#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
PRAMEF11	440560	broad.mit.edu	37	1	12885289	12885289	+	Silent	SNP	G	G	T	rs200907281	byFrequency	TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr1:12885289G>T	ENST00000535591.1	-	4	1017	c.822C>A	c.(820-822)ctC>ctA	p.L274L	RP5-845O24.8_ENST00000438401.1_lincRNA	NM_001146344.1	NP_001139816.1	O60813	PRA11_HUMAN	PRAME family member 11	274					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.L274L(3)		NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|lung(7)|pancreas(2)|skin(4)|urinary_tract(1)	27						GGCACTGGGAGAGATGCTTCA	0.458													.|||	1958	0.390974	0.1899	0.3501	5008	,	,		13255	0.6895		0.4553	False		,,,				2504	0.318					uc001auk.2		NA																	3	Substitution - coding silent(3)		kidney(2)|endometrium(1)		0						c.(820-822)CTC>CTA		PRAME family member 11							67.0	40.0	49.0					1																	12885289		582	1168	1750	SO:0001819	synonymous_variant	440560							g.chr1:12885289G>T	AL049680	CCDS53268.1	1p36.21	2013-01-17			ENSG00000204513	ENSG00000239810		"""-"""	14086	protein-coding gene	gene with protein product							Standard	XM_006710645		Approved		uc001auk.2	O60813	OTTHUMG00000001929	ENST00000535591.1:c.822C>A	1.37:g.12885289G>T			Somatic					p.L274L	NM_001146344	NP_001139816	WXS	Illumina HiSeq	Unspecified	O60813	PRA11_HUMAN			4	1018	-			274			LRR 3.			Silent	SNP	ENST00000535591.1	37	c.822C>A	CCDS53268.1																																																																																				0.458	PRAMEF11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_496341		7	175	1	0	0.00448238	0.00461855	7	175				
KIF17	57576	broad.mit.edu	37	1	21031194	21031194	+	Missense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr1:21031194G>A	ENST00000247986.2	-	5	1179	c.869C>T	c.(868-870)tCg>tTg	p.S290L	KIF17_ENST00000400463.3_Missense_Mutation_p.S290L|KIF17_ENST00000375044.1_Missense_Mutation_p.S190L			Q9P2E2	KIF17_HUMAN	kinesin family member 17	290	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		CGTCAGCTTCGAGTCACGGTA	0.622																																						uc001bdr.3		NA																	0				ovary(3)|skin(1)	4						c.(868-870)TCG>TTG		kinesin family member 17 isoform a							91.0	83.0	86.0					1																	21031194		2203	4300	6503	SO:0001583	missense	57576				microtubule-based movement|protein transport	cytoplasm|microtubule	ATP binding	g.chr1:21031194G>A	AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.869C>T	1.37:g.21031194G>A	ENSP00000247986:p.Ser290Leu		Somatic				KIF17_uc001bds.3_Missense_Mutation_p.S290L	p.S290L	NM_020816	NP_065867	WXS	Illumina HiSeq	Unspecified	Q9P2E2	KIF17_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)	5	987	-		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)	290					A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Missense_Mutation	SNP	ENST00000247986.2	37	c.869C>T	CCDS213.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.486405	0.84854	.	.	ENSG00000117245	ENST00000375044;ENST00000400463;ENST00000247986	D;D;D	0.86230	-2.09;-2.09;-2.09	5.11	4.18	0.49190	Kinesin, motor domain (4);	0.329626	0.16997	U	0.191080	D	0.96608	0.8893	H	0.99600	4.65	0.58432	D	0.999992	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.97688	1.0177	10	0.87932	D	0	.	14.8219	0.70080	0.0:0.2718:0.7282:0.0	.	290;290	Q9P2E2-3;Q9P2E2	.;KIF17_HUMAN	L	190;290;290	ENSP00000364184:S190L;ENSP00000383311:S290L;ENSP00000247986:S290L	ENSP00000247986:S290L	S	-	2	0	KIF17	20903781	1.000000	0.71417	0.986000	0.45419	0.956000	0.61745	7.952000	0.87827	1.256000	0.44068	0.462000	0.41574	TCG		0.622	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276995.1	NM_020816		16	44	0	0	0	0	16	44				
COL16A1	1307	broad.mit.edu	37	1	32148956	32148956	+	Silent	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr1:32148956G>A	ENST00000373672.3	-	35	2910	c.2394C>T	c.(2392-2394)gcC>gcT	p.A798A	COL16A1_ENST00000373668.3_Silent_p.A798A|COL16A1_ENST00000271069.6_Silent_p.A797A	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	798	Collagen-like 4.|Triple-helical region 5 (COL5) with 3 imperfections.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		GCAAACCCGGGGCTCCAGGCT	0.617																																					Colon(143;498 1786 21362 25193 36625)	uc001btk.1		NA																	0				ovary(8)	8						c.(2392-2394)GCC>GCT		alpha 1 type XVI collagen precursor							115.0	133.0	127.0					1																	32148956		1970	4147	6117	SO:0001819	synonymous_variant	1307				cell adhesion|female pregnancy|integrin-mediated signaling pathway	collagen type XVI	integrin binding|structural molecule activity	g.chr1:32148956G>A	M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.2394C>T	1.37:g.32148956G>A			Somatic				COL16A1_uc001btj.1_Silent_p.A627A|COL16A1_uc001btl.3_Silent_p.A798A	p.A798A	NM_001856	NP_001847	WXS	Illumina HiSeq	Unspecified	Q07092	COGA1_HUMAN		STAD - Stomach adenocarcinoma(196;0.059)	35	2759	-		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)	798			Triple-helical region 5 (COL5) with 3 imperfections.		Q16593|Q59F89|Q71RG9	Silent	SNP	ENST00000373672.3	37	c.2394C>T	CCDS41297.1																																																																																				0.617	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2	NM_001856		45	141	0	0	0	0	45	141				
CELSR2	1952	broad.mit.edu	37	1	109795883	109795883	+	Missense_Mutation	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr1:109795883C>T	ENST00000271332.3	+	1	3243	c.3182C>T	c.(3181-3183)aCt>aTt	p.T1061I		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	1061	Cadherin 9. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		GATAGTCTGACTTACAGCTTT	0.547																																					NSCLC(158;1285 2011 34800 34852 42084)	uc001dxa.3		NA																	0				ovary(4)|lung(3)|skin(1)	8						c.(3181-3183)ACT>ATT		cadherin EGF LAG seven-pass G-type receptor 2							66.0	61.0	63.0					1																	109795883		2203	4300	6503	SO:0001583	missense	1952				dendrite morphogenesis|homophilic cell adhesion|neural plate anterior/posterior regionalization|neuropeptide signaling pathway|regulation of cell-cell adhesion|regulation of transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding	g.chr1:109795883C>T	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.3182C>T	1.37:g.109795883C>T	ENSP00000271332:p.Thr1061Ile		Somatic					p.T1061I	NM_001408	NP_001399	WXS	Illumina HiSeq	Unspecified	Q9HCU4	CELR2_HUMAN		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)	1	3243	+		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)	1061			Cadherin 9.|Extracellular (Potential).		Q5T2Y7|Q92566	Missense_Mutation	SNP	ENST00000271332.3	37	c.3182C>T	CCDS796.1	.	.	.	.	.	.	.	.	.	.	N	6.386	0.439336	0.12104	.	.	ENSG00000143126	ENST00000271332	T	0.42900	0.96	5.02	4.07	0.47477	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.15912	0.0383	L	0.50333	1.59	0.29468	N	0.85728	B	0.06786	0.001	B	0.09377	0.004	T	0.08493	-1.0719	9	0.16420	T	0.52	.	7.0245	0.24932	0.1225:0.668:0.1323:0.0772	.	1061	Q9HCU4	CELR2_HUMAN	I	1061	ENSP00000271332:T1061I	ENSP00000271332:T1061I	T	+	2	0	CELSR2	109597406	0.001000	0.12720	1.000000	0.80357	0.997000	0.91878	1.054000	0.30455	2.619000	0.88677	0.650000	0.86243	ACT		0.547	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408		16	43	0	0	0	0	16	43				
WDR77	79084	broad.mit.edu	37	1	111985333	111985333	+	Missense_Mutation	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr1:111985333C>T	ENST00000235090.5	-	8	948	c.742G>A	c.(742-744)Gtc>Atc	p.V248I	RP11-552M11.4_ENST00000416099.1_RNA|WDR77_ENST00000411751.2_Missense_Mutation_p.V184I|WDR77_ENST00000497278.1_5'UTR	NM_024102.2	NP_077007.1	Q9BQA1	MEP50_HUMAN	WD repeat domain 77	248					gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA metabolic process (GO:0016070)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|methylosome (GO:0034709)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)			NS(2)|endometrium(2)|kidney(2)|large_intestine(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		all_cancers(81;0.000902)|all_epithelial(167;0.00056)|all_lung(203;0.00277)|Lung NSC(277;0.0043)		Lung(183;0.0238)|Colorectal(144;0.0296)|all cancers(265;0.0488)|Epithelial(280;0.0732)|COAD - Colon adenocarcinoma(174;0.114)|LUSC - Lung squamous cell carcinoma(189;0.135)		GAGCTCAGGACACAGCTTGTA	0.493																																						uc001ebb.2		NA																	0					0						c.(742-744)GTC>ATC		WD repeat domain 77							121.0	89.0	100.0					1																	111985333		2203	4300	6503	SO:0001583	missense	79084				ncRNA metabolic process|spliceosomal snRNP assembly	cytosol|nucleus	ligand-dependent nuclear receptor transcription coactivator activity|protein binding	g.chr1:111985333C>T	BC016946	CCDS835.1	1p13.2	2013-01-09		2005-08-09	ENSG00000116455	ENSG00000116455		"""WD repeat domain containing"""	29652	protein-coding gene	gene with protein product		611734				11756452, 8619474	Standard	NM_024102		Approved	MEP50	uc001ebb.3	Q9BQA1	OTTHUMG00000011748	ENST00000235090.5:c.742G>A	1.37:g.111985333C>T	ENSP00000235090:p.Val248Ile		Somatic				WDR77_uc010owd.1_RNA|WDR77_uc010owe.1_Missense_Mutation_p.V184I	p.V248I	NM_024102	NP_077007	WXS	Illumina HiSeq	Unspecified	Q9BQA1	MEP50_HUMAN		Lung(183;0.0238)|Colorectal(144;0.0296)|all cancers(265;0.0488)|Epithelial(280;0.0732)|COAD - Colon adenocarcinoma(174;0.114)|LUSC - Lung squamous cell carcinoma(189;0.135)	8	781	-		all_cancers(81;0.000902)|all_epithelial(167;0.00056)|all_lung(203;0.00277)|Lung NSC(277;0.0043)	248			WD 4.		B3KMW6|B4DP38|Q3LID2|Q53FU2|Q6JZZ5|Q96GK4|Q9BWY3	Missense_Mutation	SNP	ENST00000235090.5	37	c.742G>A	CCDS835.1	.	.	.	.	.	.	.	.	.	.	C	12.02	1.812857	0.32053	.	.	ENSG00000116455	ENST00000235090;ENST00000411751	T;T	0.29655	1.56;1.59	5.82	2.51	0.30379	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.649699	0.17042	N	0.189282	T	0.03608	0.0103	N	0.03608	-0.345	0.21782	N	0.999548	B;B	0.02656	0.0;0.0	B;B	0.12837	0.008;0.004	T	0.44982	-0.9292	10	0.17832	T	0.49	-7.6691	7.2969	0.26397	0.1392:0.667:0.0:0.1938	.	184;248	B4DP38;Q9BQA1	.;MEP50_HUMAN	I	248;184	ENSP00000235090:V248I;ENSP00000400321:V184I	ENSP00000235090:V248I	V	-	1	0	WDR77	111786856	0.742000	0.28228	0.809000	0.32408	0.684000	0.39900	1.049000	0.30392	0.767000	0.33267	0.563000	0.77884	GTC		0.493	WDR77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032465.1	NM_024102		5	19	0	0	0	0	5	19				
PDE4DIP	9659	broad.mit.edu	37	1	145075708	145075708	+	Missense_Mutation	SNP	C	C	T	rs148346797	byFrequency	TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr1:145075708C>T	ENST00000530740.1	-	1	193	c.155G>A	c.(154-156)cGg>cAg	p.R52Q	PDE4DIP_ENST00000369359.4_Missense_Mutation_p.R52Q|PDE4DIP_ENST00000369345.4_Missense_Mutation_p.R52Q|PDE4DIP_ENST00000369348.3_Missense_Mutation_p.R52Q			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	0					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CTCCGGGCGCCGTCTTTCCCG	0.721			T	PDGFRB	MPD																																	uc001emh.2		NA		Dom	yes		1	1q12	9659	T	phosphodiesterase 4D interacting protein (myomegalin)			L	PDGFRB		MPD		0				ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5						c.(154-156)CGG>CAG		phosphodiesterase 4D interacting protein isoform							33.0	45.0	41.0					1																	145075708		2192	4282	6474	SO:0001583	missense	9659				cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding	g.chr1:145075708C>T	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000530740.1:c.155G>A	1.37:g.145075708C>T	ENSP00000435654:p.Arg52Gln		Somatic				NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_Missense_Mutation_p.R52Q|PDE4DIP_uc001emk.2_Missense_Mutation_p.R52Q	p.R52Q	NM_022359	NP_071754	WXS	Illumina HiSeq	Unspecified	Q5VU43	MYOME_HUMAN		Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)	1	372	-			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000530740.1	37	c.155G>A		.	.	.	.	.	.	.	.	.	.	C	13.71	2.319874	0.41096	.	.	ENSG00000178104	ENST00000530740;ENST00000369359;ENST00000369348;ENST00000369345	T;T;T	0.09723	4.63;4.62;2.95	3.6	1.7	0.24286	.	.	.	.	.	T	0.01695	0.0054	N	0.19112	0.55	0.09310	N	1	P;B	0.42649	0.786;0.066	B;B	0.33620	0.167;0.007	T	0.43782	-0.9370	9	0.38643	T	0.18	.	5.0555	0.14531	0.0:0.7269:0.0:0.2731	.	52;52	Q5TB27;E9PJ64	.;.	Q	52	ENSP00000435654:R52Q;ENSP00000358366:R52Q;ENSP00000358354:R52Q	ENSP00000358351:R52Q	R	-	2	0	PDE4DIP	143787065	0.000000	0.05858	0.015000	0.15790	0.058000	0.15608	-0.033000	0.12246	0.847000	0.35167	0.561000	0.74099	CGG		0.721	PDE4DIP-036	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000384663.2	NM_022359		13	82	0	0	0	0	13	82				
VHLL	391104	broad.mit.edu	37	1	156268971	156268971	+	Silent	SNP	T	T	G			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr1:156268971T>G	ENST00000339922.3	-	1	457	c.10A>C	c.(10-12)Aga>Cga	p.R4R		NM_001004319.2	NP_001004319.1	Q6RSH7	VHLL_HUMAN	von Hippel-Lindau tumor suppressor-like	4										endometrium(1)|lung(2)|ovary(1)	4	Hepatocellular(266;0.158)					TTCCCCGCTCTCCAGGGCATT	0.592																																						uc001fok.2		NA																	0				ovary(1)	1						c.(10-12)AGA>CGA		von Hippel-Lindau tumor suppressor-like							38.0	44.0	42.0					1																	156268971		2201	4298	6499	SO:0001819	synonymous_variant	391104				protein ubiquitination	nucleus		g.chr1:156268971T>G			1q22	2013-09-24			ENSG00000189030	ENSG00000189030			30666	protein-coding gene	gene with protein product			"""VHL pseudogene"""	VHLP		14757845	Standard	NM_001004319		Approved	VLP	uc001fok.3	Q6RSH7	OTTHUMG00000024058	ENST00000339922.3:c.10A>C	1.37:g.156268971T>G			Somatic					p.R4R	NM_001004319	NP_001004319	WXS	Illumina HiSeq	Unspecified	Q6RSH7	VHLL_HUMAN			1	458	-	Hepatocellular(266;0.158)		4					A1L4M4	Silent	SNP	ENST00000339922.3	37	c.10A>C																																																																																					0.592	VHLL-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000060590.3	NM_001004319		22	79	0	0	0	0	22	79				
KIRREL	55243	broad.mit.edu	37	1	158047906	158047906	+	Missense_Mutation	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr1:158047906C>T	ENST00000359209.6	+	3	395	c.328C>T	c.(328-330)Cgg>Tgg	p.R110W	KIRREL_ENST00000368173.3_Missense_Mutation_p.R110W|KIRREL_ENST00000392272.2_Missense_Mutation_p.R110W|KIRREL_ENST00000416935.2_Intron|KIRREL_ENST00000360089.4_Missense_Mutation_p.R49W			Q96J84	KIRR1_HUMAN	kin of IRRE like (Drosophila)	110	Ig-like C2-type 1.				excretion (GO:0007588)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of actin filament polymerization (GO:0030838)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|dendritic shaft (GO:0043198)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	myosin binding (GO:0017022)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(5)|skin(3)|stomach(1)	38	all_hematologic(112;0.0378)					CCTGCGCTCTCGGCGGGCCAA	0.607																																						uc001frn.3		NA																	0				ovary(1)	1						c.(328-330)CGG>TGG		kin of IRRE like precursor							100.0	95.0	97.0					1																	158047906		2203	4300	6503	SO:0001583	missense	55243					integral to membrane		g.chr1:158047906C>T	AK001707	CCDS1172.2, CCDS72952.1	1q21-q25	2013-01-29			ENSG00000183853	ENSG00000183853		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15734	protein-coding gene	gene with protein product	"""nephrin-like protein 1"""	607428				12424224	Standard	NM_001286349		Approved	NEPH1	uc001frn.4	Q96J84	OTTHUMG00000022438	ENST00000359209.6:c.328C>T	1.37:g.158047906C>T	ENSP00000352138:p.Arg110Trp		Somatic				KIRREL_uc010pib.1_Intron|KIRREL_uc009wsq.2_Missense_Mutation_p.R49W	p.R110W	NM_018240	NP_060710	WXS	Illumina HiSeq	Unspecified	Q96J84	KIRR1_HUMAN			3	732	+	all_hematologic(112;0.0378)		110			Extracellular (Potential).|Ig-like C2-type 1.		Q5W0F8|Q5XKC6|Q7Z696|Q7Z7N8|Q8TB15|Q9H9N1|Q9NVA5	Missense_Mutation	SNP	ENST00000359209.6	37	c.328C>T	CCDS1172.2	.	.	.	.	.	.	.	.	.	.	C	19.63	3.863830	0.71949	.	.	ENSG00000183853	ENST00000360089;ENST00000368173;ENST00000392272;ENST00000359209	T;T;T;T	0.68025	1.62;-0.3;-0.3;-0.3	4.29	3.34	0.38264	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.37577	N	0.002029	T	0.69079	0.3071	M	0.62154	1.92	0.80722	D	1	D;D	0.89917	0.975;1.0	P;D	0.64595	0.582;0.927	T	0.73623	-0.3924	10	0.87932	D	0	-25.0859	11.2486	0.49013	0.1844:0.8156:0.0:0.0	.	49;110	Q5W0F9;Q96J84	.;KIRR1_HUMAN	W	49;110;110;110	ENSP00000353202:R49W;ENSP00000357155:R110W;ENSP00000376098:R110W;ENSP00000352138:R110W	ENSP00000352138:R110W	R	+	1	2	KIRREL	156314530	0.995000	0.38212	0.999000	0.59377	0.973000	0.67179	1.788000	0.38714	1.111000	0.41721	0.467000	0.42956	CGG		0.607	KIRREL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058342.3	NM_018240		9	117	0	0	0	0	9	117				
OR10X1	128367	broad.mit.edu	37	1	158549570	158549570	+	Silent	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr1:158549570C>T	ENST00000368150.1	-	1	119	c.120G>A	c.(118-120)caG>caA	p.Q40Q		NM_001004477.1	NP_001004477.1	Q8NGY0	O10X1_HUMAN	olfactory receptor, family 10, subfamily X, member 1 (gene/pseudogene)	40						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(22)|ovary(2)|skin(2)|urinary_tract(1)	37	all_hematologic(112;0.0378)					AAAGAAATGTCTGTACATGTG	0.423																																						uc010pin.1		NA																	0				ovary(1)	1						c.(118-120)CAG>CAA		olfactory receptor, family 10, subfamily X,							125.0	125.0	125.0					1																	158549570		2203	4300	6503	SO:0001819	synonymous_variant	128367				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158549570C>T	BK004194	CCDS30900.1	1q23.1	2013-10-10	2013-10-10	2004-03-10	ENSG00000186400	ENSG00000186400		"""GPCR / Class A : Olfactory receptors"""	14995	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily X, member 1"""	OR10X1P			Standard	NM_001004477		Approved		uc010pin.2	Q8NGY0	OTTHUMG00000019635	ENST00000368150.1:c.120G>A	1.37:g.158549570C>T			Somatic					p.Q40Q	NM_001004477	NP_001004477	WXS	Illumina HiSeq	Unspecified	Q8NGY0	O10X1_HUMAN			1	120	-	all_hematologic(112;0.0378)		40			Extracellular (Potential).		Q6IFR8	Silent	SNP	ENST00000368150.1	37	c.120G>A	CCDS30900.1																																																																																				0.423	OR10X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051850.2	NM_001004477		6	78	0	0	0	0	6	78				
FMO1	2326	broad.mit.edu	37	1	171250015	171250015	+	Missense_Mutation	SNP	C	C	G			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr1:171250015C>G	ENST00000354841.4	+	5	849	c.718C>G	c.(718-720)Cag>Gag	p.Q240E	FMO1_ENST00000402921.2_Missense_Mutation_p.Q177E|FMO1_ENST00000367750.3_Missense_Mutation_p.Q240E|FMO1_ENST00000469112.1_3'UTR	NM_001282692.1	NP_001269621.1	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1	240					NADPH oxidation (GO:0070995)|organic acid metabolic process (GO:0006082)|small molecule metabolic process (GO:0044281)|toxin metabolic process (GO:0009404)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|monooxygenase activity (GO:0004497)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(2)|skin(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Cevimeline(DB00185)|Cimetidine(DB00501)|Lorcaserin(DB04871)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	GACACGCTTTCAGAACATGTT	0.493																																						uc009wvz.2		NA																	0				skin(1)	1						c.(718-720)CAG>GAG		flavin containing monooxygenase 1							115.0	103.0	107.0					1																	171250015		2203	4300	6503	SO:0001583	missense	2326				NADPH oxidation|organic acid metabolic process|toxin metabolic process|xenobiotic metabolic process	endoplasmic reticulum lumen|integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding	g.chr1:171250015C>G	M64082	CCDS1294.1, CCDS60351.1	1q24.3	2011-08-04			ENSG00000010932	ENSG00000010932	1.14.13.8		3769	protein-coding gene	gene with protein product		136130					Standard	XM_005245037		Approved		uc001ghl.3	Q01740	OTTHUMG00000035502	ENST00000354841.4:c.718C>G	1.37:g.171250015C>G	ENSP00000346901:p.Gln240Glu		Somatic				FMO1_uc010pme.1_Missense_Mutation_p.Q177E|FMO1_uc001ghl.2_Missense_Mutation_p.Q240E|FMO1_uc001ghm.2_Missense_Mutation_p.Q240E|FMO1_uc001ghn.2_Missense_Mutation_p.Q240E	p.Q240E	NM_002021	NP_002012	WXS	Illumina HiSeq	Unspecified	Q01740	FMO1_HUMAN			6	854	+	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)		240					A8K248|B7Z3P4|Q5QPT2|Q9UJC2	Missense_Mutation	SNP	ENST00000354841.4	37	c.718C>G	CCDS1294.1	.	.	.	.	.	.	.	.	.	.	C	9.446	1.089409	0.20390	.	.	ENSG00000010932	ENST00000367750;ENST00000402921;ENST00000354841	T;T;T	0.52057	0.68;0.68;0.68	6.06	5.15	0.70609	.	0.434742	0.26571	N	0.023634	T	0.11750	0.0286	N	0.17345	0.48	0.36299	D	0.856883	B;B;B	0.11235	0.004;0.002;0.001	B;B;B	0.13407	0.009;0.008;0.006	T	0.14643	-1.0465	10	0.16896	T	0.51	-2.8355	5.425	0.16421	0.1499:0.6312:0.1443:0.0746	.	177;240;240	B7Z3P4;B2RCG5;Q01740	.;.;FMO1_HUMAN	E	240;177;240	ENSP00000356724:Q240E;ENSP00000385543:Q177E;ENSP00000346901:Q240E	ENSP00000346901:Q240E	Q	+	1	0	FMO1	169516639	0.000000	0.05858	1.000000	0.80357	0.891000	0.51852	0.547000	0.23299	1.555000	0.49500	0.655000	0.94253	CAG		0.493	FMO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086212.1	NM_002021		7	68	0	0	0	0	7	68				
CEP350	9857	broad.mit.edu	37	1	180080243	180080243	+	Missense_Mutation	SNP	A	A	G	rs150197968		TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr1:180080243A>G	ENST00000367607.3	+	38	9719	c.9301A>G	c.(9301-9303)Att>Gtt	p.I3101V	CEP350_ENST00000490141.1_3'UTR	NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	3101					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						CAAAGATACTATTGATGTTCT	0.463																																						uc001gnt.2		NA																	0				ovary(4)	4						c.(9301-9303)ATT>GTT		centrosome-associated protein 350		A	VAL/ILE	0,4406		0,0,2203	120.0	102.0	108.0		9301	3.7	1.0	1	dbSNP_134	108	1,8599	1.2+/-3.3	0,1,4299	no	missense	CEP350	NM_014810.4	29	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	benign	3101/3118	180080243	1,13005	2203	4300	6503	SO:0001583	missense	9857					centrosome|nucleus|spindle		g.chr1:180080243A>G	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.9301A>G	1.37:g.180080243A>G	ENSP00000356579:p.Ile3101Val		Somatic				CEP350_uc009wxl.2_Missense_Mutation_p.I3100V|CEP350_uc001gnv.2_Missense_Mutation_p.I1236V|CEP350_uc001gnw.1_Missense_Mutation_p.I858V|CEP350_uc001gnx.1_Missense_Mutation_p.I858V	p.I3101V	NM_014810	NP_055625	WXS	Illumina HiSeq	Unspecified	Q5VT06	CE350_HUMAN			38	9684	+			3101					O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	ENST00000367607.3	37	c.9301A>G	CCDS1336.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	7.483|7.483	0.649052|0.649052	0.14516|0.14516	0.0|0.0	1.16E-4|1.16E-4	ENSG00000135837|ENSG00000135837	ENST00000367607;ENST00000417046|ENST00000429851	T|.	0.50277|.	0.75|.	6.05|6.05	3.74|3.74	0.42951|0.42951	.|.	0.000000|.	0.49916|.	D|.	0.000138|.	T|T	0.31513|0.31513	0.0799|0.0799	N|N	0.25890|0.25890	0.77|0.77	0.26856|0.26856	N|N	0.968067|0.968067	P;B|.	0.43973|.	0.823;0.076|.	P;B|.	0.48952|.	0.596;0.024|.	T|T	0.19484|0.19484	-1.0304|-1.0304	9|5	.|.	.|.	.|.	.|.	8.4887|8.4887	0.33086|0.33086	0.7058:0.0:0.2942:0.0|0.7058:0.0:0.2942:0.0	.|.	3101;3101|.	E7EU22;Q5VT06|.	.;CE350_HUMAN|.	V|C	3101;565|1275	ENSP00000356579:I3101V|.	.|.	I|Y	+|+	1|2	0|0	CEP350|CEP350	178346866|178346866	0.994000|0.994000	0.37717|0.37717	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	2.467000|2.467000	0.45093|0.45093	0.533000|0.533000	0.28675|0.28675	0.528000|0.528000	0.53228|0.53228	ATT|TAT		0.463	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810		15	29	0	0	0	0	15	29				
PPFIA4	8497	broad.mit.edu	37	1	203013095	203013095	+	Missense_Mutation	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr1:203013095C>T	ENST00000447715.2	+	8	814	c.373C>T	c.(373-375)Cat>Tat	p.H125Y	PPFIA4_ENST00000367240.2_Missense_Mutation_p.H125Y|PPFIA4_ENST00000414050.2_5'Flank|PPFIA4_ENST00000295706.4_5'UTR			O75335	LIPA4_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4	125					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(20)|ovary(4)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	50						GGTGTCCCGCCATGAACGGTC	0.622																																						uc009xaj.2		NA																	0				ovary(4)|skin(1)	5						c.(814-816)CAT>TAT		SubName: Full=Liprin alpha4;							52.0	47.0	49.0					1																	203013095		876	1991	2867	SO:0001583	missense	8497				cell communication	cell surface|cytoplasm	protein binding	g.chr1:203013095C>T	AF034801	CCDS44296.1	1q32.1	2013-01-10			ENSG00000143847	ENSG00000143847		"""Sterile alpha motif (SAM) domain containing"""	9248	protein-coding gene	gene with protein product	"""Liprin-alpha4"""	603145				9624153	Standard	XM_005245553		Approved		uc009xaj.3	O75335	OTTHUMG00000042123	ENST00000447715.2:c.373C>T	1.37:g.203013095C>T	ENSP00000402576:p.His125Tyr		Somatic				PPFIA4_uc010pqf.1_5'Flank	p.H272Y			WXS	Illumina HiSeq	Unspecified	O75335	LIPA4_HUMAN			8	814	+			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					A2RUJ5|B1APN8|B1N949|B7ZM43|O94971	Missense_Mutation	SNP	ENST00000447715.2	37	c.814C>T		.	.	.	.	.	.	.	.	.	.	C	29.1	4.981616	0.93044	.	.	ENSG00000143847	ENST00000367240;ENST00000447715	T;T	0.49432	0.78;0.78	4.87	4.87	0.63330	.	0.000000	0.46758	D	0.000270	T	0.70815	0.3267	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.74731	-0.3566	9	0.87932	D	0	-18.0029	18.5725	0.91140	0.0:1.0:0.0:0.0	.	125	B1N949	.	Y	125	ENSP00000356209:H125Y;ENSP00000402576:H125Y	ENSP00000356209:H125Y	H	+	1	0	PPFIA4	201279718	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	7.609000	0.82925	2.711000	0.92665	0.561000	0.74099	CAT		0.622	PPFIA4-005	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000462949.1	NM_015053		8	31	0	0	0	0	8	31				
FCAMR	83953	broad.mit.edu	37	1	207135705	207135705	+	Missense_Mutation	SNP	G	G	A	rs200786919		TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr1:207135705G>A	ENST00000324852.4	-	5	979	c.505C>T	c.(505-507)Cgt>Tgt	p.R169C	FCAMR_ENST00000450945.2_Missense_Mutation_p.R169C|FCAMR_ENST00000486178.1_5'Flank|FCAMR_ENST00000400962.3_Missense_Mutation_p.R169C	NM_001170631.1	NP_001164102.1	Q8WWV6	FCAMR_HUMAN	Fc receptor, IgA, IgM, high affinity	124	Ig-like V-type.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|skin(1)|stomach(1)	11						AGGGCCACACGGTCACGATAG	0.572																																					Ovarian(199;1883 2142 16966 44409 45154)	uc001hfa.3		NA																	0				ovary(1)	1						c.(505-507)CGT>TGT		Fc receptor, IgA, IgM, high affinity isoform 2		G	CYS/ARG,CYS/ARG,CYS/ARG	0,3136		0,0,1568	107.0	99.0	101.0		505,505,505	4.6	0.4	1		101	3,7161		0,3,3579	no	missense,missense,missense	FCAMR	NM_001122979.2,NM_001170631.1,NM_032029.4	180,180,180	0,3,5147	AA,AG,GG		0.0419,0.0,0.0291	probably-damaging,probably-damaging,probably-damaging	169/266,169/578,169/266	207135705	3,10297	1568	3582	5150	SO:0001583	missense	83953					integral to membrane|plasma membrane	receptor activity	g.chr1:207135705G>A	AF354295	CCDS41460.1, CCDS53468.1	1q32.1	2013-01-14			ENSG00000162897	ENSG00000162897		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	24692	protein-coding gene	gene with protein product		605484				11779189	Standard	NM_001122979		Approved	FKSG87, FCA/MR, CD351	uc001hfa.4	Q8WWV6	OTTHUMG00000036579	ENST00000324852.4:c.505C>T	1.37:g.207135705G>A	ENSP00000316491:p.Arg169Cys		Somatic				FCAMR_uc001hfb.2_Missense_Mutation_p.R169C|FCAMR_uc009xca.1_Missense_Mutation_p.R169C|FCAMR_uc001hfc.2_Missense_Mutation_p.R144C	p.R169C	NM_001122980	NP_001116452	WXS	Illumina HiSeq	Unspecified	Q8WWV6	FCAMR_HUMAN			5	1005	-			124			Extracellular (Potential).|Ig-like V-type.		Q32M82|Q8WWV5|Q96SA2	Missense_Mutation	SNP	ENST00000324852.4	37	c.505C>T	CCDS53468.1	.	.	.	.	.	.	.	.	.	.	G	14.58	2.578831	0.46006	0.0	4.19E-4	ENSG00000162897	ENST00000400962;ENST00000324852;ENST00000450945;ENST00000367087	T;T;T	0.10477	2.87;2.87;2.87	5.6	4.63	0.57726	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.102536	0.40728	N	0.001024	T	0.40886	0.1135	M	0.93507	3.425	0.40365	D	0.979281	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;1.0;0.999;1.0	T	0.50906	-0.8772	10	0.87932	D	0	-10.5226	10.973	0.47450	0.0:0.0:0.8139:0.186	.	124;144;124;124	Q8WWV6-4;D2KTA8;Q8WWV6-2;Q8WWV6	.;.;.;FCAMR_HUMAN	C	169;169;169;145	ENSP00000383746:R169C;ENSP00000316491:R169C;ENSP00000392707:R169C	ENSP00000316491:R169C	R	-	1	0	FCAMR	205202328	0.888000	0.30383	0.351000	0.25721	0.016000	0.09150	2.048000	0.41278	2.636000	0.89361	0.655000	0.94253	CGT		0.572	FCAMR-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088969.2	NM_032029		28	41	0	0	0	0	28	41				
GPR137B	7107	broad.mit.edu	37	1	236341831	236341831	+	Silent	SNP	A	A	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr1:236341831A>T	ENST00000366592.3	+	3	673	c.582A>T	c.(580-582)cgA>cgT	p.R194R	GPR137B_ENST00000366591.4_Intron	NM_003272.3	NP_003263.1	O60478	G137B_HUMAN	G protein-coupled receptor 137B	194						integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|membrane (GO:0016020)				endometrium(2)|large_intestine(1)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.197)|Prostate(94;0.219)|Acute lymphoblastic leukemia(190;0.226)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)			TCTCTGTGCGAGTGGCCATTA	0.473																																						uc001hxq.2		NA																	0					0						c.(580-582)CGA>CGT		G protein-coupled receptor 137B							257.0	222.0	234.0					1																	236341831		2203	4300	6503	SO:0001819	synonymous_variant	7107					integral to plasma membrane|membrane fraction		g.chr1:236341831A>T	AF027826	CCDS1609.1	1q42-q43	2012-08-10	2006-01-26	2006-01-26	ENSG00000077585	ENSG00000077585			11862	protein-coding gene	gene with protein product		604658	"""transmembrane 7 superfamily member 1 (upregulated in kidney)"""	TM7SF1		9521871	Standard	NM_003272		Approved		uc001hxq.3	O60478	OTTHUMG00000037994	ENST00000366592.3:c.582A>T	1.37:g.236341831A>T			Somatic				GPR137B_uc001hxr.1_5'UTR|GPR137B_uc009xge.2_RNA	p.R194R	NM_003272	NP_003263	WXS	Illumina HiSeq	Unspecified	O60478	G137B_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		3	673	+	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.197)|Prostate(94;0.219)|Acute lymphoblastic leukemia(190;0.226)	194			Helical; (Potential).		Q53EK7|Q5TAE6|Q6FHI3	Silent	SNP	ENST00000366592.3	37	c.582A>T	CCDS1609.1	.	.	.	.	.	.	.	.	.	.	A	12.25	1.882444	0.33255	.	.	ENSG00000077585	ENST00000454895	.	.	.	5.7	-11.0	0.00169	.	.	.	.	.	T	0.34395	0.0896	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43065	-0.9414	4	.	.	.	-10.9123	3.8415	0.08917	0.2356:0.4902:0.0933:0.1808	.	.	.	.	V	58	.	.	E	+	2	0	GPR137B	234408454	0.011000	0.17503	0.823000	0.32752	0.941000	0.58515	-0.948000	0.03897	-1.871000	0.01138	0.459000	0.35465	GAG		0.473	GPR137B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092761.1	NM_003272		27	54	0	0	0	0	27	54				
RYR2	6262	broad.mit.edu	37	1	237969504	237969504	+	Missense_Mutation	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr1:237969504C>T	ENST00000366574.2	+	99	14536	c.14219C>T	c.(14218-14220)gCc>gTc	p.A4740V	RYR2_ENST00000360064.6_Missense_Mutation_p.A4746V|RYR2_ENST00000542537.1_Missense_Mutation_p.A4724V	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4740					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TTTTTTTTTGCCGCTCACCTT	0.403																																						uc001hyl.1		NA																	0				ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(14218-14220)GCC>GTC		cardiac muscle ryanodine receptor							235.0	206.0	215.0					1																	237969504		1897	4114	6011	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237969504C>T	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.14219C>T	1.37:g.237969504C>T	ENSP00000355533:p.Ala4740Val		Somatic				RYR2_uc010pyb.1_Missense_Mutation_p.A173V	p.A4740V	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		99	14339	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	4740			Helical; Name=M7; (Potential).		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.14219C>T	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	C	32	5.192398	0.94960	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000536033	D;D;D	0.97994	-4.65;-4.65;-4.65	5.43	5.43	0.79202	Ion transport (1);	0.000000	0.64402	U	0.000012	D	0.99026	0.9667	M	0.91872	3.25	0.80722	D	1	B;D	0.69078	0.301;0.997	B;D	0.80764	0.315;0.994	D	0.99529	1.0960	10	0.87932	D	0	.	19.5999	0.95557	0.0:1.0:0.0:0.0	.	173;4740	F5H3C7;Q92736	.;RYR2_HUMAN	V	4740;4746;4724;173	ENSP00000355533:A4740V;ENSP00000353174:A4746V;ENSP00000443798:A4724V	ENSP00000353174:A4746V	A	+	2	0	RYR2	236036127	1.000000	0.71417	1.000000	0.80357	0.832000	0.47134	7.747000	0.85070	2.700000	0.92200	0.655000	0.94253	GCC		0.403	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		3	29	0	0	0	0	3	29				
LYZL2	119180	broad.mit.edu	37	10	30915048	30915048	+	Missense_Mutation	SNP	T	T	C	rs143775752	byFrequency	TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr10:30915048T>C	ENST00000375318.2	-	3	478	c.422A>G	c.(421-423)cAc>cGc	p.H141R		NM_183058.2	NP_898881.2	Q7Z4W2	LYZL2_HUMAN	lysozyme-like 2	95					cell wall macromolecule catabolic process (GO:0016998)	extracellular region (GO:0005576)	lysozyme activity (GO:0003796)	p.H141L(1)		NS(2)|central_nervous_system(1)|large_intestine(1)|lung(14)|prostate(1)	19		Prostate(175;0.151)				GCAGGCGACGTGGCAGTGGTT	0.557													T|||	14	0.00279553	0.0	0.0	5008	,	,		21609	0.0		0.0	False		,,,				2504	0.0143					uc001ivk.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(421-423)CAC>CGC		lysozyme-like 2		T	ARG/HIS	1,4405	2.1+/-5.4	0,1,2202	171.0	147.0	156.0		422	2.2	0.9	10	dbSNP_134	156	4,8596	3.7+/-12.6	0,4,4296	no	missense	LYZL2	NM_183058.2	29	0,5,6498	CC,CT,TT		0.0465,0.0227,0.0384	benign	141/195	30915048	5,13001	2203	4300	6503	SO:0001583	missense	119180				cell wall macromolecule catabolic process	extracellular region	lysozyme activity	g.chr10:30915048T>C	AF139543	CCDS7167.2	10p11.23	2009-12-04			ENSG00000151033	ENSG00000151033			29613	protein-coding gene	gene with protein product		612748					Standard	NM_183058		Approved		uc001ivk.3	Q7Z4W2	OTTHUMG00000017898	ENST00000375318.2:c.422A>G	10.37:g.30915048T>C	ENSP00000364467:p.His141Arg		Somatic					p.H141R	NM_183058	NP_898881	WXS	Illumina HiSeq	Unspecified	Q7Z4W2	LYZL2_HUMAN			3	435	-		Prostate(175;0.151)	95					Q6NZ69	Missense_Mutation	SNP	ENST00000375318.2	37	c.422A>G	CCDS7167.2	.	.	.	.	.	.	.	.	.	.	T	5.445	0.267209	0.10294	2.27E-4	4.65E-4	ENSG00000151033	ENST00000375318	T	0.74842	-0.88	2.16	2.16	0.27623	.	0.285349	0.33401	N	0.004959	T	0.61286	0.2335	L	0.46157	1.445	0.34196	D	0.672651	B	0.12013	0.005	B	0.09377	0.004	T	0.60979	-0.7155	10	0.29301	T	0.29	-27.6221	6.338	0.21306	0.0:0.0:0.0:1.0	.	141	Q7Z4W2-2	.	R	141	ENSP00000364467:H141R	ENSP00000364467:H141R	H	-	2	0	LYZL2	30955054	0.847000	0.29606	0.876000	0.34364	0.451000	0.32288	1.560000	0.36331	1.244000	0.43870	0.254000	0.18369	CAC		0.557	LYZL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047434.1	NM_183058		11	54	0	0	0	0	11	54				
ZNF438	220929	broad.mit.edu	37	10	31133973	31133973	+	Missense_Mutation	SNP	C	C	G			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr10:31133973C>G	ENST00000361310.3	-	7	2733	c.2404G>C	c.(2404-2406)Gag>Cag	p.E802Q	ZNF438_ENST00000444692.2_Missense_Mutation_p.E792Q|ZNF438_ENST00000442986.1_Missense_Mutation_p.E802Q|ZNF438_ENST00000436087.2_Missense_Mutation_p.E802Q|ZNF438_ENST00000413025.1_Missense_Mutation_p.E802Q|ZNF438_ENST00000538351.2_Missense_Mutation_p.E753Q|ZNF438_ENST00000375311.1_Missense_Mutation_p.E366Q|ZNF438_ENST00000452305.1_Missense_Mutation_p.E792Q|ZNF438_ENST00000331737.6_Missense_Mutation_p.E792Q			Q7Z4V0	ZN438_HUMAN	zinc finger protein 438	802					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(15)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(175;0.0587)				GAAGGGTCCTCACAGTTATGC	0.517																																						uc010qdz.1		NA																	0				ovary(1)|breast(1)	2						c.(2404-2406)GAG>CAG		zinc finger protein 438 isoform a							189.0	185.0	186.0					10																	31133973		2203	4300	6503	SO:0001583	missense	220929				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr10:31133973C>G	AK057323	CCDS7168.1, CCDS44369.1, CCDS53504.1	10p11.23	2006-02-15			ENSG00000183621	ENSG00000183621		"""Zinc fingers, C2H2-type"""	21029	protein-coding gene	gene with protein product							Standard	NM_182755		Approved	bA330O11.1	uc010qeb.2	Q7Z4V0	OTTHUMG00000017904	ENST00000361310.3:c.2404G>C	10.37:g.31133973C>G	ENSP00000354663:p.Glu802Gln		Somatic				ZNF438_uc001ivn.2_Missense_Mutation_p.E753Q|ZNF438_uc010qdy.1_Missense_Mutation_p.E792Q|ZNF438_uc001ivo.3_Missense_Mutation_p.E366Q|ZNF438_uc009xlg.2_Missense_Mutation_p.E802Q|ZNF438_uc001ivp.3_Missense_Mutation_p.E792Q|ZNF438_uc010qea.1_Missense_Mutation_p.E802Q|ZNF438_uc010qeb.1_Missense_Mutation_p.E802Q	p.E802Q	NM_182755	NP_877432	WXS	Illumina HiSeq	Unspecified	Q7Z4V0	ZN438_HUMAN			8	2839	-		Prostate(175;0.0587)	802					A2A3J4|A8K9L5|Q5T426|Q658Q4|Q6ZN65	Missense_Mutation	SNP	ENST00000361310.3	37	c.2404G>C	CCDS7168.1	.	.	.	.	.	.	.	.	.	.	C	17.75	3.465822	0.63513	.	.	ENSG00000183621	ENST00000331737;ENST00000361310;ENST00000436087;ENST00000442986;ENST00000413025;ENST00000452305;ENST00000444692;ENST00000538351;ENST00000430896;ENST00000375311	T;T;T;T;T;T;T;T;T	0.30981	1.52;1.53;1.53;1.53;1.53;1.52;1.52;1.51;1.84	5.5	1.49	0.22878	Zinc finger, C2H2 (1);	0.135346	0.64402	N	0.000003	T	0.30166	0.0756	L	0.56769	1.78	0.42852	D	0.994088	P;P	0.49358	0.874;0.923	B;B	0.42771	0.223;0.397	T	0.10359	-1.0633	10	0.62326	D	0.03	-22.7774	10.8812	0.46939	0.0:0.5636:0.3691:0.0673	.	802;792	Q7Z4V0;Q7Z4V0-2	ZN438_HUMAN;.	Q	792;802;802;802;802;792;792;753;521;366	ENSP00000333571:E792Q;ENSP00000354663:E802Q;ENSP00000406934:E802Q;ENSP00000412363:E802Q;ENSP00000387546:E802Q;ENSP00000413060:E792Q;ENSP00000410898:E792Q;ENSP00000445461:E753Q;ENSP00000364460:E366Q	ENSP00000333571:E792Q	E	-	1	0	ZNF438	31173979	1.000000	0.71417	0.149000	0.22428	0.626000	0.37791	3.304000	0.51866	0.081000	0.16988	-0.165000	0.13383	GAG		0.517	ZNF438-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277006.1	NM_182755		7	184	0	0	0	0	7	184				
ANKRD30A	91074	broad.mit.edu	37	10	37506697	37506697	+	Missense_Mutation	SNP	G	G	C			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr10:37506697G>C	ENST00000602533.1	+	33	3089	c.2990G>C	c.(2989-2991)gGa>gCa	p.G997A	ANKRD30A_ENST00000374660.1_Missense_Mutation_p.G1116A|ANKRD30A_ENST00000361713.1_Missense_Mutation_p.G997A			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	1053					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						GAAGAATTAGGAAGAATCGAA	0.318																																						uc001iza.1		NA																	0				ovary(7)|breast(1)|skin(1)	9						c.(2989-2991)GGA>GCA		ankyrin repeat domain 30A							63.0	63.0	63.0					10																	37506697		1808	4064	5872	SO:0001583	missense	91074					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr10:37506697G>C	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.2990G>C	10.37:g.37506697G>C	ENSP00000473551:p.Gly997Ala		Somatic					p.G997A	NM_052997	NP_443723	WXS	Illumina HiSeq	Unspecified	Q9BXX3	AN30A_HUMAN			33	3089	+			1053			Potential.		Q5W025	Missense_Mutation	SNP	ENST00000602533.1	37	c.2990G>C		.	.	.	.	.	.	.	.	.	.	g	11.94	1.788615	0.31685	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.16073	2.37;2.37	2.82	-0.225	0.13111	.	.	.	.	.	T	0.10852	0.0265	N	0.24115	0.695	0.09310	N	0.999999	B	0.27765	0.188	B	0.28232	0.087	T	0.29518	-1.0009	9	0.59425	D	0.04	.	6.5903	0.22644	0.3697:0.0:0.6303:0.0	.	1053	Q9BXX3	AN30A_HUMAN	A	997;1116	ENSP00000354432:G997A;ENSP00000363792:G1116A	ENSP00000354432:G997A	G	+	2	0	ANKRD30A	37546703	0.464000	0.25807	0.001000	0.08648	0.001000	0.01503	0.821000	0.27338	-0.333000	0.08476	-0.344000	0.07964	GGA		0.318	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997		3	40	0	0	0	0	3	40				
ALOX5	240	broad.mit.edu	37	10	45941026	45941026	+	Missense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr10:45941026G>A	ENST00000374391.2	+	14	1969	c.1916G>A	c.(1915-1917)cGc>cAc	p.R639H	ALOX5_ENST00000542434.1_Missense_Mutation_p.R582H|RP11-67C2.2_ENST00000435635.1_RNA	NM_000698.3|NM_001256153.1	NP_000689.1|NP_001243082.1	P09917	LOX5_HUMAN	arachidonate 5-lipoxygenase	639	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|leukotriene production involved in inflammatory response (GO:0002540)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nuclear envelope (GO:0005635)|nuclear envelope lumen (GO:0005641)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)	arachidonate 5-lipoxygenase activity (GO:0004051)|iron ion binding (GO:0005506)			breast(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Lung SC(717;0.0257)			Aminosalicylic Acid(DB00233)|Balsalazide(DB01014)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Mesalazine(DB00244)|Minocycline(DB01017)|Montelukast(DB00471)|Sulfasalazine(DB00795)|Vitamin E(DB00163)|Zileuton(DB00744)	GCCCGATTCCGCAAGAACCTC	0.532																																						uc001jce.2		NA																	0				ovary(1)|pancreas(1)	2						c.(1915-1917)CGC>CAC		arachidonate 5-lipoxygenase	Diethylcarbamazine(DB00711)|Hydrocortisone(DB00741)|Leflunomide(DB01097)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Minocycline(DB01017)|Montelukast(DB00471)|Quinacrine(DB01103)|Vitamin E(DB00163)|Zileuton(DB00744)						99.0	94.0	96.0					10																	45941026		2203	4300	6503	SO:0001583	missense	240				hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process	cytosol|nuclear envelope lumen|nuclear matrix|nuclear membrane	arachidonate 5-lipoxygenase activity|iron ion binding|lipoxygenase activity|protein binding	g.chr10:45941026G>A	J03571	CCDS7212.1, CCDS58078.1	10q11.2	2008-03-18			ENSG00000012779	ENSG00000012779	1.13.11.34	"""Arachidonate lipoxygenases"""	435	protein-coding gene	gene with protein product		152390				2565035	Standard	NM_001256153		Approved	5-LOX	uc001jce.4	P09917	OTTHUMG00000018081	ENST00000374391.2:c.1916G>A	10.37:g.45941026G>A	ENSP00000363512:p.Arg639His		Somatic				ALOX5_uc009xmt.2_Missense_Mutation_p.R607H|ALOX5_uc010qfg.1_Missense_Mutation_p.R582H	p.R639H	NM_000698	NP_000689	WXS	Illumina HiSeq	Unspecified	P09917	LOX5_HUMAN			14	2015	+		Lung SC(717;0.0257)	639			Lipoxygenase.		B7ZLS0|E5FPY5|E5FPY7|E5FPY8|Q5JQ14	Missense_Mutation	SNP	ENST00000374391.2	37	c.1916G>A	CCDS7212.1	.	.	.	.	.	.	.	.	.	.	G	15.92	2.976004	0.53720	.	.	ENSG00000012779	ENST00000542434;ENST00000374391	D;D	0.90444	-2.67;-2.67	5.14	4.24	0.50183	Lipoxygenase, C-terminal (3);	0.152591	0.64402	N	0.000015	D	0.89543	0.6745	M	0.81179	2.53	0.27278	N	0.958182	P;B;B	0.39862	0.692;0.068;0.043	B;B;B	0.36134	0.218;0.049;0.027	D	0.85291	0.1067	10	0.59425	D	0.04	-26.8399	11.8919	0.52635	0.085:0.0:0.915:0.0	.	582;607;639	B7ZLS0;E5FPY8;P09917	.;.;LOX5_HUMAN	H	582;639	ENSP00000437634:R582H;ENSP00000363512:R639H	ENSP00000363512:R639H	R	+	2	0	ALOX5	45261032	1.000000	0.71417	1.000000	0.80357	0.750000	0.42670	6.597000	0.74118	1.537000	0.49254	0.655000	0.94253	CGC		0.532	ALOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047780.1			7	52	0	0	0	0	7	52				
CTNNA3	29119	broad.mit.edu	37	10	67829147	67829147	+	Missense_Mutation	SNP	A	A	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr10:67829147A>T	ENST00000433211.2	-	15	2252	c.2078T>A	c.(2077-2079)aTa>aAa	p.I693K	CTNNA3_ENST00000373735.1_5'UTR|CTNNA3_ENST00000373744.4_Missense_Mutation_p.I693K	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						ATCATCCCATATCTCAATCTC	0.403																																						uc009xpn.1		NA																	0				skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						c.(2077-2079)ATA>AAA		catenin, alpha 3							281.0	236.0	251.0					10																	67829147		2203	4300	6503	SO:0001583	missense	29119				cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity	g.chr10:67829147A>T	AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.2078T>A	10.37:g.67829147A>T	ENSP00000389714:p.Ile693Lys		Somatic				CTNNA3_uc001jmw.2_Missense_Mutation_p.I693K	p.I693K	NM_001127384	NP_001120856	WXS	Illumina HiSeq	Unspecified	Q9UI47	CTNA3_HUMAN			15	2201	-			693						Missense_Mutation	SNP	ENST00000433211.2	37	c.2078T>A	CCDS7269.1	.	.	.	.	.	.	.	.	.	.	A	9.292	1.050804	0.19827	.	.	ENSG00000183230	ENST00000433211;ENST00000373744;ENST00000373735	T;T;T	0.24723	1.84;1.84;1.84	5.29	5.29	0.74685	.	0.000000	0.64402	D	0.000012	T	0.04048	0.0113	N	0.00055	-2.37	0.80722	D	1	B	0.20671	0.047	B	0.21151	0.033	T	0.35724	-0.9777	10	0.02654	T	1	-21.2463	8.6333	0.33933	0.8294:0.0:0.0:0.1706	.	693	Q9UI47	CTNA3_HUMAN	K	693;693;32	ENSP00000389714:I693K;ENSP00000362849:I693K;ENSP00000362840:I32K	ENSP00000362840:I32K	I	-	2	0	CTNNA3	67499153	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.350000	0.59392	2.009000	0.58944	0.482000	0.46254	ATA		0.403	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048282.2	NM_013266		35	91	0	0	0	0	35	91				
WAPAL	23063	broad.mit.edu	37	10	88232379	88232379	+	Missense_Mutation	SNP	T	T	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr10:88232379T>A	ENST00000298767.5	-	6	2355	c.1883A>T	c.(1882-1884)gAa>gTa	p.E628V	WAPAL_ENST00000263070.7_5'Flank	NM_015045.2	NP_055860.1	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog (Drosophila)	628	Mediates interaction with the cohesin complex.|WAPL. {ECO:0000255|PROSITE- ProRule:PRU00603}.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of chromatin binding (GO:0035562)|negative regulation of DNA replication (GO:0008156)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of fibroblast proliferation (GO:0048146)|protein localization to chromatin (GO:0071168)|regulation of chromosome condensation (GO:0060623)|regulation of cohesin localization to chromatin (GO:0071922)|response to toxic substance (GO:0009636)|viral process (GO:0016032)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)				breast(2)|endometrium(2)|kidney(5)|large_intestine(6)|lung(13)|ovary(2)|stomach(1)	31						TTCTTTGTCTTCTCGTCTGCA	0.358																																						uc001kdo.2		NA																	0				ovary(1)	1						c.(1882-1884)GAA>GTA		wings apart-like homolog							126.0	110.0	115.0					10																	88232379		2202	4300	6502	SO:0001583	missense	23063				cell division|interspecies interaction between organisms|mitosis|negative regulation of chromatin binding|negative regulation of DNA replication|negative regulation of sister chromatid cohesion|protein localization to chromatin|regulation of cohesin localization to chromatin	chromatin|cohesin complex|cytoplasm	protein binding	g.chr10:88232379T>A	AB065003	CCDS7375.1	10q23.31	2006-12-08	2006-03-16	2006-03-16	ENSG00000062650	ENSG00000062650			23293	protein-coding gene	gene with protein product	"""friend of EBNA2"""	610754	"""KIAA0261"""	KIAA0261		9039502, 17112726	Standard	XM_006717726		Approved	FOE, WAPL	uc001kdo.3	Q7Z5K2	OTTHUMG00000018651	ENST00000298767.5:c.1883A>T	10.37:g.88232379T>A	ENSP00000298767:p.Glu628Val		Somatic				WAPAL_uc009xsv.2_5'Flank|WAPAL_uc001kdn.2_Missense_Mutation_p.E665V|WAPAL_uc009xsw.2_Missense_Mutation_p.E622V	p.E628V	NM_015045	NP_055860	WXS	Illumina HiSeq	Unspecified	Q7Z5K2	WAPL_HUMAN			6	2325	-			628			Mediates interaction with the cohesin complex.|WAPL.		A7E2B5|Q5VSK5|Q8IX10|Q92549	Missense_Mutation	SNP	ENST00000298767.5	37	c.1883A>T	CCDS7375.1	.	.	.	.	.	.	.	.	.	.	T	18.27	3.586311	0.66105	.	.	ENSG00000062650	ENST00000342368;ENST00000298767;ENST00000372076	T	0.52754	0.65	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.66025	0.2748	L	0.60455	1.87	0.80722	D	1	D;D;D	0.89917	0.998;0.998;1.0	D;D;D	0.87578	0.994;0.994;0.998	T	0.68281	-0.5450	10	0.66056	D	0.02	.	15.9854	0.80147	0.0:0.0:0.0:1.0	.	622;628;665	B2RTX8;Q7Z5K2;Q7Z5K2-2	.;WAPL_HUMAN;.	V	713;628;713	ENSP00000298767:E628V	ENSP00000298767:E628V	E	-	2	0	WAPAL	88222359	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.698000	0.84413	2.165000	0.68154	0.533000	0.62120	GAA		0.358	WAPAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049151.2	NM_015045		9	35	0	0	0	0	9	35				
ZDHHC16	84287	broad.mit.edu	37	10	99211482	99211482	+	Missense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr10:99211482G>A	ENST00000370854.3	+	2	239	c.50G>A	c.(49-51)cGc>cAc	p.R17H	ZDHHC16_ENST00000393760.1_Missense_Mutation_p.R17H|ZDHHC16_ENST00000353979.3_Missense_Mutation_p.R17H|ZDHHC16_ENST00000352634.4_Missense_Mutation_p.R17H|ZDHHC16_ENST00000370846.4_Missense_Mutation_p.R17H|ZDHHC16_ENST00000345745.5_Missense_Mutation_p.R17H|ZDHHC16_ENST00000370842.2_Missense_Mutation_p.R17H	NM_032327.2	NP_115703.2	Q969W1	ZDH16_HUMAN	zinc finger, DHHC-type containing 16	17					apoptotic process (GO:0006915)|protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			kidney(4)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	14		Colorectal(252;0.0846)		Epithelial(162;5.81e-10)|all cancers(201;4.19e-08)		CTCTGCCTCCGCCTCCTTCTG	0.667																																						uc001knj.2		NA																	0				ovary(1)	1						c.(49-51)CGC>CAC		Abl-philin 2 isoform 1							29.0	34.0	32.0					10																	99211482		2203	4300	6503	SO:0001583	missense	84287				apoptosis	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity|zinc ion binding	g.chr10:99211482G>A	AF258563	CCDS7460.1, CCDS7461.1, CCDS7462.1, CCDS7463.1, CCDS73176.1	10q24.1	2008-05-02			ENSG00000171307	ENSG00000171307		"""Zinc fingers, DHHC-type"""	20714	protein-coding gene	gene with protein product						12021275	Standard	NM_198043		Approved	APH2	uc001knk.3	Q969W1	OTTHUMG00000018847	ENST00000370854.3:c.50G>A	10.37:g.99211482G>A	ENSP00000359891:p.Arg17His		Somatic				ZDHHC16_uc001knp.2_Missense_Mutation_p.R17H|ZDHHC16_uc001knk.2_Missense_Mutation_p.R17H|ZDHHC16_uc001knl.2_Missense_Mutation_p.R17H|ZDHHC16_uc001knm.2_Missense_Mutation_p.R17H|ZDHHC16_uc001knn.2_Missense_Mutation_p.R17H|ZDHHC16_uc010qow.1_Missense_Mutation_p.R17H|ZDHHC16_uc009xvq.2_RNA|ZDHHC16_uc001kno.2_Missense_Mutation_p.R17H|ZDHHC16_uc009xvr.2_Missense_Mutation_p.R17H	p.R17H	NM_198046	NP_932163	WXS	Illumina HiSeq	Unspecified	Q969W1	ZDH16_HUMAN		Epithelial(162;5.81e-10)|all cancers(201;4.19e-08)	3	399	+		Colorectal(252;0.0846)	17			Cytoplasmic (Potential).		D3DR52|D3DR53|D3DR54|Q5JTG7|Q5JTH0|Q8N4Z6|Q8WY84|Q9BSV3	Missense_Mutation	SNP	ENST00000370854.3	37	c.50G>A	CCDS7460.1	.	.	.	.	.	.	.	.	.	.	G	16.01	3.000728	0.54254	.	.	ENSG00000171307	ENST00000370854;ENST00000393760;ENST00000414567;ENST00000370846;ENST00000352634;ENST00000353979;ENST00000370842;ENST00000345745;ENST00000433086	T;T;T;T;T;T;T;T;T	0.20463	2.07;2.07;2.07;2.07;2.07;2.07;2.07;2.07;2.07	5.59	5.59	0.84812	.	0.052524	0.64402	D	0.000001	T	0.29028	0.0721	N	0.20986	0.625	0.40582	D	0.981407	B;B;D;B;B;B;B	0.76494	0.0;0.002;0.999;0.0;0.003;0.0;0.0	B;B;D;B;B;B;B	0.65987	0.0;0.001;0.94;0.0;0.002;0.0;0.0	T	0.04551	-1.0943	10	0.87932	D	0	.	10.6764	0.45789	0.1171:0.0:0.8829:0.0	.	17;17;17;17;17;17;17	B4DNL2;E9PCL9;B1AMU0;Q969W1-3;Q969W1-4;Q969W1-2;Q969W1	.;.;.;.;.;.;ZDH16_HUMAN	H	17	ENSP00000359891:R17H;ENSP00000377357:R17H;ENSP00000400719:R17H;ENSP00000359883:R17H;ENSP00000345383:R17H;ENSP00000323360:R17H;ENSP00000359879:R17H;ENSP00000304487:R17H;ENSP00000398532:R17H	ENSP00000304487:R17H	R	+	2	0	ZDHHC16	99201472	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.556000	0.67307	2.641000	0.89580	0.561000	0.74099	CGC		0.667	ZDHHC16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049658.2	NM_032327		16	23	0	0	0	0	16	23				
