST00000295927.3	+	3	772	c.627C>T	c.(625-627)gcC>gcT	p.A209A	VEPH1_ENST00000543418.1_Intron|VEPH1_ENST00000392833.2_Intron|VEPH1_ENST00000362010.2_Intron|VEPH1_ENST00000392832.2_Intron	NM_002852.3	NP_002843.2	P26022	PTX3_HUMAN	pentraxin 3, long	209	Pentaxin.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of exo-alpha-sialidase activity (GO:1903016)|negative regulation of glycoprotein metabolic process (GO:1903019)|negative regulation of viral entry into host cell (GO:0046597)|opsonization (GO:0008228)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phagocytosis (GO:0050766)|response to yeast (GO:0001878)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	(1->3)-beta-D-glucan binding (GO:0001872)|complement component C1q binding (GO:0001849)|virion binding (GO:0046790)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|stomach(1)	10			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			CTTTTAGTGCCTGCATTTGGG	0.423																																						uc003fbl.3		NA																	0				central_nervous_system(1)	1						c.(625-627)GCC>GCT		pentraxin 3 precursor							96.0	93.0	94.0					3																	157160249		2203	4300	6503	SO:0001819	synonymous_variant	5806				inflammatory response	extracellular region		g.chr3:157160249C>T	X63613	CCDS3180.1	3q25	2010-03-11	2010-03-11		ENSG00000163661	ENSG00000163661			9692	protein-coding gene	gene with protein product		602492	"""pentaxin-related gene, rapidly induced by IL-1 beta"", ""tumor necrosis factor, alpha-induced protein 5"", ""pentraxin-related gene, rapidly induced by IL-1 beta"""	TNFAIP5		1429570	Standard	NM_002852		Approved	TSG-14	uc003fbl.4	P26022	OTTHUMG00000158750	ENST00000295927.3:c.627C>T	3.37:g.157160249C>T			Somatic				VEPH1_uc003fbj.1_Intron|VEPH1_uc003fbk.1_Intron|VEPH1_uc010hvu.1_Intron	p.A209A	NM_002852	NP_002843	WXS	Illumina HiSeq	Unspecified	P26022	PTX3_HUMAN	Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)		3	770	+			209			Pentaxin.		B2R6T6|Q38M82	Silent	SNP	ENST00000295927.3	37	c.627C>T	CCDS3180.1																																																																																				0.423	PTX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352028.1	NM_002852		15	86	0	0	0	0	15	86				
FAM43A	131583	broad.mit.edu	37	3	194408636	194408636	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr3:194408636G>T	ENST00000329759.4	+	1	2015	c.1081G>T	c.(1081-1083)Ggc>Tgc	p.G361C		NM_153690.4	NP_710157.2	Q8N2R8	FA43A_HUMAN	family with sequence similarity 43, member A	361										breast(2)|central_nervous_system(1)|lung(6)|skin(1)	10	all_cancers(143;2.04e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.147)	OV - Ovarian serous cystadenocarcinoma(49;8.37e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;1.78e-05)		TAGCGACCTGGGCGAGCTCAG	0.711																																						uc003fuj.2		NA																	0				central_nervous_system(1)	1						c.(1081-1083)GGC>TGC		hypothetical protein LOC131583							11.0	11.0	11.0					3																	194408636		2171	4239	6410	SO:0001583	missense	131583							g.chr3:194408636G>T	AK074503	CCDS33923.1	3q29	2004-07-28			ENSG00000185112	ENSG00000185112			26888	protein-coding gene	gene with protein product						12477932	Standard	NM_153690		Approved	FLJ90022	uc003fuj.3	Q8N2R8	OTTHUMG00000156016	ENST00000329759.4:c.1081G>T	3.37:g.194408636G>T	ENSP00000371397:p.Gly361Cys		Somatic					p.G361C	NM_153690	NP_710157	WXS	Illumina HiSeq	Unspecified	Q8N2R8	FA43A_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;8.37e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;1.78e-05)	1	2015	+	all_cancers(143;2.04e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.147)	361					A3KME2|Q8IXP4|Q8WZ07	Missense_Mutation	SNP	ENST00000329759.4	37	c.1081G>T	CCDS33923.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.936340	0.73442	.	.	ENSG00000185112	ENST00000329759	D	0.85013	-1.93	4.8	2.92	0.33932	.	0.056487	0.64402	D	0.000001	D	0.83931	0.5361	L	0.48642	1.525	0.58432	D	0.999996	P	0.43431	0.807	P	0.50136	0.632	T	0.83066	-0.0145	10	0.59425	D	0.04	-14.7209	9.027	0.36236	0.0832:0.1478:0.769:0.0	.	361	Q8N2R8	FA43A_HUMAN	C	361	ENSP00000371397:G361C	ENSP00000371397:G361C	G	+	1	0	FAM43A	195889925	1.000000	0.71417	0.996000	0.52242	0.982000	0.71751	4.956000	0.63645	1.016000	0.39470	0.655000	0.94253	GGC		0.711	FAM43A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342734.1	NM_153690		4	15	1	0	0.00909568	0.00936359	4	15				
ZCCHC4	29063	broad.mit.edu	37	4	25351204	25351204	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr4:25351204G>C	ENST00000302874.4	+	7	874	c.850G>C	c.(850-852)Gaa>Caa	p.E284Q	ZCCHC4_ENST00000505451.1_3'UTR	NM_024936.2	NP_079212.2	Q9H5U6	ZCHC4_HUMAN	zinc finger, CCHC domain containing 4	284							methyltransferase activity (GO:0008168)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(2)|ovary(2)|pancreas(1)	9		Breast(46;0.0503)				TGGCTTGGTTGAACCTCTGGC	0.378																																						uc003grl.3		NA																	0				ovary(2)	2						c.(850-852)GAA>CAA		zinc finger, CCHC domain containing 4							182.0	176.0	178.0					4																	25351204		1873	4093	5966	SO:0001583	missense	29063						methyltransferase activity|nucleic acid binding|zinc ion binding	g.chr4:25351204G>C	AF161537	CCDS43218.1	4p15.31	2014-02-18			ENSG00000168228	ENSG00000168228		"""Zinc fingers, CCHC domain containing"""	22917	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 4"""	611792				11042152	Standard	NM_024936		Approved	HSPC052, FLJ23024, ZGRF4	uc003grl.4	Q9H5U6	OTTHUMG00000160563	ENST00000302874.4:c.850G>C	4.37:g.25351204G>C	ENSP00000303468:p.Glu284Gln		Somatic				ZCCHC4_uc003grm.1_RNA|ZCCHC4_uc003grn.3_Missense_Mutation_p.E50Q	p.E284Q	NM_024936	NP_079212	WXS	Illumina HiSeq	Unspecified	Q9H5U6	ZCHC4_HUMAN			7	886	+		Breast(46;0.0503)	284					B2RXF6|B4DRD8|B7ZW20|Q5IW78|Q96AN7	Missense_Mutation	SNP	ENST00000302874.4	37	c.850G>C	CCDS43218.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.93|15.93	2.977145|2.977145	0.53720|0.53720	.|.	.|.	ENSG00000168228|ENSG00000168228	ENST00000302874|ENST00000505412	T|.	0.52983|.	0.64|.	5.4|5.4	4.55|4.55	0.56014|0.56014	.|.	0.161059|.	0.56097|.	D|.	0.000035|.	T|.	0.65974|.	0.2743|.	M|M	0.67700|0.67700	2.07|2.07	0.37526|0.37526	D|D	0.917738|0.917738	P|.	0.45957|.	0.869|.	P|.	0.48425|.	0.577|.	T|.	0.69228|.	-0.5200|.	10|.	0.52906|.	T|.	0.07|.	-8.0501|-8.0501	11.814|11.814	0.52199|0.52199	0.085:0.0:0.915:0.0|0.085:0.0:0.915:0.0	.|.	284|.	Q9H5U6|.	ZCHC4_HUMAN|.	Q|S	284|148	ENSP00000303468:E284Q|.	ENSP00000303468:E284Q|.	E|X	+|+	1|2	0|2	ZCCHC4|ZCCHC4	24960302|24960302	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	4.272000|4.272000	0.58908|0.58908	2.520000|2.520000	0.84964|0.84964	0.655000|0.655000	0.94253|0.94253	GAA|TGA		0.378	ZCCHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361151.1			28	152	0	0	0	0	28	152				
RHOH	399	broad.mit.edu	37	4	40245288	40245288	+	Silent	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr4:40245288G>A	ENST00000381799.5	+	3	1006	c.282G>A	c.(280-282)ttG>ttA	p.L94L	RHOH_ENST00000505618.1_Silent_p.L94L	NM_001278363.1|NM_001278365.1|NM_001278366.1|NM_001278367.1|NM_001278369.1|NM_004310.4	NP_001265292.1|NP_001265294.1|NP_001265295.1|NP_001265296.1|NP_001265298.1|NP_004301.1	Q15669	RHOH_HUMAN	ras homolog family member H	94					mast cell activation (GO:0045576)|negative regulation of catalytic activity (GO:0043086)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of phosphorylation (GO:0042326)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase inhibitor activity (GO:0005095)|kinase inhibitor activity (GO:0019210)|Rho GTPase binding (GO:0017048)			kidney(1)|large_intestine(3)|lung(7)|ovary(1)	12						TCCTGAACTTGAAGAACAAGT	0.572																																						uc003guz.2		NA																	0				ovary(1)|lung(1)	2						c.(280-282)TTG>TTA		ras homolog gene family, member H precursor							95.0	82.0	86.0					4																	40245288		2203	4300	6503	SO:0001819	synonymous_variant	399				negative regulation of I-kappaB kinase/NF-kappaB cascade|regulation of small GTPase mediated signal transduction|regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|T cell differentiation	cytosol|mitochondrion|plasma membrane	GTP binding|GTPase inhibitor activity|kinase inhibitor activity|Rho GTPase binding	g.chr4:40245288G>A	Z35227	CCDS3458.1	4p13	2014-09-17	2012-02-27	2004-03-24	ENSG00000168421	ENSG00000168421			686	protein-coding gene	gene with protein product		602037	"""ras homolog gene family, member H"""	ARHH		7784061	Standard	NM_001278359		Approved	RhoH, TTF	uc003guz.2	Q15669	OTTHUMG00000099373	ENST00000381799.5:c.282G>A	4.37:g.40245288G>A			Somatic					p.L94L	NM_004310	NP_004301	WXS	Illumina HiSeq	Unspecified	Q15669	RHOH_HUMAN			3	1006	+			94						Silent	SNP	ENST00000381799.5	37	c.282G>A	CCDS3458.1																																																																																				0.572	RHOH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216820.3	NM_004310		14	32	0	0	0	0	14	32				
LIMCH1	22998	broad.mit.edu	37	4	41648692	41648692	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr4:41648692C>T	ENST00000313860.7	+	12	1501	c.1447C>T	c.(1447-1449)Ccc>Tcc	p.P483S	LIMCH1_ENST00000514096.1_Missense_Mutation_p.P324S|LIMCH1_ENST00000509277.1_Missense_Mutation_p.P317S|LIMCH1_ENST00000503057.1_Missense_Mutation_p.P868S|LIMCH1_ENST00000396595.3_Missense_Mutation_p.P329S|LIMCH1_ENST00000381753.4_Missense_Mutation_p.P317S|LIMCH1_ENST00000512632.1_Missense_Mutation_p.P483S|LIMCH1_ENST00000511496.1_Missense_Mutation_p.P324S|LIMCH1_ENST00000508501.1_Missense_Mutation_p.P483S|LIMCH1_ENST00000512820.1_Missense_Mutation_p.P471S|LIMCH1_ENST00000513024.1_Missense_Mutation_p.P312S|LIMCH1_ENST00000512946.1_Missense_Mutation_p.P483S	NM_014988.2	NP_055803.2	Q9UPQ0	LIMC1_HUMAN	LIM and calponin homology domains 1	483					actomyosin structure organization (GO:0031032)		zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(1)|large_intestine(9)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(5)	41						CCTGAATGACCCCAATCCCAT	0.488																																						uc003gvu.3		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(1447-1449)CCC>TCC		LIM and calponin homology domains 1 isoform a							230.0	236.0	234.0					4																	41648692		2203	4300	6503	SO:0001583	missense	22998				actomyosin structure organization		actin binding|zinc ion binding	g.chr4:41648692C>T	AB029025	CCDS33977.1, CCDS47047.1, CCDS54763.1, CCDS54764.1, CCDS54765.1, CCDS75119.1, CCDS75121.1	4p13	2007-06-14		2008-01-09	ENSG00000064042	ENSG00000064042			29191	protein-coding gene	gene with protein product						10470851	Standard	XM_005248057		Approved	DKFZP686A01247, LIMCH1A, LMO7B	uc003gvz.4	Q9UPQ0	OTTHUMG00000160575	ENST00000313860.7:c.1447C>T	4.37:g.41648692C>T	ENSP00000316891:p.Pro483Ser		Somatic				LIMCH1_uc003gvv.3_Missense_Mutation_p.P483S|LIMCH1_uc003gvw.3_Missense_Mutation_p.P483S|LIMCH1_uc003gvx.3_Missense_Mutation_p.P471S|LIMCH1_uc003gwe.3_Missense_Mutation_p.P483S|LIMCH1_uc003gvy.3_Missense_Mutation_p.P312S|LIMCH1_uc003gwa.3_Missense_Mutation_p.P324S|LIMCH1_uc003gvz.3_Missense_Mutation_p.P868S|LIMCH1_uc011byu.1_Missense_Mutation_p.P317S|LIMCH1_uc003gwc.3_Missense_Mutation_p.P329S|LIMCH1_uc003gwd.3_Missense_Mutation_p.P317S|LIMCH1_uc011byv.1_Missense_Mutation_p.P234S	p.P483S	NM_014988	NP_055803	WXS	Illumina HiSeq	Unspecified	Q9UPQ0	LIMC1_HUMAN			12	1501	+			483					A8MXC3|E9PHM7|Q503B5|Q5CZB1|Q5CZB6|Q5H9S8|Q68E07|Q6PJ44|Q7Z3G5|Q8N3S9|Q8N6M2	Missense_Mutation	SNP	ENST00000313860.7	37	c.1447C>T	CCDS33977.1	.	.	.	.	.	.	.	.	.	.	C	19.42	3.824827	0.71143	.	.	ENSG00000064042	ENST00000513024;ENST00000508501;ENST00000512946;ENST00000313860;ENST00000512632;ENST00000512820;ENST00000503057;ENST00000511496;ENST00000313875;ENST00000514096;ENST00000509277;ENST00000396595;ENST00000381753	T;T;T;T;T;T;T;T;T;T;T;T	0.53206	0.97;1.28;1.33;1.27;0.97;1.24;0.66;0.71;0.63;0.97;0.97;0.64	5.61	5.61	0.85477	.	0.060838	0.64402	D	0.000003	T	0.70176	0.3194	M	0.72894	2.215	0.80722	D	1	D;B;P;B;B;D;B;D;D;D;D	0.89917	0.972;0.077;0.76;0.34;0.34;0.998;0.302;1.0;1.0;1.0;1.0	P;B;P;B;B;D;B;D;D;D;D	0.91635	0.776;0.082;0.519;0.437;0.316;0.997;0.237;0.999;0.998;0.999;0.998	T	0.72043	-0.4409	10	0.72032	D	0.01	-13.3913	19.6241	0.95671	0.0:1.0:0.0:0.0	.	234;317;483;317;329;868;312;471;483;483;483	B7Z3G0;E9PDJ9;D6RD46;Q9UPQ0-9;Q9UPQ0-6;G5EA03;Q9UPQ0-5;Q9UPQ0-4;E9PHM7;Q9UPQ0-2;Q9UPQ0	.;.;.;.;.;.;.;.;.;.;LIMC1_HUMAN	S	312;483;483;483;483;471;868;324;867;324;317;329;317	ENSP00000425222:P312S;ENSP00000424825:P483S;ENSP00000424645:P483S;ENSP00000316891:P483S;ENSP00000427045:P483S;ENSP00000424437:P471S;ENSP00000425631:P868S;ENSP00000421242:P324S;ENSP00000426334:P324S;ENSP00000422864:P317S;ENSP00000379840:P329S;ENSP00000371172:P317S	ENSP00000316891:P483S	P	+	1	0	LIMCH1	41343449	1.000000	0.71417	0.999000	0.59377	0.827000	0.46813	1.907000	0.39897	2.627000	0.88993	0.591000	0.81541	CCC		0.488	LIMCH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000361249.2	NM_014988		33	320	0	0	0	0	33	320				
ANKRD50	57182	broad.mit.edu	37	4	125592795	125592795	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr4:125592795C>T	ENST00000504087.1	-	4	2674	c.1637G>A	c.(1636-1638)aGa>aAa	p.R546K	ANKRD50_ENST00000515641.1_Missense_Mutation_p.R367K	NM_020337.2	NP_065070.1	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	546										NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(14)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	55						CAATAATGTTCTCCCATTTGA	0.398																																						uc003ifg.3		NA																	0				central_nervous_system(1)	1						c.(1636-1638)AGA>AAA		ankyrin repeat domain 50							123.0	120.0	121.0					4																	125592795		2203	4300	6503	SO:0001583	missense	57182							g.chr4:125592795C>T	AB033049	CCDS34060.1, CCDS54802.1	4q28.1	2013-01-10			ENSG00000151458	ENSG00000151458		"""Ankyrin repeat domain containing"""	29223	protein-coding gene	gene with protein product							Standard	NM_020337		Approved	KIAA1223	uc010inw.3	Q9ULJ7	OTTHUMG00000161398	ENST00000504087.1:c.1637G>A	4.37:g.125592795C>T	ENSP00000425658:p.Arg546Lys		Somatic				ANKRD50_uc011cgo.1_Missense_Mutation_p.R367K|ANKRD50_uc010inw.2_Missense_Mutation_p.R546K	p.R546K	NM_020337	NP_065070	WXS	Illumina HiSeq	Unspecified	Q9ULJ7	ANR50_HUMAN			3	1903	-			546			ANK 3.		A8K4V3|B4DHJ6|E9PDW0|Q6N064|Q6ZSE6	Missense_Mutation	SNP	ENST00000504087.1	37	c.1637G>A	CCDS34060.1	.	.	.	.	.	.	.	.	.	.	C	13.24	2.179221	0.38511	.	.	ENSG00000151458	ENST00000504087;ENST00000515641	T;T	0.64803	-0.12;2.41	4.98	4.98	0.66077	Ankyrin repeat-containing domain (4);	0.057395	0.64402	D	0.000006	T	0.55465	0.1922	L	0.39467	1.215	0.45883	D	0.998737	B	0.11235	0.004	B	0.12156	0.007	T	0.49466	-0.8937	10	0.27785	T	0.31	.	18.4479	0.90691	0.0:1.0:0.0:0.0	.	546	Q9ULJ7	ANR50_HUMAN	K	546;367	ENSP00000425658:R546K;ENSP00000425355:R367K	ENSP00000425658:R546K	R	-	2	0	ANKRD50	125812245	1.000000	0.71417	0.347000	0.25668	0.997000	0.91878	3.505000	0.53356	2.590000	0.87494	0.555000	0.69702	AGA		0.398	ANKRD50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364775.1	NM_020337		6	64	0	0	0	0	6	64				
SPEF2	79925	broad.mit.edu	37	5	35806816	35806816	+	Nonsense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr5:35806816C>G	ENST00000356031.3	+	35	5172	c.5018C>G	c.(5017-5019)tCa>tGa	p.S1673*	SPEF2_ENST00000303129.4_Nonsense_Mutation_p.S470*|SPEF2_ENST00000440995.2_Nonsense_Mutation_p.S1668*|CTD-2113L7.1_ENST00000510433.1_RNA	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	1673					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CAGACCTCCTCAACTGATGCA	0.388																																						uc003jjo.2		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(5017-5019)TCA>TGA		KPL2 protein isoform 1							62.0	57.0	59.0					5																	35806816		1837	4097	5934	SO:0001587	stop_gained	79925				nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity	g.chr5:35806816C>G	AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.5018C>G	5.37:g.35806816C>G	ENSP00000348314:p.Ser1673*		Somatic				SPEF2_uc003jjp.1_Nonsense_Mutation_p.S1159*|SPEF2_uc003jjr.2_Nonsense_Mutation_p.S728*	p.S1673*	NM_024867	NP_079143	WXS	Illumina HiSeq	Unspecified	Q9C093	SPEF2_HUMAN	Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		35	5129	+	all_lung(31;7.56e-05)		1673					Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Nonsense_Mutation	SNP	ENST00000356031.3	37	c.5018C>G	CCDS43309.1	.	.	.	.	.	.	.	.	.	.	C	39	7.309422	0.98203	.	.	ENSG00000152582	ENST00000356031;ENST00000440995;ENST00000303129	.	.	.	5.33	0.263	0.15602	.	1.198900	0.06104	N	0.665979	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	.	5.1299	0.14905	0.3327:0.4986:0.0:0.1687	.	.	.	.	X	1673;1668;470	.	ENSP00000303843:S470X	S	+	2	0	SPEF2	35842573	0.000000	0.05858	0.185000	0.23176	0.126000	0.20510	-0.197000	0.09518	0.167000	0.19631	-0.169000	0.13324	TCA		0.388	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	NM_144722		5	29	0	0	0	0	5	29				
DHX29	54505	broad.mit.edu	37	5	54591224	54591224	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr5:54591224C>G	ENST00000251636.5	-	5	782	c.634G>C	c.(634-636)Gag>Cag	p.E212Q	RP11-506H20.1_ENST00000506435.1_RNA	NM_019030.2	NP_061903.2	Q7Z478	DHX29_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 29	212						eukaryotic 43S preinitiation complex (GO:0016282)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation initiation factor activity (GO:0003743)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|lung(6)|ovary(4)|prostate(1)|skin(3)|urinary_tract(2)	46		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)				TTAGGGTCCTCTTCATATGTT	0.333																																						uc003jpx.2		NA																	0				ovary(2)|central_nervous_system(1)|skin(1)	4						c.(634-636)GAG>CAG		DEAH (Asp-Glu-Ala-His) box polypeptide 29							151.0	145.0	147.0					5																	54591224		2203	4299	6502	SO:0001583	missense	54505						ATP binding|ATP-dependent helicase activity|translation initiation factor activity	g.chr5:54591224C>G	AY036974	CCDS34158.1	5q11.2	2008-02-05	2003-06-13	2003-06-20	ENSG00000067248	ENSG00000067248		"""DEAH-boxes"""	15815	protein-coding gene	gene with protein product		612720	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 29"""	DDX29			Standard	XM_005248544		Approved		uc003jpx.3	Q7Z478	OTTHUMG00000162313	ENST00000251636.5:c.634G>C	5.37:g.54591224C>G	ENSP00000251636:p.Glu212Gln		Somatic				DHX29_uc010ivw.2_RNA	p.E212Q	NM_019030	NP_061903	WXS	Illumina HiSeq	Unspecified	Q7Z478	DHX29_HUMAN			5	754	-		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)	212					O75549|Q63HN0|Q63HN3|Q8IWW2|Q8N3A1|Q9UMH2	Missense_Mutation	SNP	ENST00000251636.5	37	c.634G>C	CCDS34158.1	.	.	.	.	.	.	.	.	.	.	C	8.557	0.876933	0.17395	.	.	ENSG00000067248	ENST00000251636	T	0.03801	3.8	5.95	5.09	0.68999	.	0.483713	0.25094	N	0.033191	T	0.05640	0.0148	L	0.40543	1.245	0.29280	N	0.870095	B	0.23735	0.09	B	0.23419	0.046	T	0.14783	-1.0460	10	0.28530	T	0.3	.	12.1877	0.54250	0.0:0.8598:0.0:0.1402	.	212	Q7Z478	DHX29_HUMAN	Q	212	ENSP00000251636:E212Q	ENSP00000251636:E212Q	E	-	1	0	DHX29	54626981	0.995000	0.38212	0.890000	0.34922	0.003000	0.03518	3.879000	0.56138	1.538000	0.49270	-0.142000	0.14014	GAG		0.333	DHX29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368532.1	NM_019030		11	85	0	0	0	0	11	85				
MAP3K1	4214	broad.mit.edu	37	5	56179360	56179360	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr5:56179360G>C	ENST00000399503.3	+	15	3673	c.3673G>C	c.(3673-3675)Gag>Cag	p.E1225Q		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	1225					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		GTAGACACCAGAGACTCTACC	0.368																																						uc003jqw.3		NA																	0				ovary(1)|skin(1)	2						c.(3673-3675)GAG>CAG		mitogen-activated protein kinase kinase kinase							116.0	107.0	110.0					5																	56179360		1858	4085	5943	SO:0001583	missense	4214				cellular response to mechanical stimulus|innate immune response|MyD88-dependent toll-like receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol	ATP binding|zinc ion binding	g.chr5:56179360G>C	U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.3673G>C	5.37:g.56179360G>C	ENSP00000382423:p.Glu1225Gln		Somatic					p.E1225Q	NM_005921	NP_005912	WXS	Illumina HiSeq	Unspecified	Q13233	M3K1_HUMAN		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)	15	4174	+		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)	1225						Missense_Mutation	SNP	ENST00000399503.3	37	c.3673G>C	CCDS43318.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.997449	0.93227	.	.	ENSG00000095015	ENST00000399503	T	0.69926	-0.44	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.77922	0.4203	L	0.54323	1.7	0.80722	D	1	D	0.67145	0.996	P	0.60012	0.867	T	0.77935	-0.2401	10	0.66056	D	0.02	.	20.3431	0.98773	0.0:0.0:1.0:0.0	.	1225	Q13233	M3K1_HUMAN	Q	1225	ENSP00000382423:E1225Q	ENSP00000382423:E1225Q	E	+	1	0	MAP3K1	56215117	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	8.462000	0.90374	2.880000	0.98712	0.650000	0.86243	GAG		0.368	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000132309.2	XM_042066		3	56	0	0	0	0	3	56				
HTR1A	3350	broad.mit.edu	37	5	63256583	63256583	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr5:63256583C>G	ENST00000323865.3	-	1	1197	c.964G>C	c.(964-966)Gag>Cag	p.E322Q	RP11-158J3.2_ENST00000502882.1_RNA	NM_000524.3	NP_000515.2	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled	322					adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|behavioral fear response (GO:0001662)|cell proliferation (GO:0008283)|exploration behavior (GO:0035640)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cell proliferation (GO:0008284)|regulation of behavior (GO:0050795)|regulation of dopamine metabolic process (GO:0042053)|regulation of hormone secretion (GO:0046883)|regulation of serotonin secretion (GO:0014062)|serotonin metabolic process (GO:0042428)|serotonin receptor signaling pathway (GO:0007210)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(29)|ovary(2)|pancreas(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	56		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Acepromazine(DB01614)|Alprenolol(DB00866)|Alverine(DB01616)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinitapride(DB08810)|Clozapine(DB00363)|Desipramine(DB01151)|Dopamine(DB00988)|Doxepin(DB01142)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Methysergide(DB00247)|Mianserin(DB06148)|Molindone(DB01618)|Naratriptan(DB00952)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Ondansetron(DB00904)|Paliperidone(DB01267)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sumatriptan(DB00669)|Thioproperazine(DB01622)|Trazodone(DB00656)|Trimipramine(DB00726)|Vilazodone(DB06684)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	TTTTTCCTCTCGAAAGAGGCG	0.617																																						uc011cqt.1		NA																	0				ovary(2)|pancreas(2)	4						c.(964-966)GAG>CAG		5-hydroxytryptamine (serotonin) receptor 1A	Alprenolol(DB00866)|Aripiprazole(DB01238)|Buspirone(DB00490)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Fluvoxamine(DB00176)|Lisuride(DB00589)|Methysergide(DB00247)|Mirtazapine(DB00370)|Pindolol(DB00960)|Propranolol(DB00571)|Quetiapine(DB01224)|Sertraline(DB01104)|Tegaserod(DB01079)|Trazodone(DB00656)|Venlafaxine(DB00285)|Ziprasidone(DB00246)						52.0	55.0	54.0					5																	63256583		2203	4300	6503	SO:0001583	missense	3350				behavior|positive regulation of cell proliferation	integral to plasma membrane	serotonin receptor activity	g.chr5:63256583C>G	AF498978	CCDS34168.1	5q11.2-q13	2012-08-08	2012-02-03			ENSG00000178394		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5286	protein-coding gene	gene with protein product		109760	"""5-hydroxytryptamine (serotonin) receptor 1A"""	ADRB2RL1, ADRBRL1		2591972, 12969265	Standard	NM_000524		Approved	5-HT1A	uc011cqt.3	P08908		ENST00000323865.3:c.964G>C	5.37:g.63256583C>G	ENSP00000316244:p.Glu322Gln		Somatic					p.E322Q	NM_000524	NP_000515	WXS	Illumina HiSeq	Unspecified	P08908	5HT1A_HUMAN		Lung(70;0.105)	1	964	-		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)	322			Cytoplasmic (By similarity).		Q6LAE7	Missense_Mutation	SNP	ENST00000323865.3	37	c.964G>C	CCDS34168.1	.	.	.	.	.	.	.	.	.	.	C	17.95	3.514517	0.64522	.	.	ENSG00000178394	ENST00000323865	T	0.63255	-0.03	5.17	5.17	0.71159	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.64216	0.2578	L	0.46947	1.48	0.80722	D	1	P	0.38223	0.623	P	0.46917	0.531	T	0.56486	-0.7971	10	0.15499	T	0.54	.	17.8521	0.88750	0.0:1.0:0.0:0.0	.	322	P08908	5HT1A_HUMAN	Q	322	ENSP00000316244:E322Q	ENSP00000316244:E322Q	E	-	1	0	HTR1A	63292339	1.000000	0.71417	0.997000	0.53966	0.881000	0.50899	5.517000	0.67061	2.692000	0.91855	0.655000	0.94253	GAG		0.617	HTR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368397.1	NM_000524		4	51	0	0	0	0	4	51				
XRCC4	7518	broad.mit.edu	37	5	82400809	82400809	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr5:82400809G>C	ENST00000511817.1	+	2	151	c.71G>C	c.(70-72)tGg>tCg	p.W24S	XRCC4_ENST00000396027.4_Missense_Mutation_p.W24S|XRCC4_ENST00000509268.1_3'UTR|XRCC4_ENST00000338635.6_Missense_Mutation_p.W24S|XRCC4_ENST00000282268.3_Missense_Mutation_p.W24S			Q13426	XRCC4_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 4	24					cellular response to lithium ion (GO:0071285)|central nervous system development (GO:0007417)|DNA ligation involved in DNA repair (GO:0051103)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|immunoglobulin V(D)J recombination (GO:0033152)|in utero embryonic development (GO:0001701)|isotype switching (GO:0045190)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of ligase activity (GO:0051351)|positive regulation of neurogenesis (GO:0050769)|pro-B cell differentiation (GO:0002328)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytosol (GO:0005829)|DNA ligase IV complex (GO:0032807)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(2)|skin(3)	17		Lung NSC(167;0.00132)|all_lung(232;0.00154)|Ovarian(174;0.034)		OV - Ovarian serous cystadenocarcinoma(54;1.44e-38)|Epithelial(54;3.72e-33)|all cancers(79;9.22e-28)		CAAGTATCTTGGGAGAAAACA	0.338								Non-homologous end-joining																														uc003kib.2		NA																	0				skin(3)	3						c.(70-72)TGG>TCG	NHEJ	X-ray repair cross complementing protein 4							88.0	93.0	91.0					5																	82400809		2203	4297	6500	SO:0001583	missense	7518				DNA ligation involved in DNA repair|double-strand break repair via nonhomologous end joining|initiation of viral infection|positive regulation of ligase activity|provirus integration|response to X-ray	cytosol|DNA ligase IV complex|DNA-dependent protein kinase-DNA ligase 4 complex|nucleoplasm	DNA binding|protein C-terminus binding	g.chr5:82400809G>C	AB017445	CCDS4058.1, CCDS4059.1	5q14.2	2008-02-05			ENSG00000152422	ENSG00000152422			12831	protein-coding gene	gene with protein product	"""X-ray repair, complementing defective, repair in Chinese hamster"", ""DNA repair protein XRCC4"""	194363				1697445, 7665175	Standard	NM_022406		Approved		uc003kib.3	Q13426	OTTHUMG00000131319	ENST00000511817.1:c.71G>C	5.37:g.82400809G>C	ENSP00000421491:p.Trp24Ser		Somatic				XRCC4_uc003kia.1_Missense_Mutation_p.W24S|XRCC4_uc003kid.2_Missense_Mutation_p.W24S|XRCC4_uc003kic.2_Missense_Mutation_p.W24S|XRCC4_uc003kie.2_Missense_Mutation_p.W24S|XRCC4_uc003kif.1_Missense_Mutation_p.W24S	p.W24S	NM_022406	NP_071801	WXS	Illumina HiSeq	Unspecified	Q13426	XRCC4_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;1.44e-38)|Epithelial(54;3.72e-33)|all cancers(79;9.22e-28)	2	199	+		Lung NSC(167;0.00132)|all_lung(232;0.00154)|Ovarian(174;0.034)	24					A8K3X4|Q9BS72|Q9UP94	Missense_Mutation	SNP	ENST00000511817.1	37	c.71G>C	CCDS4059.1	.	.	.	.	.	.	.	.	.	.	G	18.73	3.687147	0.68157	.	.	ENSG00000152422	ENST00000282268;ENST00000338635;ENST00000396027;ENST00000511817	T;T;T;T	0.27256	1.68;1.68;1.68;1.68	5.67	5.67	0.87782	DNA double-strand break repair and VJ recombination XRCC4, N-terminal (2);	0.070853	0.64402	D	0.000010	T	0.50939	0.1645	M	0.62016	1.91	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.28459	-1.0043	10	0.38643	T	0.18	-6.5224	20.1169	0.97940	0.0:0.0:1.0:0.0	.	24;24;24	Q13426-2;Q13426;Q13426-3	.;XRCC4_HUMAN;.	S	24	ENSP00000282268:W24S;ENSP00000342011:W24S;ENSP00000379344:W24S;ENSP00000421491:W24S	ENSP00000282268:W24S	W	+	2	0	XRCC4	82436565	1.000000	0.71417	1.000000	0.80357	0.809000	0.45718	6.344000	0.72991	2.835000	0.97688	0.591000	0.81541	TGG		0.338	XRCC4-003	NOVEL	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000369624.1	NM_022550		10	110	0	0	0	0	10	110				
