#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
CAMTA1	23261	broad.mit.edu	37	1	7798213	7798213	+	Missense_Mutation	SNP	G	G	A	rs375995525		TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr1:7798213G>A	ENST00000303635.7	+	16	4060	c.3853G>A	c.(3853-3855)Gag>Aag	p.E1285K	CAMTA1_ENST00000439411.2_Missense_Mutation_p.E1285K	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	1285					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		GTCTGTCCCCGAGACACTCAG	0.552			T	WWTR1	epitheliod hemangioendothelioma								G|||	1	0.000199681	0.0	0.0	5008	,	,		19960	0.0		0.001	False		,,,				2504	0.0					uc001aoi.2		NA		Dom	yes		1	1p36.31-p36.23	611501		calmodulin binding transcription activator 1			M					0				ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9						c.(3853-3855)GAG>AAG		calmodulin-binding transcription activator 1		G	LYS/GLU	1,4405	2.1+/-5.4	0,1,2202	56.0	54.0	55.0		3853	5.1	1.0	1		55	0,8600		0,0,4300	no	missense	CAMTA1	NM_015215.2	56	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	1285/1674	7798213	1,13005	2203	4300	6503	SO:0001583	missense	23261				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding	g.chr1:7798213G>A	AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.3853G>A	1.37:g.7798213G>A	ENSP00000306522:p.Glu1285Lys		Somatic				CAMTA1_uc010nzv.1_Missense_Mutation_p.E372K|CAMTA1_uc001aok.3_Missense_Mutation_p.E328K|CAMTA1_uc001aoj.2_Missense_Mutation_p.E241K	p.E1285K	NM_015215	NP_056030	WXS	Illumina HiSeq	Unspecified	Q9Y6Y1	CMTA1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)	16	4060	+	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)	1285					A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Missense_Mutation	SNP	ENST00000303635.7	37	c.3853G>A	CCDS30576.1	.	.	.	.	.	.	.	.	.	.	G	14.67	2.603802	0.46423	2.27E-4	0.0	ENSG00000171735	ENST00000303635;ENST00000439411;ENST00000414738;ENST00000303646	T;T	0.21932	1.98;1.99	5.06	5.06	0.68205	.	0.101773	0.64402	D	0.000004	T	0.23014	0.0556	L	0.44542	1.39	0.35820	D	0.824495	D;D;D;D	0.57899	0.959;0.976;0.981;0.976	B;B;P;B	0.46253	0.282;0.353;0.509;0.427	T	0.14364	-1.0475	10	0.23891	T	0.37	-15.1793	15.2211	0.73310	0.0:0.1409:0.8591:0.0	.	1285;372;241;1285	Q9Y6Y1-2;B4DXR3;Q7Z7P1;Q9Y6Y1	.;.;.;CMTA1_HUMAN	K	1285;1285;372;241	ENSP00000306522:E1285K;ENSP00000402561:E1285K	ENSP00000306522:E1285K	E	+	1	0	CAMTA1	7720800	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.899000	0.69846	2.505000	0.84491	0.655000	0.94253	GAG		0.552	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000003588.3	NM_015215		23	14	0	0	0	0	23	14				
MACF1	23499	broad.mit.edu	37	1	39951383	39951383	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr1:39951383G>A	ENST00000372915.3	+	97	22171	c.22084G>A	c.(22084-22086)Ggg>Agg	p.G7362R	MACF1_ENST00000361689.2_Missense_Mutation_p.G5404R|MACF1_ENST00000567887.1_Missense_Mutation_p.G7566R|MACF1_ENST00000539005.1_Missense_Mutation_p.G5274R|MACF1_ENST00000317713.7_Missense_Mutation_p.G5404R|MACF1_ENST00000564288.1_Missense_Mutation_p.G7529R|MACF1_ENST00000545844.1_Missense_Mutation_p.G5404R|MACF1_ENST00000289893.4_Missense_Mutation_p.G5912R			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	7362	C-terminal tail. {ECO:0000250}.				ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CTCCAGGAGAGGGCTAAACAA	0.542																																						uc010oiu.1		NA																	0				ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16						c.(17734-17736)GGG>AGG		microfilament and actin filament cross-linker							92.0	94.0	93.0					1																	39951383		2203	4300	6503	SO:0001583	missense	23499				cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding	g.chr1:39951383G>A	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.22084G>A	1.37:g.39951383G>A	ENSP00000362006:p.Gly7362Arg		Somatic				MACF1_uc010ois.1_Missense_Mutation_p.G5404R|MACF1_uc001cde.1_Missense_Mutation_p.G318R|MACF1_uc001cdf.1_Missense_Mutation_p.G287R|MACF1_uc001cdg.2_3'UTR|MACF1_uc001cdh.2_3'UTR	p.G5912R	NM_033044	NP_149033	WXS	Illumina HiSeq	Unspecified	Q9UPN3	MACF1_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)		64	17865	+	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	7362			C-terminal tail (By similarity).		B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37	c.17734G>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.6|24.6	4.549223|4.549223	0.86127|0.86127	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893;ENST00000539218|ENST00000372925;ENST00000446276	T;T;T;T;T;T|T;T	0.63417|0.63580	-0.0;0.05;-0.0;-0.04;0.15;1.15|1.51;-0.05	5.7|5.7	5.7|5.7	0.88788|0.88788	.|.	0.000000|.	0.64402|.	D|.	0.000009|.	T|T	0.72128|0.72128	0.3422|0.3422	L|L	0.53249|0.53249	1.67|1.67	0.80722|0.80722	D|D	1|1	D;B;D;P|.	0.89917|.	1.0;0.203;1.0;0.655|.	D;B;D;B|.	0.97110|.	0.987;0.099;1.0;0.389|.	T|T	0.67684|0.67684	-0.5607|-0.5607	9|6	.|.	.|.	.|.	.|.	19.8351|19.8351	0.96655|0.96655	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	7362;5404;5912;341|.	Q9UPN3;F8W8Q1;Q96PK2;B1ANQ7|.	MACF1_HUMAN;.;MACF4_HUMAN;.|.	R|K	5404;7362;5404;5404;5274;5912;318|4407;428	ENSP00000439537:G5404R;ENSP00000362006:G7362R;ENSP00000354573:G5404R;ENSP00000313438:G5404R;ENSP00000444364:G5274R;ENSP00000289893:G5912R|ENSP00000362016:R4407K;ENSP00000391512:R428K	.|.	G|R	+|+	1|2	0|0	MACF1|MACF1	39723970|39723970	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	4.931000|4.931000	0.63469|0.63469	2.687000|2.687000	0.91594|0.91594	0.655000|0.655000	0.94253|0.94253	GGG|AGG		0.542	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044		6	129	0	0	0	0	6	129				
ZFP69B	65243	broad.mit.edu	37	1	40929123	40929123	+	Silent	SNP	C	C	G			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr1:40929123C>G	ENST00000411995.2	+	6	1842	c.1467C>G	c.(1465-1467)tcC>tcG	p.S489S	RP1-228H13.5_ENST00000565390.1_RNA|ZFP69B_ENST00000361584.3_Silent_p.S387S|ZFP69B_ENST00000484445.1_3'UTR	NM_023070.2	NP_075558.2	Q9UJL9	ZF69B_HUMAN	ZFP69 zinc finger protein B	489					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										ATGATTCATCCTTTGCTAAAC	0.388																																						uc001cfn.1		NA																	0				ovary(2)	2						c.(1465-1467)TCC>TCG		zinc finger protein 643							78.0	76.0	76.0					1																	40929123		2203	4300	6503	SO:0001819	synonymous_variant	65243				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr1:40929123C>G	BC017498	CCDS452.1, CCDS452.2	1p34.2	2013-01-09	2012-11-27	2012-11-27	ENSG00000187801	ENSG00000187801		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	28053	protein-coding gene	gene with protein product			"""zinc finger protein 643"""	ZNF643			Standard	NM_023070		Approved	ZKSCAN23B, FLJ34293, ZSCAN54B	uc001cfn.2	Q9UJL9	OTTHUMG00000007302	ENST00000411995.2:c.1467C>G	1.37:g.40929123C>G			Somatic				ZNF643_uc001cfl.1_Silent_p.S387S|ZNF643_uc001cfm.1_Silent_p.S355S	p.S489S	NM_023070	NP_075558	WXS	Illumina HiSeq	Unspecified	Q9UJL9	ZN643_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;5.25e-18)		5	1764	+	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	489			C2H2-type 8.		Q5QPL4	Silent	SNP	ENST00000411995.2	37	c.1467C>G	CCDS452.2																																																																																				0.388	ZFP69B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019078.2	NM_023070		4	47	0	0	0	0	4	47				
ST3GAL3	6487	broad.mit.edu	37	1	44365306	44365306	+	Silent	SNP	T	T	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr1:44365306T>A	ENST00000361392.4	+	9	828	c.651T>A	c.(649-651)ccT>ccA	p.P217P	ST3GAL3_ENST00000262915.3_Silent_p.P286P|ST3GAL3_ENST00000372369.1_Silent_p.P217P|ST3GAL3_ENST00000372367.1_Intron|ST3GAL3_ENST00000372366.1_Intron|ST3GAL3_ENST00000461375.1_3'UTR|ST3GAL3_ENST00000372372.2_Silent_p.P255P|ST3GAL3_ENST00000531816.1_Intron|ST3GAL3_ENST00000361812.4_Intron|ST3GAL3_ENST00000351035.3_Silent_p.P255P|ST3GAL3_ENST00000347631.2_Silent_p.P232P|ST3GAL3_ENST00000332628.6_Silent_p.P186P|ST3GAL3_ENST00000531451.1_Intron|ST3GAL3_ENST00000330208.2_Intron|ST3GAL3_ENST00000361746.4_Silent_p.P286P|ST3GAL3_ENST00000372368.2_Silent_p.P271P|ST3GAL3_ENST00000353126.3_Silent_p.P217P|ST3GAL3_ENST00000372374.2_Silent_p.P186P|ST3GAL3_ENST00000361400.4_Silent_p.P201P|ST3GAL3_ENST00000545417.1_Intron|ST3GAL3_ENST00000528371.1_Intron|ST3GAL3_ENST00000372365.1_Intron|ST3GAL3_ENST00000533933.1_Silent_p.P217P|ST3GAL3_ENST00000372377.4_Intron|ST3GAL3_ENST00000531993.1_Silent_p.P201P|ST3GAL3_ENST00000372375.2_Silent_p.P271P|ST3GAL3_ENST00000372362.2_Intron|ST3GAL3_ENST00000335430.6_Intron	NM_001270459.1|NM_006279.3|NM_174964.2	NP_001257388.1|NP_006270.1|NP_777624.1	Q11203	SIAT6_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 3	217					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)|N-acetyllactosaminide alpha-2,3-sialyltransferase activity (GO:0008118)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(3)|skin(1)	19	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0518)				TGCAGCGGCCTGAGCAGTACG	0.537																																						uc001ckc.2		NA																	0				ovary(3)	3						c.(649-651)CCT>CCA		sialyltransferase 6 isoform j							109.0	108.0	108.0					1																	44365306		2203	4300	6503	SO:0001819	synonymous_variant	6487				protein glycosylation	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	N-acetyllactosaminide alpha-2,3-sialyltransferase activity	g.chr1:44365306T>A	L23768	CCDS492.1, CCDS493.1, CCDS494.1, CCDS495.1, CCDS496.1, CCDS497.1, CCDS498.1, CCDS499.1, CCDS500.1, CCDS53310.1, CCDS57988.1, CCDS57989.1, CCDS57990.1, CCDS57991.1, CCDS57992.1, CCDS57993.1, CCDS57994.1	1p34.1	2014-01-31	2005-02-07	2005-02-07	ENSG00000126091	ENSG00000126091	2.4.99.6	"""Sialyltransferases"""	10866	protein-coding gene	gene with protein product	"""ST3Gal III"""	606494	"""sialyltransferase 6 (N-acetyllacosaminide alpha 2,3-sialyltransferase)"", ""mental retardation, non-syndromic, autosomal recessive, 12"""	SIAT6, MRT12		8333853, 21907012	Standard	NM_174963		Approved		uc001cjz.4	Q11203	OTTHUMG00000007561	ENST00000361392.4:c.651T>A	1.37:g.44365306T>A			Somatic				ST3GAL3_uc010okj.1_RNA|ST3GAL3_uc001cjz.2_Silent_p.P232P|ST3GAL3_uc001cka.2_Intron|ST3GAL3_uc001ckb.2_Silent_p.P286P|ST3GAL3_uc001ckd.2_Silent_p.P271P|ST3GAL3_uc001cke.2_Silent_p.P201P|ST3GAL3_uc001ckf.2_Silent_p.P255P|ST3GAL3_uc001ckg.2_Silent_p.P217P|ST3GAL3_uc001ckh.2_Intron|ST3GAL3_uc001cki.2_Intron|ST3GAL3_uc009vwv.2_Silent_p.P217P|ST3GAL3_uc001ckj.2_RNA|ST3GAL3_uc009vww.2_Intron|ST3GAL3_uc001ckk.2_Silent_p.P186P|ST3GAL3_uc009vwy.2_Silent_p.P123P|ST3GAL3_uc009vwx.2_RNA|ST3GAL3_uc001ckm.2_Intron|ST3GAL3_uc001ckl.2_Intron|ST3GAL3_uc009vwz.2_Intron|ST3GAL3_uc001ckn.2_Intron|ST3GAL3_uc001ckp.2_Intron|ST3GAL3_uc001cko.2_Silent_p.P201P|ST3GAL3_uc009vxa.2_Silent_p.P4P|ST3GAL3_uc001ckq.2_Intron|ST3GAL3_uc001ckr.2_Silent_p.P170P|ST3GAL3_uc009vxb.2_Intron	p.P217P	NM_006279	NP_006270	WXS	Illumina HiSeq	Unspecified	Q11203	SIAT6_HUMAN			9	828	+	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0518)	217			Lumenal (Potential).		A9Z1W2|D3DPX8|Q5T4W9|Q5T4X0|Q5T4X7|Q5T4X8|Q5T4X9|Q5T4Y0|Q5T4Y2|Q5T4Y3|Q5T4Y4|Q86UR6|Q86UR7|Q86UR8|Q86UR9|Q86US0|Q86US1|Q86US2|Q8IX41|Q8IX42|Q8IX43|Q8IX44|Q8IX45|Q8IX46|Q8IX47|Q8IX48|Q8IX49|Q8IX50|Q8IX51|Q8IX52|Q8IX53|Q8IX54|Q8IX55|Q8IX56|Q8IX57|Q8IX58	Silent	SNP	ENST00000361392.4	37	c.651T>A	CCDS492.1	.	.	.	.	.	.	.	.	.	.	T	9.762	1.170396	0.21621	.	.	ENSG00000126091	ENST00000490502	.	.	.	5.69	-11.4	0.00090	.	.	.	.	.	T	0.33644	0.0870	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45614	-0.9249	4	.	.	.	.	3.6193	0.08089	0.2541:0.4271:0.1336:0.1851	.	.	.	.	Q	16	.	.	L	+	2	0	ST3GAL3	44137893	0.000000	0.05858	0.154000	0.22540	0.946000	0.59487	-3.668000	0.00398	-3.114000	0.00240	-1.258000	0.01471	CTG		0.537	ST3GAL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019964.1	NM_174963		42	54	0	0	0	0	42	54				
CC2D1B	200014	broad.mit.edu	37	1	52823543	52823543	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr1:52823543C>G	ENST00000371586.2	-	14	1645	c.1507G>C	c.(1507-1509)Gcc>Ccc	p.A503P	CC2D1B_ENST00000438831.1_5'UTR|CC2D1B_ENST00000460261.1_5'UTR|CC2D1B_ENST00000284376.3_Missense_Mutation_p.A497P	NM_032449.2	NP_115825.1	Q5T0F9	C2D1B_HUMAN	coiled-coil and C2 domain containing 1B	503						nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(1)|large_intestine(6)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	27						GGTTTCTTGGCCACTGGGGCC	0.632																																						uc001ctq.1		NA																	0				ovary(2)	2						c.(1507-1509)GCC>CCC		coiled-coil and C2 domain containing 1B							52.0	58.0	56.0					1																	52823543		2203	4300	6503	SO:0001583	missense	200014							g.chr1:52823543C>G	AB058739	CCDS30714.1	1p32.3	2008-02-05			ENSG00000154222	ENSG00000154222			29386	protein-coding gene	gene with protein product						11347906	Standard	NM_032449		Approved	KIAA1836	uc001ctq.2	Q5T0F9	OTTHUMG00000008102	ENST00000371586.2:c.1507G>C	1.37:g.52823543C>G	ENSP00000360642:p.Ala503Pro		Somatic				CC2D1B_uc001ctr.2_Missense_Mutation_p.A43P|CC2D1B_uc001cts.2_Missense_Mutation_p.A188P	p.A503P	NM_032449	NP_115825	WXS	Illumina HiSeq	Unspecified	Q5T0F9	C2D1B_HUMAN			14	1645	-			503					Q49AE8|Q5T0F8|Q5T0G0|Q6ZNQ1|Q96AP3|Q96I04|Q96JJ1	Missense_Mutation	SNP	ENST00000371586.2	37	c.1507G>C	CCDS30714.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.88|11.88	1.770485|1.770485	0.31320|0.31320	.|.	.|.	ENSG00000154222|ENSG00000154222	ENST00000371586;ENST00000284376;ENST00000371573|ENST00000438021;ENST00000450942	T;T|.	0.37411|.	1.55;1.2|.	5.37|5.37	4.45|4.45	0.53987|0.53987	.|.	0.469632|.	0.23941|.	N|.	0.043044|.	T|T	0.39410|0.39410	0.1077|0.1077	N|N	0.13140|0.13140	0.3|0.3	0.80722|0.80722	D|D	1|1	B;P;P|.	0.48503|.	0.001;0.911;0.769|.	B;P;B|.	0.46917|.	0.004;0.531;0.33|.	T|T	0.20638|0.20638	-1.0269|-1.0269	10|5	0.21540|.	T|.	0.41|.	-7.528|-7.528	11.3356|11.3356	0.49503|0.49503	0.181:0.819:0.0:0.0|0.181:0.819:0.0:0.0	.|.	283;497;503|.	Q5T0G1;Q5T0F9-2;Q5T0F9|.	.;.;C2D1B_HUMAN|.	P|C	503;497;411|283;416	ENSP00000360642:A503P;ENSP00000284376:A497P|.	ENSP00000284376:A497P|.	A|W	-|-	1|3	0|0	CC2D1B|CC2D1B	52596131|52596131	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.724000|0.724000	0.41520|0.41520	2.564000|2.564000	0.45931|0.45931	1.483000|1.483000	0.48342|0.48342	0.556000|0.556000	0.70494|0.70494	GCC|TGG		0.632	CC2D1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000022189.1	NM_032449		30	11	0	0	0	0	30	11				
CLCA1	1179	broad.mit.edu	37	1	86961316	86961316	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr1:86961316C>T	ENST00000234701.3	+	13	2422	c.2071C>T	c.(2071-2073)Cag>Tag	p.Q691*	CLCA1_ENST00000394711.1_Nonsense_Mutation_p.Q691*			A8K7I4	CLCA1_HUMAN	chloride channel accessory 1	691					calcium ion transport (GO:0006816)|cellular response to hypoxia (GO:0071456)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|zymogen granule membrane (GO:0042589)	chloride channel activity (GO:0005254)			NS(1)|breast(3)|endometrium(1)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)		AGTGATACCCCAGCAGAGTGG	0.448																																						uc001dlt.2		NA																	0				ovary(1)	1						c.(2071-2073)CAG>TAG		chloride channel accessory 1 precursor							87.0	86.0	86.0					1																	86961316		2203	4300	6503	SO:0001587	stop_gained	1179				calcium ion transport	extracellular space|integral to plasma membrane	chloride channel activity	g.chr1:86961316C>T		CCDS709.1	1p22.3	2012-02-26	2009-01-29		ENSG00000016490	ENSG00000016490			2015	protein-coding gene	gene with protein product		603906	"""chloride channel, calcium activated, family member 1"", ""chloride channel regulator 1"""			9828122	Standard	NM_001285		Approved	CaCC, CLCRG1	uc001dlt.3	A8K7I4	OTTHUMG00000010254	ENST00000234701.3:c.2071C>T	1.37:g.86961316C>T	ENSP00000234701:p.Gln691*		Somatic					p.Q691*	NM_001285	NP_001276	WXS	Illumina HiSeq	Unspecified	A8K7I4	CLCA1_HUMAN		all cancers(265;0.0249)|Epithelial(280;0.0476)	12	2200	+		Lung NSC(277;0.239)	691					B2RAV5|O95151|Q5TDF4|Q9UNF6|Q9UPC6	Nonsense_Mutation	SNP	ENST00000234701.3	37	c.2071C>T	CCDS709.1	.	.	.	.	.	.	.	.	.	.	C	38	6.965892	0.97967	.	.	ENSG00000016490	ENST00000234701;ENST00000394711	.	.	.	5.45	2.4	0.29515	.	1.236130	0.05637	N	0.582812	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	2.0814	11.554	0.50737	0.4709:0.5291:0.0:0.0	.	.	.	.	X	691	.	ENSP00000234701:Q691X	Q	+	1	0	CLCA1	86733904	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	0.127000	0.15790	0.300000	0.22699	0.655000	0.94253	CAG		0.448	CLCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028277.1	NM_001285		21	7	0	0	0	0	21	7				
NBPF15	284565	broad.mit.edu	37	1	148594407	148594407	+	Missense_Mutation	SNP	G	G	A	rs144416833	byFrequency	TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr1:148594407G>A	ENST00000369187.3	+	19	2269	c.1780G>A	c.(1780-1782)Gtg>Atg	p.V594M	NBPF15_ENST00000442702.2_Missense_Mutation_p.V594M	NM_173638.3	NP_775909.2	Q8N660	NBPFF_HUMAN	neuroblastoma breakpoint family, member 15	594	NBPF 6. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				NS(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|skin(2)	12	all_hematologic(923;0.032)					GCTCTACGGCGTGCTGATGGA	0.458													.|||	6	0.00119808	0.0008	0.0	5008	,	,		18795	0.001		0.0	False		,,,				2504	0.0041					uc001esc.2		NA																	0					0						c.(1780-1782)GTG>ATG		hypothetical protein LOC284565		A	MET/VAL,MET/VAL	4,4330		0,4,2163	129.0	160.0	150.0		1780,1780	0.5	0.0	1	dbSNP_134	150	1,8599		0,1,4299	no	missense,missense	NBPF15	NM_001170755.1,NM_173638.3	21,21	0,5,6462	AA,AG,GG		0.0116,0.0923,0.0387	benign,benign	594/671,594/671	148594407	5,12929	2167	4300	6467	SO:0001583	missense	284565					cytoplasm		g.chr1:148594407G>A	BC023087	CCDS72852.1	1q21.1	2014-01-16			ENSG00000243452	ENSG00000266338		"""neuroblastoma breakpoint family"""	28791	protein-coding gene	gene with protein product		610414, 614005	"""neuroblastoma breakpoint family, member 16"""	NBPF16		16079250	Standard	NM_173638		Approved	MGC8902	uc001esc.2	Q8N660	OTTHUMG00000013634	ENST00000369187.3:c.1780G>A	1.37:g.148594407G>A	ENSP00000358188:p.Val594Met		Somatic					p.V594M	NM_173638	NP_775909	WXS	Illumina HiSeq	Unspecified	Q8N660	NBPFF_HUMAN			19	2269	+	all_hematologic(923;0.032)		594			NBPF 6.		Q3BBV9|Q8IX77	Missense_Mutation	SNP	ENST00000369187.3	37	c.1780G>A	CCDS932.1	.	.	.	.	.	.	.	.	.	.	.	3.083	-0.188652	0.06299	9.23E-4	1.16E-4	ENSG00000243452	ENST00000442702;ENST00000369187	T;T	0.06849	3.25;3.25	0.502	0.502	0.16932	DUF1220 (2);	.	.	.	.	T	0.02455	0.0075	L	0.44542	1.39	0.09310	N	1	B	0.26081	0.141	B	0.24155	0.051	T	0.42361	-0.9456	8	0.49607	T	0.09	.	.	.	.	.	594	Q8N660	NBPFF_HUMAN	M	594	ENSP00000416864:V594M;ENSP00000358188:V594M	ENSP00000358188:V594M	V	+	1	0	NBPF15	146861031	0.018000	0.18449	0.002000	0.10522	0.003000	0.03518	-2.111000	0.01333	0.557000	0.29117	0.377000	0.23210	GTG		0.458	NBPF15-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038609.3	NM_173638		124	192	0	0	0	0	124	192				
SNX27	81609	broad.mit.edu	37	1	151640992	151640992	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr1:151640992C>T	ENST00000458013.2	+	7	1150	c.1030C>T	c.(1030-1032)Cag>Tag	p.Q344*	SNX27_ENST00000482791.1_3'UTR|SNX27_ENST00000368838.1_Nonsense_Mutation_p.Q251*|SNX27_ENST00000368843.3_Nonsense_Mutation_p.Q344*			Q96L92	SNX27_HUMAN	sorting nexin family member 27	344	FERM-like region F1.|Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|establishment of natural killer cell polarity (GO:0001770)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to plasma membrane (GO:1990126)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|immunological synapse (GO:0001772)|nucleus (GO:0005634)	phosphatidylinositol-3-phosphate binding (GO:0032266)			central_nervous_system(1)|large_intestine(2)|ovary(2)	5	Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			ACTCTACATTCAGAATTATAC	0.383																																					Colon(46;291 966 40145 41237 41888)	uc001eyn.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(1030-1032)CAG>TAG		sorting nexin family member 27							117.0	117.0	117.0					1																	151640992		2203	4300	6503	SO:0001587	stop_gained	81609				cell communication|protein transport|signal transduction	cytosol|early endosome	phosphatidylinositol binding|protein binding	g.chr1:151640992C>T	AB007957	CCDS1001.1	1q21.3	2008-03-11			ENSG00000143376	ENSG00000143376		"""Sorting nexins"""	20073	protein-coding gene	gene with protein product		611541				12461558	Standard	XM_005245509		Approved	MY014, KIAA0488, MGC20471	uc001eyn.1	Q96L92	OTTHUMG00000013052	ENST00000458013.2:c.1030C>T	1.37:g.151640992C>T	ENSP00000400333:p.Gln344*		Somatic				SNX27_uc001eyo.2_Nonsense_Mutation_p.Q251*|SNX27_uc001eyp.2_Nonsense_Mutation_p.Q158*	p.Q344*	NM_030918	NP_112180	WXS	Illumina HiSeq	Unspecified	Q96L92	SNX27_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.181)		7	1046	+	Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		344			Ras-associating.		Q32Q36|Q4AEJ5|Q5VWB0|Q5VWB1|Q5VWB2|Q6IPP6|Q86UB1|Q96D79|Q9H3K8	Nonsense_Mutation	SNP	ENST00000458013.2	37	c.1030C>T		.	.	.	.	.	.	.	.	.	.	C	37	6.006100	0.97195	.	.	ENSG00000143376	ENST00000458013;ENST00000368843;ENST00000368838	.	.	.	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	.	17.2485	0.87035	0.0:1.0:0.0:0.0	.	.	.	.	X	344;344;251	.	ENSP00000357831:Q251X	Q	+	1	0	SNX27	149907616	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.044000	0.76578	2.656000	0.90262	0.305000	0.20034	CAG		0.383	SNX27-003	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000036624.3	NM_030918		30	92	0	0	0	0	30	92				
FLG	2312	broad.mit.edu	37	1	152276850	152276850	+	Silent	SNP	C	C	T	rs139345866		TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr1:152276850C>T	ENST00000368799.1	-	3	10547	c.10512G>A	c.(10510-10512)tcG>tcA	p.S3504S	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3504	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CATGGTGATGCGACCATGAGT	0.577									Ichthyosis																													uc001ezu.1		NA																	0				ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(10510-10512)TCG>TCA		filaggrin		C		0,4406		0,0,2203	245.0	237.0	240.0		10512	-5.7	0.0	1	dbSNP_134	240	3,8591	3.0+/-9.4	0,3,4294	no	coding-synonymous	FLG	NM_002016.1		0,3,6497	TT,TC,CC		0.0349,0.0,0.0231		3504/4062	152276850	3,12997	2203	4297	6500	SO:0001819	synonymous_variant	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152276850C>T	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.10512G>A	1.37:g.152276850C>T			Somatic					p.S3504S	NM_002016	NP_002007	WXS	Illumina HiSeq	Unspecified	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	10548	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		3504			Ser-rich.|Filaggrin 21.		Q01720|Q5T583|Q9UC71	Silent	SNP	ENST00000368799.1	37	c.10512G>A	CCDS30860.1																																																																																				0.577	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		138	227	0	0	0	0	138	227				
LMNA	4000	broad.mit.edu	37	1	156106747	156106747	+	Silent	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr1:156106747G>A	ENST00000368300.4	+	8	1628	c.1416G>A	c.(1414-1416)caG>caA	p.Q472Q	LMNA_ENST00000368301.2_Silent_p.Q472Q|LMNA_ENST00000347559.2_Silent_p.Q472Q|LMNA_ENST00000368299.3_Silent_p.Q472Q|LMNA_ENST00000496738.1_3'UTR|LMNA_ENST00000473598.2_Silent_p.Q373Q|LMNA_ENST00000448611.2_Silent_p.Q360Q|LMNA_ENST00000392353.3_Silent_p.Q391Q|LMNA_ENST00000368297.1_Silent_p.Q391Q|LMNA_ENST00000361308.4_Silent_p.Q472Q	NM_170707.3	NP_733821.1	P02545	LMNA_HUMAN	lamin A/C	472	LTD.|Tail.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to hypoxia (GO:0071456)|endoplasmic reticulum unfolded protein response (GO:0030968)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic nuclear envelope reassembly (GO:0007084)|muscle organ development (GO:0007517)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|positive regulation of cell aging (GO:0090343)|protein localization to nucleus (GO:0034504)|regulation of cell migration (GO:0030334)|regulation of protein localization to nucleus (GO:1900180)|sterol regulatory element binding protein import into nucleus (GO:0035105)|ventricular cardiac muscle cell development (GO:0055015)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament (GO:0005882)|lamin filament (GO:0005638)|nuclear envelope (GO:0005635)|nuclear lamina (GO:0005652)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	structural molecule activity (GO:0005198)			NS(1)|endometrium(1)|kidney(1)|lung(3)|ovary(4)	10	Hepatocellular(266;0.158)					TCAAGCGCCAGAATGGAGATG	0.592									Werner syndrome;Hutchinson-Gilford Progeria Syndrome																													uc001fni.2		NA																	0				ovary(2)	2						c.(1414-1416)CAG>CAA		lamin A/C isoform 1 precursor							53.0	50.0	51.0					1																	156106747		2203	4300	6503	SO:0001819	synonymous_variant	4000	Werner_syndrome|Hutchinson-Gilford_Progeria_Syndrome	Familial Cancer Database	WS, Adult Progeria;HGPS, Progeria	cellular component disassembly involved in apoptosis|cellular response to hypoxia|establishment or maintenance of microtubule cytoskeleton polarity|muscle organ development|positive regulation of cell aging|regulation of apoptosis|regulation of cell migration	cytoplasm|lamin filament|nuclear envelope|nuclear envelope|perinuclear region of cytoplasm	protein binding|structural molecule activity|structural molecule activity	g.chr1:156106747G>A	BC014507	CCDS1129.1, CCDS1131.1, CCDS58038.1, CCDS72941.1, CCDS72942.1	1q22	2014-09-17			ENSG00000160789	ENSG00000160789		"""Intermediate filaments type V, lamins"""	6636	protein-coding gene	gene with protein product		150330	"""cardiomyopathy, dilated 1A (autosomal dominant)"", ""limb girdle muscular dystrophy 1B (autosomal dominant)"", ""progeria 1 (Hutchinson-Gilford type)"", ""lamin A/C-like 1"""	LMN1, CMD1A, LGMD1B, PRO1, LMNL1		8511676, 8838815, 12702809	Standard	NM_005572		Approved	HGPS	uc001fni.3	P02545	OTTHUMG00000013961	ENST00000368300.4:c.1416G>A	1.37:g.156106747G>A			Somatic				LMNA_uc001fnf.1_Silent_p.Q472Q|LMNA_uc001fng.2_Silent_p.Q472Q|LMNA_uc001fnh.2_Silent_p.Q472Q|LMNA_uc009wro.1_Silent_p.Q472Q|LMNA_uc010pgz.1_Silent_p.Q360Q|LMNA_uc001fnj.2_Silent_p.Q391Q|LMNA_uc001fnk.2_Silent_p.Q373Q|LMNA_uc009wrp.2_3'UTR|LMNA_uc010pha.1_Silent_p.Q128Q	p.Q472Q	NM_170707	NP_733821	WXS	Illumina HiSeq	Unspecified	P02545	LMNA_HUMAN			8	1665	+	Hepatocellular(266;0.158)		472			Tail.		B4DI32|D3DVB0|D6RAQ3|E7EUI9|P02546|Q5I6Y4|Q5I6Y6|Q5TCJ2|Q5TCJ3|Q6UYC3|Q969I8|Q96JA2	Silent	SNP	ENST00000368300.4	37	c.1416G>A	CCDS1129.1																																																																																				0.592	LMNA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039200.2	NM_170707		23	19	0	0	0	0	23	19				
KIAA1614	57710	broad.mit.edu	37	1	180910242	180910242	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr1:180910242A>G	ENST00000367588.4	+	7	3035	c.2980A>G	c.(2980-2982)Aag>Gag	p.K994E	KIAA1614_ENST00000367587.1_Missense_Mutation_p.K615E|RP11-46A10.5_ENST00000358073.2_RNA	NM_020950.1	NP_066001.1	Q5VZ46	K1614_HUMAN	KIAA1614	994	Ser-rich.									NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	33						GGACCAGAACAAGAAAAGGAG	0.642																																						uc001gok.2		NA																	0				ovary(3)|skin(1)	4						c.(2980-2982)AAG>GAG		hypothetical protein LOC57710							33.0	39.0	37.0					1																	180910242		1862	4091	5953	SO:0001583	missense	57710							g.chr1:180910242A>G	AB046834	CCDS41442.1	1q25.3	2008-02-05			ENSG00000135835	ENSG00000135835			29327	protein-coding gene	gene with protein product							Standard	NM_020950		Approved		uc001gok.2	Q5VZ46	OTTHUMG00000035183	ENST00000367588.4:c.2980A>G	1.37:g.180910242A>G	ENSP00000356560:p.Lys994Glu		Somatic				KIAA1614_uc001gol.1_Missense_Mutation_p.K615E|KIAA1614_uc001gom.1_Missense_Mutation_p.K85E	p.K994E	NM_020950	NP_066001	WXS	Illumina HiSeq	Unspecified	Q5VZ46	K1614_HUMAN			7	3047	+			994			Ser-rich.		Q5VZ45|Q9HCF8	Missense_Mutation	SNP	ENST00000367588.4	37	c.2980A>G	CCDS41442.1	.	.	.	.	.	.	.	.	.	.	A	11.65	1.700957	0.30142	.	.	ENSG00000135835	ENST00000367588;ENST00000367587	T;T	0.27890	2.19;1.64	5.21	5.21	0.72293	.	0.297670	0.31233	N	0.008004	T	0.47192	0.1432	L	0.55481	1.735	0.30230	N	0.796007	P;D	0.71674	0.93;0.998	P;D	0.66847	0.561;0.947	T	0.55939	-0.8061	9	0.36615	T	0.2	-16.6463	12.6012	0.56499	1.0:0.0:0.0:0.0	.	615;994	Q5VZ46-2;Q5VZ46	.;K1614_HUMAN	E	994;615	ENSP00000356560:K994E;ENSP00000356559:K615E	ENSP00000356559:K615E	K	+	1	0	KIAA1614	179176865	0.850000	0.29656	0.552000	0.28243	0.077000	0.17291	1.700000	0.37815	1.954000	0.56735	0.459000	0.35465	AAG		0.642	KIAA1614-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085151.1	XM_046531		6	47	0	0	0	0	6	47				
PRG4	10216	broad.mit.edu	37	1	186276981	186276981	+	Silent	SNP	A	A	G			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr1:186276981A>G	ENST00000445192.2	+	7	2175	c.2130A>G	c.(2128-2130)aaA>aaG	p.K710K	PRG4_ENST00000367484.3_Intron|PRG4_ENST00000367485.4_Silent_p.K617K|PRG4_ENST00000367483.4_Silent_p.K669K|PRG4_ENST00000367486.3_Silent_p.K667K	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	710	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						CTACCCCTAAAGGGACTGCTC	0.582																																						uc001gru.3		NA																	0				skin(1)	1						c.(2128-2130)AAA>AAG		proteoglycan 4 isoform A							162.0	175.0	171.0					1																	186276981		2203	4300	6503	SO:0001819	synonymous_variant	10216				cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity	g.chr1:186276981A>G	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.2130A>G	1.37:g.186276981A>G			Somatic				PRG4_uc001grt.3_Silent_p.K669K|PRG4_uc009wyl.2_Silent_p.K617K|PRG4_uc009wym.2_Silent_p.K576K|PRG4_uc010poo.1_Intron	p.K710K	NM_005807	NP_005798	WXS	Illumina HiSeq	Unspecified	Q92954	PRG4_HUMAN			7	2181	+			710			59 X 8 AA repeats of K-X-P-X-P-T-T-X.|43; approximate.		Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Silent	SNP	ENST00000445192.2	37	c.2130A>G	CCDS1369.1																																																																																				0.582	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807		4	196	0	0	0	0	4	196				
TPR	7175	broad.mit.edu	37	1	186321170	186321170	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr1:186321170C>G	ENST00000367478.4	-	19	2703	c.2407G>C	c.(2407-2409)Gag>Cag	p.E803Q	TPR_ENST00000474852.1_5'UTR	NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	803					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		AACAAAGACTCTCTTTGCTGA	0.318			T	NTRK1	papillary thyroid																																	uc001grv.2		NA		Dom	yes		1	1q25	7175	T	translocated promoter region			E	NTRK1		papillary thyroid		0				ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7						c.(2407-2409)GAG>CAG		nuclear pore complex-associated protein TPR							137.0	130.0	132.0					1																	186321170		1814	4075	5889	SO:0001583	missense	7175				carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity	g.chr1:186321170C>G	U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.2407G>C	1.37:g.186321170C>G	ENSP00000356448:p.Glu803Gln		Somatic					p.E803Q	NM_003292	NP_003283	WXS	Illumina HiSeq	Unspecified	P12270	TPR_HUMAN		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)	19	2704	-		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)	803			Potential.		Q15655|Q5SWY0|Q99968	Missense_Mutation	SNP	ENST00000367478.4	37	c.2407G>C	CCDS41446.1	.	.	.	.	.	.	.	.	.	.	C	32	5.135838	0.94517	.	.	ENSG00000047410	ENST00000367478	T	0.30981	1.51	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.54838	0.1883	M	0.68593	2.085	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.40384	-0.9566	10	0.25106	T	0.35	.	19.5445	0.95285	0.0:1.0:0.0:0.0	.	803	P12270	TPR_HUMAN	Q	803	ENSP00000356448:E803Q	ENSP00000356448:E803Q	E	-	1	0	TPR	184587793	1.000000	0.71417	0.998000	0.56505	0.972000	0.66771	7.197000	0.77814	2.711000	0.92665	0.563000	0.77884	GAG		0.318	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086353.2	NM_003292		19	100	0	0	0	0	19	100				
CR1	1378	broad.mit.edu	37	1	207751469	207751469	+	Silent	SNP	C	C	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr1:207751469C>A	ENST00000367049.4	+	29	4857	c.4857C>A	c.(4855-4857)ggC>ggA	p.G1619G	CR1_ENST00000367052.1_Silent_p.G1169G|CR1_ENST00000367053.1_Silent_p.G1169G|CR1_ENST00000367051.1_Silent_p.G1169G|RP11-78B10.2_ENST00000597497.1_RNA|CR1_ENST00000400960.2_Silent_p.G1169G|RP11-78B10.2_ENST00000596003.1_RNA	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1169	Sushi 25. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						GTCAGCCTGGCTTTGTCATGA	0.483																																						uc001hfy.2		NA																	0				ovary(3)	3						c.(3505-3507)GGC>GGA		complement receptor 1 isoform F precursor							54.0	55.0	55.0					1																	207751469		1853	4090	5943	SO:0001819	synonymous_variant	1378				complement activation, classical pathway|innate immune response	integral to plasma membrane	complement receptor activity	g.chr1:207751469C>A	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.4857C>A	1.37:g.207751469C>A			Somatic				CR1_uc009xcl.1_Silent_p.G719G|CR1_uc001hfx.2_Silent_p.G1619G	p.G1169G	NM_000573	NP_000564	WXS	Illumina HiSeq	Unspecified	P17927	CR1_HUMAN			21	3647	+			1169			Extracellular (Potential).|Sushi 18.		Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Silent	SNP	ENST00000367049.4	37	c.3507C>A	CCDS44308.1																																																																																				0.483	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1	NM_000573		8	115	1	0	0.00010058	0.000118119	8	115				
LAMB3	3914	broad.mit.edu	37	1	209796421	209796421	+	Missense_Mutation	SNP	A	A	C			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr1:209796421A>C	ENST00000356082.4	-	17	2596	c.2462T>G	c.(2461-2463)gTc>gGc	p.V821G	LAMB3_ENST00000391911.1_Missense_Mutation_p.V821G|MIR4260_ENST00000583107.1_RNA|LAMB3_ENST00000367030.3_Missense_Mutation_p.V821G	NM_000228.2	NP_000219.2	Q13751	LAMB3_HUMAN	laminin, beta 3	821	Domain I.				brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	extracellular region (GO:0005576)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		CCTGGGAAGGACACCCCTGCA	0.632																																						uc001hhg.2		NA																	0				central_nervous_system(2)|skin(2)|large_intestine(1)|ovary(1)	6						c.(2461-2463)GTC>GGC		laminin, beta 3 precursor							54.0	63.0	60.0					1																	209796421		2203	4300	6503	SO:0001583	missense	3914				cell adhesion|epidermis development|hemidesmosome assembly		structural molecule activity	g.chr1:209796421A>C	D37766	CCDS1487.1	1q32	2013-03-01	2002-08-29		ENSG00000196878	ENSG00000196878		"""Laminins"""	6490	protein-coding gene	gene with protein product		150310	"""laminin, beta 3 (nicein (125kD), kalinin (140kD), BM600 (125kD))"""	LAMNB1		8088808, 7774918	Standard	NM_001127641		Approved	nicein-125kDa, kalinin-140kDa, BM600-125kDa	uc001hhh.3	Q13751	OTTHUMG00000036360	ENST00000356082.4:c.2462T>G	1.37:g.209796421A>C	ENSP00000348384:p.Val821Gly		Somatic				LAMB3_uc009xco.2_Missense_Mutation_p.V821G|LAMB3_uc001hhh.2_Missense_Mutation_p.V821G|LAMB3_uc010psl.1_RNA	p.V821G	NM_001017402	NP_001017402	WXS	Illumina HiSeq	Unspecified	Q13751	LAMB3_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0519)	16	2852	-			821			Domain I.		D3DT88|O14947|Q14733|Q9UJK4|Q9UJL1	Missense_Mutation	SNP	ENST00000356082.4	37	c.2462T>G	CCDS1487.1	.	.	.	.	.	.	.	.	.	.	A	11.35	1.611754	0.28712	.	.	ENSG00000196878	ENST00000391911;ENST00000356082;ENST00000367030	T;T;T	0.37915	1.17;1.17;1.17	5.21	1.14	0.20703	.	0.361310	0.31041	N	0.008371	T	0.22820	0.0551	N	0.22421	0.69	0.25224	N	0.989886	B	0.20887	0.049	B	0.16722	0.016	T	0.22417	-1.0217	10	0.87932	D	0	.	9.6805	0.40067	0.3716:0.0:0.6284:0.0	.	821	Q13751	LAMB3_HUMAN	G	821	ENSP00000375778:V821G;ENSP00000348384:V821G;ENSP00000355997:V821G	ENSP00000348384:V821G	V	-	2	0	LAMB3	207863044	0.002000	0.14202	0.899000	0.35326	0.652000	0.38707	0.367000	0.20382	0.216000	0.20781	-0.474000	0.04947	GTC		0.632	LAMB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088525.2	NM_000228		44	60	0	0	0	0	44	60				
PTPN14	5784	broad.mit.edu	37	1	214542900	214542900	+	Silent	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr1:214542900C>T	ENST00000366956.5	-	17	3365	c.3171G>A	c.(3169-3171)aaG>aaA	p.K1057K	PTPN14_ENST00000543945.1_3'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14	1057	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)			NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		GGTGCTTGACCTTCAAGCCCG	0.478																																					Colon(92;557 1424 24372 34121 40073)	uc001hkk.1		NA																	0				breast(2)|ovary(1)|kidney(1)|skin(1)	5						c.(3169-3171)AAG>AAA		protein tyrosine phosphatase, non-receptor type							237.0	218.0	224.0					1																	214542900		2203	4300	6503	SO:0001819	synonymous_variant	5784				lymphangiogenesis	cytoplasm|cytoskeleton	protein tyrosine phosphatase activity|receptor tyrosine kinase binding	g.chr1:214542900C>T	X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.3171G>A	1.37:g.214542900C>T			Somatic					p.K1057K	NM_005401	NP_005392	WXS	Illumina HiSeq	Unspecified	Q15678	PTN14_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)	17	3442	-			1057			Tyrosine-protein phosphatase.		Q5VSI0	Silent	SNP	ENST00000366956.5	37	c.3171G>A	CCDS1514.1																																																																																				0.478	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089918.2	NM_005401		94	204	0	0	0	0	94	204				
LEFTY2	7044	broad.mit.edu	37	1	226125198	226125198	+	Silent	SNP	C	C	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr1:226125198C>A	ENST00000366820.5	-	4	1392	c.1044G>T	c.(1042-1044)gtG>gtT	p.V348V	RP4-559A3.6_ENST00000513672.1_RNA|LEFTY2_ENST00000420304.2_Silent_p.V314V|LEFTY2_ENST00000474493.1_5'Flank	NM_003240.3	NP_003231.2	O00292	LFTY2_HUMAN	left-right determination factor 2	348					blood coagulation (GO:0007596)|cell growth (GO:0016049)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|platelet alpha granule lumen (GO:0031093)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	16	Breast(184;0.197)					TGCACTTCTGCACCCTCATGT	0.617																																					Colon(172;116 2643 9098 43333)	uc001hpt.1		NA																	0					0						c.(1042-1044)GTG>GTT		endometrial bleeding associated factor							57.0	56.0	56.0					1																	226125198		2203	4300	6503	SO:0001819	synonymous_variant	7044				cell growth|multicellular organismal development|platelet activation|platelet degranulation|transforming growth factor beta receptor signaling pathway	extracellular space|platelet alpha granule lumen	cytokine activity|growth factor activity|transforming growth factor beta receptor binding	g.chr1:226125198C>A	U81523	CCDS1549.1, CCDS53479.1	1q42.1	2008-07-18	2004-11-17	2004-11-17	ENSG00000143768	ENSG00000143768			3122	protein-coding gene	gene with protein product	"""transforming growth factor, beta-4 (endometrial bleeding-associated factor; LEFTY A)"""	601877	"""endometrial bleeding associated factor (left-right determination, factor A; transforming growth factor beta superfamily)"""	TGFB4, EBAF		9153275	Standard	NM_001172425		Approved	LEFTA, LEFTYA	uc001hpt.2	O00292	OTTHUMG00000037441	ENST00000366820.5:c.1044G>T	1.37:g.226125198C>A			Somatic				LEFTY2_uc010pvk.1_Silent_p.V314V|LEFTY2_uc009xek.1_3'UTR	p.V348V	NM_003240	NP_003231	WXS	Illumina HiSeq	Unspecified	O00292	LFTY2_HUMAN			4	1124	-	Breast(184;0.197)		348					B3KNH4|B4E332|E9PDM4|O75611|Q5TE89|Q8NBQ9	Silent	SNP	ENST00000366820.5	37	c.1044G>T	CCDS1549.1																																																																																				0.617	LEFTY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091152.1	NM_003240		35	59	1	0	3.11e-16	4.07e-16	35	59				
LIN9	286826	broad.mit.edu	37	1	226454018	226454018	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr1:226454018C>T	ENST00000328205.5	-	9	1425	c.880G>A	c.(880-882)Gag>Aag	p.E294K	LIN9_ENST00000481685.1_Missense_Mutation_p.E259K|LIN9_ENST00000366801.1_Missense_Mutation_p.E243K	NM_173083.3	NP_775106.2	Q5TKA1	LIN9_HUMAN	lin-9 DREAM MuvB core complex component	278	Sufficient for interaction with RB1.				DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|transcriptional repressor complex (GO:0017053)				breast(3)|endometrium(4)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Breast(184;0.158)			GBM - Glioblastoma multiforme(131;0.131)		GGCATTGTCTCATGAGGTTCA	0.363																																					Ovarian(197;1696 2974 11248 14117)	uc001hqa.2		NA																	0					0						c.(880-882)GAG>AAG		lin-9 homolog							57.0	57.0	57.0					1																	226454018		2203	4300	6503	SO:0001583	missense	286826				cell cycle|DNA replication	nucleoplasm		g.chr1:226454018C>T	AY166858	CCDS1553.1	1q42	2014-07-17	2014-07-17		ENSG00000183814	ENSG00000183814			30830	protein-coding gene	gene with protein product	"""TUDOR gene similar"", ""rb related pathway actor"""	609375	"""lin-9 homolog (C. elegans)"""			15538385, 23667535	Standard	NM_173083		Approved	TGS	uc001hqa.3	Q5TKA1	OTTHUMG00000037557	ENST00000328205.5:c.880G>A	1.37:g.226454018C>T	ENSP00000329102:p.Glu294Lys		Somatic				LIN9_uc001hqb.2_Missense_Mutation_p.E259K|LIN9_uc001hqc.2_Missense_Mutation_p.E226K|LIN9_uc009xel.1_Missense_Mutation_p.E259K	p.E294K	NM_173083	NP_775106	WXS	Illumina HiSeq	Unspecified	Q5TKA1	LIN9_HUMAN		GBM - Glioblastoma multiforme(131;0.131)	9	1190	-	Breast(184;0.158)		278			Sufficient for interaction with RB1.		Q5U5L8|Q5U7E1|Q6PI55|Q6ZTV4|Q7Z3J1	Missense_Mutation	SNP	ENST00000328205.5	37	c.880G>A	CCDS1553.1	.	.	.	.	.	.	.	.	.	.	C	34	5.377375	0.95945	.	.	ENSG00000183814	ENST00000460719;ENST00000328205;ENST00000366808;ENST00000366801;ENST00000481685;ENST00000366807	.	.	.	5.59	5.59	0.84812	.	0.044601	0.85682	D	0.000000	T	0.79924	0.4530	M	0.76838	2.35	0.80722	D	1	D;D;D	0.71674	0.988;0.998;0.996	P;D;P	0.65987	0.815;0.94;0.836	T	0.81430	-0.0936	9	0.66056	D	0.02	.	19.5963	0.95541	0.0:1.0:0.0:0.0	.	259;278;428	C9J5J4;Q5TKA1;B1ANK3	.;LIN9_HUMAN;.	K	254;294;349;243;259;428	.	ENSP00000329102:E294K	E	-	1	0	LIN9	224520641	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	6.795000	0.75140	2.648000	0.89879	0.561000	0.74099	GAG		0.363	LIN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091523.2	NM_173083		9	23	0	0	0	0	9	23				
ADCK3	56997	broad.mit.edu	37	1	227170663	227170663	+	Silent	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr1:227170663C>T	ENST00000366779.1	+	13	3779	c.1008C>T	c.(1006-1008)ttC>ttT	p.F336F	ADCK3_ENST00000478406.1_3'UTR|ADCK3_ENST00000458507.2_Silent_p.F57F|ADCK3_ENST00000433743.2_Intron|ADCK3_ENST00000366778.1_Silent_p.F284F|ADCK3_ENST00000366777.3_Silent_p.F336F			Q8NI60	ADCK3_HUMAN	aarF domain containing kinase 3	336	Protein kinase.				cell death (GO:0008219)|ubiquinone biosynthetic process (GO:0006744)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|kidney(2)|large_intestine(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	9						AGCGGCCCTTCGCCGCCGCAT	0.642																																						uc001hqm.1		NA																	0					0						c.(1006-1008)TTC>TTT		chaperone, ABC1 activity of bc1 complex like							15.0	18.0	17.0					1																	227170663		2192	4295	6487	SO:0001819	synonymous_variant	56997				cell death	mitochondrion	ATP binding|protein serine/threonine kinase activity	g.chr1:227170663C>T	AJ278126	CCDS1557.1	1q42.11	2011-05-03	2010-10-01	2010-10-01	ENSG00000163050	ENSG00000163050			16812	protein-coding gene	gene with protein product	"""coenzyme Q8 homolog (yeast)"""	606980	"""chaperone-ABC1 (activity of bc1 complex, S.pombe)-like"", ""chaperone, ABC1 activity of bc1 complex like (S. pombe)"", ""chaperone, ABC1 activity of bc1 complex homolog (S. pombe)"""	CABC1			Standard	NM_020247		Approved	COQ8, SCAR9	uc001hqn.1	Q8NI60	OTTHUMG00000037621	ENST00000366779.1:c.1008C>T	1.37:g.227170663C>T			Somatic				CABC1_uc001hqn.1_Silent_p.F336F|CABC1_uc009xeq.1_Silent_p.F284F|CABC1_uc010pvq.1_Silent_p.F57F|CABC1_uc010pvr.1_Intron|CABC1_uc001hqo.1_Silent_p.F57F|CABC1_uc009xer.1_5'UTR	p.F336F	NM_020247	NP_064632	WXS	Illumina HiSeq	Unspecified	Q8NI60	ADCK3_HUMAN			13	4427	+		Prostate(94;0.0771)	336			Protein kinase.		Q5T7A5|Q63HK0|Q8NCJ6|Q9HBQ1|Q9NQ67	Silent	SNP	ENST00000366779.1	37	c.1008C>T	CCDS1557.1																																																																																				0.642	ADCK3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091712.1	NM_020247		3	5	0	0	0	0	3	5				
OR1C1	26188	broad.mit.edu	37	1	247921171	247921171	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr1:247921171C>G	ENST00000408896.2	-	1	811	c.538G>C	c.(538-540)Gat>Cat	p.D180H		NM_012353.2	NP_036485.2	Q15619	OR1C1_HUMAN	olfactory receptor, family 1, subfamily C, member 1	180					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(32)|skin(2)|upper_aerodigestive_tract(1)	46	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	OV - Ovarian serous cystadenocarcinoma(106;0.0168)			GGATTGAGATCACAGAAGAAA	0.483																																						uc010pza.1		NA																	0				skin(1)	1						c.(538-540)GAT>CAT		olfactory receptor, family 1, subfamily C,							64.0	64.0	64.0					1																	247921171		2108	4249	6357	SO:0001583	missense	26188				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247921171C>G	X89674	CCDS41481.1	1q44	2012-08-09			ENSG00000221888	ENSG00000221888		"""GPCR / Class A : Olfactory receptors"""	8182	protein-coding gene	gene with protein product						9119360	Standard	NM_012353		Approved	TPCR27, HSTPCR27	uc010pza.2	Q15619	OTTHUMG00000040198	ENST00000408896.2:c.538G>C	1.37:g.247921171C>G	ENSP00000386138:p.Asp180His		Somatic					p.D180H	NM_012353	NP_036485	WXS	Illumina HiSeq	Unspecified	Q15619	OR1C1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0168)		1	538	-	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	180			Extracellular (Potential).		B9EIR9|Q5VVD2|Q6IF97|Q8NGZ1|Q96R83	Missense_Mutation	SNP	ENST00000408896.2	37	c.538G>C	CCDS41481.1	.	.	.	.	.	.	.	.	.	.	C	19.88	3.908911	0.72868	.	.	ENSG00000221888	ENST00000408896	T	0.00164	8.64	3.21	3.21	0.36854	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00695	0.0023	H	0.94620	3.56	0.37610	D	0.920892	D	0.89917	1.0	D	0.97110	1.0	T	0.59910	-0.7365	9	0.87932	D	0	.	14.508	0.67764	0.0:1.0:0.0:0.0	.	180	Q15619	OR1C1_HUMAN	H	180	ENSP00000386138:D180H	ENSP00000386138:D180H	D	-	1	0	OR1C1	245987794	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	2.837000	0.48191	1.793000	0.52555	0.585000	0.79938	GAT		0.483	OR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096855.1			17	29	0	0	0	0	17	29				
OR11L1	391189	broad.mit.edu	37	1	248005020	248005020	+	Missense_Mutation	SNP	T	T	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr1:248005020T>A	ENST00000355784.2	-	1	234	c.179A>T	c.(178-180)tAc>tTc	p.Y60F		NM_001001959.1	NP_001001959.1	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L, member 1	60						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GAGGAACATGTACATAGGGGA	0.547																																						uc001idn.1		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(178-180)TAC>TTC		olfactory receptor, family 11, subfamily L,							74.0	65.0	68.0					1																	248005020		2203	4300	6503	SO:0001583	missense	391189				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248005020T>A	AB065646	CCDS31098.1	1q44	2013-09-24			ENSG00000197591	ENSG00000197591		"""GPCR / Class A : Olfactory receptors"""	14998	protein-coding gene	gene with protein product							Standard	NM_001001959		Approved		uc001idn.1	Q8NGX0	OTTHUMG00000040193	ENST00000355784.2:c.179A>T	1.37:g.248005020T>A	ENSP00000348033:p.Tyr60Phe		Somatic					p.Y60F	NM_001001959	NP_001001959	WXS	Illumina HiSeq	Unspecified	Q8NGX0	O11L1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0319)		1	179	-	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		60			Helical; Name=2; (Potential).			Missense_Mutation	SNP	ENST00000355784.2	37	c.179A>T	CCDS31098.1	.	.	.	.	.	.	.	.	.	.	T	13.83	2.353531	0.41700	.	.	ENSG00000197591	ENST00000355784	T	0.14391	2.51	4.2	3.03	0.35002	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33309	U	0.005054	T	0.24736	0.0600	M	0.88906	2.99	0.32759	N	0.505403	B	0.24132	0.098	B	0.32342	0.144	T	0.27739	-1.0065	10	0.87932	D	0	.	9.8275	0.40921	0.154:0.0:0.0:0.846	.	60	Q8NGX0	O11L1_HUMAN	F	60	ENSP00000348033:Y60F	ENSP00000348033:Y60F	Y	-	2	0	OR11L1	246071643	1.000000	0.71417	0.593000	0.28771	0.582000	0.36321	4.173000	0.58249	0.720000	0.32209	0.443000	0.29094	TAC		0.547	OR11L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096850.1	NM_001001959		12	21	0	0	0	0	12	21				
OR2T12	127064	broad.mit.edu	37	1	248458698	248458698	+	Silent	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr1:248458698C>T	ENST00000317996.1	-	1	182	c.183G>A	c.(181-183)ctG>ctA	p.L61L		NM_001004692.1	NP_001004692.1	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T, member 12	61						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(3)|large_intestine(3)|lung(25)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			AAAGTTGGCTCAGGAGGAAGT	0.552																																						uc010pzj.1		NA																	0				skin(2)|ovary(1)	3						c.(181-183)CTG>CTA		olfactory receptor, family 2, subfamily T,							56.0	44.0	48.0					1																	248458698		2203	4294	6497	SO:0001819	synonymous_variant	127064				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248458698C>T	BK004485	CCDS31110.1	1q44	2012-08-09			ENSG00000177201	ENSG00000177201		"""GPCR / Class A : Olfactory receptors"""	19592	protein-coding gene	gene with protein product							Standard	NM_001004692		Approved		uc010pzj.2	Q8NG77	OTTHUMG00000040457	ENST00000317996.1:c.183G>A	1.37:g.248458698C>T			Somatic					p.L61L	NM_001004692	NP_001004692	WXS	Illumina HiSeq	Unspecified	Q8NG77	O2T12_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0201)		1	183	-	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		61			Helical; Name=2; (Potential).			Silent	SNP	ENST00000317996.1	37	c.183G>A	CCDS31110.1																																																																																				0.552	OR2T12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097353.1	NM_001004692		54	58	0	0	0	0	54	58				
LARP4B	23185	broad.mit.edu	37	10	863817	863817	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr10:863817G>A	ENST00000316157.3	-	14	1583	c.1543C>T	c.(1543-1545)Cag>Tag	p.Q515*	LARP4B_ENST00000469487.1_5'Flank	NM_015155.1	NP_055970.1	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B	515					positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	38						GTTGGAGACTGTGTCTGGCTG	0.557																																						uc001ifs.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(1543-1545)CAG>TAG		La ribonucleoprotein domain family, member 4B							94.0	99.0	97.0					10																	863817		2203	4300	6503	SO:0001587	stop_gained	23185						nucleotide binding|RNA binding	g.chr10:863817G>A	D86971	CCDS31131.1	10p15.3	2011-08-24	2009-06-09	2009-06-09	ENSG00000107929	ENSG00000107929		"""La ribonucleoprotein domain containing"""	28987	protein-coding gene	gene with protein product			"""KIAA0217"", ""La ribonucleoprotein domain family, member 5"""	KIAA0217, LARP5		9039502, 20573744	Standard	NM_015155		Approved		uc031ptb.1	Q92615	OTTHUMG00000017534	ENST00000316157.3:c.1543C>T	10.37:g.863817G>A	ENSP00000326128:p.Gln515*		Somatic					p.Q515*	NM_015155	NP_055970	WXS	Illumina HiSeq	Unspecified	Q92615	LAR4B_HUMAN			14	1584	-			515					A7MD20|Q5T3R3|Q5T3R4|Q5T3R5|Q68CY4	Nonsense_Mutation	SNP	ENST00000316157.3	37	c.1543C>T	CCDS31131.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	40|40	8.222029|8.222029	0.98712|0.98712	.|.	.|.	ENSG00000107929|ENSG00000107929	ENST00000316157|ENST00000448368	.|T	.|0.46451	.|0.87	6.11|6.11	6.11|6.11	0.99139|0.99139	.|.	0.049877|.	0.85682|.	D|.	0.000000|.	.|T	.|0.65196	.|0.2668	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.61787	.|-0.6991	.|5	0.06494|0.48119	T|T	0.89|0.1	-34.6809|-34.6809	20.7342|20.7342	0.99715|0.99715	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|I	515|80	.|ENSP00000394545:T80I	ENSP00000326128:Q515X|ENSP00000394545:T80I	Q|T	-|-	1|2	0|0	LARP4B|LARP4B	853817|853817	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.942000|0.942000	0.58702|0.58702	6.992000|6.992000	0.76238|0.76238	2.906000|2.906000	0.99361|0.99361	0.655000|0.655000	0.94253|0.94253	CAG|ACA		0.557	LARP4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046395.2	NM_015155		23	49	0	0	0	0	23	49				
IL2RA	3559	broad.mit.edu	37	10	6061875	6061875	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr10:6061875C>T	ENST00000379959.3	-	5	786	c.613G>A	c.(613-615)Ggc>Agc	p.G205S	SNORA14_ENST00000516113.1_RNA|IL2RA_ENST00000256876.6_Missense_Mutation_p.G196S|IL2RA_ENST00000379954.1_Missense_Mutation_p.G133S	NM_000417.2	NP_000408.1	P01589	IL2RA_HUMAN	interleukin 2 receptor, alpha	205					activation-induced cell death of T cells (GO:0006924)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-2-mediated signaling pathway (GO:0038110)|negative regulation of defense response to virus (GO:0050687)|negative regulation of immune response (GO:0050777)|negative regulation of inflammatory response (GO:0050728)|negative regulation of T cell proliferation (GO:0042130)|Notch signaling pathway (GO:0007219)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of T cell differentiation (GO:0045582)|regulation of T cell homeostatic proliferation (GO:0046013)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|interleukin-2 receptor activity (GO:0004911)			endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	17					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	TCAGGACGGCCTTCGGGGCTT	0.597																																						uc001iiz.1		NA																	0				ovary(1)|skin(1)	2						c.(613-615)GGC>AGC		interleukin 2 receptor, alpha chain precursor	Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)						119.0	105.0	110.0					10																	6061875		2203	4300	6503	SO:0001583	missense	3559				cell proliferation	integral to membrane	interleukin-2 receptor activity	g.chr10:6061875C>T	X01057	CCDS7076.1	10p15-p14	2014-09-17			ENSG00000134460	ENSG00000134460		"""Interleukins and interleukin receptors"", ""CD molecules"""	6008	protein-coding gene	gene with protein product		147730	"""insulin-dependent diabetes mellitus 10"""	IL2R, IDDM10		3925551, 17676041	Standard	NM_000417		Approved	CD25	uc001iiz.2	P01589	OTTHUMG00000017616	ENST00000379959.3:c.613G>A	10.37:g.6061875C>T	ENSP00000369293:p.Gly205Ser		Somatic				IL2RA_uc009xih.1_Missense_Mutation_p.G133S|IL2RA_uc001ija.1_Intron	p.G205S	NM_000417	NP_000408	WXS	Illumina HiSeq	Unspecified	P01589	IL2RA_HUMAN			5	772	-			205			Extracellular (Potential).		Q5W007	Missense_Mutation	SNP	ENST00000379959.3	37	c.613G>A	CCDS7076.1	.	.	.	.	.	.	.	.	.	.	C	1.626	-0.520297	0.04171	.	.	ENSG00000134460	ENST00000379959;ENST00000379954;ENST00000256876	T;T;T	0.39592	1.65;1.07;1.7	3.59	-2.66	0.06077	.	1.667730	0.03178	N	0.171705	T	0.12178	0.0296	N	0.00841	-1.15	0.09310	N	1	B;B	0.15930	0.015;0.0	B;B	0.13407	0.009;0.0	T	0.06917	-1.0800	10	0.18276	T	0.48	-41.4739	0.8135	0.01098	0.1619:0.3381:0.1592:0.3407	.	133;205	Q5W005;P01589	.;IL2RA_HUMAN	S	205;133;196	ENSP00000369293:G205S;ENSP00000369287:G133S;ENSP00000256876:G196S	ENSP00000256876:G196S	G	-	1	0	IL2RA	6101881	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.846000	0.04336	-0.541000	0.06257	-0.424000	0.05967	GGC		0.597	IL2RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046627.1	NM_000417		30	59	0	0	0	0	30	59				
MCM10	55388	broad.mit.edu	37	10	13240697	13240697	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr10:13240697G>T	ENST00000484800.2	+	16	2234	c.2131G>T	c.(2131-2133)Gaa>Taa	p.E711*	MCM10_ENST00000378694.1_Nonsense_Mutation_p.E710*|MCM10_ENST00000378714.3_Nonsense_Mutation_p.E710*			Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	711					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(4)|ovary(2)|skin(1)|stomach(1)	9						AGCTGAGGATGAATTGGAGCC	0.458																																						uc001ima.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(2131-2133)GAA>TAA		minichromosome maintenance complex component 10							98.0	100.0	99.0					10																	13240697		2203	4300	6503	SO:0001587	stop_gained	55388				cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle	nucleoplasm	metal ion binding|protein binding	g.chr10:13240697G>T	AB042719	CCDS7095.1, CCDS7096.1	10p13	2008-08-01	2007-04-04		ENSG00000065328	ENSG00000065328			18043	protein-coding gene	gene with protein product		609357	"""MCM10 minichromosome maintenance deficient 10 (S. cerevisiae)"""			11095689, 17699597	Standard	NM_018518		Approved	PRO2249, CNA43, DNA43	uc001ima.3	Q7L590	OTTHUMG00000017694	ENST00000484800.2:c.2131G>T	10.37:g.13240697G>T	ENSP00000418268:p.Glu711*		Somatic				MCM10_uc001imb.2_Nonsense_Mutation_p.E710*|MCM10_uc001imc.2_Nonsense_Mutation_p.E710*	p.E711*	NM_182751	NP_877428	WXS	Illumina HiSeq	Unspecified	Q7L590	MCM10_HUMAN			16	2232	+			711					A8K9I6|B7ZKZ8|Q3MIR3|Q7LD55|Q96GX4|Q96NB6|Q9H0D7|Q9H3P9|Q9P177	Nonsense_Mutation	SNP	ENST00000484800.2	37	c.2131G>T	CCDS7096.1	.	.	.	.	.	.	.	.	.	.	G	39	7.657909	0.98415	.	.	ENSG00000065328	ENST00000378714;ENST00000361282;ENST00000484800;ENST00000378694	.	.	.	5.13	5.13	0.70059	.	0.138265	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	-11.8788	13.2978	0.60307	0.0762:0.0:0.9238:0.0	.	.	.	.	X	710;711;711;710	.	ENSP00000354945:E711X	E	+	1	0	MCM10	13280703	1.000000	0.71417	0.993000	0.49108	0.344000	0.29017	8.197000	0.89727	2.547000	0.85894	0.655000	0.94253	GAA		0.458	MCM10-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356853.1	NM_182751		45	61	1	0	8.94e-30	1.19e-29	45	61				
NPFFR1	64106	broad.mit.edu	37	10	72020461	72020461	+	Silent	SNP	G	G	A	rs200754367	byFrequency	TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr10:72020461G>A	ENST00000277942.6	-	3	356	c.357C>T	c.(355-357)agC>agT	p.S119S		NM_022146.4	NP_071429.1	Q9GZQ6	NPFF1_HUMAN	neuropeptide FF receptor 1	119					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)			endometrium(2)|lung(1)	3						GCACCAAGCCGCTCATCTTGC	0.567													G|||	5	0.000998403	0.0008	0.0014	5008	,	,		20334	0.001		0.0	False		,,,				2504	0.002					uc010qjk.1		NA																	0					0						c.(349-351)AGC>AGT		neuropeptide FF receptor 1		G		2,4096		0,2,2047	42.0	49.0	47.0		357	1.5	1.0	10		47	16,8392		0,16,4188	no	coding-synonymous	NPFFR1	NM_022146.4		0,18,6235	AA,AG,GG		0.1903,0.0488,0.1439		119/431	72020461	18,12488	2049	4204	6253	SO:0001819	synonymous_variant	64106					integral to membrane|plasma membrane	neuropeptide receptor activity	g.chr10:72020461G>A	AB040104	CCDS53539.1	10q21-q22	2012-08-10	2006-02-15	2006-02-15	ENSG00000148734	ENSG00000148734		"""GPCR / Class A :  Neuropeptide receptors : FF/AF"", ""GPCR / Class A : RF amide peptide receptors"""	17425	protein-coding gene	gene with protein product	"""neuropeptide FF 1"""	607448	"""G protein-coupled receptor 147"""	GPR147		11024015	Standard	NM_022146		Approved	OT7T022, NPFF1R1	uc021psj.1	Q9GZQ6	OTTHUMG00000018404	ENST00000277942.6:c.357C>T	10.37:g.72020461G>A			Somatic					p.S117S	NM_022146	NP_071429	WXS	Illumina HiSeq	Unspecified	Q9GZQ6	NPFF1_HUMAN			2	357	-			119			Helical; Name=3; (Potential).		A2RRF0|Q8NGR0|Q96RN3	Silent	SNP	ENST00000277942.6	37	c.351C>T	CCDS53539.1																																																																																				0.567	NPFFR1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048504.2	NM_022146		7	17	0	0	0	0	7	17				
ZSWIM8	23053	broad.mit.edu	37	10	75552076	75552076	+	Missense_Mutation	SNP	T	T	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr10:75552076T>A	ENST00000605216.1	+	10	1996	c.1779T>A	c.(1777-1779)agT>agA	p.S593R	ZSWIM8_ENST00000603114.1_Missense_Mutation_p.S593R|ZSWIM8_ENST00000604729.1_Missense_Mutation_p.S593R|ZSWIM8_ENST00000604524.1_Missense_Mutation_p.S593R|ZSWIM8_ENST00000431225.1_3'UTR|ZSWIM8_ENST00000398706.2_Missense_Mutation_p.S593R	NM_001242487.1	NP_001229416.1	A7E2V4	ZSWM8_HUMAN	zinc finger, SWIM-type containing 8	593	Gly-rich.						zinc ion binding (GO:0008270)										GGGCTGGCAGTGGGAGCAAGG	0.642																																						uc009xrl.2		NA																	0				breast(1)	1						c.(1777-1779)AGT>AGA		hypothetical protein LOC23053							16.0	22.0	20.0					10																	75552076		2019	4181	6200	SO:0001583	missense	23053						zinc ion binding	g.chr10:75552076T>A	BC151206, BC040726	CCDS44440.1, CCDS60560.1	10q22.3	2012-11-02	2012-11-02	2012-11-02	ENSG00000214655	ENSG00000214655		"""Zinc fingers, SWIM-type"""	23528	protein-coding gene	gene with protein product			"""KIAA0913"""	KIAA0913			Standard	NM_015037		Approved	4832404P21Rik	uc001jvj.3	A7E2V4	OTTHUMG00000018486	ENST00000605216.1:c.1779T>A	10.37:g.75552076T>A	ENSP00000474748:p.Ser593Arg		Somatic				KIAA0913_uc001jve.2_Missense_Mutation_p.S593R|KIAA0913_uc001jvf.2_Missense_Mutation_p.S593R|KIAA0913_uc001jvh.2_RNA|KIAA0913_uc001jvi.2_Missense_Mutation_p.S16R|KIAA0913_uc010qkr.1_Missense_Mutation_p.S16R|KIAA0913_uc001jvj.2_Missense_Mutation_p.S16R	p.S593R	NM_015037	NP_055852	WXS	Illumina HiSeq	Unspecified	A7E2V4	K0913_HUMAN			10	1811	+	Prostate(51;0.0112)		593			Gly-rich.		B2RP37|O94987|Q17RS8|Q2TAB8|Q6P439|Q8IW81|Q8NB34|Q9H8F3	Missense_Mutation	SNP	ENST00000605216.1	37	c.1779T>A		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	15.26|15.26|15.26	2.782067|2.782067|2.782067	0.49891|0.49891|0.49891	.|.|.	.|.|.	ENSG00000214655|ENSG00000214655|ENSG00000214655	ENST00000398706|ENST00000431225|ENST00000433366	T|.|.	0.43294|.|.	0.95|.|.	5.55|5.55|5.55	3.17|3.17|3.17	0.36434|0.36434|0.36434	.|.|.	0.253756|.|.	0.25324|.|.	U|.|.	0.031491|.|.	T|T|T	0.27524|0.27524|0.27524	0.0676|0.0676|0.0676	N|N|N	0.08118|0.08118|0.08118	0|0|0	0.34019|0.34019|0.34019	D|D|D	0.652401|0.652401|0.652401	B;B;B;B|.|.	0.21905|.|.	0.062;0.018;0.018;0.062|.|.	B;B;B;B|.|.	0.28849|.|.	0.095;0.031;0.046;0.095|.|.	T|T|T	0.33369|0.33369|0.33369	-0.9871|-0.9871|-0.9871	10|5|5	0.40728|.|.	T|.|.	0.16|.|.	0.5373|0.5373|0.5373	9.0382|9.0382|9.0382	0.36300|0.36300|0.36300	0.0:0.1455:0.0:0.8545|0.0:0.1455:0.0:0.8545|0.0:0.1455:0.0:0.8545	.|.|.	593;593;593;593|.|.	A7E2V4;A7E2V4-3;A7E2V4-5;A7E2V4-4|.|.	K0913_HUMAN;.;.;.|.|.	R|E|R	593|90|316	ENSP00000381693:S593R|.|.	ENSP00000381693:S593R|.|.	S|V|W	+|+|+	3|2|1	2|0|0	KIAA0913|KIAA0913|KIAA0913	75222082|75222082|75222082	0.998000|0.998000|0.998000	0.40836|0.40836|0.40836	0.999000|0.999000|0.999000	0.59377|0.59377|0.59377	0.997000|0.997000|0.997000	0.91878|0.91878|0.91878	0.458000|0.458000|0.458000	0.21892|0.21892|0.21892	0.508000|0.508000|0.508000	0.28173|0.28173|0.28173	0.533000|0.533000|0.533000	0.62120|0.62120|0.62120	AGT|GTG|TGG		0.642	ZSWIM8-012	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000468545.1	NM_001242487		13	17	0	0	0	0	13	17				
LIPN	643418	broad.mit.edu	37	10	90521213	90521213	+	Silent	SNP	T	T	C			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr10:90521213T>C	ENST00000404459.1	+	1	51	c.51T>C	c.(49-51)aaT>aaC	p.N17N		NM_001102469.1	NP_001095939.1	Q5VXI9	LIPN_HUMAN	lipase, family member N	17					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	hydrolase activity, acting on ester bonds (GO:0016788)			endometrium(1)|kidney(1)|large_intestine(5)|lung(1)|skin(1)	9		Colorectal(252;0.0161)		Colorectal(12;4.83e-05)|COAD - Colon adenocarcinoma(12;6.5e-05)		GAACTTTAAATGCTGGTGGAT	0.343																																						uc010qmw.1		NA																	0					0						c.(49-51)AAT>AAC		lipase-like, ab-hydrolase domain containing 4							146.0	140.0	142.0					10																	90521213		1836	4084	5920	SO:0001819	synonymous_variant	643418				lipid catabolic process	extracellular region	hydrolase activity	g.chr10:90521213T>C		CCDS44456.1	10q23.31	2013-09-20	2007-02-27	2007-02-27	ENSG00000204020	ENSG00000204020			23452	protein-coding gene	gene with protein product		613924	"""lipase-like, ab-hydrolase domain containing 4"""	LIPL4			Standard	NM_001102469		Approved	bA186O14.3	uc010qmw.2	Q5VXI9	OTTHUMG00000018694	ENST00000404459.1:c.51T>C	10.37:g.90521213T>C			Somatic					p.N17N	NM_001102469	NP_001095939	WXS	Illumina HiSeq	Unspecified	Q5VXI9	LIPN_HUMAN		Colorectal(12;4.83e-05)|COAD - Colon adenocarcinoma(12;6.5e-05)	1	51	+		Colorectal(252;0.0161)	17					A7KIH9	Silent	SNP	ENST00000404459.1	37	c.51T>C	CCDS44456.1																																																																																				0.343	LIPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049254.2	XM_926751		39	62	0	0	0	0	39	62				
TLX1	3195	broad.mit.edu	37	10	102891411	102891411	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr10:102891411C>G	ENST00000370196.6	+	1	2155	c.113C>G	c.(112-114)tCg>tGg	p.S38W	TLX1NB_ENST00000445873.1_5'Flank|TLX1_ENST00000467928.2_Missense_Mutation_p.S38W|TLX1NB_ENST00000425505.1_5'Flank			P31314	TLX1_HUMAN	T-cell leukemia homeobox 1	38					cell fate commitment (GO:0045165)|central nervous system development (GO:0007417)|neuron differentiation (GO:0030182)|organ formation (GO:0048645)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spleen development (GO:0048536)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(1)|upper_aerodigestive_tract(1)	2				Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		GGACCCGCCTCGCGCCTCCAG	0.706			T	"""TRB@, TRD@"""	T-ALL																																	uc001ksw.2		NA		Dom	yes		10	10q24	3195	T	""" T-cell leukemia, homeobox 1 (HOX11)"""			L	TRB@|TRD@		T-ALL		0				breast(1)	1						c.(112-114)TCG>TGG		T-cell leukemia homeobox 1							20.0	22.0	21.0					10																	102891411		2201	4298	6499	SO:0001583	missense	3195					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr10:102891411C>G	M62626	CCDS7510.1, CCDS55725.1	10q24.32	2011-06-20	2005-12-22	2002-05-31	ENSG00000107807	ENSG00000107807		"""Homeoboxes / ANTP class : NKL subclass"""	5056	protein-coding gene	gene with protein product	"""Homeo box-11 (T-cell leukemia-3 associated breakpoint, homologous to Drosophila Notch)"", ""homeo box 11 (T-cell lymphoma 3-associated breakpoint)"""	186770	"""homeo box 11 (T-cell lymphoma 3-associated breakpoint)"", ""T-cell leukemia, homeobox 1"""	TCL3, HOX11		1676542, 1973146	Standard	NM_005521		Approved		uc001ksw.3	P31314	OTTHUMG00000019341	ENST00000370196.6:c.113C>G	10.37:g.102891411C>G	ENSP00000359215:p.Ser38Trp		Somatic				TLX1NB_uc001ksv.2_5'Flank	p.S38W	NM_005521	NP_005512	WXS	Illumina HiSeq	Unspecified	P31314	TLX1_HUMAN		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)	1	351	+			38					A1L4G3|O75699|Q5VXP2|Q9HCA0|Q9UD59	Missense_Mutation	SNP	ENST00000370196.6	37	c.113C>G	CCDS7510.1	.	.	.	.	.	.	.	.	.	.	C	17.51	3.408438	0.62399	.	.	ENSG00000107807	ENST00000370196;ENST00000463716;ENST00000467928	D;D	0.92446	-2.75;-3.04	4.45	4.45	0.53987	.	0.475710	0.22557	N	0.058503	D	0.89501	0.6733	L	0.27053	0.805	0.36193	D	0.850195	D	0.53151	0.958	P	0.47864	0.559	D	0.92723	0.6193	10	0.56958	D	0.05	.	16.6933	0.85327	0.0:1.0:0.0:0.0	.	38	P31314	TLX1_HUMAN	W	38	ENSP00000359215:S38W;ENSP00000434914:S38W	ENSP00000359215:S38W	S	+	2	0	TLX1	102881401	0.093000	0.21703	0.964000	0.40570	0.984000	0.73092	2.561000	0.45905	2.029000	0.59856	0.462000	0.41574	TCG		0.706	TLX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051193.3	NM_005521		8	15	0	0	0	0	8	15				
