#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ANKS1B	56899	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	12	100377920	100377920	+	Silent	SNP	G	G	A			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr12:100377920G>A	ENST00000547776.2	-	1	95	c.96C>T	c.(94-96)ggC>ggT	p.G32G	ANKS1B_ENST00000329257.7_Silent_p.G32G|ANKS1B_ENST00000547010.1_5'UTR	NM_152788.4	NP_690001.3	Q7Z6G8	ANS1B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1B	32						cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ephrin receptor binding (GO:0046875)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(15)|lung(38)|pancreas(1)|prostate(2)|skin(1)	70		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		CGGATCCACCGCCCAGGATCC	0.572																																						.											0													71.0	80.0	77.0					12																	100377920		1968	4131	6099	SO:0001819	synonymous_variant	56899			AF145204	CCDS55864.1, CCDS55865.1, CCDS55866.1, CCDS55867.1, CCDS55868.1, CCDS55869.1, CCDS55870.1, CCDS55871.1, CCDS55872.1	12q23.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	24600	protein-coding gene	gene with protein product		607815				10490826, 12415113	Standard	NM_020140		Approved	EB-1, AIDA-1, cajalin-2, ANKS2	uc001tge.2	Q7Z6G8		ENST00000547776.2:c.96C>T	12.37:g.100377920G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A5PKY5|A7E259|A8K153|A8MSN4|B4DFP6|B4DH98|F8VPM3|F8VZR9|F8WC27|Q5XLJ0|Q6IVB5|Q6NUS4|Q7Z6G6|Q7Z6G7|Q8TAP3|Q9NRX7|Q9Y5K9	Silent	SNP	ENST00000547776.2	37	CCDS55872.1																																																																																				0.572	ANKS1B-003	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000408421.3	NM_020140	
TRIM11	81559	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	1	228582602	228582602	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr1:228582602A>G	ENST00000284551.6	-	6	1489	c.1211T>C	c.(1210-1212)gTg>gCg	p.V404A	TRIM11_ENST00000493030.2_Missense_Mutation_p.V279A|TRIM11_ENST00000460651.1_5'UTR|RP11-245P10.8_ENST00000602963.1_RNA	NM_145214.2	NP_660215.1	Q96F44	TRI11_HUMAN	tripartite motif containing 11	404	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of neurogenesis (GO:0050768)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of viral entry into host cell (GO:0046598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|skin(1)	18		Prostate(94;0.0724)				AAAGATCCCCACGCGCCTGGG	0.597																																						.											0													71.0	79.0	76.0					1																	228582602		2203	4300	6503	SO:0001583	missense	81559			AF220125	CCDS31048.1	1q42.13	2013-01-09	2011-01-25		ENSG00000154370	ENSG00000154370		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16281	protein-coding gene	gene with protein product		607868	"""tripartite motif-containing 11"""			11331580	Standard	NM_145214		Approved	RNF92, BIA1	uc001hss.3	Q96F44	OTTHUMG00000039773	ENST00000284551.6:c.1211T>C	1.37:g.228582602A>G	ENSP00000284551:p.Val404Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A6NKE2|B2RB82|B3KUS3|B4DX88|Q5VSU1|Q8NCA6|Q9C022	Missense_Mutation	SNP	ENST00000284551.6	37	CCDS31048.1	.	.	.	.	.	.	.	.	.	.	A	15.81	2.943345	0.53079	.	.	ENSG00000154370	ENST00000284551	T	0.75589	-0.95	4.76	4.76	0.60689	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.43747	D	0.000540	D	0.87410	0.6170	M	0.90650	3.135	0.80722	D	1	P;D	0.60575	0.912;0.988	P;D	0.70935	0.741;0.971	D	0.89783	0.3962	10	0.87932	D	0	.	12.5428	0.56182	1.0:0.0:0.0:0.0	.	403;404	Q96F44-3;Q96F44	.;TRI11_HUMAN	A	404	ENSP00000284551:V404A	ENSP00000284551:V404A	V	-	2	0	TRIM11	226649225	0.970000	0.33590	0.691000	0.30163	0.025000	0.11179	8.827000	0.92041	1.920000	0.55613	0.496000	0.49642	GTG		0.597	TRIM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095995.3	NM_145214	
ADAMTS7	11173	broad.mit.edu;hgsc.bcm.edu	37	15	79060504	79060504	+	Frame_Shift_Del	DEL	C	C	-			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr15:79060504delC	ENST00000388820.4	-	17	2826	c.2616delG	c.(2614-2616)aggfs	p.R872fs	ADAMTS7_ENST00000566303.1_5'UTR	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	872	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						CGCTGCACTTCCTCTGTTGGT	0.697																																						.											0													22.0	23.0	23.0					15																	79060504		2190	4289	6479	SO:0001589	frameshift_variant	11173			AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.2616delG	15.37:g.79060504delC	ENSP00000373472:p.Arg872fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q14F51|Q6P7J9	Frame_Shift_Del	DEL	ENST00000388820.4	37	CCDS32303.1																																																																																				0.697	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
TBC1D24	57465	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	16	2547069	2547069	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr16:2547069A>G	ENST00000293970.5	+	2	1053	c.920A>G	c.(919-921)aAt>aGt	p.N307S	RP11-20I23.1_ENST00000564543.1_Missense_Mutation_p.N307S|TBC1D24_ENST00000434757.2_Missense_Mutation_p.N307S|TBC1D24_ENST00000567020.1_Missense_Mutation_p.N307S	NM_001199107.1	NP_001186036.1	Q9ULP9	TBC24_HUMAN	TBC1 domain family, member 24	307					neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|terminal bouton (GO:0043195)	Rab GTPase activator activity (GO:0005097)			endometrium(2)|kidney(4)|large_intestine(3)|lung(4)	13						CAGATGGCCAATGAGAAAGCC	0.617																																						.											0													45.0	51.0	49.0					16																	2547069		2102	4232	6334	SO:0001583	missense	57465			AB032997	CCDS42107.1, CCDS55980.1	16p13.3	2014-05-07				ENSG00000162065			29203	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 6"""	613577	"""deafness, autosomal recessive 86"""	DFNB86		10574461, 24387994, 24729539	Standard	NM_001199107		Approved	KIAA1171, TLDC6, DFNA65	uc002cql.3	Q9ULP9		ENST00000293970.5:c.920A>G	16.37:g.2547069A>G	ENSP00000293970:p.Asn307Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A0JNW3|B9A6M6|Q2KJ08	Missense_Mutation	SNP	ENST00000293970.5	37	CCDS55980.1	.	.	.	.	.	.	.	.	.	.	A	19.54	3.847006	0.71603	.	.	ENSG00000162065	ENST00000293970;ENST00000434757	T;T	0.24151	1.87;1.87	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.50292	0.1607	M	0.73598	2.24	0.58432	D	0.999997	D;D;D	0.89917	0.995;1.0;1.0	P;D;D	0.91635	0.904;0.997;0.999	T	0.51244	-0.8730	10	0.46703	T	0.11	-37.885	13.7275	0.62767	1.0:0.0:0.0:0.0	.	307;307;307	B9A6M6;Q9ULP9;Q9ULP9-2	.;TBC24_HUMAN;.	S	307	ENSP00000293970:N307S;ENSP00000390106:N307S	ENSP00000293970:N307S	N	+	2	0	TBC1D24	2487070	1.000000	0.71417	0.995000	0.50966	0.988000	0.76386	7.399000	0.79935	1.919000	0.55581	0.533000	0.62120	AAT		0.617	TBC1D24-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000435637.1	NM_020705	
SRRM2	23524	hgsc.bcm.edu	37	16	2819139	2819139	+	Silent	SNP	C	C	T			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr16:2819139C>T	ENST00000301740.8	+	12	8424	c.7875C>T	c.(7873-7875)tcC>tcT	p.S2625S	AC092117.2_ENST00000581119.1_RNA|SRRM2_ENST00000574593.1_3'UTR	NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	2625	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						cctcctcctcctcttcttcct	0.592																																						.											0													141.0	121.0	128.0					16																	2819139		2198	4300	6498	SO:0001819	synonymous_variant	23524			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.7875C>T	16.37:g.2819139C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Silent	SNP	ENST00000301740.8	37	CCDS32373.1																																																																																				0.592	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
HOXB4	3214	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	17	46654334	46654334	+	Missense_Mutation	SNP	T	T	A			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr17:46654334T>A	ENST00000332503.5	-	2	2297	c.506A>T	c.(505-507)tAc>tTc	p.Y169F	HOXB3_ENST00000472863.1_Intron|HOXB3_ENST00000498678.1_Intron|HOXB3_ENST00000490677.1_5'Flank|HOXB3_ENST00000476342.1_Intron|HOXB3_ENST00000311626.4_5'Flank|HOXB3_ENST00000460160.1_Intron|HOXB3_ENST00000489475.1_Intron|HOXB-AS3_ENST00000465846.2_RNA|HOXB3_ENST00000485909.2_5'Flank|HOXB3_ENST00000465120.3_Intron|MIR10A_ENST00000385043.1_RNA|HOXB3_ENST00000552000.2_Intron	NM_024015.4	NP_076920.1	P17483	HXB4_HUMAN	homeobox B4	169					anterior/posterior pattern specification (GO:0009952)|bone marrow development (GO:0048539)|cell proliferation (GO:0008283)|definitive hemopoiesis (GO:0060216)|embryonic skeletal system morphogenesis (GO:0048704)|hematopoietic stem cell differentiation (GO:0060218)|morphogenesis of an epithelial sheet (GO:0002011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of stem cell differentiation (GO:2000738)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|somatic stem cell division (GO:0048103)|spleen development (GO:0048536)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|urinary_tract(2)	9						CTGGCGCGTGTAGGCGGTCCG	0.607																																						.											0													60.0	65.0	63.0					17																	46654334		2203	4300	6503	SO:0001583	missense	3214				CCDS11529.1	17q21.32	2011-06-20	2005-12-22		ENSG00000182742	ENSG00000182742		"""Homeoboxes / ANTP class : HOXL subclass"""	5115	protein-coding gene	gene with protein product		142965	"""homeo box B4"""	HOX2, HOX2F		1973146, 1358459	Standard	NM_024015		Approved		uc002inp.3	P17483	OTTHUMG00000159920	ENST00000332503.5:c.506A>T	17.37:g.46654334T>A	ENSP00000328928:p.Tyr169Phe	Somatic		WXS	Illumina HiSeq	Phase_I	Q9NTA0	Missense_Mutation	SNP	ENST00000332503.5	37	CCDS11529.1	.	.	.	.	.	.	.	.	.	.	T	26.9	4.777571	0.90195	.	.	ENSG00000182742	ENST00000332503	D	0.94828	-3.53	5.27	4.2	0.49525	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.93194	0.7832	N	0.11892	0.195	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93155	0.6553	10	0.87932	D	0	.	10.5006	0.44804	0.0:0.0772:0.0:0.9228	.	169	P17483	HXB4_HUMAN	F	169	ENSP00000328928:Y169F	ENSP00000328928:Y169F	Y	-	2	0	HOXB4	44009333	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.250000	0.72435	0.852000	0.35287	0.459000	0.35465	TAC		0.607	HOXB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358259.2		
SGCA	6442	hgsc.bcm.edu	37	17	48245013	48245013	+	Silent	SNP	C	C	T			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr17:48245013C>T	ENST00000262018.3	+	3	264	c.228C>T	c.(226-228)ctC>ctT	p.L76L	SGCA_ENST00000513942.1_Intron|SGCA_ENST00000344627.6_Silent_p.L76L|SGCA_ENST00000451235.2_Intron|RP11-893F2.14_ENST00000572855.1_RNA|SGCA_ENST00000543315.1_Silent_p.L76L	NM_000023.2	NP_000014.1	Q16586	SGCA_HUMAN	sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein)	76					muscle contraction (GO:0006936)|muscle organ development (GO:0007517)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(7)|ovary(2)|skin(1)	14						CCCGGTGGCTCCGCTACACCC	0.667																																						.											0													47.0	47.0	47.0					17																	48245013		2203	4300	6503	SO:0001819	synonymous_variant	6442			L34355	CCDS32679.1, CCDS45729.1	17q21	2014-09-17	2002-08-29		ENSG00000108823	ENSG00000108823			10805	protein-coding gene	gene with protein product	"""50kD DAG"", ""Sarcoglycan, alpha (50kD dystrophin-associated glycoprotein; adhalin)"", ""adhalin (limb girdle muscular dystrophy 2D)"""	600119	"""sarcoglycan, alpha (50kD dystrophin-associated glycoprotein)"""	ADL		7937874	Standard	NM_000023		Approved	SCARMD1, LGMD2D, adhalin, DMDA2, A2	uc002iqi.3	Q16586	OTTHUMG00000162024	ENST00000262018.3:c.228C>T	17.37:g.48245013C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A6NEB8|A8K3K7|Q13710|Q13712	Silent	SNP	ENST00000262018.3	37	CCDS32679.1																																																																																				0.667	SGCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366841.1	NM_000023	
DOT1L	84444	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	19	2207667	2207667	+	Silent	SNP	C	C	T			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr19:2207667C>T	ENST00000398665.3	+	11	987	c.951C>T	c.(949-951)atC>atT	p.I317I		NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	317	DOT1. {ECO:0000255|PROSITE- ProRule:PRU00902}.				histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGCACACTATCGACCGCACCA	0.632																																						.											0													72.0	85.0	80.0					19																	2207667		2187	4267	6454	SO:0001819	synonymous_variant	84444			AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.951C>T	19.37:g.2207667C>T		Somatic		WXS	Illumina HiSeq	Phase_I	O60379|Q96JL1	Silent	SNP	ENST00000398665.3	37	CCDS42460.1	.	.	.	.	.	.	.	.	.	.	C	11.73	1.724445	0.30593	.	.	ENSG00000104885	ENST00000440640	.	.	.	4.84	-2.37	0.06643	.	.	.	.	.	T	0.50548	0.1622	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45891	-0.9230	4	.	.	.	-25.0987	6.4921	0.22121	0.1462:0.1694:0.0:0.6845	.	.	.	.	L	104	.	.	S	+	2	0	DOT1L	2158667	0.977000	0.34250	0.993000	0.49108	0.972000	0.66771	0.145000	0.16157	-0.138000	0.11434	-0.793000	0.03317	TCG		0.632	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318066.1	NM_032482	
KALRN	8997	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	3	124201729	124201729	+	Missense_Mutation	SNP	A	A	T			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr3:124201729A>T	ENST00000240874.3	+	28	4417	c.4260A>T	c.(4258-4260)aaA>aaT	p.K1420N	KALRN_ENST00000460856.1_Missense_Mutation_p.K1411N|KALRN_ENST00000360013.3_Missense_Mutation_p.K1420N	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	1420	DH 1. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						GGATCACCAAATATCAACTGC	0.537																																						.											0													252.0	200.0	217.0					3																	124201729		2203	4300	6503	SO:0001583	missense	8997			U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.4260A>T	3.37:g.124201729A>T	ENSP00000240874:p.Lys1420Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	ENST00000240874.3	37	CCDS3027.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.43|19.43	3.826148|3.826148	0.71143|0.71143	.|.	.|.	ENSG00000160145|ENSG00000160145	ENST00000460856;ENST00000240874;ENST00000360013|ENST00000354186	T;T;T|.	0.41758|.	0.99;0.99;0.99|.	5.31|5.31	3.47|3.47	0.39725|0.39725	Dbl homology (DH) domain (5);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.86814|0.86814	0.6023|0.6023	H|H	0.98199|0.98199	4.17|4.17	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;0.997;1.0|.	D;D;D;D|.	0.97110|.	1.0;1.0;0.991;1.0|.	D|D	0.89291|0.89291	0.3619|0.3619	10|5	0.87932|.	D|.	0|.	.|.	10.1107|10.1107	0.42561|0.42561	0.2349:0.0:0.7651:0.0|0.2349:0.0:0.7651:0.0	.|.	1411;766;1420;1420|.	C9IZQ6;F2Z3Q6;O60229;O60229-2|.	.;.;KALRN_HUMAN;.|.	N|I	1411;1420;1420|1389	ENSP00000418611:K1411N;ENSP00000240874:K1420N;ENSP00000353109:K1420N|.	ENSP00000240874:K1420N|.	K|N	+|+	3|2	2|0	KALRN|KALRN	125684419|125684419	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.948000|0.948000	0.59901|0.59901	2.240000|2.240000	0.43088|0.43088	1.449000|1.449000	0.47699|0.47699	-0.242000|-0.242000	0.12053|0.12053	AAA|AAT		0.537	KALRN-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258843.4	NM_003947	
EPHB1	2047	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	3	134873005	134873005	+	Missense_Mutation	SNP	G	G	A	rs183234182		TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr3:134873005G>A	ENST00000398015.3	+	6	1679	c.1309G>A	c.(1309-1311)Gtt>Att	p.V437I	EPHB1_ENST00000493838.1_5'UTR	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	437	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						CCCCTCCACCGTTCCCATCAT	0.532													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20316	0.0		0.0	False		,,,				2504	0.0					.											0								G	ILE/VAL	0,4304		0,0,2152	199.0	212.0	207.0		1309	5.0	1.0	3		207	1,8563		0,1,4281	no	missense	EPHB1	NM_004441.4	29	0,1,6433	AA,AG,GG		0.0117,0.0,0.0078	possibly-damaging	437/985	134873005	1,12867	2152	4282	6434	SO:0001583	missense	2047			L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.1309G>A	3.37:g.134873005G>A	ENSP00000381097:p.Val437Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Missense_Mutation	SNP	ENST00000398015.3	37	CCDS46921.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	19.63	3.862742	0.71949	0.0	1.17E-4	ENSG00000154928	ENST00000398015	T	0.55588	0.51	5.0	5.0	0.66597	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.066621	0.64402	D	0.000014	T	0.50922	0.1644	M	0.64997	1.995	0.80722	D	1	P	0.42556	0.783	B	0.36885	0.235	T	0.56408	-0.7984	10	0.41790	T	0.15	.	18.0819	0.89443	0.0:0.0:1.0:0.0	.	437	P54762	EPHB1_HUMAN	I	437	ENSP00000381097:V437I	ENSP00000381097:V437I	V	+	1	0	EPHB1	136355695	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.657000	0.98554	2.610000	0.88304	0.655000	0.94253	GTT		0.532	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357671.1	NM_004441	
CRIPAK	285464	hgsc.bcm.edu	37	4	1389130	1389130	+	Silent	SNP	G	G	A			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr4:1389130G>A	ENST00000324803.4	+	1	3791	c.831G>A	c.(829-831)ggG>ggA	p.G277G		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	277					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.G277G(1)		NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			GCCGATGTGGGGTGCCCGCCT	0.687																																						.											1	Substitution - coding silent(1)	lung(1)											154.0	143.0	147.0					4																	1389130		2202	4299	6501	SO:0001819	synonymous_variant	285464			AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.831G>A	4.37:g.1389130G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q8NB03	Silent	SNP	ENST00000324803.4	37	CCDS3349.1																																																																																				0.687	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
