#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ZNF436	80818	broad.mit.edu;hgsc.bcm.edu	37	1	23696027	23696028	+	5'Flank	INS	-	-	T	rs372720347|rs147377149		TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr1:23696027_23696028insT	ENST00000314011.4	-	0	0				C1orf213_ENST00000454117.1_Intron|C1orf213_ENST00000458053.1_Intron|C1orf213_ENST00000518821.1_Intron|C1orf213_ENST00000335648.3_Frame_Shift_Ins_p.L80fs|Y_RNA_ENST00000364535.1_RNA|ZNF436_ENST00000374608.3_5'Flank|C1orf213_ENST00000437367.2_Intron	NM_001077195.1	NP_001070663.1	Q9C0F3	ZN436_HUMAN	zinc finger protein 436						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;5.97e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000977)|KIRC - Kidney renal clear cell carcinoma(1967;0.00336)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		AATTCGTAGACTTGCAGGCGAA	0.564																																						.											0																																										SO:0001631	upstream_gene_variant	148898			AB051497	CCDS233.1	1p36	2013-01-08			ENSG00000125945	ENSG00000125945		"""Zinc fingers, C2H2-type"", ""-"""	20814	protein-coding gene	gene with protein product		611703				11214970	Standard	NM_001077195		Approved	KIAA1710, Zfp46	uc001bgt.3	Q9C0F3	OTTHUMG00000003232		1.37:g.23696029_23696029dupT	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_I	Q658I9	RNA	INS	ENST00000314011.4	37	CCDS233.1																																																																																				0.564	ZNF436-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008908.1	NM_030634	
HNF1B	6928	broad.mit.edu;hgsc.bcm.edu	37	17	36099508	36099510	+	In_Frame_Del	DEL	TTG	TTG	-			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	TTG	TTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr17:36099508_36099510delTTG	ENST00000225893.4	-	2	826_828	c.465_467delCAA	c.(463-468)aacaag>aag	p.N155del	HNF1B_ENST00000427275.2_In_Frame_Del_p.N155del|HNF1B_ENST00000560016.1_In_Frame_Del_p.N155del|HNF1B_ENST00000561193.1_In_Frame_Del_p.N155del	NM_000458.2|NM_001165923.1	NP_000449.1|NP_001159395.1	P35680	HNF1B_HUMAN	HNF1 homeobox B	155					anterior/posterior pattern specification (GO:0009952)|branching morphogenesis of an epithelial tube (GO:0048754)|embryonic digestive tract morphogenesis (GO:0048557)|endocrine pancreas development (GO:0031018)|endodermal cell fate specification (GO:0001714)|epithelial cell proliferation (GO:0050673)|genitalia development (GO:0048806)|hepatoblast differentiation (GO:0061017)|hindbrain development (GO:0030902)|inner cell mass cell differentiation (GO:0001826)|insulin secretion (GO:0030073)|kidney development (GO:0001822)|mesonephric duct formation (GO:0072181)|negative regulation of mesenchymal cell apoptotic process involved in mesonephric nephron morphogenesis (GO:0061296)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric nephron tubule development (GO:0039020)|pronephros development (GO:0048793)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of endodermal cell fate specification (GO:0042663)|regulation of pronephros size (GO:0035565)|regulation of Wnt signaling pathway (GO:0030111)|response to glucose (GO:0009749)|ureteric bud elongation (GO:0060677)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(6)|kidney(3)|large_intestine(2)|liver(1)|lung(3)|ovary(3)|prostate(1)|skin(2)	28		Breast(25;0.00765)|Ovarian(249;0.15)	STAD - Stomach adenocarcinoma(1;0.0142)			AGGGGTGCCCTTGTTGAGATGCT	0.542																																					Colon(71;102 1179 9001 27917 43397)	.											0			GRCh37	CM060487	HNF1B	M																																				SO:0001651	inframe_deletion	6928			BC017714	CCDS11324.1, CCDS58538.1	17q12	2014-05-06	2007-08-24	2007-08-24	ENSG00000108753	ENSG00000275410		"""Homeoboxes / HNF class"""	11630	protein-coding gene	gene with protein product		189907	"""transcription factor 2, hepatic; LF-B3; variant hepatic nuclear factor"""	TCF2		1677179, 10484768	Standard	NM_000458		Approved	LFB3, VHNF1, HNF1beta, MODY5	uc002hok.4	P35680	OTTHUMG00000188478	ENST00000225893.4:c.465_467delCAA	17.37:g.36099511_36099513delTTG	ENSP00000225893:p.Asn155del	Somatic		WXS	Illumina HiSeq	Phase_I	B4DKM3|E0YMJ9	In_Frame_Del	DEL	ENST00000225893.4	37	CCDS11324.1																																																																																				0.542	HNF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256807.3	NM_000458	
DSCAM	1826	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	21	41684190	41684190	+	Missense_Mutation	SNP	G	G	A	rs565609019		TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr21:41684190G>A	ENST00000400454.1	-	9	2357	c.1880C>T	c.(1879-1881)aCg>aTg	p.T627M		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	627	Ig-like C2-type 7.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				CCAGGTGATCGTGATGGGTAA	0.532													G|||	1	0.000199681	0.0	0.0	5008	,	,		15104	0.0		0.0	False		,,,				2504	0.001				Melanoma(134;970 1778 1785 21664 32388)	.											0													64.0	62.0	63.0					21																	41684190		1907	4135	6042	SO:0001583	missense	1826			AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.1880C>T	21.37:g.41684190G>A	ENSP00000383303:p.Thr627Met	Somatic		WXS	Illumina HiSeq	Phase_I	O60468	Missense_Mutation	SNP	ENST00000400454.1	37	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	G	15.74	2.921590	0.52653	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.68479	-0.33;-0.33	5.55	4.64	0.57946	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.259938	0.38959	N	0.001504	T	0.74779	0.3761	M	0.72118	2.19	0.30527	N	0.767845	D	0.56287	0.975	P	0.52758	0.708	T	0.75795	-0.3192	10	0.37606	T	0.19	.	16.2728	0.82629	0.0:0.1328:0.8672:0.0	.	627	O60469	DSCAM_HUMAN	M	627;379	ENSP00000383303:T627M;ENSP00000385342:T379M	ENSP00000383303:T627M	T	-	2	0	DSCAM	40606060	0.969000	0.33509	0.960000	0.40013	0.808000	0.45660	1.706000	0.37878	1.284000	0.44531	0.563000	0.77884	ACG		0.532	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
NDUFS1	4719	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	2	207008833	207008833	+	Missense_Mutation	SNP	C	C	G	rs137994727		TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr2:207008833C>G	ENST00000233190.6	-	10	1162	c.896G>C	c.(895-897)cGt>cCt	p.R299P	NDUFS1_ENST00000432169.1_Missense_Mutation_p.R188P|NDUFS1_ENST00000449699.1_Missense_Mutation_p.R299P|NDUFS1_ENST00000455934.2_Missense_Mutation_p.R313P|NDUFS1_ENST00000457011.1_Missense_Mutation_p.R183P|NDUFS1_ENST00000440274.1_Missense_Mutation_p.R263P|NDUFS1_ENST00000423725.1_Missense_Mutation_p.R242P	NM_005006.6	NP_004997.4	P28331	NDUS1_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)	299	4Fe-4S Mo/W bis-MGD-type. {ECO:0000255|PROSITE-ProRule:PRU01004}.				apoptotic mitochondrial changes (GO:0008637)|ATP metabolic process (GO:0046034)|cellular metabolic process (GO:0044237)|cellular respiration (GO:0045333)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|regulation of mitochondrial membrane potential (GO:0051881)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial respiratory chain complex I (GO:0005747)	2 iron, 2 sulfur cluster binding (GO:0051537)|4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(15)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						AAGTCTTTGACGTTTTAGCCC	0.368																																						.											0													101.0	98.0	99.0					2																	207008833		2203	4300	6503	SO:0001583	missense	4719				CCDS2366.1, CCDS56162.1, CCDS56163.1, CCDS56164.1, CCDS56165.1	2q33-q34	2011-07-04	2002-08-29		ENSG00000023228	ENSG00000023228	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7707	protein-coding gene	gene with protein product	"""complex I 75kDa subunit"", ""NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial"""	157655	"""NADH dehydrogenase (ubiquinone) Fe-S protein 1 (75kD) (NADH-coenzyme Q reductase)"""			1935949	Standard	NM_005006		Approved	CI-75k	uc010ziq.2	P28331	OTTHUMG00000132892	ENST00000233190.6:c.896G>C	2.37:g.207008833C>G	ENSP00000233190:p.Arg299Pro	Somatic		WXS	Illumina HiSeq	Phase_I	B4DIN9|B4DJA0|B4DPG1|B4DUC1|E7ENF3|Q53TR8|Q8N1C4|Q8TCC9	Missense_Mutation	SNP	ENST00000233190.6	37	CCDS2366.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.241323	0.79912	.	.	ENSG00000023228	ENST00000233190;ENST00000423725;ENST00000457011;ENST00000440274;ENST00000455934;ENST00000449699;ENST00000432169	D;D;D;D;D;D;D	0.81821	-1.54;-1.54;-1.54;-1.54;-1.54;-1.54;-1.54	5.87	4.04	0.47022	.	0.093926	0.64402	D	0.000001	D	0.90130	0.6916	M	0.89214	3.015	0.80722	D	1	P;D;D;D	0.89917	0.819;1.0;1.0;1.0	B;D;D;D	0.83275	0.19;0.996;0.996;0.993	D	0.90265	0.4303	10	0.59425	D	0.04	-23.6636	11.7113	0.51626	0.0:0.8093:0.1241:0.0665	.	188;263;313;299	B4DPG1;E7ENF3;B4DJA0;P28331	.;.;.;NDUS1_HUMAN	P	299;242;183;263;313;299;188	ENSP00000233190:R299P;ENSP00000397760:R242P;ENSP00000400976:R183P;ENSP00000409766:R263P;ENSP00000392709:R313P;ENSP00000399912:R299P;ENSP00000409689:R188P	ENSP00000233190:R299P	R	-	2	0	NDUFS1	206717078	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	7.744000	0.85034	0.801000	0.34066	0.591000	0.81541	CGT		0.368	NDUFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256391.4	NM_005006	
NPY2R	4887	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	4	156136035	156136035	+	Missense_Mutation	SNP	T	T	A			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr4:156136035T>A	ENST00000329476.3	+	2	1433	c.944T>A	c.(943-945)aTg>aAg	p.M315K	NPY2R_ENST00000506608.1_Missense_Mutation_p.M315K	NM_000910.2	NP_000901.1	P49146	NPY2R_HUMAN	neuropeptide Y receptor Y2	315					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral fear response (GO:0001662)|cardiac left ventricle morphogenesis (GO:0003214)|locomotory behavior (GO:0007626)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neurological system process (GO:0031645)|negative regulation of secretion (GO:0051048)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuropeptide signaling pathway (GO:0007218)|nitric oxide mediated signal transduction (GO:0007263)|outflow tract morphogenesis (GO:0003151)|positive regulation of cell adhesion (GO:0045785)|positive regulation of circadian sleep/wake cycle, non-REM sleep (GO:0046010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of peptide secretion (GO:0002793)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of sensory perception of pain (GO:0051930)|secretion (GO:0046903)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|neuropeptide Y receptor activity (GO:0004983)|peptide YY receptor activity (GO:0001601)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(17)|prostate(1)|skin(5)|urinary_tract(1)	36	all_hematologic(180;0.24)	Renal(120;0.0854)			Cysteamine(DB00847)	ATCATCGCCATGTGCTCCACT	0.537																																						.											0													125.0	99.0	108.0					4																	156136035		2203	4300	6503	SO:0001583	missense	4887			U42766	CCDS3791.1	4q31	2012-08-08				ENSG00000185149		"""GPCR / Class A : Neuropeptide receptors : Y"""	7957	protein-coding gene	gene with protein product		162642				7559383	Standard	NM_000910		Approved		uc003ioq.3	P49146		ENST00000329476.3:c.944T>A	4.37:g.156136035T>A	ENSP00000332591:p.Met315Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q13281|Q13457|Q4W5G7|Q6AZZ6|Q9UE67	Missense_Mutation	SNP	ENST00000329476.3	37	CCDS3791.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.026321	0.75390	.	.	ENSG00000185149	ENST00000329476;ENST00000506608	T;T	0.64803	-0.12;-0.12	5.86	5.86	0.93980	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.84320	0.5446	M	0.93197	3.39	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.88428	0.3033	10	0.87932	D	0	.	15.4267	0.75059	0.0:0.0:0.0:1.0	.	315	P49146	NPY2R_HUMAN	K	315	ENSP00000332591:M315K;ENSP00000426366:M315K	ENSP00000332591:M315K	M	+	2	0	NPY2R	156355485	1.000000	0.71417	1.000000	0.80357	0.804000	0.45430	8.040000	0.89188	2.236000	0.73375	0.523000	0.50628	ATG		0.537	NPY2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365128.1	NM_000910	
KIF2A	3796	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	5	61653554	61653554	+	Nonsense_Mutation	SNP	C	C	T			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr5:61653554C>T	ENST00000401507.3	+	8	1002	c.691C>T	c.(691-693)Cga>Tga	p.R231*	KIF2A_ENST00000509663.2_Intron|KIF2A_ENST00000407818.3_Nonsense_Mutation_p.R231*|KIF2A_ENST00000506857.1_Nonsense_Mutation_p.R185*|KIF2A_ENST00000381103.2_Nonsense_Mutation_p.R211*	NM_001243953.1|NM_004520.4	NP_001230882.1|NP_004511.2	O00139	KIF2A_HUMAN	kinesin heavy chain member 2A	231	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|nervous system development (GO:0007399)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	15		Lung NSC(810;8.94e-06)|Prostate(74;0.0132)|Ovarian(174;0.051)|Breast(144;0.077)		Lung(70;0.14)		TGTAAGAAAACGACCACTCAA	0.254																																						.											0													75.0	79.0	78.0					5																	61653554		2201	4297	6498	SO:0001587	stop_gained	3796			BC031828	CCDS3980.2, CCDS47216.1, CCDS58949.1	5q12-q13	2008-02-05	2006-09-26	2006-09-26	ENSG00000068796	ENSG00000068796		"""Kinesins"""	6318	protein-coding gene	gene with protein product		602591	"""kinesin heavy chain member 2"""	KIF2		9177777	Standard	NM_001098511		Approved	HK2	uc003jsz.4	O00139	OTTHUMG00000097755	ENST00000401507.3:c.691C>T	5.37:g.61653554C>T	ENSP00000385622:p.Arg231*	Somatic		WXS	Illumina HiSeq	Phase_I	A5YM42|A5YM54|B4DY54|D3DW97|E9PB70|Q7Z5I3|Q8N5Q7	Nonsense_Mutation	SNP	ENST00000401507.3	37	CCDS3980.2	.	.	.	.	.	.	.	.	.	.	C	38	7.152452	0.98099	.	.	ENSG00000068796	ENST00000401507;ENST00000381103;ENST00000514082;ENST00000407818;ENST00000506857	.	.	.	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.9318	0.92570	0.0:1.0:0.0:0.0	.	.	.	.	X	231;211;212;231;185	.	ENSP00000370493:R211X	R	+	1	2	KIF2A	61689311	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.421000	0.59848	2.459000	0.83118	0.585000	0.79938	CGA		0.254	KIF2A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317989.1	NM_004520	
KCNK5	8645	hgsc.bcm.edu	37	6	39159435	39159435	+	Nonsense_Mutation	SNP	C	C	T			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr6:39159435C>T	ENST00000359534.3	-	5	1069	c.731G>A	c.(730-732)tGg>tAg	p.W244*		NM_003740.3	NP_003731.1	O95279	KCNK5_HUMAN	potassium channel, subfamily K, member 5	244					excretion (GO:0007588)|potassium ion transport (GO:0006813)	integral component of plasma membrane (GO:0005887)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(4)|skin(3)	19						GCTCACCTTCCAGTTGACAAA	0.587																																						.											0													83.0	92.0	89.0					6																	39159435		2203	4300	6503	SO:0001587	stop_gained	8645			AF084830	CCDS4841.1	6p21	2012-03-07			ENSG00000164626	ENSG00000164626		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6280	protein-coding gene	gene with protein product		603493				9812978, 16382106	Standard	XM_005249456		Approved	K2p5.1, TASK-2	uc003oon.3	O95279	OTTHUMG00000014642	ENST00000359534.3:c.731G>A	6.37:g.39159435C>T	ENSP00000352527:p.Trp244*	Somatic		WXS	Illumina HiSeq	Phase_I	B2RAQ6|B5TJL2|Q5VV76	Nonsense_Mutation	SNP	ENST00000359534.3	37	CCDS4841.1	.	.	.	.	.	.	.	.	.	.	C	39	7.558550	0.98358	.	.	ENSG00000164626	ENST00000359534	.	.	.	5.27	5.27	0.74061	.	0.691332	0.14594	N	0.310056	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.2502	0.93921	0.0:1.0:0.0:0.0	.	.	.	.	X	244	.	ENSP00000352527:W244X	W	-	2	0	KCNK5	39267413	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.880000	0.69698	2.619000	0.88677	0.561000	0.74099	TGG		0.587	KCNK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040449.1	NM_003740	
DST	667	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	6	56480802	56480802	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr6:56480802C>T	ENST00000370765.6	-	24	7570	c.7463G>A	c.(7462-7464)gGc>gAc	p.G2488D	DST_ENST00000361203.3_Intron|DST_ENST00000244364.6_Intron|DST_ENST00000446842.2_Intron|DST_ENST00000312431.6_Intron|DST_ENST00000370788.2_Intron|DST_ENST00000421834.2_Intron|DST_ENST00000370769.4_Intron|DST_ENST00000370754.5_Intron	NM_001723.5	NP_001714.1	Q03001	DYST_HUMAN	dystonin	1784					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			ATCAATTATGCCCCCTGTACT	0.517																																						.											0													71.0	77.0	75.0					6																	56480802		2203	4300	6503	SO:0001583	missense	667			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000370765.6:c.7463G>A	6.37:g.56480802C>T	ENSP00000359801:p.Gly2488Asp	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000370765.6	37	CCDS4959.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.322255	0.81580	.	.	ENSG00000151914	ENST00000370765	D	0.86030	-2.06	5.94	5.94	0.96194	.	.	.	.	.	D	0.92341	0.7570	.	.	.	0.35699	D	0.815492	D	0.89917	1.0	D	0.97110	1.0	D	0.91303	0.5068	7	0.52906	T	0.07	.	20.3593	0.98849	0.0:1.0:0.0:0.0	.	2488	Q03001-3	.	D	2488	ENSP00000359801:G2488D	ENSP00000359801:G2488D	G	-	2	0	DST	56588761	1.000000	0.71417	0.990000	0.47175	0.960000	0.62799	7.818000	0.86416	2.822000	0.97130	0.557000	0.71058	GGC		0.517	DST-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041027.2	NM_001723	