ACSL5	51703	broad.mit.edu	37	10	114158684	114158684	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr10:114158684A>G	ENST00000393081.1	+	3	489	c.182A>G	c.(181-183)cAg>cGg	p.Q61R	ACSL5_ENST00000479936.1_3'UTR|ACSL5_ENST00000354655.4_Missense_Mutation_p.Q61R|ACSL5_ENST00000356116.1_Missense_Mutation_p.Q117R|ACSL5_ENST00000433418.1_Missense_Mutation_p.Q61R|ACSL5_ENST00000354273.4_Missense_Mutation_p.Q61R	NM_203380.1	NP_976314.1	Q9ULC5	ACSL5_HUMAN	acyl-CoA synthetase long-chain family member 5	61					cellular lipid metabolic process (GO:0044255)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)			breast(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|stomach(1)	21		Colorectal(252;0.117)|Breast(234;0.222)		Epithelial(162;0.0343)|all cancers(201;0.137)		GGGGTTTCCCAGAAGAACAAT	0.463																																						uc001kzs.2		NA																	0				large_intestine(2)|skin(1)	3						c.(181-183)CAG>CGG		acyl-CoA synthetase long-chain family member 5							173.0	145.0	155.0					10																	114158684		2203	4300	6503	SO:0001583	missense	51703				fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|mitochondrial outer membrane	ATP binding|long-chain fatty acid-CoA ligase activity	g.chr10:114158684A>G	AB033899	CCDS7572.1, CCDS7573.1	10q25.1-q25.2	2004-06-21	2004-02-19	2004-02-20	ENSG00000197142	ENSG00000197142		"""Acyl-CoA synthetase family"""	16526	protein-coding gene	gene with protein product	"""FACL5 for fatty acid coenzyme A ligase 5"", ""long-chain acyl-CoA synthetase 5"", ""long-chain fatty acid coenzyme A ligase 5"", ""fatty-acid-Coenzyme A ligase, long-chain 5"""	605677	"""fatty-acid-Coenzyme A ligase, long-chain 5"""	FACL5		11127823	Standard	NM_016234		Approved	ACS5, ACS2	uc001kzu.3	Q9ULC5	OTTHUMG00000019060	ENST00000393081.1:c.182A>G	10.37:g.114158684A>G	ENSP00000376796:p.Gln61Arg		Somatic				ACSL5_uc001kzt.2_Missense_Mutation_p.Q61R|ACSL5_uc001kzu.2_Missense_Mutation_p.Q117R|ACSL5_uc009xxz.2_Missense_Mutation_p.Q61R	p.Q61R	NM_203379	NP_976313	WXS	Illumina HiSeq	Unspecified	Q9ULC5	ACSL5_HUMAN		Epithelial(162;0.0343)|all cancers(201;0.137)	3	323	+		Colorectal(252;0.117)|Breast(234;0.222)	61			Cytoplasmic (Potential).		A6GV77|D3DRB3|Q6UX44|Q9UIU4	Missense_Mutation	SNP	ENST00000393081.1	37	c.182A>G	CCDS7573.1	.	.	.	.	.	.	.	.	.	.	A	10.40	1.338630	0.24253	.	.	ENSG00000197142	ENST00000354655;ENST00000393081;ENST00000356116;ENST00000433418;ENST00000354273	T;T;T;T;T	0.38722	1.91;1.91;1.88;1.12;1.91	5.01	3.84	0.44239	.	0.194838	0.43260	D	0.000595	T	0.35970	0.0950	L	0.57536	1.79	0.80722	D	1	B;B;B	0.29341	0.242;0.202;0.097	B;B;B	0.31946	0.054;0.138;0.045	T	0.07424	-1.0773	10	0.15952	T	0.53	-4.2237	8.4688	0.32973	0.5662:0.0:0.0:0.4338	.	61;117;61	A6GV77;Q9ULC5-3;Q9ULC5	.;.;ACSL5_HUMAN	R	61;61;117;61;61	ENSP00000346680:Q61R;ENSP00000376796:Q61R;ENSP00000348429:Q117R;ENSP00000403647:Q61R;ENSP00000346223:Q61R	ENSP00000346223:Q61R	Q	+	2	0	ACSL5	114148674	1.000000	0.71417	0.627000	0.29227	0.298000	0.27526	4.610000	0.61155	0.811000	0.34303	0.454000	0.30748	CAG		0.463	ACSL5-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050386.1	NM_016234		55	73	0	0	0	0	55	73				
ACSL5	51703	broad.mit.edu	37	10	114171725	114171725	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr10:114171725G>C	ENST00000393081.1	+	11	1243	c.936G>C	c.(934-936)gaG>gaC	p.E312D	ACSL5_ENST00000369410.3_Missense_Mutation_p.E94D|RP11-324O2.3_ENST00000598447.1_RNA|ACSL5_ENST00000354655.4_Missense_Mutation_p.E312D|ACSL5_ENST00000356116.1_Missense_Mutation_p.E368D|RP11-324O2.3_ENST00000449782.2_RNA|RP11-324O2.6_ENST00000424422.1_RNA|ACSL5_ENST00000433418.1_Missense_Mutation_p.E312D|ACSL5_ENST00000354273.4_Missense_Mutation_p.E312D|RP11-324O2.3_ENST00000594870.2_RNA	NM_203380.1	NP_976314.1	Q9ULC5	ACSL5_HUMAN	acyl-CoA synthetase long-chain family member 5	312					cellular lipid metabolic process (GO:0044255)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)			breast(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|stomach(1)	21		Colorectal(252;0.117)|Breast(234;0.222)		Epithelial(162;0.0343)|all cancers(201;0.137)		ATATGTTTGAGAGGATTGTAC	0.478																																						uc001kzs.2		NA																	0				large_intestine(2)|skin(1)	3						c.(934-936)GAG>GAC		acyl-CoA synthetase long-chain family member 5							240.0	200.0	213.0					10																	114171725		2203	4300	6503	SO:0001583	missense	51703				fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|mitochondrial outer membrane	ATP binding|long-chain fatty acid-CoA ligase activity	g.chr10:114171725G>C	AB033899	CCDS7572.1, CCDS7573.1	10q25.1-q25.2	2004-06-21	2004-02-19	2004-02-20	ENSG00000197142	ENSG00000197142		"""Acyl-CoA synthetase family"""	16526	protein-coding gene	gene with protein product	"""FACL5 for fatty acid coenzyme A ligase 5"", ""long-chain acyl-CoA synthetase 5"", ""long-chain fatty acid coenzyme A ligase 5"", ""fatty-acid-Coenzyme A ligase, long-chain 5"""	605677	"""fatty-acid-Coenzyme A ligase, long-chain 5"""	FACL5		11127823	Standard	NM_016234		Approved	ACS5, ACS2	uc001kzu.3	Q9ULC5	OTTHUMG00000019060	ENST00000393081.1:c.936G>C	10.37:g.114171725G>C	ENSP00000376796:p.Glu312Asp		Somatic				ACSL5_uc001kzt.2_Missense_Mutation_p.E312D|ACSL5_uc001kzu.2_Missense_Mutation_p.E368D|ACSL5_uc009xxz.2_Missense_Mutation_p.E312D|ACSL5_uc010qrj.1_Missense_Mutation_p.E94D	p.E312D	NM_203379	NP_976313	WXS	Illumina HiSeq	Unspecified	Q9ULC5	ACSL5_HUMAN		Epithelial(162;0.0343)|all cancers(201;0.137)	11	1077	+		Colorectal(252;0.117)|Breast(234;0.222)	312			Cytoplasmic (Potential).		A6GV77|D3DRB3|Q6UX44|Q9UIU4	Missense_Mutation	SNP	ENST00000393081.1	37	c.936G>C	CCDS7573.1	.	.	.	.	.	.	.	.	.	.	G	19.57	3.853147	0.71719	.	.	ENSG00000197142	ENST00000354655;ENST00000393081;ENST00000356116;ENST00000433418;ENST00000354273;ENST00000369410	T;T;T;T;T;T	0.11169	2.8;2.8;2.8;2.8;2.8;2.8	5.69	1.27	0.21489	AMP-dependent synthetase/ligase (1);	0.172440	0.51477	D	0.000091	T	0.24431	0.0592	M	0.78637	2.42	0.58432	D	0.999995	B;B;P;P	0.48694	0.35;0.018;0.914;0.877	B;B;P;P	0.57548	0.35;0.038;0.622;0.823	T	0.01222	-1.1414	10	0.40728	T	0.16	-9.1478	9.8042	0.40783	0.3955:0.0:0.6045:0.0	.	94;312;368;312	B4DX30;A6GV77;Q9ULC5-3;Q9ULC5	.;.;.;ACSL5_HUMAN	D	312;312;368;312;312;94	ENSP00000346680:E312D;ENSP00000376796:E312D;ENSP00000348429:E368D;ENSP00000403647:E312D;ENSP00000346223:E312D;ENSP00000358418:E94D	ENSP00000346223:E312D	E	+	3	2	ACSL5	114161715	1.000000	0.71417	0.997000	0.53966	0.965000	0.64279	1.245000	0.32790	0.361000	0.24292	0.655000	0.94253	GAG		0.478	ACSL5-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050386.1	NM_016234		7	139	0	0	0	0	7	139				
NLRP14	338323	broad.mit.edu	37	11	7063670	7063670	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr11:7063670G>T	ENST00000299481.4	+	4	759	c.413G>T	c.(412-414)tGg>tTg	p.W138L		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	138					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)			breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		TGCATCACTTGGGACAAGAAG	0.363																																						uc001mfb.1		NA																	0				ovary(3)|breast(2)|pancreas(1)|lung(1)|skin(1)	8						c.(412-414)TGG>TTG		NLR family, pyrin domain containing 14							59.0	67.0	64.0					11																	7063670		2200	4296	6496	SO:0001583	missense	338323				cell differentiation|multicellular organismal development|spermatogenesis		ATP binding	g.chr11:7063670G>T	BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.413G>T	11.37:g.7063670G>T	ENSP00000299481:p.Trp138Leu		Somatic					p.W138L	NM_176822	NP_789792	WXS	Illumina HiSeq	Unspecified	Q86W24	NAL14_HUMAN		Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)	4	736	+			138					Q7RTR6	Missense_Mutation	SNP	ENST00000299481.4	37	c.413G>T	CCDS7776.1	.	.	.	.	.	.	.	.	.	.	G	9.091	1.001639	0.19121	.	.	ENSG00000158077	ENST00000299481	T	0.70282	-0.47	4.05	-6.59	0.01830	.	1.853690	0.02831	N	0.126736	T	0.50939	0.1645	L	0.38175	1.15	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29671	-1.0004	10	0.18276	T	0.48	.	0.8936	0.01259	0.1715:0.2141:0.2594:0.355	.	138	Q86W24	NAL14_HUMAN	L	138	ENSP00000299481:W138L	ENSP00000299481:W138L	W	+	2	0	NLRP14	7020246	0.001000	0.12720	0.000000	0.03702	0.012000	0.07955	-0.156000	0.10100	-1.587000	0.01630	0.650000	0.86243	TGG		0.363	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384551.1	NM_176822		30	16	1	0	1.4e-14	1.81e-14	30	16				
OR10A6	390093	broad.mit.edu	37	11	7950014	7950014	+	Missense_Mutation	SNP	A	A	C			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr11:7950014A>C	ENST00000309838.2	-	1	195	c.196T>G	c.(196-198)Tta>Gta	p.L66V		NM_001004461.1	NP_001004461.1	Q8NH74	O10A6_HUMAN	olfactory receptor, family 10, subfamily A, member 6	66						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	22				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		ACCACAGATAAGTTCAGGAGA	0.443																																						uc010rbh.1		NA																	0				ovary(1)|skin(1)	2						c.(196-198)TTA>GTA		olfactory receptor, family 10, subfamily A,							117.0	113.0	114.0					11																	7950014		2201	4296	6497	SO:0001583	missense	390093				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:7950014A>C	AB065515	CCDS31420.1	11p15.4	2012-08-09			ENSG00000175393	ENSG00000175393		"""GPCR / Class A : Olfactory receptors"""	15132	protein-coding gene	gene with protein product							Standard	NM_001004461		Approved		uc010rbh.2	Q8NH74	OTTHUMG00000165671	ENST00000309838.2:c.196T>G	11.37:g.7950014A>C	ENSP00000312470:p.Leu66Val		Somatic					p.L66V	NM_001004461	NP_001004461	WXS	Illumina HiSeq	Unspecified	Q8NH74	O10A6_HUMAN		Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)	1	196	-			66			Helical; Name=2; (Potential).		Q6IF59	Missense_Mutation	SNP	ENST00000309838.2	37	c.196T>G	CCDS31420.1	.	.	.	.	.	.	.	.	.	.	A	14.15	2.450121	0.43531	.	.	ENSG00000175393	ENST00000309838	T	0.00507	6.92	4.14	1.74	0.24563	GPCR, rhodopsin-like superfamily (1);	0.000000	0.34002	N	0.004352	T	0.02193	0.0068	H	0.95816	3.725	0.25473	N	0.987809	D	0.76494	0.999	D	0.83275	0.996	T	0.25950	-1.0117	10	0.72032	D	0.01	.	6.059	0.19826	0.6508:0.0:0.3492:0.0	.	66	Q8NH74	O10A6_HUMAN	V	66	ENSP00000312470:L66V	ENSP00000312470:L66V	L	-	1	2	OR10A6	7906590	0.003000	0.15002	0.994000	0.49952	0.573000	0.36030	0.121000	0.15667	0.239000	0.21243	0.533000	0.62120	TTA		0.443	OR10A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385703.1	NM_001004461		61	29	0	0	0	0	61	29				
NAV2	89797	broad.mit.edu	37	11	19970445	19970445	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr11:19970445G>A	ENST00000396087.3	+	11	2632	c.2533G>A	c.(2533-2535)Gtg>Atg	p.V845M	NAV2_ENST00000396085.1_Missense_Mutation_p.V822M|NAV2_ENST00000527559.2_Missense_Mutation_p.V774M|NAV2_ENST00000360655.4_Missense_Mutation_p.V758M|NAV2_ENST00000349880.4_Missense_Mutation_p.V822M|NAV2_ENST00000540292.1_Missense_Mutation_p.V776M	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	845					glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						AGGTCGCTATGTGTACTCCGC	0.612																																						uc010rdm.1		NA																	0				skin(4)|ovary(1)|pancreas(1)	6						c.(2533-2535)GTG>ATG		neuron navigator 2 isoform 2							93.0	86.0	88.0					11																	19970445		2199	4293	6492	SO:0001583	missense	89797					nucleus	ATP binding|helicase activity	g.chr11:19970445G>A	AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.2533G>A	11.37:g.19970445G>A	ENSP00000379396:p.Val845Met		Somatic				NAV2_uc001mpp.2_Missense_Mutation_p.V758M|NAV2_uc001mpr.3_Missense_Mutation_p.V822M	p.V845M	NM_145117	NP_660093	WXS	Illumina HiSeq	Unspecified	Q8IVL1	NAV2_HUMAN			11	2894	+			845					A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Missense_Mutation	SNP	ENST00000396087.3	37	c.2533G>A	CCDS58126.1	.	.	.	.	.	.	.	.	.	.	G	0.648	-0.810536	0.02798	.	.	ENSG00000166833	ENST00000360655;ENST00000396085;ENST00000349880;ENST00000396087;ENST00000527559;ENST00000540292	T;T;T;T;T;T	0.28255	1.63;1.75;1.74;1.74;1.63;1.62	5.02	3.1	0.35709	.	0.534081	0.18054	N	0.153172	T	0.16727	0.0402	N	0.19112	0.55	0.80722	D	1	B;B	0.10296	0.001;0.003	B;B	0.14578	0.004;0.011	T	0.06588	-1.0818	9	.	.	.	.	6.7552	0.23510	0.2409:0.142:0.6171:0.0	.	822;758	Q8IVL1-3;Q8IVL1-4	.;.	M	758;822;822;845;774;776	ENSP00000353871:V758M;ENSP00000379394:V822M;ENSP00000309577:V822M;ENSP00000379396:V845M;ENSP00000435395:V774M;ENSP00000443489:V776M	.	V	+	1	0	NAV2	19927021	0.873000	0.30073	0.586000	0.28679	0.851000	0.48451	1.334000	0.33827	1.234000	0.43709	0.655000	0.94253	GTG		0.612	NAV2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324112.1	NM_145117		40	14	0	0	0	0	40	14				
RAG2	5897	broad.mit.edu	37	11	36614509	36614509	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr11:36614509C>T	ENST00000311485.3	-	2	1371	c.1210G>A	c.(1210-1212)Gaa>Aaa	p.E404K	C11orf74_ENST00000334307.5_5'Flank|C11orf74_ENST00000446510.2_5'Flank|C11orf74_ENST00000347206.4_5'Flank|C11orf74_ENST00000534635.1_5'Flank|RAG2_ENST00000528428.1_5'Flank	NM_000536.3|NM_001243785.1|NM_001243786.1	NP_000527.2|NP_001230714.1|NP_001230715.1	P55895	RAG2_HUMAN	recombination activating gene 2	404					B cell differentiation (GO:0030183)|chromatin modification (GO:0016568)|pre-B cell allelic exclusion (GO:0002331)|T cell differentiation in thymus (GO:0033077)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|pancreas(2)|prostate(1)|skin(4)	32	all_lung(20;0.226)	all_hematologic(20;0.00756)				TCATCATCTTCATTATAGGTG	0.403									Familial Hemophagocytic Lymphohistiocytosis																													uc001mwv.3		NA																	0				skin(3)|ovary(1)|pancreas(1)	5						c.(1210-1212)GAA>AAA		recombination activating gene 2							149.0	142.0	145.0					11																	36614509		2202	4298	6500	SO:0001583	missense	5897	Familial_Hemophagocytic_Lymphohistiocytosis	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	chromatin modification|pre-B cell allelic exclusion|somatic diversification of immunoglobulins|T cell differentiation in thymus|V(D)J recombination	nucleus	chromatin binding|DNA binding|endonuclease activity|methylated histone residue binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-4,5-bisphosphate binding|zinc ion binding	g.chr11:36614509C>T	AF080577	CCDS7903.1	11p13	2014-09-17				ENSG00000175097			9832	protein-coding gene	gene with protein product		179616				1283330	Standard	NM_000536		Approved		uc001mwv.4	P55895		ENST00000311485.3:c.1210G>A	11.37:g.36614509C>T	ENSP00000308620:p.Glu404Lys		Somatic				RAG1_uc001mwt.2_Intron|C11orf74_uc010rfd.1_5'Flank|C11orf74_uc001mww.1_5'Flank|C11orf74_uc001mwx.1_5'Flank|C11orf74_uc001mwy.1_5'Flank|C11orf74_uc001mwz.1_5'Flank|C11orf74_uc010rfe.1_5'Flank	p.E404K	NM_000536	NP_000527	WXS	Illumina HiSeq	Unspecified	P55895	RAG2_HUMAN			2	1398	-	all_lung(20;0.226)	all_hematologic(20;0.00756)	404					A8K9E9|Q8TBL4	Missense_Mutation	SNP	ENST00000311485.3	37	c.1210G>A	CCDS7903.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.437933	0.83885	.	.	ENSG00000175097	ENST00000311485	D	0.97529	-4.42	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	D	0.98588	0.9528	M	0.84948	2.725	0.80722	D	1	D	0.61080	0.989	D	0.72338	0.977	D	0.99425	1.0934	10	0.87932	D	0	-18.2542	19.6531	0.95825	0.0:1.0:0.0:0.0	.	404	P55895	RAG2_HUMAN	K	404	ENSP00000308620:E404K	ENSP00000308620:E404K	E	-	1	0	RAG2	36571085	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.445000	0.80570	2.715000	0.92844	0.650000	0.86243	GAA		0.403	RAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389536.1	NM_000536		38	24	0	0	0	0	38	24				
FAM111B	374393	broad.mit.edu	37	11	58892341	58892341	+	Missense_Mutation	SNP	T	T	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr11:58892341T>A	ENST00000343597.3	+	4	962	c.771T>A	c.(769-771)gaT>gaA	p.D257E	FAM111B_ENST00000411426.1_Missense_Mutation_p.D227E|FAM111B_ENST00000529618.1_Missense_Mutation_p.D227E	NM_198947.3	NP_945185.1	Q6SJ93	F111B_HUMAN	family with sequence similarity 111, member B	257							catalytic activity (GO:0003824)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(12)|ovary(3)|pancreas(1)|skin(1)	40						CCATGGTGGATGAAGTATCTG	0.343																																						uc001nnl.2		NA																	0				ovary(2)	2						c.(769-771)GAT>GAA		hypothetical protein LOC374393 isoform a							52.0	54.0	53.0					11																	58892341		2197	4291	6488	SO:0001583	missense	374393						catalytic activity	g.chr11:58892341T>A	BC062456	CCDS7972.1, CCDS44611.1	11q12.1	2014-03-13			ENSG00000189057	ENSG00000189057			24200	protein-coding gene	gene with protein product		615584				24268661	Standard	NM_198947		Approved	CANP	uc001nnl.3	Q6SJ93	OTTHUMG00000167279	ENST00000343597.3:c.771T>A	11.37:g.58892341T>A	ENSP00000341565:p.Asp257Glu		Somatic				FAM111B_uc001nnm.2_Missense_Mutation_p.D227E|FAM111B_uc010rko.1_Missense_Mutation_p.D227E	p.D257E	NM_198947	NP_945185	WXS	Illumina HiSeq	Unspecified	Q6SJ93	F111B_HUMAN			4	1014	+			257					B4E2G2|Q6P661	Missense_Mutation	SNP	ENST00000343597.3	37	c.771T>A	CCDS7972.1	.	.	.	.	.	.	.	.	.	.	T	11.83	1.754980	0.31046	.	.	ENSG00000189057	ENST00000411426;ENST00000529618;ENST00000343597	T;T;T	0.41400	1.0;1.0;1.05	4.05	-5.63	0.02474	.	0.491069	0.16512	N	0.211212	T	0.28962	0.0719	M	0.76574	2.34	0.09310	N	1	B	0.32467	0.372	B	0.25614	0.062	T	0.22521	-1.0214	10	0.87932	D	0	.	1.2722	0.02023	0.3652:0.0845:0.2479:0.3025	.	257	Q6SJ93	F111B_HUMAN	E	227;227;257	ENSP00000393855:D227E;ENSP00000432875:D227E;ENSP00000341565:D257E	ENSP00000341565:D257E	D	+	3	2	FAM111B	58648917	0.006000	0.16342	0.019000	0.16419	0.492000	0.33523	-0.508000	0.06344	-0.762000	0.04664	0.459000	0.35465	GAT		0.343	FAM111B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393974.1	NM_198947		4	31	0	0	0	0	4	31				
B3GAT3	26229	broad.mit.edu	37	11	62384617	62384617	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr11:62384617G>A	ENST00000265471.5	-	3	687	c.460C>T	c.(460-462)Cat>Tat	p.H154Y	B3GAT3_ENST00000531383.1_Missense_Mutation_p.H154Y|B3GAT3_ENST00000534026.1_Missense_Mutation_p.H154Y	NM_012200.3	NP_036332.2	O94766	B3GA3_HUMAN	beta-1,3-glucuronyltransferase 3	154					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	cis-Golgi network (GO:0005801)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity (GO:0015018)|glucuronosyltransferase activity (GO:0015020)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(2)|urinary_tract(1)	12						CCACGGGGATGAACCCAGCCA	0.687																																						uc001ntw.2		NA																	0					0						c.(460-462)CAT>TAT		beta-1,3-glucuronyltransferase 3							38.0	41.0	40.0					11																	62384617		2202	4299	6501	SO:0001583	missense	26229				glycosaminoglycan biosynthetic process	Golgi membrane|integral to membrane	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity|manganese ion binding	g.chr11:62384617G>A	AB009598	CCDS8025.1	11q12	2014-07-08	2014-07-08		ENSG00000149541	ENSG00000149541	2.4.1.135	"""Beta-1,3-glucuronyltransferases"""	923	protein-coding gene	gene with protein product	"""glucuronosyltransferase I"", ""galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 3"""	606374	"""beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)"""			9506957	Standard	NM_012200		Approved	GlcAT-I	uc001ntw.3	O94766	OTTHUMG00000167685	ENST00000265471.5:c.460C>T	11.37:g.62384617G>A	ENSP00000265471:p.His154Tyr		Somatic				B3GAT3_uc009ynz.2_Missense_Mutation_p.H147Y|B3GAT3_uc001ntx.2_RNA|B3GAT3_uc010rlz.1_Missense_Mutation_p.H154Y	p.H154Y	NM_012200	NP_036332	WXS	Illumina HiSeq	Unspecified	O94766	B3GA3_HUMAN			3	489	-			154			Lumenal (Potential).		B7ZAB3|Q96I06|Q9UEP0	Missense_Mutation	SNP	ENST00000265471.5	37	c.460C>T	CCDS8025.1	.	.	.	.	.	.	.	.	.	.	g	5.604	0.296124	0.10622	.	.	ENSG00000149541	ENST00000265471;ENST00000531383;ENST00000534026;ENST00000534715	T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.03	5.56	5.56	0.83823	.	0.217448	0.39407	N	0.001373	T	0.47967	0.1474	L	0.27053	0.805	0.22521	N	0.99903	B;B;B	0.14438	0.01;0.0;0.0	B;B;B	0.12837	0.008;0.0;0.0	T	0.30268	-0.9984	10	0.30078	T	0.28	.	12.0352	0.53420	0.0:0.0:0.8276:0.1724	.	154;160;154	B7ZAB3;Q5U676;O94766	.;.;B3GA3_HUMAN	Y	154;154;154;177	ENSP00000265471:H154Y;ENSP00000431359:H154Y;ENSP00000432474:H154Y;ENSP00000432854:H177Y	ENSP00000265471:H154Y	H	-	1	0	B3GAT3	62141193	0.024000	0.19004	0.992000	0.48379	0.969000	0.65631	1.818000	0.39012	2.616000	0.88540	0.556000	0.70494	CAT		0.687	B3GAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395588.1	NM_012200		33	46	0	0	0	0	33	46				
TM7SF2	7108	broad.mit.edu	37	11	64883456	64883456	+	Silent	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr11:64883456G>A	ENST00000279263.7	+	10	1350	c.1188G>A	c.(1186-1188)caG>caA	p.Q396Q	AP003068.12_ENST00000527789.1_RNA|TM7SF2_ENST00000345348.5_Silent_p.Q369Q|TM7SF2_ENST00000540748.1_Silent_p.Q280Q	NM_003273.2	NP_003264.2	O76062	ERG24_HUMAN	transmembrane 7 superfamily member 2	396					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	delta14-sterol reductase activity (GO:0050613)			lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						AGTGCCTGCAGAAGTACGGCC	0.632																																						uc001oct.2		NA																	0				ovary(1)	1						c.(1186-1188)CAG>CAA		transmembrane 7 superfamily member 2							43.0	49.0	47.0					11																	64883456		2090	4203	6293	SO:0001819	synonymous_variant	7108				cholesterol biosynthetic process	endoplasmic reticulum membrane|integral to plasma membrane	delta14-sterol reductase activity	g.chr11:64883456G>A	BC012857	CCDS41669.1, CCDS60846.1	11q13.1	2013-05-23			ENSG00000149809	ENSG00000149809	1.3.1.70		11863	protein-coding gene	gene with protein product	"""delta(14)-sterol reductase"""	603414				9615229, 9286704	Standard	NM_003273		Approved	ANG1, DHCR14A, NET47	uc001oct.4	O76062	OTTHUMG00000165603	ENST00000279263.7:c.1188G>A	11.37:g.64883456G>A			Somatic				TM7SF2_uc010rny.1_Silent_p.Q280Q|TM7SF2_uc001ocu.2_Silent_p.Q369Q|TM7SF2_uc001ocv.2_Silent_p.Q417Q|uc009yqb.1_5'Flank	p.Q396Q	NM_003273	NP_003264	WXS	Illumina HiSeq	Unspecified	O76062	ERG24_HUMAN			10	1335	+			396					A8K4H0|O95982|Q8IY06|Q96E64|Q96GZ1	Silent	SNP	ENST00000279263.7	37	c.1188G>A	CCDS41669.1																																																																																				0.632	TM7SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385234.1	NM_003273		21	32	0	0	0	0	21	32				
RAB1B	81876	broad.mit.edu	37	11	66039643	66039643	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr11:66039643G>C	ENST00000311481.6	+	3	250	c.103G>C	c.(103-105)Gag>Cag	p.E35Q	RAB1B_ENST00000527397.1_Missense_Mutation_p.E35Q|RP11-867G23.3_ENST00000501708.1_lincRNA	NM_030981.2	NP_112243.1	Q9H0U4	RAB1B_HUMAN	RAB1B, member RAS oncogene family	35					ER to Golgi vesicle-mediated transport (GO:0006888)|positive regulation of glycoprotein metabolic process (GO:1903020)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|virion assembly (GO:0019068)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)			large_intestine(2)|lung(1)|ovary(1)|prostate(1)	5						CACGTACACAGAGAGCTACAT	0.527																																						uc001ohf.2		NA																	0					0						c.(103-105)GAG>CAG		RAB1B, member RAS oncogene family							220.0	211.0	214.0					11																	66039643		2200	4295	6495	SO:0001583	missense	81876				protein transport|small GTPase mediated signal transduction	Golgi apparatus|membrane	GTP binding|protein binding	g.chr11:66039643G>C	AJ245875	CCDS31613.1	11q13.1	2008-02-05			ENSG00000174903	ENSG00000174903		"""RAB, member RAS oncogene"""	18370	protein-coding gene	gene with protein product		612565				9030196	Standard	NM_030981		Approved		uc001ohf.3	Q9H0U4	OTTHUMG00000166916	ENST00000311481.6:c.103G>C	11.37:g.66039643G>C	ENSP00000310226:p.Glu35Gln		Somatic				uc001ohg.1_RNA	p.E35Q	NM_030981	NP_112243	WXS	Illumina HiSeq	Unspecified	Q9H0U4	RAB1B_HUMAN			3	198	+			35					A8K7S1	Missense_Mutation	SNP	ENST00000311481.6	37	c.103G>C	CCDS31613.1	.	.	.	.	.	.	.	.	.	.	G	17.43	3.388162	0.61956	.	.	ENSG00000174903	ENST00000311481;ENST00000527397;ENST00000314965;ENST00000394080	T;T	0.78481	-1.18;-1.18	3.99	3.99	0.46301	Small GTP-binding protein domain (1);	0.000000	0.64402	D	0.000001	T	0.72637	0.3485	L	0.49350	1.555	0.80722	D	1	B	0.17268	0.021	B	0.21360	0.034	T	0.72656	-0.4227	10	0.56958	D	0.05	.	13.6096	0.62068	0.0:0.0:1.0:0.0	.	35	Q9H0U4	RAB1B_HUMAN	Q	35	ENSP00000310226:E35Q;ENSP00000435195:E35Q	ENSP00000310226:E35Q	E	+	1	0	RAB1B	65796219	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.691000	0.84191	2.067000	0.61834	0.561000	0.74099	GAG		0.527	RAB1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391886.2	NM_030981		74	150	0	0	0	0	74	150				
TCIRG1	10312	broad.mit.edu	37	11	67816400	67816400	+	Missense_Mutation	SNP	A	A	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr11:67816400A>T	ENST00000265686.3	+	14	1717	c.1609A>T	c.(1609-1611)Atg>Ttg	p.M537L	RP11-802E16.3_ENST00000529934.1_RNA|TCIRG1_ENST00000532635.1_Missense_Mutation_p.M321L	NM_006019.3	NP_006010.2	Q13488	VPP3_HUMAN	T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3	537					ATP hydrolysis coupled proton transport (GO:0015991)|cellular defense response (GO:0006968)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of cell proliferation (GO:0008284)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	hydrogen ion transmembrane transporter activity (GO:0015078)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|large_intestine(3)|lung(4)|ovary(3)|prostate(1)	16						CAAGATGAAGATGTCCGTCAT	0.632																																						uc001one.2		NA																	0				ovary(1)	1						c.(1609-1611)ATG>TTG		T-cell, immune regulator 1 isoform a							165.0	151.0	156.0					11																	67816400		2200	4294	6494	SO:0001583	missense	10312				ATP hydrolysis coupled proton transport|cellular defense response|cellular iron ion homeostasis|insulin receptor signaling pathway|positive regulation of cell proliferation|transferrin transport	apical plasma membrane|endosome membrane|integral to plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	hydrogen ion transmembrane transporter activity	g.chr11:67816400A>T	AF025374	CCDS8177.1, CCDS53670.1	11q13.2	2014-09-17	2006-01-20		ENSG00000110719	ENSG00000110719		"""ATPases / V-type"""	11647	protein-coding gene	gene with protein product	"""T-cell immune response cDNA 7"""	604592	"""T-cell, immune regulator 1"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein a isoform 3"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3"""			8579597, 9806637	Standard	NM_006019		Approved	TIRC7, OC-116, OC116, ATP6N1C, Atp6i, a3, ATP6V0A3	uc001one.3	Q13488	OTTHUMG00000167358	ENST00000265686.3:c.1609A>T	11.37:g.67816400A>T	ENSP00000265686:p.Met537Leu		Somatic				TCIRG1_uc001ong.2_Missense_Mutation_p.M321L|TCIRG1_uc001onh.2_Missense_Mutation_p.M239L|TCIRG1_uc001oni.2_Missense_Mutation_p.M41L|TCIRG1_uc009ysd.2_5'Flank	p.M537L	NM_006019	NP_006010	WXS	Illumina HiSeq	Unspecified	Q13488	VPP3_HUMAN			14	1717	+			537			Lumenal (Potential).		O75877|Q8WVC5	Missense_Mutation	SNP	ENST00000265686.3	37	c.1609A>T	CCDS8177.1	.	.	.	.	.	.	.	.	.	.	A	11.06	1.526867	0.27299	.	.	ENSG00000110719	ENST00000265686;ENST00000532635	D;D	0.84370	-1.84;-1.84	4.28	4.28	0.50868	.	0.000000	0.85682	D	0.000000	D	0.86456	0.5937	L	0.37750	1.13	0.80722	D	1	D	0.71674	0.998	D	0.87578	0.998	T	0.82350	-0.0501	10	0.13470	T	0.59	-48.4598	12.3932	0.55370	1.0:0.0:0.0:0.0	.	537	Q13488	VPP3_HUMAN	L	537;321	ENSP00000265686:M537L;ENSP00000434407:M321L	ENSP00000265686:M537L	M	+	1	0	TCIRG1	67572976	1.000000	0.71417	1.000000	0.80357	0.219000	0.24729	9.047000	0.93823	1.785000	0.52413	0.528000	0.53228	ATG		0.632	TCIRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394305.1	NM_006019		62	86	0	0	0	0	62	86				
NAALAD2	10003	broad.mit.edu	37	11	89902099	89902099	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr11:89902099G>C	ENST00000534061.1	+	12	1511	c.1281G>C	c.(1279-1281)gaG>gaC	p.E427D	NAALAD2_ENST00000321955.4_Missense_Mutation_p.E394D|NAALAD2_ENST00000375944.3_Intron	NM_005467.3	NP_005458.1	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	427	NAALADase.				neurotransmitter catabolic process (GO:0042135)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|N-formylglutamate deformylase activity (GO:0050129)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(32)|pancreas(1)|prostate(3)|skin(5)|stomach(2)	59		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				AACTACAGGAGAATGTCAAAA	0.303																																						uc001pdf.3		NA																	0				pancreas(1)|skin(1)	2						c.(1279-1281)GAG>GAC		N-acetylated alpha-linked acidic dipeptidase 2							55.0	59.0	58.0					11																	89902099		2201	4293	6494	SO:0001583	missense	10003				proteolysis	integral to membrane	carboxypeptidase activity|dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metallopeptidase activity|serine-type peptidase activity	g.chr11:89902099G>C	AJ012370	CCDS8288.1, CCDS73364.1	11q14.3-q21	2011-08-16			ENSG00000077616	ENSG00000077616	3.4.17.21		14526	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase III"""	611636				10085079	Standard	NM_005467		Approved	NAALADASE2, NAADALASE2, GPCIII	uc001pdf.4	Q9Y3Q0	OTTHUMG00000166368	ENST00000534061.1:c.1281G>C	11.37:g.89902099G>C	ENSP00000432481:p.Glu427Asp		Somatic				NAALAD2_uc009yvx.2_Missense_Mutation_p.E394D|NAALAD2_uc009yvy.2_Intron	p.E427D	NM_005467	NP_005458	WXS	Illumina HiSeq	Unspecified	Q9Y3Q0	NALD2_HUMAN			12	1390	+		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)	427			Extracellular (Potential).|NAALADase.		B3KQR4|Q4KKV4|Q4VAM9	Missense_Mutation	SNP	ENST00000534061.1	37	c.1281G>C	CCDS8288.1	.	.	.	.	.	.	.	.	.	.	G	11.35	1.611746	0.28712	.	.	ENSG00000077616	ENST00000534061;ENST00000321955	T;T	0.39406	1.08;1.08	5.75	1.51	0.23008	Peptidase M28 (1);	0.143295	0.47455	N	0.000223	T	0.25269	0.0614	L	0.28608	0.87	0.80722	D	1	B	0.22851	0.076	B	0.25291	0.059	T	0.05053	-1.0909	9	.	.	.	-17.7676	5.5118	0.16884	0.4221:0.1358:0.4421:0.0	.	427	Q9Y3Q0	NALD2_HUMAN	D	427;394	ENSP00000432481:E427D;ENSP00000320083:E394D	.	E	+	3	2	NAALAD2	89541747	0.868000	0.29978	0.998000	0.56505	0.631000	0.37964	-0.075000	0.11431	0.020000	0.15106	0.650000	0.86243	GAG		0.303	NAALAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389424.2	NM_005467		12	42	0	0	0	0	12	42				
CNTN5	53942	broad.mit.edu	37	11	100211833	100211833	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr11:100211833C>G	ENST00000524871.1	+	23	3216	c.2926C>G	c.(2926-2928)Caa>Gaa	p.Q976E	CNTN5_ENST00000279463.3_Missense_Mutation_p.Q976E|CNTN5_ENST00000524560.1_3'UTR|CNTN5_ENST00000528682.1_Missense_Mutation_p.Q976E|CNTN5_ENST00000418526.2_Missense_Mutation_p.Q902E	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	976					cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		AGCTCCTAGTCAAGCACCTAG	0.428																																						uc001pga.2		NA																	0				skin(3)|ovary(2)|pancreas(2)|breast(1)	8						c.(2926-2928)CAA>GAA		contactin 5 isoform long							113.0	109.0	110.0					11																	100211833		1849	4099	5948	SO:0001583	missense	53942				cell adhesion	anchored to membrane|plasma membrane	protein binding	g.chr11:100211833C>G	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.2926C>G	11.37:g.100211833C>G	ENSP00000435637:p.Gln976Glu		Somatic				CNTN5_uc001pgb.2_Missense_Mutation_p.Q902E|CNTN5_uc010ruk.1_Missense_Mutation_p.Q247E	p.Q976E	NM_014361	NP_055176	WXS	Illumina HiSeq	Unspecified	O94779	CNTN5_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)	23	3265	+		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)	976			Fibronectin type-III 4.		A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Missense_Mutation	SNP	ENST00000524871.1	37	c.2926C>G	CCDS53696.1	.	.	.	.	.	.	.	.	.	.	C	8.063	0.768579	0.15983	.	.	ENSG00000149972	ENST00000528682;ENST00000524871;ENST00000418526;ENST00000279463	T;T;T;T	0.51817	0.69;0.69;0.69;0.69	5.46	4.52	0.55395	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.112996	0.64402	N	0.000009	T	0.48926	0.1527	M	0.75615	2.305	0.46376	D	0.999011	B;B	0.06786	0.001;0.001	B;B	0.09377	0.003;0.004	T	0.45279	-0.9272	9	.	.	.	.	15.0469	0.71835	0.0:0.8573:0.1427:0.0	.	902;976	O94779-2;O94779	.;CNTN5_HUMAN	E	976;976;902;976	ENSP00000436185:Q976E;ENSP00000435637:Q976E;ENSP00000393229:Q902E;ENSP00000279463:Q976E	.	Q	+	1	0	CNTN5	99717043	1.000000	0.71417	0.861000	0.33841	0.026000	0.11368	4.386000	0.59620	1.251000	0.43983	0.655000	0.94253	CAA		0.428	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361		4	110	0	0	0	0	4	110				
DYNC2H1	79659	broad.mit.edu	37	11	102993566	102993566	+	Missense_Mutation	SNP	A	A	C			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr11:102993566A>C	ENST00000375735.2	+	11	1642	c.1498A>C	c.(1498-1500)Atc>Ctc	p.I500L	DYNC2H1_ENST00000334267.7_Missense_Mutation_p.I500L|DYNC2H1_ENST00000398093.3_Missense_Mutation_p.I500L	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	500	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		AGATGATACTATCAAGATTGC	0.358																																						uc001pho.2		NA																	0					0						c.(1498-1500)ATC>CTC		dynein, cytoplasmic 2, heavy chain 1							83.0	74.0	77.0					11																	102993566		1822	4072	5894	SO:0001583	missense	79659				cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity	g.chr11:102993566A>C	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.1498A>C	11.37:g.102993566A>C	ENSP00000364887:p.Ile500Leu		Somatic				DYNC2H1_uc001phn.1_Missense_Mutation_p.I500L|DYNC2H1_uc009yxe.1_Missense_Mutation_p.I500L	p.I500L	NM_001080463	NP_001073932	WXS	Illumina HiSeq	Unspecified	Q8NCM8	DYHC2_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)	11	1642	+		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)	500			Stem (By similarity).		O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	37	c.1498A>C	CCDS53701.1	.	.	.	.	.	.	.	.	.	.	A	7.833	0.720281	0.15372	.	.	ENSG00000187240	ENST00000375735;ENST00000334267;ENST00000398093	T;T;T	0.54071	0.59;0.59;0.59	5.23	1.42	0.22433	Dynein heavy chain, domain-1 (1);	0.421582	0.14669	U	0.305455	T	0.30541	0.0768	N	0.16307	0.4	0.36158	D	0.847933	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.001;0.003;0.001	T	0.18366	-1.0339	10	0.13853	T	0.58	.	8.1005	0.30854	0.5326:0.3993:0.0681:0.0	.	500;500;500	Q8NCM8-3;Q8NCM8;Q8NCM8-2	.;DYHC2_HUMAN;.	L	500	ENSP00000364887:I500L;ENSP00000334021:I500L;ENSP00000381167:I500L	ENSP00000334021:I500L	I	+	1	0	DYNC2H1	102498776	0.422000	0.25473	0.933000	0.37362	0.779000	0.44077	0.880000	0.28159	0.036000	0.15547	-0.299000	0.09455	ATC		0.358	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652		15	25	0	0	0	0	15	25				
BSX	390259	broad.mit.edu	37	11	122850009	122850009	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr11:122850009C>T	ENST00000343035.2	-	2	467	c.419G>A	c.(418-420)cGa>cAa	p.R140Q		NM_001098169.1	NP_001091639.1	Q3C1V8	BSH_HUMAN	brain-specific homeobox	140					eating behavior (GO:0042755)|locomotory behavior (GO:0007626)|mammary gland involution (GO:0060056)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(2)	10		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0361)		CAGCTCCACTCGTTCTGGCGT	0.637																																						uc010rzs.1		NA																	0					0						c.(418-420)CGA>CAA		brain specific homeobox							63.0	74.0	70.0					11																	122850009		2079	4206	6285	SO:0001583	missense	390259							g.chr11:122850009C>T		CCDS41728.1	11q24.1	2011-07-19			ENSG00000188909	ENSG00000188909		"""Homeoboxes / ANTP class : NKL subclass"""	20450	protein-coding gene	gene with protein product		611074					Standard	NM_001098169		Approved	BSX1	uc010rzs.2	Q3C1V8	OTTHUMG00000150247	ENST00000343035.2:c.419G>A	11.37:g.122850009C>T	ENSP00000344285:p.Arg140Gln		Somatic					p.R140Q	NM_001098169	NP_001091639	WXS	Illumina HiSeq	Unspecified	Q3C1V8	BSH_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0361)	2	419	-		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	140			Homeobox.			Missense_Mutation	SNP	ENST00000343035.2	37	c.419G>A	CCDS41728.1	.	.	.	.	.	.	.	.	.	.	C	36	5.858733	0.97036	.	.	ENSG00000188909	ENST00000343035	D	0.97455	-4.39	5.22	5.22	0.72569	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.110668	0.64402	D	0.000019	D	0.98994	0.9657	H	0.95712	3.71	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99505	1.0954	10	0.87932	D	0	.	18.7806	0.91930	0.0:1.0:0.0:0.0	.	140	Q3C1V8	BSH_HUMAN	Q	140	ENSP00000344285:R140Q	ENSP00000344285:R140Q	R	-	2	0	BSX	122355219	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.680000	0.84062	2.454000	0.82982	0.655000	0.94253	CGA		0.637	BSX-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317076.1	NM_001098169		42	97	0	0	0	0	42	97				
FGF23	8074	broad.mit.edu	37	12	4479837	4479837	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr12:4479837C>G	ENST00000237837.1	-	3	573	c.428G>C	c.(427-429)aGa>aCa	p.R143T		NM_020638.2	NP_065689.1	Q9GZV9	FGF23_HUMAN	fibroblast growth factor 23	143					cell differentiation (GO:0030154)|cellular phosphate ion homeostasis (GO:0030643)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of bone mineralization (GO:0030502)|negative regulation of hormone secretion (GO:0046888)|negative regulation of osteoblast differentiation (GO:0045668)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphate ion homeostasis (GO:0055062)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vitamin D 24-hydroxylase activity (GO:0010980)|regulation of phosphate transport (GO:0010966)|vitamin D catabolic process (GO:0042369)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	22			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)|STAD - Stomach adenocarcinoma(119;0.206)			CAGGAAGGCTCTCTTCGCCCG	0.597																																						uc001qmq.1		NA																	0				ovary(2)|breast(1)|skin(1)	4						c.(427-429)AGA>ACA		fibroblast growth factor 23 precursor							94.0	94.0	94.0					12																	4479837		2203	4300	6503	SO:0001583	missense	8074				cell differentiation|insulin receptor signaling pathway|negative regulation of bone mineralization|negative regulation of hormone secretion|negative regulation of osteoblast differentiation|positive regulation of vitamin D 24-hydroxylase activity|regulation of phosphate transport|vitamin D catabolic process	extracellular space	growth factor activity	g.chr12:4479837C>G	AF263537	CCDS8526.1	12p13	2008-07-04			ENSG00000118972	ENSG00000118972			3680	protein-coding gene	gene with protein product		605380				11032749, 18310961	Standard	NM_020638		Approved		uc001qmq.1	Q9GZV9	OTTHUMG00000168241	ENST00000237837.1:c.428G>C	12.37:g.4479837C>G	ENSP00000237837:p.Arg143Thr		Somatic					p.R143T	NM_020638	NP_065689	WXS	Illumina HiSeq	Unspecified	Q9GZV9	FGF23_HUMAN	Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)|STAD - Stomach adenocarcinoma(119;0.206)		3	574	-			143					Q4V758	Missense_Mutation	SNP	ENST00000237837.1	37	c.428G>C	CCDS8526.1	.	.	.	.	.	.	.	.	.	.	C	6.960	0.547071	0.13312	.	.	ENSG00000118972	ENST00000237837	D	0.86432	-2.12	4.88	3.06	0.35304	.	0.231257	0.41605	D	0.000849	D	0.83760	0.5324	M	0.75615	2.305	0.09310	N	1	B	0.31485	0.325	B	0.29862	0.108	T	0.76729	-0.2852	10	0.66056	D	0.02	-17.938	6.0446	0.19752	0.0:0.5749:0.0:0.4251	.	143	Q9GZV9	FGF23_HUMAN	T	143	ENSP00000237837:R143T	ENSP00000237837:R143T	R	-	2	0	FGF23	4350098	0.019000	0.18553	0.282000	0.24776	0.019000	0.09904	0.734000	0.26101	0.653000	0.30826	0.549000	0.68633	AGA		0.597	FGF23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398936.1			68	110	0	0	0	0	68	110				
GDF3	9573	broad.mit.edu	37	12	7842556	7842556	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr12:7842556G>A	ENST00000329913.3	-	2	1060	c.1013C>T	c.(1012-1014)tCc>tTc	p.S338F		NM_020634.1	NP_065685.1	Q9NR23	GDF3_HUMAN	growth differentiation factor 3	338					endoderm development (GO:0007492)|eye development (GO:0001654)|formation of anatomical boundary (GO:0048859)|growth (GO:0040007)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of epidermal cell differentiation (GO:0045605)|notochord development (GO:0030903)|primitive streak formation (GO:0090009)|regulation of cell fate commitment (GO:0010453)|response to dietary excess (GO:0002021)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	28						GTAGAGCATGGAAATGGGAGA	0.478																																						uc001qte.2		NA																	0				skin(3)|ovary(1)|lung(1)|central_nervous_system(1)	6						c.(1012-1014)TCC>TTC		growth differentiation factor 3 precursor							110.0	100.0	104.0					12																	7842556		2203	4300	6503	SO:0001583	missense	9573				eye development|growth|skeletal system development	extracellular space	cytokine activity|growth factor activity	g.chr12:7842556G>A	AF263538	CCDS8581.1	12p13.1	2014-01-30			ENSG00000184344	ENSG00000184344		"""Endogenous ligands"""	4218	protein-coding gene	gene with protein product		606522				9467948	Standard	NM_020634		Approved		uc001qte.3	Q9NR23	OTTHUMG00000168433	ENST00000329913.3:c.1013C>T	12.37:g.7842556G>A	ENSP00000331745:p.Ser338Phe		Somatic					p.S338F	NM_020634	NP_065685	WXS	Illumina HiSeq	Unspecified	Q9NR23	GDF3_HUMAN			2	1049	-			338					Q8NEJ4	Missense_Mutation	SNP	ENST00000329913.3	37	c.1013C>T	CCDS8581.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.963172	0.74016	.	.	ENSG00000184344	ENST00000329913	T	0.78924	-1.22	3.95	3.95	0.45737	Transforming growth factor-beta, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.91821	0.7412	H	0.97516	4.02	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94453	0.7669	10	0.87932	D	0	.	14.3125	0.66424	0.0:0.0:1.0:0.0	.	338	Q9NR23	GDF3_HUMAN	F	338	ENSP00000331745:S338F	ENSP00000331745:S338F	S	-	2	0	GDF3	7733823	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	8.717000	0.91425	2.148000	0.66965	0.561000	0.74099	TCC		0.478	GDF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399717.1			30	59	0	0	0	0	30	59				
TMPRSS12	283471	broad.mit.edu	37	12	51281127	51281127	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr12:51281127G>A	ENST00000398458.3	+	5	910	c.878G>A	c.(877-879)gGc>gAc	p.G293D	TMPRSS12_ENST00000551456.1_3'UTR	NM_182559.2	NP_872365	Q86WS5	TMPSC_HUMAN	transmembrane (C-terminal) protease, serine 12	293	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	18						TACGGACATGGCTGTGGTCGA	0.433																																						uc001rwx.3		NA																	0					0						c.(877-879)GGC>GAC		transmembrane protease, serine 12 precursor							135.0	135.0	135.0					12																	51281127		1878	4105	5983	SO:0001583	missense	283471				proteolysis	integral to membrane	serine-type endopeptidase activity	g.chr12:51281127G>A	BC048112	CCDS44881.1	12q13.12	2014-08-12	2010-04-21		ENSG00000186452	ENSG00000186452		"""Serine peptidases / Transmembrane"""	28779	protein-coding gene	gene with protein product			"""transmembrane protease, serine 12"""				Standard	NM_182559		Approved	MGC57341, CT151	uc001rwx.4	Q86WS5	OTTHUMG00000169483	ENST00000398458.3:c.878G>A	12.37:g.51281127G>A	ENSP00000381476:p.Gly293Asp		Somatic				TMPRSS12_uc001rwy.2_3'UTR	p.G293D	NM_182559	NP_872365	WXS	Illumina HiSeq	Unspecified	Q86WS5	TMPSC_HUMAN			5	925	+			293			Peptidase S1.|Extracellular (Potential).		B9ZVX2	Missense_Mutation	SNP	ENST00000398458.3	37	c.878G>A	CCDS44881.1	.	.	.	.	.	.	.	.	.	.	G	17.12	3.307480	0.60305	.	.	ENSG00000186452	ENST00000398458	T	0.58940	0.3	5.27	5.27	0.74061	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.52532	D	0.000071	T	0.69369	0.3103	L	0.47190	1.495	0.45250	D	0.998253	D	0.89917	1.0	D	0.79108	0.992	T	0.70842	-0.4762	10	0.59425	D	0.04	-12.7935	14.3966	0.67015	0.0:0.0:1.0:0.0	.	293	Q86WS5	TMPSC_HUMAN	D	293	ENSP00000381476:G293D	ENSP00000381476:G293D	G	+	2	0	TMPRSS12	49567394	1.000000	0.71417	0.996000	0.52242	0.334000	0.28698	4.945000	0.63568	2.454000	0.82982	0.467000	0.42956	GGC		0.433	TMPRSS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404289.1	NM_182559		53	73	0	0	0	0	53	73				
KRT76	51350	broad.mit.edu	37	12	53164843	53164843	+	Missense_Mutation	SNP	T	T	G			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr12:53164843T>G	ENST00000332411.2	-	7	1477	c.1424A>C	c.(1423-1425)aAg>aCg	p.K475T		NM_015848.4	NP_056932.2	Q01546	K22O_HUMAN	keratin 76	475	Coil 2.|Rod.				cytoskeleton organization (GO:0007010)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						CAGGGCCAGCTTGACGTTCAT	0.572																																						uc001sax.2		NA																	0				breast(1)|skin(1)	2						c.(1423-1425)AAG>ACG		keratin 76							126.0	116.0	119.0					12																	53164843		2203	4300	6503	SO:0001583	missense	51350				cytoskeleton organization	keratin filament	structural molecule activity	g.chr12:53164843T>G	M99063	CCDS8838.1	12q13.13	2013-06-25			ENSG00000185069	ENSG00000185069		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24430	protein-coding gene	gene with protein product						1282112, 16831889	Standard	NM_015848		Approved	HUMCYT2A, KRT2B, KRT2P	uc001sax.3	Q01546	OTTHUMG00000169797	ENST00000332411.2:c.1424A>C	12.37:g.53164843T>G	ENSP00000330101:p.Lys475Thr		Somatic					p.K475T	NM_015848	NP_056932	WXS	Illumina HiSeq	Unspecified	Q01546	K22O_HUMAN			7	1478	-			475			Rod.|Coil 2.		B4DRR3|Q7Z795	Missense_Mutation	SNP	ENST00000332411.2	37	c.1424A>C	CCDS8838.1	.	.	.	.	.	.	.	.	.	.	T	26.2	4.713810	0.89112	.	.	ENSG00000185069	ENST00000332411	D	0.94862	-3.54	5.13	5.13	0.70059	Filament (1);	0.000000	0.48767	D	0.000171	D	0.98153	0.9390	H	0.96365	3.81	0.58432	D	0.999996	D	0.89917	1.0	D	0.91635	0.999	D	0.99585	1.0974	10	0.87932	D	0	.	15.6444	0.77036	0.0:0.0:0.0:1.0	.	475	Q01546	K22O_HUMAN	T	475	ENSP00000330101:K475T	ENSP00000330101:K475T	K	-	2	0	KRT76	51451110	1.000000	0.71417	0.995000	0.50966	0.960000	0.62799	5.182000	0.65059	2.234000	0.73211	0.533000	0.62120	AAG		0.572	KRT76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405928.1	NM_015848		9	116	0	0	0	0	9	116				
OR6C75	390323	broad.mit.edu	37	12	55759093	55759093	+	Silent	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr12:55759093C>T	ENST00000343399.3	+	1	199	c.199C>T	c.(199-201)Ctg>Ttg	p.L67L		NM_001005497.1	NP_001005497.1	A6NL08	O6C75_HUMAN	olfactory receptor, family 6, subfamily C, member 75	67						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(5)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)	25						CTTCTCATTCCTGGAAATTTC	0.443																																						uc010spk.1		NA																	0				ovary(2)|large_intestine(1)	3						c.(199-201)CTG>TTG		olfactory receptor, family 6, subfamily C,							139.0	136.0	137.0					12																	55759093		2203	4300	6503	SO:0001819	synonymous_variant	390323				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr12:55759093C>T		CCDS31820.1	12q13.2	2013-09-23			ENSG00000187857	ENSG00000187857		"""GPCR / Class A : Olfactory receptors"""	31304	protein-coding gene	gene with protein product							Standard	NM_001005497		Approved		uc010spk.2	A6NL08	OTTHUMG00000169886	ENST00000343399.3:c.199C>T	12.37:g.55759093C>T			Somatic					p.L67L	NM_001005497	NP_001005497	WXS	Illumina HiSeq	Unspecified	A6NL08	O6C75_HUMAN			1	199	+			67			Helical; Name=2; (Potential).			Silent	SNP	ENST00000343399.3	37	c.199C>T	CCDS31820.1																																																																																				0.443	OR6C75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406418.1			81	119	0	0	0	0	81	119				
LRP1	4035	broad.mit.edu	37	12	57594938	57594938	+	Splice_Site	SNP	T	T	C	rs111522273		TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr12:57594938T>C	ENST00000243077.3	+	65	10811		c.e65+2			NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1						aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GGGACTGCCGTGAGTGTCAGA	0.567																																						uc001snd.2		NA																	0				ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22						c.e65+2		low density lipoprotein-related protein 1	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)						169.0	148.0	155.0					12																	57594938		2203	4300	6503	SO:0001630	splice_region_variant	4035				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity	g.chr12:57594938T>C	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.10345+2T>C	12.37:g.57594938T>C			Somatic					p.P3449_splice	NM_002332	NP_002323	WXS	Illumina HiSeq	Unspecified	Q07954	LRP1_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.0103)	65	10811	+								Q2PP12|Q86SW0|Q8IVG8	Splice_Site	SNP	ENST00000243077.3	37	c.10345_splice	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	T	17.91	3.503672	0.64298	.	.	ENSG00000123384	ENST00000243077;ENST00000555124	.	.	.	5.38	5.38	0.77491	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5525	0.68078	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	LRP1	55881205	1.000000	0.71417	1.000000	0.80357	0.673000	0.39480	7.771000	0.85420	2.276000	0.75962	0.454000	0.30748	.		0.567	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	Intron	45	84	0	0	0	0	45	84				
HELB	92797	broad.mit.edu	37	12	66725387	66725387	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr12:66725387G>C	ENST00000247815.4	+	12	3183	c.3124G>C	c.(3124-3126)Ggt>Cgt	p.G1042R		NM_033647.3	NP_387467.2	Q8NG08	HELB_HUMAN	helicase (DNA) B	1042					DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication, synthesis of RNA primer (GO:0006269)		ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|single-stranded DNA-dependent ATP-dependent DNA helicase activity (GO:0017116)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(15)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	40			GBM - Glioblastoma multiforme(2;0.000142)	GBM - Glioblastoma multiforme(28;0.0265)		AAGAACCTGTGGTGTGAATGA	0.388																																						uc001sti.2		NA																	0				central_nervous_system(1)|pancreas(1)	2						c.(3124-3126)GGT>CGT		helicase (DNA) B							81.0	82.0	82.0					12																	66725387		2202	4300	6502	SO:0001583	missense	92797				DNA replication, synthesis of RNA primer		ATP binding|ATP-dependent 5'-3' DNA helicase activity|single-stranded DNA-dependent ATP-dependent DNA helicase activity	g.chr12:66725387G>C	AF319995	CCDS8976.1	12q14.2	2009-01-15			ENSG00000127311	ENSG00000127311			17196	protein-coding gene	gene with protein product		614539				12181327	Standard	NM_033647		Approved		uc001sti.3	Q8NG08	OTTHUMG00000169006	ENST00000247815.4:c.3124G>C	12.37:g.66725387G>C	ENSP00000247815:p.Gly1042Arg		Somatic				HELB_uc010ssz.1_RNA|HELB_uc009zqt.1_RNA	p.G1042R	NM_033647	NP_387467	WXS	Illumina HiSeq	Unspecified	Q8NG08	HELB_HUMAN	GBM - Glioblastoma multiforme(2;0.000142)	GBM - Glioblastoma multiforme(28;0.0265)	12	3152	+			1042					A8K4C9|Q4G0T2|Q9H7L5	Missense_Mutation	SNP	ENST00000247815.4	37	c.3124G>C	CCDS8976.1	.	.	.	.	.	.	.	.	.	.	G	11.63	1.694848	0.30052	.	.	ENSG00000127311	ENST00000247815	T	0.13657	2.57	4.97	-0.248	0.13015	.	1.133400	0.06618	N	0.756893	T	0.09158	0.0226	L	0.44542	1.39	0.09310	N	1	P	0.37015	0.578	B	0.30782	0.12	T	0.32428	-0.9907	9	.	.	.	-0.4324	1.6239	0.02719	0.1759:0.1425:0.468:0.2136	.	1042	Q8NG08	HELB_HUMAN	R	1042	ENSP00000247815:G1042R	.	G	+	1	0	HELB	65011654	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.045000	0.14013	0.281000	0.22233	0.655000	0.94253	GGT		0.388	HELB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401919.1			5	160	0	0	0	0	5	160				
IL22	50616	broad.mit.edu	37	12	68645319	68645319	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr12:68645319G>T	ENST00000538666.1	-	5	506	c.436C>A	c.(436-438)Caa>Aaa	p.Q146K	IL22_ENST00000328087.4_Missense_Mutation_p.Q146K			Q9GZX6	IL22_HUMAN	interleukin 22	146					acute-phase response (GO:0006953)|cell-cell signaling (GO:0007267)|inflammatory response (GO:0006954)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	interleukin-22 receptor binding (GO:0045518)			breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)	14		Myeloproliferative disorder(1001;0.0255)	Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;5.06e-05)|BRCA - Breast invasive adenocarcinoma(357;0.00104)		TTCAGCTTTTGCACATTCCTC	0.363																																						uc001sty.1		NA																	0					0						c.(436-438)CAA>AAA		interleukin 22 precursor							292.0	234.0	254.0					12																	68645319		2203	4300	6503	SO:0001583	missense	50616				acute-phase response	extracellular space	cytokine activity|interleukin-22 receptor binding	g.chr12:68645319G>T	AF279437	CCDS8982.1	12q15	2014-05-22			ENSG00000127318	ENSG00000127318		"""Interleukins and interleukin receptors"""	14900	protein-coding gene	gene with protein product	"""IL-10-related T-cell-derived inducible factor"""	605330				10954742, 10875937	Standard	NM_020525		Approved	ILTIF, IL-21, zcyto18, IL-TIF, IL-D110, TIFa, TIFIL-23, IL-22, MGC79382, MGC79384	uc001sty.1	Q9GZX6	OTTHUMG00000169119	ENST00000538666.1:c.436C>A	12.37:g.68645319G>T	ENSP00000442424:p.Gln146Lys		Somatic				IL22_uc010stb.1_Missense_Mutation_p.Q146K	p.Q146K	NM_020525	NP_065386	WXS	Illumina HiSeq	Unspecified	Q9GZX6	IL22_HUMAN	Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;5.06e-05)|BRCA - Breast invasive adenocarcinoma(357;0.00104)	4	489	-		Myeloproliferative disorder(1001;0.0255)	146						Missense_Mutation	SNP	ENST00000538666.1	37	c.436C>A	CCDS8982.1	.	.	.	.	.	.	.	.	.	.	G	4.905	0.168228	0.09339	.	.	ENSG00000127318	ENST00000538666;ENST00000328087	T;T	0.45276	0.9;0.9	4.6	2.67	0.31697	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.965104	0.08586	N	0.923736	T	0.37019	0.0988	L	0.54323	1.7	0.09310	N	1	B	0.27853	0.191	B	0.20767	0.031	T	0.22347	-1.0219	9	.	.	.	-0.0064	9.5164	0.39109	0.0:0.0:0.5993:0.4007	.	146	Q9GZX6	IL22_HUMAN	K	146	ENSP00000442424:Q146K;ENSP00000329384:Q146K	.	Q	-	1	0	IL22	66931586	0.009000	0.17119	0.004000	0.12327	0.649000	0.38597	0.567000	0.23608	0.783000	0.33636	0.655000	0.94253	CAA		0.363	IL22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402318.1	NM_020525		23	134	1	0	3.74e-20	4.95e-20	23	134				
MDM1	56890	broad.mit.edu	37	12	68719244	68719244	+	Missense_Mutation	SNP	C	C	A	rs138314442		TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr12:68719244C>A	ENST00000303145.7	-	4	696	c.610G>T	c.(610-612)Gct>Tct	p.A204S	MDM1_ENST00000393543.3_3'UTR|MDM1_ENST00000545724.1_5'UTR|MDM1_ENST00000411698.2_Intron|MDM1_ENST00000540418.1_5'UTR|MDM1_ENST00000430606.2_3'UTR	NM_017440.4	NP_059136.2	Q8TC05	MDM1_HUMAN	Mdm1 nuclear protein homolog (mouse)	204					retina development in camera-type eye (GO:0060041)	nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(7)	33			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000174)		AAAGCTGGAGCAGTTTCTTTA	0.348																																						uc001stz.2		NA																	0				ovary(3)|skin(2)	5						c.(610-612)GCT>TCT		mouse Mdm1 nuclear protein homolog isoform 1							126.0	138.0	134.0					12																	68719244		2203	4300	6503	SO:0001583	missense	56890					nucleus		g.chr12:68719244C>A	AF007130	CCDS8983.1, CCDS44938.1, CCDS55841.1, CCDS55842.1	12q15	2008-04-14	2008-04-14			ENSG00000111554			29917	protein-coding gene	gene with protein product		613813	"""Mdm4, transformed 3T3 cell double minute 1, p53 binding protein (mouse)"""			8619474, 9110174	Standard	NM_017440		Approved		uc001stz.2	Q8TC05		ENST00000303145.7:c.610G>T	12.37:g.68719244C>A	ENSP00000302537:p.Ala204Ser		Somatic				MDM1_uc010stc.1_Intron|MDM1_uc009zqv.1_5'UTR|MDM1_uc001sua.3_3'UTR|MDM1_uc010std.1_3'UTR	p.A204S	NM_017440	NP_059136	WXS	Illumina HiSeq	Unspecified	Q8TC05	MDM1_HUMAN	Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000174)	4	746	-			204					B4DM65|E7EPQ3|O43406|Q8WTV9|Q9NR04	Missense_Mutation	SNP	ENST00000303145.7	37	c.610G>T	CCDS8983.1	.	.	.	.	.	.	.	.	.	.	C	4.318	0.058283	0.08339	.	.	ENSG00000111554	ENST00000303145;ENST00000541686	T;T	0.20069	2.1;2.1	5.29	-2.31	0.06765	.	0.234344	0.44285	D	0.000471	T	0.09686	0.0238	L	0.32530	0.975	0.21897	N	0.999486	B	0.20988	0.05	B	0.20384	0.029	T	0.15378	-1.0439	9	.	.	.	-1.3443	0.1795	0.00122	0.2815:0.2747:0.1929:0.2509	.	204	Q8TC05	MDM1_HUMAN	S	204;199	ENSP00000302537:A204S;ENSP00000446000:A199S	.	A	-	1	0	MDM1	67005511	0.717000	0.27966	0.011000	0.14972	0.991000	0.79684	1.307000	0.33516	-0.153000	0.11137	0.561000	0.74099	GCT		0.348	MDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402402.1	NM_020128		103	380	1	0	2.98e-41	4.04e-41	103	380				
GALNT4	8693	broad.mit.edu	37	12	89917406	89917406	+	Silent	SNP	A	A	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr12:89917406A>T	ENST00000529983.2	-	1	1177	c.921T>A	c.(919-921)ccT>ccA	p.P307P	GALNT4_ENST00000413530.1_Silent_p.P135P|POC1B_ENST00000549504.1_Intron|RP11-734K2.4_ENST00000605233.1_RNA|POC1B-GALNT4_ENST00000548729.1_Silent_p.P304P|POC1B-GALNT4_ENST00000547474.1_3'UTR|POC1B_ENST00000393179.4_Intron|POC1B_ENST00000549035.1_Intron|POC1B_ENST00000313546.3_Intron|POC1B_ENST00000541909.1_Intron	NM_003774.4	NP_003765.2	Q8N4A0	GALT4_HUMAN	polypeptide N-acetylgalactosaminyltransferase 4	307	Catalytic subdomain B.				carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			endometrium(4)|kidney(2)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)	14						CAGCCATGGTAGGTGATCTGA	0.473																																						uc001tbd.2		NA																	0					0						c.(919-921)CCT>CCA		polypeptide N-acetylgalactosaminyltransferase 4							120.0	118.0	119.0					12																	89917406		1952	4152	6104	SO:0001819	synonymous_variant	8693				carbohydrate metabolic process	Golgi membrane|integral to membrane|perinuclear region of cytoplasm	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr12:89917406A>T	Y08564	CCDS53817.1	12q21.33	2014-03-13	2014-03-13		ENSG00000257594	ENSG00000257594	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4126	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 4"""	603565	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4)"""			9804815	Standard	NM_003774		Approved	GalNAc-T4	uc001tbd.3	Q8N4A0	OTTHUMG00000166292	ENST00000529983.2:c.921T>A	12.37:g.89917406A>T			Somatic				POC1B_uc001tba.2_Intron|POC1B_uc001tbb.2_Intron|POC1B_uc001tbc.2_Intron|POC1B_uc010sun.1_Intron|GALNT4_uc001tbe.2_Silent_p.P304P|GALNT4_uc010suo.1_5'UTR	p.P307P	NM_003774	NP_003765	WXS	Illumina HiSeq	Unspecified	Q8N4A0	GALT4_HUMAN			1	1130	-			307			Catalytic subdomain B.|Lumenal (Potential).		B2R775|B4DMX6|O00208	Silent	SNP	ENST00000529983.2	37	c.921T>A	CCDS53817.1																																																																																				0.473	GALNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388973.2	NM_003774		7	79	0	0	0	0	7	79				
STAB2	55576	broad.mit.edu	37	12	104118864	104118864	+	Missense_Mutation	SNP	A	A	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr12:104118864A>T	ENST00000388887.2	+	45	4999	c.4795A>T	c.(4795-4797)Att>Ttt	p.I1599F		NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						CCGCGGCAGCATTTATCAGGT	0.438																																						uc001tjw.2		NA																	0				ovary(9)|skin(5)	14						c.(4795-4797)ATT>TTT		stabilin 2 precursor							118.0	114.0	115.0					12																	104118864		2203	4300	6503	SO:0001583	missense	55576				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity	g.chr12:104118864A>T	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.4795A>T	12.37:g.104118864A>T	ENSP00000373539:p.Ile1599Phe		Somatic				STAB2_uc009zug.2_RNA	p.I1599F	NM_017564	NP_060034	WXS	Illumina HiSeq	Unspecified	Q8WWQ8	STAB2_HUMAN			45	4981	+			1599	IY -> HE (in Ref. 7; AAF82398).		Extracellular (Potential).|FAS1 5.			Missense_Mutation	SNP	ENST00000388887.2	37	c.4795A>T	CCDS31888.1	.	.	.	.	.	.	.	.	.	.	A	15.65	2.896199	0.52121	.	.	ENSG00000136011	ENST00000388887;ENST00000258495	D	0.93076	-3.16	5.38	4.25	0.50352	FAS1 domain (3);	0.129087	0.52532	D	0.000063	D	0.94604	0.8261	M	0.72479	2.2	0.41800	D	0.989911	D	0.61080	0.989	P	0.58780	0.845	D	0.94218	0.7465	10	0.52906	T	0.07	.	9.7687	0.40576	0.9173:0.0:0.0827:0.0	.	1599	Q8WWQ8	STAB2_HUMAN	F	1599;286	ENSP00000373539:I1599F	ENSP00000258495:I286F	I	+	1	0	STAB2	102642994	1.000000	0.71417	0.640000	0.29408	0.224000	0.24922	3.417000	0.52714	2.035000	0.60131	0.459000	0.35465	ATT		0.438	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1			67	16	0	0	0	0	67	16				
GLT8D2	83468	broad.mit.edu	37	12	104390557	104390557	+	Missense_Mutation	SNP	C	C	T	rs7133444	byFrequency	TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr12:104390557C>T	ENST00000360814.4	-	8	961	c.556G>A	c.(556-558)Gat>Aat	p.D186N	GLT8D2_ENST00000548660.1_Missense_Mutation_p.D186N|GLT8D2_ENST00000546436.1_Missense_Mutation_p.D186N	NM_031302.3	NP_112592.1	Q9H1C3	GL8D2_HUMAN	glycosyltransferase 8 domain containing 2	186						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)	p.D186N(1)		kidney(3)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)	16						GAGGGCAAATCGCAGTCATCT	0.502																																						uc001tkh.1		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(1)|skin(1)	2						c.(556-558)GAT>AAT		glycosyltransferase 8 domain containing 2							109.0	110.0	110.0					12																	104390557		2203	4300	6503	SO:0001583	missense	83468					integral to membrane	transferase activity, transferring glycosyl groups	g.chr12:104390557C>T	BC022343	CCDS9096.1	12q23.3	2013-02-22			ENSG00000120820	ENSG00000120820		"""Glycosyltransferase family 8 domain containing"""	24890	protein-coding gene	gene with protein product							Standard	NM_031302		Approved	FLJ31494	uc001tkh.1	Q9H1C3	OTTHUMG00000170120	ENST00000360814.4:c.556G>A	12.37:g.104390557C>T	ENSP00000354053:p.Asp186Asn		Somatic				GLT8D2_uc001tki.1_Missense_Mutation_p.D186N	p.D186N	NM_031302	NP_112592	WXS	Illumina HiSeq	Unspecified	Q9H1C3	GL8D2_HUMAN			8	962	-			186			Lumenal (Potential).		Q96KA2	Missense_Mutation	SNP	ENST00000360814.4	37	c.556G>A	CCDS9096.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.592722	0.86953	.	.	ENSG00000120820	ENST00000360814;ENST00000546436;ENST00000548660	T;T;T	0.22945	1.93;1.93;1.93	5.13	3.32	0.38043	.	0.048279	0.85682	N	0.000000	T	0.41003	0.1140	L	0.55213	1.73	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.09840	-1.0656	10	0.19147	T	0.46	.	11.3561	0.49617	0.0:0.8531:0.0:0.1469	rs7133444;rs7133444	186	Q9H1C3	GL8D2_HUMAN	N	186	ENSP00000354053:D186N;ENSP00000449750:D186N;ENSP00000447450:D186N	ENSP00000354053:D186N	D	-	1	0	GLT8D2	102914687	1.000000	0.71417	0.775000	0.31657	0.972000	0.66771	4.964000	0.63701	0.575000	0.29434	0.563000	0.77884	GAT		0.502	GLT8D2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407371.1	NM_031302		59	19	0	0	0	0	59	19				
HECTD4	283450	broad.mit.edu	37	12	112665943	112665943	+	Silent	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr12:112665943C>T	ENST00000430131.2	-	42	6683	c.5538G>A	c.(5536-5538)ggG>ggA	p.G1846G	HECTD4_ENST00000550722.1_Silent_p.G2122G|HECTD4_ENST00000377560.5_Silent_p.G2096G			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	1846					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										CAGGAGCTGACCCATCTCCTG	0.517																																						uc009zwc.2		NA																	0				ovary(1)|lung(1)	2						c.(5536-5538)GGG>GGA		chromosome 12 open reading frame 51							113.0	111.0	112.0					12																	112665943		2003	4160	6163	SO:0001819	synonymous_variant	283450							g.chr12:112665943C>T	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.5538G>A	12.37:g.112665943C>T			Somatic				C12orf51_uc001ttr.1_Silent_p.G21G	p.G1846G	NM_001109662	NP_001103132	WXS	Illumina HiSeq	Unspecified					36	5556	-								L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Silent	SNP	ENST00000430131.2	37	c.5538G>A		.	.	.	.	.	.	.	.	.	.	C	9.900	1.206557	0.22205	.	.	ENSG00000173064	ENST00000550968	.	.	.	6.03	0.422	0.16457	.	.	.	.	.	T	0.80369	0.4610	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.84390	0.0554	5	0.62326	D	0.03	.	21.0995	0.99946	0.0:0.2036:0.7964:0.0	.	.	.	.	D	13	.	ENSP00000449652:G13D	G	-	2	0	C12orf51	111150326	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	0.690000	0.25451	0.066000	0.16515	0.655000	0.94253	GGT		0.517	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813		43	22	0	0	0	0	43	22				
CDK8	1024	broad.mit.edu	37	13	26975692	26975692	+	Silent	SNP	G	G	A	rs138501276		TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr13:26975692G>A	ENST00000381527.3	+	12	1703	c.1200G>A	c.(1198-1200)ccG>ccA	p.P400P	CDK8_ENST00000536792.1_3'UTR|CDK8_ENST00000480323.1_3'UTR	NM_001260.1	NP_001251.1	P49336	CDK8_HUMAN	cyclin-dependent kinase 8	400					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	25	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0384)|Epithelial(112;0.142)|OV - Ovarian serous cystadenocarcinoma(117;0.188)		AGGGACCCCCGTTGAAGAAAG	0.473																																						uc001uqr.1		NA																	0				lung(2)|large_intestine(1)|ovary(1)|skin(1)	5						c.(1198-1200)CCG>CCA		cyclin-dependent kinase 8		G		1,4405	2.1+/-5.4	0,1,2202	118.0	108.0	111.0		1200	-5.4	0.2	13	dbSNP_134	111	0,8600		0,0,4300	no	coding-synonymous	CDK8	NM_001260.1		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		400/465	26975692	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	1024				regulation of transcription, DNA-dependent|transcription, DNA-dependent	mediator complex	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity	g.chr13:26975692G>A	X85753	CCDS9317.1	13q12	2011-11-08			ENSG00000132964	ENSG00000132964		"""Cyclin-dependent kinases"""	1779	protein-coding gene	gene with protein product		603184				7568034	Standard	NM_001260		Approved	K35	uc001uqr.1	P49336	OTTHUMG00000016617	ENST00000381527.3:c.1200G>A	13.37:g.26975692G>A			Somatic				CDK8_uc001uqs.1_Silent_p.P399P|CDK8_uc001uqt.1_Silent_p.P227P	p.P400P	NM_001260	NP_001251	WXS	Illumina HiSeq	Unspecified	P49336	CDK8_HUMAN		all cancers(112;0.0384)|Epithelial(112;0.142)|OV - Ovarian serous cystadenocarcinoma(117;0.188)	12	1226	+	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)	400					Q5VUF3|Q6ISB5	Silent	SNP	ENST00000381527.3	37	c.1200G>A	CCDS9317.1																																																																																				0.473	CDK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044250.1			7	47	0	0	0	0	7	47				
MYCBP2	23077	broad.mit.edu	37	13	77671556	77671556	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr13:77671556C>G	ENST00000544440.2	-	56	9636	c.9619G>C	c.(9619-9621)Ggg>Cgg	p.G3207R	MYCBP2_ENST00000407578.2_Missense_Mutation_p.G3245R|MYCBP2_ENST00000482517.1_5'Flank|MYCBP2_ENST00000357337.6_Missense_Mutation_p.G3207R|MYCBP2-AS1_ENST00000593933.1_RNA					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		TGTGACTCCCCACACAGTTCA	0.448																																						uc001vkf.2		NA																	0				ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14						c.(9619-9621)GGG>CGG		MYC binding protein 2							115.0	104.0	108.0					13																	77671556		2203	4300	6503	SO:0001583	missense	23077				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding	g.chr13:77671556C>G	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.9619G>C	13.37:g.77671556C>G	ENSP00000444596:p.Gly3207Arg		Somatic				MYCBP2_uc010aev.2_Missense_Mutation_p.G2611R|MYCBP2_uc001vkg.1_Missense_Mutation_p.G730R	p.G3207R	NM_015057	NP_055872	WXS	Illumina HiSeq	Unspecified	O75592	MYCB2_HUMAN		GBM - Glioblastoma multiforme(99;0.109)	57	9710	-		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)	3207						Missense_Mutation	SNP	ENST00000544440.2	37	c.9619G>C		.	.	.	.	.	.	.	.	.	.	C	20.8	4.046440	0.75846	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.32988	1.43;1.43;1.43	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.49304	0.1549	L	0.38175	1.15	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.997	T	0.42865	-0.9426	10	0.59425	D	0.04	.	19.9433	0.97172	0.0:1.0:0.0:0.0	.	3207;3207	O75592-2;O75592	.;MYCB2_HUMAN	R	3207;3245;3207	ENSP00000349892:G3207R;ENSP00000384288:G3245R;ENSP00000444596:G3207R	ENSP00000349892:G3207R	G	-	1	0	MYCBP2	76569557	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	7.818000	0.86416	2.716000	0.92895	0.655000	0.94253	GGG		0.448	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057		14	29	0	0	0	0	14	29				
SLITRK5	26050	broad.mit.edu	37	13	88327892	88327892	+	Silent	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr13:88327892C>T	ENST00000325089.6	+	2	468	c.249C>T	c.(247-249)atC>atT	p.I83I	SLITRK5_ENST00000400028.3_Intron	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	83					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					GTTTCCCAATCTACCACCTCT	0.453																																						uc001vln.2		NA																	0				ovary(2)|pancreas(2)|central_nervous_system(1)	5						c.(247-249)ATC>ATT		SLIT and NTRK-like family, member 5 precursor							166.0	168.0	168.0					13																	88327892		2203	4300	6503	SO:0001819	synonymous_variant	26050					integral to membrane		g.chr13:88327892C>T	AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.249C>T	13.37:g.88327892C>T			Somatic				SLITRK5_uc010tic.1_Intron	p.I83I	NM_015567	NP_056382	WXS	Illumina HiSeq	Unspecified	O94991	SLIK5_HUMAN			2	468	+	all_neural(89;0.101)|Medulloblastoma(90;0.163)		83			LRR 1.|Extracellular (Potential).		B3KNB8|B4DSH5|Q5VT81	Silent	SNP	ENST00000325089.6	37	c.249C>T	CCDS9465.1																																																																																				0.453	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045416.3			84	138	0	0	0	0	84	138				