SORCS3	22986	broad.mit.edu	37	10	106976783	106976783	+	Missense_Mutation	SNP	C	C	G			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr10:106976783C>G	ENST00000369701.3	+	19	2864	c.2637C>G	c.(2635-2637)atC>atG	p.I879M	SORCS3_ENST00000369699.4_Missense_Mutation_p.I165M	NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	879	PKD. {ECO:0000255|PROSITE- ProRule:PRU00151}.				learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		AGGACGGCATCAAGCACGTGT	0.517																																					NSCLC(116;1497 1690 7108 13108 14106)	uc001kyi.1		NA																	0				ovary(6)|skin(3)|central_nervous_system(1)	10						c.(2635-2637)ATC>ATG		VPS10 domain receptor protein SORCS 3 precursor							180.0	137.0	152.0					10																	106976783		2203	4300	6503	SO:0001583	missense	22986					integral to membrane	neuropeptide receptor activity	g.chr10:106976783C>G	AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.2637C>G	10.37:g.106976783C>G	ENSP00000358715:p.Ile879Met		Somatic				SORCS3_uc010qqz.1_RNA	p.I879M	NM_014978	NP_055793	WXS	Illumina HiSeq	Unspecified	Q9UPU3	SORC3_HUMAN		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)	19	2864	+		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)	879			PKD.|Lumenal (Potential).		Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	ENST00000369701.3	37	c.2637C>G	CCDS7558.1	.	.	.	.	.	.	.	.	.	.	C	18.10	3.548171	0.65311	.	.	ENSG00000156395	ENST00000369701;ENST00000369699	T;T	0.61392	0.11;0.11	5.87	4.96	0.65561	PKD domain (4);	0.000000	0.85682	D	0.000000	T	0.74764	0.3759	M	0.76574	2.34	0.49582	D	0.999803	D	0.89917	1.0	D	0.83275	0.996	T	0.76528	-0.2926	9	.	.	.	.	14.225	0.65853	0.272:0.728:0.0:0.0	.	879	Q9UPU3	SORC3_HUMAN	M	879;165	ENSP00000358715:I879M;ENSP00000358713:I165M	.	I	+	3	3	SORCS3	106966773	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.888000	0.48594	1.590000	0.49995	0.655000	0.94253	ATC		0.517	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978		13	35	0	0	0	0	13	35				
GFRA1	2674	broad.mit.edu	37	10	117884986	117884986	+	Silent	SNP	C	C	T	rs371921058		TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr10:117884986C>T	ENST00000355422.6	-	6	1066	c.516G>A	c.(514-516)tcG>tcA	p.S172S	GFRA1_ENST00000369236.1_Silent_p.S167S|GFRA1_ENST00000544592.1_Silent_p.S51S|GFRA1_ENST00000439649.3_Silent_p.S167S	NM_005264.4	NP_005255.1	P56159	GFRA1_HUMAN	GDNF family receptor alpha 1	172					axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	glial cell-derived neurotrophic factor receptor activity (GO:0016167)|receptor binding (GO:0005102)			endometrium(2)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	26		Lung NSC(174;0.21)		all cancers(201;0.0337)		TGATGTACGCCGACCTGTACT	0.577													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18102	0.0		0.0	False		,,,				2504	0.0				Ovarian(128;329 1725 45498 46808 50759)	uc001lcj.2		NA																	0				ovary(1)|pancreas(1)	2						c.(514-516)TCG>TCA		GDNF family receptor alpha 1 isoform a		C	,,	0,4406		0,0,2203	81.0	68.0	72.0		501,516,501	-11.5	0.0	10		72	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	GFRA1	NM_001145453.1,NM_005264.4,NM_145793.3	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	167/461,172/466,167/461	117884986	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	2674				axon guidance	anchored to membrane|extrinsic to membrane|plasma membrane	glial cell-derived neurotrophic factor receptor activity	g.chr10:117884986C>T	AF038421	CCDS7593.1, CCDS44481.1	10q25-q26	2011-01-25			ENSG00000151892	ENSG00000151892			4243	protein-coding gene	gene with protein product		601496		GDNFRA		9465905, 9545641	Standard	NM_005264		Approved	RETL1, GDNFR, GFR-ALPHA-1, RET1L, TRNR1	uc001lcj.3	P56159	OTTHUMG00000019097	ENST00000355422.6:c.516G>A	10.37:g.117884986C>T			Somatic				GFRA1_uc001lci.2_Silent_p.S167S|GFRA1_uc009xyr.2_Silent_p.S167S	p.S172S	NM_005264	NP_005255	WXS	Illumina HiSeq	Unspecified	P56159	GFRA1_HUMAN		all cancers(201;0.0337)	6	1214	-		Lung NSC(174;0.21)	172			2		A8KA21|O15507|O43912	Silent	SNP	ENST00000355422.6	37	c.516G>A	CCDS44481.1																																																																																				0.577	GFRA1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050512.2	NM_145793		12	28	0	0	0	0	12	28				
PSMA1	5682	broad.mit.edu	37	11	14526746	14526746	+	Missense_Mutation	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr11:14526746C>T	ENST00000396394.2	-	10	1180	c.784G>A	c.(784-786)Gaa>Aaa	p.E262K	PSMA1_ENST00000555531.1_3'UTR|PSMA1_ENST00000418988.2_Missense_Mutation_p.E268K|PSMA1_ENST00000419365.2_3'UTR|PSMA1_ENST00000524606.1_5'UTR|PSMA1_ENST00000396393.1_Missense_Mutation_p.E262K|PSMA1_ENST00000530457.1_Missense_Mutation_p.E237K	NM_002786.3	NP_002777.1	P25786	PSA1_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 1	262					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysome (GO:0005844)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	RNA binding (GO:0003723)|threonine-type endopeptidase activity (GO:0004298)			large_intestine(1)|skin(1)|upper_aerodigestive_tract(1)	3						ACTTAATGTTCCATTGGTTCA	0.333																																						uc001mlk.2		NA																	0				upper_aerodigestive_tract(1)|skin(1)	2						c.(784-786)GAA>AAA		proteasome alpha 1 subunit isoform 2							179.0	188.0	185.0					11																	14526746		2200	4294	6494	SO:0001583	missense	5682				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|polysome|proteasome core complex, alpha-subunit complex	protein binding|RNA binding|threonine-type endopeptidase activity	g.chr11:14526746C>T	X61969	CCDS7816.1, CCDS31431.1	11p15.1	2005-10-10			ENSG00000129084	ENSG00000129084		"""Proteasome (prosome, macropain) subunits"""	9530	protein-coding gene	gene with protein product		602854				1398136, 2025653	Standard	NM_148976		Approved	HC2, NU, PROS30, MGC14542, MGC14575, MGC14751, MGC1667, MGC21459, MGC22853, MGC23915	uc001mlk.3	P25786	OTTHUMG00000165825	ENST00000396394.2:c.784G>A	11.37:g.14526746C>T	ENSP00000379676:p.Glu262Lys		Somatic				PSMA1_uc001mll.2_Missense_Mutation_p.E268K|PSMA1_uc010rcp.1_RNA|PSMA1_uc001mlj.2_Missense_Mutation_p.E237K	p.E262K	NM_002786	NP_002777	WXS	Illumina HiSeq	Unspecified	P25786	PSA1_HUMAN			10	930	-			262					A8K400|Q53YE8|Q9BRV9	Missense_Mutation	SNP	ENST00000396394.2	37	c.784G>A	CCDS7816.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.100248	0.76983	.	.	ENSG00000129084	ENST00000396394;ENST00000396393;ENST00000530457;ENST00000418988	T;T;T;T	0.33654	1.42;1.42;1.4;1.41	5.35	5.35	0.76521	.	0.049531	0.85682	D	0.000000	T	0.55481	0.1923	L	0.52573	1.65	0.80722	D	1	P;P	0.37398	0.593;0.458	P;B	0.57846	0.828;0.292	T	0.54603	-0.8269	10	0.72032	D	0.01	-11.6946	17.1882	0.86872	0.0:1.0:0.0:0.0	.	268;262	P25786-2;P25786	.;PSA1_HUMAN	K	262;262;237;268	ENSP00000379676:E262K;ENSP00000379675:E262K;ENSP00000441166:E237K;ENSP00000414359:E268K	ENSP00000379675:E262K	E	-	1	0	PSMA1	14483322	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.356000	0.66052	2.655000	0.90218	0.591000	0.81541	GAA		0.333	PSMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386421.3	NM_002786		26	70	0	0	0	0	26	70				
MRGPRX4	117196	broad.mit.edu	37	11	18195639	18195639	+	Missense_Mutation	SNP	G	G	C			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr11:18195639G>C	ENST00000314254.3	+	1	1256	c.836G>C	c.(835-837)aGg>aCg	p.R279T	RP11-113D6.6_ENST00000527671.1_Intron	NM_054032.3	NP_473373.2	Q96LA9	MRGX4_HUMAN	MAS-related GPR, member X4	279						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32						GGCTCCTTTAGGCAGCGTCAA	0.488																																						uc001mnv.1		NA																	0				skin(1)	1						c.(835-837)AGG>ACG		MAS-related GPR, member X4							97.0	96.0	97.0					11																	18195639		2199	4291	6490	SO:0001583	missense	117196					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr11:18195639G>C	AY042216	CCDS7831.1	11p15.1	2013-10-10			ENSG00000179817	ENSG00000179817		"""GPCR / Class A : Orphans"""	17617	protein-coding gene	gene with protein product		607230				11551509	Standard	NM_054032		Approved	MRGX4	uc001mnv.1	Q96LA9	OTTHUMG00000166442	ENST00000314254.3:c.836G>C	11.37:g.18195639G>C	ENSP00000314042:p.Arg279Thr		Somatic					p.R279T	NM_054032	NP_473373	WXS	Illumina HiSeq	Unspecified	Q96LA9	MRGX4_HUMAN			1	1256	+			279			Cytoplasmic (Potential).		Q3KNU3|Q3KNU4|Q502W0|Q8TDD6|Q8TDD7	Missense_Mutation	SNP	ENST00000314254.3	37	c.836G>C	CCDS7831.1	.	.	.	.	.	.	.	.	.	.	G	13.75	2.329721	0.41297	.	.	ENSG00000179817	ENST00000314254	T	0.39787	1.06	2.85	0.645	0.17782	.	0.083384	0.51477	D	0.000087	T	0.58623	0.2135	M	0.90542	3.125	0.09310	N	1	D	0.58620	0.983	P	0.62382	0.901	T	0.48969	-0.8987	10	0.59425	D	0.04	.	2.9092	0.05731	0.1603:0.0:0.5695:0.2702	.	279	Q96LA9	MRGX4_HUMAN	T	279	ENSP00000314042:R279T	ENSP00000314042:R279T	R	+	2	0	MRGPRX4	18152215	0.029000	0.19370	0.006000	0.13384	0.269000	0.26545	1.537000	0.36083	0.540000	0.28808	0.430000	0.28490	AGG		0.488	MRGPRX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389788.1	NM_054032		13	66	0	0	0	0	13	66				
IGSF22	283284	broad.mit.edu	37	11	18735568	18735568	+	Nonsense_Mutation	SNP	G	G	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr11:18735568G>T	ENST00000513874.1	-	14	2065	c.1926C>A	c.(1924-1926)taC>taA	p.Y642*	RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	642	Ig-like 4.									NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						TGCCATCCTTGTACCATGTCA	0.602																																						uc009yht.2		NA																	0				ovary(4)|large_intestine(2)|kidney(1)	7						c.(1924-1926)TAC>TAA		immunoglobulin superfamily, member 22							119.0	123.0	122.0					11																	18735568		2178	4260	6438	SO:0001587	stop_gained	283284							g.chr11:18735568G>T	AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.1926C>A	11.37:g.18735568G>T	ENSP00000421191:p.Tyr642*		Somatic				IGSF22_uc001mpa.2_RNA	p.Y642*	NM_173588	NP_775859	WXS	Illumina HiSeq	Unspecified	Q8N9C0	IGS22_HUMAN			14	2116	-			642			Ig-like 4.		A6NNA0|D6RGV7	Nonsense_Mutation	SNP	ENST00000513874.1	37	c.1926C>A	CCDS41625.2	.	.	.	.	.	.	.	.	.	.	G	40	7.922824	0.98563	.	.	ENSG00000179057	ENST00000513874	.	.	.	4.11	2.03	0.26663	.	0.000000	0.31519	U	0.007518	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.8636	0.24079	0.3273:0.0:0.6727:0.0	.	.	.	.	X	642	.	ENSP00000322422:Y642X	Y	-	3	2	IGSF22	18692144	1.000000	0.71417	0.959000	0.39883	0.989000	0.77384	1.310000	0.33551	0.323000	0.23307	0.551000	0.68910	TAC		0.602	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360850.2	NM_173588		24	64	1	0	9.86e-18	1.14e-17	24	64				
ANO5	203859	broad.mit.edu	37	11	22257816	22257816	+	Silent	SNP	C	C	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr11:22257816C>A	ENST00000324559.8	+	8	1073	c.756C>A	c.(754-756)ctC>ctA	p.L252L		NM_001142649.1|NM_213599.2	NP_001136121.1|NP_998764.1	Q75V66	ANO5_HUMAN	anoctamin 5	252					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	intracellular calcium activated chloride channel activity (GO:0005229)			breast(2)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(12)|lung(36)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CCTATCCACTCCATGATGTAT	0.383																																						uc001mqi.2		NA																	0				central_nervous_system(3)|ovary(1)	4						c.(754-756)CTC>CTA		anoctamin 5 isoform a							114.0	97.0	103.0					11																	22257816		2203	4300	6503	SO:0001819	synonymous_variant	203859					chloride channel complex|endoplasmic reticulum membrane	chloride channel activity	g.chr11:22257816C>A	AL833271	CCDS31444.1	11p15.1	2014-09-17	2008-08-28	2008-08-28	ENSG00000171714	ENSG00000171714		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	27337	protein-coding gene	gene with protein product		608662	"""transmembrane protein 16E"", ""limb girdle muscular dystrophy 2L (autosomal recessive)"""	TMEM16E, LGMD2L		15067359, 20096397, 24692353	Standard	NM_213599		Approved	GDD1	uc001mqi.2	Q75V66	OTTHUMG00000166051	ENST00000324559.8:c.756C>A	11.37:g.22257816C>A			Somatic				ANO5_uc001mqj.2_Silent_p.L251L	p.L252L	NM_213599	NP_998764	WXS	Illumina HiSeq	Unspecified	Q75V66	ANO5_HUMAN			8	1073	+			252			Cytoplasmic (Potential).			Silent	SNP	ENST00000324559.8	37	c.756C>A	CCDS31444.1																																																																																				0.383	ANO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387615.1	NM_213599		11	37	1	0	5.17e-11	5.83e-11	11	37				
TCP11L1	55346	broad.mit.edu	37	11	33083210	33083210	+	Missense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr11:33083210G>A	ENST00000334274.4	+	7	1310	c.910G>A	c.(910-912)Gtc>Atc	p.V304I	TCP11L1_ENST00000432887.1_Missense_Mutation_p.V304I|TCP11L1_ENST00000531632.2_Missense_Mutation_p.V304I|TCP11L1_ENST00000324357.9_Missense_Mutation_p.V83I	NM_018393.3	NP_060863.3	Q9NUJ3	T11L1_HUMAN	t-complex 11, testis-specific-like 1	304						microtubule (GO:0005874)				kidney(1)|liver(2)|lung(2)|skin(1)	6						CCCTGTTGCTGTCCAGAATTA	0.547																																						uc001mud.2		NA																	0					0						c.(910-912)GTC>ATC		t-complex 11 (mouse) like 1							46.0	42.0	43.0					11																	33083210		2202	4298	6500	SO:0001583	missense	55346							g.chr11:33083210G>A	BC041696	CCDS7882.1	11p13	2014-08-12	2012-09-20		ENSG00000176148	ENSG00000176148			25655	protein-coding gene	gene with protein product			"""t-complex 11 (mouse) like 1"""				Standard	NM_001145541		Approved	FLJ11336	uc010rei.2	Q9NUJ3	OTTHUMG00000165303	ENST00000334274.4:c.910G>A	11.37:g.33083210G>A	ENSP00000335595:p.Val304Ile		Somatic				TCP11L1_uc009yju.2_Missense_Mutation_p.V119I|TCP11L1_uc010rei.1_Missense_Mutation_p.V304I|TCP11L1_uc001mue.2_Missense_Mutation_p.V304I|TCP11L1_uc001muf.1_RNA	p.V304I	NM_018393	NP_060863	WXS	Illumina HiSeq	Unspecified	Q9NUJ3	T11L1_HUMAN			7	1310	+			304					D3DR01|Q8IVX4	Missense_Mutation	SNP	ENST00000334274.4	37	c.910G>A	CCDS7882.1	.	.	.	.	.	.	.	.	.	.	G	9.128	1.010744	0.19277	.	.	ENSG00000176148	ENST00000334274;ENST00000531632;ENST00000432887;ENST00000324357	T;T;T;T	0.12361	2.69;2.69;2.69;2.69	5.42	0.917	0.19380	.	0.289314	0.37669	N	0.001997	T	0.10294	0.0252	L	0.31664	0.95	0.28679	N	0.905214	B	0.22276	0.067	B	0.23150	0.044	T	0.17107	-1.0380	10	0.59425	D	0.04	-27.2078	11.4238	0.49998	0.3994:0.0:0.6006:0.0	.	304	Q9NUJ3	T11L1_HUMAN	I	304;304;304;83	ENSP00000335595:V304I;ENSP00000433067:V304I;ENSP00000395070:V304I;ENSP00000316279:V83I	ENSP00000316279:V83I	V	+	1	0	TCP11L1	33039786	0.958000	0.32768	0.287000	0.24848	0.061000	0.15899	1.033000	0.30191	0.272000	0.22027	0.650000	0.86243	GTC		0.547	TCP11L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383377.4	NM_018393		5	17	0	0	0	0	5	17				
OR4C11	219429	broad.mit.edu	37	11	55371357	55371357	+	Missense_Mutation	SNP	G	G	A	rs141808171		TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr11:55371357G>A	ENST00000302231.4	-	1	517	c.493C>T	c.(493-495)Cct>Tct	p.P165S		NM_001004700.2	NP_001004700.2	Q6IEV9	OR4CB_HUMAN	olfactory receptor, family 4, subfamily C, member 11	165						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(5)|lung(23)|ovary(1)|prostate(1)|skin(1)	33						CCACAGAAAGGCAATCTTAAG	0.443													g|||	1	0.000199681	0.0008	0.0	5008	,	,		14058	0.0		0.0	False		,,,				2504	0.0					uc010rii.1		NA																	0				ovary(1)	1						c.(493-495)CCT>TCT		olfactory receptor, family 4, subfamily C,		G	SER/PRO	3,4353		0,3,2175	71.0	61.0	65.0		493	4.3	0.6	11	dbSNP_134	65	0,8024		0,0,4012	yes	missense	OR4C11	NM_001004700.2	74	0,3,6187	AA,AG,GG		0.0,0.0689,0.0242	possibly-damaging	165/311	55371357	3,12377	2178	4012	6190	SO:0001583	missense	219429				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55371357G>A	AB065774	CCDS31503.1	11q11	2012-08-09		2004-03-10	ENSG00000172188	ENSG00000172188		"""GPCR / Class A : Olfactory receptors"""	15167	protein-coding gene	gene with protein product				OR4C11P			Standard	NM_001004700		Approved		uc010rii.2	Q6IEV9	OTTHUMG00000165290	ENST00000302231.4:c.493C>T	11.37:g.55371357G>A	ENSP00000306651:p.Pro165Ser		Somatic					p.P165S	NM_001004700	NP_001004700	WXS	Illumina HiSeq	Unspecified	Q6IEV9	OR4CB_HUMAN			1	493	-			165			Extracellular (Potential).		B9EIL4|Q8NGL8	Missense_Mutation	SNP	ENST00000302231.4	37	c.493C>T	CCDS31503.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	9.737	1.163864	0.21538	6.89E-4	0.0	ENSG00000172188	ENST00000302231	T	0.00164	8.64	4.34	4.34	0.51931	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48286	U	0.000182	T	0.00210	0.0006	L	0.42008	1.315	0.09310	N	1	P	0.40431	0.717	P	0.45753	0.492	T	0.54255	-0.8321	10	0.66056	D	0.02	.	11.9262	0.52820	0.0:0.1763:0.8237:0.0	.	165	Q6IEV9	OR4CB_HUMAN	S	165	ENSP00000306651:P165S	ENSP00000306651:P165S	P	-	1	0	OR4C11	55127933	0.000000	0.05858	0.555000	0.28281	0.025000	0.11179	-0.562000	0.05950	2.425000	0.82216	0.478000	0.44815	CCT		0.443	OR4C11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383268.1	NM_001004700		16	14	0	0	0	0	16	14				
OR5D13	390142	broad.mit.edu	37	11	55541352	55541352	+	Missense_Mutation	SNP	G	G	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr11:55541352G>T	ENST00000361760.1	+	1	439	c.439G>T	c.(439-441)Gtg>Ttg	p.V147L		NM_001001967.1	NP_001001967.1	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D, member 13	147						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(1)|lung(20)|ovary(1)|pancreas(2)|skin(2)|stomach(1)|urinary_tract(1)	40		all_epithelial(135;0.196)				TGCTCTTCTGGTGGCTGGGTC	0.403																																						uc010ril.1		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(439-441)GTG>TTG		olfactory receptor, family 5, subfamily D,							203.0	203.0	203.0					11																	55541352		2200	4296	6496	SO:0001583	missense	390142				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55541352G>T	BK004394	CCDS31507.1	11q11	2012-08-09			ENSG00000198877	ENSG00000198877		"""GPCR / Class A : Olfactory receptors"""	15280	protein-coding gene	gene with protein product							Standard	NM_001001967		Approved		uc010ril.2	Q8NGL4	OTTHUMG00000166807	ENST00000361760.1:c.439G>T	11.37:g.55541352G>T	ENSP00000354800:p.Val147Leu		Somatic					p.V147L	NM_001001967	NP_001001967	WXS	Illumina HiSeq	Unspecified	Q8NGL4	OR5DD_HUMAN			1	439	+		all_epithelial(135;0.196)	147			Helical; Name=4; (Potential).		Q6IF68|Q6IFC9	Missense_Mutation	SNP	ENST00000361760.1	37	c.439G>T	CCDS31507.1	.	.	.	.	.	.	.	.	.	.	G	15.05	2.719374	0.48728	.	.	ENSG00000198877	ENST00000361760	T	0.36878	1.23	3.3	3.3	0.37823	GPCR, rhodopsin-like superfamily (1);	0.692985	0.11217	N	0.587097	T	0.53286	0.1787	M	0.73753	2.245	0.09310	N	1	B	0.33212	0.402	P	0.47134	0.539	T	0.51733	-0.8668	10	0.56958	D	0.05	-13.4377	13.7145	0.62689	0.0:0.0:1.0:0.0	.	147	Q8NGL4	OR5DD_HUMAN	L	147	ENSP00000354800:V147L	ENSP00000354800:V147L	V	+	1	0	OR5D13	55297928	0.000000	0.05858	0.040000	0.18447	0.006000	0.05464	0.224000	0.17738	1.886000	0.54624	0.486000	0.48141	GTG		0.403	OR5D13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391511.1	NM_001001967		15	137	1	0	2e-07	2.22e-07	15	137				
PC	5091	broad.mit.edu	37	11	66617416	66617416	+	Missense_Mutation	SNP	G	G	A	rs192822072		TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr11:66617416G>A	ENST00000393958.2	-	19	2983	c.2890C>T	c.(2890-2892)Cgc>Tgc	p.R964C	PC_ENST00000393960.1_Missense_Mutation_p.R964C|PC_ENST00000393955.2_Missense_Mutation_p.R964C|PC_ENST00000528224.1_5'Flank|PC_ENST00000529047.1_Missense_Mutation_p.R84C	NM_000920.3	NP_000911.2	P11498	PYC_HUMAN	pyruvate carboxylase	964					biotin metabolic process (GO:0006768)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|oxaloacetate metabolic process (GO:0006107)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|pyruvate carboxylase activity (GO:0004736)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	ACCTTAGAGCGAAAGGGTTCG	0.627													G|||	1	0.000199681	0.0	0.0	5008	,	,		14439	0.0		0.001	False		,,,				2504	0.0					uc001ojn.1		NA																	0				ovary(2)|lung(1)|kidney(1)	4						c.(2890-2892)CGC>TGC		pyruvate carboxylase precursor	Biotin(DB00121)|Pyruvic acid(DB00119)						34.0	38.0	37.0					11																	66617416		2200	4295	6495	SO:0001583	missense	5091				gluconeogenesis|lipid biosynthetic process	mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|metal ion binding|pyruvate carboxylase activity	g.chr11:66617416G>A	U04641	CCDS8152.1	11q13.4-q13.5	2012-07-11			ENSG00000173599	ENSG00000173599	6.4.1.1		8636	protein-coding gene	gene with protein product		608786				6548474	Standard	NM_022172		Approved	PCB	uc001ojn.1	P11498	OTTHUMG00000167099	ENST00000393958.2:c.2890C>T	11.37:g.66617416G>A	ENSP00000377530:p.Arg964Cys		Somatic				PC_uc001ojo.1_Missense_Mutation_p.R964C|PC_uc001ojp.1_Missense_Mutation_p.R964C|PC_uc001ojm.1_5'Flank	p.R964C	NM_022172	NP_071504	WXS	Illumina HiSeq	Unspecified	P11498	PYC_HUMAN		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	18	2939	-		Melanoma(852;0.0525)	964					B4DN00|Q16705	Missense_Mutation	SNP	ENST00000393958.2	37	c.2890C>T	CCDS8152.1	3	0.0013736263736263737	2	0.0040650406504065045	0	0.0	0	0.0	1	0.0013192612137203166	G	16.54	3.152868	0.57259	.	.	ENSG00000173599	ENST00000529047;ENST00000393955;ENST00000393958;ENST00000393960	D;D;D;D	0.96365	-1.87;-3.99;-3.99;-3.99	5.01	5.01	0.66863	Carboxylase, conserved domain (1);	0.000000	0.85682	D	0.000000	D	0.98865	0.9616	H	0.98089	4.145	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.99297	1.0900	10	0.87932	D	0	-27.0792	15.8561	0.78979	0.0:0.0:1.0:0.0	.	964	P11498	PYC_HUMAN	C	84;964;964;964	ENSP00000435905:R84C;ENSP00000377527:R964C;ENSP00000377530:R964C;ENSP00000377532:R964C	ENSP00000377527:R964C	R	-	1	0	PC	66373992	1.000000	0.71417	0.999000	0.59377	0.796000	0.44982	3.875000	0.56108	2.603000	0.88011	0.462000	0.41574	CGC		0.627	PC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393115.1	NM_001040716		10	31	0	0	0	0	10	31				
OR2AT4	341152	broad.mit.edu	37	11	74800175	74800175	+	Missense_Mutation	SNP	G	G	C			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr11:74800175G>C	ENST00000305159.3	-	1	624	c.584C>G	c.(583-585)tCt>tGt	p.S195C		NM_001005285.1	NP_001005285.1	A6NND4	O2AT4_HUMAN	olfactory receptor, family 2, subfamily AT, member 4	195						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(2)	12						GGTGGTGTCAGAGCAGGAGGC	0.567																																						uc010rro.1		NA																	0				ovary(1)	1						c.(583-585)TCT>TGT		olfactory receptor, family 2, subfamily AT,							59.0	52.0	55.0					11																	74800175		2200	4293	6493	SO:0001583	missense	341152				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:74800175G>C	BK004820	CCDS31639.1	11q13.4	2012-08-09			ENSG00000171561	ENSG00000171561		"""GPCR / Class A : Olfactory receptors"""	19620	protein-coding gene	gene with protein product							Standard	NM_001005285		Approved		uc010rro.2	A6NND4	OTTHUMG00000165370	ENST00000305159.3:c.584C>G	11.37:g.74800175G>C	ENSP00000304846:p.Ser195Cys		Somatic					p.S195C	NM_001005285	NP_001005285	WXS	Illumina HiSeq	Unspecified	A6NND4	O2AT4_HUMAN			1	584	-			195			Extracellular (Potential).		B9EGZ8	Missense_Mutation	SNP	ENST00000305159.3	37	c.584C>G	CCDS31639.1	.	.	.	.	.	.	.	.	.	.	G	15.72	2.917342	0.52546	.	.	ENSG00000171561	ENST00000305159	T	0.43294	0.95	5.26	4.28	0.50868	GPCR, rhodopsin-like superfamily (1);	0.000000	0.31257	U	0.007962	T	0.67627	0.2913	M	0.92507	3.315	0.25859	N	0.98384	D	0.89917	1.0	D	0.74023	0.982	T	0.63395	-0.6647	10	0.72032	D	0.01	.	8.4463	0.32843	0.0:0.1663:0.6618:0.1719	.	195	A6NND4	O2AT4_HUMAN	C	195	ENSP00000304846:S195C	ENSP00000304846:S195C	S	-	2	0	OR2AT4	74477823	0.000000	0.05858	1.000000	0.80357	0.945000	0.59286	0.704000	0.25661	2.617000	0.88574	0.650000	0.86243	TCT		0.567	OR2AT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383734.1	NM_001005285		3	34	0	0	0	0	3	34				
CUL5	8065	broad.mit.edu	37	11	107925516	107925516	+	Missense_Mutation	SNP	A	A	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr11:107925516A>T	ENST00000393094.2	+	6	1312	c.696A>T	c.(694-696)aaA>aaT	p.K232N		NM_003478.3	NP_003469.2	Q93034	CUL5_HUMAN	cullin 5	232					calcium ion transmembrane transport (GO:0070588)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cytosolic calcium ion homeostasis (GO:0051480)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|response to osmotic stress (GO:0006970)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	Cul5-RING ubiquitin ligase complex (GO:0031466)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|receptor activity (GO:0004872)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(1)|prostate(1)|skin(1)	23		all_cancers(61;7.09e-10)|all_epithelial(67;2.97e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|Melanoma(852;4.48e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;3.58e-05)|Epithelial(105;4.68e-05)|all cancers(92;0.00122)|OV - Ovarian serous cystadenocarcinoma(223;0.217)		ATTATATGAAATATGTAAGTT	0.323																																						uc001pjv.2		NA																	0				ovary(1)	1						c.(694-696)AAA>AAT		Vasopressin-activated calcium-mobilizing							51.0	53.0	52.0					11																	107925516		2201	4295	6496	SO:0001583	missense	8065				cell cycle arrest|cell proliferation|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|ubiquitin-dependent protein catabolic process|viral reproduction	cullin-RING ubiquitin ligase complex|cytosol	calcium channel activity|receptor activity|ubiquitin protein ligase binding	g.chr11:107925516A>T	X81882	CCDS31668.1	11q22.3	2011-05-24			ENSG00000166266	ENSG00000166266			2556	protein-coding gene	gene with protein product		601741				8681378, 9037604	Standard	XM_005271682		Approved	VACM-1	uc001pjv.3	Q93034	OTTHUMG00000166369	ENST00000393094.2:c.696A>T	11.37:g.107925516A>T	ENSP00000376808:p.Lys232Asn		Somatic				CUL5_uc001pju.2_RNA	p.K232N	NM_003478	NP_003469	WXS	Illumina HiSeq	Unspecified	Q93034	CUL5_HUMAN		BRCA - Breast invasive adenocarcinoma(274;3.58e-05)|Epithelial(105;4.68e-05)|all cancers(92;0.00122)|OV - Ovarian serous cystadenocarcinoma(223;0.217)	6	1363	+		all_cancers(61;7.09e-10)|all_epithelial(67;2.97e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|Melanoma(852;4.48e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)	232					A8K960|O14766|Q9BZC6	Missense_Mutation	SNP	ENST00000393094.2	37	c.696A>T	CCDS31668.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	27.7|27.7	4.858293|4.858293	0.91433|0.91433	.|.	.|.	ENSG00000166266|ENSG00000166266	ENST00000532782|ENST00000393094	.|T	.|0.76709	.|-1.04	6.02|6.02	6.02|6.02	0.97574|0.97574	.|Cullin, N-terminal (1);Cullin repeat-like-containing domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.81602|0.81602	0.4857|0.4857	M|M	0.78049|0.78049	2.395|2.395	0.80722|0.80722	D|D	1|1	.|P	.|0.45531	.|0.86	.|P	.|0.44561	.|0.453	D|D	0.84072|0.84072	0.0380|0.0380	5|10	.|0.62326	.|D	.|0.03	-23.9135|-23.9135	16.5446|16.5446	0.84426|0.84426	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|232	.|Q93034	.|CUL5_HUMAN	L|N	129|232	.|ENSP00000376808:K232N	.|ENSP00000376808:K232N	I|K	+|+	1|3	0|2	CUL5|CUL5	107430726|107430726	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.300000|9.300000	0.96151|0.96151	2.311000|2.311000	0.77944|0.77944	0.533000|0.533000	0.62120|0.62120	ATA|AAA		0.323	CUL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389429.1			15	25	0	0	0	0	15	25				
OR10S1	219873	broad.mit.edu	37	11	123848324	123848324	+	Silent	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr11:123848324G>A	ENST00000531945.1	-	1	164	c.75C>T	c.(73-75)ttC>ttT	p.F25F		NM_001004474.1	NP_001004474.1	Q8NGN2	O10S1_HUMAN	olfactory receptor, family 10, subfamily S, member 1	25						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	36		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		CCTCCAGGAAGAAGTGGCTCA	0.502																																						uc001pzm.1		NA																	0				ovary(1)|skin(1)	2						c.(73-75)TTC>TTT		olfactory receptor, family 10, subfamily S,							67.0	68.0	68.0					11																	123848324		2202	4299	6501	SO:0001819	synonymous_variant	219873				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123848324G>A	BK004509	CCDS31701.1	11q24.1	2012-08-09			ENSG00000196248	ENSG00000196248		"""GPCR / Class A : Olfactory receptors"""	14807	protein-coding gene	gene with protein product							Standard	NM_001004474		Approved		uc001pzm.1	Q8NGN2	OTTHUMG00000165963	ENST00000531945.1:c.75C>T	11.37:g.123848324G>A			Somatic					p.F25F	NM_001004474	NP_001004474	WXS	Illumina HiSeq	Unspecified	Q8NGN2	O10S1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)	1	75	-		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	25			Extracellular (Potential).		B9EH43|Q6IEV3|Q96R78	Silent	SNP	ENST00000531945.1	37	c.75C>T	CCDS31701.1																																																																																				0.502	OR10S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387265.2	NM_001004474		6	77	0	0	0	0	6	77				
NFRKB	4798	broad.mit.edu	37	11	129746654	129746654	+	Missense_Mutation	SNP	C	C	T	rs376035619		TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr11:129746654C>T	ENST00000446488.3	-	16	1812	c.1709G>A	c.(1708-1710)cGc>cAc	p.R570H	NFRKB_ENST00000524794.1_Missense_Mutation_p.R595H|NFRKB_ENST00000304521.5_Missense_Mutation_p.R570H|NFRKB_ENST00000524746.1_Missense_Mutation_p.R570H	NM_001143835.1	NP_001137307.1	Q6P4R8	NFRKB_HUMAN	nuclear factor related to kappaB binding protein	570					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protease binding (GO:0002020)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(13)|ovary(4)|skin(3)|urinary_tract(1)	32	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0167)|Lung(977;0.171)|LUSC - Lung squamous cell carcinoma(976;0.184)		CCGGTCGGAGCGCAGCAGGGA	0.572																																						uc001qfi.2		NA																	0				ovary(3)	3						c.(1708-1710)CGC>CAC		nuclear factor related to kappaB binding protein							106.0	88.0	94.0					11																	129746654		2201	4297	6498	SO:0001583	missense	4798				DNA recombination|DNA repair|inflammatory response|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	Ino80 complex	DNA binding|protease binding	g.chr11:129746654C>T		CCDS8483.1, CCDS44770.1	11q24-q25	2011-07-06			ENSG00000170322	ENSG00000170322		"""INO80 complex subunits"""	7802	protein-coding gene	gene with protein product	"""nuclear factor related to kappa B binding protein"", ""DNA-binding protein R kappa B"", ""INO80 complex subunit G"""	164013				1427843	Standard	NM_006165		Approved	DKFZp547B2013, INO80G	uc001qfg.3	Q6P4R8	OTTHUMG00000165761	ENST00000446488.3:c.1709G>A	11.37:g.129746654C>T	ENSP00000400476:p.Arg570His		Somatic				NFRKB_uc001qfg.2_Missense_Mutation_p.R595H|NFRKB_uc001qfh.2_Missense_Mutation_p.R593H|NFRKB_uc010sbw.1_Missense_Mutation_p.R580H|NFRKB_uc009zcr.2_5'Flank	p.R570H	NM_001143835	NP_001137307	WXS	Illumina HiSeq	Unspecified	Q6P4R8	NFRKB_HUMAN		OV - Ovarian serous cystadenocarcinoma(99;0.0167)|Lung(977;0.171)|LUSC - Lung squamous cell carcinoma(976;0.184)	17	1910	-	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)	570					Q12869|Q15312|Q9H048	Missense_Mutation	SNP	ENST00000446488.3	37	c.1709G>A	CCDS44770.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.840243	0.91117	.	.	ENSG00000170322	ENST00000304521;ENST00000446488;ENST00000524794;ENST00000524746;ENST00000531755	.	.	.	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.74854	0.3771	L	0.40543	1.245	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.996;0.996;0.998;0.998	T	0.73655	-0.3914	9	0.56958	D	0.05	-13.5772	20.6439	0.99570	0.0:1.0:0.0:0.0	.	580;570;570;595	B4DSL1;Q6P4R8;Q6P4R8-3;Q6P4R8-2	.;NFRKB_HUMAN;.;.	H	570;570;595;570;580	.	ENSP00000303800:R570H	R	-	2	0	NFRKB	129251864	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.416000	0.80143	2.884000	0.98904	0.655000	0.94253	CGC		0.572	NFRKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386063.2	NM_006165		8	37	0	0	0	0	8	37				
COPS7A	50813	broad.mit.edu	37	12	6839587	6839587	+	Missense_Mutation	SNP	G	G	A	rs144125600		TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr12:6839587G>A	ENST00000543155.1	+	6	1032	c.550G>A	c.(550-552)Gtg>Atg	p.V184M	COPS7A_ENST00000538410.1_Missense_Mutation_p.V184M|COPS7A_ENST00000539735.1_Missense_Mutation_p.V184M|COPS7A_ENST00000534947.1_Missense_Mutation_p.V184M|COPS7A_ENST00000542150.1_3'UTR|COPS7A_ENST00000229251.3_Missense_Mutation_p.V184M|COPS7A_ENST00000534877.1_Missense_Mutation_p.V184M	NM_001164094.1	NP_001157566.1	Q9UBW8	CSN7A_HUMAN	COP9 signalosome subunit 7A	184					cullin deneddylation (GO:0010388)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)				endometrium(2)|kidney(1)|large_intestine(1)|liver(2)|lung(2)|ovary(1)|urinary_tract(1)	10						CTGTGAGGTCGTGCTGTCAGG	0.567																																						uc001qqj.2		NA																	0				ovary(1)	1						c.(550-552)GTG>ATG		COP9 complex subunit 7a		G	MET/VAL,MET/VAL,MET/VAL,MET/VAL	0,4406		0,0,2203	91.0	84.0	87.0		550,550,550,550	5.6	1.0	12	dbSNP_134	87	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	COPS7A	NM_001164093.1,NM_001164094.1,NM_001164095.1,NM_016319.2	21,21,21,21	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	184/276,184/276,184/276,184/276	6839587	1,13005	2203	4300	6503	SO:0001583	missense	50813				cullin deneddylation	cytoplasm|signalosome		g.chr12:6839587G>A	AF193844	CCDS8558.1	12p13.31	2013-03-14	2013-03-14		ENSG00000111652	ENSG00000111652			16758	protein-coding gene	gene with protein product			"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 7A"", ""COP9 constitutive photomorphogenic homolog subunit 7A (Arabidopsis)"""				Standard	NM_001164093		Approved	CSN7A	uc001qqh.3	Q9UBW8	OTTHUMG00000169182	ENST00000543155.1:c.550G>A	12.37:g.6839587G>A	ENSP00000438115:p.Val184Met		Somatic				COPS7A_uc009zex.2_RNA|COPS7A_uc001qqk.2_Missense_Mutation_p.V184M|COPS7A_uc001qql.2_RNA|COPS7A_uc001qqh.2_Missense_Mutation_p.V184M|COPS7A_uc001qqi.2_Missense_Mutation_p.V184M|COPS7A_uc001qqm.2_RNA|COPS7A_uc001qqn.3_Missense_Mutation_p.V184M|COPS7A_uc001qqo.2_Missense_Mutation_p.V184M	p.V184M	NM_001164094	NP_001157566	WXS	Illumina HiSeq	Unspecified	Q9UBW8	CSN7A_HUMAN			6	789	+			184					A8K9A6|Q9NVX3|Q9UJW4	Missense_Mutation	SNP	ENST00000543155.1	37	c.550G>A	CCDS8558.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.404246	0.83230	0.0	1.16E-4	ENSG00000111652	ENST00000543155;ENST00000442593;ENST00000229251;ENST00000539735;ENST00000538410;ENST00000534947;ENST00000541866;ENST00000534877;ENST00000538753	.	.	.	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.75831	0.3903	M	0.68952	2.095	0.80722	D	1	D;D	0.64830	0.994;0.99	P;P	0.58820	0.846;0.705	T	0.75935	-0.3142	9	0.49607	T	0.09	-6.8838	19.5049	0.95111	0.0:0.0:1.0:0.0	.	184;184	F5H248;Q9UBW8	.;CSN7A_HUMAN	M	184	.	ENSP00000229251:V184M	V	+	1	0	COPS7A	6709848	1.000000	0.71417	0.959000	0.39883	0.799000	0.45148	9.427000	0.97472	2.603000	0.88011	0.650000	0.86243	GTG		0.567	COPS7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402740.1			4	73	0	0	0	0	4	73				
ITPR2	3709	broad.mit.edu	37	12	26493141	26493141	+	Missense_Mutation	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr12:26493141C>T	ENST00000381340.3	-	56	8394	c.7978G>A	c.(7978-7980)Gtc>Atc	p.V2660I	RP11-513G19.1_ENST00000535324.1_RNA	NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	2660					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	AGCTGTTTGACCAGACTCATG	0.547																																						uc001rhg.2		NA																	0				kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14						c.(7978-7980)GTC>ATC		inositol 1,4,5-triphosphate receptor, type 2							65.0	68.0	67.0					12																	26493141		2064	4229	6293	SO:0001583	missense	3709				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity	g.chr12:26493141C>T	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.7978G>A	12.37:g.26493141C>T	ENSP00000370744:p.Val2660Ile		Somatic					p.V2660I	NM_002223	NP_002214	WXS	Illumina HiSeq	Unspecified	Q14571	ITPR2_HUMAN			56	8395	-	Colorectal(261;0.0847)		2660			Cytoplasmic (Potential).		O94773	Missense_Mutation	SNP	ENST00000381340.3	37	c.7978G>A	CCDS41764.1	.	.	.	.	.	.	.	.	.	.	C	17.17	3.321475	0.60634	.	.	ENSG00000123104	ENST00000381340	T	0.39056	1.1	5.58	5.58	0.84498	.	0.000000	0.64402	D	0.000001	T	0.61211	0.2329	L	0.55213	1.73	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	T	0.52094	-0.8621	10	0.29301	T	0.29	.	19.9662	0.97271	0.0:1.0:0.0:0.0	.	2660	Q14571	ITPR2_HUMAN	I	2660	ENSP00000370744:V2660I	ENSP00000370744:V2660I	V	-	1	0	ITPR2	26384408	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	4.859000	0.62954	2.793000	0.96121	0.655000	0.94253	GTC		0.547	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223		18	35	0	0	0	0	18	35				
ITPR2	3709	broad.mit.edu	37	12	26572049	26572049	+	Missense_Mutation	SNP	T	T	C			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr12:26572049T>C	ENST00000381340.3	-	50	7459	c.7043A>G	c.(7042-7044)tAt>tGt	p.Y2348C	RP11-513G19.1_ENST00000535324.1_RNA	NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	2348					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	CGCCACGTGATAGAGAAAGGC	0.453																																						uc001rhg.2		NA																	0				kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14						c.(7042-7044)TAT>TGT		inositol 1,4,5-triphosphate receptor, type 2							91.0	98.0	96.0					12																	26572049		2026	4193	6219	SO:0001583	missense	3709				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity	g.chr12:26572049T>C	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.7043A>G	12.37:g.26572049T>C	ENSP00000370744:p.Tyr2348Cys		Somatic				ITPR2_uc009zjg.1_Missense_Mutation_p.Y499C	p.Y2348C	NM_002223	NP_002214	WXS	Illumina HiSeq	Unspecified	Q14571	ITPR2_HUMAN			50	7460	-	Colorectal(261;0.0847)		2348			Extracellular (Potential).		O94773	Missense_Mutation	SNP	ENST00000381340.3	37	c.7043A>G	CCDS41764.1	.	.	.	.	.	.	.	.	.	.	T	19.30	3.801835	0.70682	.	.	ENSG00000123104	ENST00000381340	D	0.98437	-4.93	5.22	5.22	0.72569	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99190	0.9719	M	0.93420	3.415	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99218	1.0878	10	0.87932	D	0	.	15.2716	0.73705	0.0:0.0:0.0:1.0	.	2348	Q14571	ITPR2_HUMAN	C	2348	ENSP00000370744:Y2348C	ENSP00000370744:Y2348C	Y	-	2	0	ITPR2	26463316	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	4.642000	0.61383	2.193000	0.70182	0.533000	0.62120	TAT		0.453	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223		19	51	0	0	0	0	19	51				
PPFIBP1	8496	broad.mit.edu	37	12	27826759	27826759	+	Splice_Site	SNP	G	G	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr12:27826759G>T	ENST00000318304.8	+	16	1713	c.1430G>T	c.(1429-1431)gGg>gTg	p.G477V	PPFIBP1_ENST00000537927.1_Splice_Site_p.G324V|PPFIBP1_ENST00000542629.1_Splice_Site_p.G446V|PPFIBP1_ENST00000228425.6_Splice_Site_p.G460V	NM_001198916.1|NM_177444.2	NP_001185845.1|NP_803193	Q86W92	LIPB1_HUMAN	PTPRF interacting protein, binding protein 1 (liprin beta 1)	477					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)			PPFIBP1/ALK(3)	central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(13)|prostate(2)|skin(1)	32	Lung SC(9;0.0873)					ACATCTGATGGGGTGGGTTCT	0.348																																						uc001ric.1		NA																PPFIBP1/ALK(3)	0				soft_tissue(3)|kidney(1)|skin(1)	5						c.(1429-1431)GGG>GTG		PTPRF interacting protein binding protein 1							67.0	71.0	70.0					12																	27826759		2203	4300	6503	SO:0001630	splice_region_variant	8496				cell adhesion	plasma membrane	protein binding	g.chr12:27826759G>T	AF034802	CCDS8713.1, CCDS55812.1, CCDS55813.1, CCDS55814.1	12p12.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9249	protein-coding gene	gene with protein product		603141				9624153, 11836260	Standard	NM_003622		Approved	L2, hSGT2, hSgt2p, SGT2	uc001ric.2	Q86W92		ENST00000318304.8:c.1431+1G>T	12.37:g.27826759G>T			Somatic				PPFIBP1_uc010sjr.1_Missense_Mutation_p.G308V|PPFIBP1_uc001rib.1_Missense_Mutation_p.G460V|PPFIBP1_uc001ria.2_Missense_Mutation_p.G446V|PPFIBP1_uc001rid.1_Missense_Mutation_p.G324V|PPFIBP1_uc001rif.1_5'Flank	p.G477V	NM_003622	NP_003613	WXS	Illumina HiSeq	Unspecified	Q86W92	LIPB1_HUMAN			16	1807	+	Lung SC(9;0.0873)		477					O75336|Q86X70|Q9NY03|Q9ULJ0	Missense_Mutation	SNP	ENST00000318304.8	37	c.1430G>T	CCDS55812.1	.	.	.	.	.	.	.	.	.	.	G	2.004	-0.428672	0.04701	.	.	ENSG00000110841	ENST00000540114;ENST00000537927;ENST00000318304;ENST00000542629;ENST00000228425;ENST00000537261	T;T;T;T;T	0.29655	1.58;1.56;1.98;1.98;1.98	5.81	2.68	0.31781	.	0.522359	0.14310	U	0.327723	T	0.13884	0.0336	N	0.11560	0.145	0.42835	D	0.994038	B;B;B;B	0.06786	0.0;0.0;0.001;0.0	B;B;B;B	0.10450	0.005;0.001;0.005;0.002	T	0.09975	-1.0650	10	0.27785	T	0.31	-9.9728	3.9617	0.09413	0.0821:0.1099:0.3231:0.485	.	324;477;460;446	Q86W92-3;Q86W92;Q86W92-2;Q86W92-4	.;LIPB1_HUMAN;.;.	V	308;324;477;446;460;162	ENSP00000444304:G308V;ENSP00000445425:G324V;ENSP00000314724:G477V;ENSP00000443442:G446V;ENSP00000228425:G460V	ENSP00000228425:G460V	G	+	2	0	PPFIBP1	27718026	0.754000	0.28360	0.623000	0.29173	0.029000	0.11900	0.662000	0.25038	0.771000	0.33359	-0.136000	0.14681	GGG		0.348	PPFIBP1-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402877.1	NM_003622	Missense_Mutation	11	41	1	0	5.17e-11	5.83e-11	11	41				
ALG10	84920	broad.mit.edu	37	12	34179307	34179307	+	Silent	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr12:34179307C>T	ENST00000266483.2	+	3	1198	c.879C>T	c.(877-879)taC>taT	p.Y293Y	AC046130.1_ENST00000401300.2_RNA|RP11-847H18.2_ENST00000501954.2_RNA|ALG10_ENST00000538927.1_Intron	NM_032834.3	NP_116223.3	Q5BKT4	AG10A_HUMAN	ALG10, alpha-1,2-glucosyltransferase	293					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring hexosyl groups (GO:0016758)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	26	Lung NSC(5;3.82e-05)|Acute lymphoblastic leukemia(23;0.0142)|all_hematologic(23;0.0429)	Lung NSC(34;0.204)|all_lung(34;0.235)				AACTATTCTACTTTTTTTCAT	0.348																																						uc001rlm.2		NA																	0				skin(1)	1						c.(877-879)TAC>TAT		asparagine-linked glycosylation 10 homolog							132.0	138.0	136.0					12																	34179307		2203	4297	6500	SO:0001819	synonymous_variant	84920				dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	dolichyl-phosphate-glucose-glycolipid alpha-glucosyltransferase activity	g.chr12:34179307C>T	AJ312278	CCDS41769.1	12p11.21	2013-03-04	2013-03-04		ENSG00000139133	ENSG00000139133	2.4.1.256		23162	protein-coding gene	gene with protein product	"""derepression of ITR1 expression 2 homolog (S. cerevisiae)"", ""dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase"""	603313	"""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (yeast)"", ""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe)"""				Standard	NM_032834		Approved	FLJ14751, DIE2, ALG10A	uc001rlm.3	Q5BKT4	OTTHUMG00000169285	ENST00000266483.2:c.879C>T	12.37:g.34179307C>T			Somatic					p.Y293Y	NM_032834	NP_116223	WXS	Illumina HiSeq	Unspecified	Q5BKT4	AG10A_HUMAN			3	1198	+	Lung NSC(5;3.82e-05)|Acute lymphoblastic leukemia(23;0.0142)|all_hematologic(23;0.0429)	Lung NSC(34;0.204)|all_lung(34;0.235)	293			Helical; (Potential).		Q6NS98|Q96DU0|Q96SM6	Silent	SNP	ENST00000266483.2	37	c.879C>T	CCDS41769.1																																																																																				0.348	ALG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403309.1	NM_032834		43	111	0	0	0	0	43	111				
OR6C65	403282	broad.mit.edu	37	12	55794794	55794794	+	Missense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr12:55794794G>A	ENST00000379665.2	+	1	581	c.482G>A	c.(481-483)gGc>gAc	p.G161D		NM_001005518.1	NP_001005518.1	A6NJZ3	O6C65_HUMAN	olfactory receptor, family 6, subfamily C, member 65	161						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(3)|lung(9)	15						GTGATTATGGGCCTCCAACTG	0.433																																						uc010spl.1		NA																	0					0						c.(481-483)GGC>GAC		olfactory receptor, family 6, subfamily C,							176.0	183.0	181.0					12																	55794794		2203	4300	6503	SO:0001583	missense	403282				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr12:55794794G>A		CCDS31821.1	12q13.2	2013-09-23			ENSG00000205328	ENSG00000205328		"""GPCR / Class A : Olfactory receptors"""	31295	protein-coding gene	gene with protein product							Standard	NM_001005518		Approved		uc010spl.2	A6NJZ3	OTTHUMG00000169955	ENST00000379665.2:c.482G>A	12.37:g.55794794G>A	ENSP00000368986:p.Gly161Asp		Somatic					p.G161D	NM_001005518	NP_001005518	WXS	Illumina HiSeq	Unspecified	A6NJZ3	O6C65_HUMAN			1	482	+			161			Helical; Name=4; (Potential).		B2RNH9	Missense_Mutation	SNP	ENST00000379665.2	37	c.482G>A	CCDS31821.1	.	.	.	.	.	.	.	.	.	.	G	9.178	1.022974	0.19433	.	.	ENSG00000205328	ENST00000379665	T	0.00076	8.76	3.56	2.57	0.30868	GPCR, rhodopsin-like superfamily (1);	0.439860	0.16705	U	0.202939	T	0.00178	0.0005	L	0.52573	1.65	0.09310	N	1	B	0.32753	0.383	B	0.40940	0.344	T	0.18681	-1.0329	10	0.49607	T	0.09	.	6.3665	0.21457	0.0:0.3194:0.5173:0.1633	.	161	A6NJZ3	O6C65_HUMAN	D	161	ENSP00000368986:G161D	ENSP00000368986:G161D	G	+	2	0	OR6C65	54081061	0.000000	0.05858	0.251000	0.24312	0.520000	0.34377	-0.683000	0.05179	1.994000	0.58287	0.424000	0.28305	GGC		0.433	OR6C65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406674.1			75	163	0	0	0	0	75	163				
PDX1	3651	broad.mit.edu	37	13	28498614	28498614	+	Missense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr13:28498614G>A	ENST00000381033.4	+	2	747	c.628G>A	c.(628-630)Ggc>Agc	p.G210S		NM_000209.3	NP_000200.1	O00330	ODPX_HUMAN	pancreatic and duodenal homeobox 1	80	Interaction with DLD.				cellular metabolic process (GO:0044237)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	transferase activity, transferring acyl groups (GO:0016746)					all_cancers(110;0.175)|all_hematologic(3;0.0447)|Acute lymphoblastic leukemia(6;0.155)	Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	GBM - Glioblastoma multiforme(144;0.0402)|all cancers(112;0.0404)|OV - Ovarian serous cystadenocarcinoma(117;0.197)		CAAGAAGCGCGGCGGCGGGAC	0.657																																						uc001urt.2		NA																	0					0						c.(628-630)GGC>AGC		pancreatic and duodenal homeobox 1							27.0	29.0	29.0					13																	28498614		2202	4300	6502	SO:0001583	missense	3651				detection of glucose|generation of precursor metabolites and energy|insulin secretion|nitric oxide mediated signal transduction|organ morphogenesis|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter|type B pancreatic cell differentiation	nucleus	sequence-specific DNA binding transcription factor activity	g.chr13:28498614G>A	AF035260	CCDS9327.1	13q12.1	2012-03-09	2006-12-01	2006-12-01	ENSG00000139515	ENSG00000139515		"""Homeoboxes / ANTP class : HOXL subclass"""	6107	protein-coding gene	gene with protein product	"""somatostatin transcription factor 1"""	600733	"""insulin promoter factor 1, homeodomain transcription factor"""	IPF1		7590740	Standard	NM_000209		Approved	IDX-1, STF-1, PDX-1, MODY4	uc001urt.2	P52945	OTTHUMG00000016638	ENST00000381033.4:c.628G>A	13.37:g.28498614G>A	ENSP00000370421:p.Gly210Ser		Somatic					p.G210S	NM_000209	NP_000200	WXS	Illumina HiSeq	Unspecified	P52945	PDX1_HUMAN	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	GBM - Glioblastoma multiforme(144;0.0402)|all cancers(112;0.0404)|OV - Ovarian serous cystadenocarcinoma(117;0.197)	2	736	+	all_cancers(110;0.175)|all_hematologic(3;0.0447)|Acute lymphoblastic leukemia(6;0.155)	Lung SC(185;0.0156)	210	GG -> SS (in Ref. 6; AAC05157).				B4DW62|D3DR11|E9PB14|E9PBP7|O60221|Q96FV8|Q99783	Missense_Mutation	SNP	ENST00000381033.4	37	c.628G>A	CCDS9327.1	.	.	.	.	.	.	.	.	.	.	G	9.446	1.089426	0.20390	.	.	ENSG00000139515	ENST00000381033	D	0.90844	-2.74	4.41	1.3	0.21679	.	0.338746	0.34291	N	0.004095	T	0.75708	0.3886	N	0.08118	0	0.25494	N	0.987618	B	0.10296	0.003	B	0.10450	0.005	T	0.58267	-0.7666	10	0.07175	T	0.84	.	10.0702	0.42328	0.2939:0.0:0.7061:0.0	.	210	P52945	PDX1_HUMAN	S	210	ENSP00000370421:G210S	ENSP00000370421:G210S	G	+	1	0	PDX1	27396614	0.991000	0.36638	0.312000	0.25196	0.910000	0.53928	1.770000	0.38532	-0.016000	0.14127	0.455000	0.32223	GGC		0.657	PDX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044310.2	NM_000209		7	16	0	0	0	0	7	16				
DIS3	22894	broad.mit.edu	37	13	73349468	73349468	+	Missense_Mutation	SNP	C	C	G			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr13:73349468C>G	ENST00000377767.4	-	6	968	c.868G>C	c.(868-870)Gat>Cat	p.D290H	DIS3_ENST00000377780.4_Missense_Mutation_p.D260H|DIS3_ENST00000545453.1_Missense_Mutation_p.D128H	NM_014953.3	NP_055768.3	Q9Y2L1	RRP44_HUMAN	DIS3 exosome endoribonuclease and 3'-5' exoribonuclease	290					CUT catabolic process (GO:0071034)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of GTPase activity (GO:0043547)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|endonuclease activity (GO:0004519)|guanyl-nucleotide exchange factor activity (GO:0005085)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(7)|kidney(5)|large_intestine(10)|lung(6)|prostate(2)|skin(1)	35		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)		GBM - Glioblastoma multiforme(99;0.000181)		GCCACAATATCTTCGTGAACA	0.388										Multiple Myeloma(4;0.011)																												uc001vix.3		NA																	0				central_nervous_system(1)	1						c.(868-870)GAT>CAT		DIS3 mitotic control isoform a							126.0	131.0	130.0					13																	73349468		2203	4300	6503	SO:0001583	missense	22894				CUT catabolic process|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|rRNA catabolic process|rRNA processing	cytosol|exosome (RNase complex)|nucleolus|nucleoplasm	3'-5'-exoribonuclease activity|endonuclease activity|guanyl-nucleotide exchange factor activity|protein binding|RNA binding	g.chr13:73349468C>G	AB023225	CCDS9447.1, CCDS45057.1	13q21.32	2014-03-05	2014-03-05	2007-01-12	ENSG00000083520	ENSG00000083520			20604	protein-coding gene	gene with protein product	"""exosome component 11"""	607533	"""KIAA1008"", ""DIS3 mitotic control homolog (S. cerevisiae)"""	KIAA1008		11935316, 9562621	Standard	XM_005266294		Approved	dis3p, RRP44, EXOSC11	uc001vix.4	Q9Y2L1	OTTHUMG00000017070	ENST00000377767.4:c.868G>C	13.37:g.73349468C>G	ENSP00000366997:p.Asp290His	Multiple Myeloma(4;0.011)	Somatic				DIS3_uc001viy.3_Missense_Mutation_p.D260H|DIS3_uc001viz.2_RNA	p.D290H	NM_014953	NP_055768	WXS	Illumina HiSeq	Unspecified	Q9Y2L1	RRP44_HUMAN		GBM - Glioblastoma multiforme(99;0.000181)	6	1242	-		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)	290					A6NI21|B2RBL2|Q5W0P7|Q5W0P8|Q658Z7|Q7Z481|Q8WWI2|Q9UG36	Missense_Mutation	SNP	ENST00000377767.4	37	c.868G>C	CCDS9447.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.970615	0.92919	.	.	ENSG00000083520	ENST00000377767;ENST00000377780;ENST00000545453	T;T;T	0.65916	-0.18;-0.18;-0.18	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	D	0.86623	0.5977	H	0.95780	3.72	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.89270	0.3604	10	0.87932	D	0	.	20.6397	0.99537	0.0:1.0:0.0:0.0	.	260;290	Q9Y2L1-2;Q9Y2L1	.;RRP44_HUMAN	H	290;260;128	ENSP00000366997:D290H;ENSP00000367011:D260H;ENSP00000440058:D128H	ENSP00000366997:D290H	D	-	1	0	DIS3	72247469	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	7.746000	0.85057	2.880000	0.98712	0.650000	0.86243	GAT		0.388	DIS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045250.2	NM_014953		18	65	0	0	0	0	18	65				