ASPN	54829	hgsc.bcm.edu	37	9	95237030	95237030	+	Missense_Mutation	SNP	A	A	C	rs143279922		TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr9:95237030A>C	ENST00000375544.3	-	2	393	c.150T>G	c.(148-150)gaT>gaG	p.D50E	ASPN_ENST00000375543.1_Missense_Mutation_p.D50E|ASPN_ENST00000395538.3_Missense_Mutation_p.D50E|CENPP_ENST00000375587.3_Intron|ASPN_ENST00000450139.2_Missense_Mutation_p.D22E	NM_017680.4	NP_060150	Q9BXN1	ASPN_HUMAN	asporin	50	Poly-Asp.				bone mineralization (GO:0030282)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	9						TGTCCtcatcatcatcatcat	0.398																																						.											0													112.0	102.0	105.0					9																	95237030		2203	4300	6503	SO:0001583	missense	54829			AF316824		9q22.31	2008-05-14	2007-02-15		ENSG00000106819	ENSG00000106819		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	14872	protein-coding gene	gene with protein product	"""asporin proteoglycan"""	608135	"""asporin (LRR class 1)"""				Standard	NM_017680		Approved	FLJ20129, SLRR1C, PLAP1	uc004ase.2	Q9BXN1	OTTHUMG00000020227	ENST00000375544.3:c.150T>G	9.37:g.95237030A>C	ENSP00000364694:p.Asp50Glu	Somatic		WXS	Illumina HiSeq	Phase_I	Q5TBF3|Q96K79|Q96LD0|Q9NXP3	Missense_Mutation	SNP	ENST00000375544.3	37		.	.	.	.	.	.	.	.	.	.	A	2.759	-0.258312	0.05791	.	.	ENSG00000106819	ENST00000375544;ENST00000375543;ENST00000395538;ENST00000450139	T;T;T	0.52983	0.64;0.69;0.69	3.41	-5.95	0.02241	.	1.551710	0.03954	N	0.288946	T	0.32645	0.0836	L	0.40543	1.245	0.09310	N	1	B;B	0.32245	0.361;0.001	B;B	0.27380	0.079;0.001	T	0.11941	-1.0567	10	0.22109	T	0.4	.	7.6964	0.28598	0.4608:0.1193:0.4198:0.0	.	50;50	Q5TBF2;Q9BXN1	.;ASPN_HUMAN	E	50;50;50;22	ENSP00000364694:D50E;ENSP00000364693:D50E;ENSP00000378909:D50E	ENSP00000364693:D50E	D	-	3	2	ASPN	94276851	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	-1.911000	0.01583	-2.152000	0.00794	-2.339000	0.00246	GAT		0.398	ASPN-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000053094.1	NM_017680	
USP9X	8239	broad.mit.edu;hgsc.bcm.edu	37	X	41088984	41088985	+	Frame_Shift_Ins	INS	-	-	A			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chrX:41088984_41088985insA	ENST00000324545.8	+	43	8016_8017	c.7383_7384insA	c.(7384-7386)agtfs	p.S2462fs	USP9X_ENST00000378308.2_Frame_Shift_Ins_p.S2462fs	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	2462					axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						AGAGATCACATAGTGCTAGGAT	0.431																																					Ovarian(172;1807 2695 35459 49286)	.											0																																										SO:0001589	frameshift_variant	8239			X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.7384dupA	X.37:g.41088985_41088985dupA	ENSP00000316357:p.Ser2462fs	Somatic		WXS	Illumina HiSeq	Phase_I	O75550|Q8WWT3|Q8WX12	Frame_Shift_Ins	INS	ENST00000324545.8	37	CCDS43930.1																																																																																				0.431	USP9X-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056250.4	NM_004652	
EEF1B2	1933	hgsc.bcm.edu	37	2	207027464	207027464	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr2:207027464C>T	ENST00000392222.2	+	6	910	c.535C>T	c.(535-537)Cca>Tca	p.P179S	SNORA41_ENST00000384675.1_RNA|SNORD51_ENST00000384320.2_RNA|EEF1B2_ENST00000392221.1_Missense_Mutation_p.P179S|EEF1B2_ENST00000236957.5_Missense_Mutation_p.P179S	NM_001959.3	NP_001950.1	P24534	EF1B_HUMAN	eukaryotic translation elongation factor 1 beta 2	179					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)	translation elongation factor activity (GO:0003746)			breast(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(6)	16						TAAACTAGTTCCAGTGGGATA	0.358																																						.											0													79.0	86.0	83.0					2																	207027464		2203	4300	6503	SO:0001583	missense	1933			X60489	CCDS2367.1	2q33.3	2011-04-28			ENSG00000114942	ENSG00000114942			3208	protein-coding gene	gene with protein product		600655				8250921	Standard	NM_001959		Approved		uc002vbf.1	P24534	OTTHUMG00000132891	ENST00000392222.2:c.535C>T	2.37:g.207027464C>T	ENSP00000376056:p.Pro179Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A8K795|Q6IBH9	Missense_Mutation	SNP	ENST00000392222.2	37	CCDS2367.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.787326	0.90367	.	.	ENSG00000114942	ENST00000236957;ENST00000392221;ENST00000392222	.	.	.	5.2	5.2	0.72013	Translation elongation factor EF1B/ribosomal protein S6 (1);Translation elongation factor EF1B, beta/delta subunit, guanine nucleotide exchange (3);	0.000000	0.85682	D	0.000000	D	0.83718	0.5315	M	0.82433	2.59	0.80722	D	1	P	0.48294	0.908	D	0.68483	0.958	D	0.85972	0.1477	9	0.87932	D	0	-1.39	18.7341	0.91748	0.0:1.0:0.0:0.0	.	179	P24534	EF1B_HUMAN	S	179	.	ENSP00000236957:P179S	P	+	1	0	EEF1B2	206735709	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.435000	0.82474	0.655000	0.94253	CCA		0.358	EEF1B2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336436.1	NM_001037663	
CNR1	1268	hgsc.bcm.edu	37	6	88853866	88853866	+	Silent	SNP	C	C	T			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr6:88853866C>T	ENST00000537554.1	-	2	4690	c.1128G>A	c.(1126-1128)aaG>aaA	p.K376K	CNR1_ENST00000549716.1_Silent_p.K315K|CNR1_ENST00000369499.2_Silent_p.K376K|CNR1_ENST00000369501.2_Silent_p.K376K|CNR1_ENST00000362094.5_3'UTR|CNR1_ENST00000428600.2_Silent_p.K376K|CNR1_ENST00000535130.1_Silent_p.K376K|CNR1_ENST00000549890.1_Silent_p.K376K|CNR1_ENST00000468898.1_Silent_p.K343K	NM_001160226.1|NM_001160258.1	NP_001153698.1|NP_001153730.1	P21554	CNR1_HUMAN	cannabinoid receptor 1 (brain)	376					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|negative regulation of blood pressure (GO:0045776)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of mast cell activation (GO:0033004)|negative regulation of nitric-oxide synthase activity (GO:0051001)|positive regulation of acute inflammatory response to antigenic stimulus (GO:0002866)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood pressure (GO:0045777)|positive regulation of fever generation (GO:0031622)|positive regulation of neuron projection development (GO:0010976)|regulation of feeding behavior (GO:0060259)|regulation of insulin secretion (GO:0050796)|regulation of penile erection (GO:0060405)|regulation of synaptic transmission, GABAergic (GO:0032228)|regulation of synaptic transmission, glutamatergic (GO:0051966)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|sensory perception of pain (GO:0019233)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)|drug binding (GO:0008144)			breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|prostate(1)|skin(10)|urinary_tract(1)	37		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.15)	Dronabinol(DB00470)|Nabilone(DB00486)|Rimonabant(DB06155)	CAAACACCGTCTTAATGAGCT	0.517																																						.											0													128.0	123.0	125.0					6																	88853866		2203	4300	6503	SO:0001819	synonymous_variant	1268			AF107262	CCDS5015.1, CCDS5016.1, CCDS5016.2	6q14-q15	2012-08-08			ENSG00000118432	ENSG00000118432		"""GPCR / Class A : Cannabinoid receptors"""	2159	protein-coding gene	gene with protein product		114610		CNR			Standard	NM_016083		Approved	CB1K5, CB-R, CB1, CANN6, CB1A	uc003pmq.4	P21554	OTTHUMG00000015184	ENST00000537554.1:c.1128G>A	6.37:g.88853866C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B2R9T4|E1P512|Q13949|Q495Z0|Q4PLI4|Q4VBM6|Q5JVL5|Q5UB37|Q9UNN0	Silent	SNP	ENST00000537554.1	37	CCDS5015.1																																																																																				0.517	CNR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354204.2		
PNISR	25957	broad.mit.edu;hgsc.bcm.edu;bcgsc.ca	37	6	99852539	99852539	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr6:99852539C>T	ENST00000369239.5	-	9	1246	c.1042G>A	c.(1042-1044)Gat>Aat	p.D348N	PNISR_ENST00000438806.1_Missense_Mutation_p.D348N	NM_032870.2	NP_116259.2	Q8TF01	PNISR_HUMAN	PNN-interacting serine/arginine-rich protein	348						cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24						TCTGTGACATCCAGCAGAATT	0.343																																						.											0													112.0	109.0	110.0					6																	99852539		2203	4299	6502	SO:0001583	missense	25957			AK027759	CCDS5043.1	6q16.3	2011-06-06	2011-06-06	2011-06-06	ENSG00000132424	ENSG00000132424			21222	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 111"", ""splicing factor, arginine/serine-rich 18"""	C6orf111, SFRS18		14578391	Standard	NM_032870		Approved	FLJ14752, bA98I9.2, DKFZp564B0769, SRrp130	uc021zdd.1	Q8TF01	OTTHUMG00000015262	ENST00000369239.5:c.1042G>A	6.37:g.99852539C>T	ENSP00000358242:p.Asp348Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A8K540|E1P5D2|Q5T064|Q5T065|Q6P2B4|Q6P2N4|Q6PJ93|Q6PK36|Q7Z640|Q8N2L1|Q8TF00|Q96K10|Q96SI3|Q96SM5|Q9P076|Q9P0C0|Q9Y4N3	Missense_Mutation	SNP	ENST00000369239.5	37	CCDS5043.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.595129	0.86953	.	.	ENSG00000132424	ENST00000369239;ENST00000438806	T;T	0.48522	0.81;0.81	5.44	4.56	0.56223	.	0.091506	0.85682	D	0.000000	T	0.37046	0.0989	L	0.50333	1.59	0.54753	D	0.999987	P	0.50819	0.939	P	0.45538	0.484	T	0.42103	-0.9471	10	0.87932	D	0	.	16.2025	0.82095	0.0:0.8666:0.1334:0.0	.	348	Q8TF01	PNISR_HUMAN	N	348	ENSP00000358242:D348N;ENSP00000387997:D348N	ENSP00000358242:D348N	D	-	1	0	PNISR	99959260	1.000000	0.71417	0.998000	0.56505	0.694000	0.40290	7.346000	0.79347	1.271000	0.44313	-0.189000	0.12847	GAT		0.343	PNISR-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041598.1	NM_032870	
MST1L	11223	broad.mit.edu	37	1	17085780	17085780	+	RNA	SNP	G	G	A			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr1:17085780G>A	ENST00000455405.2	-	0	0							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										GCCGCACGTCGTCTGTACAAC	0.692																																						.											0																																												11223			U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17085780G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B7WPB1|Q13209	Silent	SNP	ENST00000455405.2	37																																																																																					0.692	MST1L-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000400328.1	NM_001271733	
PDZK1IP1	10158	broad.mit.edu	37	1	47653017	47653017	+	Silent	SNP	G	G	A			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr1:47653017G>A	ENST00000294338.2	-	2	272	c.150C>T	c.(148-150)gtC>gtT	p.V50V	PDZK1IP1_ENST00000371885.1_Silent_p.V50V|PDZK1IP1_ENST00000491793.1_5'Flank	NM_005764.3	NP_005755.1	Q13113	PDZ1I_HUMAN	PDZK1 interacting protein 1	50						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				endometrium(1)|lung(1)|prostate(1)	3						AGAAGTGGTTGACTGCAAAGG	0.622																																						.											0													64.0	55.0	58.0					1																	47653017		2202	4299	6501	SO:0001819	synonymous_variant	10158			U21049	CCDS546.1	1p33	2008-02-05			ENSG00000162366	ENSG00000162366			16887	protein-coding gene	gene with protein product		607178				9815914, 8701988, 12754212, 12837682	Standard	NM_005764		Approved	DD96, MAP17, SPAP	uc001cqw.3	Q13113	OTTHUMG00000007852	ENST00000294338.2:c.150C>T	1.37:g.47653017G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q6ICT9|Q96EI1	Silent	SNP	ENST00000294338.2	37	CCDS546.1																																																																																				0.622	PDZK1IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021655.1	NM_005764	
USH2A	7399	broad.mit.edu	37	1	216219788	216219788	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr1:216219788T>C	ENST00000307340.3	-	32	6696	c.6310A>G	c.(6310-6312)Aac>Gac	p.N2104D	USH2A_ENST00000366943.2_Missense_Mutation_p.N2104D	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2104	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ACTATGTAGTTCTCCTCACTG	0.403										HNSCC(13;0.011)																												.											0													107.0	90.0	96.0					1																	216219788		2203	4300	6503	SO:0001583	missense	7399			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.6310A>G	1.37:g.216219788T>C	ENSP00000305941:p.Asn2104Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	T	1.716	-0.497836	0.04291	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.54071	0.59;0.59	5.42	4.28	0.50868	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.412679	0.20460	N	0.091907	T	0.41673	0.1169	L	0.46741	1.465	0.09310	N	0.999998	B	0.09022	0.002	B	0.08055	0.003	T	0.15723	-1.0427	10	0.29301	T	0.29	.	7.6799	0.28507	0.0:0.158:0.0:0.842	.	2104	O75445	USH2A_HUMAN	D	2104	ENSP00000305941:N2104D;ENSP00000355910:N2104D	ENSP00000305941:N2104D	N	-	1	0	USH2A	214286411	0.421000	0.25465	0.989000	0.46669	0.074000	0.17049	1.333000	0.33816	2.187000	0.69744	0.528000	0.53228	AAC		0.403	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
CSGALNACT2	55454	broad.mit.edu	37	10	43659419	43659419	+	Missense_Mutation	SNP	G	G	T	rs79064394		TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr10:43659419G>T	ENST00000374466.3	+	5	1421	c.1086G>T	c.(1084-1086)ttG>ttT	p.L362F		NM_018590.3	NP_061060.3	Q8N6G5	CGAT2_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 2	362					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|dermatan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050652)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)	p.L362F(5)		endometrium(12)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						GAGAGGTCTTGATGTTTTTCT	0.433																																						.											5	Substitution - Missense(5)	endometrium(4)|kidney(1)											223.0	221.0	222.0					10																	43659419		2203	4300	6503	SO:0001583	missense	55454			AF116646	CCDS7201.1	10q11.21	2013-02-19			ENSG00000169826	ENSG00000169826		"""Beta 4-glycosyltransferases"""	24292	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase 2"""					12446672	Standard	NM_018590		Approved	GALNACT2, MGC40204, PRO0082, GALNACT-2	uc001jan.4	Q8N6G5	OTTHUMG00000018023	ENST00000374466.3:c.1086G>T	10.37:g.43659419G>T	ENSP00000363590:p.Leu362Phe	Somatic		WXS	Illumina HiSeq	Phase_I	B3KWL7|Q6MZJ5|Q6MZP6|Q8TCH4|Q9P1I6	Missense_Mutation	SNP	ENST00000374466.3	37	CCDS7201.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.499782	0.85176	.	.	ENSG00000169826	ENST00000374466	T	0.27256	1.68	6.08	5.17	0.71159	.	0.064535	0.64402	D	0.000004	T	0.57359	0.2048	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.63721	-0.6573	10	0.87932	D	0	-11.7375	14.8306	0.70146	0.0683:0.0:0.9317:0.0	.	362	Q8N6G5	CGAT2_HUMAN	F	362	ENSP00000363590:L362F	ENSP00000363590:L362F	L	+	3	2	CSGALNACT2	42979425	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.683000	0.37638	2.894000	0.99253	0.591000	0.81541	TTG		0.433	CSGALNACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047693.1	NM_018590	
GPAM	57678	broad.mit.edu	37	10	113933564	113933564	+	Missense_Mutation	SNP	G	G	T			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr10:113933564G>T	ENST00000348367.4	-	7	650	c.453C>A	c.(451-453)aaC>aaA	p.N151K	GPAM_ENST00000423155.1_Missense_Mutation_p.N151K|GPAM_ENST00000369425.1_Missense_Mutation_p.N151K			Q9HCL2	GPAT1_HUMAN	glycerol-3-phosphate acyltransferase, mitochondrial	151					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|defense response to virus (GO:0051607)|fatty acid homeostasis (GO:0055089)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|interleukin-2 secretion (GO:0070970)|negative regulation of activation-induced cell death of T cells (GO:0070236)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of multicellular organism growth (GO:0040018)|regulation of cytokine secretion (GO:0050707)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			breast(2)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Epithelial(162;0.0306)|all cancers(201;0.123)		AACCATCAGGGTTTAATTCAG	0.393																																					Ovarian(161;1017 2606 18293 52943)	.											0													87.0	79.0	81.0					10																	113933564		2203	4300	6503	SO:0001583	missense	57678			AL832464	CCDS7570.1	10q25.3	2009-07-15			ENSG00000119927	ENSG00000119927			24865	protein-coding gene	gene with protein product	"""glycerol-3-phosphate acyltransferase 1, mitochondrial"""	602395				10997877, 8369314	Standard	NM_020918		Approved	KIAA1560, MGC26846, GPAT1	uc001kzp.3	Q9HCL2	OTTHUMG00000019055	ENST00000348367.4:c.453C>A	10.37:g.113933564G>T	ENSP00000265276:p.Asn151Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VW51|Q86TA3	Missense_Mutation	SNP	ENST00000348367.4	37	CCDS7570.1	.	.	.	.	.	.	.	.	.	.	G	11.05	1.524672	0.27299	.	.	ENSG00000119927	ENST00000348367;ENST00000423155;ENST00000369425	T;T;T	0.67523	-0.27;-0.27;-0.27	6.02	-1.13	0.09775	.	0.206543	0.50627	D	0.000102	T	0.41534	0.1163	L	0.29908	0.895	0.19300	N	0.999979	B;B	0.26672	0.156;0.067	B;B	0.22386	0.039;0.027	T	0.36529	-0.9744	10	0.06099	T	0.92	-25.0851	6.8287	0.23897	0.6387:0.0:0.2374:0.1239	.	151;151	Q5VW52;Q9HCL2	.;GPAT1_HUMAN	K	151	ENSP00000265276:N151K;ENSP00000409242:N151K;ENSP00000358433:N151K	ENSP00000265276:N151K	N	-	3	2	GPAM	113923554	0.727000	0.28069	0.892000	0.35008	0.576000	0.36127	0.020000	0.13466	-0.375000	0.07955	-0.145000	0.13849	AAC		0.393	GPAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050377.1	NM_020918	