RINT1	60561	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	7	105182935	105182935	+	Silent	SNP	T	T	C			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr7:105182935T>C	ENST00000257700.2	+	4	585	c.354T>C	c.(352-354)aaT>aaC	p.N118N	RINT1_ENST00000477285.1_3'UTR	NM_021930.4	NP_068749.3	Q6NUQ1	RINT1_HUMAN	RAD50 interactor 1	118					G2 DNA damage checkpoint (GO:0031572)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						AATTTCTTAATCAGTTTCTGG	0.378																																						.											0													96.0	98.0	97.0					7																	105182935		2203	4300	6503	SO:0001819	synonymous_variant	60561			AF317622	CCDS34726.1	7q22.2	2007-05-03			ENSG00000135249	ENSG00000135249			21876	protein-coding gene	gene with protein product		610089				11096100, 15029241	Standard	NM_021930		Approved	FLJ11785, RINT-1	uc003vda.1	Q6NUQ1	OTTHUMG00000157400	ENST00000257700.2:c.354T>C	7.37:g.105182935T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q75MG9|Q75MH0|Q96IW8|Q9H229|Q9HAD9	Silent	SNP	ENST00000257700.2	37	CCDS34726.1																																																																																				0.378	RINT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348686.1	NM_021930	
SLCO1B7	338821	hgsc.bcm.edu	37	12	21168673	21168673	+	Missense_Mutation	SNP	C	C	T	rs560786449		TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr12:21168673C>T	ENST00000421593.2	+	1	44	c.44C>T	c.(43-45)tCc>tTc	p.S15F	SLCO1B3_ENST00000553473.1_Intron|SLCO1B7_ENST00000554957.1_Intron|LST3_ENST00000381541.3_Intron|LST3_ENST00000540229.1_Intron	NM_001009562.4	NP_001009562.3	G3V0H7	SO1B7_HUMAN	solute carrier organic anion transporter family, member 1B7 (non-functional)	15						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(25)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	46						TTTGAGATATCCTCTTCTCTT	0.308													C|||	1	0.000199681	0.0008	0.0	5008	,	,		14693	0.0		0.0	False		,,,				2504	0.0					.											0													81.0	81.0	81.0					12																	21168673		2149	4285	6434	SO:0001583	missense	338821			AF401642	CCDS44843.1	12p12.3	2013-05-22			ENSG00000205754	ENSG00000205754		"""Solute carriers"""	32934	protein-coding gene	gene with protein product							Standard	NM_001009562		Approved	LST3, SLC21A21		G3V0H7	OTTHUMG00000169045	ENST00000421593.2:c.44C>T	12.37:g.21168673C>T	ENSP00000394168:p.Ser15Phe	Somatic		WXS	Illumina HiSeq	Phase_I	Q71QF0	Missense_Mutation	SNP	ENST00000421593.2	37	CCDS44843.1	.	.	.	.	.	.	.	.	.	.	.	13.32	2.201898	0.38905	.	.	ENSG00000205754	ENST00000421593	D	0.85171	-1.95	2.68	2.68	0.31781	.	0.613533	0.18029	N	0.153991	D	0.92011	0.7469	M	0.86502	2.82	0.80722	D	1	D	0.59357	0.985	D	0.65987	0.94	D	0.92969	0.6396	10	0.87932	D	0	.	12.7175	0.57123	0.0:1.0:0.0:0.0	.	15	G3V0H7	.	F	15	ENSP00000394168:S15F	ENSP00000394168:S15F	S	+	2	0	SLCO1B7	21059940	0.541000	0.26417	0.931000	0.37212	0.210000	0.24377	6.583000	0.74053	1.476000	0.48215	0.407000	0.27541	TCC		0.308	SLCO1B7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402066.1	NM_001009562	
CDH11	1009	hgsc.bcm.edu	37	16	65006841	65006841	+	Silent	SNP	G	G	T			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr16:65006841G>T	ENST00000268603.4	-	9	1971	c.1356C>A	c.(1354-1356)gcC>gcA	p.A452A	CDH11_ENST00000394156.3_Silent_p.A452A|CDH11_ENST00000566827.1_Silent_p.A326A	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	452	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		TGTTGAGCCAGGCTGTTTCCT	0.388			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																												.		Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	0													132.0	133.0	132.0					16																	65006841		2203	4300	6503	SO:0001819	synonymous_variant	1009			D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.1356C>A	16.37:g.65006841G>T		Somatic		WXS	Illumina HiSeq	Phase_I	A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Silent	SNP	ENST00000268603.4	37	CCDS10803.1																																																																																				0.388	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268755.1	NM_033664	
MEF2C	4208	hgsc.bcm.edu	37	5	88025096	88025096	+	Silent	SNP	A	A	G			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr5:88025096A>G	ENST00000437473.2	-	9	1320	c.903T>C	c.(901-903)ccT>ccC	p.P301P	MEF2C_ENST00000504921.2_Silent_p.P301P|MEF2C_ENST00000340208.5_Silent_p.P311P|MEF2C_ENST00000514028.1_Silent_p.P301P|MEF2C_ENST00000424173.2_Silent_p.P291P|MEF2C_ENST00000506554.1_Silent_p.P301P|MEF2C_ENST00000514015.1_Silent_p.P301P|MEF2C_ENST00000503554.1_5'Flank|MEF2C_ENST00000508569.1_Silent_p.P293P|MEF2C_ENST00000510942.1_Silent_p.P293P|MEF2C_ENST00000539796.1_Silent_p.P245P	NM_001193350.1|NM_002397.4	NP_001180279.1|NP_002388.2	Q06413	MEF2C_HUMAN	myocyte enhancer factor 2C	301					apoptotic process (GO:0006915)|B cell homeostasis (GO:0001782)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac ventricle formation (GO:0003211)|cartilage morphogenesis (GO:0060536)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|cellular response to fluid shear stress (GO:0071498)|cellular response to glucose stimulus (GO:0071333)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to trichostatin A (GO:0035984)|chondrocyte differentiation (GO:0002062)|dentate gyrus development (GO:0021542)|embryonic viscerocranium morphogenesis (GO:0048703)|endochondral ossification (GO:0001958)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|germinal center formation (GO:0002467)|glomerulus morphogenesis (GO:0072102)|heart development (GO:0007507)|heart looping (GO:0001947)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|MAPK cascade (GO:0000165)|melanocyte differentiation (GO:0030318)|monocyte differentiation (GO:0030224)|muscle cell differentiation (GO:0042692)|muscle cell fate determination (GO:0007521)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myotube differentiation (GO:0014902)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of ossification (GO:0030279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nephron tubule epithelial cell differentiation (GO:0072160)|nervous system development (GO:0007399)|neural crest cell differentiation (GO:0014033)|neuron development (GO:0048666)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoblast differentiation (GO:0001649)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|platelet formation (GO:0030220)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primary heart field specification (GO:0003138)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of dendritic spine development (GO:0060998)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of germinal center formation (GO:0002634)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron apoptotic process (GO:0043523)|regulation of neurotransmitter secretion (GO:0046928)|regulation of sarcomere organization (GO:0060297)|regulation of synapse assembly (GO:0051963)|regulation of synaptic activity (GO:0060025)|regulation of synaptic plasticity (GO:0048167)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|renal tubule morphogenesis (GO:0061333)|response to ischemia (GO:0002931)|response to virus (GO:0009615)|response to vitamin E (GO:0033197)|secondary heart field specification (GO:0003139)|sinoatrial valve morphogenesis (GO:0003185)|skeletal muscle tissue development (GO:0007519)|smooth muscle cell differentiation (GO:0051145)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|sarcomere (GO:0030017)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|miRNA binding (GO:0035198)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	40		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)		CTGGTAAAGTAGGAGTTGCTA	0.398										HNSCC(66;0.2)																												.											0													74.0	82.0	80.0					5																	88025096		1860	4108	5968	SO:0001819	synonymous_variant	4208			AL833268	CCDS47244.1, CCDS47245.1, CCDS54877.1, CCDS54878.1	5q14.3	2013-07-03	2007-04-24		ENSG00000081189	ENSG00000081189		"""Myocyte enhancer factors"""	6996	protein-coding gene	gene with protein product		600662				8455629	Standard	NM_002397		Approved		uc003kjl.3	Q06413	OTTHUMG00000162634	ENST00000437473.2:c.903T>C	5.37:g.88025096A>G		Somatic		WXS	Illumina HiSeq	Phase_I	C9JMZ0|D7F7N5|F8W7V7	Silent	SNP	ENST00000437473.2	37	CCDS47245.1																																																																																				0.398	MEF2C-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000369817.1	NM_002397	
CLCNKB	1188	broad.mit.edu	37	1	16383402	16383402	+	Silent	SNP	C	C	T	rs6698427		TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr1:16383402C>T	ENST00000375679.4	+	20	2166	c.2055C>T	c.(2053-2055)gcC>gcT	p.A685A	CLCNKB_ENST00000375667.3_Silent_p.A515A|FAM131C_ENST00000494078.1_5'Flank	NM_000085.4	NP_000076.2	P51801	CLCKB_HUMAN	chloride channel, voltage-sensitive Kb	685					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|metal ion binding (GO:0046872)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)|skin(6)|stomach(2)|urinary_tract(1)	21		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		ATCCGCCAGCCCCAAAGTGAG	0.587																																						.											0													66.0	64.0	65.0					1																	16383402		2203	4300	6503	SO:0001819	synonymous_variant	1188			AK098217	CCDS168.1, CCDS57974.1	1p36	2012-09-26	2012-02-23		ENSG00000184908	ENSG00000184908		"""Ion channels / Chloride channels : Voltage-sensitive"""	2027	protein-coding gene	gene with protein product		602023	"""chloride channel Kb"""				Standard	NM_000085		Approved	hClC-Kb		P51801	OTTHUMG00000009530	ENST00000375679.4:c.2055C>T	1.37:g.16383402C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B3KUY3|Q5T5Q7|Q5T5Q8	Silent	SNP	ENST00000375679.4	37	CCDS168.1																																																																																				0.587	CLCNKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026331.1	NM_000085	
Unknown	0	broad.mit.edu	37	1	16975451	16975451	+	IGR	SNP	G	G	A	rs377221418		TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr1:16975451G>A								CROCCP2 (14397 upstream) : RNU1-3 (17828 downstream)																							CGCGTGGCTGGGGGCCATCCG	0.597																																						.											0																																										SO:0001628	intergenic_variant	11209																															1.37:g.16975451G>A		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	SNP		37																																																																																				0	0.597								
ODF2L	57489	broad.mit.edu	37	1	86826142	86826142	+	Frame_Shift_Del	DEL	T	T	-	rs372782838		TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr1:86826142delT	ENST00000359242.3	-	12	1502	c.1221delA	c.(1219-1221)aaafs	p.K407fs	ODF2L_ENST00000317336.7_Frame_Shift_Del_p.K407fs|ODF2L_ENST00000394731.1_Frame_Shift_Del_p.K247fs|ODF2L_ENST00000370567.1_Frame_Shift_Del_p.K378fs|ODF2L_ENST00000370566.3_Frame_Shift_Del_p.K378fs|ODF2L_ENST00000524695.1_5'UTR|ODF2L_ENST00000294678.2_Frame_Shift_Del_p.K378fs	NM_001007022.2	NP_001007023.2	Q9ULJ1	ODF2L_HUMAN	outer dense fiber of sperm tails 2-like	407						centrosome (GO:0005813)		p.K378fs*22(2)		endometrium(2)|kidney(2)|large_intestine(10)|lung(6)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	24				all cancers(265;0.0313)|Epithelial(280;0.0611)		GGGTTTTCTGTTTTTTTTCTA	0.289																																						.											2	Deletion - Frameshift(2)	lung(2)											87.0	92.0	90.0					1																	86826142		2202	4293	6495	SO:0001589	frameshift_variant	57489				CCDS30763.1, CCDS41354.1, CCDS30763.2, CCDS41354.2, CCDS53339.1	1p22.3	2008-02-05			ENSG00000122417	ENSG00000122417			29225	protein-coding gene	gene with protein product						10574462	Standard	NM_020729		Approved	KIAA1229	uc001dll.2	Q9ULJ1	OTTHUMG00000010080	ENST00000359242.3:c.1221delA	1.37:g.86826142delT	ENSP00000359600:p.Lys407fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8MU56|B4E037|Q05C40|Q5BJG5|Q5TBX3|Q5TBX4|Q86X31	Frame_Shift_Del	DEL	ENST00000359242.3	37	CCDS41354.2																																																																																				0.289	ODF2L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027873.2		
OR5M9	390162	broad.mit.edu	37	11	56230641	56230641	+	Missense_Mutation	SNP	C	C	A			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr11:56230641C>A	ENST00000279791.1	-	1	236	c.237G>T	c.(235-237)atG>atT	p.M79I		NM_001004743.1	NP_001004743.1	Q8NGP3	OR5M9_HUMAN	olfactory receptor, family 5, subfamily M, member 9	79						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	36	Esophageal squamous(21;0.00448)					AGTTTTCCAGCATTTTGGGGG	0.453																																						.											0													87.0	89.0	89.0					11																	56230641		2201	4296	6497	SO:0001583	missense	390162			AB065747	CCDS31531.1	11q11	2012-08-09			ENSG00000150269	ENSG00000150269		"""GPCR / Class A : Olfactory receptors"""	15294	protein-coding gene	gene with protein product							Standard	NM_001004743		Approved		uc010rjj.2	Q8NGP3	OTTHUMG00000166874	ENST00000279791.1:c.237G>T	11.37:g.56230641C>A	ENSP00000279791:p.Met79Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IEW5|Q96RB9	Missense_Mutation	SNP	ENST00000279791.1	37	CCDS31531.1	.	.	.	.	.	.	.	.	.	.	C	14.06	2.423338	0.43020	.	.	ENSG00000150269	ENST00000279791	T	0.05513	3.43	4.85	4.85	0.62838	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000034	T	0.10380	0.0254	L	0.58510	1.815	0.31057	N	0.714523	P	0.35226	0.491	B	0.35971	0.215	T	0.01935	-1.1244	10	0.87932	D	0	-37.1441	15.8179	0.78618	0.0:1.0:0.0:0.0	.	79	Q8NGP3	OR5M9_HUMAN	I	79	ENSP00000279791:M79I	ENSP00000279791:M79I	M	-	3	0	OR5M9	55987217	0.000000	0.05858	1.000000	0.80357	0.763000	0.43281	0.307000	0.19296	2.394000	0.81467	0.549000	0.68633	ATG		0.453	OR5M9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391638.1	NM_001004743	
IL18BP	10068	broad.mit.edu	37	11	71715034	71715034	+	IGR	SNP	T	T	G			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr11:71715034T>G	ENST00000393703.4	+	0	1788				NUMA1_ENST00000358965.6_Missense_Mutation_p.N2065H|NUMA1_ENST00000351960.6_Missense_Mutation_p.N943H|NUMA1_ENST00000393695.3_Missense_Mutation_p.N2079H	NM_001039660.1	NP_001034749.1	O95998	I18BP_HUMAN	interleukin 18 binding protein						cellular response to hydrogen peroxide (GO:0070301)|cellular response to tumor necrosis factor (GO:0071356)|extracellular negative regulation of signal transduction (GO:1900116)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	interleukin-18 binding (GO:0042007)|receptor antagonist activity (GO:0048019)			endometrium(2)|kidney(1)|large_intestine(3)|lung(1)	7						CTGCGAGTGTTGGGGGAAGCC	0.642																																						.											0													68.0	79.0	75.0					11																	71715034		2200	4293	6493	SO:0001628	intergenic_variant	4926			AF110798	CCDS8206.2, CCDS44666.1	11q13	2013-01-11			ENSG00000137496	ENSG00000137496		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5987	protein-coding gene	gene with protein product	"""MC51L-53L-54L homolog gene product"""	604113				10023777	Standard	NM_001145055		Approved	IL18BPa	uc001orf.1	O95998	OTTHUMG00000133713		11.37:g.71715034T>G		Somatic		WXS	Illumina HiSeq	Phase_I	B3KUZ0|B7WPK4|O95993|O96027|Q9NZA9|Q9UBR7	Missense_Mutation	SNP	ENST00000393703.4	37	CCDS8206.2	.	.	.	.	.	.	.	.	.	.	T	15.27	2.785011	0.49997	.	.	ENSG00000137497	ENST00000351960;ENST00000358965;ENST00000393695;ENST00000359652;ENST00000536544	T;T;T	0.18338	2.22;2.7;2.7	4.94	3.79	0.43588	.	0.757314	0.12099	N	0.499697	T	0.20659	0.0497	N	0.14661	0.345	0.30119	N	0.80582	P;P;P;D	0.64830	0.547;0.514;0.547;0.994	B;B;B;P	0.62560	0.346;0.351;0.346;0.904	T	0.05273	-1.0895	10	0.54805	T	0.06	.	8.8246	0.35047	0.0:0.0:0.3009:0.6991	.	2085;2065;2079;943	Q4LE64;Q14980-2;Q14980;Q9BTE9	.;.;NUMA1_HUMAN;.	H	943;2065;2079;1628;1052	ENSP00000260051:N943H;ENSP00000351851:N2065H;ENSP00000377298:N2079H	ENSP00000260051:N943H	N	-	1	0	NUMA1	71392682	0.004000	0.15560	0.959000	0.39883	0.398000	0.30690	1.487000	0.35540	2.081000	0.62600	0.533000	0.62120	AAC		0.642	IL18BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000258012.2	NM_173042	
MYH7	4625	broad.mit.edu;mdanderson.org	37	14	23892897	23892897	+	Missense_Mutation	SNP	A	A	T	rs140244068		TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr14:23892897A>T	ENST00000355349.3	-	24	3120	c.2958T>A	c.(2956-2958)gaT>gaA	p.D986E		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	986					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		CAATGATCTCATCCAGCCCAG	0.552																																						.											0													152.0	144.0	147.0					14																	23892897		2203	4300	6503	SO:0001583	missense	4625			M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.2958T>A	14.37:g.23892897A>T	ENSP00000347507:p.Asp986Glu	Somatic		WXS	Illumina HiSeq	Phase_I	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	ENST00000355349.3	37	CCDS9601.1	.	.	.	.	.	.	.	.	.	.	A	18.20	3.571521	0.65765	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.88664	-2.41	5.06	-3.3	0.05003	.	.	.	.	.	T	0.82268	0.5000	N	0.20483	0.58	0.40115	D	0.976535	P	0.39282	0.666	P	0.45712	0.491	T	0.75010	-0.3468	9	0.42905	T	0.14	.	11.5747	0.50854	0.6067:0.0:0.3933:0.0	.	986	P12883	MYH7_HUMAN	E	986	ENSP00000347507:D986E	ENSP00000347507:D986E	D	-	3	2	MYH7	22962737	0.743000	0.28239	0.990000	0.47175	0.962000	0.63368	0.029000	0.13666	-0.447000	0.07138	-0.290000	0.09829	GAT		0.552	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257	
SOS2	6655	broad.mit.edu;mdanderson.org	37	14	50626456	50626456	+	Silent	SNP	T	T	A			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr14:50626456T>A	ENST00000216373.5	-	10	1819	c.1545A>T	c.(1543-1545)gtA>gtT	p.V515V	SOS2_ENST00000555794.1_5'UTR|SOS2_ENST00000543680.1_Silent_p.V482V	NM_006939.2	NP_008870.2	Q07890	SOS2_HUMAN	son of sevenless homolog 2 (Drosophila)	515	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	DNA binding (GO:0003677)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(16)|ovary(2)|skin(1)	39	all_epithelial(31;0.000822)|Breast(41;0.0065)					CATCTTTGGATACTAATTCAA	0.343																																						.											0													86.0	88.0	87.0					14																	50626456		2203	4300	6503	SO:0001819	synonymous_variant	6655			L13858	CCDS9697.1	14q21	2013-01-10	2001-12-04		ENSG00000100485	ENSG00000100485		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11188	protein-coding gene	gene with protein product		601247	"""son of sevenless (Drosophilia) homolog 2"""			8276400	Standard	NM_006939		Approved		uc001wxs.4	Q07890	OTTHUMG00000140292	ENST00000216373.5:c.1545A>T	14.37:g.50626456T>A		Somatic		WXS	Illumina HiSeq	Phase_I	B7ZKT6|D3DSB4|Q15503|Q17RN1	Silent	SNP	ENST00000216373.5	37	CCDS9697.1																																																																																				0.343	SOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276878.2		