MYCBP2	23077	broad.mit.edu	37	13	77651324	77651324	+	Missense_Mutation	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr13:77651324C>T	ENST00000544440.2	-	67	11586	c.11569G>A	c.(11569-11571)Gaa>Aaa	p.E3857K	MYCBP2_ENST00000357337.6_Missense_Mutation_p.E3857K|MYCBP2-AS1_ENST00000593933.1_RNA|MYCBP2-AS1_ENST00000450627.2_RNA|MYCBP2-AS1_ENST00000422231.2_RNA|MYCBP2_ENST00000407578.2_Missense_Mutation_p.E3895K|MYCBP2-AS1_ENST00000596342.1_RNA|MYCBP2-AS1_ENST00000448470.2_RNA					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		GTCTCAGCTTCACAGTTCCTC	0.433																																						uc001vkf.2		NA																	0				ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14						c.(11569-11571)GAA>AAA		MYC binding protein 2							110.0	95.0	100.0					13																	77651324		2203	4300	6503	SO:0001583	missense	23077				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding	g.chr13:77651324C>T	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.11569G>A	13.37:g.77651324C>T	ENSP00000444596:p.Glu3857Lys		Somatic				MYCBP2_uc010aev.2_Missense_Mutation_p.E3261K|MYCBP2_uc001vke.2_Missense_Mutation_p.E477K	p.E3857K	NM_015057	NP_055872	WXS	Illumina HiSeq	Unspecified	O75592	MYCB2_HUMAN		GBM - Glioblastoma multiforme(99;0.109)	68	11660	-		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)	3857			DOC.			Missense_Mutation	SNP	ENST00000544440.2	37	c.11569G>A		.	.	.	.	.	.	.	.	.	.	C	35	5.503210	0.96371	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.33654	1.4;1.4;1.4	5.26	5.26	0.73747	Anaphase-promoting complex, subunit 10/DOC domain (1);	0.000000	0.85682	D	0.000000	T	0.59500	0.2198	M	0.68317	2.08	0.80722	D	1	P	0.52842	0.956	D	0.65010	0.931	T	0.61613	-0.7027	10	0.72032	D	0.01	.	19.2343	0.93851	0.0:1.0:0.0:0.0	.	3857	O75592	MYCB2_HUMAN	K	3857;3895;3857	ENSP00000349892:E3857K;ENSP00000384288:E3895K;ENSP00000444596:E3857K	ENSP00000349892:E3857K	E	-	1	0	MYCBP2	76549325	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.445000	0.80570	2.605000	0.88082	0.585000	0.79938	GAA		0.433	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057		14	33	0	0	0	0	14	33				
SLITRK1	114798	broad.mit.edu	37	13	84455029	84455029	+	Missense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr13:84455029G>A	ENST00000377084.2	-	1	1499	c.614C>T	c.(613-615)gCg>gTg	p.A205V		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	205					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		CAGGATCTCCGCAATACCAGG	0.542																																						uc001vlk.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5						c.(613-615)GCG>GTG		slit and trk like 1 protein precursor							73.0	70.0	71.0					13																	84455029		2203	4300	6503	SO:0001583	missense	114798					integral to membrane		g.chr13:84455029G>A	AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.614C>T	13.37:g.84455029G>A	ENSP00000366288:p.Ala205Val		Somatic					p.A205V	NM_052910	NP_443142	WXS	Illumina HiSeq	Unspecified	Q96PX8	SLIK1_HUMAN		GBM - Glioblastoma multiforme(99;0.07)	1	1500	-	Medulloblastoma(90;0.18)	Breast(118;0.212)	205			Extracellular (Potential).		Q5U5I6|Q96SF9	Missense_Mutation	SNP	ENST00000377084.2	37	c.614C>T	CCDS9464.1	.	.	.	.	.	.	.	.	.	.	G	0.220	-1.029348	0.02045	.	.	ENSG00000178235	ENST00000377084	T	0.51325	0.71	4.72	4.72	0.59763	.	0.119454	0.56097	D	0.000027	T	0.22781	0.0550	N	0.01874	-0.695	0.51767	D	0.999932	B	0.09022	0.002	B	0.08055	0.003	T	0.10497	-1.0627	10	0.16420	T	0.52	-6.4324	16.4091	0.83701	0.0:0.0:1.0:0.0	.	205	Q96PX8	SLIK1_HUMAN	V	205	ENSP00000366288:A205V	ENSP00000366288:A205V	A	-	2	0	SLITRK1	83353030	1.000000	0.71417	0.969000	0.41365	0.990000	0.78478	3.710000	0.54860	2.461000	0.83175	0.561000	0.74099	GCG		0.542	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910		22	39	0	0	0	0	22	39				
CHD8	57680	broad.mit.edu	37	14	21873943	21873943	+	Silent	SNP	C	C	T	rs371880895		TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr14:21873943C>T	ENST00000557364.1	-	15	3251	c.2988G>A	c.(2986-2988)ccG>ccA	p.P996P	CHD8_ENST00000430710.3_Silent_p.P717P|CHD8_ENST00000399982.2_Silent_p.P996P|CHD8_ENST00000555962.1_Intron			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	996	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		GAAATTGTGACGGTTCCAAGA	0.418																																						uc001was.1		NA																	0				ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)|skin(1)	10						c.(2149-2151)CCG>CCA		chromodomain helicase DNA binding protein 8		C	,	0,3712		0,0,1856	198.0	189.0	192.0		2988,2151	-2.8	1.0	14		192	1,8209		0,1,4104	no	coding-synonymous,coding-synonymous	CHD8	NM_001170629.1,NM_020920.3	,	0,1,5960	TT,TC,CC		0.0122,0.0,0.0084	,	996/2582,717/2303	21873943	1,11921	1856	4105	5961	SO:0001819	synonymous_variant	57680				ATP-dependent chromatin remodeling|canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	MLL1 complex	ATP binding|beta-catenin binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity|methylated histone residue binding|p53 binding	g.chr14:21873943C>T	AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.2988G>A	14.37:g.21873943C>T			Somatic				CHD8_uc001war.1_Silent_p.P613P|CHD8_uc001wav.1_Silent_p.P159P	p.P717P	NM_020920	NP_065971	WXS	Illumina HiSeq	Unspecified	Q9HCK8	CHD8_HUMAN	Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)	15	2245	-	all_cancers(95;0.00121)		996			Helicase ATP-binding.		Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Silent	SNP	ENST00000557364.1	37	c.2151G>A	CCDS53885.1	.	.	.	.	.	.	.	.	.	.	C	9.421	1.083011	0.20309	0.0	1.22E-4	ENSG00000100888	ENST00000555935	.	.	.	5.43	-2.8	0.05823	.	.	.	.	.	T	0.38081	0.1027	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.29971	-0.9994	4	.	.	.	-17.1666	0.9982	0.01472	0.2104:0.2308:0.1354:0.4234	.	.	.	.	I	222	.	.	V	-	1	0	CHD8	20943783	0.000000	0.05858	0.975000	0.42487	0.991000	0.79684	-1.069000	0.03444	-0.673000	0.05259	-0.271000	0.10264	GTC		0.418	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410436.1	NM_020920		8	130	0	0	0	0	8	130				
NPAS3	64067	broad.mit.edu	37	14	34263139	34263139	+	Missense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr14:34263139G>A	ENST00000356141.4	+	10	1190	c.1190G>A	c.(1189-1191)cGc>cAc	p.R397H	NPAS3_ENST00000548645.1_Missense_Mutation_p.R367H|NPAS3_ENST00000357798.5_Missense_Mutation_p.R384H|NPAS3_ENST00000551492.1_Missense_Mutation_p.R402H|NPAS3_ENST00000346562.2_Missense_Mutation_p.R365H			Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3	397	PAC.				locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|positive regulation of transcription, DNA-templated (GO:0045893)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	40	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		AAGTACTATCGCTGGATGCAG	0.373																																						uc001wru.2		NA																	0				ovary(1)|skin(1)	2						c.(1189-1191)CGC>CAC		neuronal PAS domain protein 3 isoform 3							138.0	125.0	130.0					14																	34263139		2203	4300	6503	SO:0001583	missense	64067				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity	g.chr14:34263139G>A	AF164438	CCDS9645.1, CCDS53891.1, CCDS53892.1, CCDS55912.1	14q13.1	2013-08-23			ENSG00000151322	ENSG00000151322		"""Basic helix-loop-helix proteins"""	19311	protein-coding gene	gene with protein product		609430					Standard	NM_022123		Approved	MOP6, PASD6, bHLHe12	uc001wru.3	Q8IXF0	OTTHUMG00000140215	ENST00000356141.4:c.1190G>A	14.37:g.34263139G>A	ENSP00000348460:p.Arg397His		Somatic				NPAS3_uc001wrs.2_Missense_Mutation_p.R384H|NPAS3_uc001wrt.2_Missense_Mutation_p.R365H|NPAS3_uc001wrv.2_Missense_Mutation_p.R367H	p.R397H	NM_173159	NP_071406	WXS	Illumina HiSeq	Unspecified	Q8IXF0	NPAS3_HUMAN	LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)	10	1254	+	Breast(36;0.0102)|Hepatocellular(127;0.133)		397			PAC.		Q86US6|Q86US7|Q8IXF2|Q9BY81|Q9H323|Q9Y4L8	Missense_Mutation	SNP	ENST00000356141.4	37	c.1190G>A	CCDS53891.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.661083	0.88154	.	.	ENSG00000151322	ENST00000551634;ENST00000551492;ENST00000346562;ENST00000548645;ENST00000356141;ENST00000357798	T;T;T;T;T;T	0.27720	1.65;1.65;1.65;1.65;1.65;1.65	5.79	5.79	0.91817	PAS fold-3 (1);	0.000000	0.85682	D	0.000000	T	0.66107	0.2756	M	0.90252	3.1	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.997;0.998;0.997;0.998	T	0.72239	-0.4351	10	0.87932	D	0	.	20.0367	0.97561	0.0:0.0:1.0:0.0	.	367;397;365;384	Q8IXF0-2;Q8IXF0;Q8IXF0-4;Q8IXF0-3	.;NPAS3_HUMAN;.;.	H	374;402;365;367;397;384	ENSP00000448373:R374H;ENSP00000450392:R402H;ENSP00000319610:R365H;ENSP00000448916:R367H;ENSP00000348460:R397H;ENSP00000350446:R384H	ENSP00000319610:R365H	R	+	2	0	NPAS3	33332890	1.000000	0.71417	0.962000	0.40283	0.987000	0.75469	9.835000	0.99442	2.741000	0.93983	0.557000	0.71058	CGC		0.373	NPAS3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276645.1			10	47	0	0	0	0	10	47				
ITPK1	3705	broad.mit.edu	37	14	93408122	93408122	+	Silent	SNP	G	G	A	rs199744063	byFrequency	TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr14:93408122G>A	ENST00000267615.6	-	11	1202	c.1029C>T	c.(1027-1029)gcC>gcT	p.A343A	ITPK1_ENST00000555495.1_Silent_p.A224A|ITPK1_ENST00000556603.2_Silent_p.A343A|ITPK1_ENST00000354313.3_Intron			Q13572	ITPK1_HUMAN	inositol-tetrakisphosphate 1-kinase	343					blood coagulation (GO:0007596)|dephosphorylation (GO:0016311)|inositol phosphate metabolic process (GO:0043647)|inositol trisphosphate metabolic process (GO:0032957)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|inositol tetrakisphosphate 1-kinase activity (GO:0047325)|inositol-1,3,4,5,6-pentakisphosphate 1-phosphatase activity (GO:0052825)|inositol-1,3,4,6-tetrakisphosphate 1-phosphatase activity (GO:0052831)|inositol-1,3,4,6-tetrakisphosphate 6-phosphatase activity (GO:0052830)|inositol-1,3,4-trisphosphate 5-kinase activity (GO:0052726)|inositol-1,3,4-trisphosphate 6-kinase activity (GO:0052725)|inositol-3,4,6-trisphosphate 1-kinase activity (GO:0052835)|isomerase activity (GO:0016853)|magnesium ion binding (GO:0000287)			endometrium(1)|large_intestine(3)|lung(6)|ovary(1)	11		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)		CCGCCGGCTCGGCCAGAAGCT	0.711													G|||	3	0.000599042	0.0	0.0029	5008	,	,		13883	0.001		0.0	False		,,,				2504	0.0					uc001ybg.2		NA																	0					0						c.(1027-1029)GCC>GCT		inositol 1,3,4-triphosphate 5/6 kinase isoform		G	,,	0,4228		0,0,2114	10.0	10.0	10.0		1029,,1029	-9.1	0.0	14		10	1,8297		0,1,4148	no	coding-synonymous,intron,coding-synonymous	ITPK1	NM_001142593.1,NM_001142594.1,NM_014216.4	,,	0,1,6262	AA,AG,GG		0.0121,0.0,0.0080	,,	343/415,,343/415	93408122	1,12525	2114	4149	6263	SO:0001819	synonymous_variant	3705				blood coagulation|inositol trisphosphate metabolic process|signal transduction	cytosol	ATP binding|hydrolase activity|inositol tetrakisphosphate 1-kinase activity|inositol-1,3,4-trisphosphate 5/6-kinase activity|isomerase activity|ligase activity|magnesium ion binding	g.chr14:93408122G>A	U51336	CCDS9907.1, CCDS45157.1	14q32.12	2012-08-16	2011-04-28		ENSG00000100605	ENSG00000100605	2.7.1.134		6177	protein-coding gene	gene with protein product		601838	"""inositol 1,3,4-triphosphate 5/6 kinase"""			8662638, 11042108	Standard	NM_014216		Approved		uc001ybh.3	Q13572	OTTHUMG00000171226	ENST00000267615.6:c.1029C>T	14.37:g.93408122G>A			Somatic				ITPK1_uc001ybe.2_Intron|ITPK1_uc001ybf.2_Silent_p.A224A|ITPK1_uc001ybh.2_Silent_p.A343A	p.A343A	NM_014216	NP_055031	WXS	Illumina HiSeq	Unspecified	Q13572	ITPK1_HUMAN		Epithelial(152;0.124)|all cancers(159;0.169)	11	1318	-		all_cancers(154;0.077)|all_epithelial(191;0.247)	343					Q9BTL6|Q9H2E7	Silent	SNP	ENST00000267615.6	37	c.1029C>T	CCDS9907.1																																																																																				0.711	ITPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412421.2	NM_014216		4	14	0	0	0	0	4	14				
ITPK1	3705	broad.mit.edu	37	14	93412800	93412800	+	Missense_Mutation	SNP	G	G	T	rs144084022		TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr14:93412800G>T	ENST00000267615.6	-	10	950	c.777C>A	c.(775-777)gaC>gaA	p.D259E	ITPK1_ENST00000555495.1_Missense_Mutation_p.D140E|ITPK1_ENST00000556603.2_Missense_Mutation_p.D259E|ITPK1_ENST00000354313.3_Missense_Mutation_p.D259E|ITPK1_ENST00000556954.1_5'UTR			Q13572	ITPK1_HUMAN	inositol-tetrakisphosphate 1-kinase	259	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.				blood coagulation (GO:0007596)|dephosphorylation (GO:0016311)|inositol phosphate metabolic process (GO:0043647)|inositol trisphosphate metabolic process (GO:0032957)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|inositol tetrakisphosphate 1-kinase activity (GO:0047325)|inositol-1,3,4,5,6-pentakisphosphate 1-phosphatase activity (GO:0052825)|inositol-1,3,4,6-tetrakisphosphate 1-phosphatase activity (GO:0052831)|inositol-1,3,4,6-tetrakisphosphate 6-phosphatase activity (GO:0052830)|inositol-1,3,4-trisphosphate 5-kinase activity (GO:0052726)|inositol-1,3,4-trisphosphate 6-kinase activity (GO:0052725)|inositol-3,4,6-trisphosphate 1-kinase activity (GO:0052835)|isomerase activity (GO:0016853)|magnesium ion binding (GO:0000287)	p.D259E(1)		endometrium(1)|large_intestine(3)|lung(6)|ovary(1)	11		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)		GGATGACCTCGTCGCTCGGCC	0.637																																						uc001ybg.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(775-777)GAC>GAA		inositol 1,3,4-triphosphate 5/6 kinase isoform							82.0	73.0	76.0					14																	93412800		2203	4300	6503	SO:0001583	missense	3705				blood coagulation|inositol trisphosphate metabolic process|signal transduction	cytosol	ATP binding|hydrolase activity|inositol tetrakisphosphate 1-kinase activity|inositol-1,3,4-trisphosphate 5/6-kinase activity|isomerase activity|ligase activity|magnesium ion binding	g.chr14:93412800G>T	U51336	CCDS9907.1, CCDS45157.1	14q32.12	2012-08-16	2011-04-28		ENSG00000100605	ENSG00000100605	2.7.1.134		6177	protein-coding gene	gene with protein product		601838	"""inositol 1,3,4-triphosphate 5/6 kinase"""			8662638, 11042108	Standard	NM_014216		Approved		uc001ybh.3	Q13572	OTTHUMG00000171226	ENST00000267615.6:c.777C>A	14.37:g.93412800G>T	ENSP00000267615:p.Asp259Glu		Somatic				ITPK1_uc001ybe.2_Missense_Mutation_p.D259E|ITPK1_uc001ybf.2_Missense_Mutation_p.D140E|ITPK1_uc001ybh.2_Missense_Mutation_p.D259E	p.D259E	NM_014216	NP_055031	WXS	Illumina HiSeq	Unspecified	Q13572	ITPK1_HUMAN		Epithelial(152;0.124)|all cancers(159;0.169)	10	1066	-		all_cancers(154;0.077)|all_epithelial(191;0.247)	259			ATP-grasp.		Q9BTL6|Q9H2E7	Missense_Mutation	SNP	ENST00000267615.6	37	c.777C>A	CCDS9907.1	.	.	.	.	.	.	.	.	.	.	G	12.77	2.036671	0.35893	.	.	ENSG00000100605	ENST00000354313;ENST00000405174;ENST00000556603;ENST00000555495;ENST00000267615;ENST00000311458	T	0.07444	3.19	5.25	-2.06	0.07298	ATP-grasp fold (1);ATP-grasp fold, subdomain 2 (1);	0.046421	0.85682	D	0.000000	T	0.09069	0.0224	L	0.38175	1.15	0.54753	D	0.999989	D;P	0.58970	0.984;0.863	P;B	0.53224	0.721;0.203	T	0.19484	-1.0304	10	0.02654	T	1	-1.5868	13.9544	0.64137	0.5197:0.0:0.4803:0.0	.	259;259	Q13572;Q13572-2	ITPK1_HUMAN;.	E	259;289;259;140;259;259	ENSP00000346272:D259E	ENSP00000267615:D259E	D	-	3	2	ITPK1	92482553	0.092000	0.21681	0.493000	0.27502	0.011000	0.07611	-0.332000	0.07904	-0.573000	0.05998	-2.069000	0.00389	GAC		0.637	ITPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412421.2	NM_014216		5	41	1	0	0.000602214	0.00063008	5	41				
AHNAK2	113146	broad.mit.edu	37	14	105409647	105409647	+	Silent	SNP	G	G	C			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr14:105409647G>C	ENST00000333244.5	-	7	12260	c.12141C>G	c.(12139-12141)ctC>ctG	p.L4047L	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4047						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGTGCCCTTTGAGGCTGGCTC	0.627																																						uc010axc.1		NA																	0				ovary(1)	1						c.(12139-12141)CTC>CTG		AHNAK nucleoprotein 2							124.0	130.0	128.0					14																	105409647		1863	4101	5964	SO:0001819	synonymous_variant	113146					nucleus		g.chr14:105409647G>C	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.12141C>G	14.37:g.105409647G>C			Somatic				AHNAK2_uc001ypx.2_Silent_p.L3947L	p.L4047L	NM_138420	NP_612429	WXS	Illumina HiSeq	Unspecified	Q8IVF2	AHNK2_HUMAN	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)		7	12261	-		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	4047					Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	c.12141C>G	CCDS45177.1																																																																																				0.627	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		9	200	0	0	0	0	9	200				
RYR3	6263	broad.mit.edu	37	15	33962690	33962690	+	Silent	SNP	T	T	G			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr15:33962690T>G	ENST00000389232.4	+	38	5863	c.5793T>G	c.(5791-5793)gtT>gtG	p.V1931V	RYR3_ENST00000415757.3_Silent_p.V1931V	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	1931	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GTGCCTTGGTTTACAAAATCA	0.522																																						uc001zhi.2		NA																	0				ovary(5)|central_nervous_system(4)|lung(1)	10						c.(5791-5793)GTT>GTG		ryanodine receptor 3							76.0	88.0	84.0					15																	33962690		1934	4131	6065	SO:0001819	synonymous_variant	6263				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr15:33962690T>G		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.5793T>G	15.37:g.33962690T>G			Somatic				RYR3_uc010bar.2_Silent_p.V1931V	p.V1931V	NM_001036	NP_001027	WXS	Illumina HiSeq	Unspecified	Q15413	RYR3_HUMAN		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)	38	5863	+		all_lung(180;7.18e-09)	1931			4 X approximate repeats.|Cytoplasmic (By similarity).		O15175|Q15412	Silent	SNP	ENST00000389232.4	37	c.5793T>G	CCDS45210.1																																																																																				0.522	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1			10	35	0	0	0	0	10	35				
MAP1A	4130	broad.mit.edu	37	15	43815140	43815140	+	Missense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr15:43815140G>A	ENST00000300231.5	+	4	1919	c.1469G>A	c.(1468-1470)cGt>cAt	p.R490H	MAP1A_ENST00000382031.1_Missense_Mutation_p.R728H|MAP1A_ENST00000399453.1_Missense_Mutation_p.R490H			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	490	9 X 3 AA repeats of K-K-[DE].|Lys-rich (basic).				microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	GACAGGAGCCGTGCTATCCGT	0.542																																						uc001zrt.2		NA																	0				ovary(3)|breast(3)|pancreas(2)|skin(1)	9						c.(1468-1470)CGT>CAT		microtubule-associated protein 1A	Estramustine(DB01196)						36.0	36.0	36.0					15																	43815140		1927	4123	6050	SO:0001583	missense	4130					cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity	g.chr15:43815140G>A	U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.1469G>A	15.37:g.43815140G>A	ENSP00000300231:p.Arg490His		Somatic					p.R490H	NM_002373	NP_002364	WXS	Illumina HiSeq	Unspecified	P78559	MAP1A_HUMAN		GBM - Glioblastoma multiforme(94;3.05e-06)	4	1936	+		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)	490			Lys-rich (basic).|9 X 3 AA repeats of K-K-[DE].		O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	ENST00000300231.5	37	c.1469G>A	CCDS42031.1	.	.	.	.	.	.	.	.	.	.	G	12.29	1.892722	0.33442	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231;ENST00000442025	T;T;T	0.54279	0.58;0.58;0.58	5.39	5.39	0.77823	.	0.000000	0.28572	N	0.014868	T	0.69717	0.3142	M	0.72479	2.2	0.24171	N	0.995628	D	0.89917	1.0	D	0.69824	0.966	T	0.63537	-0.6615	10	0.62326	D	0.03	-10.2558	13.5852	0.61926	0.076:0.0:0.924:0.0	.	490	P78559	MAP1A_HUMAN	H	728;490;490;490	ENSP00000371462:R728H;ENSP00000382380:R490H;ENSP00000300231:R490H	ENSP00000300231:R490H	R	+	2	0	MAP1A	41602432	0.995000	0.38212	0.996000	0.52242	0.931000	0.56810	4.671000	0.61590	2.804000	0.96469	0.655000	0.94253	CGT		0.542	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132894.5	NM_002373		10	12	0	0	0	0	10	12				
USP8	9101	broad.mit.edu	37	15	50763974	50763974	+	Silent	SNP	G	G	C			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr15:50763974G>C	ENST00000396444.3	+	8	1169	c.831G>C	c.(829-831)ctG>ctC	p.L277L	USP8_ENST00000433963.1_Silent_p.L277L|USP8_ENST00000425032.3_Silent_p.L200L|USP8_ENST00000307179.4_Silent_p.L277L	NM_001128610.1|NM_005154.3	NP_001122082.1|NP_005145.3	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8	277	Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.				cell proliferation (GO:0008283)|endosome organization (GO:0007032)|mitotic cytokinesis (GO:0000281)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|Ras protein signal transduction (GO:0007265)|ubiquitin-dependent protein catabolic process (GO:0006511)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|midbody (GO:0030496)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		TCCGGAGTCTGAAAGATGCAC	0.393																																						uc001zym.3		NA																	0				lung(1)|central_nervous_system(1)	2						c.(829-831)CTG>CTC		ubiquitin specific peptidase 8							162.0	159.0	160.0					15																	50763974		2196	4294	6490	SO:0001819	synonymous_variant	9101				cell cycle|cell proliferation|endosome organization|protein K48-linked deubiquitination|protein K63-linked deubiquitination|ubiquitin-dependent protein catabolic process	cytosol|early endosome|extrinsic to plasma membrane|nucleus	cysteine-type endopeptidase activity|SH3 domain binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr15:50763974G>C	D29956	CCDS10137.1, CCDS61632.1	15q21.1	2014-03-03	2005-08-08		ENSG00000138592	ENSG00000138592		"""Ubiquitin-specific peptidases"""	12631	protein-coding gene	gene with protein product		603158	"""ubiquitin specific protease 8"""			12838346, 9582025, 24482476	Standard	NM_005154		Approved	HumORF8, KIAA0055, UBPY, SPG59	uc001zyl.4	P40818	OTTHUMG00000131645	ENST00000396444.3:c.831G>C	15.37:g.50763974G>C			Somatic				USP8_uc001zyk.1_5'UTR|USP8_uc001zyl.3_Silent_p.L277L|USP8_uc001zyn.3_Silent_p.L277L|USP8_uc010ufh.1_Silent_p.L200L|USP8_uc010bev.1_Intron	p.L277L	NM_001128611	NP_001122083	WXS	Illumina HiSeq	Unspecified	P40818	UBP8_HUMAN		all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)	9	1331	+			277			Rhodanese.		B4DKA8|Q2TB31|Q7Z3U2|Q86VA0|Q8IWI7	Silent	SNP	ENST00000396444.3	37	c.831G>C	CCDS10137.1																																																																																				0.393	USP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254541.1	NM_005154		4	103	0	0	0	0	4	103				
PRTG	283659	broad.mit.edu	37	15	55931991	55931991	+	Missense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr15:55931991G>A	ENST00000389286.4	-	13	2220	c.2173C>T	c.(2173-2175)Ccc>Tcc	p.P725S		NM_173814.4	NP_776175.2			protogenin											breast(1)|endometrium(6)|kidney(4)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		AGATGGTGGGGTGGTGGTGGA	0.448																																						uc002adg.2		NA																	0				large_intestine(1)|ovary(1)|skin(1)	3						c.(2173-2175)CCC>TCC		protogenin precursor							150.0	164.0	160.0					15																	55931991		2054	4184	6238	SO:0001583	missense	283659				multicellular organismal development	integral to membrane		g.chr15:55931991G>A	AK098622	CCDS42040.1	15q21.3	2013-02-11	2010-06-24		ENSG00000166450	ENSG00000166450		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26373	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 5"""	613261	"""protogenin homolog (Gallus gallus)"""				Standard	NM_173814		Approved	FLJ25756, IGDCC5	uc002adg.3	Q2VWP7		ENST00000389286.4:c.2173C>T	15.37:g.55931991G>A	ENSP00000373937:p.Pro725Ser		Somatic					p.P725S	NM_173814	NP_776175	WXS	Illumina HiSeq	Unspecified	Q2VWP7	PRTG_HUMAN		all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)	13	2221	-			725			Fibronectin type-III 4.			Missense_Mutation	SNP	ENST00000389286.4	37	c.2173C>T	CCDS42040.1	.	.	.	.	.	.	.	.	.	.	G	32	5.174909	0.94807	.	.	ENSG00000166450	ENST00000389286	T	0.79749	-1.3	5.81	5.81	0.92471	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.91064	0.7188	M	0.87971	2.92	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	D	0.90638	0.4572	10	0.45353	T	0.12	-19.4977	19.072	0.93143	0.0:0.0:1.0:0.0	.	725	Q2VWP7	PRTG_HUMAN	S	725	ENSP00000373937:P725S	ENSP00000373937:P725S	P	-	1	0	PRTG	53719283	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.119000	0.94362	2.741000	0.93983	0.655000	0.94253	CCC		0.448	PRTG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419357.1	NM_173814		6	63	0	0	0	0	6	63				
DPP8	54878	broad.mit.edu	37	15	65793046	65793046	+	Silent	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr15:65793046G>A	ENST00000341861.5	-	4	2072	c.492C>T	c.(490-492)gtC>gtT	p.V164V	DPP8_ENST00000321118.7_Silent_p.V164V|DPP8_ENST00000339244.5_Silent_p.V164V|DPP8_ENST00000559233.1_Silent_p.V164V|DPP8_ENST00000321147.6_Silent_p.V164V|DPP8_ENST00000358939.4_Silent_p.V148V|DPP8_ENST00000300141.6_Silent_p.V148V|Y_RNA_ENST00000516408.1_RNA	NM_197960.2	NP_932064.1	Q6V1X1	DPP8_HUMAN	dipeptidyl-peptidase 8	164					immune response (GO:0006955)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(2)|endometrium(3)|large_intestine(11)|lung(11)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						AAGCAATTCCGACTGTTCCAA	0.398																																						uc002aov.2		NA																	0				ovary(1)	1						c.(490-492)GTC>GTT		dipeptidyl peptidase 8 isoform 1							211.0	200.0	204.0					15																	65793046		2201	4299	6500	SO:0001819	synonymous_variant	54878				immune response|proteolysis	cytoplasm|membrane|nucleus	aminopeptidase activity|dipeptidyl-peptidase activity|serine-type peptidase activity	g.chr15:65793046G>A	AF221634	CCDS10207.1, CCDS10208.1, CCDS10209.1, CCDS10210.1	15q22	2008-07-18	2006-01-12		ENSG00000074603	ENSG00000074603			16490	protein-coding gene	gene with protein product	"""dipeptidyl peptidase VIII"", ""dipeptidyl peptidase IV-related protein-1"", ""prolyl dipeptidase DPP8"""	606819	"""dipeptidylpeptidase 8"""			11012666	Standard	XM_005254500		Approved	DP8, DPRP1, MSTP141, FLJ14920, FLJ20283, MGC26191	uc002aox.3	Q6V1X1	OTTHUMG00000133150	ENST00000341861.5:c.492C>T	15.37:g.65793046G>A			Somatic				DPP8_uc002aow.2_Silent_p.V164V|DPP8_uc010uiv.1_RNA|DPP8_uc002aox.2_Silent_p.V148V|DPP8_uc002aoy.2_Silent_p.V164V|DPP8_uc002aoz.2_Silent_p.V148V|DPP8_uc010bhj.2_Silent_p.V164V|DPP8_uc002apa.2_Silent_p.V61V	p.V164V	NM_130434	NP_569118	WXS	Illumina HiSeq	Unspecified	Q6V1X1	DPP8_HUMAN			4	2070	-			164					Q7Z4C8|Q7Z4D3|Q7Z4E1|Q8IWG7|Q8NEM5|Q96JX1|Q9HBM2|Q9HBM3|Q9HBM4|Q9HBM5|Q9NXF4	Silent	SNP	ENST00000341861.5	37	c.492C>T	CCDS10207.1																																																																																				0.398	DPP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256847.1	NM_017743		40	82	0	0	0	0	40	82				
MYO9A	4649	broad.mit.edu	37	15	72119040	72119040	+	Nonsense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr15:72119040G>A	ENST00000356056.5	-	42	8000	c.7528C>T	c.(7528-7530)Cag>Tag	p.Q2510*	MYO9A_ENST00000424560.1_Nonsense_Mutation_p.Q2581*|MYO9A_ENST00000444904.1_Nonsense_Mutation_p.Q2491*|MYO9A_ENST00000564571.1_3'UTR	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	2510	Tail.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						TTGGTTTTCTGAGGTGAGTTT	0.478																																						uc002atl.3		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(7528-7530)CAG>TAG		myosin IXA							140.0	147.0	145.0					15																	72119040		2199	4297	6496	SO:0001587	stop_gained	4649				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|visual perception	cytosol|integral to membrane|unconventional myosin complex	actin binding|ATP binding|GTPase activator activity|metal ion binding|motor activity	g.chr15:72119040G>A	AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.7528C>T	15.37:g.72119040G>A	ENSP00000348349:p.Gln2510*		Somatic				MYO9A_uc002atj.2_Nonsense_Mutation_p.Q441*|MYO9A_uc002atk.2_Nonsense_Mutation_p.Q1305*	p.Q2510*	NM_006901	NP_008832	WXS	Illumina HiSeq	Unspecified	B2RTY4	MYO9A_HUMAN			42	8001	-			2510			Tail.		B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Nonsense_Mutation	SNP	ENST00000356056.5	37	c.7528C>T	CCDS10239.1	.	.	.	.	.	.	.	.	.	.	G	39	7.420691	0.98272	.	.	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	.	16.188	0.81967	0.0:0.1331:0.8669:0.0	.	.	.	.	X	2510;2581;2491	.	ENSP00000348349:Q2510X	Q	-	1	0	MYO9A	69906094	1.000000	0.71417	1.000000	0.80357	0.797000	0.45037	3.540000	0.53611	2.514000	0.84764	0.563000	0.77884	CAG		0.478	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257308.1	NM_006901		36	87	0	0	0	0	36	87				
ADPGK	83440	broad.mit.edu	37	15	73048712	73048712	+	Missense_Mutation	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr15:73048712C>T	ENST00000311669.8	-	5	813	c.720G>A	c.(718-720)atG>atA	p.M240I	ADPGK_ENST00000567733.1_Intron|ADPGK_ENST00000456471.2_5'Flank	NM_031284.4	NP_112574.3	Q9BRR6	ADPGK_HUMAN	ADP-dependent glucokinase	240	ADPK. {ECO:0000255|PROSITE- ProRule:PRU00584}.				glycolytic process (GO:0006096)	extracellular region (GO:0005576)|membrane (GO:0016020)	ADP-specific glucokinase activity (GO:0043843)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|skin(1)	7						CCAGCATATTCATGGCCCCGT	0.537																																						uc002avg.3		NA																	0					0						c.(718-720)ATG>ATA		ADP-dependent glucokinase							98.0	96.0	97.0					15																	73048712		1901	4134	6035	SO:0001583	missense	83440				glycolysis	extracellular region	ADP-specific glucokinase activity|metal ion binding	g.chr15:73048712C>T	AL136873	CCDS42057.1	15q24.1	2012-07-02			ENSG00000159322	ENSG00000159322			25250	protein-coding gene	gene with protein product		611861				11230166	Standard	NM_031284		Approved	DKFZp434B195, ADP-GK	uc002avf.4	Q9BRR6	OTTHUMG00000172777	ENST00000311669.8:c.720G>A	15.37:g.73048712C>T	ENSP00000312250:p.Met240Ile		Somatic				ADPGK_uc002ave.3_5'UTR|ADPGK_uc010ukw.1_Missense_Mutation_p.M182I|ADPGK_uc002avf.3_Missense_Mutation_p.M240I|ADPGK_uc002avi.3_Missense_Mutation_p.M118I|ADPGK_uc002avh.3_Missense_Mutation_p.M1I	p.M240I	NM_031284	NP_112574	WXS	Illumina HiSeq	Unspecified	Q9BRR6	ADPGK_HUMAN			5	814	-			240			ADPK.		Q49AU7|Q8NBI1|Q8WZ90|Q96NF8|Q9H0A7	Missense_Mutation	SNP	ENST00000311669.8	37	c.720G>A	CCDS42057.1	.	.	.	.	.	.	.	.	.	.	N	16.31	3.087138	0.55968	.	.	ENSG00000159322	ENST00000311669;ENST00000443764;ENST00000331065	T	0.37411	1.2	5.45	5.45	0.79879	.	0.037251	0.85682	D	0.000000	T	0.28200	0.0696	L	0.36672	1.1	0.80722	D	1	P;P;B	0.39696	0.503;0.683;0.313	B;B;B	0.39660	0.113;0.306;0.108	T	0.03112	-1.1071	10	0.18276	T	0.48	-34.5749	10.8426	0.46724	0.0:0.8542:0.0:0.1458	.	182;240;240	B4DG35;Q9BRR6;Q9BRR6-2	.;ADPGK_HUMAN;.	I	240;159;118	ENSP00000312250:M240I	ENSP00000312250:M240I	M	-	3	0	ADPGK	70835765	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.030000	0.57260	2.560000	0.86352	0.655000	0.94253	ATG		0.537	ADPGK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420434.1	NM_031284		5	63	0	0	0	0	5	63				
RLBP1	6017	broad.mit.edu	37	15	89754989	89754989	+	Missense_Mutation	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr15:89754989C>T	ENST00000268125.5	-	7	1108	c.669G>A	c.(667-669)atG>atA	p.M223I		NM_000326.4	NP_000317.1	P12271	RLBP1_HUMAN	retinaldehyde binding protein 1	223	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|visual perception (GO:0007601)|vitamin A metabolic process (GO:0006776)	cell body (GO:0044297)|cytosol (GO:0005829)	11-cis retinal binding (GO:0005502)|retinol binding (GO:0019841)|transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(1)|prostate(1)|skin(1)	18	Lung NSC(78;0.0472)|all_lung(78;0.089)				Vitamin A(DB00162)	GCATGTCCACCATCTTCCTGA	0.547																																						uc002bnl.2		NA																	0				central_nervous_system(1)	1						c.(667-669)ATG>ATA		retinaldehyde binding protein 1	Vitamin A(DB00162)						124.0	108.0	113.0					15																	89754989		2200	4299	6499	SO:0001583	missense	6017				response to stimulus|visual perception|vitamin A metabolic process	cytoplasm|soluble fraction	retinol binding|transporter activity	g.chr15:89754989C>T	BC004199	CCDS32324.1	15q26.1	2007-07-16	2001-11-28			ENSG00000140522			10024	protein-coding gene	gene with protein product		180090	"""retinaldehyde-binding protein 1"""			1733864, 9326942	Standard	NM_000326		Approved	CRALBP	uc002bnl.3	P12271		ENST00000268125.5:c.669G>A	15.37:g.89754989C>T	ENSP00000268125:p.Met223Ile		Somatic					p.M223I	NM_000326	NP_000317	WXS	Illumina HiSeq	Unspecified	P12271	RLBP1_HUMAN			7	1049	-	Lung NSC(78;0.0472)|all_lung(78;0.089)		223			CRAL-TRIO.		B2R667	Missense_Mutation	SNP	ENST00000268125.5	37	c.669G>A	CCDS32324.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.802982	0.90623	.	.	ENSG00000140522	ENST00000268125	T	0.73152	-0.72	5.51	5.51	0.81932	Cellular retinaldehyde-binding/triple function, C-terminal (5);	0.000000	0.85682	D	0.000000	T	0.68815	0.3042	N	0.12853	0.265	0.80722	D	1	D	0.71674	0.998	D	0.68621	0.959	T	0.62277	-0.6888	10	0.05833	T	0.94	-14.5593	19.4153	0.94694	0.0:1.0:0.0:0.0	.	223	P12271	RLBP1_HUMAN	I	223	ENSP00000268125:M223I	ENSP00000268125:M223I	M	-	3	0	RLBP1	87555993	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.471000	0.80985	2.595000	0.87683	0.561000	0.74099	ATG		0.547	RLBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421135.1	NM_000326		3	40	0	0	0	0	3	40				
VPS33B	26276	broad.mit.edu	37	15	91542965	91542965	+	Missense_Mutation	SNP	G	G	C			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr15:91542965G>C	ENST00000333371.3	-	22	2069	c.1716C>G	c.(1714-1716)ttC>ttG	p.F572L	VPS33B_ENST00000535906.1_Missense_Mutation_p.F545L|VPS33B_ENST00000535843.1_Missense_Mutation_p.F481L	NM_018668.3	NP_061138.3	Q9H267	VP33B_HUMAN	vacuolar protein sorting 33 homolog B (yeast)	572					lysosome localization (GO:0032418)|melanosome localization (GO:0032400)|membrane fusion (GO:0061025)|platelet alpha granule organization (GO:0070889)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule (GO:0031091)				central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|stomach(2)	16	Lung NSC(78;0.0987)|all_lung(78;0.175)					AACCACCCAAGAACACCACCA	0.507																																						uc002bqp.1		NA																	0				ovary(2)	2						c.(1714-1716)TTC>TTG		vacuolar protein sorting 33B (yeast homolog))							262.0	260.0	261.0					15																	91542965		2198	4298	6496	SO:0001583	missense	26276				cellular membrane fusion|lysosome localization|melanosome localization|platelet alpha granule organization|protein transport|vesicle docking involved in exocytosis	late endosome membrane|lysosomal membrane|perinuclear region of cytoplasm|platelet alpha granule	protein binding	g.chr15:91542965G>C	AF201694	CCDS10369.1, CCDS73783.1	15q26.1	2006-12-19	2006-12-19		ENSG00000184056	ENSG00000184056			12712	protein-coding gene	gene with protein product		608552	"""vacuolar protein sorting 33B (yeast homolog)"""			8996080	Standard	XM_005254887		Approved	FLJ14848	uc002bqp.1	Q9H267	OTTHUMG00000149835	ENST00000333371.3:c.1716C>G	15.37:g.91542965G>C	ENSP00000327650:p.Phe572Leu		Somatic				VPS33B_uc002bqq.1_Missense_Mutation_p.F481L|VPS33B_uc010uqu.1_Missense_Mutation_p.F545L	p.F572L	NM_018668	NP_061138	WXS	Illumina HiSeq	Unspecified	Q9H267	VP33B_HUMAN			22	2070	-	Lung NSC(78;0.0987)|all_lung(78;0.175)		572					B3KQF6|Q96K14|Q9NRP6|Q9NSF3	Missense_Mutation	SNP	ENST00000333371.3	37	c.1716C>G	CCDS10369.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.642459	0.87859	.	.	ENSG00000184056	ENST00000333371;ENST00000535906;ENST00000535843;ENST00000537510	T;T;T	0.78924	-1.22;-1.22;-1.22	5.95	4.86	0.63082	.	0.000000	0.85682	D	0.000000	D	0.87485	0.6189	M	0.82193	2.58	0.58432	D	0.999999	D;D	0.67145	0.995;0.996	D;D	0.69307	0.938;0.963	D	0.87641	0.2522	10	0.51188	T	0.08	-19.559	13.9931	0.64378	0.083:0.0:0.917:0.0	.	545;572	F5H008;Q9H267	.;VP33B_HUMAN	L	572;545;481;527	ENSP00000327650:F572L;ENSP00000444053:F545L;ENSP00000446267:F481L	ENSP00000327650:F572L	F	-	3	2	VPS33B	89343969	1.000000	0.71417	0.934000	0.37439	0.896000	0.52359	4.228000	0.58619	2.825000	0.97269	0.655000	0.94253	TTC		0.507	VPS33B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313496.1	NM_018668		8	216	0	0	0	0	8	216				
IFT140	9742	broad.mit.edu	37	16	1614075	1614075	+	Missense_Mutation	SNP	C	C	T	rs387907192		TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr16:1614075C>T	ENST00000426508.2	-	17	2353	c.1990G>A	c.(1990-1992)Gaa>Aaa	p.E664K	IFT140_ENST00000439987.2_5'UTR	NM_014714.3	NP_055529.2	Q96RY7	IF140_HUMAN	intraflagellar transport 140	664			E -> K (in SRTD9; partial to complete loss of basal body localization and increase of cytoplasmic localization). {ECO:0000269|PubMed:22503633}.		cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)|protein localization to cilium (GO:0061512)|regulation of cilium assembly (GO:1902017)|renal system development (GO:0072001)|retina development in camera-type eye (GO:0060041)|skeletal system morphogenesis (GO:0048705)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)|photoreceptor connecting cilium (GO:0032391)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(12)|lung(10)|ovary(5)|pancreas(1)|prostate(4)|skin(4)|stomach(2)|urinary_tract(1)	53		Hepatocellular(780;0.219)				TGCACGGCTTCGCATACAAAC	0.577																																						uc002cmb.2		NA																	0				ovary(3)|pancreas(1)|skin(1)	5						c.(1990-1992)GAA>AAA		intraflagellar transport 140							54.0	63.0	60.0					16																	1614075		2199	4300	6499	SO:0001583	missense	9742							g.chr16:1614075C>T	AB011162	CCDS10439.1	16p13.3	2014-07-03	2014-07-03	2005-11-02	ENSG00000187535	ENSG00000187535		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29077	protein-coding gene	gene with protein product		614620	"""WD and tetratricopeptide repeats 2"", ""intraflagellar transport 140 homolog (Chlamydomonas)"""	WDTC2		9628581	Standard	NM_014714		Approved	gs114, KIAA0590	uc002cmb.3	Q96RY7	OTTHUMG00000128585	ENST00000426508.2:c.1990G>A	16.37:g.1614075C>T	ENSP00000406012:p.Glu664Lys		Somatic				IFT140_uc002clz.2_Missense_Mutation_p.E315K	p.E664K	NM_014714	NP_055529	WXS	Illumina HiSeq	Unspecified	Q96RY7	IF140_HUMAN			17	2352	-		Hepatocellular(780;0.219)	664					A2A2A8|D3DU75|O60332|Q9UG52	Missense_Mutation	SNP	ENST00000426508.2	37	c.1990G>A	CCDS10439.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.075306	0.76415	.	.	ENSG00000187535	ENST00000397417;ENST00000426508;ENST00000439987	D	0.83506	-1.73	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	D	0.92153	0.7512	M	0.84433	2.695	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.93035	0.6452	10	0.62326	D	0.03	.	18.6071	0.91271	0.0:1.0:0.0:0.0	.	664;389	Q96RY7;B4DR58	IF140_HUMAN;.	K	664	ENSP00000406012:E664K	ENSP00000380562:E664K	E	-	1	0	IFT140	1554076	1.000000	0.71417	0.789000	0.31954	0.003000	0.03518	7.044000	0.76578	2.407000	0.81776	0.467000	0.42956	GAA		0.577	IFT140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250438.2	NM_014714		5	53	0	0	0	0	5	53				
CREBBP	1387	broad.mit.edu	37	16	3820572	3820572	+	Splice_Site	SNP	G	G	C			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr16:3820572G>C	ENST00000262367.5	-	14	3688	c.2879C>G	c.(2878-2880)cCg>cGg	p.P960R	CREBBP_ENST00000382070.3_Splice_Site_p.P922R	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	960					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GAGGCTTACCGGTGTGCCAGG	0.572			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																															uc002cvv.2		NA		Dom/Rec	yes		16	16p13.3	1387	T|N|F|Mis|O	CREB binding protein (CBP)	yes	Rubinstein-Taybi syndrome	L	MLL|MORF|RUNXBP2		ALL|AML|DLBCL|B-NHL 		0				haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127						c.(2878-2880)CCG>CGG		CREB binding protein isoform a							139.0	168.0	158.0					16																	3820572		2197	4300	6497	SO:0001630	splice_region_variant	1387	Rubinstein-Taybi_syndrome			cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding	g.chr16:3820572G>C	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.2880+1C>G	16.37:g.3820572G>C			Somatic				CREBBP_uc002cvw.2_Missense_Mutation_p.P922R	p.P960R	NM_004380	NP_004371	WXS	Illumina HiSeq	Unspecified	Q92793	CBP_HUMAN		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)	14	3083	-		Ovarian(90;0.0266)	960					D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	ENST00000262367.5	37	c.2879C>G	CCDS10509.1	.	.	.	.	.	.	.	.	.	.	G	15.24	2.775155	0.49786	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	D;D	0.84660	-1.88;-1.8	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	D	0.92401	0.7588	M	0.71206	2.165	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.91658	0.5340	10	0.59425	D	0.04	-23.7214	20.5827	0.99408	0.0:0.0:1.0:0.0	.	990;960	Q4LE28;Q92793	.;CBP_HUMAN	R	960;990;922	ENSP00000262367:P960R;ENSP00000371502:P922R	ENSP00000262367:P960R	P	-	2	0	CREBBP	3760573	1.000000	0.71417	1.000000	0.80357	0.814000	0.46013	8.841000	0.92131	2.941000	0.99782	0.655000	0.94253	CCG		0.572	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	Missense_Mutation	54	221	0	0	0	0	54	221				
ACSM2B	348158	broad.mit.edu	37	16	20565237	20565237	+	Missense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr16:20565237G>A	ENST00000329697.6	-	5	770	c.602C>T	c.(601-603)gCa>gTa	p.A201V	ACSM2B_ENST00000565322.1_Missense_Mutation_p.A122V|ACSM2B_ENST00000567001.1_Missense_Mutation_p.A201V|ACSM2B_ENST00000567288.1_5'Flank|ACSM2B_ENST00000565232.1_Missense_Mutation_p.A201V	NM_001105069.1	NP_001098539.1	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member 2B	201					fatty acid metabolic process (GO:0006631)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(4)|lung(33)|ovary(1)|prostate(1)|skin(5)	57						AGTGGTGGATGCCTCACTGAC	0.493																																						uc002dhj.3		NA																	0				skin(3)|ovary(1)|central_nervous_system(1)	5						c.(601-603)GCA>GTA		acyl-CoA synthetase medium-chain family member							116.0	100.0	105.0					16																	20565237		2201	4300	6501	SO:0001583	missense	348158				fatty acid metabolic process|xenobiotic metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|CoA-ligase activity|metal ion binding	g.chr16:20565237G>A	AY160217	CCDS10586.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000066813	ENSG00000066813		"""Acyl-CoA synthetase family"""	30931	protein-coding gene	gene with protein product	"""xenobiotic/medium chain fatty acid:CoA ligase"""	614359	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2		12616642	Standard	NM_182617		Approved	HXMA, HYST1046	uc002dhk.4	Q68CK6	OTTHUMG00000131555	ENST00000329697.6:c.602C>T	16.37:g.20565237G>A	ENSP00000327453:p.Ala201Val		Somatic				ACSM2B_uc002dhk.3_Missense_Mutation_p.A201V|ACSM2B_uc010bwf.1_Missense_Mutation_p.A201V	p.A201V	NM_182617	NP_872423	WXS	Illumina HiSeq	Unspecified	Q68CK6	ACS2B_HUMAN			6	812	-			201					Q86YT1	Missense_Mutation	SNP	ENST00000329697.6	37	c.602C>T	CCDS10586.1	.	.	.	.	.	.	.	.	.	.	G	12.70	2.017272	0.35606	.	.	ENSG00000066813	ENST00000329697	T	0.39787	1.06	3.36	3.36	0.38483	AMP-dependent synthetase/ligase (1);	0.000000	0.46758	D	0.000270	T	0.52484	0.1737	L	0.55834	1.745	0.30494	N	0.771047	D;D	0.67145	0.996;0.996	P;P	0.59546	0.859;0.859	T	0.56637	-0.7946	10	0.62326	D	0.03	-16.9432	12.0765	0.53647	0.0:0.0:1.0:0.0	.	201;201	A8K051;Q68CK6	.;ACS2B_HUMAN	V	201	ENSP00000327453:A201V	ENSP00000327453:A201V	A	-	2	0	ACSM2B	20472738	0.422000	0.25473	0.186000	0.23195	0.185000	0.23345	2.008000	0.40893	1.878000	0.54408	0.609000	0.83330	GCA		0.493	ACSM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254417.2	NM_182617		14	44	0	0	0	0	14	44				
FHOD1	29109	broad.mit.edu	37	16	67263809	67263809	+	Missense_Mutation	SNP	G	G	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr16:67263809G>T	ENST00000258201.4	-	21	3546	c.3299C>A	c.(3298-3300)cCc>cAc	p.P1100H	AC040160.1_ENST00000454102.2_5'Flank|LRRC29_ENST00000341546.3_5'Flank|LRRC29_ENST00000409509.1_5'Flank|LRRC29_ENST00000462169.1_5'Flank	NM_013241.2	NP_037373.2	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	1100	DAD.				positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			breast(4)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	34		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		TGTATCACTGGGTAAACTGGA	0.587																																						uc002esl.2		NA																	0				breast(2)|ovary(1)	3						c.(3298-3300)CCC>CAC		formin homology 2 domain containing 1							68.0	71.0	70.0					16																	67263809		2198	4300	6498	SO:0001583	missense	29109				actin cytoskeleton organization	cytoplasm|cytoskeleton|nucleus	actin binding	g.chr16:67263809G>T	AF113615	CCDS10834.1	16q22	2008-02-22			ENSG00000135723	ENSG00000135723			17905	protein-coding gene	gene with protein product		606881				10352228, 16112087	Standard	NM_013241		Approved	FHOS	uc002esl.3	Q9Y613	OTTHUMG00000137521	ENST00000258201.4:c.3299C>A	16.37:g.67263809G>T	ENSP00000258201:p.Pro1100His		Somatic				LRRC29_uc002esf.2_5'Flank|LRRC29_uc002esg.2_5'Flank|LRRC29_uc010vjg.1_5'Flank|FHOD1_uc002esk.2_Missense_Mutation_p.P159H|FHOD1_uc010ced.2_Missense_Mutation_p.P907H	p.P1100H	NM_013241	NP_037373	WXS	Illumina HiSeq	Unspecified	Q9Y613	FHOD1_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)	21	3411	-		Ovarian(137;0.0563)	1100					Q59F76|Q6Y1F2|Q76MS8|Q8N521	Missense_Mutation	SNP	ENST00000258201.4	37	c.3299C>A	CCDS10834.1	.	.	.	.	.	.	.	.	.	.	G	15.61	2.883844	0.51908	.	.	ENSG00000135723	ENST00000258201	T	0.37235	1.21	4.92	4.92	0.64577	.	0.325582	0.34067	N	0.004281	T	0.55305	0.1912	M	0.72894	2.215	0.51233	D	0.999913	D	0.57257	0.979	P	0.57776	0.827	T	0.58797	-0.7573	10	0.59425	D	0.04	.	16.8658	0.86029	0.0:0.0:1.0:0.0	.	1100	Q9Y613	FHOD1_HUMAN	H	1100	ENSP00000258201:P1100H	ENSP00000258201:P1100H	P	-	2	0	FHOD1	65821310	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.179000	0.58290	2.556000	0.86216	0.563000	0.77884	CCC		0.587	FHOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268844.2			20	50	1	0	7.45e-12	8.49e-12	20	50				
PRMT7	54496	broad.mit.edu	37	16	68390961	68390961	+	Missense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr16:68390961G>A	ENST00000339507.5	+	19	2743	c.1913G>A	c.(1912-1914)gGc>gAc	p.G638D	PRMT7_ENST00000449359.3_Missense_Mutation_p.G588D|PRMT7_ENST00000348497.4_Missense_Mutation_p.G490D|PRMT7_ENST00000441236.1_Missense_Mutation_p.G588D			Q9NVM4	ANM7_HUMAN	protein arginine methyltransferase 7	638	SAM-dependent MTase PRMT-type 2. {ECO:0000255|PROSITE-ProRule:PRU01015}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|histone arginine methylation (GO:0034969)|histone methylation (GO:0016571)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|peptidyl-arginine methylation, to symmetrical-dimethyl arginine (GO:0019918)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of protein binding (GO:0043393)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	[myelin basic protein]-arginine N-methyltransferase activity (GO:0016277)|histone binding (GO:0042393)|histone methyltransferase activity (H4-R3 specific) (GO:0044020)|histone-arginine N-methyltransferase activity (GO:0008469)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)|protein-arginine omega-N symmetric methyltransferase activity (GO:0035243)|ribonucleoprotein complex binding (GO:0043021)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			endometrium(3)|kidney(2)|large_intestine(3)|lung(10)|pancreas(1)|urinary_tract(1)	20		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0155)|Epithelial(162;0.0629)		CTACAGGGGGGCTGCTGCTGG	0.632																																						uc002evy.1		NA																	0					0						c.(1912-1914)GGC>GAC		protein arginine methyltransferase 7							42.0	40.0	41.0					16																	68390961		2198	4300	6498	SO:0001583	missense	54496				cell differentiation|DNA methylation involved in gamete generation|regulation of gene expression by genetic imprinting|regulation of transcription, DNA-dependent|spliceosomal snRNP assembly|transcription, DNA-dependent	cytosol|nucleus	[myelin basic protein]-arginine N-methyltransferase activity|histone methyltransferase activity (H4-R3 specific)|protein-arginine omega-N monomethyltransferase activity|protein-arginine omega-N symmetric methyltransferase activity|ribonucleoprotein binding	g.chr16:68390961G>A	AK001502	CCDS10866.1, CCDS54033.1	16q22.1	2008-02-05			ENSG00000132600	ENSG00000132600		"""Protein arginine methyltransferases"""	25557	protein-coding gene	gene with protein product		610087				15044439	Standard	NM_001184824		Approved	FLJ10640, KIAA1933	uc002evy.2	Q9NVM4	OTTHUMG00000137556	ENST00000339507.5:c.1913G>A	16.37:g.68390961G>A	ENSP00000343103:p.Gly638Asp		Somatic				PRMT7_uc010vlg.1_Missense_Mutation_p.G588D|PRMT7_uc002evz.1_Missense_Mutation_p.G410D	p.G638D	NM_019023	NP_061896	WXS	Illumina HiSeq	Unspecified	Q9NVM4	ANM7_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0155)|Epithelial(162;0.0629)	19	2189	+		Ovarian(137;0.192)	638					B3KPR0|B3KUG9|B4E379|Q96PV5|Q9H9L0	Missense_Mutation	SNP	ENST00000339507.5	37	c.1913G>A	CCDS10866.1	.	.	.	.	.	.	.	.	.	.	g	1.514	-0.548680	0.04024	.	.	ENSG00000132600	ENST00000449359;ENST00000441236;ENST00000348497;ENST00000339507	T;T	0.75260	-0.92;1.08	6.07	3.84	0.44239	.	0.694442	0.15672	N	0.250336	T	0.40067	0.1102	N	0.01352	-0.895	0.19775	N	0.999955	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.31696	-0.9934	10	0.08381	T	0.77	-5.2144	6.1952	0.20546	0.7557:0.1622:0.0821:0.0	.	588;490;638	Q9NVM4-3;Q9NVM4-2;Q9NVM4	.;.;ANM7_HUMAN	D	588;588;490;638	ENSP00000345775:G490D;ENSP00000343103:G638D	ENSP00000343103:G638D	G	+	2	0	PRMT7	66948462	0.453000	0.25721	0.915000	0.36163	0.015000	0.08874	1.241000	0.32743	0.543000	0.28864	-1.091000	0.02175	GGC		0.632	PRMT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268892.3	NM_019023		4	28	0	0	0	0	4	28				