ATE1	11101	broad.mit.edu;bcgsc.ca	37	10	123596309	123596309	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr10:123596309A>G	ENST00000224652.6	-	10	1266	c.1181T>C	c.(1180-1182)cTt>cCt	p.L394P	ATE1_ENST00000540606.1_Missense_Mutation_p.L387P|ATE1_ENST00000369040.3_Missense_Mutation_p.L298P|ATE1_ENST00000535655.1_Missense_Mutation_p.L95P|ATE1_ENST00000369043.3_Missense_Mutation_p.L394P|ATE1_ENST00000543447.1_Missense_Mutation_p.L279P	NM_001001976.1	NP_001001976.1	O95260	ATE1_HUMAN	arginyltransferase 1	394					protein arginylation (GO:0016598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	arginyltransferase activity (GO:0004057)			endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		all_neural(114;0.061)|Lung NSC(174;0.095)|all_lung(145;0.124)|Breast(234;0.212)				TTTCTCATGAAGCTGCCTAGT	0.328																																						.											0													48.0	53.0	52.0					10																	123596309		2196	4293	6489	SO:0001583	missense	11101			AF079098	CCDS31299.1, CCDS31300.1, CCDS73211.1, CCDS73212.1, CCDS73213.1	10q26	2013-05-08			ENSG00000107669	ENSG00000107669	2.3.2.8		782	protein-coding gene	gene with protein product		607103				16002466, 16943202	Standard	XM_005269458		Approved		uc001lfq.3	O95260	OTTHUMG00000019178	ENST00000224652.6:c.1181T>C	10.37:g.123596309A>G	ENSP00000224652:p.Leu394Pro	Somatic		WXS	Illumina HiSeq	Phase_I	O95261|Q5SQQ3|Q8WW04	Missense_Mutation	SNP	ENST00000224652.6	37	CCDS31300.1	.	.	.	.	.	.	.	.	.	.	A	24.2	4.504714	0.85176	.	.	ENSG00000107669	ENST00000369043;ENST00000535655;ENST00000224652;ENST00000369040;ENST00000540606;ENST00000543447	.	.	.	5.66	5.66	0.87406	Acyl-CoA N-acyltransferase (1);Arginine-tRNA-protein transferase, C-terminal (1);	0.000000	0.64402	D	0.000001	D	0.87585	0.6214	H	0.96048	3.76	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;1.0;0.999;0.998	D	0.91320	0.5081	9	0.66056	D	0.02	-7.6788	15.898	0.79350	1.0:0.0:0.0:0.0	.	387;298;394;394	F5GXE4;B4E107;O95260;O95260-2	.;.;ATE1_HUMAN;.	P	394;95;394;298;387;279	.	ENSP00000224652:L394P	L	-	2	0	ATE1	123586299	1.000000	0.71417	0.998000	0.56505	0.959000	0.62525	9.270000	0.95690	2.161000	0.67846	0.533000	0.62120	CTT		0.328	ATE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_001001976	
TH	7054	broad.mit.edu	37	11	2186902	2186902	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr11:2186902A>G	ENST00000381178.1	-	12	1307	c.1289T>C	c.(1288-1290)cTc>cCc	p.L430P	TH_ENST00000352909.3_Missense_Mutation_p.L399P|TH_ENST00000333684.5_Missense_Mutation_p.L309P|TH_ENST00000381175.1_Missense_Mutation_p.L426P	NM_199292.2	NP_954986.2	P07101	TY3H_HUMAN	tyrosine hydroxylase	430					anatomical structure morphogenesis (GO:0009653)|catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|cellular response to growth factor stimulus (GO:0071363)|cellular response to manganese ion (GO:0071287)|cellular response to nicotine (GO:0071316)|cerebral cortex development (GO:0021987)|circadian sleep/wake cycle (GO:0042745)|dopamine biosynthetic process (GO:0042416)|dopamine biosynthetic process from tyrosine (GO:0006585)|eating behavior (GO:0042755)|embryonic camera-type eye morphogenesis (GO:0048596)|epinephrine biosynthetic process (GO:0042418)|eye photoreceptor cell development (GO:0042462)|fatty acid metabolic process (GO:0006631)|glycoside metabolic process (GO:0016137)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|isoquinoline alkaloid metabolic process (GO:0033076)|learning (GO:0007612)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|memory (GO:0007613)|multicellular organismal aging (GO:0010259)|neurotransmitter biosynthetic process (GO:0042136)|norepinephrine biosynthetic process (GO:0042421)|organ morphogenesis (GO:0009887)|phthalate metabolic process (GO:0018963)|phytoalexin metabolic process (GO:0052314)|pigmentation (GO:0043473)|regulation of heart contraction (GO:0008016)|response to activity (GO:0014823)|response to amphetamine (GO:0001975)|response to corticosterone (GO:0051412)|response to electrical stimulus (GO:0051602)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to ether (GO:0045472)|response to herbicide (GO:0009635)|response to hypoxia (GO:0001666)|response to light stimulus (GO:0009416)|response to lipopolysaccharide (GO:0032496)|response to nutrient levels (GO:0031667)|response to peptide hormone (GO:0043434)|response to pyrethroid (GO:0046684)|response to salt stress (GO:0009651)|response to water deprivation (GO:0009414)|response to zinc ion (GO:0010043)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|sphingolipid metabolic process (GO:0006665)|synaptic transmission, dopaminergic (GO:0001963)|synaptic vesicle amine transport (GO:0015842)|terpene metabolic process (GO:0042214)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|melanosome membrane (GO:0033162)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perikaryon (GO:0043204)|smooth endoplasmic reticulum (GO:0005790)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	amino acid binding (GO:0016597)|dopamine binding (GO:0035240)|enzyme binding (GO:0019899)|ferric iron binding (GO:0008199)|ferrous iron binding (GO:0008198)|oxygen binding (GO:0019825)|tetrahydrobiopterin binding (GO:0034617)|tyrosine 3-monooxygenase activity (GO:0004511)			NS(1)|endometrium(1)|large_intestine(1)|lung(7)|skin(1)	11		all_epithelial(84;1.46e-23)|Lung NSC(207;4.44e-11)|all_lung(207;1.11e-09)|Ovarian(85;1.78e-06)|Breast(177;1.78e-05)|Medulloblastoma(188;0.0208)|all_neural(188;0.0416)	Colorectal(5;0.00245)|COAD - Colon adenocarcinoma(6;0.0239)	BRCA - Breast invasive adenocarcinoma(625;8.45e-09)|Lung(200;0.000152)|LUSC - Lung squamous cell carcinoma(625;0.00154)	L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)|Metyrosine(DB00765)|Tetrahydrobiopterin(DB00360)	TCTCACCAGGAGCTCCCCGTA	0.662																																						.											0													51.0	50.0	51.0					11																	2186902		2200	4297	6497	SO:0001583	missense	7054			X05290	CCDS7730.1, CCDS7731.1, CCDS31338.1	11p15.5	2013-06-03			ENSG00000180176	ENSG00000180176	1.14.16.2		11782	protein-coding gene	gene with protein product	"""tyrosine 3-monooxygenase"""	191290					Standard	NM_199292		Approved	DYT5b	uc001lvq.3	P07101	OTTHUMG00000009559	ENST00000381178.1:c.1289T>C	11.37:g.2186902A>G	ENSP00000370571:p.Leu430Pro	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZL70|B7ZL73|Q0PWM2|Q0PWM3|Q15585|Q15588|Q15589|Q2M3B4	Missense_Mutation	SNP	ENST00000381178.1	37	CCDS7731.1	.	.	.	.	.	.	.	.	.	.	A	15.01	2.705500	0.48412	.	.	ENSG00000180176	ENST00000381178;ENST00000381175;ENST00000352909;ENST00000333684	D;D;D;D	0.99807	-6.85;-6.85;-6.85;-6.85	4.03	2.78	0.32641	Aromatic amino acid hydroxylase, C-terminal (4);	0.000000	0.64402	D	0.000001	D	0.99764	0.9904	M	0.93763	3.455	0.58432	D	0.999995	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.999;0.999;0.999;1.0;0.999	D	0.97556	1.0095	10	0.87932	D	0	5.1889	9.5303	0.39189	0.823:0.177:0.0:0.0	.	403;309;305;399;430;426	B7ZL73;Q0PWM2;Q0PWM3;P07101-3;P07101;P07101-2	.;.;.;.;TY3H_HUMAN;.	P	430;426;399;309	ENSP00000370571:L430P;ENSP00000370567:L426P;ENSP00000325951:L399P;ENSP00000328814:L309P	ENSP00000328814:L309P	L	-	2	0	TH	2143478	1.000000	0.71417	0.998000	0.56505	0.080000	0.17528	7.030000	0.76484	1.603000	0.50134	0.402000	0.26972	CTC		0.662	TH-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026597.1	NM_000360	
TRIM49B	283116	broad.mit.edu	37	11	49056667	49056667	+	Frame_Shift_Del	DEL	C	C	-			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr11:49056667delC	ENST00000332682.7	+	5	787	c.759delC	c.(757-759)cacfs	p.H253fs		NM_001206626.1	NP_001193555.1	A6NDI0	TR49B_HUMAN	tripartite motif containing 49B	253						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			lung(8)	8						ACATATTACACAGGTGAGTGT	0.333																																						.											0																																										SO:0001589	frameshift_variant	283116				CCDS55762.1	11p11.12	2014-02-17			ENSG00000182053	ENSG00000182053		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	42955	protein-coding gene	gene with protein product							Standard	NM_001206626		Approved		uc021qix.1	A6NDI0		ENST00000332682.7:c.759delC	11.37:g.49056667delC	ENSP00000330216:p.His253fs	Somatic		WXS	Illumina HiSeq	Phase_I		Frame_Shift_Del	DEL	ENST00000332682.7	37	CCDS55762.1																																																																																				0.333	TRIM49B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
RSF1	51773	broad.mit.edu	37	11	77409663	77409663	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr11:77409663T>C	ENST00000308488.6	-	7	2886	c.2584A>G	c.(2584-2586)Agt>Ggt	p.S862G	RSF1_ENST00000480887.1_Missense_Mutation_p.S610G|RSF1_ENST00000360355.2_Missense_Mutation_p.S831G			Q96T23	RSF1_HUMAN	remodeling and spacing factor 1	862					CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RSF complex (GO:0031213)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)			GACCCTTCACTTTCATCATTG	0.418																																						.											0													159.0	151.0	154.0					11																	77409663		2200	4292	6492	SO:0001583	missense	51773			AF380176, AF227948	CCDS8253.1	11q14.1	2013-01-28	2006-05-25	2006-05-25	ENSG00000048649	ENSG00000048649		"""Zinc fingers, PHD-type"""	18118	protein-coding gene	gene with protein product		608522	"""hepatitis B virus x associated protein"""	HBXAP		11788598, 12972596	Standard	NM_016578		Approved	XAP8, RSF-1, p325	uc001oyn.3	Q96T23	OTTHUMG00000150433	ENST00000308488.6:c.2584A>G	11.37:g.77409663T>C	ENSP00000311513:p.Ser862Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q86X86|Q9H3L8|Q9NVZ8|Q9NYU0	Missense_Mutation	SNP	ENST00000308488.6	37	CCDS8253.1	.	.	.	.	.	.	.	.	.	.	T	18.28	3.590084	0.66105	.	.	ENSG00000048649	ENST00000308488;ENST00000480887;ENST00000360355;ENST00000526324	D;D;D;D	0.86497	-2.08;-2.09;-2.07;-2.13	4.68	4.68	0.58851	Zinc finger, FYVE/PHD-type (1);	0.000000	0.64402	D	0.000013	T	0.79375	0.4435	L	0.29908	0.895	0.37258	D	0.906843	P	0.44734	0.842	B	0.36959	0.237	D	0.83999	0.0342	10	0.49607	T	0.09	-11.6966	14.2598	0.66078	0.0:0.0:0.0:1.0	.	862	Q96T23	RSF1_HUMAN	G	862;610;831;663	ENSP00000311513:S862G;ENSP00000434509:S610G;ENSP00000353511:S831G;ENSP00000432022:S663G	ENSP00000311513:S862G	S	-	1	0	RSF1	77087311	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.058000	0.64300	2.086000	0.62901	0.482000	0.46254	AGT		0.418	RSF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318075.2	NM_016578	
A2M	2	broad.mit.edu	37	12	9242558	9242558	+	Silent	SNP	C	C	T			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr12:9242558C>T	ENST00000318602.7	-	21	2965	c.2658G>A	c.(2656-2658)gaG>gaA	p.E886E		NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin	886					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)			breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	CTGAAGGCACCTCAGTCCCAC	0.413													C|||	1	0.000199681	0.0	0.0	5008	,	,		-128	0.0		0.0	False		,,,				2504	0.001					.											0													94.0	94.0	94.0					12																	9242558		1914	4121	6035	SO:0001819	synonymous_variant	2			BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.2658G>A	12.37:g.9242558C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	Silent	SNP	ENST00000318602.7	37	CCDS44827.1	.	.	.	.	.	.	.	.	.	.	C	0.016	-1.527696	0.00959	.	.	ENSG00000175899	ENST00000543436	.	.	.	5.68	-0.311	0.12761	.	.	.	.	.	T	0.51702	0.1690	.	.	.	0.41759	D	0.989704	.	.	.	.	.	.	T	0.38650	-0.9651	4	.	.	.	.	6.7089	0.23266	0.0:0.4781:0.1145:0.4074	.	.	.	.	K	134	.	.	R	-	2	0	A2M	9133825	0.000000	0.05858	0.013000	0.15412	0.013000	0.08279	-0.202000	0.09451	-0.356000	0.08187	-0.140000	0.14226	AGG		0.413	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317233.2	NM_000014	
FNDC3A	22862	broad.mit.edu	37	13	49719943	49719943	+	Silent	SNP	A	A	G			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr13:49719943A>G	ENST00000492622.2	+	8	1154	c.849A>G	c.(847-849)gtA>gtG	p.V283V	FNDC3A_ENST00000398316.3_Silent_p.V227V|FNDC3A_ENST00000541916.1_Silent_p.V283V	NM_001079673.1	NP_001073141.1	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A	283	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				fertilization (GO:0009566)|Sertoli cell development (GO:0060009)|single organismal cell-cell adhesion (GO:0016337)|spermatid development (GO:0007286)	acrosomal vesicle (GO:0001669)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|prostate(5)|skin(2)|urinary_tract(1)	41		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)		GGACAGTAGTACTTACCTGGT	0.383																																						.											0													116.0	108.0	111.0					13																	49719943		2203	4300	6503	SO:0001819	synonymous_variant	22862			AB023187	CCDS9413.2, CCDS41886.1	13q14.12	2013-02-11	2005-01-20	2005-01-22	ENSG00000102531	ENSG00000102531		"""Fibronectin type III domain containing"""	20296	protein-coding gene	gene with protein product		615794	"""fibronectin type III domain containing 3"""	FNDC3			Standard	NM_001079673		Approved	bA203I16.5, KIAA0970	uc001vcm.3	Q9Y2H6	OTTHUMG00000016911	ENST00000492622.2:c.849A>G	13.37:g.49719943A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B4DYG1|Q5HYC9|Q5JVF8|Q5JVF9|Q6EVH3|Q6EVH4|Q6N020|Q6P9D5|Q6ZME4|Q9H1W1	Silent	SNP	ENST00000492622.2	37	CCDS41886.1																																																																																				0.383	FNDC3A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354845.2	NM_014923	
MYH6	4624	broad.mit.edu	37	14	23871766	23871766	+	Missense_Mutation	SNP	C	C	A	rs200260629	byFrequency	TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr14:23871766C>A	ENST00000356287.3	-	11	1077	c.1048G>T	c.(1048-1050)Gtc>Ttc	p.V350F	MYH6_ENST00000405093.3_Missense_Mutation_p.V350F			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	350	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)			breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		AGCTTGTAGACGCCAGCTTTC	0.612																																						.											0													113.0	106.0	108.0					14																	23871766		2203	4300	6503	SO:0001583	missense	4624			D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.1048G>T	14.37:g.23871766C>A	ENSP00000348634:p.Val350Phe	Somatic		WXS	Illumina HiSeq	Phase_I	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Missense_Mutation	SNP	ENST00000356287.3	37	CCDS9600.1	.	.	.	.	.	.	.	.	.	.	.	15.63	2.891589	0.52014	.	.	ENSG00000197616	ENST00000405093;ENST00000356287	D;D	0.89552	-2.53;-2.53	3.82	1.83	0.25207	Myosin head, motor domain (2);	.	.	.	.	D	0.92264	0.7546	M	0.90252	3.1	0.33668	D	0.610552	P;P	0.35124	0.485;0.485	P;P	0.46510	0.519;0.519	D	0.92436	0.5958	9	0.87932	D	0	.	7.8698	0.29558	0.0:0.6811:0.0:0.3189	.	350;350	D9YZU2;P13533	.;MYH6_HUMAN	F	350	ENSP00000386041:V350F;ENSP00000348634:V350F	ENSP00000348634:V350F	V	-	1	0	MYH6	22941606	0.001000	0.12720	0.161000	0.22692	0.966000	0.64601	-0.073000	0.11468	0.182000	0.20032	0.305000	0.20034	GTC		0.612	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071796.3		
C14orf1	11161	broad.mit.edu	37	14	76118234	76118234	+	Splice_Site	SNP	T	T	C			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr14:76118234T>C	ENST00000256319.6	-	4	670		c.e4-2		FLVCR2_ENST00000553587.1_Intron|FLVCR2_ENST00000556241.1_Intron	NM_007176.3	NP_009107.1	Q9UKR5	ERG28_HUMAN	chromosome 14 open reading frame 1						sterol biosynthetic process (GO:0016126)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	6		all_epithelial(191;0.125)|all_neural(303;0.13)|Myeloproliferative disorder(585;0.163)		BRCA - Breast invasive adenocarcinoma(234;0.00147)		TGATAGAGCCTATAAGGAAGC	0.458																																						.											0													98.0	98.0	98.0					14																	76118234		2203	4300	6503	SO:0001630	splice_region_variant	11161			AF134159	CCDS9845.1	14q24.3	2012-08-16			ENSG00000133935	ENSG00000133935			1187	protein-coding gene	gene with protein product		604576				10449901, 12958361, 11160377	Standard	NM_007176		Approved	NET51, ERG28	uc001xrt.3	Q9UKR5	OTTHUMG00000171488	ENST00000256319.6:c.225-2A>G	14.37:g.76118234T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q9P093|Q9UPI2	Splice_Site	SNP	ENST00000256319.6	37	CCDS9845.1	.	.	.	.	.	.	.	.	.	.	T	16.08	3.022922	0.54683	.	.	ENSG00000133935	ENST00000256319	.	.	.	5.7	5.7	0.88788	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.638	0.76970	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	C14orf1	75187987	1.000000	0.71417	0.932000	0.37286	0.477000	0.33069	7.624000	0.83124	2.172000	0.68678	0.533000	0.62120	.		0.458	C14orf1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413683.1	NM_007176	Intron
KIAA0430	9665	broad.mit.edu	37	16	15718883	15718883	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr16:15718883T>C	ENST00000396368.3	-	9	2307	c.2101A>G	c.(2101-2103)Acc>Gcc	p.T701A	KIAA0430_ENST00000548025.1_Missense_Mutation_p.T698A|KIAA0430_ENST00000602337.1_Missense_Mutation_p.T698A|KIAA0430_ENST00000344181.3_Intron|KIAA0430_ENST00000551742.1_Missense_Mutation_p.T700A|KIAA0430_ENST00000540441.2_Missense_Mutation_p.T558A	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430	701					double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						TTCTGACTGGTTTTGTAAACG	0.478																																						.											0													129.0	125.0	126.0					16																	15718883		1933	4143	6076	SO:0001583	missense	9665			AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.2101A>G	16.37:g.15718883T>C	ENSP00000379654:p.Thr701Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Missense_Mutation	SNP	ENST00000396368.3	37	CCDS10562.2	.	.	.	.	.	.	.	.	.	.	T	13.58	2.279882	0.40294	.	.	ENSG00000166783	ENST00000396368;ENST00000540441;ENST00000321370;ENST00000548025;ENST00000551742	.	.	.	6.08	1.35	0.21983	.	0.834384	0.11312	N	0.576993	T	0.31638	0.0803	L	0.36672	1.1	0.23138	N	0.998239	B;B;B;B	0.15141	0.005;0.012;0.012;0.003	B;B;B;B	0.12156	0.007;0.007;0.007;0.003	T	0.23547	-1.0185	9	0.45353	T	0.12	.	8.3104	0.32068	0.0:0.3151:0.0:0.6849	.	699;698;697;700	Q9Y4F3-5;F8VV09;Q9Y4F3-4;Q9Y4F3	.;.;.;LKAP_HUMAN	A	701;558;700;698;700	.	ENSP00000315718:T700A	T	-	1	0	KIAA0430	15626384	0.833000	0.29383	0.033000	0.17914	0.728000	0.41692	0.719000	0.25881	-0.028000	0.13850	0.482000	0.46254	ACC		0.478	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252131.2	NM_014647	
TRAPPC8	22878	broad.mit.edu;ucsc.edu;mdanderson.org	37	18	29511428	29511428	+	Silent	SNP	T	T	C			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr18:29511428T>C	ENST00000283351.4	-	2	551	c.216A>G	c.(214-216)gtA>gtG	p.V72V	TRAPPC8_ENST00000582513.1_Silent_p.V72V|TRAPPC8_ENST00000582539.1_Silent_p.V18V|TRAPPC8_ENST00000584876.1_5'UTR	NM_014939.3	NP_055754	Q9Y2L5	TPPC8_HUMAN	trafficking protein particle complex 8	72					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(7)|liver(2)|lung(13)|ovary(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						CAATGTTGCTTACTGCTATCT	0.368																																						.											0													147.0	148.0	148.0					18																	29511428		2203	4300	6503	SO:0001819	synonymous_variant	22878			AB023229	CCDS11901.1	18q12.1	2011-10-10	2010-06-29	2010-06-29	ENSG00000153339	ENSG00000153339		"""Trafficking protein particle complex"""	29169	protein-coding gene	gene with protein product	"""general sporulation gene 1 homolog (S. cerevisiae)"""	614136	"""KIAA1012"""	KIAA1012		10231032, 11230166	Standard	NM_014939		Approved	HsT2706, TRS85, GSG1	uc002kxc.4	Q9Y2L5	OTTHUMG00000132267	ENST00000283351.4:c.216A>G	18.37:g.29511428T>C		Somatic		WXS	Illumina HiSeq	Phase_I	A0JP15|B3KME5|Q9H0L2	Silent	SNP	ENST00000283351.4	37	CCDS11901.1																																																																																				0.368	TRAPPC8-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255355.1	NM_014939	