EXOC3L4	91828	broad.mit.edu;ucsc.edu	37	14	103576543	103576543	+	Silent	SNP	C	C	T			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr14:103576543C>T	ENST00000380069.3	+	11	2228	c.2152C>T	c.(2152-2154)Ctg>Ttg	p.L718L		NM_001077594.1	NP_001071062.1	Q17RC7	EX3L4_HUMAN	exocyst complex component 3-like 4	718					exocytosis (GO:0006887)	exocyst (GO:0000145)				cervix(2)|endometrium(2)|lung(4)|ovary(1)|skin(1)	10						CATGGCTGTGCTGATCACCTG	0.692																																						.											0													8.0	8.0	8.0					14																	103576543		2011	3950	5961	SO:0001819	synonymous_variant	91828			AK000671	CCDS32163.1	14q32.32	2011-01-31	2011-01-31	2011-01-31	ENSG00000205436	ENSG00000205436			20120	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 73"""	C14orf73			Standard	NM_001077594		Approved		uc001ymk.3	Q17RC7		ENST00000380069.3:c.2152C>T	14.37:g.103576543C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q14CR2	Silent	SNP	ENST00000380069.3	37	CCDS32163.1																																																																																				0.692	EXOC3L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415663.1	XM_941093	
HERC2P2	400322	broad.mit.edu	37	15	23283056	23283064	+	RNA	DEL	CCCGCTCTT	CCCGCTCTT	-	rs201936350	byFrequency	TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	CCCGCTCTT	CCCGCTCTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr15:23283056_23283064delCCCGCTCTT	ENST00000560464.1	-	0	5186_5194									hect domain and RLD 2 pseudogene 2																		ATCTTCCTGACCCGCTCTTCACAGTCTTC	0.526														926	0.184904	0.4584	0.0879	5008	,	,		21653	0.0982		0.0726	False		,,,				2504	0.089					.											0																																												400322			AF041080		15q11.2	2014-03-18			ENSG00000140181				4870	pseudogene	pseudogene						9730612	Standard	NR_002824		Approved	D15F37S3	uc001yvq.2		OTTHUMG00000171926		15.37:g.23283056_23283064delCCCGCTCTT		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	DEL	ENST00000560464.1	37																																																																																					0.526	HERC2P2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000415936.1		
CHAC1	79094	broad.mit.edu	37	15	41247647	41247647	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr15:41247647A>G	ENST00000446533.3	+	3	779	c.470A>G	c.(469-471)gAg>gGg	p.E157G	CHAC1_ENST00000487220.1_5'UTR|CHAC1_ENST00000444189.2_Intron	NM_001142776.1|NM_024111.3	NP_001136248.1|NP_077016.2	Q9BUX1	CHAC1_HUMAN	ChaC, cation transport regulator homolog 1 (E. coli)	157					intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of protein processing (GO:0010955)|neurogenesis (GO:0022008)|Notch signaling pathway (GO:0007219)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|trans-Golgi network (GO:0005802)	Notch binding (GO:0005112)			endometrium(1)|large_intestine(1)|skin(1)	3		all_cancers(109;1.42e-13)|all_epithelial(112;1.48e-11)|Lung NSC(122;5.77e-09)|all_lung(180;1.08e-07)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;2.66e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.163)		AATGTGCGAGAGGCAGTGCTT	0.577																																						.											0													219.0	167.0	185.0					15																	41247647		2203	4299	6502	SO:0001583	missense	79094			BC019625	CCDS10070.2, CCDS45233.1	15q15.1	2013-09-12	2006-09-12		ENSG00000128965	ENSG00000128965			28680	protein-coding gene	gene with protein product	"""gamma-GCT acting on glutathione homolog 1"""	614587	"""ChaC, cation transport regulator-like 1 (E. coli)"""			23070364	Standard	NM_024111		Approved	MGC4504	uc001znh.2	Q9BUX1	OTTHUMG00000130208	ENST00000446533.3:c.470A>G	15.37:g.41247647A>G	ENSP00000398105:p.Glu157Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q0VIA0	Missense_Mutation	SNP	ENST00000446533.3	37	CCDS10070.2	.	.	.	.	.	.	.	.	.	.	A	18.28	3.589030	0.66105	.	.	ENSG00000128965	ENST00000446533	T	0.72942	-0.7	6.03	6.03	0.97812	Butirosin biosynthesis, BtrG-like (1);	0.046444	0.85682	D	0.000000	D	0.90383	0.6990	H	0.97874	4.095	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93794	0.7095	10	0.87932	D	0	-30.8996	16.5655	0.84588	1.0:0.0:0.0:0.0	.	157	Q9BUX1	CHAC1_HUMAN	G	157	ENSP00000398105:E157G	ENSP00000398105:E157G	E	+	2	0	CHAC1	39034939	1.000000	0.71417	0.842000	0.33263	0.012000	0.07955	9.271000	0.95698	2.302000	0.77476	0.533000	0.62120	GAG		0.577	CHAC1-001	KNOWN	downstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252526.3	NM_024111	
ACSF3	197322	broad.mit.edu;bcgsc.ca	37	16	89167160	89167160	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr16:89167160C>T	ENST00000317447.4	+	3	448	c.71C>T	c.(70-72)gCg>gTg	p.A24V	ACSF3_ENST00000406948.3_Missense_Mutation_p.A24V|ACSF3_ENST00000378345.4_Intron	NM_001127214.2|NM_001243279.1|NM_001284316.1|NM_174917.3	NP_001120686.1|NP_001230208.1|NP_001271245.1|NP_777577.2	Q4G176	ACSF3_HUMAN	acyl-CoA synthetase family member 3	24					fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|malonate catabolic process (GO:0090410)	mitochondrion (GO:0005739)	acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)|malonyl-CoA synthetase activity (GO:0090409)			central_nervous_system(1)|endometrium(1)|kidney(2)|lung(9)|prostate(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(80;0.0281)		CTGGCGCCTGCGAGACACAGA	0.677																																						.											0													18.0	21.0	20.0					16																	89167160		2187	4275	6462	SO:0001583	missense	197322			AK075499	CCDS10974.1, CCDS73926.1	16q24.3	2013-01-15			ENSG00000176715	ENSG00000176715		"""Acyl-CoA synthetase family"""	27288	protein-coding gene	gene with protein product	"""malonyl-CoA synthetase"""	614245				17762044, 21846720	Standard	XM_005256293		Approved		uc010cig.2	Q4G176	OTTHUMG00000138044	ENST00000317447.4:c.71C>T	16.37:g.89167160C>T	ENSP00000320646:p.Ala24Val	Somatic		WXS	Illumina HiSeq	Phase_I	A8K4J8|C9JQL6|Q6INA0|Q8N2F7	Missense_Mutation	SNP	ENST00000317447.4	37	CCDS10974.1	.	.	.	.	.	.	.	.	.	.	C	8.492	0.862167	0.17178	.	.	ENSG00000176715	ENST00000317447;ENST00000537290;ENST00000406948	T;T;T	0.55588	0.94;0.51;0.94	5.02	-2.79	0.05841	.	8.160970	0.00166	N	0.000000	T	0.21267	0.0512	N	0.02539	-0.55	0.09310	N	1	B	0.14805	0.011	B	0.04013	0.001	T	0.27571	-1.0070	10	0.06236	T	0.91	0.3531	3.8312	0.08874	0.1036:0.3059:0.4224:0.1682	.	24	Q4G176	ACSF3_HUMAN	V	24	ENSP00000320646:A24V;ENSP00000440734:A24V;ENSP00000384627:A24V	ENSP00000320646:A24V	A	+	2	0	ACSF3	87694661	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.995000	0.03712	-0.559000	0.06110	-1.027000	0.02421	GCG		0.677	ACSF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269919.1	NM_174917	
TP53	7157	broad.mit.edu	37	17	7578212	7578212	+	Nonsense_Mutation	SNP	G	G	A	rs397516436		TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr17:7578212G>A	ENST00000269305.4	-	6	826	c.637C>T	c.(637-639)Cga>Tga	p.R213*	TP53_ENST00000359597.4_Nonsense_Mutation_p.R213*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R213*|TP53_ENST00000574684.1_Intron|TP53_ENST00000445888.2_Nonsense_Mutation_p.R213*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R213*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R213*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	213	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R213*(250)|p.R81*(21)|p.R120*(21)|p.0?(8)|p.?(5)|p.R213G(5)|p.R213fs*35(3)|p.R213fs*34(3)|p.D208_V216delDRNTFRHSV(1)|p.R120G(1)|p.D207_R213delDDRNTFR(1)|p.T211_S215delTFRHS(1)|p.R81fs*>11(1)|p.D208fs*1(1)|p.R120fs*35(1)|p.R81G(1)|p.R209_R213delRNTFR(1)|p.R213fs*2(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213R(1)|p.R213fs*32(1)|p.R209fs*6(1)|p.R213W(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACACTATGTCGAAAAGTGTTT	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	333	Substitution - Nonsense(292)|Deletion - Frameshift(8)|Whole gene deletion(8)|Substitution - Missense(8)|Deletion - In frame(5)|Insertion - Frameshift(5)|Unknown(5)|Complex - deletion inframe(1)|Substitution - coding silent(1)	large_intestine(89)|breast(45)|lung(37)|upper_aerodigestive_tract(30)|central_nervous_system(18)|skin(16)|oesophagus(15)|stomach(14)|ovary(14)|haematopoietic_and_lymphoid_tissue(10)|urinary_tract(9)|biliary_tract(8)|liver(8)|soft_tissue(5)|endometrium(5)|bone(4)|prostate(3)|thyroid(1)|pancreas(1)|autonomic_ganglia(1)	GRCh37	CM951226	TP53	M							132.0	118.0	123.0					17																	7578212		2203	4300	6503	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.637C>T	17.37:g.7578212G>A	ENSP00000269305:p.Arg213*	Somatic		WXS	Illumina HiSeq	Phase_I	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	37	6.039727	0.97226	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.28	3.25	0.37280	.	0.057335	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.5444	12.7263	0.57173	0.0:0.0:0.701:0.299	.	.	.	.	X	213;213;213;213;213;213;202;120;81;120;81	.	ENSP00000269305:R213X	R	-	1	2	TP53	7518937	0.971000	0.33674	0.123000	0.21794	0.957000	0.61999	1.659000	0.37387	0.702000	0.31825	0.563000	0.77884	CGA		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
UBTF	7343	broad.mit.edu	37	17	42289365	42289365	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr17:42289365T>C	ENST00000302904.4	-	9	1273	c.781A>G	c.(781-783)Aga>Gga	p.R261G	UBTF_ENST00000533177.1_Missense_Mutation_p.R224G|UBTF_ENST00000393606.3_Missense_Mutation_p.R224G|UBTF_ENST00000527034.1_Missense_Mutation_p.R224G|UBTF_ENST00000436088.1_Missense_Mutation_p.R261G|UBTF_ENST00000343638.5_Missense_Mutation_p.R224G|CTB-175E5.7_ENST00000586560.1_RNA|UBTF_ENST00000526094.1_Missense_Mutation_p.R224G|UBTF_ENST00000529383.1_Missense_Mutation_p.R261G			P17480	UBF1_HUMAN	upstream binding transcription factor, RNA polymerase I	261					chromatin silencing at rDNA (GO:0000183)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(9)|lung(10)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.114)		ATATAGTCTCTCATGATCTCC	0.607																																						.											0													138.0	126.0	130.0					17																	42289365		2203	4300	6503	SO:0001583	missense	7343			BC042297	CCDS11480.1, CCDS42346.1	17q21.31	2014-03-25			ENSG00000108312	ENSG00000108312			12511	protein-coding gene	gene with protein product		600673				9126496	Standard	NM_001076683		Approved	UBF, NOR-90, UBF1, UBF2	uc010czs.3	P17480	OTTHUMG00000167585	ENST00000302904.4:c.781A>G	17.37:g.42289365T>C	ENSP00000302640:p.Arg261Gly	Somatic		WXS	Illumina HiSeq	Phase_I	A8K6R8	Missense_Mutation	SNP	ENST00000302904.4	37	CCDS11480.1	.	.	.	.	.	.	.	.	.	.	t	15.35	2.808102	0.50421	.	.	ENSG00000108312	ENST00000343638;ENST00000302904;ENST00000527034;ENST00000533177;ENST00000436088;ENST00000393606;ENST00000526094;ENST00000529383	D;D;D;D;D;D;D;D	0.98419	-4.88;-4.71;-4.92;-4.88;-4.71;-4.88;-4.88;-4.71	4.58	2.19	0.27852	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.061420	0.64402	N	0.000008	D	0.98204	0.9406	M	0.61703	1.905	0.49213	D	0.999767	D;P;D	0.76494	0.999;0.856;0.999	D;P;D	0.87578	0.997;0.771;0.998	D	0.96981	0.9715	10	0.25751	T	0.34	-8.2683	12.7655	0.57388	0.0:0.0:0.5518:0.4481	.	224;224;261	E9PKP7;P17480-2;P17480	.;.;UBF1_HUMAN	G	224;261;224;224;261;224;224;261	ENSP00000345297:R224G;ENSP00000302640:R261G;ENSP00000431539:R224G;ENSP00000437180:R224G;ENSP00000390669:R261G;ENSP00000377231:R224G;ENSP00000432925:R224G;ENSP00000435708:R261G	ENSP00000302640:R261G	R	-	1	2	UBTF	39644891	1.000000	0.71417	0.999000	0.59377	0.958000	0.62258	3.366000	0.52343	1.032000	0.39892	0.254000	0.18369	AGA		0.607	UBTF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395205.1	NM_014233	
CEP131	22994	broad.mit.edu	37	17	79164828	79164828	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr17:79164828T>C	ENST00000269392.4	-	23	3078	c.2831A>G	c.(2830-2832)gAg>gGg	p.E944G	AZI1_ENST00000575907.1_Missense_Mutation_p.E908G|AZI1_ENST00000374782.3_Missense_Mutation_p.E905G|AZI1_ENST00000450824.2_Missense_Mutation_p.E941G	NM_014984.2	NP_055799.2	Q9UPN4	CP131_HUMAN		944					cell differentiation (GO:0030154)|G2/M transition of mitotic cell cycle (GO:0000086)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular protein transport (GO:0090316)|regulation of centrosome duplication (GO:0010824)|spermatogenesis (GO:0007283)	BBSome (GO:0034464)|cell projection (GO:0042995)|centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(1)|lung(12)|ovary(2)|prostate(3)|urinary_tract(5)	36	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			AAGCTTCCGCTCCGACTGCTC	0.662																																						.											0													43.0	51.0	48.0					17																	79164828		2203	4299	6502	SO:0001583	missense	22994																														ENST00000269392.4:c.2831A>G	17.37:g.79164828T>C	ENSP00000269392:p.Glu944Gly	Somatic		WXS	Illumina HiSeq	Phase_I	A6NHI8|B2RN11|Q96F50	Missense_Mutation	SNP	ENST00000269392.4	37		.	.	.	.	.	.	.	.	.	.	T	24.2	4.503710	0.85176	.	.	ENSG00000141577	ENST00000450824;ENST00000374782;ENST00000269392	T;T;T	0.20881	2.04;2.06;2.05	4.49	4.49	0.54785	.	0.000000	0.85682	D	0.000000	T	0.43964	0.1271	M	0.66939	2.045	0.58432	D	0.999993	D;D;D;D	0.89917	0.999;0.993;1.0;1.0	D;P;D;D	0.76575	0.928;0.888;0.988;0.988	T	0.43718	-0.9374	10	0.72032	D	0.01	-26.681	13.9375	0.64034	0.0:0.0:0.0:1.0	.	941;944;905;941	B2RN10;Q9UPN4;Q9UPN4-3;Q9UPN4-2	.;AZI1_HUMAN;.;.	G	941;905;944	ENSP00000393583:E941G;ENSP00000363914:E905G;ENSP00000269392:E944G	ENSP00000269392:E944G	E	-	2	0	AZI1	76779423	1.000000	0.71417	0.985000	0.45067	0.919000	0.55068	4.810000	0.62598	1.900000	0.55004	0.482000	0.46254	GAG		0.662	AZI1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000256070.1		
DLL3	10683	broad.mit.edu	37	19	39994863	39994863	+	Missense_Mutation	SNP	G	G	A	rs139297205		TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr19:39994863G>A	ENST00000205143.4	+	5	812	c.805G>A	c.(805-807)Gga>Aga	p.G269R	DLL3_ENST00000356433.5_Missense_Mutation_p.G269R	NM_016941.3	NP_058637.1	Q9NYJ7	DLL3_HUMAN	delta-like 3 (Drosophila)	269					compartment pattern specification (GO:0007386)|negative regulation of neurogenesis (GO:0050768)|Notch signaling pathway (GO:0007219)|paraxial mesoderm development (GO:0048339)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)	integral component of membrane (GO:0016021)	Notch binding (GO:0005112)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(7)	19	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;5.89e-26)|all cancers(26;1.96e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			TGCTACCACCGGATGCCTTGT	0.642																																						.											0			GRCh37	CM065111	DLL3	M	rs139297205	G	ARG/GLY,ARG/GLY	1,4405	2.1+/-5.4	0,1,2202	77.0	69.0	71.0		805,805	-0.6	0.2	19	dbSNP_134	71	5,8595	4.3+/-15.6	0,5,4295	yes	missense,missense	DLL3	NM_016941.3,NM_203486.2	125,125	0,6,6497	AA,AG,GG		0.0581,0.0227,0.0461	benign,benign	269/619,269/588	39994863	6,13000	2203	4300	6503	SO:0001583	missense	10683			AF241373	CCDS12537.1, CCDS12538.1	19q13.2	2008-05-14	2001-12-03			ENSG00000090932			2909	protein-coding gene	gene with protein product		602768	"""delta (Drosophila)-like 3"""			10364530, 10742114	Standard	NM_203486		Approved	SCDO1	uc002olx.2	Q9NYJ7		ENST00000205143.4:c.805G>A	19.37:g.39994863G>A	ENSP00000205143:p.Gly269Arg	Somatic		WXS	Illumina HiSeq	Phase_I	E9PFG2|Q8NBS4	Missense_Mutation	SNP	ENST00000205143.4	37	CCDS12538.1	.	.	.	.	.	.	.	.	.	.	G	4.072	0.011286	0.07912	2.27E-4	5.81E-4	ENSG00000090932	ENST00000356433;ENST00000205143	D;D	0.89617	-2.49;-2.54	5.4	-0.643	0.11482	.	0.427722	0.19935	N	0.102780	T	0.64627	0.2615	N	0.02158	-0.66	0.18873	N	0.999982	B;B;B	0.11235	0.004;0.002;0.0	B;B;B	0.06405	0.002;0.001;0.001	T	0.56817	-0.7916	9	.	.	.	.	4.0338	0.09721	0.2132:0.1101:0.5644:0.1123	.	269;269;269	Q8NBS4;Q9NYJ7;E9PFG2	.;DLL3_HUMAN;.	R	269	ENSP00000348810:G269R;ENSP00000205143:G269R	.	G	+	1	0	DLL3	44686703	0.991000	0.36638	0.191000	0.23289	0.009000	0.06853	2.220000	0.42908	0.369000	0.24510	-1.020000	0.02445	GGA		0.642	DLL3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464958.1		
ZNF180	7733	broad.mit.edu	37	19	44980907	44980907	+	Silent	SNP	T	T	C			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr19:44980907T>C	ENST00000221327.4	-	5	2072	c.1791A>G	c.(1789-1791)agA>agG	p.R597R	ZNF180_ENST00000585514.1_5'Flank|ZNF180_ENST00000391956.4_Silent_p.R572R|AC069278.4_ENST00000591684.1_lincRNA|ZNF180_ENST00000592529.1_Silent_p.R570R	NM_013256.3	NP_037388.2	Q9UJW8	ZN180_HUMAN	zinc finger protein 180	597					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(14)|lung(6)|ovary(2)|urinary_tract(1)	33		Prostate(69;0.0435)				CAGTATGAGTTCTCTGATGTA	0.418																																					Esophageal Squamous(180;1353 2003 32862 46574 49854)	.											0													107.0	109.0	108.0					19																	44980907		2203	4300	6503	SO:0001819	synonymous_variant	7733			AF192913	CCDS12639.1, CCDS62707.1, CCDS62708.1	19q13.2	2013-01-08	2006-08-22			ENSG00000167384		"""Zinc fingers, C2H2-type"", ""-"""	12970	protein-coding gene	gene with protein product		606740	"""zinc finger protein 180 (HHZ168)"""				Standard	NM_001288762		Approved	HHZ168	uc002ozf.4	Q9UJW8		ENST00000221327.4:c.1791A>G	19.37:g.44980907T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B2RCN6|B3KV56|K7EQX9|Q58F03|Q9P1U2	Silent	SNP	ENST00000221327.4	37	CCDS12639.1																																																																																				0.418	ZNF180-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451601.1	NM_013256	
