#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ZNF384	171017	hgsc.bcm.edu	37	12	6777081	6777081	+	Silent	SNP	C	C	T			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr12:6777081C>T	ENST00000396801.3	-	11	1740	c.1533G>A	c.(1531-1533)caG>caA	p.Q511Q	ZNF384_ENST00000396795.1_Silent_p.Q450Q|ZNF384_ENST00000361959.3_Silent_p.Q511Q|RP4-761J14.8_ENST00000586338.1_RNA|ZNF384_ENST00000319770.3_Silent_p.Q434Q|ZNF384_ENST00000355772.4_Silent_p.Q395Q|RP4-761J14.8_ENST00000589924.1_RNA|ZNF384_ENST00000396799.2_Silent_p.Q450Q	NM_001135734.2	NP_001129206.1	Q8TF68	ZN384_HUMAN	zinc finger protein 384	511	Gln-rich.				nucleocytoplasmic transport (GO:0006913)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	focal adhesion (GO:0005925)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)		EWSR1/ZNF384(4)	breast(3)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(1)	18						gctgctgctgctgctgctgct	0.667			T	"""EWSR1, TAF15 """	ALL																																	.		Dom	yes		12	12p13	171017	zinc finger protein 384 (CIZ/NMP4)		L	0													15.0	19.0	18.0					12																	6777081		2200	4287	6487	SO:0001819	synonymous_variant	171017			U80738	CCDS8557.1, CCDS31732.1, CCDS44817.1	12p12	2013-01-08	2002-05-23	2002-05-24		ENSG00000126746		"""Zinc fingers, C2H2-type"""	11955	protein-coding gene	gene with protein product		609951	"""trinucleotide repeat containing 1"""	TNRC1		9225980, 11149472	Standard	NM_001135734		Approved	CAGH1A, CIZ, NMP4, NP	uc010sfh.2	Q8TF68		ENST00000396801.3:c.1533G>A	12.37:g.6777081C>T		Somatic		WXS	Illumina HiSeq	Phase_I	O15407|Q7Z722|Q8N938	Silent	SNP	ENST00000396801.3	37	CCDS44817.1																																																																																				0.667	ZNF384-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400712.1		
ERICH6B	220081	hgsc.bcm.edu	37	13	46170737	46170737	+	Missense_Mutation	SNP	T	T	C	rs142875900|rs375947127|rs117004691	byFrequency	TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr13:46170737T>C	ENST00000298738.2	-	3	568	c.404A>G	c.(403-405)gAg>gGg	p.E135G		NM_182542.2	NP_872348.2	Q5W0A0	ERI6B_HUMAN		135	Glu-rich.									breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)	5						ctcttcctcctccagatgctc	0.493													T|||	1383	0.276158	0.1362	0.4308	5008	,	,		19669	0.1607		0.494	False		,,,				2504	0.2505					.											0													133.0	77.0	94.0					13																	46170737		692	1565	2257	SO:0001583	missense	220081																														ENST00000298738.2:c.404A>G	13.37:g.46170737T>C	ENSP00000298738:p.Glu135Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q96MB5	Missense_Mutation	SNP	ENST00000298738.2	37	CCDS45045.1	.	.	.	.	.	.	.	.	.	.	T	8.448	0.852491	0.17106	.	.	ENSG00000165837	ENST00000298738	T	0.06608	3.28	2.24	-2.01	0.07410	.	.	.	.	.	T	0.04137	0.0115	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.40534	-0.9558	9	0.87932	D	0	-2.345	6.5075	0.22204	0.0:0.4358:0.0:0.5642	.	135;135	A2VDI6;Q5W0A0	.;F194B_HUMAN	G	135	ENSP00000298738:E135G	ENSP00000298738:E135G	E	-	2	0	FAM194B	45068738	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.707000	0.05041	-0.286000	0.09076	-1.636000	0.00776	GAG		0.493	FAM194B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044781.3		
AKT1S1	84335	broad.mit.edu;hgsc.bcm.edu;bcgsc.ca	37	19	50374973	50374973	+	Splice_Site	SNP	T	T	A			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr19:50374973T>A	ENST00000391833.1	-	3	2447	c.458A>T	c.(457-459)gAt>gTt	p.D153V	AKT1S1_ENST00000391834.2_Splice_Site_p.D153V|AKT1S1_ENST00000391832.3_Splice_Site_p.D153V|AKT1S1_ENST00000391831.1_Splice_Site_p.D153V|AKT1S1_ENST00000391835.1_Splice_Site_p.D173V|AKT1S1_ENST00000344175.5_Splice_Site_p.D153V	NM_001278160.1	NP_001265089.1			AKT1 substrate 1 (proline-rich)											kidney(1)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	5		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		GBM - Glioblastoma multiforme(134;0.0116)|OV - Ovarian serous cystadenocarcinoma(262;0.0132)		CAGGCTGCCATCTGAAAGAGA	0.657																																						.											0													44.0	48.0	47.0					19																	50374973		2203	4299	6502	SO:0001630	splice_region_variant	84335			BC022241	CCDS12784.1, CCDS59410.1	19q13.33	2008-02-05			ENSG00000204673	ENSG00000204673			28426	protein-coding gene	gene with protein product	"""proline-rich Akt substrate, 40 kDa"""	610221				12524439	Standard	NM_032375		Approved	PRAS40, MGC2865, Lobe	uc031rmg.1	Q96B36	OTTHUMG00000150246	ENST00000391833.1:c.458-1A>T	19.37:g.50374973T>A		Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000391833.1	37	CCDS12784.1	.	.	.	.	.	.	.	.	.	.	T	16.89	3.248560	0.59103	.	.	ENSG00000204673	ENST00000391833;ENST00000344175;ENST00000391832;ENST00000391834;ENST00000391835;ENST00000391831	T;T;T;T;T;T	0.61859	0.09;0.09;0.09;0.09;0.07;0.09	4.14	4.14	0.48551	.	0.061402	0.64402	D	0.000009	T	0.69396	0.3106	L	0.55213	1.73	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.72374	-0.4313	10	0.87932	D	0	.	11.4203	0.49978	0.0:0.0:0.0:1.0	.	153	Q96B36	AKTS1_HUMAN	V	153;153;153;153;173;153	ENSP00000375709:D153V;ENSP00000341698:D153V;ENSP00000375708:D153V;ENSP00000375710:D153V;ENSP00000375711:D173V;ENSP00000375707:D153V	ENSP00000341698:D153V	D	-	2	0	AKT1S1	55066785	0.998000	0.40836	0.992000	0.48379	0.446000	0.32137	4.804000	0.62554	1.867000	0.54127	0.533000	0.62120	GAT		0.657	AKT1S1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317073.1	NM_032375	Missense_Mutation
PCDHGB1	56104	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	5	140731460	140731460	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr5:140731460C>T	ENST00000523390.1	+	1	1633	c.1633C>T	c.(1633-1635)Cgc>Tgc	p.R545C	PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018922.2|NM_032095.1	NP_061745.1|NP_115266.1	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1	545	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGTGAGCCTGCGCGTGTTGGT	0.706																																						.											0													42.0	52.0	49.0					5																	140731460		2137	4244	6381	SO:0001583	missense	56104			AF152517	CCDS54923.1, CCDS75330.1	5q31	2010-01-26				ENSG00000254221		"""Cadherins / Protocadherins : Clustered"""	8708	other	protocadherin	"""protocadherin gamma subfamily B, 1, isoform 2"""	606299				10380929	Standard	NM_018922		Approved	PCDH-GAMMA-B1		Q9Y5G3		ENST00000523390.1:c.1633C>T	5.37:g.140731460C>T	ENSP00000429273:p.Arg545Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q3SY75|Q9Y5C8	Missense_Mutation	SNP	ENST00000523390.1	37	CCDS54923.1	.	.	.	.	.	.	.	.	.	.	.	12.73	2.024200	0.35701	.	.	ENSG00000254221	ENST00000523390	T	0.54279	0.58	5.39	3.58	0.41010	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.54208	0.1844	M	0.87381	2.88	0.31152	N	0.705383	P;B	0.43750	0.816;0.452	B;B	0.37989	0.233;0.262	T	0.63037	-0.6726	9	0.56958	D	0.05	.	7.9252	0.29870	0.3979:0.5288:0.0:0.0733	.	545;545	Q9Y5G3-2;Q9Y5G3	.;PCDGD_HUMAN	C	545	ENSP00000429273:R545C	ENSP00000429273:R545C	R	+	1	0	PCDHGB1	140711644	0.002000	0.14202	1.000000	0.80357	0.801000	0.45260	-0.074000	0.11450	0.735000	0.32537	0.563000	0.77884	CGC		0.706	PCDHGB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374740.1	NM_018922	
ICE1	23379	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	5	5464930	5464930	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr5:5464930A>G	ENST00000296564.7	+	13	5705	c.5483A>G	c.(5482-5484)cAg>cGg	p.Q1828R		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1828					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						TTGGGGACTCAGCAGGATTCA	0.498																																						.											0													39.0	42.0	41.0					5																	5464930		1989	4184	6173	SO:0001583	missense	23379																														ENST00000296564.7:c.5483A>G	5.37:g.5464930A>G	ENSP00000296564:p.Gln1828Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	ENST00000296564.7	37	CCDS47187.1	.	.	.	.	.	.	.	.	.	.	A	4.793	0.147435	0.09134	.	.	ENSG00000164151	ENST00000296564	T	0.11169	2.8	4.66	0.709	0.18150	.	.	.	.	.	T	0.05731	0.0150	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.42155	-0.9468	9	0.29301	T	0.29	0.1943	6.0771	0.19921	0.5811:0.3301:0.0888:0.0	.	1828	Q9Y2F5	K0947_HUMAN	R	1828	ENSP00000296564:Q1828R	ENSP00000296564:Q1828R	Q	+	2	0	KIAA0947	5517930	0.000000	0.05858	0.003000	0.11579	0.332000	0.28634	0.673000	0.25203	-0.122000	0.11766	0.383000	0.25322	CAG		0.498	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1		
PANK3	79646	hgsc.bcm.edu	37	5	167988517	167988517	+	Missense_Mutation	SNP	C	C	T	rs200317426		TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr5:167988517C>T	ENST00000239231.6	-	5	1133	c.817G>A	c.(817-819)Ggg>Agg	p.G273R	MIR103A1_ENST00000362165.1_RNA|PANK3_ENST00000520504.1_5'UTR	NM_024594.3	NP_078870.1	Q9H999	PANK3_HUMAN	pantothenate kinase 3	273					coenzyme A biosynthetic process (GO:0015937)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			NS(1)|cervix(2)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	Renal(175;0.000159)|Lung NSC(126;0.0441)|all_lung(126;0.0909)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0989)|OV - Ovarian serous cystadenocarcinoma(192;0.147)|Epithelial(171;0.188)		ATCATATTCCCAAAACTGCAG	0.313																																						.											0													41.0	41.0	41.0					5																	167988517		2202	4298	6500	SO:0001583	missense	79646			AK022961	CCDS4368.1	5q35.1	2008-02-05			ENSG00000120137	ENSG00000120137			19365	protein-coding gene	gene with protein product		606161				11479594	Standard	NM_024594		Approved	FLJ12899	uc003lzz.2	Q9H999	OTTHUMG00000130410	ENST00000239231.6:c.817G>A	5.37:g.167988517C>T	ENSP00000239231:p.Gly273Arg	Somatic		WXS	Illumina HiSeq	Phase_I	D3DQL1|Q53FJ9|Q7RTX4	Missense_Mutation	SNP	ENST00000239231.6	37	CCDS4368.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.789998	0.90367	.	.	ENSG00000120137	ENST00000239231	D	0.99911	-7.93	4.74	4.74	0.60224	.	0.000000	0.85682	D	0.000000	D	0.99932	0.9969	H	0.96333	3.805	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95783	0.8818	10	0.87932	D	0	-7.8036	16.7329	0.85440	0.0:1.0:0.0:0.0	.	273	Q9H999	PANK3_HUMAN	R	273	ENSP00000239231:G273R	ENSP00000239231:G273R	G	-	1	0	PANK3	167921095	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	7.818000	0.86416	2.188000	0.69820	0.555000	0.69702	GGG		0.313	PANK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252793.2	NM_024594	
CENPC	1060	hgsc.bcm.edu	37	4	68357934	68357934	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr4:68357934C>T	ENST00000273853.6	-	16	2729	c.2479G>A	c.(2479-2481)Gta>Ata	p.V827I		NM_001812.2	NP_001803.2	Q03188	CENPC_HUMAN	centromere protein C	827					chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	centromeric DNA binding (GO:0019237)|DNA binding (GO:0003677)	p.V827L(1)									GGGTCCTTTACCCTCGTTGGC	0.338																																						.											1	Substitution - Missense(1)	lung(1)											94.0	83.0	86.0					4																	68357934		1826	4089	5915	SO:0001583	missense	1060			M95724	CCDS47063.1	4q13.2	2013-11-05	2013-07-03	2013-07-03	ENSG00000145241	ENSG00000145241			1854	protein-coding gene	gene with protein product		117141	"""centromere protein C 1"""	CENPC1		7959789	Standard	XR_245245		Approved	CENP-C, hcp-4, MIF2	uc003hdd.1	Q03188	OTTHUMG00000160735	ENST00000273853.6:c.2479G>A	4.37:g.68357934C>T	ENSP00000273853:p.Val827Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q8IW27|Q9P0M5	Missense_Mutation	SNP	ENST00000273853.6	37	CCDS47063.1	.	.	.	.	.	.	.	.	.	.	C	12.31	1.898264	0.33535	.	.	ENSG00000145241	ENST00000273853	.	.	.	5.34	3.61	0.41365	Cupin, RmlC-type (1);	0.459555	0.20370	N	0.093673	T	0.28566	0.0707	L	0.31664	0.95	0.09310	N	0.999998	B	0.15141	0.012	B	0.15052	0.012	T	0.16041	-1.0416	9	0.31617	T	0.26	-5.9703	8.3069	0.32047	0.0:0.8169:0.0:0.1831	.	827	Q03188	CENPC_HUMAN	I	827	.	ENSP00000273853:V827I	V	-	1	0	CENPC1	68040529	0.708000	0.27876	0.312000	0.25196	0.994000	0.84299	1.086000	0.30853	0.747000	0.32809	0.563000	0.77884	GTA		0.338	CENPC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362001.2		
