#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
AFG3L2	10939	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	12367034	12367034	+	Nonsense_Mutation	SNP	A	A	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr18:12367034A>T	ENST00000269143.3	-	5	713	c.482T>A	c.(481-483)tTg>tAg	p.L161*		NM_006796.2	NP_006787.2	Q9Y4W6	AFG32_HUMAN	AFG3-like AAA ATPase 2	161					axonogenesis (GO:0007409)|cell death (GO:0008219)|cristae formation (GO:0042407)|mitochondrial fusion (GO:0008053)|mitochondrial protein processing (GO:0034982)|muscle fiber development (GO:0048747)|myelination (GO:0042552)|nerve development (GO:0021675)|neuromuscular junction development (GO:0007528)|regulation of multicellular organism growth (GO:0040014)|righting reflex (GO:0060013)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(12)|prostate(3)|skin(1)|stomach(3)|urinary_tract(1)	27					Adenosine triphosphate(DB00171)	CTTGAGCAGCAAGTAAAACAT	0.463																																																	0													107.0	101.0	103.0					18																	12367034		2203	4300	6503	SO:0001587	stop_gained	10939			Y18314	CCDS11859.1	18p11.21	2014-09-17	2013-10-17		ENSG00000141385	ENSG00000141385		"""ATPases / AAA-type"""	315	protein-coding gene	gene with protein product		604581	"""AFG3 (ATPase family gene 3, yeast)-like 2"", ""spinocerebellar ataxia 28"", ""AFG3 ATPase family gene 3-like 2 (yeast)"", ""AFG3 ATPase family gene 3-like 2 (S. cerevisiae)"", ""AFG3 ATPase family member 3-like 2 (S. cerevisiae)"""	SCA28		10395799, 18769991	Standard	NM_006796		Approved	SPAX5	uc002kqz.2	Q9Y4W6	OTTHUMG00000131695	ENST00000269143.3:c.482T>A	18.37:g.12367034A>T	ENSP00000269143:p.Leu161*	Somatic		WXS	Illumina HiSeq	Phase_I	Q6P1L0	Nonsense_Mutation	SNP	ENST00000269143.3	37	CCDS11859.1	.	.	.	.	.	.	.	.	.	.	A	39	7.718240	0.98450	.	.	ENSG00000141385	ENST00000269143;ENST00000537174	.	.	.	5.72	5.72	0.89469	.	0.090154	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	-1.9294	15.9898	0.80197	1.0:0.0:0.0:0.0	.	.	.	.	X	161;176	.	ENSP00000269143:L161X	L	-	2	0	AFG3L2	12357034	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.753000	0.62183	2.182000	0.69389	0.533000	0.62120	TTG		0.463	AFG3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254603.2		NM_006796	
AP3M2	10947	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	42015561	42015561	+	Missense_Mutation	SNP	G	G	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr8:42015561G>A	ENST00000518421.1	+	4	667	c.376G>A	c.(376-378)Gag>Aag	p.E126K	AP3M2_ENST00000396926.3_Missense_Mutation_p.E126K|AP3M2_ENST00000174653.3_Missense_Mutation_p.E126K|AP3M2_ENST00000517922.1_Missense_Mutation_p.E126K|AP3M2_ENST00000520685.1_Intron	NM_001134296.1	NP_001127768.1	P53677	AP3M2_HUMAN	adaptor-related protein complex 3, mu 2 subunit	126					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)				endometrium(3)|kidney(1)|large_intestine(1)|lung(10)|prostate(1)|stomach(1)	17	all_cancers(6;8.14e-25)|all_epithelial(6;2.41e-27)|all_lung(13;5.09e-13)|Lung NSC(13;8.38e-12)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|Colorectal(10;0.00165)|OV - Ovarian serous cystadenocarcinoma(14;0.00346)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)			ATTGGCTACCGAGTCGAACAT	0.433																																																	0													185.0	168.0	174.0					8																	42015561		2203	4300	6503	SO:0001583	missense	10947			D38293	CCDS6125.1	8p11.2	2008-07-07			ENSG00000070718	ENSG00000070718			570	protein-coding gene	gene with protein product		610469				7601449	Standard	NM_006803		Approved	CLA20, AP47B	uc003xoo.3	P53677	OTTHUMG00000164060	ENST00000518421.1:c.376G>A	8.37:g.42015561G>A	ENSP00000428787:p.Glu126Lys	Somatic		WXS	Illumina HiSeq	Phase_I	B2RCR0|D3DSY2|Q7Z472	Missense_Mutation	SNP	ENST00000518421.1	37	CCDS6125.1	.	.	.	.	.	.	.	.	.	.	G	35	5.530849	0.96446	.	.	ENSG00000070718	ENST00000518421;ENST00000174653;ENST00000396926;ENST00000521280;ENST00000522288;ENST00000517922;ENST00000517499	T;T;T;T;T	0.79749	-1.29;-1.29;-1.29;-1.3;-1.26	4.79	4.79	0.61399	Longin-like (1);AP complex, mu/sigma subunit (1);	0.000000	0.85682	D	0.000000	D	0.92877	0.7734	H	0.95816	3.725	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.992	D	0.95097	0.8227	10	0.87932	D	0	-28.7842	18.2325	0.89938	0.0:0.0:1.0:0.0	.	126;126	E7ER80;P53677	.;AP3M2_HUMAN	K	126;126;126;11;126;126;35	ENSP00000428787:E126K;ENSP00000174653:E126K;ENSP00000380132:E126K;ENSP00000430616:E11K;ENSP00000429435:E126K	ENSP00000174653:E126K	E	+	1	0	AP3M2	42134718	1.000000	0.71417	0.928000	0.36995	0.912000	0.54170	9.330000	0.96422	2.363000	0.80096	0.650000	0.86243	GAG		0.433	AP3M2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376996.1			
ARAP3	64411	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	141051674	141051674	+	Missense_Mutation	SNP	C	C	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr5:141051674C>A	ENST00000239440.4	-	10	1645	c.1580G>T	c.(1579-1581)tGt>tTt	p.C527F	ARAP3_ENST00000508305.1_Missense_Mutation_p.C449F|ARAP3_ENST00000513878.1_Missense_Mutation_p.C189F	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	527	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)	p.C527Y(1)		NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						CTCACCTGCACACTGCTTGCA	0.612																																																	1	Substitution - Missense(1)	endometrium(1)											161.0	161.0	161.0					5																	141051674		2203	4300	6503	SO:0001583	missense	64411			AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.1580G>T	5.37:g.141051674C>A	ENSP00000239440:p.Cys527Phe	Somatic		WXS	Illumina HiSeq	Phase_I	B4DIT1|D3DQE3	Missense_Mutation	SNP	ENST00000239440.4	37	CCDS4266.1	.	.	.	.	.	.	.	.	.	.	C	17.30	3.354412	0.61293	.	.	ENSG00000120318	ENST00000508305;ENST00000239440;ENST00000513878	D;D;D	0.96011	-3.88;-3.88;-3.88	3.39	2.52	0.30459	.	0.000000	0.85682	U	0.000000	D	0.98416	0.9473	H	0.98664	4.295	0.46096	D	0.998869	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.91635	0.999;0.961;0.989	D	0.97762	1.0221	10	0.87932	D	0	.	10.2292	0.43245	0.0:0.8984:0.0:0.1016	.	189;449;527	B4DIT1;G5E9Y3;Q8WWN8	.;.;ARAP3_HUMAN	F	449;527;189	ENSP00000421826:C449F;ENSP00000239440:C527F;ENSP00000421468:C189F	ENSP00000239440:C527F	C	-	2	0	ARAP3	141031858	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.881000	0.69706	0.631000	0.30412	0.563000	0.77884	TGT		0.612	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251805.1		NM_022481	