HADHB	3032	broad.mit.edu;bcgsc.ca	37	2	26502036	26502036	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr2:26502036A>G	ENST00000317799.5	+	9	768	c.664A>G	c.(664-666)Acc>Gcc	p.T222A	HADHB_ENST00000405867.3_Intron|HADHB_ENST00000545822.1_Missense_Mutation_p.T200A|HADHB_ENST00000537713.1_Missense_Mutation_p.T207A|HADHB_ENST00000494615.1_3'UTR	NM_000183.2	NP_000174.1	P55084	ECHB_HUMAN	hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit	222					cardiolipin acyl-chain remodeling (GO:0035965)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrial envelope (GO:0005740)|mitochondrial fatty acid beta-oxidation multienzyme complex (GO:0016507)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|acetyl-CoA C-acyltransferase activity (GO:0003988)|enoyl-CoA hydratase activity (GO:0004300)|fatty-acyl-CoA binding (GO:0000062)|long-chain-3-hydroxyacyl-CoA dehydrogenase activity (GO:0016509)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|NAD binding (GO:0051287)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CACCAGTGAGACCATGGGCCA	0.537																																						.											0													101.0	97.0	98.0					2																	26502036		2203	4300	6503	SO:0001583	missense	3032				CCDS1722.1, CCDS62871.1, CCDS62872.1	2p23	2010-04-30	2010-04-30		ENSG00000138029	ENSG00000138029	2.3.1.16		4803	protein-coding gene	gene with protein product	"""mitochondrial trifunctional protein, beta subunit"""	143450	"""hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), beta subunit"""			9605857	Standard	NM_000183		Approved	MTPB	uc002rgz.3	P55084	OTTHUMG00000096978	ENST00000317799.5:c.664A>G	2.37:g.26502036A>G	ENSP00000325136:p.Thr222Ala	Somatic		WXS	Illumina HiSeq	Phase_I	B2RB16|B4E2W0|O14969|Q53TA6|Q96C77|Q9H3F5|Q9T2V8	Missense_Mutation	SNP	ENST00000317799.5	37	CCDS1722.1	.	.	.	.	.	.	.	.	.	.	A	19.07	3.756867	0.69648	.	.	ENSG00000138029	ENST00000317799;ENST00000537713;ENST00000545822	D;D;D	0.87103	-2.21;-2.21;-2.21	5.69	5.69	0.88448	Thiolase-like, subgroup (1);Thiolase, N-terminal (1);Thiolase-like (1);	0.090399	0.85682	D	0.000000	D	0.86973	0.6062	L	0.52364	1.645	0.80722	D	1	P;B;P	0.42692	0.747;0.287;0.787	B;B;P	0.45712	0.358;0.411;0.491	D	0.87747	0.2589	10	0.56958	D	0.05	-23.2145	15.0712	0.72040	1.0:0.0:0.0:0.0	.	207;200;222	F5GZQ3;B4E2W0;P55084	.;.;ECHB_HUMAN	A	222;207;200	ENSP00000325136:T222A;ENSP00000444295:T207A;ENSP00000442665:T200A	ENSP00000325136:T222A	T	+	1	0	HADHB	26355540	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.044000	0.76578	2.291000	0.77112	0.533000	0.62120	ACC		0.537	HADHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214050.2	NM_000183	
ANKRD30BL	554226	broad.mit.edu	37	2	132919171	132919171	+	Silent	SNP	A	A	G	rs199695856		TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr2:132919171A>G	ENST00000409867.1	-	1	357	c.108T>C	c.(106-108)caT>caC	p.H36H	ANKRD30BL_ENST00000470729.1_Intron			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	36										endometrium(1)|kidney(3)	4						TGAGATCCCCATGGTGAATCA	0.582																																						.											0																																										SO:0001819	synonymous_variant	554226					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.108T>C	2.37:g.132919171A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B8ZZL7	RNA	SNP	ENST00000409867.1	37																																																																																					0.582	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331353.2	NR_027019	
ANKRD30BL	554226	broad.mit.edu	37	2	132919192	132919192	+	Silent	SNP	G	G	A	rs111295191		TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr2:132919192G>A	ENST00000409867.1	-	1	336	c.87C>T	c.(85-87)aaC>aaT	p.N29N	ANKRD30BL_ENST00000470729.1_Intron			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	29										endometrium(1)|kidney(3)	4						CGTAAGAGTCGTTGTTGGTGT	0.602																																						.											0																																										SO:0001819	synonymous_variant	554226					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.87C>T	2.37:g.132919192G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B8ZZL7	RNA	SNP	ENST00000409867.1	37																																																																																					0.602	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331353.2	NR_027019	
SRC	6714	broad.mit.edu;bcgsc.ca	37	20	36022638	36022638	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr20:36022638C>T	ENST00000373578.2	+	7	860	c.511C>T	c.(511-513)Ccg>Tcg	p.P171S	SRC_ENST00000360723.4_Missense_Mutation_p.P177S|SRC_ENST00000373567.2_Missense_Mutation_p.P171S|SRC_ENST00000358208.4_Missense_Mutation_p.P171S|SRC_ENST00000373558.2_Missense_Mutation_p.P177S|SRC_ENST00000445403.1_Missense_Mutation_p.P171S	NM_198291.1	NP_938033.1	P12931	SRC_HUMAN	SRC proto-oncogene, non-receptor tyrosine kinase	171	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|bone resorption (GO:0045453)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cellular response to progesterone stimulus (GO:0071393)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|membrane organization (GO:0061024)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of mitochondrial depolarization (GO:0051902)|negative regulation of protein homooligomerization (GO:0032463)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oogenesis (GO:0048477)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of integrin activation (GO:0033625)|positive regulation of podosome assembly (GO:0071803)|positive regulation of protein kinase B signaling (GO:0051897)|progesterone receptor signaling pathway (GO:0050847)|protein autophosphorylation (GO:0046777)|Ras protein signal transduction (GO:0007265)|regulation of bone resorption (GO:0045124)|regulation of caveolin-mediated endocytosis (GO:2001286)|regulation of cell-cell adhesion (GO:0022407)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of epithelial cell migration (GO:0010632)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of protein binding (GO:0043393)|regulation of vascular permeability (GO:0043114)|response to interleukin-1 (GO:0070555)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|stress fiber assembly (GO:0043149)|T cell costimulation (GO:0031295)|transforming growth factor beta receptor signaling pathway (GO:0007179)|uterus development (GO:0060065)|viral process (GO:0016032)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ephrin receptor binding (GO:0046875)|growth factor receptor binding (GO:0070851)|heme binding (GO:0020037)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphoprotein binding (GO:0051219)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(16)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	30		Myeloproliferative disorder(115;0.00878)			Bosutinib(DB06616)|Dasatinib(DB01254)|Ponatinib(DB08901)	TGCAGAGAACCCGAGAGGGAC	0.567																																						.											0													103.0	100.0	101.0					20																	36022638		2203	4300	6503	SO:0001583	missense	6714			AF077754	CCDS13294.1	20q12-q13	2014-06-25	2014-06-25		ENSG00000197122	ENSG00000197122		"""SH2 domain containing"""	11283	protein-coding gene	gene with protein product		190090	"""v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog"""	SRC1		2582238	Standard	NM_005417		Approved	ASV, c-src	uc002xgy.3	P12931	OTTHUMG00000032417	ENST00000373578.2:c.511C>T	20.37:g.36022638C>T	ENSP00000362680:p.Pro171Ser	Somatic		WXS	Illumina HiSeq	Phase_I	E1P5V4|Q76P87|Q86VB9|Q9H5A8	Missense_Mutation	SNP	ENST00000373578.2	37	CCDS13294.1	.	.	.	.	.	.	.	.	.	.	C	11.84	1.760002	0.31137	.	.	ENSG00000197122	ENST00000445403;ENST00000373578;ENST00000360723;ENST00000358208;ENST00000373567;ENST00000373558	D;D;D;D;D;D	0.88741	-2.42;-2.42;-2.42;-2.42;-2.42;-2.42	4.88	4.88	0.63580	SH2 motif (4);	0.110608	0.64402	D	0.000014	D	0.85427	0.5694	L	0.45352	1.415	0.44469	D	0.997404	P	0.41080	0.737	B	0.41135	0.348	D	0.83441	0.0043	10	0.23302	T	0.38	.	15.5649	0.76284	0.0:1.0:0.0:0.0	.	171	P12931	SRC_HUMAN	S	171;171;177;171;171;177	ENSP00000408503:P171S;ENSP00000362680:P171S;ENSP00000353950:P177S;ENSP00000350941:P171S;ENSP00000362668:P171S;ENSP00000362659:P177S	ENSP00000350941:P171S	P	+	1	0	SRC	35456052	1.000000	0.71417	0.985000	0.45067	0.663000	0.39108	3.598000	0.54038	2.526000	0.85167	0.561000	0.74099	CCG		0.567	SRC-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268142.1	NM_005417	
HMGXB4	10042	broad.mit.edu	37	22	35661575	35661576	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr22:35661575_35661576delAG	ENST00000216106.5	+	5	1322_1323	c.1194_1195delAG	c.(1192-1197)aaagagfs	p.E399fs	HMGXB4_ENST00000444518.2_Frame_Shift_Del_p.E290fs	NM_001003681.2	NP_001003681.1	Q9UGU5	HMGX4_HUMAN	HMG box domain containing 4	399					endosome to lysosome transport (GO:0008333)|negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)	NURF complex (GO:0016589)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|large_intestine(6)|liver(1)|lung(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						agaaggacaaagagagagagag	0.465																																						.											0																																										SO:0001589	frameshift_variant	10042			AJ010069	CCDS33641.1	22q13	2011-07-01	2009-01-05	2009-01-05	ENSG00000100281	ENSG00000100281		"""High mobility group / Non-canonical"""	5003	protein-coding gene	gene with protein product		604702	"""high-mobility group protein 2-like 1"""	HMG2L1		10329004, 10591208, 20511232	Standard	NM_001003681		Approved	THC211630	uc003anl.3	Q9UGU5	OTTHUMG00000150439	ENST00000216106.5:c.1194_1195delAG	22.37:g.35661585_35661586delAG	ENSP00000216106:p.Glu399fs	Somatic		WXS	Illumina HiSeq	Phase_I	O75672|O75673|Q9UMT5	Frame_Shift_Del	DEL	ENST00000216106.5	37	CCDS33641.1																																																																																				0.465	HMGXB4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318104.2	NM_005487	
GPD1L	23171	broad.mit.edu	37	3	32169635	32169643	+	In_Frame_Del	DEL	AAGATGTGG	AAGATGTGG	-			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	AAGATGTGG	AAGATGTGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr3:32169635_32169643delAAGATGTGG	ENST00000282541.5	+	2	316_324	c.115_123delAAGATGTGG	c.(115-123)aagatgtggdel	p.KMW39del		NM_015141.3	NP_055956.1	Q8N335	GPD1L_HUMAN	glycerol-3-phosphate dehydrogenase 1-like	39					carbohydrate metabolic process (GO:0005975)|cellular lipid metabolic process (GO:0044255)|glycerol-3-phosphate catabolic process (GO:0046168)|glycerophospholipid biosynthetic process (GO:0046474)|NAD metabolic process (GO:0019674)|NADH metabolic process (GO:0006734)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein kinase C signaling (GO:0090038)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|positive regulation of protein localization to cell surface (GO:2000010)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate (GO:0002027)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|ventricular cardiac muscle cell action potential (GO:0086005)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycerol-3-phosphate dehydrogenase complex (GO:0009331)|plasma membrane (GO:0005886)	glycerol-3-phosphate dehydrogenase [NAD+] activity (GO:0004367)|ion channel binding (GO:0044325)|NAD binding (GO:0051287)|sodium channel regulator activity (GO:0017080)			large_intestine(4)|lung(7)|ovary(1)	12						CTCCACAGTCAAGATGTGGGTCTTTGAAG	0.354																																						.											0																																										SO:0001651	inframe_deletion	23171			D42047	CCDS33729.1	3p22.3	2014-09-17			ENSG00000152642	ENSG00000152642			28956	protein-coding gene	gene with protein product		611778				7788527	Standard	NM_015141		Approved	KIAA0089	uc003cew.3	Q8N335	OTTHUMG00000155846	ENST00000282541.5:c.115_123delAAGATGTGG	3.37:g.32169635_32169643delAAGATGTGG	ENSP00000282541:p.Lys39_Trp41del	Somatic		WXS	Illumina HiSeq	Phase_I	A8K9U3|Q14702|Q9BRM5	In_Frame_Del	DEL	ENST00000282541.5	37	CCDS33729.1																																																																																				0.354	GPD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341975.2	NM_015141	
WDR6	11180	broad.mit.edu	37	3	49051528	49051528	+	Missense_Mutation	SNP	T	T	G			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr3:49051528T>G	ENST00000608424.1	+	2	2600	c.2561T>G	c.(2560-2562)gTt>gGt	p.V854G	WDR6_ENST00000415265.2_Missense_Mutation_p.V302G|WDR6_ENST00000395474.3_Missense_Mutation_p.V884G|WDR6_ENST00000448293.1_Missense_Mutation_p.V803G			Q9NNW5	WDR6_HUMAN	WD repeat domain 6	854					cell cycle arrest (GO:0007050)|negative regulation of autophagy (GO:0010507)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|liver(1)|lung(9)|ovary(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26				Kidney(197;9.12e-07)|KIRC - Kidney renal clear cell carcinoma(197;1.32e-05)|BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000155)		CATCGGATGGTTAAGGTAGAC	0.592											OREG0015565	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0													70.0	63.0	66.0					3																	49051528		2203	4299	6502	SO:0001583	missense	11180			AF099100	CCDS2782.2	3p21.31	2013-01-09			ENSG00000178252	ENSG00000178252		"""WD repeat domain containing"""	12758	protein-coding gene	gene with protein product		606031					Standard	NM_018031		Approved		uc003cvj.2	Q9NNW5	OTTHUMG00000133546	ENST00000608424.1:c.2561T>G	3.37:g.49051528T>G	ENSP00000477389:p.Val854Gly	Somatic	959	WXS	Illumina HiSeq	Phase_I	B4DHK2|Q3MIT1|Q9UF63	Missense_Mutation	SNP	ENST00000608424.1	37		.	.	.	.	.	.	.	.	.	.	T	17.49	3.401499	0.62288	.	.	ENSG00000178252	ENST00000395474;ENST00000415265;ENST00000448293	T;T	0.62788	-0.0;0.01	5.39	5.39	0.77823	WD40 repeat-like-containing domain (1);	0.380503	0.29066	N	0.013250	T	0.63920	0.2552	L	0.43152	1.355	0.58432	D	0.999998	P;P;P	0.48834	0.916;0.821;0.821	P;P;P	0.50590	0.562;0.645;0.645	T	0.60732	-0.7205	10	0.27785	T	0.31	-15.9814	15.7039	0.77563	0.0:0.0:0.0:1.0	.	302;854;803	E9PBK6;Q9NNW5;E9PDU5	.;WDR6_HUMAN;.	G	884;302;803	ENSP00000378857:V884G;ENSP00000413432:V803G	ENSP00000378857:V884G	V	+	2	0	WDR6	49026532	1.000000	0.71417	1.000000	0.80357	0.036000	0.12997	7.749000	0.85096	2.172000	0.68678	0.459000	0.35465	GTT		0.592	WDR6-024	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000471652.1		
CCNA2	890	broad.mit.edu	37	4	122743634	122743634	+	Silent	SNP	A	A	G			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr4:122743634A>G	ENST00000274026.5	-	2	684	c.381T>C	c.(379-381)gcT>gcC	p.A127A		NM_001237.3	NP_001228	P20248	CCNA2_HUMAN	cyclin A2	127					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic G2 DNA damage checkpoint (GO:0007095)|mitotic nuclear division (GO:0007067)|organ regeneration (GO:0031100)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|response to estradiol (GO:0032355)|response to glucagon (GO:0033762)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	12						CTGAATTAAAAGCCAGGGCAT	0.413																																						.											0													102.0	100.0	101.0					4																	122743634		2203	4300	6503	SO:0001819	synonymous_variant	890				CCDS3723.1	4q27	2012-07-12			ENSG00000145386	ENSG00000145386			1578	protein-coding gene	gene with protein product		123835		CCNA, CCN1		1675006	Standard	NM_001237		Approved		uc003iec.4	P20248	OTTHUMG00000133072	ENST00000274026.5:c.381T>C	4.37:g.122743634A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A8K7B6|Q2M3U6|Q4W5P4|Q6LER8	Silent	SNP	ENST00000274026.5	37	CCDS3723.1																																																																																				0.413	CCNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256712.2	NM_001237	
DMXL1	1657	broad.mit.edu	37	5	118525451	118525451	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr5:118525451C>T	ENST00000311085.8	+	29	7264	c.7184C>T	c.(7183-7185)cCg>cTg	p.P2395L	DMXL1_ENST00000539542.1_Missense_Mutation_p.P2395L	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	2395										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		CGTTTTAGGCCGTCAAAAATG	0.403																																						.											0													103.0	104.0	104.0					5																	118525451		2202	4300	6502	SO:0001583	missense	1657			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.7184C>T	5.37:g.118525451C>T	ENSP00000309690:p.Pro2395Leu	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000311085.8	37	CCDS4125.1	.	.	.	.	.	.	.	.	.	.	C	12.20	1.866827	0.32977	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	T;T	0.08634	3.07;3.07	5.95	5.95	0.96441	.	0.611989	0.18961	N	0.126395	T	0.06781	0.0173	N	0.22421	0.69	0.38100	D	0.937229	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.40346	-0.9568	10	0.18710	T	0.47	-1.0995	13.5655	0.61815	0.0:0.9292:0.0:0.0708	.	2395;2395	F5H269;Q9Y485	.;DMXL1_HUMAN	L	2395	ENSP00000309690:P2395L;ENSP00000439479:P2395L	ENSP00000309690:P2395L	P	+	2	0	DMXL1	118553350	1.000000	0.71417	0.995000	0.50966	0.581000	0.36288	2.212000	0.42835	2.821000	0.97095	0.650000	0.86243	CCG		0.403	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250862.1	NM_005509	
DPY19L2P1	554236	broad.mit.edu	37	7	35161155	35161155	+	IGR	SNP	G	G	A	rs372458897		TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr7:35161155G>A								DPY19L2P1 (13809 upstream) : TBX20 (80886 downstream)																							GAGCACAGGTGTATATTAAAG	0.318																																						.											0																																										SO:0001628	intergenic_variant	554236																															7.37:g.35161155G>A		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	SNP		37																																																																																				0	0.318								