ELAVL4	1996	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	1	50659551	50659551	+	Missense_Mutation	SNP	C	C	T	rs138779266		TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr1:50659551C>T	ENST00000371823.4	+	4	693	c.469C>T	c.(469-471)Cgt>Tgt	p.R157C	ELAVL4_ENST00000371824.1_Missense_Mutation_p.R157C|ELAVL4_ENST00000371819.1_Missense_Mutation_p.R162C|ELAVL4_ENST00000448907.2_Missense_Mutation_p.R160C|ELAVL4_ENST00000371827.1_Missense_Mutation_p.R157C|ELAVL4_ENST00000371821.1_Missense_Mutation_p.R162C|ELAVL4_ENST00000357083.4_Missense_Mutation_p.R174C	NM_001144774.1|NM_021952.3	NP_001138246.1|NP_068771.2	P26378	ELAV4_HUMAN	ELAV like neuron-specific RNA binding protein 4	157	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|RNA processing (GO:0006396)		AU-rich element binding (GO:0017091)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	32						GCAATACGGCCGTATCATCAC	0.453																																						.											0								C	CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	191.0	166.0	174.0		469,520,469,478,469	6.1	1.0	1	dbSNP_134	174	0,8600		0,0,4300	no	missense,missense,missense,missense,missense	ELAVL4	NM_001144774.1,NM_001144775.1,NM_001144776.1,NM_001144777.1,NM_021952.3	180,180,180,180,180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	157/367,174/384,157/367,160/370,157/381	50659551	1,13005	2203	4300	6503	SO:0001583	missense	1996			AY033998	CCDS553.1, CCDS44138.1, CCDS44139.1, CCDS44140.1, CCDS53315.1, CCDS72788.1	1p34	2013-10-03	2013-10-03		ENSG00000162374	ENSG00000162374		"""RNA binding motif (RRM) containing"""	3315	protein-coding gene	gene with protein product	"""Hu antigen D"""	168360	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D)"", ""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4"""	HUD		8222755	Standard	XM_005270581		Approved	PNEM	uc001csb.2	P26378	OTTHUMG00000007877	ENST00000371823.4:c.469C>T	1.37:g.50659551C>T	ENSP00000360888:p.Arg157Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B1APY6|B1APY7|B7Z4G7|Q8IYD4|Q96J74|Q96J75|Q9UD24	Missense_Mutation	SNP	ENST00000371823.4	37	CCDS553.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.838760	0.91117	2.27E-4	0.0	ENSG00000162374	ENST00000448907;ENST00000371827;ENST00000357083;ENST00000371824;ENST00000371823;ENST00000371821;ENST00000371819	T;T;T;T;T;T;T	0.16897	2.31;2.31;2.31;2.31;2.31;2.31;2.31	6.11	6.11	0.99139	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.40322	0.1112	L	0.51422	1.61	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.999;1.0;0.999;1.0;0.999;0.998;0.998	P;D;P;P;P;P;P	0.72075	0.887;0.976;0.787;0.887;0.819;0.819;0.887	T	0.02574	-1.1139	10	0.87932	D	0	.	20.7342	0.99715	0.0:1.0:0.0:0.0	.	162;162;157;157;174;157;160	B1APY9;B1APY8;P26378-2;P26378;P26378-3;P26378-4;B7Z4G7	.;.;.;ELAV4_HUMAN;.;.;.	C	160;157;174;157;157;162;162	ENSP00000399939:R160C;ENSP00000360892:R157C;ENSP00000349594:R174C;ENSP00000360889:R157C;ENSP00000360888:R157C;ENSP00000360886:R162C;ENSP00000360884:R162C	ENSP00000349594:R174C	R	+	1	0	ELAVL4	50432138	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.770000	0.85390	2.906000	0.99361	0.655000	0.94253	CGT		0.453	ELAVL4-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000021712.1	NM_021952	
RAP1GAP2	23108	hgsc.bcm.edu	37	17	2901620	2901620	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr17:2901620T>C	ENST00000254695.8	+	14	1240	c.1150T>C	c.(1150-1152)Tac>Cac	p.Y384H	RAP1GAP2_ENST00000542807.1_Missense_Mutation_p.Y384H|RAP1GAP2_ENST00000366401.4_Missense_Mutation_p.Y369H|RAP1GAP2_ENST00000540393.2_Missense_Mutation_p.Y365H	NM_015085.4	NP_055900.4	Q684P5	RPGP2_HUMAN	RAP1 GTPase activating protein 2	384	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				negative regulation of neuron projection development (GO:0010977)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)|nuclear membrane (GO:0031965)	Rap GTPase activator activity (GO:0046582)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	11						CTTACATGCCTACATCGTCGT	0.532																																						.											0													114.0	113.0	113.0					17																	2901620		2041	4190	6231	SO:0001583	missense	23108			AB028962	CCDS45573.1, CCDS45574.1	17p13.3	2009-09-14	2009-09-14	2009-09-14		ENSG00000132359			29176	protein-coding gene	gene with protein product			"""GTPase activating RANGAP domain-like 4"", ""GTPase activating Rap/RanGAP domain-like 4"""	GARNL4		15632203	Standard	NM_015085		Approved	KIAA1039	uc010ckd.3	Q684P5		ENST00000254695.8:c.1150T>C	17.37:g.2901620T>C	ENSP00000254695:p.Tyr384His	Somatic		WXS	Illumina HiSeq	Phase_I	B2RTY5|Q684P4|Q6AI00|Q6ZVF0|Q9UPW2	Missense_Mutation	SNP	ENST00000254695.8	37	CCDS45573.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.175858	0.78564	.	.	ENSG00000132359	ENST00000254695;ENST00000366401;ENST00000540393;ENST00000542807	D;D;D;D	0.93763	-3.28;-3.28;-3.28;-3.28	5.66	5.66	0.87406	Rap/ran-GAP (2);	0.173492	0.52532	D	0.000068	D	0.95382	0.8501	L	0.49571	1.57	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.81914	0.991;0.995	D	0.95853	0.8876	10	0.87932	D	0	-22.4855	15.0728	0.72053	0.0:0.0:0.0:1.0	.	369;384	Q684P5-2;Q684P5	.;RPGP2_HUMAN	H	384;369;365;384	ENSP00000254695:Y384H;ENSP00000389824:Y369H;ENSP00000439688:Y365H;ENSP00000444890:Y384H	ENSP00000254695:Y384H	Y	+	1	0	RAP1GAP2	2848370	1.000000	0.71417	1.000000	0.80357	0.517000	0.34286	8.040000	0.89188	2.158000	0.67659	0.459000	0.35465	TAC		0.532	RAP1GAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438208.2		
SLC4A5	57835	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	2	74454137	74454137	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr2:74454137C>T	ENST00000377634.4	-	28	3484	c.3085G>A	c.(3085-3087)Gcg>Acg	p.A1029T	SLC4A5_ENST00000394019.2_Missense_Mutation_p.A1013T|SLC4A5_ENST00000423644.1_Missense_Mutation_p.G953D|RP11-287D1.3_ENST00000451608.2_3'UTR|SLC4A5_ENST00000377632.1_Intron|SLC4A5_ENST00000346834.4_Intron|SLC4A5_ENST00000357822.5_Missense_Mutation_p.A1029T|SLC4A5_ENST00000359484.4_Missense_Mutation_p.A911T|SLC4A5_ENST00000358683.4_Missense_Mutation_p.A911T|SLC4A5_ENST00000483195.1_5'UTR					solute carrier family 4 (sodium bicarbonate cotransporter), member 5											breast(5)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(13)|ovary(5)|pancreas(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						CAGAGCACCGCCAGGCAGAGG	0.647																																						.											0													72.0	74.0	74.0					2																	74454137		2203	4300	6503	SO:0001583	missense	57835			AF243499	CCDS1936.1, CCDS1937.1	2p13.1	2013-07-19	2013-07-19		ENSG00000188687	ENSG00000188687		"""Solute carriers"""	18168	protein-coding gene	gene with protein product		606757	"""solute carrier family 4, sodium bicarbonate cotransporter, member 5"""			10978526, 11087115	Standard	NM_133478		Approved	NBC4	uc002sko.1	Q9BY07	OTTHUMG00000090263	ENST00000377634.4:c.3085G>A	2.37:g.74454137C>T	ENSP00000366861:p.Ala1029Thr	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000377634.4	37	CCDS1936.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.4|24.4	4.528596|4.528596	0.85706|0.85706	.|.	.|.	ENSG00000188687|ENSG00000188687	ENST00000394019;ENST00000451608;ENST00000359484;ENST00000358683;ENST00000357822;ENST00000377634|ENST00000423644;ENST00000425249	T;T;T;T;T|T;T	0.70399|0.72394	-0.48;-0.48;-0.48;-0.48;-0.48|-0.65;-0.38	5.24|5.24	5.24|5.24	0.73138|0.73138	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.74382|0.74382	0.3709|0.3709	M|M	0.68952|0.68952	2.095|2.095	0.36027|0.36027	D|D	0.839141|0.839141	P;D;D|P	0.89917|0.50272	0.939;1.0;0.973|0.933	P;D;P|P	0.87578|0.46479	0.857;0.998;0.843|0.518	T|T	0.82822|0.82822	-0.0267|-0.0267	10|9	0.62326|0.87932	D|D	0.03|0	.|.	16.3639|16.3639	0.83307|0.83307	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	911;1029;1013|915	Q9BY07-7;Q9BY07;Q9BY07-3|E7EQT3	.;S4A5_HUMAN;.|.	T|D	1013;1029;911;911;1029;1029|953;915	ENSP00000377587:A1013T;ENSP00000352461:A911T;ENSP00000351513:A911T;ENSP00000350475:A1029T;ENSP00000366861:A1029T|ENSP00000395804:G953D;ENSP00000405678:G915D	ENSP00000350475:A1029T|ENSP00000395804:G953D	A|G	-|-	1|2	0|0	SLC4A5|SLC4A5	74307645|74307645	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.995000|0.995000	0.86356|0.86356	5.920000|5.920000	0.70017|0.70017	2.726000|2.726000	0.93360|0.93360	0.637000|0.637000	0.83480|0.83480	GCG|GGC		0.647	SLC4A5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206583.3		
SLC39A10	57181	hgsc.bcm.edu;bcgsc.ca	37	2	196548601	196548601	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr2:196548601C>T	ENST00000409086.3	+	3	1462	c.1187C>T	c.(1186-1188)cCt>cTt	p.P396L	SLC39A10_ENST00000359634.5_Missense_Mutation_p.P396L|SLC39A10_ENST00000541054.1_5'UTR	NM_001127257.1	NP_001120729.1	Q9ULF5	S39AA_HUMAN	solute carrier family 39 (zinc transporter), member 10	396					transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(16)|pancreas(1)|prostate(1)|skin(2)	34			OV - Ovarian serous cystadenocarcinoma(117;0.221)			AACCTGGTTCCTGAAGATGAG	0.318																																						.											0													57.0	62.0	60.0					2																	196548601		2203	4300	6503	SO:0001583	missense	57181				CCDS33353.1	2q33.1	2013-05-22			ENSG00000196950	ENSG00000196950		"""Solute carriers"""	20861	protein-coding gene	gene with protein product		608733	"""solute carrier family 39 (metal ion transporter), member 10"""			12659941	Standard	NM_020342		Approved	KIAA1265, FLJ90515, DKFZp564L2123	uc002utg.4	Q9ULF5	OTTHUMG00000154380	ENST00000409086.3:c.1187C>T	2.37:g.196548601C>T	ENSP00000386766:p.Pro396Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A8K5C6|B4DGU0|Q3MJA4|Q68CR5|Q6DKH6|Q9Y3Z1	Missense_Mutation	SNP	ENST00000409086.3	37	CCDS33353.1	.	.	.	.	.	.	.	.	.	.	C	11.41	1.630975	0.28978	.	.	ENSG00000196950	ENST00000409086;ENST00000359634	T;T	0.67345	-0.26;-0.26	4.84	4.84	0.62591	.	1.226200	0.05271	N	0.517580	T	0.58694	0.2140	L	0.39898	1.24	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.52238	-0.8602	10	0.34782	T	0.22	.	6.9824	0.24709	0.0:0.8523:0.0:0.1477	.	396	Q9ULF5	S39AA_HUMAN	L	396	ENSP00000386766:P396L;ENSP00000352655:P396L	ENSP00000352655:P396L	P	+	2	0	SLC39A10	196256846	1.000000	0.71417	1.000000	0.80357	0.616000	0.37450	2.752000	0.47516	2.511000	0.84671	0.650000	0.86243	CCT		0.318	SLC39A10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335186.1	XM_047707	
ARL5B	221079	broad.mit.edu	37	10	18957460	18957460	+	Splice_Site	SNP	T	T	C			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr10:18957460T>C	ENST00000377275.3	+	3	342	c.109T>C	c.(109-111)Tta>Cta	p.L37L		NM_178815.3	NP_848930.1	Q96KC2	ARL5B_HUMAN	ADP-ribosylation factor-like 5B	37					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			lung(1)|ovary(1)	2						TTTCAACAGCTTAATGAATGA	0.353																																						.											0													94.0	90.0	91.0					10																	18957460		2203	4300	6503	SO:0001630	splice_region_variant	221079			AF494061	CCDS7131.1	10p13	2014-05-09	2005-11-03	2005-11-03	ENSG00000165997	ENSG00000165997		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	23052	protein-coding gene	gene with protein product		608909	"""ADP-ribosylation factor-like 8"""	ARL8		12853149	Standard	XM_005252400		Approved		uc001iqd.1	Q96KC2	OTTHUMG00000017765	ENST00000377275.3:c.108-1T>C	10.37:g.18957460T>C		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000377275.3	37	CCDS7131.1																																																																																				0.353	ARL5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047078.1	NM_178815	Silent
MASTL	84930	broad.mit.edu;bcgsc.ca	37	10	27447559	27447559	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr10:27447559A>G	ENST00000375940.4	+	2	325	c.268A>G	c.(268-270)Agc>Ggc	p.S90G	MASTL_ENST00000342386.6_Missense_Mutation_p.S90G|MASTL_ENST00000375946.4_Missense_Mutation_p.S90G			Q96GX5	GWL_HUMAN	microtubule associated serine/threonine kinase-like	90	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to DNA damage stimulus (GO:0006974)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of protein phosphatase type 2A activity (GO:0034048)|regulation of cell cycle (GO:0051726)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein phosphatase 2A binding (GO:0051721)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						ACTAAGCAAAAGCCCATTCAT	0.338																																						.											0													176.0	171.0	173.0					10																	27447559		2203	4300	6503	SO:0001583	missense	84930			BC009107	CCDS7153.1, CCDS53502.1, CCDS53503.1	10p12.1	2005-11-03			ENSG00000120539	ENSG00000120539			19042	protein-coding gene	gene with protein product		608221					Standard	NM_001172303		Approved	FLJ14813, THC2	uc001itm.3	Q96GX5	OTTHUMG00000017855	ENST00000375940.4:c.268A>G	10.37:g.27447559A>G	ENSP00000365107:p.Ser90Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q5T8D5|Q5T8D7|Q8NCD6|Q96SJ5	Missense_Mutation	SNP	ENST00000375940.4	37	CCDS53502.1	.	.	.	.	.	.	.	.	.	.	A	26.4	4.738018	0.89573	.	.	ENSG00000120539	ENST00000375946;ENST00000342386;ENST00000375940	T;T;T	0.66280	-0.2;-0.2;-0.2	5.48	5.48	0.80851	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.74397	0.3711	L	0.51853	1.615	0.80722	D	1	P;D;D	0.76494	0.84;0.996;0.999	P;D;D	0.81914	0.607;0.975;0.995	T	0.76046	-0.3102	10	0.56958	D	0.05	-19.8091	15.5726	0.76352	1.0:0.0:0.0:0.0	.	90;90;90	Q96GX5-2;Q96GX5;Q96GX5-3	.;GWL_HUMAN;.	G	90	ENSP00000365113:S90G;ENSP00000343446:S90G;ENSP00000365107:S90G	ENSP00000343446:S90G	S	+	1	0	MASTL	27487565	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.524000	0.90579	2.080000	0.62538	0.455000	0.32223	AGC		0.338	MASTL-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047320.1	NM_032844	
HABP2	3026	broad.mit.edu;bcgsc.ca	37	10	115348753	115348753	+	3'UTR	SNP	T	T	C			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr10:115348753T>C	ENST00000351270.3	+	0	2404				NRAP_ENST00000359988.3_Missense_Mutation_p.K1725R|HABP2_ENST00000542051.1_3'UTR|NRAP_ENST00000360478.3_Missense_Mutation_p.K1690R|NRAP_ENST00000369360.3_Missense_Mutation_p.K1698R|NRAP_ENST00000369358.4_Missense_Mutation_p.K1733R	NM_004132.3	NP_004123.1	Q14520	HABP2_HUMAN	hyaluronan binding protein 2						cell adhesion (GO:0007155)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	glycosaminoglycan binding (GO:0005539)|serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(8)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	23		Colorectal(252;0.0233)|Breast(234;0.0672)		Epithelial(162;0.00319)|all cancers(201;0.0112)	Hyaluronan(DB08818)	CAGGGCCTTCTTCTTTTTGAC	0.537																																						.											0													173.0	161.0	165.0					10																	115348753		2203	4300	6503	SO:0001624	3_prime_UTR_variant	4892				CCDS7577.1, CCDS53579.1	10q25.3	2008-08-01	2001-11-28		ENSG00000148702	ENSG00000148702			4798	protein-coding gene	gene with protein product	"""plasma hyaluronan binding protein"", ""factor VII activating protein"""	603924	"""hyaluronan-binding protein 2"""			8827452, 12437095	Standard	NM_004132		Approved	HABP, PHBP, HGFAL, FSAP	uc001lai.4	Q14520	OTTHUMG00000019073	ENST00000351270.3:c.*625T>C	10.37:g.115348753T>C		Somatic		WXS	Illumina HiSeq	Phase_I	A8K467|B7Z8U5|F5H5M6|O00663	Missense_Mutation	SNP	ENST00000351270.3	37	CCDS7577.1	.	.	.	.	.	.	.	.	.	.	T	7.613	0.675114	0.14841	.	.	ENSG00000197893	ENST00000369358;ENST00000369360;ENST00000359988;ENST00000360478;ENST00000369350	T;T;T;T	0.18657	2.41;2.41;2.29;2.2	5.66	3.37	0.38596	.	0.208119	0.51477	N	0.000088	T	0.11793	0.0287	L	0.31926	0.97	0.29282	N	0.869937	B;B;B;B	0.11235	0.001;0.002;0.004;0.002	B;B;B;B	0.13407	0.004;0.004;0.009;0.004	T	0.28490	-1.0042	10	0.07325	T	0.83	.	5.8094	0.18457	0.0:0.5019:0.0:0.4981	.	847;1726;1690;1725	B1ANW7;A0AVL2;Q86VF7-4;Q86VF7	.;.;.;NRAP_HUMAN	R	1733;1698;1725;1690;847	ENSP00000358365:K1733R;ENSP00000358367:K1698R;ENSP00000353078:K1725R;ENSP00000353666:K1690R	ENSP00000353078:K1725R	K	-	2	0	NRAP	115338743	1.000000	0.71417	1.000000	0.80357	0.281000	0.26958	1.622000	0.36997	1.186000	0.42985	0.454000	0.30748	AAG		0.537	HABP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050428.1	NM_004132	