MIER2	54531	broad.mit.edu	37	19	327253	327253	+	Missense_Mutation	SNP	G	G	T	rs200916519		TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr19:327253G>T	ENST00000264819.4	-	5	383	c.373C>A	c.(373-375)Caa>Aaa	p.Q125K	MIER2_ENST00000592722.1_5'Flank	NM_017550.1	NP_060020.1	Q8N344	MIER2_HUMAN	mesoderm induction early response 1, family member 2	125					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(4)|kidney(1)|large_intestine(5)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22		all_cancers(10;1.05e-30)|all_epithelial(18;3.04e-19)|Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;2.49e-05)|all_lung(49;4.36e-05)|Breast(49;0.000304)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TTCGCTATTTGTTCCTTTAAA	0.438																																						.											0													164.0	172.0	169.0					19																	327253		2203	4300	6503	SO:0001583	missense	54531			AB033019	CCDS32855.1	19p13.3	2008-02-05	2006-04-20	2006-04-20		ENSG00000105556			29210	protein-coding gene	gene with protein product			"""KIAA1193"""	KIAA1193		10574462	Standard	NM_017550		Approved		uc002lok.1	Q8N344		ENST00000264819.4:c.373C>A	19.37:g.327253G>T	ENSP00000264819:p.Gln125Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q9ULM7	Missense_Mutation	SNP	ENST00000264819.4	37	CCDS32855.1	.	.	.	.	.	.	.	.	.	.	.	19.31	3.803816	0.70682	.	.	ENSG00000105556	ENST00000264819	T	0.21932	1.98	5.14	4.09	0.47781	.	0.146358	0.31495	N	0.007553	T	0.44138	0.1279	M	0.69823	2.125	0.49389	D	0.999789	D	0.69078	0.997	D	0.73380	0.98	T	0.43196	-0.9406	10	0.66056	D	0.02	-13.4902	13.2028	0.59778	0.0:0.1593:0.8407:0.0	.	125	Q8N344	MIER2_HUMAN	K	125	ENSP00000264819:Q125K	ENSP00000264819:Q125K	Q	-	1	0	MIER2	278253	1.000000	0.71417	0.967000	0.41034	0.962000	0.63368	5.907000	0.69908	1.163000	0.42636	0.555000	0.69702	CAA		0.438	MIER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451784.1	XM_041843	
LRP3	4037	broad.mit.edu	37	19	33697008	33697008	+	Silent	SNP	C	C	T	rs201999025		TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr19:33697008C>T	ENST00000253193.7	+	5	1534	c.1332C>T	c.(1330-1332)ccC>ccT	p.P444P	CTD-2540B15.13_ENST00000609744.1_RNA	NM_002333.3	NP_002324.2	O75074	LRP3_HUMAN	low density lipoprotein receptor-related protein 3	444	LDL-receptor class A 3. {ECO:0000255|PROSITE-ProRule:PRU00124}.				receptor-mediated endocytosis (GO:0006898)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|pancreas(2)	15	Esophageal squamous(110;0.137)					AAAGCTGTCCCGACGGCGCCG	0.662													C|||	1	0.000199681	0.0	0.0014	5008	,	,		15326	0.0		0.0	False		,,,				2504	0.0					.											0													24.0	24.0	24.0					19																	33697008		2200	4297	6497	SO:0001819	synonymous_variant	4037			AB009462	CCDS12430.1	19q13.11	2013-05-30			ENSG00000130881	ENSG00000130881		"""Low density lipoprotein receptors"""	6695	protein-coding gene	gene with protein product		603159				9693042, 7959795	Standard	NM_002333		Approved	LRP-3, hLRp105	uc010edh.3	O75074	OTTHUMG00000180343	ENST00000253193.7:c.1332C>T	19.37:g.33697008C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B3KQD6|B4DKF2	Silent	SNP	ENST00000253193.7	37	CCDS12430.1																																																																																				0.662	LRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450842.4		
NBEAL1	65065	broad.mit.edu	37	2	204055051	204055051	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr2:204055051A>G	ENST00000449802.1	+	45	7106	c.6773A>G	c.(6772-6774)gAa>gGa	p.E2258G		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	2258	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.									NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						GATGAGAAAGAAAGAAAAGCC	0.353																																						.											0													105.0	106.0	105.0					2																	204055051		1852	4092	5944	SO:0001583	missense	65065			AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.6773A>G	2.37:g.204055051A>G	ENSP00000399903:p.Glu2258Gly	Somatic		WXS	Illumina HiSeq	Phase_I	A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Missense_Mutation	SNP	ENST00000449802.1	37	CCDS46495.1	.	.	.	.	.	.	.	.	.	.	A	25.8	4.680066	0.88542	.	.	ENSG00000144426	ENST00000449802;ENST00000340268;ENST00000414576	D;D	0.81499	-1.5;-1.5	5.21	5.21	0.72293	BEACH domain (4);	0.048085	0.85682	D	0.000000	D	0.92001	0.7466	M	0.93462	3.42	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.998	D	0.93688	0.7004	10	0.59425	D	0.04	.	15.036	0.71748	1.0:0.0:0.0:0.0	.	2258;2247	Q6ZS30;C9JGK5	NBEL1_HUMAN;.	G	2258;2258;273	ENSP00000399903:E2258G;ENSP00000388466:E273G	ENSP00000344985:E2258G	E	+	2	0	NBEAL1	203763296	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	8.791000	0.91849	2.091000	0.63221	0.377000	0.23210	GAA		0.353	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333982.4		
COL4A3	1285	broad.mit.edu	37	2	228112294	228112294	+	Silent	SNP	A	A	G			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr2:228112294A>G	ENST00000396578.3	+	8	624	c.462A>G	c.(460-462)ggA>ggG	p.G154G	AC097662.2_ENST00000606119.1_RNA|AC097662.2_ENST00000439598.2_RNA|AC097662.2_ENST00000396588.2_RNA|AC097662.2_ENST00000437673.1_RNA	NM_000091.4	NP_000082.2	Q01955	CO4A3_HUMAN	collagen, type IV, alpha 3 (Goodpasture antigen)	154	Triple-helical region.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|blood circulation (GO:0008015)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|collagen catabolic process (GO:0030574)|endothelial cell apoptotic process (GO:0072577)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|sensory perception of sound (GO:0007605)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metalloendopeptidase inhibitor activity (GO:0008191)|structural molecule activity (GO:0005198)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		GTTTGAAAGGACAAAAGGTAA	0.403																																						.											0													346.0	368.0	361.0					2																	228112294		1957	4142	6099	SO:0001819	synonymous_variant	1285				CCDS42829.1	2q36-q37	2014-09-17			ENSG00000169031	ENSG00000169031		"""Collagens"""	2204	protein-coding gene	gene with protein product	"""tumstatin"""	120070				1737849	Standard	NM_000091		Approved		uc002vom.2	Q01955	OTTHUMG00000149891	ENST00000396578.3:c.462A>G	2.37:g.228112294A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q53QQ1|Q53R14|Q53RW8|Q9BQT2|Q9NYC4|Q9UDJ9|Q9UDK9|Q9UDL0|Q9UDL1	Silent	SNP	ENST00000396578.3	37	CCDS42829.1																																																																																				0.403	COL4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331409.2	NM_000091	
COPS8	10920	broad.mit.edu	37	2	238004481	238004481	+	Silent	SNP	A	A	G			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr2:238004481A>G	ENST00000354371.2	+	6	1109	c.456A>G	c.(454-456)ggA>ggG	p.G152G	COPS8_ENST00000409629.1_Silent_p.G149G|COPS8_ENST00000392008.2_Silent_p.G103G|COPS8_ENST00000409334.1_Silent_p.G116G	NM_006710.4	NP_006701.1	Q99627	CSN8_HUMAN	COP9 signalosome subunit 8	152					activation of NF-kappaB-inducing kinase activity (GO:0007250)|cullin deneddylation (GO:0010388)|negative regulation of cell proliferation (GO:0008285)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				large_intestine(1)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	4		Breast(86;0.000162)|Renal(207;0.00339)|all_hematologic(139;0.0123)|Ovarian(221;0.0694)|Acute lymphoblastic leukemia(138;0.0775)|all_lung(227;0.169)|all_neural(83;0.211)		Epithelial(121;7.41e-23)|OV - Ovarian serous cystadenocarcinoma(60;5.42e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000175)|Lung(119;0.011)|LUSC - Lung squamous cell carcinoma(224;0.0258)		TAGAACAAGGATGGCAAGCTG	0.423																																						.											0													129.0	120.0	123.0					2																	238004481		2203	4300	6503	SO:0001819	synonymous_variant	10920				CCDS2517.1, CCDS42835.1	2q37.3	2013-03-14	2013-03-14		ENSG00000198612	ENSG00000198612			24335	protein-coding gene	gene with protein product			"""COP9 constitutive photomorphogenic homolog subunit 8 (Arabidopsis)"""			7634324, 12732143	Standard	NM_006710		Approved	COP9, CSN8, MGC1297, SGN8	uc002vwh.3	Q99627	OTTHUMG00000133297	ENST00000354371.2:c.456A>G	2.37:g.238004481A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A8K1H6|Q53QS9	Silent	SNP	ENST00000354371.2	37	CCDS2517.1																																																																																				0.423	COPS8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257082.3	NM_006710	
GPCPD1	56261	broad.mit.edu	37	20	5548180	5548180	+	Missense_Mutation	SNP	T	T	A			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr20:5548180T>A	ENST00000379019.4	-	13	1388	c.1176A>T	c.(1174-1176)ttA>ttT	p.L392F	GPCPD1_ENST00000481038.1_5'UTR	NM_019593.3	NP_062539.1	Q9NPB8	GPCP1_HUMAN	glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae)	392	GP-PDE.				glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)	glycerophosphocholine phosphodiesterase activity (GO:0047389)|starch binding (GO:2001070)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|skin(1)	16						GAATTTCAAATAATTCAACTG	0.249																																						.											0													68.0	77.0	74.0					20																	5548180		2201	4298	6499	SO:0001583	missense	56261				CCDS13090.1	20p12.3	2011-01-25			ENSG00000125772	ENSG00000125772			26957	protein-coding gene	gene with protein product		614124				10718198, 20576599	Standard	NM_019593		Approved	KIAA1434, GDE5, GDPD6	uc002wme.4	Q9NPB8	OTTHUMG00000031806	ENST00000379019.4:c.1176A>T	20.37:g.5548180T>A	ENSP00000368305:p.Leu392Phe	Somatic		WXS	Illumina HiSeq	Phase_I	D3DW06|Q9BQL8|Q9NUX0	Missense_Mutation	SNP	ENST00000379019.4	37	CCDS13090.1	.	.	.	.	.	.	.	.	.	.	T	18.95	3.731877	0.69189	.	.	ENSG00000125772	ENST00000379019	T	0.11930	2.73	5.05	-0.32	0.12721	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);	0.000000	0.64402	D	0.000001	T	0.23171	0.0560	L	0.57536	1.79	0.52501	D	0.99995	D	0.89917	1.0	D	0.91635	0.999	T	0.27872	-1.0061	10	0.09590	T	0.72	-14.4099	8.5129	0.33229	0.0:0.5133:0.0:0.4867	.	392	Q9NPB8	GPCP1_HUMAN	F	392	ENSP00000368305:L392F	ENSP00000368305:L392F	L	-	3	2	GPCPD1	5496180	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	1.120000	0.31271	0.059000	0.16252	0.455000	0.32223	TTA		0.249	GPCPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077869.1	NM_019593	
AZI2	64343	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	28365568	28365568	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr3:28365568C>T	ENST00000479665.1	-	8	1675	c.1144G>A	c.(1144-1146)Gat>Aat	p.D382N	CMC1_ENST00000466830.1_3'UTR|AZI2_ENST00000295748.3_5'UTR	NM_022461.3	NP_071906.1	Q9H6S1	AZI2_HUMAN	5-azacytidine induced 2	382					dendritic cell differentiation (GO:0097028)|dendritic cell proliferation (GO:0044565)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|interferon-alpha production (GO:0032607)|interferon-gamma production (GO:0032609)|interleukin-6 production (GO:0032635)|mitotic cell cycle (GO:0000278)|T cell activation (GO:0042110)|tumor necrosis factor production (GO:0032640)	cytoplasm (GO:0005737)				cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	15						TTATGTTGATCCAAGTAATGC	0.393																																						.											0													130.0	133.0	132.0					3																	28365568		2203	4299	6502	SO:0001583	missense	64343			AC093142	CCDS2647.1, CCDS46782.1, CCDS46783.1	3p23	2006-03-01			ENSG00000163512	ENSG00000163512			24002	protein-coding gene	gene with protein product		609916				10580148	Standard	NM_001134432		Approved	NAP1, FLJ21939, AZ2	uc003ceb.4	Q9H6S1	OTTHUMG00000130573	ENST00000479665.1:c.1144G>A	3.37:g.28365568C>T	ENSP00000419371:p.Asp382Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A8K3M2|C9JB40|H7BXU6|Q86W99|Q9BQF1	Missense_Mutation	SNP	ENST00000479665.1	37	CCDS2647.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.668401	0.88348	.	.	ENSG00000163512	ENST00000479665	.	.	.	5.94	5.94	0.96194	.	0.114416	0.64402	D	0.000016	T	0.76891	0.4051	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.77923	-0.2406	9	0.87932	D	0	-10.089	15.1295	0.72511	0.1413:0.8587:0.0:0.0	.	382	Q9H6S1	AZI2_HUMAN	N	382	.	ENSP00000419371:D382N	D	-	1	0	AZI2	28340572	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	3.282000	0.51693	2.820000	0.97059	0.650000	0.86243	GAT		0.393	AZI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252998.2	NM_203326	
ZFP62	643836	broad.mit.edu	37	5	180276230	180276230	+	Silent	SNP	T	T	C	rs546545965		TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr5:180276230T>C	ENST00000502412.1	-	2	2322	c.2265A>G	c.(2263-2265)aaA>aaG	p.K755K	ZFP62_ENST00000506377.1_Intron|ZFP62_ENST00000512132.1_Silent_p.K722K|ZFP62_ENST00000359141.6_Silent_p.K695K	NM_001172638.1	NP_001166109.1	Q8NB50	ZFP62_HUMAN	ZFP62 zinc finger protein	755					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|endometrium(2)|pancreas(1)	4	all_cancers(89;4.01e-05)|all_epithelial(37;4.69e-06)|Renal(175;0.000159)|Lung NSC(126;0.0027)|all_lung(126;0.00469)|Breast(19;0.114)	all_cancers(40;0.00336)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)|all_lung(500;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ACACATAGGGTTTCTCCCCTG	0.488													T|||	1	0.000199681	0.0	0.0	5008	,	,		19840	0.001		0.0	False		,,,				2504	0.0					.											0													86.0	83.0	84.0					5																	180276230		692	1591	2283	SO:0001819	synonymous_variant	643836			AK002206	CCDS47357.1, CCDS47357.2, CCDS54955.1	5q35.3	2013-01-08	2012-11-27			ENSG00000196670		"""Zinc fingers, C2H2-type"""	23241	protein-coding gene	gene with protein product		610281	"""zinc finger protein 62 homolog (mouse)"", ""zinc finger protein 62"""			8808410	Standard	NM_152283		Approved	FLJ34231, ZET, ZNF755	uc011dhf.2	Q8NB50		ENST00000502412.1:c.2265A>G	5.37:g.180276230T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B4DIP6|B4E0N3|B5MDX6|B7ZVZ2|B9EIP6|E9PFT8|J3QTA9	Silent	SNP	ENST00000502412.1	37	CCDS54955.1																																																																																				0.488	ZFP62-002	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368386.2	NM_152283	
EHMT2	10919	broad.mit.edu;bcgsc.ca	37	6	31848574	31848574	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr6:31848574A>G	ENST00000375537.4	-	27	3334	c.3328T>C	c.(3328-3330)Ttc>Ctc	p.F1110L	EHMT2-AS1_ENST00000434689.1_RNA|EHMT2_ENST00000395728.3_Missense_Mutation_p.F1167L|SLC44A4_ENST00000375562.4_5'Flank|SLC44A4_ENST00000465707.1_5'Flank|EHMT2_ENST00000375528.4_Missense_Mutation_p.F1133L|SLC44A4_ENST00000229729.6_5'Flank|EHMT2_ENST00000375530.4_Missense_Mutation_p.F1076L|EHMT2_ENST00000480912.1_5'UTR	NM_006709.3	NP_006700.3	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2	1110	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				DNA methylation (GO:0006306)|DNA methylation on cytosine within a CG sequence (GO:0010424)|fertilization (GO:0009566)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ growth (GO:0035265)|peptidyl-lysine dimethylation (GO:0018027)|regulation of DNA replication (GO:0006275)|spermatid development (GO:0007286)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	21						TGGTTGATGAAGCGGCTGATG	0.572																																						.											0													168.0	122.0	138.0					6																	31848574		2203	4300	6503	SO:0001583	missense	10919			AF134726	CCDS4725.1, CCDS4726.1, CCDS75425.1	6p21.3	2013-01-10	2004-03-22	2005-06-09	ENSG00000204371	ENSG00000204371	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	14129	protein-coding gene	gene with protein product		604599	"""chromosome 6 open reading frame 30"", ""HLA-B associated transcript 8"""	C6orf30, BAT8		8457211, 11316813	Standard	XM_005274833		Approved	G9A, Em:AF134726.3, NG36/G9a, KMT1C	uc003nxz.1	Q96KQ7	OTTHUMG00000031180	ENST00000375537.4:c.3328T>C	6.37:g.31848574A>G	ENSP00000364687:p.Phe1110Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B0UZY2|Q14349|Q5JP83|Q5JQ92|Q5JQA1|Q5JQG3|Q6PK06|Q96MH5|Q96QD0|Q9UQL8|Q9Y331	Missense_Mutation	SNP	ENST00000375537.4	37	CCDS4725.1	.	.	.	.	.	.	.	.	.	.	A	26.9	4.782755	0.90282	.	.	ENSG00000204371	ENST00000395728;ENST00000375528;ENST00000375530;ENST00000375537;ENST00000442298	D;D;D;D	0.82803	-1.65;-1.65;-1.65;-1.65	4.35	4.35	0.52113	SET domain (3);	0.000000	0.85682	D	0.000000	D	0.89276	0.6669	M	0.82823	2.61	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.998;1.0;0.999	D	0.90970	0.4819	10	0.87932	D	0	.	12.9305	0.58284	1.0:0.0:0.0:0.0	.	1133;1076;1110;931	A2ABF8;Q96KQ7-2;Q96KQ7;Q59FM7	.;.;EHMT2_HUMAN;.	L	1167;1133;1076;1110;931	ENSP00000379078:F1167L;ENSP00000364678:F1133L;ENSP00000364680:F1076L;ENSP00000364687:F1110L	ENSP00000364678:F1133L	F	-	1	0	EHMT2	31956553	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.607000	0.90891	1.963000	0.57068	0.533000	0.62120	TTC		0.572	EHMT2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076355.5	NM_006709	