TUSC5	286753	broad.mit.edu	37	17	1183494	1183494	+	Missense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr17:1183494G>A	ENST00000333813.3	+	1	538	c.199G>A	c.(199-201)Gag>Aag	p.E67K		NM_172367.2	NP_758955.2	Q8IXB3	TUSC5_HUMAN	tumor suppressor candidate 5	67					response to biotic stimulus (GO:0009607)	integral component of membrane (GO:0016021)				endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|prostate(4)|skin(2)	15				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		GGCCATCTCCGAGGGGCACCT	0.632																																						uc002fsi.1		NA																	0				skin(2)	2						c.(199-201)GAG>AAG		LOST1							47.0	53.0	51.0					17																	1183494		1920	4134	6054	SO:0001583	missense	286753				response to biotic stimulus	integral to membrane		g.chr17:1183494G>A	AB090231	CCDS42225.1	17p13.3	2009-10-16			ENSG00000184811	ENSG00000184811			29592	protein-coding gene	gene with protein product	"""located at seventeen p thirteen point three 1"", ""interferon induced transmembrane protein domain containing 3"""	612211				12660825	Standard	NM_172367		Approved	LOST1, IFITMD3	uc002fsi.1	Q8IXB3	OTTHUMG00000132196	ENST00000333813.3:c.199G>A	17.37:g.1183494G>A	ENSP00000329548:p.Glu67Lys		Somatic					p.E67K	NM_172367	NP_758955	WXS	Illumina HiSeq	Unspecified	Q8IXB3	TUSC5_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)	1	538	+			67					A6NMK4	Missense_Mutation	SNP	ENST00000333813.3	37	c.199G>A	CCDS42225.1	.	.	.	.	.	.	.	.	.	.	G	18.20	3.571357	0.65765	.	.	ENSG00000184811	ENST00000333813	T	0.70869	-0.52	5.38	5.38	0.77491	.	0.167443	0.34603	U	0.003835	T	0.61515	0.2353	M	0.65975	2.015	0.42438	D	0.992704	P	0.52692	0.955	B	0.33121	0.158	T	0.66606	-0.5881	10	0.06891	T	0.86	-23.0619	17.7493	0.88429	0.0:0.0:1.0:0.0	.	67	Q8IXB3	TUSC5_HUMAN	K	67	ENSP00000329548:E67K	ENSP00000329548:E67K	E	+	1	0	TUSC5	1130244	1.000000	0.71417	0.609000	0.28983	0.633000	0.38033	5.078000	0.64425	2.558000	0.86282	0.537000	0.68136	GAG		0.632	TUSC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255249.1	NM_172367		17	54	0	0	0	0	17	54				
MYO1C	4641	broad.mit.edu	37	17	1387576	1387576	+	Missense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr17:1387576G>A	ENST00000359786.5	-	2	421	c.97C>T	c.(97-99)Cgg>Tgg	p.R33W	MYO1C_ENST00000438665.2_Missense_Mutation_p.R14W|MYO1C_ENST00000361007.2_5'UTR|MYO1C_ENST00000575158.1_5'UTR|MYO1C_ENST00000545534.2_Missense_Mutation_p.R9W	NM_001080779.1	NP_001074248.1	Q12965	MYO1E_HUMAN	myosin IC	0	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|liver(2)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	17				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		ATGGTCACCCGAACCCCGTCA	0.652																																						uc002fsp.2		NA																	0					0						c.(97-99)CGG>TGG		myosin IC isoform a							40.0	39.0	39.0					17																	1387576		2203	4300	6503	SO:0001583	missense	4641				mRNA transport|protein transport|transmembrane transport	basal plasma membrane|cytoplasm|filamentous actin|lateral plasma membrane|nuclear pore|nucleolus|nucleoplasm|stereocilium membrane	actin binding|ATP binding|calmodulin binding|motor activity	g.chr17:1387576G>A	X98507	CCDS11003.1, CCDS42226.1, CCDS45562.1	17p13.3	2011-09-27			ENSG00000197879	ENSG00000197879		"""Myosins / Myosin superfamily : Class I"""	7597	protein-coding gene	gene with protein product		606538				9119401	Standard	NM_001080779		Approved	myr2	uc002fsp.3	O00159	OTTHUMG00000090323	ENST00000359786.5:c.97C>T	17.37:g.1387576G>A	ENSP00000352834:p.Arg33Trp		Somatic				MYO1C_uc002fsn.2_Missense_Mutation_p.R14W|MYO1C_uc002fso.2_5'UTR|MYO1C_uc010vqj.1_5'UTR|MYO1C_uc010vqk.1_Missense_Mutation_p.R9W	p.R33W	NM_001080779	NP_001074248	WXS	Illumina HiSeq	Unspecified	O00159	MYO1C_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)	2	317	-			33					Q14778	Missense_Mutation	SNP	ENST00000359786.5	37	c.97C>T	CCDS42226.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.956456	0.92726	.	.	ENSG00000197879	ENST00000359786;ENST00000438665;ENST00000535856;ENST00000545534	D;D;D	0.88124	-2.34;-2.32;-2.34	4.54	3.56	0.40772	.	0.240037	0.34046	N	0.004306	D	0.86426	0.5930	N	0.24115	0.695	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.998	P;P;P	0.59424	0.82;0.739;0.857	D	0.87748	0.2590	10	0.87932	D	0	.	13.1144	0.59292	0.0:0.0:0.8387:0.1613	.	9;33;14	B7Z3E5;O00159;O00159-3	.;MYO1C_HUMAN;.	W	33;14;14;9	ENSP00000352834:R33W;ENSP00000412197:R14W;ENSP00000437685:R9W	ENSP00000352834:R33W	R	-	1	2	MYO1C	1334326	1.000000	0.71417	0.816000	0.32577	0.976000	0.68499	5.827000	0.69300	1.105000	0.41606	0.561000	0.74099	CGG		0.652	MYO1C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206685.4			6	24	0	0	0	0	6	24				
WSCD1	23302	broad.mit.edu	37	17	5998441	5998441	+	Silent	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr17:5998441C>T	ENST00000574946.1	+	5	1137	c.747C>T	c.(745-747)cgC>cgT	p.R249R	WSCD1_ENST00000573634.1_Silent_p.R133R|WSCD1_ENST00000539421.1_Silent_p.R249R|WSCD1_ENST00000317744.5_Silent_p.R249R|WSCD1_ENST00000574232.1_Silent_p.R249R			Q658N2	WSCD1_HUMAN	WSC domain containing 1	249	WSC 2. {ECO:0000255|PROSITE- ProRule:PRU00558}.					integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)	35						CCACCTACCGCGGATGCTTCC	0.572																																						uc010cli.2		NA																	0					0						c.(745-747)CGC>CGT		WSC domain containing 1							125.0	124.0	124.0					17																	5998441		2203	4300	6503	SO:0001819	synonymous_variant	23302					integral to membrane	sulfotransferase activity	g.chr17:5998441C>T		CCDS32538.1	17p13.2	2008-02-05				ENSG00000179314			29060	protein-coding gene	gene with protein product							Standard	XM_005256572		Approved	KIAA0523	uc002gcn.3	Q658N2		ENST00000574946.1:c.747C>T	17.37:g.5998441C>T			Somatic				WSCD1_uc002gcn.2_Silent_p.R249R|WSCD1_uc002gco.2_Silent_p.R249R|WSCD1_uc010clj.2_5'UTR	p.R249R	NM_015253	NP_056068	WXS	Illumina HiSeq	Unspecified	Q658N2	WSCD1_HUMAN			5	1126	+			249			WSC 2.		A8K0N8|D3DTM3|O60276|Q96G45	Silent	SNP	ENST00000574946.1	37	c.747C>T	CCDS32538.1																																																																																				0.572	WSCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438965.4	NM_015253		18	82	0	0	0	0	18	82				
SPAG5	10615	broad.mit.edu	37	17	26913009	26913009	+	Missense_Mutation	SNP	C	C	T	rs374597210		TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr17:26913009C>T	ENST00000321765.5	-	7	1945	c.1613G>A	c.(1612-1614)cGt>cAt	p.R538H		NM_006461.3	NP_006452.3	Q96R06	SPAG5_HUMAN	sperm associated antigen 5	538	Interaction with KNSTRN.				chromosome segregation (GO:0007059)|mitotic sister chromatid segregation (GO:0000070)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|microtubule plus-end (GO:0035371)|mitotic spindle (GO:0072686)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43	Lung NSC(42;0.00431)					TGTTTCTGCACGCCGAGACTA	0.483																																						uc002hbq.2		NA																	0				central_nervous_system(1)	1						c.(1612-1614)CGT>CAT		sperm associated antigen 5		C	HIS/ARG	0,4406		0,0,2203	180.0	170.0	173.0		1613	-7.7	0.0	17		173	2,8598	2.2+/-6.3	0,2,4298	no	missense	SPAG5	NM_006461.3	29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign	538/1194	26913009	2,13004	2203	4300	6503	SO:0001583	missense	10615				cell division|mitosis|phosphatidylinositol-mediated signaling|spindle organization	condensed chromosome kinetochore|cytoplasm|spindle pole	protein binding	g.chr17:26913009C>T	AF063308	CCDS32594.1	17q11.2	2008-07-18			ENSG00000076382	ENSG00000076382			13452	protein-coding gene	gene with protein product	"""mitotic spindle coiled-coil related protein"", ""astrin"", ""mitotic spindle associated protein p126"""	615562				11549262	Standard	NM_006461		Approved	DEEPEST, MAP126, hMAP126	uc002hbq.3	Q96R06	OTTHUMG00000166586	ENST00000321765.5:c.1613G>A	17.37:g.26913009C>T	ENSP00000323300:p.Arg538His		Somatic				SGK494_uc010waq.1_Intron	p.R538H	NM_006461	NP_006452	WXS	Illumina HiSeq	Unspecified	Q96R06	SPAG5_HUMAN			7	1705	-	Lung NSC(42;0.00431)		538					O95213|Q9BWE8|Q9NT17|Q9UFE6	Missense_Mutation	SNP	ENST00000321765.5	37	c.1613G>A	CCDS32594.1	.	.	.	.	.	.	.	.	.	.	C	4.188	0.033503	0.08101	0.0	2.33E-4	ENSG00000076382	ENST00000321765;ENST00000536674	.	.	.	5.72	-7.74	0.01241	.	0.704156	0.13220	N	0.404467	T	0.23094	0.0558	L	0.32530	0.975	0.09310	N	1	B	0.15930	0.015	B	0.09377	0.004	T	0.07290	-1.0780	9	0.40728	T	0.16	3.3823	7.3522	0.26697	0.1762:0.3404:0.0:0.4834	.	538	Q96R06	SPAG5_HUMAN	H	538;35	.	ENSP00000323300:R538H	R	-	2	0	SPAG5	23937136	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.254000	0.02874	-1.661000	0.01484	-1.731000	0.00696	CGT		0.483	SPAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390564.2	NM_006461		46	143	0	0	0	0	46	143				
MED24	9862	broad.mit.edu	37	17	38175892	38175892	+	Missense_Mutation	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr17:38175892C>T	ENST00000394128.2	-	26	2941	c.2860G>A	c.(2860-2862)Gaa>Aaa	p.E954K	MED24_ENST00000356271.3_Missense_Mutation_p.E941K|MED24_ENST00000394127.2_Missense_Mutation_p.E941K|MED24_ENST00000501516.3_Missense_Mutation_p.E973K|MED24_ENST00000394126.1_Missense_Mutation_p.E979K	NM_014815.3	NP_055630.2	O75448	MED24_HUMAN	mediator complex subunit 24	954					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	41	Colorectal(19;0.000442)					TTCACCAGTTCCGACACCTGC	0.657																																						uc002htt.2		NA																	0				ovary(1)	1						c.(2860-2862)GAA>AAA		mediator complex subunit 24 isoform 1							64.0	55.0	58.0					17																	38175892		2203	4300	6503	SO:0001583	missense	9862				androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	g.chr17:38175892C>T	AF055995	CCDS11359.1, CCDS42315.1	17q21.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000008838	ENSG00000008838			22963	protein-coding gene	gene with protein product		607000	"""thyroid hormone receptor associated protein 4"", ""cofactor required for Sp1 transcriptional activation, subunit 4, 100kDa"""	THRAP4, CRSP4			Standard	NM_001079518		Approved	TRAP100, KIAA0130, DRIP100, CRSP100	uc002htt.3	O75448	OTTHUMG00000133329	ENST00000394128.2:c.2860G>A	17.37:g.38175892C>T	ENSP00000377686:p.Glu954Lys		Somatic				MED24_uc010weq.1_Missense_Mutation_p.E76K|MED24_uc002htr.2_Missense_Mutation_p.E66K|MED24_uc010wer.1_Missense_Mutation_p.E332K|MED24_uc010wes.1_Missense_Mutation_p.E814K|MED24_uc010wet.1_RNA|MED24_uc002hts.2_Missense_Mutation_p.E979K|MED24_uc002htu.2_Missense_Mutation_p.E941K|MED24_uc010cwn.2_Missense_Mutation_p.E941K|MED24_uc010weu.1_Missense_Mutation_p.E864K	p.E954K	NM_014815	NP_055630	WXS	Illumina HiSeq	Unspecified	O75448	MED24_HUMAN			26	3173	-	Colorectal(19;0.000442)		954					A8K4S5|B3KMR9|Q14143|Q9NNY5	Missense_Mutation	SNP	ENST00000394128.2	37	c.2860G>A	CCDS11359.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.61|18.61	3.660185|3.660185	0.67586|0.67586	.|.	.|.	ENSG00000008838|ENSG00000008838	ENST00000394126;ENST00000356271;ENST00000394128;ENST00000394127;ENST00000536318;ENST00000543759;ENST00000537674;ENST00000431269|ENST00000422942	T;T;T|.	0.67523|.	0.8;0.84;-0.27|.	4.97|4.97	4.97|4.97	0.65823|0.65823	Mediator complex, subunit Med24, N-terminal (1);|.	0.051067|.	0.85682|.	D|.	0.000000|.	T|T	0.66208|0.66208	0.2766|0.2766	L|L	0.41236|0.41236	1.265|1.265	0.80722|0.80722	D|D	1|1	B;P;B;P;B;P|.	0.49783|.	0.361;0.476;0.135;0.789;0.361;0.928|.	B;B;B;P;B;P|.	0.48189|.	0.121;0.159;0.084;0.504;0.121;0.57|.	T|T	0.62530|0.62530	-0.6835|-0.6835	10|5	0.07030|.	T|.	0.85|.	-16.4582|-16.4582	18.5973|18.5973	0.91234|0.91234	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	864;864;941;954;896;531|.	F8W9R9;B4E1A5;O75448-2;O75448;F5H0K1;B4E0S3|.	.;.;.;MED24_HUMAN;.;.|.	K|E	954;954;954;941;896;271;112;864|251	ENSP00000377684:E954K;ENSP00000377686:E954K;ENSP00000377685:E941K|.	ENSP00000348610:E954K|.	E|G	-|-	1|2	0|0	MED24|MED24	35429418|35429418	1.000000|1.000000	0.71417|0.71417	0.965000|0.965000	0.40720|0.40720	0.907000|0.907000	0.53573|0.53573	7.776000|7.776000	0.85560|0.85560	2.447000|2.447000	0.82792|0.82792	0.650000|0.650000	0.86243|0.86243	GAA|GGA		0.657	MED24-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257147.2	NM_014815		20	42	0	0	0	0	20	42				
VEZF1	7716	broad.mit.edu	37	17	56060414	56060414	+	Missense_Mutation	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr17:56060414C>T	ENST00000581208.1	-	2	414	c.374G>A	c.(373-375)cGa>cAa	p.R125Q	VEZF1_ENST00000584396.1_Missense_Mutation_p.R116Q	NM_007146.2	NP_009077.2	Q14119	VEZF1_HUMAN	vascular endothelial zinc finger 1	125					angiogenesis (GO:0001525)|cellular defense response (GO:0006968)|endothelial cell development (GO:0001885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(2)|lung(5)|ovary(1)	10						CAACGAAGTTCGGCTGCTGTC	0.567																																						uc002ivf.1		NA																	0				ovary(1)|breast(1)	2						c.(373-375)CGA>CAA		zinc finger protein 161																																				SO:0001583	missense	7716				cellular defense response|regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding	g.chr17:56060414C>T	D28118	CCDS32687.1	17q22	2012-10-05	2006-08-16	2006-08-16	ENSG00000136451	ENSG00000136451		"""Zinc fingers, C2H2-type"""	12949	protein-coding gene	gene with protein product		606747	"""zinc finger protein 161"""	ZNF161		8035792	Standard	XM_005257643		Approved	DB1	uc002ivf.1	Q14119	OTTHUMG00000178777	ENST00000581208.1:c.374G>A	17.37:g.56060414C>T	ENSP00000462337:p.Arg125Gln		Somatic				VEZF1_uc010dcn.1_5'UTR	p.R125Q	NM_007146	NP_009077	WXS	Illumina HiSeq	Unspecified	Q14119	VEZF1_HUMAN			2	517	-			125						Missense_Mutation	SNP	ENST00000581208.1	37	c.374G>A	CCDS32687.1	.	.	.	.	.	.	.	.	.	.	C	19.17	3.775676	0.70107	.	.	ENSG00000136451	ENST00000258963	.	.	.	5.34	5.34	0.76211	.	0.109676	0.64402	D	0.000010	T	0.35393	0.0930	N	0.14661	0.345	0.58432	D	0.999991	D	0.56035	0.974	B	0.37550	0.253	T	0.22941	-1.0202	9	0.30078	T	0.28	-5.1571	19.0388	0.92989	0.0:1.0:0.0:0.0	.	125	Q14119	VEZF1_HUMAN	Q	125	.	ENSP00000258963:R125Q	R	-	2	0	VEZF1	53415413	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.695000	0.68279	2.510000	0.84645	0.643000	0.83706	CGA		0.567	VEZF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443321.1			10	36	0	0	0	0	10	36				
ANKRD12	23253	broad.mit.edu	37	18	9257777	9257777	+	Silent	SNP	G	G	T	rs74916798		TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr18:9257777G>T	ENST00000262126.4	+	9	4752	c.4512G>T	c.(4510-4512)tcG>tcT	p.S1504S	ANKRD12_ENST00000400020.3_Silent_p.S1481S|ANKRD12_ENST00000383440.2_Silent_p.S1481S|RP11-888D10.4_ENST00000609701.1_RNA	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	1504						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						ATGCTGAATCGATTTCTAAAC	0.413																																						uc002knv.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(4510-4512)TCG>TCT		ankyrin repeat domain 12 isoform 1							49.0	51.0	51.0					18																	9257777		2200	4299	6499	SO:0001819	synonymous_variant	23253					nucleus		g.chr18:9257777G>T	AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.4512G>T	18.37:g.9257777G>T			Somatic				ANKRD12_uc002knw.2_Silent_p.S1481S|ANKRD12_uc002knx.2_Silent_p.S1481S|ANKRD12_uc010dkx.1_Silent_p.S1211S	p.S1504S	NM_015208	NP_056023	WXS	Illumina HiSeq	Unspecified	Q6UB98	ANR12_HUMAN			9	4769	+			1504					O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Silent	SNP	ENST00000262126.4	37	c.4512G>T	CCDS11843.1																																																																																				0.413	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2	NM_015208		11	35	1	0	7.04e-09	7.87e-09	11	35				
KCTD1	284252	broad.mit.edu	37	18	24039710	24039710	+	Missense_Mutation	SNP	C	C	G			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr18:24039710C>G	ENST00000408011.3	-	4	1048	c.489G>C	c.(487-489)ttG>ttC	p.L163F	KCTD1_ENST00000417602.1_Missense_Mutation_p.L771F|KCTD1_ENST00000317932.7_Missense_Mutation_p.L163F|KCTD1_ENST00000579973.1_Missense_Mutation_p.L163F|KCTD1_ENST00000580059.1_Missense_Mutation_p.L163F	NM_001136205.2	NP_001129677.1	Q719H9	KCTD1_HUMAN	potassium channel tetramerization domain containing 1	163					negative regulation of transcription, DNA-templated (GO:0045892)|protein homooligomerization (GO:0051260)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(3)	12	all_cancers(21;0.00191)|Lung NSC(5;0.000698)|all_lung(6;0.0019)|Ovarian(20;0.0848)		Epithelial(2;7.8e-06)|OV - Ovarian serous cystadenocarcinoma(3;9.02e-06)|all cancers(3;3.37e-05)			CTTCTTCTATCAAGGATTTGT	0.512																																						uc002kvw.2		NA																	0				ovary(1)	1						c.(487-489)TTG>TTC		potassium channel tetramerisation domain							132.0	111.0	118.0					18																	24039710		2203	4300	6503	SO:0001583	missense	284252				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|voltage-gated potassium channel complex	transcription corepressor activity|transcription factor binding|voltage-gated potassium channel activity	g.chr18:24039710C>G	AF542549	CCDS11888.1	18q11.2	2013-09-20	2013-06-20		ENSG00000134504	ENSG00000134504			18249	protein-coding gene	gene with protein product		613420	"""potassium channel tetramerisation domain containing 1"""	C18orf5			Standard	NM_001142730		Approved		uc010xbj.3	Q719H9	OTTHUMG00000131947	ENST00000408011.3:c.489G>C	18.37:g.24039710C>G	ENSP00000384367:p.Leu163Phe		Somatic				KCTD1_uc010xbj.1_Missense_Mutation_p.L771F|KCTD1_uc010xbk.1_Missense_Mutation_p.L163F|KCTD1_uc002kvy.2_Missense_Mutation_p.L81F	p.L163F	NM_001136205	NP_001129677	WXS	Illumina HiSeq	Unspecified	Q719H9	KCTD1_HUMAN	Epithelial(2;7.8e-06)|OV - Ovarian serous cystadenocarcinoma(3;9.02e-06)|all cancers(3;3.37e-05)		4	1049	-	all_cancers(21;0.00191)|Lung NSC(5;0.000698)|all_lung(6;0.0019)|Ovarian(20;0.0848)		163					A8K1F5	Missense_Mutation	SNP	ENST00000408011.3	37	c.489G>C	CCDS11888.1	.	.	.	.	.	.	.	.	.	.	C	19.98	3.926976	0.73327	.	.	ENSG00000134504	ENST00000317932;ENST00000417602;ENST00000408011	T;D;T	0.82081	-1.19;-1.57;-1.19	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	D	0.90249	0.6951	M	0.66939	2.045	0.80722	D	1	D	0.69078	0.997	D	0.69479	0.964	D	0.90925	0.4786	10	0.72032	D	0.01	.	19.1034	0.93283	0.0:1.0:0.0:0.0	.	163	Q719H9	KCTD1_HUMAN	F	163;771;163	ENSP00000314831:L163F;ENSP00000408405:L771F;ENSP00000384367:L163F	ENSP00000314831:L163F	L	-	3	2	KCTD1	22293708	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.926000	0.28804	2.517000	0.84864	0.655000	0.94253	TTG		0.512	KCTD1-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000446265.1	XM_209091		4	63	0	0	0	0	4	63				
S1PR4	8698	broad.mit.edu	37	19	3179595	3179595	+	Missense_Mutation	SNP	G	G	A	rs553676200		TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr19:3179595G>A	ENST00000246115.3	+	1	860	c.805G>A	c.(805-807)Ggg>Agg	p.G269R		NM_003775.3	NP_003766.1	O95977	S1PR4_HUMAN	sphingosine-1-phosphate receptor 4	269					activation of phospholipase C activity (GO:0007202)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)|sphingosine-1-phosphate receptor activity (GO:0038036)			breast(1)|kidney(2)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	13						CCCACTCTTCGGGCTGCTGCT	0.697																																					GBM(82;318 1638 33279 49708)	uc002lxg.2		NA																	0				lung(1)|skin(1)	2						c.(805-807)GGG>AGG		sphingosine-1-phosphate receptor 4 precursor							60.0	62.0	61.0					19																	3179595		2203	4300	6503	SO:0001583	missense	8698				activation of phospholipase C activity|elevation of cytosolic calcium ion concentration|immune response	integral to plasma membrane	lipid binding|lysosphingolipid and lysophosphatidic acid receptor activity	g.chr19:3179595G>A	AJ000479	CCDS12105.1	19p13.3	2012-08-08	2008-04-30	2008-04-30		ENSG00000125910		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	3170	protein-coding gene	gene with protein product		603751	"""endothelial differentiation, G-protein-coupled receptor 6"", ""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 6"""	EDG6		9790765	Standard	NM_003775		Approved		uc002lxg.3	O95977		ENST00000246115.3:c.805G>A	19.37:g.3179595G>A	ENSP00000246115:p.Gly269Arg		Somatic					p.G269R	NM_003775	NP_003766	WXS	Illumina HiSeq	Unspecified	O95977	S1PR4_HUMAN			1	830	+			269			Helical; Name=6; (By similarity).		D6W612	Missense_Mutation	SNP	ENST00000246115.3	37	c.805G>A	CCDS12105.1	.	.	.	.	.	.	.	.	.	.	G	12.78	2.041197	0.35989	.	.	ENSG00000125910	ENST00000246115	T	0.71817	-0.6	4.23	1.97	0.26223	GPCR, rhodopsin-like superfamily (1);	0.474372	0.20959	N	0.082596	T	0.60405	0.2266	L	0.53249	1.67	0.35064	D	0.761867	P	0.45768	0.866	B	0.38921	0.285	T	0.63703	-0.6577	10	0.25106	T	0.35	.	10.7572	0.46243	0.0:0.0:0.4693:0.5307	.	269	O95977	S1PR4_HUMAN	R	269	ENSP00000246115:G269R	ENSP00000246115:G269R	G	+	1	0	S1PR4	3130595	0.004000	0.15560	0.998000	0.56505	0.618000	0.37518	0.481000	0.22260	0.209000	0.20645	0.462000	0.41574	GGG		0.697	S1PR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452517.1	NM_003775		31	56	0	0	0	0	31	56				
ZNF763	284390	broad.mit.edu	37	19	12089308	12089308	+	Missense_Mutation	SNP	G	G	A	rs370964246		TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr19:12089308G>A	ENST00000358987.3	+	4	696	c.569G>A	c.(568-570)cGc>cAc	p.R190H	ZNF763_ENST00000538752.1_Missense_Mutation_p.R210H|ZNF763_ENST00000343949.5_Missense_Mutation_p.R193H|ZNF763_ENST00000590798.1_Missense_Mutation_p.R210H|ZNF763_ENST00000545530.1_Missense_Mutation_p.R68H			Q0D2J5	ZN763_HUMAN	zinc finger protein 763	190					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)	15						ATTCGAAGACGCATGGTAATG	0.408																																						uc002msw.2		NA																	0				central_nervous_system(1)	1						c.(568-570)CGC>CAC		zinc finger protein 763		G	HIS/ARG	0,4406		0,0,2203	120.0	122.0	122.0		578	-2.7	0.0	19		122	1,8599		0,1,4299	no	missense	ZNF763	NM_001012753.1	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		193/398	12089308	1,13005	2203	4300	6503	SO:0001583	missense	284390				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:12089308G>A	AK092240	CCDS45982.1	19p13.2	2014-02-12	2006-08-14		ENSG00000197054	ENSG00000197054		"""Zinc fingers, C2H2-type"", ""-"""	27614	protein-coding gene	gene with protein product							Standard	NM_001012753		Approved	ZNF440L		Q0D2J5	OTTHUMG00000156430	ENST00000358987.3:c.569G>A	19.37:g.12089308G>A	ENSP00000402017:p.Arg190His		Somatic				ZNF763_uc010xmf.1_Missense_Mutation_p.R210H|ZNF763_uc002msv.2_Missense_Mutation_p.R193H|ZNF763_uc010xmg.1_Missense_Mutation_p.R68H	p.R190H	NM_001012753	NP_001012771	WXS	Illumina HiSeq	Unspecified	Q0D2J5	ZN763_HUMAN			4	724	+			190			C2H2-type 2; degenerate.		B3KRU3|B4DRE7	Missense_Mutation	SNP	ENST00000358987.3	37	c.569G>A		.	.	.	.	.	.	.	.	.	.	g	0.011	-1.732958	0.00687	0.0	1.16E-4	ENSG00000197054	ENST00000538752;ENST00000343949;ENST00000545530;ENST00000358987	T;T;T;T	0.04551	3.6;3.6;3.6;3.6	1.4	-2.71	0.05986	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.00552	0.0018	N	0.00010	-3.02	0.09310	N	0.999996	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.39840	-0.9594	9	0.02654	T	1	.	2.3058	0.04173	0.5795:0.0:0.18:0.2405	.	210;190;193	F5H0A9;Q0D2J5;Q0D2J5-2	.;ZN763_HUMAN;.	H	210;193;68;190	ENSP00000438117:R210H;ENSP00000369774:R193H;ENSP00000446166:R68H;ENSP00000402017:R190H	ENSP00000369774:R193H	R	+	2	0	ZNF763	11950308	0.793000	0.28825	0.000000	0.03702	0.005000	0.04900	3.555000	0.53727	-1.257000	0.02475	-1.373000	0.01185	CGC		0.408	ZNF763-002	KNOWN	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000344158.1	NM_001012753		40	94	0	0	0	0	40	94				
UNC13A	23025	broad.mit.edu	37	19	17768990	17768990	+	Silent	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr19:17768990C>T	ENST00000519716.2	-	9	647	c.648G>A	c.(646-648)acG>acA	p.T216T	UNC13A_ENST00000252773.7_Silent_p.T216T|UNC13A_ENST00000550896.1_Silent_p.T216T|UNC13A_ENST00000552293.1_Silent_p.T216T|UNC13A_ENST00000428389.2_Silent_p.T304T|UNC13A_ENST00000551649.1_Silent_p.T216T	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	216					beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						TGGGTTGTGACGTAGTATAAT	0.557																																						uc002nhd.2		NA																	0				ovary(3)	3						c.(910-912)ACG>ACA		unc-13 homolog A							138.0	141.0	140.0					19																	17768990		2114	4224	6338	SO:0001819	synonymous_variant	23025				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding	g.chr19:17768990C>T	AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.648G>A	19.37:g.17768990C>T			Somatic					p.T304T	NM_001080421	NP_001073890	WXS	Illumina HiSeq	Unspecified	Q9UPW8	UN13A_HUMAN			10	912	-			216					E5RHY9	Silent	SNP	ENST00000519716.2	37	c.912G>A	CCDS46013.2																																																																																				0.557	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376169.2	XM_038604		3	31	0	0	0	0	3	31				
SLC7A10	56301	broad.mit.edu	37	19	33702376	33702376	+	Missense_Mutation	SNP	C	C	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr19:33702376C>A	ENST00000253188.4	-	6	1002	c.856G>T	c.(856-858)Gcc>Tcc	p.A286S		NM_019849.2	NP_062823.1	Q9NS82	AAA1_HUMAN	solute carrier family 7 (neutral amino acid transporter light chain, asc system), member 10	286					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|D-alanine transport (GO:0042941)|D-serine transport (GO:0042942)|ion transport (GO:0006811)|L-serine transport (GO:0015825)|leukocyte migration (GO:0050900)|neutral amino acid transport (GO:0015804)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-serine transmembrane transporter activity (GO:0015194)|neutral amino acid transmembrane transporter activity (GO:0015175)			central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|stomach(1)	18	Esophageal squamous(110;0.137)					GTGAAGTAGGCAATGTTGGTG	0.627																																						uc002num.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(856-858)GCC>TCC		solute carrier family 7, member 10							165.0	110.0	128.0					19																	33702376		2203	4300	6503	SO:0001583	missense	56301				blood coagulation|cellular nitrogen compound metabolic process|ion transport|leukocyte migration	integral to plasma membrane	L-serine transmembrane transporter activity	g.chr19:33702376C>A	AB037670	CCDS12431.1	19q13.11	2013-05-28	2011-07-12		ENSG00000130876	ENSG00000130876		"""Solute carriers"""	11058	protein-coding gene	gene with protein product		607959				10734121, 10863037	Standard	NM_019849		Approved	asc-1	uc002num.2	Q9NS82	OTTHUMG00000180344	ENST00000253188.4:c.856G>T	19.37:g.33702376C>A	ENSP00000253188:p.Ala286Ser		Somatic				SLC7A10_uc002nul.2_5'UTR	p.A286S	NM_019849	NP_062823	WXS	Illumina HiSeq	Unspecified	Q9NS82	AAA1_HUMAN			6	1003	-	Esophageal squamous(110;0.137)		286			Helical; (Potential).		B2RE84	Missense_Mutation	SNP	ENST00000253188.4	37	c.856G>T	CCDS12431.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.043777	0.75732	.	.	ENSG00000130876	ENST00000253188	D	0.90324	-2.65	5.51	5.51	0.81932	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.93327	0.7873	L	0.45422	1.42	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92193	0.5761	10	0.35671	T	0.21	.	18.3844	0.90462	0.0:1.0:0.0:0.0	.	286	Q9NS82	AAA1_HUMAN	S	286	ENSP00000253188:A286S	ENSP00000253188:A286S	A	-	1	0	SLC7A10	38394216	1.000000	0.71417	0.957000	0.39632	0.336000	0.28762	7.452000	0.80683	2.604000	0.88044	0.591000	0.81541	GCC		0.627	SLC7A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450846.2	NM_019849		5	20	1	0	0.000602214	0.00063008	5	20				
HKR1	284459	broad.mit.edu	37	19	37854366	37854366	+	Missense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr19:37854366G>A	ENST00000324411.4	+	6	1938	c.1669G>A	c.(1669-1671)Gag>Aag	p.E557K	HKR1_ENST00000591134.1_Intron|HKR1_ENST00000392153.3_Missense_Mutation_p.E538K|HKR1_ENST00000541583.2_Missense_Mutation_p.E496K|HKR1_ENST00000544914.1_Missense_Mutation_p.E284K|HKR1_ENST00000591471.1_Missense_Mutation_p.E284K|HKR1_ENST00000589392.1_Missense_Mutation_p.E539K	NM_181786.2	NP_861451.1	P10072	HKR1_HUMAN	HKR1, GLI-Kruppel zinc finger family member	557					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TATGTGCAGGGAGTGTGGCAG	0.512																																						uc002ogb.2		NA																	0				ovary(2)	2						c.(1669-1671)GAG>AAG		GLI-Kruppel family member HKR1							53.0	48.0	49.0					19																	37854366		2203	4300	6503	SO:0001583	missense	284459				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:37854366G>A	M20675	CCDS12502.1	19q13.13	2013-01-08	2010-05-04			ENSG00000181666		"""Zinc fingers, C2H2-type"", ""-"""	4928	protein-coding gene	gene with protein product	"""oncogene HKR1"""	165250	"""GLI-Kruppel family member HKR1"""			2850480, 9813242	Standard	NM_181786		Approved	ZNF875	uc002ogb.3	P10072		ENST00000324411.4:c.1669G>A	19.37:g.37854366G>A	ENSP00000315505:p.Glu557Lys		Somatic				HKR1_uc002ofx.2_Missense_Mutation_p.E273K|HKR1_uc002ofy.2_Missense_Mutation_p.E273K|HKR1_uc002oga.2_Missense_Mutation_p.E539K|HKR1_uc010xto.1_Missense_Mutation_p.E539K|HKR1_uc002ogc.2_Missense_Mutation_p.E538K|HKR1_uc010xtp.1_Missense_Mutation_p.E496K|HKR1_uc002ogd.2_Missense_Mutation_p.E496K	p.E557K	NM_181786	NP_861451	WXS	Illumina HiSeq	Unspecified	P10072	HKR1_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)		6	1938	+			557			C2H2-type 10.		A8MRS7|Q6PJD0|Q9BSW9|Q9UM09	Missense_Mutation	SNP	ENST00000324411.4	37	c.1669G>A	CCDS12502.1	.	.	.	.	.	.	.	.	.	.	G	16.39	3.110488	0.56398	.	.	ENSG00000181666	ENST00000544914;ENST00000414402;ENST00000392153;ENST00000542144;ENST00000324411;ENST00000541583	T;T;T;T	0.16597	2.33;2.33;2.33;2.33	2.77	1.69	0.24217	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.26557	0.0649	L	0.42529	1.33	0.48511	D	0.999666	D;P;P;B	0.56287	0.975;0.919;0.906;0.308	P;P;B;B	0.58873	0.847;0.541;0.4;0.122	T	0.02901	-1.1096	9	0.87932	D	0	.	10.6431	0.45604	0.0:0.3728:0.6272:0.0	.	496;538;557;539	Q7Z6E1;P10072-2;P10072;B4DSY3	.;.;HKR1_HUMAN;.	K	284;336;538;593;557;496	ENSP00000437774:E284K;ENSP00000375994:E538K;ENSP00000315505:E557K;ENSP00000438261:E496K	ENSP00000315505:E557K	E	+	1	0	HKR1	42546206	0.000000	0.05858	0.982000	0.44146	0.954000	0.61252	-0.017000	0.12590	0.714000	0.32081	0.650000	0.86243	GAG		0.512	HKR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458375.1	NM_181786		9	25	0	0	0	0	9	25				
ZNF419	79744	broad.mit.edu	37	19	58004287	58004287	+	Missense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr19:58004287G>A	ENST00000221735.7	+	5	548	c.362G>A	c.(361-363)aGt>aAt	p.S121N	ZNF419_ENST00000347466.6_Missense_Mutation_p.S89N|ZNF419_ENST00000426954.2_Missense_Mutation_p.S109N|ZNF419_ENST00000354197.4_Missense_Mutation_p.S109N|ZNF419_ENST00000424930.2_Missense_Mutation_p.S122N|ZNF419_ENST00000442920.2_Missense_Mutation_p.S108N|AC003005.4_ENST00000601674.1_Intron|ZNF419_ENST00000415379.2_Missense_Mutation_p.S75N			Q96HQ0	ZN419_HUMAN	zinc finger protein 419	121					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Breast(46;0.0848)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0252)|Lung(386;0.171)		GGACTGCTCAGTTCAAACATT	0.473																																						uc002qov.2		NA																	0					0						c.(361-363)AGT>AAT		zinc finger protein 419 isoform 2							75.0	76.0	76.0					19																	58004287		2203	4300	6503	SO:0001583	missense	79744				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:58004287G>A	AK026886	CCDS42637.1, CCDS46211.1, CCDS54325.1, CCDS54326.1, CCDS54327.1, CCDS54328.1	19q13.43	2013-01-08	2006-12-15	2006-12-15	ENSG00000105136	ENSG00000105136		"""Zinc fingers, C2H2-type"", ""-"""	20648	protein-coding gene	gene with protein product			"""zinc finger protein 419A"""	ZNF419A			Standard	NM_001098492		Approved		uc010ety.1	Q96HQ0	OTTHUMG00000037073	ENST00000221735.7:c.362G>A	19.37:g.58004287G>A	ENSP00000221735:p.Ser121Asn		Somatic				ZNF547_uc002qpm.3_Intron|ZNF419_uc010ety.1_Missense_Mutation_p.S122N|ZNF419_uc010etz.1_Missense_Mutation_p.S109N|ZNF419_uc010eua.1_Missense_Mutation_p.S108N|ZNF419_uc002qow.2_Missense_Mutation_p.S89N|ZNF419_uc010eub.1_Missense_Mutation_p.S76N|ZNF419_uc010euc.1_Missense_Mutation_p.S75N	p.S121N	NM_024691	NP_078967	WXS	Illumina HiSeq	Unspecified	Q96HQ0	ZN419_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0252)|Lung(386;0.171)	5	602	+		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Breast(46;0.0848)|Renal(1328;0.157)	121					B4DXU7|B4E348|B7ZA41|E9PCP4|E9PED0|E9PET3|E9PFX9|Q9H5P0	Missense_Mutation	SNP	ENST00000221735.7	37	c.362G>A	CCDS54326.1	.	.	.	.	.	.	.	.	.	.	G	3.214	-0.161024	0.06502	.	.	ENSG00000105136	ENST00000284020;ENST00000524372;ENST00000424930;ENST00000426954;ENST00000354197;ENST00000519310;ENST00000442920;ENST00000517598;ENST00000347466;ENST00000415379;ENST00000521754;ENST00000221735;ENST00000521137	T;T;T;T;T;T;T;T;T;T	0.24151	3.33;3.34;3.27;1.87;3.33;3.25;3.25;5.36;3.32;7.03	1.45	0.38	0.16222	.	.	.	.	.	T	0.20941	0.0504	N	0.25332	0.735	0.09310	N	1	B;B;B;B;B;P;P	0.38504	0.039;0.039;0.361;0.18;0.117;0.634;0.525	B;B;B;B;B;B;P	0.48524	0.017;0.017;0.054;0.037;0.077;0.116;0.58	T	0.29610	-1.0006	9	0.13108	T	0.6	.	5.7715	0.18255	0.1972:0.0:0.8028:0.0	.	75;75;108;109;122;89;121	E9PFX9;B4DXU7;E9PCP4;E9PET3;E9PED0;Q96HQ0-2;Q96HQ0	.;.;.;.;.;.;ZN419_HUMAN	N	124;109;122;109;109;33;108;122;89;75;76;121;88	ENSP00000388864:S122N;ENSP00000390916:S109N;ENSP00000346136:S109N;ENSP00000429880:S33N;ENSP00000414709:S108N;ENSP00000299860:S89N;ENSP00000392129:S75N;ENSP00000428523:S76N;ENSP00000221735:S121N;ENSP00000429628:S88N	ENSP00000221735:S121N	S	+	2	0	ZNF419	62696099	0.001000	0.12720	0.000000	0.03702	0.021000	0.10359	0.587000	0.23909	0.174000	0.19809	0.205000	0.17691	AGT		0.473	ZNF419-006	KNOWN	NAGNAG_splice_site|non_canonical_polymorphism|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000378506.1	NM_024691		6	27	0	0	0	0	6	27				
LTBP1	4052	broad.mit.edu	37	2	33413884	33413884	+	Missense_Mutation	SNP	T	T	C			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr2:33413884T>C	ENST00000404816.2	+	7	2020	c.1667T>C	c.(1666-1668)cTt>cCt	p.L556P	LTBP1_ENST00000407925.1_Missense_Mutation_p.L230P|LTBP1_ENST00000354476.3_Missense_Mutation_p.L556P|LTBP1_ENST00000402934.1_Missense_Mutation_p.L230P|LTBP1_ENST00000404525.1_Missense_Mutation_p.L230P|LTBP1_ENST00000418533.2_Missense_Mutation_p.L230P|LTBP1_ENST00000390003.4_Missense_Mutation_p.L230P			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	556					extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				AAGACACAGCTTGGCCGGTGC	0.498																																						uc002ros.2		NA																	0				ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8						c.(1666-1668)CTT>CCT		latent transforming growth factor beta binding							121.0	120.0	120.0					2																	33413884		2203	4300	6503	SO:0001583	missense	4052				negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity	g.chr2:33413884T>C		CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.1667T>C	2.37:g.33413884T>C	ENSP00000386043:p.Leu556Pro		Somatic				LTBP1_uc002rot.2_Missense_Mutation_p.L230P|LTBP1_uc002rou.2_Missense_Mutation_p.L230P|LTBP1_uc002rov.2_Missense_Mutation_p.L230P|LTBP1_uc010ymz.1_Missense_Mutation_p.L230P|LTBP1_uc010yna.1_Missense_Mutation_p.L230P	p.L556P	NM_206943	NP_996826	WXS	Illumina HiSeq	Unspecified	Q14766	LTBP1_HUMAN			7	1667	+	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)	556					A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Missense_Mutation	SNP	ENST00000404816.2	37	c.1667T>C	CCDS33177.2	.	.	.	.	.	.	.	.	.	.	T	25.9	4.689896	0.88735	.	.	ENSG00000049323	ENST00000404816;ENST00000354476;ENST00000390003;ENST00000418533;ENST00000402934;ENST00000404525;ENST00000407925	D;D;D;D;D;D;D	0.93076	-3.16;-3.16;-3.16;-3.16;-3.16;-3.16;-3.16	5.73	5.73	0.89815	Matrix fibril-associated (2);	.	.	.	.	D	0.96009	0.8700	M	0.62723	1.935	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.999;0.998;1.0;0.999;1.0	D	0.96470	0.9348	9	0.87932	D	0	.	16.0283	0.80558	0.0:0.0:0.0:1.0	.	556;230;230;230;230;556	Q14766;E7EV71;Q14766-3;Q14766-2;Q14766-5;Q14766-4	LTBP1_HUMAN;.;.;.;.;.	P	556;556;230;230;230;230;230	ENSP00000386043:L556P;ENSP00000346467:L556P;ENSP00000374653:L230P;ENSP00000393057:L230P;ENSP00000384373:L230P;ENSP00000385359:L230P;ENSP00000384091:L230P	ENSP00000346467:L556P	L	+	2	0	LTBP1	33267388	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.396000	0.79891	2.199000	0.70637	0.459000	0.35465	CTT		0.498	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943		36	80	0	0	0	0	36	80				
GPR75	10936	broad.mit.edu	37	2	54080512	54080512	+	Missense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr2:54080512G>A	ENST00000394705.2	-	2	1652	c.1382C>T	c.(1381-1383)tCt>tTt	p.S461F	ASB3_ENST00000498475.2_Intron|ASB3_ENST00000406625.2_Intron|GPR75-ASB3_ENST00000352846.3_Intron	NM_006794.3	NP_006785.1	O95800	GPR75_HUMAN	G protein-coupled receptor 75	461					chemokine-mediated signaling pathway (GO:0070098)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of neuron death (GO:1901214)	integral component of plasma membrane (GO:0005887)	C-C chemokine receptor activity (GO:0016493)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	18			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			ATGTCCAGCAGAGATCTTGGG	0.488																																						uc002rxo.3		NA																	0				ovary(1)|skin(1)	2						c.(1381-1383)TCT>TTT		G protein-coupled receptor 75							162.0	152.0	155.0					2																	54080512		2203	4300	6503	SO:0001583	missense	10936					integral to plasma membrane	G-protein coupled receptor activity	g.chr2:54080512G>A	AF101472	CCDS1849.1	2p16	2012-08-21			ENSG00000119737	ENSG00000119737		"""GPCR / Class A : Orphans"""	4526	protein-coding gene	gene with protein product		606704				10381362	Standard	NM_006794		Approved	WI-31133	uc002rxo.3	O95800	OTTHUMG00000129280	ENST00000394705.2:c.1382C>T	2.37:g.54080512G>A	ENSP00000378195:p.Ser461Phe		Somatic				ASB3_uc002rxi.3_Intron	p.S461F	NM_006794	NP_006785	WXS	Illumina HiSeq	Unspecified	O95800	GPR75_HUMAN	Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)		2	1653	-			461			Cytoplasmic (Potential).		B2RC02|Q6NWR2	Missense_Mutation	SNP	ENST00000394705.2	37	c.1382C>T	CCDS1849.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.939425	0.73557	.	.	ENSG00000119737	ENST00000394705	T	0.27402	1.67	4.99	4.99	0.66335	.	0.057779	0.64402	D	0.000001	T	0.55162	0.1903	.	.	.	0.80722	D	1	D	0.71674	0.998	P	0.62014	0.897	T	0.59402	-0.7461	9	0.87932	D	0	-11.9767	18.82	0.92092	0.0:0.0:1.0:0.0	.	461	O95800	GPR75_HUMAN	F	461	ENSP00000378195:S461F	ENSP00000378195:S461F	S	-	2	0	GPR75	53934016	1.000000	0.71417	0.723000	0.30687	0.994000	0.84299	7.174000	0.77620	2.756000	0.94617	0.561000	0.74099	TCT		0.488	GPR75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251403.2			16	134	0	0	0	0	16	134				
COX5B	1329	broad.mit.edu	37	2	98264531	98264531	+	Missense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr2:98264531G>A	ENST00000258424.2	+	4	397	c.350G>A	c.(349-351)gGa>gAa	p.G117E	COX5B_ENST00000464949.1_3'UTR	NM_001862.2	NP_001853.2	P10606	COX5B_HUMAN	cytochrome c oxidase subunit Vb	117					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|respiratory electron transport chain (GO:0022904)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	cytochrome-c oxidase activity (GO:0004129)|metal ion binding (GO:0046872)			endometrium(1)|lung(1)|urinary_tract(1)	3						CCCCGCTGTGGAGCCCATTAC	0.502																																						uc002sya.2		NA																	0					0						c.(349-351)GGA>GAA		cytochrome c oxidase subunit Vb precursor							42.0	42.0	42.0					2																	98264531		2203	4300	6503	SO:0001583	missense	1329				respiratory electron transport chain|respiratory gaseous exchange	mitochondrial inner membrane	cytochrome-c oxidase activity|metal ion binding	g.chr2:98264531G>A	BC006229	CCDS2032.1	2q11.2	2011-07-04			ENSG00000135940	ENSG00000135940	1.9.3.1	"""Mitochondrial respiratory chain complex / Complex IV"""	2269	protein-coding gene	gene with protein product		123866					Standard	NM_001862		Approved		uc002sya.3	P10606	OTTHUMG00000130548	ENST00000258424.2:c.350G>A	2.37:g.98264531G>A	ENSP00000258424:p.Gly117Glu		Somatic					p.G117E	NM_001862	NP_001853	WXS	Illumina HiSeq	Unspecified	P10606	COX5B_HUMAN			4	379	+			117					Q53YB7|Q96J18|Q99610	Missense_Mutation	SNP	ENST00000258424.2	37	c.350G>A	CCDS2032.1	.	.	.	.	.	.	.	.	.	.	.	27.1	4.798226	0.90538	.	.	ENSG00000135940	ENST00000258424	.	.	.	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	D	0.84297	0.5441	M	0.87900	2.915	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86843	0.2018	9	0.87932	D	0	-4.0426	16.8909	0.86087	0.0:0.0:1.0:0.0	.	117	P10606	COX5B_HUMAN	E	117	.	ENSP00000258424:G117E	G	+	2	0	COX5B	97630963	1.000000	0.71417	1.000000	0.80357	0.825000	0.46686	9.198000	0.94994	2.605000	0.88082	0.561000	0.74099	GGA		0.502	COX5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252972.2	NM_001862		3	30	0	0	0	0	3	30				
GRB14	2888	broad.mit.edu	37	2	165365311	165365311	+	Missense_Mutation	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr2:165365311C>T	ENST00000263915.3	-	7	1406	c.868G>A	c.(868-870)Gtg>Atg	p.V290M	GRB14_ENST00000543549.1_Missense_Mutation_p.V203M	NM_004490.2	NP_004481.2	Q14449	GRB14_HUMAN	growth factor receptor-bound protein 14	290	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			breast(3)|endometrium(2)|large_intestine(6)|lung(10)|ovary(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32						GCCAGTGACACATAAATATCA	0.348																																						uc002ucl.2		NA																	0				ovary(5)|upper_aerodigestive_tract(1)|lung(1)	7						c.(868-870)GTG>ATG		growth factor receptor-bound protein 14							112.0	116.0	115.0					2																	165365311		2203	4300	6503	SO:0001583	missense	2888				blood coagulation|leukocyte migration	cytosol|endosome membrane|Golgi membrane|microsome|plasma membrane	SH3/SH2 adaptor activity	g.chr2:165365311C>T		CCDS2222.1	2q22-q24	2013-02-14			ENSG00000115290	ENSG00000115290		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4565	protein-coding gene	gene with protein product		601524				8812444	Standard	XM_005246477		Approved		uc002ucl.3	Q14449	OTTHUMG00000132135	ENST00000263915.3:c.868G>A	2.37:g.165365311C>T	ENSP00000263915:p.Val290Met		Somatic				GRB14_uc010zcv.1_Missense_Mutation_p.V203M|GRB14_uc002ucm.2_RNA	p.V290M	NM_004490	NP_004481	WXS	Illumina HiSeq	Unspecified	Q14449	GRB14_HUMAN			7	1409	-			290			PH.		B7Z7F9|Q7Z6I1	Missense_Mutation	SNP	ENST00000263915.3	37	c.868G>A	CCDS2222.1	.	.	.	.	.	.	.	.	.	.	C	11.60	1.687561	0.29962	.	.	ENSG00000115290	ENST00000263915;ENST00000543549;ENST00000446413	T;T;T	0.75938	-0.98;-0.98;-0.98	5.93	3.13	0.36017	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.382170	0.31922	N	0.006844	T	0.56992	0.2023	N	0.24115	0.695	0.29422	N	0.860466	B;B	0.13145	0.005;0.007	B;B	0.19946	0.027;0.026	T	0.49123	-0.8972	10	0.28530	T	0.3	-5.7965	7.855	0.29476	0.0:0.6232:0.0:0.3768	.	203;290	B7Z7F9;Q14449	.;GRB14_HUMAN	M	290;203;245	ENSP00000263915:V290M;ENSP00000443699:V203M;ENSP00000416786:V245M	ENSP00000263915:V290M	V	-	1	0	GRB14	165073557	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	0.823000	0.27366	0.830000	0.34757	0.650000	0.86243	GTG		0.348	GRB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255180.2			16	63	0	0	0	0	16	63				
CIR1	9541	broad.mit.edu	37	2	175252492	175252492	+	Nonsense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr2:175252492G>A	ENST00000342016.3	-	2	180	c.88C>T	c.(88-90)Cag>Tag	p.Q30*	CIR1_ENST00000362053.5_Nonsense_Mutation_p.Q30*	NM_004882.3	NP_004873.3	Q86X95	CIR1_HUMAN	corepressor interacting with RBPJ, 1	30	Interaction with RBPJ.				mRNA processing (GO:0006397)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(5)|skin(1)	15						GATATTTTCTGTTCTGCCATC	0.254																																						uc002uim.2		NA																	0				large_intestine(1)	1						c.(88-90)CAG>TAG		CBF1 interacting corepressor							120.0	117.0	118.0					2																	175252492		2198	4296	6494	SO:0001587	stop_gained	9541				mRNA processing|negative regulation of transcription, DNA-dependent|RNA splicing	nuclear speck	protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity	g.chr2:175252492G>A	AF098297	CCDS2256.1	2q31.1	2009-07-14			ENSG00000138433	ENSG00000138433			24217	protein-coding gene	gene with protein product	"""recepin"", ""CBF1 interacting corepressor"""	605228				15652350, 11222720, 9874765	Standard	NM_004882		Approved	CIR	uc002uim.3	Q86X95	OTTHUMG00000132338	ENST00000342016.3:c.88C>T	2.37:g.175252492G>A	ENSP00000339723:p.Gln30*		Somatic				CIR1_uc002uin.2_5'UTR|CIR1_uc002uio.2_5'UTR|CIR1_uc002uip.2_5'UTR	p.Q30*	NM_004882	NP_004873	WXS	Illumina HiSeq	Unspecified	Q86X95	CIR1_HUMAN			2	181	-			30			Interaction with RBPJ.		A6NFI6|A8K8M4|O95367|Q12804|Q4G1B9|Q6PJI4|Q8IWI2	Nonsense_Mutation	SNP	ENST00000342016.3	37	c.88C>T	CCDS2256.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.029276	0.93518	.	.	ENSG00000138433	ENST00000342016	.	.	.	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.3211	0.94240	0.0:0.0:1.0:0.0	.	.	.	.	X	30	.	ENSP00000339723:Q30X	Q	-	1	0	CIR1	174960738	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.729000	0.98795	2.638000	0.89438	0.591000	0.81541	CAG		0.254	CIR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255460.1	NM_004882		11	42	0	0	0	0	11	42				
NFE2L2	4780	broad.mit.edu	37	2	178098810	178098810	+	Missense_Mutation	SNP	C	C	G			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr2:178098810C>G	ENST00000397062.3	-	2	789	c.235G>C	c.(235-237)Gag>Cag	p.E79Q	NFE2L2_ENST00000423513.1_Missense_Mutation_p.E63Q|NFE2L2_ENST00000397063.4_Missense_Mutation_p.E63Q|NFE2L2_ENST00000446151.2_Missense_Mutation_p.E63Q|NFE2L2_ENST00000464747.1_Missense_Mutation_p.E63Q	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	79					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E79K(10)|p.E79Q(10)		central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			TCACCTGTCTCTTCATCTAGT	0.443			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																												uc002ulh.3		NA		Dom	yes		2	2q31	4780	Mis	nuclear factor (erythroid-derived 2)-like 2 (NRF2)			E			NSCLC|HNSCC		20	Substitution - Missense(20)		lung(13)|oesophagus(4)|upper_aerodigestive_tract(1)|urinary_tract(1)|cervix(1)	central_nervous_system(1)	1						c.(235-237)GAG>CAG		nuclear factor erythroid 2-like 2 isoform 1							147.0	146.0	146.0					2																	178098810		1899	4107	6006	SO:0001583	missense	4780				transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:178098810C>G		CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.235G>C	2.37:g.178098810C>G	ENSP00000380252:p.Glu79Gln	HNSCC(56;0.16)	Somatic				NFE2L2_uc002ulg.3_Missense_Mutation_p.E63Q|NFE2L2_uc010zfa.1_Missense_Mutation_p.E63Q|NFE2L2_uc002uli.3_Missense_Mutation_p.E63Q|NFE2L2_uc010fra.2_Missense_Mutation_p.E63Q|NFE2L2_uc010frb.2_Missense_Mutation_p.E63Q	p.E79Q	NM_006164	NP_006155	WXS	Illumina HiSeq	Unspecified	Q16236	NF2L2_HUMAN	Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)		2	790	-			79					B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	ENST00000397062.3	37	c.235G>C	CCDS42782.1	.	.	.	.	.	.	.	.	.	.	C	18.55	3.647218	0.67358	.	.	ENSG00000116044	ENST00000397063;ENST00000397062;ENST00000446151;ENST00000449627;ENST00000448782;ENST00000421929;ENST00000423513	T;T;T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53;1.53;1.53	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.64327	0.2588	M	0.87180	2.865	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.87578	0.996;0.994;0.998;0.996	T	0.69087	-0.5238	10	0.87932	D	0	.	19.9976	0.97389	0.0:1.0:0.0:0.0	.	63;63;63;79	E9PGJ7;B4DNB0;C9JFL6;Q16236	.;.;.;NF2L2_HUMAN	Q	63;79;63;63;63;63;63	ENSP00000380253:E63Q;ENSP00000380252:E79Q;ENSP00000411575:E63Q;ENSP00000391590:E63Q;ENSP00000400073:E63Q;ENSP00000412191:E63Q;ENSP00000410015:E63Q	ENSP00000380252:E79Q	E	-	1	0	NFE2L2	177807056	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.298000	0.78815	2.737000	0.93849	0.563000	0.77884	GAG		0.443	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257752.4	NM_006164		3	46	0	0	0	0	3	46				
NFE2L2	4780	broad.mit.edu	37	2	178098957	178098957	+	Missense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr2:178098957G>A	ENST00000397062.3	-	2	642	c.88C>T	c.(88-90)Ctt>Ttt	p.L30F	NFE2L2_ENST00000423513.1_Missense_Mutation_p.L14F|NFE2L2_ENST00000397063.4_Missense_Mutation_p.L14F|NFE2L2_ENST00000446151.2_Missense_Mutation_p.L14F|NFE2L2_ENST00000464747.1_Missense_Mutation_p.L14F	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	30					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L30F(5)		central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			CTTACTCCAAGATCTATATCT	0.368			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																												uc002ulh.3		NA		Dom	yes		2	2q31	4780	Mis	nuclear factor (erythroid-derived 2)-like 2 (NRF2)			E			NSCLC|HNSCC		5	Substitution - Missense(5)		lung(3)|oesophagus(1)|skin(1)	central_nervous_system(1)	1						c.(88-90)CTT>TTT		nuclear factor erythroid 2-like 2 isoform 1							68.0	61.0	63.0					2																	178098957		1842	4101	5943	SO:0001583	missense	4780				transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:178098957G>A		CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.88C>T	2.37:g.178098957G>A	ENSP00000380252:p.Leu30Phe	HNSCC(56;0.16)	Somatic				NFE2L2_uc002ulg.3_Missense_Mutation_p.L14F|NFE2L2_uc010zfa.1_Missense_Mutation_p.L14F|NFE2L2_uc002uli.3_Missense_Mutation_p.L14F|NFE2L2_uc010fra.2_Missense_Mutation_p.L14F|NFE2L2_uc010frb.2_Missense_Mutation_p.L14F	p.L30F	NM_006164	NP_006155	WXS	Illumina HiSeq	Unspecified	Q16236	NF2L2_HUMAN	Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)		2	643	-			30					B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	ENST00000397062.3	37	c.88C>T	CCDS42782.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.298628	0.81025	.	.	ENSG00000116044	ENST00000397063;ENST00000397062;ENST00000446151;ENST00000449627;ENST00000448782;ENST00000421929;ENST00000423513	T;T;T;T;T;T;T	0.38240	1.15;1.15;1.15;1.15;1.15;1.15;1.15	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.68109	0.2965	M	0.86953	2.85	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.91635	0.997;0.997;0.999;0.997	T	0.72623	-0.4237	10	0.87932	D	0	.	19.9976	0.97389	0.0:0.0:1.0:0.0	.	14;14;14;30	E9PGJ7;B4DNB0;C9JFL6;Q16236	.;.;.;NF2L2_HUMAN	F	14;30;14;14;14;14;14	ENSP00000380253:L14F;ENSP00000380252:L30F;ENSP00000411575:L14F;ENSP00000391590:L14F;ENSP00000400073:L14F;ENSP00000412191:L14F;ENSP00000410015:L14F	ENSP00000380252:L30F	L	-	1	0	NFE2L2	177807203	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.476000	0.97823	2.737000	0.93849	0.563000	0.77884	CTT		0.368	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257752.4	NM_006164		7	25	0	0	0	0	7	25				