CTAGE6	340307	broad.mit.edu	37	7	143453697	143453697	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr7:143453697A>G	ENST00000470691.2	-	1	1092	c.1055T>C	c.(1054-1056)cTt>cCt	p.L352P	RNU6-267P_ENST00000516714.1_RNA	NM_178561.4	NP_848656.2	Q86UF2	CTGE6_HUMAN	CTAGE family, member 6	352						integral component of membrane (GO:0016021)						Melanoma(164;0.0903)					ATGCTCTGTAAGCTCTTCCTT	0.303																																						.											0													16.0	13.0	14.0					7																	143453697		1804	4014	5818	SO:0001583	missense	340307			BC043153	CCDS64790.1	7q35	2013-05-22	2013-02-25	2013-02-25	ENSG00000271321	ENSG00000271321			28644	protein-coding gene	gene with protein product			"""CTAGE family, member 6, pseudogene"""	CTAGE6P		12477932	Standard	NM_178561		Approved	MGC41943	uc003wdk.4	Q86UF2	OTTHUMG00000157770	ENST00000470691.2:c.1055T>C	7.37:g.143453697A>G	ENSP00000474388:p.Leu352Pro	Somatic		WXS	Illumina HiSeq	Phase_I	A4FU29|Q3ZCM5	Missense_Mutation	SNP	ENST00000470691.2	37																																																																																					0.303	CTAGE6-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000349580.2	NM_178561	
SMARCA2	6595	broad.mit.edu	37	9	2039815	2039815	+	Silent	SNP	G	G	A	rs574062756	byFrequency	TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr9:2039815G>A	ENST00000382203.1	+	4	914	c.705G>A	c.(703-705)caG>caA	p.Q235Q	SMARCA2_ENST00000357248.2_Silent_p.Q235Q|SMARCA2_ENST00000349721.2_Silent_p.Q235Q|RP11-264I13.2_ENST00000426860.1_RNA|SMARCA2_ENST00000382194.1_Silent_p.Q235Q|SMARCA2_ENST00000491574.1_3'UTR			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	235	Poly-Gln.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		agcagcagcagcaacagcagc	0.587													G|||	41	0.0081869	0.0151	0.0029	5008	,	,		10366	0.0089		0.0	False		,,,				2504	0.0102					.											0													10.0	13.0	12.0					9																	2039815		2161	4205	6366	SO:0001819	synonymous_variant	6595			D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.705G>A	9.37:g.2039815G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Silent	SNP	ENST00000382203.1	37	CCDS34977.1																																																																																				0.587	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070	
C8G	733	broad.mit.edu	37	9	139839860	139839860	+	Missense_Mutation	SNP	G	G	T			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr9:139839860G>T	ENST00000224181.3	+	1	148	c.88G>T	c.(88-90)Gca>Tca	p.A30S	FBXW5_ENST00000483559.1_5'Flank|FBXW5_ENST00000325285.3_5'Flank	NM_000606.2	NP_000597.2	P07360	CO8G_HUMAN	complement component 8, gamma polypeptide	30					complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	retinol binding (GO:0019841)			NS(1)|prostate(1)|skin(1)	3	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;7.88e-06)|Epithelial(140;0.000107)		ACGCCGGCCCGCATCCCCCAT	0.647											OREG0019623	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0													18.0	19.0	18.0					9																	139839860		2195	4295	6490	SO:0001583	missense	733			X06465	CCDS7017.1	9q	2011-11-15			ENSG00000176919	ENSG00000176919		"""Complement system"", ""Lipocalins"""	1354	protein-coding gene	gene with protein product		120930					Standard	NM_000606		Approved		uc004cka.2	P07360	OTTHUMG00000020955	ENST00000224181.3:c.88G>T	9.37:g.139839860G>T	ENSP00000224181:p.Ala30Ser	Somatic	1651	WXS	Illumina HiSeq	Phase_I	Q14CT8|Q14CU0|Q5SQ07	Missense_Mutation	SNP	ENST00000224181.3	37	CCDS7017.1	.	.	.	.	.	.	.	.	.	.	g	9.776	1.174015	0.21704	.	.	ENSG00000176919	ENST00000371634;ENST00000224181	T;T	0.23950	1.88;2.67	5.06	-5.45	0.02616	Calycin-like (1);Calycin (1);	1.279830	0.05352	N	0.532000	T	0.18551	0.0445	L	0.36672	1.1	0.09310	N	1	B	0.26258	0.145	B	0.20577	0.03	T	0.31916	-0.9926	10	0.46703	T	0.11	-4.3064	9.5945	0.39565	0.4247:0.199:0.3763:0.0	.	30	P07360	CO8G_HUMAN	S	30	ENSP00000360697:A30S;ENSP00000224181:A30S	ENSP00000224181:A30S	A	+	1	0	C8G	138959681	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-1.305000	0.02738	-1.057000	0.03201	-0.328000	0.08392	GCA		0.647	C8G-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055178.1		
WAS	7454	broad.mit.edu;mdanderson.org;bcgsc.ca	37	X	48545247	48545247	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chrX:48545247C>T	ENST00000376701.4	+	7	712	c.637C>T	c.(637-639)Cgt>Tgt	p.R213C	WAS_ENST00000483750.1_3'UTR	NM_000377.2	NP_000368.1	P42768	WASP_HUMAN	Wiskott-Aldrich syndrome	213					actin filament polymerization (GO:0030041)|actin filament-based movement (GO:0030048)|actin polymerization or depolymerization (GO:0008154)|blood coagulation (GO:0007596)|defense response (GO:0006952)|endosomal transport (GO:0016197)|epidermis development (GO:0008544)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|protein complex assembly (GO:0006461)|regulation of catalytic activity (GO:0050790)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|vesicle membrane (GO:0012506)	identical protein binding (GO:0042802)|phospholipase binding (GO:0043274)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|small GTPase regulator activity (GO:0005083)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	28		all_lung(315;1.27e-10)				TTCACGATACCGTGGGCTCCC	0.567			"""Mis, N, F, S"""			lymphoma																																.		X-linked recessive		Wiskott-Aldrich syndrome	X	Xp11.23-p11.22	7454	Wiskott-Aldrich syndrome		L	0													89.0	70.0	76.0					X																	48545247		2203	4300	6503	SO:0001583	missense	7454			AF115548	CCDS14303.1	Xp11.4-p11.21	2014-09-17	2012-07-12		ENSG00000015285	ENSG00000015285			12731	protein-coding gene	gene with protein product	"""eczema-thrombocytopenia"""	300392	"""thrombocytopenia 1 (X-linked)"", ""Wiskott-Aldrich syndrome (eczema-thrombocytopenia)"""	IMD2, THC		7795648	Standard	NM_000377		Approved	WASP	uc004dkm.4	P42768	OTTHUMG00000034483	ENST00000376701.4:c.637C>T	X.37:g.48545247C>T	ENSP00000365891:p.Arg213Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q9BU11|Q9UNJ9	Missense_Mutation	SNP	ENST00000376701.4	37	CCDS14303.1	.	.	.	.	.	.	.	.	.	.	C	18.57	3.652001	0.67472	.	.	ENSG00000015285	ENST00000450772;ENST00000376701	D;D	0.99741	-6.49;-6.6	4.39	4.39	0.52855	.	0.000000	0.85682	D	0.000000	D	0.99444	0.9803	L	0.52011	1.625	0.58432	D	0.999991	D	0.89917	1.0	D	0.74023	0.982	D	0.98302	1.0519	10	0.72032	D	0.01	-7.2719	13.6191	0.62126	0.0:1.0:0.0:0.0	.	213	P42768	WASP_HUMAN	C	213	ENSP00000410537:R213C;ENSP00000365891:R213C	ENSP00000365891:R213C	R	+	1	0	WAS	48430191	1.000000	0.71417	1.000000	0.80357	0.749000	0.42624	5.209000	0.65208	1.777000	0.52277	0.279000	0.19357	CGT		0.567	WAS-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083379.1	NM_000377	
DYRK1B	9149	broad.mit.edu	37	19	40321175	40321176	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr19:40321175_40321176insC	ENST00000593685.1	-	4	679_680	c.211_212insG	c.(211-213)gccfs	p.A71fs	DYRK1B_ENST00000348817.3_Frame_Shift_Ins_p.A71fs|DYRK1B_ENST00000323039.5_Frame_Shift_Ins_p.A71fs|DYRK1B_ENST00000601972.1_Frame_Shift_Ins_p.A71fs|DYRK1B_ENST00000430012.2_Frame_Shift_Ins_p.A71fs|DYRK1B_ENST00000597639.1_Frame_Shift_Ins_p.A71fs			Q9Y463	DYR1B_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B	71					adipose tissue development (GO:0060612)|myoblast fusion (GO:0007520)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(7)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	24	all_cancers(60;5.79e-06)|all_lung(34;5.2e-08)|Lung NSC(34;6.14e-08)|Ovarian(47;0.06)		Epithelial(26;5.74e-25)|OV - Ovarian serous cystadenocarcinoma(5;3.13e-24)|all cancers(26;8.59e-23)			CGCCTGCTGGGCCCGCCGCTTC	0.584																																						.											0																																										SO:0001589	frameshift_variant	9149			Y17999	CCDS12543.1, CCDS12544.1, CCDS46075.1	19q13.2	2012-10-02			ENSG00000105204	ENSG00000105204	2.7.12.1		3092	protein-coding gene	gene with protein product	"""minibrain-related kinase"""	604556				9918863	Standard	XM_005259395		Approved	MIRK	uc002omj.3	Q9Y463		ENST00000593685.1:c.212dupG	19.37:g.40321178_40321178dupC	ENSP00000469863:p.Ala71fs	Somatic		WXS	Illumina HiSeq	Phase_I	O75258|O75788|O75789	Frame_Shift_Ins	INS	ENST00000593685.1	37	CCDS12543.1																																																																																				0.584	DYRK1B-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462874.2	NM_004714	
GCNT2	2651	ucsc.edu	37	6	10626704	10626704	+	Missense_Mutation	SNP	T	T	G	rs200336999		TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr6:10626704T>G	ENST00000379597.3	+	3	1629	c.1073T>G	c.(1072-1074)gTt>gGt	p.V358G	GCNT2_ENST00000316170.3_Missense_Mutation_p.V356G|GCNT2_ENST00000410107.1_Missense_Mutation_p.V72G|GCNT2_ENST00000265012.4_Missense_Mutation_p.V358G|GCNT2_ENST00000397423.2_3'UTR|GCNT2_ENST00000495262.1_Missense_Mutation_p.V358G			Q8N0V5	GNT2A_HUMAN	glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)	358					maintenance of lens transparency (GO:0036438)|negative regulation of cell-substrate adhesion (GO:0010812)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of protein kinase B signaling (GO:0051897)|posttranscriptional regulation of gene expression (GO:0010608)|protein glycosylation (GO:0006486)|transforming growth factor beta receptor signaling pathway (GO:0007179)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)			endometrium(2)|kidney(1)|large_intestine(5)|lung(2)|ovary(2)	12	Ovarian(93;0.107)|Breast(50;0.148)	all_hematologic(90;0.107)		KIRC - Kidney renal clear cell carcinoma(1;0.099)|Kidney(1;0.119)		AAGTGGCTGGTTAATTCACCA	0.423																																						.											0													110.0	109.0	109.0					6																	10626704		2203	4300	6503	SO:0001583	missense	2651			L41605	CCDS4512.1, CCDS4513.1, CCDS34338.1	6p24.2	2014-07-18	2006-02-23		ENSG00000111846	ENSG00000111846	2.4.1.150	"""Blood group antigens"", ""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	4204	protein-coding gene	gene with protein product	"""Ii blood group"", ""unassigned linkage group 3"""	600429	"""glucosaminyl (N-acetyl) transferase 5"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (Ii blood group)"", ""cataract, congenital"""	NACGT1, II, GCNT5, CCAT		8449405, 9915862	Standard	NM_145649		Approved	IGNT, NAGCT1, bA421M1.1, bA360O19.2, ULG3	uc003mze.3	Q06430	OTTHUMG00000014244	ENST00000379597.3:c.1073T>G	6.37:g.10626704T>G	ENSP00000368917:p.Val358Gly	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000379597.3	37	CCDS34338.1	.	.	.	.	.	.	.	.	.	.	T	14.84	2.655719	0.47467	.	.	ENSG00000111846	ENST00000410107;ENST00000495262;ENST00000379597;ENST00000316170;ENST00000265012	T;T;T;T;T	0.47869	0.83;2.85;2.85;2.85;2.86	5.6	1.6	0.23607	.	1.025490	0.07750	N	0.948455	T	0.24967	0.0606	L	0.39898	1.24	0.09310	N	1	B;B;B;B	0.31705	0.336;0.154;0.336;0.076	B;B;B;B	0.39027	0.197;0.079;0.288;0.18	T	0.45687	-0.9244	10	0.72032	D	0.01	-30.6503	7.7404	0.28837	0.241:0.0:0.1261:0.6329	.	358;72;358;356	Q8N0V5;B7ZBL3;Q8NFS9;Q06430	GNT2A_HUMAN;.;GNT2C_HUMAN;GNT2B_HUMAN	G	72;358;358;356;358	ENSP00000386321:V72G;ENSP00000419411:V358G;ENSP00000368917:V358G;ENSP00000314844:V356G;ENSP00000265012:V358G	ENSP00000265012:V358G	V	+	2	0	GCNT2	10734690	0.181000	0.23161	0.048000	0.18961	0.987000	0.75469	1.266000	0.33039	0.374000	0.24650	0.528000	0.53228	GTT		0.423	GCNT2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327912.3	NM_145649	
IDE	3416	ucsc.edu	37	10	94291641	94291641	+	Silent	SNP	A	A	G			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr10:94291641A>G	ENST00000265986.6	-	4	581	c.525T>C	c.(523-525)gaT>gaC	p.D175D		NM_004969.3	NP_004960.2	P14735	IDE_HUMAN	insulin-degrading enzyme	175					beta-amyloid metabolic process (GO:0050435)|bradykinin catabolic process (GO:0010815)|determination of adult lifespan (GO:0008340)|hormone catabolic process (GO:0042447)|insulin catabolic process (GO:1901143)|insulin metabolic process (GO:1901142)|insulin receptor signaling pathway (GO:0008286)|negative regulation of proteolysis (GO:0045861)|positive regulation of protein oligomerization (GO:0032461)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein homotetramerization (GO:0051289)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|ubiquitin homeostasis (GO:0010992)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|beta-amyloid binding (GO:0001540)|beta-endorphin binding (GO:0031626)|glycoprotein binding (GO:0001948)|insulin binding (GO:0043559)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|urinary_tract(2)	33					"""""""Insulin(DB00071)|Bacitracin(DB00626)|Insulin Regular(DB00030)"""	TGCAACTTTCATCGAACAAGG	0.363																																						.											0													73.0	68.0	70.0					10																	94291641		2203	4300	6503	SO:0001819	synonymous_variant	3416			M21188	CCDS7421.1, CCDS53554.1	10q23-q25	2007-03-27			ENSG00000119912	ENSG00000119912			5381	protein-coding gene	gene with protein product	"""insulysin"""	146680				2293021	Standard	NM_004969		Approved		uc001kia.3	P14735	OTTHUMG00000018759	ENST00000265986.6:c.525T>C	10.37:g.94291641A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B2R721|B7ZAU2|D3DR35|Q5T5N2	Silent	SNP	ENST00000265986.6	37	CCDS7421.1																																																																																				0.363	IDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049393.1	NM_004969	
KDM2B	84678	ucsc.edu	37	12	121891003	121891003	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr12:121891003A>G	ENST00000377071.4	-	13	1951	c.1879T>C	c.(1879-1881)Tgc>Cgc	p.C627R	KDM2B_ENST00000536437.1_Missense_Mutation_p.C510R|KDM2B_ENST00000377069.4_Missense_Mutation_p.C596R|KDM2B_ENST00000542973.1_5'UTR	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	627					embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						CAGAAGTGGCACTCTCCGCAC	0.692																																						.											0													26.0	31.0	29.0					12																	121891003		2048	4183	6231	SO:0001583	missense	84678			AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.1879T>C	12.37:g.121891003A>G	ENSP00000366271:p.Cys627Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Missense_Mutation	SNP	ENST00000377071.4	37	CCDS41850.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.474763	0.84640	.	.	ENSG00000089094	ENST00000397480;ENST00000377069;ENST00000377071;ENST00000536437;ENST00000397478;ENST00000540043;ENST00000261824	T;T;T	0.77229	-0.16;-0.8;-1.08	5.03	5.03	0.67393	Zinc finger, CXXC-type (2);	0.000000	0.56097	D	0.000023	D	0.91043	0.7182	H	0.94847	3.59	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.999;0.999;0.997;0.999	D;D;D;D;D	0.87578	0.998;0.998;0.998;0.988;0.998	D	0.93505	0.6848	10	0.87932	D	0	-17.4654	14.9219	0.70843	1.0:0.0:0.0:0.0	.	67;510;627;596;67	B7ZB05;Q1RLM7;Q8NHM5;A8MRS1;B4DSN4	.;.;KDM2B_HUMAN;.;.	R	627;596;627;510;627;67;627	ENSP00000366269:C596R;ENSP00000366271:C627R;ENSP00000445196:C510R	ENSP00000261824:C627R	C	-	1	0	KDM2B	120375386	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.126000	0.94411	2.112000	0.64535	0.454000	0.30748	TGC		0.692	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402132.2	NM_032590	
RAI1	10743	ucsc.edu	37	17	17712752	17712752	+	Splice_Site	SNP	A	A	G			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr17:17712752A>G	ENST00000353383.1	+	5	6177	c.5708A>G	c.(5707-5709)aAg>aGg	p.K1903R	RAI1_ENST00000261641.6_Intron	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	1903					circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		CCCAAACATAAGGTAGGGGAC	0.567																																						.											0													114.0	126.0	122.0					17																	17712752		2203	4300	6503	SO:0001630	splice_region_variant	10743			AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.5709+1A>G	17.37:g.17712752A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Missense_Mutation	SNP	ENST00000353383.1	37	CCDS11188.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.338487	0.81911	.	.	ENSG00000108557	ENST00000353383	T	0.70282	-0.47	4.87	3.77	0.43336	Zinc finger, PHD-type (1);	.	.	.	.	T	0.74589	0.3736	L	0.31926	0.97	0.80722	D	1	D	0.71674	0.998	D	0.85130	0.997	T	0.73072	-0.4098	9	0.45353	T	0.12	.	11.187	0.48662	0.8455:0.1545:0.0:0.0	.	1903	Q7Z5J4	RAI1_HUMAN	R	1903	ENSP00000323074:K1903R	ENSP00000323074:K1903R	K	+	2	0	RAI1	17653477	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	7.258000	0.78371	0.797000	0.33971	-0.438000	0.05819	AAG		0.567	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131775.1	NM_030665	Missense_Mutation