F10	2159	broad.mit.edu	37	13	113777199	113777199	+	Silent	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr13:113777199C>T	ENST00000375559.3	+	1	68	c.30C>T	c.(28-30)ctC>ctT	p.L10L	F10_ENST00000375551.3_Silent_p.L10L|F10_ENST00000483537.1_3'UTR|F10_ENST00000409306.1_Silent_p.L10L	NM_000504.3	NP_000495.1	P00742	FA10_HUMAN	coagulation factor X	10					blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|blood coagulation, intrinsic pathway (GO:0007597)|cellular protein metabolic process (GO:0044267)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of cell migration (GO:0030335)|positive regulation of protein kinase B signaling (GO:0051897)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|intrinsic component of external side of plasma membrane (GO:0031233)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phospholipid binding (GO:0005543)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(4)|lung(10)|pancreas(1)|stomach(1)	18	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.113)|all_lung(25;0.0364)|all_epithelial(44;0.0373)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0805)|Epithelial(84;0.231)		Antihemophilic Factor(DB00025)|Apixaban(DB06605)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Enoxaparin(DB01225)|Fondaparinux sodium(DB00569)|Heparin(DB01109)|Menadione(DB00170)|Rivaroxaban(DB06228)	TCGTCCTGCTCAGTGCCTCCC	0.672																																						uc001vsx.2		NA																	0				pancreas(1)	1						c.(28-30)CTC>CTT		coagulation factor X preproprotein	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Enoxaparin(DB01225)|Heparin(DB01109)|Menadione(DB00170)|Reteplase(DB00015)|Tenecteplase(DB00031)						79.0	56.0	63.0					13																	113777199		2203	4300	6503	SO:0001819	synonymous_variant	2159				blood coagulation, extrinsic pathway|blood coagulation, intrinsic pathway|peptidyl-glutamic acid carboxylation|positive regulation of cell migration|positive regulation of protein kinase B signaling cascade|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|extracellular region|Golgi lumen	calcium ion binding|phospholipid binding|protein binding|serine-type endopeptidase activity	g.chr13:113777199C>T		CCDS9530.1	13q34	2012-10-02			ENSG00000126218	ENSG00000126218	3.4.21.6		3528	protein-coding gene	gene with protein product		613872					Standard	XM_005268298		Approved		uc001vsx.3	P00742	OTTHUMG00000017374	ENST00000375559.3:c.30C>T	13.37:g.113777199C>T			Somatic				F10_uc010agq.1_RNA|F10_uc001vsy.2_Silent_p.L10L|F10_uc001vsz.2_Silent_p.L10L	p.L10L	NM_000504	NP_000495	WXS	Illumina HiSeq	Unspecified	P00742	FA10_HUMAN	all cancers(43;0.0805)|Epithelial(84;0.231)		1	87	+	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.113)|all_lung(25;0.0364)|all_epithelial(44;0.0373)|Lung NSC(25;0.128)|Breast(118;0.188)	10					Q14340	Silent	SNP	ENST00000375559.3	37	c.30C>T	CCDS9530.1																																																																																				0.672	F10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045841.3			12	25	0	0	0	0	12	25				
AP1G2	8906	broad.mit.edu	37	14	24034829	24034829	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr14:24034829C>T	ENST00000308724.5	-	6	1482	c.727G>A	c.(727-729)Gac>Aac	p.D243N	AP1G2_ENST00000556277.1_5'UTR|RP11-66N24.3_ENST00000555968.1_RNA|AP1G2_ENST00000397120.3_Missense_Mutation_p.D243N	NM_003917.2	NP_003908.1	O75843	AP1G2_HUMAN	adaptor-related protein complex 1, gamma 2 subunit	243					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	AP-1 adaptor complex (GO:0030121)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle (GO:0005798)|membrane (GO:0016020)|transport vesicle (GO:0030133)	protein transporter activity (GO:0008565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	28	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00672)		AGGAAGGGGTCGCTGACTCCA	0.557																																						uc001wkl.2		NA																	0				ovary(1)	1						c.(727-729)GAC>AAC		adaptor-related protein complex 1, gamma 2							76.0	67.0	70.0					14																	24034829		2203	4300	6503	SO:0001583	missense	8906				interspecies interaction between organisms|intracellular protein transport|vesicle-mediated transport	AP-1 adaptor complex|endosome membrane	protein binding|protein transporter activity	g.chr14:24034829C>T	AB015318	CCDS9602.1	14q11.2	2008-07-03			ENSG00000213983	ENSG00000213983			556	protein-coding gene	gene with protein product		603534				9733768, 9762922	Standard	XM_005268167		Approved	G2AD	uc001wkl.2	O75843	OTTHUMG00000028760	ENST00000308724.5:c.727G>A	14.37:g.24034829C>T	ENSP00000312442:p.Asp243Asn		Somatic				AP1G2_uc001wkj.2_5'UTR|AP1G2_uc001wkk.3_Missense_Mutation_p.D171N|AP1G2_uc001wkn.2_5'UTR|uc001wko.1_RNA|AP1G2_uc001wkp.1_5'Flank|AP1G2_uc010tnp.1_Missense_Mutation_p.D243N|AP1G2_uc010aks.2_Missense_Mutation_p.D171N|AP1G2_uc010akt.2_Missense_Mutation_p.D171N|AP1G2_uc010tnq.1_RNA	p.D243N	NM_003917	NP_003908	WXS	Illumina HiSeq	Unspecified	O75843	AP1G2_HUMAN		GBM - Glioblastoma multiforme(265;0.00672)	7	1064	-	all_cancers(95;0.000251)		243					D3DS51|O75504	Missense_Mutation	SNP	ENST00000308724.5	37	c.727G>A	CCDS9602.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.648073	0.87958	.	.	ENSG00000213983	ENST00000308724;ENST00000397120;ENST00000545295;ENST00000535852	T;T	0.25085	1.82;1.82	5.62	4.72	0.59763	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.52901	0.1763	M	0.87180	2.865	0.58432	D	0.999998	D;D	0.89917	0.999;1.0	D;D	0.68192	0.923;0.956	T	0.56312	-0.8000	10	0.46703	T	0.11	-22.6408	12.8006	0.57584	0.0:0.9183:0.0:0.0817	.	243;98	O75843;Q86V28	AP1G2_HUMAN;.	N	243;243;33;98	ENSP00000312442:D243N;ENSP00000380309:D243N	ENSP00000312442:D243N	D	-	1	0	AP1G2	23104669	0.990000	0.36364	0.991000	0.47740	0.990000	0.78478	2.847000	0.48270	2.651000	0.90000	0.655000	0.94253	GAC		0.557	AP1G2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071812.4	NM_003917		16	31	0	0	0	0	16	31				
NYNRIN	57523	broad.mit.edu	37	14	24884134	24884134	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr14:24884134C>T	ENST00000382554.3	+	9	3497	c.3179C>T	c.(3178-3180)gCa>gTa	p.A1060V		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	1060					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						CTGCCAGGGGCAGCTTCTCCC	0.647																																						uc001wpf.3		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(3178-3180)GCA>GTA		hypothetical protein LOC57523							72.0	85.0	81.0					14																	24884134		2063	4190	6253	SO:0001583	missense	57523				DNA integration	integral to membrane	DNA binding	g.chr14:24884134C>T	AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.3179C>T	14.37:g.24884134C>T	ENSP00000371994:p.Ala1060Val		Somatic					p.A1060V	NM_025081	NP_079357	WXS	Illumina HiSeq	Unspecified	Q9P2P1	NYNRI_HUMAN			9	3497	+			1060					Q6P153|Q86TR3|Q9HAC4	Missense_Mutation	SNP	ENST00000382554.3	37	c.3179C>T	CCDS45090.1	.	.	.	.	.	.	.	.	.	.	C	3.977	-0.007290	0.07773	.	.	ENSG00000205978	ENST00000382554	T	0.09073	3.02	4.32	-5.88	0.02290	.	.	.	.	.	T	0.01627	0.0052	N	0.01048	-1.04	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43360	-0.9396	9	0.02654	T	1	.	3.9136	0.09213	0.1432:0.4953:0.1462:0.2153	.	1060	Q9P2P1	NYNRI_HUMAN	V	1060	ENSP00000371994:A1060V	ENSP00000371994:A1060V	A	+	2	0	NYNRIN	23953974	0.002000	0.14202	0.000000	0.03702	0.019000	0.09904	-0.189000	0.09629	-0.664000	0.05324	-0.379000	0.06801	GCA		0.647	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412939.1			9	121	0	0	0	0	9	121				
KLHL28	54813	broad.mit.edu	37	14	45414307	45414307	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr14:45414307C>T	ENST00000396128.4	-	2	944	c.825G>A	c.(823-825)atG>atA	p.M275I	KLHL28_ENST00000355081.2_Missense_Mutation_p.M289I	NM_017658.3	NP_060128.2	Q9NXS3	KLH28_HUMAN	kelch-like family member 28	275										breast(2)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						GAGGTCGTGTCATCAAGACTG	0.418																																						uc001wvq.2		NA																	0				ovary(1)	1						c.(823-825)ATG>ATA		BTB (POZ) domain containing 5							124.0	119.0	121.0					14																	45414307		2203	4300	6503	SO:0001583	missense	54813							g.chr14:45414307C>T	AK000088	CCDS9680.1	14q21.1	2013-02-22	2013-02-22	2007-01-09	ENSG00000179454	ENSG00000179454		"""Kelch-like"", ""BTB/POZ domain containing"""	19741	protein-coding gene	gene with protein product			"""BTB (POZ) domain containing 5"", ""kelch-like 28 (Drosophila)"""	BTBD5			Standard	NM_017658		Approved	FLJ20081	uc001wvr.3	Q9NXS3	OTTHUMG00000140263	ENST00000396128.4:c.825G>A	14.37:g.45414307C>T	ENSP00000379434:p.Met275Ile		Somatic				KLHL28_uc001wvr.2_Missense_Mutation_p.M275I|KLHL28_uc001wvt.3_Missense_Mutation_p.M275I	p.M275I	NM_017658	NP_060128	WXS	Illumina HiSeq	Unspecified	Q9NXS3	KLH28_HUMAN			2	1071	-			275					Q0VAL5	Missense_Mutation	SNP	ENST00000396128.4	37	c.825G>A	CCDS9680.1	.	.	.	.	.	.	.	.	.	.	C	10.93	1.488988	0.26686	.	.	ENSG00000179454	ENST00000396128;ENST00000355081	T;T	0.72505	-0.66;-0.66	5.85	2.89	0.33648	Kelch-type beta propeller (1);	0.386485	0.35772	N	0.002996	T	0.55577	0.1929	L	0.39514	1.22	0.33610	D	0.603517	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.55761	-0.8090	10	0.59425	D	0.04	.	3.4171	0.07380	0.1299:0.4799:0.2518:0.1384	.	275;275	Q9NXS3-2;Q9NXS3	.;KLH28_HUMAN	I	275;289	ENSP00000379434:M275I;ENSP00000347193:M289I	ENSP00000347193:M289I	M	-	3	0	KLHL28	44484057	0.907000	0.30839	1.000000	0.80357	0.998000	0.95712	-0.052000	0.11865	0.315000	0.23110	0.655000	0.94253	ATG		0.418	KLHL28-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276790.3			50	65	0	0	0	0	50	65				
SOS2	6655	broad.mit.edu	37	14	50616839	50616839	+	Silent	SNP	T	T	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr14:50616839T>A	ENST00000216373.5	-	14	2545	c.2271A>T	c.(2269-2271)ccA>ccT	p.P757P	SOS2_ENST00000543680.1_Silent_p.P724P	NM_006939.2	NP_008870.2	Q07890	SOS2_HUMAN	son of sevenless homolog 2 (Drosophila)	757	Poly-Pro.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	DNA binding (GO:0003677)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(16)|ovary(2)|skin(1)	39	all_epithelial(31;0.000822)|Breast(41;0.0065)					ATTCAATTGGTGGAGGTGGAC	0.408																																						uc001wxs.3		NA																	0				ovary(2)	2						c.(2269-2271)CCA>CCT		son of sevenless homolog 2							271.0	229.0	243.0					14																	50616839		2203	4300	6503	SO:0001819	synonymous_variant	6655				apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	DNA binding|protein binding|Rho guanyl-nucleotide exchange factor activity	g.chr14:50616839T>A	L13858	CCDS9697.1	14q21	2013-01-10	2001-12-04		ENSG00000100485	ENSG00000100485		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11188	protein-coding gene	gene with protein product		601247	"""son of sevenless (Drosophilia) homolog 2"""			8276400	Standard	NM_006939		Approved		uc001wxs.4	Q07890	OTTHUMG00000140292	ENST00000216373.5:c.2271A>T	14.37:g.50616839T>A			Somatic				SOS2_uc010tql.1_Silent_p.P724P|SOS2_uc010tqm.1_RNA	p.P757P	NM_006939	NP_008870	WXS	Illumina HiSeq	Unspecified	Q07890	SOS2_HUMAN			14	2369	-	all_epithelial(31;0.000822)|Breast(41;0.0065)		757			Poly-Pro.		B7ZKT6|D3DSB4|Q15503|Q17RN1	Silent	SNP	ENST00000216373.5	37	c.2271A>T	CCDS9697.1																																																																																				0.408	SOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276878.2			50	94	0	0	0	0	50	94				
SYNE2	23224	broad.mit.edu	37	14	64518544	64518544	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr14:64518544C>G	ENST00000344113.4	+	48	8125	c.7913C>G	c.(7912-7914)aCt>aGt	p.T2638S	SYNE2_ENST00000358025.3_Missense_Mutation_p.T2638S|SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000554584.1_Missense_Mutation_p.T2671S	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2638					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		GTACAGGACACTGAGATTTCT	0.448																																						uc001xgm.2		NA																	0				ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14						c.(7912-7914)ACT>AGT		spectrin repeat containing, nuclear envelope 2							106.0	101.0	103.0					14																	64518544		1942	4163	6105	SO:0001583	missense	23224				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding	g.chr14:64518544C>G	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.7913C>G	14.37:g.64518544C>G	ENSP00000341781:p.Thr2638Ser		Somatic				SYNE2_uc001xgl.2_Missense_Mutation_p.T2638S	p.T2638S	NM_015180	NP_055995	WXS	Illumina HiSeq	Unspecified	Q8WXH0	SYNE2_HUMAN		all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)	48	8143	+			2638			Potential.|Cytoplasmic (Potential).		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	37	c.7913C>G	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	C	0.053	-1.243151	0.01481	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.56941	0.79;0.79;0.43	5.68	0.132	0.14762	.	1.567710	0.03969	N	0.291306	T	0.33411	0.0862	N	0.08118	0	0.09310	N	0.999999	B;B	0.32968	0.272;0.392	B;B	0.28709	0.043;0.093	T	0.33214	-0.9877	10	0.66056	D	0.02	.	9.5237	0.39152	0.0:0.3396:0.0:0.6604	.	2638;2638	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	S	2638;2638;2671;2671	ENSP00000350719:T2638S;ENSP00000341781:T2638S;ENSP00000452570:T2671S	ENSP00000261678:T2671S	T	+	2	0	SYNE2	63588297	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	1.049000	0.30392	-0.368000	0.08040	-2.010000	0.00438	ACT		0.448	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914		14	99	0	0	0	0	14	99				
MTHFD1	4522	broad.mit.edu	37	14	64891551	64891551	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr14:64891551G>T	ENST00000545908.1	+	9	1154	c.925G>T	c.(925-927)Gtg>Ttg	p.V309L	CTD-2555O16.2_ENST00000556640.1_RNA|MTHFD1_ENST00000216605.8_Missense_Mutation_p.V253L			P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase	253	Formyltetrahydrofolate synthetase.				folic acid metabolic process (GO:0046655)|folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)|methylenetetrahydrofolate dehydrogenase [NAD(P)+] activity (GO:0004486)			endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	30				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	Tetrahydrofolic acid(DB00116)	GAGAAAAGTTGTGGGTGATGT	0.488																																					Colon(18;220 581 13419 18191 31512)|GBM(126;343 1658 28700 44425 52519)	uc001xhb.2		NA																	0				ovary(2)	2						c.(757-759)GTG>TTG		methylenetetrahydrofolate dehydrogenase 1	NADH(DB00157)|Tetrahydrofolic acid(DB00116)						96.0	77.0	83.0					14																	64891551		2203	4300	6503	SO:0001583	missense	4522				folic acid metabolic process|folic acid-containing compound biosynthetic process|histidine biosynthetic process|methionine biosynthetic process|one-carbon metabolic process|purine nucleotide biosynthetic process	cytosol|mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|methenyltetrahydrofolate cyclohydrolase activity|methylenetetrahydrofolate dehydrogenase (NADP+) activity|methylenetetrahydrofolate dehydrogenase|protein binding	g.chr14:64891551G>T	J04031	CCDS9763.1	14q24	2004-12-13			ENSG00000100714	ENSG00000100714	1.5.1.15, 3.5.4.-		7432	protein-coding gene	gene with protein product		172460		MTHFC, MTHFD		3053686, 2786332	Standard	NM_005956		Approved		uc001xhb.3	P11586	OTTHUMG00000141309	ENST00000545908.1:c.925G>T	14.37:g.64891551G>T	ENSP00000438588:p.Val309Leu		Somatic				MTHFD1_uc010aqe.2_Missense_Mutation_p.V289L|MTHFD1_uc010aqf.2_Missense_Mutation_p.V309L	p.V253L	NM_005956	NP_005947	WXS	Illumina HiSeq	Unspecified	P11586	C1TC_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	9	1144	+			253			Methylenetetrahydrofolate dehydrogenase and cyclohydrolase.		B2R5Y2|G3V2B8|Q86VC9|Q9BVP5	Missense_Mutation	SNP	ENST00000545908.1	37	c.757G>T		.	.	.	.	.	.	.	.	.	.	G	17.94	3.512615	0.64522	.	.	ENSG00000100714	ENST00000545908;ENST00000555709;ENST00000216605;ENST00000555252	T;T;T;T	0.59502	0.26;0.26;0.26;0.26	5.89	5.89	0.94794	Tetrahydrofolate dehydrogenase/cyclohydrolase, NAD(P)-binding domain (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.65995	0.2745	M	0.81802	2.56	0.80722	D	1	B;B;B	0.18310	0.014;0.002;0.027	B;B;B	0.28232	0.064;0.064;0.087	T	0.64453	-0.6404	10	0.66056	D	0.02	-21.0884	18.5149	0.90933	0.0:0.0:1.0:0.0	.	309;253;253	F5H2F4;P11586;G3V2B8	.;C1TC_HUMAN;.	L	309;253;309;233	ENSP00000438588:V309L;ENSP00000450560:V253L;ENSP00000216605:V309L;ENSP00000451309:V233L	ENSP00000216605:V253L	V	+	1	0	MTHFD1	63961304	1.000000	0.71417	0.969000	0.41365	0.404000	0.30871	9.793000	0.99091	2.822000	0.97130	0.650000	0.86243	GTG		0.488	MTHFD1-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000412167.1			4	38	1	0	1.24e-05	1.5e-05	4	38				
ARG2	384	broad.mit.edu	37	14	68108986	68108986	+	Missense_Mutation	SNP	C	C	T	rs570385517	byFrequency	TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr14:68108986C>T	ENST00000261783.3	+	3	448	c.268C>T	c.(268-270)Cgc>Tgc	p.R90C	ARG2_ENST00000556491.1_3'UTR	NM_001172.3	NP_001163.1	P78540	ARGI2_HUMAN	arginase 2	90					arginine metabolic process (GO:0006525)|cellular nitrogen compound metabolic process (GO:0034641)|nitric oxide biosynthetic process (GO:0006809)|small molecule metabolic process (GO:0044281)|striated muscle contraction (GO:0006941)|urea cycle (GO:0000050)|ureteric bud development (GO:0001657)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	arginase activity (GO:0004053)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|ovary(1)|prostate(1)	11				all cancers(60;0.000582)|OV - Ovarian serous cystadenocarcinoma(108;0.00392)|BRCA - Breast invasive adenocarcinoma(234;0.00928)	L-Arginine(DB00125)|L-Ornithine(DB00129)	AGTGAATCCACGCTCAGTGGG	0.507													C|||	3	0.000599042	0.0	0.0	5008	,	,		18676	0.0		0.0	False		,,,				2504	0.0031					uc001xjs.2		NA																	0					0						c.(268-270)CGC>TGC		arginase 2 precursor	L-Arginine(DB00125)|L-Ornithine(DB00129)						94.0	76.0	82.0					14																	68108986		2203	4300	6503	SO:0001583	missense	384				arginine metabolic process|nitric oxide biosynthetic process|urea cycle	mitochondrial matrix	arginase activity|metal ion binding	g.chr14:68108986C>T	D86724	CCDS9785.1	14q24.1	2013-05-01	2013-05-01			ENSG00000081181			664	protein-coding gene	gene with protein product		107830	"""arginase, type II"""			8954792, 8898077	Standard	NM_001172		Approved		uc001xjs.3	P78540		ENST00000261783.3:c.268C>T	14.37:g.68108986C>T	ENSP00000261783:p.Arg90Cys		Somatic					p.R90C	NM_001172	NP_001163	WXS	Illumina HiSeq	Unspecified	P78540	ARGI2_HUMAN		all cancers(60;0.000582)|OV - Ovarian serous cystadenocarcinoma(108;0.00392)|BRCA - Breast invasive adenocarcinoma(234;0.00928)	3	384	+			90					B2R690|Q6FHY8	Missense_Mutation	SNP	ENST00000261783.3	37	c.268C>T	CCDS9785.1	.	.	.	.	.	.	.	.	.	.	C	31	5.069023	0.93950	.	.	ENSG00000081181	ENST00000261783	T	0.47528	0.84	5.15	5.15	0.70609	Ureohydrolase domain (1);	0.000000	0.85682	D	0.000000	T	0.78291	0.4260	H	0.94462	3.54	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.84563	0.0651	10	0.87932	D	0	.	18.8203	0.92094	0.0:1.0:0.0:0.0	.	90	P78540	ARGI2_HUMAN	C	90	ENSP00000261783:R90C	ENSP00000261783:R90C	R	+	1	0	ARG2	67178739	1.000000	0.71417	0.989000	0.46669	0.987000	0.75469	5.846000	0.69444	2.698000	0.92095	0.585000	0.79938	CGC		0.507	ARG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415190.2	NM_001172		24	31	0	0	0	0	24	31				
SYNDIG1L	646658	broad.mit.edu	37	14	74874373	74874373	+	Silent	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr14:74874373C>T	ENST00000554823.1	-	3	643	c.582G>A	c.(580-582)ggG>ggA	p.G194G	SYNDIG1L_ENST00000331628.3_Silent_p.G194G			A6NDD5	SYN1L_HUMAN	synapse differentiation inducing 1-like	194					response to biotic stimulus (GO:0009607)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|lung(8)|pancreas(1)|prostate(1)|skin(1)	14						GGCGGAAGTCCCCTTTGGAGA	0.662																																						uc001xpx.2		NA																	0					0						c.(580-582)GGG>GGA		transmembrane protein 90A							71.0	93.0	86.0					14																	74874373		2147	4252	6399	SO:0001819	synonymous_variant	646658				response to biotic stimulus	Golgi apparatus|integral to membrane		g.chr14:74874373C>T		CCDS41970.1	14q24.3	2011-06-30	2011-06-30	2011-06-30		ENSG00000183379			32388	protein-coding gene	gene with protein product	"""caudate-and putamen-enriched sequence"", ""interferon induced transmembrane protein domain containing 4"""	609999	"""transmembrane protein 90A"""	TMEM90A		16359841	Standard	NM_001105579		Approved	capucin, IFITMD4	uc001xpx.2	A6NDD5		ENST00000554823.1:c.582G>A	14.37:g.74874373C>T			Somatic					p.G194G	NM_001105579	NP_001099049	WXS	Illumina HiSeq	Unspecified	A6NDD5	SYN1L_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00159)	4	830	-			194						Silent	SNP	ENST00000554823.1	37	c.582G>A	CCDS41970.1																																																																																				0.662	SYNDIG1L-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412341.1	XM_938515		33	69	0	0	0	0	33	69				
CCDC88C	440193	broad.mit.edu	37	14	91787565	91787565	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr14:91787565G>A	ENST00000389857.6	-	13	1512	c.1426C>T	c.(1426-1428)Cag>Tag	p.Q476*		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	476					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				ATGGTGCTCTGGAGGCTCTGA	0.587																																						uc010aty.2		NA																	0				ovary(3)	3						c.(1426-1428)CAG>TAG		DVL-binding protein DAPLE							34.0	34.0	34.0					14																	91787565		1982	4159	6141	SO:0001587	stop_gained	440193				microtubule cytoskeleton organization|protein destabilization|protein homooligomerization|regulation of protein phosphorylation|Wnt receptor signaling pathway	cytoplasm|insoluble fraction	microtubule binding|PDZ domain binding|protein self-association	g.chr14:91787565G>A		CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.1426C>T	14.37:g.91787565G>A	ENSP00000374507:p.Gln476*		Somatic					p.Q476*	NM_001080414	NP_001073883	WXS	Illumina HiSeq	Unspecified	Q9P219	DAPLE_HUMAN			13	1525	-		all_cancers(154;0.0468)	476			Potential.		Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Nonsense_Mutation	SNP	ENST00000389857.6	37	c.1426C>T	CCDS45151.1	.	.	.	.	.	.	.	.	.	.	G	40	8.237319	0.98719	.	.	ENSG00000015133	ENST00000389857	.	.	.	5.8	5.8	0.92144	.	0.000000	0.46145	U	0.000302	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	-45.5291	20.0537	0.97638	0.0:0.0:1.0:0.0	.	.	.	.	X	476	.	ENSP00000374507:Q476X	Q	-	1	0	CCDC88C	90857318	1.000000	0.71417	0.994000	0.49952	0.994000	0.84299	9.285000	0.95894	2.758000	0.94735	0.561000	0.74099	CAG		0.587	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411650.1	XM_029353		8	14	0	0	0	0	8	14				
PPP4R4	57718	broad.mit.edu	37	14	94722876	94722876	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr14:94722876G>T	ENST00000304338.3	+	17	2099	c.1945G>T	c.(1945-1947)Gaa>Taa	p.E649*		NM_058237.1	NP_478144.1	Q6NUP7	PP4R4_HUMAN	protein phosphatase 4, regulatory subunit 4	649					negative regulation of phosphoprotein phosphatase activity (GO:0032515)|regulation of protein serine/threonine phosphatase activity (GO:0080163)	cytoplasm (GO:0005737)|protein serine/threonine phosphatase complex (GO:0008287)	protein phosphatase regulator activity (GO:0019888)			NS(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(15)|lung(10)|skin(7)|upper_aerodigestive_tract(2)	40						TCAGCAGTTAGAAATGTGTGT	0.348																																						uc001ycs.1		NA																	0				skin(3)|upper_aerodigestive_tract(1)	4						c.(1945-1947)GAA>TAA		HEAT-like repeat-containing protein isoform 1							108.0	112.0	110.0					14																	94722876		2203	4300	6503	SO:0001587	stop_gained	57718					cytoplasm|protein serine/threonine phosphatase complex	protein binding	g.chr14:94722876G>T	AB046842, BC068491	CCDS9921.1, CCDS9922.1	14q32.2	2014-07-18	2008-09-16	2008-09-16	ENSG00000119698	ENSG00000119698		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	23788	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 14"""		"""KIAA1622"""	KIAA1622		18715871	Standard	NM_020958		Approved	PP4R4, CFAP14	uc001ycs.1	Q6NUP7		ENST00000304338.3:c.1945G>T	14.37:g.94722876G>T	ENSP00000305924:p.Glu649*		Somatic					p.E649*	NM_058237	NP_478144	WXS	Illumina HiSeq	Unspecified	Q6NUP7	PP4R4_HUMAN			17	2099	+			649					Q9BUF8|Q9HCF0	Nonsense_Mutation	SNP	ENST00000304338.3	37	c.1945G>T	CCDS9921.1	.	.	.	.	.	.	.	.	.	.	G	40	8.254293	0.98727	.	.	ENSG00000119698	ENST00000304338	.	.	.	5.56	5.56	0.83823	.	0.251762	0.46442	D	0.000293	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-22.0115	19.5251	0.95201	0.0:0.0:1.0:0.0	.	.	.	.	X	649	.	ENSP00000305924:E649X	E	+	1	0	PPP4R4	93792629	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.779000	0.85648	2.608000	0.88229	0.655000	0.94253	GAA		0.348	PPP4R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413056.1	NM_058237		5	26	1	0	0.000602214	0.000698526	5	26				
HHIPL1	84439	broad.mit.edu	37	14	100125954	100125954	+	Silent	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr14:100125954C>T	ENST00000330710.5	+	4	1334	c.1236C>T	c.(1234-1236)cgC>cgT	p.R412R	HHIPL1_ENST00000357223.2_Silent_p.R412R	NM_001127258.1	NP_001120730.1	Q96JK4	HIPL1_HUMAN	HHIP-like 1	412					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)|membrane (GO:0016020)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)|scavenger receptor activity (GO:0005044)			breast(1)|endometrium(2)|large_intestine(2)|lung(8)|skin(2)	15		Melanoma(154;0.128)				GCACTGGCCGCGGGCGCCTCT	0.726																																						uc010avs.2		NA																	0				skin(2)	2						c.(1234-1236)CGC>CGT		HHIP-like protein 1 isoform a							4.0	6.0	5.0					14																	100125954		2051	4073	6124	SO:0001819	synonymous_variant	84439				carbohydrate metabolic process	extracellular region|membrane	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding|scavenger receptor activity	g.chr14:100125954C>T	AB058725	CCDS9953.1, CCDS45162.1	14q32	2008-01-16	2008-01-16	2008-01-16		ENSG00000182218			19710	protein-coding gene	gene with protein product			"""KIAA1822"""	KIAA1822			Standard	NM_032425		Approved		uc010avs.3	Q96JK4		ENST00000330710.5:c.1236C>T	14.37:g.100125954C>T			Somatic				HHIPL1_uc001ygl.1_Silent_p.R412R	p.R412R	NM_001127258	NP_001120730	WXS	Illumina HiSeq	Unspecified	Q96JK4	HIPL1_HUMAN			4	1301	+		Melanoma(154;0.128)	412					A2RUF8|B2RN09|Q6UXX2	Silent	SNP	ENST00000330710.5	37	c.1236C>T	CCDS45162.1																																																																																				0.726	HHIPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413811.1	XM_041566		6	4	0	0	0	0	6	4				
AHNAK2	113146	broad.mit.edu	37	14	105421961	105421961	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr14:105421961C>T	ENST00000333244.5	-	5	444	c.325G>A	c.(325-327)Gag>Aag	p.E109K	AHNAK2_ENST00000557457.1_5'Flank	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	109						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TCTGTTGCCTCCTGGACAGCC	0.602																																						uc010axc.1		NA																	0				ovary(1)	1						c.(325-327)GAG>AAG		AHNAK nucleoprotein 2							76.0	81.0	79.0					14																	105421961		2156	4254	6410	SO:0001583	missense	113146					nucleus		g.chr14:105421961C>T	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.325G>A	14.37:g.105421961C>T	ENSP00000353114:p.Glu109Lys		Somatic				AHNAK2_uc001ypx.2_Missense_Mutation_p.E9K	p.E109K	NM_138420	NP_612429	WXS	Illumina HiSeq	Unspecified	Q8IVF2	AHNK2_HUMAN	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)		5	445	-		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	109					Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	c.325G>A	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	C	13.05	2.119909	0.37436	.	.	ENSG00000185567	ENST00000333244	T	0.40476	1.03	4.72	3.83	0.44106	PDZ/DHR/GLGF (1);	0.246048	0.24700	U	0.036320	T	0.43986	0.1272	M	0.77313	2.365	0.18873	N	0.999988	B	0.32753	0.383	B	0.31442	0.13	T	0.35301	-0.9794	10	0.32370	T	0.25	.	13.4933	0.61408	0.0:0.8437:0.1563:0.0	.	109	Q8IVF2	AHNK2_HUMAN	K	109	ENSP00000353114:E109K	ENSP00000353114:E109K	E	-	1	0	AHNAK2	104493006	1.000000	0.71417	0.832000	0.32986	0.333000	0.28666	1.790000	0.38734	1.217000	0.43442	-0.156000	0.13503	GAG		0.602	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		30	48	0	0	0	0	30	48				
ATP8B4	79895	broad.mit.edu	37	15	50264849	50264849	+	Silent	SNP	G	G	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr15:50264849G>T	ENST00000284509.6	-	13	1314	c.1173C>A	c.(1171-1173)tcC>tcA	p.S391S	ATP8B4_ENST00000559829.1_Silent_p.S391S	NM_024837.2	NP_079113.2	Q8TF62	AT8B4_HUMAN	ATPase, class I, type 8B, member 4	391						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(6)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|urinary_tract(1)	73		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		CCGTTTTGTCGGAGAAAATGT	0.433																																						uc001zxu.2		NA																	0				skin(3)|ovary(2)|breast(2)|large_intestine(1)	8						c.(1171-1173)TCC>TCA		ATPase class I type 8B member 4							114.0	97.0	103.0					15																	50264849		2196	4295	6491	SO:0001819	synonymous_variant	79895				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr15:50264849G>T	AB075819	CCDS32238.1	15q21.2	2010-04-20	2007-09-19		ENSG00000104043	ENSG00000104043		"""ATPases / P-type"""	13536	protein-coding gene	gene with protein product		609123	"""ATPase, Class I, type 8B, member 4"""			11015572	Standard	NM_024837		Approved	ATPIM, KIAA1939	uc001zxu.3	Q8TF62		ENST00000284509.6:c.1173C>A	15.37:g.50264849G>T			Somatic				ATP8B4_uc010ber.2_Silent_p.S264S|ATP8B4_uc010ufd.1_Silent_p.S264S|ATP8B4_uc010ufe.1_RNA	p.S391S	NM_024837	NP_079113	WXS	Illumina HiSeq	Unspecified	Q8TF62	AT8B4_HUMAN		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)	13	1315	-		all_lung(180;0.00183)	391			Cytoplasmic (Potential).		Q9H727	Silent	SNP	ENST00000284509.6	37	c.1173C>A	CCDS32238.1																																																																																				0.433	ATP8B4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418100.1	NM_024837		20	3	1	0	3.8e-18	5.02e-18	20	3				
USP8	9101	broad.mit.edu	37	15	50769168	50769168	+	Silent	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr15:50769168G>A	ENST00000396444.3	+	9	1310	c.972G>A	c.(970-972)caG>caA	p.Q324Q	USP8_ENST00000307179.4_Silent_p.Q324Q|USP8_ENST00000433963.1_Silent_p.Q324Q|USP8_ENST00000425032.3_Silent_p.Q247Q	NM_001128610.1|NM_005154.3	NP_001122082.1|NP_005145.3	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8	324					cell proliferation (GO:0008283)|endosome organization (GO:0007032)|mitotic cytokinesis (GO:0000281)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|Ras protein signal transduction (GO:0007265)|ubiquitin-dependent protein catabolic process (GO:0006511)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|midbody (GO:0030496)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		CACGACGCCAGAATGAAGAGG	0.393																																						uc001zym.3		NA																	0				lung(1)|central_nervous_system(1)	2						c.(970-972)CAG>CAA		ubiquitin specific peptidase 8							87.0	76.0	80.0					15																	50769168		2196	4294	6490	SO:0001819	synonymous_variant	9101				cell cycle|cell proliferation|endosome organization|protein K48-linked deubiquitination|protein K63-linked deubiquitination|ubiquitin-dependent protein catabolic process	cytosol|early endosome|extrinsic to plasma membrane|nucleus	cysteine-type endopeptidase activity|SH3 domain binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr15:50769168G>A	D29956	CCDS10137.1, CCDS61632.1	15q21.1	2014-03-03	2005-08-08		ENSG00000138592	ENSG00000138592		"""Ubiquitin-specific peptidases"""	12631	protein-coding gene	gene with protein product		603158	"""ubiquitin specific protease 8"""			12838346, 9582025, 24482476	Standard	NM_005154		Approved	HumORF8, KIAA0055, UBPY, SPG59	uc001zyl.4	P40818	OTTHUMG00000131645	ENST00000396444.3:c.972G>A	15.37:g.50769168G>A			Somatic				USP8_uc001zyk.1_Missense_Mutation_p.R24K|USP8_uc001zyl.3_Silent_p.Q324Q|USP8_uc001zyn.3_Silent_p.Q324Q|USP8_uc010ufh.1_Silent_p.Q247Q|USP8_uc010bev.1_Intron	p.Q324Q	NM_001128611	NP_001122083	WXS	Illumina HiSeq	Unspecified	P40818	UBP8_HUMAN		all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)	10	1472	+			324					B4DKA8|Q2TB31|Q7Z3U2|Q86VA0|Q8IWI7	Silent	SNP	ENST00000396444.3	37	c.972G>A	CCDS10137.1																																																																																				0.393	USP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254541.1	NM_005154		26	14	0	0	0	0	26	14				
CSPG4	1464	broad.mit.edu	37	15	75982451	75982451	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr15:75982451G>A	ENST00000308508.5	-	3	1047	c.955C>T	c.(955-957)Cgg>Tgg	p.R319W		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	319	Globular or compact configuration stabilized by disulfide bonds.|Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.|Neurite growth inhibition. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						AGACTGCCCCGTGGCTCCAGG	0.617																																						uc002baw.2		NA																	0				ovary(2)|pancreas(1)	3						c.(955-957)CGG>TGG		chondroitin sulfate proteoglycan 4 precursor							20.0	17.0	18.0					15																	75982451		2189	4281	6470	SO:0001583	missense	1464				angiogenesis|cell differentiation|intracellular signal transduction|positive regulation of peptidyl-tyrosine phosphorylation|tissue remodeling	apical plasma membrane|cell surface|integral to plasma membrane|intracellular|lamellipodium membrane	protein kinase binding|signal transducer activity	g.chr15:75982451G>A	X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.955C>T	15.37:g.75982451G>A	ENSP00000312506:p.Arg319Trp		Somatic					p.R319W	NM_001897	NP_001888	WXS	Illumina HiSeq	Unspecified	Q6UVK1	CSPG4_HUMAN			3	1048	-			319			Extracellular (Potential).|Neurite growth inhibition (By similarity).|Globular or compact configuration stabilized by disulfide bonds.|Laminin G-like 2.		D3DW77|Q92675	Missense_Mutation	SNP	ENST00000308508.5	37	c.955C>T	CCDS10284.1	.	.	.	.	.	.	.	.	.	.	.	13.70	2.314164	0.40996	.	.	ENSG00000173546	ENST00000308508	T	0.78246	-1.16	5.26	4.33	0.51752	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.581990	0.17476	N	0.172896	T	0.79353	0.4431	L	0.43152	1.355	0.09310	N	1	D	0.67145	0.996	P	0.54210	0.745	T	0.71567	-0.4554	10	0.72032	D	0.01	.	13.1712	0.59599	0.0:0.1601:0.8399:0.0	.	319	Q6UVK1	CSPG4_HUMAN	W	319	ENSP00000312506:R319W	ENSP00000312506:R319W	R	-	1	2	CSPG4	73769506	0.562000	0.26586	0.009000	0.14445	0.262000	0.26303	4.234000	0.58658	1.180000	0.42898	0.555000	0.69702	CGG		0.617	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286472.1	NM_001897		12	7	0	0	0	0	12	7				
HDGFRP3	50810	broad.mit.edu	37	15	83820108	83820108	+	Silent	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr15:83820108G>A	ENST00000299633.4	-	5	1068	c.465C>T	c.(463-465)tcC>tcT	p.S155S		NM_016073.3	NP_057157.1	Q9Y3E1	HDGR3_HUMAN		155					cell proliferation (GO:0008283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				kidney(1)|large_intestine(1)|lung(4)|prostate(1)	7						ACTGTTTAGAGGATTTCTAAA	0.393																																						uc002bjs.1		NA																	0					0						c.(463-465)TCC>TCT		hepatoma-derived growth factor, related protein							93.0	86.0	88.0					15																	83820108		2203	4300	6503	SO:0001819	synonymous_variant	50810				cell proliferation	nucleus	growth factor activity	g.chr15:83820108G>A																												ENST00000299633.4:c.465C>T	15.37:g.83820108G>A			Somatic					p.S155S	NM_016073	NP_057157	WXS	Illumina HiSeq	Unspecified	Q9Y3E1	HDGR3_HUMAN			5	620	-			155						Silent	SNP	ENST00000299633.4	37	c.465C>T	CCDS32314.1																																																																																				0.393	HDGFRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419898.1			17	31	0	0	0	0	17	31				
CACNA1H	8912	broad.mit.edu	37	16	1245997	1245997	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr16:1245997C>T	ENST00000348261.5	+	5	865	c.617C>T	c.(616-618)cCc>cTc	p.P206L	CACNA1H_ENST00000358590.4_Missense_Mutation_p.P206L|CACNA1H_ENST00000565831.1_Missense_Mutation_p.P206L	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	206					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	GTGCTGCGGCCCCTCCGCGCC	0.657																																						uc002cks.2		NA																	0				breast(2)	2						c.(616-618)CCC>CTC		calcium channel, voltage-dependent, T type,	Flunarizine(DB04841)|Mibefradil(DB01388)						50.0	60.0	57.0					16																	1245997		2041	4176	6217	SO:0001583	missense	8912				aldosterone biosynthetic process|axon guidance|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|muscle contraction|myoblast fusion|positive regulation of acrosome reaction|regulation of heart contraction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity	g.chr16:1245997C>T	AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.617C>T	16.37:g.1245997C>T	ENSP00000334198:p.Pro206Leu		Somatic				CACNA1H_uc002ckt.2_Missense_Mutation_p.P206L	p.P206L	NM_021098	NP_066921	WXS	Illumina HiSeq	Unspecified	O95180	CAC1H_HUMAN			5	865	+		Hepatocellular(780;0.00369)	206			Helical; Name=S4 of repeat I; (Potential).|I.		B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	ENST00000348261.5	37	c.617C>T	CCDS45375.1	.	.	.	.	.	.	.	.	.	.	C	18.74	3.688849	0.68271	.	.	ENSG00000196557	ENST00000348261;ENST00000358590	D;D	0.97976	-4.64;-4.64	4.23	4.23	0.50019	Ion transport (1);	0.255415	0.39274	N	0.001415	D	0.98579	0.9525	M	0.79805	2.47	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.99624	1.0984	10	0.66056	D	0.02	.	15.9489	0.79817	0.0:1.0:0.0:0.0	.	206;206	O95180-2;O95180	.;CAC1H_HUMAN	L	206	ENSP00000334198:P206L;ENSP00000351401:P206L	ENSP00000334198:P206L	P	+	2	0	CACNA1H	1185998	1.000000	0.71417	0.999000	0.59377	0.053000	0.15095	5.887000	0.69751	2.061000	0.61500	0.478000	0.44815	CCC		0.657	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421601.1	NM_001005407		41	56	0	0	0	0	41	56				
RAB26	25837	broad.mit.edu	37	16	2201695	2201695	+	Splice_Site	SNP	G	G	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr16:2201695G>T	ENST00000210187.6	+	4	508		c.e4-1		RAB26_ENST00000541451.1_Splice_Site	NM_014353.4	NP_055168.2	Q9ULW5	RAB26_HUMAN	RAB26, member RAS oncogene family						exocrine system development (GO:0035272)|Golgi to plasma membrane protein transport (GO:0043001)|regulated secretory pathway (GO:0045055)|regulation of exocytosis (GO:0017157)|small GTPase mediated signal transduction (GO:0007264)	Golgi membrane (GO:0000139)|intrinsic component of plasma membrane (GO:0031226)|secretory granule membrane (GO:0030667)	GMP binding (GO:0019002)|GTP binding (GO:0005525)			kidney(1)|large_intestine(1)|lung(3)	5						TGTCGCTGCAGATGTGGGACA	0.622																																						uc002cou.2		NA																	0					0						c.e4-1		RAB26, member RAS oncogene family							105.0	89.0	94.0					16																	2201695		2197	4300	6497	SO:0001630	splice_region_variant	25837				exocrine system development|protein transport|regulation of exocytosis|small GTPase mediated signal transduction	intrinsic to plasma membrane	GTP binding|protein binding	g.chr16:2201695G>T	AB027137	CCDS10460.1	16p13.3	2008-07-28			ENSG00000167964	ENSG00000167964		"""RAB, member RAS oncogene"""	14259	protein-coding gene	gene with protein product		605455				11043516	Standard	NM_014353		Approved		uc002cou.3	Q9ULW5	OTTHUMG00000128829	ENST00000210187.6:c.349-1G>T	16.37:g.2201695G>T			Somatic				RAB26_uc010bsf.2_Splice_Site_p.M51_splice	p.M117_splice	NM_014353	NP_055168	WXS	Illumina HiSeq	Unspecified	Q9ULW5	RAB26_HUMAN			4	483	+								B2RAA6|Q3L6K5|Q6NXS7	Splice_Site	SNP	ENST00000210187.6	37	c.349_splice	CCDS10460.1	.	.	.	.	.	.	.	.	.	.	G	12.45	1.941245	0.34283	.	.	ENSG00000167964	ENST00000541451;ENST00000210187	.	.	.	3.85	3.85	0.44370	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5154	0.67816	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RAB26	2141696	1.000000	0.71417	0.990000	0.47175	0.493000	0.33554	8.832000	0.92079	1.994000	0.58287	0.305000	0.20034	.		0.622	RAB26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250767.2		Intron	16	31	1	0	7.05e-17	9.26e-17	16	31				
RAB26	25837	broad.mit.edu	37	16	2203334	2203334	+	Missense_Mutation	SNP	G	G	A	rs149402189		TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr16:2203334G>A	ENST00000210187.6	+	9	843	c.683G>A	c.(682-684)cGc>cAc	p.R228H	RP11-304L19.5_ENST00000563192.1_lincRNA|TRAF7_ENST00000326181.6_5'Flank|RAB26_ENST00000541451.1_Missense_Mutation_p.R162H|SNORD60_ENST00000383903.1_RNA	NM_014353.4	NP_055168.2	Q9ULW5	RAB26_HUMAN	RAB26, member RAS oncogene family	228					exocrine system development (GO:0035272)|Golgi to plasma membrane protein transport (GO:0043001)|regulated secretory pathway (GO:0045055)|regulation of exocytosis (GO:0017157)|small GTPase mediated signal transduction (GO:0007264)	Golgi membrane (GO:0000139)|intrinsic component of plasma membrane (GO:0031226)|secretory granule membrane (GO:0030667)	GMP binding (GO:0019002)|GTP binding (GO:0005525)			kidney(1)|large_intestine(1)|lung(3)	5						TTGAAGCAGCGCTCCATGAAG	0.642													G|||	1	0.000199681	0.0	0.0	5008	,	,		17047	0.0		0.001	False		,,,				2504	0.0					uc002cou.2		NA																	0					0						c.(682-684)CGC>CAC		RAB26, member RAS oncogene family		G	HIS/ARG	1,4395	2.1+/-5.4	0,1,2197	53.0	57.0	56.0		683	3.5	0.8	16	dbSNP_134	56	18,8582	12.6+/-44.7	0,18,4282	yes	missense	RAB26	NM_014353.4	29	0,19,6479	AA,AG,GG		0.2093,0.0227,0.1462	probably-damaging	228/257	2203334	19,12977	2198	4300	6498	SO:0001583	missense	25837				exocrine system development|protein transport|regulation of exocytosis|small GTPase mediated signal transduction	intrinsic to plasma membrane	GTP binding|protein binding	g.chr16:2203334G>A	AB027137	CCDS10460.1	16p13.3	2008-07-28			ENSG00000167964	ENSG00000167964		"""RAB, member RAS oncogene"""	14259	protein-coding gene	gene with protein product		605455				11043516	Standard	NM_014353		Approved		uc002cou.3	Q9ULW5	OTTHUMG00000128829	ENST00000210187.6:c.683G>A	16.37:g.2203334G>A	ENSP00000210187:p.Arg228His		Somatic				RAB26_uc010bsf.2_Missense_Mutation_p.R162H|TRAF7_uc002cow.2_5'Flank	p.R228H	NM_014353	NP_055168	WXS	Illumina HiSeq	Unspecified	Q9ULW5	RAB26_HUMAN			9	817	+			228					B2RAA6|Q3L6K5|Q6NXS7	Missense_Mutation	SNP	ENST00000210187.6	37	c.683G>A	CCDS10460.1	.	.	.	.	.	.	.	.	.	.	G	14.83	2.653814	0.47362	2.27E-4	0.002093	ENSG00000167964	ENST00000541451;ENST00000210187	T;T	0.80304	-1.36;-1.36	4.42	3.46	0.39613	.	0.000000	0.64402	U	0.000005	T	0.72495	0.3467	L	0.49640	1.575	0.46849	D	0.999222	P	0.46578	0.88	B	0.37943	0.261	T	0.74682	-0.3583	10	0.87932	D	0	.	10.4233	0.44363	0.0977:0.0:0.9023:0.0	.	228	Q9ULW5	RAB26_HUMAN	H	162;228	ENSP00000441580:R162H;ENSP00000210187:R228H	ENSP00000210187:R228H	R	+	2	0	RAB26	2143335	0.992000	0.36948	0.761000	0.31378	0.514000	0.34195	7.184000	0.77705	1.079000	0.41038	0.313000	0.20887	CGC		0.642	RAB26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250767.2			26	48	0	0	0	0	26	48				
USP7	7874	broad.mit.edu	37	16	8990890	8990890	+	Missense_Mutation	SNP	C	C	G	rs368894909		TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr16:8990890C>G	ENST00000344836.4	-	26	2983	c.2785G>C	c.(2785-2787)Gtg>Ctg	p.V929L	USP7_ENST00000535863.1_Missense_Mutation_p.V830L|USP7_ENST00000381886.4_Missense_Mutation_p.V913L	NM_003470.2	NP_003461.2	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7 (herpes virus-associated)	929					maintenance of DNA methylation (GO:0010216)|multicellular organismal development (GO:0007275)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|protein deubiquitination (GO:0016579)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|transcription-coupled nucleotide-excision repair (GO:0006283)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|p53 binding (GO:0002039)|protein C-terminus binding (GO:0008022)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(13)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	48						CCAAGCTCCACGGCCTTTTTA	0.438																																						uc002czl.2		NA																	0				ovary(3)	3						c.(2785-2787)GTG>CTG		ubiquitin specific peptidase 7							286.0	258.0	267.0					16																	8990890		2197	4300	6497	SO:0001583	missense	7874				interspecies interaction between organisms|multicellular organismal development|protein deubiquitination|regulation of sequence-specific DNA binding transcription factor activity|ubiquitin-dependent protein catabolic process	cytoplasm|PML body	cysteine-type endopeptidase activity|p53 binding|protein C-terminus binding|transcription factor binding|ubiquitin protein ligase binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr16:8990890C>G	Z72499	CCDS32385.1, CCDS66941.1	16p13.3	2008-04-11	2005-08-08			ENSG00000187555		"""Ubiquitin-specific peptidases"""	12630	protein-coding gene	gene with protein product		602519	"""ubiquitin specific protease 7 (herpes virus-associated)"""	HAUSP		12838346, 9925944	Standard	NM_003470		Approved		uc002czl.2	Q93009		ENST00000344836.4:c.2785G>C	16.37:g.8990890C>G	ENSP00000343535:p.Val929Leu		Somatic				USP7_uc010uyk.1_Missense_Mutation_p.V830L|USP7_uc002czj.2_RNA|USP7_uc010uyj.1_Missense_Mutation_p.V830L|USP7_uc002czk.2_Missense_Mutation_p.V913L	p.V929L	NM_003470	NP_003461	WXS	Illumina HiSeq	Unspecified	Q93009	UBP7_HUMAN			26	2984	-			929					A6NMY8|B7Z815|H0Y3G8	Missense_Mutation	SNP	ENST00000344836.4	37	c.2785G>C	CCDS32385.1	.	.	.	.	.	.	.	.	.	.	C	16.67	3.188474	0.57909	.	.	ENSG00000187555	ENST00000344836;ENST00000381886;ENST00000535863	T;T	0.07688	3.17;3.19	5.68	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.05410	0.0143	N	0.11201	0.11	0.80722	D	1	B;B	0.12630	0.006;0.006	B;B	0.08055	0.003;0.003	T	0.40831	-0.9542	10	0.22109	T	0.4	.	15.0751	0.72071	0.0:0.9318:0.0:0.0682	.	929;913	Q93009;B7Z815	UBP7_HUMAN;.	L	929;937;830	ENSP00000343535:V929L;ENSP00000443646:V830L	ENSP00000343535:V929L	V	-	1	0	USP7	8898391	1.000000	0.71417	0.367000	0.25926	0.992000	0.81027	7.684000	0.84104	1.539000	0.49286	0.650000	0.86243	GTG		0.438	USP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434268.2			13	251	0	0	0	0	13	251				
CIITA	4261	broad.mit.edu	37	16	11004076	11004076	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr16:11004076G>T	ENST00000324288.8	+	13	2981	c.2848G>T	c.(2848-2850)Gag>Tag	p.E950*	CIITA_ENST00000381835.5_Nonsense_Mutation_p.E366*|CIITA_ENST00000537380.1_3'UTR	NM_000246.3	NP_000237	P33076	C2TA_HUMAN	class II, major histocompatibility complex, transactivator	950			Missing (in BLS2). {ECO:0000269|PubMed:8402893}.		aging (GO:0007568)|cellular response to electrical stimulus (GO:0071257)|cellular response to exogenous dsRNA (GO:0071360)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to antibiotic (GO:0046677)|response to interferon-gamma (GO:0034341)|transcription, DNA-templated (GO:0006351)	cell surface (GO:0009986)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|kinase activity (GO:0016301)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transferase activity, transferring acyl groups (GO:0016746)			central_nervous_system(1)|large_intestine(7)|ovary(1)|skin(1)|stomach(2)	12						CACAGCTGGGGAGCTCCCTGC	0.557			T	"""FLJ27352, CD274, CD273, RALGDS, RUNDC2A, C16orf75, BCL6"""	"""PMBL, Hodgkin Lymphona, """																																	uc002dai.3		NA		Dom	yes		16	16p13	4261	T	"""class II, major histocompatibility complex, transactivator"""			L	FLJ27352|CD274|CD273|RALGDS|RUNDC2A|C16orf75		PMBL|Hodgkin Lymphona|		0				central_nervous_system(1)	1						c.(2848-2850)GAG>TAG		class II transactivator							89.0	67.0	75.0					16																	11004076		2197	4300	6497	SO:0001587	stop_gained	4261				interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|response to antibiotic|transcription, DNA-dependent	nucleus	activating transcription factor binding|ATP binding|protein C-terminus binding|protein complex binding|transcription coactivator activity|transcription regulatory region DNA binding	g.chr16:11004076G>T	U18259	CCDS10544.1, CCDS66943.1, CCDS73826.1	16p13	2014-09-17	2005-08-12	2005-08-12	ENSG00000179583	ENSG00000179583		"""Nucleotide-binding domain and leucine rich repeat containing"""	7067	protein-coding gene	gene with protein product	"""NLR family, acid domain containing"", ""nucleotide-binding oligomerization domain, leucine rich repeat and acid domain containing"""	600005	"""MHC class II transactivator"""	MHC2TA		8402893	Standard	NM_000246		Approved	C2TA, NLRA	uc002dai.4	P33076	OTTHUMG00000129753	ENST00000324288.8:c.2848G>T	16.37:g.11004076G>T	ENSP00000316328:p.Glu950*		Somatic				CIITA_uc002daj.3_Nonsense_Mutation_p.E951*|CIITA_uc002dak.3_Nonsense_Mutation_p.E366*|CIITA_uc010bup.1_Silent_p.G346G	p.E950*	NM_000246	NP_000237	WXS	Illumina HiSeq	Unspecified	P33076	C2TA_HUMAN			13	2981	+			950		Missing (in BLS2).			A0N0N9|D3DUG0|E9PFE0|Q29675|Q8SNB8|Q96KL4	Nonsense_Mutation	SNP	ENST00000324288.8	37	c.2848G>T	CCDS10544.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.966794	0.92855	.	.	ENSG00000179583	ENST00000324288;ENST00000381835	.	.	.	5.05	4.04	0.47022	.	1.246530	0.05594	N	0.575166	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	.	12.0117	0.53291	0.0:0.175:0.825:0.0	.	.	.	.	X	950;366	.	ENSP00000316328:E950X	E	+	1	0	CIITA	10911577	0.095000	0.21747	0.009000	0.14445	0.506000	0.33950	2.294000	0.43567	2.509000	0.84616	0.561000	0.74099	GAG		0.557	CIITA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251966.2	NM_000246		11	22	1	0	0.00010058	0.000118119	11	22				
MYH11	4629	broad.mit.edu	37	16	15797863	15797863	+	Silent	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr16:15797863G>A	ENST00000300036.5	-	41	6013	c.5904C>T	c.(5902-5904)acC>acT	p.T1968T	MYH11_ENST00000396324.3_Silent_p.T1975T|MYH11_ENST00000576790.2_3'UTR|MYH11_ENST00000452625.2_3'UTR|NDE1_ENST00000396355.1_Intron|NDE1_ENST00000342673.5_Intron|MYH11_ENST00000573908.1_5'UTR|NDE1_ENST00000396354.1_Intron	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	1968	C-terminal.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						CACTGGCCTTGGTTCCATTGA	0.428			T	CBFB	AML																																	uc002ddy.2		NA		Dom	yes		16	16p13.13-p13.12	4629	T	"""myosin, heavy polypeptide 11, smooth muscle"""			L	CBFB		AML		0				ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15						c.(5902-5904)ACC>ACT		smooth muscle myosin heavy chain 11 isoform							233.0	229.0	230.0					16																	15797863		2197	4300	6497	SO:0001819	synonymous_variant	4629				axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle	g.chr16:15797863G>A	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.5904C>T	16.37:g.15797863G>A			Somatic				MYH11_uc002ddv.2_3'UTR|MYH11_uc002ddw.2_3'UTR|MYH11_uc002ddx.2_Silent_p.T1975T|MYH11_uc010bvg.2_3'UTR|NDE1_uc010uzy.1_Intron|NDE1_uc002dds.2_Intron	p.T1968T	NM_002474	NP_002465	WXS	Illumina HiSeq	Unspecified	P35749	MYH11_HUMAN			41	6011	-			1968			Carboxyl-terminal.		D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Silent	SNP	ENST00000300036.5	37	c.5904C>T	CCDS10565.1	.	.	.	.	.	.	.	.	.	.	G	9.101	1.004126	0.19199	.	.	ENSG00000133392	ENST00000396320	.	.	.	5.43	4.45	0.53987	.	.	.	.	.	T	0.64746	0.2626	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.63659	-0.6587	5	0.39692	T	0.17	.	12.0511	0.53507	0.0:0.1736:0.8264:0.0	.	.	.	.	L	1988	.	ENSP00000379613:P1988L	P	-	2	0	MYH11	15705364	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	1.571000	0.36450	1.244000	0.43870	0.561000	0.74099	CCA		0.428	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113		111	153	0	0	0	0	111	153				
ZNF768	79724	broad.mit.edu	37	16	30536326	30536326	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr16:30536326C>A	ENST00000380412.5	-	2	1310	c.1135G>T	c.(1135-1137)Ggc>Tgc	p.G379C	ZNF768_ENST00000562803.1_Missense_Mutation_p.G348C	NM_024671.3	NP_078947.3	Q9H5H4	ZN768_HUMAN	zinc finger protein 768	379					regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	DNA-directed RNA polymerase II, core complex (GO:0005665)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|prostate(1)	15						TAGCACTTGCCGCACTCGGTG	0.637																																						uc002dyk.3		NA																	0					0						c.(1135-1137)GGC>TGC		zinc finger protein 768							43.0	42.0	42.0					16																	30536326		2197	4300	6497	SO:0001583	missense	79724				regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	DNA-directed RNA polymerase II, core complex	DNA binding|zinc ion binding	g.chr16:30536326C>A	BC013760	CCDS10681.2	16p11.2	2013-01-08			ENSG00000169957	ENSG00000169957		"""Zinc fingers, C2H2-type"""	26273	protein-coding gene	gene with protein product						12477932	Standard	NM_024671		Approved	FLJ23436	uc002dyk.4	Q9H5H4	OTTHUMG00000132392	ENST00000380412.5:c.1135G>T	16.37:g.30536326C>A	ENSP00000369777:p.Gly379Cys		Somatic				ZNF768_uc010vex.1_Missense_Mutation_p.G348C|uc002dyl.1_5'Flank|ZNF768_uc010vew.1_Missense_Mutation_p.G348C	p.G379C	NM_024671	NP_078947	WXS	Illumina HiSeq	Unspecified	Q9H5H4	ZN768_HUMAN			2	1311	-			379			C2H2-type 5.		Q569L7|Q96CX4	Missense_Mutation	SNP	ENST00000380412.5	37	c.1135G>T	CCDS10681.2	.	.	.	.	.	.	.	.	.	.	C	17.08	3.298220	0.60195	.	.	ENSG00000169957	ENST00000380412;ENST00000538507	T	0.07800	3.16	4.72	4.72	0.59763	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.41396	D	0.000883	T	0.37892	0.1020	M	0.91038	3.17	0.46901	D	0.99924	D	0.89917	1.0	D	0.83275	0.996	T	0.49624	-0.8920	10	0.87932	D	0	-12.1614	16.5926	0.84770	0.0:1.0:0.0:0.0	.	379	Q9H5H4	ZN768_HUMAN	C	379;292	ENSP00000369777:G379C	ENSP00000369777:G379C	G	-	1	0	ZNF768	30443827	.	.	1.000000	0.80357	0.684000	0.39900	.	.	2.470000	0.83445	0.436000	0.28706	GGC		0.637	ZNF768-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255522.2	NM_024671		23	20	1	0	2.42e-17	3.18e-17	23	20				
ITGAD	3681	broad.mit.edu	37	16	31422110	31422110	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr16:31422110G>T	ENST00000389202.2	+	12	1316	c.1267G>T	c.(1267-1269)Gcc>Tcc	p.A423S		NM_005353.2	NP_005344.2	Q13349	ITAD_HUMAN	integrin, alpha D	423					activated T cell proliferation (GO:0050798)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)	cell surface (GO:0009986)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(43)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						GGTCCTGGGGGCCCCCCGCTA	0.642																																						uc002ebv.1		NA																	0				skin(1)	1						c.(1267-1269)GCC>TCC		integrin, alpha D precursor							36.0	37.0	36.0					16																	31422110		2197	4300	6497	SO:0001583	missense	3681				cell-cell adhesion|cell-matrix adhesion|immune response|integrin-mediated signaling pathway	integrin complex	receptor activity	g.chr16:31422110G>T	U40274	CCDS32438.1	16p13.1-p11	2010-03-23				ENSG00000156886		"""CD molecules"", ""Integrins"""	6146	protein-coding gene	gene with protein product		602453				8666289, 9598326	Standard	NM_005353		Approved	CD11d, ADB2	uc002ebv.1	Q13349		ENST00000389202.2:c.1267G>T	16.37:g.31422110G>T	ENSP00000373854:p.Ala423Ser		Somatic				ITGAD_uc010cap.1_Missense_Mutation_p.A423S	p.A423S	NM_005353	NP_005344	WXS	Illumina HiSeq	Unspecified	Q13349	ITAD_HUMAN			12	1316	+			423			FG-GAP 4.|Extracellular (Potential).		Q15575|Q15576	Missense_Mutation	SNP	ENST00000389202.2	37	c.1267G>T	CCDS32438.1	.	.	.	.	.	.	.	.	.	.	g	15.28	2.786879	0.49997	.	.	ENSG00000156886	ENST00000444228;ENST00000389202	T	0.39056	1.1	4.4	2.39	0.29439	.	.	.	.	.	T	0.65133	0.2662	M	0.90145	3.09	0.32280	N	0.567672	D;D	0.67145	0.996;0.996	D;D	0.68621	0.959;0.959	T	0.69873	-0.5027	9	0.72032	D	0.01	.	7.479	0.27393	0.0971:0.169:0.7339:0.0	.	439;423	Q59H14;Q13349	.;ITAD_HUMAN	S	439;423	ENSP00000373854:A423S	ENSP00000373854:A423S	A	+	1	0	ITGAD	31329611	1.000000	0.71417	0.995000	0.50966	0.190000	0.23558	3.222000	0.51223	0.292000	0.22492	0.197000	0.17608	GCC		0.642	ITGAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432836.1	NM_005353		25	53	1	0	7.38e-10	9.3e-10	25	53				
RFWD3	55159	broad.mit.edu	37	16	74695292	74695292	+	Missense_Mutation	SNP	T	T	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr16:74695292T>A	ENST00000361070.4	-	2	153	c.56A>T	c.(55-57)cAa>cTa	p.Q19L	RFWD3_ENST00000571750.1_Missense_Mutation_p.Q19L	NM_018124.3	NP_060594.3	Q6PCD5	RFWD3_HUMAN	ring finger and WD repeat domain 3	19					DNA repair (GO:0006281)|mitotic G1 DNA damage checkpoint (GO:0031571)|protein ubiquitination (GO:0016567)|regulation of DNA damage checkpoint (GO:2000001)|response to ionizing radiation (GO:0010212)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|MDM2/MDM4 family protein binding (GO:0097371)|p53 binding (GO:0002039)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	26						AGCTGGCTGTTGTTCGGCATG	0.483																																						uc002fda.2		NA																	0				lung(2)|breast(1)	3						c.(55-57)CAA>CTA		ring finger and WD repeat domain 3							122.0	130.0	127.0					16																	74695292		2197	4299	6496	SO:0001583	missense	55159				DNA repair|mitotic cell cycle G1/S transition DNA damage checkpoint|response to ionizing radiation	nucleus	MDM2 binding|p53 binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr16:74695292T>A	AK001382	CCDS32486.1	16q22.3	2013-01-09						"""WD repeat domain containing"", ""RING-type (C3HC4) zinc fingers"""	25539	protein-coding gene	gene with protein product		614151				21504906	Standard	XM_005256021		Approved	FLJ10520, RNF201	uc002fda.3	Q6PCD5		ENST00000361070.4:c.56A>T	16.37:g.74695292T>A	ENSP00000354361:p.Gln19Leu		Somatic				RFWD3_uc010cgq.2_Missense_Mutation_p.Q19L	p.Q19L	NM_018124	NP_060594	WXS	Illumina HiSeq	Unspecified	Q6PCD5	RFWD3_HUMAN			2	154	-			19					A8K585|B2RE35|D3DUJ8|Q5XKR3|Q9H9Q3|Q9NVT4	Missense_Mutation	SNP	ENST00000361070.4	37	c.56A>T	CCDS32486.1	.	.	.	.	.	.	.	.	.	.	T	10.76	1.441502	0.25900	.	.	ENSG00000168411	ENST00000361070;ENST00000444004	T	0.19105	2.17	3.66	3.66	0.41972	.	6.749730	0.00481	N	0.000122	T	0.14743	0.0356	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.11665	-1.0578	10	0.87932	D	0	-0.4669	8.99	0.36017	0.0:0.0:0.0:1.0	.	19	Q6PCD5	RFWD3_HUMAN	L	19	ENSP00000354361:Q19L	ENSP00000354361:Q19L	Q	-	2	0	RFWD3	73252793	0.000000	0.05858	0.074000	0.20217	0.033000	0.12548	0.009000	0.13219	1.915000	0.55452	0.533000	0.62120	CAA		0.483	RFWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436506.2	NM_018124		112	170	0	0	0	0	112	170				
GAN	8139	broad.mit.edu	37	16	81399047	81399047	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr16:81399047C>T	ENST00000568107.2	+	9	1628	c.1466C>T	c.(1465-1467)aCt>aTt	p.T489I	GAN_ENST00000567335.1_3'UTR	NM_022041.3	NP_071324.1	Q9H2C0	GAN_HUMAN	gigaxonin	489					cell death (GO:0008219)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)	25		Colorectal(91;0.153)				GAGATGGTAACTTGCAAGTCC	0.468																																					GBM(106;1239 1507 7582 9741 33976)	uc002fgo.2		NA																	0				ovary(2)	2						c.(1465-1467)ACT>ATT		gigaxonin							248.0	219.0	229.0					16																	81399047		2201	4300	6501	SO:0001583	missense	8139				cell death	cytoplasm|neurofilament	protein binding	g.chr16:81399047C>T	AF291673	CCDS10935.1	16q24.1	2014-09-17	2008-08-01		ENSG00000261609	ENSG00000261609		"""Kelch-like"", ""BTB/POZ domain containing"""	4137	protein-coding gene	gene with protein product	"""kelch-like family member 16"""	605379	"""giant axonal neuropathy (gigaxonin)"""			9450783, 11062483	Standard	NM_022041		Approved	GAN1, KLHL16	uc002fgo.3	Q9H2C0	OTTHUMG00000137627	ENST00000568107.2:c.1466C>T	16.37:g.81399047C>T	ENSP00000476795:p.Thr489Ile		Somatic					p.T489I	NM_022041	NP_071324	WXS	Illumina HiSeq	Unspecified	Q9H2C0	GAN_HUMAN			9	1614	+		Colorectal(91;0.153)	489			Kelch 5.			Missense_Mutation	SNP	ENST00000568107.2	37	c.1466C>T	CCDS10935.1	.	.	.	.	.	.	.	.	.	.	C	13.97	2.396813	0.42512	.	.	ENSG00000127688	ENST00000248272	T	0.66815	-0.23	5.69	5.69	0.88448	Galactose oxidase, beta-propeller (1);	5.349510	0.00357	N	0.000029	T	0.63129	0.2485	N	0.14661	0.345	0.80722	D	1	P	0.41313	0.745	B	0.41236	0.351	T	0.55418	-0.8144	10	0.31617	T	0.26	.	20.181	0.98201	0.0:1.0:0.0:0.0	.	489	Q9H2C0	GAN_HUMAN	I	489	ENSP00000248272:T489I	ENSP00000248272:T489I	T	+	2	0	GAN	79956548	1.000000	0.71417	0.149000	0.22428	0.175000	0.22909	5.804000	0.69135	2.840000	0.97914	0.655000	0.94253	ACT		0.468	GAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269050.3			93	96	0	0	0	0	93	96				
ITGAE	3682	broad.mit.edu	37	17	3631298	3631298	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr17:3631298C>T	ENST00000263087.4	-	26	3097	c.2999G>A	c.(2998-3000)gGa>gAa	p.G1000E	ITGAE_ENST00000571185.1_5'UTR|CTD-3195I5.4_ENST00000575043.1_RNA	NM_002208.4	NP_002199.3	P38570	ITAE_HUMAN	integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)	1000					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	external side of plasma membrane (GO:0009897)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)		GTATTCTGCTCCAAAGAGGTT	0.418																																					NSCLC(182;635 2928 8995 38788)	uc002fwo.3		NA																	0				large_intestine(2)|breast(1)|pancreas(1)	4						c.(2998-3000)GGA>GAA		integrin, alpha E precursor							126.0	117.0	120.0					17																	3631298		2203	4300	6503	SO:0001583	missense	3682				cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity	g.chr17:3631298C>T	L25851	CCDS32531.1	17p13	2010-03-23				ENSG00000083457		"""CD molecules"", ""Integrins"""	6147	protein-coding gene	gene with protein product		604682				8119947	Standard	NM_002208		Approved	CD103, HUMINAE	uc002fwo.4	P38570		ENST00000263087.4:c.2999G>A	17.37:g.3631298C>T	ENSP00000263087:p.Gly1000Glu		Somatic					p.G1000E	NM_002208	NP_002199	WXS	Illumina HiSeq	Unspecified	P38570	ITAE_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)	26	3098	-			1000			Extracellular (Potential).		Q17RS6|Q9NZU9	Missense_Mutation	SNP	ENST00000263087.4	37	c.2999G>A	CCDS32531.1	.	.	.	.	.	.	.	.	.	.	C	5.113	0.206537	0.09704	.	.	ENSG00000083457	ENST00000263087	T	0.45276	0.9	5.49	2.07	0.26955	Integrin alpha-2 (1);	.	.	.	.	T	0.33265	0.0857	L	0.57536	1.79	0.33026	D	0.529561	B	0.20550	0.046	B	0.22601	0.04	T	0.35375	-0.9791	9	0.11485	T	0.65	.	7.0208	0.24912	0.0:0.6346:0.0:0.3654	.	1000	P38570	ITAE_HUMAN	E	1000	ENSP00000263087:G1000E	ENSP00000263087:G1000E	G	-	2	0	ITGAE	3578047	0.554000	0.26522	0.999000	0.59377	0.940000	0.58332	-0.086000	0.11233	0.672000	0.31204	0.655000	0.94253	GGA		0.418	ITGAE-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438169.1	NM_002208		36	42	0	0	0	0	36	42				
TP53	7157	broad.mit.edu	37	17	7576928	7576928	+	Splice_Site	SNP	T	T	C	rs397516439		TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr17:7576928T>C	ENST00000269305.4	-	9	1109		c.e9-2		TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(28)|p.0?(8)|p.A307fs*34(1)|p.L308fs*31(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGGGCAGTGCTAGGAAAGAGG	0.493		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		38	Unknown(28)|Whole gene deletion(8)|Deletion - Frameshift(2)	p.?(14)|p.0?(7)|p.A307fs*34(1)|p.L308fs*31(1)	lung(11)|upper_aerodigestive_tract(6)|breast(5)|bone(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|urinary_tract(2)|liver(2)|large_intestine(1)|stomach(1)|gastrointestinal_tract_(site_indeterminate)(1)|ovary(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245						c.e9-1	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							137.0	124.0	129.0					17																	7576928		2203	4300	6503	SO:0001630	splice_region_variant	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7576928T>C	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.920-2A>G	17.37:g.7576928T>C		HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)	Somatic				TP53_uc002gig.1_Intron|TP53_uc002gih.2_Splice_Site_p.A307_splice|TP53_uc010cne.1_Splice_Site|TP53_uc010cnf.1_Splice_Site_p.A175_splice|TP53_uc010cng.1_Splice_Site_p.A175_splice|TP53_uc002gii.1_Splice_Site_p.A175_splice|TP53_uc010cnh.1_Splice_Site_p.A307_splice|TP53_uc010cni.1_Splice_Site_p.A307_splice|TP53_uc002gij.2_Splice_Site_p.A307_splice	p.A307_splice	NM_001126112	NP_001119584	WXS	Illumina HiSeq	Unspecified	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	9	1114	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)						Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	ENST00000269305.4	37	c.920_splice	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	8.085	0.773141	0.16051	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	4.71	3.58	0.41010	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.665	0.28426	0.187:0.0:0.0:0.813	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7517653	0.089000	0.21612	0.933000	0.37362	0.236000	0.25371	0.838000	0.27572	1.993000	0.58246	0.459000	0.35465	.		0.493	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Intron	46	45	0	0	0	0	46	45				
NOS2	4843	broad.mit.edu	37	17	26125804	26125804	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr17:26125804G>C	ENST00000313735.6	-	2	265	c.32C>G	c.(31-33)aCc>aGc	p.T11S		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	11					arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	GTGGAATTTGGTCTTGAACAG	0.458																																						uc002gzu.2		NA																	0				skin(2)|ovary(1)|breast(1)	4						c.(31-33)ACC>AGC		nitric oxide synthase 2A	Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)						201.0	187.0	192.0					17																	26125804		2203	4300	6503	SO:0001583	missense	4843				arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding	g.chr17:26125804G>C	U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.32C>G	17.37:g.26125804G>C	ENSP00000327251:p.Thr11Ser		Somatic				NOS2_uc010crh.1_Missense_Mutation_p.T11S|NOS2_uc010wab.1_Missense_Mutation_p.T11S	p.T11S	NM_000625	NP_000616	WXS	Illumina HiSeq	Unspecified	P35228	NOS2_HUMAN			2	296	-			11					A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Missense_Mutation	SNP	ENST00000313735.6	37	c.32C>G	CCDS11223.1	.	.	.	.	.	.	.	.	.	.	G	12.40	1.926117	0.34002	.	.	ENSG00000007171	ENST00000313735;ENST00000379105;ENST00000302153	T	0.01538	4.79	5.79	-1.75	0.08031	.	1.025950	0.07722	N	0.943765	T	0.01558	0.0050	N	0.22421	0.69	0.09310	N	1	B;B	0.18461	0.028;0.007	B;B	0.21360	0.034;0.009	T	0.47661	-0.9100	10	0.56958	D	0.05	.	5.7617	0.18203	0.4242:0.1336:0.4422:0.0	.	11;11	F8WEM3;P35228	.;NOS2_HUMAN	S	11	ENSP00000327251:T11S	ENSP00000305638:T11S	T	-	2	0	NOS2	23149931	0.122000	0.22280	0.000000	0.03702	0.061000	0.15899	0.237000	0.17985	-0.570000	0.06022	0.655000	0.94253	ACC		0.458	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255597.1	NM_000625		33	33	0	0	0	0	33	33				