APC	324	broad.mit.edu	37	5	112175987	112175987	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr5:112175987G>T	ENST00000457016.1	+	16	5076	c.4696G>T	c.(4696-4698)Gat>Tat	p.D1566Y	APC_ENST00000508376.2_Missense_Mutation_p.D1566Y|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Missense_Mutation_p.D1566Y			P25054	APC_HUMAN	adenomatous polyposis coli	1566	Asp/Glu-rich (acidic).|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.D1566N(1)|p.K1192fs*3(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		CCTATTAGATGATTCAGATGA	0.363		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	uc010jby.2		12	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	D|Mis|N|F|S	adenomatous polyposis of the colon gene			"""E, M, O"""		colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS	colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS		3	Substitution - Missense(1)|Unknown(1)|Deletion - Frameshift(1)	p.K1192fs*3(1)|p.?(1)	large_intestine(1)|soft_tissue(1)|skin(1)	large_intestine(2123)|stomach(123)|soft_tissue(55)|small_intestine(34)|breast(26)|pancreas(25)|urinary_tract(20)|lung(19)|thyroid(18)|liver(13)|central_nervous_system(10)|ovary(9)|skin(7)|upper_aerodigestive_tract(6)|adrenal_gland(6)|bone(6)|NS(5)|prostate(4)|endometrium(3)|kidney(1)|oesophagus(1)|biliary_tract(1)	2515						c.(4696-4698)GAT>TAT		adenomatous polyposis coli							89.0	96.0	94.0					5																	112175987		2202	4300	6502	SO:0001583	missense	324	Hereditary_Desmoid_Disease|Familial_Adenomatous_Polyposis|Turcot_syndrome	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	canonical Wnt receptor signaling pathway|cell adhesion|cell cycle arrest|cell migration|cellular component disassembly involved in apoptosis|cytokinesis after mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|negative regulation of microtubule depolymerization|positive regulation of apoptosis|positive regulation of cell migration|positive regulation of pseudopodium assembly|protein complex assembly|regulation of attachment of spindle microtubules to kinetochore|response to DNA damage stimulus|tight junction assembly	adherens junction|APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|kinetochore|lamellipodium|lateral plasma membrane|nucleus|ruffle membrane|tight junction	beta-catenin binding|gamma-catenin binding|microtubule plus-end binding|protein kinase binding|protein kinase regulator activity	g.chr5:112175987G>T	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4696G>T	5.37:g.112175987G>T	ENSP00000413133:p.Asp1566Tyr	TSP Lung(16;0.13)	Somatic				APC_uc011cvt.1_Missense_Mutation_p.D1548Y|APC_uc003kpz.3_Missense_Mutation_p.D1566Y|APC_uc003kpy.3_Missense_Mutation_p.D1566Y|APC_uc010jbz.2_Missense_Mutation_p.D1283Y|APC_uc010jca.2_Missense_Mutation_p.D866Y	p.D1566Y	NM_001127511	NP_001120983	WXS	Illumina HiSeq	Unspecified	P25054	APC_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)	16	5076	+		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)	1566			Ser-rich.|Asp/Glu-rich (acidic).		D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	ENST00000457016.1	37	c.4696G>T	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	G	19.93	3.917577	0.73098	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	D;D;D	0.90261	-2.64;-2.64;-2.64	6.16	6.16	0.99307	.	0.088233	0.85682	D	0.000000	D	0.92893	0.7739	L	0.60455	1.87	0.80722	D	1	P;D	0.59767	0.95;0.986	P;P	0.53722	0.458;0.733	D	0.91211	0.4999	9	.	.	.	-16.1415	20.8598	0.99761	0.0:0.0:1.0:0.0	.	1568;1566	Q4LE70;P25054	.;APC_HUMAN	Y	1566	ENSP00000413133:D1566Y;ENSP00000257430:D1566Y;ENSP00000427089:D1566Y	.	D	+	1	0	APC	112203886	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.476000	0.97823	2.937000	0.99478	0.650000	0.86243	GAT		0.363	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038		12	83	1	0	0.00010058	0.000106523	12	83				
GRAMD3	65983	broad.mit.edu	37	5	125821386	125821386	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr5:125821386G>C	ENST00000285689.3	+	11	1440	c.979G>C	c.(979-981)Gaa>Caa	p.E327Q	GRAMD3_ENST00000515200.1_Missense_Mutation_p.E305Q|GRAMD3_ENST00000542322.1_Missense_Mutation_p.E335Q|GRAMD3_ENST00000511134.1_Missense_Mutation_p.E311Q|GRAMD3_ENST00000502348.1_Missense_Mutation_p.E218Q|GRAMD3_ENST00000544396.1_Missense_Mutation_p.E223Q|GRAMD3_ENST00000543198.1_Missense_Mutation_p.E305Q|RP11-517I3.1_ENST00000515808.1_RNA|RP11-517I3.1_ENST00000512500.1_RNA|GRAMD3_ENST00000513040.1_Missense_Mutation_p.E342Q	NM_023927.2	NP_076416.2	Q96HH9	GRAM3_HUMAN	GRAM domain containing 3	327						cytoplasmic microtubule (GO:0005881)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		Prostate(80;0.0928)	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0401)|OV - Ovarian serous cystadenocarcinoma(64;0.0604)|all cancers(49;0.108)		AGGTCTGTCAGAAACTGTTGG	0.353																																						uc003ktu.2		NA																	0				central_nervous_system(1)	1						c.(979-981)GAA>CAA		GRAM domain containing 3 isoform 2							119.0	111.0	114.0					5																	125821386		2203	4300	6503	SO:0001583	missense	65983							g.chr5:125821386G>C	BC008590	CCDS4136.1, CCDS54891.1, CCDS54892.1, CCDS54893.1, CCDS54894.1	5q23.2	2014-02-12	2005-11-03		ENSG00000155324	ENSG00000155324			24911	protein-coding gene	gene with protein product	"""HCV NS3 transactivated protein 2"""					12477932	Standard	NM_023927		Approved	NS3TP2, FLJ21313	uc011cwt.2	Q96HH9	OTTHUMG00000128943	ENST00000285689.3:c.979G>C	5.37:g.125821386G>C	ENSP00000285689:p.Glu327Gln		Somatic				GRAMD3_uc011cwt.1_Missense_Mutation_p.E342Q|GRAMD3_uc011cwv.1_Missense_Mutation_p.E335Q|GRAMD3_uc011cww.1_Missense_Mutation_p.E223Q|GRAMD3_uc011cwx.1_RNA|GRAMD3_uc011cwy.1_Missense_Mutation_p.E218Q|GRAMD3_uc011cwz.1_Missense_Mutation_p.E311Q	p.E327Q	NM_023927	NP_076416	WXS	Illumina HiSeq	Unspecified	Q96HH9	GRAM3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0401)|OV - Ovarian serous cystadenocarcinoma(64;0.0604)|all cancers(49;0.108)	11	1409	+		Prostate(80;0.0928)	327					B7Z1F2|B7Z3R1|B7Z6D8|B7Z8T2|D3DSZ3|Q9H753	Missense_Mutation	SNP	ENST00000285689.3	37	c.979G>C	CCDS4136.1	.	.	.	.	.	.	.	.	.	.	G	14.68	2.607393	0.46527	.	.	ENSG00000155324	ENST00000513040;ENST00000285689;ENST00000515200;ENST00000542322;ENST00000544396;ENST00000543198;ENST00000502348;ENST00000511134	T;T;T;T;T;T;T;T	0.35048	1.33;1.34;1.35;1.34;1.39;1.36;1.39;1.36	6.07	5.2	0.72013	.	0.541856	0.22355	N	0.061150	T	0.39835	0.1093	M	0.62723	1.935	0.31029	N	0.717691	B;P;B;P;B	0.51791	0.319;0.948;0.373;0.947;0.319	B;B;B;P;B	0.45660	0.03;0.391;0.122;0.489;0.03	T	0.42103	-0.9471	10	0.25106	T	0.35	.	13.6706	0.62422	0.0728:0.0:0.9272:0.0	.	311;223;335;342;327	B7Z8T2;B7Z1F2;B7Z3R1;B7Z6D8;Q96HH9	.;.;.;.;GRAM3_HUMAN	Q	342;327;305;335;223;305;218;311	ENSP00000426120:E342Q;ENSP00000285689:E327Q;ENSP00000426143:E305Q;ENSP00000441876:E335Q;ENSP00000444049:E223Q;ENSP00000442902:E305Q;ENSP00000427596:E218Q;ENSP00000426088:E311Q	ENSP00000285689:E327Q	E	+	1	0	GRAMD3	125849285	1.000000	0.71417	1.000000	0.80357	0.705000	0.40729	4.410000	0.59774	2.885000	0.99019	0.655000	0.94253	GAA		0.353	GRAMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250922.2	NM_023927		6	60	0	0	0	0	6	60				
RAD50	10111	broad.mit.edu	37	5	131953875	131953875	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr5:131953875G>A	ENST00000265335.6	+	21	3665	c.3278G>A	c.(3277-3279)cGa>cAa	p.R1093Q	RAD50_ENST00000378823.3_Missense_Mutation_p.R954Q			Q92878	RAD50_HUMAN	RAD50 homolog (S. cerevisiae)	1093					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	membrane (GO:0016020)|Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|nuclease activity (GO:0004518)|protein binding, bridging (GO:0030674)|zinc ion binding (GO:0008270)			breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AAAGAACTTCGAGAACCACAA	0.323								Homologous recombination																														uc003kxi.2		NA																	0				lung(2)|ovary(1)|skin(1)	4						c.(3277-3279)CGA>CAA	Homologous_recombination	RAD50 homolog isoform 1							113.0	129.0	123.0					5																	131953875		2203	4299	6502	SO:0001583	missense	10111				DNA duplex unwinding|double-strand break repair via homologous recombination|positive regulation of kinase activity|positive regulation of protein autophosphorylation|reciprocal meiotic recombination|regulation of mitotic recombination|telomere maintenance via telomerase	Mre11 complex|nuclear chromosome, telomeric region|nucleoplasm	ATP binding|DNA binding|nuclease activity|protein binding, bridging|zinc ion binding	g.chr5:131953875G>A	Z75311	CCDS34233.1	5q23-q31	2008-05-30	2001-11-28		ENSG00000113522	ENSG00000113522			9816	protein-coding gene	gene with protein product		604040	"""RAD50 (S. cerevisiae) homolog"""			8756642, 9705271	Standard	NM_005732		Approved	hRad50, RAD50-2	uc003kxi.3	Q92878	OTTHUMG00000059613	ENST00000265335.6:c.3278G>A	5.37:g.131953875G>A	ENSP00000265335:p.Arg1093Gln		Somatic				RAD50_uc003kxh.2_Missense_Mutation_p.R954Q	p.R1093Q	NM_005732	NP_005723	WXS	Illumina HiSeq	Unspecified	Q92878	RAD50_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		21	3665	+		all_cancers(142;0.0368)|Breast(839;0.198)	1093					B9EGF5|O43254|Q6GMT7|Q6P5X3|Q9UP86	Missense_Mutation	SNP	ENST00000265335.6	37	c.3278G>A	CCDS34233.1	.	.	.	.	.	.	.	.	.	.	G	17.12	3.307952	0.60305	.	.	ENSG00000113522	ENST00000378823;ENST00000265335	T;T	0.05258	3.47;3.7	5.4	3.62	0.41486	.	0.143232	0.48286	D	0.000186	T	0.04770	0.0129	L	0.27053	0.805	0.41967	D	0.990738	B	0.30021	0.265	B	0.26310	0.068	T	0.45614	-0.9249	10	0.15952	T	0.53	-5.1738	12.2807	0.54762	0.1386:0.0:0.8614:0.0	.	1093	Q92878	RAD50_HUMAN	Q	954;1093	ENSP00000368100:R954Q;ENSP00000265335:R1093Q	ENSP00000265335:R1093Q	R	+	2	0	RAD50	131981774	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.109000	0.57824	0.768000	0.33290	0.655000	0.94253	CGA		0.323	RAD50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132566.5	NM_005732		32	187	0	0	0	0	32	187				
PCDH1	5097	broad.mit.edu	37	5	141244811	141244811	+	Missense_Mutation	SNP	C	C	T	rs200086291	byFrequency	TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr5:141244811C>T	ENST00000394536.3	-	3	1224	c.1085G>A	c.(1084-1086)cGa>cAa	p.R362Q	PCDH1_ENST00000456271.1_Missense_Mutation_p.R350Q|PCDH1_ENST00000503492.1_Intron|PCDH1_ENST00000287008.3_Missense_Mutation_p.R362Q|PCDH1_ENST00000536585.1_Missense_Mutation_p.R340Q|PCDH1_ENST00000511044.1_5'UTR	NM_001278613.1|NM_001278615.1	NP_001265542.1|NP_001265544.1	Q08174	PCDH1_HUMAN	protocadherin 1	362	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		GTTGGTGCCTCGGTCCTTAGC	0.582													C|||	3	0.000599042	0.0	0.0	5008	,	,		20482	0.0		0.003	False		,,,				2504	0.0				Ovarian(132;1609 1739 4190 14731 45037)	uc003llq.2		NA																	0				ovary(5)	5						c.(1084-1086)CGA>CAA		protocadherin 1 isoform 1 precursor		C	GLN/ARG,GLN/ARG	0,4406		0,0,2203	120.0	113.0	116.0		1085,1085	5.3	1.0	5		116	5,8595	4.3+/-15.6	0,5,4295	yes	missense,missense	PCDH1	NM_002587.3,NM_032420.2	43,43	0,5,6498	TT,TC,CC		0.0581,0.0,0.0384	possibly-damaging,possibly-damaging	362/1061,362/1238	141244811	5,13001	2203	4300	6503	SO:0001583	missense	5097				cell-cell signaling|homophilic cell adhesion|nervous system development	cell-cell junction|integral to plasma membrane	calcium ion binding	g.chr5:141244811C>T	AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000394536.3:c.1085G>A	5.37:g.141244811C>T	ENSP00000378043:p.Arg362Gln		Somatic				PCDH1_uc003llp.2_Missense_Mutation_p.R362Q|PCDH1_uc011dbf.1_Missense_Mutation_p.R340Q	p.R362Q	NM_002587	NP_002578	WXS	Illumina HiSeq	Unspecified	Q08174	PCDH1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)	3	1202	-		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	362			Extracellular (Potential).|Cadherin 3.		Q8IUP2	Missense_Mutation	SNP	ENST00000394536.3	37	c.1085G>A	CCDS43375.1	3	0.0013736263736263737	0	0.0	0	0.0	0	0.0	3	0.00395778364116095	c	16.94	3.260885	0.59431	0.0	5.81E-4	ENSG00000156453	ENST00000287008;ENST00000394536;ENST00000456271;ENST00000357517;ENST00000536585	T;T;T;T;T	0.51325	0.71;0.71;0.71;0.71;0.71	5.35	5.35	0.76521	Cadherin (4);Cadherin-like (1);	0.206931	0.23937	N	0.043096	T	0.31451	0.0797	N	0.20807	0.61	0.36395	D	0.862776	P;P	0.50710	0.816;0.938	B;B	0.41764	0.366;0.25	T	0.23261	-1.0193	10	0.31617	T	0.26	.	9.9224	0.41472	0.0:0.9104:0.0:0.0896	.	362;362	Q08174;Q08174-2	PCDH1_HUMAN;.	Q	362;362;350;373;340	ENSP00000287008:R362Q;ENSP00000378043:R362Q;ENSP00000403497:R350Q;ENSP00000350122:R373Q;ENSP00000438825:R340Q	ENSP00000287008:R362Q	R	-	2	0	PCDH1	141224995	0.940000	0.31905	1.000000	0.80357	0.989000	0.77384	1.587000	0.36622	2.804000	0.96469	0.645000	0.84053	CGA		0.582	PCDH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251862.1	NM_032420		14	102	0	0	0	0	14	102				
KIAA0141	9812	broad.mit.edu	37	5	141307791	141307791	+	Missense_Mutation	SNP	C	C	T	rs372014031		TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr5:141307791C>T	ENST00000432126.2	+	4	474	c.340C>T	c.(340-342)Cgg>Tgg	p.R114W	KIAA0141_ENST00000194118.4_Missense_Mutation_p.R114W	NM_001142603.1|NM_014773.3	NP_001136075.1|NP_055588.3	Q14154	DELE_HUMAN	KIAA0141	114					extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	mitochondrion (GO:0005739)				endometrium(3)|large_intestine(4)|lung(5)|skin(1)|urinary_tract(3)	16		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGACCTCAGCGGGTAGAACA	0.612																																						uc003lls.2		NA																	0				skin(1)	1						c.(340-342)CGG>TGG		hypothetical protein LOC9812 precursor		C	TRP/ARG,TRP/ARG	0,4406		0,0,2203	103.0	94.0	97.0		340,340	3.7	0.0	5		97	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	KIAA0141	NM_001142603.1,NM_014773.3	101,101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	114/516,114/516	141307791	1,13005	2203	4300	6503	SO:0001583	missense	9812				apoptosis|regulation of caspase activity	mitochondrion	protein binding	g.chr5:141307791C>T	BC011269	CCDS4268.1	5q31	2011-05-05			ENSG00000081791	ENSG00000081791			28969	protein-coding gene	gene with protein product	"""death ligand signal enhancer"""	615741				20563667	Standard	XM_005268549		Approved	DELE	uc003llt.3	Q14154	OTTHUMG00000129662	ENST00000432126.2:c.340C>T	5.37:g.141307791C>T	ENSP00000396225:p.Arg114Trp		Somatic				KIAA0141_uc003llt.2_Missense_Mutation_p.R114W	p.R114W	NM_001142603	NP_001136075	WXS	Illumina HiSeq	Unspecified	Q14154	DELE_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		4	462	+		all_hematologic(541;0.118)	114					Q969R4|Q96EU9	Missense_Mutation	SNP	ENST00000432126.2	37	c.340C>T	CCDS4268.1	.	.	.	.	.	.	.	.	.	.	C	13.13	2.144372	0.37825	0.0	1.16E-4	ENSG00000081791	ENST00000432126;ENST00000194118;ENST00000508751	T;T;T	0.23147	2.5;2.5;1.92	5.62	3.72	0.42706	.	0.860890	0.10023	N	0.725728	T	0.22859	0.0552	L	0.47716	1.5	0.09310	N	1	D	0.56287	0.975	B	0.40565	0.333	T	0.14727	-1.0462	10	0.66056	D	0.02	0.9978	8.0461	0.30551	0.1566:0.7577:0.0:0.0857	.	114	Q14154	DELE_HUMAN	W	114	ENSP00000396225:R114W;ENSP00000194118:R114W;ENSP00000422686:R114W	ENSP00000194118:R114W	R	+	1	2	KIAA0141	141287975	0.000000	0.05858	0.004000	0.12327	0.276000	0.26787	0.209000	0.17435	1.487000	0.48415	0.555000	0.69702	CGG		0.612	KIAA0141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251863.2	NM_014773		11	67	0	0	0	0	11	67				
ZNF300	91975	broad.mit.edu	37	5	150276107	150276107	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr5:150276107C>G	ENST00000274599.5	-	6	1114	c.694G>C	c.(694-696)Gag>Cag	p.E232Q	ZNF300_ENST00000446148.2_Missense_Mutation_p.E248Q|ZNF300_ENST00000427179.1_3'UTR|ZNF300_ENST00000394226.2_Missense_Mutation_p.E232Q|ZNF300_ENST00000418587.2_Missense_Mutation_p.E196Q	NM_052860.2	NP_443092.1	Q96RE9	ZN300_HUMAN	zinc finger protein 300	232					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)	27		Medulloblastoma(196;0.109)|all_hematologic(541;0.131)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGAATCTTCTCAAGATTAGAA	0.353																																						uc003lsy.1		NA																	0				ovary(1)|skin(1)	2						c.(694-696)GAG>CAG		zinc finger protein 300							83.0	87.0	86.0					5																	150276107		2202	4298	6500	SO:0001583	missense	91975				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr5:150276107C>G	AF395541	CCDS4311.2, CCDS54939.1, CCDS54940.1	5q33.1	2013-01-08			ENSG00000145908	ENSG00000145908		"""Zinc fingers, C2H2-type"", ""-"""	13091	protein-coding gene	gene with protein product		612429				14746915	Standard	NM_052860		Approved		uc021yfx.1	Q96RE9	OTTHUMG00000130076	ENST00000274599.5:c.694G>C	5.37:g.150276107C>G	ENSP00000274599:p.Glu232Gln		Somatic				IRGM_uc011dcl.1_Intron	p.E232Q	NM_052860	NP_443092	WXS	Illumina HiSeq	Unspecified	Q96RE9	ZN300_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		6	961	-		Medulloblastoma(196;0.109)|all_hematologic(541;0.131)	232					A8MY91|B3KU35|B4DU78|F5GWS1|Q06DQ3|Q17RP3|Q5H9N5	Missense_Mutation	SNP	ENST00000274599.5	37	c.694G>C	CCDS4311.2	.	.	.	.	.	.	.	.	.	.	C	7.152	0.583904	0.13749	.	.	ENSG00000145908	ENST00000446148;ENST00000274599;ENST00000418587;ENST00000394226	T;T;T;T	0.08634	3.15;3.15;3.07;3.15	3.04	2.15	0.27550	.	.	.	.	.	T	0.03477	0.0100	N	0.08118	0	0.09310	N	1	B	0.14012	0.009	B	0.12156	0.007	T	0.43343	-0.9397	9	0.02654	T	1	.	8.1018	0.30861	0.0:0.7504:0.2496:0.0	.	232	Q96RE9	ZN300_HUMAN	Q	248;232;196;232	ENSP00000397178:E248Q;ENSP00000274599:E232Q;ENSP00000392593:E196Q;ENSP00000377773:E232Q	ENSP00000274599:E232Q	E	-	1	0	ZNF300	150256300	0.000000	0.05858	0.868000	0.34077	0.691000	0.40173	0.450000	0.21762	0.831000	0.34780	0.557000	0.71058	GAG		0.353	ZNF300-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_052860		22	121	0	0	0	0	22	121				
KIF4B	285643	broad.mit.edu	37	5	154393495	154393495	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr5:154393495G>A	ENST00000435029.4	+	1	236	c.76G>A	c.(76-78)Gag>Aag	p.E26K		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	26	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			AGAGATTAGCGAGGGCTGCCA	0.522																																						uc010jih.1		NA																	0				ovary(1)	1						c.(76-78)GAG>AAG		kinesin family member 4B							120.0	111.0	114.0					5																	154393495		2203	4300	6503	SO:0001583	missense	285643				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity	g.chr5:154393495G>A	AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.76G>A	5.37:g.154393495G>A	ENSP00000387875:p.Glu26Lys		Somatic					p.E26K	NM_001099293	NP_001092763	WXS	Illumina HiSeq	Unspecified	Q2VIQ3	KIF4B_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)		1	236	+	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	26			Kinesin-motor.			Missense_Mutation	SNP	ENST00000435029.4	37	c.76G>A	CCDS47324.1	.	.	.	.	.	.	.	.	.	.	g	16.48	3.134097	0.56828	.	.	ENSG00000226650	ENST00000435029	T	0.74842	-0.88	1.48	1.48	0.22813	Kinesin, motor domain (4);	.	.	.	.	T	0.66867	0.2833	L	0.34521	1.04	0.53688	D	0.999975	P	0.47762	0.9	P	0.48738	0.588	T	0.64002	-0.6509	9	0.39692	T	0.17	.	8.8832	0.35387	0.0:0.0:1.0:0.0	.	26	Q2VIQ3	KIF4B_HUMAN	K	26	ENSP00000387875:E26K	ENSP00000387875:E26K	E	+	1	0	KIF4B	154373688	0.998000	0.40836	0.979000	0.43373	0.949000	0.60115	3.539000	0.53604	1.138000	0.42230	0.563000	0.77884	GAG		0.522	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377478.1			22	44	0	0	0	0	22	44				
GABRB2	2561	broad.mit.edu	37	5	160721121	160721121	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr5:160721121G>C	ENST00000393959.1	-	10	1505	c.1506C>G	c.(1504-1506)ttC>ttG	p.F502L	GABRB2_ENST00000520240.1_Missense_Mutation_p.F464L|GABRB2_ENST00000274547.2_Missense_Mutation_p.F502L|GABRB2_ENST00000517547.1_Missense_Mutation_p.F304L|GABRB2_ENST00000353437.6_Missense_Mutation_p.F464L|GABRB2_ENST00000517901.1_Missense_Mutation_p.F401L			P47870	GBRB2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 2	502					cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|GABA-A receptor activity (GO:0004890)|inhibitory extracellular ligand-gated ion channel activity (GO:0005237)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(9)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	26	Renal(175;0.00259)	Medulloblastoma(196;0.021)|all_neural(177;0.0463)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	AGACGATGTTGAAGAAGGAAA	0.468																																						uc003lys.1		NA																	0					0						c.(1504-1506)TTC>TTG		gamma-aminobutyric acid (GABA) A receptor, beta	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)						125.0	122.0	123.0					5																	160721121		2203	4300	6503	SO:0001583	missense	2561				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|GABA-A receptor activity	g.chr5:160721121G>C		CCDS4354.1, CCDS4355.1	5q34	2012-06-22			ENSG00000145864	ENSG00000145864		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4082	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 2"""	600232				7851879	Standard	NM_000813		Approved		uc003lys.1	P47870	OTTHUMG00000130349	ENST00000393959.1:c.1506C>G	5.37:g.160721121G>C	ENSP00000377531:p.Phe502Leu		Somatic				GABRB2_uc011deh.1_Missense_Mutation_p.F303L|GABRB2_uc003lyr.1_Missense_Mutation_p.F464L|GABRB2_uc003lyt.1_Missense_Mutation_p.F464L|GABRB2_uc010jiu.1_Missense_Mutation_p.F401L	p.F502L	NM_021911	NP_068711	WXS	Illumina HiSeq	Unspecified	P47870	GBRB2_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		11	1724	-	Renal(175;0.00259)	Medulloblastoma(196;0.021)|all_neural(177;0.0463)	502			Helical; (Probable).		A8K115|A8K1A0|D1LYT0|D1LYT1|Q16323|Q4FZB2	Missense_Mutation	SNP	ENST00000393959.1	37	c.1506C>G	CCDS4355.1	.	.	.	.	.	.	.	.	.	.	G	34	5.348557	0.95807	.	.	ENSG00000145864	ENST00000393959;ENST00000274547;ENST00000353437;ENST00000520240;ENST00000517901;ENST00000517547	D;D;D;D;D;D	0.87729	-2.29;-2.29;-2.29;-2.29;-2.29;-2.29	5.75	5.75	0.90469	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.92622	0.7656	L	0.59967	1.855	0.80722	D	1	D;D;D;D	0.89917	0.963;0.995;1.0;0.994	D;D;D;D	0.91635	0.966;0.951;0.999;0.944	D	0.92032	0.5634	10	0.52906	T	0.07	.	19.9447	0.97177	0.0:0.0:1.0:0.0	.	304;401;502;464	B7Z279;E7EV50;P47870;P47870-1	.;.;GBRB2_HUMAN;.	L	502;502;464;464;401;304	ENSP00000377531:F502L;ENSP00000274547:F502L;ENSP00000274546:F464L;ENSP00000429320:F464L;ENSP00000430532:F401L;ENSP00000429750:F304L	ENSP00000274547:F502L	F	-	3	2	GABRB2	160653699	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.600000	0.67599	2.719000	0.93026	0.655000	0.94253	TTC		0.468	GABRB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252704.1			7	55	0	0	0	0	7	55				
FGFR4	2264	broad.mit.edu	37	5	176519745	176519745	+	Silent	SNP	C	C	T	rs375390888		TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr5:176519745C>T	ENST00000292408.4	+	8	1262	c.1017C>T	c.(1015-1017)atC>atT	p.I339I	FGFR4_ENST00000292410.3_Silent_p.I339I|FGFR4_ENST00000393637.1_Silent_p.I339I|FGFR4_ENST00000393648.2_Silent_p.I339I|FGFR4_ENST00000502906.1_Silent_p.I339I	NM_002011.3|NM_213647.1	NP_002002.3|NP_998812.1	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4	339	Ig-like C2-type 3.				alveolar secondary septum development (GO:0061144)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphate ion homeostasis (GO:0055062)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of proteolysis (GO:0045862)|protein autophosphorylation (GO:0046777)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cholesterol homeostasis (GO:2000188)|regulation of extracellular matrix disassembly (GO:0010715)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	34	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)|Ponatinib(DB08901)	GCAATTCCATCGGCCTCTCCT	0.632										TSP Lung(9;0.080)																												uc003mfl.2		NA																	0				lung(11)|stomach(1)|central_nervous_system(1)|breast(1)|skin(1)|prostate(1)	16						c.(1015-1017)ATC>ATT		fibroblast growth factor receptor 4 isoform 1	Palifermin(DB00039)	C	,,	0,4406		0,0,2203	64.0	60.0	62.0		1017,1017,1017	-1.5	1.0	5		62	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	FGFR4	NM_002011.3,NM_022963.2,NM_213647.1	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	339/803,339/763,339/803	176519745	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	2264				insulin receptor signaling pathway|positive regulation of cell proliferation	integral to plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor receptor activity	g.chr5:176519745C>T	AF202063	CCDS4410.1, CCDS4411.1	5q35.2	2013-09-19			ENSG00000160867	ENSG00000160867		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3691	protein-coding gene	gene with protein product		134935					Standard	XM_005265837		Approved	JTK2, CD334	uc003mfm.3	P22455	OTTHUMG00000151523	ENST00000292408.4:c.1017C>T	5.37:g.176519745C>T		TSP Lung(9;0.080)	Somatic				FGFR4_uc003mfm.2_Silent_p.I339I|FGFR4_uc011dfu.1_Silent_p.I339I|FGFR4_uc011dfw.1_Silent_p.I339I|FGFR4_uc003mfo.2_Silent_p.I339I	p.I339I	NM_002011	NP_002002	WXS	Illumina HiSeq	Unspecified	P22455	FGFR4_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		8	1184	+	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	339			Extracellular (Potential).|Ig-like C2-type 3.		G3JVM2|G3JVM5|G3JVM7|G3JVM9|O43785|Q14309|Q71TW8|Q8TDA0|Q96KE5	Silent	SNP	ENST00000292408.4	37	c.1017C>T	CCDS4410.1																																																																																				0.632	FGFR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253410.1			4	52	0	0	0	0	4	52				