CPNE5	57699	broad.mit.edu;ucsc.edu	37	6	36759870	36759870	+	Silent	SNP	A	A	G			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr6:36759870A>G	ENST00000244751.2	-	8	1092	c.468T>C	c.(466-468)ggT>ggC	p.G156G		NM_020939.1	NP_065990.1	Q9HCH3	CPNE5_HUMAN	copine V	156	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.					extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(4)|liver(1)|lung(9)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25						TTCCTGGGACACCACTGGGAG	0.567																																						.											0													121.0	98.0	106.0					6																	36759870		2203	4300	6503	SO:0001819	synonymous_variant	57699			H09181	CCDS4825.1	6p21.2	2010-05-28			ENSG00000124772	ENSG00000124772			2318	protein-coding gene	gene with protein product		604209				9430674	Standard	NM_020939		Approved	CPN5, COPN5, KIAA1599	uc003omr.1	Q9HCH3	OTTHUMG00000014602	ENST00000244751.2:c.468T>C	6.37:g.36759870A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q7Z6C8	Silent	SNP	ENST00000244751.2	37	CCDS4825.1																																																																																				0.567	CPNE5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040351.1	NM_020939	
KIAA1324L	222223	broad.mit.edu	37	7	86542297	86542297	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr7:86542297T>C	ENST00000450689.2	-	14	2140	c.1955A>G	c.(1954-1956)gAg>gGg	p.E652G	KIAA1324L_ENST00000490995.1_5'Flank|KIAA1324L_ENST00000297222.6_Missense_Mutation_p.E412G|KIAA1324L_ENST00000444627.1_Missense_Mutation_p.R606G|KIAA1324L_ENST00000416314.1_Missense_Mutation_p.E485G	NM_001142749.2	NP_001136221.1	A8MWY0	K132L_HUMAN	KIAA1324-like	652						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(14)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44	Esophageal squamous(14;0.0058)					AATACAAGCCTCTTTGCCATA	0.473																																						.											0													120.0	98.0	105.0					7																	86542297		2203	4300	6503	SO:0001583	missense	222223			AK055902	CCDS34677.1, CCDS47632.1, CCDS34677.2	7q21.12	2008-09-18			ENSG00000164659	ENSG00000164659			21945	protein-coding gene	gene with protein product	"""EIG121-like"""	614048					Standard	NM_001142749		Approved	FLJ31340, EIG121L	uc011kha.2	A8MWY0	OTTHUMG00000153995	ENST00000450689.2:c.1955A>G	7.37:g.86542297T>C	ENSP00000413445:p.Glu652Gly	Somatic		WXS	Illumina HiSeq	Phase_I	A4D1C9|B4DJV3|Q17RI6|Q96DP2	Missense_Mutation	SNP	ENST00000450689.2	37	CCDS47632.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.88|16.88	3.244237|3.244237	0.59103|0.59103	.|.	.|.	ENSG00000164659|ENSG00000164659	ENST00000450689;ENST00000297222;ENST00000416314|ENST00000444627	T;T;T|T	0.20738|0.18502	2.31;2.06;2.05|2.21	5.82|5.82	5.82|5.82	0.92795|0.92795	Growth factor, receptor (1);|.	0.091963|.	0.85682|.	D|.	0.000000|.	T|T	0.30541|0.30541	0.0768|0.0768	L|L	0.55834|0.55834	1.745|1.745	0.80722|0.80722	D|D	1|1	P;P;P|.	0.52316|.	0.936;0.952;0.952|.	P;P;P|.	0.49528|.	0.614;0.6;0.461|.	T|T	0.00770|0.00770	-1.1573|-1.1573	10|6	0.31617|.	T|.	0.26|.	.|.	15.3651|15.3651	0.74516|0.74516	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	652;412;485|.	A8MWY0;A8MWY0-2;B4DJV3|.	K132L_HUMAN;.;.|.	G|G	652;412;485|606	ENSP00000413445:E652G;ENSP00000297222:E412G;ENSP00000402390:E485G|ENSP00000397377:R606G	ENSP00000297222:E412G|.	E|R	-|-	2|1	0|2	KIAA1324L|KIAA1324L	86380233|86380233	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.951000|0.951000	0.60555|0.60555	7.499000|7.499000	0.81566|0.81566	2.222000|2.222000	0.72286|0.72286	0.533000|0.533000	0.62120|0.62120	GAG|AGG		0.473	KIAA1324L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333372.3	NM_152748	
SHROOM4	57477	broad.mit.edu	37	X	50376364	50376364	+	Silent	SNP	A	A	G			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chrX:50376364A>G	ENST00000289292.7	-	4	2992	c.2709T>C	c.(2707-2709)taT>taC	p.Y903Y	SHROOM4_ENST00000376020.2_Silent_p.Y903Y|SHROOM4_ENST00000460112.3_Silent_p.Y787Y			Q9ULL8	SHRM4_HUMAN	shroom family member 4	903	Cys-rich.				actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					CCCCAGAACAATAAATGCAAG	0.463																																						.											0													74.0	61.0	66.0					X																	50376364		2203	4300	6503	SO:0001819	synonymous_variant	57477			AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.2709T>C	X.37:g.50376364A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A7E2X9|D6RFW0|Q96LA0	Silent	SNP	ENST00000289292.7	37	CCDS35277.1																																																																																				0.463	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056564.4	NM_020717	
PASD1	139135	broad.mit.edu	37	X	150791421	150791421	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chrX:150791421T>C	ENST00000370357.4	+	7	676	c.431T>C	c.(430-432)gTc>gCc	p.V144A		NM_173493.2	NP_775764.2	Q8IV76	PASD1_HUMAN	PAS domain containing 1	144						nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(3)|liver(1)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48	Acute lymphoblastic leukemia(192;6.56e-05)					TTTCCTGTGGTCTTTAGTGGC	0.448																																						.											0													258.0	214.0	229.0					X																	150791421		2203	4300	6503	SO:0001583	missense	139135			AY270020	CCDS35431.1	Xq28	2009-08-06			ENSG00000166049	ENSG00000166049			20686	protein-coding gene	gene with protein product	"""cancer/testis antigen 63"""					15122589, 15162151	Standard	NM_173493		Approved	CT63	uc004fev.4	Q8IV76	OTTHUMG00000024169	ENST00000370357.4:c.431T>C	X.37:g.150791421T>C	ENSP00000359382:p.Val144Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q3MNE0|Q69HD7|Q8N7X9	Missense_Mutation	SNP	ENST00000370357.4	37	CCDS35431.1	.	.	.	.	.	.	.	.	.	.	T	9.529	1.110219	0.20714	.	.	ENSG00000166049	ENST00000370357	T	0.68903	-0.36	3.78	1.21	0.21127	.	.	.	.	.	T	0.38241	0.1033	N	0.14661	0.345	0.09310	N	1	B	0.32382	0.368	B	0.29176	0.099	T	0.30966	-0.9960	9	0.02654	T	1	.	5.8489	0.18681	0.4373:0.0:0.0:0.5627	.	144	Q8IV76	PASD1_HUMAN	A	144	ENSP00000359382:V144A	ENSP00000359382:V144A	V	+	2	0	PASD1	150542077	0.006000	0.16342	0.000000	0.03702	0.004000	0.04260	1.042000	0.30303	0.130000	0.18549	0.417000	0.27973	GTC		0.448	PASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060879.2	NM_173493	
ATP2B3	492	broad.mit.edu	37	X	152823628	152823628	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chrX:152823628A>G	ENST00000349466.2	+	16	2818	c.2492A>G	c.(2491-2493)aAc>aGc	p.N831S	ATP2B3_ENST00000393842.1_Missense_Mutation_p.N817S|ATP2B3_ENST00000370186.1_Missense_Mutation_p.N817S|ATP2B3_ENST00000263519.4_Missense_Mutation_p.N831S|ATP2B3_ENST00000370181.2_Missense_Mutation_p.N817S|ATP2B3_ENST00000460549.1_3'UTR|ATP2B3_ENST00000359149.3_Missense_Mutation_p.N831S			Q16720	AT2B3_HUMAN	ATPase, Ca++ transporting, plasma membrane 3	831					blood coagulation (GO:0007596)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(2)|breast(5)|endometrium(7)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(3)	50	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ACCGATGACAACTTCACCAGC	0.572																																						.											0													239.0	148.0	179.0					X																	152823628		2203	4300	6503	SO:0001583	missense	492			U60414	CCDS14722.1, CCDS35440.1	Xq28	2014-07-18			ENSG00000067842	ENSG00000067842	3.6.3.8	"""ATPases / P-type"""	816	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 3"", ""cilia and flagella associated protein 39"""	300014	"""spinocerebellar ataxia, X-linked 1"", ""cerebellar ataxia 2 (X-linked)"""	SCAX1, CLA2		8187550, 22912398	Standard	NM_021949		Approved	PMCA3, CFAP39	uc004fht.1	Q16720	OTTHUMG00000024202	ENST00000349466.2:c.2492A>G	X.37:g.152823628A>G	ENSP00000343886:p.Asn831Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B7WNR8|B7WNY5|Q12995|Q16858	Missense_Mutation	SNP	ENST00000349466.2	37	CCDS35440.1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.368767	0.82463	.	.	ENSG00000067842	ENST00000370186;ENST00000349466;ENST00000393842;ENST00000359149;ENST00000263519;ENST00000370181	D;D;D;D;D;D	0.97665	-4.48;-4.48;-4.48;-4.48;-4.48;-4.48	4.84	4.84	0.62591	HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.98115	0.9378	M	0.77103	2.36	0.54753	D	0.999985	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.98863	1.0763	10	0.87932	D	0	-40.3883	12.5684	0.56322	1.0:0.0:0.0:0.0	.	831;831	Q16720;Q16720-2	AT2B3_HUMAN;.	S	817;831;817;831;831;817	ENSP00000359205:N817S;ENSP00000343886:N831S;ENSP00000377425:N817S;ENSP00000352062:N831S;ENSP00000263519:N831S;ENSP00000359200:N817S	ENSP00000263519:N831S	N	+	2	0	ATP2B3	152476822	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	9.335000	0.96500	1.603000	0.50134	0.378000	0.23410	AAC		0.572	ATP2B3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060957.1	NM_021949	
ENAH	55740	broad.mit.edu	37	1	225702514	225702515	+	Frame_Shift_Ins	INS	-	-	G			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr1:225702514_225702515insG	ENST00000366844.3	-	7	1452_1453	c.1001_1002insC	c.(1000-1002)ccafs	p.P334fs	ENAH_ENST00000366843.2_Frame_Shift_Ins_p.P334fs|ENAH_ENST00000284563.6_Frame_Shift_Ins_p.P581fs	NM_001008493.1|NM_018212.4	NP_001008493.1|NP_060682.2	Q8N8S7	ENAH_HUMAN	enabled homolog (Drosophila)	334	Pro-rich.				actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|intracellular transport (GO:0046907)|neural tube closure (GO:0001843)|T cell receptor signaling pathway (GO:0050852)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)|synapse (GO:0045202)	WW domain binding (GO:0050699)			NS(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Breast(184;0.206)			GBM - Glioblastoma multiforme(131;0.19)		gagggggccctgggggaggagg	0.658																																						.											0																																										SO:0001589	frameshift_variant	55740			AK001635	CCDS31040.1, CCDS31041.1	1q32.2	2013-08-06			ENSG00000154380	ENSG00000154380			18271	protein-coding gene	gene with protein product	"""mammalian enabled"""	609061				1420303	Standard	XM_005273182		Approved	FLJ10773, NDPP1, MENA	uc001hpc.1	Q8N8S7	OTTHUMG00000037742	ENST00000366844.3:c.1002dupC	1.37:g.225702519_225702519dupG	ENSP00000355809:p.Pro334fs	Somatic		WXS	Illumina HiSeq	Phase_I	D0PQI2|Q502W5|Q5T5M7|Q5VTQ9|Q5VTR0|Q9NVF3|Q9UFB8	Frame_Shift_Ins	INS	ENST00000366844.3	37	CCDS31041.1																																																																																				0.658	ENAH-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000357426.2	NM_018212	
PPP2R1B	5519	broad.mit.edu	37	11	111637006	111637007	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr11:111637006_111637007insC	ENST00000527614.1	-	1	144_145	c.79_80insG	c.(79-81)gttfs	p.V27fs	PPP2R1B_ENST00000341980.6_Frame_Shift_Ins_p.V27fs|PPP2R1B_ENST00000311129.5_Frame_Shift_Ins_p.V27fs|RP11-108O10.2_ENST00000529841.1_lincRNA|PPP2R1B_ENST00000426998.2_Frame_Shift_Ins_p.V27fs|PPP2R1B_ENST00000393055.2_Frame_Shift_Ins_p.V27fs|PPP2R1B_ENST00000427203.2_5'UTR	NM_001177562.1|NM_002716.4	NP_001171033.1|NP_002707.3	P30154	2AAB_HUMAN	protein phosphatase 2, regulatory subunit A, beta	27					apoptotic process involved in morphogenesis (GO:0060561)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)	extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|liver(1)|lung(10)|prostate(1)|urinary_tract(2)	22		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|Epithelial(105;2.36e-06)|all cancers(92;3.78e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0761)		GTCGATTAAAACCGCGATCGGG	0.629																																						.											0																																										SO:0001589	frameshift_variant	5519			AF087438	CCDS8348.1, CCDS8349.1, CCDS53706.1, CCDS53707.1, CCDS53708.1	11q23.1	2010-06-18	2010-04-14		ENSG00000137713	ENSG00000137713	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9303	protein-coding gene	gene with protein product	"""PP2A-A-beta"", ""protein phosphatase 2A, regulatory subunit A, beta isoform"""	603113	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoform"""			2159327, 9795170	Standard	NM_181699		Approved	PR65B, PP2A-Abeta	uc001plw.1	P30154	OTTHUMG00000166741	ENST00000527614.1:c.80dupG	11.37:g.111637008_111637008dupC	ENSP00000437193:p.Val27fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8MY67|B0YJ69|B4DGQ6|B4DK91|B4DWW5|F8W8G1|O75620|Q8NHV8	Frame_Shift_Ins	INS	ENST00000527614.1	37	CCDS8349.1																																																																																				0.629	PPP2R1B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391298.1	NM_002716	
URGCP	55665	broad.mit.edu	37	7	43917145	43917146	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr7:43917145_43917146insC	ENST00000453200.1	-	6	2409_2410	c.1916_1917insG	c.(1915-1917)ggcfs	p.G639fs	URGCP_ENST00000447717.3_Frame_Shift_Ins_p.G596fs|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000336086.6_Frame_Shift_Ins_p.G596fs|URGCP_ENST00000443736.1_Frame_Shift_Ins_p.G596fs|URGCP_ENST00000223341.7_Frame_Shift_Ins_p.G596fs|URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000402306.3_Frame_Shift_Ins_p.G630fs			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	639					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						AACGCCTCTGGCCTGCCGGCAG	0.629																																						.											0																																										SO:0001589	frameshift_variant	55665				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.1917dupG	7.37:g.43917147_43917147dupC	ENSP00000396918:p.Gly639fs	Somatic		WXS	Illumina HiSeq	Phase_I	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Frame_Shift_Ins	INS	ENST00000453200.1	37	CCDS47578.1																																																																																				0.629	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338995.1	NM_001077664	
DECR2	26063	ucsc.edu	37	16	461365	461365	+	Silent	SNP	C	C	T			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr16:461365C>T	ENST00000219481.5	+	8	804	c.666C>T	c.(664-666)ggC>ggT	p.G222G	DECR2_ENST00000461947.1_Intron|DECR2_ENST00000424398.2_Silent_p.G210G	NM_020664.3	NP_065715.1	Q9NUI1	DECR2_HUMAN	2,4-dienoyl CoA reductase 2, peroxisomal	222					unsaturated fatty acid biosynthetic process (GO:0006636)	peroxisomal membrane (GO:0005778)	2,4-dienoyl-CoA reductase (NADPH) activity (GO:0008670)|receptor binding (GO:0005102)|trans-2-enoyl-CoA reductase (NADPH) activity (GO:0019166)			central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(4)	9		Hepatocellular(16;0.00015)				CTCCAGGTGGCCCTCAGGCCA	0.672																																						.											0													31.0	34.0	33.0					16																	461365		2202	4298	6500	SO:0001819	synonymous_variant	26063			AJ293009	CCDS10409.1	16p13.3	2011-09-14			ENSG00000242612	ENSG00000242612	1.3.1.34	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	2754	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 17C, member 1"""	615839				11514237, 19027726	Standard	NM_020664		Approved	PDCR, SDR17C1	uc002chb.3	Q9NUI1	OTTHUMG00000047846	ENST00000219481.5:c.666C>T	16.37:g.461365C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZRS7|Q96ET0	Silent	SNP	ENST00000219481.5	37	CCDS10409.1																																																																																				0.672	DECR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109069.4	NM_020664	
DOCK2	1794	ucsc.edu	37	5	169504838	169504838	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr5:169504838A>G	ENST00000256935.8	+	48	5071	c.4991A>G	c.(4990-4992)gAg>gGg	p.E1664G	DOCK2_ENST00000540750.1_Missense_Mutation_p.E725G|DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000520908.1_Missense_Mutation_p.E1156G	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1664					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCTACCTCAGAGAGGTCAGTC	0.592																																						.											0													86.0	78.0	81.0					5																	169504838		2203	4300	6503	SO:0001583	missense	1794			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.4991A>G	5.37:g.169504838A>G	ENSP00000256935:p.Glu1664Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	37	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	A	14.42	2.531198	0.45073	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.09723	3.61;3.25;2.95	5.08	5.08	0.68730	.	0.281154	0.34959	N	0.003556	T	0.07999	0.0200	N	0.24115	0.695	0.46011	D	0.998817	B;B;B	0.30511	0.058;0.282;0.181	B;B;B	0.26770	0.045;0.05;0.073	T	0.35674	-0.9779	10	0.25106	T	0.35	.	13.9017	0.63809	1.0:0.0:0.0:0.0	.	1156;220;1664	E7ERW7;B3KY14;Q92608	.;.;DOCK2_HUMAN	G	1664;1156;725	ENSP00000256935:E1664G;ENSP00000429283:E1156G;ENSP00000438827:E725G	ENSP00000256935:E1664G	E	+	2	0	DOCK2	169437416	1.000000	0.71417	0.976000	0.42696	0.438000	0.31896	7.695000	0.84257	1.935000	0.56089	0.456000	0.33151	GAG		0.592	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
HRNR	388697	ucsc.edu	37	1	152186042	152186042	+	Missense_Mutation	SNP	A	A	G	rs12751022	byFrequency	TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr1:152186042A>G	ENST00000368801.2	-	3	8138	c.8063T>C	c.(8062-8064)tTg>tCg	p.L2688S	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	2688				L -> S (in Ref. 1; BAC57496). {ECO:0000305}.	establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.L2688S(1)		autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGAGTGACCCAAGCGAGACTC	0.582													G|||	2279	0.455072	0.3336	0.5908	5008	,	,		10987	0.6181		0.3718	False		,,,				2504	0.4407					.											1	Substitution - Missense(1)	prostate(1)											30.0	26.0	28.0					1																	152186042		1929	3848	5777	SO:0001583	missense	388697			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.8063T>C	1.37:g.152186042A>G	ENSP00000357791:p.Leu2688Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	37	CCDS30859.1	1136	0.5201465201465202	216	0.43902439024390244	226	0.6243093922651933	348	0.6083916083916084	346	0.45646437994722955	G	3.703	-0.061145	0.07317	.	.	ENSG00000197915	ENST00000368801	T	0.01484	4.84	2.89	1.85	0.25348	.	.	.	.	.	T	0.00178	0.0005	N	0.00308	-1.67	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.14755	-1.0461	8	0.08381	T	0.77	.	5.4214	0.16402	0.4598:0.0:0.5402:0.0	rs12751022	2688	Q86YZ3	HORN_HUMAN	S	2688	ENSP00000357791:L2688S	ENSP00000357791:L2688S	L	-	2	0	HRNR	150452666	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.091000	0.11146	0.047000	0.15862	-0.291000	0.09656	TTG		0.582	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868	