SUPT6H	6830	broad.mit.edu	37	17	27009843	27009843	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr17:27009843C>T	ENST00000314616.6	+	14	1979	c.1696C>T	c.(1696-1698)Ccc>Tcc	p.P566S	SUPT6H_ENST00000347486.4_Missense_Mutation_p.P566S	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	566	Interaction with KDM6A. {ECO:0000250}.|Interaction with PAAF1.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					TCCCGCGGAGCCCTTGGAGCT	0.602																																						uc002hby.2		NA																	0				ovary(2)|skin(1)	3						c.(1696-1698)CCC>TCC		suppressor of Ty 6 homolog							64.0	57.0	59.0					17																	27009843		2203	4300	6503	SO:0001583	missense	6830				chromatin remodeling|regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter	nucleus	hydrolase activity, acting on ester bonds|RNA binding|sequence-specific DNA binding transcription factor activity	g.chr17:27009843C>T	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.1696C>T	17.37:g.27009843C>T	ENSP00000319104:p.Pro566Ser		Somatic				SUPT6H_uc010crt.2_Missense_Mutation_p.P566S	p.P566S	NM_003170	NP_003161	WXS	Illumina HiSeq	Unspecified	Q7KZ85	SPT6H_HUMAN			14	1786	+	Lung NSC(42;0.00431)		566					A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	ENST00000314616.6	37	c.1696C>T	CCDS32596.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.747810	0.89663	.	.	ENSG00000109111	ENST00000314616;ENST00000347486	T;T	0.27890	1.64;1.64	5.95	5.95	0.96441	Tex-like domain (1);	0.000000	0.85682	D	0.000000	T	0.66107	0.2756	M	0.89534	3.04	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.71527	-0.4566	10	0.87932	D	0	-12.3831	20.3854	0.98941	0.0:1.0:0.0:0.0	.	566	Q7KZ85	SPT6H_HUMAN	S	566	ENSP00000319104:P566S;ENSP00000338143:P566S	ENSP00000319104:P566S	P	+	1	0	SUPT6H	24033970	1.000000	0.71417	0.999000	0.59377	0.709000	0.40893	7.399000	0.79935	2.825000	0.97269	0.655000	0.94253	CCC		0.602	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170		33	46	0	0	0	0	33	46				
AATF	26574	broad.mit.edu	37	17	35306512	35306512	+	Silent	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr17:35306512G>A	ENST00000225402.5	+	1	338	c.87G>A	c.(85-87)gaG>gaA	p.E29E		NM_012138.3	NP_036270.1	Q9NY61	AATF_HUMAN	apoptosis antagonizing transcription factor	29					apoptotic signaling pathway (GO:0097190)|cell adhesion (GO:0007155)|cellular response to DNA damage stimulus (GO:0006974)|embryonic cleavage (GO:0040016)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of apoptotic process (GO:0043066)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of superoxide anion generation (GO:0032929)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mitotic cell cycle (GO:0007346)|ribosome biogenesis (GO:0042254)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	leucine zipper domain binding (GO:0043522)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(1)|large_intestine(4)|lung(7)|ovary(2)|skin(2)	18		Breast(25;0.00607)				CGGACCCCGAGGAAGGTGAGG	0.746																																					NSCLC(49;901 1159 19183 41572 46244)	uc002hni.2		NA																	0					0						c.(85-87)GAG>GAA		apoptosis antagonizing transcription factor							13.0	15.0	14.0					17																	35306512		2169	4270	6439	SO:0001819	synonymous_variant	26574				anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|negative regulation of superoxide anion generation|nerve growth factor receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to DNA damage stimulus	centrosome|focal adhesion|nucleolus	leucine zipper domain binding|sequence-specific DNA binding transcription factor activity	g.chr17:35306512G>A	AF083208	CCDS32632.1	17q12	2014-05-06			ENSG00000108270	ENSG00000275700			19235	protein-coding gene	gene with protein product		608463				11027528, 10783144	Standard	NM_012138		Approved	DED, CHE-1, CHE1, BFR2	uc002hni.3	Q9NY61	OTTHUMG00000188458	ENST00000225402.5:c.87G>A	17.37:g.35306512G>A			Somatic				AATF_uc002hnj.2_RNA	p.E29E	NM_012138	NP_036270	WXS	Illumina HiSeq	Unspecified	Q9NY61	AATF_HUMAN			1	338	+		Breast(25;0.00607)	29					A6NCJ6|B3KQ26|Q9P0A4|Q9UNX5	Silent	SNP	ENST00000225402.5	37	c.87G>A	CCDS32632.1																																																																																				0.746	AATF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451543.1	NM_012138		3	6	0	0	0	0	3	6				
KRTAP4-11	653240	broad.mit.edu	37	17	39274113	39274113	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr17:39274113G>A	ENST00000391413.2	-	1	493	c.455C>T	c.(454-456)tCc>tTc	p.S152F		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	152	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament (GO:0045095)				endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			gcagcagctggattcacagca	0.657																																						uc002hvz.2		NA																	0					0						c.(454-456)TCC>TTC		keratin associated protein 4-11							9.0	13.0	12.0					17																	39274113		684	1580	2264	SO:0001583	missense	653240					keratin filament		g.chr17:39274113G>A	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.455C>T	17.37:g.39274113G>A	ENSP00000375232:p.Ser152Phe		Somatic					p.S152F	NM_033059	NP_149048	WXS	Illumina HiSeq	Unspecified	Q9BYQ6	KR411_HUMAN	STAD - Stomach adenocarcinoma(17;0.000371)		1	494	-		Breast(137;0.000496)	152			27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].|25.		A0AUY2	Missense_Mutation	SNP	ENST00000391413.2	37	c.455C>T	CCDS45675.1	.	.	.	.	.	.	.	.	.	.	.	9.245	1.039350	0.19669	.	.	ENSG00000212721	ENST00000391413	T	0.00633	6.08	4.24	3.23	0.37069	.	1.123640	0.07164	U	0.851234	T	0.01523	0.0049	M	0.78916	2.43	0.09310	N	1	B	0.29378	0.243	B	0.27380	0.079	T	0.46020	-0.9221	10	0.72032	D	0.01	.	11.8449	0.52378	0.0:0.179:0.821:0.0	.	152	Q9BYQ6	KR411_HUMAN	F	152	ENSP00000375232:S152F	ENSP00000375232:S152F	S	-	2	0	KRTAP4-11	36527639	0.950000	0.32346	0.592000	0.28758	0.209000	0.24338	2.891000	0.48617	0.872000	0.35775	0.609000	0.83330	TCC		0.657	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1			9	27	0	0	0	0	9	27				
RNFT1	51136	broad.mit.edu	37	17	58042024	58042024	+	Start_Codon_SNP	SNP	T	T	C			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr17:58042024T>C	ENST00000305783.8	-	1	56	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	RP11-178C3.2_ENST00000586209.1_lincRNA|RNFT1_ENST00000442346.2_5'UTR|RP11-178C3.1_ENST00000591035.1_Intron	NM_016125.3	NP_057209.3	Q5M7Z0	RNFT1_HUMAN	ring finger protein, transmembrane 1	1						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	9	all_cancers(5;1.58e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;7.95e-12)|all cancers(12;1.34e-10)			AACAGCGGCATACACCGCCTC	0.701																																						uc002iya.2		NA																	0					0						c.(1-3)ATG>GTG		PTD016 protein							18.0	22.0	20.0					17																	58042024		1962	4140	6102	SO:0001582	initiator_codon_variant	51136					integral to membrane	zinc ion binding	g.chr17:58042024T>C	BC006971	CCDS11622.2	17q23.2	2013-01-09			ENSG00000189050	ENSG00000189050		"""RING-type (C3HC4) zinc fingers"""	30206	protein-coding gene	gene with protein product		615172				12477932	Standard	NM_016125		Approved	PTD016	uc002iya.3	Q5M7Z0	OTTHUMG00000148658	ENST00000305783.8:c.1A>G	17.37:g.58042024T>C	ENSP00000304670:p.Met1Val		Somatic				uc002iye.1_5'Flank|RNFT1_uc002iyb.2_RNA|RNFT1_uc002iyc.2_5'UTR|RNFT1_uc010wop.1_Missense_Mutation_p.M1V|RNFT1_uc002iyd.3_Missense_Mutation_p.M1V	p.M1V	NM_016125	NP_057209	WXS	Illumina HiSeq	Unspecified	Q5M7Z0	RNFT1_HUMAN	Epithelial(12;7.95e-12)|all cancers(12;1.34e-10)		1	94	-	all_cancers(5;1.58e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		1					Q8N7D0|Q96IZ9|Q9Y686	Missense_Mutation	SNP	ENST00000305783.8	37	c.1A>G	CCDS11622.2	.	.	.	.	.	.	.	.	.	.	T	12.75	2.031344	0.35797	.	.	ENSG00000189050	ENST00000305783	T	0.39592	1.07	4.3	-1.36	0.09085	.	.	.	.	.	T	0.25005	0.0607	.	.	.	0.20196	N	0.999924	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.22208	-1.0223	8	0.52906	T	0.07	.	2.4671	0.04555	0.2167:0.1846:0.4762:0.1225	.	1;1;1	B4DHL4;Q5M7Z0-2;Q5M7Z0	.;.;RNFT1_HUMAN	V	1	ENSP00000304670:M1V	ENSP00000304670:M1V	M	-	1	0	RNFT1	55396806	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	0.013000	0.13310	-0.277000	0.09193	-1.202000	0.01658	ATG		0.701	RNFT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308958.1	NM_016125	Missense_Mutation	6	9	0	0	0	0	6	9				
TLK2	11011	broad.mit.edu	37	17	60685501	60685501	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr17:60685501G>C	ENST00000326270.9	+	22	2405	c.2137G>C	c.(2137-2139)Gaa>Caa	p.E713Q	TLK2_ENST00000343388.7_Missense_Mutation_p.E659Q|TLK2_ENST00000582809.1_Missense_Mutation_p.E542Q|TLK2_ENST00000346027.5_Missense_Mutation_p.E691Q|TLK2_ENST00000542523.1_Missense_Mutation_p.E659Q	NM_001284333.1	NP_001271262.1	Q86UE8	TLK2_HUMAN	tousled-like kinase 2	713	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|negative regulation of autophagy (GO:0010507)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of chromatin assembly or disassembly (GO:0001672)	intermediate filament (GO:0005882)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(4)|large_intestine(6)|liver(2)|lung(10)|prostate(1)|stomach(1)|urinary_tract(1)	39						AGTAACACCTGAAGCAAAGGT	0.433																																						uc010ddp.2		NA																	0				stomach(1)|kidney(1)	2						c.(2137-2139)GAA>CAA		tousled-like kinase 2 isoform A							67.0	67.0	67.0					17																	60685501		2203	4300	6503	SO:0001583	missense	11011				cell cycle|chromatin modification|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr17:60685501G>C	AB004884	CCDS11633.1, CCDS45753.1, CCDS62283.1	17q23	2008-07-18							11842	protein-coding gene	gene with protein product		608439				9427565, 10523312	Standard	NM_006852		Approved	PKU-ALPHA, MGC44450	uc002izz.4	Q86UE8		ENST00000326270.9:c.2137G>C	17.37:g.60685501G>C	ENSP00000316512:p.Glu713Gln		Somatic				TLK2_uc002izx.3_Missense_Mutation_p.E539Q|TLK2_uc002izz.3_Missense_Mutation_p.E691Q|TLK2_uc002jaa.3_Missense_Mutation_p.E659Q|TLK2_uc010wpd.1_Missense_Mutation_p.E659Q	p.E713Q	NM_006852	NP_006843	WXS	Illumina HiSeq	Unspecified	Q86UE8	TLK2_HUMAN			22	2405	+			713			Protein kinase.		D3DU07|Q9UKI7|Q9Y4F7	Missense_Mutation	SNP	ENST00000326270.9	37	c.2137G>C		.	.	.	.	.	.	.	.	.	.	G	25.6	4.655372	0.88056	.	.	ENSG00000146872	ENST00000346027;ENST00000343388;ENST00000326270;ENST00000542523	T;T;T;T	0.68624	-0.34;-0.34;-0.34;-0.34	5.78	5.78	0.91487	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.045508	0.85682	D	0.000000	T	0.77343	0.4116	L	0.43598	1.365	0.80722	D	1	D;P;P;P	0.64830	0.994;0.929;0.824;0.956	D;P;P;P	0.69142	0.962;0.702;0.702;0.906	T	0.78099	-0.2336	10	0.72032	D	0.01	.	19.0021	0.92838	0.0:0.0:1.0:0.0	.	713;659;691;691	Q86UE8;Q86UE8-3;Q86UE8-2;D3DU05	TLK2_HUMAN;.;.;.	Q	691;659;713;659	ENSP00000275780:E691Q;ENSP00000340800:E659Q;ENSP00000316512:E713Q;ENSP00000442311:E659Q	ENSP00000316512:E713Q	E	+	1	0	TLK2	58039233	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	9.837000	0.99465	2.724000	0.93272	0.563000	0.77884	GAA		0.433	TLK2-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000445140.1	NM_006852		35	29	0	0	0	0	35	29				
RECQL5	9400	broad.mit.edu	37	17	73624385	73624385	+	Silent	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr17:73624385G>A	ENST00000317905.5	-	18	2877	c.2718C>T	c.(2716-2718)tcC>tcT	p.S906S	RECQL5_ENST00000443199.2_5'UTR|RECQL5_ENST00000423245.2_Silent_p.S879S	NM_004259.6	NP_004250.4	O94762	RECQ5_HUMAN	RecQ protein-like 5	906					chromosome separation (GO:0051304)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|mitotic nuclear division (GO:0007067)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA helicase activity (GO:0003678)|nucleic acid binding (GO:0003676)|RNA polymerase II core binding (GO:0000993)	p.S879S(1)		breast(1)|cervix(3)|endometrium(3)|kidney(7)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	36	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			CGCCAGGAGCGGAGAGCTGGA	0.597								Other identified genes with known or suspected DNA repair function																														uc010dgl.2		NA																	1	Substitution - coding silent(1)		lung(1)	kidney(3)	3						c.(2716-2718)TCC>TCT	Other_identified_genes_with_known_or_suspected_DNA_repair_function	RecQ protein-like 5 isoform 1							79.0	93.0	89.0					17																	73624385		2068	4207	6275	SO:0001819	synonymous_variant	9400				DNA recombination|DNA repair	cytoplasm|nuclear membrane|nucleolus|nucleoplasm	ATP binding|ATP-dependent helicase activity|DNA helicase activity|nucleic acid binding	g.chr17:73624385G>A	AB006533	CCDS32735.1, CCDS42380.1, CCDS45777.1	17q25	2014-03-07	2014-03-07	2014-03-07	ENSG00000108469	ENSG00000108469			9950	protein-coding gene	gene with protein product	"""RecQ protein 5"""	603781				9878247	Standard	NM_004259		Approved	RecQ5, FLJ90603	uc010dgl.3	O94762		ENST00000317905.5:c.2718C>T	17.37:g.73624385G>A			Somatic				RECQL5_uc010dgk.2_Silent_p.S879S|RECQL5_uc002jot.3_Silent_p.S102S	p.S906S	NM_004259	NP_004250	WXS	Illumina HiSeq	Unspecified	O94762	RECQ5_HUMAN	all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)		18	2874	-	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		906					Q9H0B1|Q9P1W7|Q9UNC8	Silent	SNP	ENST00000317905.5	37	c.2718C>T	CCDS42380.1																																																																																				0.597	RECQL5-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448207.1	NM_004259		8	49	0	0	0	0	8	49				
RNF213	57674	broad.mit.edu	37	17	78322014	78322014	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr17:78322014C>A	ENST00000582970.1	+	29	10022	c.9879C>A	c.(9877-9879)caC>caA	p.H3293Q	RNF213_ENST00000508628.2_Missense_Mutation_p.H3342Q|RNF213_ENST00000336301.6_Missense_Mutation_p.H1366Q	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	3293					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GACAGAGGCACAACTCCTTTG	0.597																																						uc002jyh.1		NA																	0				ovary(8)|lung(6)|breast(3)|large_intestine(2)|central_nervous_system(1)|pancreas(1)	21						c.(4096-4098)CAC>CAA		ring finger protein 213							78.0	69.0	72.0					17																	78322014		2203	4300	6503	SO:0001583	missense	57674							g.chr17:78322014C>A	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.9879C>A	17.37:g.78322014C>A	ENSP00000464087:p.His3293Gln		Somatic					p.H1366Q	NM_020914	NP_065965	WXS	Illumina HiSeq	Unspecified	Q9HCF4	ALO17_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)		4	4321	+	all_neural(118;0.0538)		Error:Variant_position_missing_in_Q9HCF4_after_alignment					C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	37	c.4098C>A	CCDS58606.1	.	.	.	.	.	.	.	.	.	.	C	3.778	-0.046262	0.07407	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.15952	2.38	4.82	-1.27	0.09347	.	0.130324	0.51477	D	0.000091	T	0.37865	0.1019	M	0.85710	2.77	0.09310	N	0.999996	D	0.67145	0.996	D	0.64506	0.926	T	0.23726	-1.0180	10	0.72032	D	0.01	.	10.7822	0.46384	0.0:0.4041:0.0:0.5959	.	1366	Q63HN8	RN213_HUMAN	Q	3293;3342;1366	ENSP00000338218:H1366Q	ENSP00000338218:H1366Q	H	+	3	2	RNF213	75936609	0.000000	0.05858	0.026000	0.17262	0.074000	0.17049	-0.292000	0.08332	-0.344000	0.08338	0.462000	0.41574	CAC		0.597	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914		3	44	1	0	6.4e-05	7.63e-05	3	44				
PTPRM	5797	broad.mit.edu	37	18	8296397	8296397	+	Missense_Mutation	SNP	A	A	C			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr18:8296397A>C	ENST00000332175.8	+	18	3784	c.2747A>C	c.(2746-2748)gAc>gCc	p.D916A	PTPRM_ENST00000400060.4_Missense_Mutation_p.D930A|PTPRM_ENST00000444013.1_Missense_Mutation_p.D703A|PTPRM_ENST00000400053.4_Missense_Mutation_p.D854A|PTPRM_ENST00000580170.1_Missense_Mutation_p.D929A	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	916	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				GCACCATGGGACTCGGCTAAG	0.423																																						uc002knn.3		NA																	0				lung(3)|ovary(2)|central_nervous_system(1)	6						c.(2746-2748)GAC>GCC		protein tyrosine phosphatase, receptor type, M							184.0	159.0	168.0					18																	8296397		2203	4300	6503	SO:0001583	missense	5797				homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr18:8296397A>C	X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.2747A>C	18.37:g.8296397A>C	ENSP00000331418:p.Asp916Ala		Somatic				PTPRM_uc010dkv.2_Missense_Mutation_p.D929A|PTPRM_uc010wzl.1_Missense_Mutation_p.D703A	p.D916A	NM_002845	NP_002836	WXS	Illumina HiSeq	Unspecified	P28827	PTPRM_HUMAN			18	3250	+		Colorectal(10;0.234)	916			Tyrosine-protein phosphatase 1.|Cytoplasmic (Potential).		A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	ENST00000332175.8	37	c.2747A>C	CCDS11840.1	.	.	.	.	.	.	.	.	.	.	A	19.03	3.747789	0.69533	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	T;T;T;T	0.29917	1.55;1.55;1.55;1.55	5.72	5.72	0.89469	Protein-tyrosine phosphatase, receptor/non-receptor type (2);	0.046705	0.85682	D	0.000000	T	0.30947	0.0781	L	0.51422	1.61	0.80722	D	1	B;P;P	0.36660	0.012;0.564;0.564	B;B;B	0.33454	0.013;0.164;0.164	T	0.12760	-1.0535	10	0.87932	D	0	.	16.2988	0.82793	1.0:0.0:0.0:0.0	.	703;929;916	E7EVX9;A7MBN1;P28827	.;.;PTPRM_HUMAN	A	916;930;854;703	ENSP00000331418:D916A;ENSP00000382933:D930A;ENSP00000382927:D854A;ENSP00000387608:D703A	ENSP00000331418:D916A	D	+	2	0	PTPRM	8286397	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.287000	0.95975	2.311000	0.77944	0.533000	0.62120	GAC		0.423	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1			3	38	0	0	0	0	3	38				
ZNF846	162993	broad.mit.edu	37	19	9868519	9868519	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr19:9868519G>T	ENST00000397902.2	-	6	1647	c.1234C>A	c.(1234-1236)Cat>Aat	p.H412N	ZNF846_ENST00000588267.1_Intron|ZNF846_ENST00000586293.1_3'UTR|ZNF846_ENST00000592859.1_Intron	NM_001077624.1	NP_001071092.1	Q147U1	ZN846_HUMAN	zinc finger protein 846	412					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	22						ATCCTTACATGTTGACTAAGC	0.403																																						uc002mmb.1		NA																	0				ovary(1)	1						c.(1234-1236)CAT>AAT		zinc finger protein 846							90.0	102.0	98.0					19																	9868519		2179	4293	6472	SO:0001583	missense	162993				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:9868519G>T	AK097652	CCDS42496.1	19p13.2	2013-01-08			ENSG00000196605	ENSG00000196605		"""Zinc fingers, C2H2-type"", ""-"""	27260	protein-coding gene	gene with protein product							Standard	NM_001077624		Approved		uc002mmb.1	Q147U1		ENST00000397902.2:c.1234C>A	19.37:g.9868519G>T	ENSP00000380999:p.His412Asn		Somatic				ZNF846_uc010xky.1_Intron|ZNF846_uc010xkz.1_Intron|ZNF846_uc010dww.2_Intron|ZNF846_uc002mmc.1_Missense_Mutation_p.H283N	p.H412N	NM_001077624	NP_001071092	WXS	Illumina HiSeq	Unspecified	Q147U1	ZN846_HUMAN			6	1765	-			412			C2H2-type 10.		A8K0H1|B3KUP1	Missense_Mutation	SNP	ENST00000397902.2	37	c.1234C>A	CCDS42496.1	.	.	.	.	.	.	.	.	.	.	.	21.9	4.215756	0.79352	.	.	ENSG00000196605	ENST00000397902	D	0.86865	-2.18	2.01	2.01	0.26516	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94079	0.8102	M	0.93106	3.38	0.25877	N	0.983638	D	0.89917	1.0	D	0.91635	0.999	D	0.85126	0.0972	8	.	.	.	.	10.1292	0.42669	0.0:0.0:1.0:0.0	.	412	Q147U1	ZN846_HUMAN	N	412	ENSP00000380999:H412N	.	H	-	1	0	ZNF846	9729519	1.000000	0.71417	0.005000	0.12908	0.820000	0.46376	7.779000	0.85648	1.458000	0.47871	0.456000	0.33151	CAT		0.403	ZNF846-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450253.1	NM_001077624		28	52	1	0	4.23e-11	5.38e-11	28	52				
CDKN2D	1032	broad.mit.edu	37	19	10675688	10675688	+	IGR	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr19:10675688C>T	ENST00000393599.2	-	0	1422				KRI1_ENST00000361821.5_Missense_Mutation_p.R66Q|KRI1_ENST00000312962.6_Missense_Mutation_p.R70Q|KRI1_ENST00000537964.1_5'UTR	NM_001800.3|NM_079421.2	NP_001791.1|NP_524145.1	P55273	CDN2D_HUMAN	cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4)						autophagic cell death (GO:0048102)|cell cycle arrest (GO:0007050)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of phosphorylation (GO:0042326)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to retinoic acid (GO:0032526)|response to UV (GO:0009411)|response to vitamin D (GO:0033280)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|protein kinase binding (GO:0019901)			endometrium(3)|lung(2)|ovary(1)	6			Epithelial(33;1.58e-05)|all cancers(31;6.36e-05)			GTAAAAGTCCCGCTCCTGCTG	0.522											OREG0025239	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										uc002moy.1		NA																	0				ovary(1)	1						c.(208-210)CGG>CAG		KRI1 homolog							81.0	85.0	84.0					19																	10675688		2203	4300	6503	SO:0001628	intergenic_variant	65095							g.chr19:10675688C>T		CCDS12244.1	19p13	2013-01-10				ENSG00000129355		"""Ankyrin repeat domain containing"""	1790	protein-coding gene	gene with protein product		600927				8575754	Standard	NM_079421		Approved	INK4D, p19	uc002mpa.3	P55273			19.37:g.10675688C>T			Somatic	OREG0025239	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	666	KRI1_uc002mox.1_Missense_Mutation_p.R66Q	p.R70Q	NM_023008	NP_075384	WXS	Illumina HiSeq	Unspecified	Q8N9T8	KRI1_HUMAN	Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)		3	218	-			70					Q13102|Q6FGE9	Missense_Mutation	SNP	ENST00000393599.2	37	c.209G>A	CCDS12244.1	.	.	.	.	.	.	.	.	.	.	c	15.44	2.835645	0.50951	.	.	ENSG00000129347	ENST00000312962;ENST00000361821;ENST00000541101;ENST00000539027	T;T;T	0.37584	1.19;1.19;1.19	4.09	3.02	0.34903	.	0.131886	0.44902	U	0.000410	T	0.20292	0.0488	L	0.37697	1.125	0.33019	D	0.528559	B;B	0.33379	0.272;0.41	B;B	0.18561	0.022;0.017	T	0.20505	-1.0273	10	0.17832	T	0.49	-13.7142	8.451	0.32871	0.0:0.8007:0.0:0.1993	.	70;66	Q8N9T8;D3YTE0	KRI1_HUMAN;.	Q	70;66;70;61	ENSP00000320917:R70Q;ENSP00000355366:R66Q;ENSP00000445789:R61Q	ENSP00000320917:R70Q	R	-	2	0	KRI1	10536688	0.102000	0.21896	0.992000	0.48379	0.913000	0.54294	1.898000	0.39809	1.984000	0.57885	0.442000	0.29010	CGG		0.522	CDKN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452030.1	NM_079421		34	65	0	0	0	0	34	65				
CCDC151	115948	broad.mit.edu	37	19	11537725	11537725	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr19:11537725C>G	ENST00000356392.4	-	4	667	c.580G>C	c.(580-582)Gag>Cag	p.E194Q	CCDC151_ENST00000586836.1_Missense_Mutation_p.E3Q|CCDC151_ENST00000545100.1_Missense_Mutation_p.E140Q|CCDC151_ENST00000591179.1_Missense_Mutation_p.E168Q	NM_145045.4	NP_659482.3	A5D8V7	CC151_HUMAN	coiled-coil domain containing 151	194										endometrium(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)	12						TTTTGCGCCTCCGCCATCTCC	0.677																																						uc002mrs.2		NA																	0				ovary(1)	1						c.(580-582)GAG>CAG		coiled-coil domain containing 151							37.0	43.0	41.0					19																	11537725		2011	4172	6183	SO:0001583	missense	115948							g.chr19:11537725C>G		CCDS42501.1	19p13.2	2014-02-20				ENSG00000198003			28303	protein-coding gene	gene with protein product		615956				24067530	Standard	NM_145045		Approved	MGC20983	uc002mrs.3	A5D8V7		ENST00000356392.4:c.580G>C	19.37:g.11537725C>G	ENSP00000348757:p.Glu194Gln		Somatic				CCDC151_uc002mrr.2_Missense_Mutation_p.E129Q|CCDC151_uc010dxz.2_Missense_Mutation_p.E168Q	p.E194Q	NM_145045	NP_659482	WXS	Illumina HiSeq	Unspecified	A5D8V7	CC151_HUMAN			4	723	-			194			Potential.		B4DXT0|Q96CG5	Missense_Mutation	SNP	ENST00000356392.4	37	c.580G>C	CCDS42501.1	.	.	.	.	.	.	.	.	.	.	C	11.94	1.788966	0.31685	.	.	ENSG00000198003	ENST00000545100;ENST00000356392;ENST00000543934	D;D	0.84298	-1.83;-1.83	4.86	3.79	0.43588	.	0.260219	0.37761	N	0.001948	D	0.89860	0.6837	M	0.70595	2.14	0.09310	N	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.74023	0.982;0.982;0.982	T	0.81675	-0.0825	10	0.23302	T	0.38	-14.725	12.0554	0.53531	0.1738:0.8261:0.0:0.0	.	194;194;174	B3KPH7;A5D8V7;B4DG09	.;CC151_HUMAN;.	Q	140;194;173	ENSP00000442987:E140Q;ENSP00000348757:E194Q	ENSP00000348757:E194Q	E	-	1	0	CCDC151	11398725	0.788000	0.28762	0.015000	0.15790	0.035000	0.12851	5.076000	0.64413	1.001000	0.39076	0.561000	0.74099	GAG		0.677	CCDC151-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458800.1	NM_145045		30	45	0	0	0	0	30	45				
OR7C2	26658	broad.mit.edu	37	19	15052714	15052714	+	Silent	SNP	C	C	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr19:15052714C>A	ENST00000248072.3	+	1	414	c.414C>A	c.(412-414)ccC>ccA	p.P138P		NM_012377.1	NP_036509.1	O60412	OR7C2_HUMAN	olfactory receptor, family 7, subfamily C, member 2	138						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(8)|ovary(2)|skin(2)	15	Ovarian(108;0.203)					TCATGAACCCCCGGCTCTGTG	0.537																																						uc010xoc.1		NA																	0				ovary(2)|skin(1)	3						c.(412-414)CCC>CCA		olfactory receptor, family 7, subfamily C,							135.0	131.0	132.0					19																	15052714		2203	4300	6503	SO:0001819	synonymous_variant	26658				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr19:15052714C>A	U86255	CCDS12320.1	19p13.1	2012-08-09				ENSG00000127529		"""GPCR / Class A : Olfactory receptors"""	8374	protein-coding gene	gene with protein product				OR7C3			Standard	NM_012377		Approved	OR19-18	uc010xoc.2	O60412		ENST00000248072.3:c.414C>A	19.37:g.15052714C>A			Somatic					p.P138P	NM_012377	NP_036509	WXS	Illumina HiSeq	Unspecified	O60412	OR7C2_HUMAN			1	414	+	Ovarian(108;0.203)		138			Cytoplasmic (Potential).		O43881|Q6IFP9	Silent	SNP	ENST00000248072.3	37	c.414C>A	CCDS12320.1																																																																																				0.537	OR7C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466281.1			64	115	1	0	2.9e-36	3.88e-36	64	115				
NOTCH3	4854	broad.mit.edu	37	19	15288423	15288423	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr19:15288423T>C	ENST00000263388.2	-	24	4391	c.4316A>G	c.(4315-4317)aAc>aGc	p.N1439S		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1439					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			GCAGCGGCTGTTGTTGAAGAG	0.701																																						uc002nan.2		NA																	0				lung(8)|ovary(5)|skin(4)|prostate(2)|central_nervous_system(1)|breast(1)	21						c.(4315-4317)AAC>AGC		Notch homolog 3 precursor							9.0	9.0	9.0					19																	15288423		2161	4218	6379	SO:0001583	missense	4854				Notch receptor processing|Notch signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity	g.chr19:15288423T>C	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.4316A>G	19.37:g.15288423T>C	ENSP00000263388:p.Asn1439Ser		Somatic				NOTCH3_uc002nao.1_Missense_Mutation_p.N1387S	p.N1439S	NM_000435	NP_000426	WXS	Illumina HiSeq	Unspecified	Q9UM47	NOTC3_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)		24	4392	-			1439			Extracellular (Potential).|LNR 2.		Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	ENST00000263388.2	37	c.4316A>G	CCDS12326.1	.	.	.	.	.	.	.	.	.	.	T	27.3	4.815660	0.90790	.	.	ENSG00000074181	ENST00000263388	D	0.94613	-3.47	4.66	4.66	0.58398	Notch domain (4);	.	.	.	.	D	0.96266	0.8782	M	0.78344	2.41	0.58432	D	0.999998	D	0.53619	0.961	P	0.59115	0.852	D	0.96489	0.9362	9	0.66056	D	0.02	.	13.0613	0.59008	0.0:0.0:0.0:1.0	.	1439	Q9UM47	NOTC3_HUMAN	S	1439	ENSP00000263388:N1439S	ENSP00000263388:N1439S	N	-	2	0	NOTCH3	15149423	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.840000	0.86819	1.728000	0.51552	0.260000	0.18958	AAC		0.701	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1	NM_000435		7	2	0	0	0	0	7	2				
AKAP8L	26993	broad.mit.edu	37	19	15514345	15514345	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr19:15514345C>T	ENST00000397410.5	-	4	433	c.303G>A	c.(301-303)atG>atA	p.M101I	AKAP8L_ENST00000595465.2_Intron|AKAP8L_ENST00000595879.1_5'Flank	NM_014371.2	NP_055186.2	Q9ULX6	AKP8L_HUMAN	A kinase (PRKA) anchor protein 8-like	101						cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(4)|kidney(2)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	11						AATGCGGCACCATATCTAAGC	0.537																																						uc002naw.1		NA																	0				ovary(1)	1						c.(301-303)ATG>ATA		A kinase (PRKA) anchor protein 8-like							129.0	132.0	131.0					19																	15514345		2065	4221	6286	SO:0001583	missense	26993					cytoplasm|nuclear matrix	DEAD/H-box RNA helicase binding|DNA binding|zinc ion binding	g.chr19:15514345C>T	BC000713	CCDS46005.1	19p13.12	2013-10-16			ENSG00000011243	ENSG00000011243			29857	protein-coding gene	gene with protein product	"""neighbor of A kinase anchoring protein 95"""	609475				10748171, 10761695	Standard	XM_005259854		Approved	NAKAP95, HAP95	uc002naw.1	Q9ULX6	OTTHUMG00000182446	ENST00000397410.5:c.303G>A	19.37:g.15514345C>T	ENSP00000380557:p.Met101Ile		Somatic				AKAP8L_uc002nax.1_RNA|AKAP8L_uc010xoh.1_Intron|AKAP8L_uc002nay.1_Missense_Mutation_p.M101I|AKAP8L_uc002naz.2_5'Flank	p.M101I	NM_014371	NP_055186	WXS	Illumina HiSeq	Unspecified	Q9ULX6	AKP8L_HUMAN			4	402	-			101					B4DJ74|B5BU90|O94792|Q96J58|Q9NRQ0|Q9UGM0	Missense_Mutation	SNP	ENST00000397410.5	37	c.303G>A	CCDS46005.1	.	.	.	.	.	.	.	.	.	.	C	15.99	2.996519	0.54147	.	.	ENSG00000011243	ENST00000397410	T	0.57752	0.38	5.43	3.21	0.36854	.	0.224786	0.43260	D	0.000588	T	0.42177	0.1191	L	0.39245	1.2	0.32105	N	0.590022	B;B	0.15930	0.015;0.003	B;B	0.15484	0.013;0.002	T	0.49303	-0.8954	10	0.66056	D	0.02	-2.5685	9.7	0.40180	0.16:0.686:0.154:0.0	.	101;101	B3KMD4;Q9ULX6	.;AKP8L_HUMAN	I	101	ENSP00000380557:M101I	ENSP00000380557:M101I	M	-	3	0	AKAP8L	15375345	1.000000	0.71417	0.993000	0.49108	0.991000	0.79684	2.645000	0.46621	0.603000	0.29913	0.561000	0.74099	ATG		0.537	AKAP8L-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461301.2	NM_014371		65	101	0	0	0	0	65	101				
OR10H5	284433	broad.mit.edu	37	19	15905429	15905429	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr19:15905429G>A	ENST00000308940.8	+	1	669	c.571G>A	c.(571-573)Gat>Aat	p.D191N		NM_001004466.1	NP_001004466.1	Q8NGA6	O10H5_HUMAN	olfactory receptor, family 10, subfamily H, member 5	191						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(9)|ovary(1)	20						GGCCTGTGGAGATGATGTGCT	0.572																																						uc010xos.1		NA																	0				ovary(1)	1						c.(571-573)GAT>AAT		olfactory receptor, family 10, subfamily H,							165.0	130.0	142.0					19																	15905429		2203	4300	6503	SO:0001583	missense	284433				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr19:15905429G>A	AC011537	CCDS32940.1	19p13.12	2013-09-24			ENSG00000172519	ENSG00000172519		"""GPCR / Class A : Olfactory receptors"""	15389	protein-coding gene	gene with protein product							Standard	NM_001004466		Approved		uc010xos.2	Q8NGA6	OTTHUMG00000182284	ENST00000308940.8:c.571G>A	19.37:g.15905429G>A	ENSP00000310704:p.Asp191Asn		Somatic					p.D191N	NM_001004466	NP_001004466	WXS	Illumina HiSeq	Unspecified	Q8NGA6	O10H5_HUMAN			1	571	+			191			Extracellular (Potential).		Q6IFJ0|Q96R60	Missense_Mutation	SNP	ENST00000308940.8	37	c.571G>A	CCDS32940.1	.	.	.	.	.	.	.	.	.	.	.	2.898	-0.228097	0.06022	.	.	ENSG00000172519	ENST00000308940	T	0.00231	8.49	2.8	-5.24	0.02789	GPCR, rhodopsin-like superfamily (1);	2.764020	0.01573	N	0.020683	T	0.00178	0.0005	L	0.48362	1.52	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.35943	-0.9768	10	0.49607	T	0.09	.	6.5177	0.22256	0.2701:0.2063:0.5235:0.0	.	191	Q8NGA6	O10H5_HUMAN	N	191	ENSP00000310704:D191N	ENSP00000310704:D191N	D	+	1	0	OR10H5	15766429	.	.	0.000000	0.03702	0.082000	0.17680	.	.	-1.509000	0.01798	-0.889000	0.02933	GAT		0.572	OR10H5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460363.1			6	86	0	0	0	0	6	86				
SLC5A5	6528	broad.mit.edu	37	19	17988641	17988641	+	Missense_Mutation	SNP	G	G	A	rs368434203		TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr19:17988641G>A	ENST00000222248.3	+	6	1155	c.808G>A	c.(808-810)Gtg>Atg	p.V270M		NM_000453.2	NP_000444.1	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium/iodide cotransporter), member 5	270					cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|iodide transport (GO:0015705)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	iodide transmembrane transporter activity (GO:0015111)|sodium:iodide symporter activity (GO:0008507)			NS(2)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						GCAGCGCTACGTGGCTTGCCG	0.607																																					Melanoma(65;1008 1708 7910 46650)	uc002nhr.3		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(808-810)GTG>ATG		solute carrier family 5 (sodium iodide		G	MET/VAL	0,4406		0,0,2203	128.0	109.0	116.0		808	3.4	1.0	19		116	1,8599	1.2+/-3.3	0,1,4299	no	missense	SLC5A5	NM_000453.2	21	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	270/644	17988641	1,13005	2203	4300	6503	SO:0001583	missense	6528				cellular nitrogen compound metabolic process|cellular response to cAMP|cellular response to gonadotropin stimulus|hormone biosynthetic process	integral to membrane|nucleus|plasma membrane	iodide transmembrane transporter activity|sodium:iodide symporter activity	g.chr19:17988641G>A		CCDS12368.1	19p13.11	2013-07-19	2013-07-19		ENSG00000105641	ENSG00000105641		"""Solute carriers"""	11040	protein-coding gene	gene with protein product		601843	"""solute carrier family 5 (sodium iodide symporter), member 5"""			9231811	Standard	NM_000453		Approved	NIS	uc002nhr.4	Q92911		ENST00000222248.3:c.808G>A	19.37:g.17988641G>A	ENSP00000222248:p.Val270Met		Somatic					p.V270M	NM_000453	NP_000444	WXS	Illumina HiSeq	Unspecified	Q92911	SC5A5_HUMAN			6	1155	+			270			Cytoplasmic (Potential).		O43702|Q2M335|Q9NYB6	Missense_Mutation	SNP	ENST00000222248.3	37	c.808G>A	CCDS12368.1	.	.	.	.	.	.	.	.	.	.	G	19.38	3.817419	0.70912	0.0	1.16E-4	ENSG00000105641	ENST00000222248	D	0.86956	-2.19	5.62	3.4	0.38934	.	0.203992	0.41500	D	0.000868	T	0.73682	0.3618	N	0.13043	0.29	0.39338	D	0.965525	P	0.37573	0.6	B	0.34824	0.19	T	0.73895	-0.3838	10	0.40728	T	0.16	.	9.1395	0.36894	0.0783:0.0:0.7771:0.1446	.	270	Q92911	SC5A5_HUMAN	M	270	ENSP00000222248:V270M	ENSP00000222248:V270M	V	+	1	0	SLC5A5	17849641	0.662000	0.27439	1.000000	0.80357	0.891000	0.51852	0.904000	0.28491	1.402000	0.46780	0.555000	0.69702	GTG		0.607	SLC5A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466690.1			45	67	0	0	0	0	45	67				
KIAA1683	80726	broad.mit.edu	37	19	18368445	18368445	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr19:18368445C>T	ENST00000600328.3	-	4	3281	c.3088G>A	c.(3088-3090)Gac>Aac	p.D1030N	KIAA1683_ENST00000600359.3_Missense_Mutation_p.D984N|PDE4C_ENST00000596647.1_5'Flank|KIAA1683_ENST00000392413.4_Missense_Mutation_p.D1217N|PDE4C_ENST00000355502.3_5'Flank			Q9H0B3	K1683_HUMAN	KIAA1683	1030						mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						CAGCGATGGTCAGATACTGTC	0.657																																						uc002nin.2		NA																	0				ovary(2)	2						c.(3088-3090)GAC>AAC		KIAA1683 isoform b							29.0	31.0	30.0					19																	18368445		2192	4284	6476	SO:0001583	missense	80726					mitochondrion		g.chr19:18368445C>T	AB051470	CCDS32958.1, CCDS46017.1, CCDS46018.1	19p13.1	2008-02-05				ENSG00000130518			29350	protein-coding gene	gene with protein product						11214970, 11230166	Standard	NM_025249		Approved		uc010ebn.2	Q9H0B3		ENST00000600328.3:c.3088G>A	19.37:g.18368445C>T	ENSP00000470780:p.Asp1030Asn		Somatic				PDE4C_uc002nil.3_5'Flank|KIAA1683_uc010ebn.2_Missense_Mutation_p.D1217N|KIAA1683_uc010xqe.1_Missense_Mutation_p.D984N|KIAA1683_uc010xqf.1_RNA	p.D1030N	NM_025249	NP_079525	WXS	Illumina HiSeq	Unspecified	Q9H0B3	K1683_HUMAN			4	3304	-			1030					B4DYH2|E9PDE0|E9PH54|Q2KHR5|Q8N4G8|Q96M14|Q9C0I0	Missense_Mutation	SNP	ENST00000600328.3	37	c.3088G>A	CCDS32958.1	.	.	.	.	.	.	.	.	.	.	C	13.78	2.338978	0.41398	.	.	ENSG00000130518	ENST00000392413;ENST00000359737;ENST00000427634;ENST00000392412;ENST00000411671	T;T;T	0.03441	4.02;4.01;3.93	4.26	3.1	0.35709	.	0.420814	0.16434	N	0.214601	T	0.06096	0.0158	L	0.34521	1.04	0.09310	N	1	D;D	0.57257	0.979;0.97	P;P	0.54270	0.747;0.681	T	0.41124	-0.9526	10	0.18710	T	0.47	-10.0458	10.8319	0.46665	0.0:0.7879:0.2121:0.0	.	1217;1030	E9PDE0;Q9H0B3	.;K1683_HUMAN	N	1217;1030;984;294;644	ENSP00000376213:D1217N;ENSP00000352774:D1030N;ENSP00000404501:D984N	ENSP00000352774:D1030N	D	-	1	0	KIAA1683	18229445	0.002000	0.14202	0.283000	0.24790	0.030000	0.12068	1.281000	0.33214	1.935000	0.56089	0.313000	0.20887	GAC		0.657	KIAA1683-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466312.3			25	44	0	0	0	0	25	44				
ZNF737	100129842	broad.mit.edu	37	19	20736633	20736633	+	Silent	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr19:20736633C>T	ENST00000427401.4	-	2	106	c.12G>A	c.(10-12)ttG>ttA	p.L4L	ZNF737_ENST00000596797.1_Silent_p.L4L|CTC-513N18.7_ENST00000595094.1_lincRNA	NM_001159293.1	NP_001152765.1	O75373	ZN737_HUMAN	zinc finger protein 737	4	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|lung(7)|ovary(1)|stomach(1)|urinary_tract(1)	13						CTCTAAATTGCAATGGCCCCT	0.403																																						uc002npa.2		NA																	0				ovary(1)	1						c.(10-12)TTG>TTA		zinc finger protein 737							31.0	28.0	29.0					19																	20736633		692	1591	2283	SO:0001819	synonymous_variant	100129842				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding	g.chr19:20736633C>T	BC015765	CCDS54238.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	32468	protein-coding gene	gene with protein product		603984					Standard	NM_001159293		Approved	ZNF102	uc002npa.3	O75373		ENST00000427401.4:c.12G>A	19.37:g.20736633C>T			Somatic					p.L4L	NM_001159293	NP_001152765	WXS	Illumina HiSeq	Unspecified	C9JHM3	C9JHM3_HUMAN			2	192	-			4					C9JHM3	Silent	SNP	ENST00000427401.4	37	c.12G>A	CCDS54238.1																																																																																				0.403	ZNF737-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447844.2	NM_145289		36	44	0	0	0	0	36	44				
ZNF507	22847	broad.mit.edu	37	19	32844322	32844322	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr19:32844322C>T	ENST00000311921.4	+	2	778	c.586C>T	c.(586-588)Ccc>Tcc	p.P196S	ZNF507_ENST00000355898.5_Missense_Mutation_p.P196S|ZNF507_ENST00000544431.1_Missense_Mutation_p.P196S	NM_001136156.1|NM_014910.4	NP_001129628.1|NP_055725.2	Q8TCN5	ZN507_HUMAN	zinc finger protein 507	196					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	31	Esophageal squamous(110;0.162)					GTGCGTAAGCCCCTCCAGCTC	0.468																																						uc002nte.2		NA																	0				ovary(1)|pancreas(1)|kidney(1)|central_nervous_system(1)|skin(1)	5						c.(586-588)CCC>TCC		zinc finger protein 507							76.0	77.0	76.0					19																	32844322		2203	4300	6503	SO:0001583	missense	22847				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:32844322C>T	AB029007	CCDS32985.1	19q13.12	2008-02-05				ENSG00000168813		"""Zinc fingers, C2H2-type"""	23783	protein-coding gene	gene with protein product							Standard	NM_014910		Approved	KIAA1084	uc002ntd.3	Q8TCN5		ENST00000311921.4:c.586C>T	19.37:g.32844322C>T	ENSP00000312277:p.Pro196Ser		Somatic				ZNF507_uc002ntc.2_Missense_Mutation_p.P196S|ZNF507_uc010xrn.1_Missense_Mutation_p.P196S|ZNF507_uc002ntd.2_Missense_Mutation_p.P196S	p.P196S	NM_001136156	NP_001129628	WXS	Illumina HiSeq	Unspecified	Q8TCN5	ZN507_HUMAN			3	858	+	Esophageal squamous(110;0.162)		196					A8K911|Q2TBF1|Q6MZU0|Q9UPR8	Missense_Mutation	SNP	ENST00000311921.4	37	c.586C>T	CCDS32985.1	.	.	.	.	.	.	.	.	.	.	C	0.015	-1.555501	0.00918	.	.	ENSG00000168813	ENST00000355898;ENST00000311921;ENST00000544431	T;T;T	0.05513	3.73;3.73;3.43	5.54	4.49	0.54785	.	0.444404	0.24962	N	0.034212	T	0.07548	0.0190	L	0.47716	1.5	0.09310	N	1	B;B	0.20887	0.049;0.001	B;B	0.19666	0.026;0.003	T	0.20009	-1.0288	10	0.48119	T	0.1	.	10.583	0.45267	0.1401:0.7061:0.1538:0.0	.	196;196	Q8TCN5;Q8TCN5-2	ZN507_HUMAN;.	S	196	ENSP00000348162:P196S;ENSP00000312277:P196S;ENSP00000441549:P196S	ENSP00000312277:P196S	P	+	1	0	ZNF507	37536162	0.005000	0.15991	0.681000	0.30009	0.095000	0.18619	0.677000	0.25262	1.283000	0.44513	0.655000	0.94253	CCC		0.468	ZNF507-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450301.3	NM_014910		37	49	0	0	0	0	37	49				
KMT2B	9757	broad.mit.edu	37	19	36210733	36210733	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr19:36210733C>T	ENST00000222270.7	+	3	484	c.484C>T	c.(484-486)Cct>Tct	p.P162S	KMT2B_ENST00000341701.1_Missense_Mutation_p.P162S|KMT2B_ENST00000420124.1_Missense_Mutation_p.P162S|KMT2B_ENST00000607650.1_RNA	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	162					chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										GACCCCCCTTCCTCCTCCTCG	0.607																																						uc010eei.2		NA																	0				central_nervous_system(6)|breast(2)|ovary(1)|kidney(1)|skin(1)	11						c.(484-486)CCT>TCT		myeloid/lymphoid or mixed-lineage leukemia 4							68.0	75.0	73.0					19																	36210733		1950	4131	6081	SO:0001583	missense	9757				chromatin-mediated maintenance of transcription		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:36210733C>T	AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.484C>T	19.37:g.36210733C>T	ENSP00000222270:p.Pro162Ser		Somatic					p.P162S	NM_014727	NP_055542	WXS	Illumina HiSeq	Unspecified	Q9UMN6	MLL4_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0515)		3	484	+	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		162					O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Missense_Mutation	SNP	ENST00000222270.7	37	c.484C>T	CCDS46055.1	.	.	.	.	.	.	.	.	.	.	C	17.30	3.354765	0.61293	.	.	ENSG00000105663	ENST00000222270;ENST00000420124;ENST00000341701	D;D;T	0.86769	-2.17;-2.17;0.45	5.0	5.0	0.66597	.	0.369627	0.19707	N	0.107918	T	0.78547	0.4300	N	0.14661	0.345	0.33535	D	0.594081	B	0.23058	0.079	B	0.24269	0.052	T	0.81848	-0.0744	10	0.72032	D	0.01	.	13.7808	0.63081	0.0:1.0:0.0:0.0	.	162	Q9UMN6	MLL4_HUMAN	S	162	ENSP00000222270:P162S;ENSP00000398837:P162S;ENSP00000345761:P162S	ENSP00000222270:P162S	P	+	1	0	AD000671.1	40902573	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.164000	0.42387	2.318000	0.78349	0.561000	0.74099	CCT		0.607	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014727		52	97	0	0	0	0	52	97				
HNRNPL	3191	broad.mit.edu	37	19	39336596	39336596	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr19:39336596G>C	ENST00000221419.5	-	3	887	c.521C>G	c.(520-522)tCt>tGt	p.S174C	AC008982.2_ENST00000600473.1_RNA|HNRNPL_ENST00000600873.1_Missense_Mutation_p.S41C	NM_001533.2	NP_001524.2	P14866	HNRPL_HUMAN	heterogeneous nuclear ribonucleoprotein L	174	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			CTGGCTGGTAGAGTAGTTGAC	0.522																																						uc010xul.1		NA																	0					0						c.(520-522)TCT>TGT		heterogeneous nuclear ribonucleoprotein L							121.0	117.0	118.0					19																	39336596		2203	4300	6503	SO:0001583	missense	3191				nuclear mRNA splicing, via spliceosome	cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding|transcription regulatory region DNA binding	g.chr19:39336596G>C	X16135	CCDS33015.1, CCDS33016.1	19q13.2	2013-06-12		2007-08-16	ENSG00000104824	ENSG00000104824		"""RNA binding motif (RRM) containing"""	5045	protein-coding gene	gene with protein product		603083		HNRPL		2687284	Standard	NM_001533		Approved		uc021uuh.1	P14866	OTTHUMG00000182612	ENST00000221419.5:c.521C>G	19.37:g.39336596G>C	ENSP00000221419:p.Ser174Cys		Somatic				HNRNPL_uc010xum.1_Missense_Mutation_p.S41C|HNRNPL_uc010xun.1_5'Flank	p.S174C	NM_001533	NP_001524	WXS	Illumina HiSeq	Unspecified	P14866	HNRPL_HUMAN	Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)		3	532	-	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		174			RRM 1.		A6ND69|A6NIT8|Q9H3P3	Missense_Mutation	SNP	ENST00000221419.5	37	c.521C>G	CCDS33015.1	.	.	.	.	.	.	.	.	.	.	G	19.05	3.752109	0.69533	.	.	ENSG00000104824	ENST00000221419;ENST00000388749;ENST00000388750;ENST00000423415;ENST00000536292	.	.	.	5.39	5.39	0.77823	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.000000	0.85682	D	0.000000	T	0.71333	0.3327	M	0.80616	2.505	0.80722	D	1	B	0.21688	0.059	B	0.21917	0.037	T	0.71679	-0.4520	9	0.87932	D	0	.	17.9088	0.88928	0.0:0.0:1.0:0.0	.	174	P14866	HNRPL_HUMAN	C	174;41;41;41;102	.	ENSP00000221419:S174C	S	-	2	0	HNRNPL	44028436	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.711000	0.98735	2.541000	0.85698	0.462000	0.41574	TCT		0.522	HNRNPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462670.1			51	98	0	0	0	0	51	98				
CLPTM1	1209	broad.mit.edu	37	19	45496120	45496120	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr19:45496120C>T	ENST00000337392.5	+	14	2125	c.1975C>T	c.(1975-1977)Cct>Tct	p.P659S	CLPTM1_ENST00000541297.2_Missense_Mutation_p.P645S|CLPTM1_ENST00000546079.1_Missense_Mutation_p.P557S	NM_001282175.1|NM_001282176.1|NM_001294.2	NP_001269104.1|NP_001269105.1|NP_001285.1	O96005	CLPT1_HUMAN	cleft lip and palate associated transmembrane protein 1	659					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of T cell differentiation in thymus (GO:0033081)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00354)|Epithelial(262;0.187)		CCAGGAAGCCCCTCCAAAGCC	0.682																																						uc002pai.2		NA																	0				ovary(1)	1						c.(1975-1977)CCT>TCT		cleft lip and palate associated transmembrane							41.0	46.0	44.0					19																	45496120		2203	4300	6503	SO:0001583	missense	1209				cell differentiation|multicellular organismal development|regulation of T cell differentiation in thymus	external side of plasma membrane|integral to plasma membrane		g.chr19:45496120C>T	AF037339	CCDS12651.1, CCDS74394.1, CCDS74395.1	19q13.3	2008-02-05				ENSG00000104853			2087	protein-coding gene	gene with protein product		604783				9828125	Standard	NM_001294		Approved		uc002pai.3	O96005		ENST00000337392.5:c.1975C>T	19.37:g.45496120C>T	ENSP00000336994:p.Pro659Ser		Somatic				CLPTM1_uc010xxf.1_Missense_Mutation_p.P557S|CLPTM1_uc010xxg.1_Missense_Mutation_p.P645S	p.P659S	NM_001294	NP_001285	WXS	Illumina HiSeq	Unspecified	O96005	CLPT1_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00354)|Epithelial(262;0.187)	14	1990	+		all_neural(266;0.224)|Ovarian(192;0.231)	659			Cytoplasmic (Potential).		B3KQH2|B4DDS3|B4E2X9|B7Z9X9|F5H8J3|Q53ET6|Q9BSS5	Missense_Mutation	SNP	ENST00000337392.5	37	c.1975C>T	CCDS12651.1	.	.	.	.	.	.	.	.	.	.	C	12.65	2.000138	0.35320	.	.	ENSG00000104853	ENST00000546079;ENST00000541297;ENST00000337392	.	.	.	4.81	1.23	0.21249	.	.	.	.	.	T	0.13970	0.0338	N	0.08118	0	0.27483	N	0.952527	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.001	T	0.33059	-0.9883	8	0.05436	T	0.98	.	6.36	0.21422	0.0:0.5382:0.3627:0.0991	.	645;659	F5H8J3;O96005	.;CLPT1_HUMAN	S	557;645;659	.	ENSP00000336994:P659S	P	+	1	0	CLPTM1	50187960	0.997000	0.39634	1.000000	0.80357	0.998000	0.95712	1.088000	0.30877	0.725000	0.32318	0.650000	0.86243	CCT		0.682	CLPTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453267.1	NM_001294		20	33	0	0	0	0	20	33				
CKM	1158	broad.mit.edu	37	19	45810135	45810135	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr19:45810135T>C	ENST00000221476.3	-	8	1193	c.1019A>G	c.(1018-1020)gAt>gGt	p.D340G		NM_001824.4	NP_001815.2	P06732	KCRM_HUMAN	creatine kinase, muscle	340	Phosphagen kinase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00843}.				cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|phosphocreatine biosynthetic process (GO:0046314)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)			cervix(1)|endometrium(1)|large_intestine(8)|lung(3)|prostate(2)|skin(2)	17		Ovarian(192;0.0336)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;2.29e-44)|Epithelial(262;1.05e-38)|GBM - Glioblastoma multiforme(486;3.56e-07)	Creatine(DB00148)	GCCCAGCCGATCAGCGTTGGA	0.582																																						uc002pbd.2		NA																	0				skin(1)	1						c.(1018-1020)GAT>GGT		muscle creatine kinase	Creatine(DB00148)						169.0	140.0	150.0					19																	45810135		2203	4300	6503	SO:0001583	missense	1158				creatine metabolic process	cytosol	ATP binding|creatine kinase activity	g.chr19:45810135T>C	M14780	CCDS12659.1	19q13.32	2012-10-02			ENSG00000104879	ENSG00000104879	2.7.3.2		1994	protein-coding gene	gene with protein product		123310		CKMM			Standard	NM_001824		Approved		uc002pbd.4	P06732		ENST00000221476.3:c.1019A>G	19.37:g.45810135T>C	ENSP00000221476:p.Asp340Gly		Somatic					p.D340G	NM_001824	NP_001815	WXS	Illumina HiSeq	Unspecified	P06732	KCRM_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;2.29e-44)|Epithelial(262;1.05e-38)|GBM - Glioblastoma multiforme(486;3.56e-07)	8	1093	-		Ovarian(192;0.0336)|all_neural(266;0.112)	340			Phosphagen kinase C-terminal.		Q96QL9	Missense_Mutation	SNP	ENST00000221476.3	37	c.1019A>G	CCDS12659.1	.	.	.	.	.	.	.	.	.	.	T	27.1	4.797087	0.90453	.	.	ENSG00000104879	ENST00000221476	T	0.11930	2.73	5.49	5.49	0.81192	ATP:guanido phosphotransferase, catalytic domain (2);Glutamine synthetase/guanido kinase, catalytic domain (1);	0.046898	0.85682	D	0.000000	T	0.52306	0.1726	H	0.97365	3.99	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.69339	-0.5171	10	0.72032	D	0.01	-36.2019	13.5457	0.61702	0.0:0.0:0.0:1.0	.	340	P06732	KCRM_HUMAN	G	340	ENSP00000221476:D340G	ENSP00000221476:D340G	D	-	2	0	CKM	50501975	1.000000	0.71417	0.986000	0.45419	0.819000	0.46315	7.676000	0.84012	2.097000	0.63578	0.459000	0.35465	GAT		0.582	CKM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457569.1			57	116	0	0	0	0	57	116				
VASP	7408	broad.mit.edu	37	19	46027399	46027399	+	Splice_Site	SNP	A	A	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr19:46027399A>T	ENST00000245932.6	+	10	1311	c.955A>T	c.(955-957)Agg>Tgg	p.R319W		NM_003370.3	NP_003361.1	P50552	VASP_HUMAN	vasodilator-stimulated phosphoprotein	319	EVH2.				actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|neural tube closure (GO:0001843)|positive regulation of actin filament polymerization (GO:0030838)|protein homotetramerization (GO:0051289)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	profilin binding (GO:0005522)			endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(2)	18		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0145)|GBM - Glioblastoma multiforme(486;0.154)		AACCTTGCCAAGGTAGGCCAT	0.577											OREG0025556	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										uc002pcg.2		NA																	0					0						c.(955-957)AGG>TGG		vasodilator-stimulated phosphoprotein							82.0	74.0	77.0					19																	46027399		2203	4300	6503	SO:0001630	splice_region_variant	7408				axon guidance|cell junction assembly|T cell receptor signaling pathway	actin cytoskeleton|cytosol|filopodium membrane|focal adhesion|lamellipodium membrane	actin binding|profilin binding|SH3 domain binding	g.chr19:46027399A>T		CCDS33051.1	19q13.32	2012-02-22			ENSG00000125753	ENSG00000125753			12652	protein-coding gene	gene with protein product		601703				8812448	Standard	XM_005259199		Approved		uc002pcg.3	P50552		ENST00000245932.6:c.956+1A>T	19.37:g.46027399A>T			Somatic	OREG0025556	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	936	VASP_uc010eki.2_Missense_Mutation_p.R153W|VASP_uc002pci.2_Missense_Mutation_p.R305W	p.R319W	NM_003370	NP_003361	WXS	Illumina HiSeq	Unspecified	P50552	VASP_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.0145)|GBM - Glioblastoma multiforme(486;0.154)	10	1297	+		Ovarian(192;0.051)|all_neural(266;0.112)	319			EVH2.		B2RBT9|Q6PIZ1|Q93035	Missense_Mutation	SNP	ENST00000245932.6	37	c.955A>T	CCDS33051.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.043162	0.75732	.	.	ENSG00000125753	ENST00000245932	T	0.73258	-0.73	4.29	4.29	0.51040	.	0.334930	0.30890	N	0.008677	T	0.80773	0.4687	M	0.67700	2.07	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	T	0.82450	-0.0451	10	0.66056	D	0.02	-19.0799	11.7119	0.51630	1.0:0.0:0.0:0.0	.	319	P50552	VASP_HUMAN	W	319	ENSP00000245932:R319W	ENSP00000245932:R319W	R	+	1	2	VASP	50719239	1.000000	0.71417	1.000000	0.80357	0.660000	0.38997	5.112000	0.64634	1.942000	0.56320	0.459000	0.35465	AGG		0.577	VASP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459589.1		Missense_Mutation	31	29	0	0	0	0	31	29				
MYH14	79784	broad.mit.edu	37	19	50713685	50713685	+	Silent	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr19:50713685C>T	ENST00000596571.1	+	1	63	c.63C>T	c.(61-63)ccC>ccT	p.P21P	MYH14_ENST00000262269.8_Silent_p.P21P|MYH14_ENST00000440075.2_Silent_p.P21P|MYH14_ENST00000376970.2_Silent_p.P21P|MYH14_ENST00000601313.1_Silent_p.P21P|MYH14_ENST00000425460.1_Silent_p.P21P|MYH14_ENST00000598205.1_Silent_p.P21P			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	21					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		GCCCAGTGCCCGAGGCGGCCC	0.756																																						uc002prr.1		NA																	0				central_nervous_system(1)	1						c.(61-63)CCC>CCT		myosin, heavy chain 14 isoform 2																																				SO:0001819	synonymous_variant	79784				axon guidance|regulation of cell shape	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity	g.chr19:50713685C>T	AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.63C>T	19.37:g.50713685C>T			Somatic				MYH14_uc010enu.1_Silent_p.P21P|MYH14_uc002prq.1_Silent_p.P21P	p.P21P	NM_024729	NP_079005	WXS	Illumina HiSeq	Unspecified	Q7Z406	MYH14_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)	2	110	+		all_neural(266;0.0571)|Ovarian(192;0.0728)	21			Myosin head-like.		B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Silent	SNP	ENST00000596571.1	37	c.63C>T	CCDS59411.1																																																																																				0.756	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464710.2	NM_024729		5	1	0	0	0	0	5	1				
ZNF845	91664	broad.mit.edu	37	19	53854940	53854940	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr19:53854940C>G	ENST00000595091.1	+	5	1231	c.1012C>G	c.(1012-1014)Caa>Gaa	p.Q338E	ZNF845_ENST00000458035.1_Missense_Mutation_p.Q338E			Q96IR2	ZN845_HUMAN	zinc finger protein 845	338					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(10)|lung(7)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	26						GACCTTCAGTCAAACGTCATA	0.388																																						uc010ydv.1		NA																	0					0						c.(1012-1014)CAA>GAA		zinc finger protein 845							59.0	52.0	54.0					19																	53854940		692	1591	2283	SO:0001583	missense	91664				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53854940C>G	BC007307	CCDS46170.1	19q13.42	2013-01-08			ENSG00000213799	ENSG00000213799		"""Zinc fingers, C2H2-type"", ""-"""	25112	protein-coding gene	gene with protein product							Standard	NM_138374		Approved		uc010ydv.1	Q96IR2		ENST00000595091.1:c.1012C>G	19.37:g.53854940C>G	ENSP00000470005:p.Gln338Glu		Somatic				ZNF845_uc010ydw.1_Missense_Mutation_p.Q338E	p.Q338E	NM_138374	NP_612383	WXS	Illumina HiSeq	Unspecified	Q96IR2	ZN845_HUMAN			4	1129	+			338			C2H2-type 5.			Missense_Mutation	SNP	ENST00000595091.1	37	c.1012C>G	CCDS46170.1	.	.	.	.	.	.	.	.	.	.	C	6.762	0.509485	0.12883	.	.	ENSG00000213799	ENST00000458035;ENST00000427984	T	0.01119	5.31	2.05	-4.11	0.03928	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01287	0.0042	L	0.59967	1.855	0.09310	N	1	B	0.27117	0.168	B	0.21151	0.033	T	0.33085	-0.9882	9	0.30078	T	0.28	.	6.1179	0.20137	0.3598:0.4083:0.232:0.0	.	338	Q96IR2	ZN845_HUMAN	E	338	ENSP00000388311:Q338E	ENSP00000412086:Q338E	Q	+	1	0	ZNF845	58546752	0.000000	0.05858	0.000000	0.03702	0.648000	0.38561	-2.409000	0.01041	-1.930000	0.01056	0.205000	0.17691	CAA		0.388	ZNF845-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464359.1	XM_039908		29	50	0	0	0	0	29	50				
PRKCG	5582	broad.mit.edu	37	19	54401792	54401792	+	Silent	SNP	G	G	C			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr19:54401792G>C	ENST00000263431.3	+	11	1473	c.1191G>C	c.(1189-1191)ctG>ctC	p.L397L	PRKCG_ENST00000542049.1_Silent_p.L284L|PRKCG_ENST00000536044.1_3'UTR|PRKCG_ENST00000540413.1_Silent_p.L397L	NM_002739.3	NP_002730.1	P05129	KPCG_HUMAN	protein kinase C, gamma	397	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cell death (GO:0008219)|chemosensory behavior (GO:0007635)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein ubiquitination (GO:0031397)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of mismatch repair (GO:0032425)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to morphine (GO:0043278)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic membrane (GO:0097060)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(4)|ovary(2)|pancreas(2)|skin(1)	10	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)	Tamoxifen(DB00675)	ACTGCACGCTGGTGGAGAAAC	0.637																																						uc002qcq.1		NA																	0				lung(4)|ovary(2)|pancreas(2)|large_intestine(1)	9						c.(1189-1191)CTG>CTC		protein kinase C, gamma							41.0	38.0	39.0					19																	54401792		2203	4300	6503	SO:0001819	synonymous_variant	5582				activation of phospholipase C activity|cell death|intracellular signal transduction|negative regulation of protein catabolic process|negative regulation of protein ubiquitination|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of mismatch repair|synaptic transmission	cytosol	ATP binding|protein kinase C activity|zinc ion binding	g.chr19:54401792G>C	M13977	CCDS12867.1	19q13.4	2014-09-17			ENSG00000126583	ENSG00000126583	2.7.11.1		9402	protein-coding gene	gene with protein product	"""PKC-gamma"""	176980		PKCG, SCA14		8432525, 3755548	Standard	NM_002739		Approved	PKCC, MGC57564	uc002qcq.1	P05129	OTTHUMG00000064846	ENST00000263431.3:c.1191G>C	19.37:g.54401792G>C			Somatic				PRKCG_uc010yef.1_3'UTR|PRKCG_uc010yeg.1_Silent_p.L397L|PRKCG_uc010yeh.1_Silent_p.L284L	p.L397L	NM_002739	NP_002730	WXS	Illumina HiSeq	Unspecified	P05129	KPCG_HUMAN		GBM - Glioblastoma multiforme(134;0.0521)	11	1473	+	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)		397			Protein kinase.		B7Z8Q0	Silent	SNP	ENST00000263431.3	37	c.1191G>C	CCDS12867.1																																																																																				0.637	PRKCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139233.3	NM_002739		13	19	0	0	0	0	13	19				
KIF3C	3797	broad.mit.edu	37	2	26203809	26203809	+	Silent	SNP	G	G	C			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr2:26203809G>C	ENST00000264712.3	-	1	1557	c.978C>G	c.(976-978)ctC>ctG	p.L326L	KIF3C_ENST00000405914.1_Silent_p.L326L	NM_002254.6	NP_002245	O14782	KIF3C_HUMAN	kinesin family member 3C	326	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle transport along microtubule (GO:0072384)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGGAGTCCTGGAGCAGCCGGG	0.607																																						uc002rgu.2		NA																	0				ovary(3)|skin(1)	4						c.(976-978)CTC>CTG		kinesin family member 3C							56.0	61.0	59.0					2																	26203809		2203	4300	6503	SO:0001819	synonymous_variant	3797				blood coagulation|microtubule-based movement	cytosol|kinesin complex|microtubule	ATP binding|microtubule motor activity	g.chr2:26203809G>C		CCDS1719.1	2p23	2008-02-05			ENSG00000084731	ENSG00000084731		"""Kinesins"""	6321	protein-coding gene	gene with protein product		602845				9480755	Standard	NM_002254		Approved		uc002rgu.2	O14782	OTTHUMG00000094797	ENST00000264712.3:c.978C>G	2.37:g.26203809G>C			Somatic				KIF3C_uc010eyj.1_RNA|KIF3C_uc010ykr.1_Silent_p.L326L	p.L326L	NM_002254	NP_002245	WXS	Illumina HiSeq	Unspecified	O14782	KIF3C_HUMAN			1	1635	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		326			Kinesin-motor.		O43544|Q4ZG18|Q53SX5|Q562F7	Silent	SNP	ENST00000264712.3	37	c.978C>G	CCDS1719.1																																																																																				0.607	KIF3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211611.1			22	46	0	0	0	0	22	46				
PRKD3	23683	broad.mit.edu	37	2	37506980	37506980	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr2:37506980C>T	ENST00000379066.1	-	8	1843	c.1081G>A	c.(1081-1083)Gaa>Aaa	p.E361K	PRKD3_ENST00000234179.2_Missense_Mutation_p.E361K			O94806	KPCD3_HUMAN	protein kinase D3	361					intracellular signal transduction (GO:0035556)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)			breast(3)|central_nervous_system(2)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33		all_hematologic(82;0.21)				GATGGCTCTTCTGTGTCATCC	0.398																																					Melanoma(80;621 1355 8613 11814 51767)	uc002rqd.2		NA																	0				lung(2)|ovary(1)|central_nervous_system(1)	4						c.(1081-1083)GAA>AAA		protein kinase D3							104.0	101.0	102.0					2																	37506980		2203	4300	6503	SO:0001583	missense	23683				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction	cytoplasm|membrane|nucleus	ATP binding|metal ion binding|protein binding|protein kinase C activity	g.chr2:37506980C>T	AB015982	CCDS1789.1	2p21	2013-01-10	2004-10-28	2004-10-30	ENSG00000115825	ENSG00000115825		"""Pleckstrin homology (PH) domain containing"""	9408	protein-coding gene	gene with protein product		607077	"""protein kinase C, nu"""	PRKCN		10231560	Standard	NM_005813		Approved	EPK2	uc002rqd.3	O94806	OTTHUMG00000100961	ENST00000379066.1:c.1081G>A	2.37:g.37506980C>T	ENSP00000368356:p.Glu361Lys		Somatic				PRKD3_uc002rqe.1_5'Flank|PRKD3_uc002rqf.1_Missense_Mutation_p.E361K	p.E361K	NM_005813	NP_005804	WXS	Illumina HiSeq	Unspecified	O94806	KPCD3_HUMAN			7	1636	-		all_hematologic(82;0.21)	361					D6W587|Q53TR7|Q8NEL8	Missense_Mutation	SNP	ENST00000379066.1	37	c.1081G>A	CCDS1789.1	.	.	.	.	.	.	.	.	.	.	C	18.22	3.574685	0.65878	.	.	ENSG00000115825	ENST00000379066;ENST00000234179	T;T	0.65732	-0.17;-0.17	5.88	5.01	0.66863	.	0.057209	0.64402	D	0.000002	T	0.60011	0.2236	M	0.70275	2.135	0.80722	D	1	P;B	0.35139	0.486;0.311	B;B	0.32677	0.098;0.15	T	0.60424	-0.7266	10	0.35671	T	0.21	-23.8934	13.4447	0.61134	0.0:0.9276:0.0:0.0724	.	361;361	O94806-2;O94806	.;KPCD3_HUMAN	K	361	ENSP00000368356:E361K;ENSP00000234179:E361K	ENSP00000234179:E361K	E	-	1	0	PRKD3	37360484	1.000000	0.71417	0.855000	0.33649	0.861000	0.49209	7.143000	0.77348	1.499000	0.48617	0.591000	0.81541	GAA		0.398	PRKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218570.3	NM_005813		50	49	0	0	0	0	50	49				
ABCG8	64241	broad.mit.edu	37	2	44099198	44099198	+	Silent	SNP	C	C	T	rs553899742		TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr2:44099198C>T	ENST00000272286.2	+	7	1138	c.1048C>T	c.(1048-1050)Cta>Tta	p.L350L		NM_022437.2	NP_071882.1	Q9H221	ABCG8_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 8	350					ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|phospholipid transport (GO:0015914)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein heterodimerization activity (GO:0046982)|sterol transporter activity (GO:0015248)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(21)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	AGCCCTGTTTCTAGAAAAAGT	0.537																																						uc002rtq.2		NA																	0				skin(3)|ovary(1)	4						c.(1048-1050)CTA>TTA		ATP-binding cassette sub-family G member 8							108.0	106.0	107.0					2																	44099198		2203	4300	6503	SO:0001819	synonymous_variant	64241				cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity	g.chr2:44099198C>T	AF320294	CCDS1815.1	2p21	2012-03-14	2008-07-31		ENSG00000143921	ENSG00000143921		"""ATP binding cassette transporters / subfamily G"""	13887	protein-coding gene	gene with protein product	"""gallbladder disease 4"", ""sterolin 2"""	605460	"""ATP-binding cassette, sub-family G (WHITE), member 8 (sterolin 2)"""			11099417, 17626266	Standard	NM_022437		Approved	GBD4	uc002rtq.3	Q9H221	OTTHUMG00000128756	ENST00000272286.2:c.1048C>T	2.37:g.44099198C>T			Somatic				ABCG8_uc010yoa.1_Silent_p.L350L	p.L350L	NM_022437	NP_071882	WXS	Illumina HiSeq	Unspecified	Q9H221	ABCG8_HUMAN			7	1138	+		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	350			Cytoplasmic (Potential).		Q53QN8	Silent	SNP	ENST00000272286.2	37	c.1048C>T	CCDS1815.1																																																																																				0.537	ABCG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250671.1	NM_022437		48	72	0	0	0	0	48	72				
LRPPRC	10128	broad.mit.edu	37	2	44162018	44162018	+	Splice_Site	SNP	C	C	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr2:44162018C>A	ENST00000260665.7	-	24	2562		c.e24-1			NM_133259.3	NP_573566.2	P42704	LPPRC_HUMAN	leucine-rich pentatricopeptide repeat containing						mitochondrion transport along microtubule (GO:0047497)|mRNA transport (GO:0051028)|negative regulation of mitochondrial RNA catabolic process (GO:0000961)|regulation of mitochondrial translation (GO:0070129)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(3)|endometrium(3)|kidney(5)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|skin(2)	41		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				TAGGTCGCCCCTTAGAAACAA	0.328																																						uc002rtr.2		NA																	0				ovary(2)|skin(1)	3						c.e24-1		leucine-rich PPR motif-containing protein							51.0	52.0	52.0					2																	44162018		2202	4299	6501	SO:0001630	splice_region_variant	10128				mitochondrion transport along microtubule|mRNA transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	condensed nuclear chromosome|cytoskeleton|mitochondrial nucleoid|nuclear inner membrane|nuclear outer membrane|nucleoplasm|perinuclear region of cytoplasm	beta-tubulin binding|microtubule binding|RNA binding	g.chr2:44162018C>A	M92439	CCDS33189.1	2p21	2012-02-24	2012-02-24		ENSG00000138095	ENSG00000138095			15714	protein-coding gene	gene with protein product		607544	"""Leigh syndrome, French-Canadian type (cytochrome oxidase deficiency)"""	LSFC		8012652, 8619474, 22045337	Standard	NM_133259		Approved	GP130, LRP130	uc002rtr.2	P42704	OTTHUMG00000152782	ENST00000260665.7:c.2505-1G>T	2.37:g.44162018C>A			Somatic				LRPPRC_uc010yob.1_Splice_Site_p.K735_splice	p.K835_splice	NM_133259	NP_573566	WXS	Illumina HiSeq	Unspecified	P42704	LPPRC_HUMAN			24	2563	-		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)						A0PJE3|A8K1V1|Q53PC0|Q53QN7|Q6ZUD8|Q7Z7A6|Q96D84	Splice_Site	SNP	ENST00000260665.7	37	c.2505_splice	CCDS33189.1	.	.	.	.	.	.	.	.	.	.	C	12.64	1.998235	0.35226	.	.	ENSG00000138095	ENST00000465633;ENST00000260665	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7656	0.96337	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LRPPRC	44015522	1.000000	0.71417	0.994000	0.49952	0.056000	0.15407	7.090000	0.76916	2.760000	0.94817	0.655000	0.94253	.		0.328	LRPPRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327823.1	NM_133259	Intron	23	38	1	0	2.22e-12	2.82e-12	23	38				
EFEMP1	2202	broad.mit.edu	37	2	56149558	56149558	+	Silent	SNP	G	G	A	rs182486751		TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr2:56149558G>A	ENST00000394555.2	-	2	453	c.18C>T	c.(16-18)ttC>ttT	p.F6F	EFEMP1_ENST00000497698.1_5'UTR|EFEMP1_ENST00000394554.1_Silent_p.F6F|EFEMP1_ENST00000424836.2_5'UTR|EFEMP1_ENST00000355426.3_Silent_p.F6F	NM_001039348.2|NM_001039349.2	NP_001034437.1|NP_001034438.1	Q12805	FBLN3_HUMAN	EGF containing fibulin-like extracellular matrix protein 1	6					epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|negative regulation of chondrocyte differentiation (GO:0032331)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|epidermal growth factor-activated receptor activity (GO:0005006)			NS(1)|breast(2)|endometrium(4)|large_intestine(6)|lung(5)|ovary(5)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			GCATAGTTAGGAAAAGGGCTT	0.428													G|||	1	0.000199681	0.0	0.0014	5008	,	,		21041	0.0		0.0	False		,,,				2504	0.0				GBM(92;934 1319 7714 28760 40110)	uc002rzh.2		NA																	0				ovary(4)|pancreas(1)|skin(1)	6						c.(16-18)TTC>TTT		EGF-containing fibulin-like extracellular matrix		G	,	0,4406		0,0,2203	149.0	140.0	143.0		18,18	4.1	1.0	2		143	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	EFEMP1	NM_001039348.2,NM_001039349.2	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	6/494,6/494	56149558	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	2202				negative regulation of chondrocyte differentiation|peptidyl-tyrosine phosphorylation|regulation of transcription, DNA-dependent|visual perception	extracellular space|proteinaceous extracellular matrix	calcium ion binding|epidermal growth factor receptor activity|epidermal growth factor receptor binding|growth factor activity	g.chr2:56149558G>A	U03877	CCDS1857.1	2p16	2013-01-08	2011-01-25		ENSG00000115380	ENSG00000115380		"""Fibulins"""	3218	protein-coding gene	gene with protein product	"""fibulin 3"""	601548	"""fibrillin-like"", ""EGF-containing fibulin-like extracellular matrix protein 1"""	DHRD, FBNL		8812496, 7799918	Standard	NM_001039348		Approved	S1-5, FBLN3, MTLV	uc002rzi.3	Q12805	OTTHUMG00000129343	ENST00000394555.2:c.18C>T	2.37:g.56149558G>A			Somatic				EFEMP1_uc002rzi.2_Silent_p.F6F|EFEMP1_uc002rzj.2_Silent_p.F6F|EFEMP1_uc010ypc.1_5'UTR	p.F6F	NM_004105	NP_004096	WXS	Illumina HiSeq	Unspecified	Q12805	FBLN3_HUMAN	LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)		2	348	-			6					A8K3I4|B4DW75|D6W5D2|Q541U7	Silent	SNP	ENST00000394555.2	37	c.18C>T	CCDS1857.1																																																																																				0.428	EFEMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251491.2			66	71	0	0	0	0	66	71				