ARHGEF25	115557	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	58010243	58010243	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr12:58010243G>T	ENST00000286494.4	+	14	2057	c.1597G>T	c.(1597-1599)Gag>Tag	p.E533*	AC025165.8_ENST00000593846.1_RNA|AC025165.8_ENST00000356672.3_RNA|ARHGEF25_ENST00000477314.1_3'UTR|ARHGEF25_ENST00000333972.7_Nonsense_Mutation_p.E572*|AC025165.8_ENST00000610219.1_RNA|AC025165.8_ENST00000444467.1_RNA	NM_182947.3	NP_891992	Q86VW2	ARHGP_HUMAN	Rho guanine nucleotide exchange factor (GEF) 25	533						cytosol (GO:0005829)|myofibril (GO:0030016)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	28						ACCCAAAGGGGAGGTGGCCAG	0.562																																																	0													61.0	59.0	60.0					12																	58010243		2203	4300	6503	SO:0001587	stop_gained	115557				CCDS8947.1, CCDS44931.1	12q13.3	2011-11-16			ENSG00000240771	ENSG00000240771		"""Rho guanine nucleotide exchange factors"""	30275	protein-coding gene	gene with protein product	"""RAC/CDC42 exchange factor"""	610215				12547822	Standard	NM_182947		Approved	GEFT, p63RhoGEF	uc009zpy.4	Q86VW2	OTTHUMG00000152516	ENST00000286494.4:c.1597G>T	12.37:g.58010243G>T	ENSP00000286494:p.Glu533*	Somatic		WXS	Illumina HiSeq	Phase_I	A6NJH5|A9CQZ6|F8W7Z4|Q8WV84|Q96E63	Nonsense_Mutation	SNP	ENST00000286494.4	37	CCDS8947.1	.	.	.	.	.	.	.	.	.	.	g	39	7.368636	0.98241	.	.	ENSG00000240771	ENST00000333972;ENST00000286494	.	.	.	4.87	3.0	0.34707	.	0.000000	0.36268	N	0.002691	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	.	6.3617	0.21433	0.0997:0.1879:0.7124:0.0	.	.	.	.	X	572;533	.	ENSP00000286494:E533X	E	+	1	0	ARHGEF25	56296510	1.000000	0.71417	0.998000	0.56505	0.476000	0.33039	1.852000	0.39348	1.181000	0.42912	0.655000	0.94253	GAG		0.562	ARHGEF25-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000326561.1		NM_133483	
ATP10D	57205	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	47538705	47538705	+	Silent	SNP	C	C	G			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr4:47538705C>G	ENST00000273859.3	+	9	1415	c.1146C>G	c.(1144-1146)gtC>gtG	p.V382V	ATP10D_ENST00000504445.1_Intron	NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	382					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						CTTCTTAGGTCTTGATTCCTA	0.308																																																	0													81.0	82.0	82.0					4																	47538705		2200	4296	6496	SO:0001819	synonymous_variant	57205			AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.1146C>G	4.37:g.47538705C>G		Somatic		WXS	Illumina HiSeq	Phase_I	A2RRC8|D6REN2|Q8NC70|Q96SR3	Silent	SNP	ENST00000273859.3	37	CCDS3476.1																																																																																				0.308	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216900.1		NM_020453	
C1orf198	84886	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	230991424	230991424	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr1:230991424C>T	ENST00000366663.5	-	2	514	c.374G>A	c.(373-375)tGg>tAg	p.W125*	C1orf198_ENST00000470540.1_Nonsense_Mutation_p.W87*|C1orf198_ENST00000427697.2_Intron|C1orf198_ENST00000523410.1_5'UTR	NM_032800.2	NP_116189.1	Q9H425	CA198_HUMAN	chromosome 1 open reading frame 198	125						cytoplasm (GO:0005737)				breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	17	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)				CTTTGTTTCCCAGGAGAAAGG	0.348																																																	0													85.0	90.0	89.0					1																	230991424		2203	4300	6503	SO:0001587	stop_gained	84886			BC066649	CCDS1587.1, CCDS44330.1, CCDS44331.1	1q42.2	2008-02-05			ENSG00000119280	ENSG00000119280			25900	protein-coding gene	gene with protein product							Standard	NM_032800		Approved	FLJ14525, MGC10710, FLJ16283, DKFZp667D152, FLJ38847	uc001hub.3	Q9H425	OTTHUMG00000037790	ENST00000366663.5:c.374G>A	1.37:g.230991424C>T	ENSP00000355623:p.Trp125*	Somatic		WXS	Illumina HiSeq	Phase_I	A8K8R8|B3KTW1|G5EA08	Nonsense_Mutation	SNP	ENST00000366663.5	37	CCDS1587.1	.	.	.	.	.	.	.	.	.	.	c	39	7.418497	0.98272	.	.	ENSG00000119280	ENST00000366663;ENST00000470540;ENST00000522201	.	.	.	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.9358	15.0225	0.71640	0.0:1.0:0.0:0.0	.	.	.	.	X	125;87;82	.	ENSP00000355623:W125X	W	-	2	0	C1orf198	229058047	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.822000	0.62686	2.606000	0.88127	0.558000	0.71614	TGG		0.348	C1orf198-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092236.2		NM_032800	
SSMEM1	136263	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	129847772	129847772	+	Missense_Mutation	SNP	T	T	G			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr7:129847772T>G	ENST00000297819.3	+	1	73	c.22T>G	c.(22-24)Ttt>Gtt	p.F8V	RP11-775D22.3_ENST00000483283.1_RNA|TMEM209_ENST00000336804.8_5'Flank|TMEM209_ENST00000397622.2_5'Flank|TMEM209_ENST00000462753.1_5'Flank|TMEM209_ENST00000473456.1_5'Flank	NM_145268.3	NP_660311.1	Q8WWF3	SSMM1_HUMAN	serine-rich single-pass membrane protein 1	8						integral component of membrane (GO:0016021)											TTTTTCCTTATTTTGGGAGGT	0.423																																																	0													177.0	168.0	171.0					7																	129847772		2203	4300	6503	SO:0001583	missense	136263			AK097635	CCDS5816.1	7q32.2	2013-03-08	2013-03-08	2013-03-08	ENSG00000165120	ENSG00000165120			29580	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 45"""	C7orf45		12477932	Standard	NM_145268		Approved	FLJ40316	uc003vpp.3	Q8WWF3	OTTHUMG00000157844	ENST00000297819.3:c.22T>G	7.37:g.129847772T>G	ENSP00000297819:p.Phe8Val	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000297819.3	37	CCDS5816.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.263162	0.80358	.	.	ENSG00000165120	ENST00000297819	T	0.58652	0.32	5.54	5.54	0.83059	.	0.183949	0.39083	N	0.001474	T	0.72977	0.3528	M	0.67953	2.075	0.41734	D	0.989577	D	0.89917	1.0	D	0.87578	0.998	T	0.76348	-0.2992	10	0.87932	D	0	-20.9667	12.3511	0.55148	0.0:0.0:0.0:1.0	.	8	Q8WWF3	CG045_HUMAN	V	8	ENSP00000297819:F8V	ENSP00000297819:F8V	F	+	1	0	C7orf45	129635008	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	2.582000	0.46085	2.243000	0.73865	0.533000	0.62120	TTT		0.423	SSMEM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349768.1		NM_145268	
CCNB2	9133	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	59407028	59407028	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr15:59407028C>T	ENST00000288207.2	+	5	741	c.550C>T	c.(550-552)Cag>Tag	p.Q184*	CCNB2_ENST00000559622.1_Nonsense_Mutation_p.Q103*	NM_004701.3	NP_004692.1	O95067	CCNB2_HUMAN	cyclin B2	184					G2/M transition of mitotic cell cycle (GO:0000086)|growth (GO:0040007)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)				kidney(4)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	9						TAGGCTTCTGCAGGAGACTCT	0.458																																																	0													221.0	207.0	212.0					15																	59407028		2191	4291	6482	SO:0001587	stop_gained	9133			AF002822	CCDS10170.1	15q21.3	2004-01-19			ENSG00000157456	ENSG00000157456			1580	protein-coding gene	gene with protein product		602755					Standard	NM_004701		Approved	HsT17299	uc002afz.3	O95067	OTTHUMG00000132715	ENST00000288207.2:c.550C>T	15.37:g.59407028C>T	ENSP00000288207:p.Gln184*	Somatic		WXS	Illumina HiSeq	Phase_I	B3KM93|Q6FI99	Nonsense_Mutation	SNP	ENST00000288207.2	37	CCDS10170.1	.	.	.	.	.	.	.	.	.	.	C	34	5.382967	0.95967	.	.	ENSG00000157456	ENST00000288207	.	.	.	5.54	5.54	0.83059	.	0.110848	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.4665	0.90757	0.0:1.0:0.0:0.0	.	.	.	.	X	184	.	ENSP00000288207:Q184X	Q	+	1	0	CCNB2	57194320	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.601000	0.87937	0.655000	0.94253	CAG		0.458	CCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256016.1		NM_004701	