IRX3	79191	ucsc.edu	37	16	54318841	54318841	+	Missense_Mutation	SNP	C	C	A	rs567541390		TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr16:54318841C>A	ENST00000329734.3	-	2	1664	c.952G>T	c.(952-954)Gcc>Tcc	p.A318S		NM_024336.2	NP_077312.2	P78415	IRX3_HUMAN	iroquois homeobox 3	318	Pro-rich.				mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of neuron differentiation (GO:0045666)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)|transcription, DNA-templated (GO:0006351)	axon (GO:0030424)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|soft_tissue(1)|urinary_tract(1)	14						GAGGCCACGGCCACTGGTGGT	0.667																																					GBM(143;1830 1866 4487 4646 37383)	.											0													7.0	9.0	8.0					16																	54318841		2121	4185	6306	SO:0001583	missense	79191			U90308	CCDS10750.1	16q12.2	2011-06-20	2007-07-13		ENSG00000177508	ENSG00000177508		"""Homeoboxes / TALE class"""	14360	protein-coding gene	gene with protein product		612985					Standard	NM_024336		Approved	IRX-1	uc002eht.1	P78415	OTTHUMG00000133200	ENST00000329734.3:c.952G>T	16.37:g.54318841C>A	ENSP00000331608:p.Ala318Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q7Z4A4|Q7Z4A5|Q8IVC6	Missense_Mutation	SNP	ENST00000329734.3	37	CCDS10750.1	.	.	.	.	.	.	.	.	.	.	C	0.815	-0.750701	0.03041	.	.	ENSG00000177508	ENST00000329734;ENST00000541845	T	0.52754	0.65	4.17	2.21	0.28008	.	0.404066	0.25587	N	0.029650	T	0.21307	0.0513	N	0.08118	0	0.23076	N	0.998335	B	0.23377	0.084	B	0.20184	0.028	T	0.23833	-1.0177	10	0.08599	T	0.76	-4.344	8.1936	0.31383	0.0:0.7998:0.0:0.2002	.	318	P78415	IRX3_HUMAN	S	318;17	ENSP00000331608:A318S	ENSP00000331608:A318S	A	-	1	0	IRX3	52876342	0.002000	0.14202	0.493000	0.27502	0.226000	0.24999	0.216000	0.17585	0.431000	0.26258	0.449000	0.29647	GCC		0.667	IRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256910.2		
KIAA1462	57608	ucsc.edu	37	10	30317404	30317404	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr10:30317404A>G	ENST00000375377.1	-	3	1774	c.1673T>C	c.(1672-1674)cTc>cCc	p.L558P		NM_020848.2	NP_065899.1	Q9P266	JCAD_HUMAN	KIAA1462	558					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)				breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(23)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	75						GAACTTTTTGAGCTTGGTTTG	0.468																																						.											0													100.0	102.0	101.0					10																	30317404		1887	4129	6016	SO:0001583	missense	57608			AB040895	CCDS41500.1	10p12.1	2013-04-23			ENSG00000165757	ENSG00000165757			29283	protein-coding gene	gene with protein product	"""junctional protein associated with coronary artery disease"""	614398				10819331, 21884682	Standard	NM_020848		Approved	JCAD	uc001iux.3	Q9P266	OTTHUMG00000017885	ENST00000375377.1:c.1673T>C	10.37:g.30317404A>G	ENSP00000364526:p.Leu558Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q5HYA7|Q5T992|Q86WZ9|Q9BYJ2	Missense_Mutation	SNP	ENST00000375377.1	37	CCDS41500.1	.	.	.	.	.	.	.	.	.	.	A	16.56	3.158533	0.57368	.	.	ENSG00000165757	ENST00000375377	T	0.21734	1.99	5.62	4.48	0.54585	.	0.289920	0.33180	N	0.005195	T	0.29524	0.0736	M	0.69823	2.125	0.80722	D	1	P	0.46952	0.887	P	0.45406	0.479	T	0.06463	-1.0825	10	0.87932	D	0	-30.5916	11.3824	0.49766	0.9289:0.0:0.071:0.0	.	558	Q9P266	K1462_HUMAN	P	558	ENSP00000364526:L558P	ENSP00000364526:L558P	L	-	2	0	KIAA1462	30357410	1.000000	0.71417	0.761000	0.31378	0.596000	0.36781	4.584000	0.60971	0.962000	0.38057	0.459000	0.35465	CTC		0.468	KIAA1462-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047409.1	NM_020848	
KIF19	124602	ucsc.edu	37	17	72339295	72339295	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr17:72339295T>C	ENST00000389916.4	+	5	590	c.452T>C	c.(451-453)cTg>cCg	p.L151P		NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	151	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						ATGTCCTACCTGGAGGTGAGT	0.617																																						.											0													70.0	55.0	60.0					17																	72339295		2203	4300	6503	SO:0001583	missense	124602			AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.452T>C	17.37:g.72339295T>C	ENSP00000374566:p.Leu151Pro	Somatic		WXS	Illumina HiSeq	Phase_I	A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Missense_Mutation	SNP	ENST00000389916.4	37	CCDS32718.2	.	.	.	.	.	.	.	.	.	.	T	20.8	4.044207	0.75732	.	.	ENSG00000196169	ENST00000551294;ENST00000389916	T;T	0.80393	-0.94;-1.37	5.48	5.48	0.80851	Kinesin, motor domain (4);	.	.	.	.	D	0.93504	0.7927	H	0.98155	4.16	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.997;0.986;0.99;0.99	D	0.95672	0.8724	9	0.87932	D	0	.	14.6067	0.68483	0.0:0.0:0.0:1.0	.	151;151;151;151	Q2TAC6;F8VW50;Q2TAC6-3;Q2TAC6-2	KIF19_HUMAN;.;.;.	P	151	ENSP00000449134:L151P;ENSP00000374566:L151P	ENSP00000374566:L151P	L	+	2	0	KIF19	69850890	1.000000	0.71417	0.999000	0.59377	0.626000	0.37791	7.518000	0.81795	2.103000	0.63969	0.454000	0.30748	CTG		0.617	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319644.2	NM_153209	
LCMT2	9836	ucsc.edu	37	15	43622621	43622621	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr15:43622621T>C	ENST00000305641.5	-	1	182	c.67A>G	c.(67-69)Agc>Ggc	p.S23G	LCMT2_ENST00000544735.1_5'UTR|ADAL_ENST00000422466.2_5'Flank|ADAL_ENST00000389651.4_5'Flank|ADAL_ENST00000428046.3_5'Flank|LCMT2_ENST00000567039.1_Missense_Mutation_p.S23G	NM_014793.4	NP_055608.2	O60294	TYW4_HUMAN	leucine carboxyl methyltransferase 2	23					tRNA processing (GO:0008033)		methyltransferase activity (GO:0008168)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(2)|liver(1)|lung(9)|skin(1)|urinary_tract(1)	20		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.1e-07)	L-Leucine(DB00149)	GAACGCTTGCTGAGGGCGCTG	0.692																																						.											0													18.0	21.0	20.0					15																	43622621		2116	4131	6247	SO:0001583	missense	9836			AF265443	CCDS10094.1	15q15.3	2007-01-26			ENSG00000168806	ENSG00000168806			17558	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 4"""	611246				9628581, 17150819	Standard	NM_014793		Approved	KIAA0547, MGC9534, TYW4, PPM2	uc001zrg.3	O60294	OTTHUMG00000130705	ENST00000305641.5:c.67A>G	15.37:g.43622621T>C	ENSP00000307214:p.Ser23Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q4JFT6|Q96B55|Q9NR10	Missense_Mutation	SNP	ENST00000305641.5	37	CCDS10094.1	.	.	.	.	.	.	.	.	.	.	T	26.0	4.696451	0.88830	.	.	ENSG00000168806	ENST00000305641	T	0.25414	1.8	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.55878	0.1948	M	0.88842	2.985	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.62699	-0.6799	10	0.59425	D	0.04	.	12.0108	0.53286	0.0:0.0:0.0:1.0	.	23	O60294	LCMT2_HUMAN	G	23	ENSP00000307214:S23G	ENSP00000307214:S23G	S	-	1	0	LCMT2	41409913	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.541000	0.67212	2.333000	0.79357	0.533000	0.62120	AGC		0.692	LCMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253205.1	NM_014793	
SLC1A4	6509	ucsc.edu	37	2	65217143	65217143	+	Silent	SNP	C	C	A	rs561935539		TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr2:65217143C>A	ENST00000234256.3	+	1	609	c.366C>A	c.(364-366)ggC>ggA	p.G122G	SLC1A4_ENST00000493121.1_Intron|SLC1A4_ENST00000531327.1_Intron	NM_003038.4	NP_003029.2	P43007	SATT_HUMAN	solute carrier family 1 (glutamate/neutral amino acid transporter), member 4	122					amino acid transport (GO:0006865)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|cognition (GO:0050890)|glutamine transport (GO:0006868)|hydroxyproline transport (GO:0034589)|ion transport (GO:0006811)|L-alanine transport (GO:0015808)|L-cystine transport (GO:0015811)|L-serine transport (GO:0015825)|proline transmembrane transport (GO:0035524)|proline transport (GO:0015824)|synaptic transmission, glutamatergic (GO:0035249)|threonine transport (GO:0015826)|transmembrane transport (GO:0055085)	cell surface (GO:0009986)|centrosome (GO:0005813)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament (GO:0005882)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)|L-alanine transmembrane transporter activity (GO:0015180)|L-cystine transmembrane transporter activity (GO:0015184)|L-glutamine transmembrane transporter activity (GO:0015186)|L-hydroxyproline transmembrane transporter activity (GO:0034590)|L-proline transmembrane transporter activity (GO:0015193)|L-serine transmembrane transporter activity (GO:0015194)|L-threonine transmembrane transporter activity (GO:0015195)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|urinary_tract(1)	13					L-Alanine(DB00160)	CCTACTTTGGCCTCACCACAC	0.682																																						.											0													16.0	18.0	17.0					2																	65217143		2203	4300	6503	SO:0001819	synonymous_variant	6509				CCDS1879.1, CCDS54362.1	2p15-p13	2013-05-22			ENSG00000115902	ENSG00000115902		"""Solute carriers"""	10942	protein-coding gene	gene with protein product	"""alanine/serine/cysteine/threonine transporter"""	600229				7896285, 8910405	Standard	NM_003038		Approved	SATT, ASCT1	uc010yqa.2	P43007	OTTHUMG00000129537	ENST00000234256.3:c.366C>A	2.37:g.65217143C>A		Somatic		WXS	Illumina HiSeq	Phase_I	B7Z3C0|D6W5F0	Silent	SNP	ENST00000234256.3	37	CCDS1879.1																																																																																				0.682	SLC1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251726.2	NM_003038	
SLC23A3	151295	ucsc.edu	37	2	220030023	220030023	+	Silent	SNP	A	A	G			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr2:220030023A>G	ENST00000409878.3	-	8	1067	c.1035T>C	c.(1033-1035)ccT>ccC	p.P345P	SLC23A3_ENST00000295738.7_Intron|SLC23A3_ENST00000396775.3_Intron|SLC23A3_ENST00000455516.2_Silent_p.P353P	NM_001144889.1	NP_001138361.1	Q6PIS1	S23A3_HUMAN	solute carrier family 23, member 3	345					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	11		Renal(207;0.0474)		Epithelial(149;9.27e-07)|all cancers(144;0.000156)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GAGGTGGGGGAGGCAAATGCA	0.672																																						.											0													23.0	34.0	30.0					2																	220030023		692	1591	2283	SO:0001819	synonymous_variant	151295			BC030243	CCDS42819.1, CCDS46517.1, CCDS46518.1	2q35	2013-07-18	2013-07-18		ENSG00000213901	ENSG00000213901		"""Solute carriers"""	20601	protein-coding gene	gene with protein product							Standard	NM_144712		Approved	SVCT3, FLJ31168, Yspl1	uc010zkr.2	Q6PIS1	OTTHUMG00000154616	ENST00000409878.3:c.1035T>C	2.37:g.220030023A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B7Z512|Q2PYN6|Q96NA6	Silent	SNP	ENST00000409878.3	37	CCDS46518.1																																																																																				0.672	SLC23A3-010	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336331.2	NM_144712	
TMEM132A	54972	ucsc.edu	37	11	60701218	60701218	+	Splice_Site	SNP	T	T	C			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr11:60701218T>C	ENST00000453848.2	+	8	1717		c.e8+2		TMEM132A_ENST00000005286.4_Splice_Site			Q24JP5	T132A_HUMAN	transmembrane protein 132A							endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|prostate(1)|skin(3)	32						TGCTGAAGGGTGAGTGGAGGC	0.672																																						.											0													9.0	8.0	8.0					11																	60701218		2174	4249	6423	SO:0001630	splice_region_variant	54972			AK000546	CCDS7997.1, CCDS44618.1	11q12.2	2006-03-02	2006-03-02	2006-03-02	ENSG00000006118	ENSG00000006118			31092	protein-coding gene	gene with protein product			"""heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) binding protein 1"""	HSPA5BP1		12514190, 10997877	Standard	NM_017870		Approved	GBP, FLJ20539	uc001nqi.3	Q24JP5	OTTHUMG00000167803	ENST00000453848.2:c.1559+2T>C	11.37:g.60701218T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q69YU7|Q86VZ8|Q86W97|Q9H8K3|Q9HCI9|Q9NWY0	Splice_Site	SNP	ENST00000453848.2	37	CCDS44618.1	.	.	.	.	.	.	.	.	.	.	T	14.66	2.603215	0.46423	.	.	ENSG00000006118	ENST00000444690;ENST00000453848;ENST00000005286;ENST00000536409	.	.	.	4.38	4.38	0.52667	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.5458	0.56199	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	TMEM132A	60457794	1.000000	0.71417	1.000000	0.80357	0.672000	0.39443	1.573000	0.36472	1.909000	0.55274	0.528000	0.53228	.		0.672	TMEM132A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000396352.1	NM_017870	Intron
UNC5B	219699	ucsc.edu	37	10	73044593	73044593	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr10:73044593A>G	ENST00000335350.6	+	3	837	c.421A>G	c.(421-423)Agt>Ggt	p.S141G	UNC5B_ENST00000373192.4_Missense_Mutation_p.S141G	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)	141	Ig-like.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						CACCACCAAGAGTCGCCGAGC	0.652																																						.											0													79.0	75.0	77.0					10																	73044593		2203	4300	6503	SO:0001583	missense	219699			AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.421A>G	10.37:g.73044593A>G	ENSP00000334329:p.Ser141Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	Missense_Mutation	SNP	ENST00000335350.6	37	CCDS7309.1	.	.	.	.	.	.	.	.	.	.	A	28.7	4.938744	0.92526	.	.	ENSG00000107731	ENST00000335350;ENST00000373192	T;T	0.24723	1.84;1.84	5.03	5.03	0.67393	Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.53867	0.1823	M	0.82823	2.61	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.986	T	0.59963	-0.7355	10	0.54805	T	0.06	-11.1453	14.7589	0.69590	1.0:0.0:0.0:0.0	.	141;141	Q8IZJ1-2;Q8IZJ1	.;UNC5B_HUMAN	G	141	ENSP00000334329:S141G;ENSP00000362288:S141G	ENSP00000334329:S141G	S	+	1	0	UNC5B	72714599	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.339000	0.96797	1.880000	0.54463	0.454000	0.30748	AGT		0.652	UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048541.1	NM_170744	
ZC3HAV1	56829	ucsc.edu	37	7	138794049	138794049	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr7:138794049A>G	ENST00000242351.5	-	1	345	c.29T>C	c.(28-30)aTc>aCc	p.I10T	ZC3HAV1_ENST00000471652.1_Missense_Mutation_p.I10T|ZC3HAV1_ENST00000464606.1_Missense_Mutation_p.I10T	NM_020119.3	NP_064504.2	Q7Z2W4	ZCCHV_HUMAN	zinc finger CCCH-type, antiviral 1	10	N-terminal domain.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of mRNA catabolic process (GO:0061014)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(4)|skin(1)	37						GATTTTGGTGATGAAGCAGCA	0.662																																						.											0													12.0	16.0	15.0					7																	138794049		2138	4262	6400	SO:0001583	missense	56829			BX571742	CCDS5851.1, CCDS55171.1	7q34	2012-07-05			ENSG00000105939	ENSG00000105939		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	23721	protein-coding gene	gene with protein product	"""zinc finger antiviral protein"", "" CCCH-type zinc finger antiviral protein"""	607312				12215647, 12851707	Standard	NM_024625		Approved	ZAP, FLB6421, FLJ13288, MGC48898, ZC3HDC2, ZC3H2, PARP13	uc003vun.3	Q7Z2W4	OTTHUMG00000157471	ENST00000242351.5:c.29T>C	7.37:g.138794049A>G	ENSP00000242351:p.Ile10Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A4D1R2|A4D1S4|Q8IW57|Q8TAJ3|Q96N79|Q9H8R9|Q9P0Y7	Missense_Mutation	SNP	ENST00000242351.5	37	CCDS5851.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.594052	0.86953	.	.	ENSG00000105939	ENST00000242351;ENST00000464606;ENST00000471652	T;T;T	0.42900	0.96;0.96;0.96	4.63	4.63	0.57726	.	0.268964	0.26836	N	0.022257	T	0.57755	0.2075	M	0.71581	2.175	0.38353	D	0.944395	D;D	0.69078	0.992;0.997	P;P	0.61397	0.866;0.888	T	0.65800	-0.6080	10	0.87932	D	0	.	10.5908	0.45308	1.0:0.0:0.0:0.0	.	10;10	Q7Z2W4-2;Q7Z2W4	.;ZCCHV_HUMAN	T	10	ENSP00000242351:I10T;ENSP00000418385:I10T;ENSP00000419855:I10T	ENSP00000242351:I10T	I	-	2	0	ZC3HAV1	138444589	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.970000	0.63742	2.073000	0.62155	0.402000	0.26972	ATC		0.662	ZC3HAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348915.1	NM_020119	
CLEC18A	348174	mdanderson.org	37	16	69988260	69988260	+	Silent	SNP	G	G	A	rs684036	byFrequency	TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr16:69988260G>A	ENST00000288040.6	+	3	427	c.240G>A	c.(238-240)caG>caA	p.Q80Q	CLEC18A_ENST00000568461.1_Silent_p.Q80Q|CLEC18A_ENST00000449317.2_Silent_p.Q80Q|CLEC18A_ENST00000393701.2_Silent_p.Q80Q	NM_001136214.2	NP_001129686.1	A5D8T8	CL18A_HUMAN	C-type lectin domain family 18, member A	80	SCP.					extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			NS(1)|endometrium(2)|lung(1)|skin(1)	5						GCCTGGCCCAGCTGGCTCAAG	0.647													.|||	759	0.151558	0.0174	0.2709	5008	,	,		17235	0.0704		0.328	False		,,,				2504	0.1503					.											0								A	,	3,4371		0,3,2184	48.0	36.0	40.0		240,240	-3.4	0.0	16	dbSNP_83	40	221,7801		0,221,3790	no	coding-synonymous,coding-synonymous	CLEC18A	NM_001136214.1,NM_182619.2	,	0,224,5974	AA,AG,GG		2.7549,0.0686,1.807	,	80/447,80/447	69988260	224,12172	2187	4011	6198	SO:0001819	synonymous_variant	348174			AF428259	CCDS10886.1	16q22.1	2010-04-27	2009-03-10	2009-03-10		ENSG00000157322		"""C-type lectin domain containing"""	30388	protein-coding gene	gene with protein product	"""mannose receptor-like"""					12975309	Standard	NM_001136214		Approved	MRCL	uc010vlo.3	A5D8T8		ENST00000288040.6:c.240G>A	16.37:g.69988260G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8K1G9|Q6DCB3|Q7Z5K9|Q96HH2	Silent	SNP	ENST00000288040.6	37	CCDS10886.1																																																																																				0.647	CLEC18A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000268955.2	NM_182619	
HLA-C	3107	mdanderson.org	37	6	31238009	31238009	+	Silent	SNP	T	T	C	rs1131014	byFrequency	TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr6:31238009T>C	ENST00000376228.5	-	4	887	c.873A>G	c.(871-873)caA>caG	p.Q291Q	HLA-C_ENST00000383329.3_Silent_p.Q291Q	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	291	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						TGAGGGGCTCTTGCAGCCCCT	0.592													C|||	2561	0.511382	0.6172	0.549	5008	,	,		13431	0.5744		0.4404	False		,,,				2504	0.3497					.											0													23.0	30.0	28.0					6																	31238009		2121	4194	6315	SO:0001819	synonymous_variant	3107			M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.873A>G	6.37:g.31238009T>C		Somatic		WXS	Illumina HiSeq	Phase_I	O02864|O02958|Q29643|Q9MY30	Silent	SNP	ENST00000376228.5	37	CCDS34393.1	872	0.3992673992673993	230	0.46747967479674796	148	0.4088397790055249	255	0.4458041958041958	239	0.3153034300791557	.	0.019	-1.465537	0.01053	.	.	ENSG00000204525	ENST00000415537	.	.	.	2.67	-5.33	0.02713	.	.	.	.	.	T	0.06005	0.0156	.	.	.	0.53005	P	3.799999999998249E-5	.	.	.	.	.	.	T	0.24154	-1.0168	3	.	.	.	.	2.6503	0.04996	0.1827:0.239:0.4507:0.1277	rs41551714	.	.	.	R	255	.	.	K	-	2	0	HLA-C	31345988	0.000000	0.05858	0.108000	0.21378	0.013000	0.08279	-3.876000	0.00344	-1.974000	0.00998	-0.711000	0.03637	AAG		0.592	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076281.3	NM_002117	