TTN	7273	broad.mit.edu	37	2	179584490	179584490	+	Missense_Mutation	SNP	C	C	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr2:179584490C>A	ENST00000591111.1	-	80	23002	c.22778G>T	c.(22777-22779)tGt>tTt	p.C7593F	TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.C6666F|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.C7910F|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	13144	Ig-like 58.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGTCACTACACACTCTAATGC	0.398																																						uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(19996-19998)TGT>TTT		titin isoform N2-A							122.0	111.0	115.0					2																	179584490		1881	4112	5993	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179584490C>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.22778G>T	2.37:g.179584490C>A	ENSP00000465570:p.Cys7593Phe		Somatic				TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.C3327F	p.C6666F	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		79	20221	-			7593					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.19997G>T		.	.	.	.	.	.	.	.	.	.	C	9.419	1.082542	0.20309	.	.	ENSG00000155657	ENST00000342992	T	0.62941	-0.01	6.08	6.08	0.98989	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.89291	0.6673	H	0.99555	4.625	0.80722	D	1	D	0.69078	0.997	D	0.70016	0.967	D	0.93093	0.6501	9	0.87932	D	0	.	20.6634	0.99662	0.0:1.0:0.0:0.0	.	7593	Q8WZ42	TITIN_HUMAN	F	6666	ENSP00000343764:C6666F	ENSP00000343764:C6666F	C	-	2	0	TTN	179292735	0.996000	0.38824	1.000000	0.80357	0.716000	0.41182	2.018000	0.40991	2.894000	0.99253	0.655000	0.94253	TGT		0.398	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		4	54	1	0	0.00024832	0.00026251	4	54				
MPP4	58538	broad.mit.edu	37	2	202523236	202523236	+	Missense_Mutation	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr2:202523236C>T	ENST00000409474.3	-	16	1300	c.1093G>A	c.(1093-1095)Gag>Aag	p.E365K	MPP4_ENST00000396886.3_Missense_Mutation_p.E290K|MPP4_ENST00000447335.2_Missense_Mutation_p.E358K|MPP4_ENST00000409143.1_Missense_Mutation_p.E307K|MPP4_ENST00000428900.2_Missense_Mutation_p.E341K|MPP4_ENST00000315506.7_Missense_Mutation_p.E321K|MPP4_ENST00000359962.5_Missense_Mutation_p.E365K	NM_033066.2	NP_149055	Q96JB8	MPP4_HUMAN	membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)	365					protein localization to synapse (GO:0035418)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|presynaptic membrane (GO:0042734)				kidney(1)|lung(11)	12						ACAAACTCCTCCTTGTCTGAA	0.368																																						uc002uyk.3		NA																	0					0						c.(1093-1095)GAG>AAG		membrane protein, palmitoylated 4							88.0	81.0	83.0					2																	202523236		1838	4090	5928	SO:0001583	missense	58538					cytoplasm	protein binding	g.chr2:202523236C>T	AF316032	CCDS46491.1	2q33.2	2008-05-15			ENSG00000082126	ENSG00000082126			13680	protein-coding gene	gene with protein product		606575		DLG6		11414766	Standard	NM_033066		Approved		uc002uyk.4	Q96JB8	OTTHUMG00000154525	ENST00000409474.3:c.1093G>A	2.37:g.202523236C>T	ENSP00000387278:p.Glu365Lys		Somatic				MPP4_uc002uyi.3_5'UTR|MPP4_uc010ftj.2_Missense_Mutation_p.E358K|MPP4_uc010zhq.1_Missense_Mutation_p.E334K|MPP4_uc010zhr.1_Missense_Mutation_p.E341K|MPP4_uc010zhs.1_Missense_Mutation_p.E290K|MPP4_uc002uyj.3_Missense_Mutation_p.E330K|MPP4_uc010zht.1_Missense_Mutation_p.E307K|MPP4_uc002uyl.3_RNA|MPP4_uc010ftk.2_Missense_Mutation_p.E321K	p.E365K	NM_033066	NP_149055	WXS	Illumina HiSeq	Unspecified	Q96JB8	MPP4_HUMAN			16	1301	-			365					C9IZK4|Q53TT3|Q6ZNH6|Q96Q43|Q96Q44	Missense_Mutation	SNP	ENST00000409474.3	37	c.1093G>A	CCDS46491.1	.	.	.	.	.	.	.	.	.	.	C	13.48	2.248448	0.39797	.	.	ENSG00000082126	ENST00000409474;ENST00000315506;ENST00000396886;ENST00000359962;ENST00000315549;ENST00000374605;ENST00000428900;ENST00000409143;ENST00000447335	T;T;T;T;T;T	0.04862	3.54;3.57;3.57;3.57;3.56;3.58	5.24	5.24	0.73138	Src homology-3 domain (1);	1.694860	0.03971	N	0.291655	T	0.05914	0.0154	N	0.08118	0	0.34460	D	0.701658	B;B;B;B;B;B;B;B	0.09022	0.001;0.0;0.001;0.001;0.002;0.001;0.001;0.002	B;B;B;B;B;B;B;B	0.14023	0.001;0.001;0.002;0.002;0.002;0.002;0.002;0.01	T	0.25187	-1.0139	10	0.19590	T	0.45	.	16.0987	0.81152	0.0:1.0:0.0:0.0	.	307;290;341;334;321;358;365;330	F6Q0Y6;B4DUF3;E7ET46;B7ZM19;Q96JB8-2;E7EUL8;Q96JB8;Q96JB8-4	.;.;.;.;.;.;MPP4_HUMAN;.	K	365;321;290;365;330;294;341;307;358	ENSP00000387278:E365K;ENSP00000319363:E321K;ENSP00000353047:E365K;ENSP00000416781:E341K;ENSP00000387293:E307K;ENSP00000406160:E358K	ENSP00000319363:E321K	E	-	1	0	MPP4	202231481	1.000000	0.71417	0.998000	0.56505	0.738000	0.42128	1.955000	0.40372	2.600000	0.87896	0.655000	0.94253	GAG		0.368	MPP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335748.2			8	15	0	0	0	0	8	15				
ASIC4	55515	broad.mit.edu	37	2	220397137	220397137	+	Missense_Mutation	SNP	G	G	A	rs370439074		TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr2:220397137G>A	ENST00000347842.3	+	4	1351	c.1337G>A	c.(1336-1338)cGg>cAg	p.R446Q	ASIC4_ENST00000473709.1_3'UTR|ASIC4_ENST00000358078.4_Missense_Mutation_p.R446Q	NM_182847.2	NP_878267.2	Q96FT7	ASIC4_HUMAN	acid-sensing (proton-gated) ion channel family member 4	446					ion transmembrane transport (GO:0034220)|sodium ion transmembrane transport (GO:0035725)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)	ion channel activity (GO:0005216)|sodium channel activity (GO:0005272)|sodium ion transmembrane transporter activity (GO:0015081)										TCTGCCTGCCGGCTGCGCTGT	0.677																																						uc002vma.2		NA																	0				ovary(2)	2						c.(1336-1338)CGG>CAG		amiloride-sensitive cation channel 4 isoform 2		G	GLN/ARG,GLN/ARG	0,4406		0,0,2203	49.0	47.0	48.0		1337,1337	4.1	1.0	2		48	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ACCN4	NM_018674.4,NM_182847.2	43,43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	446/667,446/648	220397137	1,13005	2203	4300	6503	SO:0001583	missense	55515					integral to plasma membrane	sodium channel activity|sodium ion transmembrane transporter activity	g.chr2:220397137G>A	AJ271643	CCDS2442.1	2q36.1	2012-02-22	2012-02-22	2012-02-22	ENSG00000072182	ENSG00000072182		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	21263	protein-coding gene	gene with protein product		606715	"""amiloride-sensitive cation channel 4, pituitary"", ""amiloride-sensitive cation channel family member 4, pituitary"""	ACCN4		10852210	Standard	NM_182847		Approved	BNAC4	uc002vma.3	Q96FT7	OTTHUMG00000058928	ENST00000347842.3:c.1337G>A	2.37:g.220397137G>A	ENSP00000326627:p.Arg446Gln		Somatic				ACCN4_uc010fwi.1_Missense_Mutation_p.R446Q|ACCN4_uc010fwj.1_Missense_Mutation_p.R446Q|ACCN4_uc002vly.1_3'UTR|ACCN4_uc002vlz.2_Missense_Mutation_p.R446Q|ACCN4_uc002vmb.2_Missense_Mutation_p.R100Q	p.R446Q	NM_182847	NP_878267	WXS	Illumina HiSeq	Unspecified	Q96FT7	ACCN4_HUMAN		Epithelial(149;5.47e-10)|all cancers(144;9e-08)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.0086)|READ - Rectum adenocarcinoma(5;0.156)	4	1351	+		Renal(207;0.0183)	446			Extracellular (Potential).		Q53SB7|Q6GMS1|Q6PIN9|Q9NQA4	Missense_Mutation	SNP	ENST00000347842.3	37	c.1337G>A	CCDS2442.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.900701	0.92035	0.0	1.16E-4	ENSG00000072182	ENST00000347842;ENST00000358078	T;T	0.65178	-0.14;-0.14	4.1	4.1	0.47936	Na+ channel, amiloride-sensitive, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.73799	0.3633	L	0.60904	1.88	0.58432	D	0.999999	D;D	0.89917	1.0;0.993	D;P	0.70227	0.968;0.891	T	0.71234	-0.4653	10	0.27082	T	0.32	-16.0781	16.5064	0.84273	0.0:0.0:1.0:0.0	.	446;446	Q96FT7;Q96FT7-4	ACCN4_HUMAN;.	Q	446	ENSP00000326627:R446Q;ENSP00000350786:R446Q	ENSP00000326627:R446Q	R	+	2	0	ACCN4	220105381	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.501000	0.66950	2.305000	0.77605	0.561000	0.74099	CGG		0.677	ASIC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130263.1	NM_018674		15	24	0	0	0	0	15	24				
RBM44	375316	broad.mit.edu	37	2	238726938	238726938	+	Missense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr2:238726938G>A	ENST00000409864.1	+	3	1633	c.1379G>A	c.(1378-1380)aGt>aAt	p.S460N	RBM44_ENST00000444524.2_Intron|RBM44_ENST00000316997.4_Missense_Mutation_p.S460N			Q6ZP01	RBM44_HUMAN	RNA binding motif protein 44	459						cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)	nucleotide binding (GO:0000166)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)			breast(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(7)|ovary(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;3.74e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.3e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000118)|Lung(119;0.0112)|LUSC - Lung squamous cell carcinoma(224;0.0266)		GATGCAGCAAGTTGTACAGTC	0.398																																						uc002vxi.3		NA																	0				ovary(4)	4						c.(1378-1380)AGT>AAT		RNA binding motif protein 44							98.0	91.0	93.0					2																	238726938		1945	4134	6079	SO:0001583	missense	375316						nucleotide binding|RNA binding	g.chr2:238726938G>A	AK097730	CCDS46554.1	2q37.3	2013-02-12			ENSG00000177483	ENSG00000177483		"""RNA binding motif (RRM) containing"""	24756	protein-coding gene	gene with protein product							Standard	NM_001080504		Approved	FLJ40411	uc002vxi.4	Q6ZP01	OTTHUMG00000152937	ENST00000409864.1:c.1379G>A	2.37:g.238726938G>A	ENSP00000386727:p.Ser460Asn		Somatic					p.S460N	NM_001080504	NP_001073973	WXS	Illumina HiSeq	Unspecified	Q6ZP01	RBM44_HUMAN		Epithelial(121;3.74e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.3e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000118)|Lung(119;0.0112)|LUSC - Lung squamous cell carcinoma(224;0.0266)	3	1511	+		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)	459					A0AUW3	Missense_Mutation	SNP	ENST00000409864.1	37	c.1379G>A	CCDS46554.1	.	.	.	.	.	.	.	.	.	.	G	0.135	-1.109091	0.01813	.	.	ENSG00000177483	ENST00000316997;ENST00000409864	T;T	0.22743	1.94;1.94	5.68	-4.41	0.03590	.	1.840180	0.02081	N	0.052301	T	0.06690	0.0171	N	0.01576	-0.805	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.30909	-0.9962	10	0.10902	T	0.67	3.989	6.8301	0.23905	0.4759:0.2158:0.3083:0.0	.	459	Q6ZP01	RBM44_HUMAN	N	460	ENSP00000321179:S460N;ENSP00000386727:S460N	ENSP00000321179:S460N	S	+	2	0	RBM44	238391677	0.000000	0.05858	0.000000	0.03702	0.418000	0.31294	0.025000	0.13577	-0.479000	0.06813	-0.216000	0.12614	AGT		0.398	RBM44-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328733.2	NM_001080504		15	28	0	0	0	0	15	28				
SLC5A4	6527	broad.mit.edu	37	22	32625325	32625325	+	Missense_Mutation	SNP	C	C	T	rs142416109		TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr22:32625325C>T	ENST00000266086.4	-	11	1147	c.1136G>A	c.(1135-1137)cGa>cAa	p.R379Q	RP1-90G24.10_ENST00000434942.1_RNA	NM_014227.2	NP_055042.1	Q9NY91	SC5A4_HUMAN	solute carrier family 5 (glucose activated ion channel), member 4	379					carbohydrate transport (GO:0008643)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(15)|pancreas(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						CATCAGGCCTCGCAGTCCTGG	0.537													C|||	1	0.000199681	0.0	0.0	5008	,	,		19277	0.0		0.0	False		,,,				2504	0.001					uc003ami.2		NA																	0					0						c.(1135-1137)CGA>CAA		solute carrier family 5 (low affinity glucose		C	GLN/ARG	0,4406		0,0,2203	70.0	67.0	68.0		1136	4.7	1.0	22	dbSNP_134	68	1,8599		0,1,4299	no	missense	SLC5A4	NM_014227.2	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	379/660	32625325	1,13005	2203	4300	6503	SO:0001583	missense	6527				carbohydrate transport|sodium ion transport	integral to membrane	symporter activity	g.chr22:32625325C>T	U41897	CCDS13903.1	22q12.3	2013-07-19	2013-07-19		ENSG00000100191	ENSG00000100191		"""Solute carriers"""	11039	protein-coding gene	gene with protein product			"""solute carrier family 5 (low affinity glucose cotransporter), member 4"""			9501190, 12354616	Standard	NM_014227		Approved	SAAT1, SGLT3, DJ90G24.4	uc003ami.3	Q9NY91	OTTHUMG00000150007	ENST00000266086.4:c.1136G>A	22.37:g.32625325C>T	ENSP00000266086:p.Arg379Gln		Somatic					p.R379Q	NM_014227	NP_055042	WXS	Illumina HiSeq	Unspecified	Q9NY91	SC5A4_HUMAN			11	1138	-			379			Extracellular (Potential).		O15279	Missense_Mutation	SNP	ENST00000266086.4	37	c.1136G>A	CCDS13903.1	.	.	.	.	.	.	.	.	.	.	.	17.89	3.498562	0.64298	0.0	1.16E-4	ENSG00000100191	ENST00000266086	D	0.88741	-2.42	4.65	4.65	0.58169	.	0.000000	0.85682	D	0.000000	D	0.92708	0.7682	M	0.88031	2.925	0.80722	D	1	B	0.31193	0.312	B	0.42188	0.379	D	0.93341	0.6710	10	0.72032	D	0.01	.	15.39	0.74735	0.0:1.0:0.0:0.0	.	379	Q9NY91	SC5A4_HUMAN	Q	379	ENSP00000266086:R379Q	ENSP00000266086:R379Q	R	-	2	0	SLC5A4	30955325	1.000000	0.71417	1.000000	0.80357	0.031000	0.12232	5.845000	0.69437	2.574000	0.86865	0.655000	0.94253	CGA		0.537	SLC5A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315724.1	NM_014227		5	36	0	0	0	0	5	36				
APOL2	23780	broad.mit.edu	37	22	36623928	36623928	+	Missense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr22:36623928G>A	ENST00000249066.6	-	6	1012	c.536C>T	c.(535-537)gCc>gTc	p.A179V	APOL2_ENST00000358502.5_Missense_Mutation_p.A179V|APOL2_ENST00000451256.2_Missense_Mutation_p.A291V	NM_145637.1	NP_663612.1	Q9BQE5	APOL2_HUMAN	apolipoprotein L, 2	179					acute-phase response (GO:0006953)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|maternal process involved in female pregnancy (GO:0060135)|multicellular organismal development (GO:0007275)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|membrane (GO:0016020)	high-density lipoprotein particle binding (GO:0008035)|lipid binding (GO:0008289)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)|skin(1)|urinary_tract(2)	9						GCGGGCTTGGGCTCGTGCCCG	0.517																																						uc003aoz.2		NA																	0					0						c.(535-537)GCC>GTC		apolipoprotein L2							68.0	71.0	70.0					22																	36623928		2079	4225	6304	SO:0001583	missense	23780				acute-phase response|cholesterol metabolic process|lipid transport|lipoprotein metabolic process|maternal process involved in female pregnancy|multicellular organismal development	endoplasmic reticulum membrane|extracellular region	high-density lipoprotein particle binding|lipid binding|receptor binding	g.chr22:36623928G>A	AF324224	CCDS43014.1	22q12.3	2013-09-20			ENSG00000128335	ENSG00000128335		"""Apolipoproteins"""	619	protein-coding gene	gene with protein product	"""apolipoprotein L-II"""	607252				10591208, 11374903	Standard	NM_145637		Approved	APOL-II	uc003apa.3	Q9BQE5	OTTHUMG00000150634	ENST00000249066.6:c.536C>T	22.37:g.36623928G>A	ENSP00000249066:p.Ala179Val		Somatic				APOL2_uc011amm.1_Missense_Mutation_p.A291V|APOL2_uc003apa.2_Missense_Mutation_p.A179V	p.A179V	NM_030882	NP_112092	WXS	Illumina HiSeq	Unspecified	Q9BQE5	APOL2_HUMAN			5	872	-			179					B0QYK7|O95915|Q59GW9|Q5TH96|Q969T6|Q9BT28|Q9UGT1|Q9UH10	Missense_Mutation	SNP	ENST00000249066.6	37	c.536C>T	CCDS43014.1	.	.	.	.	.	.	.	.	.	.	G	10.23	1.293425	0.23564	.	.	ENSG00000128335	ENST00000358502;ENST00000249066;ENST00000451256	T;T;T	0.03717	3.83;3.83;3.83	3.66	-1.85	0.07784	.	1.101390	0.06762	N	0.782055	T	0.07638	0.0192	M	0.72118	2.19	0.09310	N	1	B;B	0.34181	0.44;0.44	B;B	0.38378	0.272;0.272	T	0.41520	-0.9504	10	0.40728	T	0.16	.	11.3625	0.49651	0.0:0.0:0.4273:0.5726	.	291;179	B4E1T5;Q9BQE5	.;APOL2_HUMAN	V	179;179;291	ENSP00000351292:A179V;ENSP00000249066:A179V;ENSP00000403153:A291V	ENSP00000249066:A179V	A	-	2	0	APOL2	34953874	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.563000	0.05943	-0.269000	0.09298	-2.062000	0.00397	GCC		0.517	APOL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000319279.1	NM_145637		16	37	0	0	0	0	16	37				
EP300	2033	broad.mit.edu	37	22	41564866	41564866	+	Missense_Mutation	SNP	C	C	G			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr22:41564866C>G	ENST00000263253.7	+	25	5386	c.4167C>G	c.(4165-4167)aaC>aaG	p.N1389K	RNU6-375P_ENST00000517050.1_RNA|RP1-85F18.6_ENST00000415054.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	1389	CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.				apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						CTCCACCCAACCAGAGGTATG	0.458			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																													uc003azl.3		NA		Rec	yes		22	22q13	2033	T| N|F|Mis|O	300 kd E1A-Binding protein gene			"""L, E"""	MLL|RUNXBP2		colorectal|breast|pancreatic|AML|ALL|DLBCL		0				haematopoietic_and_lymphoid_tissue(22)|large_intestine(13)|breast(9)|central_nervous_system(5)|upper_aerodigestive_tract(4)|pancreas(4)|lung(3)|ovary(2)|stomach(1)|skin(1)	64						c.(4165-4167)AAC>AAG		E1A binding protein p300							158.0	141.0	147.0					22																	41564866		2203	4300	6503	SO:0001583	missense	2033	Rubinstein-Taybi_syndrome	Familial Cancer Database	Broad Thumb-Hallux syndrome	apoptosis|cell cycle|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|histone H4 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of androgen receptor signaling pathway|response to estrogen stimulus|response to hypoxia	centrosome|histone acetyltransferase complex	androgen receptor binding|beta-catenin binding|DNA binding|histone acetyltransferase activity|RNA polymerase II activating transcription factor binding|transcription coactivator activity|zinc ion binding	g.chr22:41564866C>G	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.4167C>G	22.37:g.41564866C>G	ENSP00000263253:p.Asn1389Lys		Somatic					p.N1389K	NM_001429	NP_001420	WXS	Illumina HiSeq	Unspecified	Q09472	EP300_HUMAN			25	4562	+			1389					B1AKC2	Missense_Mutation	SNP	ENST00000263253.7	37	c.4167C>G	CCDS14010.1	.	.	.	.	.	.	.	.	.	.	C	16.87	3.242028	0.58995	.	.	ENSG00000100393	ENST00000263253	D	0.93811	-3.29	5.95	3.74	0.42951	.	0.000000	0.51477	D	0.000082	D	0.96562	0.8878	M	0.91354	3.2	0.40425	D	0.979884	D	0.89917	1.0	D	0.87578	0.998	D	0.95369	0.8462	10	0.87932	D	0	-10.6349	6.266	0.20928	0.0:0.4341:0.0:0.5659	.	1389	Q09472	EP300_HUMAN	K	1389	ENSP00000263253:N1389K	ENSP00000263253:N1389K	N	+	3	2	EP300	39894812	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.689000	0.37700	0.666000	0.31087	0.563000	0.77884	AAC		0.458	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1	NM_001429		5	80	0	0	0	0	5	80				
MTMR14	64419	broad.mit.edu	37	3	9691417	9691417	+	Silent	SNP	C	C	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr3:9691417C>A	ENST00000296003.4	+	1	272	c.150C>A	c.(148-150)ggC>ggA	p.G50G	MTMR14_ENST00000420925.1_Silent_p.G50G|MTMR14_ENST00000353332.5_Silent_p.G50G|MTMR14_ENST00000351233.5_Silent_p.G50G	NM_001077525.2	NP_001070993.1	Q8NCE2	MTMRE_HUMAN	myotubularin related protein 14	50					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(2)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	21	Medulloblastoma(99;0.227)					GCGGGACCGGCGGCTCTAAGG	0.612																																						uc003brz.2		NA																	0				skin(1)	1						c.(148-150)GGC>GGA		jumpy isoform 2							13.0	16.0	15.0					3																	9691417		1950	4137	6087	SO:0001819	synonymous_variant	64419					perinuclear region of cytoplasm|ruffle	phosphatidylinositol-3-phosphatase activity|protein tyrosine phosphatase activity	g.chr3:9691417C>A	BC001674	CCDS43043.1, CCDS43044.1, CCDS43045.1	3p26	2011-06-09	2006-12-18	2006-12-18	ENSG00000163719	ENSG00000163719		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	26190	protein-coding gene	gene with protein product	"""egg-derived tyrosine phosphatase homolog (Drosophila)"""	611089	"""chromosome 3 open reading frame 29"""	C3orf29		15186772	Standard	NM_022485		Approved	FLJ22405, FLJ90311, hJumpy, hEDTP	uc003brz.3	Q8NCE2	OTTHUMG00000155111	ENST00000296003.4:c.150C>A	3.37:g.9691417C>A			Somatic				MTMR14_uc003bsa.2_Silent_p.G50G|MTMR14_uc003bsb.2_Silent_p.G50G|MTMR14_uc011ath.1_RNA|MTMR14_uc010hcl.2_Silent_p.G50G	p.G50G	NM_001077525	NP_001070993	WXS	Illumina HiSeq	Unspecified	Q8NCE2	MTMRE_HUMAN			1	274	+	Medulloblastoma(99;0.227)		50					Q0JTH5|Q0JU83|Q6PIZ4|Q6QE21|Q86VK9|Q8IYK1|Q8TCM7|Q9H6C0	Silent	SNP	ENST00000296003.4	37	c.150C>A	CCDS43043.1																																																																																				0.612	MTMR14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338435.1	NM_022485		7	13	1	0	5.18e-06	5.62e-06	7	13				
PLCL2	23228	broad.mit.edu	37	3	17056295	17056295	+	Silent	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr3:17056295C>T	ENST00000418129.2	+	3	2997	c.2532C>T	c.(2530-2532)ccC>ccT	p.P844P	PLCL2_ENST00000396755.2_Silent_p.P844P|PLCL2_ENST00000432376.1_Silent_p.P844P	NM_001144382.1	NP_001137854.1	Q9UPR0	PLCL2_HUMAN	phospholipase C-like 2	970	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				B cell proliferation involved in immune response (GO:0002322)|B-1a B cell differentiation (GO:0002337)|gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|negative regulation of B cell receptor signaling pathway (GO:0050859)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GABA receptor binding (GO:0050811)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	43						TTCTGGGGCCCGATAACACAC	0.542																																						uc011awc.1		NA																	0				skin(2)|ovary(1)|lung(1)	4						c.(2884-2886)CCC>CCT		phospholipase C-like 2 isoform 1							167.0	167.0	167.0					3																	17056295		2203	4300	6503	SO:0001819	synonymous_variant	23228				intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity	g.chr3:17056295C>T	AB029015	CCDS33713.1, CCDS74911.1	3p25.3-p25.1	2008-03-18	2002-02-18	2002-02-22	ENSG00000154822	ENSG00000154822			9064	protein-coding gene	gene with protein product		614276	"""phospholipase C, epsilon 2"""	PLCE2		10470851	Standard	NM_015184		Approved	KIAA1092	uc011awd.2	Q9UPR0	OTTHUMG00000155467	ENST00000418129.2:c.2532C>T	3.37:g.17056295C>T			Somatic				PLCL2_uc011awd.1_Silent_p.P844P	p.P962P	NM_001144382	NP_001137854	WXS	Illumina HiSeq	Unspecified	Q9UPR0	PLCL2_HUMAN			6	2991	+			970					A8K5V4|Q8N498|Q9H8L0|Q9UFP9	Silent	SNP	ENST00000418129.2	37	c.2886C>T	CCDS33713.1	.	.	.	.	.	.	.	.	.	.	C	8.257	0.810320	0.16537	.	.	ENSG00000154822	ENST00000419842	T	0.21734	1.99	5.16	-6.31	0.02001	.	0.164644	0.53938	D	0.000041	T	0.18841	0.0452	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.09250	-1.0683	7	0.31617	T	0.26	.	8.1806	0.31309	0.0:0.3664:0.1055:0.5281	.	.	.	.	L	588	ENSP00000404433:P588L	ENSP00000404433:P588L	P	+	2	0	PLCL2	17031299	0.000000	0.05858	0.638000	0.29380	0.860000	0.49131	-1.899000	0.01600	-1.378000	0.02120	-2.035000	0.00420	CCG		0.542	PLCL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340250.3			43	115	0	0	0	0	43	115				
TBC1D5	9779	broad.mit.edu	37	3	17226630	17226630	+	Missense_Mutation	SNP	T	T	C			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr3:17226630T>C	ENST00000253692.7	-	19	3487	c.1823A>G	c.(1822-1824)tAc>tGc	p.Y608C	TBC1D5_ENST00000414318.2_5'UTR|TBC1D5_ENST00000429924.2_Missense_Mutation_p.Y582C|TBC1D5_ENST00000446818.2_Missense_Mutation_p.Y630C|TBC1D5_ENST00000429383.4_Missense_Mutation_p.Y608C	NM_014744.2	NP_055559.1	Q92609	TBCD5_HUMAN	TBC1 domain family, member 5	608						retromer complex (GO:0030904)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	36						CTTTGCACAGTATTTGCACAT	0.398																																						uc003cbf.2		NA																	0				ovary(1)	1						c.(1822-1824)TAC>TGC		TBC1 domain family, member 5 isoform b							157.0	132.0	140.0					3																	17226630		2203	4300	6503	SO:0001583	missense	9779					intracellular	protein binding|Rab GTPase activator activity	g.chr3:17226630T>C	D86965	CCDS33714.1, CCDS46770.1	3p24.3	2013-07-09			ENSG00000131374	ENSG00000131374			19166	protein-coding gene	gene with protein product		615740				19531583	Standard	NM_014744		Approved	KIAA0210	uc003cbe.3	Q92609	OTTHUMG00000155488	ENST00000253692.7:c.1823A>G	3.37:g.17226630T>C	ENSP00000253692:p.Tyr608Cys		Somatic				TBC1D5_uc010heu.2_Missense_Mutation_p.Y195C|TBC1D5_uc010hev.2_Missense_Mutation_p.Y630C|TBC1D5_uc003cbe.2_Missense_Mutation_p.Y608C|TBC1D5_uc010hew.1_Missense_Mutation_p.Y582C	p.Y608C	NM_014744	NP_055559	WXS	Illumina HiSeq	Unspecified	Q92609	TBCD5_HUMAN			19	3488	-			608					A6NP25|C9JP52	Missense_Mutation	SNP	ENST00000253692.7	37	c.1823A>G	CCDS33714.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.446376	0.84101	.	.	ENSG00000131374	ENST00000253692;ENST00000429383;ENST00000446818;ENST00000429924	T;T;T;T	0.69040	1.31;1.31;1.31;-0.37	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.73313	0.3571	L	0.29908	0.895	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.999;0.999;0.999	T	0.74714	-0.3572	10	0.49607	T	0.09	-17.1445	15.2526	0.73559	0.0:0.0:0.0:1.0	.	582;630;608;608	C9J3F6;C9JP52;B9A6K1;Q92609	.;.;.;TBCD5_HUMAN	C	608;608;630;582	ENSP00000253692:Y608C;ENSP00000398127:Y608C;ENSP00000402935:Y630C;ENSP00000411925:Y582C	ENSP00000253692:Y608C	Y	-	2	0	TBC1D5	17201634	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.193000	0.77780	2.248000	0.74166	0.533000	0.62120	TAC		0.398	TBC1D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340301.3	NM_014744		18	50	0	0	0	0	18	50				
ZCWPW2	152098	broad.mit.edu	37	3	28557085	28557085	+	Missense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr3:28557085G>A	ENST00000383768.2	+	8	945	c.757G>A	c.(757-759)Gat>Aat	p.D253N	ZCWPW2_ENST00000421010.1_Missense_Mutation_p.D253N			Q504Y3	ZCPW2_HUMAN	zinc finger, CW type with PWWP domain 2	253							zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(6)|ovary(2)	17						TGTTTATTCTGATGATGCCTT	0.308																																						uc003ceh.2		NA																	0				ovary(2)	2						c.(757-759)GAT>AAT		zinc finger, CW type with PWWP domain 2							47.0	49.0	49.0					3																	28557085		2202	4296	6498	SO:0001583	missense	152098						zinc ion binding	g.chr3:28557085G>A	BC065764	CCDS33723.1	3p23	2005-08-22			ENSG00000206559	ENSG00000206559			23574	protein-coding gene	gene with protein product						14607086	Standard	XM_005264892		Approved	ZCW2	uc003cei.3	Q504Y3	OTTHUMG00000155705	ENST00000383768.2:c.757G>A	3.37:g.28557085G>A	ENSP00000373278:p.Asp253Asn		Somatic				ZCWPW2_uc003cei.2_Missense_Mutation_p.D253N|ZCWPW2_uc010hfo.2_Missense_Mutation_p.D58N	p.D253N	NM_001040432	NP_001035522	WXS	Illumina HiSeq	Unspecified	Q504Y3	ZCPW2_HUMAN			8	925	+			253						Missense_Mutation	SNP	ENST00000383768.2	37	c.757G>A	CCDS33723.1	.	.	.	.	.	.	.	.	.	.	G	10.60	1.396048	0.25205	.	.	ENSG00000206559	ENST00000383768;ENST00000421010	T;T	0.52057	0.68;0.68	5.61	4.74	0.60224	.	0.349377	0.24657	N	0.036679	T	0.33206	0.0855	N	0.20986	0.625	0.29916	N	0.823165	B	0.13145	0.007	B	0.15052	0.012	T	0.24512	-1.0158	10	0.39692	T	0.17	-25.3906	10.6881	0.45854	0.088:0.0:0.912:0.0	.	253	Q504Y3	ZCPW2_HUMAN	N	253	ENSP00000373278:D253N;ENSP00000412386:D253N	ENSP00000373278:D253N	D	+	1	0	ZCWPW2	28532089	1.000000	0.71417	0.992000	0.48379	0.106000	0.19336	2.493000	0.45320	1.391000	0.46566	-0.143000	0.13931	GAT		0.308	ZCWPW2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341318.1	XM_087384		7	20	0	0	0	0	7	20				
SETD2	29072	broad.mit.edu	37	3	47147603	47147603	+	Missense_Mutation	SNP	A	A	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr3:47147603A>T	ENST00000409792.3	-	6	4765	c.4723T>A	c.(4723-4725)Ttt>Att	p.F1575I		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1575	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TCTAGGACAAAGGTGTTCCTG	0.363			"""N, F, S, Mis"""		clear cell renal carcinoma																																	uc003cqs.2		NA		Rec	yes		3	3p21.31	29072	N|F|S|Mis	SET domain containing 2			E			clear cell renal carcinoma		0				kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32						c.(4723-4725)TTT>ATT		SET domain containing 2							72.0	67.0	68.0					3																	47147603		2203	4300	6503	SO:0001583	missense	29072				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding	g.chr3:47147603A>T	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.4723T>A	3.37:g.47147603A>T	ENSP00000386759:p.Phe1575Ile		Somatic				SETD2_uc003cqv.2_Missense_Mutation_p.F1564I	p.F1575I	NM_014159	NP_054878	WXS	Illumina HiSeq	Unspecified	Q9BYW2	SETD2_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)	6	4776	-		Acute lymphoblastic leukemia(5;0.0169)	1575			SET.		O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	37	c.4723T>A	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	A	31	5.069742	0.93950	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792	D	0.84070	-1.8	5.43	5.43	0.79202	SET domain (3);	0.000000	0.56097	D	0.000040	D	0.92583	0.7644	M	0.89601	3.045	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.996;0.999	D	0.94059	0.7325	10	0.87932	D	0	.	15.7723	0.78180	1.0:0.0:0.0:0.0	.	1575;1575	F2Z317;Q9BYW2	.;SETD2_HUMAN	I	1575	ENSP00000386759:F1575I	ENSP00000386759:F1575I	F	-	1	0	SETD2	47122607	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	8.840000	0.92125	2.195000	0.70347	0.528000	0.53228	TTT		0.363	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159		10	26	0	0	0	0	10	26				
PLXNB1	5364	broad.mit.edu	37	3	48460693	48460693	+	Missense_Mutation	SNP	C	C	G			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr3:48460693C>G	ENST00000358536.4	-	12	3061	c.2792G>C	c.(2791-2793)cGg>cCg	p.R931P	PLXNB1_ENST00000448774.2_Intron|PLXNB1_ENST00000456774.1_Missense_Mutation_p.R748P|PLXNB1_ENST00000296440.6_Missense_Mutation_p.R931P|PLXNB1_ENST00000358459.4_Missense_Mutation_p.R748P	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1	931					axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CCGGATTTCCCGCTCCACATG	0.612																																						uc003csw.2		NA																	0				ovary(2)|pancreas(1)|breast(1)|skin(1)	5						c.(2791-2793)CGG>CCG		plexin B1 precursor							35.0	32.0	33.0					3																	48460693		2203	4300	6503	SO:0001583	missense	5364				axon guidance|cell migration|intracellular signal transduction|regulation of cell shape|regulation of cytoskeleton organization|regulation of small GTPase mediated signal transduction|semaphorin-plexin signaling pathway	extracellular region|integral to plasma membrane|intracellular|semaphorin receptor complex	GTPase activator activity|semaphorin receptor activity|semaphorin receptor binding	g.chr3:48460693C>G	X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.2792G>C	3.37:g.48460693C>G	ENSP00000351338:p.Arg931Pro		Somatic				PLXNB1_uc003csu.2_Missense_Mutation_p.R748P|PLXNB1_uc003csx.2_Missense_Mutation_p.R931P|PLXNB1_uc010hjx.1_RNA|PLXNB1_uc003csy.1_5'Flank	p.R931P	NM_002673	NP_002664	WXS	Illumina HiSeq	Unspecified	O43157	PLXB1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)	12	3062	-			931			Extracellular (Potential).		A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Missense_Mutation	SNP	ENST00000358536.4	37	c.2792G>C	CCDS2765.1	.	.	.	.	.	.	.	.	.	.	C	15.66	2.899470	0.52227	.	.	ENSG00000164050	ENST00000296440;ENST00000358459;ENST00000358536;ENST00000456774	T;T;T;T	0.03607	3.87;3.91;3.87;3.91	4.5	2.67	0.31697	.	0.242138	0.27080	N	0.021037	T	0.10035	0.0246	L	0.41492	1.28	0.80722	D	1	D;B	0.89917	1.0;0.196	D;B	0.91635	0.999;0.106	T	0.03981	-1.0987	10	0.62326	D	0.03	.	9.8204	0.40878	0.0:0.8282:0.0:0.1718	.	931;748	O43157;O43157-2	PLXB1_HUMAN;.	P	931;748;931;748	ENSP00000296440:R931P;ENSP00000351242:R748P;ENSP00000351338:R931P;ENSP00000414199:R748P	ENSP00000296440:R931P	R	-	2	0	PLXNB1	48435697	0.664000	0.27457	0.651000	0.29564	0.934000	0.57294	1.497000	0.35649	0.880000	0.35969	0.313000	0.20887	CGG		0.612	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344454.1	NM_002673		9	12	0	0	0	0	9	12				
CADM2	253559	broad.mit.edu	37	3	85932554	85932554	+	Missense_Mutation	SNP	A	A	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr3:85932554A>T	ENST00000407528.2	+	3	387	c.325A>T	c.(325-327)Atg>Ttg	p.M109L	CADM2_ENST00000383699.3_Missense_Mutation_p.M118L|CADM2_ENST00000405615.2_Missense_Mutation_p.M111L	NM_001167674.1	NP_001161146.1	Q8N3J6	CADM2_HUMAN	cell adhesion molecule 2	109	Ig-like V-type.				adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|synapse (GO:0045202)				endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(1)|prostate(1)|skin(4)	38		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		TTTATTTACAATGCCTGTCAA	0.428																																						uc003dqj.2		NA																	0				ovary(1)|lung(1)|kidney(1)|skin(1)	4						c.(325-327)ATG>TTG		immunoglobulin superfamily, member 4D							105.0	87.0	93.0					3																	85932554		2203	4300	6503	SO:0001583	missense	253559				adherens junction organization|cell junction assembly	integral to membrane|plasma membrane		g.chr3:85932554A>T	AF538973	CCDS33792.1, CCDS54613.1, CCDS54614.1	3p12.2	2013-01-11	2007-02-07	2007-02-07	ENSG00000175161	ENSG00000175161		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	29849	protein-coding gene	gene with protein product	"""nectin-like 3"""	609938	"""immunoglobulin superfamily, member 4D"""	IGSF4D			Standard	NM_153184		Approved	NECL3, Necl-3, SynCAM2	uc003dqj.3	Q8N3J6	OTTHUMG00000158990	ENST00000407528.2:c.325A>T	3.37:g.85932554A>T	ENSP00000384575:p.Met109Leu		Somatic				CADM2_uc003dqk.2_Missense_Mutation_p.M118L|CADM2_uc003dql.2_Missense_Mutation_p.M111L	p.M109L	NM_153184	NP_694854	WXS	Illumina HiSeq	Unspecified	Q8N3J6	CADM2_HUMAN		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)	3	951	+		Lung NSC(201;0.0148)	109			Ig-like V-type.|Extracellular (Potential).		G3XHN7|G3XHN8|Q3KQY9|Q658Q7|Q8IZP8	Missense_Mutation	SNP	ENST00000407528.2	37	c.325A>T	CCDS54614.1	.	.	.	.	.	.	.	.	.	.	A	14.94	2.684036	0.47991	.	.	ENSG00000175161	ENST00000383699;ENST00000407528;ENST00000405615	T;T;T	0.64803	-0.12;-0.12;-0.12	5.54	4.39	0.52855	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.035192	0.85682	N	0.000000	T	0.71082	0.3298	L	0.50333	1.59	0.51767	D	0.999936	P;P;P	0.52692	0.955;0.488;0.544	D;P;P	0.70227	0.968;0.588;0.711	T	0.67300	-0.5705	10	0.30078	T	0.28	.	11.6336	0.51189	0.9302:0.0:0.0698:0.0	.	111;118;109	Q8N3J6-3;G3XHN4;Q8N3J6	.;.;CADM2_HUMAN	L	118;109;111	ENSP00000373200:M118L;ENSP00000384575:M109L;ENSP00000384193:M111L	ENSP00000373200:M118L	M	+	1	0	CADM2	86015244	1.000000	0.71417	0.998000	0.56505	0.008000	0.06430	8.910000	0.92685	1.040000	0.40099	-0.263000	0.10527	ATG		0.428	CADM2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352822.1	NM_153184		13	22	0	0	0	0	13	22				
EPHA3	2042	broad.mit.edu	37	3	89468369	89468369	+	Missense_Mutation	SNP	G	G	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr3:89468369G>T	ENST00000336596.2	+	11	2128	c.1903G>T	c.(1903-1905)Gtg>Ttg	p.V635L	EPHA3_ENST00000494014.1_Missense_Mutation_p.V635L	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	635	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		ATTTGGAGAGGTGTGCAGTGG	0.363										TSP Lung(6;0.00050)																												uc003dqy.2		NA																	0				lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33						c.(1903-1905)GTG>TTG		ephrin receptor EphA3 isoform a precursor							86.0	90.0	88.0					3																	89468369		2203	4296	6499	SO:0001583	missense	2042					extracellular region|integral to plasma membrane	ATP binding	g.chr3:89468369G>T	M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.1903G>T	3.37:g.89468369G>T	ENSP00000337451:p.Val635Leu	TSP Lung(6;0.00050)	Somatic				EPHA3_uc010hon.1_RNA	p.V635L	NM_005233	NP_005224	WXS	Illumina HiSeq	Unspecified	P29320	EPHA3_HUMAN		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)	11	2128	+	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)	635			Cytoplasmic (Potential).|Protein kinase.|ATP (By similarity).		Q9H2V3|Q9H2V4	Missense_Mutation	SNP	ENST00000336596.2	37	c.1903G>T	CCDS2922.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.049488	0.93740	.	.	ENSG00000044524	ENST00000336596;ENST00000494014	D;D	0.82344	-1.6;-1.6	5.8	5.8	0.92144	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.93501	0.7926	M	0.92784	3.345	0.80722	D	1	D	0.53745	0.962	D	0.68765	0.96	D	0.94048	0.7315	9	.	.	.	.	20.062	0.97678	0.0:0.0:1.0:0.0	.	635	P29320	EPHA3_HUMAN	L	635	ENSP00000337451:V635L;ENSP00000419190:V635L	.	V	+	1	0	EPHA3	89551059	1.000000	0.71417	0.939000	0.37840	0.990000	0.78478	9.869000	0.99810	2.730000	0.93505	0.563000	0.77884	GTG		0.363	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233		25	41	1	0	7.93e-12	9.01e-12	25	41				
NXPE3	91775	broad.mit.edu	37	3	101520161	101520161	+	Missense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr3:101520161G>A	ENST00000491511.2	+	5	1132	c.176G>A	c.(175-177)cGa>cAa	p.R59Q	NXPE3_ENST00000273347.5_Missense_Mutation_p.R59Q|NXPE3_ENST00000422132.1_Missense_Mutation_p.R59Q|NXPE3_ENST00000477909.1_Missense_Mutation_p.R59Q	NM_001134456.1	NP_001127928.1	Q969Y0	NXPE3_HUMAN	neurexophilin and PC-esterase domain family, member 3	59						extracellular region (GO:0005576)											GGAATTAGCCGAAATCCCTAC	0.532																																						uc003dvn.2		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(175-177)CGA>CAA		hypothetical protein LOC91775 precursor							131.0	127.0	129.0					3																	101520161		2203	4300	6503	SO:0001583	missense	91775					extracellular region		g.chr3:101520161G>A	AK054664	CCDS2945.1	3q12.3	2012-06-14	2012-06-11	2012-06-11	ENSG00000144815	ENSG00000144815			28238	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member C"""	FAM55C		12975309	Standard	NM_001134456		Approved	MGC15606	uc003dvn.3	Q969Y0	OTTHUMG00000159179	ENST00000491511.2:c.176G>A	3.37:g.101520161G>A	ENSP00000417485:p.Arg59Gln		Somatic				FAM55C_uc010hpn.2_Missense_Mutation_p.R59Q	p.R59Q	NM_145037	NP_659474	WXS	Illumina HiSeq	Unspecified	Q969Y0	FA55C_HUMAN			5	813	+			59					A8K0X4|D3DN53|Q7Z2S8	Missense_Mutation	SNP	ENST00000491511.2	37	c.176G>A	CCDS2945.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.723954	0.89298	.	.	ENSG00000144815	ENST00000273347;ENST00000491511;ENST00000477909;ENST00000422132	T;T;T;T	0.12774	2.65;2.65;2.65;2.65	5.67	5.67	0.87782	.	0.168092	0.51477	D	0.000087	T	0.18676	0.0448	L	0.27053	0.805	0.37114	D	0.900506	D	0.71674	0.998	P	0.54346	0.749	T	0.04976	-1.0914	10	0.10377	T	0.69	-18.4506	20.1421	0.98061	0.0:0.0:1.0:0.0	.	59	Q969Y0	FA55C_HUMAN	Q	59	ENSP00000273347:R59Q;ENSP00000417485:R59Q;ENSP00000418369:R59Q;ENSP00000396421:R59Q	ENSP00000273347:R59Q	R	+	2	0	FAM55C	103002851	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.272000	0.65559	2.836000	0.97738	0.655000	0.94253	CGA		0.532	NXPE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353711.2	NM_145037		6	127	0	0	0	0	6	127				
ADCY5	111	broad.mit.edu	37	3	123046600	123046600	+	Missense_Mutation	SNP	G	G	C			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr3:123046600G>C	ENST00000462833.1	-	7	3024	c.1812C>G	c.(1810-1812)atC>atG	p.I604M	ADCY5_ENST00000491190.1_Missense_Mutation_p.I237M|ADCY5_ENST00000309879.5_Missense_Mutation_p.I254M	NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	604					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		TGGTGATGTGGATGCGTCTAC	0.552																																						uc003egh.1		NA																	0				ovary(4)	4						c.(1810-1812)ATC>ATG		adenylate cyclase 5							75.0	61.0	66.0					3																	123046600		2203	4300	6503	SO:0001583	missense	111				activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding	g.chr3:123046600G>C	U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.1812C>G	3.37:g.123046600G>C	ENSP00000419361:p.Ile604Met		Somatic				ADCY5_uc003egg.1_Missense_Mutation_p.I237M|ADCY5_uc003egi.1_Missense_Mutation_p.I163M	p.I604M	NM_183357	NP_899200	WXS	Illumina HiSeq	Unspecified	O95622	ADCY5_HUMAN		GBM - Glioblastoma multiforme(114;0.0342)	7	1812	-			604			Cytoplasmic (Potential).		B7Z8A6|Q7RTV7|Q8NFM3	Missense_Mutation	SNP	ENST00000462833.1	37	c.1812C>G	CCDS3022.1	.	.	.	.	.	.	.	.	.	.	G	18.88	3.717019	0.68844	.	.	ENSG00000173175	ENST00000462833;ENST00000491190;ENST00000309879;ENST00000466617	D;D;D;D	0.86297	-2.1;-2.1;-2.1;-2.1	5.52	4.64	0.57946	Adenylyl cyclase class-3/4/guanylyl cyclase (4);	0.000000	0.64402	D	0.000001	D	0.95162	0.8432	H	0.95437	3.67	0.58432	D	0.99999	D;D	0.89917	1.0;0.996	D;D	0.80764	0.994;0.989	D	0.96105	0.9072	10	0.87932	D	0	.	13.5601	0.61784	0.0:0.0:0.7173:0.2827	.	604;237	O95622;B3KWA8	ADCY5_HUMAN;.	M	604;237;254;163	ENSP00000419361:I604M;ENSP00000418537:I237M;ENSP00000308685:I254M;ENSP00000420082:I163M	ENSP00000308685:I254M	I	-	3	3	ADCY5	124529290	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	2.661000	0.46758	1.308000	0.44962	0.655000	0.94253	ATC		0.552	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355889.4	XM_171048		3	25	0	0	0	0	3	25				
GHSR	2693	broad.mit.edu	37	3	172165820	172165820	+	Silent	SNP	G	G	A	rs200490484		TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr3:172165820G>A	ENST00000241256.2	-	1	426	c.384C>T	c.(382-384)taC>taT	p.Y128Y	GHSR_ENST00000427970.1_Silent_p.Y128Y	NM_198407.2	NP_940799.1	Q92847	GHSR_HUMAN	growth hormone secretagogue receptor	128					actin polymerization or depolymerization (GO:0008154)|adult feeding behavior (GO:0008343)|cellular response to insulin stimulus (GO:0032869)|decidualization (GO:0046697)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone secretion (GO:0030252)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin secretion (GO:0046676)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of appetite (GO:0032100)|positive regulation of fatty acid metabolic process (GO:0045923)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of multicellular organism growth (GO:0040018)|regulation of hindgut contraction (GO:0043134)|regulation of synapse assembly (GO:0051963)|response to food (GO:0032094)|response to hormone (GO:0009725)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|growth hormone secretagogue receptor activity (GO:0001616)|growth hormone-releasing hormone receptor activity (GO:0016520)|peptide hormone binding (GO:0017046)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	33	Ovarian(172;0.00143)|Breast(254;0.197)		Lung(28;3.93e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			GCACCGTGGCGTAGGTGCAGC	0.632																																					Esophageal Squamous(93;641 1401 20883 29581 34638)	uc003fib.1		NA																	0				lung(3)|ovary(1)|central_nervous_system(1)	5						c.(382-384)TAC>TAT		growth hormone secretagogue receptor isoform 1a							67.0	61.0	63.0					3																	172165820		2203	4300	6503	SO:0001819	synonymous_variant	2693				actin polymerization or depolymerization|adult feeding behavior|decidualization|growth hormone secretion|hormone-mediated signaling pathway|negative regulation of inflammatory response|negative regulation of interleukin-1 beta production|negative regulation of interleukin-6 biosynthetic process|negative regulation of tumor necrosis factor biosynthetic process|positive regulation of appetite|positive regulation of multicellular organism growth	cell surface|integral to membrane|membrane raft|neuron projection|plasma membrane	growth hormone secretagogue receptor activity|growth hormone-releasing hormone receptor activity	g.chr3:172165820G>A	AY429112	CCDS3218.1, CCDS46959.1	3q26.31	2012-08-08			ENSG00000121853	ENSG00000121853		"""GPCR / Class A : Ghrelin receptors"""	4267	protein-coding gene	gene with protein product		601898				8688086	Standard	NM_198407		Approved		uc003fib.2	Q92847	OTTHUMG00000156946	ENST00000241256.2:c.384C>T	3.37:g.172165820G>A			Somatic				GHSR_uc011bpv.1_Silent_p.Y128Y	p.Y128Y	NM_198407	NP_940799	WXS	Illumina HiSeq	Unspecified	Q92847	GHSR_HUMAN	Lung(28;3.93e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)		1	384	-	Ovarian(172;0.00143)|Breast(254;0.197)		128			Helical; Name=3; (Potential).		Q14D12|Q6ISR8|Q92848|Q96RJ7	Silent	SNP	ENST00000241256.2	37	c.384C>T	CCDS3218.1																																																																																				0.632	GHSR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346728.1	NM_004122		8	19	0	0	0	0	8	19				
PIK3CA	5290	broad.mit.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	uc003fjk.2	H1047R(BT20_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(MCAS_OVARY)|H1047R(HCC1954_BREAST)|H1047R(RKO_LARGE_INTESTINE)|H1047L(EFM19_BREAST)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(CAL29_URINARY_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(T47D_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(SKOV3_OVARY)|H1047R(MDAMB453_BREAST)	57		Dom	yes		3	3q26.3	5290	Mis	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			"""E, O"""			colorectal|gastric|gliobastoma|breast		1582	Substitution - Missense(1582)	p.H1047R(1269)|p.H1047L(152)|p.H1047Y(31)|p.H1047Q(3)|p.H1047T(1)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)	breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553						c.(3139-3141)CAT>CGT		phosphoinositide-3-kinase, catalytic, alpha							99.0	89.0	92.0					3																	178952085		1912	4130	6042	SO:0001583	missense	5290				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	g.chr3:178952085A>G		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg	HNSCC(19;0.045)|TSP Lung(28;0.18)	Somatic					p.H1047R	NM_006218	NP_006209	WXS	Illumina HiSeq	Unspecified	P42336	PK3CA_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		21	3297	+	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		1047		H -> L (in cancer).|H -> R (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane).|H -> Y (in cancer).	PI3K/PI4K.		Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	c.3140A>G	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2			17	61	0	0	0	0	17	61				
RGS12	6002	broad.mit.edu	37	4	3318626	3318626	+	Silent	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr4:3318626G>A	ENST00000344733.5	+	2	1633	c.729G>A	c.(727-729)acG>acA	p.T243T	RGS12_ENST00000382788.3_Silent_p.T243T|RGS12_ENST00000336727.3_Silent_p.T243T|RGS12_ENST00000543385.1_Silent_p.T243T	NM_198229.2	NP_937872.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12	243	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				positive regulation of GTPase activity (GO:0043547)|regulation of catalytic activity (GO:0050790)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|GTPase regulator activity (GO:0030695)|receptor signaling protein activity (GO:0005057)			autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TTCCTTCCACGAGCTCCAACC	0.532																																						uc003ggw.2		NA																	0				skin(1)	1						c.(727-729)ACG>ACA		regulator of G-protein signalling 12 isoform 1							53.0	51.0	52.0					4																	3318626		2203	4300	6503	SO:0001819	synonymous_variant	6002					condensed nuclear chromosome|cytoplasm|plasma membrane	GTPase activator activity|receptor signaling protein activity	g.chr4:3318626G>A	AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788		"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""			9651375	Standard	NM_198229		Approved		uc003ggw.3	O14924	OTTHUMG00000090277	ENST00000344733.5:c.729G>A	4.37:g.3318626G>A			Somatic				RGS12_uc003ggu.2_Silent_p.T243T|RGS12_uc010ics.1_Intron|RGS12_uc011bvr.1_RNA|RGS12_uc003ggv.2_Silent_p.T243T|RGS12_uc003ggx.1_Silent_p.T243T	p.T243T	NM_198229	NP_937872	WXS	Illumina HiSeq	Unspecified	O14924	RGS12_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (64;0.168)	2	1633	+			243			PID.		B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	Silent	SNP	ENST00000344733.5	37	c.729G>A	CCDS3366.1																																																																																				0.532	RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206602.1	NM_002926		13	46	0	0	0	0	13	46				
CLOCK	9575	broad.mit.edu	37	4	56315585	56315585	+	Missense_Mutation	SNP	C	C	G			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr4:56315585C>G	ENST00000309964.4	-	16	1677	c.1427G>C	c.(1426-1428)aGa>aCa	p.R476T	CLOCK_ENST00000513440.1_Missense_Mutation_p.R476T|CLOCK_ENST00000381322.1_Missense_Mutation_p.R476T	NM_004898.3	NP_004889.1	O15516	CLOCK_HUMAN	clock circadian regulator	476	Interaction with NR3C1. {ECO:0000250|UniProtKB:O08785}.|Interaction with SIRT1. {ECO:0000250|UniProtKB:O08785}.				cellular response to ionizing radiation (GO:0071479)|chromatin organization (GO:0006325)|circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|DNA damage checkpoint (GO:0000077)|histone acetylation (GO:0016573)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of transcription, DNA-templated (GO:0045892)|photoperiodism (GO:0009648)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of hair cycle (GO:0042634)|regulation of insulin secretion (GO:0050796)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of type B pancreatic cell development (GO:2000074)|response to redox state (GO:0051775)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|chromosome (GO:0005694)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|histone acetyltransferase activity (GO:0004402)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(8)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)			TGATGACCTTCTTTGCACCAT	0.398																																						uc003haz.1		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(1426-1428)AGA>ACA		clock							191.0	176.0	181.0					4																	56315585		2203	4300	6503	SO:0001583	missense	9575				circadian rhythm|photoperiodism|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|transcription factor complex	DNA binding|histone acetyltransferase activity|sequence-specific DNA binding transcription factor activity|signal transducer activity	g.chr4:56315585C>G	AF011568	CCDS3500.1	4q12	2012-12-07	2012-12-07		ENSG00000134852	ENSG00000134852		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	2082	protein-coding gene	gene with protein product		601851	"""clock (mouse) homolog"", ""clock homolog (mouse)"""			10198158	Standard	NM_001267843		Approved	KIAA0334, KAT13D, bHLHe8	uc003hba.2	O15516	OTTHUMG00000102141	ENST00000309964.4:c.1427G>C	4.37:g.56315585C>G	ENSP00000308741:p.Arg476Thr		Somatic				CLOCK_uc003hba.1_Missense_Mutation_p.R476T|CLOCK_uc010igu.1_RNA	p.R476T	NM_004898	NP_004889	WXS	Illumina HiSeq	Unspecified	O15516	CLOCK_HUMAN	LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)		18	2353	-	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		476					A0AV01|A2I2N9|O14516|Q9UIT8	Missense_Mutation	SNP	ENST00000309964.4	37	c.1427G>C	CCDS3500.1	.	.	.	.	.	.	.	.	.	.	C	15.13	2.740872	0.49151	.	.	ENSG00000134852	ENST00000309964;ENST00000381322;ENST00000513440	T;T;T	0.05513	3.43;3.43;3.43	5.59	5.59	0.84812	.	0.265640	0.42821	D	0.000649	T	0.19248	0.0462	M	0.74881	2.28	0.80722	D	1	D	0.55605	0.972	P	0.52267	0.694	T	0.00212	-1.1914	10	0.37606	T	0.19	.	19.5713	0.95421	0.0:1.0:0.0:0.0	.	476	O15516	CLOCK_HUMAN	T	476	ENSP00000308741:R476T;ENSP00000370723:R476T;ENSP00000426983:R476T	ENSP00000308741:R476T	R	-	2	0	CLOCK	56010342	1.000000	0.71417	0.956000	0.39512	0.008000	0.06430	5.074000	0.64401	2.783000	0.95769	0.655000	0.94253	AGA		0.398	CLOCK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361993.2	NM_004898		23	48	0	0	0	0	23	48				