RGS14	10636	broad.mit.edu	37	5	176794747	176794747	+	Silent	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr5:176794747G>A	ENST00000408923.3	+	7	848	c.660G>A	c.(658-660)ccG>ccA	p.P220P		NM_006480.4	NP_006471.2	O43566	RGS14_HUMAN	regulator of G-protein signaling 14	220					cell division (GO:0051301)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mitotic nuclear division (GO:0007067)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of synaptic plasticity (GO:0031914)|nucleocytoplasmic transport (GO:0006913)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neurogenesis (GO:0050769)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to oxidative stress (GO:0006979)|spindle organization (GO:0007051)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual learning (GO:0008542)|zygote asymmetric cell division (GO:0010070)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|microtubule (GO:0005874)|nuclear body (GO:0016604)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|spindle (GO:0005819)|spindle pole (GO:0000922)	GDP-dissociation inhibitor activity (GO:0005092)|GTPase activator activity (GO:0005096)|microtubule binding (GO:0008017)|receptor signaling complex scaffold activity (GO:0030159)|receptor signaling protein activity (GO:0005057)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|skin(3)|upper_aerodigestive_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGTCGCTGCCGCTGGGTGTGG	0.711																																					NSCLC(47;353 1896 28036)	uc003mgf.2		NA																	0				lung(1)	1						c.(658-660)CCG>CCA		regulator of G-protein signalling 14							22.0	33.0	30.0					5																	176794747		1962	4129	6091	SO:0001819	synonymous_variant	10636				chromosome segregation|long-term memory|long-term synaptic potentiation|negative regulation of ERK1 and ERK2 cascade|negative regulation of MAP kinase activity|negative regulation of synaptic plasticity|nucleocytoplasmic transport|platelet-derived growth factor receptor signaling pathway|positive regulation of neurogenesis|regulation of DNA-dependent transcription in response to stress|regulation of G-protein coupled receptor protein signaling pathway|response to oxidative stress|spindle organization|visual learning|zygote asymmetric cell division	cell junction|centrosome|dendritic spine|microtubule|PML body|postsynaptic density|postsynaptic membrane|spindle pole	GDP-dissociation inhibitor activity|GTPase activator activity|microtubule binding|receptor signaling complex scaffold activity|receptor signaling protein activity	g.chr5:176794747G>A	AF037195	CCDS43405.1	5q35.3	2008-02-05	2007-08-14		ENSG00000169220	ENSG00000169220		"""Regulators of G-protein signaling"""	9996	protein-coding gene	gene with protein product		602513	"""regulator of G-protein signalling 14"""				Standard	NM_006480		Approved		uc003mgf.3	O43566	OTTHUMG00000163324	ENST00000408923.3:c.660G>A	5.37:g.176794747G>A			Somatic				RGS14_uc003mgg.1_Silent_p.P67P|RGS14_uc003mgh.2_Silent_p.P67P|RGS14_uc003mgi.2_5'UTR	p.P220P	NM_006480	NP_006471	WXS	Illumina HiSeq	Unspecified	O43566	RGS14_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		7	842	+	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	220					O43565|Q506M1|Q6ZWA4|Q8TD62	Silent	SNP	ENST00000408923.3	37	c.660G>A	CCDS43405.1	.	.	.	.	.	.	.	.	.	.	G	11.50	1.658173	0.29425	.	.	ENSG00000169220	ENST00000511890	.	.	.	3.83	-6.36	0.01969	.	.	.	.	.	T	0.34048	0.0884	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40701	-0.9549	4	.	.	.	-27.0072	0.3654	0.00371	0.3164:0.2229:0.1263:0.3344	.	.	.	.	H	90	.	.	R	+	2	0	RGS14	176727353	0.000000	0.05858	0.902000	0.35471	0.878000	0.50629	-2.421000	0.01031	-1.063000	0.03177	0.462000	0.41574	CGC		0.711	RGS14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372676.1	NM_006480		6	34	0	0	0	0	6	34				
NUP153	9972	broad.mit.edu	37	6	17637953	17637953	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr6:17637953G>C	ENST00000262077.2	-	16	1894	c.1895C>G	c.(1894-1896)aCa>aGa	p.T632R	NUP153_ENST00000537253.1_Missense_Mutation_p.T663R	NM_005124.2	NP_005115.2	P49790	NU153_HUMAN	nucleoporin 153kDa	632					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of RNA export from nucleus (GO:0046832)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleocytoplasmic transporter activity (GO:0005487)|protein anchor (GO:0043495)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			NS(2)|breast(6)|endometrium(4)|kidney(3)|large_intestine(7)|lung(23)|ovary(3)|skin(3)|urinary_tract(2)	53	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			TACTGGGCTTGTTGCGGTGGG	0.438																																						uc003ncd.1		NA																	0				lung(4)|ovary(2)|breast(2)|skin(1)	9						c.(1894-1896)ACA>AGA		nucleoporin 153kDa							103.0	97.0	99.0					6																	17637953		2203	4300	6503	SO:0001583	missense	9972				carbohydrate metabolic process|glucose transport|interspecies interaction between organisms|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleolus|nucleoplasm	DNA binding|protein binding|transporter activity|zinc ion binding	g.chr6:17637953G>C	Z25535	CCDS4541.1, CCDS64359.1, CCDS75407.1	6p22.3	2008-07-29	2002-08-29		ENSG00000124789	ENSG00000124789			8062	protein-coding gene	gene with protein product		603948	"""nucleoporin 153kD"""			8110839	Standard	NM_001278209		Approved	HNUP153	uc003ncd.2	P49790	OTTHUMG00000014312	ENST00000262077.2:c.1895C>G	6.37:g.17637953G>C	ENSP00000262077:p.Thr632Arg		Somatic				NUP153_uc011dje.1_Missense_Mutation_p.T663R|NUP153_uc010jpl.1_Missense_Mutation_p.T590R	p.T632R	NM_005124	NP_005115	WXS	Illumina HiSeq	Unspecified	P49790	NU153_HUMAN	all cancers(50;0.0981)|Epithelial(50;0.112)		16	2095	-	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	632					B4DIK2|E7EPX5|F6QR24|Q4LE47|Q5T9I7|Q7Z743	Missense_Mutation	SNP	ENST00000262077.2	37	c.1895C>G	CCDS4541.1	.	.	.	.	.	.	.	.	.	.	G	13.52	2.262255	0.39995	.	.	ENSG00000124789	ENST00000262077;ENST00000430136;ENST00000537253	T;T	0.32023	1.47;1.47	5.34	5.34	0.76211	Nucleoporin, Nup153-like (1);	0.000000	0.53938	D	0.000060	T	0.28632	0.0709	N	0.20986	0.625	0.44048	D	0.996783	P;D;P	0.76494	0.611;0.999;0.668	B;D;B	0.73708	0.16;0.981;0.333	T	0.04216	-1.0968	10	0.28530	T	0.3	-10.6033	14.6292	0.68643	0.0:0.1455:0.8545:0.0	.	663;612;632	F6QR24;Q4LE47;P49790	.;.;NU153_HUMAN	R	632;612;663	ENSP00000262077:T632R;ENSP00000444029:T663R	ENSP00000262077:T632R	T	-	2	0	NUP153	17745932	1.000000	0.71417	0.990000	0.47175	0.948000	0.59901	2.845000	0.48254	2.464000	0.83262	0.655000	0.94253	ACA		0.438	NUP153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039953.1			10	80	0	0	0	0	10	80				
HIST1H2BF	8343	broad.mit.edu	37	6	26200015	26200015	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr6:26200015G>A	ENST00000359985.1	+	1	268	c.229G>A	c.(229-231)Gag>Aag	p.E77K	HIST1H2AD_ENST00000341023.1_5'Flank|HIST1H3D_ENST00000356476.2_5'Flank|HIST1H3D_ENST00000377831.5_5'Flank	NM_003522.3	NP_003513.1	P62807	H2B1C_HUMAN	histone cluster 1, H2bf	77					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.E77K(3)		haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|liver(2)|lung(7)|upper_aerodigestive_tract(3)	17		all_hematologic(11;0.196)				CATCGCTGGCGAGGCTTCCCG	0.612																																						uc003ngx.2		NA																	3	Substitution - Missense(3)		upper_aerodigestive_tract(2)|lung(1)		0						c.(229-231)GAG>AAG		histone cluster 1, H2bf							143.0	137.0	139.0					6																	26200015		2203	4300	6503	SO:0001583	missense	8343				defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding	g.chr6:26200015G>A	Z80779	CCDS4592.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197846	ENSG00000277224		"""Histones / Replication-dependent"""	4752	protein-coding gene	gene with protein product		602804	"""H2B histone family, member G"", ""histone 1, H2bf"""	H2BFG		9119399, 12408966	Standard	NM_003522		Approved	H2B/g	uc003ngx.3	P62807	OTTHUMG00000014445	ENST00000359985.1:c.229G>A	6.37:g.26200015G>A	ENSP00000353074:p.Glu77Lys		Somatic				HIST1H3D_uc003ngv.2_5'Flank|HIST1H2AD_uc003ngw.2_5'Flank	p.E77K	NM_003522	NP_003513	WXS	Illumina HiSeq	Unspecified	P62807	H2B1C_HUMAN			1	229	+		all_hematologic(11;0.196)	77					P02278|Q3B872|Q4VB69|Q93078|Q93080	Missense_Mutation	SNP	ENST00000359985.1	37	c.229G>A	CCDS4592.1	.	.	.	.	.	.	.	.	.	.	.	20.5	3.992985	0.74703	.	.	ENSG00000197846	ENST00000359985	T	0.34472	1.36	3.89	3.89	0.44902	.	0.000000	0.41823	D	0.000808	T	0.42966	0.1226	.	.	.	0.37925	D	0.931804	.	.	.	.	.	.	T	0.46555	-0.9183	7	0.54805	T	0.06	.	15.7145	0.77658	0.0:0.0:1.0:0.0	.	.	.	.	K	77	ENSP00000353074:E77K	ENSP00000353074:E77K	E	+	1	0	HIST1H2BF	26307994	1.000000	0.71417	0.760000	0.31359	0.006000	0.05464	6.646000	0.74348	2.102000	0.63906	0.650000	0.86243	GAG		0.612	HIST1H2BF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040108.1	NM_003522		11	155	0	0	0	0	11	155				
BTN1A1	696	broad.mit.edu	37	6	26505360	26505360	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr6:26505360C>G	ENST00000244513.6	+	3	701	c.635C>G	c.(634-636)tCt>tGt	p.S212C		NM_001732.2	NP_001723.2	Q13410	BT1A1_HUMAN	butyrophilin, subfamily 1, member A1	212	Ig-like V-type 2.					extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|skin(1)|soft_tissue(1)|urinary_tract(1)	26						AGAGACACTTCTGCGAAAAAT	0.448																																						uc003nif.3		NA																	0				ovary(1)|skin(1)	2						c.(634-636)TCT>TGT		butyrophilin, subfamily 1, member A1 precursor							109.0	111.0	111.0					6																	26505360		2203	4300	6503	SO:0001583	missense	696					extracellular region|integral to plasma membrane	receptor activity	g.chr6:26505360C>G	U39576	CCDS4614.1	6p22.1	2014-01-14			ENSG00000124557	ENSG00000124557		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1135	protein-coding gene	gene with protein product		601610		BTN		8114113, 9382921	Standard	NM_001732		Approved	BT, BTN1	uc003nif.4	Q13410	OTTHUMG00000016358	ENST00000244513.6:c.635C>G	6.37:g.26505360C>G	ENSP00000244513:p.Ser212Cys		Somatic					p.S212C	NM_001732	NP_001723	WXS	Illumina HiSeq	Unspecified	Q13410	BT1A1_HUMAN			3	655	+			212			Extracellular (Potential).|Ig-like V-type 2.		Q4VAN3|Q4VAN4|Q9H458	Missense_Mutation	SNP	ENST00000244513.6	37	c.635C>G	CCDS4614.1	.	.	.	.	.	.	.	.	.	.	C	9.208	1.030256	0.19512	.	.	ENSG00000124557	ENST00000244513;ENST00000377586	T	0.76709	-1.04	5.63	2.78	0.32641	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.532611	0.17472	N	0.173072	D	0.82926	0.5143	M	0.92649	3.33	0.09310	N	1	D	0.89917	1.0	D	0.77557	0.99	T	0.74022	-0.3798	10	0.66056	D	0.02	.	3.7059	0.08400	0.1739:0.5692:0.1678:0.0891	.	212	Q13410	BT1A1_HUMAN	C	212	ENSP00000244513:S212C	ENSP00000244513:S212C	S	+	2	0	BTN1A1	26613339	0.000000	0.05858	0.001000	0.08648	0.023000	0.10783	0.362000	0.20284	0.671000	0.31185	-0.182000	0.12963	TCT		0.448	BTN1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043776.1	NM_001732		11	71	0	0	0	0	11	71				
PGBD1	84547	broad.mit.edu	37	6	28269871	28269871	+	Missense_Mutation	SNP	C	C	T	rs147237521	byFrequency	TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr6:28269871C>T	ENST00000405948.2	+	7	2660	c.2240C>T	c.(2239-2241)tCg>tTg	p.S747L	PGBD1_ENST00000259883.3_Missense_Mutation_p.S747L	NM_001184743.1|NM_032507.3	NP_001171672.1|NP_115896.1	Q96JS3	PGBD1_HUMAN	piggyBac transposable element derived 1	747						membrane (GO:0016020)|nucleus (GO:0005634)	scavenger receptor activity (GO:0005044)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	41						CAAATTATTTCGAAATACAGG	0.388													C|||	3	0.000599042	0.0023	0.0	5008	,	,		20459	0.0		0.0	False		,,,				2504	0.0					uc003nky.2		NA																	0				ovary(4)	4						c.(2239-2241)TCG>TTG		piggyBac transposable element derived 1		C	LEU/SER,LEU/SER	2,4404	4.2+/-10.8	0,2,2201	104.0	99.0	101.0		2240,2240	3.5	0.7	6	dbSNP_134	101	0,8600		0,0,4300	yes	missense,missense	PGBD1	NM_001184743.1,NM_032507.3	145,145	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	possibly-damaging,possibly-damaging	747/810,747/810	28269871	2,13004	2203	4300	6503	SO:0001583	missense	84547				viral reproduction	membrane|nucleus	scavenger receptor activity|sequence-specific DNA binding transcription factor activity	g.chr6:28269871C>T	D88259	CCDS4648.1	6p22.1	2013-01-09			ENSG00000137338	ENSG00000137338		"""-"""	19398	protein-coding gene	gene with protein product							Standard	NM_001184743		Approved	HUCEP-4, dJ874C20.4, SCAND4	uc003nkz.3	Q96JS3	OTTHUMG00000014520	ENST00000405948.2:c.2240C>T	6.37:g.28269871C>T	ENSP00000385213:p.Ser747Leu		Somatic				PGBD1_uc003nkz.2_Missense_Mutation_p.S747L	p.S747L	NM_032507	NP_115896	WXS	Illumina HiSeq	Unspecified	Q96JS3	PGBD1_HUMAN			7	2610	+			747					Q53F43|Q6NTF5|Q8WWS4	Missense_Mutation	SNP	ENST00000405948.2	37	c.2240C>T	CCDS4648.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	12.77	2.037303	0.35989	4.54E-4	0.0	ENSG00000137338	ENST00000405948;ENST00000259883	T;T	0.18960	2.18;2.18	4.38	3.51	0.40186	.	0.148948	0.25714	U	0.028799	T	0.19525	0.0469	L	0.52573	1.65	0.24652	N	0.993516	D	0.61697	0.99	P	0.62649	0.905	T	0.02526	-1.1146	10	0.52906	T	0.07	-23.5211	8.2222	0.31547	0.0:0.891:0.0:0.109	.	747	Q96JS3	PGBD1_HUMAN	L	747	ENSP00000385213:S747L;ENSP00000259883:S747L	ENSP00000259883:S747L	S	+	2	0	PGBD1	28377850	0.982000	0.34865	0.696000	0.30242	0.368000	0.29767	1.395000	0.34520	1.197000	0.43143	0.591000	0.81541	TCG		0.388	PGBD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040188.2			8	52	0	0	0	0	8	52				
OR2H1	26716	broad.mit.edu	37	6	29430385	29430385	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr6:29430385C>G	ENST00000377136.1	+	4	1304	c.839C>G	c.(838-840)aCt>aGt	p.T280S	OR2H1_ENST00000377132.1_Missense_Mutation_p.T280S|OR2H1_ENST00000396792.2_Missense_Mutation_p.T280S|OR2H1_ENST00000377133.1_Missense_Mutation_p.T280S|OR2H1_ENST00000442615.1_Missense_Mutation_p.T280S|OR2H1_ENST00000473369.1_3'UTR			Q9GZK4	OR2H1_HUMAN	olfactory receptor, family 2, subfamily H, member 1	280						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(5)|lung(12)	17						GCAGTGGGCACTCCTTCACTT	0.512																																						uc003nmi.2		NA																	0					0						c.(838-840)ACT>AGT		olfactory receptor, family 2, subfamily H,							94.0	97.0	96.0					6																	29430385		1510	2709	4219	SO:0001583	missense	26716				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:29430385C>G	AF044491	CCDS4660.1	6p22.1	2014-02-19	2002-02-28		ENSG00000204688	ENSG00000204688		"""GPCR / Class A : Olfactory receptors"""	8252	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily H, member 8"""	OR2H6, OR2H8			Standard	NM_030883		Approved	OR6-2	uc003nmi.3	Q9GZK4	OTTHUMG00000031050	ENST00000377136.1:c.839C>G	6.37:g.29430385C>G	ENSP00000366340:p.Thr280Ser		Somatic				OR2H1_uc003nmj.1_Missense_Mutation_p.T280S|OR2H1_uc010jri.1_Missense_Mutation_p.T202S	p.T280S	NM_030883	NP_112145	WXS	Illumina HiSeq	Unspecified	Q9GZK4	OR2H1_HUMAN			3	1282	+			280			Helical; Name=7; (Potential).		B0S7T4|O43629|O43661|O43662|Q5SUN6|Q9GZK9	Missense_Mutation	SNP	ENST00000377136.1	37	c.839C>G	CCDS4660.1	.	.	.	.	.	.	.	.	.	.	C	11.54	1.668145	0.29604	.	.	ENSG00000204688	ENST00000377136;ENST00000377133;ENST00000442615;ENST00000377132;ENST00000396792	T;T;T;T;T	0.35605	1.3;1.3;1.3;1.3;1.3	3.09	2.21	0.28008	GPCR, rhodopsin-like superfamily (1);	0.173783	0.27821	N	0.017717	T	0.40886	0.1135	M	0.78801	2.425	0.09310	N	1	D	0.59767	0.986	D	0.64506	0.926	T	0.14699	-1.0463	10	0.87932	D	0	.	8.5084	0.33201	0.0:0.7936:0.0:0.2064	.	280	Q9GZK4	OR2H1_HUMAN	S	280	ENSP00000366340:T280S;ENSP00000366337:T280S;ENSP00000393254:T280S;ENSP00000366336:T280S;ENSP00000380010:T280S	ENSP00000366336:T280S	T	+	2	0	OR2H1	29538364	0.000000	0.05858	0.009000	0.14445	0.237000	0.25408	-0.149000	0.10204	0.857000	0.35407	0.603000	0.83216	ACT		0.512	OR2H1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194014.3			14	91	0	0	0	0	14	91				
TRIM10	10107	broad.mit.edu	37	6	30126982	30126982	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr6:30126982C>G	ENST00000449742.2	-	2	545	c.470G>C	c.(469-471)aGa>aCa	p.R157T	TRIM10_ENST00000376704.3_Missense_Mutation_p.R157T	NM_006778.3	NP_006769.2	Q9UDY6	TRI10_HUMAN	tripartite motif containing 10	157					erythrocyte differentiation (GO:0030218)|innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			ovary(1)	1						AATCTCCTCTCTCTCTTTTCT	0.423																																						uc003npo.3		NA																	0					0						c.(469-471)AGA>ACA		tripartite motif-containing 10 isoform 1							107.0	108.0	108.0					6																	30126982		1511	2709	4220	SO:0001583	missense	10107					cytoplasm	zinc ion binding	g.chr6:30126982C>G	Y07829	CCDS4676.1, CCDS34375.1	6p21.3	2013-01-09	2011-01-25	2001-11-23	ENSG00000204613	ENSG00000204613		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10072	protein-coding gene	gene with protein product		605701	"""tripartite motif-containing 10"""	RNF9		9271628, 10207104	Standard	NM_052828		Approved	RFB30, HERF1	uc003npo.3	Q9UDY6	OTTHUMG00000031295	ENST00000449742.2:c.470G>C	6.37:g.30126982C>G	ENSP00000397073:p.Arg157Thr		Somatic				TRIM10_uc003npn.2_Missense_Mutation_p.R157T	p.R157T	NM_006778	NP_006769	WXS	Illumina HiSeq	Unspecified	Q9UDY6	TRI10_HUMAN			2	546	-			157			Potential.		A6NF84|Q5SRJ5|Q5SRK8|Q86Z08|Q96QB6|Q9C023|Q9C024	Missense_Mutation	SNP	ENST00000449742.2	37	c.470G>C	CCDS34375.1	.	.	.	.	.	.	.	.	.	.	C	11.67	1.706796	0.30232	.	.	ENSG00000204613	ENST00000449742;ENST00000376704;ENST00000376706	D;D	0.82344	-1.6;-1.6	5.2	4.32	0.51571	.	0.220880	0.32401	N	0.006142	T	0.74291	0.3697	M	0.86178	2.8	0.32675	N	0.516282	B;B	0.20052	0.022;0.041	B;B	0.17979	0.006;0.02	T	0.70410	-0.4879	10	0.33141	T	0.24	.	11.7508	0.51847	0.0:0.8221:0.1779:0.0	.	157;157	Q9UDY6;Q9UDY6-2	TRI10_HUMAN;.	T	157	ENSP00000397073:R157T;ENSP00000365894:R157T	ENSP00000365894:R157T	R	-	2	0	TRIM10	30234961	1.000000	0.71417	1.000000	0.80357	0.484000	0.33280	2.796000	0.47869	1.154000	0.42482	0.643000	0.83706	AGA		0.423	TRIM10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076634.1			3	61	0	0	0	0	3	61				
TRIM15	89870	broad.mit.edu	37	6	30131831	30131831	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr6:30131831C>G	ENST00000376694.4	+	1	839	c.370C>G	c.(370-372)Cag>Gag	p.Q124E	TRIM15_ENST00000376688.1_Intron	NM_033229.2	NP_150232.2	Q9C019	TRI15_HUMAN	tripartite motif containing 15	124					innate immune response (GO:0045087)|mesodermal cell fate determination (GO:0007500)|negative regulation of intracellular transport of viral material (GO:1901253)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of RIG-I signaling pathway (GO:1900246)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of type I interferon production (GO:0032481)	intracellular (GO:0005622)	zinc ion binding (GO:0008270)			large_intestine(2)|lung(8)|prostate(2)|skin(1)|urinary_tract(1)	14						CGAGGCCATTCAGCCCTACCG	0.577																																						uc010jrx.2		NA																	0					0						c.(370-372)CAG>GAG		tripartite motif protein 15							60.0	52.0	55.0					6																	30131831		1510	2709	4219	SO:0001583	missense	89870				mesodermal cell fate determination	intracellular	zinc ion binding	g.chr6:30131831C>G	AF220132, U34249	CCDS4677.1	6p21.33	2013-01-09	2011-01-25		ENSG00000204610	ENSG00000204610		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16284	protein-coding gene	gene with protein product			"""zinc finger protein 178"", ""tripartite motif-containing 15"""	ZNF178		11331580, 8304341, 8812418	Standard	NM_033229		Approved	ZNFB7, RNF93	uc010jrx.3	Q9C019	OTTHUMG00000031031	ENST00000376694.4:c.370C>G	6.37:g.30131831C>G	ENSP00000365884:p.Gln124Glu		Somatic					p.Q124E	NM_033229	NP_150232	WXS	Illumina HiSeq	Unspecified	Q9C019	TRI15_HUMAN			1	849	+			124					A2BEC9|O95604|Q8IUX9|Q9C018	Missense_Mutation	SNP	ENST00000376694.4	37	c.370C>G	CCDS4677.1	.	.	.	.	.	.	.	.	.	.	C	7.086	0.571182	0.13623	.	.	ENSG00000204610	ENST00000376695;ENST00000376694	T	0.72167	-0.63	5.54	3.71	0.42584	.	0.435132	0.19499	N	0.112787	T	0.30198	0.0757	L	0.52759	1.655	0.20764	N	0.999853	B	0.26195	0.144	B	0.21708	0.036	T	0.35968	-0.9767	10	0.02654	T	1	.	4.309	0.10962	0.1618:0.5967:0.1566:0.0849	.	124	Q9C019	TRI15_HUMAN	E	55;124	ENSP00000365884:Q124E	ENSP00000365884:Q124E	Q	+	1	0	TRIM15	30239810	0.000000	0.05858	0.697000	0.30258	0.458000	0.32498	-0.069000	0.11542	0.648000	0.30732	0.551000	0.68910	CAG		0.577	TRIM15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076026.2	NM_033229		11	42	0	0	0	0	11	42				
HSPA1L	3305	broad.mit.edu	37	6	31778792	31778792	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr6:31778792C>T	ENST00000375654.4	-	2	1147	c.958G>A	c.(958-960)Gaa>Aaa	p.E320K	HSPA1L_ENST00000417199.3_Missense_Mutation_p.E320K	NM_005527.3	NP_005518.3	P34931	HS71L_HUMAN	heat shock 70kDa protein 1-like	320					binding of sperm to zona pellucida (GO:0007339)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|pleura(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						AGCGCTTTTTCTACAGGCTCC	0.488																																						uc003nxh.2		NA																	0				ovary(3)|pleura(1)|kidney(1)|skin(1)	6						c.(958-960)GAA>AAA		heat shock 70kDa protein 1-like							62.0	63.0	63.0					6																	31778792		2203	4300	6503	SO:0001583	missense	3305				response to unfolded protein		ATP binding	g.chr6:31778792C>T	D85730	CCDS34413.1	6p21.3	2014-01-21	2002-08-29		ENSG00000204390	ENSG00000204390		"""Heat shock proteins / HSP70"""	5234	protein-coding gene	gene with protein product		140559	"""heat shock 70kD protein-like 1"""			9685725, 9349405	Standard	NM_005527		Approved	HSP70-HOM, hum70t	uc003nxh.3	P34931	OTTHUMG00000031208	ENST00000375654.4:c.958G>A	6.37:g.31778792C>T	ENSP00000364805:p.Glu320Lys		Somatic				HSPA1L_uc010jte.2_Missense_Mutation_p.E320K	p.E320K	NM_005527	NP_005518	WXS	Illumina HiSeq	Unspecified	P34931	HS71L_HUMAN			2	1141	-			320					A6NNB0|B0UXW8|O75634|Q2HXR3|Q8NE72|Q96QC9|Q9UQM1	Missense_Mutation	SNP	ENST00000375654.4	37	c.958G>A	CCDS34413.1	.	.	.	.	.	.	.	.	.	.	C	18.85	3.710995	0.68730	.	.	ENSG00000204390	ENST00000375654;ENST00000417199;ENST00000375653;ENST00000424494	T;T	0.00986	5.47;5.47	5.4	5.4	0.78164	.	0.000000	0.35378	N	0.003254	T	0.00998	0.0033	L	0.34521	1.04	0.80722	D	1	P	0.44690	0.841	P	0.48921	0.595	T	0.75107	-0.3434	10	0.72032	D	0.01	-6.9863	16.7132	0.85391	0.0:1.0:0.0:0.0	.	320	P34931	HS71L_HUMAN	K	320;320;265;210	ENSP00000364805:E320K;ENSP00000387691:E320K	ENSP00000364804:E265K	E	-	1	0	HSPA1L	31886771	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	5.910000	0.69931	2.810000	0.96702	0.585000	0.79938	GAA		0.488	HSPA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076416.2			10	65	0	0	0	0	10	65				
KIFC1	3833	broad.mit.edu	37	6	33371665	33371665	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr6:33371665G>C	ENST00000428849.2	+	6	965	c.515G>C	c.(514-516)aGa>aCa	p.R172T		NM_002263.3	NP_002254.2	Q9BW19	KIFC1_HUMAN	kinesin family member C1	172					ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|spindle assembly (GO:0051225)	endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|minus-end-directed microtubule motor activity (GO:0008569)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(3)|skin(1)	13						GACCAGCTCAGAGATGCCCAG	0.557																																						uc003oef.3		NA																	0					0						c.(514-516)AGA>ACA		kinesin family member C1							107.0	106.0	106.0					6																	33371665		2203	4300	6503	SO:0001583	missense	3833				blood coagulation|cell division|microtubule-based movement|mitotic sister chromatid segregation	early endosome|microtubule|microtubule associated complex|microtubule organizing center|nucleus|spindle	ATP binding|microtubule motor activity	g.chr6:33371665G>C	D14678	CCDS34430.1	6p21.32	2014-05-15	2003-01-09	2003-01-10	ENSG00000237649	ENSG00000237649		"""Kinesins"""	6389	protein-coding gene	gene with protein product		603763	"""kinesin-like 2"""	KNSL2		8276466	Standard	NM_002263		Approved	HSET	uc003oef.4	Q9BW19	OTTHUMG00000031209	ENST00000428849.2:c.515G>C	6.37:g.33371665G>C	ENSP00000393963:p.Arg172Thr		Somatic				KIFC1_uc011drf.1_Missense_Mutation_p.R164T	p.R172T	NM_002263	NP_002254	WXS	Illumina HiSeq	Unspecified	Q9BW19	KIFC1_HUMAN			6	965	+			172			Potential.		O60887|Q14834|Q4KMP0|Q5SU09|Q6GMS7|Q6P4A5|Q9UQP7	Missense_Mutation	SNP	ENST00000428849.2	37	c.515G>C	CCDS34430.1	.	.	.	.	.	.	.	.	.	.	G	6.610	0.480917	0.12581	.	.	ENSG00000237649	ENST00000428849	T	0.78003	-1.14	5.34	-0.489	0.12052	.	0.781158	0.12132	N	0.496687	T	0.46210	0.1381	L	0.53249	1.67	0.09310	N	1	B;B	0.26195	0.144;0.087	B;B	0.20577	0.03;0.03	T	0.28933	-1.0028	10	0.22706	T	0.39	-23.2621	5.8734	0.18816	0.3437:0.1337:0.5226:0.0	.	164;172	B4E063;Q9BW19	.;KIFC1_HUMAN	T	172	ENSP00000393963:R172T	ENSP00000393963:R172T	R	+	2	0	KIFC1	33479643	0.000000	0.05858	0.123000	0.21794	0.857000	0.48899	-0.999000	0.03697	-0.282000	0.09128	0.563000	0.77884	AGA		0.557	KIFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076417.1	NM_002263		12	91	0	0	0	0	12	91				
KCNK16	83795	broad.mit.edu	37	6	39284586	39284586	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr6:39284586G>T	ENST00000373229.5	-	4	646	c.633C>A	c.(631-633)agC>agA	p.S211R	KCNK16_ENST00000373227.4_Missense_Mutation_p.S211R|KCNK16_ENST00000437525.2_Missense_Mutation_p.S211R|KCNK17_ENST00000453413.2_5'Flank|KCNK17_ENST00000373231.4_5'Flank|KCNK16_ENST00000507712.1_Missense_Mutation_p.S146R|KCNK16_ENST00000425054.2_Missense_Mutation_p.S211R	NM_032115.3	NP_115491.1	Q96T55	KCNKG_HUMAN	potassium channel, subfamily K, member 16	211					potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)	13						AGCCAATGGTGCTGAGAGTGA	0.532																																						uc003ooq.2		NA																	0				ovary(2)|skin(1)	3						c.(631-633)AGC>AGA		potassium channel, subfamily K, member 16							183.0	180.0	181.0					6																	39284586		2203	4300	6503	SO:0001583	missense	83795					integral to membrane	potassium channel activity|voltage-gated ion channel activity	g.chr6:39284586G>T	AF358909	CCDS4843.1, CCDS47420.1, CCDS47421.1, CCDS47422.1	6p21.2-p21.1	2012-03-07			ENSG00000095981	ENSG00000095981		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14464	protein-coding gene	gene with protein product		607369				11263999, 16382106	Standard	NM_032115		Approved	K2p16.1, TALK-1, TALK1	uc003ooq.3	Q96T55	OTTHUMG00000014645	ENST00000373229.5:c.633C>A	6.37:g.39284586G>T	ENSP00000362326:p.Ser211Arg		Somatic				KCNK17_uc003ooo.2_5'Flank|KCNK17_uc003oop.2_5'Flank|KCNK16_uc003oor.3_Missense_Mutation_p.S211R|KCNK16_uc010jwy.2_Missense_Mutation_p.S211R|KCNK16_uc011dtz.1_Missense_Mutation_p.S211R	p.S211R	NM_032115	NP_115491	WXS	Illumina HiSeq	Unspecified	Q96T55	KCNKG_HUMAN			4	647	-			211					B5TJL9|Q2M2N9|Q5TCF3|Q6X6Z3|Q6X6Z4|Q6X6Z5|Q9H591	Missense_Mutation	SNP	ENST00000373229.5	37	c.633C>A	CCDS4843.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.288925	0.80914	.	.	ENSG00000095981	ENST00000373229;ENST00000425054;ENST00000507712;ENST00000373227;ENST00000437525	T;T;T;T;T	0.35048	1.33;1.33;1.33;1.33;1.33	5.35	5.35	0.76521	Ion transport 2 (1);	0.093380	0.64402	D	0.000001	T	0.68769	0.3037	H	0.95574	3.69	0.58432	D	0.999998	D;D;D;D	0.89917	0.999;1.0;0.999;1.0	D;D;D;D	0.91635	0.985;0.991;0.943;0.999	T	0.79451	-0.1798	10	0.87932	D	0	.	18.647	0.91415	0.0:0.0:1.0:0.0	.	211;211;211;211	B5TJL9;Q96T55-5;Q96T55-4;Q96T55	.;.;.;KCNKG_HUMAN	R	211;211;146;211;211	ENSP00000362326:S211R;ENSP00000391498:S211R;ENSP00000423842:S146R;ENSP00000362324:S211R;ENSP00000415375:S211R	ENSP00000362324:S211R	S	-	3	2	KCNK16	39392564	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.916000	0.63362	2.519000	0.84933	0.561000	0.74099	AGC		0.532	KCNK16-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040452.2	NM_032115		36	247	1	0	4.47e-08	4.87e-08	36	247				