SLC5A7	60482	broad.mit.edu	37	2	108626706	108626706	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr2:108626706G>A	ENST00000264047.2	+	9	1408	c.1132G>A	c.(1132-1134)Gtt>Att	p.V378I	SLC5A7_ENST00000540517.1_Missense_Mutation_p.V273I|SLC5A7_ENST00000409059.1_Missense_Mutation_p.V378I	NM_021815.2	NP_068587.1	Q9GZV3	SC5A7_HUMAN	solute carrier family 5 (sodium/choline cotransporter), member 7	378					acetylcholine biosynthetic process (GO:0008292)|cell death (GO:0008219)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	choline binding (GO:0033265)|choline transmembrane transporter activity (GO:0015220)|choline:sodium symporter activity (GO:0005307)	p.V378I(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	49					Choline(DB00122)	CAAAGAAATCGTTTGGGTTAT	0.443																																						uc002tdv.2		NA																	2	Substitution - Missense(2)	p.V378I(1)	ovary(1)|pancreas(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(1132-1134)GTT>ATT		solute carrier family 5 (choline transporter),	Choline(DB00122)						148.0	120.0	129.0					2																	108626706		2203	4300	6503	SO:0001583	missense	60482				acetylcholine biosynthetic process|neurotransmitter secretion	integral to membrane|plasma membrane	choline:sodium symporter activity	g.chr2:108626706G>A	AF276871	CCDS2074.1	2q12	2013-07-19	2013-07-19		ENSG00000115665	ENSG00000115665		"""Solute carriers"""	14025	protein-coding gene	gene with protein product		608761	"""solute carrier family 5 (choline transporter), member 7"""			11027560	Standard	NM_021815		Approved	hCHT, CHT1	uc002tdv.3	Q9GZV3	OTTHUMG00000130959	ENST00000264047.2:c.1132G>A	2.37:g.108626706G>A	ENSP00000264047:p.Val378Ile		Somatic				SLC5A7_uc010ywm.1_Missense_Mutation_p.V131I|SLC5A7_uc010fjj.2_Missense_Mutation_p.V378I|SLC5A7_uc010ywn.1_Missense_Mutation_p.V265I	p.V378I	NM_021815	NP_068587	WXS	Illumina HiSeq	Unspecified	Q9GZV3	SC5A7_HUMAN			9	1408	+			378			Helical; (Potential).		Q53TF2	Missense_Mutation	SNP	ENST00000264047.2	37	c.1132G>A	CCDS2074.1	.	.	.	.	.	.	.	.	.	.	G	8.887	0.953064	0.18431	.	.	ENSG00000115665	ENST00000409059;ENST00000540517;ENST00000264047	D;D;D	0.89050	-2.46;-2.46;-2.46	5.85	2.92	0.33932	.	0.168277	0.51477	N	0.000083	T	0.79724	0.4495	N	0.25647	0.755	0.49915	D	0.999832	B	0.06786	0.001	B	0.10450	0.005	T	0.70360	-0.4893	10	0.31617	T	0.26	-25.0208	8.2684	0.31829	0.1388:0.0:0.7353:0.1259	.	378	Q9GZV3	SC5A7_HUMAN	I	378;273;378	ENSP00000387346:V378I;ENSP00000445351:V273I;ENSP00000264047:V378I	ENSP00000264047:V378I	V	+	1	0	SLC5A7	107993138	1.000000	0.71417	0.256000	0.24389	0.798000	0.45092	4.104000	0.57790	0.773000	0.33404	-0.143000	0.13931	GTT		0.443	SLC5A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253562.1			42	60	0	0	0	0	42	60				
LY75	4065	broad.mit.edu	37	2	160663608	160663608	+	Silent	SNP	G	G	C			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr2:160663608G>C	ENST00000263636.4	-	34	4893	c.4866C>G	c.(4864-4866)gtC>gtG	p.V1622V	LY75_ENST00000554112.1_Silent_p.V1622V|LY75_ENST00000553424.1_Intron|LY75-CD302_ENST00000505052.1_Intron|LY75-CD302_ENST00000504764.1_Silent_p.V1622V	NM_002349.3	NP_002340.2	O60449	LY75_HUMAN	lymphocyte antigen 75	1622	C-type lectin 10. {ECO:0000255|PROSITE- ProRule:PRU00040}.				endocytosis (GO:0006897)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(22)|prostate(7)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	59				COAD - Colon adenocarcinoma(177;0.132)		TTTCCCATTTGACAAATGTCA	0.343																																						uc002ubc.3		NA																	0					0						c.(4864-4866)GTC>GTG		lymphocyte antigen 75 precursor							143.0	132.0	136.0					2																	160663608		2203	4300	6503	SO:0001819	synonymous_variant	4065				endocytosis|immune response|inflammatory response	integral to plasma membrane	receptor activity|sugar binding	g.chr2:160663608G>C	AF011333	CCDS2211.1	2q24	2011-08-30			ENSG00000054219	ENSG00000054219		"""CD molecules"", ""C-type lectin domain containing"""	6729	protein-coding gene	gene with protein product		604524				9553150	Standard	NM_002349		Approved	DEC-205, CLEC13B, CD205		O60449	OTTHUMG00000132025	ENST00000263636.4:c.4866C>G	2.37:g.160663608G>C			Somatic				LY75_uc002ubb.3_Silent_p.V1622V|LY75_uc010fos.2_Intron	p.V1622V	NM_002349	NP_002340	WXS	Illumina HiSeq	Unspecified	O60449	LY75_HUMAN		COAD - Colon adenocarcinoma(177;0.132)	34	4935	-			1622			Extracellular (Potential).|C-type lectin 10.		O75913|Q53R46|Q53TF5|Q7Z575|Q7Z577	Silent	SNP	ENST00000263636.4	37	c.4866C>G	CCDS2211.1																																																																																				0.343	LY75-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255035.1			15	40	0	0	0	0	15	40				
ITGB6	3694	broad.mit.edu	37	2	160994637	160994637	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr2:160994637C>T	ENST00000283249.2	-	9	1418	c.1181G>A	c.(1180-1182)tGt>tAt	p.C394Y	ITGB6_ENST00000409967.2_Missense_Mutation_p.C394Y|ITGB6_ENST00000428609.2_Missense_Mutation_p.C352Y|ITGB6_ENST00000409872.1_Missense_Mutation_p.C394Y	NM_001282353.1|NM_001282354.1|NM_001282388.1	NP_001269282.1|NP_001269283.1|NP_001269317.1	P18564	ITB6_HUMAN	integrin, beta 6	394					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|multicellular organismal development (GO:0007275)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23						ACCGTTGTTACAGATGGCTGT	0.428																																						uc002ubh.2		NA																	0				ovary(1)|lung(1)|skin(1)	3						c.(1180-1182)TGT>TAT		integrin, beta 6 precursor							266.0	224.0	238.0					2																	160994637		2203	4300	6503	SO:0001583	missense	3694				cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|multicellular organismal development	integrin complex	receptor activity	g.chr2:160994637C>T		CCDS2212.1, CCDS63040.1, CCDS74596.1, CCDS74597.1	2q24.2	2010-03-23			ENSG00000115221	ENSG00000115221		"""Integrins"""	6161	protein-coding gene	gene with protein product		147558				1729173, 8120056	Standard	NM_001282353		Approved		uc002ubh.2	P18564	OTTHUMG00000132026	ENST00000283249.2:c.1181G>A	2.37:g.160994637C>T	ENSP00000283249:p.Cys394Tyr		Somatic				ITGB6_uc010fou.2_Missense_Mutation_p.C394Y|ITGB6_uc010zcq.1_Missense_Mutation_p.C352Y|ITGB6_uc010fov.1_Missense_Mutation_p.C394Y	p.C394Y	NM_000888	NP_000879	WXS	Illumina HiSeq	Unspecified	P18564	ITB6_HUMAN			9	1197	-			394			Extracellular (Potential).		B2R9W5|C9JA97|Q0VA95|Q16500|Q53RG5|Q53RR6	Missense_Mutation	SNP	ENST00000283249.2	37	c.1181G>A	CCDS2212.1	.	.	.	.	.	.	.	.	.	.	C	15.78	2.933490	0.52866	.	.	ENSG00000115221	ENST00000283249;ENST00000428609;ENST00000409967;ENST00000409872	D;D;D;D	0.95447	-3.71;-3.71;-3.71;-3.71	5.3	5.3	0.74995	Integrin beta subunit, N-terminal (2);	0.000000	0.85682	D	0.000000	D	0.98544	0.9514	H	0.95260	3.645	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99449	1.0940	10	0.87932	D	0	.	19.3313	0.94291	0.0:1.0:0.0:0.0	.	352;394	E9PEE8;P18564	.;ITB6_HUMAN	Y	394;352;394;394	ENSP00000283249:C394Y;ENSP00000408024:C352Y;ENSP00000386828:C394Y;ENSP00000386367:C394Y	ENSP00000283249:C394Y	C	-	2	0	ITGB6	160702883	1.000000	0.71417	0.804000	0.32291	0.094000	0.18550	7.559000	0.82265	2.648000	0.89879	0.650000	0.86243	TGT		0.428	ITGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255036.1	NM_000888		6	134	0	0	0	0	6	134				
KLHL23	151230	broad.mit.edu	37	2	170591601	170591601	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr2:170591601T>C	ENST00000392647.2	+	2	321	c.77T>C	c.(76-78)tTc>tCc	p.F26S	KLHL23_ENST00000272797.4_Missense_Mutation_p.F26S|KLHL23_ENST00000602521.1_Intron	NM_144711.5	NP_653312.2	Q8NBE8	KLH23_HUMAN	kelch-like family member 23	26										breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(4)|skin(1)|urinary_tract(1)	16						CTGGATGCATTCAGAACATTT	0.363																																						uc002ufh.1		NA																	0					0						c.(76-78)TTC>TCC		kelch-like 23							91.0	100.0	97.0					2																	170591601		2203	4300	6503	SO:0001583	missense	151230							g.chr2:170591601T>C	BC010437	CCDS2236.1	2q31.1	2013-01-30	2013-01-30		ENSG00000213160	ENSG00000213160		"""Kelch-like"", ""BTB/POZ domain containing"""	27506	protein-coding gene	gene with protein product			"""kelch-like 23 (Drosophila)"""				Standard	NM_144711		Approved	MGC2610, FLJ37812, MGC22679	uc002ufi.2	Q8NBE8	OTTHUMG00000132213	ENST00000392647.2:c.77T>C	2.37:g.170591601T>C	ENSP00000376419:p.Phe26Ser		Somatic				KLHL23_uc002ufi.1_Missense_Mutation_p.F26S	p.F26S	NM_144711	NP_653312	WXS	Illumina HiSeq	Unspecified	Q8NBE8	KLH23_HUMAN			4	415	+			26					Q8N9B9|Q96FT8	Missense_Mutation	SNP	ENST00000392647.2	37	c.77T>C	CCDS2236.1	.	.	.	.	.	.	.	.	.	.	T	18.40	3.615043	0.66672	.	.	ENSG00000213160	ENST00000272797;ENST00000392647	T;T	0.71698	-0.59;-0.59	5.6	5.6	0.85130	BTB/POZ fold (2);	0.049591	0.85682	D	0.000000	D	0.82756	0.5106	M	0.83953	2.67	0.33298	D	0.564442	D	0.57899	0.981	P	0.57679	0.825	D	0.87130	0.2196	9	0.87932	D	0	.	15.7932	0.78384	0.0:0.0:0.0:1.0	.	26	Q8NBE8	KLH23_HUMAN	S	26	ENSP00000272797:F26S;ENSP00000376419:F26S	ENSP00000272797:F26S	F	+	2	0	KLHL23	170299847	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	7.654000	0.83653	2.124000	0.65301	0.533000	0.62120	TTC		0.363	KLHL23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255271.2	NM_144711		5	118	0	0	0	0	5	118				
ITGA4	3676	broad.mit.edu	37	2	182387035	182387035	+	Silent	SNP	C	C	T	rs369064185		TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr2:182387035C>T	ENST00000397033.2	+	18	2470	c.2040C>T	c.(2038-2040)ccC>ccT	p.P680P		NM_000885.4	NP_000876.3	P13612	ITA4_HUMAN	integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	680					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|chorio-allantoic fusion (GO:0060710)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|face development (GO:0060324)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|negative regulation of protein homodimerization activity (GO:0090074)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha4-beta7 complex (GO:0034669)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)	p.P680P(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)|Tinzaparin(DB06822)	TCAAACTACCCGTGGGTCTTT	0.338																																						uc002unu.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6						c.(2038-2040)CCC>CCT		integrin alpha 4 precursor	Natalizumab(DB00108)	C		1,3711		0,1,1855	171.0	161.0	164.0		2040	3.9	0.2	2		164	0,8192		0,0,4096	no	coding-synonymous	ITGA4	NM_000885.4		0,1,5951	TT,TC,CC		0.0,0.0269,0.0084		680/1033	182387035	1,11903	1856	4096	5952	SO:0001819	synonymous_variant	3676				blood coagulation|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response	integrin complex	identical protein binding|receptor activity	g.chr2:182387035C>T		CCDS42788.1	2q31-q32	2010-03-23			ENSG00000115232	ENSG00000115232		"""CD molecules"", ""Integrins"""	6140	protein-coding gene	gene with protein product		192975		CD49D		1537388	Standard	NM_000885		Approved	CD49d	uc002unu.3	P13612	OTTHUMG00000154212	ENST00000397033.2:c.2040C>T	2.37:g.182387035C>T			Somatic				ITGA4_uc010frj.1_Silent_p.P162P|ITGA4_uc002unv.2_5'UTR	p.P680P	NM_000885	NP_000876	WXS	Illumina HiSeq	Unspecified	P13612	ITA4_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0593)		18	2803	+			680			Extracellular (Potential).		D3DPG4|Q7Z4L6	Silent	SNP	ENST00000397033.2	37	c.2040C>T	CCDS42788.1																																																																																				0.338	ITGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334427.1			25	47	0	0	0	0	25	47				
ZNF804A	91752	broad.mit.edu	37	2	185801843	185801843	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr2:185801843G>T	ENST00000302277.6	+	4	2314	c.1720G>T	c.(1720-1722)Gat>Tat	p.D574Y		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	574							metal ion binding (GO:0046872)	p.D574Y(1)		NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						GGACACTCTAGATGAAAAATA	0.299																																						uc002uph.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						c.(1720-1722)GAT>TAT		zinc finger protein 804A							31.0	37.0	35.0					2																	185801843		2151	4277	6428	SO:0001583	missense	91752					intracellular	zinc ion binding	g.chr2:185801843G>T	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.1720G>T	2.37:g.185801843G>T	ENSP00000303252:p.Asp574Tyr		Somatic					p.D574Y	NM_194250	NP_919226	WXS	Illumina HiSeq	Unspecified	Q7Z570	Z804A_HUMAN			4	2314	+			574					A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	37	c.1720G>T	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	G	8.516	0.867631	0.17250	.	.	ENSG00000170396	ENST00000302277	T	0.06849	3.25	5.5	0.495	0.16890	.	0.430566	0.21880	N	0.067756	T	0.09686	0.0238	L	0.48642	1.525	0.20196	N	0.999924	P	0.45986	0.87	P	0.46975	0.533	T	0.14144	-1.0483	10	0.72032	D	0.01	-3.1981	6.007	0.19551	0.2905:0.1339:0.5756:0.0	.	574	Q7Z570	Z804A_HUMAN	Y	574	ENSP00000303252:D574Y	ENSP00000303252:D574Y	D	+	1	0	ZNF804A	185510088	0.627000	0.27129	0.028000	0.17463	0.603000	0.37013	0.903000	0.28475	-0.205000	0.10219	0.650000	0.86243	GAT		0.299	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250		20	42	1	0	3.62e-10	4.58e-10	20	42				
RAB17	64284	broad.mit.edu	37	2	238483689	238483689	+	Silent	SNP	C	C	T	rs375159510		TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr2:238483689C>T	ENST00000264601.3	-	6	1241	c.612G>A	c.(610-612)gcG>gcA	p.A204A	RAB17_ENST00000409822.1_Silent_p.A77A|RAB17_ENST00000538644.1_Silent_p.A77A|RAB17_ENST00000409576.1_Intron	NM_022449.3	NP_071894.1	Q9H0T7	RAB17_HUMAN	RAB17, member RAS oncogene family	204					cilium assembly (GO:0042384)|endocytic recycling (GO:0032456)|establishment of melanosome localization (GO:0032401)|filopodium assembly (GO:0046847)|GTP catabolic process (GO:0006184)|immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor (GO:0002415)|melanosome transport (GO:0032402)|protein transport (GO:0015031)|regulation of dendrite development (GO:0050773)|regulation of filopodium assembly (GO:0051489)|regulation of synapse assembly (GO:0051963)|small GTPase mediated signal transduction (GO:0007264)|transcytosis (GO:0045056)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|dendrite (GO:0030425)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|melanosome (GO:0042470)|neuronal cell body (GO:0043025)|recycling endosome (GO:0055037)|recycling endosome membrane (GO:0055038)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(1)	4		Renal(207;0.00272)|Breast(86;0.00297)|all_hematologic(139;0.182)|Ovarian(221;0.221)		Epithelial(121;9.36e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.26e-10)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000354)|Lung(119;0.011)|LUSC - Lung squamous cell carcinoma(224;0.026)		TGGCCTGCCTCGCGGGCCCCT	0.642																																					Colon(56;987 1029 6466 13943 27336)	uc002vwz.1		NA																	0					0						c.(610-612)GCG>GCA		RAB17, member RAS oncogene family		C		1,4405	2.1+/-5.4	0,1,2202	34.0	37.0	36.0		612	-2.8	0.0	2		36	0,8600		0,0,4300	no	coding-synonymous	RAB17	NM_022449.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		204/213	238483689	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	64284				protein transport|small GTPase mediated signal transduction	intracellular|plasma membrane	GTP binding|protein binding	g.chr2:238483689C>T	AK022600	CCDS2520.1	2q37.3	2008-05-23			ENSG00000124839	ENSG00000124839		"""RAB, member RAS oncogene"""	16523	protein-coding gene	gene with protein product		602206				9624171	Standard	NM_022449		Approved		uc002vwz.2	Q9H0T7	OTTHUMG00000133299	ENST00000264601.3:c.612G>A	2.37:g.238483689C>T			Somatic				RAB17_uc002vxa.1_RNA|RAB17_uc002vxb.1_RNA	p.A204A	NM_022449	NP_071894	WXS	Illumina HiSeq	Unspecified	Q9H0T7	RAB17_HUMAN		Epithelial(121;9.36e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.26e-10)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000354)|Lung(119;0.011)|LUSC - Lung squamous cell carcinoma(224;0.026)	6	1256	-		Renal(207;0.00272)|Breast(86;0.00297)|all_hematologic(139;0.182)|Ovarian(221;0.221)	204					Q53QV6|Q6IA73|Q6PJZ0|Q9BVU1|Q9H9U9	Silent	SNP	ENST00000264601.3	37	c.612G>A	CCDS2520.1																																																																																				0.642	RAB17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257084.2			30	39	0	0	0	0	30	39				
FARP2	9855	broad.mit.edu	37	2	242380775	242380775	+	Silent	SNP	C	C	G			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr2:242380775C>G	ENST00000264042.3	+	13	1385	c.1215C>G	c.(1213-1215)gcC>gcG	p.A405A	FARP2_ENST00000373287.4_Silent_p.A405A|FARP2_ENST00000545004.1_Silent_p.A405A	NM_014808.2	NP_055623.1	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	405					actin cytoskeleton reorganization (GO:0031532)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|neuron remodeling (GO:0016322)|osteoclast differentiation (GO:0030316)|podosome assembly (GO:0071800)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of integrin activation (GO:0033623)|regulation of Rac GTPase activity (GO:0032314)|semaphorin-plexin signaling pathway (GO:0071526)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	43		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		CAGCGAATGCCTTTTACTCGC	0.502																																						uc002wbi.1		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.(1213-1215)GCC>GCG		FERM, RhoGEF and pleckstrin domain protein 2							105.0	96.0	99.0					2																	242380775		2203	4300	6503	SO:0001819	synonymous_variant	9855				axon guidance|neuron remodeling|Rac protein signal transduction|regulation of Rho protein signal transduction	cytoskeleton|cytosol|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity	g.chr2:242380775C>G	AB018336	CCDS33424.1, CCDS63197.1	2q37.3	2013-01-10			ENSG00000006607	ENSG00000006607		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16460	protein-coding gene	gene with protein product						9872452, 12351724	Standard	NM_001282984		Approved	KIAA0793, FIR, PLEKHC3, FRG	uc002wbi.2	O94887	OTTHUMG00000151574	ENST00000264042.3:c.1215C>G	2.37:g.242380775C>G			Somatic				FARP2_uc010zoq.1_Silent_p.A405A|FARP2_uc010zor.1_Silent_p.A405A|uc002wbj.2_5'Flank	p.A405A	NM_014808	NP_055623	WXS	Illumina HiSeq	Unspecified	O94887	FARP2_HUMAN		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)	13	1332	+		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)	405					B7Z6J8|F5GZ84|Q53QM5|Q8WU27|Q9UFE7	Silent	SNP	ENST00000264042.3	37	c.1215C>G	CCDS33424.1																																																																																				0.502	FARP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323153.1			27	56	0	0	0	0	27	56				
C20orf27	54976	broad.mit.edu	37	20	3739186	3739186	+	Silent	SNP	G	G	C			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr20:3739186G>C	ENST00000379772.3	-	3	969	c.159C>G	c.(157-159)gtC>gtG	p.V53V	C20orf27_ENST00000217195.8_Silent_p.V78V	NM_001258429.1	NP_001245358.1	Q9GZN8	CT027_HUMAN	chromosome 20 open reading frame 27	53										central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)|urinary_tract(1)	7						CATGTACCTTGACCAGAAAGC	0.587																																						uc002wji.1		NA																	0					0						c.(157-159)GTC>GTG		hypothetical protein LOC54976							156.0	145.0	148.0					20																	3739186		2203	4300	6503	SO:0001819	synonymous_variant	54976							g.chr20:3739186G>C	AK000557	CCDS33436.1, CCDS58763.1	20p13	2011-01-25			ENSG00000101220	ENSG00000101220			15873	protein-coding gene	gene with protein product	"""hypothetical protein LOC54976"""					11780052	Standard	NM_001258429		Approved	FLJ20550	uc002wjh.2	Q9GZN8	OTTHUMG00000031753	ENST00000379772.3:c.159C>G	20.37:g.3739186G>C			Somatic				C20orf27_uc002wjf.1_Silent_p.V78V|C20orf27_uc002wjh.1_Silent_p.V78V	p.V53V	NM_001039140	NP_001034229	WXS	Illumina HiSeq	Unspecified	Q9GZN8	CT027_HUMAN			3	388	-			53					A8K4J0|D3DVX8|Q5JX81|Q9NWX3	Silent	SNP	ENST00000379772.3	37	c.159C>G	CCDS58763.1	.	.	.	.	.	.	.	.	.	.	G	10.19	1.280897	0.23392	.	.	ENSG00000101220	ENST00000399683	.	.	.	4.96	3.01	0.34805	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-5.2493	9.3806	0.38311	0.1739:0.0:0.8261:0.0	.	.	.	.	X	47	.	.	S	-	2	0	C20orf27	3687186	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	2.092000	0.41700	0.817000	0.34445	0.650000	0.86243	TCA		0.587	C20orf27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077750.2	NM_001039140		7	142	0	0	0	0	7	142				
RIN2	54453	broad.mit.edu	37	20	19937366	19937366	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr20:19937366G>A	ENST00000255006.6	+	4	562	c.413G>A	c.(412-414)cGg>cAg	p.R138Q	RIN2_ENST00000440354.2_Missense_Mutation_p.R89Q|RIN2_ENST00000484638.1_3'UTR	NM_001242581.1|NM_018993.3	NP_001229510.1|NP_061866.1	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2	89	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	27						ATCTTGGACCGGCTCCTCCAC	0.607																																						uc002wro.1		NA																	0				lung(4)|ovary(1)	5						c.(265-267)CGG>CAG		Ras and Rab interactor 2							32.0	37.0	36.0					20																	19937366		2009	4152	6161	SO:0001583	missense	54453				endocytosis|small GTPase mediated signal transduction	cytoplasm	GTPase activator activity|Rab guanyl-nucleotide exchange factor activity	g.chr20:19937366G>A	AB060339	CCDS56182.1	20p11.22	2008-07-30			ENSG00000132669	ENSG00000132669			18750	protein-coding gene	gene with protein product		610222				11733506, 1849280, 16423831	Standard	NM_018993		Approved	RASSF4	uc002wro.2	Q8WYP3	OTTHUMG00000031996	ENST00000255006.6:c.413G>A	20.37:g.19937366G>A	ENSP00000255006:p.Arg138Gln		Somatic				RIN2_uc010gcu.1_Missense_Mutation_p.R89Q|RIN2_uc010gcv.1_5'UTR	p.R89Q	NM_018993	NP_061866	WXS	Illumina HiSeq	Unspecified	Q8WYP3	RIN2_HUMAN			3	302	+			89					Q00425|Q5TFT8|Q9BQL3|Q9H071	Missense_Mutation	SNP	ENST00000255006.6	37	c.266G>A	CCDS56182.1	.	.	.	.	.	.	.	.	.	.	G	18.43	3.621647	0.66787	.	.	ENSG00000132669	ENST00000255006;ENST00000440354	T;T	0.49139	0.79;3.19	5.25	4.3	0.51218	.	0.168788	0.47852	N	0.000217	T	0.56992	0.2023	M	0.65975	2.015	0.20563	N	0.999888	D;P	0.76494	0.999;0.913	P;B	0.58820	0.846;0.062	T	0.51148	-0.8742	9	.	.	.	-19.2651	6.6558	0.22986	0.31:0.0:0.69:0.0	.	89;89	E7EPJ1;Q8WYP3	.;RIN2_HUMAN	Q	138;89	ENSP00000255006:R138Q;ENSP00000391239:R89Q	.	R	+	2	0	RIN2	19885366	1.000000	0.71417	0.999000	0.59377	0.986000	0.74619	4.538000	0.60650	1.221000	0.43506	0.561000	0.74099	CGG		0.607	RIN2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078212.1			4	29	0	0	0	0	4	29				
ENTPD6	955	broad.mit.edu	37	20	25197285	25197285	+	Splice_Site	SNP	C	C	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr20:25197285C>A	ENST00000376652.4	+	8	874	c.711C>A	c.(709-711)ggC>ggA	p.G237G	ENTPD6_ENST00000360031.2_Splice_Site_p.G236G|ENTPD6_ENST00000433259.2_Splice_Site_p.G237G|ENTPD6_ENST00000354989.5_Splice_Site_p.G220G|Y_RNA_ENST00000365544.1_RNA			O75354	ENTP6_HUMAN	ectonucleoside triphosphate diphosphohydrolase 6 (putative)	237					response to calcium ion (GO:0051592)|response to magnesium ion (GO:0032026)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	guanosine-5'-triphosphate,3'-diphosphate diphosphatase activity (GO:0008894)|nucleoside-triphosphatase activity (GO:0017111)|uridine-diphosphatase activity (GO:0045134)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|prostate(1)|skin(1)	27						GTGCTCCAGGCAGCTTGAAAA	0.572																																						uc002wuj.2		NA																	0					0						c.(709-711)GGC>GGA		ectonucleoside triphosphate diphosphohydrolase 6							43.0	34.0	37.0					20																	25197285		2201	4300	6501	SO:0001630	splice_region_variant	955					Golgi membrane|integral to membrane	nucleoside-diphosphatase activity	g.chr20:25197285C>A	AF039916	CCDS13170.1, CCDS46586.1	20p11.21	2010-06-24	2010-06-24		ENSG00000197586	ENSG00000197586			3368	protein-coding gene	gene with protein product		603160	"""interleukin 6 signal transducer-2"""	CD39L2, IL6ST2		9676430	Standard	NM_001247		Approved	NTPDase-6, dJ738P15.3	uc002wuj.2	O75354	OTTHUMG00000032116	ENST00000376652.4:c.710-1C>A	20.37:g.25197285C>A			Somatic				ENTPD6_uc010zsy.1_Silent_p.G237G|ENTPD6_uc010gdj.1_Silent_p.G209G|ENTPD6_uc010zsz.1_Silent_p.G19G|ENTPD6_uc002wum.2_Silent_p.G220G|ENTPD6_uc010zta.1_Silent_p.G237G|ENTPD6_uc002wun.2_Silent_p.G237G|ENTPD6_uc002wuk.2_Silent_p.G236G|ENTPD6_uc002wul.2_Silent_p.G236G|ENTPD6_uc010ztb.1_Silent_p.G209G|ENTPD6_uc010ztc.1_Silent_p.G209G|ENTPD6_uc002wuo.2_Intron|ENTPD6_uc010ztd.1_Silent_p.G19G	p.G237G	NM_001247	NP_001238	WXS	Illumina HiSeq	Unspecified	O75354	ENTP6_HUMAN			8	891	+			237			Lumenal (Potential).		A6NCX6|D3DW49|Q5QPJ2|Q5QPJ5|Q7Z5B5|Q8N3H3|Q8TAS7|Q9UJD1	Silent	SNP	ENST00000376652.4	37	c.711C>A	CCDS13170.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	5.859|5.859	0.342761|0.342761	0.11069|0.11069	.|.	.|.	ENSG00000197586|ENSG00000197586	ENST00000433417;ENST00000427553;ENST00000447877|ENST00000376666	.|.	.|.	.|.	5.11|5.11	3.13|3.13	0.36017|0.36017	.|.	.|.	.|.	.|.	.|.	T|T	0.53658|0.53658	0.1810|0.1810	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.46034|0.46034	-0.9220|-0.9220	4|4	.|.	.|.	.|.	.|.	5.0517|5.0517	0.14513|0.14513	0.1541:0.6185:0.1484:0.0789|0.1541:0.6185:0.1484:0.0789	.|.	.|.	.|.	.|.	E|K	158;95;130|61	.|.	.|.	A|Q	+|+	2|1	0|0	ENTPD6|ENTPD6	25145285|25145285	0.979000|0.979000	0.34478|0.34478	0.923000|0.923000	0.36655|0.36655	0.126000|0.126000	0.20510|0.20510	0.740000|0.740000	0.26188|0.26188	0.632000|0.632000	0.30432|0.30432	-0.156000|-0.156000	0.13503|0.13503	GCA|CAG		0.572	ENTPD6-020	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078414.2		Silent	9	17	1	0	4.69e-08	5.81e-08	9	17				
DEFB116	245930	broad.mit.edu	37	20	29891043	29891043	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr20:29891043G>T	ENST00000400549.1	-	2	280	c.281C>A	c.(280-282)aCa>aAa	p.T94K		NM_001037731.1	NP_001032820.1	Q30KQ4	DB116_HUMAN	defensin, beta 116	94					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				kidney(2)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)	12	all_hematologic(12;0.158)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			TGAACTGTTTGTAACTGACAA	0.383																																						uc010ztm.1		NA																	0					0						c.(280-282)ACA>AAA		beta-defensin 116 precursor							246.0	222.0	230.0					20																	29891043		1860	4105	5965	SO:0001583	missense	245930				defense response to bacterium	extracellular region		g.chr20:29891043G>T	DQ012020	CCDS42860.1	20q11.21	2008-07-17			ENSG00000215545	ENSG00000215545		"""Defensins, beta"""	18097	protein-coding gene	gene with protein product	"""defensin, beta 16"""					11854508, 16033865	Standard	NM_001037731		Approved	DEFB-16	uc010ztm.2	Q30KQ4	OTTHUMG00000159285	ENST00000400549.1:c.281C>A	20.37:g.29891043G>T	ENSP00000383396:p.Thr94Lys		Somatic					p.T94K	NM_001037731	NP_001032820	WXS	Illumina HiSeq	Unspecified	Q30KQ4	DB116_HUMAN	Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)		2	281	-	all_hematologic(12;0.158)		94						Missense_Mutation	SNP	ENST00000400549.1	37	c.281C>A	CCDS42860.1	.	.	.	.	.	.	.	.	.	.	G	8.878	0.951039	0.18431	.	.	ENSG00000215545	ENST00000400549	T	0.16457	2.34	3.61	0.468	0.16732	.	.	.	.	.	T	0.09247	0.0228	N	0.19112	0.55	0.09310	N	1	B	0.15719	0.014	B	0.12837	0.008	T	0.32745	-0.9895	9	0.56958	D	0.05	.	2.2968	0.04152	0.1105:0.1922:0.4994:0.198	.	94	Q30KQ4	DB116_HUMAN	K	94	ENSP00000383396:T94K	ENSP00000383396:T94K	T	-	2	0	DEFB116	29354704	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.008000	0.13197	0.139000	0.18822	-0.137000	0.14449	ACA		0.383	DEFB116-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354403.1	NM_001037731		83	183	1	0	3.76e-38	5.08e-38	83	183				
SUN5	140732	broad.mit.edu	37	20	31587898	31587898	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr20:31587898G>C	ENST00000356173.3	-	5	414	c.322C>G	c.(322-324)Ctg>Gtg	p.L108V	SUN5_ENST00000375519.2_Missense_Mutation_p.F85L|SUN5_ENST00000375523.3_Missense_Mutation_p.L83V	NM_080675.3	NP_542406.2	Q8TC36	SUN5_HUMAN	Sad1 and UNC84 domain containing 5	108					spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	25						CAGAGGAGCAGAATGCCTGTC	0.587																																						uc002wyi.2		NA																	0				skin(1)	1						c.(322-324)CTG>GTG		sperm associated antigen 4-like							116.0	84.0	95.0					20																	31587898		2203	4299	6502	SO:0001583	missense	140732				spermatogenesis			g.chr20:31587898G>C	AL121756	CCDS13209.1	20q11.21	2010-01-27	2010-01-27	2010-01-27	ENSG00000167098	ENSG00000167098			16252	protein-coding gene	gene with protein product	"""testis and spermatogenesis related gene 4"""	613942	"""sperm associated antigen 4-like"""	SPAG4L		9691178, 10373309	Standard	NM_080675		Approved	dJ726C3.1, TSARG4	uc002wyi.3	Q8TC36	OTTHUMG00000032239	ENST00000356173.3:c.322C>G	20.37:g.31587898G>C	ENSP00000348496:p.Leu108Val		Somatic					p.L108V	NM_080675	NP_542406	WXS	Illumina HiSeq	Unspecified	Q8TC36	SUN5_HUMAN			5	415	-			108					A6NJ82|Q5T9R0	Missense_Mutation	SNP	ENST00000356173.3	37	c.322C>G	CCDS13209.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.48|10.48	1.360988|1.360988	0.24684|0.24684	.|.	.|.	ENSG00000167098|ENSG00000167098	ENST00000375519|ENST00000356173;ENST00000375523;ENST00000420875	T|T;T;T	0.30714|0.51574	1.52|2.53;2.56;0.7	4.11|4.11	4.11|4.11	0.48088|0.48088	.|.	.|0.483471	.|0.16451	.|N	.|0.213862	T|T	0.41650|0.41650	0.1168|0.1168	M|M	0.62723|0.62723	1.935|1.935	0.24140|0.24140	N|N	0.995734|0.995734	.|P	.|0.38020	.|0.615	.|B	.|0.29267	.|0.1	T|T	0.46414|0.46414	-0.9193|-0.9193	7|10	0.11485|0.56958	T|D	0.65|0.05	-17.7933|-17.7933	12.0302|12.0302	0.53394|0.53394	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|108	.|Q8TC36	.|SUN5_HUMAN	L|V	85|108;83;97	ENSP00000364669:F85L|ENSP00000348496:L108V;ENSP00000364673:L83V;ENSP00000400089:L97V	ENSP00000364669:F85L|ENSP00000348496:L108V	F|L	-|-	3|1	2|2	SUN5|SUN5	31051559|31051559	0.941000|0.941000	0.31946|0.31946	0.874000|0.874000	0.34290|0.34290	0.429000|0.429000	0.31625|0.31625	1.812000|1.812000	0.38952|0.38952	2.276000|2.276000	0.75962|0.75962	0.650000|0.650000	0.86243|0.86243	TTC|CTG		0.587	SUN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078659.1	NM_080675		13	71	0	0	0	0	13	71				
PHF20	51230	broad.mit.edu	37	20	34505531	34505531	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr20:34505531G>A	ENST00000374012.3	+	13	2080	c.1951G>A	c.(1951-1953)Gag>Aag	p.E651K	PHF20_ENST00000439301.1_3'UTR			Q9BVI0	PHF20_HUMAN	PHD finger protein 20	651					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(5)|endometrium(1)|kidney(7)|large_intestine(6)|lung(11)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(12;0.00631)|all_lung(11;0.0145)					CTATGACTTCGAGGTGGTCCG	0.502																																						uc002xek.1		NA																	0				ovary(1)	1						c.(1951-1953)GAG>AAG		PHD finger protein 20							133.0	104.0	114.0					20																	34505531		2203	4300	6503	SO:0001583	missense	51230				regulation of transcription, DNA-dependent|transcription, DNA-dependent	MLL1 complex	DNA binding|zinc ion binding	g.chr20:34505531G>A	AL109965	CCDS13268.1	20q11.22-q11.23	2013-01-28	2004-12-01	2004-12-01	ENSG00000025293	ENSG00000025293		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	16098	protein-coding gene	gene with protein product	"""tudor domain containing 20A"""	610335	"""chromosome 20 open reading frame 104"""	C20orf104			Standard	NM_016436		Approved	dJ1121G12.1, TDRD20A	uc002xek.1	Q9BVI0	OTTHUMG00000032367	ENST00000374012.3:c.1951G>A	20.37:g.34505531G>A	ENSP00000363124:p.Glu651Lys		Somatic					p.E651K	NM_016436	NP_057520	WXS	Illumina HiSeq	Unspecified	Q9BVI0	PHF20_HUMAN			13	2062	+	Breast(12;0.00631)|all_lung(11;0.0145)		651					A7E235|B2RB56|E1P5S3|Q566Q2|Q5JWY9|Q66K49|Q9BWV4|Q9BXA3|Q9BZW3|Q9H421|Q9H4J6|Q9NZ22	Missense_Mutation	SNP	ENST00000374012.3	37	c.1951G>A	CCDS13268.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.980822	0.92982	.	.	ENSG00000025293	ENST00000374012;ENST00000420233	T	0.64803	-0.12	5.96	5.96	0.96718	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.78672	0.4320	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.78303	-0.2256	10	0.66056	D	0.02	.	19.989	0.97359	0.0:0.0:1.0:0.0	.	651	Q9BVI0	PHF20_HUMAN	K	651;48	ENSP00000363124:E651K	ENSP00000363124:E651K	E	+	1	0	PHF20	33968945	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	8.514000	0.90545	2.830000	0.97506	0.585000	0.79938	GAG		0.502	PHF20-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078949.2	NM_016436		21	52	0	0	0	0	21	52				
SRSF6	6431	broad.mit.edu	37	20	42087030	42087030	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr20:42087030G>T	ENST00000244020.3	+	2	243	c.137G>T	c.(136-138)cGc>cTc	p.R46L		NM_006275.5	NP_006266.2	Q13247	SRSF6_HUMAN	serine/arginine-rich splicing factor 6	46	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splice site selection (GO:0006376)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell death (GO:0060548)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of keratinocyte proliferation (GO:0010837)|regulation of wound healing (GO:0061041)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA binding (GO:0003723)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|upper_aerodigestive_tract(2)	5						GAGGACTCCCGCGACGCCGAC	0.721																																						uc010zwg.1		NA																	0					0						c.(136-138)CGC>CTC		arginine/serine-rich splicing factor 6							8.0	8.0	8.0					20																	42087030		2105	4180	6285	SO:0001583	missense	6431				mRNA 3'-end processing|mRNA export from nucleus|mRNA splice site selection|termination of RNA polymerase II transcription	nucleoplasm	nucleotide binding|protein binding|RNA binding	g.chr20:42087030G>T	U30883	CCDS13318.1	20q12-q13.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000124193	ENSG00000124193		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10788	protein-coding gene	gene with protein product	"""pre-mRNA splicing factor SRP55"", ""SR splicing factor 6"""	601944	"""splicing factor, arginine/serine-rich 6"""	SFRS6		7556075, 20516191	Standard	NM_006275		Approved	SRP55, B52	uc010zwg.2	Q13247	OTTHUMG00000032502	ENST00000244020.3:c.137G>T	20.37:g.42087030G>T	ENSP00000244020:p.Arg46Leu		Somatic				SFRS6_uc002xki.2_5'UTR|SFRS6_uc002xkk.2_Missense_Mutation_p.R46L	p.R46L	NM_006275	NP_006266	WXS	Illumina HiSeq	Unspecified	Q13247	SRSF6_HUMAN	COAD - Colon adenocarcinoma(18;0.0031)		2	307	+		Myeloproliferative disorder(115;0.00452)	46			RRM 1.		B7Z6J3|E1P5W6|Q13244|Q13245|Q96J06|Q9UJB8|Q9Y3N7	Missense_Mutation	SNP	ENST00000244020.3	37	c.137G>T	CCDS13318.1	.	.	.	.	.	.	.	.	.	.	g	24.9	4.583490	0.86748	.	.	ENSG00000124193	ENST00000244020	T	0.74632	-0.86	3.59	3.59	0.41128	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.203282	0.39341	N	0.001383	D	0.83216	0.5206	M	0.63428	1.95	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.79784	0.993;0.993	D	0.85668	0.1293	10	0.87932	D	0	.	14.2003	0.65699	0.0:0.0:1.0:0.0	.	46;46	Q13247;A8K588	SRSF6_HUMAN;.	L	46	ENSP00000244020:R46L	ENSP00000244020:R46L	R	+	2	0	SRSF6	41520444	1.000000	0.71417	0.995000	0.50966	0.451000	0.32288	6.957000	0.76019	1.838000	0.53458	0.552000	0.68991	CGC		0.721	SRSF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079292.1	NM_006275		4	0	1	0	0.00024832	0.00028956	4	0				
ZNF831	128611	broad.mit.edu	37	20	57769026	57769026	+	Silent	SNP	G	G	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr20:57769026G>T	ENST00000371030.2	+	1	2952	c.2952G>T	c.(2950-2952)ctG>ctT	p.L984L		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	984							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					GGTCAGGACTGGGGACCCCTC	0.632																																						uc002yan.2		NA																	0				skin(13)|ovary(1)	14						c.(2950-2952)CTG>CTT		zinc finger protein 831							61.0	64.0	63.0					20																	57769026		1978	4152	6130	SO:0001819	synonymous_variant	128611					intracellular	nucleic acid binding|zinc ion binding	g.chr20:57769026G>T	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.2952G>T	20.37:g.57769026G>T			Somatic					p.L984L	NM_178457	NP_848552	WXS	Illumina HiSeq	Unspecified	Q5JPB2	ZN831_HUMAN			1	2952	+	all_lung(29;0.0085)		984					Q5TDR4|Q8TCP0	Silent	SNP	ENST00000371030.2	37	c.2952G>T	CCDS42894.1																																																																																				0.632	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457		34	15	1	0	3.11e-16	4.07e-16	34	15				
MORC3	23515	broad.mit.edu	37	21	37741537	37741537	+	Nonsense_Mutation	SNP	C	C	G			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr21:37741537C>G	ENST00000400485.1	+	15	1947	c.1871C>G	c.(1870-1872)tCa>tGa	p.S624*	MORC3_ENST00000487909.1_3'UTR	NM_015358.2	NP_056173.1	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3	624					cell aging (GO:0007569)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of fibroblast proliferation (GO:0048147)|peptidyl-serine phosphorylation (GO:0018105)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)	PML body (GO:0016605)	zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	35						CAGACTGGTTCAACAAGCACC	0.448																																						uc002yvi.2		NA																	0				ovary(2)	2						c.(1870-1872)TCA>TGA		MORC family CW-type zinc finger 3							218.0	216.0	217.0					21																	37741537		2149	4247	6396	SO:0001587	stop_gained	23515				cell aging|maintenance of protein location in nucleus|negative regulation of fibroblast proliferation|peptidyl-serine phosphorylation|protein stabilization	aggresome|intermediate filament cytoskeleton|PML body	ATP binding|zinc ion binding	g.chr21:37741537C>G	AK025327	CCDS42924.1	21q22.13	2005-06-15	2005-06-15	2005-06-15	ENSG00000159256	ENSG00000159256			23572	protein-coding gene	gene with protein product		610078	"""zinc finger, CW-type with coiled-coil domain 3"", ""zinc finger, CW type with coiled-coil domain 3"""	ZCWCC3		14607086	Standard	NM_015358		Approved	ZCW5, NXP2, KIAA0136	uc002yvi.3	Q14149	OTTHUMG00000086620	ENST00000400485.1:c.1871C>G	21.37:g.37741537C>G	ENSP00000383333:p.Ser624*		Somatic					p.S624*	NM_015358	NP_056173	WXS	Illumina HiSeq	Unspecified	Q14149	MORC3_HUMAN			15	1947	+			624					A8KA92|Q9UEZ2	Nonsense_Mutation	SNP	ENST00000400485.1	37	c.1871C>G	CCDS42924.1	.	.	.	.	.	.	.	.	.	.	C	37	6.150120	0.97329	.	.	ENSG00000159256	ENST00000400485	.	.	.	5.95	5.95	0.96441	.	0.272597	0.34411	N	0.003994	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-13.6669	18.5737	0.91147	0.0:1.0:0.0:0.0	.	.	.	.	X	624	.	ENSP00000383333:S624X	S	+	2	0	MORC3	36663407	0.083000	0.21467	0.132000	0.22025	0.542000	0.35054	2.070000	0.41491	2.824000	0.97209	0.655000	0.94253	TCA		0.448	MORC3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000194640.1	NM_015358		33	78	0	0	0	0	33	78				
SLC37A1	54020	broad.mit.edu	37	21	43962541	43962541	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr21:43962541G>A	ENST00000352133.2	+	7	1496	c.514G>A	c.(514-516)Ggc>Agc	p.G172S	SLC37A1_ENST00000398341.3_Missense_Mutation_p.G172S			P57057	GLPT_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 1	172					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	transporter activity (GO:0005215)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(3)	15						GCAGACCACCGGCTGGCCCAG	0.577																																						uc002zbi.2		NA																	0					0						c.(514-516)GGC>AGC		solute carrier family 37 member 1							36.0	34.0	35.0					21																	43962541		2203	4300	6503	SO:0001583	missense	54020				carbohydrate transport|transmembrane transport	integral to membrane		g.chr21:43962541G>A	AJ269529	CCDS13689.1	21q22.3	2013-07-17	2013-07-17		ENSG00000160190	ENSG00000160190		"""Solute carriers"""	11024	protein-coding gene	gene with protein product		608094	"""solute carrier family 37 (glycerol-3-phosphate transporter), member 1"""			11112347	Standard	NM_018964		Approved		uc002zbi.3	P57057	OTTHUMG00000086803	ENST00000352133.2:c.514G>A	21.37:g.43962541G>A	ENSP00000344648:p.Gly172Ser		Somatic				SLC37A1_uc002zbj.2_Missense_Mutation_p.G172S	p.G172S	NM_018964	NP_061837	WXS	Illumina HiSeq	Unspecified	P57057	GLPT_HUMAN			8	926	+			172			Helical; (Potential).		D3DSJ7|Q9HAQ1	Missense_Mutation	SNP	ENST00000352133.2	37	c.514G>A	CCDS13689.1	.	.	.	.	.	.	.	.	.	.	G	35	5.456208	0.96223	.	.	ENSG00000160190	ENST00000398341;ENST00000352133	T;T	0.57107	0.42;0.42	5.11	5.11	0.69529	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.79387	0.4437	M	0.91406	3.205	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84731	0.0745	10	0.87932	D	0	-20.7568	18.5627	0.91107	0.0:0.0:1.0:0.0	.	172	P57057	GLPT_HUMAN	S	172	ENSP00000381383:G172S;ENSP00000344648:G172S	ENSP00000344648:G172S	G	+	1	0	SLC37A1	42835610	1.000000	0.71417	0.984000	0.44739	0.955000	0.61496	9.376000	0.97181	2.361000	0.80049	0.655000	0.94253	GGC		0.577	SLC37A1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195377.1			18	28	0	0	0	0	18	28				
POTEH	23784	broad.mit.edu	37	22	16279295	16279295	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr22:16279295G>T	ENST00000343518.6	-	4	979	c.928C>A	c.(928-930)Ctc>Atc	p.L310I	RNU6-816P_ENST00000390914.1_RNA|POTEH-AS1_ENST00000422014.1_RNA	NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	310										NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						AGTGGTGTGAGGCCATGCTGT	0.323																																						uc010gqp.2		NA																	0				skin(1)	1						c.(928-930)CTC>ATC		ANKRD26-like family C, member 3																																				SO:0001583	missense	23784							g.chr22:16279295G>T	AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.928C>A	22.37:g.16279295G>T	ENSP00000340610:p.Leu310Ile		Somatic				POTEH_uc002zlg.1_RNA|POTEH_uc002zlh.1_Missense_Mutation_p.L29I|POTEH_uc002zlj.1_Missense_Mutation_p.L145I	p.L310I	NM_001136213	NP_001129685	WXS	Illumina HiSeq	Unspecified	Q6S545	POTEH_HUMAN			4	980	-			310			ANK 5.		A2CEK4|A6NCI1|A9Z1W0	Missense_Mutation	SNP	ENST00000343518.6	37	c.928C>A	CCDS46658.1	.	.	.	.	.	.	.	.	.	.	.	12.15	1.850810	0.32699	.	.	ENSG00000198062	ENST00000359587;ENST00000343518	T	0.54071	0.59	1.38	1.38	0.22167	Ankyrin repeat-containing domain (3);	0.930785	0.08680	U	0.909583	T	0.45955	0.1368	L	0.31664	0.95	0.21105	N	0.999785	P;P	0.46020	0.871;0.747	P;P	0.49799	0.622;0.596	T	0.33879	-0.9851	10	0.30854	T	0.27	.	6.2318	0.20738	0.0:0.0:1.0:0.0	.	310;273	Q6S545;A6NKF6	POTEH_HUMAN;.	I	273;310	ENSP00000340610:L310I	ENSP00000340610:L310I	L	-	1	0	POTEH	14659295	0.132000	0.22450	0.603000	0.28903	0.034000	0.12701	-0.069000	0.11542	1.077000	0.40990	0.175000	0.17021	CTC		0.323	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276918.4	NM_001136213		36	510	1	0	2.22e-12	2.82e-12	36	510				
ZNF280A	129025	broad.mit.edu	37	22	22868743	22868743	+	Silent	SNP	C	C	T	rs533439030		TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr22:22868743C>T	ENST00000302097.3	-	2	1464	c.1212G>A	c.(1210-1212)tcG>tcA	p.S404S		NM_080740.3	NP_542778.1	P59817	Z280A_HUMAN	zinc finger protein 280A	404					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	18	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		CAGCAAAGACCGACGATCTGT	0.413													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19530	0.0		0.0	False		,,,				2504	0.0					uc002zwe.2		NA																	0				ovary(1)	1						c.(1210-1212)TCG>TCA		zinc finger protein 280A							136.0	117.0	123.0					22																	22868743		2203	4300	6503	SO:0001819	synonymous_variant	129025				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr22:22868743C>T	D87009	CCDS13800.1	22q11.21	2007-09-20	2007-09-20	2007-09-20	ENSG00000169548	ENSG00000169548			18597	protein-coding gene	gene with protein product			"""zinc finger protein 280"", ""suppressor of hairy wing homolog 1 (Drosophila)"""	ZNF280, SUHW1		9074928	Standard	NM_080740		Approved	3'OY11.1, ZNF636	uc002zwe.3	P59817	OTTHUMG00000030545	ENST00000302097.3:c.1212G>A	22.37:g.22868743C>T			Somatic				LOC96610_uc011aim.1_Intron	p.S404S	NM_080740	NP_542778	WXS	Illumina HiSeq	Unspecified	P59817	Z280A_HUMAN		READ - Rectum adenocarcinoma(21;0.145)	2	1465	-	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)	404						Silent	SNP	ENST00000302097.3	37	c.1212G>A	CCDS13800.1																																																																																				0.413	ZNF280A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075433.3	NM_080740		6	116	0	0	0	0	6	116				
TCF20	6942	broad.mit.edu	37	22	42606032	42606032	+	Silent	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr22:42606032G>A	ENST00000359486.3	-	1	5416	c.5280C>T	c.(5278-5280)tcC>tcT	p.S1760S	TCF20_ENST00000335626.4_Silent_p.S1760S|TCF20_ENST00000404876.1_Silent_p.S61S	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	1760					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						TGTCCGTCTTGGAGCCATTAG	0.557																																						uc003bcj.1		NA																	0				ovary(4)|skin(1)	5						c.(5278-5280)TCC>TCT		transcription factor 20 isoform 1							82.0	85.0	84.0					22																	42606032		2203	4300	6503	SO:0001819	synonymous_variant	6942				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding	g.chr22:42606032G>A	U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.5280C>T	22.37:g.42606032G>A			Somatic				TCF20_uc003bck.1_Silent_p.S1760S|TCF20_uc003bnt.2_Silent_p.S1760S	p.S1760S	NM_005650	NP_005641	WXS	Illumina HiSeq	Unspecified	Q9UGU0	TCF20_HUMAN			1	5414	-			1760					A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Silent	SNP	ENST00000359486.3	37	c.5280C>T	CCDS14033.1																																																																																				0.557	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320531.1	NM_181492		42	88	0	0	0	0	42	88				
EDEM1	9695	broad.mit.edu	37	3	5246816	5246816	+	Silent	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr3:5246816G>A	ENST00000256497.4	+	6	1240	c.1107G>A	c.(1105-1107)ctG>ctA	p.L369L	EDEM1_ENST00000445686.1_Silent_p.L174L	NM_014674.2	NP_055489.1	Q92611	EDEM1_HUMAN	ER degradation enhancer, mannosidase alpha-like 1	369					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	calcium ion binding (GO:0005509)|misfolded protein binding (GO:0051787)			NS(1)|breast(1)|endometrium(1)|large_intestine(5)|liver(2)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22				Epithelial(13;0.0588)|OV - Ovarian serous cystadenocarcinoma(96;0.0682)		GTGCCGGGCTGGACTCCTTCT	0.453																																						uc003bqi.2		NA																	0				ovary(2)|breast(1)	3						c.(1105-1107)CTG>CTA		ER degradation enhancer, mannosidase alpha-like							95.0	103.0	100.0					3																	5246816		2203	4300	6503	SO:0001819	synonymous_variant	9695				ER-associated protein catabolic process|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|response to unfolded protein	integral to endoplasmic reticulum membrane	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity|misfolded protein binding	g.chr3:5246816G>A	D86967	CCDS33686.1	3p26.1	2008-02-05			ENSG00000134109	ENSG00000134109			18967	protein-coding gene	gene with protein product		607673				12610306	Standard	NM_014674		Approved	KIAA0212, EDEM	uc003bqi.3	Q92611	OTTHUMG00000154896	ENST00000256497.4:c.1107G>A	3.37:g.5246816G>A			Somatic				EDEM1_uc011asz.1_Silent_p.L147L|EDEM1_uc003bqh.2_Silent_p.L369L	p.L369L	NM_014674	NP_055489	WXS	Illumina HiSeq	Unspecified	Q92611	EDEM1_HUMAN		Epithelial(13;0.0588)|OV - Ovarian serous cystadenocarcinoma(96;0.0682)	6	1239	+			369			Lumenal (Potential).		A8K9C8|B4DXP3	Silent	SNP	ENST00000256497.4	37	c.1107G>A	CCDS33686.1																																																																																				0.453	EDEM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337566.2	NM_014674		62	29	0	0	0	0	62	29				
GRIP2	80852	broad.mit.edu	37	3	14565164	14565164	+	RNA	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr3:14565164C>T	ENST00000273083.3	-	0	510							Q9C0E4	GRIP2_HUMAN	glutamate receptor interacting protein 2						synaptic transmission (GO:0007268)	cytosol (GO:0005829)|plasma membrane (GO:0005886)				endometrium(5)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	25						TAGAGGGAGACGTCCACTGTC	0.498																																						uc011avi.1		NA																	0				pancreas(1)	1						c.(736-738)GTC>ATC		glutamate receptor interacting protein 2							78.0	75.0	76.0					3																	14565164		1877	4119	5996			80852				synaptic transmission	cytosol|plasma membrane	protein binding	g.chr3:14565164C>T	AB051506		3p24-p23	2012-02-08			ENSG00000144596	ENSG00000144596			23841	protein-coding gene	gene with protein product							Standard	NM_001080423		Approved	KIAA1719	uc021wtn.1	Q9C0E4	OTTHUMG00000155544		3.37:g.14565164C>T			Somatic				GRIP2_uc011avh.1_5'UTR|GRIP2_uc003byu.1_3'UTR|GRIP2_uc003byv.1_Missense_Mutation_p.V149I	p.V246I	NM_001080423	NP_001073892	WXS	Illumina HiSeq	Unspecified	Q9C0E4	GRIP2_HUMAN			6	736	-			149			PDZ 2.		Q8TEH9|Q9H7H3	Missense_Mutation	SNP	ENST00000273083.3	37	c.736G>A																																																																																					0.498	GRIP2-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000340582.2	NM_001080423		7	3	0	0	0	0	7	3				
DALRD3	55152	broad.mit.edu	37	3	49053902	49053902	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr3:49053902G>A	ENST00000341949.4	-	8	1112	c.1106C>T	c.(1105-1107)aCc>aTc	p.T369I	DALRD3_ENST00000313778.5_Missense_Mutation_p.T202I|DALRD3_ENST00000440857.1_Missense_Mutation_p.T202I|DALRD3_ENST00000441576.2_Missense_Mutation_p.T369I|DALRD3_ENST00000395462.4_Missense_Mutation_p.T202I|DALRD3_ENST00000496568.1_5'Flank	NM_001009996.1	NP_001009996.1	Q5D0E6	DALD3_HUMAN	DALR anticodon binding domain containing 3	369					arginyl-tRNA aminoacylation (GO:0006420)		arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)			breast(2)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		AAACTTGATGGTGGCCACAGA	0.577																																						uc003cvk.1		NA																	0					0						c.(1105-1107)ACC>ATC		DALR anticodon binding domain containing 3							53.0	51.0	51.0					3																	49053902		2203	4300	6503	SO:0001583	missense	55152				arginyl-tRNA aminoacylation	cytoplasm	arginine-tRNA ligase activity|ATP binding	g.chr3:49053902G>A	BC014099	CCDS2783.1, CCDS33754.1, CCDS63632.1	3p21.31	2005-01-10			ENSG00000178149	ENSG00000178149			25536	protein-coding gene	gene with protein product						12477932	Standard	NM_001009996		Approved	FLJ10496	uc003cvk.2	Q5D0E6	OTTHUMG00000156748	ENST00000341949.4:c.1106C>T	3.37:g.49053902G>A	ENSP00000344989:p.Thr369Ile		Somatic				DALRD3_uc003cvl.1_Missense_Mutation_p.T369I|DALRD3_uc003cvm.1_Missense_Mutation_p.T202I|DALRD3_uc010hko.1_Missense_Mutation_p.T202I|DALRD3_uc011bca.1_Missense_Mutation_p.T369I	p.T369I	NM_001009996	NP_001009996	WXS	Illumina HiSeq	Unspecified	Q5D0E6	DALD3_HUMAN		BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)	8	1126	-			369					Q7Z5S7|Q86WY1|Q8N105|Q8NA89|Q9NVU8	Missense_Mutation	SNP	ENST00000341949.4	37	c.1106C>T	CCDS33754.1	.	.	.	.	.	.	.	.	.	.	G	17.24	3.338163	0.60963	.	.	ENSG00000178149	ENST00000441576;ENST00000341949;ENST00000395462;ENST00000440857;ENST00000313778	T;T;T;T;T	0.48201	0.86;0.85;0.86;0.82;0.86	4.81	3.92	0.45320	.	0.171764	0.52532	D	0.000071	T	0.57036	0.2026	L	0.56769	1.78	0.48830	D	0.99971	D;D;D;P	0.58970	0.979;0.984;0.979;0.895	P;P;P;B	0.56088	0.714;0.791;0.714;0.368	T	0.57717	-0.7763	10	0.41790	T	0.15	-25.758	13.509	0.61499	0.0:0.1565:0.8435:0.0	.	369;202;369;369	B7Z727;C9JJG6;Q5D0E6-2;Q5D0E6	.;.;.;DALD3_HUMAN	I	369;369;202;202;202	ENSP00000410623:T369I;ENSP00000344989:T369I;ENSP00000378846:T202I;ENSP00000403770:T202I;ENSP00000323265:T202I	ENSP00000323265:T202I	T	-	2	0	DALRD3	49028906	1.000000	0.71417	0.985000	0.45067	0.923000	0.55619	5.575000	0.67430	1.235000	0.43724	0.561000	0.74099	ACC		0.577	DALRD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345581.1	NM_018114		22	8	0	0	0	0	22	8				
CCDC36	339834	broad.mit.edu	37	3	49278823	49278823	+	Splice_Site	SNP	G	G	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr3:49278823G>T	ENST00000438782.1	+	4	631		c.e4+1		CCDC36_ENST00000452691.2_Splice_Site|CCDC36_ENST00000451634.2_Splice_Site|CCDC36_ENST00000366429.2_Splice_Site|CCDC36_ENST00000296449.5_Splice_Site			Q8IYA8	CCD36_HUMAN	coiled-coil domain containing 36											endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(3)|ovary(1)|urinary_tract(3)	14				BRCA - Breast invasive adenocarcinoma(193;9.11e-05)|Kidney(197;0.00248)|KIRC - Kidney renal clear cell carcinoma(197;0.00262)		AATGTGACAGGTATGTAAACC	0.343																																						uc003cwk.2		NA																	0				ovary(1)|kidney(1)	2						c.e6+1		coiled-coil domain containing 36							53.0	56.0	55.0					3																	49278823		2203	4300	6503	SO:0001630	splice_region_variant	339834							g.chr3:49278823G>T	AK058049	CCDS33755.2	3p21.31	2009-08-06			ENSG00000173421	ENSG00000173421			27945	protein-coding gene	gene with protein product	"""cancer/testis antigen 74"""						Standard	NM_178173		Approved	FLJ25320, CT74	uc011bck.1	Q8IYA8	OTTHUMG00000155920	ENST00000438782.1:c.395+1G>T	3.37:g.49278823G>T			Somatic				CCDC36_uc003cwl.3_Splice_Site_p.S132_splice|CCDC36_uc011bck.1_Splice_Site_p.S132_splice	p.S132_splice	NM_178173	NP_835467	WXS	Illumina HiSeq	Unspecified	Q8IYA8	CCD36_HUMAN		BRCA - Breast invasive adenocarcinoma(193;9.11e-05)|Kidney(197;0.00248)|KIRC - Kidney renal clear cell carcinoma(197;0.00262)	6	782	+								C9JJL0|Q05DG9|Q96LP7	Splice_Site	SNP	ENST00000438782.1	37	c.395_splice	CCDS33755.2	.	.	.	.	.	.	.	.	.	.	G	16.07	3.018566	0.54576	.	.	ENSG00000173421	ENST00000296449;ENST00000438782;ENST00000452691;ENST00000366429;ENST00000309062;ENST00000451634	.	.	.	4.75	4.75	0.60458	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6184	0.76787	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CCDC36	49253827	1.000000	0.71417	1.000000	0.80357	0.629000	0.37895	6.336000	0.72954	2.626000	0.88956	0.467000	0.42956	.		0.343	CCDC36-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342332.1	NM_178173	Intron	13	6	1	0	1.05e-09	1.32e-09	13	6				
KIAA2018	205717	broad.mit.edu	37	3	113375182	113375182	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr3:113375182G>A	ENST00000478658.1	-	5	5364	c.5347C>T	c.(5347-5349)Ccc>Tcc	p.P1783S	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Missense_Mutation_p.P1783S			Q68DE3	K2018_HUMAN	KIAA2018	1783						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						ATTGGTGGGGGGCCAGTGTTT	0.418																																						uc003eam.2		NA																	0				skin(2)|ovary(1)	3						c.(5347-5349)CCC>TCC		hypothetical protein LOC205717							164.0	163.0	164.0					3																	113375182		1900	4108	6008	SO:0001583	missense	205717				regulation of transcription, DNA-dependent	membrane|nucleus	calcium ion binding|DNA binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity	g.chr3:113375182G>A	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.5347C>T	3.37:g.113375182G>A	ENSP00000420721:p.Pro1783Ser		Somatic				KIAA2018_uc003eal.2_Missense_Mutation_p.P1727S	p.P1783S	NM_001009899	NP_001009899	WXS	Illumina HiSeq	Unspecified	Q68DE3	K2018_HUMAN			7	5758	-			1783					Q7Z3L9|Q8IVF3|Q9H8T4	Missense_Mutation	SNP	ENST00000478658.1	37	c.5347C>T	CCDS43133.1	.	.	.	.	.	.	.	.	.	.	G	15.50	2.853335	0.51270	.	.	ENSG00000176542	ENST00000316407;ENST00000478658	T;T	0.18810	2.19;2.19	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.30665	0.0772	L	0.32530	0.975	0.51233	D	0.999916	D	0.89917	1.0	D	0.85130	0.997	T	0.01786	-1.1274	10	0.16896	T	0.51	-13.6	10.8371	0.46694	0.0858:0.0:0.9142:0.0	.	1783	Q68DE3	K2018_HUMAN	S	1783	ENSP00000320794:P1783S;ENSP00000420721:P1783S	ENSP00000320794:P1783S	P	-	1	0	KIAA2018	114857872	1.000000	0.71417	0.997000	0.53966	0.972000	0.66771	3.312000	0.51927	2.802000	0.96397	0.655000	0.94253	CCC		0.418	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899		99	260	0	0	0	0	99	260				
PIK3R4	30849	broad.mit.edu	37	3	130425836	130425836	+	Missense_Mutation	SNP	C	C	G	rs181074945		TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr3:130425836C>G	ENST00000356763.3	-	11	3234	c.2677G>C	c.(2677-2679)Gag>Cag	p.E893Q		NM_014602.2	NP_055417.1	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	893					innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(6)|large_intestine(16)|lung(28)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	77						GCAGAGGACTCGGAACGAGGA	0.502																																						uc003enj.2		NA																	0				ovary(3)|lung(2)|breast(2)|skin(2)|stomach(1)|central_nervous_system(1)|kidney(1)	12						c.(2677-2679)GAG>CAG		phosphoinositide-3-kinase, regulatory subunit 4							121.0	103.0	109.0					3																	130425836		2203	4300	6503	SO:0001583	missense	30849				fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	cytosol	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr3:130425836C>G	Y08991	CCDS3067.1	3q22.1	2013-01-10	2008-02-04		ENSG00000196455	ENSG00000196455		"""WD repeat domain containing"""	8982	protein-coding gene	gene with protein product		602610				8999962	Standard	NM_014602		Approved	VPS15, p150	uc003enj.3	Q99570	OTTHUMG00000159645	ENST00000356763.3:c.2677G>C	3.37:g.130425836C>G	ENSP00000349205:p.Glu893Gln		Somatic					p.E893Q	NM_014602	NP_055417	WXS	Illumina HiSeq	Unspecified	Q99570	PI3R4_HUMAN			11	3258	-			893					Q2TBF4	Missense_Mutation	SNP	ENST00000356763.3	37	c.2677G>C	CCDS3067.1	.	.	.	.	.	.	.	.	.	.	C	9.915	1.210518	0.22289	.	.	ENSG00000196455	ENST00000356763	T	0.44083	0.93	5.22	5.22	0.72569	.	0.198063	0.44097	D	0.000485	T	0.31796	0.0808	L	0.47716	1.5	0.50171	D	0.999857	P	0.44877	0.845	B	0.30179	0.112	T	0.20240	-1.0281	10	0.14252	T	0.57	-26.1393	18.7798	0.91926	0.0:1.0:0.0:0.0	.	893	Q99570	PI3R4_HUMAN	Q	893	ENSP00000349205:E893Q	ENSP00000349205:E893Q	E	-	1	0	PIK3R4	131908526	0.998000	0.40836	0.962000	0.40283	0.655000	0.38815	4.327000	0.59247	2.439000	0.82584	0.460000	0.39030	GAG		0.502	PIK3R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356668.1	NM_014602		3	53	0	0	0	0	3	53				
PIK3CB	5291	broad.mit.edu	37	3	138400825	138400825	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr3:138400825C>T	ENST00000477593.1	-	18	2561	c.2488G>A	c.(2488-2490)Gct>Act	p.A830T	PIK3CB_ENST00000289153.2_Missense_Mutation_p.A830T|PIK3CB_ENST00000544716.1_Missense_Mutation_p.A281T			P42338	PK3CB_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta	830	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				activation of MAPK activity (GO:0000187)|autophagy (GO:0006914)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|embryonic cleavage (GO:0040016)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of autophagy (GO:0010508)|regulation of cell-matrix adhesion (GO:0001952)|regulation of clathrin-mediated endocytosis (GO:2000369)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	41					Caffeine(DB00201)	TCCAAACCAGCTTCTTTCCAG	0.363																																						uc011bmq.1		NA																	0				breast(2)|ovary(1)|lung(1)|skin(1)	5						c.(2488-2490)GCT>ACT		catalytic phosphatidylinositol 3-kinase beta							121.0	107.0	112.0					3																	138400825		2203	4300	6503	SO:0001583	missense	5291				activation of MAPK activity|chemotaxis|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell receptor signaling pathway	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	g.chr3:138400825C>T		CCDS3104.1	3q22.3	2013-09-19	2012-07-13		ENSG00000051382	ENSG00000051382	2.7.1.153		8976	protein-coding gene	gene with protein product		602925	"""phosphoinositide-3-kinase, catalytic, beta polypeptide"""	PIK3C1		8246984	Standard	NM_006219		Approved		uc011bmq.3	P42338	OTTHUMG00000159893	ENST00000477593.1:c.2488G>A	3.37:g.138400825C>T	ENSP00000418143:p.Ala830Thr		Somatic				PIK3CB_uc011bmn.1_Missense_Mutation_p.A342T|PIK3CB_uc011bmo.1_Missense_Mutation_p.A281T|PIK3CB_uc011bmp.1_Missense_Mutation_p.A417T	p.A830T	NM_006219	NP_006210	WXS	Illumina HiSeq	Unspecified	P42338	PK3CB_HUMAN			17	2488	-			830			PI3K/PI4K.		D3DNF0|Q24JU2	Missense_Mutation	SNP	ENST00000477593.1	37	c.2488G>A	CCDS3104.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.979627	0.74360	.	.	ENSG00000051382	ENST00000477593;ENST00000544716;ENST00000289153	T;T;T	0.75154	-0.91;-0.91;-0.91	5.37	4.46	0.54185	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.051302	0.85682	D	0.000000	T	0.77075	0.4077	L	0.56124	1.755	0.58432	D	0.999995	P;P;P	0.51240	0.943;0.853;0.573	P;P;B	0.51701	0.677;0.568;0.253	T	0.79085	-0.1948	10	0.56958	D	0.05	-3.735	13.8311	0.63382	0.1522:0.8478:0.0:0.0	.	830;417;281	P42338;B4DZI3;Q68DL0	PK3CB_HUMAN;.;.	T	830;281;830	ENSP00000418143:A830T;ENSP00000438259:A281T;ENSP00000289153:A830T	ENSP00000289153:A830T	A	-	1	0	PIK3CB	139883515	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.462000	0.66707	2.494000	0.84150	0.585000	0.79938	GCT		0.363	PIK3CB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358019.1			17	37	0	0	0	0	17	37				
MRPS22	56945	broad.mit.edu	37	3	139069822	139069822	+	Missense_Mutation	SNP	A	A	G	rs201627731		TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr3:139069822A>G	ENST00000495075.1	+	7	1084	c.652A>G	c.(652-654)Atg>Gtg	p.M218V	MRPS22_ENST00000478464.1_Missense_Mutation_p.M177V|MRPS22_ENST00000310776.4_Missense_Mutation_p.M218V|MRPS22_ENST00000465056.1_Missense_Mutation_p.M217V|RP11-219D15.3_ENST00000608472.1_RNA			P82650	RT22_HUMAN	mitochondrial ribosomal protein S22	218						mitochondrial ribosome (GO:0005761)|mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)	structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	12						GTTTTAGACTATGTATAGCCA	0.468																																						uc003etb.2		NA																	0				ovary(2)|skin(1)	3						c.(652-654)ATG>GTG		mitochondrial ribosomal protein S22							200.0	174.0	183.0					3																	139069822		2203	4300	6503	SO:0001583	missense	56945					mitochondrial small ribosomal subunit	protein binding|structural constituent of ribosome	g.chr3:139069822A>G	AF226045	CCDS3107.1	3q23	2012-09-13			ENSG00000175110	ENSG00000175110		"""Mitochondrial ribosomal proteins / small subunits"""	14508	protein-coding gene	gene with protein product		605810				11175783	Standard	NM_020191		Approved	MRP-S22, GK002, C3orf5, GIBT	uc003etb.3	P82650	OTTHUMG00000159910	ENST00000495075.1:c.652A>G	3.37:g.139069822A>G	ENSP00000418008:p.Met218Val		Somatic				MRPS22_uc003etc.2_RNA|MRPS22_uc003etd.2_Missense_Mutation_p.M217V|MRPS22_uc003ete.2_Missense_Mutation_p.M177V	p.M218V	NM_020191	NP_064576	WXS	Illumina HiSeq	Unspecified	P82650	RT22_HUMAN			5	660	+			218					Q9H3I1	Missense_Mutation	SNP	ENST00000495075.1	37	c.652A>G	CCDS3107.1	.	.	.	.	.	.	.	.	.	.	A	1.336	-0.595478	0.03771	.	.	ENSG00000175110	ENST00000495075;ENST00000310776;ENST00000465056;ENST00000478464	D;D;D;D	0.81579	-1.51;-1.51;-1.51;-1.51	5.59	-1.64	0.08318	.	0.305970	0.41097	N	0.000941	T	0.40297	0.1111	N	0.01493	-0.835	0.28263	N	0.924757	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.04013	0.0;0.001;0.001	T	0.45249	-0.9274	10	0.02654	T	1	-7.7383	0.9574	0.01388	0.3777:0.1123:0.2866:0.2234	.	177;217;218	G5E9W7;G5E9V5;P82650	.;.;RT22_HUMAN	V	218;218;217;177	ENSP00000418008:M218V;ENSP00000310785:M218V;ENSP00000418233:M217V;ENSP00000419303:M177V	ENSP00000310785:M218V	M	+	1	0	MRPS22	140552512	0.971000	0.33674	0.993000	0.49108	0.843000	0.47879	1.745000	0.38278	0.073000	0.16731	-0.290000	0.09829	ATG		0.468	MRPS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358120.1	NM_020191		29	86	0	0	0	0	29	86				
PIK3CA	5290	broad.mit.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	uc003fjk.2	E545K(RERFLCSQ1_LUNG)|E545K(KYSE510_OESOPHAGUS)|E545K(NCIH508_LARGE_INTESTINE)|E545K(HCC202_BREAST)|E545K(BFTC909_KIDNEY)|E545K(HCT15_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(MCF7_BREAST)|E545K(NCIH460_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(BC3C_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57		Dom	yes		3	3q26.3	5290	Mis	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			"""E, O"""			colorectal|gastric|gliobastoma|breast		899	Substitution - Missense(899)	p.E545K(735)|p.E545A(75)|p.E545G(55)|p.E545?(19)|p.E545D(15)|p.E545Q(12)|p.E545V(4)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)	breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553						c.(1633-1635)GAG>AAG		phosphoinositide-3-kinase, catalytic, alpha							61.0	60.0	60.0					3																	178936091		1813	4072	5885	SO:0001583	missense	5290				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	g.chr3:178936091G>A		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	HNSCC(19;0.045)|TSP Lung(28;0.18)	Somatic					p.E545K	NM_006218	NP_006209	WXS	Illumina HiSeq	Unspecified	P42336	PK3CA_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		10	1790	+	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		545		E -> G (in KERSEB).|E -> A (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells).	PI3K helical.		Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	c.1633G>A	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2			13	79	0	0	0	0	13	79				
DVL3	1857	broad.mit.edu	37	3	183885748	183885748	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr3:183885748C>T	ENST00000313143.3	+	13	1641	c.1393C>T	c.(1393-1395)Cgc>Tgc	p.R465C	DVL3_ENST00000431765.1_Missense_Mutation_p.R448C|EIF2B5_ENST00000444495.1_Intron	NM_004423.3	NP_004414.3	Q92997	DVL3_HUMAN	dishevelled segment polarity protein 3	465	DEP. {ECO:0000255|PROSITE- ProRule:PRU00066}.			R -> P (in Ref. 1; AAB47447). {ECO:0000305}.	canonical Wnt signaling pathway (GO:0060070)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|intracellular signal transduction (GO:0035556)|non-canonical Wnt signaling pathway (GO:0035567)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|outflow tract septum morphogenesis (GO:0003148)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	cell cortex (GO:0005938)	beta-catenin binding (GO:0008013)|frizzled binding (GO:0005109)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(6)|liver(1)|lung(13)|ovary(1)|prostate(1)	35	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.08e-34)|OV - Ovarian serous cystadenocarcinoma(80;1.31e-22)			GAGGGAGGCCCGCAAGTATGC	0.577																																						uc003fms.2		NA																	0				ovary(1)|lung(1)|breast(1)	3						c.(1393-1395)CGC>TGC		dishevelled 3							127.0	114.0	118.0					3																	183885748		2203	4300	6503	SO:0001583	missense	1857				canonical Wnt receptor signaling pathway|intracellular signal transduction|positive regulation of JUN kinase activity|positive regulation of protein phosphorylation|positive regulation of transcription, DNA-dependent	cytoplasm	beta-catenin binding|frizzled binding|protease binding|protein heterodimerization activity|signal transducer activity	g.chr3:183885748C>T	D86963	CCDS3253.1	3q27	2013-05-22	2013-05-22		ENSG00000161202	ENSG00000161202		"""Dishevelled homologs"""	3087	protein-coding gene	gene with protein product		601368	"""dishevelled 3 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 3 (Drosophila)"""			8817329	Standard	NM_004423		Approved	KIAA0208	uc003fms.3	Q92997	OTTHUMG00000156841	ENST00000313143.3:c.1393C>T	3.37:g.183885748C>T	ENSP00000316054:p.Arg465Cys		Somatic				DVL3_uc011bqw.1_Missense_Mutation_p.R448C|DVL3_uc003fmt.2_Missense_Mutation_p.R136C|DVL3_uc003fmu.2_Missense_Mutation_p.R297C	p.R465C	NM_004423	NP_004414	WXS	Illumina HiSeq	Unspecified	Q92997	DVL3_HUMAN	Epithelial(37;2.08e-34)|OV - Ovarian serous cystadenocarcinoma(80;1.31e-22)		13	1533	+	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		465	R -> P (in Ref. 1; AAB47447).		DEP.		B4E3E5|D3DNT0|O14642|Q13531|Q8N5E9|Q92607	Missense_Mutation	SNP	ENST00000313143.3	37	c.1393C>T	CCDS3253.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.245155	0.80024	.	.	ENSG00000161202	ENST00000313143;ENST00000415612;ENST00000431765	T;T	0.22336	1.96;1.96	5.64	5.64	0.86602	DEP domain (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.57169	0.2035	M	0.93763	3.455	0.80722	D	1	D;D;D;D	0.89917	0.976;1.0;0.988;1.0	D;D;P;D	0.97110	0.911;1.0;0.89;1.0	T	0.67650	-0.5616	10	0.87932	D	0	0.0731	14.5277	0.67900	0.1465:0.8535:0.0:0.0	.	448;297;465;465	B4E3E5;Q9UG07;F5GWR8;Q92997	.;.;.;DVL3_HUMAN	C	465;465;448	ENSP00000316054:R465C;ENSP00000405885:R448C	ENSP00000316054:R465C	R	+	1	0	DVL3	185368442	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.719000	0.61937	2.674000	0.91012	0.655000	0.94253	CGC		0.577	DVL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346184.1	NM_004423		41	117	0	0	0	0	41	117				