FAT4	79633	broad.mit.edu	37	4	126412412	126412412	+	Missense_Mutation	SNP	G	G	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr4:126412412G>T	ENST00000394329.3	+	17	14448	c.14435G>T	c.(14434-14436)aGg>aTg	p.R4812M	FAT4_ENST00000335110.5_Missense_Mutation_p.R3053M	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	4812					branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						GACCATGGGAGGTCTTCTTCA	0.512																																						uc003ifj.3		NA																	0				ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						c.(14434-14436)AGG>ATG		FAT tumor suppressor homolog 4 precursor							57.0	59.0	59.0					4																	126412412		2203	4300	6503	SO:0001583	missense	79633				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:126412412G>T	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.14435G>T	4.37:g.126412412G>T	ENSP00000377862:p.Arg4812Met		Somatic				FAT4_uc011cgp.1_Missense_Mutation_p.R3053M|FAT4_uc003ifi.1_Missense_Mutation_p.R2289M	p.R4812M	NM_024582	NP_078858	WXS	Illumina HiSeq	Unspecified	Q6V0I7	FAT4_HUMAN			17	14435	+			4812			Cytoplasmic (Potential).		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	c.14435G>T	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	G	17.73	3.460857	0.63513	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.75704	-0.77;-0.96	4.87	4.87	0.63330	.	0.000000	0.35291	U	0.003301	D	0.83492	0.5266	L	0.57536	1.79	0.58432	D	0.999994	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.70935	0.971;0.936;0.971	D	0.84545	0.0641	10	0.52906	T	0.07	.	17.0284	0.86454	0.0:0.0:1.0:0.0	.	3053;4812;4811	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	M	4812;3053	ENSP00000377862:R4812M;ENSP00000335169:R3053M	ENSP00000335169:R3053M	R	+	2	0	FAT4	126631862	1.000000	0.71417	0.445000	0.26908	0.975000	0.68041	7.252000	0.78309	2.253000	0.74438	0.491000	0.48974	AGG		0.512	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582		21	45	1	0	2.39e-15	2.74e-15	21	45				
TMEM184C	55751	broad.mit.edu	37	4	148554974	148554974	+	Missense_Mutation	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr4:148554974C>T	ENST00000296582.3	+	9	1512	c.938C>T	c.(937-939)tCa>tTa	p.S313L	TMEM184C_ENST00000508208.1_Intron	NM_018241.2	NP_060711.2	Q9NVA4	T184C_HUMAN	transmembrane protein 184C	313						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(2)|prostate(1)	16						TACACATTCTCATATAAACCA	0.368																																						uc003ila.3		NA																	0					0						c.(937-939)TCA>TTA		transmembrane protein 184C							203.0	189.0	193.0					4																	148554974		2203	4300	6503	SO:0001583	missense	55751					integral to membrane		g.chr4:148554974C>T	AF305823	CCDS3770.1	4q31.22	2008-06-05	2008-06-05	2008-06-05		ENSG00000164168			25587	protein-coding gene	gene with protein product		613937	"""transmembrane protein 34"""	TMEM34			Standard	NM_018241		Approved	FLJ10846	uc003ila.4	Q9NVA4		ENST00000296582.3:c.938C>T	4.37:g.148554974C>T	ENSP00000296582:p.Ser313Leu		Somatic					p.S313L	NM_018241	NP_060711	WXS	Illumina HiSeq	Unspecified	Q9NVA4	T184C_HUMAN			9	1507	+			313					D3DP04|Q86X84|Q969I7|Q9NXM2	Missense_Mutation	SNP	ENST00000296582.3	37	c.938C>T	CCDS3770.1	.	.	.	.	.	.	.	.	.	.	C	34	5.399936	0.96030	.	.	ENSG00000164168	ENST00000296582	T	0.46451	0.87	5.64	5.64	0.86602	.	0.056212	0.64402	D	0.000001	T	0.60038	0.2238	M	0.86028	2.79	0.80722	D	1	P	0.43578	0.811	P	0.46419	0.516	T	0.66630	-0.5875	10	0.87932	D	0	-2.6247	20.0499	0.97621	0.0:1.0:0.0:0.0	.	313	Q9NVA4	T184C_HUMAN	L	313	ENSP00000296582:S313L	ENSP00000296582:S313L	S	+	2	0	TMEM184C	148774424	1.000000	0.71417	0.999000	0.59377	0.785000	0.44390	7.528000	0.81941	2.800000	0.96347	0.650000	0.86243	TCA		0.368	TMEM184C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364644.1	NM_018241		4	83	0	0	0	0	4	83				
FAT1	2195	broad.mit.edu	37	4	187525008	187525008	+	Nonsense_Mutation	SNP	C	C	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr4:187525008C>A	ENST00000441802.2	-	19	10881	c.10672G>T	c.(10672-10674)Gaa>Taa	p.E3558*		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	3558	Cadherin 33. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						CCTGAGTATTCTTCTCCAGAA	0.473										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)	uc003izf.2		NA																	0				ovary(10)|central_nervous_system(1)|pancreas(1)	12						c.(10672-10674)GAA>TAA		FAT tumor suppressor 1 precursor							83.0	84.0	83.0					4																	187525008		1953	4133	6086	SO:0001587	stop_gained	2195				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding	g.chr4:187525008C>A	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.10672G>T	4.37:g.187525008C>A	ENSP00000406229:p.Glu3558*	HNSCC(5;0.00058)	Somatic					p.E3558*	NM_005245	NP_005236	WXS	Illumina HiSeq	Unspecified	Q14517	FAT1_HUMAN			19	10860	-			3558			Extracellular (Potential).|Cadherin 33.			Nonsense_Mutation	SNP	ENST00000441802.2	37	c.10672G>T	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	C	52	19.962354	0.99925	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	.	.	.	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	.	18.6333	0.91369	0.0:1.0:0.0:0.0	.	.	.	.	X	3558;3560	.	ENSP00000260147:E3560X	E	-	1	0	FAT1	187762002	1.000000	0.71417	0.997000	0.53966	0.589000	0.36550	7.651000	0.83577	2.636000	0.89361	0.563000	0.77884	GAA		0.473	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245		7	28	1	0	8.13e-05	8.64e-05	7	28				
FAT1	2195	broad.mit.edu	37	4	187539863	187539863	+	Missense_Mutation	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr4:187539863C>T	ENST00000441802.2	-	10	8086	c.7877G>A	c.(7876-7878)gGc>gAc	p.G2626D		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	2626	Cadherin 24. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						GGCATTGGAGCCCTCATCGGC	0.448										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)	uc003izf.2		NA																	0				ovary(10)|central_nervous_system(1)|pancreas(1)	12						c.(7876-7878)GGC>GAC		FAT tumor suppressor 1 precursor							63.0	59.0	60.0					4																	187539863		1943	4132	6075	SO:0001583	missense	2195				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding	g.chr4:187539863C>T	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.7877G>A	4.37:g.187539863C>T	ENSP00000406229:p.Gly2626Asp	HNSCC(5;0.00058)	Somatic					p.G2626D	NM_005245	NP_005236	WXS	Illumina HiSeq	Unspecified	Q14517	FAT1_HUMAN			10	8065	-			2626			Extracellular (Potential).|Cadherin 24.			Missense_Mutation	SNP	ENST00000441802.2	37	c.7877G>A	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	C	16.61	3.170898	0.57584	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.65549	-0.16	5.2	5.2	0.72013	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.81365	0.4807	M	0.82716	2.605	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81093	-0.1089	10	0.45353	T	0.12	.	19.2916	0.94102	0.0:1.0:0.0:0.0	.	2626	Q14517	FAT1_HUMAN	D	2626;2628	ENSP00000406229:G2626D	ENSP00000260147:G2628D	G	-	2	0	FAT1	187776857	1.000000	0.71417	0.971000	0.41717	0.149000	0.21700	7.651000	0.83577	2.861000	0.98227	0.655000	0.94253	GGC		0.448	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245		9	27	0	0	0	0	9	27				
SPEF2	79925	broad.mit.edu	37	5	35659168	35659168	+	Silent	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr5:35659168C>T	ENST00000356031.3	+	8	1180	c.1026C>T	c.(1024-1026)tcC>tcT	p.S342S	SPEF2_ENST00000282469.6_Silent_p.S342S|SPEF2_ENST00000509059.1_Silent_p.S342S|SPEF2_ENST00000440995.2_Silent_p.S342S	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	342					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TGCGGCAGTCCCAGCAGGAGC	0.468																																						uc003jjo.2		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(1024-1026)TCC>TCT		KPL2 protein isoform 1							49.0	49.0	49.0					5																	35659168		2203	4300	6503	SO:0001819	synonymous_variant	79925				nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity	g.chr5:35659168C>T	AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.1026C>T	5.37:g.35659168C>T			Somatic				SPEF2_uc003jjn.1_Silent_p.S342S|SPEF2_uc003jjq.3_Silent_p.S342S	p.S342S	NM_024867	NP_079143	WXS	Illumina HiSeq	Unspecified	Q9C093	SPEF2_HUMAN	Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		8	1137	+	all_lung(31;7.56e-05)		342			Potential.		Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Silent	SNP	ENST00000356031.3	37	c.1026C>T	CCDS43309.1																																																																																				0.468	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	NM_144722		11	18	0	0	0	0	11	18				
MEF2C	4208	broad.mit.edu	37	5	88027717	88027717	+	Splice_Site	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr5:88027717C>T	ENST00000437473.2	-	7	1056	c.639G>A	c.(637-639)ggG>ggA	p.G213G	MEF2C_ENST00000340208.5_Splice_Site_p.G231G|MEF2C_ENST00000506554.1_Splice_Site_p.G213G|MEF2C_ENST00000508569.1_Splice_Site_p.G213G|MEF2C_ENST00000514028.1_Splice_Site_p.G213G|MEF2C_ENST00000503554.1_5'UTR|MEF2C_ENST00000514015.1_Splice_Site_p.G213G|MEF2C_ENST00000510942.1_Splice_Site_p.G213G|MEF2C_ENST00000504921.2_Splice_Site_p.G213G|MEF2C_ENST00000424173.2_Splice_Site_p.G211G|MEF2C_ENST00000539796.1_Splice_Site_p.G165G	NM_001193350.1|NM_002397.4	NP_001180279.1|NP_002388.2	Q06413	MEF2C_HUMAN	myocyte enhancer factor 2C	213					apoptotic process (GO:0006915)|B cell homeostasis (GO:0001782)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac ventricle formation (GO:0003211)|cartilage morphogenesis (GO:0060536)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|cellular response to fluid shear stress (GO:0071498)|cellular response to glucose stimulus (GO:0071333)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to trichostatin A (GO:0035984)|chondrocyte differentiation (GO:0002062)|dentate gyrus development (GO:0021542)|embryonic viscerocranium morphogenesis (GO:0048703)|endochondral ossification (GO:0001958)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|germinal center formation (GO:0002467)|glomerulus morphogenesis (GO:0072102)|heart development (GO:0007507)|heart looping (GO:0001947)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|MAPK cascade (GO:0000165)|melanocyte differentiation (GO:0030318)|monocyte differentiation (GO:0030224)|muscle cell differentiation (GO:0042692)|muscle cell fate determination (GO:0007521)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myotube differentiation (GO:0014902)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of ossification (GO:0030279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nephron tubule epithelial cell differentiation (GO:0072160)|nervous system development (GO:0007399)|neural crest cell differentiation (GO:0014033)|neuron development (GO:0048666)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoblast differentiation (GO:0001649)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|platelet formation (GO:0030220)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primary heart field specification (GO:0003138)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of dendritic spine development (GO:0060998)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of germinal center formation (GO:0002634)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron apoptotic process (GO:0043523)|regulation of neurotransmitter secretion (GO:0046928)|regulation of sarcomere organization (GO:0060297)|regulation of synapse assembly (GO:0051963)|regulation of synaptic activity (GO:0060025)|regulation of synaptic plasticity (GO:0048167)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|renal tubule morphogenesis (GO:0061333)|response to ischemia (GO:0002931)|response to virus (GO:0009615)|response to vitamin E (GO:0033197)|secondary heart field specification (GO:0003139)|sinoatrial valve morphogenesis (GO:0003185)|skeletal muscle tissue development (GO:0007519)|smooth muscle cell differentiation (GO:0051145)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|sarcomere (GO:0030017)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|miRNA binding (GO:0035198)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	40		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)		CATACCCGTTCCCTGTTAACA	0.388										HNSCC(66;0.2)																												uc003kjj.2		NA																	0				lung(3)|breast(2)|ovary(1)|large_intestine(1)	7						c.(637-639)GGG>GGA		myocyte enhancer factor 2C isoform 1							55.0	54.0	55.0					5																	88027717		1860	4082	5942	SO:0001630	splice_region_variant	4208				apoptosis|B cell proliferation|innate immune response|learning or memory|muscle cell differentiation|muscle organ development|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|neuron development|positive regulation of muscle cell differentiation|positive regulation of survival gene product expression|positive regulation of transcription from RNA polymerase II promoter|regulation of germinal center formation|regulation of megakaryocyte differentiation|regulation of synaptic activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	nuclear speck	activating transcription factor binding|protein heterodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding	g.chr5:88027717C>T	AL833268	CCDS47244.1, CCDS47245.1, CCDS54877.1, CCDS54878.1	5q14.3	2013-07-03	2007-04-24		ENSG00000081189	ENSG00000081189		"""Myocyte enhancer factors"""	6996	protein-coding gene	gene with protein product		600662				8455629	Standard	NM_002397		Approved		uc003kjl.3	Q06413	OTTHUMG00000162634	ENST00000437473.2:c.638-1G>A	5.37:g.88027717C>T		HNSCC(66;0.2)	Somatic				MEF2C_uc003kji.2_Silent_p.G213G|MEF2C_uc003kjk.2_Silent_p.G213G|MEF2C_uc003kjm.2_Silent_p.G211G|MEF2C_uc003kjl.2_Silent_p.G231G	p.G213G	NM_002397	NP_002388	WXS	Illumina HiSeq	Unspecified	Q06413	MEF2C_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)	7	1312	-		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)	213					C9JMZ0|D7F7N5|F8W7V7	Silent	SNP	ENST00000437473.2	37	c.639G>A	CCDS47245.1																																																																																				0.388	MEF2C-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000369817.1	NM_002397	Silent	6	11	0	0	0	0	6	11				
PCDHA9	9752	broad.mit.edu	37	5	140230437	140230437	+	Missense_Mutation	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr5:140230437C>T	ENST00000532602.1	+	1	3390	c.2357C>T	c.(2356-2358)aCg>aTg	p.T786M	PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA9_ENST00000378122.3_Missense_Mutation_p.T786M|PCDHA4_ENST00000512229.2_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	786	5 X 4 AA repeats of P-X-X-P.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACAGAGCGAACGGGAGAACCC	0.463																																					Melanoma(55;1800 1972 14909)	uc003lhu.2		NA																	0				large_intestine(2)|ovary(2)|skin(1)	5						c.(2356-2358)ACG>ATG		protocadherin alpha 9 isoform 1 precursor							65.0	69.0	68.0					5																	140230437		2197	4269	6466	SO:0001583	missense	9752				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding	g.chr5:140230437C>T	AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.2357C>T	5.37:g.140230437C>T	ENSP00000436042:p.Thr786Met		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lht.1_Missense_Mutation_p.T786M	p.T786M	NM_031857	NP_114063	WXS	Illumina HiSeq	Unspecified	Q9Y5H5	PCDA9_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	3081	+			786			Cytoplasmic (Potential).|5 X 4 AA repeats of P-X-X-P.		O15053|Q2M3S5	Missense_Mutation	SNP	ENST00000532602.1	37	c.2357C>T	CCDS54920.1	.	.	.	.	.	.	.	.	.	.	c	7.800	0.713391	0.15306	.	.	ENSG00000204961	ENST00000532602;ENST00000378122	T;T	0.12039	2.72;2.72	4.16	-8.31	0.01001	.	.	.	.	.	T	0.07369	0.0186	L	0.36672	1.1	0.09310	N	1	B;B	0.18610	0.011;0.029	B;B	0.12156	0.007;0.003	T	0.29731	-1.0002	9	0.48119	T	0.1	.	1.3444	0.02160	0.2643:0.138:0.352:0.2457	.	786;786	Q9Y5H5;Q9Y5H5-2	PCDA9_HUMAN;.	M	786	ENSP00000436042:T786M;ENSP00000367362:T786M	ENSP00000367362:T786M	T	+	2	0	PCDHA9	140210621	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-2.824000	0.00747	-2.845000	0.00333	-1.169000	0.01745	ACG		0.463	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372896.2	NM_031857		17	53	0	0	0	0	17	53				
PCDHA12	56137	broad.mit.edu	37	5	140257232	140257232	+	Silent	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr5:140257232G>A	ENST00000398631.2	+	1	2175	c.2175G>A	c.(2173-2175)gcG>gcA	p.A725A	PCDHA5_ENST00000529859.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA10_ENST00000506939.2_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	725					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTTGCTCAGCGCCGCCCACCG	0.647																																					Pancreas(113;759 1672 13322 24104 50104)	uc003lic.2		NA																	0					0						c.(2173-2175)GCG>GCA		protocadherin alpha 12 isoform 1 precursor							28.0	27.0	28.0					5																	140257232		2202	4299	6501	SO:0001819	synonymous_variant	56137				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding	g.chr5:140257232G>A	AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.2175G>A	5.37:g.140257232G>A			Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc011daf.1_Silent_p.A725A	p.A725A	NM_018903	NP_061726	WXS	Illumina HiSeq	Unspecified	Q9UN75	PCDAC_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2302	+			725			Cytoplasmic (Potential).		O75278|Q2M1N8	Silent	SNP	ENST00000398631.2	37	c.2175G>A	CCDS47285.1																																																																																				0.647	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372882.2	NM_018903		4	26	0	0	0	0	4	26				
KCNIP1	30820	broad.mit.edu	37	5	170148874	170148874	+	Silent	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr5:170148874C>T	ENST00000411494.1	+	5	327	c.327C>T	c.(325-327)ttC>ttT	p.F109F	KCNIP1_ENST00000434108.1_Silent_p.F123F|KCNIP1_ENST00000377360.4_Silent_p.F107F|KCNIP1_ENST00000520740.1_Silent_p.F70F|KCNIP1_ENST00000390656.4_Silent_p.F98F|KCNIP1_ENST00000328939.4_Silent_p.F98F			Q9NZI2	KCIP1_HUMAN	Kv channel interacting protein 1	109	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				detection of calcium ion (GO:0005513)|positive regulation of action potential (GO:0045760)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|potassium channel complex (GO:0034705)	calcium ion binding (GO:0005509)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|voltage-gated ion channel activity (GO:0005244)	p.F109F(1)		autonomic_ganglia(1)|large_intestine(7)|lung(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	18	Renal(175;0.000159)|Lung NSC(126;0.0191)|all_lung(126;0.0297)	Medulloblastoma(196;0.0109)|all_neural(177;0.0177)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TCAATGCCTTCGACACCACTC	0.547																																						uc003mas.2		NA																	1	Substitution - coding silent(1)		large_intestine(1)	skin(2)	2						c.(325-327)TTC>TTT		Kv channel interacting protein 1 isoform 1							243.0	214.0	224.0					5																	170148874		2203	4300	6503	SO:0001819	synonymous_variant	30820				detection of calcium ion|signal transduction|synaptic transmission	plasma membrane	potassium channel activity|voltage-gated ion channel activity	g.chr5:170148874C>T	AF199597	CCDS34285.1, CCDS34286.1, CCDS4374.1, CCDS64312.1, CCDS64313.1	5q35	2013-01-10			ENSG00000182132	ENSG00000182132		"""EF-hand domain containing"""	15521	protein-coding gene	gene with protein product		604660				10676964	Standard	NM_001278339		Approved	KCHIP1	uc003map.3	Q9NZI2	OTTHUMG00000130442	ENST00000411494.1:c.327C>T	5.37:g.170148874C>T			Somatic				KCNIP1_uc003map.2_Silent_p.F107F|KCNIP1_uc003mat.2_Silent_p.F98F|KCNIP1_uc010jjp.2_Silent_p.F70F|KCNIP1_uc010jjq.2_Silent_p.F123F	p.F109F	NM_001034837	NP_001030009	WXS	Illumina HiSeq	Unspecified	Q9NZI2	KCIP1_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		5	856	+	Renal(175;0.000159)|Lung NSC(126;0.0191)|all_lung(126;0.0297)	Medulloblastoma(196;0.0109)|all_neural(177;0.0177)	109			EF-hand 2.		B7Z7B4|Q3YAD0|Q3YAD1|Q3YAD2|Q3YAD3|Q5U822	Silent	SNP	ENST00000411494.1	37	c.327C>T	CCDS34286.1																																																																																				0.547	KCNIP1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000371760.1			51	96	0	0	0	0	51	96				
BMP6	654	broad.mit.edu	37	6	7727808	7727808	+	Missense_Mutation	SNP	C	C	T	rs201531160		TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr6:7727808C>T	ENST00000283147.6	+	1	779	c.620C>T	c.(619-621)gCc>gTc	p.A207V		NM_001718.4	NP_001709.1	P22004	BMP6_HUMAN	bone morphogenetic protein 6	207					BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular response to mechanical stimulus (GO:0071260)|endochondral ossification (GO:0001958)|eye development (GO:0001654)|growth (GO:0040007)|immune response (GO:0006955)|inflammatory response (GO:0006954)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|osteoblast differentiation (GO:0001649)|positive regulation of aldosterone biosynthetic process (GO:0032349)|positive regulation of aldosterone secretion (GO:2000860)|positive regulation of bone mineralization (GO:0030501)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to activity (GO:0014823)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to retinoic acid (GO:0032526)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|type B pancreatic cell development (GO:0003323)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)|protein heterodimerization activity (GO:0046982)			breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(6)|ovary(1)|prostate(1)	23	Ovarian(93;0.0721)					CAGGACAGCGCCTTCCTCAAC	0.647																																						uc003mxu.3		NA																	0				large_intestine(2)|ovary(1)	3						c.(619-621)GCC>GTC		bone morphogenetic protein 6 preproprotein							11.0	14.0	13.0					6																	7727808		1912	3820	5732	SO:0001583	missense	654				BMP signaling pathway|cartilage development|growth|immune response|positive regulation of aldosterone biosynthetic process|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription from RNA polymerase II promoter|SMAD protein signal transduction	extracellular space	BMP receptor binding|cytokine activity|growth factor activity|protein heterodimerization activity	g.chr6:7727808C>T	AF083030	CCDS4503.1	6p24-p23	2014-01-30	2003-10-06		ENSG00000153162	ENSG00000153162		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1073	protein-coding gene	gene with protein product		112266	"""vegetal related growth factor (TGFB-related)"""	VGR		1427904, 1453478	Standard	NM_001718		Approved	VGR1	uc003mxu.4	P22004	OTTHUMG00000014217	ENST00000283147.6:c.620C>T	6.37:g.7727808C>T	ENSP00000283147:p.Ala207Val		Somatic					p.A207V	NM_001718	NP_001709	WXS	Illumina HiSeq	Unspecified	P22004	BMP6_HUMAN			1	798	+	Ovarian(93;0.0721)		207					Q5TCP3	Missense_Mutation	SNP	ENST00000283147.6	37	c.620C>T	CCDS4503.1	.	.	.	.	.	.	.	.	.	.	C	12.85	2.062860	0.36373	.	.	ENSG00000153162	ENST00000537240;ENST00000283147;ENST00000540959	T	0.73469	-0.75	3.63	3.63	0.41609	Transforming growth factor-beta, N-terminal (1);	0.303370	0.28828	N	0.014001	T	0.65270	0.2675	L	0.53249	1.67	0.36576	D	0.873242	P	0.47191	0.891	P	0.46299	0.511	T	0.68842	-0.5302	10	0.41790	T	0.15	.	15.06	0.71944	0.0:1.0:0.0:0.0	.	207	P22004	BMP6_HUMAN	V	129;207;170	ENSP00000283147:A207V	ENSP00000283147:A207V	A	+	2	0	BMP6	7672807	1.000000	0.71417	0.998000	0.56505	0.028000	0.11728	1.997000	0.40786	1.835000	0.53391	0.455000	0.32223	GCC		0.647	BMP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039794.1	NM_001718		5	14	0	0	0	0	5	14				
HIST1H1C	3006	broad.mit.edu	37	6	26056394	26056394	+	Missense_Mutation	SNP	A	A	C			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr6:26056394A>C	ENST00000343677.2	-	1	305	c.263T>G	c.(262-264)gTg>gGg	p.V88G		NM_005319.3	NP_005310.1	P16403	H12_HUMAN	histone cluster 1, H1c	88	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	34						GCCCTTGCTCACCAGGCTCTT	0.532																																						uc003nfw.2		NA																	0				ovary(3)|skin(2)	5						c.(262-264)GTG>GGG		histone cluster 1, H1c							113.0	117.0	116.0					6																	26056394		2203	4300	6503	SO:0001583	missense	3006				nucleosome assembly	nucleosome|nucleus	DNA binding	g.chr6:26056394A>C	X57129	CCDS4577.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000187837	ENSG00000187837		"""Histones / Replication-dependent"""	4716	protein-coding gene	gene with protein product		142710	"""H1 histone family, member 2"", ""histone 1, H1c"""	H1F2		2759094, 12408966	Standard	NM_005319		Approved	H1.2, H1s-1, H1c	uc003nfw.3	P16403	OTTHUMG00000016140	ENST00000343677.2:c.263T>G	6.37:g.26056394A>C	ENSP00000339566:p.Val88Gly		Somatic					p.V88G	NM_005319	NP_005310	WXS	Illumina HiSeq	Unspecified	P16403	H12_HUMAN			1	306	-			88			H15.		A8K4I2	Missense_Mutation	SNP	ENST00000343677.2	37	c.263T>G	CCDS4577.1	.	.	.	.	.	.	.	.	.	.	A	18.41	3.618653	0.66787	.	.	ENSG00000187837	ENST00000343677	T	0.34667	1.35	5.63	5.63	0.86233	Histone H1/H5 (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.063670	0.64402	D	0.000008	T	0.72859	0.3513	H	0.99261	4.49	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85212	0.1021	10	0.87932	D	0	-29.0408	15.3144	0.74062	1.0:0.0:0.0:0.0	.	88	P16403	H12_HUMAN	G	88	ENSP00000339566:V88G	ENSP00000339566:V88G	V	-	2	0	HIST1H1C	26164373	1.000000	0.71417	1.000000	0.80357	0.301000	0.27625	9.082000	0.94059	2.271000	0.75665	0.533000	0.62120	GTG		0.532	HIST1H1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043372.1	NM_005319		14	94	0	0	0	0	14	94				
FKBPL	63943	broad.mit.edu	37	6	32097032	32097032	+	Nonsense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr6:32097032G>A	ENST00000375156.3	-	2	796	c.526C>T	c.(526-528)Cag>Tag	p.Q176*	ATF6B_ENST00000375203.3_5'Flank|ATF6B_ENST00000375201.4_5'Flank|ATF6B_ENST00000468502.1_5'Flank	NM_022110.3	NP_071393.2	Q9UIM3	FKBPL_HUMAN	FK506 binding protein like	176					chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)|response to radiation (GO:0009314)	endoplasmic reticulum membrane (GO:0005789)	FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)										CCAGGCAGCTGAAGCTCTGCT	0.572																																						uc003nzr.2		NA																	0					0						c.(526-528)CAG>TAG		WAF-1/CIP1 stabilizing protein 39							123.0	122.0	123.0					6																	32097032		2203	4300	6503	SO:0001587	stop_gained	63943				response to radiation	membrane|nucleus	FK506 binding|peptidyl-prolyl cis-trans isomerase activity	g.chr6:32097032G>A	AF139374	CCDS4738.1	6p21.3	2013-12-13	2001-11-28		ENSG00000204315	ENSG00000204315		"""Tetratricopeptide (TTC) repeat domain containing"""	13949	protein-coding gene	gene with protein product	"""WAF-1/CIP1 stabilizing protein 39"""		"""FK506-binding protein like"""			9056895	Standard	NM_022110		Approved	DIR1, NG7, WISp39	uc003nzr.3	Q9UIM3	OTTHUMG00000031129	ENST00000375156.3:c.526C>T	6.37:g.32097032G>A	ENSP00000364298:p.Gln176*		Somatic				ATF6B_uc003nzo.2_5'Flank|ATF6B_uc003nzn.2_5'Flank|ATF6B_uc011dpg.1_5'Flank|ATF6B_uc011dph.1_5'Flank	p.Q176*	NM_022110	NP_071393	WXS	Illumina HiSeq	Unspecified	Q9UIM3	FKBPL_HUMAN			2	796	-			176					A8K5V3|B0UYX8|Q9H5G3	Nonsense_Mutation	SNP	ENST00000375156.3	37	c.526C>T	CCDS4738.1	.	.	.	.	.	.	.	.	.	.	G	37	6.578812	0.97680	.	.	ENSG00000204315	ENST00000375156	.	.	.	5.38	3.53	0.40419	.	0.518119	0.17376	N	0.176486	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05351	T	0.99	-2.2572	5.9763	0.19382	0.0938:0.0:0.7168:0.1894	.	.	.	.	X	176	.	ENSP00000364298:Q176X	Q	-	1	0	FKBPL	32205010	0.357000	0.24938	0.980000	0.43619	0.963000	0.63663	1.367000	0.34204	2.804000	0.96469	0.462000	0.41574	CAG		0.572	FKBPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076221.2			10	149	0	0	0	0	10	149				
HACE1	57531	broad.mit.edu	37	6	105233004	105233004	+	Missense_Mutation	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr6:105233004C>T	ENST00000262903.4	-	12	1541	c.1265G>A	c.(1264-1266)gGc>gAc	p.G422D	HACE1_ENST00000369125.2_Missense_Mutation_p.G422D|HACE1_ENST00000517995.1_5'Flank	NM_020771.3	NP_065822.2	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1	422					cell cycle (GO:0007049)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|Rac protein signal transduction (GO:0016601)|regulation of cell migration (GO:0030334)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Rab GTPase binding (GO:0017137)|Rac GTPase binding (GO:0048365)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	44		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		TTCCCTTGTGCCAGTGGACAG	0.458																																						uc003pqu.1		NA																	0				ovary(5)|lung(2)	7						c.(1264-1266)GGC>GAC		HECT domain and ankyrin repeat containing, E3							109.0	102.0	104.0					6																	105233004		2203	4300	6503	SO:0001583	missense	57531				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	endoplasmic reticulum	ubiquitin-protein ligase activity	g.chr6:105233004C>T	BC034982	CCDS5050.1	6q21	2013-01-10	2012-02-23		ENSG00000085382	ENSG00000085382		"""Ankyrin repeat domain containing"""	21033	protein-coding gene	gene with protein product		610876				10718198	Standard	NM_020771		Approved	KIAA1320	uc003pqu.1	Q8IYU2	OTTHUMG00000015287	ENST00000262903.4:c.1265G>A	6.37:g.105233004C>T	ENSP00000262903:p.Gly422Asp		Somatic				HACE1_uc010kcy.1_5'UTR|HACE1_uc010kcz.1_Missense_Mutation_p.G422D|HACE1_uc010kcx.1_5'UTR|HACE1_uc003pqt.1_Missense_Mutation_p.G75D	p.G422D	NM_020771	NP_065822	WXS	Illumina HiSeq	Unspecified	Q8IYU2	HACE1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)	12	1542	-		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)	422					A8K6U5|B3KY89|B4DFM6|B4DTQ4|B7Z9X6|E9PGP0|Q5VU99|Q5VUA0|Q8ND12|Q9P2M6	Missense_Mutation	SNP	ENST00000262903.4	37	c.1265G>A	CCDS5050.1	.	.	.	.	.	.	.	.	.	.	C	0.453	-0.892854	0.02491	.	.	ENSG00000085382	ENST00000262903;ENST00000369125	T;T	0.35421	1.31;1.35	4.8	1.32	0.21799	.	0.446945	0.22554	N	0.058552	T	0.04318	0.0119	N	0.08118	0	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.43972	-0.9358	10	0.09338	T	0.73	.	6.778	0.23630	0.0:0.5065:0.0:0.4935	.	422;422;75	E9PGP0;Q8IYU2;Q8IYU2-3	.;HACE1_HUMAN;.	D	422	ENSP00000262903:G422D;ENSP00000358121:G422D	ENSP00000262903:G422D	G	-	2	0	HACE1	105339697	1.000000	0.71417	0.802000	0.32245	0.514000	0.34195	2.006000	0.40874	0.496000	0.27904	0.460000	0.39030	GGC		0.458	HACE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041643.2	XM_045095		3	46	0	0	0	0	3	46				
HS3ST5	222537	broad.mit.edu	37	6	114378489	114378489	+	Missense_Mutation	SNP	G	G	A	rs374141405		TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr6:114378489G>A	ENST00000312719.5	-	5	2161	c.973C>T	c.(973-975)Cgc>Tgc	p.R325C	RP3-399L15.3_ENST00000519104.1_RNA|HS3ST5_ENST00000411826.1_Missense_Mutation_p.R325C|RP3-399L15.3_ENST00000519270.1_RNA|RP3-399L15.3_ENST00000523087.1_RNA			Q8IZT8	HS3S5_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 5	325					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|negative regulation of coagulation (GO:0050819)|protein sulfation (GO:0006477)|regulation of viral entry into host cell (GO:0046596)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)			breast(4)|endometrium(2)|kidney(1)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	41		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)		AAGAATTTGCGCAATTTAGTA	0.408																																						uc003pwg.3		NA																	0				ovary(1)|pancreas(1)	2						c.(973-975)CGC>TGC		heparan sulfate (glucosamine)		G	CYS/ARG	1,4405	4.2+/-10.8	0,1,2202	64.0	68.0	66.0		973	6.0	1.0	6		66	1,8597	1.2+/-3.3	0,1,4298	no	missense	HS3ST5	NM_153612.3	180	0,2,6500	AA,AG,GG		0.0116,0.0227,0.0154	benign	325/347	114378489	2,13002	2203	4299	6502	SO:0001583	missense	222537				heparan sulfate proteoglycan biosynthetic process, enzymatic modification|negative regulation of coagulation|protein sulfation|regulation of virion penetration into host cell	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity|protein binding	g.chr6:114378489G>A	AF503292	CCDS34517.1	6q21	2011-11-16			ENSG00000249853	ENSG00000249853		"""Sulfotransferases, membrane-bound"""	19419	protein-coding gene	gene with protein product		609407				12138164	Standard	NM_153612		Approved	3-OST-5	uc003pwg.4	Q8IZT8	OTTHUMG00000015412	ENST00000312719.5:c.973C>T	6.37:g.114378489G>A	ENSP00000427888:p.Arg325Cys		Somatic				uc003pwf.2_Intron|HS3ST5_uc003pwh.3_Missense_Mutation_p.R325C	p.R325C	NM_153612	NP_705840	WXS	Illumina HiSeq	Unspecified	Q8IZT8	HS3S5_HUMAN		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)	2	1005	-		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)	325			Lumenal (Potential).		A8K1J2|Q52LI2|Q8N285	Missense_Mutation	SNP	ENST00000312719.5	37	c.973C>T	CCDS34517.1	.	.	.	.	.	.	.	.	.	.	G	15.06	2.722416	0.48728	2.27E-4	1.16E-4	ENSG00000249853	ENST00000312719;ENST00000411826	D;D	0.82803	-1.65;-1.65	6.02	6.02	0.97574	Sulfotransferase domain (1);	0.108901	0.64402	D	0.000004	D	0.83031	0.5166	M	0.63208	1.945	0.80722	D	1	D	0.69078	0.997	P	0.49252	0.604	T	0.81752	-0.0789	10	0.41790	T	0.15	.	20.5407	0.99260	0.0:0.0:1.0:0.0	.	325	Q8IZT8	HS3S5_HUMAN	C	325	ENSP00000427888:R325C;ENSP00000440332:R325C	ENSP00000427888:R325C	R	-	1	0	HS3ST5	114485182	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.618000	0.83043	2.865000	0.98341	0.655000	0.94253	CGC		0.408	HS3ST5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041911.2	NM_153612		23	44	0	0	0	0	23	44				
LAMA2	3908	broad.mit.edu	37	6	129649434	129649434	+	Silent	SNP	G	G	A	rs369076029		TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr6:129649434G>A	ENST00000421865.2	+	29	4237	c.4188G>A	c.(4186-4188)ccG>ccA	p.P1396P		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	1396	Laminin EGF-like 14; second part. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)	p.P1396P(1)		NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		CATGCTTGCCGGGATTTTATC	0.507																																						uc003qbn.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(8)|breast(1)|skin(1)	10						c.(4186-4188)CCG>CCA		laminin alpha 2 subunit isoform a precursor							128.0	115.0	120.0					6																	129649434		2203	4300	6503	SO:0001819	synonymous_variant	3908				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity	g.chr6:129649434G>A	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.4188G>A	6.37:g.129649434G>A			Somatic				LAMA2_uc003qbo.2_Silent_p.P1396P	p.P1396P	NM_000426	NP_000417	WXS	Illumina HiSeq	Unspecified	P24043	LAMA2_HUMAN		OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)	29	4293	+			1396			Laminin EGF-like 14; second part.		Q14736|Q5VUM2|Q93022	Silent	SNP	ENST00000421865.2	37	c.4188G>A	CCDS5138.1																																																																																				0.507	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1			21	73	0	0	0	0	21	73				
TCF21	6943	broad.mit.edu	37	6	134210907	134210907	+	Silent	SNP	G	G	A	rs201214778		TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr6:134210907G>A	ENST00000367882.4	+	1	632	c.372G>A	c.(370-372)gcG>gcA	p.A124A	RP3-323P13.2_ENST00000606544.1_RNA|RP3-323P13.2_ENST00000607033.1_RNA|RP3-323P13.2_ENST00000607573.1_RNA|RP3-323P13.2_ENST00000607641.1_RNA|TCF21_ENST00000237316.3_Silent_p.A124A	NM_003206.3	NP_003197.2	O43680	TCF21_HUMAN	transcription factor 21	124	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				branching involved in ureteric bud morphogenesis (GO:0001658)|branchiomeric skeletal muscle development (GO:0014707)|bronchiole development (GO:0060435)|diaphragm development (GO:0060539)|embryonic digestive tract morphogenesis (GO:0048557)|epithelial cell differentiation (GO:0030855)|gland development (GO:0048732)|glomerulus development (GO:0032835)|kidney development (GO:0001822)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|lung vasculature development (GO:0060426)|metanephric glomerular capillary formation (GO:0072277)|metanephric mesenchymal cell differentiation (GO:0072162)|morphogenesis of a branching structure (GO:0001763)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|reproductive structure development (GO:0048608)|respiratory system development (GO:0060541)|Sertoli cell differentiation (GO:0060008)|sex determination (GO:0007530)|spleen development (GO:0048536)|ureteric bud development (GO:0001657)|vasculature development (GO:0001944)	nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			cervix(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	13	Colorectal(23;0.221)|Breast(56;0.247)			GBM - Glioblastoma multiforme(68;0.00518)|OV - Ovarian serous cystadenocarcinoma(155;0.00783)		TCAGGCTGGCGTCCAGCTACA	0.617													G|||	1	0.000199681	0.0	0.0	5008	,	,		16024	0.001		0.0	False		,,,				2504	0.0					uc003qei.3		NA																	0					0						c.(370-372)GCG>GCA		transcription factor 21							90.0	88.0	89.0					6																	134210907		2198	4299	6497	SO:0001819	synonymous_variant	6943				branching involved in ureteric bud morphogenesis|mesoderm development|negative regulation of androgen receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent	nucleus	androgen receptor binding|E-box binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity	g.chr6:134210907G>A	AF047419	CCDS5167.1	6q23.2	2014-09-17			ENSG00000118526	ENSG00000118526		"""Basic helix-loop-helix proteins"""	11632	protein-coding gene	gene with protein product		603306				9507058	Standard	NM_198392		Approved	POD1, bHLHa23	uc003qei.4	O43680	OTTHUMG00000015608	ENST00000367882.4:c.372G>A	6.37:g.134210907G>A			Somatic				uc003qeg.1_5'Flank|TCF21_uc003qej.2_Silent_p.A124A	p.A124A	NM_003206	NP_003197	WXS	Illumina HiSeq	Unspecified	O43680	TCF21_HUMAN		GBM - Glioblastoma multiforme(68;0.00518)|OV - Ovarian serous cystadenocarcinoma(155;0.00783)	1	648	+	Colorectal(23;0.221)|Breast(56;0.247)		124			Helix-loop-helix motif.		E1P581|O43545|Q6ICV0|Q9BZ14	Silent	SNP	ENST00000367882.4	37	c.372G>A	CCDS5167.1																																																																																				0.617	TCF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042292.1	NM_198392		32	94	0	0	0	0	32	94				
AIG1	51390	broad.mit.edu	37	6	143605338	143605338	+	Missense_Mutation	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr6:143605338C>T	ENST00000275235.4	+	4	516	c.491C>T	c.(490-492)aCc>aTc	p.T164I	AIG1_ENST00000357847.4_Missense_Mutation_p.T164I|AIG1_ENST00000344492.5_Missense_Mutation_p.T112I			Q9NVV5	AIG1_HUMAN	androgen-induced 1	164						integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(155;2.34e-05)|GBM - Glioblastoma multiforme(68;0.0246)		GCCATATGTACCTTCTCTGTT	0.433																																						uc003qjh.2		NA																	0					0						c.(490-492)ACC>ATC		androgen-induced 1							119.0	96.0	104.0					6																	143605338		2203	4300	6503	SO:0001583	missense	51390					integral to membrane		g.chr6:143605338C>T	AF153605	CCDS5198.1, CCDS69216.1	6q24.1	2008-02-05			ENSG00000146416	ENSG00000146416			21607	protein-coding gene	gene with protein product		608514				11266118	Standard	NM_001286587		Approved	dJ95L4.1, AIG-1, FLJ10485	uc003qjh.3	Q9NVV5	OTTHUMG00000015721	ENST00000275235.4:c.491C>T	6.37:g.143605338C>T	ENSP00000275235:p.Thr164Ile		Somatic				AIG1_uc003qjf.2_Missense_Mutation_p.T154I|AIG1_uc003qji.2_Missense_Mutation_p.T102I	p.T164I	NM_016108	NP_057192	WXS	Illumina HiSeq	Unspecified	Q9NVV5	AIG1_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;2.34e-05)|GBM - Glioblastoma multiforme(68;0.0246)	4	531	+			164					B4DPX2|C9J569|Q5T2H2|Q6N047|Q7Z378|Q8TB14|Q9Y3A9|Q9Y5B4	Missense_Mutation	SNP	ENST00000275235.4	37	c.491C>T		.	.	.	.	.	.	.	.	.	.	C	1.193	-0.634633	0.03584	.	.	ENSG00000146416	ENST00000367601;ENST00000419072;ENST00000447498;ENST00000357847;ENST00000344492;ENST00000275235;ENST00000458219	T;T;T;T;T;T	0.30981	1.51;1.51;1.51;1.51;1.51;1.51	5.78	4.01	0.46588	.	0.452723	0.25464	N	0.030481	T	0.05960	0.0155	N	0.20530	0.585	0.80722	D	1	B;B;B	0.21225	0.053;0.014;0.017	B;B;B	0.15870	0.013;0.008;0.014	T	0.17592	-1.0364	10	0.07813	T	0.8	-18.5287	9.1694	0.37072	0.0:0.7797:0.0:0.2203	.	112;164;160	Q9NVV5-3;Q9NVV5-2;E7ENG8	.;.;.	I	160;160;112;164;112;164;76	ENSP00000356573:T160I;ENSP00000405048:T112I;ENSP00000350509:T164I;ENSP00000340090:T112I;ENSP00000275235:T164I;ENSP00000407817:T76I	ENSP00000275235:T164I	T	+	2	0	AIG1	143647031	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	1.224000	0.32539	0.808000	0.34231	0.655000	0.94253	ACC		0.433	AIG1-005	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000042510.1	NM_016108		4	31	0	0	0	0	4	31				
SUN1	23353	broad.mit.edu	37	7	883126	883126	+	Silent	SNP	G	G	A	rs370251394		TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr7:883126G>A	ENST00000405266.1	+	5	651	c.627G>A	c.(625-627)tcG>tcA	p.S209S	SUN1_ENST00000425407.2_Silent_p.S159S|SUN1_ENST00000401592.1_Silent_p.S209S|SUN1_ENST00000456758.2_Silent_p.S267S|SUN1_ENST00000403868.1_Silent_p.S209S|SUN1_ENST00000452783.2_Intron|SUN1_ENST00000457378.2_Silent_p.S230S|SUN1_ENST00000389574.3_Silent_p.S159S			O94901	SUN1_HUMAN	Sad1 and UNC84 domain containing 1	209	SYNE2-binding.				cytoskeletal anchoring at nuclear membrane (GO:0090286)|nuclear envelope organization (GO:0006998)|nuclear matrix anchoring at nuclear membrane (GO:0090292)	acrosomal membrane (GO:0002080)|integral component of nuclear inner membrane (GO:0005639)|nuclear envelope (GO:0005635)|SUN-KASH complex (GO:0034993)		p.S159S(1)		NS(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(17)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GGCCCGTGTCGAGAGTTTATT	0.522																																						uc011jvp.1		NA																	1	Substitution - coding silent(1)		large_intestine(1)		0						c.(625-627)TCG>TCA		unc-84 homolog A isoform a		G	,,,,	0,3756		0,0,1878	90.0	104.0	100.0		627,,690,627,477	-8.8	0.0	7		100	1,8193		0,1,4096	no	coding-synonymous,intron,coding-synonymous,coding-synonymous,coding-synonymous	SUN1	NM_001130965.2,NM_001171944.1,NM_001171945.1,NM_001171946.1,NM_025154.5	,,,,	0,1,5974	AA,AG,GG		0.0122,0.0,0.0084	,,,,	209/786,,230/279,209/258,159/703	883126	1,11949	1878	4097	5975	SO:0001819	synonymous_variant	23353				cytoskeletal anchoring at nuclear membrane|nuclear matrix anchoring at nuclear membrane	integral to membrane|nuclear inner membrane|SUN-KASH complex	protein binding	g.chr7:883126G>A	AF202724	CCDS43533.1, CCDS47525.1, CCDS55078.1, CCDS55079.1, CCDS55080.1	7p22.3	2010-01-27	2010-01-27	2010-01-27	ENSG00000164828	ENSG00000164828			18587	protein-coding gene	gene with protein product	"""Sad1 unc-84 domain protein 1"""	607723	"""unc-84 homolog A (C. elegans)"""	UNC84A		11593002	Standard	NM_001130965		Approved	KIAA0810, FLJ12407	uc021zym.1	O94901	OTTHUMG00000151426	ENST00000405266.1:c.627G>A	7.37:g.883126G>A			Somatic				SUN1_uc010ksa.1_Silent_p.S230S|SUN1_uc003sje.1_Silent_p.S209S|SUN1_uc003sjf.2_Silent_p.S159S|SUN1_uc011jvq.1_Intron|SUN1_uc003sjg.2_Silent_p.S20S	p.S209S	NM_001130965	NP_001124437	WXS	Illumina HiSeq	Unspecified	O94901	SUN1_HUMAN			6	706	+			209			SYNE2-binding.|Nuclear.		A5PL20|B3KMV7|B4DZF7|B7WNY4|B7WP53|E9PDU4|E9PF23|F8WD13|Q96CZ7|Q9HA14|Q9UH98	Silent	SNP	ENST00000405266.1	37	c.627G>A		.	.	.	.	.	.	.	.	.	.	G	4.232	0.041992	0.08196	0.0	1.22E-4	ENSG00000164828	ENST00000419312	.	.	.	4.4	-8.8	0.00817	.	.	.	.	.	T	0.34978	0.0916	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	T	0.51957	-0.8639	4	.	.	.	-5.5543	12.2413	0.54544	0.6045:0.3114:0.0842:0.0	.	.	.	.	Q	50	.	.	R	+	2	0	SUN1	849652	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-5.451000	0.00121	-5.250000	0.00018	-1.366000	0.01203	CGA		0.522	SUN1-001	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000322566.1	NM_025154		47	144	0	0	0	0	47	144				
RAC1	5879	broad.mit.edu	37	7	6426860	6426860	+	Missense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr7:6426860G>A	ENST00000348035.4	+	2	266	c.53G>A	c.(52-54)tGc>tAc	p.C18Y	RAC1_ENST00000356142.4_Missense_Mutation_p.C18Y|RAC1_ENST00000488373.1_3'UTR	NM_006908.4	NP_008839.2	P63000	RAC1_HUMAN	ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)	18					actin cytoskeleton organization (GO:0030036)|actin filament polymerization (GO:0030041)|anatomical structure arrangement (GO:0048532)|anatomical structure morphogenesis (GO:0009653)|apoptotic signaling pathway (GO:0097190)|auditory receptor cell morphogenesis (GO:0002093)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|bone resorption (GO:0045453)|cell adhesion (GO:0007155)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|cell-cell junction organization (GO:0045216)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|cerebral cortex radially oriented cell migration (GO:0021799)|cochlea morphogenesis (GO:0090103)|dendrite morphogenesis (GO:0048813)|dopaminergic neuron differentiation (GO:0071542)|embryonic olfactory bulb interneuron precursor migration (GO:0021831)|engulfment of apoptotic cell (GO:0043652)|epithelial cell morphogenesis (GO:0003382)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G-protein coupled receptor signaling pathway (GO:0007186)|hyperosmotic response (GO:0006972)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lamellipodium assembly (GO:0030032)|localization within membrane (GO:0051668)|mast cell chemotaxis (GO:0002551)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of receptor-mediated endocytosis (GO:0048261)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA replication (GO:0045740)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein localization to plasma membrane (GO:0072659)|regulation of cell migration (GO:0030334)|regulation of defense response to virus by virus (GO:0050690)|regulation of hydrogen peroxide metabolic process (GO:0010310)|regulation of respiratory burst (GO:0060263)|response to wounding (GO:0009611)|ruffle assembly (GO:0097178)|ruffle organization (GO:0031529)|semaphorin-plexin signaling pathway (GO:0071526)|small GTPase mediated signal transduction (GO:0007264)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell costimulation (GO:0031295)|viral process (GO:0016032)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|lamellipodium (GO:0030027)|membrane (GO:0016020)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	enzyme binding (GO:0019899)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GDP-dissociation inhibitor binding (GO:0051022)|thioesterase binding (GO:0031996)			cervix(1)|endometrium(1)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	8		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.104)	Dextromethorphan(DB00514)	GGTAAAACTTGCCTACTGATC	0.338																																						uc003spx.2		NA																	0				lung(2)	2						c.(52-54)TGC>TAC		ras-related C3 botulinum toxin substrate 1	Pravastatin(DB00175)|Simvastatin(DB00641)						118.0	116.0	117.0					7																	6426860		2203	4299	6502	SO:0001583	missense	5879				actin filament polymerization|apoptosis|axon guidance|cell motility|cell-matrix adhesion|induction of apoptosis by extracellular signals|inflammatory response|lamellipodium assembly|localization within membrane|negative regulation of interleukin-23 production|negative regulation of receptor-mediated endocytosis|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of lamellipodium assembly|positive regulation of Rho protein signal transduction|regulation of cell migration|regulation of defense response to virus by virus|regulation of hydrogen peroxide metabolic process|regulation of respiratory burst|ruffle organization|small GTPase mediated signal transduction|T cell costimulation|viral reproduction	cytosol|melanosome|plasma membrane	GTP binding|GTP-dependent protein binding|GTPase activity|thioesterase binding	g.chr7:6426860G>A	AJ132695	CCDS5348.1, CCDS5349.1	7p22	2014-01-30			ENSG00000136238	ENSG00000136238		"""Endogenous ligands"""	9801	protein-coding gene	gene with protein product		602048				2674130, 10597294	Standard	NM_006908		Approved	TC-25, p21-Rac1, Rac-1	uc003spw.3	P63000	OTTHUMG00000023540	ENST00000348035.4:c.53G>A	7.37:g.6426860G>A	ENSP00000258737:p.Cys18Tyr		Somatic				RAC1_uc003spw.2_Missense_Mutation_p.C18Y	p.C18Y	NM_006908	NP_008839	WXS	Illumina HiSeq	Unspecified	P63000	RAC1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.104)	2	294	+		Ovarian(82;0.0776)	18					O95501|P15154|Q3Y4D3|Q5JAA8|Q9BTB4	Missense_Mutation	SNP	ENST00000348035.4	37	c.53G>A	CCDS5348.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.807224	0.90623	.	.	ENSG00000136238	ENST00000348035;ENST00000356142	T;T	0.70631	-0.5;-0.5	6.05	6.05	0.98169	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.89687	0.6787	H	0.95504	3.68	0.80722	D	1	D;D	0.89917	0.995;1.0	D;D	0.80764	0.965;0.994	D	0.91615	0.5306	10	0.87932	D	0	.	20.2117	0.98287	0.0:0.0:1.0:0.0	.	18;18	P63000;A4D2P0	RAC1_HUMAN;.	Y	18	ENSP00000258737:C18Y;ENSP00000348461:C18Y	ENSP00000258737:C18Y	C	+	2	0	RAC1	6393385	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	9.611000	0.98342	2.878000	0.98634	0.650000	0.86243	TGC		0.338	RAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242868.2	NM_018890		17	41	0	0	0	0	17	41				
DFNA5	1687	broad.mit.edu	37	7	24756873	24756873	+	Splice_Site	SNP	C	C	T	rs529901453		TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr7:24756873C>T	ENST00000342947.3	-	5	1122	c.697G>A	c.(697-699)Gag>Aag	p.E233K	DFNA5_ENST00000559637.1_5'UTR|DFNA5_ENST00000409775.3_Splice_Site_p.E233K|DFNA5_ENST00000419307.1_Splice_Site_p.E69K|DFNA5_ENST00000409970.1_Splice_Site_p.E69K|DFNA5_ENST00000545231.1_Splice_Site_p.E69K	NM_004403.2	NP_004394.1	O60443	DFNA5_HUMAN	deafness, autosomal dominant 5	233					apoptotic process (GO:0006915)|inner ear receptor cell differentiation (GO:0060113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(3)|stomach(1)	19						TGGCACTCACCGAACTGGCCG	0.562													C|||	1	0.000199681	0.0	0.0	5008	,	,		21145	0.001		0.0	False		,,,				2504	0.0				GBM(78;184 1250 20134 20900 23600)	uc010kus.1		NA																	0				ovary(1)	1						c.(697-699)GAG>AAG		deafness, autosomal dominant 5 protein isoform							133.0	101.0	112.0					7																	24756873		2203	4300	6503	SO:0001630	splice_region_variant	1687				sensory perception of sound			g.chr7:24756873C>T	AF007790	CCDS5389.1, CCDS47563.1	7p15	2011-07-01			ENSG00000105928	ENSG00000105928			2810	protein-coding gene	gene with protein product		608798				8589696, 9450185	Standard	NM_004403		Approved	ICERE-1	uc010kus.1	O60443	OTTHUMG00000023237	ENST00000342947.3:c.697+1G>A	7.37:g.24756873C>T			Somatic				DFNA5_uc003swz.2_Missense_Mutation_p.E69K|DFNA5_uc003sxa.1_Missense_Mutation_p.E233K|DFNA5_uc010kut.1_Missense_Mutation_p.E69K|DFNA5_uc003sxb.2_Missense_Mutation_p.G233S	p.E233K	NM_001127453	NP_001120925	WXS	Illumina HiSeq	Unspecified	O60443	DFNA5_HUMAN			5	785	-			233					A4D156|B2RAX9|B3KT05|O14590|Q08AQ8|Q9UBV3	Missense_Mutation	SNP	ENST00000342947.3	37	c.697G>A	CCDS5389.1	.	.	.	.	.	.	.	.	.	.	C	12.69	2.012746	0.35511	.	.	ENSG00000105928	ENST00000342947;ENST00000419307;ENST00000545231;ENST00000409970;ENST00000409775	T;T;T;T;T	0.25414	1.8;1.8;1.8;1.8;1.8	5.53	5.53	0.82687	.	0.169998	0.51477	D	0.000086	T	0.27027	0.0662	L	0.50919	1.6	0.58432	D	0.999996	B	0.29886	0.26	B	0.22386	0.039	T	0.02758	-1.1114	10	0.49607	T	0.09	-13.9947	18.2178	0.89892	0.0:1.0:0.0:0.0	.	233	O60443	DFNA5_HUMAN	K	233;69;69;69;233	ENSP00000339587:E233K;ENSP00000401332:E69K;ENSP00000442661:E69K;ENSP00000387119:E69K;ENSP00000386670:E233K	ENSP00000339587:E233K	E	-	1	0	DFNA5	24723398	1.000000	0.71417	0.999000	0.59377	0.062000	0.15995	3.252000	0.51461	2.594000	0.87642	0.655000	0.94253	GAG		0.562	DFNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214060.2	NM_004403	Missense_Mutation	10	35	0	0	0	0	10	35				