ZACN	353174	ucsc.edu	37	17	74075997	74075997	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr17:74075997A>G	ENST00000334586.5	+	4	379	c.296A>G	c.(295-297)aAc>aGc	p.N99S	ZACN_ENST00000392503.2_Intron|EXOC7_ENST00000591724.1_5'Flank	NM_180990.3	NP_851321.2	Q401N2	ZACN_HUMAN	zinc activated ligand-gated ion channel	99					ion transmembrane transport (GO:0034220)|response to zinc ion (GO:0010043)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)|ligand-gated ion channel activity (GO:0015276)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	11						CTGGCCTGGAACACTAGTGCA	0.612																																						.											0													47.0	43.0	45.0					17																	74075997		2202	4299	6501	SO:0001583	missense	353174			AK122638	CCDS11740.2	17q25.3	2012-01-18	2008-04-17	2008-04-17	ENSG00000186919	ENSG00000186919		"""Ligand-gated ion channels / Zinc activated channels"""	29504	protein-coding gene	gene with protein product		610935	"""ligand-gated ion channel, zinc activated 1"""	LGICZ1		12381728, 16083862	Standard	NM_180990		Approved	LGICZ, L2, ZAC, ZAC1	uc002jqn.2	Q401N2	OTTHUMG00000157186	ENST00000334586.5:c.296A>G	17.37:g.74075997A>G	ENSP00000334854:p.Asn99Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q2TB29|Q6ZWK3|Q86YW4	Missense_Mutation	SNP	ENST00000334586.5	37	CCDS11740.2	.	.	.	.	.	.	.	.	.	.	A	14.59	2.580793	0.46006	.	.	ENSG00000186919	ENST00000334586	T	0.80738	-1.41	3.79	3.79	0.43588	Neurotransmitter-gated ion-channel ligand-binding (3);	0.314541	0.28538	N	0.014981	T	0.79885	0.4523	M	0.65975	2.015	0.51233	D	0.999919	P	0.43826	0.818	P	0.44647	0.456	T	0.81167	-0.1056	10	0.59425	D	0.04	-24.5066	10.1512	0.42794	1.0:0.0:0.0:0.0	.	99	Q401N2	ZACN_HUMAN	S	99	ENSP00000334854:N99S	ENSP00000334854:N99S	N	+	2	0	ZACN	71587592	0.972000	0.33761	0.755000	0.31263	0.354000	0.29330	2.868000	0.48436	1.587000	0.49959	0.533000	0.62120	AAC		0.612	ZACN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347827.2	NM_180990	
ANKRD20A5P	440482	mdanderson.org	37	18	14183978	14183978	+	RNA	SNP	T	T	C	rs77403707	byFrequency	TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr18:14183978T>C	ENST00000581935.1	+	0	667							A0PJZ0	A20A5_HUMAN	ankyrin repeat domain 20 family, member A5, pseudogene											lung(3)	3						TGGAACATGGTGCCAATCCAA	0.448																																						.											0													93.0	93.0	93.0					18																	14183978		2201	4296	6497			440482			BC022023		18p11.21	2011-06-01	2011-06-01	2011-06-01	ENSG00000186481	ENSG00000186481			33833	pseudogene	pseudogene			"""ankyrin repeat domain 20 family, member A5"""	ANKRD20A5			Standard	NR_040113		Approved	MGC26718	uc010xag.2	A0PJZ0	OTTHUMG00000157172		18.37:g.14183978T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q4G1B6	RNA	SNP	ENST00000581935.1	37																																																																																					0.448	ANKRD20A5P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000442833.1		
ANKRD20A5P	440482	mdanderson.org	37	18	14184023	14184023	+	RNA	SNP	T	T	G	rs62085009		TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr18:14184023T>G	ENST00000581935.1	+	0	712							A0PJZ0	A20A5_HUMAN	ankyrin repeat domain 20 family, member A5, pseudogene											lung(3)	3						CTGCTCTCCATTATGCTGTGT	0.448																																						.											0													97.0	101.0	100.0					18																	14184023		2200	4292	6492			440482			BC022023		18p11.21	2011-06-01	2011-06-01	2011-06-01	ENSG00000186481	ENSG00000186481			33833	pseudogene	pseudogene			"""ankyrin repeat domain 20 family, member A5"""	ANKRD20A5			Standard	NR_040113		Approved	MGC26718	uc010xag.2	A0PJZ0	OTTHUMG00000157172		18.37:g.14184023T>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q4G1B6	RNA	SNP	ENST00000581935.1	37																																																																																					0.448	ANKRD20A5P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000442833.1		
ARHGEF40	55701	mdanderson.org	37	14	21549893	21549893	+	Missense_Mutation	SNP	G	G	C	rs7143633	byFrequency	TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr14:21549893G>C	ENST00000298694.4	+	14	2993	c.2866G>C	c.(2866-2868)Gtg>Ctg	p.V956L	ARHGEF40_ENST00000298693.3_Missense_Mutation_p.V956L			Q8TER5	ARH40_HUMAN	Rho guanine nucleotide exchange factor (GEF) 40	956			V -> L (in dbSNP:rs7143633). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:17974005}.			cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			large_intestine(4)|ovary(3)|upper_aerodigestive_tract(2)	9						CCAGCAACACGTGGGAGAGGA	0.741													C|||	3908	0.780351	0.798	0.8963	5008	,	,		15114	0.5546		0.836	False		,,,				2504	0.8497					.											0								C	LEU/VAL	3448,786		1409,630,78	8.0	10.0	9.0		2866	4.8	1.0	14	dbSNP_116	9	7161,1095		3118,925,85	yes	missense	ARHGEF40	NM_018071.3	32	4527,1555,163	CC,CG,GG		13.2631,18.564,15.06	benign	956/1520	21549893	10609,1881	2117	4128	6245	SO:0001583	missense	55701				CCDS32041.1	14q11.2	2012-07-24			ENSG00000165801	ENSG00000165801		"""Rho guanine nucleotide exchange factors"""	25516	protein-coding gene	gene with protein product		610018				16143467	Standard	NM_001278529		Approved	solo, FLJ10357	uc001vzp.3	Q8TER5		ENST00000298694.4:c.2866G>C	14.37:g.21549893G>C	ENSP00000298694:p.Val956Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A5PL07|Q9BWP5|Q9H7L6|Q9NTF9|Q9NW24	Missense_Mutation	SNP	ENST00000298694.4	37	CCDS32041.1	1650	0.7554945054945055	392	0.7967479674796748	323	0.8922651933701657	308	0.5384615384615384	627	0.8271767810026385	C	0.838	-0.743038	0.03088	0.81436	0.867369	ENSG00000165801	ENST00000298694;ENST00000298693	T;T	0.01821	4.67;4.62	5.71	4.76	0.60689	.	0.000000	0.43260	N	0.000599	T	0.00012	0.0000	N	0.01352	-0.895	0.80722	P	0.0	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.25152	-1.0140	9	0.02654	T	1	.	12.2401	0.54538	0.0:0.6703:0.3297:0.0	rs7143633;rs61154299;rs7143633	956;956;242	Q8TER5-4;Q8TER5;Q8TER5-2	.;ARH40_HUMAN;.	L	956	ENSP00000298694:V956L;ENSP00000298693:V956L	ENSP00000298693:V956L	V	+	1	0	ARHGEF40	20619733	0.310000	0.24527	0.974000	0.42286	0.417000	0.31264	0.545000	0.23268	1.428000	0.47296	-0.216000	0.12614	GTG		0.741	ARHGEF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413122.1		
ESRRA	2101	mdanderson.org	37	11	64083221	64083221	+	Missense_Mutation	SNP	G	G	C	rs200986301		TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr11:64083221G>C	ENST00000405666.1	+	7	1289	c.1055G>C	c.(1054-1056)cGa>cCa	p.R352P	PRDX5_ENST00000352435.4_5'Flank|PRDX5_ENST00000347941.4_5'Flank|ESRRA_ENST00000000442.6_Missense_Mutation_p.R352P|PRDX5_ENST00000265462.4_5'Flank|ESRRA_ENST00000406310.1_Missense_Mutation_p.R351P	NM_001282450.1	NP_001269379.1	P11474	ERR1_HUMAN	estrogen-related receptor alpha	352	Ligand binding domain.				cartilage development (GO:0051216)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.R352P(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(8)	14						GAGCAGCTGCGAGAAGCTCTG	0.662																																						.											1	Substitution - Missense(1)	large_intestine(1)											68.0	69.0	68.0					11																	64083221		1995	4186	6181	SO:0001583	missense	2101			X51416, L38487	CCDS41667.1, CCDS60830.1	11q12	2013-01-16			ENSG00000173153	ENSG00000173153		"""Nuclear hormone receptors"""	3471	protein-coding gene	gene with protein product		601998		ESRL1		3267207	Standard	NM_004451		Approved	ERR1, ERRalpha, NR3B1, ERRa	uc001nzq.1	P11474	OTTHUMG00000150641	ENST00000405666.1:c.1055G>C	11.37:g.64083221G>C	ENSP00000384851:p.Arg352Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q14514	Missense_Mutation	SNP	ENST00000405666.1	37	CCDS41667.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.36|17.36	3.368790|3.368790	0.61624|0.61624	.|.	.|.	ENSG00000173153|ENSG00000173153	ENST00000545035|ENST00000406310;ENST00000000442;ENST00000405666	.|T;T;T	.|0.39997	.|1.05;1.05;1.05	4.36|4.36	3.45|3.45	0.39498|0.39498	.|Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.64294|0.64294	0.2585|0.2585	M|M	0.81682|0.81682	2.555|2.555	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;0.999	.|D;D	.|0.83275	.|0.996;0.911	T|T	0.69446|0.69446	-0.5143|-0.5143	5|10	.|0.72032	.|D	.|0.01	.|.	12.4594|12.4594	0.55723|0.55723	0.0:0.1705:0.8295:0.0|0.0:0.1705:0.8295:0.0	.|.	.|351;352	.|P11474-2;P11474	.|.;ERR1_HUMAN	Q|P	133|351;352;352	.|ENSP00000385971:R351P;ENSP00000000442:R352P;ENSP00000384851:R352P	.|ENSP00000000442:R352P	E|R	+|+	1|2	0|0	ESRRA|ESRRA	63839797|63839797	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	2.639000|2.639000	0.46570|0.46570	1.213000|1.213000	0.43380|0.43380	-0.218000|-0.218000	0.12543|0.12543	GAG|CGA		0.662	ESRRA-003	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319304.1	NM_004451	
CNTN5	53942	mdanderson.org	37	11	99690461	99690461	+	Missense_Mutation	SNP	A	A	G	rs10893933		TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr11:99690461A>G	ENST00000524871.1	+	4	532	c.242A>G	c.(241-243)aAt>aGt	p.N81S	CNTN5_ENST00000279463.3_Missense_Mutation_p.N81S|CNTN5_ENST00000418526.2_Intron|CNTN5_ENST00000527185.1_Missense_Mutation_p.N81S|CNTN5_ENST00000528682.1_Missense_Mutation_p.N81S	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	81			N -> S (in dbSNP:rs10893933).		cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		TCCCCCATCAATCTTTATCAT	0.428																																						.											0													53.0	52.0	52.0					11																	99690461		1877	4084	5961	SO:0001583	missense	53942			AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.242A>G	11.37:g.99690461A>G	ENSP00000435637:p.Asn81Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Missense_Mutation	SNP	ENST00000524871.1	37	CCDS53696.1	.	.	.	.	.	.	.	.	.	.	A	5.900	0.350168	0.11182	.	.	ENSG00000149972	ENST00000527185;ENST00000528682;ENST00000524871;ENST00000279463	T;T;T;T	0.53857	0.6;0.67;0.67;0.67	5.06	1.42	0.22433	.	0.775582	0.11744	N	0.533735	T	0.31513	0.0799	N	0.19112	0.55	0.31324	P	0.685664	B;B	0.19445	0.036;0.036	B;B	0.15052	0.012;0.012	T	0.37619	-0.9698	9	0.08179	T	0.78	.	8.939	0.35718	0.7862:0.0:0.2138:0.0	rs10893933;rs10893933	81;81	E9PKE8;O94779	.;CNTN5_HUMAN	S	81	ENSP00000433575:N81S;ENSP00000436185:N81S;ENSP00000435637:N81S;ENSP00000279463:N81S	ENSP00000279463:N81S	N	+	2	0	CNTN5	99195671	0.984000	0.35163	0.688000	0.30117	0.746000	0.42486	2.566000	0.45948	0.128000	0.18479	0.528000	0.53228	AAT		0.428	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361	
FAM47C	442444	mdanderson.org	37	X	37028209	37028209	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chrX:37028209G>A	ENST00000358047.3	+	1	1778	c.1726G>A	c.(1726-1728)Gat>Aat	p.D576N		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	576								p.D576N(2)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						GGAGCCTCCCGATACTGGAGT	0.647													-|||	4	0.0010596	0.003	0.0	3775	,	,		11352	0.0		0.0	False		,,,				2504	0.0					.											2	Substitution - Missense(2)	skin(2)											53.0	60.0	57.0					X																	37028209		2202	4300	6502	SO:0001583	missense	442444			AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.1726G>A	X.37:g.37028209G>A	ENSP00000367913:p.Asp576Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	37	CCDS35227.1	.	.	.	.	.	.	.	.	.	.	-	13.20	2.164778	0.38217	.	.	ENSG00000198173	ENST00000358047	T	0.13778	2.56	1.68	-1.72	0.08107	.	.	.	.	.	T	0.02970	0.0088	N	0.04508	-0.205	0.09310	N	1	P	0.40197	0.706	B	0.21917	0.037	T	0.34453	-0.9828	9	0.21014	T	0.42	.	0.8287	0.01126	0.1821:0.2196:0.3774:0.2209	.	576	Q5HY64	FA47C_HUMAN	N	576	ENSP00000367913:D576N	ENSP00000367913:D576N	D	+	1	0	FAM47C	36938130	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-1.469000	0.02348	-0.773000	0.04596	0.400000	0.26472	GAT		0.647	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736	
INSL3	3640	mdanderson.org	37	19	17932289	17932289	+	Silent	SNP	C	C	T	rs2286663	byFrequency	TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr19:17932289C>T	ENST00000317306.7	-	1	43	c.27G>A	c.(25-27)gcG>gcA	p.A9A	INSL3_ENST00000379695.5_Silent_p.A9A	NM_005543.3	NP_005534.2	P51460	INSL3_HUMAN	insulin-like 3 (Leydig cell)	9					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cell-cell signaling (GO:0007267)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oocyte maturation (GO:0001556)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell proliferation (GO:0008284)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|perinuclear region of cytoplasm (GO:0048471)	insulin receptor binding (GO:0005158)|protease binding (GO:0002020)|receptor binding (GO:0005102)			breast(1)|lung(1)	2						GCAGCACCAGCGCCCAGGCGG	0.726													C|||	615	0.122804	0.112	0.1513	5008	,	,		13113	0.2024		0.0547	False		,,,				2504	0.1053					.											0								C		234,3118		10,214,1452	4.0	7.0	6.0		27	-4.7	0.1	19	dbSNP_100	6	233,6007		3,227,2890	no	coding-synonymous	INSL3	NM_005543.2		13,441,4342	TT,TC,CC		3.734,6.9809,4.8686		9/132	17932289	467,9125	1676	3120	4796	SO:0001819	synonymous_variant	3640				CCDS12365.1, CCDS58655.1	19p13.2-p12	2013-02-26	2003-05-13			ENSG00000248099		"""Endogenous ligands"""	6086	protein-coding gene	gene with protein product	"""prepro-INSL3"""	146738	"""relaxin-like factor"""	RLNL		8020942	Standard	NM_001265587		Approved	RLF, MGC119818, MGC119819	uc010ebf.2	P51460		ENST00000317306.7:c.27G>A	19.37:g.17932289C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B4DZ72|G3XAG0|Q3KPI5|Q3KPI6|Q6YNB5|Q9UEA2|Q9UPH6	Silent	SNP	ENST00000317306.7	37	CCDS12365.1																																																																																				0.726	INSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466836.1	NM_005543	
MED17	9440	mdanderson.org	37	11	93517886	93517886	+	Missense_Mutation	SNP	G	G	C	rs2848477	byFrequency	TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr11:93517886G>C	ENST00000251871.3	+	1	494	c.207G>C	c.(205-207)gaG>gaC	p.E69D	MED17_ENST00000530819.1_Missense_Mutation_p.E69D	NM_004268.4	NP_004259.3	Q9NVC6	MED17_HUMAN	mediator complex subunit 17	69			E -> D (in dbSNP:rs2848477). {ECO:0000269|PubMed:10198638, ECO:0000269|PubMed:10235266, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:18691976, ECO:0000269|PubMed:19369195}.		androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			large_intestine(2)|lung(11)|ovary(1)	14		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				ACGCGCAGGAGTGGCCGGGCG	0.726											OREG0021291	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	2833	0.565695	0.2821	0.7464	5008	,	,		13355	0.7411		0.6382	False		,,,				2504	0.5654					.											0								C	ASP/GLU	1525,2613		338,849,882	8.0	7.0	7.0		207	1.7	1.0	11	dbSNP_100	7	5300,2958		1815,1670,644	no	missense	MED17	NM_004268.4	45	2153,2519,1526	CC,CG,GG		35.8198,36.8536,44.9419	benign	69/652	93517886	6825,5571	2069	4129	6198	SO:0001583	missense	9440			AF104254	CCDS8295.1	11q21	2007-07-30	2007-07-30	2007-07-30	ENSG00000042429	ENSG00000042429			2375	protein-coding gene	gene with protein product		603810	"""cofactor required for Sp1 transcriptional activation, subunit 6 (77kD)"", ""cofactor required for Sp1 transcriptional activation, subunit 6, 77kDa"""	CRSP6		9989412, 10198638	Standard	NM_004268		Approved	CRSP77, TRAP80, DRIP80	uc001pem.4	Q9NVC6	OTTHUMG00000167497	ENST00000251871.3:c.207G>C	11.37:g.93517886G>C	ENSP00000251871:p.Glu69Asp	Somatic	1298	WXS	Illumina HiSeq	Phase_I	B3KN07|Q9HA81|Q9UNP7|Q9Y2W0|Q9Y660	Missense_Mutation	SNP	ENST00000251871.3	37	CCDS8295.1	1311	0.6002747252747253	130	0.26422764227642276	259	0.7154696132596685	427	0.7465034965034965	495	0.6530343007915568	C	3.538	-0.094237	0.07053	0.368536	0.641802	ENSG00000042429	ENST00000251871;ENST00000530819;ENST00000427225;ENST00000533359	T;T;T	0.55588	0.51;0.51;0.51	5.76	1.67	0.24075	.	0.143160	0.64402	N	0.000006	T	0.00012	0.0000	L	0.50333	1.59	0.51482	P	7.199999999996098E-5	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.41251	-0.9519	9	0.12103	T	0.63	-17.8592	6.367	0.21461	0.0:0.5236:0.2246:0.2518	rs2848477;rs17845635;rs17858567	69;69	Q9NVC6;Q9NVC6-2	MED17_HUMAN;.	D	69;69;39;69	ENSP00000251871:E69D;ENSP00000434459:E69D;ENSP00000431524:E69D	ENSP00000251871:E69D	E	+	3	2	MED17	93157534	0.996000	0.38824	1.000000	0.80357	0.330000	0.28571	0.190000	0.17057	0.391000	0.25143	-0.216000	0.12614	GAG		0.726	MED17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394800.2	NM_004268	
ANKRD30BL	554226	mdanderson.org	37	2	133014602	133014602	+	Intron	SNP	G	G	C	rs75245503	byFrequency	TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr2:133014602G>C	ENST00000470729.1	-	1	441				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						GCCACAGACAGGAGGGAGGTA	0.721																																						.											0													27.0	45.0	39.0					2																	133014602		1553	3578	5131	SO:0001627	intron_variant	100313824					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.984+499C>G	2.37:g.133014602G>C		Somatic		WXS	Illumina HiSeq	Phase_I	B8ZZL7	RNA	SNP	ENST00000470729.1	37																																																																																					0.721	ANKRD30BL-002	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000331354.1	NR_027019	
ANKRD30BL	554226	mdanderson.org	37	2	133014612	133014612	+	Intron	SNP	A	A	C	rs199913868|rs74853538	byFrequency	TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr2:133014612A>C	ENST00000470729.1	-	1	441				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						GGAGGGAGGTACCGCAGCGAC	0.716																																						.											0													27.0	46.0	40.0					2																	133014612		1553	3577	5130	SO:0001627	intron_variant	100313824					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.984+489T>G	2.37:g.133014612A>C		Somatic		WXS	Illumina HiSeq	Phase_I	B8ZZL7	RNA	SNP	ENST00000470729.1	37																																																																																					0.716	ANKRD30BL-002	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000331354.1	NR_027019	