ABCF3	55324	broad.mit.edu	37	3	183907447	183907447	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr3:183907447C>T	ENST00000429586.2	+	13	1401	c.1216C>T	c.(1216-1218)Cgg>Tgg	p.R406W	EIF2B5_ENST00000444495.1_Intron|ABCF3_ENST00000292808.5_Missense_Mutation_p.R400W	NM_018358.2	NP_060828.2	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 3	406	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)	membrane (GO:0016020)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(20)|ovary(3)|prostate(5)|upper_aerodigestive_tract(1)	39	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			AGATGGTTACCGGGGAGACTT	0.572																																						uc003fmz.2		NA																	0				ovary(3)|lung(1)	4						c.(1216-1218)CGG>TGG		ATP-binding cassette, sub-family F (GCN20),							51.0	46.0	48.0					3																	183907447		2203	4300	6503	SO:0001583	missense	55324						ATP binding|ATPase activity	g.chr3:183907447C>T	U66685	CCDS3254.1	3q27.1	2012-05-16			ENSG00000161204	ENSG00000161204		"""ATP binding cassette transporters / subfamily F"""	72	protein-coding gene	gene with protein product						8894702	Standard	NM_018358		Approved	EST201864	uc003fmz.2	Q9NUQ8	OTTHUMG00000156824	ENST00000429586.2:c.1216C>T	3.37:g.183907447C>T	ENSP00000411471:p.Arg406Trp		Somatic				ABCF3_uc003fna.2_Missense_Mutation_p.R400W|ABCF3_uc003fnb.2_Missense_Mutation_p.R87W	p.R406W	NM_018358	NP_060828	WXS	Illumina HiSeq	Unspecified	Q9NUQ8	ABCF3_HUMAN	Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		13	1349	+	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		406			ABC transporter 1.		A8K241|Q86UA2|Q8NAN1|Q96GS8|Q9H7A8	Missense_Mutation	SNP	ENST00000429586.2	37	c.1216C>T	CCDS3254.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.251704	0.80135	.	.	ENSG00000161204	ENST00000429586;ENST00000292808	D;D	0.92446	-3.03;-3.04	4.2	4.2	0.49525	ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.96800	0.8955	M	0.92077	3.27	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.77557	0.99;0.981	D	0.97878	1.0290	10	0.87932	D	0	-18.0913	15.7155	0.77663	0.0:1.0:0.0:0.0	.	400;406	Q9NUQ8-2;Q9NUQ8	.;ABCF3_HUMAN	W	406;400	ENSP00000411471:R406W;ENSP00000292808:R400W	ENSP00000292808:R400W	R	+	1	2	ABCF3	185390141	1.000000	0.71417	0.994000	0.49952	0.966000	0.64601	7.084000	0.76866	2.186000	0.69663	0.563000	0.77884	CGG		0.572	ABCF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346047.1	NM_018358		20	41	0	0	0	0	20	41				
PIGG	54872	broad.mit.edu	37	4	499519	499519	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr4:499519G>A	ENST00000453061.2	+	3	479	c.373G>A	c.(373-375)Ggg>Agg	p.G125R	PIGG_ENST00000296306.7_Missense_Mutation_p.G36R|PIGG_ENST00000504346.1_Missense_Mutation_p.G36R|PIGG_ENST00000310340.5_Missense_Mutation_p.G125R|PIGG_ENST00000509768.1_Missense_Mutation_p.G36R|PIGG_ENST00000503111.1_Missense_Mutation_p.G36R|PIGG_ENST00000383028.4_Intron|PIGG_ENST00000536264.1_Missense_Mutation_p.G3R	NM_001127178.1	NP_001120650.1	Q5H8A4	PIGG_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class G	125					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	CP2 mannose-ethanolamine phosphotransferase activity (GO:0051267)|phosphotransferase activity, for other substituted phosphate groups (GO:0016780)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	39						ATTGATGACGGGGAGCCTTCC	0.438																																						uc003gak.3		NA																	0				central_nervous_system(2)|ovary(1)|skin(1)	4						c.(373-375)GGG>AGG		phosphatidylinositol glycan anchor biosynthesis,							67.0	63.0	64.0					4																	499519		2203	4300	6503	SO:0001583	missense	54872				C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	CP2 mannose-ethanolamine phosphotransferase activity	g.chr4:499519G>A		CCDS3336.1, CCDS46992.1, CCDS75080.1, CCDS75081.1, CCDS75082.1, CCDS75083.1	4p16.3	2013-02-26	2006-06-28		ENSG00000174227	ENSG00000174227		"""Phosphatidylinositol glycan anchor biosynthesis"""	25985	protein-coding gene	gene with protein product			"""phosphatidylinositol glycan, class G"""			15632136	Standard	XM_005272287		Approved	FLJ20265, GPI7, LAS21	uc003gak.4	Q5H8A4	OTTHUMG00000112457	ENST00000453061.2:c.373G>A	4.37:g.499519G>A	ENSP00000415203:p.Gly125Arg		Somatic				PIGG_uc003gaj.3_Missense_Mutation_p.G125R|PIGG_uc011bux.1_RNA|PIGG_uc010ibf.2_Intron|PIGG_uc003gal.3_Missense_Mutation_p.G36R|PIGG_uc003gai.2_RNA|PIGG_uc011buw.1_Missense_Mutation_p.G3R|PIGG_uc003gam.2_Missense_Mutation_p.G36R|PIGG_uc003gan.2_Missense_Mutation_p.G36R	p.G125R	NM_001127178	NP_001120650	WXS	Illumina HiSeq	Unspecified	Q5H8A4	PIGG_HUMAN			3	509	+			125			Lumenal (Potential).		B4DKC7|Q2TAK5|Q6UX31|Q7L5Y4|Q8N866|Q8NCC9|Q96SY9|Q9BVT7|Q9NXG5	Missense_Mutation	SNP	ENST00000453061.2	37	c.373G>A	CCDS46992.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.991999	0.74703	.	.	ENSG00000174227	ENST00000296306;ENST00000536264;ENST00000310340;ENST00000453061;ENST00000504346;ENST00000503111;ENST00000509768	T;D;D;D;T;T;T	0.93426	0.92;-1.67;-3.22;-3.22;0.92;0.92;0.92	5.69	5.69	0.88448	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.97980	0.9335	H	0.96777	3.88	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.99063	1.0831	10	0.87932	D	0	.	17.307	0.87198	0.0:0.0:1.0:0.0	.	3;36;36;125;125	B4DKC7;D6RFE8;Q5H8A4-5;Q5H8A4;Q5H8A4-2	.;.;.;PIGG_HUMAN;.	R	36;3;125;125;36;36;36	ENSP00000296306:G36R;ENSP00000439240:G3R;ENSP00000311750:G125R;ENSP00000415203:G125R;ENSP00000424800:G36R;ENSP00000426002:G36R;ENSP00000421550:G36R	ENSP00000296306:G36R	G	+	1	0	PIGG	489519	1.000000	0.71417	0.998000	0.56505	0.328000	0.28507	8.926000	0.92839	2.691000	0.91804	0.650000	0.86243	GGG		0.438	PIGG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357494.1	NM_017733		3	50	0	0	0	0	3	50				
DCAF16	54876	broad.mit.edu	37	4	17805431	17805431	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr4:17805431C>T	ENST00000382247.1	-	3	1394	c.334G>A	c.(334-336)Gaa>Aaa	p.E112K	DCAF16_ENST00000507768.1_5'Flank|DCAF16_ENST00000536863.1_Missense_Mutation_p.E112K	NM_017741.3	NP_060211.3	Q9NXF7	DCA16_HUMAN	DDB1 and CUL4 associated factor 16	112					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)				cervix(1)|endometrium(1)|lung(2)|ovary(1)	5						GGGGGCCATTCAGGAATTGGT	0.493																																						uc003gpn.2		NA																	0				ovary(1)	1						c.(334-336)GAA>AAA		DDB1 and CUL4 associated factor 16							107.0	118.0	114.0					4																	17805431		2203	4300	6503	SO:0001583	missense	54876					CUL4 RING ubiquitin ligase complex		g.chr4:17805431C>T	AK000287	CCDS3423.1	4p15.32	2009-07-17	2009-07-17	2009-07-17	ENSG00000163257	ENSG00000163257		"""DDB1 and CUL4 associated factors"""	25987	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 30"""	C4orf30		12477932	Standard	XM_005248169		Approved	FLJ20280	uc003gpn.3	Q9NXF7	OTTHUMG00000128536	ENST00000382247.1:c.334G>A	4.37:g.17805431C>T	ENSP00000371682:p.Glu112Lys		Somatic				DCAF16_uc003gpo.2_RNA	p.E112K	NM_017741	NP_060211	WXS	Illumina HiSeq	Unspecified	Q9NXF7	DCA16_HUMAN			3	1395	-			112					B3KPB7	Missense_Mutation	SNP	ENST00000382247.1	37	c.334G>A	CCDS3423.1	.	.	.	.	.	.	.	.	.	.	C	14.05	2.418326	0.42918	.	.	ENSG00000163257	ENST00000382247;ENST00000536863	T;T	0.38240	1.15;1.15	3.75	2.91	0.33838	.	.	.	.	.	T	0.18800	0.0451	N	0.08118	0	0.25139	N	0.990514	B	0.19200	0.034	B	0.08055	0.003	T	0.14980	-1.0453	9	0.87932	D	0	-5.8019	7.1584	0.25651	0.0:0.8791:0.0:0.1209	.	112	Q9NXF7	DCA16_HUMAN	K	112	ENSP00000371682:E112K;ENSP00000445736:E112K	ENSP00000371682:E112K	E	-	1	0	DCAF16	17414529	0.995000	0.38212	0.998000	0.56505	0.906000	0.53458	2.411000	0.44600	1.160000	0.42584	0.561000	0.74099	GAA		0.493	DCAF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250371.1	NM_017741		64	55	0	0	0	0	64	55				
TLR1	7096	broad.mit.edu	37	4	38798908	38798908	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr4:38798908C>A	ENST00000502213.2	-	3	1774	c.1545G>T	c.(1543-1545)aaG>aaT	p.K515N	TLR1_ENST00000308979.2_Missense_Mutation_p.K515N|TLR1_ENST00000510552.1_5'Flank			Q15399	TLR1_HUMAN	toll-like receptor 1	515					cellular response to triacyl bacterial lipopeptide (GO:0071727)|detection of triacyl bacterial lipopeptide (GO:0042495)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of cytokine secretion (GO:0050707)|signal transduction (GO:0007165)|toll-like receptor 1 signaling pathway (GO:0034130)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)	protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(2)	28						TTGACCTCATCTTCTGGCAGC	0.433																																					GBM(5;216 373 40795 46382)	uc003gtl.2		NA																	0				lung(2)|skin(2)|prostate(1)	5						c.(1543-1545)AAG>AAT		toll-like receptor 1 precursor							142.0	150.0	147.0					4																	38798908		2203	4297	6500	SO:0001583	missense	7096				cellular response to triacyl bacterial lipopeptide|detection of triacyl bacterial lipopeptide|inflammatory response|innate immune response|macrophage activation|positive regulation of interleukin-6 biosynthetic process|positive regulation of tumor necrosis factor biosynthetic process	integral to plasma membrane|phagocytic vesicle membrane|Toll-like receptor 1-Toll-like receptor 2 protein complex	protein heterodimerization activity|transmembrane receptor activity	g.chr4:38798908C>A	U88540	CCDS33973.1	4p14	2008-02-05				ENSG00000174125		"""CD molecules"""	11847	protein-coding gene	gene with protein product		601194				9435236, 7584026	Standard	NM_003263		Approved	rsc786, KIAA0012, CD281	uc003gtl.3	Q15399		ENST00000502213.2:c.1545G>T	4.37:g.38798908C>A	ENSP00000421259:p.Lys515Asn		Somatic					p.K515N	NM_003263	NP_003254	WXS	Illumina HiSeq	Unspecified	Q15399	TLR1_HUMAN			4	1819	-			515			Extracellular (Potential).		D1CS39|D1CS41|O15452|Q32MK3|Q32MK4|Q9UG90	Missense_Mutation	SNP	ENST00000502213.2	37	c.1545G>T	CCDS33973.1	.	.	.	.	.	.	.	.	.	.	C	5.851	0.341280	0.11069	.	.	ENSG00000174125	ENST00000308979;ENST00000502213	T;T	0.16897	2.31;2.31	4.75	-0.837	0.10766	.	0.895678	0.09584	N	0.782405	T	0.08891	0.0220	N	0.20483	0.58	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.40270	-0.9572	10	0.21540	T	0.41	.	5.0857	0.14680	0.2691:0.2761:0.385:0.0698	.	515	Q15399	TLR1_HUMAN	N	515	ENSP00000354932:K515N;ENSP00000421259:K515N	ENSP00000354932:K515N	K	-	3	2	TLR1	38475303	0.000000	0.05858	0.962000	0.40283	0.946000	0.59487	-1.077000	0.03416	-0.008000	0.14320	0.650000	0.86243	AAG		0.433	TLR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360510.3			121	37	1	0	1.51e-44	2.05e-44	121	37				
ATP8A1	10396	broad.mit.edu	37	4	42618055	42618055	+	Missense_Mutation	SNP	G	G	A	rs373363487		TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr4:42618055G>A	ENST00000381668.5	-	5	635	c.404C>T	c.(403-405)aCg>aTg	p.T135M	ATP8A1_ENST00000264449.10_Missense_Mutation_p.T135M	NM_006095.2	NP_006086.1	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1	135					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.T135M(1)		NS(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	51					Phosphatidylserine(DB00144)	CCTACCTTGCGTTTGTTTCTT	0.284																																						uc003gwr.2		NA																	1	Substitution - Missense(1)		urinary_tract(1)	skin(2)|central_nervous_system(1)	3						c.(403-405)ACG>ATG		ATPase, aminophospholipid transporter (APLT),	Phosphatidylserine(DB00144)	G	MET/THR,MET/THR	0,4400		0,0,2200	233.0	218.0	223.0		404,404	5.7	1.0	4		223	1,8595	1.2+/-3.3	0,1,4297	no	missense,missense	ATP8A1	NM_001105529.1,NM_006095.2	81,81	0,1,6497	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	135/1150,135/1165	42618055	1,12995	2200	4298	6498	SO:0001583	missense	10396				ATP biosynthetic process	chromaffin granule membrane|integral to membrane|plasma membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr4:42618055G>A	AF067820	CCDS3466.1, CCDS47049.1	4p13	2010-04-20	2007-09-19		ENSG00000124406	ENSG00000124406		"""ATPases / P-type"""	13531	protein-coding gene	gene with protein product		609542	"""ATPase, aminophospholipid transporter (APLT), Class I, type 8A, member 1"""			10198212, 9548971	Standard	NM_006095		Approved	ATPIA	uc003gwr.2	Q9Y2Q0	OTTHUMG00000099403	ENST00000381668.5:c.404C>T	4.37:g.42618055G>A	ENSP00000371084:p.Thr135Met		Somatic				ATP8A1_uc003gws.2_Missense_Mutation_p.T135M|ATP8A1_uc011byz.1_Missense_Mutation_p.T135M	p.T135M	NM_006095	NP_006086	WXS	Illumina HiSeq	Unspecified	Q9Y2Q0	AT8A1_HUMAN			5	636	-			135			Cytoplasmic (Potential).		Q32M35|Q32M36|Q4W5J7|Q4W5P2	Missense_Mutation	SNP	ENST00000381668.5	37	c.404C>T	CCDS3466.1	.	.	.	.	.	.	.	.	.	.	G	18.37	3.609636	0.66558	0.0	1.16E-4	ENSG00000124406	ENST00000381668;ENST00000264449	D;D	0.91237	-2.81;-2.81	5.7	5.7	0.88788	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.106394	0.64402	D	0.000009	D	0.95497	0.8537	M	0.92738	3.34	0.80722	D	1	P;P;P	0.50710	0.806;0.89;0.938	B;P;P	0.57371	0.44;0.819;0.689	D	0.95924	0.8933	10	0.66056	D	0.02	.	14.0416	0.64678	0.0717:0.0:0.9283:0.0	.	135;135;135	B4DII6;Q32M35;Q9Y2Q0	.;.;AT8A1_HUMAN	M	135	ENSP00000371084:T135M;ENSP00000264449:T135M	ENSP00000264449:T135M	T	-	2	0	ATP8A1	42312812	1.000000	0.71417	0.999000	0.59377	0.918000	0.54935	4.748000	0.62148	2.683000	0.91414	0.650000	0.86243	ACG		0.284	ATP8A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216861.2	NM_006095		23	10	0	0	0	0	23	10				
GRSF1	2926	broad.mit.edu	37	4	71702029	71702029	+	Silent	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr4:71702029C>T	ENST00000254799.6	-	2	477	c.360G>A	c.(358-360)gaG>gaA	p.E120E	GRSF1_ENST00000508091.1_5'UTR|GRSF1_ENST00000502323.1_5'UTR|GRSF1_ENST00000545193.1_Silent_p.E2E|GRSF1_ENST00000439371.1_5'UTR	NM_002092.3	NP_002083	Q12849	GRSF1_HUMAN	G-rich RNA sequence binding factor 1	120					anterior/posterior pattern specification (GO:0009952)|morphogenesis of embryonic epithelium (GO:0016331)|mRNA polyadenylation (GO:0006378)|tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|upper_aerodigestive_tract(2)	17		all_hematologic(202;0.21)	Lung(101;0.235)			TAGTTTTGGACTCCTTCCAAA	0.368																																						uc010iia.1		NA																	0					0						c.(358-360)GAG>GAA		G-rich RNA sequence binding factor 1 isoform 1							75.0	76.0	76.0					4																	71702029		1824	4081	5905	SO:0001819	synonymous_variant	2926				mRNA polyadenylation		mRNA binding|nucleotide binding	g.chr4:71702029C>T	BC040485	CCDS47069.1, CCDS47070.1	4q13	2013-07-16				ENSG00000132463		"""RNA binding motif (RRM) containing"""	4610	protein-coding gene	gene with protein product		604851				8036161	Standard	NM_001098477		Approved		uc010iia.1	Q12849		ENST00000254799.6:c.360G>A	4.37:g.71702029C>T			Somatic				GRSF1_uc011caz.1_Silent_p.E2E|GRSF1_uc003hfs.2_5'UTR	p.E120E	NM_002092	NP_002083	WXS	Illumina HiSeq	Unspecified	Q12849	GRSF1_HUMAN	Lung(101;0.235)		2	443	-		all_hematologic(202;0.21)	120					B3KPW0|Q4W5S5|Q6ZST3|Q8IWD6|Q8NBD2	Silent	SNP	ENST00000254799.6	37	c.360G>A	CCDS47069.1	.	.	.	.	.	.	.	.	.	.	C	11.60	1.687230	0.29962	.	.	ENSG00000132463	ENST00000514161	.	.	.	4.51	1.48	0.22813	.	.	.	.	.	T	0.42291	0.1196	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.27938	-1.0059	4	.	.	.	-7.6122	1.1241	0.01731	0.256:0.4165:0.1339:0.1937	.	.	.	.	N	57	.	.	S	-	2	0	GRSF1	71920893	0.869000	0.29996	1.000000	0.80357	0.984000	0.73092	-0.095000	0.11077	0.496000	0.27904	0.655000	0.94253	AGT		0.368	GRSF1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362642.1	NM_002092		29	53	0	0	0	0	29	53				
PPEF2	5470	broad.mit.edu	37	4	76813090	76813090	+	Missense_Mutation	SNP	A	A	C	rs199757510		TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr4:76813090A>C	ENST00000286719.7	-	3	453	c.97T>G	c.(97-99)Tac>Gac	p.Y33D	PPEF2_ENST00000510607.1_5'UTR	NM_006239.2	NP_006230.2	O14830	PPE2_HUMAN	protein phosphatase, EF-hand calcium binding domain 2	33	IQ.				detection of stimulus involved in sensory perception (GO:0050906)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|protein dephosphorylation (GO:0006470)|regulation of JUN kinase activity (GO:0043506)|regulation of MAP kinase activity (GO:0043405)|visual perception (GO:0007601)	cilium (GO:0005929)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|Hsp70 protein binding (GO:0030544)|Hsp90 protein binding (GO:0051879)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	50			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			CGGGCCACGTAGCGCCGGTAC	0.577													A|||	1	0.000199681	0.0	0.0	5008	,	,		19579	0.001		0.0	False		,,,				2504	0.0				NSCLC(105;1359 1603 15961 44567 47947)	uc003hix.2		NA																	0				ovary(2)|lung(1)|central_nervous_system(1)	4						c.(97-99)TAC>GAC		serine/threonine protein phosphatase with							61.0	62.0	62.0					4																	76813090		2203	4300	6503	SO:0001583	missense	5470				detection of stimulus involved in sensory perception|negative regulation of MAPKKK cascade|negative regulation of peptidyl-threonine phosphorylation|protein dephosphorylation|visual perception	cytoplasm|photoreceptor inner segment|photoreceptor outer segment	calcium ion binding|Hsp70 protein binding|Hsp90 protein binding|iron ion binding|manganese ion binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine phosphatase activity	g.chr4:76813090A>C	AF023456	CCDS34013.1	4q21.1	2013-01-10			ENSG00000156194	ENSG00000156194		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9244	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, beta isozyme"""	602256				9326663, 12051765	Standard	NM_006239		Approved	PPP7CB	uc003hix.3	O14830	OTTHUMG00000160915	ENST00000286719.7:c.97T>G	4.37:g.76813090A>C	ENSP00000286719:p.Tyr33Asp		Somatic				PPEF2_uc003hiy.2_RNA|PPEF2_uc003hiz.1_Missense_Mutation_p.Y33D	p.Y33D	NM_006239	NP_006230	WXS	Illumina HiSeq	Unspecified	O14830	PPE2_HUMAN	Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)		3	454	-			33			IQ.		O14831	Missense_Mutation	SNP	ENST00000286719.7	37	c.97T>G	CCDS34013.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	A	21.5	4.154084	0.78114	.	.	ENSG00000156194	ENST00000286719;ENST00000337500	T	0.54279	0.58	5.57	4.39	0.52855	.	0.116646	0.64402	D	0.000011	T	0.70404	0.3220	M	0.80183	2.485	0.45914	D	0.99875	D;D	0.76494	0.999;0.993	D;P	0.72982	0.979;0.809	T	0.72164	-0.4373	10	0.66056	D	0.02	1.1121	9.625	0.39746	0.9173:0.0:0.0827:0.0	.	33;33	O14830-2;O14830	.;PPE2_HUMAN	D	33	ENSP00000286719:Y33D	ENSP00000286719:Y33D	Y	-	1	0	PPEF2	77032114	1.000000	0.71417	0.992000	0.48379	0.941000	0.58515	5.796000	0.69080	0.941000	0.37499	-0.353000	0.07706	TAC		0.577	PPEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362929.1	NM_006239		28	72	0	0	0	0	28	72				
PDLIM5	10611	broad.mit.edu	37	4	95376534	95376534	+	Splice_Site	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr4:95376534G>A	ENST00000317968.4	+	2	231	c.95G>A	c.(94-96)aGt>aAt	p.S32N	PDLIM5_ENST00000504489.1_Splice_Site_p.S32N|PDLIM5_ENST00000538141.1_Splice_Site_p.S32N|PDLIM5_ENST00000508216.1_Splice_Site_p.S32N|PDLIM5_ENST00000450793.1_Splice_Site_p.S32N|PDLIM5_ENST00000542407.1_5'UTR|PDLIM5_ENST00000437932.1_Splice_Site_p.S32N|PDLIM5_ENST00000512274.1_Missense_Mutation_p.S32N|PDLIM5_ENST00000359265.4_Splice_Site_p.S32N|PDLIM5_ENST00000380180.3_Splice_Site_p.S32N|PDLIM5_ENST00000514743.1_Splice_Site_p.S32N|PDLIM5_ENST00000318007.5_Splice_Site_p.S32N	NM_001256428.1|NM_006457.4	NP_001243357.1|NP_006448	Q96HC4	PDLI5_HUMAN	PDZ and LIM domain 5	32	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				regulation of dendritic spine morphogenesis (GO:0061001)|regulation of synapse assembly (GO:0051963)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|actinin binding (GO:0042805)|protein kinase C binding (GO:0005080)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)		ACAATCTCTAGTGTAAGTAAA	0.428																																						uc003hti.2		NA																	0				ovary(1)|skin(1)	2						c.(94-96)AGT>AAT		PDZ and LIM domain 5 isoform a							51.0	51.0	51.0					4																	95376534		2203	4300	6503	SO:0001630	splice_region_variant	10611				regulation of dendritic spine morphogenesis|regulation of synaptogenesis	actin cytoskeleton|cell junction|cytosol|postsynaptic density|postsynaptic membrane|synaptosome	actin binding|actinin binding|protein kinase C binding|zinc ion binding	g.chr4:95376534G>A	AF061258	CCDS3641.1, CCDS47103.1, CCDS47104.1, CCDS58915.1, CCDS58916.1, CCDS58917.1, CCDS75166.1	4q22	2006-04-12			ENSG00000163110	ENSG00000163110			17468	protein-coding gene	gene with protein product		605904				15346770	Standard	NM_006457		Approved	LIM, Enh	uc003htk.4	Q96HC4	OTTHUMG00000130973	ENST00000317968.4:c.96+1G>A	4.37:g.95376534G>A			Somatic				PDLIM5_uc003htf.2_Missense_Mutation_p.S32N|PDLIM5_uc003htg.2_Missense_Mutation_p.S32N|PDLIM5_uc011cdx.1_Missense_Mutation_p.S32N|PDLIM5_uc003hth.2_Missense_Mutation_p.S32N|PDLIM5_uc003htj.2_5'UTR|PDLIM5_uc003htk.2_Missense_Mutation_p.S32N|PDLIM5_uc011cdy.1_5'UTR	p.S32N	NM_006457	NP_006448	WXS	Illumina HiSeq	Unspecified	Q96HC4	PDLI5_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)	2	246	+		Hepatocellular(203;0.114)	32			PDZ.		A8K6F9|D6RB78|E9PBF5|O60705|Q56VN4|Q5UW38|Q8WVK0	Missense_Mutation	SNP	ENST00000317968.4	37	c.95G>A	CCDS3641.1	.	.	.	.	.	.	.	.	.	.	G	19.67	3.870691	0.72065	.	.	ENSG00000163110	ENST00000359265;ENST00000437932;ENST00000380180;ENST00000318007;ENST00000450793;ENST00000538141;ENST00000317968;ENST00000512274;ENST00000503974;ENST00000504489;ENST00000508216;ENST00000514743	T;T;T;T;T;T;T;T;T;T;T;T	0.41758	0.99;1.66;1.66;1.66;1.66;1.66;1.66;2.2;1.66;2.2;1.66;1.66	5.51	4.67	0.58626	PDZ/DHR/GLGF (4);	0.341753	0.31246	N	0.007992	T	0.47469	0.1447	L	0.39633	1.23	0.80722	D	1	D;B;P;P;B;B	0.58970	0.984;0.31;0.536;0.856;0.018;0.209	P;B;B;P;B;B	0.54140	0.743;0.056;0.324;0.62;0.015;0.236	T	0.49615	-0.8921	10	0.72032	D	0.01	.	13.4116	0.60946	0.0776:0.0:0.9224:0.0	.	32;32;32;32;32;32	E9PBF5;D6RB78;Q96HC4;Q96HC4-4;Q96HC4-2;Q96HC4-3	.;.;PDLI5_HUMAN;.;.;.	N	32	ENSP00000352210:S32N;ENSP00000398469:S32N;ENSP00000369527:S32N;ENSP00000322021:S32N;ENSP00000401579:S32N;ENSP00000439795:S32N;ENSP00000321746:S32N;ENSP00000426379:S32N;ENSP00000424297:S32N;ENSP00000423009:S32N;ENSP00000426804:S32N;ENSP00000424360:S32N	ENSP00000321746:S32N	S	+	2	0	PDLIM5	95595557	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.261000	0.72509	1.315000	0.45114	0.591000	0.81541	AGT		0.428	PDLIM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253586.1		Missense_Mutation	15	11	0	0	0	0	15	11				
FBXW7	55294	broad.mit.edu	37	4	153247289	153247289	+	Missense_Mutation	SNP	G	G	C	rs149680468		TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr4:153247289G>C	ENST00000281708.4	-	10	2742	c.1513C>G	c.(1513-1515)Cgc>Ggc	p.R505G	FBXW7_ENST00000603841.1_Missense_Mutation_p.R505G|FBXW7_ENST00000393956.3_Missense_Mutation_p.R329G|FBXW7_ENST00000603548.1_Missense_Mutation_p.R505G|FBXW7_ENST00000263981.5_Missense_Mutation_p.R425G|FBXW7_ENST00000296555.5_Missense_Mutation_p.R387G	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	505			R -> L (in an ovarian cancer cell line). {ECO:0000269|PubMed:11565033, ECO:0000269|PubMed:16959974}.		cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.R505C(60)|p.R505G(18)|p.R425C(14)|p.R266C(13)|p.R425G(9)|p.R266G(9)|p.R387G(6)|p.R387C(3)|p.R505S(3)|p.R387S(1)|p.?(1)|p.R425S(1)|p.R266S(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				TGAACACAGCGGACTGCTGCA	0.468			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																	uc003ims.2		NA		Rec	yes		4	4q31.3	55294	Mis|N|D|F	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""			"""E, L"""			colorectal|endometrial|T-ALL		139	Substitution - Missense(138)|Unknown(1)	p.R505C(36)|p.R505L(6)|p.R505G(4)|p.R425C(2)|p.R425G(2)|p.R266G(2)|p.R505H(2)|p.R505S(1)|p.R505P(1)|p.R266C(1)	haematopoietic_and_lymphoid_tissue(44)|large_intestine(26)|endometrium(20)|urinary_tract(15)|lung(15)|upper_aerodigestive_tract(8)|skin(8)|ovary(2)|biliary_tract(1)	haematopoietic_and_lymphoid_tissue(125)|large_intestine(99)|stomach(16)|lung(14)|endometrium(13)|ovary(9)|biliary_tract(8)|upper_aerodigestive_tract(5)|central_nervous_system(3)|kidney(3)|skin(3)|pancreas(3)|breast(2)|prostate(2)|cervix(1)|NS(1)|bone(1)	308						c.(1513-1515)CGC>GGC		F-box and WD repeat domain containing 7 isoform							167.0	156.0	160.0					4																	153247289		2203	4300	6503	SO:0001583	missense	55294				interspecies interaction between organisms|lipid homeostasis|negative regulation of DNA endoreduplication|negative regulation of hepatocyte proliferation|negative regulation of Notch signaling pathway|negative regulation of triglyceride biosynthetic process|positive regulation of epidermal growth factor receptor activity|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|protein stabilization|protein ubiquitination|regulation of lipid storage|regulation of protein localization|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|sister chromatid cohesion|vasculature development	nucleolus|nucleolus|nucleoplasm|nucleoplasm|SCF ubiquitin ligase complex	protein binding|protein binding	g.chr4:153247289G>C	AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1513C>G	4.37:g.153247289G>C	ENSP00000281708:p.Arg505Gly		Somatic				FBXW7_uc011cii.1_Missense_Mutation_p.R505G|FBXW7_uc003imt.2_Missense_Mutation_p.R505G|FBXW7_uc011cih.1_Missense_Mutation_p.R329G|FBXW7_uc003imq.2_Missense_Mutation_p.R425G|FBXW7_uc003imr.2_Missense_Mutation_p.R387G	p.R505G	NM_033632	NP_361014	WXS	Illumina HiSeq	Unspecified	Q969H0	FBXW7_HUMAN			10	1662	-	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)	505		R -> L (in an ovarian cancer cell line).	WD 4.		B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	ENST00000281708.4	37	c.1513C>G	CCDS3777.1	.	.	.	.	.	.	.	.	.	.	G	17.95	3.513685	0.64522	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.62105	0.05;0.05;0.05;0.05	5.72	4.88	0.63580	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.101576	0.64402	D	0.000001	T	0.78679	0.4321	M	0.75085	2.285	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.81858	-0.0739	10	0.87932	D	0	-12.0024	15.0746	0.72066	0.0681:0.0:0.9319:0.0	.	329;505;387;425	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	G	505;387;425;329	ENSP00000281708:R505G;ENSP00000296555:R387G;ENSP00000263981:R425G;ENSP00000377528:R329G	ENSP00000263981:R425G	R	-	1	0	FBXW7	153466739	1.000000	0.71417	1.000000	0.80357	0.556000	0.35491	9.772000	0.98984	1.559000	0.49555	-0.145000	0.13849	CGC		0.468	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1			55	17	0	0	0	0	55	17				
VEGFC	7424	broad.mit.edu	37	4	177605120	177605120	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr4:177605120C>T	ENST00000280193.2	-	7	1635	c.1220G>A	c.(1219-1221)cGt>cAt	p.R407H	RP11-313E19.2_ENST00000509194.1_RNA|RP11-313E19.2_ENST00000504017.1_RNA	NM_005429.2	NP_005420	P49767	VEGFC_HUMAN	vascular endothelial growth factor C	407					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|induction of positive chemotaxis (GO:0050930)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of lymphangiogenesis (GO:1901492)|positive regulation of mast cell chemotaxis (GO:0060754)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein secretion (GO:0050714)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)|response to drug (GO:0042493)|signal transduction (GO:0007165)|substrate-dependent cell migration (GO:0006929)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	chemoattractant activity (GO:0042056)			biliary_tract(1)|cervix(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(2)|skin(2)	41		Breast(14;0.000223)|Renal(120;0.00988)|Prostate(90;0.00996)|Melanoma(52;0.0101)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;1.59e-18)|Epithelial(43;3.68e-16)|OV - Ovarian serous cystadenocarcinoma(60;8.52e-09)|GBM - Glioblastoma multiforme(59;0.000546)|STAD - Stomach adenocarcinoma(60;0.00308)|Colorectal(24;0.025)|COAD - Colon adenocarcinoma(29;0.0359)|LUSC - Lung squamous cell carcinoma(193;0.0397)		AGGGACACAACGACACACTTC	0.418																																						uc003ius.1		NA																	0				lung(5)	5						c.(1219-1221)CGT>CAT		vascular endothelial growth factor C							139.0	129.0	132.0					4																	177605120		1898	4126	6024	SO:0001583	missense	7424				angiogenesis|induction of positive chemotaxis|platelet activation|platelet degranulation|positive regulation of cell division|positive regulation of mast cell chemotaxis|substrate-dependent cell migration|vascular endothelial growth factor receptor signaling pathway	membrane|platelet alpha granule lumen	chemoattractant activity|growth factor activity	g.chr4:177605120C>T	BC035212	CCDS43285.1	4q34.3	2013-02-18				ENSG00000150630			12682	protein-coding gene	gene with protein product	"""vascular endothelial growth factor-related protein"""	601528				8617204	Standard	NM_005429		Approved	VRP	uc003ius.1	P49767		ENST00000280193.2:c.1220G>A	4.37:g.177605120C>T	ENSP00000280193:p.Arg407His		Somatic					p.R407H	NM_005429	NP_005420	WXS	Illumina HiSeq	Unspecified	P49767	VEGFC_HUMAN		all cancers(43;1.59e-18)|Epithelial(43;3.68e-16)|OV - Ovarian serous cystadenocarcinoma(60;8.52e-09)|GBM - Glioblastoma multiforme(59;0.000546)|STAD - Stomach adenocarcinoma(60;0.00308)|Colorectal(24;0.025)|COAD - Colon adenocarcinoma(29;0.0359)|LUSC - Lung squamous cell carcinoma(193;0.0397)	7	1650	-		Breast(14;0.000223)|Renal(120;0.00988)|Prostate(90;0.00996)|Melanoma(52;0.0101)|all_hematologic(60;0.107)|all_neural(102;0.164)	407					B2R9Q8	Missense_Mutation	SNP	ENST00000280193.2	37	c.1220G>A	CCDS43285.1	.	.	.	.	.	.	.	.	.	.	C	17.23	3.336013	0.60853	.	.	ENSG00000150630	ENST00000280193	.	.	.	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.49558	0.1564	L	0.46157	1.445	0.80722	D	1	P	0.46395	0.877	B	0.32022	0.139	T	0.57705	-0.7765	9	0.52906	T	0.07	-22.7232	19.9225	0.97093	0.0:1.0:0.0:0.0	.	407	P49767	VEGFC_HUMAN	H	407	.	ENSP00000280193:R407H	R	-	2	0	VEGFC	177842114	1.000000	0.71417	1.000000	0.80357	0.524000	0.34500	5.065000	0.64344	2.780000	0.95670	0.655000	0.94253	CGT		0.418	VEGFC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361991.1	NM_005429		28	59	0	0	0	0	28	59				
CDKN2AIP	55602	broad.mit.edu	37	4	184366790	184366790	+	Silent	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr4:184366790G>A	ENST00000504169.1	+	2	582	c.375G>A	c.(373-375)gtG>gtA	p.V125V	CDKN2AIP_ENST00000506835.1_Intron|CDKN2AIP_ENST00000510928.1_Silent_p.V125V|CDKN2AIP_ENST00000302350.4_Intron	NM_017632.2	NP_060102.1	Q9NXV6	CARF_HUMAN	CDKN2A interacting protein	125					negative regulation of cell growth (GO:0030308)|positive regulation of signal transduction (GO:0009967)|regulation of protein stability (GO:0031647)	cytoplasm (GO:0005737)|granular component (GO:0001652)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	p53 binding (GO:0002039)|RNA binding (GO:0003723)			endometrium(1)|kidney(2)|large_intestine(2)|lung(1)	6		all_lung(41;6.9e-12)|Lung NSC(41;1.28e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;1.15e-26)|Epithelial(43;2.98e-22)|OV - Ovarian serous cystadenocarcinoma(60;7.64e-10)|GBM - Glioblastoma multiforme(59;4.22e-06)|Colorectal(24;5.87e-06)|STAD - Stomach adenocarcinoma(60;2.09e-05)|COAD - Colon adenocarcinoma(29;5.15e-05)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)		TTGCCAAGGTGAAGAAAAGAG	0.363																																						uc003ivp.1		NA																	0					0						c.(373-375)GTG>GTA		CDKN2A interacting protein							120.0	108.0	113.0					4																	184366790		2203	4300	6503	SO:0001819	synonymous_variant	55602				negative regulation of cell growth|positive regulation of signal transduction|regulation of protein stability	granular component|nucleoplasm	double-stranded RNA binding|p53 binding	g.chr4:184366790G>A	AK000043	CCDS34110.1	4q35.1	2008-02-05			ENSG00000168564	ENSG00000168564			24325	protein-coding gene	gene with protein product	"""collaborates/cooperates with ARF (alternate reading frame) protein"""	615914				12154087, 16803988	Standard	NM_017632		Approved	FLJ20036, CARF	uc003ivp.1	Q9NXV6	OTTHUMG00000160626	ENST00000504169.1:c.375G>A	4.37:g.184366790G>A			Somatic				CDKN2AIP_uc003ivq.1_Intron	p.V125V	NM_017632	NP_060102	WXS	Illumina HiSeq	Unspecified	Q9NXV6	CARF_HUMAN		all cancers(43;1.15e-26)|Epithelial(43;2.98e-22)|OV - Ovarian serous cystadenocarcinoma(60;7.64e-10)|GBM - Glioblastoma multiforme(59;4.22e-06)|Colorectal(24;5.87e-06)|STAD - Stomach adenocarcinoma(60;2.09e-05)|COAD - Colon adenocarcinoma(29;5.15e-05)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)	2	537	+		all_lung(41;6.9e-12)|Lung NSC(41;1.28e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)	125					Q8TBM5|Q9NYH0	Silent	SNP	ENST00000504169.1	37	c.375G>A	CCDS34110.1																																																																																				0.363	CDKN2AIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361488.1	NM_017632		17	8	0	0	0	0	17	8				
CCT5	22948	broad.mit.edu	37	5	10256236	10256236	+	Silent	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr5:10256236G>A	ENST00000280326.4	+	4	921	c.501G>A	c.(499-501)caG>caA	p.Q167Q	CCT5_ENST00000506600.1_Silent_p.Q74Q|CCT5_ENST00000515390.1_Silent_p.Q112Q|CCT5_ENST00000503026.1_Silent_p.Q146Q|CCT5_ENST00000515676.1_Silent_p.Q129Q	NM_012073.3	NP_036205.1	P48643	TCPE_HUMAN	chaperonin containing TCP1, subunit 5 (epsilon)	167					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|response to virus (GO:0009615)	cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleolus (GO:0005730)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|G-protein beta-subunit binding (GO:0031681)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(2)	26						CCCTGATTCAGACAGCAAAAA	0.468																																						uc003jeq.2		NA																	0				ovary(2)	2						c.(499-501)CAG>CAA		chaperonin containing TCP1, subunit 5 (epsilon)							74.0	61.0	65.0					5																	10256236		2203	4300	6503	SO:0001819	synonymous_variant	22948				'de novo' posttranslational protein folding|response to virus	microtubule organizing center|nucleolus	ATP binding|unfolded protein binding	g.chr5:10256236G>A	D43950	CCDS3877.1	5p15.2	2014-09-17			ENSG00000150753	ENSG00000150753		"""Heat Shock Proteins / Chaperonins"""	1618	protein-coding gene	gene with protein product		610150					Standard	NM_012073		Approved	KIAA0098	uc003jeq.3	P48643	OTTHUMG00000131042	ENST00000280326.4:c.501G>A	5.37:g.10256236G>A			Somatic				CCT5_uc011cmq.1_Intron|CCT5_uc003jer.2_Silent_p.Q167Q|CCT5_uc010its.2_Silent_p.Q167Q|CCT5_uc011cmr.1_Silent_p.Q112Q|CCT5_uc011cms.1_Silent_p.Q129Q|CCT5_uc011cmt.1_Silent_p.Q74Q	p.Q167Q	NM_012073	NP_036205	WXS	Illumina HiSeq	Unspecified	P48643	TCPE_HUMAN			4	672	+			167					A8JZY8|A8K2X8|B4DYD8	Silent	SNP	ENST00000280326.4	37	c.501G>A	CCDS3877.1																																																																																				0.468	CCT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253688.2			22	26	0	0	0	0	22	26				
COL4A3BP	10087	broad.mit.edu	37	5	74801935	74801935	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr5:74801935T>C	ENST00000405807.4	-	2	524	c.103A>G	c.(103-105)Aac>Gac	p.N35D	COL4A3BP_ENST00000380494.5_Missense_Mutation_p.N163D|COL4A3BP_ENST00000261415.7_Missense_Mutation_p.N35D	NM_005713.2	NP_005704.1	Q9Y5P4	C43BP_HUMAN	collagen, type IV, alpha 3 (Goodpasture antigen) binding protein	35	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|ceramide metabolic process (GO:0006672)|endoplasmic reticulum organization (GO:0007029)|ER to Golgi ceramide transport (GO:0035621)|heart morphogenesis (GO:0003007)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|lipid homeostasis (GO:0055088)|mitochondrion morphogenesis (GO:0070584)|muscle contraction (GO:0006936)|protein phosphorylation (GO:0006468)|response to endoplasmic reticulum stress (GO:0034976)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ceramide binding (GO:0097001)|ceramide transporter activity (GO:0035620)|phosphatidylinositol-4-phosphate binding (GO:0070273)|protein kinase activity (GO:0004672)			breast(1)|kidney(1)|large_intestine(5)|lung(4)|skin(3)|stomach(1)|urinary_tract(1)	16		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;1e-53)		TGAATGTAGTTTGTCCACTGG	0.378																																						uc011csu.1		NA																	0				skin(1)	1						c.(103-105)AAC>GAC		alpha 3 type IV collagen binding protein isoform							93.0	88.0	90.0					5																	74801935		2203	4300	6503	SO:0001583	missense	10087				ER to Golgi ceramide transport|immune response	cytosol|endoplasmic reticulum membrane|Golgi apparatus	ceramide binding|phosphatidylinositol-4-phosphate binding|protein binding|protein kinase activity	g.chr5:74801935T>C	AF136450	CCDS4028.1, CCDS4029.1, CCDS47235.1	5q13.3	2013-01-10	2007-06-08	2007-06-08	ENSG00000113163	ENSG00000113163		"""StAR-related lipid transfer (START) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2205	protein-coding gene	gene with protein product	"""ceramide transporter"", ""StAR-related lipid transfer (START) domain containing 11"""	604677				10212244	Standard	NM_001130105		Approved	GPBP, STARD11, CERT	uc003kdt.3	Q9Y5P4	OTTHUMG00000102068	ENST00000405807.4:c.103A>G	5.37:g.74801935T>C	ENSP00000383996:p.Asn35Asp		Somatic				COL4A3BP_uc003kds.2_Missense_Mutation_p.N35D|COL4A3BP_uc003kdt.2_Missense_Mutation_p.N163D|COL4A3BP_uc003kdu.2_Missense_Mutation_p.N35D	p.N35D	NM_005713	NP_005704	WXS	Illumina HiSeq	Unspecified	Q9Y5P4	C43BP_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;1e-53)	2	525	-		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)	35			PH.		A8K7S2|B3KUB7|Q53YV1|Q53YV2|Q96Q85|Q96Q88|Q9H2S7|Q9H2S8	Missense_Mutation	SNP	ENST00000405807.4	37	c.103A>G	CCDS4028.1	.	.	.	.	.	.	.	.	.	.	T	28.4	4.917757	0.92249	.	.	ENSG00000113163	ENST00000405807;ENST00000380494;ENST00000261415	T;T;T	0.11930	2.73;2.73;2.73	5.51	5.51	0.81932	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.46151	0.1378	M	0.90705	3.14	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.997	T	0.57033	-0.7880	10	0.87932	D	0	-0.4221	15.6183	0.76784	0.0:0.0:0.0:1.0	.	35;163;35	Q9Y5P4;Q9Y5P4-3;Q9Y5P4-2	C43BP_HUMAN;.;.	D	35;163;35	ENSP00000383996:N35D;ENSP00000369862:N163D;ENSP00000261415:N35D	ENSP00000261415:N35D	N	-	1	0	COL4A3BP	74837691	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.637000	0.83313	2.092000	0.63282	0.482000	0.46254	AAC		0.378	COL4A3BP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219875.2	NM_005713		26	4	0	0	0	0	26	4				
ZFYVE16	9765	broad.mit.edu	37	5	79770505	79770505	+	Silent	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr5:79770505G>A	ENST00000338008.5	+	17	4497	c.4317G>A	c.(4315-4317)caG>caA	p.Q1439Q	ZFYVE16_ENST00000510158.1_Silent_p.Q1439Q|ZFYVE16_ENST00000505560.1_Silent_p.Q1439Q	NM_001284236.1|NM_014733.3	NP_001271165.1|NP_055548	Q7Z3T8	ZFY16_HUMAN	zinc finger, FYVE domain containing 16	1439					BMP signaling pathway (GO:0030509)|endosomal transport (GO:0016197)|protein targeting to lysosome (GO:0006622)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)|vesicle organization (GO:0016050)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|early endosome membrane (GO:0031901)|intracellular membrane-bounded organelle (GO:0043231)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein transporter activity (GO:0008565)			breast(4)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|liver(1)|lung(6)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.6e-46)|Epithelial(54;2.02e-41)|all cancers(79;5.05e-36)		TAAAGGACCAGGATTTATCTA	0.333																																					Melanoma(150;1452 1854 16018 17851 37292)	uc003kgr.3		NA																	0					0						c.(4315-4317)CAG>CAA		zinc finger, FYVE domain containing 16							77.0	81.0	80.0					5																	79770505		2202	4300	6502	SO:0001819	synonymous_variant	9765				BMP signaling pathway|endosome transport|protein targeting to lysosome|regulation of endocytosis|vesicle organization	early endosome membrane	1-phosphatidylinositol binding|metal ion binding|phosphatidylinositol-3,4,5-trisphosphate binding|protein binding|protein transporter activity	g.chr5:79770505G>A	AB002303	CCDS4050.1	5q14.1	2012-09-20			ENSG00000039319	ENSG00000039319		"""Zinc fingers, FYVE domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	20756	protein-coding gene	gene with protein product	"""endofin"", ""protein phosphatase 1, regulatory subunit 69"""	608880				11546807	Standard	NM_014733		Approved	KIAA0305, PPP1R69	uc003kgq.4	Q7Z3T8	OTTHUMG00000108178	ENST00000338008.5:c.4317G>A	5.37:g.79770505G>A			Somatic				ZFYVE16_uc003kgq.3_Silent_p.Q1439Q|ZFYVE16_uc003kgs.3_Silent_p.Q1439Q|ZFYVE16_uc003kgt.3_Silent_p.Q527Q|ZFYVE16_uc003kgu.3_Silent_p.Q191Q	p.Q1439Q	NM_001105251	NP_001098721	WXS	Illumina HiSeq	Unspecified	Q7Z3T8	ZFY16_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;1.6e-46)|Epithelial(54;2.02e-41)|all cancers(79;5.05e-36)	18	4619	+		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)	1439					O15023|Q5H9U2|Q7LAU7|Q86T69|Q8N5L3|Q8NEK3	Silent	SNP	ENST00000338008.5	37	c.4317G>A	CCDS4050.1																																																																																				0.333	ZFYVE16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226982.2	NM_014733		29	17	0	0	0	0	29	17				
MEF2C	4208	broad.mit.edu	37	5	88018742	88018742	+	Splice_Site	SNP	T	T	C			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr5:88018742T>C	ENST00000437473.2	-	11	1518	c.1101A>G	c.(1099-1101)ggA>ggG	p.G367G	MEF2C_ENST00000340208.5_Splice_Site_p.G377G|MEF2C_ENST00000514028.1_Splice_Site_p.G367G|MEF2C_ENST00000424173.2_Splice_Site_p.G357G|MEF2C_ENST00000506554.1_Intron|MEF2C_ENST00000510942.1_Splice_Site_p.G359G|MEF2C_ENST00000504921.2_Splice_Site_p.G367G|MEF2C_ENST00000539796.1_Splice_Site_p.G311G|MEF2C_ENST00000514015.1_Intron|CTC-467M3.1_ENST00000510274.1_RNA|MEF2C_ENST00000508569.1_Intron	NM_001193350.1|NM_002397.4	NP_001180279.1|NP_002388.2	Q06413	MEF2C_HUMAN	myocyte enhancer factor 2C	367					apoptotic process (GO:0006915)|B cell homeostasis (GO:0001782)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac ventricle formation (GO:0003211)|cartilage morphogenesis (GO:0060536)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|cellular response to fluid shear stress (GO:0071498)|cellular response to glucose stimulus (GO:0071333)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to trichostatin A (GO:0035984)|chondrocyte differentiation (GO:0002062)|dentate gyrus development (GO:0021542)|embryonic viscerocranium morphogenesis (GO:0048703)|endochondral ossification (GO:0001958)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|germinal center formation (GO:0002467)|glomerulus morphogenesis (GO:0072102)|heart development (GO:0007507)|heart looping (GO:0001947)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|MAPK cascade (GO:0000165)|melanocyte differentiation (GO:0030318)|monocyte differentiation (GO:0030224)|muscle cell differentiation (GO:0042692)|muscle cell fate determination (GO:0007521)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myotube differentiation (GO:0014902)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of ossification (GO:0030279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nephron tubule epithelial cell differentiation (GO:0072160)|nervous system development (GO:0007399)|neural crest cell differentiation (GO:0014033)|neuron development (GO:0048666)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoblast differentiation (GO:0001649)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|platelet formation (GO:0030220)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primary heart field specification (GO:0003138)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of dendritic spine development (GO:0060998)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of germinal center formation (GO:0002634)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron apoptotic process (GO:0043523)|regulation of neurotransmitter secretion (GO:0046928)|regulation of sarcomere organization (GO:0060297)|regulation of synapse assembly (GO:0051963)|regulation of synaptic activity (GO:0060025)|regulation of synaptic plasticity (GO:0048167)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|renal tubule morphogenesis (GO:0061333)|response to ischemia (GO:0002931)|response to virus (GO:0009615)|response to vitamin E (GO:0033197)|secondary heart field specification (GO:0003139)|sinoatrial valve morphogenesis (GO:0003185)|skeletal muscle tissue development (GO:0007519)|smooth muscle cell differentiation (GO:0051145)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|sarcomere (GO:0030017)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|miRNA binding (GO:0035198)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	40		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)		TAGTGCAAGCTCTGTAGGAGG	0.463										HNSCC(66;0.2)																												uc003kjj.2		NA																	0				lung(3)|breast(2)|ovary(1)|large_intestine(1)	7						c.(1099-1101)GGA>GGG		myocyte enhancer factor 2C isoform 1							56.0	54.0	55.0					5																	88018742		1910	4119	6029	SO:0001630	splice_region_variant	4208				apoptosis|B cell proliferation|innate immune response|learning or memory|muscle cell differentiation|muscle organ development|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|neuron development|positive regulation of muscle cell differentiation|positive regulation of survival gene product expression|positive regulation of transcription from RNA polymerase II promoter|regulation of germinal center formation|regulation of megakaryocyte differentiation|regulation of synaptic activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	nuclear speck	activating transcription factor binding|protein heterodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding	g.chr5:88018742T>C	AL833268	CCDS47244.1, CCDS47245.1, CCDS54877.1, CCDS54878.1	5q14.3	2013-07-03	2007-04-24		ENSG00000081189	ENSG00000081189		"""Myocyte enhancer factors"""	6996	protein-coding gene	gene with protein product		600662				8455629	Standard	NM_002397		Approved		uc003kjl.3	Q06413	OTTHUMG00000162634	ENST00000437473.2:c.1101-1A>G	5.37:g.88018742T>C		HNSCC(66;0.2)	Somatic				MEF2C_uc003kji.2_Silent_p.G359G|MEF2C_uc003kjk.2_Silent_p.G367G|MEF2C_uc003kjm.2_Silent_p.G357G|MEF2C_uc003kjl.2_Silent_p.G377G	p.G367G	NM_002397	NP_002388	WXS	Illumina HiSeq	Unspecified	Q06413	MEF2C_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)	11	1774	-		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)	367					C9JMZ0|D7F7N5|F8W7V7	Silent	SNP	ENST00000437473.2	37	c.1101A>G	CCDS47245.1																																																																																				0.463	MEF2C-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000369817.1	NM_002397	Silent	4	7	0	0	0	0	4	7				
GPR98	84059	broad.mit.edu	37	5	89988434	89988434	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr5:89988434C>A	ENST00000405460.2	+	32	7060	c.6964C>A	c.(6964-6966)Caa>Aaa	p.Q2322K		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	2322	Calx-beta 16. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TATCCAAGTGCAACTAACTGA	0.348																																						uc003kju.2		NA																	0				ovary(11)|central_nervous_system(3)|pancreas(2)	16						c.(6964-6966)CAA>AAA		G protein-coupled receptor 98 precursor							81.0	73.0	76.0					5																	89988434		1844	4079	5923	SO:0001583	missense	84059				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity	g.chr5:89988434C>A	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.6964C>A	5.37:g.89988434C>A	ENSP00000384582:p.Gln2322Lys		Somatic				GPR98_uc003kjt.2_Missense_Mutation_p.Q28K|GPR98_uc003kjv.2_5'Flank	p.Q2322K	NM_032119	NP_115495	WXS	Illumina HiSeq	Unspecified	Q8WXG9	GPR98_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)	32	7060	+		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)	2322			Calx-beta 16.|Extracellular (Potential).		O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	c.6964C>A	CCDS47246.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.081|9.081	0.999402|0.999402	0.19121|0.19121	.|.	.|.	ENSG00000164199|ENSG00000164199	ENST00000399043|ENST00000405460;ENST00000296619	.|T	.|0.27402	.|1.67	5.81|5.81	4.89|4.89	0.63831|0.63831	.|Na-Ca exchanger/integrin-beta4 (1);	.|0.259993	.|0.43919	.|D	.|0.000501	T|T	0.17365|0.17365	0.0417|0.0417	N|N	0.14661|0.14661	0.345|0.345	0.80722|0.80722	D|D	1|1	.|B	.|0.19706	.|0.038	.|B	.|0.14023	.|0.01	T|T	0.06356|0.06356	-1.0831|-1.0831	6|10	0.87932|0.27785	D|T	0|0.31	.|.	10.5652|10.5652	0.45169|0.45169	0.2161:0.6531:0.1308:0.0|0.2161:0.6531:0.1308:0.0	.|.	.|2322	.|Q8WXG9	.|GPR98_HUMAN	E|K	2304|2322	.|ENSP00000384582:Q2322K	ENSP00000381999:A2304E|ENSP00000296619:Q2322K	A|Q	+|+	2|1	0|0	GPR98|GPR98	90024190|90024190	0.999000|0.999000	0.42202|0.42202	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	2.384000|2.384000	0.44362|0.44362	2.738000|2.738000	0.93877|0.93877	0.655000|0.655000	0.94253|0.94253	GCA|CAA		0.348	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119		9	4	1	0	0.00829132	0.00940253	9	4				
APC	324	broad.mit.edu	37	5	112175991	112175991	+	Nonsense_Mutation	SNP	C	C	G			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr5:112175991C>G	ENST00000457016.1	+	16	5080	c.4700C>G	c.(4699-4701)tCa>tGa	p.S1567*	APC_ENST00000257430.4_Nonsense_Mutation_p.S1567*|APC_ENST00000508376.2_Nonsense_Mutation_p.S1567*|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	1567	Asp/Glu-rich (acidic).|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.K1192fs*3(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TTAGATGATTCAGATGATGAT	0.358		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	uc010jby.2		12	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	D|Mis|N|F|S	adenomatous polyposis of the colon gene			"""E, M, O"""		colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS	colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS		2	Unknown(1)|Deletion - Frameshift(1)	p.K1192fs*3(1)|p.?(1)	soft_tissue(1)|skin(1)	large_intestine(2123)|stomach(123)|soft_tissue(55)|small_intestine(34)|breast(26)|pancreas(25)|urinary_tract(20)|lung(19)|thyroid(18)|liver(13)|central_nervous_system(10)|ovary(9)|skin(7)|upper_aerodigestive_tract(6)|adrenal_gland(6)|bone(6)|NS(5)|prostate(4)|endometrium(3)|kidney(1)|oesophagus(1)|biliary_tract(1)	2515	GRCh37	CM920055	APC	M		c.(4699-4701)TCA>TGA		adenomatous polyposis coli							89.0	97.0	94.0					5																	112175991		2202	4300	6502	SO:0001587	stop_gained	324	Hereditary_Desmoid_Disease|Familial_Adenomatous_Polyposis|Turcot_syndrome	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	canonical Wnt receptor signaling pathway|cell adhesion|cell cycle arrest|cell migration|cellular component disassembly involved in apoptosis|cytokinesis after mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|negative regulation of microtubule depolymerization|positive regulation of apoptosis|positive regulation of cell migration|positive regulation of pseudopodium assembly|protein complex assembly|regulation of attachment of spindle microtubules to kinetochore|response to DNA damage stimulus|tight junction assembly	adherens junction|APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|kinetochore|lamellipodium|lateral plasma membrane|nucleus|ruffle membrane|tight junction	beta-catenin binding|gamma-catenin binding|microtubule plus-end binding|protein kinase binding|protein kinase regulator activity	g.chr5:112175991C>G	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4700C>G	5.37:g.112175991C>G	ENSP00000413133:p.Ser1567*	TSP Lung(16;0.13)	Somatic				APC_uc011cvt.1_Nonsense_Mutation_p.S1549*|APC_uc003kpz.3_Nonsense_Mutation_p.S1567*|APC_uc003kpy.3_Nonsense_Mutation_p.S1567*|APC_uc010jbz.2_Nonsense_Mutation_p.S1284*|APC_uc010jca.2_Nonsense_Mutation_p.S867*	p.S1567*	NM_001127511	NP_001120983	WXS	Illumina HiSeq	Unspecified	P25054	APC_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)	16	5080	+		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)	1567			Ser-rich.|Asp/Glu-rich (acidic).		D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	c.4700C>G	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	43	10.060327	0.99327	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.16	6.16	0.99307	.	0.059108	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-14.754	20.8598	0.99761	0.0:1.0:0.0:0.0	.	.	.	.	X	1567	.	.	S	+	2	0	APC	112203890	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.487000	0.81328	2.937000	0.99478	0.650000	0.86243	TCA		0.358	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038		32	16	0	0	0	0	32	16				
KIF3A	11127	broad.mit.edu	37	5	132052070	132052070	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr5:132052070T>C	ENST00000378746.4	-	7	1039	c.821A>G	c.(820-822)aAt>aGt	p.N274S	KIF3A_ENST00000378735.1_Missense_Mutation_p.N274S|KIF3A_ENST00000403231.1_Missense_Mutation_p.N274S|AC004237.1_ENST00000431165.1_RNA	NM_007054.5	NP_008985.3	Q9Y496	KIF3A_HUMAN	kinesin family member 3A	274	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				anterior/posterior pattern specification (GO:0009952)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|dorsal/ventral neural tube patterning (GO:0021904)|epidermal stem cell homeostasis (GO:0036334)|epidermis development (GO:0008544)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|inner ear receptor stereocilium organization (GO:0060122)|kidney development (GO:0001822)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|organelle organization (GO:0006996)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of receptor-mediated endocytosis (GO:0048260)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|neuron projection (GO:0043005)|photoreceptor connecting cilium (GO:0032391)|primary cilium (GO:0072372)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|spectrin binding (GO:0030507)			endometrium(1)|kidney(4)|large_intestine(8)|lung(3)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	25		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AAGTGAAAGATTGATTTTTGT	0.398																																						uc003kxo.2		NA																	0				pancreas(1)	1						c.(820-822)AAT>AGT		kinesin family member 3A							122.0	118.0	120.0					5																	132052070		2203	4300	6503	SO:0001583	missense	11127				blood coagulation|organelle organization|plus-end-directed vesicle transport along microtubule	centrosome|cytosol|kinesin II complex|spindle microtubule	ATP binding|plus-end-directed microtubule motor activity|protein binding	g.chr5:132052070T>C	AF041853	CCDS34235.1, CCDS75295.1, CCDS75296.1	5q31	2012-08-01			ENSG00000131437	ENSG00000131437		"""Kinesins"""	6319	protein-coding gene	gene with protein product	"""kinesin family protein 3A"""	604683				1054846	Standard	XM_005271868		Approved	FLA10, KLP-20	uc003kxo.3	Q9Y496	OTTHUMG00000059725	ENST00000378746.4:c.821A>G	5.37:g.132052070T>C	ENSP00000368020:p.Asn274Ser		Somatic				KIF3A_uc003kxn.2_Missense_Mutation_p.N233S|KIF3A_uc011cxf.1_Missense_Mutation_p.N274S|KIF3A_uc003kxp.2_Missense_Mutation_p.N274S	p.N274S	NM_007054	NP_008985	WXS	Illumina HiSeq	Unspecified	Q9Y496	KIF3A_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		7	975	-		all_cancers(142;0.0751)|Breast(839;0.198)	274			Kinesin-motor.		A8MSW9|Q59EN1|Q86XE9|Q9Y6V4	Missense_Mutation	SNP	ENST00000378746.4	37	c.821A>G	CCDS34235.1	.	.	.	.	.	.	.	.	.	.	T	27.9	4.870656	0.91587	.	.	ENSG00000131437	ENST00000378746;ENST00000378735;ENST00000541316;ENST00000403231;ENST00000450914	D;D;D	0.84223	-1.82;-1.82;-1.82	5.58	5.58	0.84498	Kinesin, motor domain (4);	0.082697	0.85682	D	0.000000	D	0.95633	0.8580	H	0.98388	4.22	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.998;1.0	D	0.97465	1.0037	10	0.87932	D	0	.	16.0556	0.80801	0.0:0.0:0.0:1.0	.	274;274;274;274	E9PES4;B4DHG8;Q9Y496;Q2UVF2	.;.;KIF3A_HUMAN;.	S	274;274;274;274;244	ENSP00000368020:N274S;ENSP00000368009:N274S;ENSP00000385808:N274S	ENSP00000368009:N274S	N	-	2	0	KIF3A	132079969	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.997000	0.88414	2.239000	0.73571	0.533000	0.62120	AAT		0.398	KIF3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132788.3	NM_007054		3	80	0	0	0	0	3	80				
SLC23A1	9963	broad.mit.edu	37	5	138707837	138707837	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr5:138707837A>G	ENST00000348729.3	-	14	1701	c.1655T>C	c.(1654-1656)aTa>aCa	p.I552T	CTB-43P18.1_ENST00000503553.3_RNA|SLC23A1_ENST00000353963.3_Missense_Mutation_p.I556T	NM_005847.4	NP_005838	Q9UHI7	S23A1_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 1	552					brain development (GO:0007420)|dehydroascorbic acid transport (GO:0070837)|L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|lung development (GO:0030324)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|brush border (GO:0005903)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular organelle (GO:0043229)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dehydroascorbic acid transporter activity (GO:0033300)|L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium ion transmembrane transporter activity (GO:0015081)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)			biliary_tract(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(5)|ovary(1)	19			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		Vitamin C(DB00126)	TCTTTTTACTATGCCCATCCC	0.443																																						uc003leh.2		NA																	0					0						c.(1654-1656)ATA>ACA		solute carrier family 23 (nucleobase	Vitamin C(DB00126)						115.0	116.0	115.0					5																	138707837		2203	4300	6503	SO:0001583	missense	9963				brain development|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|response to toxin|transepithelial L-ascorbic acid transport|water-soluble vitamin metabolic process	apical plasma membrane|cytoplasm|integral to plasma membrane|intracellular organelle|membrane fraction	dehydroascorbic acid transporter activity|L-ascorbate:sodium symporter activity|nucleobase transmembrane transporter activity|protein binding|sodium-dependent L-ascorbate transmembrane transporter activity	g.chr5:138707837A>G	AF058317	CCDS4212.1, CCDS4213.1	5q31.2	2013-07-18	2013-07-18	2003-03-21	ENSG00000170482	ENSG00000170482		"""Solute carriers"""	10974	protein-coding gene	gene with protein product		603790	"""solute carrier family 23 (nucleobase transporters), member 2"""	SLC23A2		9804989, 10331392	Standard	NM_005847		Approved	YSPL3, SVCT1	uc003leg.3	Q9UHI7	OTTHUMG00000129228	ENST00000348729.3:c.1655T>C	5.37:g.138707837A>G	ENSP00000302701:p.Ile552Thr		Somatic				SLC23A1_uc003leg.2_Missense_Mutation_p.I556T	p.I552T	NM_005847	NP_005838	WXS	Illumina HiSeq	Unspecified	Q9UHI7	S23A1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		14	1752	-			552					O95191|Q8WWB6|Q9UGH4|Q9UI39	Missense_Mutation	SNP	ENST00000348729.3	37	c.1655T>C	CCDS4212.1	.	.	.	.	.	.	.	.	.	.	A	1.355	-0.590406	0.03799	.	.	ENSG00000170482	ENST00000353963;ENST00000348729;ENST00000339881	T;T	0.17528	2.27;2.27	6.02	-0.641	0.11490	.	0.958902	0.08831	N	0.887395	T	0.07458	0.0188	N	0.10916	0.065	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.43442	-0.9391	10	0.14252	T	0.57	0.4143	6.1281	0.20189	0.4868:0.0:0.3897:0.1235	.	552;556	Q9UHI7;Q9UHI7-2	S23A1_HUMAN;.	T	556;552;213	ENSP00000302851:I556T;ENSP00000302701:I552T	ENSP00000343584:I213T	I	-	2	0	SLC23A1	138735736	0.000000	0.05858	0.003000	0.11579	0.362000	0.29581	-0.135000	0.10420	-0.055000	0.13244	-0.262000	0.10625	ATA		0.443	SLC23A1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000374185.1	NM_152685		43	47	0	0	0	0	43	47				
PCDHB11	56125	broad.mit.edu	37	5	140580820	140580820	+	Silent	SNP	C	C	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr5:140580820C>A	ENST00000354757.3	+	1	1473	c.1473C>A	c.(1471-1473)ctC>ctA	p.L491L	PCDHB11_ENST00000536699.1_Silent_p.L126L	NM_018931.2	NP_061754.1	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11	491	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACTCGCTACTCCCGCCCCAGG	0.642																																						uc003liy.2		NA																	0				skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6						c.(1471-1473)CTC>CTA		protocadherin beta 11 precursor							135.0	137.0	137.0					5																	140580820		2203	4300	6503	SO:0001819	synonymous_variant	56125				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140580820C>A	AF152490	CCDS4253.1	5q31	2010-01-26			ENSG00000197479	ENSG00000197479		"""Cadherins / Protocadherins : Clustered"""	8682	other	protocadherin	"""cadherin ME2"""	606337				10380929	Standard	NM_018931		Approved	PCDH-BETA11, ME2	uc003liy.3	Q9Y5F2	OTTHUMG00000129618	ENST00000354757.3:c.1473C>A	5.37:g.140580820C>A			Somatic				PCDHB11_uc011daj.1_Silent_p.L126L	p.L491L	NM_018931	NP_061754	WXS	Illumina HiSeq	Unspecified	Q9Y5F2	PCDBB_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1473	+			491			Extracellular (Potential).|Cadherin 5.		B4DSF7|Q2M223	Silent	SNP	ENST00000354757.3	37	c.1473C>A	CCDS4253.1																																																																																				0.642	PCDHB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251813.1	NM_018931		85	117	1	0	1.32e-40	1.79e-40	85	117				
PCDHGA7	56108	broad.mit.edu	37	5	140763371	140763371	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr5:140763371C>A	ENST00000518325.1	+	1	905	c.905C>A	c.(904-906)tCa>tAa	p.S302*	PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018920.2	NP_061743.1	Q9Y5G6	PCDG7_HUMAN	protocadherin gamma subfamily A, 7	302	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(1)|endometrium(8)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|skin(1)|stomach(3)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAGAAATATCAACTTTAGAA	0.403																																						uc003lka.1		NA																	0					0						c.(904-906)TCA>TAA		protocadherin gamma subfamily A, 7 isoform 1							64.0	63.0	63.0					5																	140763371		1851	4101	5952	SO:0001587	stop_gained	56108				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140763371C>A	AF152514	CCDS54927.1, CCDS75336.1	5q31	2010-01-26				ENSG00000253537		"""Cadherins / Protocadherins : Clustered"""	8705	other	protocadherin		606294				10380929	Standard	NM_018920		Approved	PCDH-GAMMA-A7		Q9Y5G6		ENST00000518325.1:c.905C>A	5.37:g.140763371C>A	ENSP00000430024:p.Ser302*		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003ljz.1_Nonsense_Mutation_p.S302*	p.S302*	NM_018920	NP_061743	WXS	Illumina HiSeq	Unspecified	Q9Y5G6	PCDG7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	905	+			302			Cadherin 3.|Extracellular (Potential).		B2RN87|Q9Y5D0	Nonsense_Mutation	SNP	ENST00000518325.1	37	c.905C>A	CCDS54927.1	.	.	.	.	.	.	.	.	.	.	.	21.7	4.182414	0.78677	.	.	ENSG00000253537	ENST00000518325	.	.	.	5.15	4.26	0.50523	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	.	7.0069	0.24842	0.1539:0.7057:0.0:0.1404	.	.	.	.	X	302	.	ENSP00000430024:S302X	S	+	2	0	PCDHGA7	140743555	0.000000	0.05858	0.969000	0.41365	0.970000	0.65996	-0.034000	0.12225	2.546000	0.85860	0.655000	0.94253	TCA		0.403	PCDHGA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374744.1	NM_018920		19	36	1	0	7.08e-05	8.41e-05	19	36				
FAM8A1	51439	broad.mit.edu	37	6	17600920	17600920	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr6:17600920G>A	ENST00000259963.3	+	1	335	c.280G>A	c.(280-282)Gag>Aag	p.E94K		NM_016255.2	NP_057339.1	Q9UBU6	FA8A1_HUMAN	family with sequence similarity 8, member A1	94						integral component of membrane (GO:0016021)		p.E94K(1)|p.E94Q(1)		endometrium(1)|large_intestine(2)|lung(3)	6	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.143)	all cancers(50;0.176)|Epithelial(50;0.204)			GGCGGGCTGCGAGGCGCCCGA	0.731																																						uc003ncc.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(280-282)GAG>AAG		family with sequence similarity 8, member A1							8.0	9.0	9.0					6																	17600920		1943	3891	5834	SO:0001583	missense	51439					integral to membrane		g.chr6:17600920G>A	AF097027	CCDS4540.1	6p23	2010-11-22			ENSG00000137414	ENSG00000137414			16372	protein-coding gene	gene with protein product						11707071	Standard	NM_016255		Approved	AHCP	uc003ncc.3	Q9UBU6	OTTHUMG00000014309	ENST00000259963.3:c.280G>A	6.37:g.17600920G>A	ENSP00000259963:p.Glu94Lys		Somatic					p.E94K	NM_016255	NP_057339	WXS	Illumina HiSeq	Unspecified	Q9UBU6	FA8A1_HUMAN	all cancers(50;0.176)|Epithelial(50;0.204)		1	403	+	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.143)	94					B2R725	Missense_Mutation	SNP	ENST00000259963.3	37	c.280G>A	CCDS4540.1	.	.	.	.	.	.	.	.	.	.	G	16.95	3.264359	0.59431	.	.	ENSG00000137414	ENST00000259963	.	.	.	3.27	3.27	0.37495	.	0.665957	0.13296	N	0.398619	T	0.07503	0.0189	L	0.27053	0.805	0.25404	N	0.988415	P	0.36438	0.553	B	0.20384	0.029	T	0.09228	-1.0684	9	0.21540	T	0.41	-4.5181	8.4962	0.33130	0.0:0.0:0.7685:0.2315	.	94	Q9UBU6	FA8A1_HUMAN	K	94	.	ENSP00000259963:E94K	E	+	1	0	FAM8A1	17708899	0.989000	0.36119	0.299000	0.25016	0.280000	0.26924	3.423000	0.52756	1.751000	0.51876	0.484000	0.47621	GAG		0.731	FAM8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039950.1			18	11	0	0	0	0	18	11				
BTN3A3	10384	broad.mit.edu	37	6	26452390	26452390	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr6:26452390G>T	ENST00000244519.2	+	11	1749	c.1506G>T	c.(1504-1506)ttG>ttT	p.L502F	BTN3A3_ENST00000361232.3_Missense_Mutation_p.L453F|BTN3A3_ENST00000339789.4_Missense_Mutation_p.L460F	NM_006994.4	NP_008925.1	O00478	BT3A3_HUMAN	butyrophilin, subfamily 3, member A3	502	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				T cell mediated immunity (GO:0002456)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	30						TCAGAATTTTGACCTTGGAGC	0.488																																						uc003nhz.2		NA																	0					0						c.(1504-1506)TTG>TTT		butyrophilin, subfamily 3, member A3 isoform a							96.0	93.0	94.0					6																	26452390		2203	4300	6503	SO:0001583	missense	10384					integral to membrane		g.chr6:26452390G>T	U90548	CCDS4611.1, CCDS4612.1, CCDS4612.2	6p22.1	2014-01-14			ENSG00000111801	ENSG00000111801		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	1140	protein-coding gene	gene with protein product		613595				10354554, 9149941	Standard	NM_006994		Approved	BTF3, BTN3.3	uc003nhz.3	O00478	OTTHUMG00000014451	ENST00000244519.2:c.1506G>T	6.37:g.26452390G>T	ENSP00000244519:p.Leu502Phe		Somatic				BTN3A3_uc003nia.2_Missense_Mutation_p.L460F|BTN3A3_uc011dkn.1_Missense_Mutation_p.L453F	p.L502F	NM_006994	NP_008925	WXS	Illumina HiSeq	Unspecified	O00478	BT3A3_HUMAN			11	1686	+			502			B30.2/SPRY.|Cytoplasmic (Potential).		B4DWI7|E9PCP5	Missense_Mutation	SNP	ENST00000244519.2	37	c.1506G>T	CCDS4611.1	.	.	.	.	.	.	.	.	.	.	G	12.01	1.810256	0.32053	.	.	ENSG00000111801	ENST00000244519;ENST00000339789;ENST00000361232	T;T;T	0.61627	0.09;0.09;0.09	3.15	1.16	0.20824	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);	.	.	.	.	T	0.25865	0.0630	N	0.16233	0.39	0.09310	N	1	D;P	0.58970	0.984;0.947	P;P	0.55871	0.786;0.593	T	0.13629	-1.0502	9	0.10111	T	0.7	.	5.8737	0.18816	0.0:0.2141:0.566:0.22	.	453;502	E9PCP5;O00478	.;BT3A3_HUMAN	F	502;460;453	ENSP00000244519:L502F;ENSP00000344968:L460F;ENSP00000355238:L453F	ENSP00000244519:L502F	L	+	3	2	BTN3A3	26560369	0.000000	0.05858	0.000000	0.03702	0.786000	0.44442	0.174000	0.16743	0.094000	0.17404	0.455000	0.32223	TTG		0.488	BTN3A3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040116.2	NM_006994		43	123	1	0	7.53e-24	1e-23	43	123				