CIT	11113	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	120196473	120196473	+	Missense_Mutation	SNP	G	G	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr12:120196473G>A	ENST00000261833.7	-	20	2379	c.2327C>T	c.(2326-2328)tCc>tTc	p.S776F	CIT_ENST00000537607.1_5'UTR|CIT_ENST00000392521.2_Missense_Mutation_p.S818F	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	776					cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		CTGTTCCAGGGATCTGATCTT	0.448																																																	0													163.0	162.0	163.0					12																	120196473		2203	4300	6503	SO:0001583	missense	11113			AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.2327C>T	12.37:g.120196473G>A	ENSP00000261833:p.Ser776Phe	Somatic		WXS	Illumina HiSeq	Phase_I	Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Missense_Mutation	SNP	ENST00000261833.7	37	CCDS9192.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.3|21.3	4.125060|4.125060	0.77436|0.77436	.|.	.|.	ENSG00000122966|ENSG00000122966	ENST00000392520|ENST00000392521;ENST00000261833	.|T;T	.|0.66280	.|-0.16;-0.2	5.95|5.95	5.95|5.95	0.96441|0.96441	.|.	.|0.198546	.|0.45606	.|D	.|0.000352	T|T	0.66117|0.66117	0.2757|0.2757	N|N	0.24115|0.24115	0.695|0.695	0.53688|0.53688	D|D	0.999977|0.999977	.|D;D;D	.|0.61080	.|0.976;0.989;0.965	.|P;P;P	.|0.56700	.|0.656;0.768;0.804	T|T	0.68435|0.68435	-0.5409|-0.5409	5|10	.|0.66056	.|D	.|0.02	.|.	20.3789|20.3789	0.98926|0.98926	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|818;776;309	.|Q2M5E1;O14578;O14578-3	.|.;CTRO_HUMAN;.	S|F	404|818;776	.|ENSP00000376306:S818F;ENSP00000261833:S776F	.|ENSP00000261833:S776F	P|S	-|-	1|2	0|0	CIT|CIT	118680856|118680856	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	4.677000|4.677000	0.61634|0.61634	2.826000|2.826000	0.97356|0.97356	0.563000|0.563000	0.77884|0.77884	CCC|TCC		0.448	CIT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259410.4		NM_007174	
CRYM	1428	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	21272606	21272606	+	Missense_Mutation	SNP	G	G	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr16:21272606G>T	ENST00000219599.3	-	9	1114	c.849C>A	c.(847-849)caC>caA	p.H283Q	CRYM_ENST00000543948.1_Missense_Mutation_p.H283Q|CRYM_ENST00000396023.2_Missense_Mutation_p.H283Q|CRYM_ENST00000415987.2_Missense_Mutation_p.H241Q	NM_001888.3	NP_001879.1	Q14894	CRYM_HUMAN	crystallin, mu	283					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|sensory perception of sound (GO:0007605)|thyroid hormone metabolic process (GO:0042403)|thyroid hormone transport (GO:0070327)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)|thiomorpholine-carboxylate dehydrogenase activity (GO:0047127)|thyroid hormone binding (GO:0070324)|transcription corepressor activity (GO:0003714)			large_intestine(1)|lung(3)	4				GBM - Glioblastoma multiforme(48;0.0573)		TCTTCTCACAGTGGGCTGGTT	0.507																																																	0													161.0	131.0	141.0					16																	21272606		2199	4300	6499	SO:0001583	missense	1428				CCDS10597.1	16p12.2	2013-02-14			ENSG00000103316	ENSG00000103316	1.5.1.25		2418	protein-coding gene	gene with protein product	"""thiomorpholine-carboxylate dehydrogenase"""	123740				1478656, 21332720	Standard	NM_001014444		Approved	DFNA40	uc002dim.3	Q14894	OTTHUMG00000090707	ENST00000219599.3:c.849C>A	16.37:g.21272606G>T	ENSP00000219599:p.His283Gln	Somatic		WXS	Illumina HiSeq	Phase_I	D5MNX0|Q5HYB7	Missense_Mutation	SNP	ENST00000219599.3	37	CCDS10597.1	.	.	.	.	.	.	.	.	.	.	G	12.88	2.069363	0.36470	.	.	ENSG00000103316	ENST00000543948;ENST00000219599;ENST00000396023;ENST00000415987	T;T;T;T	0.75821	-0.97;-0.97;-0.97;-0.97	5.49	1.0	0.19881	NAD(P)-binding domain (1);	0.689601	0.15312	N	0.269013	T	0.51398	0.1672	N	0.10916	0.065	0.31584	N	0.654701	B	0.02656	0.0	B	0.01281	0.0	T	0.52719	-0.8538	10	0.54805	T	0.06	-15.8893	6.8747	0.24141	0.1801:0.4234:0.3965:0.0	.	283	Q14894	CRYM_HUMAN	Q	283;283;283;241	ENSP00000440227:H283Q;ENSP00000219599:H283Q;ENSP00000379341:H283Q;ENSP00000390928:H241Q	ENSP00000219599:H283Q	H	-	3	2	CRYM	21180107	0.706000	0.27856	0.997000	0.53966	0.996000	0.88848	0.934000	0.28910	0.685000	0.31468	0.655000	0.94253	CAC		0.507	CRYM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207398.1			
DNAH10	196385	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	124420000	124420000	+	Missense_Mutation	SNP	G	G	C			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr12:124420000G>C	ENST00000409039.3	+	78	13413	c.13388G>C	c.(13387-13389)gGa>gCa	p.G4463A	DNAH10OS_ENST00000514254.2_5'Flank|CCDC92_ENST00000544798.1_Intron|RP11-380L11.3_ENST00000602292.1_RNA	NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	4463					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GTGCTGCAAGGAGTATGCCTC	0.493																																																	0													172.0	164.0	166.0					12																	124420000		1903	4133	6036	SO:0001583	missense	196385			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.13388G>C	12.37:g.124420000G>C	ENSP00000386770:p.Gly4463Ala	Somatic		WXS	Illumina HiSeq	Phase_I	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	37	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	G	29.4	5.005979	0.93287	.	.	ENSG00000197653	ENST00000409039	T	0.13657	2.57	5.39	5.39	0.77823	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.50939	0.1645	H	0.94222	3.51	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.64419	-0.6412	10	0.59425	D	0.04	.	17.9454	0.89036	0.0:0.0:1.0:0.0	.	4463	Q8IVF4	DYH10_HUMAN	A	4463	ENSP00000386770:G4463A	ENSP00000386770:G4463A	G	+	2	0	DNAH10	122985953	1.000000	0.71417	0.955000	0.39395	0.975000	0.68041	9.837000	0.99465	2.526000	0.85167	0.561000	0.74099	GGA		0.493	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3			