PANX1	24145	broad.mit.edu	37	11	93913343	93913343	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr11:93913343A>G	ENST00000227638.3	+	4	1506	c.1121A>G	c.(1120-1122)aAg>aGg	p.K374R	PANX1_ENST00000436171.2_Missense_Mutation_p.K374R	NM_015368.3	NP_056183.2	Q96RD7	PANX1_HUMAN	pannexin 1	374					calcium ion transport (GO:0006816)|cation transport (GO:0006812)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 alpha secretion (GO:0050717)|positive regulation of interleukin-1 beta secretion (GO:0050718)|protein hexamerization (GO:0034214)|response to ATP (GO:0033198)|response to ischemia (GO:0002931)|synaptic transmission (GO:0007268)	bleb (GO:0032059)|endoplasmic reticulum (GO:0005783)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium channel activity (GO:0005262)|gap junction hemi-channel activity (GO:0055077)|leak channel activity (GO:0022840)|receptor binding (GO:0005102)			endometrium(2)|large_intestine(2)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			Probenecid(DB01032)	GGCATGATCAAGATGGATGTT	0.493																																						.											0													87.0	80.0	82.0					11																	93913343		2201	4298	6499	SO:0001583	missense	24145			AF093239	CCDS8296.1	11q14-q21	2011-12-02			ENSG00000110218	ENSG00000110218		"""Ion channels / Pannexins"""	8599	protein-coding gene	gene with protein product	"""innexin"""	608420				14597722	Standard	NM_015368		Approved	MRS1, UNQ2529, PX1	uc001per.3	Q96RD7	OTTHUMG00000167757	ENST00000227638.3:c.1121A>G	11.37:g.93913343A>G	ENSP00000227638:p.Lys374Arg	Somatic		WXS	Illumina HiSeq	Phase_I	O75968|Q543A0|Q6UW26|Q96AM9|Q96L77|Q96RS5	Missense_Mutation	SNP	ENST00000227638.3	37	CCDS8296.1	.	.	.	.	.	.	.	.	.	.	A	19.19	3.779361	0.70107	.	.	ENSG00000110218	ENST00000227638;ENST00000436171	T;T	0.22945	1.93;1.93	5.31	4.19	0.49359	.	0.042144	0.85682	N	0.000000	T	0.49406	0.1555	M	0.79475	2.455	0.50313	D	0.999864	D;D	0.71674	0.997;0.998	D;D	0.80764	0.985;0.994	T	0.50709	-0.8796	10	0.72032	D	0.01	-23.8538	10.6165	0.45454	0.9243:0.0:0.0757:0.0	.	374;374	Q96RD7;Q96RD7-2	PANX1_HUMAN;.	R	374	ENSP00000227638:K374R;ENSP00000411461:K374R	ENSP00000227638:K374R	K	+	2	0	PANX1	93552991	1.000000	0.71417	1.000000	0.80357	0.691000	0.40173	4.371000	0.59523	0.874000	0.35823	0.533000	0.62120	AAG		0.493	PANX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396121.1	NM_015368	
OR10G7	390265	broad.mit.edu;mdanderson.org	37	11	123909471	123909471	+	Missense_Mutation	SNP	G	G	T			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr11:123909471G>T	ENST00000330487.5	-	1	246	c.238C>A	c.(238-240)Ctg>Atg	p.L80M		NM_001004463.1	NP_001004463.1	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G, member 7	80						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(6)|lung(20)|ovary(2)|prostate(2)|stomach(3)|urinary_tract(1)	47		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		AAGGTCATCAGCATTTTGGGC	0.537																																						.											0													139.0	150.0	146.0					11																	123909471		2200	4299	6499	SO:0001583	missense	390265			AB065754	CCDS31705.1	11q24.1	2012-08-09			ENSG00000182634	ENSG00000182634		"""GPCR / Class A : Olfactory receptors"""	14842	protein-coding gene	gene with protein product							Standard	NM_001004463		Approved		uc001pzq.1	Q8NGN6	OTTHUMG00000165969	ENST00000330487.5:c.238C>A	11.37:g.123909471G>T	ENSP00000329689:p.Leu80Met	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IFE8	Missense_Mutation	SNP	ENST00000330487.5	37	CCDS31705.1	.	.	.	.	.	.	.	.	.	.	G	9.902	1.207174	0.22205	.	.	ENSG00000182634	ENST00000330487	T	0.00441	7.41	3.39	0.353	0.16058	GPCR, rhodopsin-like superfamily (1);	0.188630	0.25810	N	0.028158	T	0.00666	0.0022	M	0.62016	1.91	0.27375	N	0.955584	D	0.89917	1.0	D	0.91635	0.999	T	0.52124	-0.8617	10	0.39692	T	0.17	.	3.5934	0.07997	0.3043:0.0:0.5206:0.1751	.	80	Q8NGN6	O10G7_HUMAN	M	80	ENSP00000329689:L80M	ENSP00000329689:L80M	L	-	1	2	OR10G7	123414681	0.311000	0.24536	0.998000	0.56505	0.726000	0.41606	-0.127000	0.10547	-0.026000	0.13895	-0.463000	0.05309	CTG		0.537	OR10G7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387271.1	NM_001004463	
ZNF384	171017	broad.mit.edu	37	12	6777102	6777102	+	Frame_Shift_Del	DEL	C	C	-			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr12:6777102delC	ENST00000396801.3	-	11	1719	c.1512delG	c.(1510-1512)cagfs	p.Q516fs	ZNF384_ENST00000396795.1_Frame_Shift_Del_p.Q455fs|ZNF384_ENST00000361959.3_Frame_Shift_Del_p.Q516fs|RP4-761J14.8_ENST00000586338.1_RNA|ZNF384_ENST00000319770.3_Frame_Shift_Del_p.Q439fs|ZNF384_ENST00000355772.4_Frame_Shift_Del_p.Q400fs|RP4-761J14.8_ENST00000589924.1_RNA|ZNF384_ENST00000396799.2_Frame_Shift_Del_p.Q455fs	NM_001135734.2	NP_001129206.1	Q8TF68	ZN384_HUMAN	zinc finger protein 384	516	Gln-rich.				nucleocytoplasmic transport (GO:0006913)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	focal adhesion (GO:0005925)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)		EWSR1/ZNF384(4)	breast(3)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(1)	18						gctgctgctgctgctgctgct	0.682			T	"""EWSR1, TAF15 """	ALL																																	.		Dom	yes		12	12p13	171017	zinc finger protein 384 (CIZ/NMP4)		L	0													13.0	16.0	15.0					12																	6777102		2189	4276	6465	SO:0001589	frameshift_variant	171017			U80738	CCDS8557.1, CCDS31732.1, CCDS44817.1	12p12	2013-01-08	2002-05-23	2002-05-24		ENSG00000126746		"""Zinc fingers, C2H2-type"""	11955	protein-coding gene	gene with protein product		609951	"""trinucleotide repeat containing 1"""	TNRC1		9225980, 11149472	Standard	NM_001135734		Approved	CAGH1A, CIZ, NMP4, NP	uc010sfh.2	Q8TF68		ENST00000396801.3:c.1512delG	12.37:g.6777102delC	ENSP00000380019:p.Gln516fs	Somatic		WXS	Illumina HiSeq	Phase_I	O15407|Q7Z722|Q8N938	Frame_Shift_Del	DEL	ENST00000396801.3	37	CCDS44817.1																																																																																				0.682	ZNF384-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400712.1		
CCNT1	904	broad.mit.edu;bcgsc.ca	37	12	49087549	49087549	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr12:49087549C>T	ENST00000261900.3	-	9	1670	c.1448G>A	c.(1447-1449)cGc>cAc	p.R483H		NM_001240.3	NP_001231.2	O60563	CCNT1_HUMAN	cyclin T1	483					cell cycle (GO:0007049)|cell division (GO:0051301)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|snRNA binding (GO:0017069)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(3)|skin(2)	27						GACTTTTATGCGCATTTTTAT	0.438																																						.											0													131.0	128.0	129.0					12																	49087549		2203	4300	6503	SO:0001583	missense	904			AF048730	CCDS8766.1, CCDS61109.1	12q13.11	2010-11-15			ENSG00000129315	ENSG00000129315			1599	protein-coding gene	gene with protein product		143055	"""human immunodeficiency virus type 1 (HIV-1) expression (elevated) 1"""	HIVE1		9491887, 9499409	Standard	NM_001240		Approved	CCNT, CYCT1	uc001rsd.4	O60563	OTTHUMG00000170393	ENST00000261900.3:c.1448G>A	12.37:g.49087549C>T	ENSP00000261900:p.Arg483His	Somatic		WXS	Illumina HiSeq	Phase_I	A9XU13|E7EX76|O60581	Missense_Mutation	SNP	ENST00000261900.3	37	CCDS8766.1	.	.	.	.	.	.	.	.	.	.	C	17.52	3.411101	0.62399	.	.	ENSG00000129315	ENST00000261900	T	0.22945	1.93	4.89	3.03	0.35002	.	0.105878	0.64402	D	0.000006	T	0.30324	0.0761	L	0.38175	1.15	0.42590	D	0.993247	D	0.69078	0.997	P	0.55161	0.77	T	0.03202	-1.1061	10	0.66056	D	0.02	-3.9863	9.6691	0.40002	0.0:0.7779:0.1419:0.0802	.	483	O60563	CCNT1_HUMAN	H	483	ENSP00000261900:R483H	ENSP00000261900:R483H	R	-	2	0	CCNT1	47373816	0.820000	0.29190	0.989000	0.46669	0.985000	0.73830	1.584000	0.36589	0.558000	0.29135	0.561000	0.74099	CGC		0.438	CCNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408853.1	NM_001240	
UBC	7316	broad.mit.edu	37	12	125396280	125396280	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr12:125396280G>A	ENST00000538617.1	-	4	1214	c.898C>T	c.(898-900)Cgc>Tgc	p.R300C	UBC_ENST00000339647.5_Missense_Mutation_p.R680C|UBC_ENST00000536769.1_Missense_Mutation_p.R680C|UBC_ENST00000546120.1_Missense_Mutation_p.R604C|UBC_ENST00000536661.1_5'Flank			P0CG48	UBC_HUMAN	ubiquitin C	680	Ubiquitin-like 4. {ECO:0000255|PROSITE- ProRule:PRU00214}.				activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protease binding (GO:0002020)			breast(3)|endometrium(4)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		CCCCTCAAGCGCAGGACCAAG	0.448																																						.											0													84.0	82.0	83.0					12																	125396280		2203	4300	6503	SO:0001583	missense	7316				CCDS9260.1	12q24.3	2008-09-08			ENSG00000150991	ENSG00000150991			12468	protein-coding gene	gene with protein product	"""polyubiquitin-C"""	191340				1315303, 11872750	Standard	NM_021009		Approved		uc001ugs.4	P0CG48		ENST00000538617.1:c.898C>T	12.37:g.125396280G>A	ENSP00000443053:p.Arg300Cys	Somatic		WXS	Illumina HiSeq	Phase_I	P02248|P02249|P02250|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Missense_Mutation	SNP	ENST00000538617.1	37		.	.	.	.	.	.	.	.	.	.	G	18.57	3.652125	0.67472	.	.	ENSG00000150991	ENST00000536769;ENST00000535460;ENST00000538617;ENST00000541046;ENST00000339647;ENST00000546120;ENST00000544656	T;T;T;T	0.77229	-1.08;-1.08;-1.08;-1.08	5.28	4.39	0.52855	Ubiquitin supergroup (1);Ubiquitin (2);	.	.	.	.	D	0.88713	0.6511	M	0.87381	2.88	0.80722	D	1	D;P;D	0.89917	0.996;0.667;1.0	D;B;D	0.81914	0.975;0.009;0.995	D	0.90359	0.4372	9	0.87932	D	0	.	13.4266	0.61028	0.0753:0.0:0.9247:0.0	.	693;528;680	Q66K58;F5H7K6;P0CG48	.;.;UBC_HUMAN	C	680;528;300;604;680;604;148	ENSP00000441543:R680C;ENSP00000443053:R300C;ENSP00000344818:R680C;ENSP00000438394:R604C	ENSP00000344818:R680C	R	-	1	0	UBC	123962233	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.069000	0.71209	1.227000	0.43598	0.462000	0.41574	CGC		0.448	UBC-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000400179.1	NM_021009	
KCNK10	54207	broad.mit.edu;mdanderson.org;bcgsc.ca	37	14	88652066	88652066	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr14:88652066C>T	ENST00000340700.5	-	7	1881	c.1430G>A	c.(1429-1431)cGg>cAg	p.R477Q	KCNK10_ENST00000319231.5_Missense_Mutation_p.R482Q|KCNK10_ENST00000312350.5_Missense_Mutation_p.R482Q	NM_021161.4	NP_066984.1	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	477					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	47						GGAGTAATTCCGGAAGGTCTT	0.498																																						.											0													147.0	146.0	147.0					14																	88652066		2203	4300	6503	SO:0001583	missense	54207			AF279890	CCDS9880.1, CCDS9881.1, CCDS9882.1	14q31	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6273	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 97"""	605873				10880510, 16382106	Standard	NM_021161		Approved	K2p10.1, TREK-2, TREK2, PPP1R97	uc001xwn.3	P57789		ENST00000340700.5:c.1430G>A	14.37:g.88652066C>T	ENSP00000343104:p.Arg477Gln	Somatic		WXS	Illumina HiSeq	Phase_I	B2R8T4|B2RCT3|B5TJL4|Q6B014|Q8TDK7|Q8TDK8|Q9HB59	Missense_Mutation	SNP	ENST00000340700.5	37	CCDS9880.1	.	.	.	.	.	.	.	.	.	.	C	17.32	3.360250	0.61403	.	.	ENSG00000100433	ENST00000340700;ENST00000312350;ENST00000319231	D;D;D	0.90844	-2.73;-2.74;-2.72	5.71	5.71	0.89125	.	0.845868	0.10735	N	0.640094	D	0.86531	0.5955	L	0.36672	1.1	0.43372	D	0.995465	P;P;P	0.42692	0.787;0.787;0.787	B;B;B	0.32677	0.15;0.105;0.15	D	0.85206	0.1018	10	0.46703	T	0.11	.	18.8558	0.92251	0.0:1.0:0.0:0.0	.	477;482;482	P57789;B2R8T4;Q6B014	KCNKA_HUMAN;.;.	Q	477;482;482	ENSP00000343104:R477Q;ENSP00000310568:R482Q;ENSP00000312811:R482Q	ENSP00000310568:R482Q	R	-	2	0	KCNK10	87721819	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	5.428000	0.66489	2.709000	0.92574	0.655000	0.94253	CGG		0.498	KCNK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410167.1	NM_021161	