TRIM27	5987	broad.mit.edu	37	6	28871930	28871930	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr6:28871930G>C	ENST00000377199.3	-	8	1815	c.1459C>G	c.(1459-1461)Ctg>Gtg	p.L487V	TRIM27_ENST00000377194.3_3'UTR	NM_006510.4	NP_006501.1	P14373	TRI27_HUMAN	tripartite motif containing 27	487	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				Arp2/3 complex-mediated actin nucleation (GO:0034314)|cell proliferation (GO:0008283)|innate immune response (GO:0045087)|interferon-gamma secretion (GO:0072643)|negative regulation of adaptive immune response (GO:0002820)|negative regulation of calcium ion import (GO:0090281)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of interleukin-2 secretion (GO:1900041)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein K63-linked ubiquitination (GO:0070534)|protein trimerization (GO:0070206)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(6)|ovary(1)	10						CAGATGATCAGAGGAGCTGCA	0.527			T	RET	papillary thyroid																																	uc003nlr.2		NA		Dom	yes		6	6p22	5987	T	tripartite motif-containing 27			E	RET		papillary thyroid		0				ovary(1)	1						c.(1459-1461)CTG>GTG		ret finger protein							113.0	123.0	120.0					6																	28871930		1509	2709	4218	SO:0001583	missense	5987				cell proliferation|negative regulation of gene expression, epigenetic|negative regulation of transcription from RNA polymerase II promoter|protein trimerization|spermatogenesis|transcription, DNA-dependent	cytoplasm|integral to plasma membrane|membrane fraction|nuclear membrane|PML body	DNA binding|protein binding|transmembrane receptor protein tyrosine kinase activity|zinc ion binding	g.chr6:28871930G>C	Z58939	CCDS4654.1	6p22	2013-01-09	2011-01-25	2006-09-26	ENSG00000204713	ENSG00000204713		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9975	protein-coding gene	gene with protein product		602165	"""ret finger protein"", ""tripartite motif-containing 27"""	RFP		8114113	Standard	NM_006510		Approved	RNF76	uc003nlr.3	P14373	OTTHUMG00000031215	ENST00000377199.3:c.1459C>G	6.37:g.28871930G>C	ENSP00000366404:p.Leu487Val		Somatic				TRIM27_uc003nls.2_3'UTR|TRIM27_uc003nlt.1_3'UTR	p.L487V	NM_006510	NP_006501	WXS	Illumina HiSeq	Unspecified	P14373	TRI27_HUMAN			8	1818	-			487			B30.2/SPRY.		A2BE15|Q5RJA8|Q5ST26|Q6LA73|Q6NXR9|Q9BZY6|Q9UJL3	Missense_Mutation	SNP	ENST00000377199.3	37	c.1459C>G	CCDS4654.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.06|18.06	3.538223|3.538223	0.65085|0.65085	.|.	.|.	ENSG00000204713|ENSG00000204713	ENST00000377199|ENST00000414543	T|.	0.69926|.	-0.44|.	4.89|4.89	4.01|4.01	0.46588|0.46588	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);|.	0.000000|.	0.42964|.	D|.	0.000622|.	T|T	0.52661|0.52661	0.1748|0.1748	M|M	0.64997|0.64997	1.995|1.995	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	T|T	0.54390|0.54390	-0.8301|-0.8301	10|5	0.72032|.	D|.	0.01|.	.|.	11.3953|11.3953	0.49838|0.49838	0.091:0.0:0.909:0.0|0.091:0.0:0.909:0.0	.|.	487|.	P14373|.	TRI27_HUMAN|.	V|C	487|221	ENSP00000366404:L487V|.	ENSP00000366404:L487V|.	L|S	-|-	1|2	2|0	TRIM27|TRIM27	28979909|28979909	0.099000|0.099000	0.21834|0.21834	0.862000|0.862000	0.33874|0.33874	0.935000|0.935000	0.57460|0.57460	0.650000|0.650000	0.24858|0.24858	1.359000|1.359000	0.45940|0.45940	0.655000|0.655000	0.94253|0.94253	CTG|TCT		0.527	TRIM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076442.2	NM_030950		57	63	0	0	0	0	57	63				
TRIM40	135644	broad.mit.edu	37	6	30105123	30105123	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr6:30105123G>A	ENST00000396581.1	+	2	696	c.310G>A	c.(310-312)Gaa>Aaa	p.E104K	TRIM40_ENST00000307859.4_Missense_Mutation_p.E104K|TRIM40_ENST00000376724.2_Missense_Mutation_p.E104K			Q6P9F5	TRI40_HUMAN	tripartite motif containing 40	104					negative regulation of cell growth (GO:0030308)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein localization to nucleus (GO:1900181)|protein neddylation (GO:0045116)	IkappaB kinase complex (GO:0008385)	zinc ion binding (GO:0008270)			ovary(1)	1						GTCTCATCATGAACTGACCAT	0.552																																						uc003npk.2		NA																	0				ovary(1)	1						c.(310-312)GAA>AAA		tripartite motif-containing 40							165.0	138.0	148.0					6																	30105123		1509	2709	4218	SO:0001583	missense	135644					intracellular	zinc ion binding	g.chr6:30105123G>A	AF489517	CCDS4675.1, CCDS69069.1	6p21.31	2013-01-09	2011-01-25		ENSG00000204614	ENSG00000204614		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	18736	protein-coding gene	gene with protein product			"""tripartite motif-containing 40"""				Standard	NM_138700		Approved	RNF35	uc003npm.2	Q6P9F5	OTTHUMG00000031083	ENST00000396581.1:c.310G>A	6.37:g.30105123G>A	ENSP00000379826:p.Glu104Lys		Somatic				TRIM40_uc003npl.1_RNA|TRIM40_uc003npm.2_Missense_Mutation_p.E104K	p.E104K	NM_138700	NP_619645	WXS	Illumina HiSeq	Unspecified	Q6P9F5	TRI40_HUMAN			2	696	+			104			B box-type.		Q5SRJ6|Q5SS36|Q8TD96	Missense_Mutation	SNP	ENST00000396581.1	37	c.310G>A		.	.	.	.	.	.	.	.	.	.	G	14.98	2.696516	0.48202	.	.	ENSG00000204614	ENST00000396581;ENST00000376724;ENST00000307859	T;T;T	0.56275	0.47;0.47;0.47	4.71	2.9	0.33743	Zinc finger, B-box (1);	0.292675	0.24396	N	0.038884	T	0.36635	0.0974	M	0.73962	2.25	0.09310	N	1	P;P	0.46395	0.651;0.877	B;P	0.45829	0.273;0.494	T	0.24835	-1.0149	10	0.52906	T	0.07	.	6.1907	0.20522	0.1017:0.1892:0.7091:0.0	.	104;104	Q5SRJ6;Q6P9F5	.;TRI40_HUMAN	K	104	ENSP00000379826:E104K;ENSP00000365914:E104K;ENSP00000308310:E104K	ENSP00000308310:E104K	E	+	1	0	TRIM40	30213102	0.098000	0.21812	0.001000	0.08648	0.655000	0.38815	2.232000	0.43018	0.569000	0.29329	0.573000	0.79308	GAA		0.552	TRIM40-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000076117.2			61	76	0	0	0	0	61	76				
PRR3	80742	broad.mit.edu	37	6	30530165	30530165	+	Splice_Site	SNP	G	G	T	rs79542230		TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr6:30530165G>T	ENST00000376560.3	+	4	919		c.e4-1		PRR3_ENST00000498336.1_Splice_Site|PRR3_ENST00000376557.3_Splice_Site	NM_025263.3	NP_079539.2	P79522	PRR3_HUMAN	proline rich 3								metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			lung(1)|ovary(1)	2						CTTGTTCACAGACAAATCCGA	0.453																																						uc003nqi.1		NA																	0					0						c.e4-1		proline-rich protein 3 isoform a							177.0	175.0	175.0					6																	30530165		1947	4173	6120	SO:0001630	splice_region_variant	80742						nucleic acid binding|zinc ion binding	g.chr6:30530165G>T	AK074531	CCDS43440.1, CCDS43441.1	6p21.32	2013-01-18	2004-05-27		ENSG00000204576	ENSG00000204576		"""Zinc fingers, CCCH-type domain containing"""	21149	protein-coding gene	gene with protein product			"""proline-rich polpeptide 3"""				Standard	NM_025263		Approved	CAT56, Em:AB014077.1, Em:AB023052.2	uc003nqi.2	P79522	OTTHUMG00000031037	ENST00000376560.3:c.461-1G>T	6.37:g.30530165G>T			Somatic				PRR3_uc003nqj.1_Splice_Site_p.D133_splice	p.D154_splice	NM_025263	NP_079539	WXS	Illumina HiSeq	Unspecified	P79522	PRR3_HUMAN			4	827	+								A1A4H4|Q5RJB5|Q5STN6	Splice_Site	SNP	ENST00000376560.3	37	c.461_splice	CCDS43440.1	.	.	.	.	.	.	.	.	.	.	G	17.49	3.402478	0.62288	.	.	ENSG00000204576	ENST00000376560;ENST00000376555;ENST00000376557	.	.	.	5.06	5.06	0.68205	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4428	0.75200	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PRR3	30638144	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.385000	0.73182	2.627000	0.88993	0.591000	0.81541	.		0.453	PRR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076033.2	NM_025263	Intron	77	199	1	0	7.63e-38	1.03e-37	77	199				
DHX16	8449	broad.mit.edu	37	6	30624230	30624230	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr6:30624230G>T	ENST00000376442.3	-	15	2563	c.2368C>A	c.(2368-2370)Ctg>Atg	p.L790M	DHX16_ENST00000376437.5_Missense_Mutation_p.L309M	NM_001164239.1|NM_003587.4	NP_001157711.1|NP_003578.2	O60231	DHX16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 16	790					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			kidney(2)|ovary(2)	4						AAAGCCAGCAGCAGTGTCTCA	0.547																																						uc003nqz.2		NA																	0				ovary(2)|kidney(2)	4						c.(2368-2370)CTG>ATG		DEAH (Asp-Glu-Ala-His) box polypeptide 16							91.0	88.0	89.0					6																	30624230		2203	4300	6503	SO:0001583	missense	8449				mRNA processing|RNA splicing	nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|RNA helicase activity	g.chr6:30624230G>T	AB001601	CCDS4685.1	6p21.3	2010-02-17	2003-06-13	2003-06-20	ENSG00000204560	ENSG00000204560		"""DEAH-boxes"""	2739	protein-coding gene	gene with protein product		603405	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 16"""	DDX16		9547260	Standard	NM_003587		Approved	DBP2, Prp2, PRPF2	uc003nqz.3	O60231	OTTHUMG00000031060	ENST00000376442.3:c.2368C>A	6.37:g.30624230G>T	ENSP00000365625:p.Leu790Met		Somatic				DHX16_uc003nqy.2_Missense_Mutation_p.L309M|DHX16_uc011dmo.1_Missense_Mutation_p.L730M	p.L790M	NM_003587	NP_003578	WXS	Illumina HiSeq	Unspecified	O60231	DHX16_HUMAN			15	2580	-			790					O60322|Q5JP45|Q969X7|Q96QC1	Missense_Mutation	SNP	ENST00000376442.3	37	c.2368C>A	CCDS4685.1	.	.	.	.	.	.	.	.	.	.	G	13.36	2.215183	0.39102	.	.	ENSG00000204560	ENST00000376442;ENST00000376437	T;T	0.03094	4.05;4.05	5.06	5.06	0.68205	.	0.074752	0.52532	D	0.000069	T	0.00754	0.0025	N	0.02802	-0.49	0.46542	D	0.999097	B;B;B	0.17268	0.021;0.021;0.005	B;B;B	0.16722	0.012;0.016;0.005	T	0.55560	-0.8122	10	0.16896	T	0.51	.	12.0926	0.53736	0.0:0.2847:0.7153:0.0	.	730;790;309	B4DZ28;O60231;Q5SQH5	.;DHX16_HUMAN;.	M	790;309	ENSP00000365625:L790M;ENSP00000365620:L309M	ENSP00000365620:L309M	L	-	1	2	DHX16	30732209	0.905000	0.30787	1.000000	0.80357	0.949000	0.60115	0.752000	0.26362	2.635000	0.89317	0.561000	0.74099	CTG		0.547	DHX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076076.2	NM_003587		11	51	1	0	0.000673444	0.000779777	11	51				
HTR1B	3351	broad.mit.edu	37	6	78172918	78172918	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr6:78172918G>A	ENST00000369947.2	-	1	572	c.203C>T	c.(202-204)gCc>gTc	p.A68V		NM_000863.1	NP_000854.1	P28222	5HT1B_HUMAN	5-hydroxytryptamine (serotonin) receptor 1B, G protein-coupled	68					adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|bone remodeling (GO:0046849)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to temperature stimulus (GO:0071502)|drinking behavior (GO:0042756)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to mineralocorticoid (GO:0051385)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|prostate(2)|upper_aerodigestive_tract(2)	25		all_cancers(76;0.0867)|Acute lymphoblastic leukemia(125;0.00119)|all_hematologic(105;0.0332)		BRCA - Breast invasive adenocarcinoma(397;0.205)	Almotriptan(DB00918)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Clozapine(DB00363)|Dihydroergotamine(DB00320)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Frovatriptan(DB00998)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Methysergide(DB00247)|Naratriptan(DB00952)|Olanzapine(DB00334)|Ondansetron(DB00904)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Rizatriptan(DB00953)|Ropinirole(DB00268)|Sumatriptan(DB00669)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	AATCACAAAGGCATTGGAGAG	0.562																																						uc003pil.1		NA																	0					0						c.(202-204)GCC>GTC		5-hydroxytryptamine (serotonin) receptor 1B	Almotriptan(DB00918)|Dexfenfluramine(DB01191)|Dihydroergotamine(DB00320)|Eletriptan(DB00216)|Ergotamine(DB00696)|Frovatriptan(DB00998)|Naratriptan(DB00952)|Pindolol(DB00960)|Propranolol(DB00571)|Rizatriptan(DB00953)|Sumatriptan(DB00669)|Venlafaxine(DB00285)|Zolmitriptan(DB00315)						245.0	219.0	228.0					6																	78172918		2203	4300	6503	SO:0001583	missense	3351				G-protein signaling, coupled to cyclic nucleotide second messenger|negative regulation of cAMP biosynthetic process|synaptic transmission	integral to plasma membrane	protein binding|serotonin receptor activity	g.chr6:78172918G>A	BC069065	CCDS4986.1	6q13	2012-08-08	2012-02-03		ENSG00000135312	ENSG00000135312		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5287	protein-coding gene	gene with protein product		182131	"""5-hydroxytryptamine (serotonin) receptor 1B"""			1348246, 11247661	Standard	NM_000863		Approved	S12, 5-HT1B, HTR1D2, 5-HT1DB	uc003pil.1	P28222	OTTHUMG00000015066	ENST00000369947.2:c.203C>T	6.37:g.78172918G>A	ENSP00000358963:p.Ala68Val		Somatic					p.A68V	NM_000863	NP_000854	WXS	Illumina HiSeq	Unspecified	P28222	5HT1B_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.205)	1	203	-		all_cancers(76;0.0867)|Acute lymphoblastic leukemia(125;0.00119)|all_hematologic(105;0.0332)	68			Helical; Name=1; (By similarity).		Q4VAY7	Missense_Mutation	SNP	ENST00000369947.2	37	c.203C>T	CCDS4986.1	.	.	.	.	.	.	.	.	.	.	G	17.93	3.509010	0.64410	.	.	ENSG00000135312	ENST00000369947	T	0.00388	7.59	4.85	4.85	0.62838	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.00073	0.0002	N	0.05414	-0.055	0.80722	D	1	B	0.27951	0.195	B	0.31390	0.129	T	0.71998	-0.4423	9	.	.	.	.	17.1254	0.86712	0.0:0.0:1.0:0.0	.	68	P28222	5HT1B_HUMAN	V	68	ENSP00000358963:A68V	.	A	-	2	0	HTR1B	78229637	1.000000	0.71417	0.974000	0.42286	0.982000	0.71751	9.548000	0.98103	2.522000	0.85027	0.561000	0.74099	GCC		0.562	HTR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041292.1	NM_000863		74	121	0	0	0	0	74	121				
SLC35F1	222553	broad.mit.edu	37	6	118556746	118556746	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr6:118556746G>T	ENST00000360388.4	+	3	625	c.424G>T	c.(424-426)Gca>Tca	p.A142S		NM_001029858.3	NP_001025029.2	Q5T1Q4	S35F1_HUMAN	solute carrier family 35, member F1	142					transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(3)|kidney(1)|large_intestine(7)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(226;0.217)		AGACCTGGAAGCAAATTATCT	0.423																																						uc003pxx.3		NA																	0				breast(1)	1						c.(424-426)GCA>TCA		solute carrier family 35, member F1							164.0	147.0	153.0					6																	118556746		2203	4300	6503	SO:0001583	missense	222553				transport	integral to membrane		g.chr6:118556746G>T	BC028615	CCDS34524.1	6q22.31	2013-05-22			ENSG00000196376	ENSG00000196376		"""Solute carriers"""	21483	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 169"""	C6orf169			Standard	NM_001029858		Approved	dJ230I3.1	uc003pxx.4	Q5T1Q4	OTTHUMG00000015460	ENST00000360388.4:c.424G>T	6.37:g.118556746G>T	ENSP00000353557:p.Ala142Ser		Somatic					p.A142S	NM_001029858	NP_001025029	WXS	Illumina HiSeq	Unspecified	Q5T1Q4	S35F1_HUMAN		GBM - Glioblastoma multiforme(226;0.217)	3	625	+			142			Helical; (Potential).		E1P564|Q1RMG1|Q4G0U9|Q4G167|Q6N007	Missense_Mutation	SNP	ENST00000360388.4	37	c.424G>T	CCDS34524.1	.	.	.	.	.	.	.	.	.	.	G	19.91	3.915059	0.73098	.	.	ENSG00000196376	ENST00000360388	T	0.70282	-0.47	5.76	5.76	0.90799	.	0.256670	0.37715	N	0.001975	T	0.80412	0.4618	M	0.84683	2.71	0.80722	D	1	B	0.22276	0.067	B	0.43990	0.438	T	0.77584	-0.2533	10	0.59425	D	0.04	.	20.326	0.98701	0.0:0.0:1.0:0.0	.	142	Q5T1Q4	S35F1_HUMAN	S	142	ENSP00000353557:A142S	ENSP00000353557:A142S	A	+	1	0	SLC35F1	118663439	1.000000	0.71417	1.000000	0.80357	0.070000	0.16714	9.338000	0.96553	2.885000	0.99019	0.643000	0.83706	GCA		0.423	SLC35F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041991.2	XM_167044		23	37	1	0	1.28e-07	1.58e-07	23	37				
TCF21	6943	broad.mit.edu	37	6	134210616	134210616	+	Silent	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr6:134210616G>A	ENST00000367882.4	+	1	341	c.81G>A	c.(79-81)tcG>tcA	p.S27S	TCF21_ENST00000237316.3_Silent_p.S27S|RP3-323P13.2_ENST00000607033.1_RNA|RP3-323P13.2_ENST00000606544.1_RNA|RP3-323P13.2_ENST00000607573.1_RNA|RP3-323P13.2_ENST00000607641.1_RNA	NM_003206.3	NP_003197.2	O43680	TCF21_HUMAN	transcription factor 21	27					branching involved in ureteric bud morphogenesis (GO:0001658)|branchiomeric skeletal muscle development (GO:0014707)|bronchiole development (GO:0060435)|diaphragm development (GO:0060539)|embryonic digestive tract morphogenesis (GO:0048557)|epithelial cell differentiation (GO:0030855)|gland development (GO:0048732)|glomerulus development (GO:0032835)|kidney development (GO:0001822)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|lung vasculature development (GO:0060426)|metanephric glomerular capillary formation (GO:0072277)|metanephric mesenchymal cell differentiation (GO:0072162)|morphogenesis of a branching structure (GO:0001763)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|reproductive structure development (GO:0048608)|respiratory system development (GO:0060541)|Sertoli cell differentiation (GO:0060008)|sex determination (GO:0007530)|spleen development (GO:0048536)|ureteric bud development (GO:0001657)|vasculature development (GO:0001944)	nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			cervix(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	13	Colorectal(23;0.221)|Breast(56;0.247)			GBM - Glioblastoma multiforme(68;0.00518)|OV - Ovarian serous cystadenocarcinoma(155;0.00783)		AAATGGATTCGAACAAGGAAT	0.577																																						uc003qei.3		NA																	0					0						c.(79-81)TCG>TCA		transcription factor 21							84.0	91.0	89.0					6																	134210616		2203	4300	6503	SO:0001819	synonymous_variant	6943				branching involved in ureteric bud morphogenesis|mesoderm development|negative regulation of androgen receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent	nucleus	androgen receptor binding|E-box binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity	g.chr6:134210616G>A	AF047419	CCDS5167.1	6q23.2	2014-09-17			ENSG00000118526	ENSG00000118526		"""Basic helix-loop-helix proteins"""	11632	protein-coding gene	gene with protein product		603306				9507058	Standard	NM_198392		Approved	POD1, bHLHa23	uc003qei.4	O43680	OTTHUMG00000015608	ENST00000367882.4:c.81G>A	6.37:g.134210616G>A			Somatic				uc003qeg.1_5'Flank|TCF21_uc003qej.2_Silent_p.S27S	p.S27S	NM_003206	NP_003197	WXS	Illumina HiSeq	Unspecified	O43680	TCF21_HUMAN		GBM - Glioblastoma multiforme(68;0.00518)|OV - Ovarian serous cystadenocarcinoma(155;0.00783)	1	357	+	Colorectal(23;0.221)|Breast(56;0.247)		27					E1P581|O43545|Q6ICV0|Q9BZ14	Silent	SNP	ENST00000367882.4	37	c.81G>A	CCDS5167.1																																																																																				0.577	TCF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042292.1	NM_198392		44	57	0	0	0	0	44	57				
FBXO30	84085	broad.mit.edu	37	6	146126431	146126431	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr6:146126431C>T	ENST00000237281.4	-	2	1277	c.1111G>A	c.(1111-1113)Gac>Aac	p.D371N		NM_032145.4	NP_115521.3	Q8TB52	FBX30_HUMAN	F-box protein 30	371							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26		Ovarian(120;0.0776)		OV - Ovarian serous cystadenocarcinoma(155;1.95e-07)|GBM - Glioblastoma multiforme(68;0.0149)		TCCCCTAAGTCTACTTTTTTC	0.388																																						uc003qla.2		NA																	0				ovary(2)|large_intestine(1)	3						c.(1111-1113)GAC>AAC		F-box only protein 30							150.0	142.0	145.0					6																	146126431		2203	4300	6503	SO:0001583	missense	84085						ubiquitin-protein ligase activity|zinc ion binding	g.chr6:146126431C>T	AF248640	CCDS5208.1	6q24	2008-02-05	2004-06-15		ENSG00000118496	ENSG00000118496		"""F-boxes /  ""other"""""	15600	protein-coding gene	gene with protein product		609101	"""F-box only protein, helicase, 18"""				Standard	XM_005267159		Approved	MGC21674, Fbx30	uc003qla.3	Q8TB52	OTTHUMG00000015749	ENST00000237281.4:c.1111G>A	6.37:g.146126431C>T	ENSP00000237281:p.Asp371Asn		Somatic				uc003qky.1_Intron	p.D371N	NM_032145	NP_115521	WXS	Illumina HiSeq	Unspecified	Q8TB52	FBX30_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;1.95e-07)|GBM - Glioblastoma multiforme(68;0.0149)	2	1310	-		Ovarian(120;0.0776)	371					Q9BXZ7	Missense_Mutation	SNP	ENST00000237281.4	37	c.1111G>A	CCDS5208.1	.	.	.	.	.	.	.	.	.	.	C	11.62	1.694020	0.30052	.	.	ENSG00000118496	ENST00000237281	T	0.19394	2.15	5.37	5.37	0.77165	.	0.187782	0.56097	D	0.000029	T	0.08313	0.0207	N	0.19112	0.55	0.33198	D	0.551822	B	0.06786	0.001	B	0.04013	0.001	T	0.08391	-1.0724	10	0.36615	T	0.2	-5.0308	19.4488	0.94859	0.0:1.0:0.0:0.0	.	371	Q8TB52	FBX30_HUMAN	N	371	ENSP00000237281:D371N	ENSP00000237281:D371N	D	-	1	0	FBXO30	146168124	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	2.874000	0.48483	2.669000	0.90835	0.655000	0.94253	GAC		0.388	FBXO30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042570.2			53	76	0	0	0	0	53	76				
CARD11	84433	broad.mit.edu	37	7	2962348	2962348	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr7:2962348G>A	ENST00000396946.4	-	17	2592	c.2189C>T	c.(2188-2190)aCa>aTa	p.T730I		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	730	PDZ.				Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)			NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		TTTGGTGCATGTGTCCAACGG	0.622			Mis		DLBCL																																	uc003smv.2		NA		Dom	yes		7	7p22	84433	Mis	"""caspase recruitment domain family, member 11"""			L			DLBCL		0				haematopoietic_and_lymphoid_tissue(43)|ovary(2)|kidney(2)|skin(2)|central_nervous_system(1)	50						c.(2188-2190)ACA>ATA		caspase recruitment domain family, member 11							154.0	101.0	119.0					7																	2962348		2203	4300	6503	SO:0001583	missense	84433				positive regulation of cytokine production|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis|T cell costimulation|T cell receptor signaling pathway	cytosol|membrane raft|plasma membrane	CARD domain binding|guanylate kinase activity	g.chr7:2962348G>A	AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.2189C>T	7.37:g.2962348G>A	ENSP00000380150:p.Thr730Ile		Somatic					p.T730I	NM_032415	NP_115791	WXS	Illumina HiSeq	Unspecified	Q9BXL7	CAR11_HUMAN		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)	17	2593	-		Ovarian(82;0.0115)	730			PDZ.		A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	ENST00000396946.4	37	c.2189C>T	CCDS5336.2	.	.	.	.	.	.	.	.	.	.	G	11.73	1.724819	0.30593	.	.	ENSG00000198286	ENST00000396946;ENST00000355508	T;T	0.52057	0.68;1.63	5.14	4.24	0.50183	PDZ/DHR/GLGF (2);	0.598876	0.17331	N	0.178109	T	0.44808	0.1311	L	0.43923	1.385	0.45541	D	0.998493	B	0.17667	0.023	B	0.24848	0.056	T	0.36504	-0.9745	10	0.52906	T	0.07	-6.3797	15.5213	0.75869	0.0:0.1388:0.8612:0.0	.	730	Q9BXL7	CAR11_HUMAN	I	730;201	ENSP00000380150:T730I;ENSP00000347695:T201I	ENSP00000347695:T201I	T	-	2	0	CARD11	2928874	0.990000	0.36364	0.048000	0.18961	0.959000	0.62525	7.061000	0.76699	1.141000	0.42275	0.555000	0.69702	ACA		0.622	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415		7	48	0	0	0	0	7	48				
RADIL	55698	broad.mit.edu	37	7	4917456	4917456	+	Silent	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr7:4917456C>T	ENST00000399583.3	-	2	502	c.315G>A	c.(313-315)agG>agA	p.R105R	RADIL_ENST00000536091.1_Silent_p.R105R	NM_018059.4	NP_060529.4	Q96JH8	RADIL_HUMAN	Ras association and DIL domains	105	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	microtubule (GO:0005874)				NS(1)|biliary_tract(2)|breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(22)|pancreas(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		GGCCGGCCTGCCTGGGGTCCA	0.682																																						uc003snj.1		NA																	0				lung(2)|central_nervous_system(2)|pancreas(2)|breast(1)	7						c.(313-315)AGG>AGA		Rap GTPase interactor							32.0	38.0	36.0					7																	4917456		2038	4158	6196	SO:0001819	synonymous_variant	55698				cell adhesion|multicellular organismal development|signal transduction		protein binding	g.chr7:4917456C>T	AB058752	CCDS43544.1	7p22.1	2010-08-27			ENSG00000157927	ENSG00000157927			22226	protein-coding gene	gene with protein product		611491				16051602, 17704304	Standard	NM_018059		Approved	FLJ10324, KIAA1849, RASIP2	uc003snj.1	Q96JH8	OTTHUMG00000151753	ENST00000399583.3:c.315G>A	7.37:g.4917456C>T			Somatic				RADIL_uc003sng.1_RNA|RADIL_uc011jwd.1_RNA	p.R105R	NM_018059	NP_060529	WXS	Illumina HiSeq	Unspecified	Q96JH8	RADIL_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)	2	488	-		Ovarian(82;0.0175)	105			Ras-associating.		A4D1Z5|A5YM49|B7ZL20|Q0VFZ9|Q75LH3|Q9BSP5|Q9H0M6|Q9NW43|Q9NWC4	Silent	SNP	ENST00000399583.3	37	c.315G>A	CCDS43544.1																																																																																				0.682	RADIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323769.2	NM_018059		38	74	0	0	0	0	38	74				
FSCN1	6624	broad.mit.edu	37	7	5632776	5632776	+	Missense_Mutation	SNP	T	T	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr7:5632776T>A	ENST00000382361.3	+	1	323	c.209T>A	c.(208-210)cTg>cAg	p.L70Q	FSCN1_ENST00000340250.6_Missense_Mutation_p.L49Q	NM_003088.3	NP_003079.1	Q16658	FSCN1_HUMAN	fascin actin-bundling protein 1	70					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|cell motility (GO:0048870)|cell proliferation (GO:0008283)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|invadopodium (GO:0071437)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|drug binding (GO:0008144)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	9		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;1.21e-13)		GGCCGCTACCTGGCGGCGGAC	0.706																																						uc003sou.2		NA																	0				ovary(1)	1						c.(208-210)CTG>CAG		fascin 1							10.0	11.0	10.0					7																	5632776		2160	4242	6402	SO:0001583	missense	6624				actin filament bundle assembly|cell migration|cell proliferation	cell junction|cytoplasm|filopodium|invadopodium|stress fiber	actin filament binding|drug binding|protein binding, bridging	g.chr7:5632776T>A	U03057	CCDS5342.1	7p22	2014-02-03	2014-02-03	2002-09-20	ENSG00000075618	ENSG00000075618		"""Fascins"""	11148	protein-coding gene	gene with protein product	"""Singed, drosophila, homolog-like"", ""actin bundling protein"""	602689	"""singed (Drosophila)-like (sea urchin fascin homolog like)"", ""fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus)"""	SNL		8068206, 10783262	Standard	NM_003088		Approved	p55, FLJ38511	uc003sou.3	Q16658	OTTHUMG00000090599	ENST00000382361.3:c.209T>A	7.37:g.5632776T>A	ENSP00000371798:p.Leu70Gln		Somatic					p.L70Q	NM_003088	NP_003079	WXS	Illumina HiSeq	Unspecified	Q16658	FSCN1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;1.21e-13)	1	323	+		Ovarian(82;0.0694)	70					A6NI89|B2RE97|Q96IC5|Q96IH1|Q9BRF1	Missense_Mutation	SNP	ENST00000382361.3	37	c.209T>A	CCDS5342.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.427743	0.83667	.	.	ENSG00000075618	ENST00000340250;ENST00000382361	T;T	0.44881	0.91;0.91	3.37	3.37	0.38596	Fascin domain (1);Actin cross-linking (1);	0.170348	0.38217	N	0.001776	T	0.67599	0.2910	M	0.90650	3.135	0.58432	D	0.999999	D	0.89917	1.0	D	0.85130	0.997	T	0.73874	-0.3845	10	0.87932	D	0	-0.0011	10.7706	0.46321	0.0:0.0:0.0:1.0	.	70	Q16658	FSCN1_HUMAN	Q	49;70	ENSP00000339729:L49Q;ENSP00000371798:L70Q	ENSP00000339729:L49Q	L	+	2	0	FSCN1	5599302	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.541000	0.67212	1.413000	0.46997	0.379000	0.24179	CTG		0.706	FSCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207153.3	NM_003088		4	10	0	0	0	0	4	10				
RSPH10B	222967	broad.mit.edu	37	7	5968017	5968017	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr7:5968017C>T	ENST00000405415.1	-	19	2628	c.2242G>A	c.(2242-2244)Gag>Aag	p.E748K	RSPH10B_ENST00000535104.1_5'UTR|RSPH10B_ENST00000441023.2_Missense_Mutation_p.E748K|RSPH10B_ENST00000337579.3_Missense_Mutation_p.E748K|RSPH10B_ENST00000539903.1_3'UTR|RSPH10B_ENST00000404406.1_Missense_Mutation_p.E748K			P0C881	R10B1_HUMAN	radial spoke head 10 homolog B (Chlamydomonas)	748										breast(1)|kidney(1)|lung(4)|ovary(1)|skin(4)	11		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0974)		TTGGGTCTCTCATATTTCTCT	0.443																																						uc003sph.1		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(2242-2244)GAG>AAG		radial spoke head 10 homolog B							156.0	150.0	152.0					7																	5968017		2203	4297	6500	SO:0001583	missense	728194							g.chr7:5968017C>T		CCDS34598.1	7p22.2	2008-07-04			ENSG00000155026	ENSG00000155026			27362	protein-coding gene	gene with protein product						16507594	Standard	NM_173565		Approved		uc003sph.1	P0C881	OTTHUMG00000152378	ENST00000405415.1:c.2242G>A	7.37:g.5968017C>T	ENSP00000385443:p.Glu748Lys		Somatic				RSPH10B2_uc003spg.1_Missense_Mutation_p.E595K|RSPH10B2_uc010ktd.1_Missense_Mutation_p.E748K|RSPH10B2_uc011jwk.1_Missense_Mutation_p.M369I	p.E748K	NM_173565	NP_775836	WXS	Illumina HiSeq	Unspecified	B2RC85	R10B2_HUMAN			20	2513	-			748					A6NMW7|Q86ST9|Q8NE68	Missense_Mutation	SNP	ENST00000405415.1	37	c.2242G>A	CCDS34598.1	.	.	.	.	.	.	.	.	.	.	C	16.39	3.109468	0.56398	.	.	ENSG00000155026	ENST00000405415;ENST00000404406;ENST00000337579;ENST00000354951;ENST00000441023	T;T;T;T	0.57752	0.38;0.38;0.38;0.38	5.08	4.2	0.49525	.	1.920850	0.03257	N	0.182673	T	0.64692	0.2621	M	0.65498	2.005	0.46631	D	0.999136	P;P	0.45348	0.58;0.856	B;P	0.49387	0.196;0.609	T	0.47983	-0.9074	10	0.39692	T	0.17	.	11.0354	0.47797	0.0:0.912:0.0:0.088	.	748;607	P0C881;F5GXE3	R10B1_HUMAN;.	K	748;748;748;607;748	ENSP00000385443:E748K;ENSP00000384097:E748K;ENSP00000338556:E748K;ENSP00000400988:E748K	ENSP00000338556:E748K	E	-	1	0	RSPH10B	5934543	0.789000	0.28775	0.017000	0.16124	0.299000	0.27559	2.700000	0.47085	1.321000	0.45227	0.638000	0.83543	GAG		0.443	RSPH10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325465.2	NM_173565		67	172	0	0	0	0	67	172				
AOAH	313	broad.mit.edu	37	7	36633994	36633994	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr7:36633994C>G	ENST00000258749.5	-	12	1288	c.889G>C	c.(889-891)Gac>Cac	p.D297H	AOAH_ENST00000431169.1_Missense_Mutation_p.D297H|AOAH_ENST00000535891.1_Missense_Mutation_p.D265H|AOAH_ENST00000538464.1_Missense_Mutation_p.D19H	NM_001637.3	NP_001628.1	P28039	AOAH_HUMAN	acyloxyacyl hydrolase (neutrophil)	297					inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|lipopolysaccharide metabolic process (GO:0008653)|negative regulation of inflammatory response (GO:0050728)	extracellular region (GO:0005576)	acyloxyacyl hydrolase activity (GO:0050528)|catalytic activity (GO:0003824)|lipoprotein lipase activity (GO:0004465)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(21)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	41						TGGGGCCAGTCAAGCTCGTTG	0.408																																						uc003tfh.3		NA																	0				skin(1)	1						c.(889-891)GAC>CAC		acyloxyacyl hydrolase precursor							129.0	125.0	127.0					7																	36633994		2203	4300	6503	SO:0001583	missense	313				inflammatory response|lipid metabolic process	extracellular region	acyloxyacyl hydrolase activity|lipoprotein lipase activity	g.chr7:36633994C>G	BC025698	CCDS5448.1, CCDS55102.1, CCDS75584.1	7p14-p12	2014-03-14			ENSG00000136250	ENSG00000136250	3.1.1.77		548	protein-coding gene	gene with protein product		102593				1883828	Standard	NM_001637		Approved		uc022abu.1	P28039	OTTHUMG00000023566	ENST00000258749.5:c.889G>C	7.37:g.36633994C>G	ENSP00000258749:p.Asp297His		Somatic				AOAH_uc010kxf.2_Missense_Mutation_p.D297H|AOAH_uc011kba.1_Missense_Mutation_p.D265H	p.D297H	NM_001637	NP_001628	WXS	Illumina HiSeq	Unspecified	P28039	AOAH_HUMAN			12	1290	-			297					A4D1Y5|B7Z490|Q53F13	Missense_Mutation	SNP	ENST00000258749.5	37	c.889G>C	CCDS5448.1	.	.	.	.	.	.	.	.	.	.	C	11.34	1.610578	0.28712	.	.	ENSG00000136250	ENST00000538464;ENST00000535891;ENST00000258749;ENST00000431169;ENST00000544647	T;D;D	0.85955	1.07;-1.93;-2.05	4.9	-2.97	0.05530	Esterase, SGNH hydrolase-type (1);Lipase, GDSL (1);	0.451659	0.22160	N	0.063789	D	0.89574	0.6754	.	.	.	0.18873	N	0.999985	P;D;D	0.89917	0.78;1.0;0.999	P;D;D	0.79784	0.701;0.993;0.971	D	0.83831	0.0252	9	0.87932	D	0	.	10.1105	0.42559	0.0:0.4864:0.0:0.5136	.	265;297;297	B7Z490;C9J8T1;P28039	.;.;AOAH_HUMAN	H	19;265;297;297;297	ENSP00000441101:D265H;ENSP00000258749:D297H;ENSP00000405683:D297H	ENSP00000258749:D297H	D	-	1	0	AOAH	36600519	0.000000	0.05858	0.124000	0.21820	0.175000	0.22909	-1.628000	0.02031	-0.872000	0.04037	0.557000	0.71058	GAC		0.408	AOAH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219829.2	NM_001637		31	79	0	0	0	0	31	79				
RFC2	5982	broad.mit.edu	37	7	73649972	73649972	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr7:73649972G>A	ENST00000055077.3	-	10	904	c.844C>T	c.(844-846)Ctt>Ttt	p.L282F	RFC2_ENST00000352131.3_Missense_Mutation_p.L248F	NM_181471.1	NP_852136.1	P35250	RFC2_HUMAN	replication factor C (activator 1) 2, 40kDa	282					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(3)	8						AAGTGAGCAAGAATCTAGACA	0.448																																						uc003uaj.2		NA																	0				liver(1)|central_nervous_system(1)	2						c.(844-846)CTT>TTT		replication factor C 2 isoform 1							99.0	95.0	97.0					7																	73649972		2203	4300	6503	SO:0001583	missense	5982				cell cycle checkpoint|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding	g.chr7:73649972G>A		CCDS5567.1, CCDS5568.1, CCDS75618.1	7q11.23	2010-04-21	2002-08-29		ENSG00000049541	ENSG00000049541		"""ATPases / AAA-type"""	9970	protein-coding gene	gene with protein product	"""activator 1"""	600404	"""replication factor C (activator 1) 2 (40kD)"""			1313560, 7774928	Standard	NM_181471		Approved	A1, RFC40	uc003uaj.3	P35250	OTTHUMG00000023239	ENST00000055077.3:c.844C>T	7.37:g.73649972G>A	ENSP00000055077:p.Leu282Phe		Somatic				RFC2_uc011kfa.1_RNA|RFC2_uc003uak.2_Missense_Mutation_p.L248F|RFC2_uc010lbp.2_Missense_Mutation_p.L211F|RFC2_uc003ual.2_Missense_Mutation_p.L181F	p.L282F	NM_181471	NP_852136	WXS	Illumina HiSeq	Unspecified	P35250	RFC2_HUMAN			10	869	-			282					B5BU07|D3DXG3|P32846|Q9BU93	Missense_Mutation	SNP	ENST00000055077.3	37	c.844C>T	CCDS5568.1	.	.	.	.	.	.	.	.	.	.	G	13.89	2.371987	0.42003	.	.	ENSG00000049541	ENST00000352131;ENST00000055077	T;T	0.57752	0.38;0.38	4.4	4.4	0.53042	Replication factor C (1);DNA polymerase III, clamp loader complex, gamma/delta/delta subunit, C-terminal (1);	0.135480	0.51477	D	0.000091	T	0.66056	0.2751	M	0.66439	2.03	0.38834	D	0.9559	P;P;P	0.50943	0.862;0.886;0.94	P;P;P	0.60682	0.807;0.878;0.789	T	0.71609	-0.4541	10	0.72032	D	0.01	.	11.9232	0.52803	0.0:0.1761:0.8238:0.0	.	248;248;282	P35250-2;Q75MT5;P35250	.;.;RFC2_HUMAN	F	248;282	ENSP00000275627:L248F;ENSP00000055077:L282F	ENSP00000055077:L282F	L	-	1	0	RFC2	73287908	1.000000	0.71417	0.312000	0.25196	0.409000	0.31022	3.535000	0.53575	2.161000	0.67846	0.462000	0.41574	CTT		0.448	RFC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252459.2	NM_181471		37	64	0	0	0	0	37	64				
PCLO	27445	broad.mit.edu	37	7	82584860	82584860	+	Silent	SNP	A	A	G			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr7:82584860A>G	ENST00000333891.9	-	5	5746	c.5409T>C	c.(5407-5409)tcT>tcC	p.S1803S	PCLO_ENST00000423517.2_Silent_p.S1803S	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						ATTTTTTACTAGAACTCTTTC	0.378																																						uc003uhx.2		NA																	0				ovary(7)	7						c.(5407-5409)TCT>TCC		piccolo isoform 1							142.0	131.0	134.0					7																	82584860		1833	4087	5920	SO:0001819	synonymous_variant	27445				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity	g.chr7:82584860A>G	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.5409T>C	7.37:g.82584860A>G			Somatic				PCLO_uc003uhv.2_Silent_p.S1803S	p.S1803S	NM_033026	NP_149015	WXS	Illumina HiSeq	Unspecified	Q9Y6V0	PCLO_HUMAN			5	5698	-			1734						Silent	SNP	ENST00000333891.9	37	c.5409T>C	CCDS47630.1																																																																																				0.378	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510		60	81	0	0	0	0	60	81				
CCDC132	55610	broad.mit.edu	37	7	92869194	92869194	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr7:92869194C>G	ENST00000305866.5	+	2	177	c.49C>G	c.(49-51)Caa>Gaa	p.Q17E	CCDC132_ENST00000535481.1_Missense_Mutation_p.Q17E|CCDC132_ENST00000544910.1_5'UTR|CCDC132_ENST00000541136.1_5'UTR|CCDC132_ENST00000317751.6_5'UTR|CCDC132_ENST00000251739.5_Missense_Mutation_p.Q17E	NM_017667.3	NP_060137.2	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132	17						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				endometrium(1)|large_intestine(2)|lung(5)	8	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			GAAAAGCCCTCAAGAAAGCCT	0.378																																						uc003umo.2		NA																	0					0						c.(49-51)CAA>GAA		coiled-coil domain containing 132 isoform a							85.0	92.0	90.0					7																	92869194		2203	4300	6503	SO:0001583	missense	55610							g.chr7:92869194C>G	AL833112, AK055965, AL832393	CCDS5630.1, CCDS43617.1, CCDS59065.1	7q21.3	2007-07-23			ENSG00000004766	ENSG00000004766			25956	protein-coding gene	gene with protein product						11347906	Standard	NM_024553		Approved	KIAA1861, FLJ20097, DKFZp313I2429	uc003umo.4	Q96JG6	OTTHUMG00000131733	ENST00000305866.5:c.49C>G	7.37:g.92869194C>G	ENSP00000307666:p.Gln17Glu		Somatic				CCDC132_uc003umq.2_RNA|CCDC132_uc003ump.2_5'UTR|CCDC132_uc003umr.2_RNA|CCDC132_uc011khz.1_Missense_Mutation_p.Q17E|CCDC132_uc003umn.2_Missense_Mutation_p.Q17E	p.Q17E	NM_017667	NP_060137	WXS	Illumina HiSeq	Unspecified	Q96JG6	CC132_HUMAN	STAD - Stomach adenocarcinoma(171;0.000302)		2	177	+	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		17					B3KX22|D1MQ00|F5H5U7|Q75N07|Q8WVK3|Q9H5C6	Missense_Mutation	SNP	ENST00000305866.5	37	c.49C>G	CCDS43617.1	.	.	.	.	.	.	.	.	.	.	C	10.67	1.416929	0.25552	.	.	ENSG00000004766	ENST00000251739;ENST00000305866;ENST00000458530;ENST00000535481	.	.	.	4.38	4.38	0.52667	.	0.226096	0.46442	D	0.000293	T	0.37348	0.1000	N	0.24115	0.695	0.80722	D	1	B;B;B	0.28801	0.001;0.002;0.223	B;B;B	0.27262	0.003;0.006;0.078	T	0.21586	-1.0241	9	0.02654	T	1	0.3551	12.7985	0.57571	0.0:1.0:0.0:0.0	.	17;17;17	B4DS55;Q96JG6;Q96JG6-2	.;CC132_HUMAN;.	E	17	.	ENSP00000251739:Q17E	Q	+	1	0	CCDC132	92707130	0.938000	0.31826	0.951000	0.38953	0.982000	0.71751	3.336000	0.52113	2.741000	0.93983	0.485000	0.47835	CAA		0.378	CCDC132-019	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341687.1	NM_017667		62	113	0	0	0	0	62	113				
TAF6	6878	broad.mit.edu	37	7	99711345	99711345	+	Silent	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr7:99711345G>A	ENST00000344095.4	-	4	816	c.291C>T	c.(289-291)gcC>gcT	p.A97A	RP11-506M12.1_ENST00000494221.1_RNA|TAF6_ENST00000418432.2_Silent_p.A40A|TAF6_ENST00000437822.2_Silent_p.A134A|TAF6_ENST00000472509.1_Silent_p.A154A|TAF6_ENST00000453269.2_Silent_p.A97A|TAF6_ENST00000497233.1_5'Flank|TAF6_ENST00000452041.1_Silent_p.A97A	NM_005641.3	NP_005632.1	P49848	TAF6_HUMAN	TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa	97					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(2)	26	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CCCCACCAGAGGCGAAGCGGA	0.607																																						uc003uti.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(289-291)GCC>GCT		TBP-associated factor 6 isoform alpha							44.0	46.0	45.0					7																	99711345		2203	4300	6503	SO:0001819	synonymous_variant	6878				negative regulation of cell cycle|negative regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr7:99711345G>A		CCDS5686.1, CCDS55135.1	7q	2010-02-26	2002-08-29	2001-12-07	ENSG00000106290	ENSG00000106290			11540	protein-coding gene	gene with protein product	"""TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80 kD"", ""transcription initiation factor TFIID 70 kD subunit"""	602955	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, E, 70/85kD"""	TAF2E		826207	Standard	NM_139315		Approved	TAFII70, TAFII80, MGC:8964, TAFII85	uc011kji.2	P49848	OTTHUMG00000154771	ENST00000344095.4:c.291C>T	7.37:g.99711345G>A			Somatic				TAF6_uc003utg.2_Silent_p.A38A|TAF6_uc003uth.2_Silent_p.A154A|TAF6_uc003utk.2_Silent_p.A97A|TAF6_uc011kji.1_Silent_p.A134A|TAF6_uc003utj.2_Silent_p.A87A|TAF6_uc003utl.2_Silent_p.A97A|TAF6_uc003utm.2_Silent_p.A97A|TAF6_uc003utn.1_RNA	p.A97A	NM_139315	NP_647476	WXS	Illumina HiSeq	Unspecified	P49848	TAF6_HUMAN			4	372	-	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)		97					A4D2B2|A4D2B3|B4DT11|D6W5U2|Q6AI29	Silent	SNP	ENST00000344095.4	37	c.291C>T	CCDS5686.1																																																																																				0.607	TAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337024.2	NM_005641		5	29	0	0	0	0	5	29				
MUC17	140453	broad.mit.edu	37	7	100677499	100677499	+	Silent	SNP	G	G	A	rs563806733		TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr7:100677499G>A	ENST00000306151.4	+	3	2866	c.2802G>A	c.(2800-2802)acG>acA	p.T934T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	934	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					ACAGCACCACGCCGGTAGTCA	0.512													G|||	1	0.000199681	0.0	0.0	5008	,	,		34565	0.001		0.0	False		,,,				2504	0.0					uc003uxp.1		NA																	0				ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(2800-2802)ACG>ACA		mucin 17 precursor							381.0	328.0	346.0					7																	100677499		2203	4300	6503	SO:0001819	synonymous_variant	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100677499G>A	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.2802G>A	7.37:g.100677499G>A			Somatic				MUC17_uc010lho.1_RNA	p.T934T	NM_001040105	NP_001035194	WXS	Illumina HiSeq	Unspecified	Q685J3	MUC17_HUMAN			3	2855	+	Lung NSC(181;0.136)|all_lung(186;0.182)		934			Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|13.		O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	c.2802G>A	CCDS34711.1																																																																																				0.512	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		257	346	0	0	0	0	257	346				
EXOC4	60412	broad.mit.edu	37	7	133689722	133689722	+	Silent	SNP	G	G	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr7:133689722G>T	ENST00000253861.4	+	16	2435	c.2406G>T	c.(2404-2406)gtG>gtT	p.V802V	EXOC4_ENST00000541309.1_Silent_p.V90V|EXOC4_ENST00000545148.1_Silent_p.V412V|EXOC4_ENST00000539845.1_Silent_p.V701V	NM_021807.3	NP_068579.3	Q96A65	EXOC4_HUMAN	exocyst complex component 4	802					cellular protein metabolic process (GO:0044267)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(16)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	50		Esophageal squamous(399;0.129)				ATGCCATTGTGGCTAATGTGG	0.463																																						uc003vrk.2		NA																	0				ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9						c.(2404-2406)GTG>GTT		SEC8 protein isoform a							126.0	116.0	119.0					7																	133689722		2203	4300	6503	SO:0001819	synonymous_variant	60412				vesicle docking involved in exocytosis	exocyst	protein N-terminus binding	g.chr7:133689722G>T	AL831989	CCDS5829.1, CCDS43648.1	7q31	2013-01-22	2005-11-01	2005-11-01	ENSG00000131558	ENSG00000131558			30389	protein-coding gene	gene with protein product		608185	"""SEC8-like 1 (S. cerevisiae)"""	SEC8L1		11214970, 12687004	Standard	XM_005250523		Approved	KIAA1699, MGC27170, SEC8, Sec8p	uc003vrk.3	Q96A65	OTTHUMG00000155259	ENST00000253861.4:c.2406G>T	7.37:g.133689722G>T			Somatic				EXOC4_uc011kpo.1_Silent_p.V701V|EXOC4_uc003vrl.2_Silent_p.V412V|EXOC4_uc011kpp.1_Silent_p.V334V|EXOC4_uc011kpq.1_Silent_p.V90V	p.V802V	NM_021807	NP_068579	WXS	Illumina HiSeq	Unspecified	Q96A65	EXOC4_HUMAN			16	2441	+		Esophageal squamous(399;0.129)	802					E9PED2|Q541U8|Q9C0G4|Q9H9K0|Q9P102	Silent	SNP	ENST00000253861.4	37	c.2406G>T	CCDS5829.1																																																																																				0.463	EXOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339182.1	NM_021807		7	99	1	0	2.01e-06	2.45e-06	7	99				
UBN2	254048	broad.mit.edu	37	7	138968956	138968956	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr7:138968956G>C	ENST00000473989.3	+	15	3305	c.3305G>C	c.(3304-3306)aGc>aCc	p.S1102T	UBN2_ENST00000288561.8_Missense_Mutation_p.S1019T	NM_173569.3	NP_775840.3	Q6ZU65	UBN2_HUMAN	ubinuclein 2	1102	Ser-rich.					extracellular space (GO:0005615)|nucleus (GO:0005634)				NS(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	42						GCCCAGGGTAGCCACTCCAGC	0.473																																						uc011kqr.1		NA																	0				ovary(1)|skin(1)	2						c.(3304-3306)AGC>ACC		ubinuclein 2							78.0	85.0	82.0					7																	138968956		2037	4187	6224	SO:0001583	missense	254048							g.chr7:138968956G>C	AK098644	CCDS43655.1, CCDS43655.2	7q34	2008-12-08			ENSG00000157741	ENSG00000157741			21931	protein-coding gene	gene with protein product		613841				19029251	Standard	NM_173569		Approved	FLJ25778, KIAA2030	uc011kqr.2	Q6ZU65	OTTHUMG00000157623	ENST00000473989.3:c.3305G>C	7.37:g.138968956G>C	ENSP00000418648:p.Ser1102Thr		Somatic					p.S1102T	NM_173569	NP_775840	WXS	Illumina HiSeq	Unspecified	Q6ZU65	UBN2_HUMAN			15	3305	+			1102			Ser-rich.		A4D1S2|Q2YDY4|Q6P1K0|Q86XN9|Q8N7D1	Missense_Mutation	SNP	ENST00000473989.3	37	c.3305G>C	CCDS43655.2	.	.	.	.	.	.	.	.	.	.	G	14.58	2.577547	0.45902	.	.	ENSG00000157741	ENST00000473989;ENST00000288561	T;T	0.38560	1.13;1.38	5.51	5.51	0.81932	.	0.336350	0.32703	N	0.005758	T	0.53658	0.1810	L	0.40543	1.245	0.32118	N	0.588398	D	0.54964	0.969	D	0.63381	0.914	T	0.53655	-0.8408	10	0.27785	T	0.31	0.0526	17.9725	0.89117	0.0:0.0:1.0:0.0	.	1102	Q6ZU65	UBN2_HUMAN	T	1102;1019	ENSP00000418648:S1102T;ENSP00000288561:S1019T	ENSP00000288561:S1019T	S	+	2	0	UBN2	138619496	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	3.646000	0.54396	2.752000	0.94435	0.557000	0.71058	AGC		0.473	UBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349272.3	NM_173569		59	66	0	0	0	0	59	66				
HTR5A	3361	broad.mit.edu	37	7	154862903	154862903	+	Silent	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr7:154862903G>A	ENST00000287907.2	+	1	870	c.294G>A	c.(292-294)ctG>ctA	p.L98L	HTR5A-AS1_ENST00000395731.2_Silent_p.T37T|HTR5A-AS1_ENST00000543018.1_Silent_p.T37T|HTR5A-AS1_ENST00000493904.1_5'UTR	NM_024012.3	NP_076917.1	P47898	5HT5A_HUMAN	5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled	98					cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hippocampus development (GO:0021766)|response to estradiol (GO:0032355)|serotonin receptor signaling pathway (GO:0007210)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	serotonin receptor activity (GO:0004993)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(3)|stomach(1)	48	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)	Asenapine(DB06216)|Loxapine(DB00408)|Olanzapine(DB00334)	CGCTGAGCCTGGTGCACGAGC	0.672																																						uc003wlu.1		NA																	0				ovary(2)|large_intestine(1)	3						c.(292-294)CTG>CTA		5-hydroxytryptamine receptor 5A							53.0	42.0	46.0					7																	154862903		2203	4299	6502	SO:0001819	synonymous_variant	3361					integral to plasma membrane	serotonin receptor activity	g.chr7:154862903G>A		CCDS5936.1	7q36.1	2012-08-08	2012-02-03		ENSG00000157219	ENSG00000157219		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5300	protein-coding gene	gene with protein product		601305	"""5-hydroxytryptamine (serotonin) receptor 5A"""			7988681	Standard	NM_024012		Approved	5-HT5A	uc003wlu.2	P47898	OTTHUMG00000151327	ENST00000287907.2:c.294G>A	7.37:g.154862903G>A			Somatic				uc011kvt.1_Silent_p.T37T|uc003wlt.2_Silent_p.T37T	p.L98L	NM_024012	NP_076917	WXS	Illumina HiSeq	Unspecified	P47898	5HT5A_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)	1	358	+	all_neural(206;0.119)	all_hematologic(28;0.0592)	98			Helical; Name=2; (By similarity).		Q2M2D2	Silent	SNP	ENST00000287907.2	37	c.294G>A	CCDS5936.1																																																																																				0.672	HTR5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322240.1	NM_024012		8	31	0	0	0	0	8	31				
SGK223	157285	broad.mit.edu	37	8	8234394	8234394	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr8:8234394C>A	ENST00000520004.1	-	3	1789	c.1525G>T	c.(1525-1527)Gag>Tag	p.E509*	SGK223_ENST00000330777.4_Nonsense_Mutation_p.E509*			Q86YV5	SG223_HUMAN		511							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										TCACCTACCTCGGAGTTCTGG	0.652																																					GBM(34;731 755 10259 33573 33867)	uc003wsh.3		NA																	0					0						c.(1525-1527)GAG>TAG		pragmin							21.0	24.0	23.0					8																	8234394		2088	4210	6298	SO:0001587	stop_gained	157285						ATP binding|non-membrane spanning protein tyrosine kinase activity	g.chr8:8234394C>A																												ENST00000520004.1:c.1525G>T	8.37:g.8234394C>A	ENSP00000428054:p.Glu509*		Somatic					p.E509*	NM_001080826	NP_001074295	WXS	Illumina HiSeq	Unspecified	Q86YV5	SG223_HUMAN			2	1525	-			509					Q8N3N5	Nonsense_Mutation	SNP	ENST00000520004.1	37	c.1525G>T	CCDS43706.1	.	.	.	.	.	.	.	.	.	.	C	31	5.090852	0.94149	.	.	ENSG00000182319	ENST00000330777;ENST00000520004	.	.	.	3.72	1.83	0.25207	.	1.606310	0.03984	N	0.293844	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	.	8.8014	0.34912	0.1488:0.3318:0.5194:0.0	.	.	.	.	X	509	.	ENSP00000330930:E509X	E	-	1	0	AC068353.1	8271804	0.002000	0.14202	0.001000	0.08648	0.007000	0.05969	0.479000	0.22228	0.510000	0.28216	-0.176000	0.13171	GAG		0.652	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374864.1			13	8	1	0	0.000219431	0.000256781	13	8				
BAG4	9530	broad.mit.edu	37	8	38034614	38034614	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr8:38034614G>A	ENST00000287322.4	+	1	498	c.227G>A	c.(226-228)gGa>gAa	p.G76E	BAG4_ENST00000521282.1_3'UTR|LSM1_ENST00000522515.1_5'Flank|BAG4_ENST00000432471.2_Missense_Mutation_p.G76E|LSM1_ENST00000520755.1_5'Flank|LSM1_ENST00000311351.4_5'Flank	NM_004874.3	NP_004865.1	O95429	BAG4_HUMAN	BCL2-associated athanogene 4	76					cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to tumor necrosis factor (GO:0071356)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of mRNA modification (GO:0090367)|negative regulation of phosphatidylinositol-3,4,5-trisphosphate 5-phosphatase activity (GO:2001145)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell adhesion (GO:0045785)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of stress fiber assembly (GO:0051496)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein localization to plasma membrane (GO:0072659)|ruffle assembly (GO:0097178)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|receptor signaling protein activity (GO:0005057)			breast(1)|kidney(2)|large_intestine(2)|liver(2)|lung(2)|ovary(1)|urinary_tract(1)	11	Colorectal(12;0.000442)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.121)				TATCCCTCGGGAGGCGCCTGG	0.706																																						uc003xky.1		NA																	0				ovary(1)	1						c.(226-228)GGA>GAA		BCL2-associated athanogene 4							16.0	17.0	17.0					8																	38034614		2193	4284	6477	SO:0001583	missense	9530				anti-apoptosis|apoptosis|protein folding	cytoplasm|nucleus	receptor signaling protein activity	g.chr8:38034614G>A	AF095194	CCDS6104.1, CCDS56533.1	8p11.23	2008-08-07			ENSG00000156735	ENSG00000156735			940	protein-coding gene	gene with protein product	"""silencer of death domains"""	603884				9873016, 9915703	Standard	NM_004874		Approved	SODD	uc003xky.2	O95429	OTTHUMG00000164064	ENST00000287322.4:c.227G>A	8.37:g.38034614G>A	ENSP00000287322:p.Gly76Glu		Somatic				LSM1_uc003xkw.2_5'Flank|LSM1_uc003xkx.2_5'Flank|BAG4_uc003xkz.1_Missense_Mutation_p.G76E	p.G76E	NM_004874	NP_004865	WXS	Illumina HiSeq	Unspecified	O95429	BAG4_HUMAN			1	509	+	Colorectal(12;0.000442)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.121)	76					B4E217|O95818	Missense_Mutation	SNP	ENST00000287322.4	37	c.227G>A	CCDS6104.1	.	.	.	.	.	.	.	.	.	.	G	15.69	2.908783	0.52439	.	.	ENSG00000156735	ENST00000432471;ENST00000287322	D;D	0.87966	-2.11;-2.32	4.35	2.51	0.30379	.	0.748441	0.11978	N	0.511032	D	0.87509	0.6195	L	0.57536	1.79	0.21147	N	0.999776	P;D	0.54047	0.761;0.964	B;P	0.50490	0.42;0.642	T	0.76366	-0.2985	10	0.40728	T	0.16	-0.318	10.6138	0.45439	0.0:0.4125:0.5875:0.0	.	76;76	B4E217;O95429	.;BAG4_HUMAN	E	76	ENSP00000393298:G76E;ENSP00000287322:G76E	ENSP00000287322:G76E	G	+	2	0	BAG4	38153771	0.962000	0.33011	0.198000	0.23420	0.484000	0.33280	1.195000	0.32186	0.432000	0.26286	-0.479000	0.04858	GGA		0.706	BAG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377038.2	NM_004874		21	6	0	0	0	0	21	6				
XKR4	114786	broad.mit.edu	37	8	56270346	56270346	+	Silent	SNP	G	G	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr8:56270346G>T	ENST00000327381.6	+	2	1015	c.915G>T	c.(913-915)ctG>ctT	p.L305L		NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4	305						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)			TGAGTATGCTGCATTTGCTAG	0.473																																						uc003xsf.2		NA																	0				pancreas(2)	2						c.(913-915)CTG>CTT		XK, Kell blood group complex subunit-related							169.0	148.0	155.0					8																	56270346		2203	4300	6503	SO:0001819	synonymous_variant	114786					integral to membrane		g.chr8:56270346G>T	AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579			29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""				Standard	NM_052898		Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.915G>T	8.37:g.56270346G>T			Somatic					p.L305L	NM_052898	NP_443130	WXS	Illumina HiSeq	Unspecified	Q5GH76	XKR4_HUMAN	Epithelial(17;0.000117)|all cancers(17;0.000836)		2	947	+			305					Q96PZ8	Silent	SNP	ENST00000327381.6	37	c.915G>T	CCDS34893.1																																																																																				0.473	XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378129.2	NM_052898		43	37	1	0	2.2e-31	2.94e-31	43	37				
CLVS1	157807	broad.mit.edu	37	8	62212732	62212732	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr8:62212732C>T	ENST00000519846.1	+	3	818	c.346C>T	c.(346-348)Ccc>Tcc	p.P116S	RP11-787D18.1_ENST00000518064.1_RNA|RP11-787D18.1_ENST00000521801.1_RNA|CLVS1_ENST00000518592.1_Intron|CLVS1_ENST00000325897.4_Missense_Mutation_p.P116S			Q8IUQ0	CLVS1_HUMAN	clavesin 1	116					lysosome organization (GO:0007040)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|transporter activity (GO:0005215)			endometrium(3)|kidney(4)|large_intestine(4)|lung(21)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	41						GGCAGATGATCCCGGCATTAA	0.507																																						uc003xuh.2		NA																	0				skin(4)|ovary(1)	5						c.(346-348)CCC>TCC		retinaldehyde binding protein 1-like 1							54.0	55.0	55.0					8																	62212732		2203	4300	6503	SO:0001583	missense	157807				lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity	g.chr8:62212732C>T	AY094971	CCDS6176.1	8q12.1	2009-10-14	2009-10-14	2009-10-14		ENSG00000177182			23139	protein-coding gene	gene with protein product		611292	"""retinaldehyde binding protein 1-like 1"""	RLBP1L1		16802092, 19651769	Standard	NM_173519		Approved	MGC34646, CRALBPL, C6orf212L	uc003xuh.3	Q8IUQ0		ENST00000519846.1:c.346C>T	8.37:g.62212732C>T	ENSP00000428402:p.Pro116Ser		Somatic				CLVS1_uc003xug.2_Missense_Mutation_p.P116S|CLVS1_uc003xui.2_Intron|CLVS1_uc010lyp.2_Missense_Mutation_p.P116S	p.P116S	NM_173519	NP_775790	WXS	Illumina HiSeq	Unspecified	Q8IUQ0	CLVS1_HUMAN			2	670	+			116					B2R7M5|C8UZT3|Q8NB32	Missense_Mutation	SNP	ENST00000519846.1	37	c.346C>T	CCDS6176.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.950343	0.92660	.	.	ENSG00000177182	ENST00000519846;ENST00000325897	T;T	0.81247	-1.47;-1.47	5.79	5.79	0.91817	Cellular retinaldehyde-binding/triple function, C-terminal (1);	0.053475	0.85682	D	0.000000	D	0.84266	0.5434	L	0.49455	1.56	0.80722	D	1	D;P	0.55800	0.973;0.754	P;P	0.53549	0.729;0.71	T	0.82161	-0.0594	9	.	.	.	-19.238	20.0313	0.97540	0.0:1.0:0.0:0.0	.	116;116	Q8IUQ0;Q8IUQ0-2	CLVS1_HUMAN;.	S	116	ENSP00000428402:P116S;ENSP00000325506:P116S	.	P	+	1	0	CLVS1	62375286	1.000000	0.71417	0.989000	0.46669	0.981000	0.71138	5.968000	0.70413	2.746000	0.94184	0.655000	0.94253	CCC		0.507	CLVS1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378323.1	NM_173519		21	60	0	0	0	0	21	60				
PREX2	80243	broad.mit.edu	37	8	68934274	68934274	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr8:68934274G>A	ENST00000288368.4	+	4	617	c.340G>A	c.(340-342)Gac>Aac	p.D114N	PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	114	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						TTCACAGAAAGACAAGTTTCG	0.299																																						uc003xxv.1		NA																	0				skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						c.(340-342)GAC>AAC		DEP domain containing 2 isoform a							95.0	93.0	94.0					8																	68934274		2203	4300	6503	SO:0001583	missense	80243				G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity	g.chr8:68934274G>A	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.340G>A	8.37:g.68934274G>A	ENSP00000288368:p.Asp114Asn		Somatic				PREX2_uc003xxu.1_Missense_Mutation_p.D114N|PREX2_uc011lez.1_Missense_Mutation_p.D49N	p.D114N	NM_024870	NP_079146	WXS	Illumina HiSeq	Unspecified	Q70Z35	PREX2_HUMAN			4	367	+			114			DH.		B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	ENST00000288368.4	37	c.340G>A	CCDS6201.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.048275	0.75846	.	.	ENSG00000046889	ENST00000288368;ENST00000396539;ENST00000354677	T	0.63417	-0.04	6.04	6.04	0.98038	Dbl homology (DH) domain (5);	0.219917	0.47455	D	0.000227	T	0.64659	0.2618	L	0.41356	1.27	0.38356	D	0.944471	B;B;B	0.30146	0.087;0.154;0.27	B;B;B	0.39339	0.138;0.297;0.287	T	0.65397	-0.6178	10	0.66056	D	0.02	.	20.5948	0.99439	0.0:0.0:1.0:0.0	.	114;114;114	Q70Z35-2;Q70Z35;Q70Z35-3	.;PREX2_HUMAN;.	N	114	ENSP00000288368:D114N	ENSP00000288368:D114N	D	+	1	0	PREX2	69096828	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.017000	0.70805	2.873000	0.98535	0.563000	0.77884	GAC		0.299	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170		19	29	0	0	0	0	19	29				
E2F5	1875	broad.mit.edu	37	8	86121536	86121536	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr8:86121536C>G	ENST00000416274.2	+	6	809	c.775C>G	c.(775-777)Cca>Gca	p.P259A	E2F5_ENST00000256117.5_Missense_Mutation_p.P260A|E2F5_ENST00000418930.2_Missense_Mutation_p.P259A|E2F5_ENST00000521429.1_Missense_Mutation_p.P86A|E2F5_ENST00000519128.1_3'UTR|E2F5_ENST00000517476.1_Missense_Mutation_p.P98A	NM_001083588.1|NM_001951.3	NP_001077057.1|NP_001942.2	Q15329	E2F5_HUMAN	E2F transcription factor 5, p130-binding	259					gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)	8						GTCCTTGACTCCAGTGACTCC	0.488																																						uc003ycz.3		NA																	0				ovary(1)	1						c.(775-777)CCA>GCA		E2F transcription factor 5 isoform 1							89.0	87.0	88.0					8																	86121536		1996	4181	6177	SO:0001583	missense	1875				G1 phase of mitotic cell cycle	transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding	g.chr8:86121536C>G	X86097	CCDS47885.1, CCDS47886.1, CCDS55254.1	8q21.2	2004-01-29			ENSG00000133740	ENSG00000133740			3119	protein-coding gene	gene with protein product		600967				7892279	Standard	NM_001083588		Approved		uc003ycz.4	Q15329	OTTHUMG00000164785	ENST00000416274.2:c.775C>G	8.37:g.86121536C>G	ENSP00000398124:p.Pro259Ala		Somatic				E2F5_uc003yda.3_Missense_Mutation_p.P259A|E2F5_uc010mab.2_Missense_Mutation_p.P98A|E2F5_uc003ydb.3_Missense_Mutation_p.P78A	p.P259A	NM_001951	NP_001942	WXS	Illumina HiSeq	Unspecified	Q15329	E2F5_HUMAN			6	812	+			259					E9PBN9|Q16601|Q92756	Missense_Mutation	SNP	ENST00000416274.2	37	c.775C>G	CCDS47885.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.44|13.44	2.237914|2.237914	0.39598|0.39598	.|.	.|.	ENSG00000133740|ENSG00000133740	ENST00000418930;ENST00000256117;ENST00000416274;ENST00000517476;ENST00000521429;ENST00000518234|ENST00000520225	D;D;D;D;D;D|.	0.88741|.	-2.42;-2.42;-2.42;-2.42;-2.42;-2.42|.	6.13|6.13	5.25|5.25	0.73442|0.73442	.|.	0.101830|.	0.64402|.	D|.	0.000002|.	T|T	0.60495|0.60495	0.2273|0.2273	L|L	0.54323|0.54323	1.7|1.7	0.40184|0.40184	D|D	0.977327|0.977327	P;B;B|.	0.38827|.	0.649;0.363;0.212|.	B;B;B|.	0.33620|.	0.117;0.167;0.08|.	T|T	0.60616|0.60616	-0.7228|-0.7228	10|5	0.42905|.	T|.	0.14|.	-9.263|-9.263	9.5759|9.5759	0.39457|0.39457	0.1417:0.7871:0.0:0.0713|0.1417:0.7871:0.0:0.0713	.|.	86;259;259|.	E5RHD4;Q15329-2;Q15329|.	.;.;E2F5_HUMAN|.	A|C	259;260;259;98;86;95|30	ENSP00000414312:P259A;ENSP00000256117:P260A;ENSP00000398124:P259A;ENSP00000429120:P98A;ENSP00000428606:P86A;ENSP00000429669:P95A|.	ENSP00000256117:P260A|.	P|S	+|+	1|2	0|0	E2F5|E2F5	86308788|86308788	0.998000|0.998000	0.40836|0.40836	0.574000|0.574000	0.28523|0.28523	0.689000|0.689000	0.40095|0.40095	4.072000|4.072000	0.57563|0.57563	1.594000|1.594000	0.50039|0.50039	0.650000|0.650000	0.86243|0.86243	CCA|TCC		0.488	E2F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380274.1	NM_001951		5	94	0	0	0	0	5	94				
PSKH2	85481	broad.mit.edu	37	8	87076791	87076791	+	Silent	SNP	G	G	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr8:87076791G>T	ENST00000276616.2	-	2	329	c.255C>A	c.(253-255)acC>acA	p.T85T	PSKH2_ENST00000517981.1_5'UTR	NM_033126.1	NP_149117.1	Q96QS6	KPSH2_HUMAN	protein serine kinase H2	85	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|kidney(11)|large_intestine(2)|lung(26)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(1)	47			STAD - Stomach adenocarcinoma(118;0.129)			AAGGTTTCTTGGTGGTCTTCT	0.483																																						uc011lfy.1		NA																	0				stomach(2)|lung(2)|ovary(1)	5						c.(253-255)ACC>ACA		protein serine kinase H2							97.0	82.0	87.0					8																	87076791		2203	4300	6503	SO:0001819	synonymous_variant	85481						ATP binding|protein serine/threonine kinase activity	g.chr8:87076791G>T	AY037806	CCDS6240.1	8q21.13	2004-06-03				ENSG00000147613			18997	protein-coding gene	gene with protein product							Standard	NM_033126		Approved		uc011lfy.2	Q96QS6		ENST00000276616.2:c.255C>A	8.37:g.87076791G>T			Somatic					p.T85T	NM_033126	NP_149117	WXS	Illumina HiSeq	Unspecified	Q96QS6	KPSH2_HUMAN	STAD - Stomach adenocarcinoma(118;0.129)		2	255	-			85			Protein kinase.		A0AV22	Silent	SNP	ENST00000276616.2	37	c.255C>A	CCDS6240.1																																																																																				0.483	PSKH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374628.1	NM_033126		28	109	1	0	8.58e-18	1.13e-17	28	109				
RMDN1	51115	broad.mit.edu	37	8	87519250	87519250	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr8:87519250G>A	ENST00000406452.3	-	2	380	c.221C>T	c.(220-222)gCt>gTt	p.A74V	RMDN1_ENST00000519966.1_Missense_Mutation_p.A74V|CPNE3_ENST00000198765.4_Intron|RMDN1_ENST00000430676.2_Missense_Mutation_p.A74V|RMDN1_ENST00000518772.1_5'UTR|RMDN1_ENST00000523911.1_Missense_Mutation_p.A30V	NM_016033.2	NP_057117.2	Q96DB5	RMD1_HUMAN	regulator of microtubule dynamics 1	74						microtubule (GO:0005874)|mitochondrion (GO:0005739)											AACCACAGCAGCCTGAGAGAT	0.368																																						uc003ydu.2		NA																	0				ovary(1)	1						c.(220-222)GCT>GTT		regulator of microtubule dynamics 1							111.0	120.0	117.0					8																	87519250		2203	4300	6503	SO:0001583	missense	51115					microtubule|spindle pole	binding	g.chr8:87519250G>A	AK000672	CCDS34918.1, CCDS69509.1, CCDS69510.1	8q21.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000176623	ENSG00000176623			24285	protein-coding gene	gene with protein product		611871	"""family with sequence similarity 82, member B"""	FAM82B		10810093	Standard	NM_016033		Approved	CGI-90, FLJ20665, RMD1	uc003ydu.3	Q96DB5	OTTHUMG00000163692	ENST00000406452.3:c.221C>T	8.37:g.87519250G>A	ENSP00000385927:p.Ala74Val		Somatic				FAM82B_uc011lfz.1_Missense_Mutation_p.A74V|FAM82B_uc011lga.1_Missense_Mutation_p.A74V	p.A74V	NM_016033	NP_057117	WXS	Illumina HiSeq	Unspecified	Q96DB5	RMD1_HUMAN			2	381	-			74					A9UMZ8|B4DNF5|B4DZW6|B5MC61|C9JSC6|E7EVI2|Q9Y398	Missense_Mutation	SNP	ENST00000406452.3	37	c.221C>T	CCDS34918.1	.	.	.	.	.	.	.	.	.	.	G	17.25	3.341499	0.61073	.	.	ENSG00000176623	ENST00000406452;ENST00000523911;ENST00000519966;ENST00000430676;ENST00000521045	T;T;T;T;T	0.45668	1.51;1.54;0.9;0.9;0.89	4.4	4.4	0.53042	.	0.991403	0.08210	N	0.980893	T	0.41604	0.1166	L	0.56769	1.78	0.80722	D	1	B;B;B	0.11235	0.002;0.004;0.004	B;B;B	0.09377	0.004;0.002;0.004	T	0.13522	-1.0506	10	0.22706	T	0.39	-1.927	12.3736	0.55267	0.0:0.0:1.0:0.0	.	74;74;74	B4DZW6;E7EVI2;Q96DB5	.;.;RMD1_HUMAN	V	74;30;74;74;30	ENSP00000385927:A74V;ENSP00000429899:A30V;ENSP00000428661:A74V;ENSP00000409661:A74V;ENSP00000428743:A30V	ENSP00000385927:A74V	A	-	2	0	FAM82B	87588366	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.256000	0.43231	2.280000	0.76307	0.655000	0.94253	GCT		0.368	RMDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374770.2	NM_016033		93	150	0	0	0	0	93	150				
RUNX1T1	862	broad.mit.edu	37	8	92999130	92999130	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr8:92999130C>A	ENST00000523629.1	-	8	1516	c.1062G>T	c.(1060-1062)tgG>tgT	p.W354C	RUNX1T1_ENST00000360348.2_Missense_Mutation_p.W317C|RUNX1T1_ENST00000265814.3_Missense_Mutation_p.W354C|RUNX1T1_ENST00000436581.2_Missense_Mutation_p.W365C|RUNX1T1_ENST00000422361.2_Missense_Mutation_p.W317C|RUNX1T1_ENST00000396218.1_Missense_Mutation_p.W327C|RUNX1T1_ENST00000520724.1_Missense_Mutation_p.W317C|RUNX1T1_ENST00000518844.1_Missense_Mutation_p.W327C	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	354	Important for oligomerization.				fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			CAAGATGTTTCCACTCTTCTG	0.378																																						uc003yfd.2		NA																	0				lung(9)|large_intestine(3)|breast(2)|central_nervous_system(1)|pancreas(1)	16						c.(1060-1062)TGG>TGT		acute myelogenous leukemia 1 translocation 1							262.0	227.0	239.0					8																	92999130		2202	4300	6502	SO:0001583	missense	862				generation of precursor metabolites and energy	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:92999130C>A	D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.1062G>T	8.37:g.92999130C>A	ENSP00000428543:p.Trp354Cys		Somatic				RUNX1T1_uc003yfc.1_Missense_Mutation_p.W327C|RUNX1T1_uc003yfe.1_Missense_Mutation_p.W317C|RUNX1T1_uc010mao.2_Missense_Mutation_p.W327C|RUNX1T1_uc011lgi.1_Missense_Mutation_p.W365C|RUNX1T1_uc010man.1_5'UTR|RUNX1T1_uc003yfb.1_Missense_Mutation_p.W317C	p.W354C	NM_175634	NP_783552	WXS	Illumina HiSeq	Unspecified	Q06455	MTG8_HUMAN	BRCA - Breast invasive adenocarcinoma(11;0.0141)		7	1146	-			354			Important for oligomerization.		B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Missense_Mutation	SNP	ENST00000523629.1	37	c.1062G>T	CCDS6256.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.318908	0.81469	.	.	ENSG00000079102	ENST00000523629;ENST00000396218;ENST00000265814;ENST00000360348;ENST00000422361;ENST00000520724;ENST00000436581;ENST00000518844	T;T;T;T;T;T;T;T	0.54479	0.57;0.57;0.57;0.57;0.57;0.57;0.57;0.57	5.39	5.39	0.77823	NHR2-like (1);	0.112233	0.64402	D	0.000003	T	0.73164	0.3552	M	0.71036	2.16	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.988	D;D;D	0.78314	0.966;0.991;0.914	T	0.75900	-0.3154	10	0.87932	D	0	-10.7827	19.1841	0.93635	0.0:1.0:0.0:0.0	.	365;354;327	E7EPN4;Q06455;Q06455-2	.;MTG8_HUMAN;.	C	354;327;354;317;317;317;365;327	ENSP00000428543:W354C;ENSP00000379520:W327C;ENSP00000265814:W354C;ENSP00000353504:W317C;ENSP00000390137:W317C;ENSP00000428742:W317C;ENSP00000402257:W365C;ENSP00000430728:W327C	ENSP00000265814:W354C	W	-	3	0	RUNX1T1	93068306	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.537000	0.85549	0.655000	0.94253	TGG		0.378	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377045.3	NM_004349, NM_175635		6	215	1	0	0.00116845	0.00134585	6	215				