MUC4	4585	mdanderson.org	37	3	195508931	195508931	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr3:195508931G>A	ENST00000463781.3	-	2	9979	c.9520C>T	c.(9520-9522)Ctt>Ttt	p.L3174F	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.L3174F|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACTGAGGAAAGGCTGGTGACA	0.582																																						.											0																																										SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9520C>T	3.37:g.195508931G>A	ENSP00000417498:p.Leu3174Phe	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	4.606	0.112617	0.08831	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32515	1.48;1.45	.	.	.	.	.	.	.	.	T	0.13286	0.0322	N	0.19112	0.55	0.09310	N	1	B	0.21225	0.053	B	0.11329	0.006	T	0.19192	-1.0313	7	.	.	.	.	3.3936	0.07298	0.2446:0.2679:0.4875:0.0	.	3046	E7ESK3	.	F	3174	ENSP00000417498:L3174F;ENSP00000420243:L3174F	.	L	-	1	0	MUC4	196993710	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.925000	0.03992	-2.321000	0.00641	-2.362000	0.00238	CTT		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC6	4588	mdanderson.org	37	11	1017654	1017654	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr11:1017654G>A	ENST00000421673.2	-	31	5197	c.5147C>T	c.(5146-5148)cCc>cTc	p.P1716L		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1716	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGTGGGGTTGGGGGTGATGTT	0.517																																						.											0													586.0	579.0	581.0					11																	1017654		2195	4281	6476	SO:0001583	missense	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5147C>T	11.37:g.1017654G>A	ENSP00000406861:p.Pro1716Leu	Somatic		WXS	Illumina HiSeq	Phase_I	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	G	7.873	0.728666	0.15507	.	.	ENSG00000184956	ENST00000421673	T	0.22539	1.95	1.58	0.52	0.17040	.	.	.	.	.	T	0.16854	0.0405	L	0.58101	1.795	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.30357	-0.9981	9	0.33940	T	0.23	.	2.2855	0.04125	0.2093:0.0:0.4243:0.3664	.	1716	Q6W4X9	MUC6_HUMAN	L	1716	ENSP00000406861:P1716L	ENSP00000406861:P1716L	P	-	2	0	MUC6	1007654	0.000000	0.05858	0.003000	0.11579	0.046000	0.14306	0.316000	0.19469	0.185000	0.20105	0.271000	0.19318	CCC		0.517	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MUC6	4588	mdanderson.org	37	11	1017669	1017669	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr11:1017669G>A	ENST00000421673.2	-	31	5182	c.5132C>T	c.(5131-5133)aCc>aTc	p.T1711I		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1711	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GATGTTGGTGGTAGAAGTTGA	0.532																																						.											0													642.0	631.0	635.0					11																	1017669		2196	4287	6483	SO:0001583	missense	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5132C>T	11.37:g.1017669G>A	ENSP00000406861:p.Thr1711Ile	Somatic		WXS	Illumina HiSeq	Phase_I	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	G	7.740	0.700992	0.15172	.	.	ENSG00000184956	ENST00000421673	T	0.18810	2.19	1.44	0.44	0.16572	.	.	.	.	.	T	0.09686	0.0238	N	0.22421	0.69	0.09310	N	1	P	0.50819	0.939	B	0.33454	0.164	T	0.23013	-1.0200	9	0.38643	T	0.18	.	6.7634	0.23552	0.0:0.0:0.7213:0.2787	.	1711	Q6W4X9	MUC6_HUMAN	I	1711	ENSP00000406861:T1711I	ENSP00000406861:T1711I	T	-	2	0	MUC6	1007669	0.000000	0.05858	0.003000	0.11579	0.070000	0.16714	-0.005000	0.12855	0.159000	0.19401	0.281000	0.19383	ACC		0.532	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
OR2T33	391195	mdanderson.org	37	1	248436932	248436932	+	Missense_Mutation	SNP	C	C	T	rs200639224		TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr1:248436932C>T	ENST00000318021.2	-	1	206	c.185G>A	c.(184-186)aGc>aAc	p.S62N		NM_001004695.1	NP_001004695.1	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T, member 33	62						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(41)|ovary(1)|prostate(1)|skin(4)	67	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			GGAAAGTTGGCTCAGGAGGAA	0.542																																						.											0								C	ASN/SER	2,4402		0,2,2200	83.0	75.0	78.0		185	2.7	1.0	1		78	0,8600		0,0,4300	no	missense	OR2T33	NM_001004695.1	46	0,2,6500	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging	62/321	248436932	2,13002	2202	4300	6502	SO:0001583	missense	391195				CCDS31109.1	1q44	2012-08-09			ENSG00000177212	ENSG00000177212		"""GPCR / Class A : Olfactory receptors"""	31255	protein-coding gene	gene with protein product							Standard	NM_001004695		Approved		uc010pzi.2	Q8NG76	OTTHUMG00000040458	ENST00000318021.2:c.185G>A	1.37:g.248436932C>T	ENSP00000324687:p.Ser62Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B2RNN0	Missense_Mutation	SNP	ENST00000318021.2	37	CCDS31109.1	18	0.008241758241758242	18	0.036585365853658534	0	0.0	0	0.0	0	0.0	-	10.52	1.373951	0.24857	4.54E-4	0.0	ENSG00000177212	ENST00000318021	T	0.00402	7.56	2.7	2.7	0.31948	GPCR, rhodopsin-like superfamily (1);	0.175206	0.27384	U	0.019616	T	0.00144	0.0004	M	0.88570	2.965	0.09310	N	1	B	0.20368	0.044	B	0.23716	0.048	T	0.50583	-0.8811	10	0.72032	D	0.01	.	2.1724	0.03853	0.1962:0.4885:0.1919:0.1235	.	62	Q8NG76	O2T33_HUMAN	N	62	ENSP00000324687:S62N	ENSP00000324687:S62N	S	-	2	0	OR2T33	246503555	0.000000	0.05858	0.974000	0.42286	0.950000	0.60333	-1.519000	0.02243	1.437000	0.47472	0.494000	0.49563	AGC		0.542	OR2T33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097354.1	NM_001004695	
SLC35G6	643664	mdanderson.org	37	17	7386090	7386091	+	Missense_Mutation	DNP	GC	GC	AA	rs7209977|rs541352076	byFrequency	TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr17:7386090_7386091GC>AA	ENST00000412468.2	+	2	902_903	c.787_788GC>AA	c.(787-789)GCc>AAc	p.A263N	POLR2A_ENST00000572844.1_5'Flank|POLR2A_ENST00000322644.6_5'Flank|ZBTB4_ENST00000311403.4_Intron	NM_001102614.1	NP_001096084.1	P0C7Q6	S35G6_HUMAN	solute carrier family 35, member G6	263			A -> T (in dbSNP:rs7209977).			integral component of membrane (GO:0016021)											GGGGATCCTCGCCTTGGTCTCC	0.634																																						.											0																																										SO:0001583	missense	643664				CCDS45603.1	17p13.1	2013-05-22	2011-08-03	2011-08-03		ENSG00000259224		"""Solute carriers"""	31351	protein-coding gene	gene with protein product			"""transmembrane protein 21B"", ""acyl-malonyl condensing enzyme 1-like 3"""	TMEM21B, AMAC1L3			Standard	NM_001102614		Approved		uc010cmj.1	P0C7Q6		Exception_encountered	17.37:g.7386090_7386091delinsAA	ENSP00000396523:p.Ala263Asn	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	DNP	ENST00000412468.2	37	CCDS45603.1																																																																																				0.634	SLC35G6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001102614	
SLC35G6	643664	mdanderson.org	37	17	7386114	7386114	+	Missense_Mutation	SNP	A	A	G	rs199996601	byFrequency	TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr17:7386114A>G	ENST00000412468.2	+	2	926	c.811A>G	c.(811-813)Agc>Ggc	p.S271G	POLR2A_ENST00000572844.1_5'Flank|POLR2A_ENST00000322644.6_5'Flank|ZBTB4_ENST00000311403.4_Intron	NM_001102614.1	NP_001096084.1	P0C7Q6	S35G6_HUMAN	solute carrier family 35, member G6	271						integral component of membrane (GO:0016021)											CACATGTGTGAGCTATGCGGT	0.592																																						.											0													137.0	112.0	120.0					17																	7386114		2203	4300	6503	SO:0001583	missense	643664				CCDS45603.1	17p13.1	2013-05-22	2011-08-03	2011-08-03		ENSG00000259224		"""Solute carriers"""	31351	protein-coding gene	gene with protein product			"""transmembrane protein 21B"", ""acyl-malonyl condensing enzyme 1-like 3"""	TMEM21B, AMAC1L3			Standard	NM_001102614		Approved		uc010cmj.1	P0C7Q6		ENST00000412468.2:c.811A>G	17.37:g.7386114A>G	ENSP00000396523:p.Ser271Gly	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000412468.2	37	CCDS45603.1	.	.	.	.	.	.	.	.	.	.	A	0.943	-0.708930	0.03230	.	.	ENSG00000181222	ENST00000412468	T	0.52295	0.67	4.06	2.97	0.34412	.	.	.	.	.	T	0.34279	0.0892	L	0.44542	1.39	0.25098	N	0.99081	B	0.02656	0.0	B	0.04013	0.001	T	0.23940	-1.0174	9	0.22706	T	0.39	-2.9278	4.559	0.12151	0.7349:0.0:0.0961:0.1691	.	271	P0C7Q6	S35G6_HUMAN	G	271	ENSP00000396523:S271G	ENSP00000396523:S271G	S	+	1	0	SLC35G6	7326838	0.924000	0.31332	0.993000	0.49108	0.007000	0.05969	0.595000	0.24029	0.560000	0.29169	-0.516000	0.04426	AGC		0.592	SLC35G6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001102614	
SLC9B1	150159	mdanderson.org	37	4	103826788	103826788	+	Silent	SNP	T	T	G	rs201197585		TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr4:103826788T>G	ENST00000296422.7	-	11	1356	c.1215A>C	c.(1213-1215)ctA>ctC	p.L405L	SLC9B1_ENST00000394789.3_Silent_p.L405L|SLC9B1_ENST00000512651.2_Intron	NM_139173.3	NP_631912	Q4ZJI4	SL9B1_HUMAN	solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1	405					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)	p.L405L(1)									ATGCCAAACTTAGAGTGGCAA	0.318																																						.											1	Substitution - coding silent(1)	pancreas(1)											54.0	54.0	54.0					4																	103826788		2201	4295	6496	SO:0001819	synonymous_variant	150159			AF447585	CCDS34041.1, CCDS47119.1	4q24	2013-05-22	2012-03-22	2011-07-26	ENSG00000164037	ENSG00000164037		"""Solute carriers"""	24244	protein-coding gene	gene with protein product		611527	"""Na+/H+ exchanger domain containing 1"", ""solute carrier family 9, subfamily B (cation proton antiporter 2), member 1"""	NHEDC1		16850186	Standard	NM_139173		Approved	NHA1	uc003hww.3	Q4ZJI4	OTTHUMG00000161114	ENST00000296422.7:c.1215A>C	4.37:g.103826788T>G		Somatic		WXS	Illumina HiSeq	Phase_I	A1KXV1|B9EH04|C9JBP7|Q49A30|Q8NCV2|Q8WVZ0	Silent	SNP	ENST00000296422.7	37	CCDS34041.1																																																																																				0.318	SLC9B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363841.1	NM_139173	
SOS2	6655	mdanderson.org;bcgsc.ca	37	14	50626363	50626363	+	Missense_Mutation	SNP	A	A	T			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr14:50626363A>T	ENST00000216373.5	-	10	1912	c.1638T>A	c.(1636-1638)agT>agA	p.S546R	SOS2_ENST00000555794.1_5'UTR|SOS2_ENST00000543680.1_Missense_Mutation_p.S513R	NM_006939.2	NP_008870.2	Q07890	SOS2_HUMAN	son of sevenless homolog 2 (Drosophila)	546	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	DNA binding (GO:0003677)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(16)|ovary(2)|skin(1)	39	all_epithelial(31;0.000822)|Breast(41;0.0065)					GATCTAGAGTACTACGATAAT	0.343																																						.											0													106.0	110.0	109.0					14																	50626363		2203	4300	6503	SO:0001583	missense	6655			L13858	CCDS9697.1	14q21	2013-01-10	2001-12-04		ENSG00000100485	ENSG00000100485		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11188	protein-coding gene	gene with protein product		601247	"""son of sevenless (Drosophilia) homolog 2"""			8276400	Standard	NM_006939		Approved		uc001wxs.4	Q07890	OTTHUMG00000140292	ENST00000216373.5:c.1638T>A	14.37:g.50626363A>T	ENSP00000216373:p.Ser546Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZKT6|D3DSB4|Q15503|Q17RN1	Missense_Mutation	SNP	ENST00000216373.5	37	CCDS9697.1	.	.	.	.	.	.	.	.	.	.	A	14.73	2.621350	0.46736	.	.	ENSG00000100485	ENST00000216373;ENST00000543680	D;D	0.88124	-2.34;-2.34	5.24	1.63	0.23807	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.122555	0.85682	D	0.000000	D	0.87951	0.6307	M	0.81942	2.565	0.54753	D	0.999985	P;P;D	0.58620	0.866;0.913;0.983	B;B;P	0.48030	0.391;0.342;0.564	D	0.85809	0.1378	10	0.56958	D	0.05	.	9.9675	0.41734	0.5506:0.0:0.4494:0.0	.	513;576;546	B7ZKT6;Q59G32;Q07890	.;.;SOS2_HUMAN	R	546;513	ENSP00000216373:S546R;ENSP00000445328:S513R	ENSP00000216373:S546R	S	-	3	2	SOS2	49696113	0.972000	0.33761	1.000000	0.80357	0.991000	0.79684	0.220000	0.17660	0.099000	0.17552	0.477000	0.44152	AGT		0.343	SOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276878.2		
TBC1D29	26083	mdanderson.org	37	17	28887667	28887667	+	Silent	SNP	T	T	C	rs78888987	byFrequency	TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr17:28887667T>C	ENST00000580161.1	+	4	2608	c.111T>C	c.(109-111)gaT>gaC	p.D37D	TBC1D29_ENST00000584297.1_Silent_p.D37D|TBC1D29_ENST00000579181.1_Silent_p.D37D|RP11-218M11.6_ENST00000582125.1_RNA			Q9UFV1	TBC29_HUMAN	TBC1 domain family, member 29	37	Rab-GAP TBC; truncated. {ECO:0000255|PROSITE-ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)	p.D37D(1)		breast(1)|kidney(1)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Myeloproliferative disorder(56;0.0255)				GCCTGTGGGATATGTATTTGC	0.572																																						.											1	Substitution - coding silent(1)	lung(1)											149.0	126.0	134.0					17																	28887667		2203	4300	6503	SO:0001819	synonymous_variant	26083			BC096718	CCDS32606.1	17q11.2	2014-09-04			ENSG00000266733	ENSG00000266733			24509	protein-coding gene	gene with protein product						12618308	Standard	XM_006721805		Approved	DKFZP434O047	uc002hfh.3	Q9UFV1	OTTHUMG00000178857	ENST00000580161.1:c.111T>C	17.37:g.28887667T>C		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000580161.1	37	CCDS32606.1																																																																																				0.572	TBC1D29-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443632.1	NM_015594	
TREML2	79865	mdanderson.org	37	6	41166022	41166022	+	Silent	SNP	A	A	G	rs386700523|rs139267947		TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr6:41166022A>G	ENST00000483722.1	-	2	386	c.201T>C	c.(199-201)ttT>ttC	p.F67F		NM_024807.2	NP_079083.2	Q5T2D2	TRML2_HUMAN	triggering receptor expressed on myeloid cells-like 2	67	Ig-like V-type.				T cell activation (GO:0042110)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|large_intestine(1)|lung(13)|ovary(1)|prostate(1)	18	Ovarian(28;0.0418)|Colorectal(47;0.196)					AGACTCGGGCAAAGCCAGGCT	0.572																																						.											0													135.0	134.0	134.0					6																	41166022		2203	4300	6503	SO:0001819	synonymous_variant	79865			AK023755	CCDS4853.1, CCDS4853.2	6p21.1	2013-01-11	2004-04-14	2004-04-16	ENSG00000112195	ENSG00000112195		"""Immunoglobulin superfamily / V-set domain containing"""	21092	protein-coding gene	gene with protein product	"""TREM-like transcript 2"""	609715	"""chromosome 6 open reading frame 76"""	C6orf76		12645956	Standard	NM_024807		Approved	FLJ13693, TLT2, dJ238O23.1	uc010jxm.1	Q5T2D2	OTTHUMG00000016349	ENST00000483722.1:c.201T>C	6.37:g.41166022A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q08AP8|Q08AP9|Q8IWY0|Q9H8E9	Silent	SNP	ENST00000483722.1	37	CCDS4853.2																																																																																				0.572	TREML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043756.3	NM_024807	
TREML2	79865	mdanderson.org	37	6	41166025	41166025	+	Silent	SNP	G	G	A	rs113267424	byFrequency	TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr6:41166025G>A	ENST00000483722.1	-	2	383	c.198C>T	c.(196-198)ggC>ggT	p.G66G		NM_024807.2	NP_079083.2	Q5T2D2	TRML2_HUMAN	triggering receptor expressed on myeloid cells-like 2	66	Ig-like V-type.				T cell activation (GO:0042110)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|large_intestine(1)|lung(13)|ovary(1)|prostate(1)	18	Ovarian(28;0.0418)|Colorectal(47;0.196)					CTCGGGCAAAGCCAGGCTCAC	0.567																																						.											0													139.0	139.0	139.0					6																	41166025		2203	4300	6503	SO:0001819	synonymous_variant	79865			AK023755	CCDS4853.1, CCDS4853.2	6p21.1	2013-01-11	2004-04-14	2004-04-16	ENSG00000112195	ENSG00000112195		"""Immunoglobulin superfamily / V-set domain containing"""	21092	protein-coding gene	gene with protein product	"""TREM-like transcript 2"""	609715	"""chromosome 6 open reading frame 76"""	C6orf76		12645956	Standard	NM_024807		Approved	FLJ13693, TLT2, dJ238O23.1	uc010jxm.1	Q5T2D2	OTTHUMG00000016349	ENST00000483722.1:c.198C>T	6.37:g.41166025G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q08AP8|Q08AP9|Q8IWY0|Q9H8E9	Silent	SNP	ENST00000483722.1	37	CCDS4853.2																																																																																				0.567	TREML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043756.3	NM_024807	
USP48	84196	mdanderson.org	37	1	22109370	22109370	+	Silent	SNP	G	G	A	rs10917042	byFrequency	TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr1:22109370G>A	ENST00000308271.9	-	1	729	c.81C>T	c.(79-81)caC>caT	p.H27H	USP48_ENST00000400301.1_Silent_p.H27H|USP48_ENST00000421625.2_Silent_p.H27H|USP48_ENST00000529637.1_Silent_p.H27H	NM_032236.5	NP_115612.4	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 48	27					ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			NS(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(14)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		CGGTCTCGATGTGCTCCTGCG	0.736													G|||	1411	0.281749	0.028	0.5274	5008	,	,		12624	0.5893		0.2197	False		,,,				2504	0.1973					.											0								G	,	275,4053		11,253,1900	18.0	16.0	17.0		81,81	0.8	1.0	1	dbSNP_120	17	1858,6642		203,1452,2595	no	coding-synonymous,coding-synonymous	USP48	NM_001032730.1,NM_032236.5	,	214,1705,4495	AA,AG,GG		21.8588,6.354,16.6277	,	27/486,27/1036	22109370	2133,10695	2164	4250	6414	SO:0001819	synonymous_variant	84196			AF502942	CCDS30623.1, CCDS44084.1	1p36.12	2008-02-05	2005-08-08	2004-04-07	ENSG00000090686	ENSG00000090686		"""Ubiquitin-specific peptidases"""	18533	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"", ""ubiquitin specific protease 48"""	USP31		12838346	Standard	XM_005246009		Approved	FLJ23277, FLJ11328, FLJ20103, FLJ23054, MGC14879	uc001bfb.3	Q86UV5	OTTHUMG00000007798	ENST00000308271.9:c.81C>T	1.37:g.22109370G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Silent	SNP	ENST00000308271.9	37	CCDS30623.1																																																																																				0.736	USP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021372.1	NM_032236	