PKD1L1	168507	broad.mit.edu	37	7	47944031	47944031	+	Missense_Mutation	SNP	G	G	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr7:47944031G>T	ENST00000289672.2	-	12	1925	c.1875C>A	c.(1873-1875)gaC>gaA	p.D625E		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	625	PKD 2. {ECO:0000255|PROSITE- ProRule:PRU00151}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						CATCCCCAAAGTCCCACAGGT	0.602																																						uc003tny.1		NA																	0				ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11						c.(1873-1875)GAC>GAA		polycystin-1L1							71.0	58.0	63.0					7																	47944031		2203	4300	6503	SO:0001583	missense	168507				cell-cell adhesion	integral to membrane		g.chr7:47944031G>T	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.1875C>A	7.37:g.47944031G>T	ENSP00000289672:p.Asp625Glu		Somatic					p.D625E	NM_138295	NP_612152	WXS	Illumina HiSeq	Unspecified	Q8TDX9	PK1L1_HUMAN			12	1875	-			625			Extracellular (Potential).|PKD 2.		Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	37	c.1875C>A	CCDS34633.1	.	.	.	.	.	.	.	.	.	.	G	19.13	3.766957	0.69878	.	.	ENSG00000158683	ENST00000289672	T	0.73789	-0.78	4.9	2.07	0.26955	PKD/Chitinase domain (1);PKD domain (4);	0.751749	0.11582	N	0.549617	T	0.74291	0.3697	L	0.52206	1.635	0.21553	N	0.999644	D	0.53619	0.961	P	0.54924	0.764	T	0.60193	-0.7311	10	0.31617	T	0.26	-16.777	6.4346	0.21817	0.3827:0.0:0.6173:0.0	.	625	Q8TDX9	PK1L1_HUMAN	E	625	ENSP00000289672:D625E	ENSP00000289672:D625E	D	-	3	2	PKD1L1	47910556	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	1.039000	0.30266	0.613000	0.30089	0.585000	0.79938	GAC		0.602	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295		13	25	1	0	2.27e-07	2.5e-07	13	25				
ZNF479	90827	broad.mit.edu	37	7	57188354	57188354	+	Silent	SNP	A	A	G			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr7:57188354A>G	ENST00000331162.4	-	5	1038	c.768T>C	c.(766-768)ctT>ctC	p.L256L		NM_033273.1	NP_150376.1	Q96JC4	ZN479_HUMAN	zinc finger protein 479	256					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(53)|ovary(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	84			GBM - Glioblastoma multiforme(1;9.18e-12)			TATGTCTAGTAAGGTTTGCAG	0.428																																						uc010kzo.2		NA																	0				ovary(3)|skin(1)	4						c.(766-768)CTT>CTC		zinc finger protein 479							44.0	45.0	45.0					7																	57188354		2108	4245	6353	SO:0001819	synonymous_variant	90827				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:57188354A>G	AF277624	CCDS43590.1	7p11.2	2013-01-08			ENSG00000185177	ENSG00000185177		"""Zinc fingers, C2H2-type"", ""-"""	23258	protein-coding gene	gene with protein product						11410164	Standard	NM_033273		Approved	KR19	uc010kzo.3	Q96JC4	OTTHUMG00000156682	ENST00000331162.4:c.768T>C	7.37:g.57188354A>G			Somatic					p.L256L	NM_033273	NP_150376	WXS	Illumina HiSeq	Unspecified	Q96JC4	ZN479_HUMAN	GBM - Glioblastoma multiforme(1;9.18e-12)		5	1039	-			256			C2H2-type 3.			Silent	SNP	ENST00000331162.4	37	c.768T>C	CCDS43590.1																																																																																				0.428	ZNF479-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345302.1	XM_291202		6	32	0	0	0	0	6	32				
HIP1	3092	broad.mit.edu	37	7	75192259	75192259	+	Missense_Mutation	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr7:75192259C>T	ENST00000336926.6	-	11	1026	c.1000G>A	c.(1000-1002)Gac>Aac	p.D334N	HIP1_ENST00000434438.2_Missense_Mutation_p.D334N	NM_005338.5	NP_005329.3	O00291	HIP1_HUMAN	huntingtin interacting protein 1	334					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|positive regulation of receptor-mediated endocytosis (GO:0048260)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|phosphatidylinositol binding (GO:0035091)|structural constituent of cytoskeleton (GO:0005200)			breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						GCATCCATGTCCATGAGGTCA	0.592			T	PDGFRB	CMML																																	uc003uds.1		NA		Dom	yes		7	7q11.23	3092	T	huntingtin interacting protein 1			L	PDGFRB		CMML		0				lung(3)|pancreas(2)|ovary(1)|breast(1)|central_nervous_system(1)	8						c.(1000-1002)GAC>AAC		huntingtin interacting protein 1							58.0	54.0	55.0					7																	75192259		2203	4300	6503	SO:0001583	missense	3092				activation of caspase activity|cell differentiation|clathrin coat assembly|endocytosis|induction of apoptosis|positive regulation of receptor-mediated endocytosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	clathrin coated vesicle membrane|cytoskeleton|Golgi apparatus|membrane fraction|nucleus	actin binding|clathrin binding|phosphatidylinositol binding|structural constituent of cytoskeleton	g.chr7:75192259C>T	AF052288	CCDS34669.1, CCDS59060.1	7q11.23	2008-07-18			ENSG00000127946	ENSG00000127946			4913	protein-coding gene	gene with protein product		601767				9140394, 9147654	Standard	NM_005338		Approved	ILWEQ	uc003uds.2	O00291	OTTHUMG00000156050	ENST00000336926.6:c.1000G>A	7.37:g.75192259C>T	ENSP00000336747:p.Asp334Asn		Somatic				HIP1_uc011kfz.1_Missense_Mutation_p.D211N	p.D334N	NM_005338	NP_005329	WXS	Illumina HiSeq	Unspecified	O00291	HIP1_HUMAN			11	1041	-			334					B4E3I7|E7ES17|O00328|Q2TB58|Q8TDL4	Missense_Mutation	SNP	ENST00000336926.6	37	c.1000G>A	CCDS34669.1	.	.	.	.	.	.	.	.	.	.	C	19.89	3.911869	0.72983	.	.	ENSG00000127946	ENST00000336926;ENST00000434438	T;T	0.15834	2.62;2.39	5.58	5.58	0.84498	.	0.323197	0.38272	N	0.001756	T	0.16514	0.0397	N	0.24115	0.695	0.58432	D	0.999995	B;B	0.30281	0.027;0.275	B;B	0.34038	0.007;0.174	T	0.04840	-1.0923	10	0.54805	T	0.06	-20.0329	18.5719	0.91138	0.0:1.0:0.0:0.0	.	334;334	E7ES17;O00291	.;HIP1_HUMAN	N	334	ENSP00000336747:D334N;ENSP00000410300:D334N	ENSP00000336747:D334N	D	-	1	0	HIP1	75030195	1.000000	0.71417	1.000000	0.80357	0.645000	0.38454	7.298000	0.78815	2.630000	0.89119	0.655000	0.94253	GAC		0.592	HIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342863.2	NM_005338		4	27	0	0	0	0	4	27				
PLXNA4	91584	broad.mit.edu	37	7	131849918	131849918	+	Missense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr7:131849918G>A	ENST00000359827.3	-	23	5290	c.4328C>T	c.(4327-4329)aCt>aTt	p.T1443I	PLXNA4_ENST00000321063.4_Missense_Mutation_p.T1443I			Q9HCM2	PLXA4_HUMAN	plexin A4	1443					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						GAGGAGGAAAGTAAACCAATT	0.517																																						uc003vra.3		NA																	0				ovary(1)	1						c.(4327-4329)ACT>ATT		plexin A4 isoform 1							107.0	118.0	114.0					7																	131849918		2180	4281	6461	SO:0001583	missense	91584					integral to membrane|intracellular|plasma membrane		g.chr7:131849918G>A	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.4328C>T	7.37:g.131849918G>A	ENSP00000352882:p.Thr1443Ile		Somatic					p.T1443I	NM_020911	NP_065962	WXS	Illumina HiSeq	Unspecified	Q9HCM2	PLXA4_HUMAN			23	4557	-			1443			Cytoplasmic (Potential).		A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	37	c.4328C>T	CCDS43646.1	.	.	.	.	.	.	.	.	.	.	G	33	5.229825	0.95173	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.12569	2.67;2.67	5.67	5.67	0.87782	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.41119	0.1145	M	0.80982	2.52	0.80722	D	1	D	0.57571	0.98	P	0.62740	0.906	T	0.28744	-1.0034	10	0.87932	D	0	.	19.7629	0.96329	0.0:0.0:1.0:0.0	.	1443	Q9HCM2	PLXA4_HUMAN	I	1443	ENSP00000323194:T1443I;ENSP00000352882:T1443I	ENSP00000323194:T1443I	T	-	2	0	PLXNA4	131500458	1.000000	0.71417	0.983000	0.44433	0.990000	0.78478	9.869000	0.99810	2.666000	0.90696	0.561000	0.74099	ACT		0.517	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775		19	47	0	0	0	0	19	47				
GIMAP2	26157	broad.mit.edu	37	7	150389491	150389491	+	Silent	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr7:150389491G>A	ENST00000223293.5	+	3	211	c.117G>A	c.(115-117)ggG>ggA	p.G39G		NM_015660.2	NP_056475.1	Q9UG22	GIMA2_HUMAN	GTPase, IMAP family member 2	39	AIG1-type G.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)	GTP binding (GO:0005525)			kidney(1)|large_intestine(1)|lung(8)|skin(2)|urinary_tract(1)	13			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GTGCTGCAGGGAACAGCATCC	0.512																																						uc003who.2		NA																	0				skin(1)	1						c.(115-117)GGG>GGA		GTPase, IMAP family member 2							76.0	66.0	70.0					7																	150389491		2203	4300	6503	SO:0001819	synonymous_variant	26157					integral to membrane	GTP binding	g.chr7:150389491G>A	AL110151	CCDS5905.1	7q36.1	2014-04-04			ENSG00000106560	ENSG00000106560		"""GTPases, IMAP"""	21789	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 12"""	608085				15474311	Standard	NM_015660		Approved	DKFZp586D0824, HIMAP2, IMAP2, IAN12	uc003who.3	Q9UG22	OTTHUMG00000157488	ENST00000223293.5:c.117G>A	7.37:g.150389491G>A			Somatic				GIMAP1_uc003whp.2_Intron	p.G39G	NM_015660	NP_056475	WXS	Illumina HiSeq	Unspecified	Q9UG22	GIMA2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	3	205	+			39					Q96L25	Silent	SNP	ENST00000223293.5	37	c.117G>A	CCDS5905.1																																																																																				0.512	GIMAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348948.1	NM_015660		7	23	0	0	0	0	7	23				
DLGAP2	9228	broad.mit.edu	37	8	1626408	1626408	+	Missense_Mutation	SNP	G	G	A	rs34274599		TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr8:1626408G>A	ENST00000421627.2	+	9	2211	c.2077G>A	c.(2077-2079)Gtc>Atc	p.V693I		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	772					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		TTCTAACAGCGTCACGGCCGC	0.557																																						uc003wpl.2		NA																	0					0						c.(2077-2079)GTC>ATC		discs large-associated protein 2							53.0	58.0	56.0					8																	1626408		2091	4193	6284	SO:0001583	missense	9228				neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding	g.chr8:1626408G>A	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.2077G>A	8.37:g.1626408G>A	ENSP00000400258:p.Val693Ile		Somatic				DLGAP2_uc003wpm.2_Missense_Mutation_p.V679I	p.V693I	NM_004745	NP_004736	WXS	Illumina HiSeq	Unspecified	Q9P1A6	DLGP2_HUMAN		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)	9	2174	+		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)	772					A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Missense_Mutation	SNP	ENST00000421627.2	37	c.2077G>A	CCDS47760.1	.	.	.	.	.	.	.	.	.	.	G	31	5.077811	0.94000	.	.	ENSG00000198010	ENST00000356067;ENST00000421627	T	0.20738	2.05	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.50171	0.1600	M	0.81942	2.565	0.48135	D	0.999596	D;D	0.76494	0.999;0.999	D;D	0.72075	0.96;0.976	T	0.57619	-0.7780	10	0.72032	D	0.01	-13.8981	17.9665	0.89100	0.0:0.0:1.0:0.0	rs34274599	758;772	Q9P1A6-2;Q9P1A6	.;DLGP2_HUMAN	I	724;693	ENSP00000400258:V693I	ENSP00000348366:V724I	V	+	1	0	DLGAP2	1613815	1.000000	0.71417	0.997000	0.53966	0.920000	0.55202	9.260000	0.95568	2.231000	0.72958	0.557000	0.71058	GTC		0.557	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745		18	36	0	0	0	0	18	36				
CHD7	55636	broad.mit.edu	37	8	61765577	61765577	+	Missense_Mutation	SNP	G	G	A	rs375199214		TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr8:61765577G>A	ENST00000423902.2	+	31	6772	c.6293G>A	c.(6292-6294)cGa>cAa	p.R2098Q	CHD7_ENST00000524602.1_Intron	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	2098					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			CGGCATGACCGAGACTTGCTG	0.542													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19850	0.0		0.0	False		,,,				2504	0.0					uc003xue.2		NA																	0				ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9						c.(6292-6294)CGA>CAA		chromodomain helicase DNA binding protein 7		G	GLN/ARG	1,4161		0,1,2080	93.0	105.0	101.0		6293	4.3	1.0	8		101	0,8426		0,0,4213	no	missense	CHD7	NM_017780.3	43	0,1,6293	AA,AG,GG		0.0,0.024,0.0079	possibly-damaging	2098/2998	61765577	1,12587	2081	4213	6294	SO:0001583	missense	55636				central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity	g.chr8:61765577G>A	AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.6293G>A	8.37:g.61765577G>A	ENSP00000392028:p.Arg2098Gln		Somatic					p.R2098Q	NM_017780	NP_060250	WXS	Illumina HiSeq	Unspecified	Q9P2D1	CHD7_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.143)		31	6770	+		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	2098					D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	SNP	ENST00000423902.2	37	c.6293G>A	CCDS47865.1	.	.	.	.	.	.	.	.	.	.	G	17.71	3.455778	0.63401	2.4E-4	0.0	ENSG00000171316	ENST00000307121;ENST00000423902	T	0.74315	-0.83	5.41	4.34	0.51931	.	0.578395	0.16344	N	0.218511	T	0.66436	0.2789	L	0.60067	1.865	0.34937	D	0.749932	P	0.42518	0.782	B	0.35470	0.203	T	0.76599	-0.2900	10	0.52906	T	0.07	-13.1808	9.7301	0.40355	0.1585:0.0:0.8415:0.0	.	2098	Q9P2D1	CHD7_HUMAN	Q	2098	ENSP00000392028:R2098Q	ENSP00000307304:R2098Q	R	+	2	0	CHD7	61928131	0.985000	0.35326	0.988000	0.46212	0.985000	0.73830	1.959000	0.40412	2.539000	0.85634	0.655000	0.94253	CGA		0.542	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2	XM_098762		13	26	0	0	0	0	13	26				
KCNB2	9312	broad.mit.edu	37	8	73480224	73480224	+	Silent	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr8:73480224C>T	ENST00000523207.1	+	2	843	c.255C>T	c.(253-255)aaC>aaT	p.N85N		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	85					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	TGAACGAGAACGAGTATTTCT	0.512																																						uc003xzb.2		NA																	0				skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7						c.(253-255)AAC>AAT		potassium voltage-gated channel, Shab-related							83.0	81.0	82.0					8																	73480224		2203	4300	6503	SO:0001819	synonymous_variant	9312				regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding	g.chr8:73480224C>T	U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.255C>T	8.37:g.73480224C>T			Somatic					p.N85N	NM_004770	NP_004761	WXS	Illumina HiSeq	Unspecified	Q92953	KCNB2_HUMAN	Epithelial(68;0.105)		2	843	+	Breast(64;0.137)		85			Cytoplasmic (Potential).		Q7Z7D0|Q9BXD3	Silent	SNP	ENST00000523207.1	37	c.255C>T	CCDS6209.1																																																																																				0.512	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1	NM_004770		17	47	0	0	0	0	17	47				
RAD54B	25788	broad.mit.edu	37	8	95419835	95419835	+	Missense_Mutation	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr8:95419835C>T	ENST00000336148.5	-	5	737	c.613G>A	c.(613-615)Ggc>Agc	p.G205S		NM_012415.3	NP_036547.1	Q9Y620	RA54B_HUMAN	RAD54 homolog B (S. cerevisiae)	205					ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair via homologous recombination (GO:0000724)|mitotic recombination (GO:0006312)|reciprocal meiotic recombination (GO:0007131)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|RNA helicase activity (GO:0003724)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(10)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)			AAACACCTGCCACTGCTGAAG	0.418								Direct reversal of damage;Homologous recombination																														uc003ygk.2		NA																	0				kidney(2)|lung(1)|skin(1)	4						c.(613-615)GGC>AGC	Direct_reversal_of_damage|Homologous_recombination	RAD54 homolog B							102.0	104.0	103.0					8																	95419835		2203	4300	6503	SO:0001583	missense	25788				double-strand break repair via homologous recombination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA translocase activity|protein binding	g.chr8:95419835C>T	AF112481	CCDS6262.1, CCDS56546.1, CCDS75768.1	8q22.1	2014-08-08			ENSG00000197275	ENSG00000197275			17228	protein-coding gene	gene with protein product		604289				10362364, 10851248	Standard	NM_012415		Approved	RDH54	uc003ygk.3	Q9Y620	OTTHUMG00000133658	ENST00000336148.5:c.613G>A	8.37:g.95419835C>T	ENSP00000336606:p.Gly205Ser		Somatic				RAD54B_uc010may.1_Missense_Mutation_p.G12S|RAD54B_uc003ygl.1_RNA	p.G205S	NM_012415	NP_036547	WXS	Illumina HiSeq	Unspecified	O95073	FSBP_HUMAN	BRCA - Breast invasive adenocarcinoma(8;0.00217)		5	711	-	Breast(36;4.5e-05)		Error:Variant_position_missing_in_O95073_after_alignment					F6WBS8	Missense_Mutation	SNP	ENST00000336148.5	37	c.613G>A	CCDS6262.1	.	.	.	.	.	.	.	.	.	.	C	36	5.624392	0.96660	.	.	ENSG00000197275	ENST00000336148	D	0.90563	-2.69	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	D	0.95548	0.8553	M	0.77616	2.38	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93692	0.7008	10	0.38643	T	0.18	-24.204	20.8598	0.99761	0.0:1.0:0.0:0.0	.	205	Q9Y620	RA54B_HUMAN	S	205	ENSP00000336606:G205S	ENSP00000336606:G205S	G	-	1	0	RAD54B	95489011	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.446000	0.80609	2.937000	0.99478	0.650000	0.86243	GGC		0.418	RAD54B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257806.3	NM_012415		5	44	0	0	0	0	5	44				
CPQ	10404	broad.mit.edu	37	8	97892096	97892096	+	Missense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr8:97892096G>A	ENST00000220763.5	+	4	922	c.712G>A	c.(712-714)Gat>Aat	p.D238N		NM_016134.2	NP_057218.1	Q9Y646	CBPQ_HUMAN	carboxypeptidase Q	238					peptide catabolic process (GO:0043171)|proteolysis (GO:0006508)|thyroid hormone generation (GO:0006590)|tissue regeneration (GO:0042246)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)	carboxypeptidase activity (GO:0004180)|metal ion binding (GO:0046872)|metallodipeptidase activity (GO:0070573)|protein homodimerization activity (GO:0042803)										TACGGTGGAAGATGCAGAAAT	0.463																																						uc003yhw.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(712-714)GAT>AAT		plasma glutamate carboxypeptidase precursor							186.0	180.0	182.0					8																	97892096		2203	4300	6503	SO:0001583	missense	10404				peptide metabolic process|proteolysis	cytoplasm|extracellular space	metal ion binding|metallocarboxypeptidase activity	g.chr8:97892096G>A	AF107834	CCDS6273.1	8q22.2	2012-02-17			ENSG00000104324	ENSG00000104324			16910	protein-coding gene	gene with protein product	"""lysosomal dipeptidase"", ""Ser-Met dipeptidase"", ""plasma glutamate carboxypeptidase"""					10206990	Standard	NM_016134		Approved	LDP, PGCP	uc003yhw.3	Q9Y646	OTTHUMG00000164690	ENST00000220763.5:c.712G>A	8.37:g.97892096G>A	ENSP00000220763:p.Asp238Asn		Somatic				PGCP_uc010mbe.2_Missense_Mutation_p.D238N	p.D238N	NM_016134	NP_057218	WXS	Illumina HiSeq	Unspecified	Q9Y646	PGCP_HUMAN			4	878	+	Breast(36;1.86e-05)		238					B2RD88|Q8NBZ1|Q9UNM8|Q9Y5X6	Missense_Mutation	SNP	ENST00000220763.5	37	c.712G>A	CCDS6273.1	.	.	.	.	.	.	.	.	.	.	G	32	5.154675	0.94686	.	.	ENSG00000104324	ENST00000220763	T	0.53640	0.61	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.72342	0.3448	M	0.84773	2.715	0.53005	D	0.999962	D;D	0.89917	0.999;1.0	D;D	0.81914	0.971;0.995	T	0.75158	-0.3416	10	0.56958	D	0.05	-15.4764	17.032	0.86463	0.0:0.0:1.0:0.0	.	238;238	B5MDX4;Q9Y646	.;PGCP_HUMAN	N	238	ENSP00000220763:D238N	ENSP00000220763:D238N	D	+	1	0	AC010859.1	97961272	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.414000	0.97362	2.775000	0.95449	0.586000	0.80456	GAT		0.463	CPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379757.2	NM_016134		5	134	0	0	0	0	5	134				
PKHD1L1	93035	broad.mit.edu	37	8	110412468	110412468	+	Silent	SNP	T	T	C			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr8:110412468T>C	ENST00000378402.5	+	13	1280	c.1176T>C	c.(1174-1176)ttT>ttC	p.F392F		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	392					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TTGCACGCTTTAGTGGATTTT	0.418										HNSCC(38;0.096)																												uc003yne.2		NA																	0				ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14						c.(1174-1176)TTT>TTC		fibrocystin L precursor							344.0	333.0	337.0					8																	110412468		1885	4107	5992	SO:0001819	synonymous_variant	93035				immune response	cytosol|extracellular space|integral to membrane	receptor activity	g.chr8:110412468T>C	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.1176T>C	8.37:g.110412468T>C		HNSCC(38;0.096)	Somatic					p.F392F	NM_177531	NP_803875	WXS	Illumina HiSeq	Unspecified	Q86WI1	PKHL1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)		13	1280	+			392			Extracellular (Potential).		Q567P2|Q9UF27	Silent	SNP	ENST00000378402.5	37	c.1176T>C	CCDS47911.1																																																																																				0.418	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531		23	228	0	0	0	0	23	228				
PKHD1L1	93035	broad.mit.edu	37	8	110535536	110535536	+	Silent	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr8:110535536C>T	ENST00000378402.5	+	76	12509	c.12405C>T	c.(12403-12405)gtC>gtT	p.V4135V		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	4135					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			ATAACCAAGTCAATGGCCTTA	0.398										HNSCC(38;0.096)																												uc003yne.2		NA																	0				ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14						c.(12403-12405)GTC>GTT		fibrocystin L precursor							115.0	111.0	112.0					8																	110535536		1891	4117	6008	SO:0001819	synonymous_variant	93035				immune response	cytosol|extracellular space|integral to membrane	receptor activity	g.chr8:110535536C>T	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.12405C>T	8.37:g.110535536C>T		HNSCC(38;0.096)	Somatic					p.V4135V	NM_177531	NP_803875	WXS	Illumina HiSeq	Unspecified	Q86WI1	PKHL1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)		76	12509	+			4135			Extracellular (Potential).		Q567P2|Q9UF27	Silent	SNP	ENST00000378402.5	37	c.12405C>T	CCDS47911.1																																																																																				0.398	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531		18	48	0	0	0	0	18	48				
CSMD3	114788	broad.mit.edu	37	8	113353856	113353856	+	Nonsense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr8:113353856G>A	ENST00000297405.5	-	42	6746	c.6502C>T	c.(6502-6504)Cga>Tga	p.R2168*	CSMD3_ENST00000352409.3_Nonsense_Mutation_p.R2098*|CSMD3_ENST00000343508.3_Nonsense_Mutation_p.R2128*|CSMD3_ENST00000455883.2_Nonsense_Mutation_p.R2064*	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2168	CUB 12. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GATCCACTTCGTACTTCCAAA	0.368										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												uc003ynu.2		NA																	0				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(6502-6504)CGA>TGA		CUB and Sushi multiple domains 3 isoform 1							96.0	91.0	93.0					8																	113353856		2203	4300	6503	SO:0001587	stop_gained	114788					integral to membrane|plasma membrane		g.chr8:113353856G>A	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.6502C>T	8.37:g.113353856G>A	ENSP00000297405:p.Arg2168*	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003yns.2_Nonsense_Mutation_p.R1370*|CSMD3_uc003ynt.2_Nonsense_Mutation_p.R2128*|CSMD3_uc011lhx.1_Nonsense_Mutation_p.R2064*	p.R2168*	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			42	6661	-			2168			Extracellular (Potential).|CUB 12.		Q96PZ3	Nonsense_Mutation	SNP	ENST00000297405.5	37	c.6502C>T	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	47	13.176628	0.99725	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	.	.	.	4.56	0.701	0.18104	.	0.070979	0.53938	D	0.000045	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.2903	0.60267	0.0:0.0:0.3756:0.6244	.	.	.	.	X	2128;2168;1438;2064;2098	.	ENSP00000297405:R2168X	R	-	1	2	CSMD3	113423032	1.000000	0.71417	0.999000	0.59377	0.911000	0.54048	2.259000	0.43259	0.028000	0.15324	-1.115000	0.02055	CGA		0.368	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		13	18	0	0	0	0	13	18				
EIF3H	8667	broad.mit.edu	37	8	117658786	117658786	+	Silent	SNP	C	C	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr8:117658786C>A	ENST00000276682.4	-	9	1693	c.927G>T	c.(925-927)ccG>ccT	p.P309P	EIF3H_ENST00000521861.1_Silent_p.P295P					eukaryotic translation initiation factor 3, subunit H											large_intestine(2)|lung(10)|skin(1)	13	all_cancers(13;3.98e-22)|Lung NSC(37;0.000183)|Ovarian(258;0.0172)					CCTCAGGGAGCGGGGGTTCTC	0.527																																						uc003yoa.2		NA																	0				lung(3)	3						c.(883-885)CCG>CCT		eukaryotic translation initiation factor 3,							157.0	166.0	163.0					8																	117658786		2203	4300	6503	SO:0001819	synonymous_variant	8667				regulation of translational initiation	cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity	g.chr8:117658786C>A	U54559	CCDS6319.1	8q24.11	2007-07-27	2007-07-27	2007-07-27	ENSG00000147677	ENSG00000147677			3273	protein-coding gene	gene with protein product		603912	"""eukaryotic translation initiation factor 3, subunit 3 gamma, 40kDa"""	EIF3S3		9341143	Standard	NM_003756		Approved	eIF3-gamma, eIF3-p40, eIF3h	uc003yoa.3	O15372	OTTHUMG00000164919	ENST00000276682.4:c.927G>T	8.37:g.117658786C>A			Somatic				EIF3H_uc003yob.2_Silent_p.P309P	p.P295P	NM_003756	NP_003747	WXS	Illumina HiSeq	Unspecified	O15372	EIF3H_HUMAN			7	911	-	all_cancers(13;3.98e-22)|Lung NSC(37;0.000183)|Ovarian(258;0.0172)		295						Silent	SNP	ENST00000276682.4	37	c.885G>T																																																																																					0.527	EIF3H-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000380913.1	NM_003756		44	131	1	0	2.48e-24	2.87e-24	44	131				
PLEC	5339	broad.mit.edu	37	8	144991068	144991068	+	Silent	SNP	C	C	T	rs572187397		TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr8:144991068C>T	ENST00000322810.4	-	32	13501	c.13332G>A	c.(13330-13332)acG>acA	p.T4444T	PLEC_ENST00000345136.3_Silent_p.T4307T|PLEC_ENST00000398774.2_Silent_p.T4275T|PLEC_ENST00000354589.3_Silent_p.T4307T|PLEC_ENST00000354958.2_Silent_p.T4285T|PLEC_ENST00000527096.1_Silent_p.T4330T|PLEC_ENST00000356346.3_Silent_p.T4293T|PLEC_ENST00000436759.2_Silent_p.T4334T|PLEC_ENST00000357649.2_Silent_p.T4311T	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	4444	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GCCGCTGCCCCGTGATGTTAT	0.677													C|||	1	0.000199681	0.0	0.0	5008	,	,		16762	0.0		0.0	False		,,,				2504	0.001					uc003zaf.1		NA																	0				large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						c.(13330-13332)ACG>ACA		plectin isoform 1							32.0	38.0	36.0					8																	144991068		2094	4213	6307	SO:0001819	synonymous_variant	5339				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle	g.chr8:144991068C>T	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.13332G>A	8.37:g.144991068C>T			Somatic				PLEC_uc003zab.1_Silent_p.T4307T|PLEC_uc003zac.1_Silent_p.T4311T|PLEC_uc003zad.2_Silent_p.T4307T|PLEC_uc003zae.1_Silent_p.T4275T|PLEC_uc003zag.1_Silent_p.T4285T|PLEC_uc003zah.2_Silent_p.T4293T|PLEC_uc003zaj.2_Silent_p.T4334T	p.T4444T	NM_201380	NP_958782	WXS	Illumina HiSeq	Unspecified	Q15149	PLEC_HUMAN			32	13502	-			4444			Globular 2.|Plectin 29.		Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	c.13332G>A	CCDS43772.1																																																																																				0.677	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445		3	47	0	0	0	0	3	47				
ADAMTSL1	92949	broad.mit.edu	37	9	18574122	18574122	+	Missense_Mutation	SNP	T	T	C			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr9:18574122T>C	ENST00000380548.4	+	4	671	c.332T>C	c.(331-333)gTg>gCg	p.V111A	MIR3152_ENST00000579801.1_RNA|ADAMTSL1_ENST00000380566.4_Missense_Mutation_p.V111A|ADAMTSL1_ENST00000431052.2_Missense_Mutation_p.V111A|ADAMTSL1_ENST00000276935.6_Missense_Mutation_p.V111A|ADAMTSL1_ENST00000380570.4_Missense_Mutation_p.V111A|ADAMTSL1_ENST00000327883.7_Missense_Mutation_p.V111A	NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	111						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		TGGCTTCCTGTGTCTAATGAC	0.498																																						uc003zne.3		NA																	0				ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5						c.(331-333)GTG>GCG		ADAMTS-like 1 isoform 4 precursor							164.0	144.0	151.0					9																	18574122		2203	4300	6503	SO:0001583	missense	92949					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding	g.chr9:18574122T>C	AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.332T>C	9.37:g.18574122T>C	ENSP00000369921:p.Val111Ala		Somatic				ADAMTSL1_uc003znb.2_Missense_Mutation_p.V111A|ADAMTSL1_uc003znc.3_Missense_Mutation_p.V111A	p.V111A	NM_001040272	NP_001035362	WXS	Illumina HiSeq	Unspecified	Q8N6G6	ATL1_HUMAN		GBM - Glioblastoma multiforme(50;1.29e-17)	4	459	+			111					A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Missense_Mutation	SNP	ENST00000380548.4	37	c.332T>C	CCDS47954.1	.	.	.	.	.	.	.	.	.	.	T	17.27	3.346212	0.61073	.	.	ENSG00000178031	ENST00000380548;ENST00000327883;ENST00000431052;ENST00000380570;ENST00000380566;ENST00000276935	T;T;T;T;T;T	0.03524	3.9;3.9;3.9;3.9;3.9;3.9	5.25	5.25	0.73442	.	.	.	.	.	T	0.08447	0.0210	M	0.72118	2.19	0.80722	D	1	P;B	0.52316	0.952;0.001	P;B	0.44518	0.452;0.005	T	0.13045	-1.0524	9	0.41790	T	0.15	.	15.4522	0.75282	0.0:0.0:0.0:1.0	.	111;111	Q8N6G6;Q8N6G6-2	ATL1_HUMAN;.	A	111	ENSP00000369921:V111A;ENSP00000327887:V111A;ENSP00000401157:V111A;ENSP00000369944:V111A;ENSP00000369940:V111A;ENSP00000276935:V111A	ENSP00000276935:V111A	V	+	2	0	ADAMTSL1	18564122	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.830000	0.86741	2.118000	0.64928	0.523000	0.50628	GTG		0.498	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401206.1			41	108	0	0	0	0	41	108				
VCP	7415	broad.mit.edu	37	9	35059087	35059087	+	Missense_Mutation	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr9:35059087C>T	ENST00000358901.6	-	15	3029	c.2134G>A	c.(2134-2136)Gag>Aag	p.E712K		NM_007126.3	NP_009057.1	P55072	TERA_HUMAN	valosin containing protein	712					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|aggresome assembly (GO:0070842)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|positive regulation of Lys63-specific deubiquitinase activity (GO:1903007)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein K63-linked deubiquitination (GO:1903006)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|retrograde protein transport, ER to cytosol (GO:0030970)|translesion synthesis (GO:0019985)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Hrd1p ubiquitin ligase complex (GO:0000836)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|site of double-strand break (GO:0035861)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|deubiquitinase activator activity (GO:0035800)|lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|protein domain specific binding (GO:0019904)|protein phosphatase binding (GO:0019903)|ubiquitin-specific protease binding (GO:1990381)			breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			GTCTGCCTCTCTCGTTCTCGC	0.552																																						uc003zvy.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(2134-2136)GAG>AAG		valosin-containing protein							157.0	128.0	138.0					9																	35059087		2203	4300	6503	SO:0001583	missense	7415				activation of caspase activity|double-strand break repair|endoplasmic reticulum unfolded protein response|ER-associated protein catabolic process|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination|retrograde protein transport, ER to cytosol	cytosol|endoplasmic reticulum|microsome|nucleus|proteasome complex	ATP binding|ATPase activity|lipid binding|polyubiquitin binding|protein domain specific binding|protein phosphatase binding	g.chr9:35059087C>T	AC004472	CCDS6573.1	9p13.3	2014-09-17	2011-01-25		ENSG00000165280	ENSG00000165280		"""ATPases / AAA-type"""	12666	protein-coding gene	gene with protein product		601023	"""valosin-containing protein"""			8595912, 7553851	Standard	NM_007126		Approved	IBMPFD, p97	uc003zvy.2	P55072	OTTHUMG00000019855	ENST00000358901.6:c.2134G>A	9.37:g.35059087C>T	ENSP00000351777:p.Glu712Lys		Somatic				VCP_uc003zvz.2_RNA|VCP_uc010mkh.1_Missense_Mutation_p.E381K|VCP_uc010mki.1_Missense_Mutation_p.E667K	p.E712K	NM_007126	NP_009057	WXS	Illumina HiSeq	Unspecified	P55072	TERA_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)		15	2523	-			712					B2R5T8|Q0V924|Q2TAI5|Q969G7|Q9UCD5	Missense_Mutation	SNP	ENST00000358901.6	37	c.2134G>A	CCDS6573.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.145306	0.77888	.	.	ENSG00000165280	ENST00000358901	D	0.94828	-3.53	5.8	5.8	0.92144	.	0.046141	0.85682	D	0.000000	D	0.92532	0.7628	L	0.51422	1.61	0.80722	D	1	B	0.02656	0.0	B	0.10450	0.005	D	0.88231	0.2903	10	0.19590	T	0.45	-32.5872	20.0591	0.97667	0.0:1.0:0.0:0.0	.	712	P55072	TERA_HUMAN	K	712	ENSP00000351777:E712K	ENSP00000351777:E712K	E	-	1	0	VCP	35049087	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.783000	0.85696	2.747000	0.94245	0.462000	0.41574	GAG		0.552	VCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052290.1	NM_007126		21	54	0	0	0	0	21	54				
FBXO10	26267	broad.mit.edu	37	9	37518327	37518327	+	Missense_Mutation	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr9:37518327C>T	ENST00000432825.2	-	9	2357	c.2309G>A	c.(2308-2310)cGa>cAa	p.R770Q	FBXO10_ENST00000541829.1_Missense_Mutation_p.R295Q|RP11-613M10.8_ENST00000544475.1_5'UTR	NM_012166.2	NP_036298.2	Q9UK96	FBX10_HUMAN	F-box protein 10	770					apoptotic process (GO:0006915)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(5)|large_intestine(11)|lung(15)|prostate(1)|upper_aerodigestive_tract(1)	34				GBM - Glioblastoma multiforme(29;0.0107)		GTTGGCCACTCGGGTGGGTTG	0.567																																						uc004aab.2		NA																	0				lung(5)	5						c.(2308-2310)CGA>CAA		F-box protein 10							79.0	89.0	86.0					9																	37518327		2138	4238	6376	SO:0001583	missense	26267					ubiquitin ligase complex	ubiquitin-protein ligase activity	g.chr9:37518327C>T	AF174598	CCDS47966.1	9p13.1	2014-01-29	2004-06-15		ENSG00000147912	ENSG00000147912		"""F-boxes /  ""other"""""	13589	protein-coding gene	gene with protein product		609092	"""F-box only protein 10"""			10531035, 10531037, 19300908	Standard	NM_012166		Approved	FBX10	uc004aab.3	Q9UK96	OTTHUMG00000019926	ENST00000432825.2:c.2309G>A	9.37:g.37518327C>T	ENSP00000403802:p.Arg770Gln		Somatic				FBXO10_uc004aac.2_Missense_Mutation_p.R786Q|FBXO10_uc004aad.2_Missense_Mutation_p.R320Q	p.R770Q	NM_012166	NP_036298	WXS	Illumina HiSeq	Unspecified	Q9UK96	FBX10_HUMAN		GBM - Glioblastoma multiforme(29;0.0107)	9	2358	-			770			PbH1 15.		Q08AL3|Q08AL4|Q5JRT8|Q9UKC3	Missense_Mutation	SNP	ENST00000432825.2	37	c.2309G>A	CCDS47966.1	.	.	.	.	.	.	.	.	.	.	C	29.5	5.010773	0.93346	.	.	ENSG00000147912	ENST00000432825;ENST00000541829	T;T	0.80393	-1.37;-1.37	5.36	4.43	0.53597	Pectin lyase fold/virulence factor (1);Carbohydrate-binding/sugar hydrolysis domain (1);Pectin lyase fold (1);	0.060146	0.64402	D	0.000004	T	0.77384	0.4122	L	0.29908	0.895	0.58432	D	0.999998	P;D;D	0.56287	0.908;0.975;0.975	P;P;P	0.52159	0.549;0.691;0.691	T	0.77490	-0.2568	10	0.51188	T	0.08	-5.2896	10.9977	0.47587	0.0:0.9023:0.0:0.0977	.	649;295;770	Q59F51;Q08AL4;Q9UK96	.;.;FBX10_HUMAN	Q	770;295	ENSP00000403802:R770Q;ENSP00000441307:R295Q	ENSP00000403802:R770Q	R	-	2	0	FBXO10	37508327	0.999000	0.42202	0.910000	0.35882	0.889000	0.51656	4.331000	0.59273	1.161000	0.42604	0.563000	0.77884	CGA		0.567	FBXO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052472.3			14	26	0	0	0	0	14	26				
DCAF10	79269	broad.mit.edu	37	9	37854962	37854962	+	Missense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr9:37854962G>A	ENST00000377724.3	+	4	1402	c.1037G>A	c.(1036-1038)aGa>aAa	p.R346K	DCAF10_ENST00000242323.7_Missense_Mutation_p.R346K|DCAF10_ENST00000483167.1_3'UTR|RP11-613M10.9_ENST00000540557.1_Intron	NM_024345.3	NP_077321.3	Q5QP82	DCA10_HUMAN	DDB1 and CUL4 associated factor 10	346					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	12						AGAGCAAGAAGAACTACTTCA	0.338																																						uc004aao.2		NA																	0				central_nervous_system(1)	1						c.(1036-1038)AGA>AAA		WD repeat domain 32							117.0	118.0	118.0					9																	37854962		2203	4300	6503	SO:0001583	missense	79269					CUL4 RING ubiquitin ligase complex		g.chr9:37854962G>A	BC003520	CCDS6613.2, CCDS75835.1	9p13.2	2013-01-09	2009-07-17	2009-07-17	ENSG00000122741	ENSG00000122741		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	23686	protein-coding gene	gene with protein product			"""WD repeat domain 32"""	WDR32			Standard	NM_001286810		Approved	MGC10765, FLJ23201	uc004aao.3	Q5QP82	OTTHUMG00000019934	ENST00000377724.3:c.1037G>A	9.37:g.37854962G>A	ENSP00000366953:p.Arg346Lys		Somatic				DCAF10_uc010mlz.2_Missense_Mutation_p.R173K|DCAF10_uc004aap.2_Missense_Mutation_p.R34K	p.R346K	NM_024345	NP_077321	WXS	Illumina HiSeq	Unspecified	Q5QP82	DCA10_HUMAN			4	1111	+			346					A4VCJ5|Q32NE2|Q8N2Q5|Q96ET5|Q9BTQ5|Q9H5P6	Missense_Mutation	SNP	ENST00000377724.3	37	c.1037G>A	CCDS6613.2	.	.	.	.	.	.	.	.	.	.	G	16.07	3.019852	0.54576	.	.	ENSG00000122741	ENST00000377724;ENST00000242323	T;T	0.73789	-0.43;-0.78	5.15	5.15	0.70609	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.76176	0.3951	N	0.24115	0.695	0.58432	D	0.99999	P;P	0.52842	0.756;0.956	P;D	0.65010	0.87;0.931	T	0.73132	-0.4079	10	0.25751	T	0.34	.	16.4724	0.84115	0.0:0.0:1.0:0.0	.	346;346	Q5QP82-2;Q5QP82	.;DCA10_HUMAN	K	346	ENSP00000366953:R346K;ENSP00000242323:R346K	ENSP00000242323:R346K	R	+	2	0	DCAF10	37844962	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.112000	0.94314	2.562000	0.86427	0.591000	0.81541	AGA		0.338	DCAF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052485.2	NM_024345		19	60	0	0	0	0	19	60				
GDA	9615	broad.mit.edu	37	9	74838108	74838108	+	Missense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr9:74838108G>A	ENST00000358399.3	+	7	772	c.679G>A	c.(679-681)Ggc>Agc	p.G227S	GDA_ENST00000376989.3_Intron|GDA_ENST00000545168.1_Missense_Mutation_p.G153S|GDA_ENST00000238018.4_Missense_Mutation_p.G227S|GDA_ENST00000376986.1_Intron|GDA_ENST00000477618.1_3'UTR	NM_001242505.2|NM_001242506.2|NM_004293.4	NP_001229434.1|NP_001229435.1|NP_004284.1	Q9Y2T3	GUAD_HUMAN	guanine deaminase	227					guanine catabolic process (GO:0006147)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	guanine deaminase activity (GO:0008892)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(1)|kidney(1)|large_intestine(1)|lung(20)|ovary(2)|skin(2)|urinary_tract(1)	32		Myeloproliferative disorder(762;0.0122)		Lung(182;0.0583)		GGGTGAACTGGGCAACATTGC	0.428																																						uc004aiq.2		NA																	0				ovary(2)|central_nervous_system(2)|skin(1)	5						c.(679-681)GGC>AGC		guanine deaminase							186.0	168.0	174.0					9																	74838108		2203	4300	6503	SO:0001583	missense	9615				nervous system development|purine base metabolic process|purine nucleotide catabolic process	cytosol	guanine deaminase activity|zinc ion binding	g.chr9:74838108G>A	AF095286	CCDS6641.1, CCDS56576.1, CCDS56577.1	9q21.13	2008-05-14			ENSG00000119125	ENSG00000119125			4212	protein-coding gene	gene with protein product		139260				10075721, 3966794	Standard	NM_001242507		Approved		uc004air.3	Q9Y2T3	OTTHUMG00000020005	ENST00000358399.3:c.679G>A	9.37:g.74838108G>A	ENSP00000351170:p.Gly227Ser		Somatic				GDA_uc011lse.1_Missense_Mutation_p.G153S|GDA_uc011lsf.1_Missense_Mutation_p.G153S|GDA_uc004air.2_Missense_Mutation_p.G227S|GDA_uc010mow.1_RNA|GDA_uc004ais.2_Intron|GDA_uc004ait.1_Missense_Mutation_p.G153S	p.G227S	NM_004293	NP_004284	WXS	Illumina HiSeq	Unspecified	Q9Y2T3	GUAD_HUMAN		Lung(182;0.0583)	7	862	+		Myeloproliferative disorder(762;0.0122)	227					B4DTY5|Q5SZC7|Q9H335|Q9ULG2	Missense_Mutation	SNP	ENST00000358399.3	37	c.679G>A	CCDS6641.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.199703	0.79015	.	.	ENSG00000119125	ENST00000545168;ENST00000238018;ENST00000358399;ENST00000414671	D;D;D;D	0.89810	-2.57;-2.57;-2.57;-2.57	5.58	5.58	0.84498	Amidohydrolase 1 (1);	0.000000	0.85682	D	0.000000	D	0.92714	0.7684	L	0.60904	1.88	0.58432	D	0.999998	P;D	0.55172	0.945;0.97	P;D	0.64595	0.821;0.927	D	0.92459	0.5976	10	0.51188	T	0.08	-16.3147	16.4881	0.84190	0.0:0.0:1.0:0.0	.	227;227	Q9Y2T3-3;Q9Y2T3	.;GUAD_HUMAN	S	153;227;227;93	ENSP00000437972:G153S;ENSP00000238018:G227S;ENSP00000351170:G227S;ENSP00000403897:G93S	ENSP00000238018:G227S	G	+	1	0	GDA	74027928	1.000000	0.71417	0.724000	0.30704	0.657000	0.38888	6.689000	0.74562	2.626000	0.88956	0.655000	0.94253	GGC		0.428	GDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052633.1			15	63	0	0	0	0	15	63				
TRPM6	140803	broad.mit.edu	37	9	77370340	77370340	+	Missense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr9:77370340G>A	ENST00000360774.1	-	28	5072	c.4835C>T	c.(4834-4836)cCa>cTa	p.P1612L	TRPM6_ENST00000376872.3_Missense_Mutation_p.P563L|TRPM6_ENST00000449912.2_Missense_Mutation_p.P1607L|TRPM6_ENST00000451710.3_Missense_Mutation_p.P1612L|TRPM6_ENST00000361255.3_Missense_Mutation_p.P1607L|TRPM6_ENST00000376864.4_Missense_Mutation_p.P1612L|TRPM6_ENST00000376871.3_Intron	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	1612					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						GTTTTCTCCTGGCTCTGGATT	0.423																																						uc004ajl.1		NA																	0				lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						c.(4834-4836)CCA>CTA		transient receptor potential cation channel,							171.0	151.0	158.0					9																	77370340		2203	4300	6503	SO:0001583	missense	140803				response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity	g.chr9:77370340G>A	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.4835C>T	9.37:g.77370340G>A	ENSP00000354006:p.Pro1612Leu		Somatic				TRPM6_uc004ajk.1_Missense_Mutation_p.P1607L|TRPM6_uc010mpb.1_RNA|TRPM6_uc010mpc.1_Missense_Mutation_p.P563L|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron|TRPM6_uc004ajj.1_Missense_Mutation_p.P568L	p.P1612L	NM_017662	NP_060132	WXS	Illumina HiSeq	Unspecified	Q9BX84	TRPM6_HUMAN			28	5073	-			1612			Cytoplasmic (Potential).		Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	ENST00000360774.1	37	c.4835C>T	CCDS6647.1	.	.	.	.	.	.	.	.	.	.	G	9.267	1.044690	0.19748	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000376872;ENST00000449912;ENST00000361255;ENST00000376864	T;T;T;T;T;T	0.53857	0.7;0.7;0.65;0.7;0.7;0.6	5.34	2.43	0.29744	.	0.755855	0.13434	N	0.388168	T	0.49795	0.1578	M	0.68952	2.095	0.50039	D	0.999844	B;B;B;B	0.31931	0.347;0.027;0.046;0.046	B;B;B;B	0.34652	0.187;0.018;0.04;0.04	T	0.47636	-0.9102	10	0.87932	D	0	.	6.5581	0.22471	0.0712:0.1305:0.6628:0.1355	.	563;1612;1607;1607	Q9BX84-5;Q9BX84;Q9BX84-3;Q9BX84-2	.;TRPM6_HUMAN;.;.	L	1612;1612;563;1607;1607;1612	ENSP00000354006:P1612L;ENSP00000407341:P1612L;ENSP00000366068:P563L;ENSP00000396672:P1607L;ENSP00000354962:P1607L;ENSP00000366060:P1612L	ENSP00000354006:P1612L	P	-	2	0	TRPM6	76560160	1.000000	0.71417	0.818000	0.32626	0.065000	0.16274	3.290000	0.51755	0.309000	0.22966	-0.169000	0.13324	CCA		0.423	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662		26	66	0	0	0	0	26	66				
OR13C4	138804	broad.mit.edu	37	9	107288587	107288587	+	Missense_Mutation	SNP	C	C	G			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr9:107288587C>G	ENST00000277216.3	-	1	903	c.904G>C	c.(904-906)Gat>Cat	p.D302H		NM_001001919.1	NP_001001919.1	Q8NGS5	O13C4_HUMAN	olfactory receptor, family 13, subfamily C, member 4	302						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(2)|lung(14)|skin(1)	18						GCTTTTACATCTTTATTTCTC	0.378																																						uc011lvn.1		NA																	0				skin(1)	1						c.(904-906)GAT>CAT		olfactory receptor, family 13, subfamily C,							54.0	59.0	57.0					9																	107288587		2203	4300	6503	SO:0001583	missense	138804				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:107288587C>G		CCDS35088.1	9q31.1	2013-09-24			ENSG00000148136	ENSG00000148136		"""GPCR / Class A : Olfactory receptors"""	14722	protein-coding gene	gene with protein product							Standard	NM_001001919		Approved		uc011lvn.2	Q8NGS5	OTTHUMG00000020407	ENST00000277216.3:c.904G>C	9.37:g.107288587C>G	ENSP00000277216:p.Asp302His		Somatic					p.D302H	NM_001001919	NP_001001919	WXS	Illumina HiSeq	Unspecified	Q8NGS5	O13C4_HUMAN			1	904	-			302			Cytoplasmic (Potential).		Q6IF51|Q96R41	Missense_Mutation	SNP	ENST00000277216.3	37	c.904G>C	CCDS35088.1	.	.	.	.	.	.	.	.	.	.	C	15.89	2.967504	0.53507	.	.	ENSG00000148136	ENST00000277216;ENST00000545903	T	0.39592	1.07	3.9	2.97	0.34412	.	0.143365	0.31531	U	0.007490	T	0.68504	0.3008	M	0.93328	3.405	0.35279	D	0.781156	D	0.76494	0.999	D	0.69142	0.962	T	0.79804	-0.1649	10	0.87932	D	0	.	9.9189	0.41453	0.0:0.8941:0.0:0.1059	.	302	Q8NGS5	O13C4_HUMAN	H	302;331	ENSP00000277216:D302H	ENSP00000277216:D302H	D	-	1	0	OR13C4	106328408	0.988000	0.35896	1.000000	0.80357	0.895000	0.52256	3.803000	0.55560	0.918000	0.36919	0.467000	0.42956	GAT		0.378	OR13C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053478.1			5	70	0	0	0	0	5	70				
OR13C9	286362	broad.mit.edu	37	9	107380043	107380043	+	Missense_Mutation	SNP	G	G	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr9:107380043G>T	ENST00000259362.1	-	1	442	c.443C>A	c.(442-444)tCc>tAc	p.S148Y		NM_001001956.1	NP_001001956.1	Q8NGT0	O13C9_HUMAN	olfactory receptor, family 13, subfamily C, member 9	148						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(6)|lung(9)|prostate(1)|skin(4)	22						TGCAAACCAGGACCCAACAGC	0.448																																						uc011lvr.1		NA																	0					0						c.(442-444)TCC>TAC		olfactory receptor, family 13, subfamily C,							124.0	111.0	115.0					9																	107380043		2203	4300	6503	SO:0001583	missense	286362				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:107380043G>T		CCDS35093.1	9q31.1	2013-09-24			ENSG00000136839	ENSG00000136839		"""GPCR / Class A : Olfactory receptors"""	15104	protein-coding gene	gene with protein product							Standard	NM_001001956		Approved		uc011lvr.2	Q8NGT0	OTTHUMG00000020416	ENST00000259362.1:c.443C>A	9.37:g.107380043G>T	ENSP00000259362:p.Ser148Tyr		Somatic					p.S148Y	NM_001001956	NP_001001956	WXS	Illumina HiSeq	Unspecified	Q8NGT0	O13C9_HUMAN			1	443	-			148			Helical; Name=4; (Potential).		Q6IFL2	Missense_Mutation	SNP	ENST00000259362.1	37	c.443C>A	CCDS35093.1	.	.	.	.	.	.	.	.	.	.	G	13.14	2.147743	0.37923	.	.	ENSG00000136839	ENST00000259362	T	0.39056	1.1	4.51	4.51	0.55191	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48286	D	0.000181	T	0.77322	0.4113	H	0.98507	4.25	0.23936	N	0.996412	D	0.89917	1.0	D	0.79108	0.992	T	0.75836	-0.3177	10	0.87932	D	0	.	14.7497	0.69516	0.0:0.0:1.0:0.0	.	148	Q8NGT0	O13C9_HUMAN	Y	148	ENSP00000259362:S148Y	ENSP00000259362:S148Y	S	-	2	0	OR13C9	106419864	0.976000	0.34144	0.749000	0.31150	0.496000	0.33645	3.235000	0.51328	2.305000	0.77605	0.643000	0.83706	TCC		0.448	OR13C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053490.1			14	103	1	0	9.05e-12	1.03e-11	14	103				
SVEP1	79987	broad.mit.edu	37	9	113139598	113139598	+	Missense_Mutation	SNP	T	T	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr9:113139598T>A	ENST00000401783.2	-	45	10793	c.10457A>T	c.(10456-10458)aAt>aTt	p.N3486I	SVEP1_ENST00000297826.5_Missense_Mutation_p.N1412I|SVEP1_ENST00000374469.1_Missense_Mutation_p.N3463I	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	3486					cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						GGAACAAGCATTTGGGCGTTG	0.502																																						uc010mtz.2		NA																	0				ovary(7)	7						c.(10456-10458)AAT>ATT		polydom							70.0	68.0	69.0					9																	113139598		1910	4117	6027	SO:0001583	missense	79987				cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding	g.chr9:113139598T>A	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.10457A>T	9.37:g.113139598T>A	ENSP00000384917:p.Asn3486Ile		Somatic				SVEP1_uc010mty.2_Missense_Mutation_p.N1412I	p.N3486I	NM_153366	NP_699197	WXS	Illumina HiSeq	Unspecified	Q4LDE5	SVEP1_HUMAN			45	10794	-			3486					Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	c.10457A>T	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	T	27.5	4.836714	0.91117	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000297826	T;T;T	0.66460	1.72;1.72;-0.21	5.43	5.43	0.79202	Epidermal growth factor-like (1);	0.000000	0.85682	D	0.000000	T	0.71384	0.3333	L	0.41356	1.27	0.80722	D	1	D	0.69078	0.997	P	0.60068	0.868	T	0.68375	-0.5425	10	0.26408	T	0.33	.	15.4959	0.75648	0.0:0.0:0.0:1.0	.	3486	Q4LDE5	SVEP1_HUMAN	I	3486;3463;1412	ENSP00000384917:N3486I;ENSP00000363593:N3463I;ENSP00000297826:N1412I	ENSP00000297826:N1412I	N	-	2	0	SVEP1	112179419	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.521000	0.81832	2.066000	0.61787	0.533000	0.62120	AAT		0.502	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				18	42	0	0	0	0	18	42				
SVEP1	79987	broad.mit.edu	37	9	113170974	113170974	+	Nonsense_Mutation	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr9:113170974C>T	ENST00000401783.2	-	38	7242	c.6906G>A	c.(6904-6906)tgG>tgA	p.W2302*	SVEP1_ENST00000297826.5_Nonsense_Mutation_p.W228*|SVEP1_ENST00000374469.1_Nonsense_Mutation_p.W2279*	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	2302	Sushi 15. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						TCTGACATGTCCAAGAACTGT	0.443																																						uc010mtz.2		NA																	0				ovary(7)	7						c.(6904-6906)TGG>TGA		polydom							83.0	84.0	84.0					9																	113170974		1907	4126	6033	SO:0001587	stop_gained	79987				cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding	g.chr9:113170974C>T	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.6906G>A	9.37:g.113170974C>T	ENSP00000384917:p.Trp2302*		Somatic				SVEP1_uc010mty.2_Nonsense_Mutation_p.W228*	p.W2302*	NM_153366	NP_699197	WXS	Illumina HiSeq	Unspecified	Q4LDE5	SVEP1_HUMAN			38	7243	-			2302			Sushi 15.		Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Nonsense_Mutation	SNP	ENST00000401783.2	37	c.6906G>A	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	C	50	16.573856	0.99867	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000297826	.	.	.	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.17832	T	0.49	.	20.0545	0.97645	0.0:1.0:0.0:0.0	.	.	.	.	X	2302;2279;228	.	ENSP00000297826:W228X	W	-	3	0	SVEP1	112210795	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.833000	0.69349	2.748000	0.94277	0.655000	0.94253	TGG		0.443	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				17	59	0	0	0	0	17	59				