DNAJB4	11080	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	78481792	78481792	+	Missense_Mutation	SNP	G	G	C			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr1:78481792G>C	ENST00000370763.5	+	3	1132	c.875G>C	c.(874-876)aGa>aCa	p.R292T	GIPC2_ENST00000476882.1_Intron|DNAJB4_ENST00000487931.1_3'UTR	NM_007034.3	NP_008965.2	Q9UDY4	DNJB4_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 4	292					protein folding (GO:0006457)|response to heat (GO:0009408)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chaperone binding (GO:0051087)|unfolded protein binding (GO:0051082)			endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	10						ATGAGGAGAAGAATTATTGGA	0.393																																																	0													105.0	104.0	105.0					1																	78481792		2203	4300	6503	SO:0001583	missense	11080			U40992	CCDS684.1	1p31.1	2011-09-02			ENSG00000162616	ENSG00000162616		"""Heat shock proteins / DNAJ (HSP40)"""	14886	protein-coding gene	gene with protein product		611327				9546042, 11147971	Standard	NM_007034		Approved	HLJ1	uc001dij.3	Q9UDY4	OTTHUMG00000040905	ENST00000370763.5:c.875G>C	1.37:g.78481792G>C	ENSP00000359799:p.Arg292Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B2R824|Q13431	Missense_Mutation	SNP	ENST00000370763.5	37	CCDS684.1	.	.	.	.	.	.	.	.	.	.	G	17.89	3.500603	0.64298	.	.	ENSG00000162616	ENST00000370763	T	0.45276	0.9	5.96	5.96	0.96718	Chaperone DnaJ, C-terminal (1);HSP40/DnaJ peptide-binding (1);	0.050094	0.85682	D	0.000000	T	0.32071	0.0817	L	0.55103	1.725	0.80722	D	1	B	0.31859	0.343	B	0.37833	0.259	T	0.13308	-1.0514	10	0.14252	T	0.57	.	20.422	0.99049	0.0:0.0:1.0:0.0	.	292	Q9UDY4	DNJB4_HUMAN	T	292	ENSP00000359799:R292T	ENSP00000359799:R292T	R	+	2	0	DNAJB4	78254380	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.316000	0.43761	2.832000	0.97577	0.655000	0.94253	AGA		0.393	DNAJB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098248.3			
FAM73B	84895	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	131804663	131804663	+	Silent	SNP	C	C	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr9:131804663C>T	ENST00000358369.4	+	3	403	c.177C>T	c.(175-177)gcC>gcT	p.A59A	FAM73B_ENST00000406926.2_Silent_p.A59A|FAM73B_ENST00000474534.1_3'UTR|FAM73B_ENST00000277475.5_Silent_p.A59A	NM_032809.2	NP_116198.2	Q7L4E1	FA73B_HUMAN	family with sequence similarity 73, member B	59					bone development (GO:0060348)	integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(1)	13						TGGCCCTGGCCCTGGCTGCCC	0.657																																																	0													45.0	37.0	40.0					9																	131804663		2203	4300	6503	SO:0001819	synonymous_variant	84895			AK074127	CCDS6917.1	9q34.13	2008-02-05	2005-08-11	2005-08-11	ENSG00000148343	ENSG00000148343			23621	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 54"""	C9orf54			Standard	NM_032809		Approved	FLJ14596, FLJ00199	uc004bxa.3	Q7L4E1	OTTHUMG00000020770	ENST00000358369.4:c.177C>T	9.37:g.131804663C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q8NBM3|Q8TEJ6|Q969E6	Silent	SNP	ENST00000358369.4	37	CCDS6917.1																																																																																				0.657	FAM73B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054542.7		NM_032809	
FIGN	55137	hgsc.bcm.edu	37	2	164466233	164466234	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr2:164466233_164466234insC	ENST00000333129.3	-	3	2422_2423	c.2108_2109insG	c.(2107-2109)ggcfs	p.G703fs	FIGN_ENST00000409634.1_Intron|FIGN_ENST00000482917.1_5'Flank	NM_018086.2	NP_060556.2	Q5HY92	FIGN_HUMAN	fidgetin	703					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)			breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(1)|prostate(2)|skin(1)	47						CATGGAGGGGGCCCACCACTGC	0.5																																																	0																																										SO:0001589	frameshift_variant	55137			AK001267	CCDS2221.2	2q24	2010-04-21			ENSG00000182263	ENSG00000182263		"""ATPases / AAA-type"""	13285	protein-coding gene	gene with protein product		605295				11017077	Standard	XM_005246661		Approved		uc002uck.1	Q5HY92	OTTHUMG00000074059	ENST00000333129.3:c.2109dupG	2.37:g.164466236_164466236dupC	ENSP00000333836:p.Gly703fs	Somatic		WXS	Illumina HiSeq	Phase_I	B3KWM0|Q9H6M5|Q9NVZ9	Frame_Shift_Ins	INS	ENST00000333129.3	37	CCDS2221.2																																																																																				0.500	FIGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157220.2		NM_018086	
GBP1	2633	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	89523725	89523725	+	Missense_Mutation	SNP	C	C	T	rs374475528		TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr1:89523725C>T	ENST00000370473.4	-	6	1043	c.824G>A	c.(823-825)aGt>aAt	p.S275N	GBP1_ENST00000484970.1_5'Flank	NM_002053.2	NP_002044.2	P32455	GBP1_HUMAN	guanylate binding protein 1, interferon-inducible	275	GB1/RHD3-type G.|GTPase domain (Globular).				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)	cytosol (GO:0005829)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			endometrium(7)|kidney(4)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	30		Lung NSC(277;0.123)		all cancers(265;0.0156)|Epithelial(280;0.0291)		TTTGGAATTACTAAAGATGTA	0.468																																																	0													131.0	138.0	136.0					1																	89523725		2203	4300	6503	SO:0001583	missense	2633			BC002666	CCDS718.1	1p22.2	2011-03-09	2011-03-09		ENSG00000117228	ENSG00000117228			4182	protein-coding gene	gene with protein product		600411	"""guanylate binding protein 1, interferon-inducible, 67kDa"""			7518790	Standard	NM_002053		Approved		uc001dmx.2	P32455	OTTHUMG00000010614	ENST00000370473.4:c.824G>A	1.37:g.89523725C>T	ENSP00000359504:p.Ser275Asn	Somatic		WXS	Illumina HiSeq	Phase_I	D3DT26|Q5T8M1	Missense_Mutation	SNP	ENST00000370473.4	37	CCDS718.1	.	.	.	.	.	.	.	.	.	.	C	8.534	0.871721	0.17322	.	.	ENSG00000117228	ENST00000370473;ENST00000542693	T	0.62232	0.04	4.48	-0.425	0.12317	Guanylate-binding protein, N-terminal (1);	0.926429	0.09422	N	0.804270	T	0.24967	0.0606	L	0.39326	1.205	0.09310	N	1	B	0.06786	0.001	B	0.13407	0.009	T	0.19582	-1.0301	10	0.26408	T	0.33	.	4.7021	0.12832	0.0:0.4725:0.1656:0.3619	.	275	P32455	GBP1_HUMAN	N	275;238	ENSP00000359504:S275N	ENSP00000359504:S275N	S	-	2	0	GBP1	89296313	0.000000	0.05858	0.016000	0.15963	0.177000	0.22998	-0.330000	0.07925	0.022000	0.15160	-0.802000	0.03209	AGT		0.468	GBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029289.3		NM_002053	