AQR	9716	broad.mit.edu	37	15	35219284	35219284	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr15:35219284G>A	ENST00000156471.5	-	13	1295	c.1070C>T	c.(1069-1071)gCa>gTa	p.A357V		NM_014691.2	NP_055506.1	O60306	AQR_HUMAN	aquarius intron-binding spliceosomal factor	357					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(10)|lung(18)|ovary(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	57		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		ATCTACTTCTGCCACATTTGA	0.338																																						.											0													53.0	51.0	52.0					15																	35219284		1812	4072	5884	SO:0001583	missense	9716			AB011132	CCDS42013.1	15q13	2013-09-12	2013-09-12			ENSG00000021776			29513	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 164"""	610548	"""aquarius homolog (mouse)"""			9626505, 16949364	Standard	NM_014691		Approved	KIAA0560, fSAP164, IBP160	uc001ziv.3	O60306		ENST00000156471.5:c.1070C>T	15.37:g.35219284G>A	ENSP00000156471:p.Ala357Val	Somatic		WXS	Illumina HiSeq	Phase_I	A0JP17|A5YKK3|Q2YDX9|Q6IRU8|Q6PIC8	Missense_Mutation	SNP	ENST00000156471.5	37	CCDS42013.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.795158	0.90453	.	.	ENSG00000021776	ENST00000156471;ENST00000543879	D	0.93811	-3.29	5.73	4.82	0.62117	.	0.000000	0.85682	D	0.000000	D	0.94381	0.8193	M	0.83692	2.655	0.51767	D	0.999936	P	0.45902	0.868	P	0.47044	0.535	D	0.93285	0.6663	10	0.31617	T	0.26	-17.0162	14.7041	0.69176	0.0695:0.0:0.9305:0.0	.	357	O60306	AQR_HUMAN	V	357	ENSP00000156471:A357V	ENSP00000156471:A357V	A	-	2	0	AQR	33006576	1.000000	0.71417	0.999000	0.59377	0.910000	0.53928	9.452000	0.97615	1.428000	0.47296	-0.136000	0.14681	GCA		0.338	AQR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417526.2	NM_014691	
ZSCAN10	84891	broad.mit.edu	37	16	3139359	3139359	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr16:3139359delA	ENST00000252463.2	-	5	1998	c.1911delT	c.(1909-1911)tgtfs	p.C637fs	ZSCAN10_ENST00000575108.1_Frame_Shift_Del_p.C298fs|ZSCAN10_ENST00000538082.2_Frame_Shift_Del_p.C555fs|RP11-473M20.9_ENST00000571404.1_lincRNA	NM_032805.1	NP_116194.1	Q96SZ4	ZSC10_HUMAN	zinc finger and SCAN domain containing 10	637					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(3)|endometrium(3)|kidney(1)|lung(8)|ovary(2)|prostate(1)|skin(4)|urinary_tract(1)	24						CGCACGTCTGACAGCTGTAGG	0.716																																						.											0													22.0	26.0	25.0					16																	3139359		2177	4265	6442	SO:0001589	frameshift_variant	84891			AA206569	CCDS10493.1, CCDS61813.1, CCDS61814.1	16p13.3	2013-01-08	2007-02-20	2007-02-20		ENSG00000130182		"""-"", ""Zinc fingers, C2H2-type"""	12997	protein-coding gene	gene with protein product			"""zinc finger protein 206"""	ZNF206		9653642	Standard	NM_032805		Approved		uc002ctv.1	Q96SZ4		ENST00000252463.2:c.1911delT	16.37:g.3139359delA	ENSP00000252463:p.Cys637fs	Somatic		WXS	Illumina HiSeq	Phase_I	B3KQD3|H0YFS6|Q1WWM2	Frame_Shift_Del	DEL	ENST00000252463.2	37	CCDS10493.1																																																																																				0.716	ZSCAN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437124.2	NM_032805	
PSG3	5671	broad.mit.edu	37	19	43233954	43233954	+	Missense_Mutation	SNP	A	A	T	rs1071709		TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr19:43233954A>T	ENST00000327495.5	-	4	1148	c.964T>A	c.(964-966)Tac>Aac	p.Y322N	PSG3_ENST00000595140.1_Missense_Mutation_p.Y322N	NM_021016.3	NP_066296.2	Q16557	PSG3_HUMAN	pregnancy specific beta-1-glycoprotein 3	322	Ig-like C2-type 2.				defense response (GO:0006952)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36		Prostate(69;0.00682)				GTGACTGGGTAACTGCGGATG	0.488																																						.											0													170.0	153.0	159.0					19																	43233954		1511	2709	4220	SO:0001583	missense	5671				CCDS12611.1	19q13.2	2013-01-29			ENSG00000221826	ENSG00000221826		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9520	protein-coding gene	gene with protein product		176392				2341148	Standard	NM_021016		Approved		uc002oue.3	Q16557	OTTHUMG00000151120	ENST00000327495.5:c.964T>A	19.37:g.43233954A>T	ENSP00000332215:p.Tyr322Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q08265|Q9BRW2|Q9UPL4|Q9UQ77	Missense_Mutation	SNP	ENST00000327495.5	37	CCDS12611.1	.	.	.	.	.	.	.	.	.	.	c	0.770	-0.765978	0.02974	.	.	ENSG00000221826	ENST00000327495	T	0.09911	2.93	1.36	-2.4	0.06583	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.03053	0.0090	N	0.02539	-0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.41645	-0.9497	9	0.26408	T	0.33	.	2.1312	0.03750	0.3034:0.4815:0.0:0.2151	.	300;322	Q08266;Q16557	.;PSG3_HUMAN	N	322	ENSP00000332215:Y322N	ENSP00000332215:Y322N	Y	-	1	0	PSG3	47925794	0.934000	0.31675	0.016000	0.15963	0.011000	0.07611	0.292000	0.19011	-0.680000	0.05211	-2.134000	0.00341	TAC		0.488	PSG3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321423.2	NM_021016	
MEIS1	4211	broad.mit.edu	37	2	66667033	66667033	+	Missense_Mutation	SNP	A	A	C			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr2:66667033A>C	ENST00000272369.9	+	3	755	c.298A>C	c.(298-300)Acc>Ccc	p.T100P	MEIS1_ENST00000488550.1_Missense_Mutation_p.T100P|MEIS1_ENST00000398506.2_Missense_Mutation_p.T98P|MEIS1_ENST00000495021.2_Missense_Mutation_p.T35P|MEIS1_ENST00000444274.2_Missense_Mutation_p.T68P|MEIS1_ENST00000560281.2_Missense_Mutation_p.T100P|MEIS1-AS2_ENST00000439433.1_RNA|MEIS1_ENST00000407092.2_Missense_Mutation_p.T100P|MEIS1-AS1_ENST00000454595.1_RNA	NM_002398.2	NP_002389.1	O00470	MEIS1_HUMAN	Meis homeobox 1	100					angiogenesis (GO:0001525)|definitive hemopoiesis (GO:0060216)|lens morphogenesis in camera-type eye (GO:0002089)|megakaryocyte development (GO:0035855)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron differentiation (GO:0045665)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(10)|prostate(2)|skin(1)|urinary_tract(1)	24						AGCTACTTGTACCCCCCGCGA	0.483																																						.											0													64.0	58.0	60.0					2																	66667033		1809	4073	5882	SO:0001583	missense	4211				CCDS46309.1	2p14	2011-06-20	2007-02-15		ENSG00000143995	ENSG00000143995		"""Homeoboxes / TALE class"""	7000	protein-coding gene	gene with protein product		601739	"""Meis1 (mouse) homolog"", ""Meis1, myeloid ecotropic viral integration site 1 homolog (mouse)"""			7565694	Standard	NM_002398		Approved		uc002sdu.3	O00470	OTTHUMG00000150714	ENST00000272369.9:c.298A>C	2.37:g.66667033A>C	ENSP00000272369:p.Thr100Pro	Somatic		WXS	Illumina HiSeq	Phase_I	A8MV50	Missense_Mutation	SNP	ENST00000272369.9	37	CCDS46309.1	.	.	.	.	.	.	.	.	.	.	A	26.6	4.749006	0.89753	.	.	ENSG00000143995	ENST00000272369;ENST00000407092;ENST00000398506;ENST00000444274;ENST00000495021	T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44	5.38	5.38	0.77491	.	0.104975	0.64402	D	0.000006	T	0.46386	0.1390	M	0.68593	2.085	0.58432	D	0.999998	P;B;P;P	0.52316	0.952;0.255;0.865;0.554	P;P;P;P	0.52909	0.713;0.454;0.501;0.454	T	0.49551	-0.8928	10	0.87932	D	0	.	15.2365	0.73436	1.0:0.0:0.0:0.0	.	35;98;100;100	F5GYS8;O00470-2;O00470;F8W8U3	.;.;MEIS1_HUMAN;.	P	100;100;98;68;35	ENSP00000272369:T100P;ENSP00000384461:T100P;ENSP00000381518:T98P;ENSP00000403206:T68P;ENSP00000440571:T35P	ENSP00000272369:T100P	T	+	1	0	MEIS1	66520537	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	9.105000	0.94246	2.254000	0.74563	0.533000	0.62120	ACC		0.483	MEIS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319725.4	NM_002398	
ZNF638	27332	broad.mit.edu	37	2	71653715	71653715	+	Silent	SNP	T	T	A			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr2:71653715T>A	ENST00000409544.1	+	24	5346	c.4716T>A	c.(4714-4716)gtT>gtA	p.V1572V	ZNF638_ENST00000264447.4_Silent_p.V1572V|ZNF638_ENST00000409407.1_Silent_p.V512V|ZNF638_ENST00000355812.3_3'UTR	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	1572					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						TCAAAAATGTTCCTTTCTCTG	0.393																																						.											0													84.0	84.0	84.0					2																	71653715		2203	4300	6503	SO:0001819	synonymous_variant	27332			D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.4716T>A	2.37:g.71653715T>A		Somatic		WXS	Illumina HiSeq	Phase_I	B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Silent	SNP	ENST00000409544.1	37	CCDS1917.1																																																																																				0.393	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327431.1	NM_014497	
NCAPH	23397	broad.mit.edu;mdanderson.org;bcgsc.ca	37	2	97032995	97032995	+	Splice_Site	SNP	G	G	C			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr2:97032995G>C	ENST00000240423.4	+	15	1925	c.1882G>C	c.(1882-1884)Gta>Cta	p.V628L	NCAPH_ENST00000427946.1_Splice_Site_p.V492L|NCAPH_ENST00000455200.1_Splice_Site_p.V617L	NM_001281710.1|NM_001281711.1|NM_015341.3	NP_001268639.1|NP_001268640.1|NP_056156.2	Q15003	CND2_HUMAN	non-SMC condensin I complex, subunit H	628					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(717;0.0221)				CCTATTTCAGGTAAATAAAAT	0.363																																						.											0													71.0	80.0	77.0					2																	97032995		2203	4300	6503	SO:0001630	splice_region_variant	23397			BC024211	CCDS2021.1, CCDS62960.1	2q11.2	2008-02-05	2006-09-04	2006-09-04	ENSG00000121152	ENSG00000121152			1112	protein-coding gene	gene with protein product		602332	"""barren (Drosophila) homolog"", ""barren homolog (Drosophila)"", ""barren homolog 1 (Drosophila)"""	BRRN1		9417923	Standard	NM_015341		Approved	CAP-H, hCAP-H	uc002svz.1	Q15003	OTTHUMG00000130451	ENST00000240423.4:c.1882-1G>C	2.37:g.97032995G>C		Somatic		WXS	Illumina HiSeq	Phase_I	B4E189|Q8TB87	Missense_Mutation	SNP	ENST00000240423.4	37	CCDS2021.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.4|24.4	4.522702|4.522702	0.85600|0.85600	.|.	.|.	ENSG00000121152|ENSG00000121152	ENST00000435349|ENST00000240423;ENST00000427946;ENST00000455200	.|T;T;T	.|0.57107	.|0.42;0.42;0.42	5.87|5.87	5.87|5.87	0.94306|0.94306	.|.	.|0.054577	.|0.64402	.|D	.|0.000001	T|T	0.67277|0.67277	0.2876|0.2876	M|M	0.76574|0.76574	2.34|2.34	0.80722|0.80722	D|D	1|1	.|P;P	.|0.52692	.|0.955;0.906	.|P;P	.|0.54060	.|0.741;0.576	T|T	0.66881|0.66881	-0.5811|-0.5811	5|9	.|.	.|.	.|.	-16.8261|-16.8261	17.697|17.697	0.88285|0.88285	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|604;628	.|B4DRG7;Q15003	.|.;CND2_HUMAN	A|L	68|628;492;617	.|ENSP00000240423:V628L;ENSP00000400774:V492L;ENSP00000407308:V617L	.|.	G|V	+|+	2|1	0|0	NCAPH|NCAPH	96396722|96396722	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	5.890000|5.890000	0.69774|0.69774	2.785000|2.785000	0.95823|0.95823	0.650000|0.650000	0.86243|0.86243	GGT|GTA		0.363	NCAPH-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252842.2	NM_015341	Missense_Mutation
TIAM1	7074	broad.mit.edu	37	21	32639202	32639202	+	Silent	SNP	G	G	T	rs139712298		TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr21:32639202G>T	ENST00000286827.3	-	5	558	c.87C>A	c.(85-87)tcC>tcA	p.S29S	TIAM1_ENST00000469412.1_Intron|TIAM1_ENST00000541036.1_Silent_p.S29S	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	29					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						AGAGGCGCAGGGAGCGGGAAG	0.582																																						.											0													45.0	47.0	46.0					21																	32639202		2203	4300	6503	SO:0001819	synonymous_variant	7074				CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.87C>A	21.37:g.32639202G>T		Somatic		WXS	Illumina HiSeq	Phase_I	B7ZLR6|F5GZ53|Q17RT7	Silent	SNP	ENST00000286827.3	37	CCDS13609.1																																																																																				0.582	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	NM_003253	
C3orf36	80111	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	3	133647421	133647421	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr3:133647421G>A	ENST00000408895.2	-	1	1235	c.227C>T	c.(226-228)gCg>gTg	p.A76V		NM_025041.2	NP_079317.2	Q3SXR2	CC036_HUMAN	chromosome 3 open reading frame 36	76										breast(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(1)	6						GGGGTGTGGCGCGGCCCACTC	0.667																																						.											0													30.0	34.0	32.0					3																	133647421		2203	4300	6503	SO:0001583	missense	80111			AK025826	CCDS3083.1	3q22.1	2011-09-30			ENSG00000221972	ENSG00000221972			26170	protein-coding gene	gene with protein product						12477932	Standard	NM_025041		Approved	FLJ22173	uc003epz.1	Q3SXR2		ENST00000408895.2:c.227C>T	3.37:g.133647421G>A	ENSP00000386219:p.Ala76Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q3SXR3|Q9H6K8	Missense_Mutation	SNP	ENST00000408895.2	37	CCDS3083.1	.	.	.	.	.	.	.	.	.	.	G	9.323	1.058484	0.19987	.	.	ENSG00000221972	ENST00000408895	.	.	.	1.69	-3.38	0.04883	.	.	.	.	.	T	0.14700	0.0355	N	0.08118	0	0.09310	N	1	B	0.24317	0.101	B	0.06405	0.002	T	0.11251	-1.0595	8	0.87932	D	0	.	3.5665	0.07901	0.3568:0.0:0.4466:0.1966	.	76	Q3SXR2	CC036_HUMAN	V	76	.	ENSP00000386219:A76V	A	-	2	0	C3orf36	135130111	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.783000	0.04638	-1.660000	0.01486	-0.823000	0.03104	GCG		0.667	C3orf36-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_025041	