ZNF451	26036	broad.mit.edu	37	6	57015615	57015615	+	Silent	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr6:57015615C>T	ENST00000370706.4	+	11	2951	c.2707C>T	c.(2707-2709)Cta>Tta	p.L903L	RP11-203B9.4_ENST00000589549.1_RNA|RP11-203B9.4_ENST00000586466.1_RNA|RP11-203B9.4_ENST00000586668.1_RNA|RP11-203B9.4_ENST00000585792.1_RNA|RP11-203B9.4_ENST00000586053.1_RNA|RP11-203B9.4_ENST00000587815.1_RNA|RP11-203B9.4_ENST00000592500.1_RNA|ZNF451_ENST00000491832.2_Silent_p.L903L|RP11-203B9.4_ENST00000416069.2_RNA|RP11-203B9.4_ENST00000591553.1_RNA|RP11-203B9.4_ENST00000586432.1_RNA|RP11-203B9.4_ENST00000588811.1_RNA|RP11-203B9.4_ENST00000589263.1_RNA|ZNF451_ENST00000357489.3_Intron|RP11-203B9.4_ENST00000592038.1_RNA	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451	903					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			TTTTGGTCATCTACCAGGGCA	0.358																																						uc003pdm.1		NA																	0				ovary(1)|pancreas(1)	2						c.(2707-2709)CTA>TTA		zinc finger protein 451 isoform 1							143.0	130.0	134.0					6																	57015615		1811	4069	5880	SO:0001819	synonymous_variant	26036				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr6:57015615C>T	AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.2707C>T	6.37:g.57015615C>T			Somatic				ZNF451_uc003pdl.2_Silent_p.L903L|ZNF451_uc003pdn.1_Intron|uc003pdq.1_Intron|ZNF451_uc003pdk.1_Silent_p.L903L	p.L903L	NM_001031623	NP_001026794	WXS	Illumina HiSeq	Unspecified	Q9Y4E5	ZN451_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)		11	2931	+	Lung NSC(77;0.145)		903					Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	Silent	SNP	ENST00000370706.4	37	c.2707C>T	CCDS43477.1																																																																																				0.358	ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041035.2	NM_015555		17	106	0	0	0	0	17	106				
CEP162	22832	broad.mit.edu	37	6	84895136	84895136	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr6:84895136C>G	ENST00000403245.3	-	13	1546	c.1432G>C	c.(1432-1434)Gaa>Caa	p.E478Q	KIAA1009_ENST00000461137.1_5'UTR|KIAA1009_ENST00000257766.4_Missense_Mutation_p.E402Q	NM_014895.2	NP_055710.2														breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	43		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)		ACAGCCCCTTCTTCTTCAGAA	0.363																																						uc010kbp.2		NA																	0				ovary(1)	1						c.(1432-1434)GAA>CAA		KIAA1009 protein							95.0	97.0	96.0					6																	84895136		2203	4299	6502	SO:0001583	missense	22832				cell division|mitosis	centrosome|nucleus|plasma membrane|spindle	protein binding	g.chr6:84895136C>G																												ENST00000403245.3:c.1432G>C	6.37:g.84895136C>G	ENSP00000385215:p.Glu478Gln		Somatic				KIAA1009_uc003pkj.3_Missense_Mutation_p.E402Q|KIAA1009_uc003pkk.2_Missense_Mutation_p.E478Q|KIAA1009_uc003pki.3_5'UTR	p.E478Q	NM_014895	NP_055710	WXS	Illumina HiSeq	Unspecified	Q5TB80	QN1_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.089)	13	1529	-		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)	478						Missense_Mutation	SNP	ENST00000403245.3	37	c.1432G>C	CCDS34494.2	.	.	.	.	.	.	.	.	.	.	C	10.71	1.426761	0.25726	.	.	ENSG00000135315	ENST00000257766;ENST00000403245	T;T	0.18810	2.19;2.19	5.1	4.21	0.49690	.	0.114139	0.38959	N	0.001519	T	0.28001	0.0690	M	0.65975	2.015	0.24488	N	0.994312	P;D	0.76494	0.873;0.999	P;D	0.69479	0.466;0.964	T	0.01879	-1.1255	10	0.52906	T	0.07	-20.0547	10.3137	0.43723	0.0:0.9066:0.0:0.0934	.	478;478	Q5TB80;C9JFM9	QN1_HUMAN;.	Q	402;478	ENSP00000257766:E402Q;ENSP00000385215:E478Q	ENSP00000257766:E402Q	E	-	1	0	KIAA1009	84951855	0.964000	0.33143	0.998000	0.56505	0.110000	0.19582	1.457000	0.35212	2.522000	0.85027	0.544000	0.68410	GAA		0.363	KIAA1009-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317315.1			9	96	0	0	0	0	9	96				
GPR63	81491	broad.mit.edu	37	6	97247016	97247016	+	Silent	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr6:97247016G>A	ENST00000229955.3	-	2	937	c.592C>T	c.(592-594)Ctg>Ttg	p.L198L	GPR63_ENST00000417980.1_Silent_p.L198L	NM_001143957.2|NM_030784.3	NP_001137429.1|NP_110411.1	Q9BZJ6	GPR63_HUMAN	G protein-coupled receptor 63	198						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			kidney(1)|large_intestine(5)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(76;6.89e-05)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.0618)|Colorectal(196;0.0721)		BRCA - Breast invasive adenocarcinoma(108;0.0912)		ACTGCAATCAGAACCTTAGCT	0.458																																						uc010kcl.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(592-594)CTG>TTG		G protein-coupled receptor 63							78.0	75.0	76.0					6																	97247016		2203	4300	6503	SO:0001819	synonymous_variant	81491					integral to membrane|plasma membrane	G-protein coupled receptor activity|protein binding	g.chr6:97247016G>A	AF317654	CCDS5036.1	6q16.1-q16.3	2012-08-21			ENSG00000112218	ENSG00000112218		"""GPCR / Class A : Orphans"""	13302	protein-coding gene	gene with protein product		606915					Standard	NM_030784		Approved	PSP24(beta), PSP24B	uc003pou.3	Q9BZJ6	OTTHUMG00000015245	ENST00000229955.3:c.592C>T	6.37:g.97247016G>A			Somatic				GPR63_uc003pou.2_Silent_p.L198L	p.L198L	NM_001143957	NP_001137429	WXS	Illumina HiSeq	Unspecified	Q9BZJ6	GPR63_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0912)	3	1070	-		all_cancers(76;6.89e-05)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.0618)|Colorectal(196;0.0721)	198			Helical; Name=4; (Potential).		Q9UJH3	Silent	SNP	ENST00000229955.3	37	c.592C>T	CCDS5036.1																																																																																				0.458	GPR63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041566.2			5	109	0	0	0	0	5	109				
LAMA4	3910	broad.mit.edu	37	6	112537671	112537671	+	Splice_Site	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr6:112537671C>T	ENST00000230538.7	-	3	593		c.e3-1		LAMA4_ENST00000389463.4_Splice_Site|LAMA4_ENST00000431543.2_Splice_Site|LAMA4_ENST00000522006.1_Splice_Site|RP1-142L7.9_ENST00000603682.1_lincRNA|LAMA4_ENST00000524032.1_Splice_Site|LAMA4_ENST00000424408.2_Splice_Site	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4						blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		CATTGCATTTCTGCAACAGAC	0.393																																						uc003pvu.2		NA																	0				ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9						c.e3-1		laminin, alpha 4 isoform 1 precursor							83.0	71.0	75.0					6																	112537671		2203	4300	6503	SO:0001630	splice_region_variant	3910				cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding	g.chr6:112537671C>T		CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.196-1G>A	6.37:g.112537671C>T			Somatic				LAMA4_uc003pvv.2_Splice_Site_p.K66_splice|LAMA4_uc003pvt.2_Splice_Site_p.K66_splice|LAMA4_uc003pvw.2_Splice_Site_p.K66_splice	p.K66_splice	NM_001105206	NP_001098676	WXS	Illumina HiSeq	Unspecified	Q16363	LAMA4_HUMAN		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)	3	505	-		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)						Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Splice_Site	SNP	ENST00000230538.7	37	c.196_splice	CCDS43491.1	.	.	.	.	.	.	.	.	.	.	C	9.480	1.097969	0.20552	.	.	ENSG00000112769	ENST00000230538;ENST00000522006;ENST00000389463;ENST00000424408;ENST00000454881;ENST00000521398;ENST00000542588;ENST00000368639;ENST00000519932;ENST00000431543;ENST00000243219;ENST00000521690	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.6392	0.88130	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LAMA4	112644364	1.000000	0.71417	1.000000	0.80357	0.032000	0.12392	5.001000	0.63946	2.748000	0.94277	0.650000	0.86243	.		0.393	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041876.2	NM_001105206	Intron	9	40	0	0	0	0	9	40				
ALDH8A1	64577	broad.mit.edu	37	6	135239804	135239804	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr6:135239804C>T	ENST00000265605.2	-	7	1281	c.1213G>A	c.(1213-1215)Gaa>Aaa	p.E405K	ALDH8A1_ENST00000367847.2_Missense_Mutation_p.E355K|ALDH8A1_ENST00000367845.2_Missense_Mutation_p.E351K	NM_022568.3	NP_072090.1	Q9H2A2	AL8A1_HUMAN	aldehyde dehydrogenase 8 family, member A1	405					9-cis-retinoic acid biosynthetic process (GO:0042904)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	retinal dehydrogenase activity (GO:0001758)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	36	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)		ACCTCCTCTTCACTATCAAAG	0.517																																						uc003qew.2		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(1213-1215)GAA>AAA		aldehyde dehydrogenase 8A1 isoform 1							160.0	115.0	130.0					6																	135239804		2203	4300	6503	SO:0001583	missense	64577				retinal metabolic process	cytoplasm	retinal dehydrogenase activity	g.chr6:135239804C>T	AL021939	CCDS5171.1, CCDS5172.1, CCDS55057.1	6q24.1-q25.1	2008-07-03			ENSG00000118514	ENSG00000118514		"""Aldehyde dehydrogenases"""	15471	protein-coding gene	gene with protein product		606467				11007799	Standard	NM_001193480		Approved	ALDH12	uc003qew.3	Q9H2A2	OTTHUMG00000015623	ENST00000265605.2:c.1213G>A	6.37:g.135239804C>T	ENSP00000265605:p.Glu405Lys		Somatic				ALDH8A1_uc003qex.2_Missense_Mutation_p.E351K|ALDH8A1_uc010kgh.2_Missense_Mutation_p.E183K|ALDH8A1_uc011ecx.1_Missense_Mutation_p.E355K	p.E405K	NM_022568	NP_072090	WXS	Illumina HiSeq	Unspecified	Q9H2A2	AL8A1_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)	7	1266	-	Colorectal(23;0.221)		405					B7Z521|O60793|Q24JS9|Q53GT3|Q5TI80	Missense_Mutation	SNP	ENST00000265605.2	37	c.1213G>A	CCDS5171.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.221150	0.79464	.	.	ENSG00000118514	ENST00000265605;ENST00000367845;ENST00000367847;ENST00000460753	T;T;T;T	0.78126	1.43;1.43;1.43;-1.15	5.83	4.96	0.65561	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.042271	0.85682	N	0.000000	D	0.87144	0.6104	M	0.88570	2.965	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79108	0.992;0.987;0.992	D	0.89139	0.3515	10	0.52906	T	0.07	.	15.0283	0.71687	0.0:0.932:0.0:0.068	.	355;351;405	B7Z521;Q9H2A2-2;Q9H2A2	.;.;AL8A1_HUMAN	K	405;351;355;90	ENSP00000265605:E405K;ENSP00000356819:E351K;ENSP00000356821:E355K;ENSP00000437161:E90K	ENSP00000265605:E405K	E	-	1	0	ALDH8A1	135281497	1.000000	0.71417	0.887000	0.34795	0.381000	0.30169	7.678000	0.84035	1.482000	0.48325	0.655000	0.94253	GAA		0.517	ALDH8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042334.2			7	74	0	0	0	0	7	74				
UTRN	7402	broad.mit.edu	37	6	144772564	144772564	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr6:144772564C>G	ENST00000367545.3	+	17	2131	c.2131C>G	c.(2131-2133)Cag>Gag	p.Q711E		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	711	Interaction with SYNM.				aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		AACTGCCATTCAGACCACAGA	0.363																																						uc003qkt.2		NA																	0				ovary(4)|pancreas(1)	5						c.(2131-2133)CAG>GAG		utrophin							111.0	105.0	107.0					6																	144772564		2203	4300	6503	SO:0001583	missense	7402				muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding	g.chr6:144772564C>G	AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.2131C>G	6.37:g.144772564C>G	ENSP00000356515:p.Gln711Glu		Somatic				UTRN_uc010khq.1_Missense_Mutation_p.Q711E	p.Q711E	NM_007124	NP_009055	WXS	Illumina HiSeq	Unspecified	P46939	UTRO_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)	17	2223	+		Ovarian(120;0.218)	711			Interaction with SYNM.|Spectrin 5.		Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	ENST00000367545.3	37	c.2131C>G	CCDS34547.1	.	.	.	.	.	.	.	.	.	.	C	17.68	3.449452	0.63178	.	.	ENSG00000152818	ENST00000367529;ENST00000367545	T	0.61040	0.14	5.99	5.99	0.97316	.	0.141093	0.32488	N	0.006027	T	0.51568	0.1682	M	0.78637	2.42	0.80722	D	1	B	0.33000	0.393	B	0.27500	0.08	T	0.57051	-0.7877	10	0.52906	T	0.07	.	20.4756	0.99175	0.0:1.0:0.0:0.0	.	711	P46939	UTRO_HUMAN	E	711	ENSP00000356515:Q711E	ENSP00000356499:Q711E	Q	+	1	0	UTRN	144814257	1.000000	0.71417	1.000000	0.80357	0.795000	0.44927	4.479000	0.60236	2.847000	0.97988	0.655000	0.94253	CAG		0.363	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1			7	32	0	0	0	0	7	32				
ARID1B	57492	broad.mit.edu	37	6	157522076	157522076	+	Missense_Mutation	SNP	G	G	A	rs376207220		TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr6:157522076G>A	ENST00000350026.5	+	17	4310	c.4309G>A	c.(4309-4311)Ggc>Agc	p.G1437S	ARID1B_ENST00000275248.4_Missense_Mutation_p.G1432S|ARID1B_ENST00000367148.1_Missense_Mutation_p.G1490S|ARID1B_ENST00000346085.5_Missense_Mutation_p.G1450S	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1437					chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		GATGATGGGCGGCCCGCTGCA	0.637																																						uc003qqn.2		NA																	0				ovary(1)|breast(1)	2						c.(4294-4296)GGC>AGC		AT rich interactive domain 1B (SWI1-like)		G	SER/GLY,SER/GLY	1,4405	2.1+/-5.4	0,1,2202	27.0	31.0	30.0		4309,4348	5.1	0.9	6		30	0,8592		0,0,4296	no	missense,missense	ARID1B	NM_017519.2,NM_020732.3	56,56	0,1,6498	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging	1437/2237,1450/2250	157522076	1,12997	2203	4296	6499	SO:0001583	missense	57492				chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity	g.chr6:157522076G>A	AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.4309G>A	6.37:g.157522076G>A	ENSP00000055163:p.Gly1437Ser		Somatic				ARID1B_uc003qqo.2_Missense_Mutation_p.G1392S|ARID1B_uc003qqp.2_Missense_Mutation_p.G1379S	p.G1432S	NM_017519	NP_059989	WXS	Illumina HiSeq	Unspecified	Q8NFD5	ARI1B_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)	18	4446	+		Breast(66;0.000162)|Ovarian(120;0.0265)	1437					Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Missense_Mutation	SNP	ENST00000350026.5	37	c.4294G>A	CCDS5251.2	.	.	.	.	.	.	.	.	.	.	G	14.98	2.697192	0.48202	2.27E-4	0.0	ENSG00000049618	ENST00000346085;ENST00000350026;ENST00000367148;ENST00000275248;ENST00000414678	T;T;T;T;T	0.02763	4.64;4.58;4.65;4.66;4.17	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.01287	0.0042	L	0.31065	0.9	0.58432	D	0.999994	P;P;P	0.37594	0.466;0.601;0.601	B;B;B	0.23018	0.019;0.043;0.043	T	0.63435	-0.6638	10	0.45353	T	0.12	.	18.8669	0.92296	0.0:0.0:1.0:0.0	.	1437;1450;1432	Q8NFD5;Q8NFD5-2;G3XAA0	ARI1B_HUMAN;.;.	S	1450;1437;1490;1432;959	ENSP00000344546:G1450S;ENSP00000055163:G1437S;ENSP00000356116:G1490S;ENSP00000275248:G1432S;ENSP00000412835:G959S	ENSP00000275248:G1432S	G	+	1	0	ARID1B	157563768	1.000000	0.71417	0.918000	0.36340	0.587000	0.36485	7.134000	0.77268	2.528000	0.85240	0.591000	0.81541	GGC		0.637	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372723.1	NM_020732		10	29	0	0	0	0	10	29				
MICALL2	79778	broad.mit.edu	37	7	1477794	1477794	+	Silent	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr7:1477794C>T	ENST00000297508.7	-	12	2425	c.2250G>A	c.(2248-2250)cgG>cgA	p.R750R	MICALL2_ENST00000405088.4_Silent_p.R538R|MICALL2_ENST00000471899.1_5'UTR	NM_182924.3	NP_891554.1	Q8IY33	MILK2_HUMAN	MICAL-like 2	750	Forms an intramolecular interaction with the N-terminal CH and LIM zinc-binding domains-containing region keeping the protein in a closed conformation. {ECO:0000250}.				actin cytoskeleton reorganization (GO:0031532)|actin filament polymerization (GO:0030041)|endocytic recycling (GO:0032456)|neuron projection development (GO:0031175)|substrate adhesion-dependent cell spreading (GO:0034446)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|stress fiber (GO:0001725)|tight junction (GO:0005923)	actin filament binding (GO:0051015)|filamin binding (GO:0031005)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(8)|ovary(2)|skin(2)	19		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;6.01e-15)		GGGCGTCCAGCCGCCTCTCGA	0.726																																						uc003skj.3		NA																	0				central_nervous_system(1)	1						c.(2248-2250)CGG>CGA		MICAL-like 2 isoform 1							8.0	10.0	9.0					7																	1477794		2139	4214	6353	SO:0001819	synonymous_variant	79778					cytoplasm|cytoskeleton	zinc ion binding	g.chr7:1477794C>T	BC037988	CCDS5324.1	7p22.3	2006-11-24			ENSG00000164877	ENSG00000164877			29672	protein-coding gene	gene with protein product	"""junctional Rab13-binding protein"""					12110185, 16525024	Standard	NM_182924		Approved	MGC46023, FLJ23471, MICAL-L2, JRAB	uc003skj.4	Q8IY33	OTTHUMG00000119021	ENST00000297508.7:c.2250G>A	7.37:g.1477794C>T			Somatic				MICALL2_uc003skh.3_5'UTR|MICALL2_uc003ski.3_Silent_p.R237R	p.R750R	NM_182924	NP_891554	WXS	Illumina HiSeq	Unspecified	Q8IY33	MILK2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;6.01e-15)	12	2397	-		Ovarian(82;0.0253)	750			Potential.		D3YTD2|Q7RTP4|Q7Z655|Q8TEQ4|Q9H5F9	Silent	SNP	ENST00000297508.7	37	c.2250G>A	CCDS5324.1																																																																																				0.726	MICALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239223.2	NM_182924		2	3	0	0	0	0	2	3				
FOXK1	221937	broad.mit.edu	37	7	4722413	4722413	+	Silent	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr7:4722413C>T	ENST00000328914.4	+	1	474	c.474C>T	c.(472-474)ttC>ttT	p.F158F	FOXK1_ENST00000446823.1_Intron	NM_001037165.1	NP_001032242.1			forkhead box K1											breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;7.43e-15)		AGCCGCACTTCTACCTGCGCT	0.692																																						uc003snc.1		NA																	0				upper_aerodigestive_tract(1)|skin(1)	2						c.(472-474)TTC>TTT		forkhead box K1							17.0	16.0	16.0					7																	4722413		2199	4297	6496	SO:0001819	synonymous_variant	221937				cell differentiation|embryo development|muscle organ development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	g.chr7:4722413C>T	BK004104	CCDS34591.1	7p22	2006-12-15			ENSG00000164916	ENSG00000164916		"""Forkhead boxes"""	23480	protein-coding gene	gene with protein product						15202027	Standard	NM_001037165		Approved	IMAGE:5164497	uc003snc.1	P85037	OTTHUMG00000151739	ENST00000328914.4:c.474C>T	7.37:g.4722413C>T			Somatic				FOXK1_uc003sna.1_Intron|FOXK1_uc003snb.1_Silent_p.F158F	p.F158F	NM_001037165	NP_001032242	WXS	Illumina HiSeq	Unspecified	P85037	FOXK1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;7.43e-15)	1	484	+		Ovarian(82;0.0175)	158			FHA.			Silent	SNP	ENST00000328914.4	37	c.474C>T	CCDS34591.1																																																																																				0.692	FOXK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323729.2			3	12	0	0	0	0	3	12				
FOXK1	221937	broad.mit.edu	37	7	4800700	4800700	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr7:4800700G>C	ENST00000328914.4	+	8	1702	c.1702G>C	c.(1702-1704)Gag>Cag	p.E568Q	FOXK1_ENST00000446823.1_Missense_Mutation_p.E405Q	NM_001037165.1	NP_001032242.1			forkhead box K1											breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;7.43e-15)		CGCAGGCCTGGAGGAGAAACC	0.637																																						uc003snc.1		NA																	0				upper_aerodigestive_tract(1)|skin(1)	2						c.(1702-1704)GAG>CAG		forkhead box K1							77.0	83.0	81.0					7																	4800700		2203	4300	6503	SO:0001583	missense	221937				cell differentiation|embryo development|muscle organ development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	g.chr7:4800700G>C	BK004104	CCDS34591.1	7p22	2006-12-15			ENSG00000164916	ENSG00000164916		"""Forkhead boxes"""	23480	protein-coding gene	gene with protein product						15202027	Standard	NM_001037165		Approved	IMAGE:5164497	uc003snc.1	P85037	OTTHUMG00000151739	ENST00000328914.4:c.1702G>C	7.37:g.4800700G>C	ENSP00000328720:p.Glu568Gln		Somatic				FOXK1_uc003sna.1_Missense_Mutation_p.E405Q	p.E568Q	NM_001037165	NP_001032242	WXS	Illumina HiSeq	Unspecified	P85037	FOXK1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;7.43e-15)	8	1712	+		Ovarian(82;0.0175)	568						Missense_Mutation	SNP	ENST00000328914.4	37	c.1702G>C	CCDS34591.1	.	.	.	.	.	.	.	.	.	.	G	17.10	3.301705	0.60195	.	.	ENSG00000164916	ENST00000446823;ENST00000450194;ENST00000328914;ENST00000545598	D;D	0.96491	-3.71;-4.03	5.46	5.46	0.80206	.	0.126264	0.52532	D	0.000074	D	0.96935	0.8999	L	0.57536	1.79	0.45183	D	0.998199	D;P	0.71674	0.998;0.61	P;B	0.59761	0.863;0.215	D	0.96276	0.9202	10	0.38643	T	0.18	.	16.4776	0.84136	0.0:0.0:1.0:0.0	.	568;405	P85037;P85037-2	FOXK1_HUMAN;.	Q	405;324;568;451	ENSP00000394442:E405Q;ENSP00000328720:E568Q	ENSP00000328720:E568Q	E	+	1	0	FOXK1	4767226	1.000000	0.71417	0.987000	0.45799	0.799000	0.45148	7.868000	0.87116	2.573000	0.86826	0.655000	0.94253	GAG		0.637	FOXK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323729.2			9	94	0	0	0	0	9	94				
MACC1	346389	broad.mit.edu	37	7	20198921	20198921	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr7:20198921G>C	ENST00000400331.5	-	5	1371	c.1063C>G	c.(1063-1065)Ctt>Gtt	p.L355V	MACC1_ENST00000332878.4_Missense_Mutation_p.L355V|MACC1_ENST00000589011.1_Missense_Mutation_p.L355V	NM_182762.3	NP_877439.3	Q6ZN28	MACC1_HUMAN	metastasis associated in colon cancer 1	355					positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(15)|lung(12)|ovary(2)|prostate(1)|skin(3)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(1)	39						GGTGACGGAAGAGCTTTAGCT	0.398																																						uc003sus.3		NA																	0				ovary(2)|skin(1)	3						c.(1063-1065)CTT>GTT		putative binding protein 7a5							62.0	56.0	58.0					7																	20198921		2203	4300	6503	SO:0001583	missense	346389				positive regulation of cell division|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	growth factor activity	g.chr7:20198921G>C		CCDS5369.1	7p15.3	2008-10-14			ENSG00000183742	ENSG00000183742			30215	protein-coding gene	gene with protein product		612646					Standard	NM_182762		Approved	7A5, SH3BP4L	uc003sus.4	Q6ZN28	OTTHUMG00000128415	ENST00000400331.5:c.1063C>G	7.37:g.20198921G>C	ENSP00000383185:p.Leu355Val		Somatic				MACC1_uc010kug.2_Missense_Mutation_p.L355V	p.L355V	NM_182762	NP_877439	WXS	Illumina HiSeq	Unspecified	Q6ZN28	MACC1_HUMAN			5	1372	-			355					A8MUS5|B2RNR9|Q6ZQN8|Q7Z5A5	Missense_Mutation	SNP	ENST00000400331.5	37	c.1063C>G	CCDS5369.1	.	.	.	.	.	.	.	.	.	.	G	0.015	-1.541666	0.00934	.	.	ENSG00000183742	ENST00000400331;ENST00000332878	T;T	0.07216	3.21;3.21	5.72	-4.22	0.03800	.	0.628302	0.17567	N	0.169581	T	0.03564	0.0102	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.42085	-0.9472	10	0.15499	T	0.54	-0.1652	8.7503	0.34611	0.0:0.2872:0.4113:0.3015	.	355	Q6ZN28	MACC1_HUMAN	V	355	ENSP00000383185:L355V;ENSP00000328410:L355V	ENSP00000328410:L355V	L	-	1	0	MACC1	20165446	0.000000	0.05858	0.011000	0.14972	0.180000	0.23129	-0.334000	0.07883	-1.107000	0.03004	-1.058000	0.02302	CTT		0.398	MACC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250202.5	NM_182762		3	67	0	0	0	0	3	67				
NT5C3A	51251	broad.mit.edu	37	7	33066516	33066516	+	Silent	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr7:33066516G>A	ENST00000242210.7	-	2	241	c.165C>T	c.(163-165)ttC>ttT	p.F55F	NT5C3A_ENST00000396152.2_Silent_p.F16F|NT5C3A_ENST00000409467.1_Silent_p.F4F|NT5C3A_ENST00000610140.1_Silent_p.F50F|NT5C3A_ENST00000409787.1_Silent_p.F16F|NT5C3A_ENST00000405342.1_Silent_p.F16F|AVL9_ENST00000404479.1_Intron|NT5C3A_ENST00000381626.2_Silent_p.F4F	NM_001002009.2|NM_001002010.2	NP_001002009.1|NP_001002010.1	Q9H0P0	5NT3A_HUMAN	5'-nucleotidase, cytosolic IIIA	55					dephosphorylation (GO:0016311)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide metabolic process (GO:0009117)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside metabolic process (GO:0006213)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	2'-phosphotransferase activity (GO:0008665)|5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)										AACTTTTCTGGAATTCTGGCA	0.343																																						uc003tdk.2		NA																	0				ovary(1)	1						c.(163-165)TTC>TTT		5'-nucleotidase, cytosolic III isoform 1							68.0	67.0	67.0					7																	33066516		2203	4299	6502	SO:0001819	synonymous_variant	51251				nucleotide metabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	cytosol|endoplasmic reticulum	2'-phosphotransferase activity|5'-nucleotidase activity|magnesium ion binding|nucleotide binding	g.chr7:33066516G>A	AF312735	CCDS34616.1, CCDS34617.1, CCDS55101.1	7p14.3	2013-03-06	2013-03-06	2013-03-06	ENSG00000122643	ENSG00000122643	3.1.3.5		17820	protein-coding gene	gene with protein product	"""lupin"""	606224	"""5'-nucleotidase, cytosolic III"""	NT5C3		11042152, 10942414	Standard	NM_001002010		Approved	UMPH1, PSN1, PN-I, UMPH, P5'N-1, cN-III, p36, POMP, hUMP1	uc003tdk.4	Q9H0P0	OTTHUMG00000152983	ENST00000242210.7:c.165C>T	7.37:g.33066516G>A			Somatic				AVL9_uc011kai.1_Intron|NT5C3_uc003tdi.2_Silent_p.F16F|NT5C3_uc003tdj.2_Silent_p.F16F	p.F55F	NM_001002010	NP_001002010	WXS	Illumina HiSeq	Unspecified	Q9H0P0	5NT3_HUMAN	GBM - Glioblastoma multiforme(11;0.0894)		2	242	-			55					A8K253|B2RAA5|B8ZZC4|Q6IPZ1|Q6NXS6|Q7L3G6|Q9P0P5|Q9UC42|Q9UC43|Q9UC44|Q9UC45	Silent	SNP	ENST00000242210.7	37	c.165C>T	CCDS34616.1																																																																																				0.343	NT5C3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328880.1	NM_016489		9	60	0	0	0	0	9	60				
ELMO1	9844	broad.mit.edu	37	7	37172813	37172813	+	Silent	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr7:37172813G>A	ENST00000310758.4	-	14	1760	c.1113C>T	c.(1111-1113)ttC>ttT	p.F371F	ELMO1_ENST00000448602.1_Silent_p.F371F|ELMO1_ENST00000341056.3_Silent_p.F73F|ELMO1_ENST00000442504.1_Silent_p.F371F	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1	371	ELMO. {ECO:0000255|PROSITE- ProRule:PRU00664}.				actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						GAGTCTGCGTGAAGTCCATGG	0.468																																						uc003tfk.1		NA																	0				ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6						c.(1111-1113)TTC>TTT		engulfment and cell motility 1 isoform 1							153.0	132.0	139.0					7																	37172813		2203	4300	6503	SO:0001819	synonymous_variant	9844				actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding	g.chr7:37172813G>A	AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.1113C>T	7.37:g.37172813G>A			Somatic				ELMO1_uc011kbc.1_Silent_p.F275F|ELMO1_uc010kxg.1_Silent_p.F371F	p.F371F	NM_014800	NP_055615	WXS	Illumina HiSeq	Unspecified	Q92556	ELMO1_HUMAN			14	1420	-			371			ELMO.		A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Silent	SNP	ENST00000310758.4	37	c.1113C>T	CCDS5449.1	.	.	.	.	.	.	.	.	.	.	G	9.969	1.224879	0.22457	.	.	ENSG00000155849	ENST00000433246	.	.	.	5.27	-2.38	0.06622	.	.	.	.	.	T	0.58163	0.2103	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55811	-0.8082	4	.	.	.	.	12.5218	0.56065	0.5019:0.0:0.4981:0.0	.	.	.	.	L	151	.	.	S	-	2	0	ELMO1	37139338	0.947000	0.32204	0.975000	0.42487	0.982000	0.71751	0.012000	0.13287	-0.593000	0.05844	0.655000	0.94253	TCA		0.468	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219830.4	NM_130442		14	141	0	0	0	0	14	141				
YAE1D1	57002	broad.mit.edu	37	7	39606114	39606114	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr7:39606114G>C	ENST00000223273.2	+	1	140	c.97G>C	c.(97-99)Gaa>Caa	p.E33Q	YAE1D1_ENST00000448268.1_Missense_Mutation_p.E33Q|YAE1D1_ENST00000432096.2_Missense_Mutation_p.E33Q|AC011290.4_ENST00000439751.2_RNA	NM_020192.3	NP_064577.1	Q9NRH1	YAED1_HUMAN	Yae1 domain containing 1	33																	GGCGCAGCGGGAATGGCAGAG	0.587																																						uc003thc.3		NA																	0					0						c.(97-99)GAA>CAA		hypothetical protein LOC57002							90.0	80.0	83.0					7																	39606114		2203	4300	6503	SO:0001583	missense	57002							g.chr7:39606114G>C	AF226046	CCDS5459.1, CCDS64630.1	7p14.1	2011-11-24	2011-11-24	2011-11-24	ENSG00000241127	ENSG00000241127			24857	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 36"""	C7orf36		12477932	Standard	NM_020192		Approved	GK003	uc003thc.4	Q9NRH1	OTTHUMG00000128689	ENST00000223273.2:c.97G>C	7.37:g.39606114G>C	ENSP00000223273:p.Glu33Gln		Somatic					p.E33Q	NM_020192	NP_064577	WXS	Illumina HiSeq	Unspecified	Q9NRH1	CG036_HUMAN			1	106	+			33					A4D1W4|B4DE83|Q6IAF7|Q8WVZ5	Missense_Mutation	SNP	ENST00000223273.2	37	c.97G>C	CCDS5459.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.048850	0.75846	.	.	ENSG00000241127	ENST00000223273;ENST00000448268;ENST00000432096	T;T;T	0.55413	0.52;0.67;0.63	5.65	5.65	0.86999	.	0.050221	0.85682	D	0.000000	T	0.66376	0.2783	M	0.86343	2.81	0.47123	D	0.999321	D	0.59767	0.986	P	0.47206	0.541	T	0.74763	-0.3555	10	0.72032	D	0.01	-13.8636	17.5154	0.87771	0.0:0.0:1.0:0.0	.	33	Q9NRH1	CG036_HUMAN	Q	33	ENSP00000223273:E33Q;ENSP00000400511:E33Q;ENSP00000395777:E33Q	ENSP00000223273:E33Q	E	+	1	0	C7orf36	39572639	1.000000	0.71417	1.000000	0.80357	0.732000	0.41865	6.204000	0.72143	2.646000	0.89796	0.655000	0.94253	GAA		0.587	YAE1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250586.1	NM_020192		5	36	0	0	0	0	5	36				