GOLGA5	9950	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	93301996	93301996	+	Missense_Mutation	SNP	A	A	G	rs373869475		TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr14:93301996A>G	ENST00000163416.2	+	11	2294	c.2038A>G	c.(2038-2040)Att>Gtt	p.I680V	GOLGA5_ENST00000355976.2_Missense_Mutation_p.I680V	NM_005113.2	NP_005104	Q8TBA6	GOGA5_HUMAN	golgin A5	680					Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein homodimerization activity (GO:0042803)|Rab GTPase binding (GO:0017137)			large_intestine(6)|lung(1)|ovary(2)	9		all_cancers(154;0.0934)		COAD - Colon adenocarcinoma(157;0.222)		TGCTAGTTCAATTGATCAGTT	0.423			T	RET	papillary thyroid																																			Dom	yes		14	14q	9950	"""golgi autoantigen, golgin subfamily a, 5  (PTC5)"""		E	0								A	VAL/ILE	1,4405	2.1+/-5.4	0,1,2202	83.0	67.0	72.0		2038	5.7	1.0	14		72	0,8600		0,0,4300	no	missense	GOLGA5	NM_005113.2	29	0,1,6502	GG,GA,AA		0.0,0.0227,0.0077	possibly-damaging	680/732	93301996	1,13005	2203	4300	6503	SO:0001583	missense	9950			AF085199	CCDS9905.1	14q32.12	2012-05-04	2010-02-12		ENSG00000066455	ENSG00000066455			4428	protein-coding gene	gene with protein product	"""golgi integral membrane protein 5"""	606918	"""golgi autoantigen, golgin subfamily a, 5"""			2734021, 9443391, 15004235	Standard	NM_005113		Approved	ret-II, golgin-84, rfg5, GOLIM5	uc001yaz.1	Q8TBA6	OTTHUMG00000171217	ENST00000163416.2:c.2038A>G	14.37:g.93301996A>G	ENSP00000163416:p.Ile680Val	Somatic		WXS	Illumina HiSeq	Phase_I	C9JRU1|O95287|Q03962|Q2TS49|Q9UQQ7	Missense_Mutation	SNP	ENST00000163416.2	37	CCDS9905.1	.	.	.	.	.	.	.	.	.	.	A	25.8	4.671915	0.88348	2.27E-4	0.0	ENSG00000066455	ENST00000163416;ENST00000355976;ENST00000439315	T;T	0.56776	0.44;0.44	5.69	5.69	0.88448	.	0.000000	0.47455	D	0.000234	T	0.58906	0.2155	L	0.52126	1.63	0.80722	D	1	P	0.40282	0.711	P	0.47941	0.562	T	0.61471	-0.7056	10	0.62326	D	0.03	-23.1752	15.9379	0.79729	1.0:0.0:0.0:0.0	.	680	Q8TBA6	GOGA5_HUMAN	V	680;680;589	ENSP00000163416:I680V;ENSP00000348252:I680V	ENSP00000163416:I680V	I	+	1	0	GOLGA5	92371749	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	8.950000	0.93019	2.159000	0.67721	0.528000	0.53228	ATT		0.423	GOLGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412365.1			
HECW1	23072	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	43484071	43484071	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr7:43484071G>T	ENST00000395891.2	+	11	1905	c.1300G>T	c.(1300-1302)Gga>Tga	p.G434*	HECW1_ENST00000453890.1_Nonsense_Mutation_p.G434*	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	434					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						GGTCTCTGTGGGACCTGAAGG	0.622																																																	0													22.0	25.0	24.0					7																	43484071		2078	4211	6289	SO:0001587	stop_gained	23072			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.1300G>T	7.37:g.43484071G>T	ENSP00000379228:p.Gly434*	Somatic		WXS	Illumina HiSeq	Phase_I	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Nonsense_Mutation	SNP	ENST00000395891.2	37	CCDS5469.2	.	.	.	.	.	.	.	.	.	.	G	39	7.309118	0.98203	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	.	.	.	5.2	2.35	0.29111	.	2.606440	0.01395	N	0.013368	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	.	7.1438	0.25570	0.2599:0.1187:0.6214:0.0	.	.	.	.	X	434	.	ENSP00000265522:G434X	G	+	1	0	HECW1	43450596	0.001000	0.12720	0.001000	0.08648	0.282000	0.26991	1.036000	0.30228	0.272000	0.22027	0.591000	0.81541	GGA		0.622	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2		NM_015052	
HSPA9	3313	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	137902359	137902359	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr5:137902359C>A	ENST00000297185.3	-	9	1053	c.928G>T	c.(928-930)Gaa>Taa	p.E310*	HSPA9_ENST00000501917.2_5'UTR	NM_004134.6	NP_004125.3	P38646	GRP75_HUMAN	heat shock 70kDa protein 9 (mortalin)	310					cellular protein metabolic process (GO:0044267)|negative regulation of apoptotic process (GO:0043066)|protein export from nucleus (GO:0006611)|protein folding (GO:0006457)|protein targeting to mitochondrion (GO:0006626)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			breast(2)|endometrium(1)|kidney(4)|large_intestine(8)|lung(12)|upper_aerodigestive_tract(1)	28			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TCAGCAGCTTCCCGTACCCTC	0.433																																																	0													160.0	148.0	152.0					5																	137902359		2203	4300	6503	SO:0001587	stop_gained	3313			L11066	CCDS4208.1	5q31.1	2011-09-02	2006-10-31	2006-10-31	ENSG00000113013	ENSG00000113013		"""Heat shock proteins / HSP70"""	5244	protein-coding gene	gene with protein product		600548	"""heat shock 70kDa protein 9B (mortalin-2)"""	HSPA9B		7684501	Standard	NM_004134		Approved	GRP75, PBP74, mot-2, mthsp75	uc003ldf.3	P38646	OTTHUMG00000129206	ENST00000297185.3:c.928G>T	5.37:g.137902359C>A	ENSP00000297185:p.Glu310*	Somatic		WXS	Illumina HiSeq	Phase_I	B2RCM1|P30036|P31932|Q1HB43|Q53H23|Q6GU03|Q9BWB7|Q9UC56	Nonsense_Mutation	SNP	ENST00000297185.3	37	CCDS4208.1	.	.	.	.	.	.	.	.	.	.	C	38	7.005480	0.97998	.	.	ENSG00000113013	ENST00000297185;ENST00000541333;ENST00000540484	.	.	.	4.98	4.98	0.66077	.	0.096500	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-15.1398	18.2292	0.89928	0.0:1.0:0.0:0.0	.	.	.	.	X	310;263;296	.	ENSP00000297185:E310X	E	-	1	0	HSPA9	137930258	1.000000	0.71417	0.992000	0.48379	0.988000	0.76386	7.625000	0.83145	2.458000	0.83093	0.591000	0.81541	GAA		0.433	HSPA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251285.1		NM_004134	
INTS9	55756	hgsc.bcm.edu	37	8	28651299	28651299	+	Intron	SNP	A	A	C	rs67407592		TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr8:28651299A>C	ENST00000521022.1	-	10	1119				INTS9_ENST00000397363.4_Intron|INTS9_ENST00000416984.2_Intron|INTS9_ENST00000521777.1_Intron	NM_018250.3	NP_060720.2	Q9NV88	INT9_HUMAN	integrator complex subunit 9						snRNA processing (GO:0016180)	cytoplasm (GO:0005737)|integrator complex (GO:0032039)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|pancreas(2)|prostate(1)|urinary_tract(2)	19		Ovarian(32;0.0439)		KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.152)		AAATTCACAAAAAAAAAAAAA	0.368																																																	0													24.0	30.0	28.0					8																	28651299		2202	4299	6501	SO:0001627	intron_variant	55756			BC025267	CCDS34873.1, CCDS55215.1, CCDS55216.1	8p21.1	2008-02-05			ENSG00000104299	ENSG00000104299			25592	protein-coding gene	gene with protein product		611352				16239144	Standard	NM_001172562		Approved	FLJ10871, CPSF2L, RC-74	uc011lav.2	Q9NV88	OTTHUMG00000164030	ENST00000521022.1:c.1037+24T>G	8.37:g.28651299A>C		Somatic		WXS	Illumina HiSeq	Phase_I	B7Z560|B7Z6M5|O00224|Q8TB16	RNA	SNP	ENST00000521022.1	37	CCDS34873.1																																																																																				0.368	INTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376846.1		NM_018250	