ICAM5	7087	mdanderson.org	37	19	10407169	10407169	+	Silent	SNP	G	G	C	rs710845	byFrequency	TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr19:10407169G>C	ENST00000221980.4	+	11	2715	c.2652G>C	c.(2650-2652)ctG>ctC	p.L884L		NM_003259.3	NP_003250.3	Q9UMF0	ICAM5_HUMAN	intercellular adhesion molecule 5, telencephalin	884					phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(20;2.64e-09)|Epithelial(33;4.31e-06)|all cancers(31;9.75e-06)			CCGTGTGTCTGAACGGAgcgg	0.771													C|||	2557	0.510583	0.5681	0.6455	5008	,	,		6247	0.3313		0.5895	False		,,,				2504	0.4407					.											0								C		1682,962		566,550,206	4.0	3.0	3.0		2652	0.5	1.0	19	dbSNP_86	3	2905,1749		979,947,401	no	coding-synonymous	ICAM5	NM_003259.3		1545,1497,607	CC,CG,GG		37.5806,36.3843,37.1472		884/925	10407169	4587,2711	1322	2327	3649	SO:0001819	synonymous_variant	7087			U72671	CCDS12233.1	19p13.2	2013-01-14				ENSG00000105376		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5348	protein-coding gene	gene with protein product	"""telencephalin"""	601852		TLCN		8995416, 9828136	Standard	NM_003259		Approved	TLN	uc002mnu.4	Q9UMF0		ENST00000221980.4:c.2652G>C	19.37:g.10407169G>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q9Y6F3	Silent	SNP	ENST00000221980.4	37	CCDS12233.1																																																																																				0.771	ICAM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451217.1	NM_003259	
KRTAP9-9	81870	mdanderson.org	37	17	39412093	39412093	+	Silent	SNP	C	C	A	rs368292401		TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr17:39412093C>A	ENST00000394008.1	+	1	458	c.456C>A	c.(454-456)acC>acA	p.T152T		NM_030975.2	NP_112237.2	Q9BYP9	KRA99_HUMAN	keratin associated protein 9-9	137	14 X 5 AA repeats of C-C-[RQVGE]- [SPSTNQ]-[TASL].					keratin filament (GO:0045095)				endometrium(3)|skin(2)|upper_aerodigestive_tract(1)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			GCTGCAGGACCACTTGCTTCC	0.602																																						.											0													165.0	172.0	169.0					17																	39412093		2203	4298	6501	SO:0001819	synonymous_variant	81870			AJ406951	CCDS54127.1	17q21.2	2010-06-03			ENSG00000198083	ENSG00000198083		"""Keratin associated proteins"""	16773	protein-coding gene	gene with protein product			"""keratin associated protein 9-5"""	KRTAP9-5		11279113	Standard	NM_030975		Approved	KAP9.9, KAP9.5	uc021txh.1	Q9BYP9	OTTHUMG00000133602	ENST00000394008.1:c.456C>A	17.37:g.39412093C>A		Somatic		WXS	Illumina HiSeq	Phase_I	B5MDD6|Q9BYQ1	Silent	SNP	ENST00000394008.1	37	CCDS54127.1																																																																																				0.602	KRTAP9-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257710.1	NM_030975	
MUC16	94025	mdanderson.org	37	19	8999479	8999479	+	Missense_Mutation	SNP	G	G	T			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr19:8999479G>T	ENST00000397910.4	-	56	40899	c.40696C>A	c.(40696-40698)Cag>Aag	p.Q13566K	MUC16_ENST00000380951.5_Missense_Mutation_p.Q207K	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13568	SEA 10. {ECO:0000255|PROSITE- ProRule:PRU00188}.			Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CAGTATAGCTGCTCTCTGTCC	0.587																																						.											0													172.0	145.0	153.0					19																	8999479		1997	4180	6177	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.40696C>A	19.37:g.8999479G>T	ENSP00000381008:p.Gln13566Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.047|0.047	-1.262604|-1.262604	0.01445|0.01445	.|.	.|.	ENSG00000181143|ENSG00000181143	ENST00000397910;ENST00000380951|ENST00000542240	T;T|.	0.35421|.	1.31;1.31|.	3.48|3.48	1.01|1.01	0.19927|0.19927	SEA (2);|.	.|.	.|.	.|.	.|.	T|T	0.43875|0.43875	0.1267|0.1267	L|L	0.48642|0.48642	1.525|1.525	.|.	.|.	.|.	B;P|.	0.39576|.	0.025;0.679|.	B;P|.	0.47044|.	0.025;0.535|.	T|T	0.52601|0.52601	-0.8554|-0.8554	8|4	0.11794|.	T|.	0.64|.	-0.0012|-0.0012	7.5959|7.5959	0.28048|0.28048	0.0:0.0:0.5377:0.4623|0.0:0.0:0.5377:0.4623	.|.	21211;13566|.	Q8WXI7;B5ME49|.	MUC16_HUMAN;.|.	K|R	13566;207|405	ENSP00000381008:Q13566K;ENSP00000370338:Q207K|.	ENSP00000370338:Q207K|.	Q|S	-|-	1|3	0|2	MUC16|MUC16	8860479|8860479	0.000000|0.000000	0.05858|0.05858	0.644000|0.644000	0.29465|0.29465	0.069000|0.069000	0.16628|0.16628	-0.955000|-0.955000	0.03869|0.03869	0.786000|0.786000	0.33708|0.33708	0.555000|0.555000	0.69702|0.69702	CAG|AGC		0.587	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC6	4588	mdanderson.org	37	11	1017022	1017022	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr11:1017022G>A	ENST00000421673.2	-	31	5829	c.5779C>T	c.(5779-5781)Cat>Tat	p.H1927Y		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1927	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		ACTTCAGGATGGTGTGTTGAG	0.557																																						.											0													680.0	683.0	682.0					11																	1017022		2201	4285	6486	SO:0001583	missense	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5779C>T	11.37:g.1017022G>A	ENSP00000406861:p.His1927Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	G	0.512	-0.865870	0.02590	.	.	ENSG00000184956	ENST00000421673	T	0.25579	1.79	3.05	-0.616	0.11583	.	.	.	.	.	T	0.14013	0.0339	L	0.29908	0.895	0.09310	N	1	B	0.13145	0.007	B	0.08055	0.003	T	0.28459	-1.0043	9	0.30078	T	0.28	.	2.386	0.04365	0.1202:0.3607:0.3491:0.17	.	1927	Q6W4X9	MUC6_HUMAN	Y	1927	ENSP00000406861:H1927Y	ENSP00000406861:H1927Y	H	-	1	0	MUC6	1007022	0.000000	0.05858	0.000000	0.03702	0.061000	0.15899	0.407000	0.21049	-0.244000	0.09639	0.313000	0.20887	CAT		0.557	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MUC6	4588	mdanderson.org	37	11	1017543	1017543	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr11:1017543G>A	ENST00000421673.2	-	31	5308	c.5258C>T	c.(5257-5259)aCt>aTt	p.T1753I		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1753	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGTGGAGGAAGTGTGTGAATG	0.552																																						.											0													834.0	785.0	802.0					11																	1017543		2201	4293	6494	SO:0001583	missense	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5258C>T	11.37:g.1017543G>A	ENSP00000406861:p.Thr1753Ile	Somatic		WXS	Illumina HiSeq	Phase_I	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	-	9.616	1.132522	0.21041	.	.	ENSG00000184956	ENST00000421673	T	0.21361	2.01	3.07	2.14	0.27477	.	.	.	.	.	T	0.24314	0.0589	N	0.24115	0.695	0.09310	N	1	D	0.59357	0.985	D	0.63488	0.915	T	0.07986	-1.0744	9	0.51188	T	0.08	.	4.2562	0.10719	0.133:0.0:0.6424:0.2245	.	1753	Q6W4X9	MUC6_HUMAN	I	1753	ENSP00000406861:T1753I	ENSP00000406861:T1753I	T	-	2	0	MUC6	1007543	0.040000	0.19996	0.001000	0.08648	0.079000	0.17450	2.410000	0.44592	0.585000	0.29608	0.313000	0.20887	ACT		0.552	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MUC6	4588	mdanderson.org	37	11	1017979	1017979	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr11:1017979G>A	ENST00000421673.2	-	31	4872	c.4822C>T	c.(4822-4824)Cct>Tct	p.P1608S		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1608	Approximate repeats.|Pro-rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GTGGTCTGAGGGTGTGATGGG	0.552																																						.											0													468.0	437.0	448.0					11																	1017979		2186	4278	6464	SO:0001583	missense	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.4822C>T	11.37:g.1017979G>A	ENSP00000406861:p.Pro1608Ser	Somatic		WXS	Illumina HiSeq	Phase_I	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	G	5.477	0.273094	0.10349	.	.	ENSG00000184956	ENST00000421673	T	0.24538	1.85	2.39	0.275	0.15659	.	.	.	.	.	T	0.22936	0.0554	M	0.62723	1.935	0.09310	N	1	B	0.33135	0.399	B	0.33042	0.157	T	0.18777	-1.0326	9	0.45353	T	0.12	.	4.8879	0.13712	0.1334:0.0:0.6602:0.2064	.	1608	Q6W4X9	MUC6_HUMAN	S	1608	ENSP00000406861:P1608S	ENSP00000406861:P1608S	P	-	1	0	MUC6	1007979	0.004000	0.15560	0.001000	0.08648	0.024000	0.10985	-0.105000	0.10907	-0.082000	0.12640	-0.707000	0.03653	CCT		0.552	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
OR5H1	26341	mdanderson.org	37	3	97851892	97851892	+	Silent	SNP	G	G	A	rs5009897		TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr3:97851892G>A	ENST00000354565.2	+	1	351	c.351G>A	c.(349-351)acG>acA	p.T117T	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005338.1	NP_001005338.1	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H, member 1	117						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|kidney(8)|large_intestine(3)|lung(13)|ovary(1)|skin(1)	34						TCTTGGCAACGATGGCATATG	0.388																																						.											0													154.0	148.0	150.0					3																	97851892		2202	4299	6501	SO:0001819	synonymous_variant	26341			X64988	CCDS33797.1	3q12.1	2012-08-09			ENSG00000231192	ENSG00000231192		"""GPCR / Class A : Olfactory receptors"""	8346	protein-coding gene	gene with protein product						1370859	Standard	NM_001005338		Approved	HTPCRX14, HSHTPCRX14	uc011bgt.2	A6NKK0	OTTHUMG00000160070	ENST00000354565.2:c.351G>A	3.37:g.97851892G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000354565.2	37	CCDS33797.1																																																																																				0.388	OR5H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359100.2	NM_001005338	
PCDHA8	56140	mdanderson.org	37	5	140221195	140221195	+	Missense_Mutation	SNP	G	G	C	rs199713478	byFrequency	TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr5:140221195G>C	ENST00000531613.1	+	1	289	c.289G>C	c.(289-291)Ggg>Cgg	p.G97R	PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA8_ENST00000378123.3_Missense_Mutation_p.G97R	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	97	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.G97R(2)		NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAGCTGTGCGGGCGGAGCGC	0.577													.|||	572	0.114217	0.1036	0.1499	5008	,	,		18938	0.0933		0.1103	False		,,,				2504	0.1288					.											2	Substitution - Missense(2)	NS(2)																																								SO:0001583	missense	56140			AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.289G>C	5.37:g.140221195G>C	ENSP00000434655:p.Gly97Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B9EGT7|O75281	Missense_Mutation	SNP	ENST00000531613.1	37	CCDS54919.1	.	.	.	.	.	.	.	.	.	.	G	17.37	3.373716	0.61624	.	.	ENSG00000204962	ENST00000531613;ENST00000378123	T;T	0.30981	1.51;1.51	3.91	3.91	0.45181	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.213176	0.22539	U	0.058753	T	0.36413	0.0966	M	0.70595	2.14	0.24709	N	0.993216	P;D	0.56287	0.915;0.975	P;P	0.47744	0.49;0.556	T	0.29397	-1.0013	10	0.49607	T	0.09	.	7.8746	0.29586	0.1899:0.0:0.8101:0.0	.	97;97	Q9Y5H6;Q9Y5H6-2	PCDA8_HUMAN;.	R	97	ENSP00000434655:G97R;ENSP00000367363:G97R	ENSP00000367363:G97R	G	+	1	0	PCDHA8	140201379	0.396000	0.25262	1.000000	0.80357	0.974000	0.67602	2.166000	0.42406	1.900000	0.55004	0.552000	0.68991	GGG		0.577	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372830.2	NM_018911	
PRKRA	8575	mdanderson.org	37	2	179315757	179315757	+	Start_Codon_SNP	SNP	T	T	G	rs9406386	byFrequency	TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr2:179315757T>G	ENST00000325748.4	-	1	201	c.1A>C	c.(1-3)Atg>Ctg	p.M1L	DFNB59_ENST00000409117.3_5'Flank|PRKRA_ENST00000470200.1_Intron|DFNB59_ENST00000375129.4_5'Flank|PRKRA_ENST00000432031.2_5'Flank|PRKRA_ENST00000487082.1_5'Flank|PRKRA_ENST00000438687.3_5'UTR	NM_003690.4	NP_003681.1	O75569	PRKRA_HUMAN	protein kinase, interferon-inducible double stranded RNA dependent activator	1	Sufficient for self-association and interaction with TARBP2.				cellular response to oxidative stress (GO:0034599)|gene expression (GO:0010467)|immune response (GO:0006955)|middle ear morphogenesis (GO:0042474)|negative regulation of cell proliferation (GO:0008285)|outer ear morphogenesis (GO:0042473)|positive regulation of catalytic activity (GO:0043085)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|production of siRNA involved in RNA interference (GO:0030422)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)|skeletal system morphogenesis (GO:0048705)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	enzyme activator activity (GO:0008047)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|skin(2)	19			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.00634)|all cancers(119;0.0265)			CTCTGGGACATGGCGAGAAGG	0.746																																					Melanoma(200;68 3001 23825 48764)	.											0													6.0	9.0	8.0					2																	179315757		1711	3612	5323	SO:0001582	initiator_codon_variant	8575			AF072860	CCDS2279.1, CCDS46460.1, CCDS46461.1	2q31.2	2009-08-25			ENSG00000180228	ENSG00000180228			9438	protein-coding gene	gene with protein product	"""protein activator of the interferon-induced protein kinase"""	603424				9687506, 10336432	Standard	NM_003690		Approved	PACT, RAX, HSD14, DYT16	uc002umf.3	O75569	OTTHUMG00000132576	ENST00000325748.4:c.1A>C	2.37:g.179315757T>G	ENSP00000318176:p.Met1Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A8K3I6|Q53G24|Q6X7T5|Q8NDK4	Missense_Mutation	SNP	ENST00000325748.4	37	CCDS2279.1	354	0.1620879120879121	36	0.07317073170731707	85	0.23480662983425415	70	0.12237762237762238	163	0.21503957783641162	T	17.06	3.292620	0.59976	.	.	ENSG00000180228	ENST00000325748	T	0.70164	-0.46	4.45	3.29	0.37713	.	0.824018	0.10788	N	0.634052	T	0.00039	0.0001	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.04635	-1.0937	9	0.87932	D	0	.	6.5676	0.22521	0.0:0.1104:0.0:0.8896	rs9406386	1	O75569	PRKRA_HUMAN	L	1	ENSP00000318176:M1L	ENSP00000318176:M1L	M	-	1	0	PRKRA	179024003	0.994000	0.37717	0.921000	0.36526	0.909000	0.53808	1.278000	0.33179	0.853000	0.35312	0.338000	0.21704	ATG		0.746	PRKRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255782.2	NM_003690	Missense_Mutation
TAS2R30	259293	mdanderson.org	37	12	11286276	11286276	+	Missense_Mutation	SNP	G	G	C			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr12:11286276G>C	ENST00000539585.1	-	1	967	c.568C>G	c.(568-570)Ctg>Gtg	p.L190V	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_001097643.1	NP_001091112.1	P59541	T2R30_HUMAN	taste receptor, type 2, member 30	190					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	13						ATCAGGGTCAGAGTGAGGGGT	0.418																																						.											0													189.0	200.0	196.0					12																	11286276		2203	4300	6503	SO:0001583	missense	259293			AX097746, AF494233	CCDS53750.1	12p13.2	2012-08-22				ENSG00000256188		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19112	protein-coding gene	gene with protein product		613963	"""taste receptor, type 2, member 47"""	TAS2R47			Standard	NM_001097643		Approved	T2R30	uc009zhs.1	P59541		ENST00000539585.1:c.568C>G	12.37:g.11286276G>C	ENSP00000444736:p.Leu190Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q645X7	Missense_Mutation	SNP	ENST00000539585.1	37	CCDS53750.1	.	.	.	.	.	.	.	.	.	.	-	1.203	-0.632049	0.03584	.	.	ENSG00000256188	ENST00000539585	T	0.00700	5.82	2.6	-4.69	0.03299	.	.	.	.	.	T	0.00724	0.0024	L	0.39245	1.2	0.09310	N	1	B	0.09022	0.002	B	0.20384	0.029	T	0.41893	-0.9483	9	0.27082	T	0.32	.	5.8078	0.18450	0.1714:0.0:0.5788:0.2498	.	190	P59541	T2R30_HUMAN	V	190	ENSP00000444736:L190V	ENSP00000444736:L190V	L	-	1	2	TAS2R30	11177543	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.309000	0.08145	-0.577000	0.05967	-0.698000	0.03680	CTG		0.418	TAS2R30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400238.1	NM_001097643	
SLCO1C1	53919	mdanderson.org	37	12	20905250	20905250	+	Silent	SNP	C	C	T	rs6487138	byFrequency	TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr12:20905250C>T	ENST00000266509.2	+	15	2295	c.1927C>T	c.(1927-1929)Ctg>Ttg	p.L643L	SLCO1C1_ENST00000545102.1_Missense_Mutation_p.S559F|SLCO1C1_ENST00000545604.1_Missense_Mutation_p.S677F|SLCO1C1_ENST00000381552.1_Missense_Mutation_p.S677F|SLCO1C1_ENST00000540354.1_Silent_p.L594L	NM_017435.4	NP_059131.1	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family, member 1C1	643					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	60	Esophageal squamous(101;0.149)				Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Meclofenamic acid(DB00939)|Methotrexate(DB00563)|Ouabain(DB01092)|Phenytoin(DB00252)|Probenecid(DB01032)	ACATATATATCTGGGACTAAC	0.299													C|||	2351	0.469449	0.2012	0.5677	5008	,	,		17354	0.5923		0.495	False		,,,				2504	0.6094					.											0								C	PHE/SER,,PHE/SER,	1092,3312	370.3+/-319.5	138,816,1248	41.0	41.0	41.0		1676,1780,2030,1927	5.4	1.0	12	dbSNP_116	41	4649,3947	591.6+/-392.9	1248,2153,897	yes	missense,coding-synonymous,missense,coding-synonymous	SLCO1C1	NM_001145944.1,NM_001145945.1,NM_001145946.1,NM_017435.4	155,,155,	1386,2969,2145	TT,TC,CC		45.9167,24.7956,44.1615	,,,	559/613,594/664,677/731,643/713	20905250	5741,7259	2202	4298	6500	SO:0001819	synonymous_variant	53919			AF260704	CCDS8683.1, CCDS53757.1, CCDS53758.1, CCDS53759.1	12p12.2	2013-05-22	2003-11-25	2003-11-26	ENSG00000139155	ENSG00000139155		"""Solute carriers"""	13819	protein-coding gene	gene with protein product		613389	"""solute carrier family 21 (organic anion transporter), member 14"""	SLC21A14			Standard	NM_017435		Approved	OATP-F, OATP1C1, OATP1	uc010sii.2	Q9NYB5	OTTHUMG00000168966	ENST00000266509.2:c.1927C>T	12.37:g.20905250C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B7Z251|B7Z3Q3|B7Z8P1|F5GZD6|Q5JPA4	Missense_Mutation	SNP	ENST00000266509.2	37	CCDS8683.1	1046	0.47893772893772896	110	0.22357723577235772	192	0.5303867403314917	358	0.6258741258741258	386	0.5092348284960422	C	16.43	3.120305	0.56613	0.247956	0.540833	ENSG00000139155	ENST00000545604;ENST00000381552;ENST00000545102	T;T;T	0.39997	1.05;1.05;1.11	5.37	5.37	0.77165	.	2.483440	0.01020	N	0.003979	T	0.00012	0.0000	.	.	.	0.31879	P	0.618765	P;P	0.51537	0.946;0.91	P;P	0.55999	0.789;0.498	T	0.46275	-0.9203	8	0.59425	D	0.04	.	16.1483	0.81586	0.0:1.0:0.0:0.0	rs6487138	559;677	F5GZD6;Q5JPA4	.;.	F	677;677;559	ENSP00000444149:S677F;ENSP00000370964:S677F;ENSP00000444527:S559F	ENSP00000370964:S677F	S	+	2	0	SLCO1C1	20796517	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.654000	0.46699	2.797000	0.96272	0.655000	0.94253	TCT		0.299	SLCO1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401765.1	NM_017435	