CDK13	8621	broad.mit.edu	37	7	40041594	40041594	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr7:40041594G>C	ENST00000181839.4	+	5	2922	c.2317G>C	c.(2317-2319)Gat>Cat	p.D773H	CDK13_ENST00000340829.5_Missense_Mutation_p.D773H|CDK13_ENST00000484589.1_3'UTR	NM_003718.4|NM_031267.3	NP_003709.3|NP_112557.2	Q14004	CDK13_HUMAN	cyclin-dependent kinase 13	773	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				alternative mRNA splicing, via spliceosome (GO:0000380)|hemopoiesis (GO:0030097)|multicellular organismal development (GO:0007275)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|positive regulation of cell proliferation (GO:0008284)|regulation of mitosis (GO:0007088)|viral process (GO:0016032)	cyclin K-CDK13 complex (GO:0002945)|extracellular space (GO:0005615)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(2)|prostate(2)|skin(5)|stomach(2)|urinary_tract(1)	49						AATAGTGACTGATAAAGAAGA	0.323																																						uc003thh.3		NA																	0				lung(2)|skin(2)|ovary(1)	5						c.(2317-2319)GAT>CAT		cell division cycle 2-like 5 isoform 1							57.0	61.0	59.0					7																	40041594		2202	4296	6498	SO:0001583	missense	8621				alternative nuclear mRNA splicing, via spliceosome|hemopoiesis|interspecies interaction between organisms|phosphorylation of RNA polymerase II C-terminal domain|positive regulation of cell proliferation|regulation of mitosis	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity	g.chr7:40041594G>C	M80629	CCDS5461.1, CCDS5462.1	7p14.1	2011-11-08	2009-12-16	2009-12-16	ENSG00000065883	ENSG00000065883		"""Cyclin-dependent kinases"""	1733	protein-coding gene	gene with protein product	"""cholinesterase-related cell division controller"""	603309	"""cell division cycle 2-like 5 (cholinesterase-related cell division controller)"""	CDC2L5		1731328, 19884882	Standard	NM_003718		Approved	CHED, CDC2L, KIAA1791	uc003thh.4	Q14004	OTTHUMG00000023726	ENST00000181839.4:c.2317G>C	7.37:g.40041594G>C	ENSP00000181839:p.Asp773His		Somatic				CDK13_uc003thi.3_Missense_Mutation_p.D773H|CDK13_uc011kbf.1_Missense_Mutation_p.D159H	p.D773H	NM_003718	NP_003709	WXS	Illumina HiSeq	Unspecified	Q14004	CDK13_HUMAN			5	2599	+			773			Protein kinase.		Q53G78|Q6DKQ9|Q75MH4|Q75MH5|Q96JN4|Q9H4A0|Q9H4A1|Q9UDR4	Missense_Mutation	SNP	ENST00000181839.4	37	c.2317G>C	CCDS5461.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.695833	0.88830	.	.	ENSG00000065883	ENST00000181839;ENST00000340829	T;T	0.67171	-0.25;-0.25	5.5	5.5	0.81552	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.80088	0.4559	L	0.57130	1.785	0.80722	D	1	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.91635	0.981;0.999;0.997	T	0.78104	-0.2334	8	.	.	.	-13.1416	19.4117	0.94675	0.0:0.0:1.0:0.0	.	159;773;773	Q9BVE2;Q14004-2;Q14004	.;.;CDK13_HUMAN	H	773	ENSP00000181839:D773H;ENSP00000340557:D773H	.	D	+	1	0	CDK13	40008119	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.852000	0.99516	2.580000	0.87095	0.467000	0.42956	GAT		0.323	CDK13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250726.2	NM_003718		16	78	0	0	0	0	16	78				
CCM2	83605	broad.mit.edu	37	7	45113081	45113081	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr7:45113081G>A	ENST00000258781.6	+	8	975	c.826G>A	c.(826-828)Gtg>Atg	p.V276M	CCM2_ENST00000461377.1_3'UTR|CCM2_ENST00000544363.1_Missense_Mutation_p.V185M|CCM2_ENST00000541586.1_Missense_Mutation_p.V218M|CCM2_ENST00000474617.1_Missense_Mutation_p.V179M|CCM2_ENST00000475551.1_Missense_Mutation_p.V270M|CCM2_ENST00000381112.3_Missense_Mutation_p.V297M	NM_031443.3	NP_113631.1	Q9BSQ5	CCM2_HUMAN	cerebral cavernous malformation 2	276					blood vessel endothelial cell differentiation (GO:0060837)|cell-cell junction organization (GO:0045216)|endothelial cell development (GO:0001885)|endothelial tube morphogenesis (GO:0061154)|in utero embryonic development (GO:0001701)|inner ear development (GO:0048839)|integrin-mediated signaling pathway (GO:0007229)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|stress-activated MAPK cascade (GO:0051403)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)	cytoplasm (GO:0005737)|protein complex (GO:0043234)				NS(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19						ATCTGTGGATGTGGGTGGTGC	0.587																																						uc003tmo.2		NA																	0					0						c.(826-828)GTG>ATG		cerebral cavernous malformation 2 isoform 2							107.0	77.0	87.0					7																	45113081		2203	4300	6503	SO:0001583	missense	83605	Familial_Cerebral_Cavernous_Angioma			endothelial tube morphogenesis|integrin-mediated signaling pathway|stress-activated MAPK cascade|vasculogenesis	cytoplasm	protein binding	g.chr7:45113081G>A	BC004903	CCDS5500.1, CCDS34630.1, CCDS55108.1, CCDS55109.1	7p13	2014-09-17	2004-02-13	2004-02-18	ENSG00000136280	ENSG00000136280			21708	protein-coding gene	gene with protein product	"""malcavernin"""	607929	"""chromosome 7 open reading frame 22"""	C7orf22		9811928	Standard	NM_001029835		Approved	MGC4607	uc003tms.3	Q9BSQ5	OTTHUMG00000129246	ENST00000258781.6:c.826G>A	7.37:g.45113081G>A	ENSP00000258781:p.Val276Met		Somatic				CCM2_uc003tmn.2_RNA|CCM2_uc003tmp.2_Missense_Mutation_p.V218M|CCM2_uc003tmq.2_RNA|CCM2_uc003tmr.2_Missense_Mutation_p.V185M|CCM2_uc003tms.2_Missense_Mutation_p.V297M	p.V276M	NM_031443	NP_113631	WXS	Illumina HiSeq	Unspecified	Q9BSQ5	CCM2_HUMAN			8	972	+			276					A4D2L4|B3KUV0|D3DVL4|E9PDJ3|F5H0E1|F5H551|Q71RE5|Q8TAT4	Missense_Mutation	SNP	ENST00000258781.6	37	c.826G>A	CCDS5500.1	.	.	.	.	.	.	.	.	.	.	G	16.53	3.148134	0.57151	.	.	ENSG00000136280	ENST00000258781;ENST00000541586;ENST00000544363;ENST00000475551;ENST00000381112;ENST00000474617	T;T;T;T;T;T	0.39592	1.07;1.07;1.07;1.07;1.07;1.07	5.11	-1.44	0.08856	.	0.591086	0.18265	N	0.146505	T	0.30823	0.0777	N	0.08118	0	0.09310	N	1	B;D;P;B	0.67145	0.003;0.996;0.547;0.001	B;P;B;B	0.59221	0.001;0.854;0.247;0.001	T	0.22626	-1.0211	10	0.48119	T	0.1	-0.1119	6.3197	0.21211	0.2806:0.2233:0.4961:0.0	.	297;185;218;276	E9PDJ3;F5H0E1;F5H551;Q9BSQ5	.;.;.;CCM2_HUMAN	M	276;218;185;270;297;179	ENSP00000258781:V276M;ENSP00000444725:V218M;ENSP00000438035:V185M;ENSP00000417180:V270M;ENSP00000370503:V297M;ENSP00000419474:V179M	ENSP00000258781:V276M	V	+	1	0	CCM2	45079606	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.174000	0.09839	-0.235000	0.09767	-0.140000	0.14226	GTG		0.587	CCM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251348.1	NM_031443		5	30	0	0	0	0	5	30				
STYXL1	51657	broad.mit.edu	37	7	75643194	75643194	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr7:75643194G>A	ENST00000248600.1	-	5	661	c.319C>T	c.(319-321)Caa>Taa	p.Q107*	STYXL1_ENST00000359697.3_Nonsense_Mutation_p.Q107*|STYXL1_ENST00000431581.1_Nonsense_Mutation_p.Q107*|STYXL1_ENST00000360591.3_Intron|STYXL1_ENST00000451157.1_Nonsense_Mutation_p.Q107*|STYXL1_ENST00000460184.2_5'UTR|STYXL1_ENST00000340062.5_Intron	NM_016086.2	NP_057170.1	Q9Y6J8	STYL1_HUMAN	serine/threonine/tyrosine interacting-like 1	107	Rhodanese.				intracellular signal transduction (GO:0035556)|protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	10						ATGGCTGCTTGAGGCACAAGA	0.522																																						uc003uej.3		NA																	0					0						c.(319-321)CAA>TAA		map kinase phosphatase-like protein MK-STYX							127.0	112.0	117.0					7																	75643194		2203	4300	6503	SO:0001587	stop_gained	51657				intracellular signal transduction|protein dephosphorylation	intracellular	protein binding|protein tyrosine/serine/threonine phosphatase activity	g.chr7:75643194G>A	AF069762	CCDS5580.1	7q11.23	2011-06-09	2005-09-22	2005-09-22	ENSG00000127952	ENSG00000127952		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	18165	protein-coding gene	gene with protein product			"""dual specificity phosphatase 24 (putative)"""	DUSP24		9757831	Standard	NM_016086		Approved	MK-STYX	uc003uel.3	Q9Y6J8	OTTHUMG00000130459	ENST00000248600.1:c.319C>T	7.37:g.75643194G>A	ENSP00000248600:p.Gln107*		Somatic				STYXL1_uc011kgf.1_Intron|STYXL1_uc011kgg.1_5'UTR|STYXL1_uc003ueh.2_Intron|STYXL1_uc003uek.3_Intron|STYXL1_uc003uel.2_Nonsense_Mutation_p.Q107*|STYXL1_uc003uem.2_Nonsense_Mutation_p.Q107*|STYXL1_uc010ldg.1_Intron|STYXL1_uc010ldh.1_Nonsense_Mutation_p.Q107*|STYXL1_uc003uen.1_Nonsense_Mutation_p.Q107*	p.Q107*	NM_016086	NP_057170	WXS	Illumina HiSeq	Unspecified	Q9Y6J8	STYL1_HUMAN			5	492	-			107			Rhodanese.		Q9UBP1|Q9UK06|Q9UK07|Q9UKG2|Q9UKG3	Nonsense_Mutation	SNP	ENST00000248600.1	37	c.319C>T	CCDS5580.1	.	.	.	.	.	.	.	.	.	.	G	19.50	3.838522	0.71373	.	.	ENSG00000127952	ENST00000248600;ENST00000359697;ENST00000404050;ENST00000431581;ENST00000454618;ENST00000451157	.	.	.	5.26	3.45	0.39498	.	0.246336	0.39210	N	0.001421	.	.	.	.	.	.	0.22185	N	0.999301	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	-13.7175	12.5793	0.56381	0.0:0.677:0.323:0.0	.	.	.	.	X	107;107;107;107;62;107	.	ENSP00000248600:Q107X	Q	-	1	0	STYXL1	75481130	0.150000	0.22732	0.021000	0.16686	0.000000	0.00434	1.185000	0.32065	0.730000	0.32425	-1.173000	0.01734	CAA		0.522	STYXL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344825.1	NM_016086		23	129	0	0	0	0	23	129				
SRRM3	222183	broad.mit.edu	37	7	75896598	75896598	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr7:75896598G>A	ENST00000326382.8	+	11	1060	c.853G>A	c.(853-855)Gaa>Aaa	p.E285K	SRRM3_ENST00000388802.4_Missense_Mutation_p.E285K|SRRM3_ENST00000464752.1_3'UTR	NM_001110199.1	NP_001103669.1	A6NNA2	SRRM3_HUMAN	serine/arginine repetitive matrix 3	285	Arg-rich.|Ser-rich.									NS(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|pancreas(1)	8						GCACCGAGACGAAGGGCGAAA	0.706																																						uc010ldi.2		NA																	0					0						c.(853-855)GAA>AAA		serine/arginine repetitive matrix 3							9.0	11.0	10.0					7																	75896598		1544	3549	5093	SO:0001583	missense	222183							g.chr7:75896598G>A	AK092590		7q11.23	2014-02-12			ENSG00000177679	ENSG00000177679			26729	protein-coding gene	gene with protein product							Standard	NM_001291831		Approved	FLJ37078	uc010ldi.2	A6NNA2	OTTHUMG00000130489	ENST00000326382.8:c.853G>A	7.37:g.75896598G>A	ENSP00000325298:p.Glu285Lys		Somatic				SRRM3_uc011kgi.1_5'UTR	p.E285K	NM_001110199	NP_001103669	WXS	Illumina HiSeq	Unspecified					11	1062	+								A6ND75	Missense_Mutation	SNP	ENST00000326382.8	37	c.853G>A		.	.	.	.	.	.	.	.	.	.	G	16.63	3.176972	0.57692	.	.	ENSG00000177679	ENST00000388802;ENST00000326382	T	0.02369	4.32	3.98	2.09	0.27110	.	0.852454	0.09813	N	0.752620	T	0.01976	0.0062	N	0.24115	0.695	0.21256	N	0.999742	B	0.23249	0.082	B	0.12837	0.008	T	0.47699	-0.9097	10	0.06365	T	0.9	-0.543	6.9348	0.24461	0.0964:0.0:0.7312:0.1723	.	285	A6NNA2	SRRM3_HUMAN	K	285	ENSP00000373454:E285K	ENSP00000325298:E285K	E	+	1	0	SRRM3	75734534	0.998000	0.40836	0.985000	0.45067	0.916000	0.54674	3.154000	0.50693	0.159000	0.19401	0.400000	0.26472	GAA		0.706	SRRM3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000252889.2	NM_001110199		4	13	0	0	0	0	4	13				
PCLO	27445	broad.mit.edu	37	7	82453635	82453635	+	Missense_Mutation	SNP	T	T	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr7:82453635T>C	ENST00000333891.9	-	19	14850	c.14513A>G	c.(14512-14514)cAt>cGt	p.H4838R	PCLO_ENST00000423517.2_Missense_Mutation_p.H4838R|PCLO_ENST00000426442.2_5'UTR	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CTGACTGGAATGAGACTTGCC	0.433																																						uc003uhx.2		NA																	0				ovary(7)	7						c.(14512-14514)CAT>CGT		piccolo isoform 1							106.0	104.0	104.0					7																	82453635		2006	4187	6193	SO:0001583	missense	27445				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity	g.chr7:82453635T>C	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.14513A>G	7.37:g.82453635T>C	ENSP00000334319:p.His4838Arg		Somatic				PCLO_uc003uhv.2_Missense_Mutation_p.H4838R|PCLO_uc003uht.1_Missense_Mutation_p.H280R|PCLO_uc003uhu.1_Missense_Mutation_p.H259R	p.H4838R	NM_033026	NP_149015	WXS	Illumina HiSeq	Unspecified	Q9Y6V0	PCLO_HUMAN			19	14802	-			4700			Ser-rich.			Missense_Mutation	SNP	ENST00000333891.9	37	c.14513A>G	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	T	10.63	1.403209	0.25291	.	.	ENSG00000186472	ENST00000333891;ENST00000423517;ENST00000380195	T;T	0.16743	2.32;2.37	5.48	5.48	0.80851	.	.	.	.	.	T	0.32071	0.0817	L	0.32530	0.975	0.80722	D	1	P;D;D;D	0.67145	0.937;0.963;0.996;0.993	P;P;D;D	0.77557	0.572;0.714;0.99;0.977	T	0.05321	-1.0892	9	0.87932	D	0	.	15.5647	0.76281	0.0:0.0:0.0:1.0	.	4838;4838;259;326	Q9Y6V0-5;Q9Y6V0-6;Q9Y6V0-3;Q32P40	.;.;.;.	R	4838;4838;325	ENSP00000334319:H4838R;ENSP00000388393:H4838R	ENSP00000334319:H4838R	H	-	2	0	PCLO	82291571	1.000000	0.71417	0.820000	0.32676	0.517000	0.34286	4.314000	0.59166	2.088000	0.63022	0.482000	0.46254	CAT		0.433	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510		9	38	0	0	0	0	9	38				
AKAP9	10142	broad.mit.edu	37	7	91726162	91726162	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr7:91726162G>C	ENST00000359028.2	+	41	10126	c.9901G>C	c.(9901-9903)Gag>Cag	p.E3301Q	AKAP9_ENST00000356239.3_Missense_Mutation_p.E3297Q|AKAP9_ENST00000358100.2_Missense_Mutation_p.E3247Q			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	3301			E -> Q (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)	p.E3301Q(1)		NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TCGAAACTTAGAGCTTCAGGT	0.438			T	BRAF	papillary thyroid																																	uc003ulg.2		NA		Dom	yes		7	7q21-q22	10142	T	A kinase (PRKA) anchor protein (yotiao) 9			E	BRAF		papillary thyroid		1	Substitution - Missense(1)	p.E3301Q(1)	breast(1)	breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26						c.(9889-9891)GAG>CAG		A-kinase anchor protein 9 isoform 2							106.0	104.0	105.0					7																	91726162		2203	4300	6503	SO:0001583	missense	10142				G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding	g.chr7:91726162G>C	AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.9901G>C	7.37:g.91726162G>C	ENSP00000351922:p.Glu3301Gln		Somatic				AKAP9_uc003ulf.2_Missense_Mutation_p.E3289Q|AKAP9_uc003uli.2_Missense_Mutation_p.E2920Q|AKAP9_uc003ulj.2_Missense_Mutation_p.E1067Q|AKAP9_uc003ull.2_Missense_Mutation_p.E193Q	p.E3297Q	NM_005751	NP_005742	WXS	Illumina HiSeq	Unspecified	Q99996	AKAP9_HUMAN	STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)		41	10114	+	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		3301		E -> Q (in a breast cancer sample; somatic mutation).	Potential.		A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	ENST00000359028.2	37	c.9889G>C		.	.	.	.	.	.	.	.	.	.	G	16.25	3.071119	0.55646	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394534	T;T;T;T	0.05447	3.54;3.54;3.62;3.44	5.56	4.69	0.59074	.	0.170707	0.28192	N	0.016253	T	0.24890	0.0604	M	0.78637	2.42	0.39940	D	0.974392	D;D;D;D;D	0.76494	0.999;0.992;0.986;0.992;0.992	D;P;P;P;P	0.68621	0.959;0.813;0.655;0.813;0.813	T	0.04005	-1.0985	10	0.62326	D	0.03	.	14.8533	0.70316	0.0694:0.0:0.9306:0.0	.	572;3301;3301;3297;3289	B3KQF9;Q99996-6;Q99996;Q99996-2;Q99996-3	.;.;AKAP9_HUMAN;.;.	Q	3297;3301;3247;3301;1143	ENSP00000348573:E3297Q;ENSP00000351922:E3301Q;ENSP00000350813:E3247Q;ENSP00000378042:E1143Q	ENSP00000348573:E3297Q	E	+	1	0	AKAP9	91564098	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	5.270000	0.65547	1.488000	0.48433	0.655000	0.94253	GAG		0.438	AKAP9-202	KNOWN	basic	protein_coding	protein_coding		NM_005751		13	72	0	0	0	0	13	72				
SAMD9	54809	broad.mit.edu	37	7	92731898	92731898	+	Silent	SNP	T	T	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr7:92731898T>C	ENST00000379958.2	-	3	3782	c.3513A>G	c.(3511-3513)gaA>gaG	p.E1171E		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	1171						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			ACTCTCTATCTTCACTTTGCT	0.393																																						uc003umf.2		NA																	0				ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7						c.(3511-3513)GAA>GAG		sterile alpha motif domain containing 9							217.0	220.0	219.0					7																	92731898		2203	4300	6503	SO:0001819	synonymous_variant	54809					cytoplasm		g.chr7:92731898T>C	AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.3513A>G	7.37:g.92731898T>C			Somatic				SAMD9_uc003umg.2_Silent_p.E1171E	p.E1171E	NM_017654	NP_060124	WXS	Illumina HiSeq	Unspecified	Q5K651	SAMD9_HUMAN	STAD - Stomach adenocarcinoma(171;0.000302)		3	3769	-	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		1171					A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Silent	SNP	ENST00000379958.2	37	c.3513A>G	CCDS34680.1																																																																																				0.393	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341761.1	NM_017654		25	163	0	0	0	0	25	163				
TAF6	6878	broad.mit.edu	37	7	99705659	99705659	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr7:99705659G>A	ENST00000344095.4	-	14	2071	c.1546C>T	c.(1546-1548)Cct>Tct	p.P516S	TAF6_ENST00000452041.1_Missense_Mutation_p.P516S|TAF6_ENST00000418432.2_Missense_Mutation_p.P440S|TAF6_ENST00000453269.2_Missense_Mutation_p.P516S|TAF6_ENST00000472509.1_Missense_Mutation_p.P573S|TAF6_ENST00000437822.2_Missense_Mutation_p.P553S|AP4M1_ENST00000421755.1_Intron	NM_005641.3	NP_005632.1	P49848	TAF6_HUMAN	TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa	516					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(2)	26	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GTCTGGACAGGAAGTGCGATG	0.647																																						uc003uti.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1546-1548)CCT>TCT		TBP-associated factor 6 isoform alpha							33.0	36.0	35.0					7																	99705659		2203	4300	6503	SO:0001583	missense	6878				negative regulation of cell cycle|negative regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr7:99705659G>A		CCDS5686.1, CCDS55135.1	7q	2010-02-26	2002-08-29	2001-12-07	ENSG00000106290	ENSG00000106290			11540	protein-coding gene	gene with protein product	"""TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80 kD"", ""transcription initiation factor TFIID 70 kD subunit"""	602955	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, E, 70/85kD"""	TAF2E		826207	Standard	NM_139315		Approved	TAFII70, TAFII80, MGC:8964, TAFII85	uc011kji.2	P49848	OTTHUMG00000154771	ENST00000344095.4:c.1546C>T	7.37:g.99705659G>A	ENSP00000344537:p.Pro516Ser		Somatic				AP4M1_uc003utd.2_Intron|TAF6_uc003utg.2_Missense_Mutation_p.P438S|TAF6_uc003uth.2_Missense_Mutation_p.P573S|TAF6_uc003utk.2_Missense_Mutation_p.P516S|TAF6_uc011kji.1_Missense_Mutation_p.P553S|TAF6_uc003utj.2_Missense_Mutation_p.P506S|TAF6_uc003utl.2_Missense_Mutation_p.P506S|TAF6_uc003utm.2_Missense_Mutation_p.P516S	p.P516S	NM_139315	NP_647476	WXS	Illumina HiSeq	Unspecified	P49848	TAF6_HUMAN			14	1627	-	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)		516					A4D2B2|A4D2B3|B4DT11|D6W5U2|Q6AI29	Missense_Mutation	SNP	ENST00000344095.4	37	c.1546C>T	CCDS5686.1	.	.	.	.	.	.	.	.	.	.	G	10.23	1.293889	0.23564	.	.	ENSG00000106290	ENST00000453269;ENST00000472509;ENST00000452041;ENST00000344095;ENST00000418432;ENST00000437822	T;T;T;T;T	0.44083	0.96;0.93;0.96;0.96;0.94	5.41	4.53	0.55603	.	0.090843	0.46758	D	0.000275	T	0.49457	0.1558	L	0.43152	1.355	0.38201	D	0.940197	D;D;D;D;D	0.89917	1.0;0.988;0.98;0.98;1.0	D;D;D;D;D	0.79108	0.992;0.986;0.968;0.968;0.992	T	0.48758	-0.9007	10	0.06625	T	0.88	-9.7712	12.0311	0.53397	0.0829:0.0:0.9171:0.0	.	553;506;506;516;440	B4DT11;P49848-2;A4D299;P49848;B3KUR4	.;.;.;TAF6_HUMAN;.	S	516;573;516;516;440;553	ENSP00000389575:P516S;ENSP00000419760:P573S;ENSP00000416396:P516S;ENSP00000344537:P516S;ENSP00000399982:P553S	ENSP00000344537:P516S	P	-	1	0	TAF6	99543595	1.000000	0.71417	0.731000	0.30826	0.230000	0.25150	3.446000	0.52928	1.517000	0.48917	0.561000	0.74099	CCT		0.647	TAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337024.2	NM_005641		5	46	0	0	0	0	5	46				
TFR2	7036	broad.mit.edu	37	7	100229801	100229801	+	Silent	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr7:100229801G>A	ENST00000462107.1	-	8	1157	c.870C>T	c.(868-870)ttC>ttT	p.F290F	TFR2_ENST00000223051.3_Silent_p.F290F|TFR2_ENST00000431692.1_Intron|TFR2_ENST00000544242.1_5'UTR			Q9UP52	TFR2_HUMAN	transferrin receptor 2	290					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transferrin receptor activity (GO:0004998)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)				Gallium nitrate(DB05260)	CTTGAGCCCCGAAGTCCTGAG	0.557																																						uc003uvv.1		NA																	0				ovary(1)|pancreas(1)	2						c.(868-870)TTC>TTT		transferrin receptor 2							116.0	122.0	120.0					7																	100229801		2203	4300	6503	SO:0001819	synonymous_variant	7036				cellular iron ion homeostasis|iron ion transport|proteolysis	cytoplasm|integral to plasma membrane	peptidase activity|transferrin receptor activity	g.chr7:100229801G>A	AF053356	CCDS34707.1	7q22	2003-01-27			ENSG00000106327	ENSG00000106327			11762	protein-coding gene	gene with protein product		604720				9799793, 12130528	Standard	NM_003227		Approved	HFE3, TFRC2	uc003uvv.1	Q9UP52	OTTHUMG00000159598	ENST00000462107.1:c.870C>T	7.37:g.100229801G>A			Somatic				TFR2_uc010lhc.1_5'UTR|TFR2_uc003uvu.1_Silent_p.F119F	p.F290F	NM_003227	NP_003218	WXS	Illumina HiSeq	Unspecified	Q9UP52	TFR2_HUMAN			7	911	-	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)		290			Extracellular (Potential).		A6NGM7|O75422|Q1HE13|Q9HA99|Q9NX67	Silent	SNP	ENST00000462107.1	37	c.870C>T	CCDS34707.1																																																																																				0.557	TFR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356392.3	NM_003227		18	87	0	0	0	0	18	87				
PRSS1	5644	broad.mit.edu	37	7	142460822	142460822	+	Missense_Mutation	SNP	T	T	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr7:142460822T>G	ENST00000311737.7	+	5	701	c.695T>G	c.(694-696)gTc>gGc	p.V232G	PRSS1_ENST00000486171.1_Missense_Mutation_p.V246G	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	232	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	TACACCAAGGTCTACAACTAT	0.488																																						uc003wak.2		NA																	0				large_intestine(1)|central_nervous_system(1)	2						c.(694-696)GTC>GGC		protease, serine, 1 preproprotein							91.0	91.0	91.0					7																	142460822		2203	4300	6503	SO:0001583	missense	5644	Hereditary_Pancreatitis			digestion|proteolysis	extracellular space	metal ion binding|protein binding|serine-type endopeptidase activity	g.chr7:142460822T>G	M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.695T>G	7.37:g.142460822T>G	ENSP00000308720:p.Val232Gly		Somatic				uc011krr.1_Intron|uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|TRY6_uc011ksn.1_Intron|PRSS1_uc003wam.2_Missense_Mutation_p.V172G	p.V232G	NM_002769	NP_002760	WXS	Illumina HiSeq	Unspecified	P07477	TRY1_HUMAN	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		5	712	+	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	232			Peptidase S1.		A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Missense_Mutation	SNP	ENST00000311737.7	37	c.695T>G	CCDS5872.1	.	.	.	.	.	.	.	.	.	.	T	13.45	2.240834	0.39598	.	.	ENSG00000204983	ENST00000486171;ENST00000311737;ENST00000529243	D;D	0.96967	-4.19;-4.19	3.18	3.18	0.36537	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.85682	D	0.000000	D	0.98488	0.9496	H	0.95950	3.745	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98667	1.0686	10	0.87932	D	0	.	10.9387	0.47260	0.0:0.0:0.0:1.0	.	246;232	E7EQ64;P07477	.;TRY1_HUMAN	G	246;232;222	ENSP00000417854:V246G;ENSP00000308720:V232G	ENSP00000308720:V232G	V	+	2	0	PRSS1	142140396	1.000000	0.71417	0.973000	0.42090	0.055000	0.15305	7.731000	0.84895	1.405000	0.46838	0.164000	0.16699	GTC		0.488	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352538.2			16	66	0	0	0	0	16	66				
GIMAP8	155038	broad.mit.edu	37	7	150164001	150164001	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr7:150164001C>T	ENST00000307271.3	+	2	789	c.215C>T	c.(214-216)tCa>tTa	p.S72L		NM_175571.2	NP_783161.1	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	72	AIG1-type G 1.					cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(26)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		CTTTTCTCCTCAATAGCTTGT	0.493																																						uc003whj.2		NA																	0				skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7						c.(214-216)TCA>TTA		GTPase, IMAP family member 8							160.0	154.0	156.0					7																	150164001		2203	4300	6503	SO:0001583	missense	155038					endoplasmic reticulum|Golgi apparatus|mitochondrion	GTP binding	g.chr7:150164001C>T	AL834361	CCDS34777.1	7q36.1	2014-04-04			ENSG00000171115	ENSG00000171115		"""GTPases, IMAP"""	21792	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 9"""					15474311	Standard	XM_005249951		Approved	DKFZp667I133, hIAN6, IAN9	uc003whj.3	Q8ND71	OTTHUMG00000158327	ENST00000307271.3:c.215C>T	7.37:g.150164001C>T	ENSP00000305107:p.Ser72Leu		Somatic					p.S72L	NM_175571	NP_783161	WXS	Illumina HiSeq	Unspecified	Q8ND71	GIMA8_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)	2	545	+			72						Missense_Mutation	SNP	ENST00000307271.3	37	c.215C>T	CCDS34777.1	.	.	.	.	.	.	.	.	.	.	C	17.40	3.380076	0.61845	.	.	ENSG00000171115	ENST00000307271	T	0.60797	0.16	4.21	3.23	0.37069	AIG1 (1);	1.591490	0.04093	N	0.311620	T	0.65842	0.2730	L	0.42529	1.33	0.09310	N	1	D	0.60575	0.988	P	0.60473	0.875	T	0.53464	-0.8435	10	0.72032	D	0.01	.	6.1012	0.20049	0.0:0.8571:0.0:0.1429	.	72	Q8ND71	GIMA8_HUMAN	L	72	ENSP00000305107:S72L	ENSP00000305107:S72L	S	+	2	0	GIMAP8	149794934	0.000000	0.05858	0.060000	0.19600	0.373000	0.29922	0.644000	0.24766	2.191000	0.70037	0.655000	0.94253	TCA		0.493	GIMAP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350701.1	NM_175571		26	140	0	0	0	0	26	140				
ATG9B	285973	broad.mit.edu	37	7	150713883	150713883	+	Missense_Mutation	SNP	G	G	A	rs574780705		TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr7:150713883G>A	ENST00000605938.1	-	10	2390	c.2315C>T	c.(2314-2316)tCg>tTg	p.S772L	ATG9B_ENST00000444312.1_Silent_p.F257F|ATG9B_ENST00000494791.1_5'UTR|ATG9B_ENST00000377974.2_Silent_p.F771F	NM_173681.5	NP_775952.4	Q674R7	ATG9B_HUMAN	autophagy related 9B	0					autophagic vacuole assembly (GO:0000045)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(4)|prostate(1)	14	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GAGGGTGCACGAAGAGGTTGG	0.612													G|||	1	0.000199681	0.0	0.0014	5008	,	,		14336	0.0		0.0	False		,,,				2504	0.0					uc011kvc.1		NA																	0				ovary(1)	1						c.(2314-2316)TTC>TTT		ATG9 autophagy related 9 homolog B							40.0	44.0	43.0					7																	150713883		2051	4206	6257	SO:0001583	missense	285973				autophagic vacuole assembly	autophagic vacuole membrane|cytoplasmic vesicle|integral to membrane		g.chr7:150713883G>A	AK027791		7q36	2014-02-12	2012-06-06	2005-09-11	ENSG00000181652	ENSG00000181652			21899	protein-coding gene	gene with protein product		612205	"""nitric oxide synthase 3 antisense"", ""ATG9 autophagy related 9 homolog B (S. cerevisiae)"""	NOS3AS		15234981, 15755735	Standard	NM_173681		Approved	FLJ14885, APG9L2, SONE	uc011kvc.2	Q674R7	OTTHUMG00000158634	ENST00000605938.1:c.2315C>T	7.37:g.150713883G>A	ENSP00000475202:p.Ser772Leu		Somatic				ATG9B_uc003wig.3_RNA	p.F772F	NM_173681	NP_775952	WXS	Illumina HiSeq	Unspecified	Q674R7	ATG9B_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	12	2392	-	all_neural(206;0.219)		772			Cytoplasmic (By similarity).		A1A5D3|Q6JRW5|Q8N8I8	Silent	SNP	ENST00000605938.1	37	c.2316C>T		.	.	.	.	.	.	.	.	.	.	G	10.38	1.333763	0.24167	.	.	ENSG00000248602	ENST00000397266	.	.	.	5.33	3.53	0.40419	.	.	.	.	.	T	0.61464	0.2349	.	.	.	.	.	.	.	.	.	.	.	.	T	0.69472	-0.5136	4	0.35671	T	0.21	-3.6132	12.711	0.57089	0.0:0.6724:0.3276:0.0	.	.	.	.	L	772	.	ENSP00000380436:S772L	S	-	2	0	AC010973.1	150344816	0.971000	0.33674	0.791000	0.31998	0.471000	0.32888	1.762000	0.38451	1.233000	0.43693	-0.261000	0.10672	TCG		0.612	ATG9B-203	KNOWN	basic	protein_coding	protein_coding		NM_173681		6	21	0	0	0	0	6	21				