ITGA5	3678	broad.mit.edu;hgsc.bcm.edu	37	12	54798566	54798566	+	Silent	SNP	C	C	G			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr12:54798566C>G	ENST00000293379.4	-	13	1599	c.1338G>C	c.(1336-1338)ctG>ctC	p.L446L	RP11-753H16.3_ENST00000550474.1_RNA|RP11-753H16.5_ENST00000552785.1_RNA	NM_002205.2	NP_002196.2	P08648	ITA5_HUMAN	integrin, alpha 5 (fibronectin receptor, alpha polypeptide)	446					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|memory (GO:0007613)|negative regulation of anoikis (GO:2000811)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|viral process (GO:0016032)|wound healing, spreading of epidermal cells (GO:0035313)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	metal ion binding (GO:0046872)|platelet-derived growth factor receptor binding (GO:0005161)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	34						TGGCTGCCCACAGGGGCTGCA	0.627											OREG0021554	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													41.0	46.0	45.0					12																	54798566		2203	4300	6503	SO:0001819	synonymous_variant	3678				CCDS8880.1	12q11-q13	2010-03-23				ENSG00000161638		"""CD molecules"", ""Integrins"""	6141	protein-coding gene	gene with protein product		135620		FNRA		2454952	Standard	NM_002205		Approved	CD49e	uc001sga.3	P08648	OTTHUMG00000169841	ENST00000293379.4:c.1338G>C	12.37:g.54798566C>G		Somatic	1003	WXS	Illumina HiSeq	Phase_I	Q96HA5	Silent	SNP	ENST00000293379.4	37	CCDS8880.1																																																																																				0.627	ITGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406174.1			
KLHL25	64410	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	86312287	86312287	+	Missense_Mutation	SNP	C	C	T	rs142937016		TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr15:86312287C>T	ENST00000337975.5	-	2	1029	c.755G>A	c.(754-756)aGc>aAc	p.S252N	MIR1276_ENST00000408707.1_RNA|KLHL25_ENST00000536947.1_Missense_Mutation_p.S252N|KLHL25_ENST00000559131.1_Intron	NM_022480.3	NP_071925.2	Q9H0H3	KLH25_HUMAN	kelch-like family member 25	252					protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of translational initiation (GO:0006446)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)				breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	25						GAGGGCCTCGCTGGAGACGGC	0.647																																																	0								C	ASN/SER	2,4402	4.2+/-10.8	0,2,2200	33.0	29.0	30.0		755	0.9	0.0	15	dbSNP_134	30	0,8598		0,0,4299	no	missense	KLHL25	NM_022480.3	46	0,2,6499	TT,TC,CC		0.0,0.0454,0.0154	benign	252/590	86312287	2,13000	2202	4299	6501	SO:0001583	missense	64410				CCDS10339.1	15q25.3	2013-02-22	2013-02-22		ENSG00000183655	ENSG00000183655		"""Kelch-like"", ""BTB/POZ domain containing"""	25732	protein-coding gene	gene with protein product	"""ectodermal-neural cortex 2"""		"""kelch-like 25 (Drosophila)"""				Standard	XM_006720635		Approved	FLJ12587, ENC2, ENC-2	uc002bly.3	Q9H0H3	OTTHUMG00000148672	ENST00000337975.5:c.755G>A	15.37:g.86312287C>T	ENSP00000336800:p.Ser252Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B2RDH2|B3KRT7	Missense_Mutation	SNP	ENST00000337975.5	37	CCDS10339.1	.	.	.	.	.	.	.	.	.	.	C	8.593	0.885143	0.17540	4.54E-4	0.0	ENSG00000183655	ENST00000337975;ENST00000538153;ENST00000536947	T;T	0.70631	-0.5;-0.5	5.23	0.94	0.19513	.	0.392163	0.27951	N	0.017185	T	0.51075	0.1653	L	0.34521	1.04	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.26503	-1.0101	10	0.11485	T	0.65	.	7.1907	0.25824	0.0:0.5643:0.2842:0.1515	.	252	Q9H0H3	ENC2_HUMAN	N	252;221;252	ENSP00000336800:S252N;ENSP00000444739:S252N	ENSP00000336800:S252N	S	-	2	0	KLHL25	84113291	0.000000	0.05858	0.001000	0.08648	0.780000	0.44128	1.048000	0.30379	0.219000	0.20840	0.456000	0.33151	AGC		0.647	KLHL25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309023.1		NM_022480	
NRROS	375387	hgsc.bcm.edu;ucsc.edu	37	3	196386769	196386775	+	Frame_Shift_Del	DEL	CCTCAGC	CCTCAGC	-			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	CCTCAGC	CCTCAGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr3:196386769_196386775delCCTCAGC	ENST00000328557.4	+	3	458_464	c.255_261delCCTCAGC	c.(253-261)agcctcagcfs	p.SLS85fs		NM_198565.1	NP_940967.1	Q86YC3	NRROS_HUMAN	negative regulator of reactive oxygen species	85					immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|superoxide metabolic process (GO:0006801)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											TCCTGGAGAGCCTCAGCCTGCACAGCT	0.657																																																	0																																										SO:0001589	frameshift_variant	375387			AY358322	CCDS3319.1	3q29	2013-07-02	2013-07-02	2013-07-02	ENSG00000174004	ENSG00000174004			24613	protein-coding gene	gene with protein product		615322	"""leucine rich repeat containing 33"""	LRRC33		12975309	Standard	NM_198565		Approved	UNQ3030, ELLP3030, MGC50789, GARPL1	uc003fwv.3	Q86YC3	OTTHUMG00000155569	ENST00000328557.4:c.255_261delCCTCAGC	3.37:g.196386769_196386775delCCTCAGC	ENSP00000328625:p.Ser85fs	Somatic		WXS	Illumina HiSeq	Phase_I		Frame_Shift_Del	DEL	ENST00000328557.4	37	CCDS3319.1																																																																																				0.657	NRROS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340676.1		NM_198565	
MBD6	114785	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	57920770	57920770	+	Silent	SNP	T	T	G			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr12:57920770T>G	ENST00000355673.3	+	7	2198	c.1842T>G	c.(1840-1842)ccT>ccG	p.P614P	MBD6_ENST00000431731.2_Silent_p.P614P	NM_052897.3	NP_443129.3	Q96DN6	MBD6_HUMAN	methyl-CpG binding domain protein 6	614	Pro-rich.					chromocenter (GO:0010369)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|urinary_tract(1)	31						TTCCACCTCCTTCAGCACCTC	0.642																																																	0													172.0	139.0	150.0					12																	57920770		2203	4300	6503	SO:0001819	synonymous_variant	114785			AB067474	CCDS8944.1	12q13.2	2008-02-05				ENSG00000166987			20445	protein-coding gene	gene with protein product						12529184	Standard	NM_052897		Approved	KIAA1887	uc001soj.1	Q96DN6		ENST00000355673.3:c.1842T>G	12.37:g.57920770T>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q8N3M0|Q8NA81|Q96Q00	Silent	SNP	ENST00000355673.3	37	CCDS8944.1																																																																																				0.642	MBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407250.1			
MCM6	4175	broad.mit.edu;hgsc.bcm.edu	37	2	136633848	136633848	+	Missense_Mutation	SNP	A	A	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr2:136633848A>T	ENST00000264156.2	-	1	148	c.88T>A	c.(88-90)Ttc>Atc	p.F30I		NM_005915.5	NP_005906.2	Q14566	MCM6_HUMAN	minichromosome maintenance complex component 6	30					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|identical protein binding (GO:0042802)|single-stranded DNA binding (GO:0003697)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(15)|prostate(2)|skin(1)	29				BRCA - Breast invasive adenocarcinoma(221;0.166)		AAGTCCAGGAACAGTTTCTGG	0.716																																					Ovarian(196;141 2104 8848 24991 25939)												0													15.0	21.0	19.0					2																	136633848		2182	4275	6457	SO:0001583	missense	4175				CCDS2179.1	2q14-q21	2008-02-05	2007-04-04		ENSG00000076003	ENSG00000076003			6949	protein-coding gene	gene with protein product	"""MIS5 homolog (S.pombe)"""	601806	"""minichromosome maintenance deficient (mis5, S. pombe) 6"", ""MCM6 minichromosome maintenance deficient 6 (MIS5 homolog, S. pombe) (S. cerevisiae)"", ""minichromosome maintenance deficient 6 homolog (S. cerevisiae)"""				Standard	NM_005915		Approved	Mis5	uc002tuw.4	Q14566	OTTHUMG00000131739	ENST00000264156.2:c.88T>A	2.37:g.136633848A>T	ENSP00000264156:p.Phe30Ile	Somatic		WXS	Illumina HiSeq	Phase_I	B2R6H2|Q13504|Q99859	Missense_Mutation	SNP	ENST00000264156.2	37	CCDS2179.1	.	.	.	.	.	.	.	.	.	.	A	36	5.638742	0.96693	.	.	ENSG00000076003	ENST00000264156	T	0.21932	1.98	4.95	4.95	0.65309	Nucleic acid-binding, OB-fold-like (1);	0.000000	0.85682	D	0.000000	T	0.58864	0.2152	H	0.95187	3.635	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.72225	-0.4355	10	0.62326	D	0.03	-15.4816	14.7872	0.69813	1.0:0.0:0.0:0.0	.	30	Q14566	MCM6_HUMAN	I	30	ENSP00000264156:F30I	ENSP00000264156:F30I	F	-	1	0	MCM6	136350318	1.000000	0.71417	0.995000	0.50966	0.991000	0.79684	8.576000	0.90770	2.075000	0.62263	0.377000	0.23210	TTC		0.716	MCM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254658.1		NM_005915	