DDX4	54514	broad.mit.edu	37	5	55111195	55111195	+	Missense_Mutation	SNP	C	C	T	rs373207863		TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr5:55111195C>T	ENST00000505374.1	+	21	2133	c.2041C>T	c.(2041-2043)Cct>Tct	p.P681S	DDX4_ENST00000354991.5_Missense_Mutation_p.P647S|DDX4_ENST00000353507.5_Missense_Mutation_p.P647S|DDX4_ENST00000514278.2_Missense_Mutation_p.P661S|DDX4_ENST00000511853.1_Missense_Mutation_p.P532S	NM_024415.2	NP_077726.1	Q9NQI0	DDX4_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 4	681					male meiosis I (GO:0007141)|multicellular organismal development (GO:0007275)|regulation of protein localization (GO:0032880)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|pi-body (GO:0071546)|piP-body (GO:0071547)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	24		Lung NSC(810;6.93e-05)|all_neural(839;0.00409)|Prostate(74;0.0107)|Breast(144;0.0544)|Ovarian(174;0.223)				TACATACATTCCTGGCTTCAG	0.353																																						.											0								C	SER/PRO,SER/PRO,SER/PRO,SER/PRO	0,4406		0,0,2203	142.0	137.0	138.0		1939,1981,1594,2041	4.6	1.0	5		138	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	DDX4	NM_001142549.1,NM_001166533.1,NM_001166534.1,NM_024415.2	74,74,74,74	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging	647/691,661/705,532/576,681/725	55111195	1,13005	2203	4300	6503	SO:0001583	missense	54514			AF262962	CCDS3969.1, CCDS47208.1, CCDS54854.1, CCDS54855.1	5p15.2-p13.1	2008-02-05	2003-06-13		ENSG00000152670	ENSG00000152670		"""DEAD-boxes"""	18700	protein-coding gene	gene with protein product		605281	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 4"""			10920202, 11850529	Standard	NM_001142549		Approved	VASA	uc003jqg.4	Q9NQI0	OTTHUMG00000097044	ENST00000505374.1:c.2041C>T	5.37:g.55111195C>T	ENSP00000424838:p.Pro681Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A8K8Q2|B3KSF4|D6RDK4|E9PCD8|Q5M7Z3|Q86VX0|Q9NT92|Q9NYB1	Missense_Mutation	SNP	ENST00000505374.1	37	CCDS3969.1	.	.	.	.	.	.	.	.	.	.	C	8.888	0.953287	0.18431	0.0	1.16E-4	ENSG00000152670	ENST00000353507;ENST00000514278;ENST00000505374;ENST00000354991;ENST00000511853	T;T;T;T;T	0.20598	2.08;2.08;2.06;2.08;2.08	5.42	4.55	0.56014	.	0.307172	0.29853	N	0.011023	T	0.13756	0.0333	N	0.10645	0.015	0.26273	N	0.978392	B;B;D	0.58620	0.004;0.009;0.983	B;B;P	0.53102	0.004;0.018;0.718	T	0.09292	-1.0681	10	0.10377	T	0.69	-12.868	6.8119	0.23809	0.3159:0.603:0.0:0.0811	.	532;647;681	E9PCD8;Q9NQI0-2;Q9NQI0	.;.;DDX4_HUMAN	S	647;661;681;647;532	ENSP00000334167:P647S;ENSP00000425359:P661S;ENSP00000424838:P681S;ENSP00000347087:P647S;ENSP00000423123:P532S	ENSP00000334167:P647S	P	+	1	0	DDX4	55146952	0.218000	0.23608	0.965000	0.40720	0.783000	0.44284	0.283000	0.18846	1.271000	0.44313	0.563000	0.77884	CCT		0.353	DDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214147.2	NM_024415	
PCDHGA2	56113	broad.mit.edu;mdanderson.org	37	5	140720557	140720557	+	Silent	SNP	C	C	T			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr5:140720557C>T	ENST00000394576.2	+	1	2019	c.2019C>T	c.(2017-2019)gcC>gcT	p.A673A	PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	673	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACATCCTGGCCGACCTGGGCA	0.687																																						.											0													55.0	64.0	61.0					5																	140720557		2203	4298	6501	SO:0001819	synonymous_variant	56113			AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.2019C>T	5.37:g.140720557C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q52LL6|Q9Y5D5	Silent	SNP	ENST00000394576.2	37	CCDS47289.1																																																																																				0.687	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374738.1	NM_018915	
PCDH12	51294	broad.mit.edu	37	5	141331089	141331089	+	Missense_Mutation	SNP	T	T	G			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr5:141331089T>G	ENST00000231484.3	-	2	4157	c.2947A>C	c.(2947-2949)Aat>Cat	p.N983H	AC005740.6_ENST00000607378.1_RNA	NM_016580.2	NP_057664.1	Q9NPG4	PCD12_HUMAN	protocadherin 12	983					calcium-dependent cell-cell adhesion (GO:0016339)|glycogen metabolic process (GO:0005977)|homophilic cell adhesion (GO:0007156)|labyrinthine layer development (GO:0060711)|neuron recognition (GO:0008038)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(3)|prostate(2)|skin(1)	38		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAGTACTTATTTCCTCGGTGG	0.557											OREG0016877	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0													111.0	101.0	105.0					5																	141331089		2203	4300	6503	SO:0001583	missense	51294			AF231025	CCDS4269.1	5q31.3	2010-01-26			ENSG00000113555	ENSG00000113555		"""Cadherins / Protocadherins : Non-clustered"""	8657	protein-coding gene	gene with protein product		605622				10716726, 10380929	Standard	NM_016580		Approved	VE-cadherin-2	uc003llx.3	Q9NPG4	OTTHUMG00000129658	ENST00000231484.3:c.2947A>C	5.37:g.141331089T>G	ENSP00000231484:p.Asn983His	Somatic	1663	WXS	Illumina HiSeq	Phase_I	Q6UXB6|Q96KB8|Q9H7Y6|Q9H8E0	Missense_Mutation	SNP	ENST00000231484.3	37	CCDS4269.1	.	.	.	.	.	.	.	.	.	.	T	29.4	5.006141	0.93287	.	.	ENSG00000113555	ENST00000231484	T	0.77098	-1.07	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	D	0.87569	0.6210	M	0.74881	2.28	0.54753	D	0.999988	D	0.89917	1.0	D	0.87578	0.998	D	0.88768	0.3262	10	0.87932	D	0	.	14.5959	0.68407	0.0:0.0:0.0:1.0	.	983	Q9NPG4	PCD12_HUMAN	H	983	ENSP00000231484:N983H	ENSP00000231484:N983H	N	-	1	0	PCDH12	141311273	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.333000	0.79357	0.533000	0.62120	AAT		0.557	PCDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251858.1	NM_016580	
PHACTR1	221692	broad.mit.edu;bcgsc.ca	37	6	12719071	12719071	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr6:12719071G>A	ENST00000379350.1	+	2	224	c.95G>A	c.(94-96)gGa>gAa	p.G32E	PHACTR1_ENST00000332995.7_Missense_Mutation_p.G32E|PHACTR1_ENST00000379348.2_Missense_Mutation_p.G32E			Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1	32					actin cytoskeleton reorganization (GO:0031532)|actomyosin structure organization (GO:0031032)|cell motility (GO:0048870)|stress fiber assembly (GO:0043149)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)|synapse (GO:0045202)	actin binding (GO:0003779)|protein phosphatase inhibitor activity (GO:0004864)			breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	26	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			TACAGTCAAGGAGCTCAAGGT	0.388																																						.											0													30.0	28.0	28.0					6																	12719071		1822	4076	5898	SO:0001583	missense	221692			AB051520	CCDS75401.1	6p23	2013-01-24	2004-05-20	2004-05-21	ENSG00000112137	ENSG00000112137		"""Phosphatase and actin regulators"""	20990	protein-coding gene	gene with protein product		608723	"""RPEL repeat containing 1"""	RPEL1		11214970, 15107502	Standard	NM_030948		Approved	KIAA1733, dJ257A7.2	uc010jpc.3	Q9C0D0	OTTHUMG00000014270	ENST00000379350.1:c.95G>A	6.37:g.12719071G>A	ENSP00000368655:p.Gly32Glu	Somatic		WXS	Illumina HiSeq	Phase_I	A8K1V2|Q3MJ93|Q5JSJ2	Missense_Mutation	SNP	ENST00000379350.1	37		.	.	.	.	.	.	.	.	.	.	G	23.8	4.459506	0.84317	.	.	ENSG00000112137	ENST00000379350;ENST00000379348;ENST00000332995;ENST00000432934	T;T;T	0.43294	0.95;0.95;0.95	6.17	6.17	0.99709	.	0.000000	0.47455	D	0.000235	T	0.42359	0.1199	N	0.14661	0.345	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.996;1.0;0.996;0.998	T	0.50110	-0.8866	10	0.87932	D	0	.	18.0353	0.89301	0.0:0.0:1.0:0.0	.	32;32;32;32	E7ESR5;Q5R356;Q9C0D0;Q9C0D0-2	.;.;PHAR1_HUMAN;.	E	32	ENSP00000368655:G32E;ENSP00000368653:G32E;ENSP00000329880:G32E	ENSP00000329880:G32E	G	+	2	0	PHACTR1	12827057	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.069000	0.71209	2.941000	0.99782	0.655000	0.94253	GGA		0.388	PHACTR1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039876.1	XM_166420	
PEX3	8504	broad.mit.edu	37	6	143780275	143780275	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr6:143780275A>G	ENST00000367591.4	+	2	190	c.127A>G	c.(127-129)Agg>Ggg	p.R43G		NM_003630.2	NP_003621.1	P56589	PEX3_HUMAN	peroxisomal biogenesis factor 3	43	Targeting to peroxisomes.				peroxisome membrane biogenesis (GO:0016557)|peroxisome organization (GO:0007031)|protein import into peroxisome membrane (GO:0045046)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of peroxisomal membrane (GO:0005779)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)|protein-lipid complex (GO:0032994)	lipid binding (GO:0008289)|protein dimerization activity (GO:0046983)			endometrium(1)|large_intestine(9)|lung(4)|ovary(2)|skin(2)	18				OV - Ovarian serous cystadenocarcinoma(155;5.73e-06)|GBM - Glioblastoma multiforme(68;0.0117)		AATACAGGAAAGGGAGGCTGC	0.343																																						.											0													109.0	105.0	106.0					6																	143780275		2203	4300	6503	SO:0001583	missense	8504			AJ001625	CCDS5199.1	6q24.2	2008-05-15			ENSG00000034693	ENSG00000034693			8858	protein-coding gene	gene with protein product		603164				9657383	Standard	NM_003630		Approved		uc003qjl.3	P56589	OTTHUMG00000015730	ENST00000367591.4:c.127A>G	6.37:g.143780275A>G	ENSP00000356563:p.Arg43Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q6FGP5	Missense_Mutation	SNP	ENST00000367591.4	37	CCDS5199.1	.	.	.	.	.	.	.	.	.	.	A	13.95	2.390393	0.42410	.	.	ENSG00000034693	ENST00000367591	T	0.53640	0.61	5.76	5.76	0.90799	.	0.153254	0.56097	D	0.000036	T	0.34454	0.0898	M	0.66378	2.025	0.58432	D	0.999999	B;B	0.10296	0.002;0.003	B;B	0.20184	0.028;0.003	T	0.34502	-0.9826	10	0.54805	T	0.06	-10.4094	12.7856	0.57502	0.8544:0.1456:0.0:0.0	.	43;43	B4DV31;P56589	.;PEX3_HUMAN	G	43	ENSP00000356563:R43G	ENSP00000356563:R43G	R	+	1	2	PEX3	143821968	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.367000	0.59498	2.197000	0.70478	0.482000	0.46254	AGG		0.343	PEX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042525.1		
TCP1	6950	broad.mit.edu;ucsc.edu;mdanderson.org	37	6	160200278	160200278	+	Silent	SNP	C	C	T			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr6:160200278C>T	ENST00000321394.7	-	12	1750	c.1470G>A	c.(1468-1470)ttG>ttA	p.L490L	TCP1_ENST00000420894.2_3'UTR|TCP1_ENST00000392168.2_Silent_p.L335L|SNORA20_ENST00000384662.1_RNA|TCP1_ENST00000544255.1_Silent_p.L266L	NM_030752.2	NP_110379.2	P17987	TCPA_HUMAN	t-complex 1	490					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|tubulin complex assembly (GO:0007021)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|nuclear heterochromatin (GO:0005720)|pericentriolar material (GO:0000242)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|large_intestine(3)|lung(2)	10		Breast(66;1.53e-05)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(65;4.05e-20)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)		TACCATTGCTCAAATCAAGAC	0.373																																						.											0													89.0	91.0	90.0					6																	160200278		2203	4300	6503	SO:0001819	synonymous_variant	6950			X52882	CCDS5269.1, CCDS43522.1	6q25-q27	2012-10-02			ENSG00000120438	ENSG00000120438		"""Heat Shock Proteins / Chaperonins"""	11655	protein-coding gene	gene with protein product		186980				3476253, 3653076	Standard	NM_030752		Approved	D6S230E, CCT1, Ccta	uc003qsr.3	P17987	OTTHUMG00000015937	ENST00000321394.7:c.1470G>A	6.37:g.160200278C>T		Somatic		WXS	Illumina HiSeq	Phase_I	E1P5B2|Q15556|Q5TCM3	Silent	SNP	ENST00000321394.7	37	CCDS5269.1																																																																																				0.373	TCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042917.2	NM_030752	
GLI3	2737	broad.mit.edu	37	7	42079819	42079819	+	Silent	SNP	G	G	T			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr7:42079819G>T	ENST00000395925.3	-	7	930	c.846C>A	c.(844-846)ccC>ccA	p.P282P	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	282					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						CTGACAGCCTGGGGCTGGAGA	0.468									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																													.											0													120.0	114.0	116.0					7																	42079819		2203	4300	6503	SO:0001819	synonymous_variant	2737	Familial Cancer Database	;		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.846C>A	7.37:g.42079819G>T		Somatic		WXS	Illumina HiSeq	Phase_I	A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Silent	SNP	ENST00000395925.3	37	CCDS5465.1																																																																																				0.468	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168	
TAF1L	138474	broad.mit.edu;mdanderson.org	37	9	32632258	32632258	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr9:32632258T>C	ENST00000242310.4	-	1	3409	c.3320A>G	c.(3319-3321)gAc>gGc	p.D1107G	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	1107					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TGAGATGCTGTCTGTGTCAGT	0.438																																						.											0													190.0	161.0	171.0					9																	32632258		2203	4300	6503	SO:0001583	missense	138474			AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.3320A>G	9.37:g.32632258T>C	ENSP00000418379:p.Asp1107Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q0VG57	Missense_Mutation	SNP	ENST00000242310.4	37	CCDS35003.1	.	.	.	.	.	.	.	.	.	.	T	15.08	2.728446	0.48833	.	.	ENSG00000122728	ENST00000242310	T	0.18502	2.21	0.479	0.479	0.16796	.	0.000000	0.85682	D	0.000000	T	0.07999	0.0200	N	0.19112	0.55	0.58432	D	0.999991	B	0.10296	0.003	B	0.10450	0.005	T	0.26780	-1.0093	10	0.17369	T	0.5	.	5.1959	0.15236	0.0:1.0E-4:0.0:0.9999	.	1107	Q8IZX4	TAF1L_HUMAN	G	1107	ENSP00000418379:D1107G	ENSP00000418379:D1107G	D	-	2	0	TAF1L	32622258	1.000000	0.71417	0.835000	0.33067	0.464000	0.32679	3.503000	0.53340	0.426000	0.26116	0.164000	0.16699	GAC		0.438	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2		