DUSP26	78986	broad.mit.edu	37	8	33454978	33454978	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr8:33454978C>T	ENST00000256261.4	-	2	573	c.56G>A	c.(55-57)cGg>cAg	p.R19Q	DUSP26_ENST00000523956.1_Missense_Mutation_p.R19Q	NM_024025.1	NP_076930.1	Q9BV47	DUS26_HUMAN	dual specificity phosphatase 26 (putative)	19					negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of cell adhesion (GO:0045785)|positive regulation of peptidyl-serine dephosphorylation (GO:1902310)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	p53 binding (GO:0002039)|phosphoprotein phosphatase activity (GO:0004721)|phosphoserine phosphatase activity (GO:0004647)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|RNA polymerase II activating transcription factor binding (GO:0001102)			NS(1)|breast(1)|kidney(1)|large_intestine(4)|lung(7)|skin(1)	15				KIRC - Kidney renal clear cell carcinoma(67;0.0918)|Kidney(114;0.111)		TGAGCTACTCCGGGAGAAGCG	0.557																																						uc003xjp.2		NA																	0					0						c.(55-57)CGG>CAG		dual specificity phosphatase 26							68.0	64.0	66.0					8																	33454978		2203	4300	6503	SO:0001583	missense	78986					Golgi apparatus|nucleus	protein binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr8:33454978C>T	AY902194	CCDS6092.1	8p12	2014-09-09			ENSG00000133878	ENSG00000133878		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	28161	protein-coding gene	gene with protein product							Standard	NM_024025		Approved	MGC1136, DUSP24	uc003xjp.3	Q9BV47	OTTHUMG00000163961	ENST00000256261.4:c.56G>A	8.37:g.33454978C>T	ENSP00000256261:p.Arg19Gln		Somatic				DUSP26_uc003xjq.2_Missense_Mutation_p.R19Q	p.R19Q	NM_024025	NP_076930	WXS	Illumina HiSeq	Unspecified	Q9BV47	DUS26_HUMAN		KIRC - Kidney renal clear cell carcinoma(67;0.0918)|Kidney(114;0.111)	2	389	-			19					D3DSV8|Q9BTW0	Missense_Mutation	SNP	ENST00000256261.4	37	c.56G>A	CCDS6092.1	.	.	.	.	.	.	.	.	.	.	C	34	5.395647	0.96009	.	.	ENSG00000133878	ENST00000256261;ENST00000523956;ENST00000522982	T;T;T	0.20200	3.89;3.89;2.09	5.5	5.5	0.81552	.	0.419375	0.23021	N	0.052859	T	0.33789	0.0875	L	0.34521	1.04	0.45390	D	0.998377	D	0.69078	0.997	D	0.67725	0.953	T	0.01600	-1.1315	10	0.21014	T	0.42	-19.8532	17.1605	0.86802	0.0:1.0:0.0:0.0	.	19	Q9BV47	DUS26_HUMAN	Q	19	ENSP00000256261:R19Q;ENSP00000429176:R19Q;ENSP00000430922:R19Q	ENSP00000256261:R19Q	R	-	2	0	DUSP26	33574520	1.000000	0.71417	0.994000	0.49952	0.912000	0.54170	7.234000	0.78134	2.590000	0.87494	0.561000	0.74099	CGG		0.557	DUSP26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376564.1	NM_024025		9	51	0	0	0	0	9	51				
GPR124	25960	broad.mit.edu	37	8	37690552	37690552	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr8:37690552C>G	ENST00000412232.2	+	9	1135	c.1122C>G	c.(1120-1122)atC>atG	p.I374M	GPR124_ENST00000315215.7_Missense_Mutation_p.I374M	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	374					central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			TGGCTGGCATCACAGCCTACC	0.667																																						uc003xkj.2		NA																	0				large_intestine(2)|ovary(2)|skin(1)	5						c.(1120-1122)ATC>ATG		G protein-coupled receptor 124 precursor							101.0	113.0	109.0					8																	37690552		2203	4300	6503	SO:0001583	missense	25960				central nervous system development|endothelial cell migration|neuropeptide signaling pathway|regulation of angiogenesis|regulation of chemotaxis|sprouting angiogenesis	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr8:37690552C>G	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.1122C>G	8.37:g.37690552C>G	ENSP00000406367:p.Ile374Met		Somatic				GPR124_uc010lvy.2_Missense_Mutation_p.I374M	p.I374M	NM_032777	NP_116166	WXS	Illumina HiSeq	Unspecified	Q96PE1	GP124_HUMAN	BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)		9	1485	+			374			Extracellular (Potential).		A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Missense_Mutation	SNP	ENST00000412232.2	37	c.1122C>G	CCDS6097.2	.	.	.	.	.	.	.	.	.	.	C	19.44	3.827480	0.71143	.	.	ENSG00000020181	ENST00000416514;ENST00000315215;ENST00000412232	T;T	0.62941	-0.01;-0.01	4.9	4.9	0.64082	GPCR, family 2, extracellular hormone receptor domain (2);	0.000000	0.85682	D	0.000000	T	0.73598	0.3607	L	0.59436	1.845	0.53688	D	0.999971	D;D	0.89917	0.998;1.0	D;D	0.87578	0.984;0.998	T	0.72001	-0.4422	10	0.35671	T	0.21	-28.3409	12.5342	0.56133	0.0:0.9195:0.0:0.0805	.	374;374	Q96PE1-2;Q96PE1	.;GP124_HUMAN	M	367;374;374	ENSP00000323508:I374M;ENSP00000406367:I374M	ENSP00000323508:I374M	I	+	3	3	GPR124	37809710	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.041000	0.41213	2.262000	0.75019	0.655000	0.94253	ATC		0.667	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2			15	134	0	0	0	0	15	134				
CHRNA6	8973	broad.mit.edu	37	8	42611780	42611780	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr8:42611780G>C	ENST00000276410.2	-	5	917	c.562C>G	c.(562-564)Ctt>Gtt	p.L188V	CHRNA6_ENST00000534622.1_Missense_Mutation_p.L173V|CHRNA6_ENST00000530869.1_5'Flank	NM_004198.3	NP_004189.1	Q15825	ACHA6_HUMAN	cholinergic receptor, nicotinic, alpha 6 (neuronal)	188					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|membrane depolarization (GO:0051899)|regulation of dopamine secretion (GO:0014059)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)			endometrium(2)|large_intestine(3)|liver(1)|lung(15)|ovary(1)	22	all_lung(13;3.33e-12)|Lung NSC(13;9.17e-11)|Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00439)|Lung NSC(58;0.0124)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	Lung(22;0.0252)|LUSC - Lung squamous cell carcinoma(45;0.0869)		Galantamine(DB00674)|Nicotine(DB00184)|Varenicline(DB01273)	ATGATTAGAAGATCAATTTCA	0.363																																						uc003xpj.2		NA																	0					0						c.(562-564)CTT>GTT		cholinergic receptor, nicotinic, alpha 6							112.0	109.0	110.0					8																	42611780		2203	4300	6503	SO:0001583	missense	8973					cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity	g.chr8:42611780G>C	U62435	CCDS6135.1, CCDS56536.1	8p22	2012-02-11	2012-02-07					"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	15963	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 6 (neuronal)"""	606888	"""cholinergic receptor, nicotinic, alpha polypeptide 6"""			8906617	Standard	NM_004198		Approved		uc003xpj.3	Q15825		ENST00000276410.2:c.562C>G	8.37:g.42611780G>C	ENSP00000276410:p.Leu188Val		Somatic				CHRNA6_uc011lcw.1_Missense_Mutation_p.L173V	p.L188V	NM_004198	NP_004189	WXS	Illumina HiSeq	Unspecified	Q15825	ACHA6_HUMAN	Lung(22;0.0252)|LUSC - Lung squamous cell carcinoma(45;0.0869)		5	608	-	all_lung(13;3.33e-12)|Lung NSC(13;9.17e-11)|Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00439)|Lung NSC(58;0.0124)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	188			Extracellular.		B2R8V4|B4DQH1	Missense_Mutation	SNP	ENST00000276410.2	37	c.562C>G	CCDS6135.1	.	.	.	.	.	.	.	.	.	.	G	19.13	3.768839	0.69878	.	.	ENSG00000147434	ENST00000276410;ENST00000534622;ENST00000533810	D;D;D	0.82081	-1.57;-1.57;-1.57	5.93	5.93	0.95920	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.89767	0.6810	M	0.73598	2.24	0.52501	D	0.999959	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.991	D	0.90094	0.4179	10	0.87932	D	0	.	11.3249	0.49442	0.1086:0.0:0.8914:0.0	.	173;188	B4DQH1;Q15825	.;ACHA6_HUMAN	V	188;173;109	ENSP00000276410:L188V;ENSP00000433871:L173V;ENSP00000434659:L109V	ENSP00000276410:L188V	L	-	1	0	CHRNA6	42730937	1.000000	0.71417	0.999000	0.59377	0.798000	0.45092	2.774000	0.47694	2.824000	0.97209	0.650000	0.86243	CTT		0.363	CHRNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383156.1			5	68	0	0	0	0	5	68				
CHD7	55636	broad.mit.edu	37	8	61736506	61736506	+	Silent	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr8:61736506C>T	ENST00000423902.2	+	13	3788	c.3309C>T	c.(3307-3309)gtC>gtT	p.V1103V	CHD7_ENST00000525508.1_Silent_p.V1103V|CHD7_ENST00000524602.1_Intron	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	1103	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			GCTGTGTAGTCATTGATGAAG	0.453																																						uc003xue.2		NA																	0				ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9						c.(3307-3309)GTC>GTT		chromodomain helicase DNA binding protein 7							129.0	128.0	128.0					8																	61736506		2066	4235	6301	SO:0001819	synonymous_variant	55636				central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity	g.chr8:61736506C>T	AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.3309C>T	8.37:g.61736506C>T			Somatic				CHD7_uc003xuf.2_Silent_p.V216V	p.V1103V	NM_017780	NP_060250	WXS	Illumina HiSeq	Unspecified	Q9P2D1	CHD7_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.143)		13	3786	+		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	1103			Helicase ATP-binding.		D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Silent	SNP	ENST00000423902.2	37	c.3309C>T	CCDS47865.1																																																																																				0.453	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2	XM_098762		13	118	0	0	0	0	13	118				
VCPIP1	80124	broad.mit.edu	37	8	67577807	67577807	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr8:67577807C>G	ENST00000310421.4	-	1	1645	c.1387G>C	c.(1387-1389)Gat>Cat	p.D463H	C8orf44-SGK3_ENST00000519289.1_5'Flank|C8orf44_ENST00000521889.1_5'Flank|C8orf44_ENST00000519561.1_5'Flank	NM_025054.4	NP_079330.2	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex interacting protein 1	463					endoplasmic reticulum membrane fusion (GO:0016320)|Golgi reassembly (GO:0090168)|mitotic nuclear division (GO:0007067)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)	ubiquitin-specific protease activity (GO:0004843)			breast(7)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(6)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			AGGCGATTATCCATTACTGCT	0.453																																					NSCLC(179;265 2915 6144 43644)	uc003xwn.2		NA																	0				lung(2)|ovary(2)|central_nervous_system(1)|breast(1)|skin(1)|kidney(1)	8						c.(1387-1389)GAT>CAT		valosin containing protein (p97)/p47 complex							140.0	138.0	139.0					8																	67577807		2203	4300	6503	SO:0001583	missense	80124				protein ubiquitination	endoplasmic reticulum|Golgi stack	ubiquitin-specific protease activity	g.chr8:67577807C>G	AB058753	CCDS6192.1	8q13	2014-02-24			ENSG00000175073	ENSG00000175073		"""OTU domain containing"""	30897	protein-coding gene	gene with protein product		611745				11347906, 12509440	Standard	NM_025054		Approved	VCIP135, KIAA1850, FLJ23132, DUBA3	uc003xwn.3	Q96JH7	OTTHUMG00000164560	ENST00000310421.4:c.1387G>C	8.37:g.67577807C>G	ENSP00000309031:p.Asp463His		Somatic				SGK3_uc003xwp.2_5'Flank|C8orf44_uc003xwo.1_5'Flank	p.D463H	NM_025054	NP_079330	WXS	Illumina HiSeq	Unspecified	Q96JH7	VCIP1_HUMAN	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)		1	1646	-		Lung NSC(129;0.142)|all_lung(136;0.227)	463					Q504T4|Q86T93|Q86W01|Q8N3A9|Q9H5R8	Missense_Mutation	SNP	ENST00000310421.4	37	c.1387G>C	CCDS6192.1	.	.	.	.	.	.	.	.	.	.	C	13.65	2.301227	0.40694	.	.	ENSG00000175073	ENST00000310421	T	0.34472	1.36	5.61	5.61	0.85477	.	0.102306	0.64402	D	0.000003	T	0.36082	0.0954	L	0.29908	0.895	0.80722	D	1	P	0.42039	0.769	B	0.42882	0.401	T	0.20940	-1.0260	10	0.87932	D	0	-14.559	19.6397	0.95753	0.0:1.0:0.0:0.0	.	463	Q96JH7	VCIP1_HUMAN	H	463	ENSP00000309031:D463H	ENSP00000309031:D463H	D	-	1	0	VCPIP1	67740361	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.632000	0.89209	0.655000	0.94253	GAT		0.453	VCPIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379227.1			30	233	0	0	0	0	30	233				
DCAF4L2	138009	broad.mit.edu	37	8	88885717	88885717	+	Silent	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr8:88885717C>T	ENST00000319675.3	-	1	579	c.483G>A	c.(481-483)gcG>gcA	p.A161A		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	161								p.A161A(2)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						TGAACAGCGACGCTGGGAGCA	0.567																																						uc003ydz.2		NA																	2	Substitution - coding silent(2)		large_intestine(1)|endometrium(1)	ovary(1)	1						c.(481-483)GCG>GCA		WD repeat domain 21C							101.0	94.0	96.0					8																	88885717		2203	4300	6503	SO:0001819	synonymous_variant	138009							g.chr8:88885717C>T	AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.483G>A	8.37:g.88885717C>T			Somatic					p.A161A	NM_152418	NP_689631	WXS	Illumina HiSeq	Unspecified	Q8NA75	DC4L2_HUMAN			1	580	-			161						Silent	SNP	ENST00000319675.3	37	c.483G>A	CCDS6245.1																																																																																				0.567	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375302.1	NM_152418		41	61	0	0	0	0	41	61				
OSGIN2	734	broad.mit.edu	37	8	90937302	90937302	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr8:90937302C>T	ENST00000297438.2	+	6	1415	c.1060C>T	c.(1060-1062)Cat>Tat	p.H354Y	OSGIN2_ENST00000451899.2_Missense_Mutation_p.H398Y	NM_004337.2	NP_004328.1	Q9Y236	OSGI2_HUMAN	oxidative stress induced growth inhibitor family member 2	354					meiotic nuclear division (GO:0007126)					breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|urinary_tract(1)	17			BRCA - Breast invasive adenocarcinoma(11;0.0344)			TCCTGAATATCATAAAGTCTA	0.368																																						uc003yeg.2		NA																	0					0						c.(1060-1062)CAT>TAT		oxidative stress induced growth inhibitor family							98.0	103.0	101.0					8																	90937302		2203	4300	6503	SO:0001583	missense	734				germ cell development|meiosis			g.chr8:90937302C>T	AF061326	CCDS6248.1, CCDS47888.1	8q21	2006-10-05	2006-10-05	2006-10-05	ENSG00000164823	ENSG00000164823			1355	protein-coding gene	gene with protein product		604598	"""chromosome 8 open reading frame 1"""	C8orf1		9933573	Standard	NM_004337		Approved	hT41	uc003yeh.3	Q9Y236	OTTHUMG00000163811	ENST00000297438.2:c.1060C>T	8.37:g.90937302C>T	ENSP00000297438:p.His354Tyr		Somatic				OSGIN2_uc003yeh.2_Missense_Mutation_p.H398Y	p.H354Y	NM_004337	NP_004328	WXS	Illumina HiSeq	Unspecified	Q9Y236	OSGI2_HUMAN	BRCA - Breast invasive adenocarcinoma(11;0.0344)		6	1406	+			354						Missense_Mutation	SNP	ENST00000297438.2	37	c.1060C>T	CCDS6248.1	.	.	.	.	.	.	.	.	.	.	C	18.34	3.602285	0.66445	.	.	ENSG00000164823	ENST00000297438;ENST00000451899	T;T	0.69435	-0.4;-0.4	5.36	5.36	0.76844	.	0.043183	0.85682	D	0.000000	D	0.83640	0.5298	M	0.83774	2.66	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.74023	0.982;0.959	D	0.85837	0.1395	10	0.72032	D	0.01	-17.5704	19.0965	0.93253	0.0:1.0:0.0:0.0	.	398;354	Q9Y236-2;Q9Y236	.;OSGI2_HUMAN	Y	354;398	ENSP00000297438:H354Y;ENSP00000396445:H398Y	ENSP00000297438:H354Y	H	+	1	0	OSGIN2	91006477	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.074000	0.71253	2.522000	0.85027	0.563000	0.77884	CAT		0.368	OSGIN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000375691.1	NM_004337		15	131	0	0	0	0	15	131				
RGS22	26166	broad.mit.edu	37	8	100975155	100975155	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr8:100975155G>C	ENST00000360863.6	-	25	3861	c.3667C>G	c.(3667-3669)Ctt>Gtt	p.L1223V	RGS22_ENST00000523287.1_Missense_Mutation_p.L1042V|RGS22_ENST00000523437.1_Missense_Mutation_p.L1211V	NM_015668.3	NP_056483.3	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	1223					positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.L1223I(2)	RGS22/SYCP1(2)	breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(33)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	68			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			ATCTTAAGAAGAATTCTCTCC	0.308																																						uc003yjb.1		NA																	2	Substitution - Missense(2)		large_intestine(2)	ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7						c.(3667-3669)CTT>GTT		regulator of G-protein signaling 22							68.0	65.0	66.0					8																	100975155		1802	4062	5864	SO:0001583	missense	26166				negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity	g.chr8:100975155G>C	AY009106	CCDS43758.1, CCDS69521.1, CCDS75775.1	8q22.2	2014-01-21	2007-08-14		ENSG00000132554	ENSG00000132554		"""Regulators of G-protein signaling"""	24499	protein-coding gene	gene with protein product		615650	"""regulator of G-protein signalling 22"""				Standard	XM_005250856		Approved	DKFZP434I092, PRTD-NY2, CT145	uc003yjb.1	Q8NE09	OTTHUMG00000164802	ENST00000360863.6:c.3667C>G	8.37:g.100975155G>C	ENSP00000354109:p.Leu1223Val		Somatic				RGS22_uc003yja.1_Missense_Mutation_p.L1042V|RGS22_uc003yjc.1_Missense_Mutation_p.L1211V	p.L1223V	NM_015668	NP_056483	WXS	Illumina HiSeq	Unspecified	Q8NE09	RGS22_HUMAN	Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)		25	3862	-			1223					A8K944|Q569L2|Q86Y71|Q9BYZ4|Q9UFN6	Missense_Mutation	SNP	ENST00000360863.6	37	c.3667C>G	CCDS43758.1	.	.	.	.	.	.	.	.	.	.	G	17.46	3.395211	0.62066	.	.	ENSG00000132554	ENST00000360863;ENST00000427793;ENST00000523287;ENST00000517843;ENST00000523437	T;T;T	0.55930	0.52;0.49;0.51	5.03	4.14	0.48551	.	0.000000	0.64402	D	0.000004	T	0.68430	0.3000	M	0.71581	2.175	0.26999	N	0.964953	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.80764	0.987;0.987;0.994	T	0.61282	-0.7094	10	0.72032	D	0.01	.	11.3655	0.49668	0.0922:0.0:0.9078:0.0	.	1211;1223;1042	A8K944;Q8NE09;G3V112	.;RGS22_HUMAN;.	V	1223;1210;1042;95;1211	ENSP00000354109:L1223V;ENSP00000429382:L1042V;ENSP00000428212:L1211V	ENSP00000354109:L1223V	L	-	1	0	RGS22	101044331	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.430000	0.52807	2.488000	0.83962	0.491000	0.48974	CTT		0.308	RGS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380365.1	NM_015668		4	35	0	0	0	0	4	35				
FAM91A1	157769	broad.mit.edu	37	8	124801858	124801858	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr8:124801858G>C	ENST00000334705.7	+	15	1530	c.1284G>C	c.(1282-1284)caG>caC	p.Q428H	FAM91A1_ENST00000521166.1_Missense_Mutation_p.Q428H	NM_144963.2	NP_659400	Q658Y4	F91A1_HUMAN	family with sequence similarity 91, member A1	428										breast(4)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28	Lung NSC(37;8.76e-13)|Ovarian(258;0.00744)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00192)			TTTAGGTTCAGAGCACTGGTG	0.333																																						uc003yqv.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1282-1284)CAG>CAC		hypothetical protein LOC157769							122.0	108.0	112.0					8																	124801858		1856	4098	5954	SO:0001583	missense	157769							g.chr8:124801858G>C	AK074370	CCDS6346.2	8q24.13	2005-10-04			ENSG00000176853	ENSG00000176853			26306	protein-coding gene	gene with protein product						12477932	Standard	XM_005250806		Approved	FLJ23790	uc003yqv.3	Q658Y4	OTTHUMG00000133021	ENST00000334705.7:c.1284G>C	8.37:g.124801858G>C	ENSP00000335082:p.Gln428His		Somatic				FAM91A1_uc011lik.1_Missense_Mutation_p.Q428H|FAM91A1_uc011lil.1_Missense_Mutation_p.Q186H	p.Q428H	NM_144963	NP_659400	WXS	Illumina HiSeq	Unspecified	Q658Y4	F91A1_HUMAN	STAD - Stomach adenocarcinoma(47;0.00192)		15	1345	+	Lung NSC(37;8.76e-13)|Ovarian(258;0.00744)|all_neural(195;0.0741)		428					B6YY23|Q658T5|Q8TE89	Missense_Mutation	SNP	ENST00000334705.7	37	c.1284G>C	CCDS6346.2	.	.	.	.	.	.	.	.	.	.	G	15.55	2.867479	0.51588	.	.	ENSG00000176853	ENST00000521166;ENST00000334705	T;T	0.30981	1.51;1.51	5.17	5.17	0.71159	.	0.051129	0.85682	D	0.000000	T	0.28532	0.0706	L	0.34521	1.04	0.47862	D	0.999532	B;P	0.48503	0.007;0.911	B;P	0.44946	0.006;0.465	T	0.02484	-1.1152	10	0.56958	D	0.05	.	12.8844	0.58034	0.0859:0.0:0.9141:0.0	.	428;428	E7ER68;Q658Y4	.;F91A1_HUMAN	H	428	ENSP00000429491:Q428H;ENSP00000335082:Q428H	ENSP00000335082:Q428H	Q	+	3	2	FAM91A1	124871039	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.948000	0.63590	2.577000	0.86979	0.557000	0.71058	CAG		0.333	FAM91A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256607.1	NM_144963		11	69	0	0	0	0	11	69				
COL22A1	169044	broad.mit.edu	37	8	139890087	139890087	+	Silent	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr8:139890087G>A	ENST00000303045.6	-	3	1010	c.564C>T	c.(562-564)atC>atT	p.I188I	COL22A1_ENST00000435777.1_Silent_p.I188I	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	188	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GCTCTGAGGCGATCTCCTCCA	0.652										HNSCC(7;0.00092)																												uc003yvd.2		NA																	0				ovary(11)|pancreas(1)|skin(1)	13						c.(562-564)ATC>ATT		collagen, type XXII, alpha 1							34.0	35.0	35.0					8																	139890087		2203	4300	6503	SO:0001819	synonymous_variant	169044				cell adhesion	collagen|cytoplasm	structural molecule activity	g.chr8:139890087G>A	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.564C>T	8.37:g.139890087G>A		HNSCC(7;0.00092)	Somatic					p.I188I	NM_152888	NP_690848	WXS	Illumina HiSeq	Unspecified	Q8NFW1	COMA1_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0517)		3	1011	-	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		188			VWFA.		B7ZMH0|C9K0G4|Q8IVT9	Silent	SNP	ENST00000303045.6	37	c.564C>T	CCDS6376.1																																																																																				0.652	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257		6	34	0	0	0	0	6	34				
C8orf31	286122	broad.mit.edu	37	8	144124445	144124445	+	Silent	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr8:144124445C>G	ENST00000395172.1	+	2	379	c.27C>G	c.(25-27)tcC>tcG	p.S9S	C8orf31_ENST00000517653.1_Intron	NM_173687.2	NP_775958.1	Q8N9H6	CH031_HUMAN	chromosome 8 open reading frame 31	9										breast(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)	10	all_cancers(97;1.89e-10)|all_epithelial(106;8.73e-09)|Lung NSC(106;0.000161)|all_lung(105;0.000447)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					ACCAGAATTCCTGCAATTCAG	0.582																																						uc003yxp.1		NA																	0				ovary(1)	1						c.(25-27)TCC>TCG		hypothetical protein LOC286122							79.0	82.0	81.0					8																	144124445		2203	4300	6503	SO:0001819	synonymous_variant	286122							g.chr8:144124445C>G		CCDS6395.1	8q24.3	2012-04-11			ENSG00000177335	ENSG00000177335			26731	protein-coding gene	gene with protein product							Standard	NM_173687		Approved	FLJ37131	uc003yxp.1	Q8N9H6	OTTHUMG00000164771	ENST00000395172.1:c.27C>G	8.37:g.144124445C>G			Somatic				C8orf31_uc003yxq.1_RNA|C8orf31_uc003yxr.1_Intron	p.S9S	NM_173687	NP_775958	WXS	Illumina HiSeq	Unspecified	Q8N9H6	CH031_HUMAN			2	379	+	all_cancers(97;1.89e-10)|all_epithelial(106;8.73e-09)|Lung NSC(106;0.000161)|all_lung(105;0.000447)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)		9					Q6GMU7	Silent	SNP	ENST00000395172.1	37	c.27C>G	CCDS6395.1																																																																																				0.582	C8orf31-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380167.1	NM_173687		11	116	0	0	0	0	11	116				
C9orf66	157983	broad.mit.edu	37	9	214662	214662	+	Silent	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr9:214662G>A	ENST00000382387.2	-	1	1231	c.735C>T	c.(733-735)ctC>ctT	p.L245L	DOCK8_ENST00000432829.2_5'Flank|DOCK8_ENST00000453981.1_5'Flank	NM_152569.2	NP_689782.2	Q5T8R8	CI066_HUMAN	chromosome 9 open reading frame 66	245	Arg-rich.									central_nervous_system(1)|cervix(1)|kidney(1)|skin(1)	4	all_lung(41;0.218)	all_cancers(5;2.09e-12)|all_epithelial(5;6.16e-09)|all_lung(10;1.15e-08)|Lung NSC(10;1.91e-08)|Acute lymphoblastic leukemia(5;0.00457)|all_hematologic(5;0.0332)|Breast(48;0.0646)|Prostate(43;0.137)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		CCTTCGGCCGGAGGTCGGCGG	0.751																																						uc003zge.3		NA																	0				central_nervous_system(1)	1						c.(733-735)CTC>CTT		hypothetical protein LOC157983							7.0	8.0	8.0					9																	214662		2169	4231	6400	SO:0001819	synonymous_variant	157983							g.chr9:214662G>A	AK055720	CCDS6439.1	9p24.3	2008-02-05			ENSG00000183784	ENSG00000183784			26436	protein-coding gene	gene with protein product							Standard	NM_152569		Approved	FLJ31158	uc003zge.4	Q5T8R8	OTTHUMG00000021017	ENST00000382387.2:c.735C>T	9.37:g.214662G>A			Somatic				DOCK8_uc011lls.1_5'Flank|DOCK8_uc003zgf.2_5'Flank	p.L245L	NM_152569	NP_689782	WXS	Illumina HiSeq	Unspecified	Q5T8R8	CI066_HUMAN	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)	1	1232	-	all_lung(41;0.218)	all_cancers(5;2.09e-12)|all_epithelial(5;6.16e-09)|all_lung(10;1.15e-08)|Lung NSC(10;1.91e-08)|Acute lymphoblastic leukemia(5;0.00457)|all_hematologic(5;0.0332)|Breast(48;0.0646)|Prostate(43;0.137)	245			Arg-rich.		Q96NB0	Silent	SNP	ENST00000382387.2	37	c.735C>T	CCDS6439.1																																																																																				0.751	C9orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055436.1	NM_152569		3	4	0	0	0	0	3	4				
GLDC	2731	broad.mit.edu	37	9	6605142	6605142	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr9:6605142G>A	ENST00000321612.6	-	6	1000	c.850C>T	c.(850-852)Cat>Tat	p.H284Y		NM_000170.2	NP_000161.2	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)	284					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|glycine dehydrogenase (decarboxylating) activity (GO:0004375)|lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|large_intestine(5)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)	CCACTCTGATGAGCTCTCTCC	0.502																																						uc003zkc.2		NA																	0				ovary(2)	2						c.(850-852)CAT>TAT		glycine dehydrogenase (decarboxylating)	Glycine(DB00145)|Pyridoxal Phosphate(DB00114)						172.0	130.0	145.0					9																	6605142		2203	4300	6503	SO:0001583	missense	2731				glycine catabolic process	mitochondrion	electron carrier activity|glycine dehydrogenase (decarboxylating) activity|lyase activity|pyridoxal phosphate binding	g.chr9:6605142G>A	D90239	CCDS34987.1	9p22	2014-09-17	2006-05-22		ENSG00000178445	ENSG00000178445	1.4.4.2		4313	protein-coding gene	gene with protein product	"""glycine cleavage system protein P"", ""glycine decarboxylase"""	238300	"""glycine dehydrogenase (decarboxylating; glycine decarboxylase, glycine cleavage system protein P)"""			1993704, 1996985	Standard	NM_000170		Approved	GCSP, NKH	uc003zkc.3	P23378	OTTHUMG00000019524	ENST00000321612.6:c.850C>T	9.37:g.6605142G>A	ENSP00000370737:p.His284Tyr		Somatic					p.H284Y	NM_000170	NP_000161	WXS	Illumina HiSeq	Unspecified	P23378	GCSP_HUMAN		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	6	1043	-		Acute lymphoblastic leukemia(23;0.161)	284					Q2M2F8	Missense_Mutation	SNP	ENST00000321612.6	37	c.850C>T	CCDS34987.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.340309	0.81911	.	.	ENSG00000178445	ENST00000321612	D	0.97303	-4.33	5.45	5.45	0.79879	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Glycine cleavage system P-protein, N-terminal (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.98927	0.9636	H	0.97732	4.065	0.80722	D	1	P	0.50943	0.94	P	0.56823	0.807	D	0.99410	1.0930	10	0.87932	D	0	-18.8898	19.6555	0.95837	0.0:0.0:1.0:0.0	.	284	P23378	GCSP_HUMAN	Y	284	ENSP00000370737:H284Y	ENSP00000370737:H284Y	H	-	1	0	GLDC	6595142	1.000000	0.71417	0.951000	0.38953	0.470000	0.32858	9.164000	0.94755	2.725000	0.93324	0.655000	0.94253	CAT		0.502	GLDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051674.2	NM_000170		12	56	0	0	0	0	12	56				