MRPS24	64951	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	43906364	43906364	+	Missense_Mutation	SNP	A	A	C			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr7:43906364A>C	ENST00000317534.5	-	4	499	c.438T>G	c.(436-438)ttT>ttG	p.F146L	URGCP-MRPS24_ENST00000603700.1_3'UTR|MRPS24_ENST00000467084.1_5'Flank	NM_032014.2	NP_114403.1	Q96EL2	RT24_HUMAN	mitochondrial ribosomal protein S24	146					translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)|mitochondrial small ribosomal subunit (GO:0005763)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	5						GACATTTGTAAAAGTAGGACA	0.488																																																	0													83.0	80.0	81.0					7																	43906364		2203	4300	6503	SO:0001583	missense	64951			AB061207	CCDS5473.1	7p14	2012-09-13			ENSG00000062582	ENSG00000062582		"""Mitochondrial ribosomal proteins / small subunits"""	14510	protein-coding gene	gene with protein product		611986				8127713, 11279123	Standard	NM_032014		Approved	MRP-S24, HSPC335	uc003tit.1	Q96EL2	OTTHUMG00000023175	ENST00000317534.5:c.438T>G	7.37:g.43906364A>C	ENSP00000318158:p.Phe146Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A4D1U9|P82668|Q96Q23|Q9P047	Missense_Mutation	SNP	ENST00000317534.5	37	CCDS5473.1	.	.	.	.	.	.	.	.	.	.	A	10.60	1.396460	0.25205	.	.	ENSG00000062582	ENST00000317534	T	0.37584	1.19	4.96	-1.86	0.07760	.	0.215064	0.48286	N	0.000193	T	0.23611	0.0571	L	0.35854	1.095	0.41986	D	0.990825	B	0.12630	0.006	B	0.16289	0.015	T	0.02877	-1.1099	10	0.44086	T	0.13	.	8.7591	0.34663	0.2329:0.1454:0.6217:0.0	.	146	Q96EL2	RT24_HUMAN	L	146	ENSP00000318158:F146L	ENSP00000318158:F146L	F	-	3	2	MRPS24	43872889	0.987000	0.35691	0.907000	0.35723	0.903000	0.53119	0.130000	0.15850	-0.623000	0.05618	0.459000	0.35465	TTT		0.488	MRPS24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250949.1		NM_032014	
MUC17	140453	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	100686874	100686874	+	Silent	SNP	T	T	G			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr7:100686874T>G	ENST00000306151.4	+	3	12241	c.12177T>G	c.(12175-12177)tcT>tcG	p.S4059S		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	4059					cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CAATTACTTCTCACACCATCC	0.537																																																	0													367.0	294.0	318.0					7																	100686874		2203	4300	6503	SO:0001819	synonymous_variant	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.12177T>G	7.37:g.100686874T>G		Somatic		WXS	Illumina HiSeq	Phase_I	O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	CCDS34711.1																																																																																				0.537	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1		NM_001040105	
NKD2	85409	broad.mit.edu;ucsc.edu	37	5	1032288	1032288	+	Missense_Mutation	SNP	A	A	C			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr5:1032288A>C	ENST00000296849.5	+	4	392	c.163A>C	c.(163-165)Aag>Cag	p.K55Q	NKD2_ENST00000274150.4_Missense_Mutation_p.K55Q|NKD2_ENST00000537972.1_Missense_Mutation_p.K55Q	NM_033120.3	NP_149111.1	Q969F2	NKD2_HUMAN	naked cuticle homolog 2 (Drosophila)	55	Targeting to the basolateral cell membrane.				exocytosis (GO:0006887)|Golgi vesicle fusion to target membrane (GO:0048210)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein processing (GO:0010954)|protein targeting to plasma membrane (GO:0072661)|Wnt signaling pathway (GO:0016055)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cytoplasmic vesicle (GO:0031410)	calcium ion binding (GO:0005509)|growth factor binding (GO:0019838)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(3)|large_intestine(1)|lung(8)|pancreas(1)	14	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)			TGGGGACCCCAAGGAGGGGCC	0.657																																																	0													60.0	71.0	67.0					5																	1032288		2202	4297	6499	SO:0001583	missense	85409			AF358137	CCDS3859.1, CCDS59486.1	5p15.3	2013-01-10			ENSG00000145506	ENSG00000145506		"""EF-hand domain containing"""	17046	protein-coding gene	gene with protein product	"""naked cuticle-2"", ""Dvl-binding protein NKD2"""	607852				11356022, 11604995	Standard	NM_033120		Approved	Naked2	uc003jbt.2	Q969F2	OTTHUMG00000090348	ENST00000296849.5:c.163A>C	5.37:g.1032288A>C	ENSP00000296849:p.Lys55Gln	Somatic		WXS	Illumina GAIIx	Phase_I	Q96EK8|Q9BSN0	Missense_Mutation	SNP	ENST00000296849.5	37	CCDS3859.1	.	.	.	.	.	.	.	.	.	.	A	10.25	1.297484	0.23650	.	.	ENSG00000145506	ENST00000296849;ENST00000274150;ENST00000537972	T;T;T	0.00581	6.42;6.42;6.42	4.2	3.01	0.34805	.	0.155772	0.40222	N	0.001152	T	0.00724	0.0024	M	0.63843	1.955	0.80722	D	1	P;P	0.37101	0.582;0.582	B;B	0.35655	0.207;0.207	T	0.73065	-0.4100	10	0.29301	T	0.29	-3.4584	7.7334	0.28799	0.7861:0.2139:0.0:0.0	.	55;55	Q969F2-2;Q969F2	.;NKD2_HUMAN	Q	55	ENSP00000296849:K55Q;ENSP00000274150:K55Q;ENSP00000440925:K55Q	ENSP00000274150:K55Q	K	+	1	0	NKD2	1085288	0.961000	0.32948	0.043000	0.18650	0.038000	0.13279	2.393000	0.44442	0.476000	0.27440	0.402000	0.26972	AAG		0.657	NKD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206720.2		NM_033120	