GDA	9615	broad.mit.edu	37	9	74828816	74828816	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr9:74828816C>T	ENST00000358399.3	+	5	580	c.487C>T	c.(487-489)Cgg>Tgg	p.R163W	GDA_ENST00000238018.4_Missense_Mutation_p.R163W|GDA_ENST00000477618.1_3'UTR|GDA_ENST00000376989.3_Missense_Mutation_p.R138W|GDA_ENST00000545168.1_Missense_Mutation_p.R89W|GDA_ENST00000376986.1_Missense_Mutation_p.R121W	NM_001242505.2|NM_001242506.2|NM_004293.4	NP_001229434.1|NP_001229435.1|NP_004284.1	Q9Y2T3	GUAD_HUMAN	guanine deaminase	163					guanine catabolic process (GO:0006147)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	guanine deaminase activity (GO:0008892)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(1)|kidney(1)|large_intestine(1)|lung(20)|ovary(2)|skin(2)|urinary_tract(1)	32		Myeloproliferative disorder(762;0.0122)		Lung(182;0.0583)		ATTTGGACAGCGGGCATTTGT	0.348																																						.											0													114.0	113.0	114.0					9																	74828816		2203	4300	6503	SO:0001583	missense	9615			AF095286	CCDS6641.1, CCDS56576.1, CCDS56577.1	9q21.13	2008-05-14			ENSG00000119125	ENSG00000119125			4212	protein-coding gene	gene with protein product		139260				10075721, 3966794	Standard	NM_001242507		Approved		uc004air.3	Q9Y2T3	OTTHUMG00000020005	ENST00000358399.3:c.487C>T	9.37:g.74828816C>T	ENSP00000351170:p.Arg163Trp	Somatic		WXS	Illumina HiSeq	Phase_I	B4DTY5|Q5SZC7|Q9H335|Q9ULG2	Missense_Mutation	SNP	ENST00000358399.3	37	CCDS6641.1	.	.	.	.	.	.	.	.	.	.	C	18.50	3.637359	0.67130	.	.	ENSG00000119125	ENST00000545168;ENST00000238018;ENST00000376989;ENST00000376986;ENST00000358399	D;D;D;D;D	0.92299	-3.01;-3.01;-3.01;-3.01;-3.01	5.64	3.72	0.42706	Amidohydrolase 1 (1);	0.000000	0.85682	D	0.000000	D	0.97269	0.9107	H	0.97023	3.925	0.54753	D	0.999982	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.97524	1.0075	10	0.87932	D	0	-9.3723	13.4568	0.61204	0.5727:0.4273:0.0:0.0	.	121;163;163	Q5SZC6;Q9Y2T3-3;Q9Y2T3	.;.;GUAD_HUMAN	W	89;163;138;121;163	ENSP00000437972:R89W;ENSP00000238018:R163W;ENSP00000366188:R138W;ENSP00000366185:R121W;ENSP00000351170:R163W	ENSP00000238018:R163W	R	+	1	2	GDA	74018636	0.998000	0.40836	1.000000	0.80357	0.989000	0.77384	0.318000	0.19504	0.671000	0.31185	0.591000	0.81541	CGG		0.348	GDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052633.1		
SPATA31C2	645961	broad.mit.edu	37	9	90747122	90747122	+	IGR	SNP	C	C	T			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr9:90747122C>T								U6 (133872 upstream) : U3 (242061 downstream)																							GTTTGAGCCGCCAAGGCCTGA	0.557																																						.											0													64.0	63.0	63.0					9																	90747122		692	1591	2283	SO:0001628	intergenic_variant	645961																															9.37:g.90747122C>T		Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP		37																																																																																				0	0.557								
SURF4	6836	broad.mit.edu	37	9	136231848	136231848	+	Silent	SNP	T	T	C			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr9:136231848T>C	ENST00000371989.3	-	5	540	c.411A>G	c.(409-411)gaA>gaG	p.E137E	SURF4_ENST00000545297.1_Intron|SURF4_ENST00000485435.2_Silent_p.E137E|SURF4_ENST00000467910.1_5'UTR|SURF4_ENST00000371991.3_Silent_p.E137E	NM_001280788.1|NM_001280790.1|NM_001280791.1|NM_033161.2	NP_001267717.1|NP_001267719.1|NP_001267720.1|NP_149351.1	O15260	SURF4_HUMAN	surfeit 4	137					Golgi organization (GO:0007030)|positive regulation of organelle organization (GO:0010638)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(5)	8				OV - Ovarian serous cystadenocarcinoma(145;5.32e-07)|Epithelial(140;4.56e-06)|all cancers(34;4.25e-05)		TGCTCTTCCCTTCAGAACGGG	0.572																																						.											0													55.0	44.0	48.0					9																	136231848		2203	4300	6503	SO:0001819	synonymous_variant	6836				CCDS6968.1, CCDS65177.1, CCDS65178.1, CCDS75929.1	9q33-q34	2008-07-21			ENSG00000148248	ENSG00000148248			11476	protein-coding gene	gene with protein product	"""surfeit locus protein 4"", ""surface 4 integral membrane protein"""	185660				8499913, 7540914	Standard	NM_033161		Approved	ERV29, FLJ22993, MGC102753	uc004cdj.3	O15260	OTTHUMG00000020868	ENST00000371989.3:c.411A>G	9.37:g.136231848T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B7Z6A4|O60923|Q5T8U6|Q9UNZ0|Q9UNZ1	Silent	SNP	ENST00000371989.3	37	CCDS6968.1																																																																																				0.572	SURF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054886.1	NM_033161	
SSX3	10214	broad.mit.edu;mdanderson.org;bcgsc.ca	37	X	48213477	48213477	+	Missense_Mutation	SNP	G	G	T			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chrX:48213477G>T	ENST00000298396.2	-	4	289	c.237C>A	c.(235-237)ttC>ttA	p.F79L	SSX3_ENST00000376895.1_5'Flank|SSX3_ENST00000376893.3_Missense_Mutation_p.F79L	NM_021014.2	NP_066294.1	Q99909	SSX3_HUMAN	synovial sarcoma, X breakpoint 3	79	KRAB-related. {ECO:0000255|PROSITE- ProRule:PRU00120}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			endometrium(3)|large_intestine(1)|lung(9)	13						CATTCCCCTGGAAGTCTGTGA	0.468																																					Colon(37;227 826 19399 40970 48007)	.											0													138.0	124.0	129.0					X																	48213477		2203	4300	6503	SO:0001583	missense	10214			U90840	CCDS14291.1	Xp11.23	2009-06-17			ENSG00000165584	ENSG00000165584			11337	protein-coding gene	gene with protein product		300325				8697803, 9378559	Standard	NM_021014		Approved	CT5.3	uc004djd.1	Q99909	OTTHUMG00000021489	ENST00000298396.2:c.237C>A	X.37:g.48213477G>T	ENSP00000298396:p.Phe79Leu	Somatic		WXS	Illumina HiSeq	Phase_I	O60223|Q5JQZ3|Q9BRW7	Missense_Mutation	SNP	ENST00000298396.2	37	CCDS14291.1	.	.	.	.	.	.	.	.	.	.	g	2.049	-0.418296	0.04766	.	.	ENSG00000165584	ENST00000298396;ENST00000376893	T;T	0.07216	3.26;3.21	0.96	0.0283	0.14158	Krueppel-associated box (1);Krueppel-associated box-related (1);	0.829980	0.10428	N	0.675889	T	0.05273	0.0140	L	0.35288	1.05	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.08055	0.002;0.003	T	0.46610	-0.9179	10	0.16896	T	0.51	.	3.126	0.06407	0.3386:0.0:0.6614:0.0	.	79;79	Q9BRW7;Q99909	.;SSX3_HUMAN	L	79	ENSP00000298396:F79L;ENSP00000366090:F79L	ENSP00000298396:F79L	F	-	3	2	SSX3	48098421	0.000000	0.05858	0.001000	0.08648	0.050000	0.14768	0.230000	0.17852	-0.051000	0.13334	0.181000	0.17075	TTC		0.468	SSX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056486.1	NM_021014	
DCP1B	196513	broad.mit.edu	37	12	2113565	2113566	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr12:2113565_2113566insC	ENST00000280665.6	-	1	111_112	c.32_33insG	c.(31-33)ggafs	p.G11fs	DCP1B_ENST00000541700.1_5'UTR|RP5-1096D14.6_ENST00000354425.4_RNA|DCP1B_ENST00000397173.4_5'UTR	NM_152640.3	NP_689853.3	Q8IZD4	DCP1B_HUMAN	decapping mRNA 1B	11					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(10)|skin(1)	24			OV - Ovarian serous cystadenocarcinoma(31;0.00193)			CGCGCCCCTTTCCCACCAGGCC	0.649																																						.											0																																										SO:0001589	frameshift_variant	196513			AY146652	CCDS31727.1	12p13.33	2013-05-02	2013-05-02		ENSG00000151065	ENSG00000151065			24451	protein-coding gene	gene with protein product		609843	"""DCP1 decapping enzyme homolog B (S. cerevisiae)"""			12417715, 15067023	Standard	NM_152640		Approved	FLJ31638	uc001qjx.1	Q8IZD4	OTTHUMG00000168113	ENST00000280665.6:c.33dupG	12.37:g.2113568_2113568dupC	ENSP00000280665:p.Gly11fs	Somatic		WXS	Illumina HiSeq	Phase_I	B4DRD1|Q86XH9|Q96BP8|Q96MZ8	Frame_Shift_Ins	INS	ENST00000280665.6	37	CCDS31727.1																																																																																				0.649	DCP1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398244.1	NM_152640	
DDX54	79039	ucsc.edu	37	12	113623117	113623117	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr12:113623117T>C	ENST00000306014.5	-	1	167	c.140A>G	c.(139-141)gAg>gGg	p.E47G	DDX54_ENST00000314045.7_Missense_Mutation_p.E47G|C12orf52_ENST00000548278.1_5'Flank|RP11-545P7.4_ENST00000552525.1_RNA|C12orf52_ENST00000552495.1_5'Flank|C12orf52_ENST00000549621.1_5'Flank	NM_024072.3	NP_076977.3	Q8TDD1	DDX54_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 54	47					ATP catabolic process (GO:0006200)|intracellular estrogen receptor signaling pathway (GO:0030520)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						CGCCTGGATCTCAAACTCGCC	0.726																																						.											0													10.0	12.0	11.0					12																	113623117		2187	4275	6462	SO:0001583	missense	79039			AF144056	CCDS31907.1, CCDS44984.1	12q24.11	2006-01-30				ENSG00000123064		"""DEAD-boxes"""	20084	protein-coding gene	gene with protein product		611665				12466272	Standard	NM_001111322		Approved	MGC2835, APR-5, DP97	uc001tuq.4	Q8TDD1	OTTHUMG00000169676	ENST00000306014.5:c.140A>G	12.37:g.113623117T>C	ENSP00000304072:p.Glu47Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q86YT8|Q9BRZ1	Missense_Mutation	SNP	ENST00000306014.5	37	CCDS31907.1	.	.	.	.	.	.	.	.	.	.	T	18.59	3.657116	0.67586	.	.	ENSG00000123064	ENST00000314045;ENST00000306014	T;T	0.10668	2.85;2.86	4.29	4.29	0.51040	.	0.241494	0.33127	N	0.005258	T	0.19725	0.0474	L	0.43152	1.355	0.42114	D	0.991397	D;D	0.69078	0.997;0.976	D;P	0.63283	0.913;0.703	T	0.00945	-1.1505	10	0.38643	T	0.18	.	10.0122	0.41992	0.0:0.0:0.0:1.0	.	47;47	Q8TDD1-2;Q8TDD1	.;DDX54_HUMAN	G	47	ENSP00000323858:E47G;ENSP00000304072:E47G	ENSP00000304072:E47G	E	-	2	0	DDX54	112107500	1.000000	0.71417	0.998000	0.56505	0.210000	0.24377	2.564000	0.45931	1.936000	0.56123	0.379000	0.24179	GAG		0.726	DDX54-002	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405435.1	NM_024072	
HELZ2	85441	ucsc.edu	37	20	62194103	62194103	+	Silent	SNP	A	A	G	rs3810484	byFrequency	TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr20:62194103A>G	ENST00000467148.1	-	8	6141	c.6072T>C	c.(6070-6072)ccT>ccC	p.P2024P	HELZ2_ENST00000427522.2_Silent_p.P1455P	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	2024					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										TGCTGGGCCCAGGGCGTGGGC	0.697													G|||	2740	0.547125	0.3956	0.4827	5008	,	,		13691	0.8482		0.4095	False		,,,				2504	0.6288					.											0								G	,	1610,2724		322,966,879	10.0	13.0	12.0		6072,4365	-4.9	0.0	20	dbSNP_107	12	3513,5019		782,1949,1535	no	coding-synonymous,coding-synonymous	PRIC285	NM_001037335.2,NM_033405.3	,	1104,2915,2414	GG,GA,AA		41.1744,37.1481,39.8181	,	2024/2650,1455/2081	62194103	5123,7743	2167	4266	6433	SO:0001819	synonymous_variant	85441			AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.6072T>C	20.37:g.62194103A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Silent	SNP	ENST00000467148.1	37	CCDS33508.1																																																																																				0.697	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335	
KIAA1244	57221	ucsc.edu	37	6	138483249	138483249	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr6:138483249A>G	ENST00000251691.4	+	1	192	c.26A>G	c.(25-27)cAg>cGg	p.Q9R		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		AGGAAGCTGCAGAAGGAGGCG	0.701																																						.											0													39.0	48.0	45.0					6																	138483249		1918	4134	6052	SO:0001583	missense	57221			AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.26A>G	6.37:g.138483249A>G	ENSP00000251691:p.Gln9Arg	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000251691.4	37	CCDS5189.2	.	.	.	.	.	.	.	.	.	.	A	23.7	4.450976	0.84209	.	.	ENSG00000112379	ENST00000251691	T	0.18174	2.23	4.07	4.07	0.47477	.	.	.	.	.	T	0.17323	0.0416	L	0.40543	1.245	0.40639	D	0.981929	D	0.54601	0.967	P	0.62382	0.901	T	0.01401	-1.1364	9	0.39692	T	0.17	-11.7155	12.2239	0.54449	1.0:0.0:0.0:0.0	.	9	Q5TH69	BIG3_HUMAN	R	9	ENSP00000251691:Q9R	ENSP00000251691:Q9R	Q	+	2	0	KIAA1244	138524942	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.816000	0.75247	1.487000	0.48415	0.374000	0.22700	CAG		0.701	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042425.4	NM_020340	
LMCD1	29995	ucsc.edu;mdanderson.org	37	3	8579024	8579024	+	Silent	SNP	G	G	A			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr3:8579024G>A	ENST00000157600.3	+	3	517	c.285G>A	c.(283-285)aaG>aaA	p.K95K	LMCD1-AS1_ENST00000439407.1_RNA|LMCD1_ENST00000454244.1_Silent_p.K22K|LMCD1_ENST00000397386.3_Intron|LMCD1_ENST00000535732.1_Silent_p.K95K	NM_014583.2	NP_055398.1	Q9NZU5	LMCD1_HUMAN	LIM and cysteine-rich domains 1	95					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|regulation of cardiac muscle hypertrophy (GO:0010611)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(2)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)	16				OV - Ovarian serous cystadenocarcinoma(96;0.124)		GGATTTACAAGAGGAACCGGA	0.537																																						.											0													137.0	142.0	140.0					3																	8579024		2203	4300	6503	SO:0001819	synonymous_variant	29995			AF169284	CCDS33688.1, CCDS63533.1, CCDS63534.1	3p26-p24	2008-07-18			ENSG00000071282	ENSG00000071282			6633	protein-coding gene	gene with protein product	"""dyxin"""	604859				10662546	Standard	NM_001278233		Approved		uc003bqq.4	Q9NZU5	OTTHUMG00000154971	ENST00000157600.3:c.285G>A	3.37:g.8579024G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B4DG80	Silent	SNP	ENST00000157600.3	37	CCDS33688.1																																																																																				0.537	LMCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337854.1	NM_014583	
CELSR3	1951	mdanderson.org	37	3	48694147	48694147	+	Silent	SNP	G	G	A	rs2286651	byFrequency	TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr3:48694147G>A	ENST00000164024.4	-	2	4663	c.4383C>T	c.(4381-4383)tgC>tgT	p.C1461C	CELSR3_ENST00000544264.1_Silent_p.C1461C	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	1461	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		AGCGCGGGCGGCAGACGCACG	0.697													G|||	499	0.0996406	0.1263	0.0793	5008	,	,		14276	0.1171		0.1183	False		,,,				2504	0.0409					.											0								G		542,3786		27,488,1649	9.0	8.0	9.0		4383	4.9	1.0	3	dbSNP_100	9	931,7547		56,819,3364	no	coding-synonymous	CELSR3	NM_001407.2		83,1307,5013	AA,AG,GG		10.9814,12.5231,11.5024		1461/3313	48694147	1473,11333	2164	4239	6403	SO:0001819	synonymous_variant	1951			AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.4383C>T	3.37:g.48694147G>A		Somatic		WXS	Illumina HiSeq	Phase_I	O75092	Silent	SNP	ENST00000164024.4	37	CCDS2775.1																																																																																				0.697	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407	