ZFHX3	463	mdanderson.org	37	16	72991715	72991715	+	Missense_Mutation	SNP	A	A	G	rs4788682	byFrequency	TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr16:72991715A>G	ENST00000268489.5	-	2	3002	c.2330T>C	c.(2329-2331)gTg>gCg	p.V777A	ZFHX3_ENST00000397992.5_Intron	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	777	Poly-Ala.		V -> A (in dbSNP:rs4788682). {ECO:0000269|PubMed:7592926}.		brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				cgccgcagccaccgccgccgc	0.642													G|||	3834	0.765575	0.7474	0.8862	5008	,	,		9194	0.6855		0.8559	False		,,,				2504	0.6943					.											0								G	,ALA/VAL	3072,924		1241,590,167	11.0	18.0	16.0		,2330	4.5	0.0	16	dbSNP_111	16	6627,1175		2887,853,161	no	intron,missense	ZFHX3	NM_001164766.1,NM_006885.3	,64	4128,1443,328	GG,GA,AA		15.0602,23.1231,17.7912	,benign	,777/3704	72991715	9699,2099	1998	3901	5899	SO:0001583	missense	463			D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.2330T>C	16.37:g.72991715A>G	ENSP00000268489:p.Val777Ala	Somatic		WXS	Illumina HiSeq	Phase_I	D3DWS8|O15101|Q13719	Missense_Mutation	SNP	ENST00000268489.5	37	CCDS10908.1	1678	0.7683150183150184	361	0.733739837398374	312	0.861878453038674	376	0.6573426573426573	629	0.8298153034300791	G	1.367	-0.587199	0.03827	0.768769	0.849398	ENSG00000140836	ENST00000268489	T	0.72615	-0.67	5.49	4.54	0.55810	.	0.000000	0.36555	N	0.002526	T	0.00012	0.0000	N	0.08118	0	0.09310	P	1.0	B	0.09022	0.002	B	0.01281	0.0	T	0.36553	-0.9743	9	0.10902	T	0.67	.	12.3576	0.55184	0.1365:0.0:0.8635:0.0	rs4788682;rs57247863	777	Q15911	ZFHX3_HUMAN	A	777	ENSP00000268489:V777A	ENSP00000268489:V777A	V	-	2	0	ZFHX3	71549216	1.000000	0.71417	0.004000	0.12327	0.024000	0.10985	5.328000	0.65887	0.709000	0.31976	-0.215000	0.12644	GTG		0.642	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
NBPF10	100132406	bcgsc.ca	37	1	145323656	145323656	+	Missense_Mutation	SNP	A	A	T	rs75252120	byFrequency	TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr1:145323656A>T	ENST00000342960.5	+	27	3528	c.3493A>T	c.(3493-3495)Att>Ttt	p.I1165F	NBPF10_ENST00000369339.3_Intron|NBPF10_ENST00000369338.1_Intron	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	752						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.I1165F(3)		NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		TATTGCAGGAATTAAAAAGGA	0.473																																						.											3	Substitution - Missense(3)	endometrium(2)|kidney(1)																																								SO:0001583	missense	100132406			BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.3493A>T	1.37:g.145323656A>T	ENSP00000345684:p.Ile1165Phe	Somatic		WXS	Illumina HiSeq	Phase_I	Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000342960.5	37	CCDS53355.1	.	.	.	.	.	.	.	.	.	.	.	7.524	0.657305	0.14580	.	.	ENSG00000163386	ENST00000342960	T	0.03441	3.93	.	.	.	.	.	.	.	.	T	0.02342	0.0072	M	0.67953	2.075	0.09310	N	1	.	.	.	.	.	.	T	0.44065	-0.9352	5	0.28530	T	0.3	.	.	.	.	.	.	.	.	F	1165	ENSP00000345684:I1165F	ENSP00000345684:I1165F	I	+	1	0	NBPF10	144035013	0.353000	0.24904	0.005000	0.12908	0.123000	0.20343	1.122000	0.31295	0.386000	0.24997	0.128000	0.15822	ATT		0.473	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001039703	
FBXO18	84893	bcgsc.ca	37	10	5960320	5960320	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr10:5960320T>C	ENST00000362091.4	+	13	2094	c.1979T>C	c.(1978-1980)gTt>gCt	p.V660A	FBXO18_ENST00000379999.5_Missense_Mutation_p.V711A|FBXO18_ENST00000397269.3_Missense_Mutation_p.V147A	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18	660					DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)			NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						ATGAACATAGTTCTGTCTCAG	0.512																																						.											0													151.0	156.0	154.0					10																	5960320		2203	4300	6503	SO:0001583	missense	84893			AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.1979T>C	10.37:g.5960320T>C	ENSP00000355415:p.Val660Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	Missense_Mutation	SNP	ENST00000362091.4	37	CCDS7072.1	.	.	.	.	.	.	.	.	.	.	T	25.6	4.656864	0.88154	.	.	ENSG00000134452	ENST00000397269;ENST00000362091;ENST00000379999	D;D;D	0.82433	-1.61;-1.61;-1.61	6.0	6.0	0.97389	.	0.264586	0.38548	N	0.001659	D	0.84156	0.5410	L	0.39898	1.24	0.50313	D	0.999867	D;P;P	0.53745	0.962;0.918;0.931	P;P;P	0.52454	0.466;0.525;0.699	D	0.85834	0.1393	10	0.72032	D	0.01	-23.0821	16.2107	0.82151	0.0:0.0:0.0:1.0	.	711;660;586	Q8NFZ0-2;Q8NFZ0;Q2TAK1	.;FBX18_HUMAN;.	A	147;660;711	ENSP00000380439:V147A;ENSP00000355415:V660A;ENSP00000369335:V711A	ENSP00000355415:V660A	V	+	2	0	FBXO18	6000326	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.192000	0.77771	2.299000	0.77371	0.529000	0.55759	GTT		0.512	FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046596.1	NM_032807	
MUC2	4583	bcgsc.ca	37	11	1093364	1093364	+	Missense_Mutation	SNP	C	C	G	rs113138128		TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr11:1093364C>G	ENST00000441003.2	+	30	5210	c.5183C>G	c.(5182-5184)aCt>aGt	p.T1728S	MUC2_ENST00000359061.5_Missense_Mutation_p.T1695S|MUC2_ENST00000333592.6_Missense_Mutation_p.T16S|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1695S(2)|p.T1728S(2)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	tccaccaccactacggtgacc	0.652																																						.											4	Substitution - Missense(4)	large_intestine(2)|haematopoietic_and_lymphoid_tissue(2)											184.0	230.0	214.0					11																	1093364		1968	3805	5773	SO:0001583	missense	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5183C>G	11.37:g.1093364C>G	ENSP00000415183:p.Thr1728Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	1.152	-0.646415	0.03531	.	.	ENSG00000198788	ENST00000441003;ENST00000359061;ENST00000333592	T;T;T	0.11604	2.76;2.85;2.86	1.47	-2.95	0.05564	.	0.396535	0.13252	N	0.402004	T	0.03136	0.0092	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42207	-0.9465	9	0.06236	T	0.91	.	4.7261	0.12941	0.0:0.4234:0.393:0.1837	.	1728	E7EUV1	.	S	1728;1695;16	ENSP00000415183:T1728S;ENSP00000351956:T1695S;ENSP00000331373:T16S	ENSP00000331373:T16S	T	+	2	0	MUC2	1083364	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.577000	0.05847	-0.762000	0.04664	-1.112000	0.02068	ACT		0.652	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
HNF1B	6928	bcgsc.ca	37	17	36099509	36099511	+	In_Frame_Del	DEL	TTG	TTG	-			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	TTG	TTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr17:36099509_36099511delTTG	ENST00000225893.4	-	2	825_827	c.464_466delCAA	c.(463-468)acaaag>aag	p.T155del	HNF1B_ENST00000427275.2_In_Frame_Del_p.T155del|HNF1B_ENST00000560016.1_In_Frame_Del_p.T155del|HNF1B_ENST00000561193.1_In_Frame_Del_p.T155del	NM_000458.2|NM_001165923.1	NP_000449.1|NP_001159395.1	P35680	HNF1B_HUMAN	HNF1 homeobox B	155					anterior/posterior pattern specification (GO:0009952)|branching morphogenesis of an epithelial tube (GO:0048754)|embryonic digestive tract morphogenesis (GO:0048557)|endocrine pancreas development (GO:0031018)|endodermal cell fate specification (GO:0001714)|epithelial cell proliferation (GO:0050673)|genitalia development (GO:0048806)|hepatoblast differentiation (GO:0061017)|hindbrain development (GO:0030902)|inner cell mass cell differentiation (GO:0001826)|insulin secretion (GO:0030073)|kidney development (GO:0001822)|mesonephric duct formation (GO:0072181)|negative regulation of mesenchymal cell apoptotic process involved in mesonephric nephron morphogenesis (GO:0061296)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric nephron tubule development (GO:0039020)|pronephros development (GO:0048793)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of endodermal cell fate specification (GO:0042663)|regulation of pronephros size (GO:0035565)|regulation of Wnt signaling pathway (GO:0030111)|response to glucose (GO:0009749)|ureteric bud elongation (GO:0060677)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(6)|kidney(3)|large_intestine(2)|liver(1)|lung(3)|ovary(3)|prostate(1)|skin(2)	28		Breast(25;0.00765)|Ovarian(249;0.15)	STAD - Stomach adenocarcinoma(1;0.0142)			GGGGTGCCCTTGTTGAGATGCTG	0.547																																					Colon(71;102 1179 9001 27917 43397)	.											0			GRCh37	CM060487	HNF1B	M																																				SO:0001651	inframe_deletion	6928			BC017714	CCDS11324.1, CCDS58538.1	17q12	2014-05-06	2007-08-24	2007-08-24	ENSG00000108753	ENSG00000275410		"""Homeoboxes / HNF class"""	11630	protein-coding gene	gene with protein product		189907	"""transcription factor 2, hepatic; LF-B3; variant hepatic nuclear factor"""	TCF2		1677179, 10484768	Standard	NM_000458		Approved	LFB3, VHNF1, HNF1beta, MODY5	uc002hok.4	P35680	OTTHUMG00000188478	ENST00000225893.4:c.464_466delCAA	17.37:g.36099509_36099511delTTG	ENSP00000225893:p.Thr155del	Somatic		WXS	Illumina HiSeq	Phase_I	B4DKM3|E0YMJ9	In_Frame_Del	DEL	ENST00000225893.4	37	CCDS11324.1																																																																																				0.547	HNF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256807.3	NM_000458	
GPD1L	23171	bcgsc.ca	37	3	32169636	32169644	+	In_Frame_Del	DEL	AAGATGTGG	AAGATGTGG	-			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	AAGATGTGG	AAGATGTGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr3:32169636_32169644delAAGATGTGG	ENST00000282541.5	+	2	317_325	c.116_124delAAGATGTGG	c.(115-126)aaagatgtggtc>atc	p.39_42KDVV>I		NM_015141.3	NP_055956.1	Q8N335	GPD1L_HUMAN	glycerol-3-phosphate dehydrogenase 1-like	39					carbohydrate metabolic process (GO:0005975)|cellular lipid metabolic process (GO:0044255)|glycerol-3-phosphate catabolic process (GO:0046168)|glycerophospholipid biosynthetic process (GO:0046474)|NAD metabolic process (GO:0019674)|NADH metabolic process (GO:0006734)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein kinase C signaling (GO:0090038)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|positive regulation of protein localization to cell surface (GO:2000010)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate (GO:0002027)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|ventricular cardiac muscle cell action potential (GO:0086005)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycerol-3-phosphate dehydrogenase complex (GO:0009331)|plasma membrane (GO:0005886)	glycerol-3-phosphate dehydrogenase [NAD+] activity (GO:0004367)|ion channel binding (GO:0044325)|NAD binding (GO:0051287)|sodium channel regulator activity (GO:0017080)			large_intestine(4)|lung(7)|ovary(1)	12						TCCACAGTCAAGATGTGGGTCTTTGAAGA	0.354																																						.											0																																										SO:0001651	inframe_deletion	23171			D42047	CCDS33729.1	3p22.3	2014-09-17			ENSG00000152642	ENSG00000152642			28956	protein-coding gene	gene with protein product		611778				7788527	Standard	NM_015141		Approved	KIAA0089	uc003cew.3	Q8N335	OTTHUMG00000155846	ENST00000282541.5:c.116_124delAAGATGTGG	3.37:g.32169636_32169644delAAGATGTGG	ENSP00000282541:p.Lys39_Val42delinsIle	Somatic		WXS	Illumina HiSeq	Phase_I	A8K9U3|Q14702|Q9BRM5	In_Frame_Del	DEL	ENST00000282541.5	37	CCDS33729.1																																																																																				0.354	GPD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341975.2	NM_015141	
HLA-A	3105	bcgsc.ca	37	6	29911261	29911261	+	Missense_Mutation	SNP	C	C	G			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr6:29911261C>G	ENST00000396634.1	+	5	901	c.560C>G	c.(559-561)aCg>aGg	p.T187R	HLA-A_ENST00000376802.2_Missense_Mutation_p.T187R|HLA-A_ENST00000376806.5_Missense_Mutation_p.T187R|HLA-A_ENST00000376809.5_Missense_Mutation_p.T187R			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	187	Alpha-2.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						CTGGATGGCACGTGCGTGGAG	0.667									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)			g|||	1039	0.207468	0.0809	0.1037	5008	,	,		12986	0.3185		0.2018	False		,,,				2504	0.3436					.											0													45.0	35.0	39.0					6																	29911261		1508	2702	4210	SO:0001583	missense	3105	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.560C>G	6.37:g.29911261C>G	ENSP00000379873:p.Thr187Arg	Somatic		WXS	Illumina HiSeq	Phase_I	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Missense_Mutation	SNP	ENST00000396634.1	37	CCDS34373.1	360	0.16483516483516483	26	0.052845528455284556	33	0.09116022099447514	149	0.26048951048951047	152	0.20052770448548812	.	0.003	-2.554518	0.00138	.	.	ENSG00000206503	ENST00000396634;ENST00000376806;ENST00000376809;ENST00000376802	T;T;T;T	0.00768	5.72;5.72;5.72;5.72	3.78	-7.56	0.01322	MHC class I, alpha chain, alpha1/alpha2 (6);MHC classes I/II-like antigen recognition protein (3);MHC class I-like antigen recognition (3);	80.137900	0.00166	N	0.000017	T	0.00109	0.0003	L	0.33668	1.02	0.80722	P	0.0	B;B;B;B;B;B	0.16396	0.017;0.003;0.003;0.001;0.003;0.003	B;B;B;B;B;B	0.22386	0.017;0.039;0.02;0.009;0.02;0.02	T	0.50980	-0.8763	9	0.05620	T	0.96	.	2.6157	0.04902	0.4361:0.0993:0.2856:0.1791	rs3129017;rs9260159;rs41555617	66;187;187;187;187;187	B4DVB9;Q5SRN7;P16188;Q5SRN5;P30455;P04439	.;.;1A30_HUMAN;.;1A36_HUMAN;1A03_HUMAN	R	187	ENSP00000379873:T187R;ENSP00000366002:T187R;ENSP00000366005:T187R;ENSP00000365998:T187R	ENSP00000365998:T187R	T	+	2	0	HLA-A	30019240	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-13.082000	0.00001	-8.487000	0.00000	-3.856000	0.00018	ACG		0.667	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	NM_002116	
MT-CO1	4512	bcgsc.ca	37	M	6381	6381	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chrM:6381G>A	ENST00000361624.2	+	1	478	c.478G>A	c.(478-480)Ggg>Agg	p.G160R	MT-ATP6_ENST00000361899.2_5'Flank|MT-TA_ENST00000387392.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TI_ENST00000387365.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	160					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						CCTCTATCTTAGGGGCCATCA	0.493																																						.											0																																										SO:0001583	missense	5742					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.478G>A	M.37:g.6381G>A	ENSP00000354499:p.Gly160Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q34770	Missense_Mutation	SNP	ENST00000361624.2	37																																																																																					0.493	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024028	
ZDHHC9	51114	bcgsc.ca	37	X	128945410	128945410	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chrX:128945410C>T	ENST00000357166.6	-	9	1244	c.853G>A	c.(853-855)Gaa>Aaa	p.E285K	ZDHHC9_ENST00000371064.3_Missense_Mutation_p.E285K	NM_016032.3	NP_057116.2	Q9Y397	ZDHC9_HUMAN	zinc finger, DHHC-type containing 9	285					peptidyl-L-cysteine S-palmitoylation (GO:0018230)|protein palmitoylation (GO:0018345)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|palmitoyltransferase complex (GO:0002178)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|Ras palmitoyltransferase activity (GO:0043849)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)	19						CACAGCACTTCACAGCAGTTC	0.517																																						.											0													123.0	88.0	100.0					X																	128945410		2203	4300	6503	SO:0001583	missense	51114			AF151847	CCDS35395.1	Xq26.1	2008-02-05			ENSG00000188706	ENSG00000188706		"""Zinc fingers, DHHC-type"""	18475	protein-coding gene	gene with protein product		300646	"""zinc finger, DHHC-type containing 10"", ""chromosome X open reading frame 11"""	ZDHHC10, CXorf11		10810093	Standard	NM_001008222		Approved	ZNF379, CGI-89, ZNF380	uc004euw.3	Q9Y397	OTTHUMG00000022375	ENST00000357166.6:c.853G>A	X.37:g.128945410C>T	ENSP00000349689:p.Glu285Lys	Somatic		WXS	Illumina HiSeq	Phase_I	B4F6G2|D3DTF9|Q59EK4|Q5JSW5|Q8WWS7|Q9BPY4|Q9NSP0|Q9NVL0|Q9NVR6	Missense_Mutation	SNP	ENST00000357166.6	37	CCDS35395.1	.	.	.	.	.	.	.	.	.	.	C	19.31	3.803195	0.70682	.	.	ENSG00000188706	ENST00000357166;ENST00000371064	T;T	0.41400	1.0;1.0	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.37433	0.1003	L	0.38175	1.15	0.80722	D	1	B	0.19706	0.038	B	0.20955	0.032	T	0.09292	-1.0681	10	0.33940	T	0.23	-9.4076	18.1866	0.89795	0.0:1.0:0.0:0.0	.	285	Q9Y397	ZDHC9_HUMAN	K	285	ENSP00000349689:E285K;ENSP00000360103:E285K	ENSP00000349689:E285K	E	-	1	0	ZDHHC9	128773091	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.666000	0.68059	2.419000	0.82065	0.594000	0.82650	GAA		0.517	ZDHHC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058213.1	NM_016032	
ZNF436	80818	bcgsc.ca	37	1	23696028	23696029	+	5'Flank	INS	-	-	T	rs147377149		TCGA-KN-8431-01A-11D-2310-10	TCGA-KN-8431-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93b51c61-6eea-4228-a102-840a2e118522	3e1c3b30-dc01-472e-b1c3-b81a850659d3	g.chr1:23696028_23696029insT	ENST00000314011.4	-	0	0				C1orf213_ENST00000454117.1_Intron|C1orf213_ENST00000458053.1_Intron|C1orf213_ENST00000518821.1_Intron|C1orf213_ENST00000335648.3_Frame_Shift_Ins_p.L80fs|Y_RNA_ENST00000364535.1_RNA|ZNF436_ENST00000374608.3_5'Flank|C1orf213_ENST00000437367.2_Intron	NM_001077195.1	NP_001070663.1	Q9C0F3	ZN436_HUMAN	zinc finger protein 436						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;5.97e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000977)|KIRC - Kidney renal clear cell carcinoma(1967;0.00336)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		ATTCGTAGACTTGCAGGCGAAG	0.569																																						.											0																																										SO:0001631	upstream_gene_variant	148898			AB051497	CCDS233.1	1p36	2013-01-08			ENSG00000125945	ENSG00000125945		"""Zinc fingers, C2H2-type"", ""-"""	20814	protein-coding gene	gene with protein product		611703				11214970	Standard	NM_001077195		Approved	KIAA1710, Zfp46	uc001bgt.3	Q9C0F3	OTTHUMG00000003232		1.37:g.23696029_23696029dupT	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_I	Q658I9	RNA	INS	ENST00000314011.4	37	CCDS233.1																																																																																				0.569	ZNF436-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008908.1	NM_030634	