LURAP1L	286343	broad.mit.edu	37	9	12821469	12821469	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr9:12821469G>C	ENST00000319264.3	+	2	1092	c.397G>C	c.(397-399)Gaa>Caa	p.E133Q		NM_203403.1	NP_981948.1	Q8IV03	LUR1L_HUMAN	leucine rich adaptor protein 1-like	136																	GTGGATGATCGAAGAAAAAGC	0.517																																						uc003zkw.2		NA																	0					0						c.(397-399)GAA>CAA		hypothetical protein LOC286343							89.0	90.0	90.0					9																	12821469		2203	4300	6503	SO:0001583	missense	286343							g.chr9:12821469G>C	AK095824	CCDS6473.1	9p22.3	2012-02-01	2012-02-01	2012-02-01	ENSG00000153714	ENSG00000153714			31452	protein-coding gene	gene with protein product	"""similar to DNA segment, Chr 4, Brigham & Womens Genetics 0951 expressed"""		"""chromosome 9 open reading frame 150"""	C9orf150		12766061	Standard	NM_203403		Approved	MGC46502, FLJ38505, bA3L8.2	uc003zkw.3	Q8IV03	OTTHUMG00000019557	ENST00000319264.3:c.397G>C	9.37:g.12821469G>C	ENSP00000321026:p.Glu133Gln		Somatic					p.E133Q	NM_203403	NP_981948	WXS	Illumina HiSeq	Unspecified	Q8IV03	CI150_HUMAN		GBM - Glioblastoma multiforme(1;1.64e-13)	2	1100	+			136					Q5VZX7|Q8N923|Q8NCG2	Missense_Mutation	SNP	ENST00000319264.3	37	c.397G>C	CCDS6473.1	.	.	.	.	.	.	.	.	.	.	G	18.66	3.671369	0.67814	.	.	ENSG00000153714	ENST00000319264	T	0.53423	0.62	5.59	5.59	0.84812	.	0.066309	0.56097	D	0.000025	T	0.67711	0.2922	L	0.57536	1.79	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.68765	-0.5322	10	0.72032	D	0.01	.	19.5985	0.95549	0.0:0.0:1.0:0.0	.	136	Q8IV03	CI150_HUMAN	Q	133	ENSP00000321026:E133Q	ENSP00000321026:E133Q	E	+	1	0	C9orf150	12811469	1.000000	0.71417	0.983000	0.44433	0.219000	0.24729	9.476000	0.97823	2.636000	0.89361	0.563000	0.77884	GAA		0.517	LURAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051730.1	NM_203403		16	69	0	0	0	0	16	69				
SIGMAR1	10280	broad.mit.edu	37	9	34635701	34635701	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr9:34635701G>C	ENST00000277010.4	-	4	673	c.600C>G	c.(598-600)ttC>ttG	p.F200L	SIGMAR1_ENST00000461426.1_5'UTR|SIGMAR1_ENST00000378892.1_Missense_Mutation_p.F111L|SIGMAR1_ENST00000477726.1_Missense_Mutation_p.F169L	NM_001282208.1|NM_005866.2	NP_001269137.1|NP_005857.1	Q99720	SGMR1_HUMAN	sigma non-opioid intracellular receptor 1	200					cell death (GO:0008219)|lipid transport (GO:0006869)|nervous system development (GO:0007399)|regulation of neuron apoptotic process (GO:0043523)	cell junction (GO:0030054)|cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lipid particle (GO:0005811)|nuclear envelope (GO:0005635)	drug binding (GO:0008144)|opioid receptor activity (GO:0004985)			large_intestine(1)|lung(1)	2					Amitriptyline(DB00321)|Dextromethorphan(DB00514)|Nortriptyline(DB00540)|Pentazocine(DB00652)|Remoxipride(DB00409)	GAAGAGTATAGAAGAGGGTGA	0.622																																						uc003zvb.2		NA																	0					0						c.(598-600)TTC>TTG		sigma non-opioid intracellular receptor 1	Dextromethorphan(DB00514)						115.0	101.0	106.0					9																	34635701		2203	4300	6503	SO:0001583	missense	10280				ergosterol biosynthetic process|lipid transport	cell junction|endoplasmic reticulum membrane|growth cone|integral to plasma membrane|lipid particle|nuclear inner membrane|nuclear outer membrane	C-8 sterol isomerase activity|drug binding	g.chr9:34635701G>C	BC004899	CCDS6562.1, CCDS6563.1	9p13.3	2008-12-18	2008-12-18	2008-12-18	ENSG00000147955	ENSG00000147955			8157	protein-coding gene	gene with protein product		601978	"""opioid receptor, sigma 1"""	OPRS1		8954936, 9453537	Standard	NM_005866		Approved	SR-BP1	uc003zvb.3	Q99720	OTTHUMG00000019829	ENST00000277010.4:c.600C>G	9.37:g.34635701G>C	ENSP00000277010:p.Phe200Leu		Somatic				SIGMAR1_uc003zva.3_Missense_Mutation_p.F180L|SIGMAR1_uc003zuz.2_Missense_Mutation_p.F111L|SIGMAR1_uc003zvc.2_Missense_Mutation_p.F169L|SIGMAR1_uc003zvd.2_RNA|SIGMAR1_uc011loo.1_Intron	p.F200L	NM_005866	NP_005857	WXS	Illumina HiSeq	Unspecified	Q99720	SGMR1_HUMAN			4	674	-			200			Cytoplasmic (Potential).		D3DRM7|O00673|O00725|Q0Z9W6|Q153Z1|Q2TSD1|Q53GN2|Q7Z653|Q8N7H3|Q9NYX0	Missense_Mutation	SNP	ENST00000277010.4	37	c.600C>G	CCDS6562.1	.	.	.	.	.	.	.	.	.	.	G	19.57	3.852974	0.71719	.	.	ENSG00000147955	ENST00000378892;ENST00000277010;ENST00000360710;ENST00000477726	T;T;T	0.64803	-0.12;-0.12;-0.12	4.43	4.43	0.53597	.	0.000000	0.85682	D	0.000000	T	0.68659	0.3025	M	0.79805	2.47	0.53005	D	0.999969	P;P;P	0.48162	0.906;0.562;0.792	P;B;B	0.46659	0.523;0.183;0.269	T	0.70978	-0.4725	10	0.30854	T	0.27	-18.3728	15.7842	0.78289	0.0:0.0:1.0:0.0	.	169;200;180	A2A3U5;Q99720;Q99720-2	.;SGMR1_HUMAN;.	L	111;200;166;169	ENSP00000368170:F111L;ENSP00000277010:F200L;ENSP00000420022:F169L	ENSP00000277010:F200L	F	-	3	2	SIGMAR1	34625701	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.224000	0.58593	2.296000	0.77279	0.462000	0.41574	TTC		0.622	SIGMAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052204.1	NM_005866		9	34	0	0	0	0	9	34				
FBXO10	26267	broad.mit.edu	37	9	37512610	37512610	+	Silent	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr9:37512610C>T	ENST00000432825.2	-	11	2853	c.2805G>A	c.(2803-2805)acG>acA	p.T935T	RP11-613M10.8_ENST00000544475.1_5'UTR|RP11-613M10.6_ENST00000413915.1_RNA|FBXO10_ENST00000541829.1_Silent_p.T460T	NM_012166.2	NP_036298.2	Q9UK96	FBX10_HUMAN	F-box protein 10	935					apoptotic process (GO:0006915)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(5)|large_intestine(11)|lung(15)|prostate(1)|upper_aerodigestive_tract(1)	34				GBM - Glioblastoma multiforme(29;0.0107)		CTGTGATCCTCGTTGCCATGG	0.607																																						uc004aab.2		NA																	0				lung(5)	5						c.(2803-2805)ACG>ACA		F-box protein 10							128.0	128.0	128.0					9																	37512610		2041	4189	6230	SO:0001819	synonymous_variant	26267					ubiquitin ligase complex	ubiquitin-protein ligase activity	g.chr9:37512610C>T	AF174598	CCDS47966.1	9p13.1	2014-01-29	2004-06-15		ENSG00000147912	ENSG00000147912		"""F-boxes /  ""other"""""	13589	protein-coding gene	gene with protein product		609092	"""F-box only protein 10"""			10531035, 10531037, 19300908	Standard	NM_012166		Approved	FBX10	uc004aab.3	Q9UK96	OTTHUMG00000019926	ENST00000432825.2:c.2805G>A	9.37:g.37512610C>T			Somatic				FBXO10_uc004aac.2_Silent_p.T951T|FBXO10_uc004aad.2_Silent_p.T485T	p.T935T	NM_012166	NP_036298	WXS	Illumina HiSeq	Unspecified	Q9UK96	FBX10_HUMAN		GBM - Glioblastoma multiforme(29;0.0107)	11	2854	-			935					Q08AL3|Q08AL4|Q5JRT8|Q9UKC3	Silent	SNP	ENST00000432825.2	37	c.2805G>A	CCDS47966.1																																																																																				0.607	FBXO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052472.3			14	117	0	0	0	0	14	117				
NAA35	60560	broad.mit.edu	37	9	88557141	88557141	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr9:88557141G>C	ENST00000361671.5	+	2	200	c.67G>C	c.(67-69)Gag>Cag	p.E23Q	NAA35_ENST00000376040.1_Missense_Mutation_p.E23Q	NM_024635.3	NP_078911.3	Q5VZE5	NAA35_HUMAN	N(alpha)-acetyltransferase 35, NatC auxiliary subunit	23					negative regulation of apoptotic process (GO:0043066)|smooth muscle cell proliferation (GO:0048659)	cytoplasm (GO:0005737)|NatC complex (GO:0031417)				central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(9)|ovary(2)|skin(2)|urinary_tract(1)	25						AGAAAAAATGGAGAAAAGCAA	0.398																																						uc004aoi.3		NA																	0				skin(2)|central_nervous_system(1)	3						c.(67-69)GAG>CAG		corneal wound healing-related protein							146.0	135.0	139.0					9																	88557141		2203	4300	6503	SO:0001583	missense	60560				smooth muscle cell proliferation	cytoplasm|nucleus|plasma membrane		g.chr9:88557141G>C	AK025266	CCDS6673.1	9q22.1	2010-01-14	2010-01-14	2010-01-14	ENSG00000135040	ENSG00000135040		"""N(alpha)-acetyltransferase subunits"""	24340	protein-coding gene	gene with protein product			"""MAK10 homolog, amino-acid N-acetyltransferase subunit (S. cerevisiae)"""	MAK10		14702039, 19660095	Standard	NM_024635		Approved	FLJ21613, FLJ22643, bA379P1.1	uc004aoi.4	Q5VZE5	OTTHUMG00000020131	ENST00000361671.5:c.67G>C	9.37:g.88557141G>C	ENSP00000354972:p.Glu23Gln		Somatic				NAA35_uc004aoj.3_Missense_Mutation_p.E23Q|NAA35_uc004aok.1_Missense_Mutation_p.E23Q	p.E23Q	NM_024635	NP_078911	WXS	Illumina HiSeq	Unspecified	Q5VZE5	NAA35_HUMAN			2	204	+			23					Q5VZE6|Q9H631|Q9H703	Missense_Mutation	SNP	ENST00000361671.5	37	c.67G>C	CCDS6673.1	.	.	.	.	.	.	.	.	.	.	G	14.93	2.681299	0.47991	.	.	ENSG00000135040	ENST00000361671;ENST00000416045;ENST00000376040	.	.	.	5.11	5.11	0.69529	.	0.170182	0.52532	D	0.000074	T	0.50188	0.1601	L	0.29908	0.895	0.46954	D	0.999267	B;B	0.23058	0.079;0.016	B;B	0.17098	0.017;0.007	T	0.43829	-0.9367	9	0.13470	T	0.59	-18.3759	18.4059	0.90536	0.0:0.0:1.0:0.0	.	23;23	Q5VZE6;Q5VZE5	.;NAA35_HUMAN	Q	23	.	ENSP00000354972:E23Q	E	+	1	0	NAA35	87746961	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	6.159000	0.71856	2.673000	0.90976	0.558000	0.71614	GAG		0.398	NAA35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052906.1	NM_024635		12	77	0	0	0	0	12	77				
NCBP1	4686	broad.mit.edu	37	9	100412873	100412873	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr9:100412873G>C	ENST00000375147.3	+	9	1242	c.986G>C	c.(985-987)aGg>aCg	p.R329T		NM_002486.4	NP_002477.1	Q09161	NCBP1_HUMAN	nuclear cap binding protein subunit 1, 80kDa	329					7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA cis splicing, via spliceosome (GO:0045292)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of viral transcription (GO:0050434)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|mRNA cap binding complex (GO:0005845)|nuclear cap binding complex (GO:0005846)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA cap binding (GO:0000339)			NS(1)|central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)	19		Acute lymphoblastic leukemia(62;0.158)				TGGAAGGAAAGGAAGACTTGG	0.378																																					Ovarian(36;879 898 2893 44212 50307)	uc004axq.2		NA																	0				central_nervous_system(1)	1						c.(985-987)AGG>ACG		nuclear cap binding protein subunit 1, 80kDa							121.0	123.0	123.0					9																	100412873		2203	4300	6503	SO:0001583	missense	4686				gene silencing by RNA|histone mRNA metabolic process|mRNA 3'-end processing|mRNA capping|mRNA cleavage|mRNA export from nucleus|ncRNA metabolic process|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of mRNA 3'-end processing|positive regulation of viral transcription|regulation of translational initiation|spliceosomal snRNP assembly|termination of RNA polymerase II transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	cytosol|mRNA cap binding complex|nucleoplasm|ribonucleoprotein complex	protein binding|RNA cap binding	g.chr9:100412873G>C	BC001450	CCDS6728.1	9q34.1	2010-01-26	2002-08-29		ENSG00000136937	ENSG00000136937			7658	protein-coding gene	gene with protein product		600469	"""nuclear cap binding protein subunit 1, 80kD"""	NCBP		7937105, 8812508	Standard	NM_002486		Approved	CBP80, Sto1	uc004axq.3	Q09161	OTTHUMG00000020332	ENST00000375147.3:c.986G>C	9.37:g.100412873G>C	ENSP00000364289:p.Arg329Thr		Somatic					p.R329T	NM_002486	NP_002477	WXS	Illumina HiSeq	Unspecified	Q09161	NCBP1_HUMAN			9	1445	+		Acute lymphoblastic leukemia(62;0.158)	329					B2R718|Q59G76|Q5T1V0|Q5T7X2	Missense_Mutation	SNP	ENST00000375147.3	37	c.986G>C	CCDS6728.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.937225	0.92458	.	.	ENSG00000136937	ENST00000375147	.	.	.	5.32	5.32	0.75619	Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.152587	0.56097	D	0.000021	T	0.77558	0.4148	M	0.87682	2.9	0.80722	D	1	P	0.49185	0.92	P	0.52710	0.707	T	0.81887	-0.0726	9	0.72032	D	0.01	-5.3066	17.222	0.86960	0.0:0.0:1.0:0.0	.	329	Q09161	NCBP1_HUMAN	T	329	.	ENSP00000364289:R329T	R	+	2	0	NCBP1	99452694	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.381000	0.97205	2.674000	0.91012	0.644000	0.83932	AGG		0.378	NCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053337.1	NM_002486		20	149	0	0	0	0	20	149				
RABEPK	10244	broad.mit.edu	37	9	127982928	127982928	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr9:127982928G>C	ENST00000373538.3	+	5	785	c.475G>C	c.(475-477)Gag>Cag	p.E159Q	RABEPK_ENST00000394124.4_3'UTR|RABEPK_ENST00000373544.1_3'UTR|RABEPK_ENST00000394125.4_Missense_Mutation_p.E159Q|RABEPK_ENST00000259460.8_Missense_Mutation_p.E108Q	NM_005833.3	NP_005824.2	Q7Z6M1	RABEK_HUMAN	Rab9 effector protein with kelch motifs	159					receptor-mediated endocytosis (GO:0006898)|vesicle docking involved in exocytosis (GO:0006904)	endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	15						TGGGGGCGGAGAGAGAGGTGC	0.587																																						uc004bpi.2		NA																	0				ovary(1)	1						c.(475-477)GAG>CAG		Rab9 effector protein with kelch motifs							98.0	85.0	89.0					9																	127982928		2203	4300	6503	SO:0001583	missense	10244				receptor-mediated endocytosis|vesicle docking involved in exocytosis	endosome membrane|plasma membrane		g.chr9:127982928G>C	BC000503	CCDS6862.1, CCDS55341.1	9q33.1-q33.3	2010-04-19			ENSG00000136933	ENSG00000136933			16896	protein-coding gene	gene with protein product		605962				9230071	Standard	NM_005833		Approved	RAB9P40, bA65N13.1	uc004bpi.3	Q7Z6M1	OTTHUMG00000020674	ENST00000373538.3:c.475G>C	9.37:g.127982928G>C	ENSP00000362639:p.Glu159Gln		Somatic				RABEPK_uc004bph.1_3'UTR|RABEPK_uc004bpj.2_Missense_Mutation_p.E108Q|RABEPK_uc004bpk.2_Missense_Mutation_p.E159Q|RABEPK_uc004bpl.1_Missense_Mutation_p.E108Q|RABEPK_uc004bpm.2_Missense_Mutation_p.E159Q	p.E159Q	NM_005833	NP_005824	WXS	Illumina HiSeq	Unspecified	Q7Z6M1	RABEK_HUMAN			6	648	+			159			Kelch 3.		A8K403|O00568|Q69YR2|Q6FHA4|Q6IBG7|Q6P092|Q86Y76|Q9BWB1	Missense_Mutation	SNP	ENST00000373538.3	37	c.475G>C	CCDS6862.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.040763	0.75732	.	.	ENSG00000136933	ENST00000394125;ENST00000259460;ENST00000373538;ENST00000416065	T;T;T;T	0.65732	1.73;-0.17;1.73;2.03	5.61	5.61	0.85477	Kelch-type beta propeller (1);	0.193386	0.53938	D	0.000054	T	0.75693	0.3884	M	0.75085	2.285	0.80722	D	1	D;P;D	0.67145	0.996;0.824;0.996	P;P;P	0.60609	0.877;0.555;0.877	T	0.70795	-0.4775	10	0.17369	T	0.5	-26.7664	18.629	0.91352	0.0:0.0:1.0:0.0	.	159;108;159	A8K403;Q7Z6M1-2;Q7Z6M1	.;.;RABEK_HUMAN	Q	159;108;159;242	ENSP00000377683:E159Q;ENSP00000259460:E108Q;ENSP00000362639:E159Q;ENSP00000402234:E242Q	ENSP00000259460:E108Q	E	+	1	0	RABEPK	127022749	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	7.866000	0.87056	2.658000	0.90341	0.585000	0.79938	GAG		0.587	RABEPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054064.1	NM_005833		8	60	0	0	0	0	8	60				
NUP214	8021	broad.mit.edu	37	9	134014764	134014764	+	Missense_Mutation	SNP	G	G	T	rs561685309		TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr9:134014764G>T	ENST00000359428.5	+	10	1246	c.1102G>T	c.(1102-1104)Gac>Tac	p.D368Y	NUP214_ENST00000411637.2_Missense_Mutation_p.D368Y|RP11-544A12.4_ENST00000415391.2_RNA|RP11-544A12.4_ENST00000588378.1_RNA|RP11-544A12.4_ENST00000589540.1_RNA|RP11-544A12.4_ENST00000589667.1_RNA|RP11-544A12.4_ENST00000587264.1_RNA|RP11-544A12.4_ENST00000586290.1_RNA|RP11-544A12.4_ENST00000587408.1_RNA|NUP214_ENST00000451030.1_Missense_Mutation_p.D368Y|RP11-544A12.4_ENST00000590461.1_RNA			P35658	NU214_HUMAN	nucleoporin 214kDa	368	Seven-bladed beta propeller.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)			NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		AGTTGTCGTAGACTATACAAA	0.418			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																Pancreas(4;24 48 25510 30394 32571)	uc004cag.2		NA		Dom	yes		9	9q34.1	8021	T	nucleoporin 214kDa (CAN)			L	DEK|SET|ABL1		AML|T-ALL		0				breast(7)|lung(3)|skin(3)|ovary(2)|central_nervous_system(1)	16						c.(1102-1104)GAC>TAC		nucleoporin 214kDa							132.0	119.0	123.0					9																	134014764		2203	4300	6503	SO:0001583	missense	8021				carbohydrate metabolic process|glucose transport|mRNA metabolic process|protein export from nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore|nucleoplasm	protein binding	g.chr9:134014764G>T	X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.1102G>T	9.37:g.134014764G>T	ENSP00000352400:p.Asp368Tyr		Somatic				NUP214_uc004cah.2_Missense_Mutation_p.D368Y|NUP214_uc004caf.1_Missense_Mutation_p.D368Y	p.D368Y	NM_005085	NP_005076	WXS	Illumina HiSeq	Unspecified	P35658	NU214_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)	10	1213	+	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)	368					A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Missense_Mutation	SNP	ENST00000359428.5	37	c.1102G>T	CCDS6940.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.0|28.0	4.884957|4.884957	0.91814|0.91814	.|.	.|.	ENSG00000126883|ENSG00000126883	ENST00000359428;ENST00000411637;ENST00000451030;ENST00000541375|ENST00000530863	D;D;D|.	0.95918|.	-3.85;-3.85;-3.85|.	5.38|5.38	5.38|5.38	0.77491|0.77491	WD40/YVTN repeat-like-containing domain (1);|.	0.000000|.	0.42420|.	D|.	0.000710|.	T|T	0.78947|0.78947	0.4364|0.4364	M|M	0.81802|0.81802	2.56|2.56	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	T|T	0.79446|0.79446	-0.1800|-0.1800	10|5	0.87932|.	D|.	0|.	-40.6171|-40.6171	18.4813|18.4813	0.90812|0.90812	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	368;368|.	P35658-4;P35658|.	.;NU214_HUMAN|.	Y|I	368|39	ENSP00000352400:D368Y;ENSP00000396576:D368Y;ENSP00000405014:D368Y|.	ENSP00000352400:D368Y|.	D|R	+|+	1|2	0|0	NUP214|NUP214	133004585|133004585	1.000000|1.000000	0.71417|0.71417	0.983000|0.983000	0.44433|0.44433	0.875000|0.875000	0.50365|0.50365	8.576000|8.576000	0.90770|0.90770	2.674000|2.674000	0.91012|0.91012	0.637000|0.637000	0.83480|0.83480	GAC|AGA		0.418	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000054694.2	NM_005085		10	41	1	0	9.31e-06	1e-05	10	41				
C9orf163	158055	broad.mit.edu	37	9	139379468	139379468	+	Missense_Mutation	SNP	C	C	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr9:139379468C>A	ENST00000354376.1	+	1	1522	c.568C>A	c.(568-570)Cta>Ata	p.L190I		NM_152571.2	NP_689784.1	Q8N9P6	CI163_HUMAN	chromosome 9 open reading frame 163	190										kidney(1)|lung(1)	2		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;4.36e-06)|Epithelial(140;5.65e-06)		GCTCGACCCTCTAGGGTCCTC	0.607											OREG0019617	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										uc004chy.2		NA																	0					0						c.(568-570)CTA>ATA		hypothetical protein LOC158055							23.0	24.0	24.0					9																	139379468		2196	4299	6495	SO:0001583	missense	158055						protein binding	g.chr9:139379468C>A	AK055336	CCDS7001.1	9q34.3	2006-03-21			ENSG00000196366	ENSG00000196366			26718	protein-coding gene	gene with protein product							Standard	NM_152571		Approved	FLJ36779	uc004chy.3	Q8N9P6	OTTHUMG00000131725	ENST00000354376.1:c.568C>A	9.37:g.139379468C>A	ENSP00000346345:p.Leu190Ile		Somatic	OREG0019617	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1648	SEC16A_uc004chx.2_5'Flank|SEC16A_uc010nbo.1_5'Flank	p.L190I	NM_152571	NP_689784	WXS	Illumina HiSeq	Unspecified	Q8N9P6	CI163_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;4.36e-06)|Epithelial(140;5.65e-06)	1	1522	+		Myeloproliferative disorder(178;0.0511)	190						Missense_Mutation	SNP	ENST00000354376.1	37	c.568C>A	CCDS7001.1	.	.	.	.	.	.	.	.	.	.	C	5.893	0.348942	0.11182	.	.	ENSG00000196366	ENST00000354376	T	0.55588	0.51	1.72	-0.303	0.12792	.	.	.	.	.	T	0.29556	0.0737	N	0.08118	0	0.09310	N	1	D	0.58620	0.983	P	0.45558	0.485	T	0.17228	-1.0376	9	0.87932	D	0	.	2.3181	0.04204	0.296:0.513:0.0:0.191	.	190	Q8N9P6	CI163_HUMAN	I	190	ENSP00000346345:L190I	ENSP00000346345:L190I	L	+	1	2	C9orf163	138499289	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.675000	0.05227	-0.097000	0.12307	0.561000	0.74099	CTA		0.607	C9orf163-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254644.1	NM_152571		6	17	1	0	3.6e-05	3.86e-05	6	17				
TMEM203	94107	broad.mit.edu	37	9	140099678	140099678	+	Silent	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr9:140099678G>A	ENST00000343666.5	-	1	412	c.189C>T	c.(187-189)ttC>ttT	p.F63F	NDOR1_ENST00000427047.2_5'Flank|NDOR1_ENST00000458322.2_5'Flank|TPRN_ENST00000541945.1_5'Flank|NDOR1_ENST00000344894.5_5'Flank|NDOR1_ENST00000371521.4_5'Flank|TMEM203_ENST00000537254.1_Silent_p.F63F	NM_053045.1	NP_444273.1	Q969S6	TM203_HUMAN	transmembrane protein 203	63						integral component of membrane (GO:0016021)				central_nervous_system(1)|kidney(1)	2	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		CGATGGTGGTGAAGTAGGTGC	0.617																																						uc004clv.2		NA																	0					0						c.(187-189)TTC>TTT		transmembrane protein 203							46.0	47.0	47.0					9																	140099678		2200	4294	6494	SO:0001819	synonymous_variant	94107					integral to membrane		g.chr9:140099678G>A	BC009283	CCDS35185.1	9q34.3	2007-12-18			ENSG00000187713	ENSG00000187713			28217	protein-coding gene	gene with protein product	"""HBeAg-binding protein 1"""					12477932	Standard	NM_053045		Approved	MGC14327, HBEBP1	uc004clv.3	Q969S6	OTTHUMG00000020985	ENST00000343666.5:c.189C>T	9.37:g.140099678G>A			Somatic				NDOR1_uc004clx.2_5'Flank|NDOR1_uc004clw.2_5'Flank|NDOR1_uc011mes.1_5'Flank|NDOR1_uc004cly.2_5'Flank	p.F63F	NM_053045	NP_444273	WXS	Illumina HiSeq	Unspecified	Q969S6	TM203_HUMAN	STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)	1	413	-	all_cancers(76;0.0926)		63			Helical; (Potential).		Q6NW08	Silent	SNP	ENST00000343666.5	37	c.189C>T	CCDS35185.1																																																																																				0.617	TMEM203-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055325.2	NM_053045		4	21	0	0	0	0	4	21				
NLGN4X	57502	broad.mit.edu	37	X	5821900	5821900	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chrX:5821900G>C	ENST00000381095.3	-	5	1446	c.819C>G	c.(817-819)ttC>ttG	p.F273L	NLGN4X_ENST00000275857.6_Missense_Mutation_p.F273L|NLGN4X_ENST00000381093.2_Missense_Mutation_p.F293L|NLGN4X_ENST00000381092.1_Missense_Mutation_p.F273L|NLGN4X_ENST00000538097.1_Missense_Mutation_p.F273L	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	273					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)			breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						TGGCCTTCTGGAAGAGACCTG	0.527																																						uc010ndh.2		NA																	0				skin(2)|large_intestine(1)|ovary(1)	4						c.(817-819)TTC>TTG		X-linked neuroligin 4 precursor							59.0	53.0	55.0					X																	5821900		2203	4300	6503	SO:0001583	missense	57502				brainstem development|cell adhesion|cell-cell junction organization|cerebellum development|male courtship behavior|positive regulation of organ growth|regulation of excitatory postsynaptic membrane potential|social behavior|synapse assembly|territorial aggressive behavior|vocalization behavior	cell surface|dendrite|integral to plasma membrane|synapse	chloride ion binding|neurexin binding|protein homodimerization activity|receptor activity	g.chrX:5821900G>C	AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.819C>G	X.37:g.5821900G>C	ENSP00000370485:p.Phe273Leu		Somatic				NLGN4X_uc004crp.2_Missense_Mutation_p.F293L|NLGN4X_uc004crq.2_Missense_Mutation_p.F273L|NLGN4X_uc010ndi.2_Missense_Mutation_p.F310L|NLGN4X_uc004crr.2_Missense_Mutation_p.F273L|NLGN4X_uc010ndj.2_Missense_Mutation_p.F273L	p.F273L	NM_181332	NP_851849	WXS	Illumina HiSeq	Unspecified	Q8N0W4	NLGNX_HUMAN			5	1320	-			273			Extracellular (Potential).		Q6UX10|Q9ULG0	Missense_Mutation	SNP	ENST00000381095.3	37	c.819C>G	CCDS14126.1	.	.	.	.	.	.	.	.	.	.	G	17.79	3.476872	0.63849	.	.	ENSG00000146938	ENST00000381095;ENST00000381093;ENST00000275857;ENST00000381092;ENST00000538097	T;T;T;T;T	0.78003	-1.14;-1.14;-1.14;-1.14;-1.14	3.79	2.92	0.33932	Carboxylesterase, type B (1);	.	.	.	.	D	0.90390	0.6992	H	0.96175	3.78	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.993;0.999	D	0.90160	0.4227	8	.	.	.	.	9.8142	0.40842	0.1052:0.0:0.8948:0.0	.	330;273;293	A6NMU8;Q8N0W4;Q8N0W4-2	.;NLGNX_HUMAN;.	L	273;293;273;273;273	ENSP00000370485:F273L;ENSP00000370483:F293L;ENSP00000275857:F273L;ENSP00000370482:F273L;ENSP00000439203:F273L	.	F	-	3	2	NLGN4X	5831900	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	2.944000	0.49034	0.465000	0.27167	0.600000	0.82982	TTC		0.527	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055673.1	NM_020742		9	66	0	0	0	0	9	66				
TBL1X	6907	broad.mit.edu	37	X	9683006	9683006	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chrX:9683006G>A	ENST00000217964.7	+	17	2310	c.1670G>A	c.(1669-1671)cGa>cAa	p.R557Q	TBL1X_ENST00000424279.1_Missense_Mutation_p.R506Q|TBL1X_ENST00000407597.2_Missense_Mutation_p.R557Q|TBL1X_ENST00000536365.1_Missense_Mutation_p.R506Q|TBL1X_ENST00000380961.1_Missense_Mutation_p.R506Q	NM_005647.3	NP_005638.1	O60907	TBL1X_HUMAN	transducin (beta)-like 1X-linked	557					canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|cervix(1)|endometrium(5)|large_intestine(7)|lung(2)|ovary(1)|skin(2)	20		Hepatocellular(5;0.000888)				TGGAACGCCCGAGGAGACAAA	0.587																																						uc010ndq.2		NA																	0				ovary(1)	1						c.(1669-1671)CGA>CAA		transducin beta-like 1X isoform a							81.0	59.0	67.0					X																	9683006		2203	4300	6503	SO:0001583	missense	6907				canonical Wnt receptor signaling pathway|cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|proteasomal ubiquitin-dependent protein catabolic process|sensory perception of sound|transcription, DNA-dependent	spindle microtubule|transcriptional repressor complex	beta-catenin binding|histone binding|protein C-terminus binding|protein domain specific binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding	g.chrX:9683006G>A	Y12781	CCDS14133.1, CCDS48078.1	Xp22.3	2013-01-10	2002-05-22	2002-05-24	ENSG00000101849	ENSG00000101849		"""WD repeat domain containing"""	11585	protein-coding gene	gene with protein product		300196	"""transducin (beta)-like 1"""	TBL1		10330347	Standard	NM_005647		Approved	EBI	uc004csr.3	O60907	OTTHUMG00000021117	ENST00000217964.7:c.1670G>A	X.37:g.9683006G>A	ENSP00000217964:p.Arg557Gln		Somatic				TBL1X_uc004csq.3_Missense_Mutation_p.R506Q|TBL1X_uc010ndr.2_Missense_Mutation_p.R506Q|TBL1X_uc004csr.2_Missense_Mutation_p.R557Q|TBL1X_uc004css.2_Missense_Mutation_p.R508Q	p.R557Q	NM_001139466	NP_001132938	WXS	Illumina HiSeq	Unspecified	O60907	TBL1X_HUMAN			17	2038	+		Hepatocellular(5;0.000888)	557			WD 8.		A8K044|A8K4J7|Q86UY2	Missense_Mutation	SNP	ENST00000217964.7	37	c.1670G>A	CCDS14133.1	.	.	.	.	.	.	.	.	.	.	G	12.79	2.044886	0.36085	.	.	ENSG00000101849	ENST00000407597;ENST00000424279;ENST00000536365;ENST00000380961;ENST00000217964	T;T;T;T;T	0.81078	-1.45;-1.45;-1.45;-1.45;-1.45	3.8	3.8	0.43715	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.359926	0.25211	N	0.032303	T	0.75049	0.3797	L	0.47716	1.5	0.33098	D	0.538804	B;B	0.24768	0.065;0.111	B;B	0.16722	0.016;0.011	T	0.79581	-0.1744	10	0.48119	T	0.1	.	15.6252	0.76851	0.0:0.0:1.0:0.0	.	520;557	Q59F53;O60907	.;TBL1X_HUMAN	Q	557;506;506;506;557	ENSP00000385988:R557Q;ENSP00000394097:R506Q;ENSP00000445317:R506Q;ENSP00000370348:R506Q;ENSP00000217964:R557Q	ENSP00000217964:R557Q	R	+	2	0	TBL1X	9643006	1.000000	0.71417	0.940000	0.37924	0.945000	0.59286	2.734000	0.47368	1.667000	0.50832	0.429000	0.28392	CGA		0.587	TBL1X-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055709.1	NM_005647		8	29	0	0	0	0	8	29				