EEFSEC	60678	mdanderson.org	37	3	127872506	127872506	+	Silent	SNP	C	C	T	rs11711710	byFrequency	TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr3:127872506C>T	ENST00000254730.6	+	1	210	c.156C>T	c.(154-156)ggC>ggT	p.G52G	EEFSEC_ENST00000483457.1_Silent_p.G52G|RUVBL1_ENST00000464873.1_5'UTR	NM_021937.3	NP_068756.2	P57772	SELB_HUMAN	eukaryotic elongation factor, selenocysteine-tRNA-specific	52	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				selenocysteine incorporation (GO:0001514)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ribonucleoprotein complex binding (GO:0043021)|selenocysteine insertion sequence binding (GO:0035368)|translation elongation factor activity (GO:0003746)|tRNA binding (GO:0000049)			NS(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(10)|ovary(1)	25						TCGATCTGGGCTTCTCGTGCT	0.726													C|||	682	0.136182	0.2315	0.134	5008	,	,		11740	0.0069		0.1143	False		,,,				2504	0.1646					.											0								C		880,3484		96,688,1398	11.0	14.0	13.0		156	4.3	1.0	3	dbSNP_120	13	1010,7520		57,896,3312	no	coding-synonymous	EEFSEC	NM_021937.3		153,1584,4710	TT,TC,CC		11.8406,20.165,14.658		52/597	127872506	1890,11004	2182	4265	6447	SO:0001819	synonymous_variant	60678				CCDS33849.1	3q21.3	2007-05-25			ENSG00000132394	ENSG00000132394			24614	protein-coding gene	gene with protein product	"""elongation factor for selenoprotein translation"""	607695				10970870, 15229221	Standard	XM_005247696		Approved	SELB, EFSEC	uc003eki.3	P57772	OTTHUMG00000159659	ENST00000254730.6:c.156C>T	3.37:g.127872506C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q96HZ6	Silent	SNP	ENST00000254730.6	37	CCDS33849.1																																																																																				0.726	EEFSEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356738.2	NM_021937	
IFNA7	3444	mdanderson.org	37	9	21202040	21202040	+	Missense_Mutation	SNP	G	G	C	rs200751233	byFrequency	TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr9:21202040G>C	ENST00000239347.3	-	1	164	c.125C>G	c.(124-126)gCa>gGa	p.A42G		NM_021057.2	NP_066401.2	P01567	IFNA7_HUMAN	interferon, alpha 7	42					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			endometrium(3)|kidney(1)|large_intestine(1)|liver(1)|lung(6)	12				GBM - Glioblastoma multiforme(5;4.75e-197)|Lung(24;1.26e-23)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		TCCCATTTGTGCCAGGAGTAT	0.507													G|||	24	0.00479233	0.0015	0.0	5008	,	,		19378	0.0179		0.004	False		,,,				2504	0.0					.											0													116.0	114.0	115.0					9																	21202040		2203	4300	6503	SO:0001583	missense	3444				CCDS34995.1	9p22	2010-12-10			ENSG00000214042	ENSG00000214042		"""Interferons"""	5428	protein-coding gene	gene with protein product		147567				1385305	Standard	NM_021057		Approved	IFNA-J, IFN-alphaJ	uc003zop.1	P01567	OTTHUMG00000019662	ENST00000239347.3:c.125C>G	9.37:g.21202040G>C	ENSP00000239347:p.Ala42Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q14607|Q5VV14	Missense_Mutation	SNP	ENST00000239347.3	37	CCDS34995.1	.	.	.	.	.	.	.	.	.	.	G	0.466	-0.886593	0.02511	.	.	ENSG00000214042	ENST00000239347	T	0.05139	3.49	3.56	-1.74	0.08056	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.761996	0.12212	N	0.489217	T	0.02688	0.0081	N	0.11560	0.145	0.09310	N	1	B	0.02656	0.0	B	0.12837	0.008	T	0.48468	-0.9033	10	0.11182	T	0.66	.	6.4322	0.21803	0.0:0.1783:0.5382:0.2835	.	42	P01567	IFNA7_HUMAN	G	42	ENSP00000239347:A42G	ENSP00000239347:A42G	A	-	2	0	IFNA7	21192040	0.000000	0.05858	0.032000	0.17829	0.205000	0.24178	-1.756000	0.01813	-0.160000	0.11002	0.586000	0.80456	GCA		0.507	IFNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051891.1	NM_021057	
IFNA7	3444	mdanderson.org	37	9	21202073	21202073	+	Missense_Mutation	SNP	C	C	G	rs76903863	byFrequency	TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr9:21202073C>G	ENST00000239347.3	-	1	131	c.92G>C	c.(91-93)aGc>aCc	p.S31T		NM_021057.2	NP_066401.2	P01567	IFNA7_HUMAN	interferon, alpha 7	31					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			endometrium(3)|kidney(1)|large_intestine(1)|liver(1)|lung(6)	12				GBM - Glioblastoma multiforme(5;4.75e-197)|Lung(24;1.26e-23)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		ATTACGCAGGCTGTGGGTCTG	0.502																																						.											0													95.0	94.0	94.0					9																	21202073		2203	4300	6503	SO:0001583	missense	3444				CCDS34995.1	9p22	2010-12-10			ENSG00000214042	ENSG00000214042		"""Interferons"""	5428	protein-coding gene	gene with protein product		147567				1385305	Standard	NM_021057		Approved	IFNA-J, IFN-alphaJ	uc003zop.1	P01567	OTTHUMG00000019662	ENST00000239347.3:c.92G>C	9.37:g.21202073C>G	ENSP00000239347:p.Ser31Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q14607|Q5VV14	Missense_Mutation	SNP	ENST00000239347.3	37	CCDS34995.1	.	.	.	.	.	.	.	.	.	.	C	7.904	0.734952	0.15574	.	.	ENSG00000214042	ENST00000239347	T	0.03413	3.94	3.14	-0.052	0.13824	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.925130	0.09173	N	0.838490	T	0.04952	0.0133	M	0.72576	2.205	0.09310	N	1	B	0.18968	0.032	B	0.23574	0.047	T	0.47032	-0.9148	10	0.21540	T	0.41	.	3.1528	0.06494	0.2119:0.5211:0.0:0.2669	.	31	P01567	IFNA7_HUMAN	T	31	ENSP00000239347:S31T	ENSP00000239347:S31T	S	-	2	0	IFNA7	21192073	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	-0.746000	0.04829	0.106000	0.17784	-0.302000	0.09304	AGC		0.502	IFNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051891.1	NM_021057	
KRT81	3887	mdanderson.org	37	12	52680993	52680993	+	Silent	SNP	C	C	T			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr12:52680993C>T	ENST00000327741.5	-	7	1208	c.1140G>A	c.(1138-1140)caG>caA	p.Q380Q	KRT86_ENST00000423955.2_Intron|KRT86_ENST00000544024.1_Intron	NM_002281.3	NP_002272.2	Q14533	KRT81_HUMAN	keratin 81	380	Coil 2.|Rod.					extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.Q380Q(2)		breast(2)|endometrium(3)|large_intestine(3)|lung(6)|prostate(1)|stomach(1)	16				BRCA - Breast invasive adenocarcinoma(357;0.189)		AGGCCATGTCCTGCTTGGCCT	0.672																																						.											2	Substitution - coding silent(2)	large_intestine(1)|prostate(1)											64.0	59.0	60.0					12																	52680993		2203	4297	6500	SO:0001819	synonymous_variant	3887			X81420	CCDS31805.1	12q13	2013-01-16	2006-07-17	2006-07-17	ENSG00000205426	ENSG00000205426		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6458	protein-coding gene	gene with protein product	"""hard keratin type II 1"""	602153	"""keratin, hair, basic, 1"""	KRTHB1		7556444, 16831889	Standard	NM_002281		Approved	Hb-1	uc001sab.3	Q14533	OTTHUMG00000167574	ENST00000327741.5:c.1140G>A	12.37:g.52680993C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q14846|Q16274|Q17R48|Q8WU52|Q9BR74	Silent	SNP	ENST00000327741.5	37	CCDS31805.1																																																																																				0.672	KRT81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395128.2	NM_002281	
MUC21	394263	mdanderson.org	37	6	30954485	30954485	+	Missense_Mutation	SNP	G	G	A	rs140951082	byFrequency	TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr6:30954485G>A	ENST00000376296.3	+	2	774	c.533G>A	c.(532-534)aGc>aAc	p.S178N	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	178	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S178N(1)		NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						AGTGGGGCCAGCACAGCCACC	0.617													G|||	8	0.00159744	0.0008	0.0014	5008	,	,		28215	0.0		0.005	False		,,,				2504	0.001					.											1	Substitution - Missense(1)	NS(1)											150.0	143.0	145.0					6																	30954485		2202	4299	6501	SO:0001583	missense	394263			AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.533G>A	6.37:g.30954485G>A	ENSP00000365473:p.Ser178Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Missense_Mutation	SNP	ENST00000376296.3	37	CCDS34388.1	.	.	.	.	.	.	.	.	.	.	G	10.17	1.277242	0.23307	.	.	ENSG00000204544	ENST00000450707;ENST00000376296	T	0.02863	4.13	3.72	-3.6	0.04570	.	.	.	.	.	T	0.00608	0.0020	L	0.34521	1.04	0.09310	N	1	B	0.16802	0.019	B	0.19946	0.027	T	0.48198	-0.9056	8	.	.	.	-1.0525	1.0899	0.01661	0.3623:0.2667:0.2352:0.1358	.	178	Q5SSG8	MUC21_HUMAN	N	178	ENSP00000365473:S178N	.	S	+	2	0	MUC21	31062464	0.000000	0.05858	0.000000	0.03702	0.052000	0.14988	-2.096000	0.01349	-0.539000	0.06273	-0.330000	0.08379	AGC		0.617	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
MUC21	394263	mdanderson.org	37	6	30955202	30955202	+	Missense_Mutation	SNP	C	C	T	rs2429294	byFrequency	TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr6:30955202C>T	ENST00000376296.3	+	2	1491	c.1250C>T	c.(1249-1251)gCc>gTc	p.A417V	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	417	28 X 15 AA approximate tandem repeats.|Ser-rich.			A -> I (in Ref. 3; AAQ88781 and 4; CAQ08321). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						TCCAGTGGGGCCAGCACTGCC	0.622													c|||	404	0.0806709	0.0749	0.1427	5008	,	,		19938	0.0556		0.0805	False		,,,				2504	0.0706					.											0																																										SO:0001583	missense	394263			AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.1250C>T	6.37:g.30955202C>T	ENSP00000365473:p.Ala417Val	Somatic		WXS	Illumina HiSeq	Phase_I	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Missense_Mutation	SNP	ENST00000376296.3	37	CCDS34388.1	217	0.09935897435897435	48	0.0975609756097561	60	0.16574585635359115	55	0.09615384615384616	54	0.0712401055408971	c	9.220	1.033023	0.19590	.	.	ENSG00000204544	ENST00000450707;ENST00000376296	T	0.01804	4.63	3.58	1.78	0.24846	.	.	.	.	.	T	0.00328	0.0010	N	0.03608	-0.345	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.37709	-0.9694	9	0.25106	T	0.35	-0.4275	7.735	0.28808	0.0:0.7843:0.0:0.2157	rs2429294	417	Q5SSG8	MUC21_HUMAN	V	267;417	ENSP00000365473:A417V	ENSP00000365473:A417V	A	+	2	0	MUC21	31063181	0.000000	0.05858	0.001000	0.08648	0.018000	0.09664	-0.835000	0.04386	0.325000	0.23359	-0.225000	0.12378	GCC		0.622	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
MUC4	4585	mdanderson.org	37	3	195509196	195509196	+	Missense_Mutation	SNP	G	G	C	rs76126602		TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr3:195509196G>C	ENST00000463781.3	-	2	9714	c.9255C>G	c.(9253-9255)caC>caG	p.H3085Q	MUC4_ENST00000475231.1_Missense_Mutation_p.H3085Q|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGGGTGGCGTGACCTGTGG	0.597																																						.											0													16.0	12.0	13.0					3																	195509196		673	1556	2229	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9255C>G	3.37:g.195509196G>C	ENSP00000417498:p.His3085Gln	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	6.625	0.483770	0.12581	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32753	1.45;1.44	.	.	.	.	.	.	.	.	T	0.12305	0.0299	N	0.19112	0.55	0.09310	N	1	P	0.40197	0.706	B	0.26693	0.072	T	0.17137	-1.0379	7	.	.	.	.	5.0315	0.14411	0.2649:0.0:0.7351:0.0	.	2957	E7ESK3	.	Q	3085	ENSP00000417498:H3085Q;ENSP00000420243:H3085Q	.	H	-	3	2	MUC4	196993975	0.803000	0.28956	0.001000	0.08648	0.000000	0.00434	1.490000	0.35573	-0.414000	0.07495	0.000000	0.15137	CAC		0.597	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
TONSL	4796	mdanderson.org	37	8	145661320	145661320	+	Silent	SNP	G	G	A	rs2721140	byFrequency	TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr8:145661320G>A	ENST00000409379.3	-	17	2525	c.2496C>T	c.(2494-2496)gcC>gcT	p.A832A	AC084125.4_ENST00000442850.1_RNA|AC084125.4_ENST00000544423.1_RNA	NM_013432.4	NP_038460.4	Q96HA7	TONSL_HUMAN	tonsoku-like, DNA repair protein	832					cytoplasmic sequestering of transcription factor (GO:0042994)|double-strand break repair via homologous recombination (GO:0000724)|regulation of RNA biosynthetic process (GO:2001141)|replication fork processing (GO:0031297)	cytoplasm (GO:0005737)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|lung(14)|ovary(3)|prostate(1)|skin(1)	26						GCCAGTCCCCGGCCAGGCACT	0.741													g|||	2347	0.46865	0.4115	0.438	5008	,	,		13786	0.4246		0.4662	False		,,,				2504	0.6155					.											0										1747,2459		402,943,758	8.0	11.0	10.0		2496	-8.9	0.0	8	dbSNP_100	10	3725,4593		923,1879,1357	no	coding-synonymous	TONSL	NM_013432.4		1325,2822,2115	AA,AG,GG		44.7824,41.5359,43.6921		832/1379	145661320	5472,7052	2103	4159	6262	SO:0001819	synonymous_variant	4796				CCDS34968.2	8q24.3	2013-01-10	2010-12-02	2010-11-30	ENSG00000160949	ENSG00000160949		"""Ankyrin repeat domain containing"""	7801	protein-coding gene	gene with protein product		604546	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2"""	NFKBIL2		7738005, 11246458	Standard	NM_013432		Approved	IKBR	uc011llg.2	Q96HA7	OTTHUMG00000153122	ENST00000409379.3:c.2496C>T	8.37:g.145661320G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B5MDP0|C9JKB1|C9JNV8|Q13006|Q9UGJ2	Silent	SNP	ENST00000409379.3	37	CCDS34968.2																																																																																				0.741	TONSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329668.2	NM_013432	