UCHL1	7345	mdanderson.org	37	4	41259633	41259633	+	Missense_Mutation	SNP	C	C	A	rs5030732	byFrequency	TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr4:41259633C>A	ENST00000284440.4	+	3	197	c.53C>A	c.(52-54)tCc>tAc	p.S18Y	UCHL1_ENST00000508768.1_Missense_Mutation_p.S18Y|UCHL1_ENST00000512788.1_Missense_Mutation_p.S18Y|UCHL1_ENST00000503431.1_Missense_Mutation_p.S18Y|UCHL1_ENST00000504818.1_3'UTR|UCHL1-AS1_ENST00000507190.1_RNA|UCHL1-AS1_ENST00000510073.1_RNA	NM_004181.4	NP_004172.2	P09936	UCHL1_HUMAN	ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)	18			S -> Y (found in patients with cataract; unknown pathological significance; loss of dimerization ability; impaired ligase activity; confers an antioxidant protective function when expressed at physiological levels in neuroblastoma cells and primary cortical neurons; dbSNP:rs5030732). {ECO:0000269|PubMed:10203348, ECO:0000269|PubMed:11027850, ECO:0000269|PubMed:15048890, ECO:0000269|PubMed:16450370, ECO:0000269|PubMed:21268678}.		adult walking behavior (GO:0007628)|axon target recognition (GO:0007412)|axon transport of mitochondrion (GO:0019896)|cell death (GO:0008219)|cell proliferation (GO:0008283)|eating behavior (GO:0042755)|muscle fiber development (GO:0048747)|negative regulation of MAP kinase activity (GO:0043407)|neuromuscular process (GO:0050905)|protein deubiquitination (GO:0016579)|response to ischemia (GO:0002931)|sensory perception of pain (GO:0019233)|ubiquitin-dependent protein catabolic process (GO:0006511)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	alpha-2A adrenergic receptor binding (GO:0031694)|cysteine-type endopeptidase activity (GO:0004197)|ligase activity (GO:0016874)|omega peptidase activity (GO:0008242)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|skin(2)	8						CAGGTGCTGTCCCGGCTGGGG	0.766													C|||	1272	0.253994	0.0121	0.2939	5008	,	,		10899	0.5437		0.1809	False		,,,				2504	0.3292					.											0			GRCh37	CM994452	UCHL1	M	rs5030732	C	TYR/SER	114,4064		2,110,1977	6.0	8.0	7.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	53	2.8	0.9	4	dbSNP_113	7	1114,7164		61,992,3086	no	missense	UCHL1	NM_004181.4	144	63,1102,5063	AA,AC,CC		13.4574,2.7286,9.8587	benign	18/224	41259633	1228,11228	2089	4139	6228	SO:0001583	missense	7345			BC000332	CCDS3462.1	4p13	2011-07-21			ENSG00000154277	ENSG00000154277	3.4.19.12	"""Parkinson disease"""	12513	protein-coding gene	gene with protein product		191342		PARK5		1840236	Standard	NM_004181		Approved	PGP9.5, Uch-L1	uc003gvo.3	P09936	OTTHUMG00000099377	ENST00000284440.4:c.53C>A	4.37:g.41259633C>A	ENSP00000284440:p.Ser18Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	Q4W5K6|Q71UM0	Missense_Mutation	SNP	ENST00000284440.4	37	CCDS3462.1	528	0.24175824175824176	16	0.032520325203252036	97	0.26795580110497236	282	0.493006993006993	133	0.17546174142480211	C	8.406	0.842968	0.16963	0.027286	0.134574	ENSG00000154277	ENST00000514924;ENST00000503431;ENST00000284440;ENST00000508768;ENST00000512788	T;T;T;T;T	0.56275	0.47;0.47;0.47;0.47;0.47	3.7	2.84	0.33178	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (4);	1.003210	0.08035	N	0.994193	T	0.00012	0.0000	L	0.37697	1.125	0.28202	P	0.9273172	P	0.38300	0.626	B	0.36567	0.228	T	0.44406	-0.9330	9	0.23891	T	0.37	-1.0546	13.1671	0.59577	0.0:0.8388:0.1611:0.0	rs5030732	18	P09936	UCHL1_HUMAN	Y	18	ENSP00000426634:S18Y;ENSP00000422542:S18Y;ENSP00000284440:S18Y;ENSP00000426895:S18Y;ENSP00000423623:S18Y	ENSP00000284440:S18Y	S	+	2	0	UCHL1	40954390	0.422000	0.25473	0.940000	0.37924	0.849000	0.48306	1.040000	0.30278	0.724000	0.32296	0.462000	0.41574	TCC		0.766	UCHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216827.1	NM_004181	
MUC6	4588	bcgsc.ca	37	11	1016628	1016628	+	Missense_Mutation	SNP	G	G	A	rs202039948		TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr11:1016628G>A	ENST00000421673.2	-	31	6223	c.6173C>T	c.(6172-6174)aCc>aTc	p.T2058I		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	2058	Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGCTGTGTGGGTGGACCCTGT	0.567																																						.											0													381.0	380.0	380.0					11																	1016628		2193	4287	6480	SO:0001583	missense	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.6173C>T	11.37:g.1016628G>A	ENSP00000406861:p.Thr2058Ile	Somatic		WXS	Illumina HiSeq	Phase_I	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	G	14.35	2.507954	0.44558	.	.	ENSG00000184956	ENST00000421673	T	0.19250	2.16	2.46	2.46	0.29980	.	.	.	.	.	T	0.20941	0.0504	L	0.50333	1.59	0.09310	N	1	D	0.56968	0.978	B	0.42738	0.396	T	0.10706	-1.0618	9	0.45353	T	0.12	.	11.0274	0.47753	0.0:0.0:1.0:0.0	.	2058	Q6W4X9	MUC6_HUMAN	I	2058	ENSP00000406861:T2058I	ENSP00000406861:T2058I	T	-	2	0	MUC6	1006628	0.007000	0.16637	0.002000	0.10522	0.226000	0.24999	1.358000	0.34102	1.716000	0.51395	0.313000	0.20887	ACC		0.567	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MUC6	4588	bcgsc.ca	37	11	1016662	1016662	+	Missense_Mutation	SNP	G	G	A	rs201489806		TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr11:1016662G>A	ENST00000421673.2	-	31	6189	c.6139C>T	c.(6139-6141)Cct>Tct	p.P2047S		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	2047	Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GTTGGTGGAGGAACGGTGCCT	0.572																																						.											0													524.0	490.0	502.0					11																	1016662		2200	4295	6495	SO:0001583	missense	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.6139C>T	11.37:g.1016662G>A	ENSP00000406861:p.Pro2047Ser	Somatic		WXS	Illumina HiSeq	Phase_I	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	G	6.404	0.442648	0.12164	.	.	ENSG00000184956	ENST00000421673	T	0.18810	2.19	3.12	-2.06	0.07298	.	.	.	.	.	T	0.10809	0.0264	L	0.33485	1.01	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.40553	-0.9557	9	0.11485	T	0.65	.	2.5371	0.04716	0.2087:0.142:0.5053:0.144	.	2047	Q6W4X9	MUC6_HUMAN	S	2047	ENSP00000406861:P2047S	ENSP00000406861:P2047S	P	-	1	0	MUC6	1006662	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.038000	0.13862	-1.027000	0.03325	-1.786000	0.00637	CCT		0.572	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
ADAMTS7	11173	bcgsc.ca	37	15	79060505	79060505	+	Frame_Shift_Del	DEL	C	C	-			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr15:79060505delC	ENST00000388820.4	-	17	2825	c.2615delG	c.(2614-2616)aggfs	p.R872fs	ADAMTS7_ENST00000566303.1_5'UTR	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	872	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						GCTGCACTTCCTCTGTTGGTC	0.697																																						.											0													22.0	23.0	23.0					15																	79060505		2191	4289	6480	SO:0001589	frameshift_variant	11173			AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.2615delG	15.37:g.79060505delC	ENSP00000373472:p.Arg872fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q14F51|Q6P7J9	Frame_Shift_Del	DEL	ENST00000388820.4	37	CCDS32303.1																																																																																				0.697	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
LYRM1	57149	bcgsc.ca	37	16	20926885	20926885	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr16:20926885C>T	ENST00000396052.2	+	4	408	c.8C>T	c.(7-9)aCg>aTg	p.T3M	LYRM1_ENST00000562740.1_Intron|LYRM1_ENST00000219168.4_Missense_Mutation_p.T3M|LYRM1_ENST00000412082.2_Intron|LYRM1_ENST00000569023.1_Missense_Mutation_p.T3M|LYRM1_ENST00000567954.1_Missense_Mutation_p.T3M|LYRM1_ENST00000439021.1_Missense_Mutation_p.T3M|LYRM1_ENST00000568663.1_Missense_Mutation_p.T3M			O43325	LYRM1_HUMAN	LYR motif containing 1	3						mitochondrion (GO:0005739)|nucleus (GO:0005634)				large_intestine(1)|prostate(1)	2						AAGATGACAACGGCAACACGA	0.448																																						.											0													101.0	98.0	99.0					16																	20926885		2201	4300	6501	SO:0001583	missense	57149				CCDS10593.1	16p12.2	2008-02-05			ENSG00000102897	ENSG00000102897		"""LYR motif containing"""	25074	protein-coding gene	gene with protein product		614709				10493829	Standard	NM_020424		Approved	A211C6.1	uc010bwl.3	O43325	OTTHUMG00000131554	ENST00000396052.2:c.8C>T	16.37:g.20926885C>T	ENSP00000379367:p.Thr3Met	Somatic		WXS	Illumina HiSeq	Phase_I	B2R4M5	Missense_Mutation	SNP	ENST00000396052.2	37	CCDS10593.1	.	.	.	.	.	.	.	.	.	.	C	11.48	1.650359	0.29336	.	.	ENSG00000102897	ENST00000439021;ENST00000219168;ENST00000412082;ENST00000396052	.	.	.	5.7	3.77	0.43336	.	0.438148	0.28606	N	0.014745	T	0.25827	0.0629	N	0.16478	0.41	0.23845	N	0.996689	B	0.06786	0.001	B	0.04013	0.001	T	0.15435	-1.0437	9	0.40728	T	0.16	-2.7685	9.6094	0.39654	0.0:0.7879:0.0:0.2121	.	3	O43325	LYRM1_HUMAN	M	3	.	ENSP00000219168:T3M	T	+	2	0	LYRM1	20834386	0.501000	0.26099	0.982000	0.44146	0.768000	0.43524	1.778000	0.38614	0.782000	0.33613	-0.136000	0.14681	ACG		0.448	LYRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254416.1	NM_020424	
NFAT5	10725	bcgsc.ca	37	16	69724942	69724942	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr16:69724942T>C	ENST00000354436.2	+	11	2138	c.1820T>C	c.(1819-1821)gTt>gCt	p.V607A	NFAT5_ENST00000393742.2_Missense_Mutation_p.V531A|NFAT5_ENST00000349945.1_Missense_Mutation_p.V531A|NFAT5_ENST00000566899.1_Missense_Mutation_p.V531A|NFAT5_ENST00000432919.1_Missense_Mutation_p.V625A|NFAT5_ENST00000567239.1_Missense_Mutation_p.V624A	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	607					cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						AGTGAAGATGTTACTCCAATG	0.348																																						.											0													99.0	97.0	98.0					16																	69724942		2198	4297	6495	SO:0001583	missense	10725			AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.1820T>C	16.37:g.69724942T>C	ENSP00000346420:p.Val607Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	Missense_Mutation	SNP	ENST00000354436.2	37	CCDS10881.1	.	.	.	.	.	.	.	.	.	.	T	15.09	2.730245	0.48939	.	.	ENSG00000102908	ENST00000432919;ENST00000426654;ENST00000349945;ENST00000354436;ENST00000393742	T;T;T;T	0.46063	0.89;0.88;0.89;0.88	5.36	5.36	0.76844	.	0.410753	0.27134	N	0.020778	T	0.31167	0.0788	L	0.51422	1.61	0.35732	D	0.818025	B;B;B	0.15473	0.013;0.003;0.0	B;B;B	0.12837	0.008;0.005;0.001	T	0.29088	-1.0023	10	0.09084	T	0.74	-0.7107	6.7615	0.23542	0.0:0.0766:0.1537:0.7697	.	624;607;625	A2RRB4;O94916;E9PHR7	.;NFAT5_HUMAN;.	A	625;624;531;607;531	ENSP00000396538:V625A;ENSP00000338806:V531A;ENSP00000346420:V607A;ENSP00000377343:V531A	ENSP00000338806:V531A	V	+	2	0	NFAT5	68282443	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.410000	0.52664	2.042000	0.60477	0.533000	0.62120	GTT		0.348	NFAT5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268952.2	NM_138714	
MPHOSPH10	10199	bcgsc.ca	37	2	71357850	71357850	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr2:71357850G>A	ENST00000244230.2	+	1	407	c.55G>A	c.(55-57)Ggc>Agc	p.G19S	MPHOSPH10_ENST00000498451.2_Missense_Mutation_p.G19S|MPHOSPH10_ENST00000468427.1_3'UTR|MCEE_ENST00000244217.5_5'Flank	NM_005791.2	NP_005782.1	O00566	MPP10_HUMAN	M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)	19					negative regulation of phosphatase activity (GO:0010923)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|rRNA processing (GO:0006364)	chromosome (GO:0005694)|nucleolus (GO:0005730)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|pancreas(2)|skin(2)|stomach(1)	26						GACGGAAGTCGGCAAAGCCAC	0.672																																						.											0													24.0	25.0	25.0					2																	71357850		2202	4297	6499	SO:0001583	missense	10199			X98494	CCDS1916.1	2p13.3	2014-06-12			ENSG00000124383	ENSG00000124383			7213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 106"""	605503				8885239, 9450966	Standard	NM_005791		Approved	MPP10, MPP10P, CT90, PPP1R106	uc002sht.2	O00566	OTTHUMG00000129715	ENST00000244230.2:c.55G>A	2.37:g.71357850G>A	ENSP00000244230:p.Gly19Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A0AVJ8	Missense_Mutation	SNP	ENST00000244230.2	37	CCDS1916.1	.	.	.	.	.	.	.	.	.	.	G	9.483	1.098617	0.20552	.	.	ENSG00000124383	ENST00000244230	T	0.09350	2.99	3.75	-3.11	0.05299	.	0.598323	0.17691	N	0.165270	T	0.07188	0.0182	L	0.53249	1.67	0.09310	N	0.999994	B;B	0.19583	0.035;0.037	B;B	0.12837	0.005;0.008	T	0.45498	-0.9257	10	0.09843	T	0.71	.	5.4531	0.16576	0.5603:0.1586:0.2811:0.0	.	19;19	B3KPV5;O00566	.;MPP10_HUMAN	S	19	ENSP00000244230:G19S	ENSP00000244230:G19S	G	+	1	0	MPHOSPH10	71211358	0.000000	0.05858	0.000000	0.03702	0.193000	0.23685	0.095000	0.15127	-0.753000	0.04721	-0.259000	0.10710	GGC		0.672	MPHOSPH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251924.2	NM_005791	
HLA-DQA1	3117	bcgsc.ca	37	6	32609173	32609173	+	Missense_Mutation	SNP	C	C	G	rs10093	byFrequency	TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chr6:32609173C>G	ENST00000343139.5	+	2	271	c.169C>G	c.(169-171)Cag>Gag	p.Q57E	HLA-DQA1_ENST00000374949.2_Missense_Mutation_p.Q57E|HLA-DQA1_ENST00000395363.1_Missense_Mutation_p.Q57E	NM_002122.3	NP_002113.2	P01909	DQA1_HUMAN	major histocompatibility complex, class II, DQ alpha 1	57	Alpha-1.		Q -> E (in allele DQA1*01:01, allele DQA1*01:04, allele DQA1*01:05, allele DQA1*01:07, allele DQA1*02:01, allele DQA1*03:01, allele DQA1*03:02 and allele DQA1*03:03; dbSNP:rs10093).		antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)			NS(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	6						TGGAGATGAGCAGTTCTACGT	0.522													.|||	2020	0.403355	0.2958	0.4827	5008	,	,		13590	0.4216		0.4483	False		,,,				2504	0.4274					.											0								G	GLU/GLN	997,3405		292,413,1496	126.0	105.0	112.0		169	-7.7	0.0	6	dbSNP_52	112	2498,6052		852,794,2629	yes	missense	HLA-DQA1	NM_002122.3	29	1144,1207,4125	GG,GC,CC		29.2164,22.6488,26.9842	benign	57/256	32609173	3495,9457	2201	4275	6476	SO:0001583	missense	3117				CCDS4752.1	6p21.3	2013-01-11			ENSG00000196735	ENSG00000196735		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4942	protein-coding gene	gene with protein product		146880		HLA-DQA			Standard	NM_002122		Approved	CELIAC1	uc003obr.3	P01909	OTTHUMG00000031106	ENST00000343139.5:c.169C>G	6.37:g.32609173C>G	ENSP00000339398:p.Gln57Glu	Somatic		WXS	Illumina HiSeq	Phase_I	O19630|O19706|P01907|P01908|P04225|P04226|P05536|P79553|Q06751|Q29876|Q29994|Q2Q6Y6|Q2Q6Y7|Q2Q6Y8|Q2WCM3|Q30064|Q30067|Q30068|Q30070|Q30071|Q30072|Q30073|Q30086|Q30101|Q5Y7D5|Q5Y7F5|Q6ICU6|Q6PR46|Q6QDB1|Q860W2|Q860W4|Q9BD37|Q9TPM3|Q9UM31	Missense_Mutation	SNP	ENST00000343139.5	37	CCDS4752.1	865|865	0.39606227106227104|0.39606227106227104	139|139	0.28252032520325204|0.28252032520325204	158|158	0.43646408839779005|0.43646408839779005	236|236	0.4125874125874126|0.4125874125874126	332|332	0.43799472295514513|0.43799472295514513	.|.	0.003|0.003	-2.453699|-2.453699	0.00175|0.00175	0.226488|0.226488	0.292164|0.292164	ENSG00000196735|ENSG00000196735	ENST00000343139;ENST00000395364;ENST00000395363;ENST00000496318;ENST00000374949|ENST00000486548	T;T;T;T|.	0.00695|.	5.83;5.83;5.83;5.83|.	3.83|3.83	-7.66|-7.66	0.01277|0.01277	.|.	1.886270|.	0.03418|.	N|.	0.205898|.	T|T	0.04137|0.04137	0.0115|0.0115	N|N	0.11000|0.11000	0.08|0.08	0.80722|0.80722	P|P	0.0|0.0	B;B|.	0.13145|.	0.007;0.0|.	B;B|.	0.19946|.	0.027;0.003|.	T|T	0.17837|0.17837	-1.0356|-1.0356	9|4	0.22109|.	T|.	0.4|.	.|.	8.8794|8.8794	0.35365|0.35365	0.118:0.5489:0.1922:0.1409|0.118:0.5489:0.1922:0.1409	rs10093;rs1129762;rs1130036;rs3188499;rs11545687;rs17354081;rs33909434|rs10093;rs1129762;rs1130036;rs3188499;rs11545687;rs17354081;rs33909434	63;57|.	Q59F33;G4XQK2|.	.;.|.	E|R	57|29	ENSP00000339398:Q57E;ENSP00000378767:Q57E;ENSP00000437302:Q57E;ENSP00000364087:Q57E|.	ENSP00000339398:Q57E|.	Q|S	+|+	1|3	0|2	HLA-DQA1|HLA-DQA1	32717151|32717151	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.007000|0.007000	0.05969|0.05969	-5.842000|-5.842000	0.00095|0.00095	-5.868000|-5.868000	0.00008|0.00008	-3.861000|-3.861000	0.00018|0.00018	CAG|AGC		0.522	HLA-DQA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076176.3	NM_002122	
USP9X	8239	bcgsc.ca	37	X	41088985	41088986	+	Frame_Shift_Ins	INS	-	-	A			TCGA-KL-8334-01A-11D-2310-10	TCGA-KL-8334-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	94434272-4cbd-4b4d-bd98-44f18526dd69	dd7bfe59-20ee-4f8c-8a95-8eb1d0846091	g.chrX:41088985_41088986insA	ENST00000324545.8	+	43	8017_8018	c.7384_7385insA	c.(7384-7386)agtfs	p.S2462fs	USP9X_ENST00000378308.2_Frame_Shift_Ins_p.S2462fs	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	2462					axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						GAGATCACATAGTGCTAGGATG	0.426																																					Ovarian(172;1807 2695 35459 49286)	.											0																																										SO:0001589	frameshift_variant	8239			X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.7384dupA	X.37:g.41088985_41088985dupA	ENSP00000316357:p.Ser2462fs	Somatic		WXS	Illumina HiSeq	Phase_I	O75550|Q8WWT3|Q8WX12	Frame_Shift_Ins	INS	ENST00000324545.8	37	CCDS43930.1																																																																																				0.426	USP9X-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056250.4	NM_004652	