FAM92A1	137392	broad.mit.edu	37	8	94713483	94713483	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr8:94713483G>T	ENST00000518322.1	+	2	199	c.58G>T	c.(58-60)Gtc>Ttc	p.V20F	LINC00535_ENST00000501400.1_RNA|FAM92A1_ENST00000423990.2_Missense_Mutation_p.V20F|FAM92A1_ENST00000522324.1_Missense_Mutation_p.V20F	NM_145269.3	NP_660312.2	A1XBS5	F92A1_HUMAN	family with sequence similarity 92, member A1	20										NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(1)	7	Breast(36;2.4e-06)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			GCAAACAGCTGTCTCAAATGT	0.453																																						uc010maq.2		NA																	0					0						c.(58-60)GTC>TTC		hypothetical protein LOC137392							59.0	55.0	56.0					8																	94713483		1889	4114	6003	SO:0001583	missense	137392							g.chr8:94713483G>T		CCDS47892.1, CCDS64933.1	8q22.1	2005-09-22			ENSG00000188343	ENSG00000188343			30452	protein-coding gene	gene with protein product						12477932	Standard	XM_005250783		Approved	FLJ38979	uc022ayd.1	A1XBS5	OTTHUMG00000164238	ENST00000518322.1:c.58G>T	8.37:g.94713483G>T	ENSP00000429367:p.Val20Phe		Somatic				FAM92A1_uc003yfu.1_RNA|FAM92A1_uc003yfv.3_RNA	p.V20F	NM_145269	NP_660312	WXS	Illumina HiSeq	Unspecified	A1XBS5	F92A1_HUMAN	BRCA - Breast invasive adenocarcinoma(8;0.0168)		2	161	+	Breast(36;2.4e-06)		20					A1XBS4|Q32ND3|Q6AHW7|Q8N8R1|Q96L09	Missense_Mutation	SNP	ENST00000518322.1	37	c.58G>T	CCDS47892.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.5|23.5	4.422766|4.422766	0.83559|0.83559	.|.	.|.	ENSG00000188343|ENSG00000188343	ENST00000523453|ENST00000518322;ENST00000522324;ENST00000522803;ENST00000423990;ENST00000436526;ENST00000341186;ENST00000540007	.|T;T;T;T	.|0.55413	.|0.52;0.52;0.52;0.52	4.38|4.38	4.38|4.38	0.52667|0.52667	.|.	.|0.055622	.|0.64402	.|D	.|0.000001	T|T	0.71005|0.71005	0.3289|0.3289	M|M	0.68317|0.68317	2.08|2.08	0.80722|0.80722	D|D	1|1	.|D	.|0.76494	.|0.999	.|D	.|0.76071	.|0.987	T|T	0.75416|0.75416	-0.3325|-0.3325	5|10	.|0.87932	.|D	.|0	-11.1295|-11.1295	17.5074|17.5074	0.87749|0.87749	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|20	.|A1XBS5	.|F92A1_HUMAN	F|F	30|20	.|ENSP00000429367:V20F;ENSP00000430069:V20F;ENSP00000428739:V20F;ENSP00000401774:V20F	.|ENSP00000341363:V20F	C|V	+|+	2|1	0|0	FAM92A1|FAM92A1	94782659|94782659	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.960000|0.960000	0.62799|0.62799	3.914000|3.914000	0.56401|0.56401	2.430000|2.430000	0.82344|0.82344	0.655000|0.655000	0.94253|0.94253	TGT|GTC		0.453	FAM92A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377890.4	NM_145269		10	41	1	0	2.81e-09	3.52e-09	10	41				
VPS13B	157680	broad.mit.edu	37	8	100513954	100513954	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr8:100513954G>A	ENST00000358544.2	+	26	4021	c.3910G>A	c.(3910-3912)Gat>Aat	p.D1304N	VPS13B_ENST00000357162.2_Missense_Mutation_p.D1304N|VPS13B_ENST00000395996.1_Missense_Mutation_p.D1304N	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	1304					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			ACCATTCTCAGATTCTGTGAC	0.368																																					Colon(161;2205 2542 7338 31318)	uc003yiv.2		NA																	0				ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20						c.(3910-3912)GAT>AAT		vacuolar protein sorting 13B isoform 5							144.0	140.0	142.0					8																	100513954		2203	4300	6503	SO:0001583	missense	157680				protein transport			g.chr8:100513954G>A	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.3910G>A	8.37:g.100513954G>A	ENSP00000351346:p.Asp1304Asn		Somatic				VPS13B_uc003yiw.2_Missense_Mutation_p.D1304N|VPS13B_uc003yiu.1_Missense_Mutation_p.D1304N|VPS13B_uc003yix.1_Missense_Mutation_p.D774N	p.D1304N	NM_017890	NP_060360	WXS	Illumina HiSeq	Unspecified	Q7Z7G8	VP13B_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.00636)		26	4021	+	Breast(36;3.73e-07)		1304					C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	c.3910G>A	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.977387	0.92982	.	.	ENSG00000132549	ENST00000357162;ENST00000358544;ENST00000395996	T;T;T	0.51071	0.72;0.72;0.72	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.67970	0.2950	M	0.61703	1.905	0.58432	D	0.999995	D;D;D;D	0.89917	0.999;0.999;1.0;0.999	D;D;D;D	0.85130	0.98;0.997;0.963;0.97	T	0.69551	-0.5115	10	0.62326	D	0.03	.	19.1316	0.93410	0.0:0.0:1.0:0.0	.	1303;1304;1304;1304	Q7Z7G8-6;Q7Z7G8-2;Q7Z7G8;Q7Z7G8-3	.;.;VP13B_HUMAN;.	N	1304	ENSP00000349685:D1304N;ENSP00000351346:D1304N;ENSP00000379318:D1304N	ENSP00000349685:D1304N	D	+	1	0	VPS13B	100583130	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	9.533000	0.98059	2.589000	0.87451	0.557000	0.71058	GAT		0.368	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042		95	129	0	0	0	0	95	129				
EIF3E	3646	broad.mit.edu	37	8	109252300	109252300	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr8:109252300C>G	ENST00000220849.5	-	3	272	c.210G>C	c.(208-210)ttG>ttC	p.L70F	EIF3E_ENST00000519030.1_5'UTR	NM_001568.2	NP_001559.1			eukaryotic translation initiation factor 3, subunit E										EIF3E/RSPO2(6)	NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(57;6.84e-10)			TTTTCTCTCTCAAAGCTAATT	0.358																																					GBM(15;360 410 8460 34179 52246)	uc003ymu.2		NA																	0				ovary(2)|kidney(1)	3						c.(208-210)TTG>TTC		eukaryotic translation initiation factor 3,							137.0	127.0	130.0					8																	109252300		2203	4300	6503	SO:0001583	missense	3646				negative regulation of translational initiation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytosol|eukaryotic translation initiation factor 3 complex|PML body	protein N-terminus binding	g.chr8:109252300C>G	U94175	CCDS6308.1	8q22-q23	2010-03-10	2007-07-27	2007-07-27	ENSG00000104408	ENSG00000104408			3277	protein-coding gene	gene with protein product		602210	"""eukaryotic translation initiation factor 3, subunit 6 48kDa"""	INT6, EIF3S6		9403073, 9295280	Standard	NM_001568		Approved	eIF3-p48, eIF3e	uc003ymu.3	P60228	OTTHUMG00000164858	ENST00000220849.5:c.210G>C	8.37:g.109252300C>G	ENSP00000220849:p.Leu70Phe		Somatic				EIF3E_uc003ymt.2_Missense_Mutation_p.L21F|EIF3E_uc003ymv.2_5'UTR|EIF3E_uc010mci.1_Missense_Mutation_p.L70F|EIF3E_uc010mcj.1_Missense_Mutation_p.L70F	p.L70F	NM_001568	NP_001559	WXS	Illumina HiSeq	Unspecified	P60228	EIF3E_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;6.84e-10)		3	238	-			70			Sufficient for interaction with TRIM27.|Sufficient for interaction with EPAS1.			Missense_Mutation	SNP	ENST00000220849.5	37	c.210G>C	CCDS6308.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.55|14.55	2.567591|2.567591	0.45694|0.45694	.|.	.|.	ENSG00000104408|ENSG00000104408	ENST00000220849;ENST00000518345|ENST00000521440	T|.	0.44083|.	0.93|.	5.54|5.54	3.11|3.11	0.35812|0.35812	Eukaryotic translation initiation factor 3 (eIF3), subunit 6, N-terminal (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.50582|.	0.1624|.	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	P;D;B|.	0.71674|.	0.759;0.998;0.395|.	B;D;B|.	0.71656|.	0.395;0.974;0.316|.	T|.	0.42531|.	-0.9446|.	10|.	0.28530|.	T|.	0.3|.	-11.4884|-11.4884	11.4432|11.4432	0.50109|0.50109	0.0:0.8:0.0:0.2|0.0:0.8:0.0:0.2	.|.	70;70;70|.	Q6IAX5;B2R806;P60228|.	.;.;EIF3E_HUMAN|.	F|S	70;21|69	ENSP00000220849:L70F|.	ENSP00000220849:L70F|.	L|X	-|-	3|2	2|2	EIF3E|EIF3E	109321476|109321476	0.988000|0.988000	0.35896|0.35896	1.000000|1.000000	0.80357|0.80357	0.938000|0.938000	0.57974|0.57974	0.280000|0.280000	0.18790|0.18790	1.313000|1.313000	0.45069|0.45069	0.484000|0.484000	0.47621|0.47621	TTG|TGA		0.358	EIF3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380612.2	NM_001568		30	126	0	0	0	0	30	126				
CSMD3	114788	broad.mit.edu	37	8	113323395	113323395	+	Splice_Site	SNP	G	G	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr8:113323395G>T	ENST00000297405.5	-	50	7941	c.7697C>A	c.(7696-7698)gCt>gAt	p.A2566D	CSMD3_ENST00000343508.3_Splice_Site_p.A2526D|CSMD3_ENST00000352409.3_Splice_Site_p.A2496D|CSMD3_ENST00000455883.2_Splice_Site_p.A2462D	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2566	CUB 14. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ACAGTAGAAAGCTTTTCAAAA	0.398										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												uc003ynu.2		NA																	0				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(7696-7698)GCT>GAT		CUB and Sushi multiple domains 3 isoform 1							57.0	54.0	55.0					8																	113323395		2203	4300	6503	SO:0001630	splice_region_variant	114788					integral to membrane|plasma membrane		g.chr8:113323395G>T	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.7697-1C>A	8.37:g.113323395G>T		HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003yns.2_Missense_Mutation_p.A1768D|CSMD3_uc003ynt.2_Missense_Mutation_p.A2526D|CSMD3_uc011lhx.1_Missense_Mutation_p.A2462D|CSMD3_uc003ynw.1_Missense_Mutation_p.A277D	p.A2566D	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			50	7856	-			2566			CUB 14.|Extracellular (Potential).		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.7697C>A	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	32	5.129329	0.94473	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.39056	1.1;1.1;1.1;1.1;1.1	5.76	5.76	0.90799	CUB (4);	0.071575	0.56097	D	0.000039	T	0.74412	0.3713	M	0.93197	3.39	0.80722	D	1	D;D;D	0.89917	1.0;0.998;0.999	D;D;D	0.78314	0.982;0.909;0.991	T	0.77153	-0.2692	10	0.37606	T	0.19	.	19.9675	0.97275	0.0:0.0:1.0:0.0	.	2462;2566;2526	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	D	2526;2566;1836;2462;2496	ENSP00000345799:A2526D;ENSP00000297405:A2566D;ENSP00000341558:A1836D;ENSP00000412263:A2462D;ENSP00000343124:A2496D	ENSP00000297405:A2566D	A	-	2	0	CSMD3	113392571	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.864000	0.99589	2.709000	0.92574	0.655000	0.94253	GCT		0.398	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	Missense_Mutation	15	59	1	0	4.93e-13	6.34e-13	15	59				
MYC	4609	broad.mit.edu	37	8	128753051	128753051	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr8:128753051G>C	ENST00000377970.2	+	3	1722	c.1212G>C	c.(1210-1212)aaG>aaC	p.K404N	MYC_ENST00000524013.1_Missense_Mutation_p.K403N	NM_002467.4	NP_002458	P01106	MYC_HUMAN	v-myc avian myelocytomatosis viral oncogene homolog	389	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular iron ion homeostasis (GO:0006879)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|chromosome organization (GO:0051276)|energy reserve metabolic process (GO:0006112)|fibroblast apoptotic process (GO:0044346)|gene expression (GO:0010467)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell division (GO:0051782)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|oxygen transport (GO:0015671)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of metanephric cap mesenchymal cell proliferation (GO:0090096)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of telomere maintenance (GO:0032204)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to growth factor (GO:0070848)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein complex binding (GO:0032403)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)	Nadroparin(DB08813)	ACAATGAAAAGGCCCCCAAGG	0.502		3	"""A, T"""	"""IGK@, BCL5, BCL7A , BTG1, TRA@, IGH@"""	"""Burkitt lymphoma,  amplified in other cancers, B-CLL"""																																	uc003ysi.2		3		Dom	yes		8	8q24.12-q24.13	4609	A|T	v-myc myelocytomatosis viral oncogene homolog (avian)			"""L, E"""	IGK@|BCL5|BCL7A |BTG1|TRA@|IGH@		Burkitt lymphoma| amplified in other cancers|B-CLL		0				lung(3)|ovary(1)|central_nervous_system(1)|pancreas(1)	6						c.(1210-1212)AAG>AAC		myc proto-oncogene protein							102.0	116.0	111.0					8																	128753051		2203	4300	6503	SO:0001583	missense	4609				branching involved in ureteric bud morphogenesis|cell cycle arrest|cell proliferation|cellular iron ion homeostasis|positive regulation of metanephric cap mesenchymal cell proliferation|positive regulation of transcription, DNA-dependent|regulation of telomere maintenance|regulation of transcription from RNA polymerase II promoter|response to drug	nucleolus|nucleoplasm	E-box binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr8:128753051G>C		CCDS6359.2	8q24	2013-07-09	2013-07-09		ENSG00000136997	ENSG00000136997		"""Basic helix-loop-helix proteins"""	7553	protein-coding gene	gene with protein product		190080					Standard	NM_002467		Approved	c-Myc, bHLHe39, MYCC	uc003ysi.3	P01106	OTTHUMG00000128475	ENST00000377970.2:c.1212G>C	8.37:g.128753051G>C	ENSP00000367207:p.Lys404Asn		Somatic					p.K404N	NM_002467	NP_002458	WXS	Illumina HiSeq	Unspecified	P01106	MYC_HUMAN	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)	3	1737	+	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	389			Helix-loop-helix motif.		A8WFE7|P01107|Q14026	Missense_Mutation	SNP	ENST00000377970.2	37	c.1212G>C	CCDS6359.2	.	.	.	.	.	.	.	.	.	.	G	17.75	3.466816	0.63625	.	.	ENSG00000136997	ENST00000377970;ENST00000524013;ENST00000454617	D;D	0.99232	-5.6;-5.6	5.39	-0.597	0.11653	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.99315	0.9760	M	0.90483	3.12	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99889	1.1129	10	0.87932	D	0	-27.5779	10.433	0.44419	0.3601:0.0:0.6399:0.0	.	389	P01106	MYC_HUMAN	N	404;403;370	ENSP00000367207:K404N;ENSP00000430235:K403N	ENSP00000367207:K404N	K	+	3	2	MYC	128822233	1.000000	0.71417	0.972000	0.41901	0.961000	0.63080	1.185000	0.32065	-0.470000	0.06901	-0.157000	0.13467	AAG		0.502	MYC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250277.3			64	305	0	0	0	0	64	305				
ASAP1	50807	broad.mit.edu	37	8	131073299	131073299	+	Silent	SNP	T	T	C			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr8:131073299T>C	ENST00000518721.1	-	28	2945	c.2718A>G	c.(2716-2718)acA>acG	p.T906T	ASAP1_ENST00000357668.1_Silent_p.T906T	NM_001247996.1|NM_018482.3	NP_001234925.1|NP_060952.2	Q9ULH1	ASAP1_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1	906	Pro-rich.				cilium morphogenesis (GO:0060271)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(22)|ovary(6)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	68						AGAGATGATCTGTTTTCCTTA	0.493																																						uc003yta.1		NA																	0				ovary(4)	4						c.(2716-2718)ACA>ACG		development and differentiation enhancing factor							118.0	125.0	123.0					8																	131073299		2203	4300	6503	SO:0001819	synonymous_variant	50807				cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding	g.chr8:131073299T>C	AB033075	CCDS6362.1, CCDS75788.1	8q24.1-q24.2	2013-01-11	2008-09-22	2008-09-22	ENSG00000153317	ENSG00000153317		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2720	protein-coding gene	gene with protein product	"""centaurin, beta 4"""	605953	"""development and differentiation enhancing factor 1"""	DDEF1		9819391	Standard	NM_018482		Approved	PAP, KIAA1249, ZG14P, CENTB4	uc003yta.2	Q9ULH1	OTTHUMG00000164772	ENST00000518721.1:c.2718A>G	8.37:g.131073299T>C			Somatic				ASAP1_uc003ysz.1_Silent_p.T717T|ASAP1_uc011liw.1_Silent_p.T899T	p.T906T	NM_018482	NP_060952	WXS	Illumina HiSeq	Unspecified	Q9ULH1	ASAP1_HUMAN			27	2746	-			906			Pro-rich.		B2RNV3	Silent	SNP	ENST00000518721.1	37	c.2718A>G	CCDS6362.1	.	.	.	.	.	.	.	.	.	.	t	9.445	1.089121	0.20390	.	.	ENSG00000153317	ENST00000524124;ENST00000519483	.	.	.	5.64	-3.88	0.04205	.	.	.	.	.	T	0.50463	0.1617	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49312	-0.8953	4	.	.	.	.	7.6228	0.28195	0.0:0.2612:0.2249:0.514	.	.	.	.	G	727;263	.	.	R	-	1	2	ASAP1	131142481	0.590000	0.26815	0.969000	0.41365	0.980000	0.70556	-0.295000	0.08298	-0.511000	0.06514	-0.253000	0.11424	AGA		0.493	ASAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380170.1	NM_018482		83	271	0	0	0	0	83	271				
OC90	729330	broad.mit.edu	37	8	133036916	133036916	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr8:133036916G>A	ENST00000443356.2	-	15	1380	c.1294C>T	c.(1294-1296)Ctc>Ttc	p.L432F	OC90_ENST00000262283.5_Missense_Mutation_p.L628F|OC90_ENST00000254627.3_Missense_Mutation_p.L416F|OC90_ENST00000603859.1_Missense_Mutation_p.L416F			Q02509	OC90_HUMAN	otoconin 90	432	Phospholipase A2-like 3.				lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(23)|ovary(2)|prostate(1)|skin(1)	37	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)			GGGCACCCGAGTCTGCTTGGG	0.627																																						uc003ytg.2		NA																	0				ovary(2)|skin(1)	3						c.(1246-1248)CTC>TTC		otoconin 90							23.0	28.0	26.0					8																	133036916		2063	4187	6250	SO:0001583	missense	729330				lipid catabolic process|phospholipid metabolic process		calcium ion binding|phospholipase A2 activity	g.chr8:133036916G>A	Z14310	CCDS47919.1	8q24.22	2011-03-01			ENSG00000253117	ENSG00000253117			8100	protein-coding gene	gene with protein product		601658		PLA2L		10329003, 9860971	Standard	NM_001080399		Approved		uc011lix.1	Q02509	OTTHUMG00000164672	ENST00000443356.2:c.1294C>T	8.37:g.133036916G>A	ENSP00000390050:p.Leu432Phe		Somatic				OC90_uc011lix.1_Missense_Mutation_p.L416F	p.L416F	NM_001080399	NP_001073868	WXS	Illumina HiSeq	Unspecified	Q02509	OC90_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.000805)		13	1246	-	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		432			Phospholipase A2-like 3.		B4DNG8	Missense_Mutation	SNP	ENST00000443356.2	37	c.1246C>T		.	.	.	.	.	.	.	.	.	.	G	12.51	1.960392	0.34565	.	.	ENSG00000253117;ENSG00000253117;ENSG00000258417	ENST00000254627;ENST00000443356;ENST00000262283	T;T;T	0.32023	1.49;1.48;1.47	5.85	0.0892	0.14458	Phospholipase A2 (3);	1.902390	0.02225	N	0.064312	T	0.17916	0.0430	N	0.02539	-0.55	0.09310	N	1	P;P	0.40970	0.554;0.734	B;P	0.44772	0.331;0.46	T	0.12319	-1.0552	10	0.56958	D	0.05	2.4278	5.3264	0.15908	0.0734:0.1114:0.4744:0.3408	.	416;432	Q02509-2;Q02509	.;OC90_HUMAN	F	416;432;628	ENSP00000254627:L416F;ENSP00000390050:L432F;ENSP00000262283:L628F	ENSP00000254627:L416F	L	-	1	0	RP11-240B13.2;OC90	133106098	0.017000	0.18338	0.000000	0.03702	0.002000	0.02628	1.945000	0.40273	0.065000	0.16485	-0.169000	0.13324	CTC		0.627	OC90-201	KNOWN	basic	protein_coding	protein_coding		NM_001080399		10	36	0	0	0	0	10	36				
KDM4C	23081	broad.mit.edu	37	9	6805612	6805612	+	Missense_Mutation	SNP	A	A	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr9:6805612A>T	ENST00000381309.3	+	3	723	c.158A>T	c.(157-159)aAg>aTg	p.K53M	KDM4C_ENST00000535193.1_Missense_Mutation_p.K75M|KDM4C_ENST00000381306.3_Missense_Mutation_p.K53M|KDM4C_ENST00000543771.1_Missense_Mutation_p.K53M|KDM4C_ENST00000442236.2_Intron|KDM4C_ENST00000536108.1_De_novo_Start_OutOfFrame|KDM4C_ENST00000401787.3_Missense_Mutation_p.K53M|KDM4C_ENST00000489243.1_3'UTR	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C	53	JmjN. {ECO:0000255|PROSITE- ProRule:PRU00537}.				histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						ATTCCTCCTAAGGAGTGGAAG	0.358																																						uc003zkh.2		NA																	0				ovary(1)	1						c.(157-159)AAG>ATG		jumonji domain containing 2C isoform 1							70.0	66.0	68.0					9																	6805612		2203	4300	6503	SO:0001583	missense	23081				positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	nuclear chromatin	androgen receptor binding|enzyme binding|histone demethylase activity (H3-K9 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding	g.chr9:6805612A>T	AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	ENST00000381309.3:c.158A>T	9.37:g.6805612A>T	ENSP00000370710:p.Lys53Met		Somatic				KDM4C_uc010mhu.2_Missense_Mutation_p.K75M|KDM4C_uc010mhw.2_Missense_Mutation_p.K53M|KDM4C_uc011lmi.1_Missense_Mutation_p.K53M|KDM4C_uc011lmj.1_RNA|KDM4C_uc003zkg.2_Missense_Mutation_p.K53M|KDM4C_uc011lmk.1_Intron|KDM4C_uc010mhv.2_Missense_Mutation_p.K53M	p.K53M	NM_015061	NP_055876	WXS	Illumina HiSeq	Unspecified	Q9H3R0	KDM4C_HUMAN			3	738	+			53			JmjN.		B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	Missense_Mutation	SNP	ENST00000381309.3	37	c.158A>T	CCDS6471.1	.	.	.	.	.	.	.	.	.	.	A	19.98	3.927214	0.73327	.	.	ENSG00000107077	ENST00000535193;ENST00000543771;ENST00000401787;ENST00000381309;ENST00000381306	T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84	5.72	3.36	0.38483	Transcription factor jumonji, JmjN (2);	0.171807	0.49916	D	0.000121	T	0.69169	0.3081	H	0.94222	3.51	0.80722	D	1	P;B;P;P;B;P	0.47962	0.482;0.326;0.893;0.903;0.337;0.76	P;B;P;P;B;P	0.54590	0.544;0.255;0.454;0.623;0.446;0.756	T	0.72991	-0.4123	10	0.87932	D	0	-12.8321	9.5378	0.39233	0.853:0.0:0.147:0.0	.	53;53;53;75;53;53	F5H347;B4E1Y4;B0QZ60;F5H7P0;Q9H3R0;Q9H3R0-2	.;.;.;.;KDM4C_HUMAN;.	M	75;53;53;53;53	ENSP00000442382:K75M;ENSP00000445427:K53M;ENSP00000383990:K53M;ENSP00000370710:K53M;ENSP00000370707:K53M	ENSP00000370707:K53M	K	+	2	0	KDM4C	6795612	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	5.106000	0.64597	0.442000	0.26555	-0.256000	0.11100	AAG		0.358	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051692.1	NM_015061		19	4	0	0	0	0	19	4				
CYLC2	1539	broad.mit.edu	37	9	105767308	105767308	+	Nonsense_Mutation	SNP	C	C	G			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr9:105767308C>G	ENST00000374798.3	+	5	465	c.395C>G	c.(394-396)tCa>tGa	p.S132*	CYLC2_ENST00000487798.1_Nonsense_Mutation_p.S132*	NM_001340.3	NP_001331.1	Q14093	CYLC2_HUMAN	cylicin, basic protein of sperm head cytoskeleton 2	132	31 X 3 AA repeats of K-K-X.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)	41		all_hematologic(171;0.125)				GATTCGGAATCAGAATTAaaa	0.318																																						uc004bbs.2		NA																	0				skin(1)	1						c.(394-396)TCA>TGA		cylicin 2							51.0	50.0	50.0					9																	105767308		2201	4295	6496	SO:0001587	stop_gained	1539				cell differentiation|multicellular organismal development|spermatogenesis	cytoskeletal calyx	structural constituent of cytoskeleton	g.chr9:105767308C>G	Z46788	CCDS35085.1	9q31.2	2008-07-21			ENSG00000155833	ENSG00000155833			2583	protein-coding gene	gene with protein product		604035				7737358	Standard	NM_001340		Approved		uc004bbs.2	Q14093	OTTHUMG00000020396	ENST00000374798.3:c.395C>G	9.37:g.105767308C>G	ENSP00000420256:p.Ser132*		Somatic					p.S132*	NM_001340	NP_001331	WXS	Illumina HiSeq	Unspecified	Q14093	CYLC2_HUMAN			5	465	+		all_hematologic(171;0.125)	132			31 X 3 AA repeats of K-K-X.		B2R8F4|Q5VVJ9	Nonsense_Mutation	SNP	ENST00000374798.3	37	c.395C>G	CCDS35085.1	.	.	.	.	.	.	.	.	.	.	C	15.71	2.913394	0.52439	.	.	ENSG00000155833	ENST00000374798;ENST00000487798	.	.	.	4.0	-0.789	0.10935	.	2.743040	0.01303	N	0.010340	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	3.9602	0.2286	0.00177	0.3414:0.2514:0.1569:0.2502	.	.	.	.	X	132	.	ENSP00000420256:S132X	S	+	2	0	CYLC2	104807129	0.000000	0.05858	0.001000	0.08648	0.063000	0.16089	-1.519000	0.02243	-0.142000	0.11354	0.591000	0.81541	TCA		0.318	CYLC2-001	KNOWN	alternative_3_UTR|NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000053463.3	NM_001340		6	27	0	0	0	0	6	27				
PTPN3	5774	broad.mit.edu	37	9	112168829	112168829	+	Missense_Mutation	SNP	C	C	G	rs59324117	byFrequency	TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr9:112168829C>G	ENST00000374541.2	-	18	1809	c.1705G>C	c.(1705-1707)Gaa>Caa	p.E569Q	PTPN3_ENST00000446349.1_Missense_Mutation_p.E393Q|PTPN3_ENST00000412145.1_Missense_Mutation_p.E438Q|PTPN3_ENST00000262539.3_Missense_Mutation_p.E415Q|PTPN3_ENST00000394827.3_Missense_Mutation_p.E37Q	NM_001145368.1|NM_002829.3	NP_001138840.1|NP_002820.3	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type 3	569	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of mitotic cell cycle (GO:0045930)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of membrane depolarization during action potential (GO:0098902)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	ATPase binding (GO:0051117)|phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						TGCGTGTGTTCTGAGATGTCC	0.557													C|||	10	0.00199681	0.0061	0.0029	5008	,	,		19461	0.0		0.0	False		,,,				2504	0.0					uc004bed.2		NA																	0				ovary(3)	3						c.(1705-1707)GAA>CAA		protein tyrosine phosphatase, non-receptor type		C	GLN/GLU,GLN/GLU,GLN/GLU,GLN/GLU,GLN/GLU,GLN/GLU	18,4388	25.3+/-52.1	0,18,2185	201.0	180.0	187.0		1570,1312,1177,844,709,1705	5.7	1.0	9	dbSNP_129	187	0,8600		0,0,4300	yes	missense,missense,missense,missense,missense,missense	PTPN3	NM_001145368.1,NM_001145369.1,NM_001145370.1,NM_001145371.1,NM_001145372.1,NM_002829.3	29,29,29,29,29,29	0,18,6485	GG,GC,CC		0.0,0.4085,0.1384	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	524/869,438/783,393/738,282/627,237/582,569/914	112168829	18,12988	2203	4300	6503	SO:0001583	missense	5774				negative regulation of membrane protein ectodomain proteolysis|negative regulation of mitotic cell cycle	cytoplasm|cytoskeleton|internal side of plasma membrane	ATPase binding|cytoskeletal protein binding|phosphotyrosine binding|protein tyrosine phosphatase activity	g.chr9:112168829C>G		CCDS6776.1, CCDS48000.1, CCDS48001.1	9q31	2011-06-09			ENSG00000070159	ENSG00000070159		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9655	protein-coding gene	gene with protein product		176877				1648725	Standard	NM_002829		Approved	PTPH1	uc004bed.2	P26045	OTTHUMG00000020475	ENST00000374541.2:c.1705G>C	9.37:g.112168829C>G	ENSP00000363667:p.Glu569Gln		Somatic				PTPN3_uc004beb.2_Missense_Mutation_p.E438Q|PTPN3_uc004bec.2_Missense_Mutation_p.E393Q|PTPN3_uc010mtu.2_RNA|PTPN3_uc011lwg.1_Missense_Mutation_p.E524Q|PTPN3_uc011lwh.1_Missense_Mutation_p.E415Q|PTPN3_uc011lwd.1_Missense_Mutation_p.E37Q|PTPN3_uc011lwe.1_Missense_Mutation_p.E282Q|PTPN3_uc011lwf.1_Missense_Mutation_p.E237Q	p.E569Q	NM_002829	NP_002820	WXS	Illumina HiSeq	Unspecified	P26045	PTN3_HUMAN			18	1817	-			569			PDZ.		A0AUW9|E7EN99|E9PGU7	Missense_Mutation	SNP	ENST00000374541.2	37	c.1705G>C	CCDS6776.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	C	35	5.461878	0.96240	0.004085	0.0	ENSG00000070159	ENST00000394831;ENST00000412145;ENST00000446349;ENST00000374541;ENST00000394827;ENST00000262539	T;T;T;T;T	0.27557	1.66;1.66;1.66;1.66;1.66	5.74	5.74	0.90152	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.44726	0.1307	N	0.21583	0.68	0.80722	D	1	D;P;P	0.89917	1.0;0.771;0.774	D;P;P	0.97110	1.0;0.574;0.688	T	0.30268	-0.9984	10	0.41790	T	0.15	.	19.9077	0.97014	0.0:1.0:0.0:0.0	rs59324117	415;524;569	B7Z3H5;B7Z9V1;P26045	.;.;PTN3_HUMAN	Q	569;438;393;569;37;415	ENSP00000416654:E438Q;ENSP00000395384:E393Q;ENSP00000363667:E569Q;ENSP00000378304:E37Q;ENSP00000262539:E415Q	ENSP00000262539:E415Q	E	-	1	0	PTPN3	111208650	1.000000	0.71417	0.958000	0.39756	0.983000	0.72400	7.818000	0.86416	2.712000	0.92718	0.561000	0.74099	GAA		0.557	PTPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053598.4			87	134	0	0	0	0	87	134				
AKAP2	11217	broad.mit.edu	37	9	112899008	112899008	+	Missense_Mutation	SNP	G	G	A	rs376721653		TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr9:112899008G>A	ENST00000259318.7	+	2	698	c.491G>A	c.(490-492)cGa>cAa	p.R164Q	AKAP2_ENST00000555236.1_Missense_Mutation_p.R395Q|PALM2-AKAP2_ENST00000302798.7_Missense_Mutation_p.R395Q|AKAP2_ENST00000434623.2_Missense_Mutation_p.R253Q|AKAP2_ENST00000510514.5_Missense_Mutation_p.R395Q|AKAP2_ENST00000374525.1_Missense_Mutation_p.R253Q|PALM2-AKAP2_ENST00000374530.3_Missense_Mutation_p.R395Q	NM_001136562.2	NP_001130034.1	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2	164										breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	33						TGTTCTTCCCGAGATGGAGAG	0.572																																						uc004bei.2		NA																	0				ovary(3)|central_nervous_system(2)|skin(1)	6						c.(1879-1881)CGA>CAA		A kinase (PRKA) anchor protein 2 isoform 2		G	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	74.0	69.0	71.0		758,491,758,1184,1184	6.2	1.0	9		71	0,8600	1.2+/-3.3	0,0,4300	no	missense,missense,missense,missense,missense	AKAP2,PALM2-AKAP2	NM_001004065.4,NM_001136562.2,NM_001198656.1,NM_007203.4,NM_147150.2	43,43,43,43,43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	253/949,164/860,253/962,395/1104,395/1091	112899008	1,13005	2203	4300	6503	SO:0001583	missense	445815						enzyme binding	g.chr9:112899008G>A	AB023137	CCDS43861.1, CCDS48003.1, CCDS56581.1	9q31.3	2009-10-16			ENSG00000241978	ENSG00000241978		"""A-kinase anchor proteins"""	372	protein-coding gene	gene with protein product	"""protein kinase A2"""	604582		PRKA2		10231032	Standard	NM_001136562		Approved	AKAP-KL, KIAA0920, DKFZp564L0716		Q9Y2D5	OTTHUMG00000156811	ENST00000259318.7:c.491G>A	9.37:g.112899008G>A	ENSP00000259318:p.Arg164Gln		Somatic				PALM2-AKAP2_uc004bek.3_Missense_Mutation_p.R395Q|PALM2-AKAP2_uc004bej.3_Missense_Mutation_p.R395Q|PALM2-AKAP2_uc004bel.1_Missense_Mutation_p.R205Q|AKAP2_uc011lwi.1_Missense_Mutation_p.R253Q|AKAP2_uc004bem.2_Missense_Mutation_p.R253Q|PALM2-AKAP2_uc010mtw.1_Missense_Mutation_p.R213Q|AKAP2_uc011lwj.1_Missense_Mutation_p.R164Q|PALM2-AKAP2_uc004ben.2_Missense_Mutation_p.R164Q	p.R627Q	NM_001136562	NP_001130034	WXS	Illumina HiSeq	Unspecified	Q9Y2D5	AKAP2_HUMAN			9	2072	+			164					B1ALX9|B2RTU4|B3KQ00|B4DTZ2|B7ZW07|B9EJB5|Q9UG26	Missense_Mutation	SNP	ENST00000259318.7	37	c.1880G>A	CCDS48003.1	.	.	.	.	.	.	.	.	.	.	G	14.25	2.479630	0.44044	2.27E-4	0.0	ENSG00000157654;ENSG00000157654;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978	ENST00000374530;ENST00000302798;ENST00000555236;ENST00000510514;ENST00000434623;ENST00000374525;ENST00000480388;ENST00000259318	T;T;T;T;T;T;T;T	0.50813	0.73;0.73;0.73;0.73;0.73;0.73;0.73;0.73	6.17	6.17	0.99709	.	0.112351	0.41294	D	0.000918	T	0.55305	0.1912	M	0.62723	1.935	0.36100	D	0.84407	D;D;D;D;D;P;P;P	0.63880	0.975;0.993;0.968;0.993;0.988;0.909;0.909;0.852	B;P;B;P;P;B;B;B	0.54590	0.251;0.756;0.335;0.756;0.575;0.182;0.182;0.088	T	0.63435	-0.6638	10	0.41790	T	0.15	-15.0089	9.102	0.36673	0.1525:0.0:0.8475:0.0	.	164;253;247;253;254;395;395;213	Q9Y2D5;Q9Y2D5-7;B4E2K2;Q9Y2D5-5;B1ALY1;Q9Y2D5-6;Q9Y2D5-4;C9JVY5	AKAP2_HUMAN;.;.;.;.;.;.;.	Q	395;395;395;395;253;253;213;164	ENSP00000363654:R395Q;ENSP00000305861:R395Q;ENSP00000451476:R395Q;ENSP00000421522:R395Q;ENSP00000404782:R253Q;ENSP00000363649:R253Q;ENSP00000419268:R213Q;ENSP00000259318:R164Q	ENSP00000259318:R164Q	R	+	2	0	PALM2-AKAP2;AKAP2	111938829	0.995000	0.38212	0.972000	0.41901	0.036000	0.12997	2.513000	0.45494	2.941000	0.99782	0.655000	0.94253	CGA		0.572	AKAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346067.3	NM_001004065		47	9	0	0	0	0	47	9				
BRINP1	1620	broad.mit.edu	37	9	121929820	121929820	+	Missense_Mutation	SNP	T	T	G			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr9:121929820T>G	ENST00000265922.3	-	8	2289	c.1828A>C	c.(1828-1830)Aca>Cca	p.T610P	BRINP1_ENST00000482797.1_Intron	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	610					cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)											TCGAAAAATGTTTTCCACCGA	0.557																																						uc004bkc.2		NA																	0				skin(3)|ovary(2)|central_nervous_system(2)|large_intestine(1)	8						c.(1828-1830)ACA>CCA		deleted in bladder cancer 1 precursor							95.0	97.0	96.0					9																	121929820		2203	4300	6503	SO:0001583	missense	1620				cell cycle arrest|cell death	cytoplasm	protein binding	g.chr9:121929820T>G	AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.1828A>C	9.37:g.121929820T>G	ENSP00000265922:p.Thr610Pro		Somatic					p.T610P	NM_014618	NP_055433	WXS	Illumina HiSeq	Unspecified	O60477	DBC1_HUMAN			8	2284	-			610					Q6IPV6|Q6P1A0|Q8WU22	Missense_Mutation	SNP	ENST00000265922.3	37	c.1828A>C	CCDS6822.1	.	.	.	.	.	.	.	.	.	.	T	19.65	3.867873	0.72065	.	.	ENSG00000078725	ENST00000373969;ENST00000265922	T	0.17054	2.3	5.41	5.41	0.78517	.	0.097739	0.64402	D	0.000001	T	0.37679	0.1012	L	0.54323	1.7	0.80722	D	1	D	0.71674	0.998	D	0.73708	0.981	T	0.12811	-1.0533	10	0.87932	D	0	-14.2577	15.4523	0.75282	0.0:0.0:0.0:1.0	.	610	O60477	DBC1_HUMAN	P	610	ENSP00000265922:T610P	ENSP00000265922:T610P	T	-	1	0	DBC1	120969641	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.959000	0.87885	2.054000	0.61138	0.533000	0.62120	ACA		0.557	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055440.2	NM_014618		116	29	0	0	0	0	116	29				
MAGEB6	158809	broad.mit.edu	37	X	26212041	26212041	+	Silent	SNP	G	G	C			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chrX:26212041G>C	ENST00000379034.1	+	2	227	c.78G>C	c.(76-78)acG>acC	p.T26T		NM_173523.2	NP_775794.2	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	26										breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(18)|ovary(3)|prostate(2)	33						AGGGTCTCACGGGTCCCCAGG	0.572																																						uc004dbr.2		NA																	0				ovary(3)	3						c.(76-78)ACG>ACC		melanoma antigen family B, 6							84.0	71.0	75.0					X																	26212041		2202	4300	6502	SO:0001819	synonymous_variant	158809							g.chrX:26212041G>C	AF320514	CCDS14217.1	Xp22.12	2009-03-17			ENSG00000176746	ENSG00000176746			23796	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 4"""	300467				10861452	Standard	NM_173523		Approved	FLJ40242, MAGE-B6, MAGEB6A, CT3.4	uc004dbr.3	Q8N7X4	OTTHUMG00000021285	ENST00000379034.1:c.78G>C	X.37:g.26212041G>C			Somatic				MAGEB6_uc010ngc.1_5'UTR	p.T26T	NM_173523	NP_775794	WXS	Illumina HiSeq	Unspecified	Q8N7X4	MAGB6_HUMAN			2	227	+			26					Q6GS19|Q9H219	Silent	SNP	ENST00000379034.1	37	c.78G>C	CCDS14217.1																																																																																				0.572	MAGEB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056123.1	NM_173523		30	16	0	0	0	0	30	16				
MAGED1	9500	broad.mit.edu	37	X	51639730	51639730	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chrX:51639730C>T	ENST00000375722.1	+	4	1231	c.979C>T	c.(979-981)Cag>Tag	p.Q327*	MAGED1_ENST00000375695.2_Nonsense_Mutation_p.Q383*|MAGED1_ENST00000494718.1_3'UTR|MAGED1_ENST00000326587.7_Nonsense_Mutation_p.Q327*|MAGED1_ENST00000375772.3_Nonsense_Mutation_p.Q327*			Q9Y5V3	MAGD1_HUMAN	melanoma antigen family D, 1	327	22 X 6 AA tandem repeats of W-[PQ]-X-P-X- X.|Pro-rich.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|circadian regulation of gene expression (GO:0032922)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of circadian rhythm (GO:0042752)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(4)|large_intestine(10)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	32	Ovarian(276;0.236)					TCCAGCTAGGCAGACCCCACC	0.602										Multiple Myeloma(10;0.10)																												uc004dpm.2		NA																	0				ovary(3)	3						c.(979-981)CAG>TAG		melanoma antigen family D, 1 isoform b							61.0	58.0	59.0					X																	51639730		2203	4300	6503	SO:0001587	stop_gained	9500				apoptosis|induction of apoptosis by extracellular signals|negative regulation of epithelial cell proliferation|nerve growth factor receptor signaling pathway|regulation of transcription, DNA-dependent	cytoplasm|plasma membrane|protein complex	protein binding	g.chrX:51639730C>T	AF124440	CCDS14337.1, CCDS35279.1	Xp11.23	2008-08-01			ENSG00000179222	ENSG00000179222			6813	protein-coding gene	gene with protein product		300224				10409427	Standard	NM_006986		Approved	NRAGE, DLXIN-1	uc004dpn.3	Q9Y5V3	OTTHUMG00000021540	ENST00000375722.1:c.979C>T	X.37:g.51639730C>T	ENSP00000364874:p.Gln327*	Multiple Myeloma(10;0.10)	Somatic				MAGED1_uc004dpn.2_Nonsense_Mutation_p.Q383*|MAGED1_uc004dpo.2_Nonsense_Mutation_p.Q327*	p.Q327*	NM_001005332	NP_001005332	WXS	Illumina HiSeq	Unspecified	Q9Y5V3	MAGD1_HUMAN			4	1074	+	Ovarian(276;0.236)		327			Pro-rich.|22 X 6 AA tandem repeats of W-[PQ]-X-P-X- X.		Q5VSH6|Q8IZ84|Q8WY92|Q9H352|Q9HBT4|Q9UF36	Nonsense_Mutation	SNP	ENST00000375722.1	37	c.979C>T	CCDS14337.1	.	.	.	.	.	.	.	.	.	.	C	34	5.339155	0.95783	.	.	ENSG00000179222	ENST00000375772;ENST00000375722;ENST00000326587;ENST00000375695	.	.	.	3.67	3.67	0.42095	.	0.000000	0.33127	N	0.005258	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.7603	0.57361	0.0:1.0:0.0:0.0	.	.	.	.	X	327;327;327;383	.	ENSP00000325333:Q327X	Q	+	1	0	MAGED1	51656470	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	1.630000	0.37081	1.779000	0.52309	0.284000	0.19432	CAG		0.602	MAGED1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056593.1	NM_001005332		30	9	0	0	0	0	30	9				
NRK	203447	broad.mit.edu	37	X	105179222	105179222	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chrX:105179222T>C	ENST00000243300.9	+	21	3863	c.3560T>C	c.(3559-3561)gTt>gCt	p.V1187A	NRK_ENST00000428173.2_Missense_Mutation_p.V1188A	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	1187					activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						GAAGTCAATGTTAACCCACTC	0.418										HNSCC(51;0.14)																												uc004emd.2		NA																	0				breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						c.(3559-3561)GTT>GCT		Nik related kinase							211.0	188.0	195.0					X																	105179222		1914	4114	6028	SO:0001583	missense	203447						ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity	g.chrX:105179222T>C	BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.3560T>C	X.37:g.105179222T>C	ENSP00000434830:p.Val1187Ala	HNSCC(51;0.14)	Somatic				NRK_uc010npc.1_Missense_Mutation_p.V855A	p.V1187A	NM_198465	NP_940867	WXS	Illumina HiSeq	Unspecified	Q7Z2Y5	NRK_HUMAN			21	3863	+			1187					Q32ND6|Q5H9K2|Q6ZMP2	Missense_Mutation	SNP	ENST00000243300.9	37	c.3560T>C		.	.	.	.	.	.	.	.	.	.	T	15.78	2.933432	0.52866	.	.	ENSG00000123572	ENST00000243300;ENST00000428173	D;D	0.87966	-2.3;-2.32	5.08	5.08	0.68730	.	0.000000	0.41938	D	0.000790	D	0.87200	0.6118	N	0.19112	0.55	0.80722	D	1	D;D	0.76494	0.999;0.993	D;D	0.80764	0.994;0.967	D	0.88238	0.2908	10	0.87932	D	0	.	9.9722	0.41761	0.0:0.0:0.0:1.0	.	855;1187	Q7Z2Y5-2;Q7Z2Y5	.;NRK_HUMAN	A	1187;1188	ENSP00000434830:V1187A;ENSP00000438378:V1188A	ENSP00000434830:V1187A	V	+	2	0	NRK	105065878	1.000000	0.71417	1.000000	0.80357	0.300000	0.27592	5.855000	0.69510	1.878000	0.54408	0.486000	0.48141	GTT		0.418	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000106480.6	NM_198465		61	26	0	0	0	0	61	26				
GPR112	139378	broad.mit.edu	37	X	135439890	135439890	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chrX:135439890G>C	ENST00000394143.1	+	10	7246	c.6955G>C	c.(6955-6957)Gct>Cct	p.A2319P	GPR112_ENST00000412101.1_Missense_Mutation_p.A2114P|GPR112_ENST00000287534.4_Intron|GPR112_ENST00000394141.1_Missense_Mutation_p.A2114P|GPR112_ENST00000370652.1_Missense_Mutation_p.A2319P	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	2319					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					ACAAGAAATGGCTACAATTTC	0.348																																						uc004ezu.1		NA																	0				ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12						c.(6955-6957)GCT>CCT		G-protein coupled receptor 112							226.0	208.0	214.0					X																	135439890		2203	4300	6503	SO:0001583	missense	139378				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chrX:135439890G>C	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.6955G>C	X.37:g.135439890G>C	ENSP00000377699:p.Ala2319Pro		Somatic				GPR112_uc010nsb.1_Missense_Mutation_p.A2114P|GPR112_uc010nsc.1_Intron	p.A2319P	NM_153834	NP_722576	WXS	Illumina HiSeq	Unspecified	Q8IZF6	GP112_HUMAN			10	7246	+	Acute lymphoblastic leukemia(192;0.000127)		2319			Extracellular (Potential).		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	c.6955G>C	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	G	16.70	3.194699	0.58017	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000394141	T;T;T;T	0.32515	1.48;1.48;1.45;1.45	5.43	1.72	0.24424	.	.	.	.	.	T	0.27241	0.0668	N	0.08118	0	0.80722	D	1	D;D	0.71674	0.998;0.993	D;P	0.64877	0.93;0.759	T	0.05699	-1.0869	9	0.40728	T	0.16	.	7.3163	0.26503	0.3766:0.0:0.6234:0.0	.	2114;2319	Q8IZF6-3;Q8IZF6	.;GP112_HUMAN	P	2319;2319;2114;2114	ENSP00000377699:A2319P;ENSP00000359686:A2319P;ENSP00000416526:A2114P;ENSP00000377697:A2114P	ENSP00000359686:A2319P	A	+	1	0	GPR112	135267556	0.999000	0.42202	0.989000	0.46669	0.859000	0.49053	0.888000	0.28268	-0.014000	0.14175	-0.192000	0.12808	GCT		0.348	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			5	126	0	0	0	0	5	126				
AHDC1	27245	broad.mit.edu	37	1	27875791	27875792	+	Frame_Shift_Ins	INS	-	-	G			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr1:27875791_27875792insG	ENST00000247087.5	-	5	3431_3432	c.2835_2836insC	c.(2833-2838)cccaagfs	p.K946fs	AHDC1_ENST00000374011.2_Frame_Shift_Ins_p.K946fs			Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	946							DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		GGCACCAGCTTGGGGAAGGTCT	0.678																																						uc009vsy.2		NA																	0				central_nervous_system(1)	1						c.(2833-2838)CCCAAGfs		AT hook, DNA binding motif, containing 1																																				SO:0001589	frameshift_variant	27245						DNA binding	g.chr1:27875791_27875792insG	AK125431	CCDS30652.1	1p36.13	2008-02-05			ENSG00000126705	ENSG00000126705			25230	protein-coding gene	gene with protein product		615790				8619474, 9110174	Standard	XM_005245848		Approved	DJ159A19.3, RP1-159A19.1	uc009vsy.3	Q5TGY3	OTTHUMG00000003398	ENST00000247087.5:c.2836dupC	1.37:g.27875795_27875795dupG	ENSP00000247087:p.Lys946fs		Somatic				AHDC1_uc009vsz.1_Frame_Shift_Ins_p.P945fs	p.P945fs	NM_001029882	NP_001025053	WXS	Illumina HiSeq	Unspecified	Q5TGY3	AHDC1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)	6	3804_3805	-		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)	945_946					Q5TGY4|Q6PJK1|Q6ZUQ6|Q99769|Q9NUF5	Frame_Shift_Ins	INS	ENST00000247087.5	37	c.2835_2836insC	CCDS30652.1																																																																																				0.678	AHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009523.3			56	33	NA	NA	NA	NA	56	33	---	---	---	---
SLC6A9	6536	broad.mit.edu	37	1	44467092	44467094	+	In_Frame_Del	DEL	GAA	GAA	-			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr1:44467092_44467094delGAA	ENST00000360584.2	-	9	1578_1580	c.1387_1389delTTC	c.(1387-1389)ttcdel	p.F463del	SLC6A9_ENST00000537678.1_In_Frame_Del_p.F325del|SLC6A9_ENST00000357730.2_In_Frame_Del_p.F409del|SLC6A9_ENST00000372310.3_In_Frame_Del_p.F390del|SLC6A9_ENST00000372306.3_In_Frame_Del_p.F390del|SLC6A9_ENST00000372307.3_In_Frame_Del_p.F325del|SLC6A9_ENST00000475075.2_In_Frame_Del_p.F279del	NM_201649.3	NP_964012.2	P48067	SC6A9_HUMAN	solute carrier family 6 (neurotransmitter transporter, glycine), member 9	463					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycine:sodium symporter activity (GO:0015375)|neurotransmitter:sodium symporter activity (GO:0005328)			endometrium(3)|large_intestine(8)|lung(7)|ovary(1)|skin(1)|urinary_tract(2)	22	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)			Glycine(DB00145)	GGATAAGCATGAAGAAGAAGAGC	0.64																																						uc001cll.2		NA																	0					0						c.(1387-1389)TTCdel		solute carrier family 6 member 9 isoform 2	Glycine(DB00145)																																			SO:0001651	inframe_deletion	6536					integral to plasma membrane|membrane fraction	glycine:sodium symporter activity|neurotransmitter:sodium symporter activity	g.chr1:44467092_44467094delGAA	S70609	CCDS30695.1, CCDS41316.1, CCDS41317.1	1p33	2013-05-22			ENSG00000196517	ENSG00000196517		"""Solute carriers"""	11056	protein-coding gene	gene with protein product		601019				8183239, 7587377	Standard	NM_006934		Approved	GLYT1	uc001cll.4	P48067	OTTHUMG00000008294	ENST00000360584.2:c.1387_1389delTTC	1.37:g.44467098_44467100delGAA	ENSP00000353791:p.Phe463del		Somatic				SLC6A9_uc009vxe.2_In_Frame_Del_p.F319del|SLC6A9_uc010okm.1_In_Frame_Del_p.F390del|SLC6A9_uc001clm.2_In_Frame_Del_p.F409del|SLC6A9_uc009vxd.2_RNA|SLC6A9_uc010okn.1_In_Frame_Del_p.F394del|SLC6A9_uc001cln.2_In_Frame_Del_p.F390del|SLC6A9_uc010oko.1_In_Frame_Del_p.F279del|SLC6A9_uc010okp.1_RNA	p.F463del	NM_201649	NP_964012	WXS	Illumina HiSeq	Unspecified	P48067	SC6A9_HUMAN			9	1579_1581	-	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)	463			Helical; Name=8; (Potential).		A6NDH1|A6NII2|A6NNZ8|Q5TAB8|Q5TAB9|Q5TAC0	In_Frame_Del	DEL	ENST00000360584.2	37	c.1387_1389delTTC	CCDS41317.1																																																																																				0.640	SLC6A9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000022825.2	NM_201649		29	68	NA	NA	NA	NA	29	68	---	---	---	---
SLITRK5	26050	broad.mit.edu	37	13	88328028	88328029	+	Frame_Shift_Ins	INS	-	-	G	rs376984309|rs202195168	byFrequency	TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr13:88328028_88328029insG	ENST00000325089.6	+	2	604_605	c.385_386insG	c.(385-387)cggfs	p.R129fs	SLITRK5_ENST00000400028.3_Intron	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	129					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					CCATGGGCTACGGGGTTTGAGG	0.45																																						uc001vln.2		NA																	0				ovary(2)|pancreas(2)|central_nervous_system(1)	5						c.(385-387)CGGfs		SLIT and NTRK-like family, member 5 precursor																																				SO:0001589	frameshift_variant	26050					integral to membrane		g.chr13:88328028_88328029insG	AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.389dupG	13.37:g.88328032_88328032dupG	ENSP00000366283:p.Arg129fs		Somatic				SLITRK5_uc010tic.1_Intron	p.R129fs	NM_015567	NP_056382	WXS	Illumina HiSeq	Unspecified	O94991	SLIK5_HUMAN			2	604_605	+	all_neural(89;0.101)|Medulloblastoma(90;0.163)		129			Extracellular (Potential).		B3KNB8|B4DSH5|Q5VT81	Frame_Shift_Ins	INS	ENST00000325089.6	37	c.385_386insG	CCDS9465.1																																																																																				0.450	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045416.3			71	108	NA	NA	NA	NA	71	108	---	---	---	---
TP53	7157	broad.mit.edu	37	17	7577032	7577033	+	Frame_Shift_Del	DEL	CC	CC	-			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr17:7577032_7577033delCC	ENST00000269305.4	-	8	1094_1095	c.905_906delGG	c.(904-906)gggfs	p.G302fs	TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Frame_Shift_Del_p.G302fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Frame_Shift_Del_p.G302fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.G302fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.G302fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	302	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.		G -> A (in a sporadic cancer; somatic mutation).|G -> E (in sporadic cancers; somatic mutation).|G -> R (in a sporadic cancer; somatic mutation).|G -> V (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.?(3)|p.G302E(3)|p.G302G(3)|p.P301_S303delPGS(1)|p.L299fs*2(1)|p.L265_K305del41(1)|p.G302fs*2(1)|p.S303fs*42(1)|p.G293fs*1(1)|p.H296_S303delHHELPPGS(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCTTAGTGCTCCCTGGGGGCAG	0.554		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		24	Whole gene deletion(8)|Deletion - Frameshift(4)|Deletion - In frame(3)|Unknown(3)|Substitution - Missense(3)|Substitution - coding silent(3)	p.0?(7)|p.G302fs*4(4)|p.?(3)|p.G302E(3)|p.G302G(3)|p.P301_S303delPGS(1)|p.L299fs*2(1)|p.L265_K305del41(1)|p.G302fs*2(1)|p.S303fs*42(1)|p.G293fs*1(1)|p.H296_S303delHHELPPGS(1)	bone(5)|breast(4)|haematopoietic_and_lymphoid_tissue(3)|lung(3)|large_intestine(2)|stomach(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|oesophagus(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245						c.(904-906)GGGfs	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a																																				SO:0001589	frameshift_variant	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7577032_7577033delCC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.905_906delGG	17.37:g.7577032_7577033delCC	ENSP00000269305:p.Gly302fs	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)	Somatic				TP53_uc002gig.1_Intron|TP53_uc002gih.2_Frame_Shift_Del_p.G302fs|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Frame_Shift_Del_p.G170fs|TP53_uc010cng.1_Frame_Shift_Del_p.G170fs|TP53_uc002gii.1_Frame_Shift_Del_p.G170fs|TP53_uc010cnh.1_Frame_Shift_Del_p.G302fs|TP53_uc010cni.1_Frame_Shift_Del_p.G302fs|TP53_uc002gij.2_Frame_Shift_Del_p.G302fs	p.G302fs	NM_001126112	NP_001119584	WXS	Illumina HiSeq	Unspecified	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	8	1099_1100	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	302		G -> R (in a sporadic cancer; somatic mutation).|G -> E (in sporadic cancers; somatic mutation).|G -> A (in a sporadic cancer; somatic mutation).|G -> V (in a sporadic cancer; somatic mutation).	Interaction with HIPK1 (By similarity).|Interaction with CARM1.		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	37	c.905_906delGG	CCDS11118.1																																																																																				0.554	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		43	70	NA	NA	NA	NA	43	70	---	---	---	---
AKAP1	8165	broad.mit.edu	37	17	55189196	55189197	+	Frame_Shift_Ins	INS	-	-	T	rs370264763		TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr17:55189196_55189197insT	ENST00000337714.3	+	4	2119_2120	c.1886_1887insT	c.(1885-1890)tatgtgfs	p.V630fs	AKAP1_ENST00000539273.1_Frame_Shift_Ins_p.V630fs|AKAP1_ENST00000571629.1_Frame_Shift_Ins_p.V630fs|AKAP1_ENST00000572557.1_Frame_Shift_Ins_p.V630fs	NM_003488.3	NP_003479.1	Q92667	AKAP1_HUMAN	A kinase (PRKA) anchor protein 1	630	KH. {ECO:0000255|PROSITE- ProRule:PRU00117}.				blood coagulation (GO:0007596)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(2)|liver(1)|lung(7)|ovary(2)|pancreas(1)|skin(1)	14	Breast(9;5.46e-08)					CAGGGGCGCTATGTGAGTTTTC	0.48																																						uc002iux.2		NA																	0				ovary(1)	1						c.(1885-1887)TATfs		A-kinase anchor protein 1 precursor																																				SO:0001589	frameshift_variant	8165				blood coagulation	cytosol|integral to membrane|mitochondrial outer membrane	protein binding|RNA binding	g.chr17:55189196_55189197insT	X97335	CCDS11594.1	17q22	2013-01-23			ENSG00000121057	ENSG00000121057		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Tudor domain containing"""	367	protein-coding gene	gene with protein product	"""protein kinase anchoring protein 1"", ""dual specificity A-kinase-anchoring protein 1"", ""protein phosphatase 1, regulatory subunit 43"", ""tudor domain containing 17"""	602449		PRKA1		8769136, 7499250	Standard	NM_003488		Approved	AKAP121, AKAP149, SAKAP84, S-AKAP84, AKAP84, D-AKAP1, PPP1R43, TDRD17	uc002iux.3	Q92667	OTTHUMG00000140369	ENST00000337714.3:c.1887dupT	17.37:g.55189197_55189197dupT	ENSP00000337736:p.Val630fs		Somatic				AKAP1_uc010wnl.1_Frame_Shift_Ins_p.Y629fs|AKAP1_uc002iuy.2_RNA|AKAP1_uc010dcm.2_Frame_Shift_Ins_p.Y629fs	p.Y629fs	NM_003488	NP_003479	WXS	Illumina HiSeq	Unspecified	Q92667	AKAP1_HUMAN			4	2117_2118	+	Breast(9;5.46e-08)		629			KH.		A8K8Q1|D3DTZ0|Q13320|Q9BW14	Frame_Shift_Ins	INS	ENST00000337714.3	37	c.1886_1887insT	CCDS11594.1																																																																																				0.480	AKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277069.1			86	100	NA	NA	NA	NA	86	100	---	---	---	---
MARK4	57787	broad.mit.edu	37	19	45762300	45762300	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr19:45762300delC	ENST00000262891.4	+	2	436	c.105delC	c.(103-105)agcfs	p.S35fs	MARK4_ENST00000300843.4_Frame_Shift_Del_p.S35fs	NM_001199867.1	NP_001186796.1	Q96L34	MARK4_HUMAN	MAP/microtubule affinity-regulating kinase 4	35					microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nervous system development (GO:0007399)|positive regulation of programmed cell death (GO:0043068)|protein phosphorylation (GO:0006468)	centrosome (GO:0005813)|microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|microtubule binding (GO:0008017)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)|ubiquitin binding (GO:0043130)			NS(1)|biliary_tract(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	31		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		CCTGGTCCAGCCGCTCACTGG	0.662																																						uc002pbb.1		NA																	0				central_nervous_system(2)|large_intestine(1)	3						c.(103-105)AGCfs		RecName: Full=MAP/microtubule affinity-regulating kinase 4;          EC=2.7.11.1; AltName: Full=MAP/microtubule affinity-regulating kinase-like 1;							35.0	30.0	31.0					19																	45762300		2203	4300	6503	SO:0001589	frameshift_variant	57787				microtubule bundle formation|nervous system development|positive regulation of programmed cell death	centrosome|neuron projection	ATP binding|gamma-tubulin binding|microtubule binding|protein serine/threonine kinase activity|tau-protein kinase activity|ubiquitin binding	g.chr19:45762300delC	AB049127	CCDS12658.1, CCDS56097.1	19q13.32	2014-04-07	2002-06-12	2002-06-14	ENSG00000007047	ENSG00000007047	2.7.11.1		13538	protein-coding gene	gene with protein product		606495	"""MAP/microtubule affinity-regulating kinase like 1"""	MARKL1		23400999, 11326310, 9108484	Standard	NM_001199867		Approved	Nbla00650, FLJ90097, KIAA1860, PAR-1D	uc002paz.2	Q96L34	OTTHUMG00000181769	ENST00000262891.4:c.105delC	19.37:g.45762300delC	ENSP00000262891:p.Ser35fs		Somatic				MARK4_uc002paz.1_Intron|MARK4_uc002pba.1_Frame_Shift_Del_p.S35fs	p.S35fs			WXS	Illumina HiSeq	Unspecified	Q96L34	MARK4_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.0102)	2	110	+		all_neural(266;0.224)|Ovarian(192;0.231)	35					Q8NG37|Q96JG7|Q96SQ2|Q9BYD8	Frame_Shift_Del	DEL	ENST00000262891.4	37	c.105delC	CCDS56097.1																																																																																				0.662	MARK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457537.1	NM_031417		16	28	NA	NA	NA	NA	16	28	---	---	---	---
ACSS2	55902	broad.mit.edu	37	20	33502206	33502206	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr20:33502206delC	ENST00000360596.2	+	7	1011	c.800delC	c.(799-801)tccfs	p.S267fs	ACSS2_ENST00000253382.5_Frame_Shift_Del_p.S267fs|ACSS2_ENST00000336325.4_Frame_Shift_Del_p.S217fs|ACSS2_ENST00000476922.1_Intron	NM_018677.3	NP_061147.1	Q9NR19	ACSA_HUMAN	acyl-CoA synthetase short-chain family member 2	267					acetate biosynthetic process (GO:0019413)|acetyl-CoA biosynthetic process from acetate (GO:0019427)|ethanol oxidation (GO:0006069)|lipid biosynthetic process (GO:0008610)|propionate biosynthetic process (GO:0019542)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	acetate-CoA ligase activity (GO:0003987)|AMP binding (GO:0016208)|ATP binding (GO:0005524)			cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(9)	21					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	ACCAGCCAGTCCCCCCCAATT	0.537																																						uc002xbd.2		NA																	0					0						c.(799-801)TCCfs		acyl-CoA synthetase short-chain family member 2	Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)						45.0	40.0	42.0					20																	33502206		2203	4300	6503	SO:0001589	frameshift_variant	55902				ethanol oxidation|lipid biosynthetic process|xenobiotic metabolic process	cytosol|nucleus	acetate-CoA ligase activity|ATP binding|protein binding	g.chr20:33502206delC	AF263614	CCDS13243.1, CCDS42868.1, CCDS42868.2	20q11.22	2012-07-13	2005-09-08	2005-09-08	ENSG00000131069	ENSG00000131069	6.2.1.1	"""Acyl-CoA synthetase family"""	15814	protein-coding gene	gene with protein product		605832	"""acetyl-Coenzyme A synthetase 2 (ADP forming)"""	ACAS2		10843999	Standard	NM_018677		Approved	ACS, ACSA, AceCS, dJ1161H23.1	uc010gey.2	Q9NR19	OTTHUMG00000032317	ENST00000360596.2:c.800delC	20.37:g.33502206delC	ENSP00000353804:p.Ser267fs		Somatic				ACSS2_uc002xbc.2_Frame_Shift_Del_p.S172fs|ACSS2_uc010zum.1_Intron|ACSS2_uc010gey.2_Frame_Shift_Del_p.S267fs|ACSS2_uc002xbe.2_Intron|ACSS2_uc002xbf.2_Intron	p.S267fs	NM_018677	NP_061147	WXS	Illumina HiSeq	Unspecified	Q9NR19	ACSA_HUMAN			7	921	+			267					A6NE90|Q5QPH2|Q5QPH3|Q8N238|Q96EL0|Q9NQP7|Q9UJ15	Frame_Shift_Del	DEL	ENST00000360596.2	37	c.800delC	CCDS13243.1																																																																																				0.537	ACSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078823.3	NM_018677		20	64	NA	NA	NA	NA	20	64	---	---	---	---
ETV5	2119	broad.mit.edu	37	3	185797720	185797721	+	Frame_Shift_Ins	INS	-	-	G			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr3:185797720_185797721insG	ENST00000306376.5	-	7	781_782	c.535_536insC	c.(535-537)catfs	p.H179fs	ETV5-AS1_ENST00000453370.1_RNA|ETV5_ENST00000434744.1_Frame_Shift_Ins_p.H179fs|ETV5_ENST00000537818.1_Frame_Shift_Ins_p.H221fs	NM_004454.2	NP_004445.1	P41161	ETV5_HUMAN	ets variant 5	179					cell differentiation (GO:0030154)|cellular response to oxidative stress (GO:0034599)|locomotory behavior (GO:0007626)|male germ-line stem cell asymmetric division (GO:0048133)|neuromuscular synaptic transmission (GO:0007274)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of synapse organization (GO:0050807)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|cervix(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	28	all_cancers(143;4.06e-12)|Ovarian(172;0.0386)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.62e-24)			TGGAAGCGAATGGGGGGCGGGG	0.614			T	"""TMPRSS2, SCL45A3"""	Prostate																																	uc003fpz.2		NA		Dom	yes		3	3q28	2119	T	ets variant gene 5			E	TMPRSS2|SCL45A3		Prostate 		0				ovary(2)|skin(2)|breast(1)	5						c.(535-537)CATfs		ets variant gene 5 (ets-related molecule)																																				SO:0001589	frameshift_variant	2119				cellular response to oxidative stress	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding	g.chr3:185797720_185797721insG	BC007333	CCDS33906.1	3q28	2008-09-12	2008-09-12		ENSG00000244405	ENSG00000244405			3494	protein-coding gene	gene with protein product	"""ets-related molecule"""	601600	"""ets variant gene 5 (ets-related molecule)"""			8152800	Standard	NM_004454		Approved	ERM	uc003fpz.3	P41161	OTTHUMG00000156639	ENST00000306376.5:c.536dupC	3.37:g.185797726_185797726dupG	ENSP00000306894:p.His179fs		Somatic				ETV5_uc003fpy.2_Frame_Shift_Ins_p.H221fs	p.H179fs	NM_004454	NP_004445	WXS	Illumina HiSeq	Unspecified	P41161	ETV5_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;1.62e-24)		7	782_783	-	all_cancers(143;4.06e-12)|Ovarian(172;0.0386)|Breast(254;0.247)		179					A6NH46|B7Z7D7|Q6IBN5	Frame_Shift_Ins	INS	ENST00000306376.5	37	c.535_536insC	CCDS33906.1																																																																																				0.614	ETV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344947.1	NM_004454		40	181	NA	NA	NA	NA	40	181	---	---	---	---
RREB1	6239	broad.mit.edu	37	6	7211049	7211071	+	Frame_Shift_Del	DEL	CCATGAGAAGGACCCTAACAGTG	CCATGAGAAGGACCCTAACAGTG	-			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr6:7211049_7211071delCCATGAGAAGGACCCTAACAGTG	ENST00000349384.6	+	7	752_774	c.438_460delCCATGAGAAGGACCCTAACAGTG	c.(436-462)atccatgagaaggaccctaacagtgccfs	p.HEKDPNSA147fs	RREB1_ENST00000379938.2_Frame_Shift_Del_p.HEKDPNSA147fs|RREB1_ENST00000334984.6_Frame_Shift_Del_p.HEKDPNSA147fs|RREB1_ENST00000379933.3_Frame_Shift_Del_p.HEKDPNSA147fs	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	147					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				ATATGAAGATCCATGAGAAGGACCCTAACAGTGCCACAGCCAC	0.439																																						uc003mxc.2		NA																	0				ovary(4)|large_intestine(2)|pancreas(2)|skin(2)|breast(1)	11						c.(436-462)ATCCATGAGAAGGACCCTAACAGTGCCfs		ras responsive element binding protein 1 isoform																																				SO:0001589	frameshift_variant	6239				multicellular organismal development|positive regulation of transcription, DNA-dependent|Ras protein signal transduction|transcription from RNA polymerase II promoter	cytoplasm|nuclear speck	DNA binding|zinc ion binding	g.chr6:7211049_7211071delCCATGAGAAGGACCCTAACAGTG	U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.438_460delCCATGAGAAGGACCCTAACAGTG	6.37:g.7211049_7211071delCCATGAGAAGGACCCTAACAGTG	ENSP00000305560:p.His147fs		Somatic				RREB1_uc010jnw.2_Frame_Shift_Del_p.I146fs|RREB1_uc003mxb.2_Frame_Shift_Del_p.I146fs|RREB1_uc010jnx.2_Frame_Shift_Del_p.I146fs|RREB1_uc003mxd.2_Frame_Shift_Del_p.I146fs	p.I146fs	NM_001003698	NP_001003698	WXS	Illumina HiSeq	Unspecified	Q92766	RREB1_HUMAN			7	828_850	+	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)	146_154					A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Frame_Shift_Del	DEL	ENST00000349384.6	37	c.438_460delCCATGAGAAGGACCCTAACAGTG	CCDS34336.1																																																																																				0.439	RREB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352985.1			12	87	NA	NA	NA	NA	12	87	---	---	---	---
HIST1H1B	3009	broad.mit.edu	37	6	27835121	27835121	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr6:27835121delC	ENST00000331442.3	-	1	238	c.187delG	c.(187-189)gcafs	p.A64fs		NM_005322.2	NP_005313.1	P16401	H15_HUMAN	histone cluster 1, H1b	64	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				chromatin organization (GO:0006325)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|positive regulation of cell growth (GO:0030307)|positive regulation of histone H3-K9 methylation (GO:0051574)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(12)|prostate(2)|upper_aerodigestive_tract(2)	24						TTAAGGGCTGCCAAAGAAAGG	0.607																																						uc003njx.2		NA																	0				large_intestine(2)|lung(1)	3						c.(187-189)GCAfs		histone cluster 1, H1b							87.0	96.0	93.0					6																	27835121		2203	4300	6503	SO:0001589	frameshift_variant	3009				nucleosome assembly	nucleosome|nucleus	DNA binding	g.chr6:27835121delC	AF531304	CCDS4635.1	6p22.1	2012-05-04	2006-10-11	2003-02-14	ENSG00000184357	ENSG00000184357		"""Histones / Replication-dependent"""	4719	protein-coding gene	gene with protein product		142711	"""H1 histone family, member 5"", ""histone 1, H1b"""	H1F5		9031620, 9119399, 12408966	Standard	NM_005322		Approved	H1.5, H1b, H1s-3	uc003njx.3	P16401	OTTHUMG00000016139	ENST00000331442.3:c.187delG	6.37:g.27835121delC	ENSP00000330074:p.Ala64fs		Somatic					p.A63fs	NM_005322	NP_005313	WXS	Illumina HiSeq	Unspecified	P16401	H15_HUMAN			1	239	-			63			H15.		Q14529|Q3MJ42	Frame_Shift_Del	DEL	ENST00000331442.3	37	c.187delG	CCDS4635.1																																																																																				0.607	HIST1H1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043371.1	NM_005322		14	166	NA	NA	NA	NA	14	166	---	---	---	---
RP1L1	94137	broad.mit.edu	37	8	10467489	10467503	+	In_Frame_Del	DEL	CTGCACCCCCTCTTC	CTGCACCCCCTCTTC	-	rs200962459|rs116242305|rs146799763|rs202231496	byFrequency	TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr8:10467489_10467503delCTGCACCCCCTCTTC	ENST00000382483.3	-	4	4328_4342	c.4105_4119delGAAGAGGGGGTGCAG	c.(4105-4119)gaagagggggtgcagdel	p.EEGVQ1369del		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1449	8 X 16 AA approximate tandem repeats of T-E-E-G-L-Q-E-E-G-V-Q-L-E-E-T-K.		Missing (in allele RP1L1-1).|Missing (in allele RP1L1-2).|Missing (in allele RP1L1-3).		cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		CTTCCTCTAACTGCACCCCCTCTTCTTGCAGCCct	0.498																																						uc003wtc.2		NA																	0				ovary(4)|breast(3)|central_nervous_system(1)	8						c.(4105-4119)GAAGAGGGGGTGCAGdel		retinitis pigmentosa 1-like 1																																				SO:0001651	inframe_deletion	94137				intracellular signal transduction			g.chr8:10467489_10467503delCTGCACCCCCTCTTC	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.4105_4119delGAAGAGGGGGTGCAG	8.37:g.10467489_10467503delCTGCACCCCCTCTTC	ENSP00000371923:p.Glu1369_Gln1373del		Somatic					p.EEGVQ1369del	NM_178857	NP_849188	WXS	Illumina HiSeq	Unspecified	Q8IWN7	RP1L1_HUMAN		COAD - Colon adenocarcinoma(149;0.0811)	4	4334_4348	-			1369_1373					Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	In_Frame_Del	DEL	ENST00000382483.3	37	c.4105_4119delGAAGAGGGGGTGCAG	CCDS43708.1																																																																																				0.498	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			10	201	NA	NA	NA	NA	10	201	---	---	---	---
PLEC	5339	broad.mit.edu	37	8	144992466	144992479	+	Frame_Shift_Del	DEL	GCTGGGCTCTGACA	GCTGGGCTCTGACA	-			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr8:144992466_144992479delGCTGGGCTCTGACA	ENST00000322810.4	-	32	12090_12103	c.11921_11934delTGTCAGAGCCCAGC	c.(11920-11934)ctgtcagagcccagcfs	p.LSEPS3974fs	PLEC_ENST00000527096.1_Frame_Shift_Del_p.LSEPS3860fs|PLEC_ENST00000398774.2_Frame_Shift_Del_p.LSEPS3805fs|PLEC_ENST00000436759.2_Frame_Shift_Del_p.LSEPS3864fs|PLEC_ENST00000356346.3_Frame_Shift_Del_p.LSEPS3823fs|PLEC_ENST00000354589.3_Frame_Shift_Del_p.LSEPS3837fs|PLEC_ENST00000345136.3_Frame_Shift_Del_p.LSEPS3837fs|PLEC_ENST00000357649.2_Frame_Shift_Del_p.LSEPS3841fs|PLEC_ENST00000354958.2_Frame_Shift_Del_p.LSEPS3815fs	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	3974	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						TGCGCACCTCGCTGGGCTCTGACAGCTGGTCGTG	0.692																																						uc003zaf.1		NA																	0				large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						c.(11920-11934)CTGTCAGAGCCCAGCfs		plectin isoform 1																																				SO:0001589	frameshift_variant	5339				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle	g.chr8:144992466_144992479delGCTGGGCTCTGACA	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.11921_11934delTGTCAGAGCCCAGC	8.37:g.144992466_144992479delGCTGGGCTCTGACA	ENSP00000323856:p.Leu3974fs		Somatic				PLEC_uc003zab.1_Frame_Shift_Del_p.L3837fs|PLEC_uc003zac.1_Frame_Shift_Del_p.L3841fs|PLEC_uc003zad.2_Frame_Shift_Del_p.L3837fs|PLEC_uc003zae.1_Frame_Shift_Del_p.L3805fs|PLEC_uc003zag.1_Frame_Shift_Del_p.L3815fs|PLEC_uc003zah.2_Frame_Shift_Del_p.L3823fs|PLEC_uc003zaj.2_Frame_Shift_Del_p.L3864fs	p.L3974fs	NM_201380	NP_958782	WXS	Illumina HiSeq	Unspecified	Q15149	PLEC_HUMAN			32	12091_12104	-			3974_3978			Plectin 21.|Globular 2.		Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Frame_Shift_Del	DEL	ENST00000322810.4	37	c.11921_11934delTGTCAGAGCCCAGC	CCDS43772.1																																																																																				0.692	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445		9	26	NA	NA	NA	NA	9	26	---	---	---	---
LRRC19	64922	broad.mit.edu	37	9	26999638	26999640	+	In_Frame_Del	DEL	ATA	ATA	-			TCGA-CV-6948-01A-11D-1912-08	TCGA-CV-6948-10A-01D-1912-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03eb2650-4b9f-46d2-b09f-378d8e919ae2	0a473b19-15a2-42aa-9307-2b830a2476e1	g.chr9:26999638_26999640delATA	ENST00000380055.5	-	2	163_165	c.53_55delTAT	c.(52-57)ttatca>tca	p.L18del	IFT74_ENST00000433700.1_Intron|LRRC19_ENST00000482770.1_5'Flank|IFT74_ENST00000429045.2_Intron|IFT74_ENST00000380062.5_Intron|IFT74_ENST00000443698.1_Intron	NM_022901.2	NP_075052.1	Q9H756	LRC19_HUMAN	leucine rich repeat containing 19	18						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(1)|lung(2)	6		all_neural(11;1.81e-09)		Lung(218;1.06e-05)|LUSC - Lung squamous cell carcinoma(38;0.0001)		ATTTTGTCTGATAATAATATCAT	0.291																																						uc003zqh.2		NA																	0					0						c.(52-57)TTATCA>TCA		leucine rich repeat containing 19 precursor																																				SO:0001651	inframe_deletion	64922					integral to membrane		g.chr9:26999638_26999640delATA	AK024955	CCDS6518.1	9p21.1	2008-02-05			ENSG00000184434	ENSG00000184434			23379	protein-coding gene	gene with protein product							Standard	NM_022901		Approved	FLJ21302	uc003zqh.3	Q9H756	OTTHUMG00000019710	ENST00000380055.5:c.53_55delTAT	9.37:g.26999644_26999646delATA	ENSP00000369395:p.Leu18del		Somatic				IFT74_uc010mja.2_Intron|IFT74_uc010mjb.2_Intron|IFT74_uc003zqf.3_Intron|IFT74_uc003zqg.3_Intron	p.L18del	NM_022901	NP_075052	WXS	Illumina HiSeq	Unspecified	Q9H756	LRC19_HUMAN		Lung(218;1.06e-05)|LUSC - Lung squamous cell carcinoma(38;0.0001)	2	164_166	-		all_neural(11;1.81e-09)	18					A0AV00|B9EG91	In_Frame_Del	DEL	ENST00000380055.5	37	c.53_55delTAT	CCDS6518.1																																																																																				0.291	LRRC19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051961.2	NM_022901		14	20	NA	NA	NA	NA	14	20	---	---	---	---