OFD1	8481	broad.mit.edu	37	X	13778324	13778324	+	Missense_Mutation	SNP	A	A	T	rs377203286		TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chrX:13778324A>T	ENST00000340096.6	+	16	2072	c.1745A>T	c.(1744-1746)aAt>aTt	p.N582I	OFD1_ENST00000380567.1_Missense_Mutation_p.N442I|OFD1_ENST00000490265.1_3'UTR|OFD1_ENST00000380550.3_Missense_Mutation_p.N542I	NM_003611.2	NP_003602.1	O75665	OFD1_HUMAN	oral-facial-digital syndrome 1	582					axoneme assembly (GO:0035082)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of fibroblast growth factor receptor signaling pathway involved in neural plate anterior/posterior pattern formation (GO:2000314)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|gamma-tubulin binding (GO:0043015)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	25						GTGCCTTGCAATGGTGAGATA	0.423																																						uc004cvp.3		NA																	0					0						c.(1744-1746)AAT>ATT		oral-facial-digital syndrome 1							167.0	146.0	153.0					X																	13778324		2203	4300	6503	SO:0001583	missense	8481				cilium movement involved in determination of left/right asymmetry|G2/M transition of mitotic cell cycle	centriole|cilium|cytosol|microtubule basal body|nuclear membrane	alpha-tubulin binding|gamma-tubulin binding	g.chrX:13778324A>T	Y15164	CCDS14157.1	Xp22	2014-06-18			ENSG00000046651	ENSG00000046651			2567	protein-coding gene	gene with protein product		300170	"""retinitis pigmentosa 23 (X-linked recessive)"""	CXorf5, RP23		9722947, 9215688, 22619378	Standard	NM_003611		Approved	71-7A, JBTS10	uc004cvp.4	O75665	OTTHUMG00000021159	ENST00000340096.6:c.1745A>T	X.37:g.13778324A>T	ENSP00000344314:p.Asn582Ile		Somatic				OFD1_uc004cvr.3_Missense_Mutation_p.N149I|OFD1_uc011mil.1_Missense_Mutation_p.N149I|OFD1_uc004cvq.3_Missense_Mutation_p.N442I|OFD1_uc010nen.2_Missense_Mutation_p.N581I|OFD1_uc004cvs.3_RNA|OFD1_uc004cvu.3_Missense_Mutation_p.N541I|OFD1_uc004cvv.3_Missense_Mutation_p.N541I	p.N582I	NM_003611	NP_003602	WXS	Illumina HiSeq	Unspecified	O75665	OFD1_HUMAN			16	2104	+			582					B9ZVU5|O75666|Q4VAK4	Missense_Mutation	SNP	ENST00000340096.6	37	c.1745A>T	CCDS14157.1	.	.	.	.	.	.	.	.	.	.	.	11.93	1.786458	0.31593	.	.	ENSG00000046651	ENST00000380550;ENST00000340096;ENST00000380567	D;D;D	0.95980	-3.87;-3.86;-1.74	5.77	-4.78	0.03209	.	1.121610	0.06549	N	0.744690	D	0.90532	0.7033	L	0.40543	1.245	0.09310	N	1	B;B;B;B;B	0.10296	0.003;0.0;0.001;0.001;0.003	B;B;B;B;B	0.08055	0.003;0.001;0.003;0.002;0.003	T	0.77900	-0.2415	10	0.33141	T	0.24	-0.239	7.3947	0.26929	0.5298:0.0:0.3673:0.1029	.	582;542;250;442;582	A8K2T9;O75665-3;B4DLQ3;A6NF31;O75665	.;.;.;.;OFD1_HUMAN	I	542;582;442	ENSP00000369923:N542I;ENSP00000344314:N582I;ENSP00000369941:N442I	ENSP00000344314:N582I	N	+	2	0	OFD1	13688245	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	1.301000	0.33447	-1.476000	0.01874	-2.029000	0.00425	AAT		0.423	OFD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055808.1	NM_003611		19	108	0	0	0	0	19	108				
ACE2	59272	broad.mit.edu	37	X	15584408	15584408	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chrX:15584408G>C	ENST00000252519.3	-	16	2184	c.2082C>G	c.(2080-2082)atC>atG	p.I694M	ACE2_ENST00000427411.1_Missense_Mutation_p.I694M|ACE2_ENST00000471548.1_5'UTR			Q9BYF1	ACE2_HUMAN	angiotensin I converting enzyme 2	694					angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|angiotensin-mediated drinking behavior (GO:0003051)|cellular protein metabolic process (GO:0044267)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|receptor biosynthetic process (GO:0032800)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of cell proliferation (GO:0042127)|regulation of cytokine production (GO:0001817)|regulation of inflammatory response (GO:0050727)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)|response to virus (GO:0009615)|viral entry into host cell (GO:0046718)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	carboxypeptidase activity (GO:0004180)|endopeptidase activity (GO:0004175)|glycoprotein binding (GO:0001948)|peptide hormone binding (GO:0017046)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	32	Hepatocellular(33;0.183)				Lisinopril(DB00722)|Moexipril(DB00691)	TTCTAGGAATGATATCAGACA	0.383																																						uc004cxa.1		NA																	0				ovary(3)	3						c.(2080-2082)ATC>ATG		angiotensin I converting enzyme 2 precursor	Moexipril(DB00691)						187.0	174.0	179.0					X																	15584408		2203	4300	6503	SO:0001583	missense	59272				angiotensin-mediated drinking behavior|proteolysis|receptor biosynthetic process|regulation of cell proliferation|virion attachment, binding of host cell surface receptor	cell surface|extracellular space|integral to membrane|membrane raft|plasma membrane	carboxypeptidase activity|glycoprotein binding|metallopeptidase activity|peptidyl-dipeptidase activity|viral receptor activity|zinc ion binding	g.chrX:15584408G>C	AF291820	CCDS14169.1	Xp22	2013-06-12	2013-06-12		ENSG00000130234	ENSG00000130234	3.4.17.23		13557	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	300335	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 2"""			10969042	Standard	NM_021804		Approved		uc004cxb.2	Q9BYF1	OTTHUMG00000021177	ENST00000252519.3:c.2082C>G	X.37:g.15584408G>C	ENSP00000252519:p.Ile694Met		Somatic				ACE2_uc004cxb.2_Missense_Mutation_p.I694M	p.I694M	NM_021804	NP_068576	WXS	Illumina HiSeq	Unspecified	Q9BYF1	ACE2_HUMAN			16	2250	-	Hepatocellular(33;0.183)		694			Extracellular (Potential).		C7ECU1|Q6UWP0|Q86WT0|Q9NRA7|Q9UFZ6	Missense_Mutation	SNP	ENST00000252519.3	37	c.2082C>G	CCDS14169.1	.	.	.	.	.	.	.	.	.	.	G	8.759	0.923217	0.18056	.	.	ENSG00000130234	ENST00000252519;ENST00000427411	D;D	0.85411	-1.98;-1.98	5.38	3.58	0.41010	.	0.883191	0.10161	N	0.708270	D	0.84092	0.5396	M	0.78049	2.395	0.09310	N	1	B	0.16802	0.019	B	0.17979	0.02	T	0.73639	-0.3919	10	0.54805	T	0.06	-1.1905	6.6827	0.23129	0.1654:0.4035:0.4311:0.0	.	694	Q9BYF1	ACE2_HUMAN	M	694	ENSP00000252519:I694M;ENSP00000389326:I694M	ENSP00000252519:I694M	I	-	3	3	ACE2	15494329	0.093000	0.21703	0.046000	0.18839	0.058000	0.15608	0.092000	0.15066	0.529000	0.28599	0.600000	0.82982	ATC		0.383	ACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055867.1			34	171	0	0	0	0	34	171				
HUWE1	10075	broad.mit.edu	37	X	53589797	53589797	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chrX:53589797C>T	ENST00000342160.3	-	52	7656	c.7199G>A	c.(7198-7200)cGa>cAa	p.R2400Q	HUWE1_ENST00000262854.6_Missense_Mutation_p.R2400Q			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	2400	Glu-rich.				base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						CTCACCTTCTCGGTTGGCCTG	0.562																																						uc004dsp.2		NA																	0				ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						c.(7198-7200)CGA>CAA		HECT, UBA and WWE domain containing 1							149.0	105.0	120.0					X																	53589797		2203	4300	6503	SO:0001583	missense	10075				base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity	g.chrX:53589797C>T	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.7199G>A	X.37:g.53589797C>T	ENSP00000340648:p.Arg2400Gln		Somatic				HUWE1_uc004dsn.2_Missense_Mutation_p.R1224Q	p.R2400Q	NM_031407	NP_113584	WXS	Illumina HiSeq	Unspecified	Q7Z6Z7	HUWE1_HUMAN			53	7601	-			2400			Glu-rich.		O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	37	c.7199G>A	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	C	18.53	3.643176	0.67244	.	.	ENSG00000086758	ENST00000342160;ENST00000262854	T;T	0.37584	1.19;1.19	5.89	5.89	0.94794	.	0.000000	0.64402	D	0.000001	T	0.46560	0.1399	N	0.19112	0.55	0.52501	D	0.999954	D;D	0.71674	0.994;0.998	D;D	0.75484	0.921;0.986	T	0.41324	-0.9515	10	0.38643	T	0.18	.	17.7712	0.88493	0.0:1.0:0.0:0.0	.	2400;2400	Q7Z6Z7;Q7Z6Z7-2	HUWE1_HUMAN;.	Q	2400	ENSP00000340648:R2400Q;ENSP00000262854:R2400Q	ENSP00000262854:R2400Q	R	-	2	0	HUWE1	53606522	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.140000	0.77322	2.470000	0.83445	0.600000	0.82982	CGA		0.562	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119		17	84	0	0	0	0	17	84				
WNK3	65267	broad.mit.edu	37	X	54321097	54321097	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chrX:54321097G>C	ENST00000375159.2	-	7	1581	c.1582C>G	c.(1582-1584)Ctt>Gtt	p.L528V	WNK3_ENST00000375169.3_Missense_Mutation_p.L528V|WNK3_ENST00000354646.2_Missense_Mutation_p.L528V			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	528					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						GCGGGAGCAAGGGGTAAAGTT	0.478																																						uc004dtd.1		NA																	0				lung(4)|ovary(3)|kidney(2)|central_nervous_system(2)	11						c.(1582-1584)CTT>GTT		WNK lysine deficient protein kinase 3 isoform 2							81.0	71.0	74.0					X																	54321097		2203	4300	6503	SO:0001583	missense	65267				intracellular protein kinase cascade|positive regulation of establishment of protein localization in plasma membrane|positive regulation of peptidyl-threonine phosphorylation|positive regulation of rubidium ion transmembrane transporter activity|positive regulation of rubidium ion transport|positive regulation of sodium ion transmembrane transporter activity|positive regulation of sodium ion transport|protein autophosphorylation	adherens junction|tight junction	ATP binding|protein binding|protein serine/threonine kinase activity|rubidium ion transmembrane transporter activity|sodium ion transmembrane transporter activity	g.chrX:54321097G>C	AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.1582C>G	X.37:g.54321097G>C	ENSP00000364301:p.Leu528Val		Somatic				WNK3_uc004dtc.1_Missense_Mutation_p.L528V	p.L528V	NM_001002838	NP_001002838	WXS	Illumina HiSeq	Unspecified	Q9BYP7	WNK3_HUMAN			8	2021	-			528					B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Missense_Mutation	SNP	ENST00000375159.2	37	c.1582C>G	CCDS14357.1	.	.	.	.	.	.	.	.	.	.	G	0.029	-1.349465	0.01266	.	.	ENSG00000196632	ENST00000375169;ENST00000354646;ENST00000375159	T;T;T	0.70045	-0.42;-0.45;-0.45	4.32	1.4	0.22301	.	1.404380	0.04699	N	0.415542	T	0.45418	0.1341	N	0.14661	0.345	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.14023	0.004;0.01	T	0.19943	-1.0290	10	0.16420	T	0.52	2.5203	2.9955	0.05997	0.0927:0.1361:0.3609:0.4103	.	528;528	Q9BYP7-3;Q9BYP7	.;WNK3_HUMAN	V	528	ENSP00000364312:L528V;ENSP00000346667:L528V;ENSP00000364301:L528V	ENSP00000346667:L528V	L	-	1	0	WNK3	54337822	0.000000	0.05858	0.000000	0.03702	0.296000	0.27459	-0.428000	0.06991	0.027000	0.15297	0.594000	0.82650	CTT		0.478	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056799.2	NM_020922		9	38	0	0	0	0	9	38				
ATP7A	538	broad.mit.edu	37	X	77301958	77301958	+	Missense_Mutation	SNP	A	A	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chrX:77301958A>G	ENST00000341514.6	+	23	4549	c.4394A>G	c.(4393-4395)aAc>aGc	p.N1465S	ATP7A_ENST00000350425.4_Missense_Mutation_p.N468S|ATP7A_ENST00000343533.5_Missense_Mutation_p.N1387S	NM_000052.5	NP_000043.4	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide	1465					blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cartilage development (GO:0051216)|catecholamine metabolic process (GO:0006584)|cellular copper ion homeostasis (GO:0006878)|central nervous system neuron development (GO:0021954)|cerebellar Purkinje cell differentiation (GO:0021702)|collagen fibril organization (GO:0030199)|copper ion export (GO:0060003)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|dendrite morphogenesis (GO:0048813)|detoxification of copper ion (GO:0010273)|dopamine metabolic process (GO:0042417)|elastic fiber assembly (GO:0048251)|elastin biosynthetic process (GO:0051542)|epinephrine metabolic process (GO:0042414)|extracellular matrix organization (GO:0030198)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|lung alveolus development (GO:0048286)|mitochondrion organization (GO:0007005)|negative regulation of metalloenzyme activity (GO:0048553)|negative regulation of neuron apoptotic process (GO:0043524)|neuron projection morphogenesis (GO:0048812)|norepinephrine biosynthetic process (GO:0042421)|norepinephrine metabolic process (GO:0042415)|peptidyl-lysine modification (GO:0018205)|pigmentation (GO:0043473)|positive regulation of catalytic activity (GO:0043085)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of oxidoreductase activity (GO:0051353)|pyramidal neuron development (GO:0021860)|regulation of gene expression (GO:0010468)|regulation of oxidative phosphorylation (GO:0002082)|release of cytochrome c from mitochondria (GO:0001836)|removal of superoxide radicals (GO:0019430)|response to iron(III) ion (GO:0010041)|response to zinc ion (GO:0010043)|serotonin metabolic process (GO:0042428)|skin development (GO:0043588)|T-helper cell differentiation (GO:0042093)|transmembrane transport (GO:0055085)|tryptophan metabolic process (GO:0006568)|tyrosine metabolic process (GO:0006570)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper ion transmembrane transporter activity (GO:0005375)|copper-dependent protein binding (GO:0032767)|copper-exporting ATPase activity (GO:0004008)|superoxide dismutase copper chaperone activity (GO:0016532)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(26)|pancreas(1)|prostate(1)|urinary_tract(1)	53					Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	GCCTCTATAAACTCACTACTG	0.438																																						uc004ecx.3		NA																	0					0						c.(4393-4395)AAC>AGC		ATPase, Cu++ transporting, alpha polypeptide							191.0	190.0	190.0					X																	77301958		2203	4296	6499	SO:0001583	missense	538				ATP biosynthetic process|blood vessel development|blood vessel remodeling|cartilage development|cellular copper ion homeostasis|cerebellar Purkinje cell differentiation|collagen fibril organization|copper ion import|detoxification of copper ion|dopamine metabolic process|elastic fiber assembly|elastin biosynthetic process|epinephrine metabolic process|hair follicle morphogenesis|locomotory behavior|lung alveolus development|negative regulation of metalloenzyme activity|neuroprotection|peptidyl-lysine modification|pigmentation|positive regulation of metalloenzyme activity|positive regulation of oxidoreductase activity|pyramidal neuron development|regulation of oxidative phosphorylation|removal of superoxide radicals|serotonin metabolic process|skin development|T-helper cell differentiation|tryptophan metabolic process	basolateral plasma membrane|cytosol|endoplasmic reticulum|endoplasmic reticulum|integral to membrane|late endosome|neuron projection|neuronal cell body|perinuclear region of cytoplasm|trans-Golgi network|trans-Golgi network transport vesicle	ATP binding|copper-dependent protein binding|copper-exporting ATPase activity|superoxide dismutase copper chaperone activity	g.chrX:77301958A>G	L06133	CCDS35339.1, CCDS75997.1	Xq21.1	2012-10-22	2008-07-31		ENSG00000165240	ENSG00000165240	3.6.3.4	"""ATPases / P-type"""	869	protein-coding gene	gene with protein product	"""copper pump 1"", ""copper-transporting ATPase 1"""	300011	"""Menkes syndrome"""	MNK		10079817	Standard	NM_000052		Approved		uc004ecx.4	Q04656	OTTHUMG00000021885	ENST00000341514.6:c.4394A>G	X.37:g.77301958A>G	ENSP00000345728:p.Asn1465Ser		Somatic					p.N1465S	NM_000052	NP_000043	WXS	Illumina HiSeq	Unspecified	Q04656	ATP7A_HUMAN			23	4554	+			1465			Cytoplasmic (Potential).		B1AT72|O00227|O00745|Q9BYY8	Missense_Mutation	SNP	ENST00000341514.6	37	c.4394A>G	CCDS35339.1	.	.	.	.	.	.	.	.	.	.	A	13.56	2.274290	0.40194	.	.	ENSG00000165240	ENST00000343533;ENST00000350425;ENST00000341514	T;T;T	0.60672	0.17;0.17;0.17	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.47746	0.1462	N	0.16478	0.41	0.50313	D	0.999865	P	0.51449	0.945	P	0.53006	0.715	T	0.45673	-0.9245	10	0.02654	T	1	-3.917	13.8073	0.63240	1.0:0.0:0.0:0.0	.	1465	Q04656	ATP7A_HUMAN	S	1387;468;1465	ENSP00000343026:N1387S;ENSP00000343678:N468S;ENSP00000345728:N1465S	ENSP00000345728:N1465S	N	+	2	0	ATP7A	77188614	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.045000	0.57368	1.634000	0.50500	0.356000	0.21956	AAC		0.438	ATP7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057306.1	NM_000052		60	239	0	0	0	0	60	239				
CPXCR1	53336	broad.mit.edu	37	X	88008988	88008988	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chrX:88008988G>C	ENST00000276127.4	+	3	832	c.573G>C	c.(571-573)gaG>gaC	p.E191D	CPXCR1_ENST00000373111.1_Missense_Mutation_p.E191D	NM_033048.5	NP_149037	Q8N123	CPXCR_HUMAN	CPX chromosome region, candidate 1	191							metal ion binding (GO:0046872)			NS(1)|cervix(1)|kidney(1)|large_intestine(11)|liver(1)|lung(20)|ovary(3)|upper_aerodigestive_tract(2)	40						CCCATCACGAGAGAGCCATAA	0.423																																						uc004efd.3		NA																	0				ovary(3)	3						c.(571-573)GAG>GAC		CPX chromosome region, candidate 1							70.0	56.0	61.0					X																	88008988		2203	4300	6503	SO:0001583	missense	53336					intracellular	zinc ion binding	g.chrX:88008988G>C	AL031116	CCDS14458.1	Xq21.3	2009-08-06			ENSG00000147183	ENSG00000147183			2332	protein-coding gene	gene with protein product	"""cancer/testis antigen 77"""					11499681	Standard	NM_033048		Approved	CT77	uc004efc.4	Q8N123	OTTHUMG00000021950	ENST00000276127.4:c.573G>C	X.37:g.88008988G>C	ENSP00000276127:p.Glu191Asp		Somatic				CPXCR1_uc004efc.3_Missense_Mutation_p.E191D	p.E191D	NM_033048	NP_149037	WXS	Illumina HiSeq	Unspecified	Q8N123	CPXCR_HUMAN			3	832	+			191					B2R9F9|D3DTE7|Q96RS3	Missense_Mutation	SNP	ENST00000276127.4	37	c.573G>C	CCDS14458.1	.	.	.	.	.	.	.	.	.	.	G	4.815	0.151505	0.09185	.	.	ENSG00000147183	ENST00000276127;ENST00000373111	T;T	0.43688	0.94;0.94	3.06	-2.95	0.05564	.	0.732413	0.11160	N	0.593141	T	0.19248	0.0462	N	0.14661	0.345	0.09310	N	1	B	0.15930	0.015	B	0.17433	0.018	T	0.20739	-1.0266	9	.	.	.	-1.0419	4.2321	0.10608	0.4336:0.3431:0.2232:0.0	.	191	Q8N123	CPXCR_HUMAN	D	191	ENSP00000276127:E191D;ENSP00000362203:E191D	.	E	+	3	2	CPXCR1	87895644	0.001000	0.12720	0.000000	0.03702	0.004000	0.04260	-0.246000	0.08878	-0.983000	0.03511	-0.209000	0.12711	GAG		0.423	CPXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057418.1	NM_033048		5	37	0	0	0	0	5	37				
PCDH11X	27328	broad.mit.edu	37	X	91134270	91134270	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chrX:91134270C>G	ENST00000373094.1	+	2	3876	c.3031C>G	c.(3031-3033)Ccg>Gcg	p.P1011A	PCDH11X_ENST00000298274.8_Missense_Mutation_p.P1011A|PCDH11X_ENST00000406881.1_Missense_Mutation_p.P1011A|PCDH11X_ENST00000361655.2_Missense_Mutation_p.P1011A|PCDH11X_ENST00000373088.1_Missense_Mutation_p.P1011A|PCDH11X_ENST00000373097.1_Missense_Mutation_p.P1011A|PCDH11X_ENST00000395337.2_Missense_Mutation_p.P1011A|PCDH11X_ENST00000361724.1_Missense_Mutation_p.P1011A|PCDH11X_ENST00000504220.2_Missense_Mutation_p.P1011A	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	1011					homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						ACACACCAGACCGGTAGGTAT	0.403																																					NSCLC(38;925 1092 2571 38200 45895)	uc004efk.1		NA																	0				large_intestine(2)	2						c.(3031-3033)CCG>GCG		protocadherin 11 X-linked isoform c							120.0	101.0	107.0					X																	91134270		2203	4300	6503	SO:0001583	missense	27328				homophilic cell adhesion	integral to plasma membrane	calcium ion binding	g.chrX:91134270C>G	AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.3031C>G	X.37:g.91134270C>G	ENSP00000362186:p.Pro1011Ala		Somatic				PCDH11X_uc004efl.1_Missense_Mutation_p.P1011A|PCDH11X_uc004efo.1_Missense_Mutation_p.P1011A|PCDH11X_uc010nmv.1_Missense_Mutation_p.P1011A|PCDH11X_uc004efm.1_Missense_Mutation_p.P1011A|PCDH11X_uc004efn.1_Missense_Mutation_p.P1011A|PCDH11X_uc004efh.1_Missense_Mutation_p.P1011A|PCDH11X_uc004efj.1_Missense_Mutation_p.P1011A	p.P1011A	NM_032968	NP_116750	WXS	Illumina HiSeq	Unspecified	Q9BZA7	PC11X_HUMAN			2	3876	+			1011			Cytoplasmic (Potential).		A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	ENST00000373094.1	37	c.3031C>G	CCDS14461.1	.	.	.	.	.	.	.	.	.	.	C	13.66	2.303290	0.40795	.	.	ENSG00000102290	ENST00000395337;ENST00000373094;ENST00000373097;ENST00000361724;ENST00000373088;ENST00000504220;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T;T;T;T	0.51325	0.75;0.79;0.8;0.77;0.79;0.71;0.73;0.81;0.79	5.2	5.2	0.72013	.	0.556594	0.18346	N	0.144012	T	0.35422	0.0931	L	0.29908	0.895	0.26615	N	0.972758	B;B;B;B;B;B;B;B	0.30605	0.204;0.125;0.125;0.222;0.071;0.081;0.287;0.032	B;B;B;B;B;B;B;B	0.32624	0.124;0.149;0.149;0.149;0.075;0.034;0.124;0.075	T	0.21518	-1.0243	10	0.02654	T	1	.	16.6987	0.85343	0.0:1.0:0.0:0.0	.	1011;1011;1011;1011;1011;1011;1011;1011	Q9BZA7-6;Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7;Q9BZA7-7;Q9BZA7-2	.;.;.;.;.;PC11X_HUMAN;.;.	A	1011	ENSP00000378746:P1011A;ENSP00000362186:P1011A;ENSP00000362189:P1011A;ENSP00000355040:P1011A;ENSP00000362180:P1011A;ENSP00000423762:P1011A;ENSP00000355105:P1011A;ENSP00000384758:P1011A;ENSP00000298274:P1011A	ENSP00000298274:P1011A	P	+	1	0	PCDH11X	91020926	0.999000	0.42202	0.986000	0.45419	0.183000	0.23260	3.228000	0.51270	2.146000	0.66826	0.600000	0.82982	CCG		0.403	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969		18	94	0	0	0	0	18	94				
ARMCX2	9823	broad.mit.edu	37	X	100911437	100911437	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chrX:100911437C>G	ENST00000328766.5	-	5	1591	c.1138G>C	c.(1138-1140)Gat>Cat	p.D380H	ARMCX2_ENST00000467416.1_5'Flank|ARMCX2_ENST00000356824.4_Missense_Mutation_p.D380H|ARMCX2_ENST00000330154.2_Missense_Mutation_p.D380H	NM_014782.5	NP_055597.1	Q7L311	ARMX2_HUMAN	armadillo repeat containing, X-linked 2	380						integral component of membrane (GO:0016021)				NS(1)|breast(4)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(6)|prostate(1)|skin(1)	29						AGAATCTCATCAATTTCATAA	0.517																																						uc004eid.2		NA																	0				ovary(6)	6						c.(1138-1140)GAT>CAT		ALEX2 protein							94.0	83.0	87.0					X																	100911437		2203	4300	6503	SO:0001583	missense	9823					integral to membrane	binding	g.chrX:100911437C>G	AB011084	CCDS14490.1	Xq21.33-q22.2	2014-03-21			ENSG00000184867	ENSG00000184867		"""Armadillo repeat containing"""	16869	protein-coding gene	gene with protein product		300363				9628581, 11162520, 16221301, 22569362	Standard	XM_005278109		Approved	ALEX2, KIAA0512, GASP9	uc004eif.3	Q7L311	OTTHUMG00000022038	ENST00000328766.5:c.1138G>C	X.37:g.100911437C>G	ENSP00000331662:p.Asp380His		Somatic				ARMCX2_uc004eie.3_Missense_Mutation_p.D380H|ARMCX2_uc004eif.3_Missense_Mutation_p.D380H|ARMCX2_uc004eig.3_Missense_Mutation_p.D380H|ARMCX2_uc010nnt.2_Missense_Mutation_p.D380H	p.D380H	NM_177949	NP_808818	WXS	Illumina HiSeq	Unspecified	Q7L311	ARMX2_HUMAN			3	1493	-			380			ARM 1.		O60267|Q5H9D9	Missense_Mutation	SNP	ENST00000328766.5	37	c.1138G>C	CCDS14490.1	.	.	.	.	.	.	.	.	.	.	C	14.95	2.688124	0.48097	.	.	ENSG00000184867	ENST00000328766;ENST00000330154;ENST00000356824	T;T;T	0.33654	1.4;1.4;1.4	3.77	3.77	0.43336	.	0.383922	0.23668	N	0.045754	T	0.51278	0.1665	L	0.55990	1.75	0.36682	D	0.87911	D	0.89917	1.0	D	0.81914	0.995	T	0.60141	-0.7321	10	0.72032	D	0.01	-13.8413	10.0786	0.42375	0.0:1.0:0.0:0.0	.	380	Q7L311	ARMX2_HUMAN	H	380	ENSP00000331662:D380H;ENSP00000328631:D380H;ENSP00000349281:D380H	ENSP00000331662:D380H	D	-	1	0	ARMCX2	100798093	0.959000	0.32827	0.998000	0.56505	0.974000	0.67602	1.266000	0.33039	2.131000	0.65755	0.422000	0.28245	GAT		0.517	ARMCX2-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057586.1	NM_014782		17	79	0	0	0	0	17	79				
R3HDML	140902	broad.mit.edu	37	20	42965898	42965898	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr20:42965898delC	ENST00000217043.2	+	1	273	c.101delC	c.(100-102)gccfs	p.A34fs		NM_178491.2	NP_848586.1	Q9H3Y0	CRSPL_HUMAN	R3H domain containing-like	34						extracellular region (GO:0005576)	peptidase inhibitor activity (GO:0030414)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)	21		Myeloproliferative disorder(115;0.028)	COAD - Colon adenocarcinoma(18;0.00189)			CCAGCCCCGGCCCAGCCCGAG	0.647																																						uc002xls.1		NA																	0					0						c.(100-102)GCCfs		R3H domain containing-like precursor							44.0	44.0	44.0					20																	42965898		2203	4299	6502	SO:0001589	frameshift_variant	140902					extracellular region	peptidase inhibitor activity	g.chr20:42965898delC	BC107048	CCDS13329.1	20q13.12	2007-04-26	2005-09-02		ENSG00000101074	ENSG00000101074			16249	protein-coding gene	gene with protein product			"""R3H domain (binds single-stranded nucleic acids) containing-like"""				Standard	NM_178491		Approved	dJ881L22.3	uc002xls.2	Q9H3Y0	OTTHUMG00000032524	ENST00000217043.2:c.101delC	20.37:g.42965898delC	ENSP00000217043:p.Ala34fs		Somatic					p.A34fs	NM_178491	NP_848586	WXS	Illumina HiSeq	Unspecified	Q9H3Y0	CRSPL_HUMAN	COAD - Colon adenocarcinoma(18;0.00189)		1	273	+		Myeloproliferative disorder(115;0.028)	34						Frame_Shift_Del	DEL	ENST00000217043.2	37	c.101delC	CCDS13329.1																																																																																				0.647	R3HDML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079344.1	NM_178491		13	74	NA	NA	NA	NA	13	74	---	---	---	---
ZNF608	57507	broad.mit.edu	37	5	123984449	123984449	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CR-6484-01A-11D-1870-08	TCGA-CR-6484-10A-01D-1870-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e72df726-1575-4789-afac-3b15a7643401	b0fa7dd3-58da-45b8-bff4-1d665e21df9f	g.chr5:123984449delA	ENST00000306315.5	-	4	2063	c.1628delT	c.(1627-1629)ttgfs	p.L543fs	ZNF608_ENST00000504926.1_Frame_Shift_Del_p.L116fs	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	543							metal ion binding (GO:0046872)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		GCCTTGGTCCAAAAAAGTAGT	0.502																																						uc003ktq.1		NA																	0				skin(3)|ovary(2)|lung(1)	6						c.(1627-1629)TTGfs		zinc finger protein 608							164.0	156.0	159.0					5																	123984449		2203	4300	6503	SO:0001589	frameshift_variant	57507					intracellular	zinc ion binding	g.chr5:123984449delA	AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.1628delT	5.37:g.123984449delA	ENSP00000307746:p.Leu543fs		Somatic				ZNF608_uc003ktr.1_Intron|ZNF608_uc003kts.1_Frame_Shift_Del_p.L543fs|ZNF608_uc003ktt.1_Frame_Shift_Del_p.L543fs	p.L543fs	NM_020747	NP_065798	WXS	Illumina HiSeq	Unspecified	Q9ULD9	ZN608_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)	4	1751	-		all_cancers(142;0.186)|Prostate(80;0.081)	543					A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	Frame_Shift_Del	DEL	ENST00000306315.5	37	c.1628delT	CCDS34219.1																																																																																				0.502	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371300.1	XM_114432		7	191	NA	NA	NA	NA	7	191	---	---	---	---