ZNF883	169834	broad.mit.edu	37	9	115760171	115760171	+	lincRNA	SNP	T	T	G			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr9:115760171T>G	ENST00000427548.1	-	0	1642							P0CG24	ZN883_HUMAN	zinc finger protein 883						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										AAGGATAGGGTTTTTCTCCAG	0.378																																						uc011lwy.1		NA																	0					0						c.(367-369)AAA>AAC		hypothetical protein LOC169834							65.0	70.0	68.0					9																	115760171		2171	4289	6460			169834				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr9:115760171T>G	AK095843		9q32	2010-07-23			ENSG00000228623	ENSG00000228623		"""Zinc fingers, C2H2-type"""	27271	protein-coding gene	gene with protein product							Standard	NM_001101338		Approved		uc011lwy.2	P0CG24	OTTHUMG00000020514		9.37:g.115760171T>G			Somatic					p.K123N	NM_001101338	NP_001094808	WXS	Illumina HiSeq	Unspecified	P0CG24	ZN883_HUMAN			5	1608	-			123						Missense_Mutation	SNP	ENST00000427548.1	37	c.369A>C																																																																																					0.378	ZNF883-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000053704.1	NM_001101338		3	45	0	0	0	0	3	45				
POLA1	5422	broad.mit.edu	37	X	24722565	24722565	+	Missense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chrX:24722565G>A	ENST00000379059.3	+	4	322	c.307G>A	c.(307-309)Gcc>Acc	p.A103T	POLA1_ENST00000379068.3_Missense_Mutation_p.A109T	NM_016937.3	NP_058633.2	P09884	DPOLA_HUMAN	polymerase (DNA directed), alpha 1, catalytic subunit	103	Asp-rich.				cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|lagging strand elongation (GO:0006273)|leading strand elongation (GO:0006272)|mitotic cell cycle (GO:0000278)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|translesion synthesis (GO:0019985)|viral process (GO:0016032)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleoside binding (GO:0001882)|nucleotide binding (GO:0000166)|protein kinase binding (GO:0019901)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|skin(2)	11					Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Nelarabine(DB01280)	TGAAGATGATGCCCTTGATGC	0.368																																						uc004dbl.2		NA																	0				ovary(2)|skin(1)	3						c.(307-309)GCC>ACC		DNA-directed DNA polymerase alpha 1	Clofarabine(DB00631)|Fludarabine(DB01073)						358.0	298.0	318.0					X																	24722565		2203	4300	6503	SO:0001583	missense	5422				cell proliferation|DNA replication checkpoint|DNA replication, synthesis of RNA primer|DNA-dependent DNA replication initiation|double-strand break repair via nonhomologous end joining|interspecies interaction between organisms|lagging strand elongation|leading strand elongation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|cytoplasm|nuclear envelope|nuclear matrix|nucleolus|nucleoplasm	chromatin binding|DNA-directed DNA polymerase activity|metal ion binding|nucleoside binding	g.chrX:24722565G>A		CCDS14214.1	Xp22.1-p21.3	2014-01-30	2008-08-07	2006-09-26	ENSG00000101868	ENSG00000101868	2.7.7.7	"""DNA polymerases"""	9173	protein-coding gene	gene with protein product		312040	"""polymerase (DNA directed), alpha"", ""polymerase (DNA directed), alpha 1"", ""N syndrome (mental retardation, malformations, chromosome breakage)"""	POLA, NSX		1689958	Standard	NM_016937		Approved	p180	uc004dbl.3	P09884	OTTHUMG00000021277	ENST00000379059.3:c.307G>A	X.37:g.24722565G>A	ENSP00000368349:p.Ala103Thr		Somatic				POLA1_uc004dbm.2_Missense_Mutation_p.A109T|POLA1_uc004dbn.2_5'UTR	p.A103T	NM_016937	NP_058633	WXS	Illumina HiSeq	Unspecified	P09884	DPOLA_HUMAN			4	330	+			103			Asp-rich.		Q86UQ7	Missense_Mutation	SNP	ENST00000379059.3	37	c.307G>A	CCDS14214.1	.	.	.	.	.	.	.	.	.	.	G	9.455	1.091633	0.20471	.	.	ENSG00000101868	ENST00000379068;ENST00000379059	T;T	0.18502	2.21;2.21	4.96	4.1	0.47936	.	0.168838	0.51477	N	0.000088	T	0.18593	0.0446	M	0.66939	2.045	0.47994	D	0.99956	B;B	0.06786	0.0;0.001	B;B	0.11329	0.004;0.006	T	0.04386	-1.0955	10	0.15066	T	0.55	-3.821	12.1748	0.54180	0.0854:0.0:0.9145:0.0	.	109;103	A6NMQ1;P09884	.;DPOLA_HUMAN	T	109;103	ENSP00000368358:A109T;ENSP00000368349:A103T	ENSP00000368349:A103T	A	+	1	0	POLA1	24632486	1.000000	0.71417	0.938000	0.37757	0.809000	0.45718	4.855000	0.62925	1.089000	0.41292	0.600000	0.82982	GCC		0.368	POLA1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056111.1	NM_016937		8	216	0	0	0	0	8	216				
MAGEB3	4114	broad.mit.edu	37	X	30254629	30254629	+	Missense_Mutation	SNP	G	G	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chrX:30254629G>T	ENST00000361644.2	+	5	1325	c.588G>T	c.(586-588)agG>agT	p.R196S		NM_002365.4	NP_002356.2	O15480	MAGB3_HUMAN	melanoma antigen family B, 3	196	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									NS(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|prostate(2)|skin(2)	25						CTCGTGGGAGGGGATTTCCCA	0.468																																						uc004dca.1		NA																	0					0						c.(586-588)AGG>AGT		melanoma antigen family B, 3							54.0	46.0	49.0					X																	30254629		2202	4300	6502	SO:0001583	missense	4114							g.chrX:30254629G>T	AK057441	CCDS14220.1	Xp21.3	2009-03-17			ENSG00000198798	ENSG00000198798			6810	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 5"""	300152				9441743	Standard	NM_002365		Approved	CT3.5	uc004dca.2	O15480	OTTHUMG00000021320	ENST00000361644.2:c.588G>T	X.37:g.30254629G>T	ENSP00000355198:p.Arg196Ser		Somatic					p.R196S	NM_002365	NP_002356	WXS	Illumina HiSeq	Unspecified	O15480	MAGB3_HUMAN			5	1325	+			196			MAGE.		A0AVE4|B3KQ52|O75861	Missense_Mutation	SNP	ENST00000361644.2	37	c.588G>T	CCDS14220.1	.	.	.	.	.	.	.	.	.	.	G	11.93	1.784665	0.31593	.	.	ENSG00000198798	ENST00000378986;ENST00000361644	T;T	0.04234	3.67;3.67	4.09	-3.82	0.04281	.	0.284302	0.25951	U	0.027260	T	0.08758	0.0217	M	0.69463	2.115	0.09310	N	1	D	0.67145	0.996	D	0.72338	0.977	T	0.32241	-0.9914	10	0.11182	T	0.66	.	0.5201	0.00610	0.2664:0.1274:0.2143:0.3918	.	196	O15480	MAGB3_HUMAN	S	196	ENSP00000368271:R196S;ENSP00000355198:R196S	ENSP00000355198:R196S	R	+	3	2	MAGEB3	30164550	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.147000	0.10234	-1.205000	0.02645	0.600000	0.82982	AGG		0.468	MAGEB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056158.2	NM_002365		12	35	1	0	6.4e-05	6.84e-05	12	35				
FAM47A	158724	broad.mit.edu	37	X	34149053	34149053	+	Missense_Mutation	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chrX:34149053C>T	ENST00000346193.3	-	1	1394	c.1343G>A	c.(1342-1344)cGg>cAg	p.R448Q		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	448										NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						TTTCTTCACCCGGGCCTCACA	0.562																																						uc004ddg.2		NA																	0				ovary(4)|central_nervous_system(1)	5						c.(1342-1344)CGG>CAG		hypothetical protein LOC158724							43.0	45.0	45.0					X																	34149053		2049	4203	6252	SO:0001583	missense	158724							g.chrX:34149053C>T	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.1343G>A	X.37:g.34149053C>T	ENSP00000345029:p.Arg448Gln		Somatic					p.R448Q	NM_203408	NP_981953	WXS	Illumina HiSeq	Unspecified	Q5JRC9	FA47A_HUMAN			1	1376	-			448					A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	37	c.1343G>A	CCDS43926.1	.	.	.	.	.	.	.	.	.	.	c	8.522	0.869038	0.17322	.	.	ENSG00000185448	ENST00000346193	T	0.14266	2.52	0.866	-1.73	0.08081	.	.	.	.	.	T	0.07503	0.0189	L	0.40543	1.245	0.09310	N	1	P	0.50710	0.938	B	0.39185	0.293	T	0.30880	-0.9963	8	0.12766	T	0.61	.	.	.	.	.	448	Q5JRC9	FA47A_HUMAN	Q	448	ENSP00000345029:R448Q	ENSP00000345029:R448Q	R	-	2	0	FAM47A	34058974	0.003000	0.15002	0.001000	0.08648	0.587000	0.36485	0.457000	0.21875	-0.865000	0.04073	0.287000	0.19450	CGG		0.562	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408		7	59	0	0	0	0	7	59				
USP9X	8239	broad.mit.edu	37	X	41075168	41075168	+	Missense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chrX:41075168G>A	ENST00000324545.8	+	35	5981	c.5348G>A	c.(5347-5349)cGc>cAc	p.R1783H	USP9X_ENST00000378308.2_Missense_Mutation_p.R1783H	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	1783	USP.				axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						ACCGTAAAGCGCTTGCTGATT	0.318																																					Ovarian(172;1807 2695 35459 49286)	uc004dfb.2		NA																	0				lung(3)|breast(2)|ovary(1)	6						c.(5347-5349)CGC>CAC		ubiquitin specific protease 9, X-linked isoform							56.0	53.0	54.0					X																	41075168		1959	4185	6144	SO:0001583	missense	8239				BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity	g.chrX:41075168G>A	X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.5348G>A	X.37:g.41075168G>A	ENSP00000316357:p.Arg1783His		Somatic				USP9X_uc004dfc.2_Missense_Mutation_p.R1783H	p.R1783H	NM_001039590	NP_001034679	WXS	Illumina HiSeq	Unspecified	Q93008	USP9X_HUMAN			35	5981	+			1783					O75550|Q8WWT3|Q8WX12	Missense_Mutation	SNP	ENST00000324545.8	37	c.5348G>A	CCDS43930.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.482916	0.84747	.	.	ENSG00000124486	ENST00000378308;ENST00000324545	T;T	0.32515	1.45;1.45	5.61	5.61	0.85477	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.091848	0.85682	D	0.000000	T	0.61451	0.2348	M	0.82923	2.615	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.975;0.993	T	0.67090	-0.5758	10	0.87932	D	0	.	18.7552	0.91830	0.0:0.0:1.0:0.0	.	1783;1783	Q93008-1;Q93008	.;USP9X_HUMAN	H	1783	ENSP00000367558:R1783H;ENSP00000316357:R1783H	ENSP00000316357:R1783H	R	+	2	0	USP9X	40960112	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.416000	0.97383	2.375000	0.81037	0.600000	0.82982	CGC		0.318	USP9X-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056250.4	NM_004652		4	46	0	0	0	0	4	46				
PPP1R3F	89801	broad.mit.edu	37	X	49127007	49127007	+	Silent	SNP	T	T	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chrX:49127007T>A	ENST00000055335.6	+	1	691	c.675T>A	c.(673-675)ggT>ggA	p.G225G	PPP1R3F_ENST00000438316.1_Intron|LL0XNC01-7P3.1_ENST00000602455.1_lincRNA|PPP1R3F_ENST00000495799.1_Intron|PPP1R3F_ENST00000466508.1_Intron	NM_033215.4	NP_149992.3	Q6ZSY5	PPR3F_HUMAN	protein phosphatase 1, regulatory subunit 3F	225	CBM21. {ECO:0000255|PROSITE- ProRule:PRU00491}.				regulation of glycogen (starch) synthase activity (GO:2000465)|regulation of glycogen biosynthetic process (GO:0005979)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycogen binding (GO:2001069)|protein phosphatase binding (GO:0019903)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(4)	27	Ovarian(276;0.236)					TCGGCCTGGGTCCCGGCCAGG	0.751																																						uc004dnh.1		NA																	0				ovary(2)|skin(1)	3						c.(673-675)GGT>GGA		protein phosphatase 1, regulatory (inhibitor)							9.0	11.0	10.0					X																	49127007		2154	4214	6368	SO:0001819	synonymous_variant	89801					integral to membrane		g.chrX:49127007T>A		CCDS35254.1, CCDS55415.1	Xp11.23	2012-04-17	2011-10-04		ENSG00000049769	ENSG00000049769		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14944	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3F"""			11948623	Standard	NM_033215		Approved	Hb2E	uc004dnh.2	Q6ZSY5	OTTHUMG00000024139	ENST00000055335.6:c.675T>A	X.37:g.49127007T>A			Somatic				PPP1R3F_uc011mnd.1_Intron|PPP1R3F_uc004dni.2_Intron	p.G225G	NM_033215	NP_149992	WXS	Illumina HiSeq	Unspecified	Q6ZSY5	PPR3F_HUMAN			1	691	+	Ovarian(276;0.236)		225			CBM21.|Extracellular (Potential).		A2VDJ8|B3KPW2|E9PCM3	Silent	SNP	ENST00000055335.6	37	c.675T>A	CCDS35254.1																																																																																				0.751	PPP1R3F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060819.2	NM_033215		7	13	0	0	0	0	7	13				
IQSEC2	23096	broad.mit.edu	37	X	53279948	53279948	+	Missense_Mutation	SNP	C	C	T			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chrX:53279948C>T	ENST00000375368.5	-	4	1980	c.1780G>A	c.(1780-1782)Gtg>Atg	p.V594M	IQSEC2_ENST00000375365.2_Missense_Mutation_p.V399M|IQSEC2_ENST00000396435.3_Missense_Mutation_p.V604M			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	594	Pro-rich.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						CTCAGGTCCACGGAGCTGTCA	0.657																																						uc004dsd.2		NA																	0				ovary(3)	3						c.(1810-1812)GTG>ATG		IQ motif and Sec7 domain 2 isoform1							18.0	16.0	17.0					X																	53279948		2199	4295	6494	SO:0001583	missense	23096				regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity	g.chrX:53279948C>T	AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.1780G>A	X.37:g.53279948C>T	ENSP00000364517:p.Val594Met		Somatic				IQSEC2_uc004dsc.2_Missense_Mutation_p.V399M	p.V604M	NM_001111125	NP_001104595	WXS	Illumina HiSeq	Unspecified	Q5JU85	IQEC2_HUMAN			5	2011	-			594			Pro-rich.		B3KT97|C7SDG1|O60275|Q5JUX1	Missense_Mutation	SNP	ENST00000375368.5	37	c.1810G>A		.	.	.	.	.	.	.	.	.	.	c	23.2	4.386723	0.82902	.	.	ENSG00000124313	ENST00000396435;ENST00000375368;ENST00000375365	T;T;T	0.21932	1.98;1.98;2.17	5.37	5.37	0.77165	.	.	.	.	.	T	0.36771	0.0979	L	0.49126	1.545	0.52099	D	0.999948	D;D	0.63046	0.992;0.988	P;P	0.57152	0.814;0.747	T	0.10268	-1.0637	9	0.72032	D	0.01	.	16.8728	0.86044	0.0:1.0:0.0:0.0	.	604;399	Q5JU85-2;Q5JU85-3	.;.	M	604;594;399	ENSP00000379712:V604M;ENSP00000364517:V594M;ENSP00000364514:V399M	ENSP00000364514:V399M	V	-	1	0	IQSEC2	53296673	1.000000	0.71417	0.992000	0.48379	0.985000	0.73830	6.024000	0.70857	2.246000	0.74042	0.597000	0.82753	GTG		0.657	IQSEC2-201	KNOWN	basic	protein_coding	protein_coding		XM_291345		7	11	0	0	0	0	7	11				
HUWE1	10075	broad.mit.edu	37	X	53577938	53577938	+	Silent	SNP	C	C	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chrX:53577938C>A	ENST00000342160.3	-	64	9766	c.9309G>T	c.(9307-9309)cgG>cgT	p.R3103R	HUWE1_ENST00000474288.1_5'Flank|HUWE1_ENST00000262854.6_Silent_p.R3103R			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	3103					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						GCTGTCGCTGCCGGGCTTCTT	0.582																																						uc004dsp.2		NA																	0				ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						c.(9307-9309)CGG>CGT		HECT, UBA and WWE domain containing 1							67.0	50.0	56.0					X																	53577938		2203	4300	6503	SO:0001819	synonymous_variant	10075				base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity	g.chrX:53577938C>A	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.9309G>T	X.37:g.53577938C>A			Somatic				HUWE1_uc004dsn.2_Silent_p.R1911R	p.R3103R	NM_031407	NP_113584	WXS	Illumina HiSeq	Unspecified	Q7Z6Z7	HUWE1_HUMAN			65	9711	-			3103					O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Silent	SNP	ENST00000342160.3	37	c.9309G>T	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	C	9.113	1.007047	0.19199	.	.	ENSG00000086758	ENST00000427052	.	.	.	5.88	-1.85	0.07784	.	.	.	.	.	T	0.38746	0.1052	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.23404	-1.0189	4	.	.	.	.	1.1082	0.01698	0.2195:0.3085:0.1058:0.3662	.	.	.	.	S	2137	.	.	A	-	1	0	HUWE1	53594663	0.355000	0.24921	0.881000	0.34555	0.994000	0.84299	-0.389000	0.07342	-1.028000	0.03321	-0.192000	0.12808	GCA		0.582	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119		12	41	1	0	1.09e-07	1.21e-07	12	41				
ARL13A	392509	broad.mit.edu	37	X	100240718	100240718	+	Missense_Mutation	SNP	T	T	C	rs373475865		TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chrX:100240718T>C	ENST00000450049.2	+	4	306	c.193T>C	c.(193-195)Tat>Cat	p.Y65H		NM_001162491.1	NP_001155963.1	Q5H913	AR13A_HUMAN	ADP-ribosylation factor-like 13A	65					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			endometrium(1)|ovary(1)	2						GTTAGATGAGTATGAACTTTC	0.463																																						uc004ego.2		NA																	0				ovary(1)	1						c.(193-195)TAT>CAT		ADP-ribosylation factor-like 13 isoform a		T	HIS/TYR,HIS/TYR,HIS/TYR	0,3282		0,0,0,1356,570	139.0	128.0	132.0		193,193,193	3.3	0.0	X		132	1,6458		0,0,1,2337,1784	no	missense,missense,missense	ARL13A	NM_001012990.3,NM_001162490.1,NM_001162491.1	83,83,83	0,0,1,3693,2354	CC,CT,C,TT,T		0.0155,0.0,0.0103	probably-damaging,probably-damaging,probably-damaging	65/291,65/291,65/257	100240718	1,9740	1926	4122	6048	SO:0001583	missense	392509						GTP binding	g.chrX:100240718T>C		CCDS55463.1	Xq22.1	2014-05-09	2005-11-18	2005-11-18	ENSG00000174225	ENSG00000174225		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	31709	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 13"""	ARL13			Standard	NM_001162491		Approved		uc011mrf.2	Q5H913	OTTHUMG00000022013	ENST00000450049.2:c.193T>C	X.37:g.100240718T>C	ENSP00000398637:p.Tyr65His		Somatic				ARL13A_uc011mrf.1_Missense_Mutation_p.Y65H|ARL13A_uc010nng.2_Missense_Mutation_p.Y65H	p.Y65H	NM_001012990	NP_001013008	WXS	Illumina HiSeq	Unspecified	Q5H913	AR13A_HUMAN			4	309	+			65					B2RTT6|B4DX50	Missense_Mutation	SNP	ENST00000450049.2	37	c.193T>C	CCDS55463.1	.	.	.	.	.	.	.	.	.	.	T	14.59	2.581718	0.46006	0.0	1.55E-4	ENSG00000174225	ENST00000450049	T	0.63255	-0.03	4.46	3.3	0.37823	.	0.184018	0.49305	D	0.000151	T	0.75133	0.3808	M	0.80028	2.48	0.22827	N	0.998682	D;D	0.76494	0.997;0.999	D;D	0.77004	0.976;0.989	T	0.64803	-0.6321	10	0.87932	D	0	.	5.8789	0.18844	0.0:0.1169:0.0:0.8831	.	65;65	B2RTT6;Q5H913	.;AR13A_HUMAN	H	65	ENSP00000398637:Y65H	ENSP00000398637:Y65H	Y	+	1	0	ARL13A	100127374	0.969000	0.33509	0.035000	0.18076	0.753000	0.42808	2.605000	0.46283	0.835000	0.34877	0.481000	0.45027	TAT		0.463	ARL13A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000057504.2	XM_373358		3	47	0	0	0	0	3	47				
NKAP	79576	broad.mit.edu	37	X	119059238	119059238	+	Missense_Mutation	SNP	A	A	G			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chrX:119059238A>G	ENST00000371410.3	-	9	1359	c.1193T>C	c.(1192-1194)cTg>cCg	p.L398P	NKAP_ENST00000477789.1_5'UTR|RP3-327A19.5_ENST00000455986.1_RNA|AC002477.1_ENST00000581061.1_RNA	NM_024528.3	NP_078804.2	Q8N5F7	NKAP_HUMAN	NFKB activating protein	398	Necessary for interaction with HDAC3 and transcriptional repression.				granulocyte differentiation (GO:0030851)|hematopoietic stem cell proliferation (GO:0071425)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|stem cell maintenance (GO:0019827)|T cell differentiation in thymus (GO:0033077)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)	20						AAAACTGGCCAGAATCTTGTT	0.398																																						uc004esh.2		NA																	0				ovary(2)	2						c.(1192-1194)CTG>CCG		NFKB activating protein							173.0	160.0	164.0					X																	119059238		2203	4300	6503	SO:0001583	missense	79576				negative regulation of transcription, DNA-dependent|Notch signaling pathway|positive regulation of alpha-beta T cell differentiation|transcription, DNA-dependent	cytoplasm|nucleus	chromatin binding|protein binding	g.chrX:119059238A>G	BC012770	CCDS14592.1	Xq24	2010-07-20			ENSG00000101882	ENSG00000101882			29873	protein-coding gene	gene with protein product	"""NF kappaB activating protein"""	300766				14550261	Standard	NM_024528		Approved	FLJ22626	uc004esh.3	Q8N5F7	OTTHUMG00000022284	ENST00000371410.3:c.1193T>C	X.37:g.119059238A>G	ENSP00000360464:p.Leu398Pro		Somatic				NKAP_uc004esg.2_Missense_Mutation_p.L285P	p.L398P	NM_024528	NP_078804	WXS	Illumina HiSeq	Unspecified	Q8N5F7	NKAP_HUMAN			9	1360	-			398			Necessary for interaction with HDAC3 and transcriptional repression.		Q6IPW6|Q96BQ2|Q9H638	Missense_Mutation	SNP	ENST00000371410.3	37	c.1193T>C	CCDS14592.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.341299	0.81911	.	.	ENSG00000101882	ENST00000371410	T	0.20738	2.05	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.49966	0.1588	M	0.82323	2.585	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.56577	-0.7956	10	0.87932	D	0	-8.4152	14.1679	0.65490	1.0:0.0:0.0:0.0	.	398	Q8N5F7	NKAP_HUMAN	P	398	ENSP00000360464:L398P	ENSP00000360464:L398P	L	-	2	0	NKAP	118943266	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.267000	0.95665	1.944000	0.56390	0.486000	0.48141	CTG		0.398	NKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058072.1	NM_024528		29	82	0	0	0	0	29	82				
STAG2	10735	broad.mit.edu	37	X	123196817	123196817	+	Silent	SNP	C	C	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chrX:123196817C>A	ENST00000371160.1	+	18	1994	c.1704C>A	c.(1702-1704)gcC>gcA	p.A568A	STAG2_ENST00000371144.3_Silent_p.A568A|STAG2_ENST00000354548.5_Silent_p.A499A|STAG2_ENST00000469481.1_Intron|STAG2_ENST00000371157.3_Silent_p.A568A|STAG2_ENST00000218089.9_Silent_p.A568A|STAG2_ENST00000371145.3_Silent_p.A568A	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	568					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						AGCTTTTTGCCGTGGCCCTTC	0.358																																						uc004etz.3		NA																	0				ovary(4)|skin(1)	5						c.(1702-1704)GCC>GCA		stromal antigen 2 isoform b							100.0	91.0	94.0					X																	123196817		2203	4300	6503	SO:0001819	synonymous_variant	10735				cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding	g.chrX:123196817C>A	Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.1704C>A	X.37:g.123196817C>A			Somatic				STAG2_uc004eua.2_Silent_p.A568A|STAG2_uc004eub.2_Silent_p.A568A|STAG2_uc004euc.2_Silent_p.A568A|STAG2_uc004eud.2_Silent_p.A568A|STAG2_uc004eue.2_Silent_p.A568A	p.A568A	NM_006603	NP_006594	WXS	Illumina HiSeq	Unspecified	Q8N3U4	STAG2_HUMAN			17	2043	+			568					B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Silent	SNP	ENST00000371160.1	37	c.1704C>A	CCDS14607.1																																																																																				0.358	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2	NM_006603		16	44	1	0	1.68e-08	1.87e-08	16	44				
ARHGAP36	158763	broad.mit.edu	37	X	130217855	130217855	+	Missense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chrX:130217855G>A	ENST00000276211.5	+	4	812	c.467G>A	c.(466-468)cGa>cAa	p.R156Q	ARHGAP36_ENST00000370921.1_Missense_Mutation_p.R20Q|ARHGAP36_ENST00000370922.1_Missense_Mutation_p.R144Q	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	156	Arg-rich.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						AACGTGGTGCGAAGGGTGTTT	0.617																																						uc004evz.2		NA																	0				ovary(3)	3						c.(466-468)CGA>CAA		hypothetical protein LOC158763 precursor							78.0	74.0	75.0					X																	130217855		2203	4300	6503	SO:0001583	missense	158763				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	g.chrX:130217855G>A		CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.467G>A	X.37:g.130217855G>A	ENSP00000276211:p.Arg156Gln		Somatic				ARHGAP36_uc004ewa.2_Missense_Mutation_p.R144Q|ARHGAP36_uc004ewb.2_Missense_Mutation_p.R125Q|ARHGAP36_uc004ewc.2_Missense_Mutation_p.R20Q	p.R156Q	NM_144967	NP_659404	WXS	Illumina HiSeq	Unspecified	Q6ZRI8	RHG36_HUMAN			4	812	+			156			Arg-rich.		B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Missense_Mutation	SNP	ENST00000276211.5	37	c.467G>A	CCDS14628.1	.	.	.	.	.	.	.	.	.	.	G	7.405	0.633550	0.14322	.	.	ENSG00000147256	ENST00000276211;ENST00000370922;ENST00000423277;ENST00000412432;ENST00000370921	T;T;T;T	0.08896	3.04;3.06;3.05;3.08	4.3	3.14	0.36123	.	0.146661	0.31949	N	0.006819	T	0.02342	0.0072	N	0.02539	-0.55	0.09310	N	0.999998	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.46303	-0.9201	10	0.02654	T	1	.	5.8744	0.18820	0.8809:0.0:0.1191:0.0	.	125;144;156	Q6ZRI8-2;Q6ZRI8-4;Q6ZRI8	.;.;RHG36_HUMAN	Q	156;144;108;125;20	ENSP00000276211:R156Q;ENSP00000359960:R144Q;ENSP00000408515:R125Q;ENSP00000359959:R20Q	ENSP00000276211:R156Q	R	+	2	0	ARHGAP36	130045536	0.998000	0.40836	0.972000	0.41901	0.227000	0.25037	2.161000	0.42358	0.759000	0.33084	-0.366000	0.07423	CGA		0.617	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355073.1	NM_144967		27	53	0	0	0	0	27	53				
MMGT1	93380	broad.mit.edu	37	X	135047295	135047295	+	Missense_Mutation	SNP	T	T	C			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chrX:135047295T>C	ENST00000305963.2	-	4	671	c.284A>G	c.(283-285)cAt>cGt	p.H95R	MMGT1_ENST00000433339.2_Missense_Mutation_p.H160R	NM_173470.1	NP_775741.1	Q8N4V1	MMGT1_HUMAN	membrane magnesium transporter 1	95					magnesium ion transport (GO:0015693)	early endosome (GO:0005769)|ER membrane protein complex (GO:0072546)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	magnesium ion transmembrane transporter activity (GO:0015095)			cervix(1)|endometrium(1)|kidney(1)	3						TCGACCACGATGATTAAATAC	0.353																																						uc004ezi.1		NA																	0					0						c.(283-285)CAT>CGT		membrane magnesium transporter 1 precursor							181.0	166.0	171.0					X																	135047295		2203	4300	6503	SO:0001583	missense	93380					early endosome membrane|endoplasmic reticulum membrane|Golgi membrane|integral to membrane	magnesium ion transmembrane transporter activity	g.chrX:135047295T>C	AL157477	CCDS14653.1	Xq26.3	2012-05-23	2008-11-21	2008-11-21	ENSG00000169446	ENSG00000169446			28100	protein-coding gene	gene with protein product	"""ER membrane protein complex subunit 5"""		"""transmembrane protein 32"""	TMEM32		18057121, 22119785	Standard	NM_173470		Approved	EMC5	uc004ezi.1	Q8N4V1	OTTHUMG00000022499	ENST00000305963.2:c.284A>G	X.37:g.135047295T>C	ENSP00000306220:p.His95Arg		Somatic				MMGT1_uc011mvw.1_Missense_Mutation_p.H160R	p.H95R	NM_173470	NP_775741	WXS	Illumina HiSeq	Unspecified	Q8N4V1	MMGT1_HUMAN			4	584	-			95			Cytoplasmic (Potential).		B2R625|B4DIY3|D3DWG7|Q5JPP7	Missense_Mutation	SNP	ENST00000305963.2	37	c.284A>G	CCDS14653.1	.	.	.	.	.	.	.	.	.	.	T	16.63	3.177717	0.57692	.	.	ENSG00000169446	ENST00000305963;ENST00000433339	.	.	.	5.75	5.75	0.90469	.	0.046653	0.85682	N	0.000000	T	0.74718	0.3753	L	0.55743	1.74	0.80722	D	1	D;B	0.89917	1.0;0.029	D;B	0.77004	0.989;0.089	T	0.76501	-0.2936	9	0.59425	D	0.04	.	14.1054	0.65085	0.0:0.0:0.0:1.0	.	160;95	Q8N4V1-2;Q8N4V1	.;MMGT1_HUMAN	R	95;160	.	ENSP00000306220:H95R	H	-	2	0	MMGT1	134874961	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.606000	0.82863	1.928000	0.55862	0.486000	0.48141	CAT		0.353	MMGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058453.3	NM_173470		42	100	0	0	0	0	42	100				
MAP7D3	79649	broad.mit.edu	37	X	135313731	135313731	+	Missense_Mutation	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chrX:135313731G>A	ENST00000316077.9	-	8	1605	c.1385C>T	c.(1384-1386)cCc>cTc	p.P462L	MAP7D3_ENST00000370663.5_Missense_Mutation_p.P444L|MAP7D3_ENST00000370661.1_Missense_Mutation_p.P427L|MAP7D3_ENST00000495432.1_5'Flank	NM_024597.3	NP_078873.2	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3	462					microtubule cytoskeleton organization (GO:0000226)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(1)	44	Acute lymphoblastic leukemia(192;0.000127)					TTTTGCCTTGGGAGATGCTTC	0.448																																						uc004ezt.2		NA																	0				ovary(2)|central_nervous_system(1)|skin(1)	4						c.(1384-1386)CCC>CTC		MAP7 domain containing 3							141.0	126.0	131.0					X																	135313731		1921	4120	6041	SO:0001583	missense	79649					cytoplasm|spindle		g.chrX:135313731G>A	AL832120	CCDS44004.1, CCDS55508.1, CCDS55509.1	Xq26.3	2014-08-13			ENSG00000129680	ENSG00000129680			25742	protein-coding gene	gene with protein product		300930				24927501	Standard	NM_001173516		Approved	FLJ12649	uc004ezt.3	Q8IWC1	OTTHUMG00000022507	ENST00000316077.9:c.1385C>T	X.37:g.135313731G>A	ENSP00000318086:p.Pro462Leu		Somatic				MAP7D3_uc004ezs.2_Missense_Mutation_p.P426L|MAP7D3_uc011mwc.1_Missense_Mutation_p.P444L|MAP7D3_uc010nsa.1_Missense_Mutation_p.P420L	p.P462L	NM_024597	NP_078873	WXS	Illumina HiSeq	Unspecified	Q8IWC1	MA7D3_HUMAN			8	1476	-	Acute lymphoblastic leukemia(192;0.000127)		462					A2A2J0|A6NCZ7|A6NHR4|B4DWD2|H7BY77|Q5JXI5|Q5JXI6|Q6P2S1|Q9H9M8	Missense_Mutation	SNP	ENST00000316077.9	37	c.1385C>T	CCDS44004.1	.	.	.	.	.	.	.	.	.	.	G	11.05	1.523464	0.27299	.	.	ENSG00000129680	ENST00000370661;ENST00000316077;ENST00000370663;ENST00000370660	T;T;T;T	0.13538	2.58;2.58;2.58;2.58	4.63	0.662	0.17880	.	.	.	.	.	T	0.08626	0.0214	N	0.24115	0.695	0.09310	N	0.999997	B;B;B;P	0.38677	0.061;0.1;0.061;0.642	B;B;B;B	0.38458	0.029;0.063;0.029;0.274	T	0.25984	-1.0116	9	0.56958	D	0.05	0.2658	4.3313	0.11064	0.0869:0.2794:0.4874:0.1464	.	444;421;462;427	B4DWD2;Q8IWC1-2;Q8IWC1;Q8IWC1-3	.;.;MA7D3_HUMAN;.	L	427;462;444;421	ENSP00000359695:P427L;ENSP00000318086:P462L;ENSP00000359697:P444L;ENSP00000359694:P421L	ENSP00000318086:P462L	P	-	2	0	MAP7D3	135141397	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.331000	0.19733	-0.113000	0.11958	-0.205000	0.12727	CCC		0.448	MAP7D3-001	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058487.2			34	90	0	0	0	0	34	90				
FGF13	2258	broad.mit.edu	37	X	137715119	137715119	+	Silent	SNP	G	G	A			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chrX:137715119G>A	ENST00000315930.6	-	5	1291	c.630C>T	c.(628-630)caC>caT	p.H210H	FGF13_ENST00000370603.3_Silent_p.H220H|FGF13_ENST00000305414.4_Silent_p.H157H|FGF13_ENST00000441825.2_Silent_p.H191H|FGF13_ENST00000541469.1_Silent_p.H164H	NM_004114.3	NP_004105.1	Q92913	FGF13_HUMAN	fibroblast growth factor 13	210					cell-cell signaling (GO:0007267)|cerebral cortex cell migration (GO:0021795)|establishment of neuroblast polarity (GO:0045200)|hippocampus development (GO:0021766)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|microtubule polymerization (GO:0046785)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of microtubule depolymerization (GO:0007026)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|positive regulation of protein kinase activity (GO:0045860)|protein localization to plasma membrane (GO:0072659)|signal transduction (GO:0007165)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular region (GO:0005576)|filopodium (GO:0030175)|growth cone (GO:0030426)|intercalated disc (GO:0014704)|microtubule (GO:0005874)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-tubulin binding (GO:0048487)|growth factor activity (GO:0008083)|ion channel binding (GO:0044325)|microtubule binding (GO:0008017)|protein kinase activator activity (GO:0030295)|sodium channel regulator activity (GO:0017080)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)	24	Acute lymphoblastic leukemia(192;0.000127)					CCGTGAGATCGTGCAGTGATG	0.483																																						uc004fam.2		NA																	0				ovary(1)|large_intestine(1)|breast(1)	3						c.(628-630)CAC>CAT		fibroblast growth factor 13 isoform 1							123.0	97.0	106.0					X																	137715119		2203	4300	6503	SO:0001819	synonymous_variant	2258				cell-cell signaling|MAPKKK cascade|nervous system development	cytoplasm|nucleus	growth factor activity|protein kinase activator activity	g.chrX:137715119G>A	BC034340	CCDS14664.1, CCDS14665.1, CCDS55511.1	Xq26.3	2008-02-05			ENSG00000129682	ENSG00000129682			3670	protein-coding gene	gene with protein product	"""fibroblast growth factor homologous factor 2"""	300070				8790420	Standard	NM_033642		Approved	FHF2, FGF2	uc011mwj.2	Q92913	OTTHUMG00000022532	ENST00000315930.6:c.630C>T	X.37:g.137715119G>A			Somatic				FGF13_uc004fan.2_Silent_p.H157H|FGF13_uc011mwi.1_Silent_p.H191H|FGF13_uc004faq.2_Silent_p.H220H|FGF13_uc004far.2_Silent_p.H191H|FGF13_uc011mwj.1_Silent_p.H220H|FGF13_uc011mwk.1_Silent_p.H164H	p.H210H	NM_004114	NP_004105	WXS	Illumina HiSeq	Unspecified	Q92913	FGF13_HUMAN			5	1292	-	Acute lymphoblastic leukemia(192;0.000127)		210					B1AK18|B7Z4M7|B7Z8N0|D3DWH4|O95830|Q9NZH9|Q9NZI0	Silent	SNP	ENST00000315930.6	37	c.630C>T	CCDS14665.1																																																																																				0.483	FGF13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058534.2	NM_004114		7	72	0	0	0	0	7	72				
KRT5	3852	broad.mit.edu	37	12	52913978	52913979	+	Frame_Shift_Ins	INS	-	-	GG	rs377261145|rs374017172		TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr12:52913978_52913979insGG	ENST00000252242.4	-	1	492_493	c.102_103insCC	c.(100-105)tccgtgfs	p.V35fs		NM_000424.3	NP_000415.2	P13647	K2C5_HUMAN	keratin 5	35	Head.				cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|hemidesmosome assembly (GO:0031581)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)			endometrium(5)|kidney(1)|large_intestine(8)|lung(15)|prostate(4)|skin(2)	35				BRCA - Breast invasive adenocarcinoma(357;0.189)		GACCGGGACACGGAGGTGAAGC	0.663																																						uc001san.2		NA																	0					0						c.(100-105)TCCGTGfs		keratin 5																																				SO:0001589	frameshift_variant	3852				epidermis development|hemidesmosome assembly	cytosol|keratin filament	protein binding|structural constituent of cytoskeleton	g.chr12:52913978_52913979insGG		CCDS8830.1	12q13.13	2013-01-16	2008-08-01		ENSG00000186081	ENSG00000186081		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6442	protein-coding gene	gene with protein product		148040	"""epidermolysis bullosa simplex 2 Dowling-Meara/Kobner/Weber-Cockayne types"", ""keratin 5 (epidermolysis bullosa simplex, Dowling-Meara/Kobner/Weber-Cockayne types)"""	EBS2		1713141, 16831889	Standard	NM_000424		Approved	KRT5A	uc001san.3	P13647	OTTHUMG00000169657	ENST00000252242.4:c.101_102dupCC	12.37:g.52913979_52913980dupGG	ENSP00000252242:p.Val35fs		Somatic				KRT5_uc009zmh.2_Frame_Shift_Ins_p.S34fs	p.S34fs	NM_000424	NP_000415	WXS	Illumina HiSeq	Unspecified	P13647	K2C5_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.189)	1	265_266	-			34_35			Head.		Q6PI71|Q6UBJ0|Q8TA91	Frame_Shift_Ins	INS	ENST00000252242.4	37	c.102_103insCC	CCDS8830.1																																																																																				0.663	KRT5-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405312.1			31	51	NA	NA	NA	NA	31	51	---	---	---	---
CTCF	10664	broad.mit.edu	37	16	67663349	67663361	+	Frame_Shift_Del	DEL	GAGGGGGAAAATG	GAGGGGGAAAATG	-			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr16:67663349_67663361delGAGGGGGAAAATG	ENST00000264010.4	+	10	2194_2206	c.1750_1762delGAGGGGGAAAATG	c.(1750-1764)gagggggaaaatggafs	p.EGENG584fs	CTCF_ENST00000401394.1_Frame_Shift_Del_p.EGENG256fs	NM_006565.3	NP_006556.1	P49711	CTCF_HUMAN	CCCTC-binding factor (zinc finger protein)	584					chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|DNA methylation (GO:0006306)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome positioning (GO:0016584)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone acetylation (GO:0035065)|regulation of histone methylation (GO:0031060)|regulation of molecular function, epigenetic (GO:0040030)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin insulator sequence binding (GO:0043035)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(6)|central_nervous_system(2)|cervix(1)|endometrium(34)|haematopoietic_and_lymphoid_tissue(7)|kidney(3)|large_intestine(9)|liver(1)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	79		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)		AGATGGCGTAGAGGGGGAAAATGGAGGAGAAAC	0.413																																					Colon(175;1200 1966 6945 23069 27405)	uc002etl.2		NA																	0				ovary(1)	1						c.(1750-1764)GAGGGGGAAAATGGAfs		CCCTC-binding factor																																				SO:0001589	frameshift_variant	10664				chromatin modification|chromosome segregation|negative regulation of transcription, DNA-dependent|nucleosome positioning|positive regulation of transcription, DNA-dependent|regulation of centromeric sister chromatid cohesion|regulation of molecular function, epigenetic	chromosome, centromeric region|condensed chromosome|nucleolus|nucleoplasm	chromatin insulator sequence binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr16:67663349_67663361delGAGGGGGAAAATG	U25435	CCDS10841.1, CCDS54029.1	16q21-q22.3	2013-01-08			ENSG00000102974	ENSG00000102974		"""Zinc fingers, C2H2-type"""	13723	protein-coding gene	gene with protein product	"""11 zinc finger transcriptional repressor"""	604167				8649389, 18550811	Standard	NM_006565		Approved		uc002etl.3	P49711	OTTHUMG00000137539	ENST00000264010.4:c.1750_1762delGAGGGGGAAAATG	16.37:g.67663349_67663361delGAGGGGGAAAATG	ENSP00000264010:p.Glu584fs		Somatic				CTCF_uc010cek.2_Frame_Shift_Del_p.E256fs|CTCF_uc002etm.1_Frame_Shift_Del_p.E73fs	p.E584fs	NM_006565	NP_006556	WXS	Illumina HiSeq	Unspecified	P49711	CTCF_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)	10	2040_2052	+		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)	584_588					B5MC38|Q53XI7|Q59EL8	Frame_Shift_Del	DEL	ENST00000264010.4	37	c.1750_1762delGAGGGGGAAAATG	CCDS10841.1																																																																																				0.413	CTCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268870.2	NM_006565		12	53	NA	NA	NA	NA	12	53	---	---	---	---
GPS2	2874	broad.mit.edu	37	17	7216126	7216127	+	Frame_Shift_Ins	INS	-	-	GG			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr17:7216126_7216127insGG	ENST00000380728.2	-	11	1232_1233	c.932_933insCC	c.(931-933)cctfs	p.P311fs	GPS2_ENST00000391950.3_Intron|GPS2_ENST00000389167.5_Frame_Shift_Ins_p.P311fs|RP11-542C16.2_ENST00000575474.1_3'UTR			Q13227	GPS2_HUMAN	G protein pathway suppressor 2	311					cell cycle (GO:0007049)|inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	GTPase inhibitor activity (GO:0005095)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(4)	24		Prostate(122;0.157)				AGGGGAGCCGAGGGCCAGGTTG	0.545																																						uc002gfv.1		NA																	0				ovary(2)|pancreas(1)	3						c.(931-933)CCTfs		G protein pathway suppressor 2																																				SO:0001589	frameshift_variant	2874				cell cycle|inactivation of MAPK activity|JNK cascade|negative regulation of JNK cascade|negative regulation of transcription from RNA polymerase II promoter	transcriptional repressor complex	GTPase inhibitor activity|protein binding|transcription corepressor activity	g.chr17:7216126_7216127insGG	U28963	CCDS11100.1	17p13.1	2006-04-29			ENSG00000132522	ENSG00000132522			4550	protein-coding gene	gene with protein product		601935				8943324	Standard	NM_004489		Approved		uc002gfx.1	Q13227	OTTHUMG00000102198	ENST00000380728.2:c.931_932dupCC	17.37:g.7216127_7216128dupGG	ENSP00000370104:p.Pro311fs		Somatic				GPS2_uc002gfw.1_Frame_Shift_Ins_p.P273fs|GPS2_uc002gfx.1_Frame_Shift_Ins_p.P311fs|NEURL4_uc002gfy.1_RNA|GPS2_uc002gfz.1_Frame_Shift_Ins_p.P311fs	p.P311fs	NM_004489	NP_004480	WXS	Illumina HiSeq	Unspecified	Q13227	GPS2_HUMAN			10	1195_1196	-		Prostate(122;0.157)	311					B4DXA1|Q6FHM8	Frame_Shift_Ins	INS	ENST00000380728.2	37	c.932_933insCC	CCDS11100.1																																																																																				0.545	GPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220048.4	NM_004489		27	137	NA	NA	NA	NA	27	137	---	---	---	---
ZBTB32	27033	broad.mit.edu	37	19	36206144	36206148	+	Frame_Shift_Del	DEL	GATGG	GATGG	-			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr19:36206144_36206148delGATGG	ENST00000392197.2	+	3	934_938	c.616_620delGATGG	c.(616-621)gatgggfs	p.DG206fs	KMT2B_ENST00000420124.1_5'Flank|KMT2B_ENST00000341701.1_5'Flank|KMT2B_ENST00000222270.7_5'Flank|ZBTB32_ENST00000262630.3_Frame_Shift_Del_p.DG206fs|KMT2B_ENST00000607650.1_RNA			Q9Y2Y4	ZBT32_HUMAN	zinc finger and BTB domain containing 32	206					DNA repair (GO:0006281)|hemopoiesis (GO:0030097)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of cytokine production (GO:0001817)|T cell proliferation (GO:0042098)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(1)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	14	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			AAGGGGAGCAGATGGGAAGCATGGA	0.615																																						uc002oay.2		NA																	0				ovary(1)|skin(1)	2						c.(616-621)GATGGGfs		zinc finger and BTB domain containing 32																																				SO:0001589	frameshift_variant	27033				DNA repair|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleoplasm	DNA binding|protein binding|transcription corepressor activity|zinc ion binding	g.chr19:36206144_36206148delGATGG	AF130255	CCDS12471.1	19q13.1	2013-01-08			ENSG00000011590	ENSG00000011590		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16763	protein-coding gene	gene with protein product	"""repressor of GATA"""	605859				10572087	Standard	XM_005258739		Approved	TZFP, FAZF, FAXF, Rog, ZNF538	uc002oay.3	Q9Y2Y4	OTTHUMG00000048118	ENST00000392197.2:c.616_620delGATGG	19.37:g.36206144_36206148delGATGG	ENSP00000376035:p.Asp206fs		Somatic				ZBTB32_uc002oaz.2_RNA|MLL4_uc010eei.2_5'Flank	p.D206fs	NM_014383	NP_055198	WXS	Illumina HiSeq	Unspecified	Q9Y2Y4	ZBT32_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0515)		2	826_830	+	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		206_207					Q8WVP2	Frame_Shift_Del	DEL	ENST00000392197.2	37	c.616_620delGATGG	CCDS12471.1																																																																																				0.615	ZBTB32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109491.3	NM_014383		9	41	NA	NA	NA	NA	9	41	---	---	---	---
OXTR	5021	broad.mit.edu	37	3	8809643	8809645	+	In_Frame_Del	DEL	GAA	GAA	-			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr3:8809643_8809645delGAA	ENST00000316793.3	-	3	853_855	c.229_231delTTC	c.(229-231)ttcdel	p.F77del	CAV3_ENST00000472766.1_Intron	NM_000916.3	NP_000907.2	P30559	OXYR_HUMAN	oxytocin receptor	77					cell surface receptor signaling pathway (GO:0007166)|digestive tract development (GO:0048565)|eating behavior (GO:0042755)|ERK1 and ERK2 cascade (GO:0070371)|estrous cycle phase (GO:0060206)|female pregnancy (GO:0007565)|heart development (GO:0007507)|lactation (GO:0007595)|maternal behavior (GO:0042711)|maternal process involved in parturition (GO:0060137)|memory (GO:0007613)|muscle contraction (GO:0006936)|negative regulation of gastric acid secretion (GO:0060455)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of norepinephrine secretion (GO:0010701)|positive regulation of penile erection (GO:0060406)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of uterine smooth muscle contraction (GO:0070474)|response to amphetamine (GO:0001975)|response to anoxia (GO:0034059)|response to cocaine (GO:0042220)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to peptide hormone (GO:0043434)|response to progesterone (GO:0032570)|sleep (GO:0030431)|social behavior (GO:0035176)|sperm ejaculation (GO:0042713)|suckling behavior (GO:0001967)|telencephalon development (GO:0021537)	apical plasma membrane (GO:0016324)|cell-cell adherens junction (GO:0005913)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	oxytocin receptor activity (GO:0004990)|peptide hormone binding (GO:0017046)|vasopressin receptor activity (GO:0005000)			NS(1)|endometrium(2)|large_intestine(4)|lung(5)|urinary_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(96;0.15)	Carbetocin(DB01282)|Oxytocin(DB00107)	GGTGCTTCATGAAGAAGAAGAGG	0.635																																						uc003brc.2		NA																	0					0						c.(229-231)TTCdel		oxytocin receptor	Carbetocin(DB01282)																																			SO:0001651	inframe_deletion	5021				female pregnancy|lactation|muscle contraction	integral to plasma membrane	oxytocin receptor activity|vasopressin receptor activity	g.chr3:8809643_8809645delGAA		CCDS2570.1	3p25	2012-08-08			ENSG00000180914	ENSG00000180914		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	8529	protein-coding gene	gene with protein product		167055				1313946	Standard	NM_000916		Approved		uc003brc.3	P30559	OTTHUMG00000090537	ENST00000316793.3:c.229_231delTTC	3.37:g.8809649_8809651delGAA	ENSP00000324270:p.Phe77del		Somatic					p.F77del	NM_000916	NP_000907	WXS	Illumina HiSeq	Unspecified	P30559	OXYR_HUMAN		OV - Ovarian serous cystadenocarcinoma(96;0.15)	3	851_853	-			77			Helical; Name=2; (Potential).		Q15071	In_Frame_Del	DEL	ENST00000316793.3	37	c.229_231delTTC	CCDS2570.1																																																																																				0.635	OXTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207061.2			5	8	NA	NA	NA	NA	5	8	---	---	---	---
TIGD4	201798	broad.mit.edu	37	4	153691769	153691770	+	Frame_Shift_Ins	INS	-	-	A	rs572232165		TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr4:153691769_153691770insA	ENST00000304337.2	-	2	1207_1208	c.387_388insT	c.(385-390)agtaatfs	p.N130fs		NM_145720.3	NP_663772.1	Q8IY51	TIGD4_HUMAN	tigger transposable element derived 4	130	HTH CENPB-type. {ECO:0000255|PROSITE- ProRule:PRU00583}.					nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(2)|large_intestine(9)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	26	all_hematologic(180;0.093)					AGCCAACCATTACTGCACTTAA	0.416																																						uc003imy.2		NA																	0				ovary(1)	1						c.(385-390)AGTAATfs		tigger transposable element derived 4																																				SO:0001589	frameshift_variant	201798				regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	chromatin binding|DNA binding	g.chr4:153691769_153691770insA	AK058054	CCDS34079.1	4q31.23	2008-02-05							18335	protein-coding gene	gene with protein product							Standard	NM_145720		Approved		uc003imy.3	Q8IY51		ENST00000304337.2:c.388dupT	4.37:g.153691770_153691770dupA	ENSP00000355162:p.Asn130fs		Somatic					p.S129fs	NM_145720	NP_663772	WXS	Illumina HiSeq	Unspecified	Q8IY51	TIGD4_HUMAN			2	1169_1170	-	all_hematologic(180;0.093)		129_130			HTH CENPB-type.|H-T-H motif (By similarity).		Q96LP5	Frame_Shift_Ins	INS	ENST00000304337.2	37	c.387_388insT	CCDS34079.1																																																																																				0.416	TIGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365028.1	NM_145720		17	47	NA	NA	NA	NA	17	47	---	---	---	---
JMY	133746	broad.mit.edu	37	5	78611869	78611869	+	Frame_Shift_Del	DEL	T	T	-			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr5:78611869delT	ENST00000396137.4	+	10	3168	c.2706delT	c.(2704-2706)agtfs	p.S902fs	JMY_ENST00000412001.1_Intron	NM_152405.4	NP_689618.4	Q8N9B5	JMY_HUMAN	junction mediating and regulatory protein, p53 cofactor	902					'de novo' actin filament nucleation (GO:0070060)|actin polymerization-dependent cell motility (GO:0070358)|Arp2/3 complex-mediated actin nucleation (GO:0034314)|cell cycle arrest (GO:0007050)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of apoptotic process (GO:0043065)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			endometrium(4)|kidney(2)|large_intestine(2)|lung(6)|skin(1)|urinary_tract(1)	16		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;4.45e-45)|Epithelial(54;5.85e-40)|all cancers(79;2.89e-35)		AGCGTGGTAGTTTTCATCTGA	0.393																																						uc003kfx.3		NA																	0					0						c.(2704-2706)AGTfs		junction-mediating and regulatory protein							163.0	153.0	156.0					5																	78611869		1910	4132	6042	SO:0001589	frameshift_variant	133746				'de novo' actin filament nucleation|actin polymerization-dependent cell motility|Arp2/3 complex-mediated actin nucleation|cell cycle arrest|DNA repair|induction of apoptosis|positive regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter	cell leading edge|cytoplasm|cytoskeleton|nucleus	actin binding|transcription coactivator activity	g.chr5:78611869delT	AK095189	CCDS4047.3	5q14.1	2010-03-23			ENSG00000152409	ENSG00000152409			28916	protein-coding gene	gene with protein product		604279				10518217	Standard	NM_152405		Approved	FLJ37870	uc003kfx.4	Q8N9B5	OTTHUMG00000131301	ENST00000396137.4:c.2706delT	5.37:g.78611869delT	ENSP00000379441:p.Ser902fs		Somatic					p.S902fs	NM_152405	NP_689618	WXS	Illumina HiSeq	Unspecified	Q8N9B5	JMY_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;4.45e-45)|Epithelial(54;5.85e-40)|all cancers(79;2.89e-35)	10	3226	+		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)	902					A1L4P5|B5MDS2|B5MDT0	Frame_Shift_Del	DEL	ENST00000396137.4	37	c.2706delT	CCDS4047.3																																																																																				0.393	JMY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254070.4	NM_152405		23	81	NA	NA	NA	NA	23	81	---	---	---	---
C6orf62	81688	broad.mit.edu	37	6	24709057	24709059	+	In_Frame_Del	DEL	ACA	ACA	-	rs200156457		TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr6:24709057_24709059delACA	ENST00000378119.4	-	4	2677_2679	c.510_512delTGT	c.(508-513)gttgtc>gtc	p.170_171VV>V	RP1-30M3.6_ENST00000606921.1_RNA|C6orf62_ENST00000378102.3_In_Frame_Del_p.141_142VV>V|C6orf62_ENST00000540769.1_In_Frame_Del_p.112_113VV>V	NM_030939.4	NP_112201.1	Q9GZU0	CF062_HUMAN	chromosome 6 open reading frame 62	170						intracellular (GO:0005622)				endometrium(2)|kidney(3)|large_intestine(2)|lung(3)	10						AGGATTGTTGACAACGATTCCAG	0.384																																						uc003nel.2		NA																	0					0						c.(508-513)GTTGTC>GTC		hypothetical protein LOC81688																																				SO:0001651	inframe_deletion	81688					intracellular		g.chr6:24709057_24709059delACA	AL136632	CCDS4559.1	6p22.1	2011-12-13			ENSG00000112308	ENSG00000112308			20998	protein-coding gene	gene with protein product	"""HBV X-transactivated protein 12"""					11230166	Standard	NM_030939		Approved	FLJ12619, DKFZP564G182, XTP12	uc003nel.3	Q9GZU0	OTTHUMG00000014361	ENST00000378119.4:c.510_512delTGT	6.37:g.24709057_24709059delACA	ENSP00000367359:p.Val171del		Somatic					p.170_171VV>V	NM_030939	NP_112201	WXS	Illumina HiSeq	Unspecified	Q9GZU0	CF062_HUMAN			4	1017_1019	-			170_171					Q3LIB6|Q5JVZ2|Q5JVZ3|Q6IA63|Q9H1Z2	In_Frame_Del	DEL	ENST00000378119.4	37	c.510_512delTGT	CCDS4559.1																																																																																				0.384	C6orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040017.1	NM_030939		19	92	NA	NA	NA	NA	19	92	---	---	---	---
KMT2C	58508	broad.mit.edu	37	7	151859299	151859300	+	Frame_Shift_Ins	INS	-	-	AAGAT			TCGA-H7-7774-01A-21D-2078-08	TCGA-H7-7774-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0eb5b79a-e3be-4b19-aef6-74247986aaf6	14396841-202f-433a-bdcc-292b733f535f	g.chr7:151859299_151859300insAAGAT	ENST00000262189.6	-	43	11580_11581	c.11362_11363insATCTT	c.(11362-11364)tctfs	p.S3788fs	KMT2C_ENST00000355193.2_Frame_Shift_Ins_p.S3788fs	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	3788					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										ATTCAAAAGAGAAGATGACTTT	0.436																																						uc003wla.2		NA								N							medulloblastoma		0				large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63						c.(11362-11364)TCTfs		myeloid/lymphoid or mixed-lineage leukemia 3																																				SO:0001589	frameshift_variant	58508				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr7:151859299_151859300insAAGAT	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.11358_11362dupATCTT	7.37:g.151859300_151859304dupAAGAT	ENSP00000262189:p.Ser3788fs		Somatic				MLL3_uc003wkz.2_Frame_Shift_Ins_p.S2849fs|MLL3_uc003wky.2_Frame_Shift_Ins_p.S1297fs	p.S3788fs	NM_170606	NP_733751	WXS	Illumina HiSeq	Unspecified	Q8NEZ4	MLL3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)	43	11581_11582	-	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	3788					Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Frame_Shift_Ins	INS	ENST00000262189.6	37	c.11362_11363insATCTT	CCDS5931.1																																																																																				0.436	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			7	33	NA	NA	NA	NA	7	33	---	---	---	---