TTC9	23508	mdanderson.org	37	14	71109153	71109153	+	Missense_Mutation	SNP	C	C	G	rs4902834	byFrequency	TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr14:71109153C>G	ENST00000256367.2	+	1	650	c.307C>G	c.(307-309)Ccg>Gcg	p.P103A	CTD-2540L5.5_ENST00000553982.1_lincRNA|CTD-2540L5.6_ENST00000500016.1_lincRNA	NM_015351.1	NP_056166.1	Q92623	TTC9A_HUMAN	tetratricopeptide repeat domain 9	103			P -> A (in dbSNP:rs4902834). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:9039502}.							skin(1)	1				all cancers(60;0.00545)|BRCA - Breast invasive adenocarcinoma(234;0.00747)|OV - Ovarian serous cystadenocarcinoma(108;0.0538)		GGACTCGCGCCCGGCCTCCCC	0.672													G|||	4215	0.841653	0.9047	0.8991	5008	,	,		8571	0.8442		0.8042	False		,,,				2504	0.7515					.											0								G	ALA/PRO	3149,341		1419,311,15	6.0	8.0	7.0		307	-7.2	0.1	14	dbSNP_111	7	6647,1125		2853,941,92	no	missense	TTC9	NM_015351.1	27	4272,1252,107	GG,GC,CC		14.475,9.7708,13.0172	benign	103/223	71109153	9796,1466	1745	3886	5631	SO:0001583	missense	23508			D86980	CCDS45132.1	14q24.2	2014-08-12			ENSG00000133985			"""Tetratricopeptide (TTC) repeat domain containing"""	20267	protein-coding gene	gene with protein product		610488					Standard	NM_015351		Approved	KIAA0227, TTC9A	uc001xmi.2	Q92623	OTTHUMG00000172133	ENST00000256367.2:c.307C>G	14.37:g.71109153C>G	ENSP00000256367:p.Pro103Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q86WT2	Missense_Mutation	SNP	ENST00000256367.2	37	CCDS45132.1	1812	0.8296703296703297	437	0.8882113821138211	330	0.9116022099447514	453	0.791958041958042	592	0.7810026385224275	G	0.069	-1.206605	0.01568	0.902292	0.85525	ENSG00000133985	ENST00000256367	T	0.18657	2.2	4.29	-7.15	0.01521	Tetratricopeptide-like helical (1);	0.478187	0.19869	N	0.104239	T	0.00012	0.0000	N	0.04508	-0.205	0.80722	P	0.0	B	0.06786	0.001	B	0.01281	0.0	T	0.27706	-1.0066	9	0.25106	T	0.35	-13.8871	0.7147	0.00930	0.2371:0.249:0.1297:0.3841	rs4902834;rs17846425;rs17859471;rs57432971;rs4902834	103	Q92623	TTC9A_HUMAN	A	103	ENSP00000256367:P103A	ENSP00000256367:P103A	P	+	1	0	TTC9	70178906	0.110000	0.22057	0.071000	0.20095	0.011000	0.07611	0.182000	0.16900	-2.181000	0.00765	-2.636000	0.00152	CCG		0.672	TTC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417024.1	XM_027236	
FRG1B	284802	bcgsc.ca	37	20	29625947	29625947	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr20:29625947T>C	ENST00000278882.3	+	5	571	c.191T>C	c.(190-192)aTt>aCt	p.I64T	FRG1B_ENST00000358464.4_Missense_Mutation_p.I64T|FRG1B_ENST00000439954.2_Missense_Mutation_p.I69T			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	64								p.I64T(4)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TCAGATGCAATTGGACCAAGA	0.343																																						.											4	Substitution - Missense(4)	urinary_tract(2)|prostate(2)																																								SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.191T>C	20.37:g.29625947T>C	ENSP00000278882:p.Ile64Thr	Somatic		WXS	Illumina HiSeq	Phase_I	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	t	11.16	1.557441	0.27827	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.53640	0.61	1.68	1.68	0.24146	.	0.048324	0.85682	N	0.000000	T	0.39279	0.1072	.	.	.	0.50313	D	0.999869	B	0.11235	0.004	B	0.30943	0.122	T	0.37549	-0.9701	9	0.62326	D	0.03	.	7.3757	0.26827	0.0:0.0:0.0:1.0	.	69	F5H5R5	.	T	64;69;64	ENSP00000408863:I69T	ENSP00000278882:I64T	I	+	2	0	FRG1B	28239608	1.000000	0.71417	0.998000	0.56505	0.053000	0.15095	6.623000	0.74238	1.028000	0.39785	0.155000	0.16302	ATT		0.343	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FILIP1L	11259	bcgsc.ca	37	3	99568907	99568907	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr3:99568907T>C	ENST00000354552.3	-	5	2083	c.1613A>G	c.(1612-1614)aAg>aGg	p.K538R	CMSS1_ENST00000421999.2_Intron|FILIP1L_ENST00000383694.2_Missense_Mutation_p.K298R|FILIP1L_ENST00000471562.1_Missense_Mutation_p.K298R|FILIP1L_ENST00000476723.1_Intron|FILIP1L_ENST00000331335.5_Missense_Mutation_p.K538R|FILIP1L_ENST00000487087.1_Missense_Mutation_p.K114R|CMSS1_ENST00000496116.1_Intron	NM_182909.2	NP_878913.2	Q4L180	FIL1L_HUMAN	filamin A interacting protein 1-like	538						cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	35						CTCAATTAACTTCTCAGTAAC	0.338																																						.											0													90.0	77.0	81.0					3																	99568907		1832	4089	5921	SO:0001583	missense	11259				CCDS43117.1, CCDS43118.1, CCDS43119.1, CCDS63700.1, CCDS74969.1	3q12.1	2011-10-21			ENSG00000168386	ENSG00000168386			24589	protein-coding gene	gene with protein product	"""downregulated in ovarian cancer 1"", ""GPBP-interacting protein of 130 kDa"""	612993				8314147, 15935955, 21832087	Standard	NM_001282793		Approved	DOC-1, GIP130	uc003dtm.3	Q4L180	OTTHUMG00000159055	ENST00000354552.3:c.1613A>G	3.37:g.99568907T>C	ENSP00000346560:p.Lys538Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B2CNV7|B2CNV8|Q13597|Q2YDY5|Q6KFX5|Q6KFX6|Q6KFX7|Q8IUM3|Q8N6Z0	Missense_Mutation	SNP	ENST00000354552.3	37	CCDS43117.1	.	.	.	.	.	.	.	.	.	.	T	16.41	3.114546	0.56505	.	.	ENSG00000168386	ENST00000354552;ENST00000487087;ENST00000471562;ENST00000331335;ENST00000383694;ENST00000441620;ENST00000495625	T;T;T;T;T;T	0.47177	0.85;1.58;1.45;0.85;1.45;1.56	5.98	5.98	0.97165	.	0.000000	0.56097	D	0.000039	T	0.53077	0.1774	M	0.79475	2.455	0.54753	D	0.999983	P;B	0.34615	0.459;0.33	B;B	0.34652	0.187;0.091	T	0.55958	-0.8058	10	0.48119	T	0.1	-18.1372	16.4622	0.84064	0.0:0.0:0.0:1.0	.	538;538	Q4L180-2;Q4L180	.;FIL1L_HUMAN	R	538;114;298;538;298;284;298	ENSP00000346560:K538R;ENSP00000417774:K114R;ENSP00000419642:K298R;ENSP00000327880:K538R;ENSP00000373192:K298R;ENSP00000419874:K298R	ENSP00000327880:K538R	K	-	2	0	FILIP1L	101051597	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.173000	0.58249	2.289000	0.77006	0.533000	0.62120	AAG		0.338	FILIP1L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353069.1	NM_014890	
PSMG4	389362	bcgsc.ca	37	6	3259345	3259345	+	Missense_Mutation	SNP	T	T	G			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr6:3259345T>G	ENST00000438998.2	+	1	218	c.89T>G	c.(88-90)gTc>gGc	p.V30G	PSMG4_ENST00000419065.2_Missense_Mutation_p.V30G|PSMG4_ENST00000451246.2_Missense_Mutation_p.V30G|PSMG4_ENST00000380305.4_Missense_Mutation_p.V30G|PSMG4_ENST00000380306.4_Intron|PSMG4_ENST00000473000.2_Missense_Mutation_p.V30G	NM_001128591.1	NP_001122063.1	Q5JS54	PSMG4_HUMAN	proteasome (prosome, macropain) assembly chaperone 4	30										endometrium(1)	1						CACTTCCACGTCATGCGGCTG	0.706																																						.											0													9.0	16.0	14.0					6																	3259345		673	1561	2234	SO:0001583	missense	389362				CCDS47360.1, CCDS47361.1, CCDS47362.1	6p25.2	2010-06-23	2008-02-25	2008-02-25	ENSG00000180822	ENSG00000180822			21108	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 86"""	C6orf86		17707236	Standard	NM_001128591		Approved	PAC4	uc010jnl.1	Q5JS54	OTTHUMG00000014142	ENST00000438998.2:c.89T>G	6.37:g.3259345T>G	ENSP00000413353:p.Val30Gly	Somatic		WXS	Illumina HiSeq	Phase_I	C9J2F8|F8WBZ2|Q5JS53|Q5JS56	Missense_Mutation	SNP	ENST00000438998.2	37	CCDS47361.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.37|18.37	3.609726|3.609726	0.66558|0.66558	.|.	.|.	ENSG00000180822|ENSG00000180822	ENST00000454610|ENST00000438998;ENST00000380305;ENST00000419065;ENST00000473000;ENST00000451246	.|.	.|.	.|.	4.8|4.8	4.8|4.8	0.61643|0.61643	.|.	.|0.161391	.|0.41396	.|D	.|0.000895	T|T	0.55970|0.55970	0.1954|0.1954	M|M	0.80183|0.80183	2.485|2.485	0.54753|0.54753	D|D	0.999982|0.999982	.|P;P;P	.|0.51351	.|0.739;0.944;0.904	.|B;P;P	.|0.50617	.|0.236;0.646;0.625	T|T	0.66164|0.66164	-0.5992|-0.5992	5|9	.|0.87932	.|D	.|0	-33.3244|-33.3244	7.5368|7.5368	0.27714|0.27714	0.0:0.1324:0.0:0.8676|0.0:0.1324:0.0:0.8676	.|.	.|30;30;30	.|Q5JS54;C9J2F8;F8WBZ2	.|PSMG4_HUMAN;.;.	A|G	18|30	.|.	.|ENSP00000424330:V30G	S|V	+|+	1|2	0|0	PSMG4|PSMG4	3204344|3204344	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	2.288000|2.288000	0.43514|0.43514	2.011000|2.011000	0.59026|0.59026	0.459000|0.459000	0.35465|0.35465	TCA|GTC		0.706	PSMG4-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039678.2		
KIAA1244	57221	bcgsc.ca	37	6	138583938	138583938	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr6:138583938C>T	ENST00000251691.4	+	12	1484	c.1318C>T	c.(1318-1320)Ctc>Ttc	p.L440F		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		CCTGGATGAGCTCAGCCAGGG	0.587																																						.											0													98.0	89.0	92.0					6																	138583938		2203	4300	6503	SO:0001583	missense	57221			AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.1318C>T	6.37:g.138583938C>T	ENSP00000251691:p.Leu440Phe	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000251691.4	37	CCDS5189.2	.	.	.	.	.	.	.	.	.	.	C	18.70	3.680008	0.68042	.	.	ENSG00000112379	ENST00000251691	T	0.05025	3.51	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.18467	0.0443	M	0.72894	2.215	0.58432	D	0.999991	D	0.76494	0.999	D	0.80764	0.994	T	0.00262	-1.1867	10	0.87932	D	0	-23.6865	17.8491	0.88739	0.0:1.0:0.0:0.0	.	440	Q5TH69	BIG3_HUMAN	F	440	ENSP00000251691:L440F	ENSP00000251691:L440F	L	+	1	0	KIAA1244	138625631	1.000000	0.71417	1.000000	0.80357	0.773000	0.43773	7.313000	0.78978	2.639000	0.89480	0.655000	0.94253	CTC		0.587	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042425.4	NM_020340	
ESRP1	54845	bcgsc.ca	37	8	95683886	95683886	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr8:95683886T>C	ENST00000433389.2	+	11	1629	c.1439T>C	c.(1438-1440)gTt>gCt	p.V480A	ESRP1_ENST00000423620.2_Missense_Mutation_p.V480A|ESRP1_ENST00000358397.5_Missense_Mutation_p.V480A|ESRP1_ENST00000454170.2_Missense_Mutation_p.V480A	NM_001034915.2|NM_017697.3	NP_001030087.2|NP_060167.2	Q6NXG1	ESRP1_HUMAN	epithelial splicing regulatory protein 1	480	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)		ESRP1/RAF1(4)	NS(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)|urinary_tract(2)	20						GTTCACATGGTTTTGAATCAC	0.383																																						.											0													41.0	40.0	40.0					8																	95683886		1907	4147	6054	SO:0001583	missense	54845			AK000178	CCDS47895.1, CCDS47896.1, CCDS47897.1, CCDS47898.1	8q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000104413	ENSG00000104413		"""RNA binding motif (RRM) containing"""	25966	protein-coding gene	gene with protein product		612959	"""RNA binding motif protein 35A"""	RBM35A		12477932	Standard	NM_017697		Approved	FLJ20171	uc003ygq.4	Q6NXG1	OTTHUMG00000164587	ENST00000433389.2:c.1439T>C	8.37:g.95683886T>C	ENSP00000405738:p.Val480Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A6NHA8|A8MPX1|E9PB47|Q2M2B0|Q499G3|Q6PJ86|Q9NXL8	Missense_Mutation	SNP	ENST00000433389.2	37	CCDS47897.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.473443	0.84640	.	.	ENSG00000104413	ENST00000423620;ENST00000433389;ENST00000358397;ENST00000454170;ENST00000517610	T;T;T;T;T	0.08807	3.05;3.05;3.05;3.05;3.05	4.98	4.98	0.66077	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.000000	0.85682	D	0.000000	T	0.29355	0.0731	M	0.75447	2.3	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.992;0.999;0.994;0.999;0.997;0.996	T	0.02813	-1.1107	10	0.72032	D	0.01	-14.9747	14.9737	0.71254	0.0:0.0:0.0:1.0	.	480;480;480;480;480;480	D7PBN3;Q6NXG1-4;Q6NXG1-2;E9PB47;Q6NXG1-3;Q6NXG1	.;.;.;.;.;ESRP1_HUMAN	A	480;480;480;480;339	ENSP00000407349:V480A;ENSP00000405738:V480A;ENSP00000351168:V480A;ENSP00000402766:V480A;ENSP00000429125:V339A	ENSP00000351168:V480A	V	+	2	0	ESRP1	95753062	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.040000	0.89188	1.981000	0.57761	0.460000	0.39030	GTT		0.383	ESRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379326.1	NM_017697	
SPTAN1	6709	bcgsc.ca	37	9	131388829	131388829	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8340-01A-11D-2310-10	TCGA-KL-8340-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d113ce88-04ab-4675-b363-92f80c28de34	44123123-63e3-46bd-85ee-c66a37c942a3	g.chr9:131388829T>C	ENST00000372731.4	+	48	6534	c.6424T>C	c.(6424-6426)Tct>Cct	p.S2142P	SPTAN1_ENST00000358161.5_Missense_Mutation_p.S2147P|SPTAN1_ENST00000372739.3_Missense_Mutation_p.S2147P	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	2142					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						CTCCCTCAGCTCTGCCCAGGC	0.597																																					NSCLC(120;833 1744 2558 35612 37579)	.											0													49.0	52.0	51.0					9																	131388829		2203	4300	6503	SO:0001583	missense	6709			M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.6424T>C	9.37:g.131388829T>C	ENSP00000361816:p.Ser2142Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Missense_Mutation	SNP	ENST00000372731.4	37	CCDS6905.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.268976	0.80469	.	.	ENSG00000197694	ENST00000358161;ENST00000372731;ENST00000372739;ENST00000372719;ENST00000372721	T;T;T	0.65549	-0.16;-0.16;-0.16	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.77532	0.4144	M	0.70595	2.14	0.80722	D	1	D;D;D	0.76494	0.999;0.981;0.99	D;D;D	0.68621	0.951;0.959;0.948	T	0.79876	-0.1618	10	0.62326	D	0.03	.	15.6721	0.77286	0.0:0.0:0.0:1.0	.	2122;2147;2142	Q13813-3;Q13813-2;Q13813	.;.;SPTA2_HUMAN	P	2147;2142;2147;2122;391	ENSP00000350882:S2147P;ENSP00000361816:S2142P;ENSP00000361824:S2147P	ENSP00000350882:S2147P	S	+	1	0	SPTAN1	130428650	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	7.698000	0.84413	2.099000	0.63709	0.460000	0.39030	TCT		0.597	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054472.1	NM_003127	