OLFML3	56944	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	114523687	114523687	+	Missense_Mutation	SNP	G	G	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr1:114523687G>A	ENST00000320334.4	+	3	591	c.517G>A	c.(517-519)Gat>Aat	p.D173N	OLFML3_ENST00000393300.2_Missense_Mutation_p.D153N|OLFML3_ENST00000491700.1_3'UTR|OLFML3_ENST00000369551.1_Missense_Mutation_p.D153N	NM_020190.2	NP_064575.1	Q9NRN5	OLFL3_HUMAN	olfactomedin-like 3	173	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)|vesicle (GO:0031982)				breast(1)|endometrium(2)|large_intestine(3)|lung(3)|prostate(2)|skin(2)|urinary_tract(1)	14	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTACGTGTTAGATGGGACACA	0.542																																																	0													65.0	59.0	61.0					1																	114523687		2203	4300	6503	SO:0001583	missense	56944			AF201945	CCDS870.1, CCDS65618.1, CCDS72839.1	1p13.1	2008-02-05			ENSG00000116774	ENSG00000116774			24956	protein-coding gene	gene with protein product		610088					Standard	NM_001286353		Approved	HNOEL-iso, OLF44	uc001eer.1	Q9NRN5	OTTHUMG00000011980	ENST00000320334.4:c.517G>A	1.37:g.114523687G>A	ENSP00000322273:p.Asp173Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q53FR1|Q53HV9|Q5SQL6|Q69AX9|Q8NBJ2	Missense_Mutation	SNP	ENST00000320334.4	37	CCDS870.1	.	.	.	.	.	.	.	.	.	.	G	8.961	0.970500	0.18659	.	.	ENSG00000116774	ENST00000369551;ENST00000320334;ENST00000393300	D;D;D	0.88818	-2.43;-2.43;-2.43	5.63	4.71	0.59529	Olfactomedin-like (3);	0.090652	0.85682	D	0.000000	T	0.68577	0.3016	N	0.11789	0.175	0.49915	D	0.999832	B;B	0.22414	0.069;0.001	B;B	0.20955	0.032;0.001	T	0.65755	-0.6091	10	0.23302	T	0.38	.	13.6267	0.62168	0.0751:0.0:0.9248:0.0	.	153;173	Q9NRN5-2;Q9NRN5	.;OLFL3_HUMAN	N	153;173;153	ENSP00000358564:D153N;ENSP00000322273:D173N;ENSP00000376977:D153N	ENSP00000322273:D173N	D	+	1	0	OLFML3	114325210	1.000000	0.71417	0.982000	0.44146	0.993000	0.82548	5.235000	0.65348	2.651000	0.90000	0.655000	0.94253	GAT		0.542	OLFML3-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033119.1		NM_020190	
NOTCH2	4853	hgsc.bcm.edu	37	1	120612006	120612006	+	Silent	SNP	G	G	A	rs4021006	byFrequency	TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr1:120612006G>A	ENST00000256646.2	-	1	234	c.15C>T	c.(13-15)cgC>cgT	p.R5R		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	5					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCAGAGCGGGGCGCAGGGCGG	0.761			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome				g|||	1973	0.39397	0.2632	0.4049	5008	,	,		21911	0.4315		0.4423	False		,,,				2504	0.4744							Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	0													6.0	8.0	8.0					1																	120612006		1838	3882	5720	SO:0001819	synonymous_variant	4853	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.15C>T	1.37:g.120612006G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q5T3X7|Q99734|Q9H240	Silent	SNP	ENST00000256646.2	37	CCDS908.1	.	.	.	.	.	.	.	.	.	.	G	9.758	1.169358	0.21621	.	.	ENSG00000134250	ENST00000538680	.	.	.	2.9	1.95	0.26073	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.0819	0.14661	0.1818:0.0:0.8182:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NOTCH2	120413529	0.988000	0.35896	0.959000	0.39883	0.588000	0.36517	1.074000	0.30703	0.543000	0.28864	0.184000	0.17185	.		0.761	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1		NM_024408	
PBRM1	55193	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	52685756	52685756	+	Splice_Site	SNP	A	A	G			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr3:52685756A>G	ENST00000296302.7	-	6	716		c.e6+1		PBRM1_ENST00000356770.4_Splice_Site|PBRM1_ENST00000337303.4_Splice_Site|PBRM1_ENST00000409114.3_Splice_Site|PBRM1_ENST00000409057.1_Splice_Site|PBRM1_ENST00000394830.3_Splice_Site|PBRM1_ENST00000409767.1_Splice_Site|PBRM1_ENST00000410007.1_Splice_Site			Q86U86	PB1_HUMAN	polybromo 1						chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TCATCTTCATACCTGTATCCT	0.378			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	0													142.0	135.0	137.0					3																	52685756		2203	4300	6503	SO:0001630	splice_region_variant	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.714+1T>C	3.37:g.52685756A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Splice_Site	SNP	ENST00000296302.7	37		.	.	.	.	.	.	.	.	.	.	A	25.0	4.594042	0.86953	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	.	.	.	5.45	5.45	0.79879	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.515	0.75815	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PBRM1	52660796	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.578000	0.90777	2.056000	0.61249	0.533000	0.62120	.		0.378	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	Intron
POPDC2	64091	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	119378938	119378938	+	Silent	SNP	G	G	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr3:119378938G>A	ENST00000264231.3	-	1	499	c.333C>T	c.(331-333)ctC>ctT	p.L111L	POPDC2_ENST00000474523.1_Intron|POPDC2_ENST00000538678.1_Silent_p.L111L|POPDC2_ENST00000493094.1_Silent_p.L111L|POPDC2_ENST00000468801.1_Silent_p.L111L	NM_022135.2	NP_071418.2	Q9HBU9	POPD2_HUMAN	popeye domain containing 2	111					regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sinoatrial node cell development (GO:0060931)	integral component of membrane (GO:0016021)	cAMP binding (GO:0030552)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	13				GBM - Glioblastoma multiforme(114;0.242)		GCGTCTTGTAGAGGAGGTCAA	0.572																																																	0													144.0	130.0	134.0					3																	119378938		2203	4300	6503	SO:0001819	synonymous_variant	64091			AF204173	CCDS2992.1	3q13.33	2004-01-15			ENSG00000121577	ENSG00000121577			17648	protein-coding gene	gene with protein product		605823				10882522	Standard	NM_022135		Approved	POP2	uc031sbc.1	Q9HBU9	OTTHUMG00000159438	ENST00000264231.3:c.333C>T	3.37:g.119378938G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q86UE7	Silent	SNP	ENST00000264231.3	37	CCDS2992.1																																																																																				0.572	POPDC2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000355378.1		NM_022135	
PSAT1	29968	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	80923397	80923397	+	Missense_Mutation	SNP	G	G	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr9:80923397G>A	ENST00000376588.3	+	6	706	c.638G>A	c.(637-639)cGt>cAt	p.R213H	PSAT1_ENST00000347159.2_Missense_Mutation_p.R213H	NM_058179.2	NP_478059.1	Q9Y617	SERC_HUMAN	phosphoserine aminotransferase 1	213					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-serine biosynthetic process (GO:0006564)|pyridoxine biosynthetic process (GO:0008615)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	O-phospho-L-serine:2-oxoglutarate aminotransferase activity (GO:0004648)|pyridoxal phosphate binding (GO:0030170)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|urinary_tract(1)	20						GTGATTGTCCGTGATGACCTG	0.522																																					Colon(34;187 791 10662 18313 37609)												0													144.0	122.0	129.0					9																	80923397		2203	4300	6503	SO:0001583	missense	29968			BC004863	CCDS6659.1, CCDS6660.1	9q21.2	2008-08-11			ENSG00000135069	ENSG00000135069			19129	protein-coding gene	gene with protein product		610936				12633500, 3651428	Standard	NM_058179		Approved	PSA	uc004ala.3	Q9Y617	OTTHUMG00000020066	ENST00000376588.3:c.638G>A	9.37:g.80923397G>A	ENSP00000365773:p.Arg213His	Somatic		WXS	Illumina HiSeq	Phase_I	Q5T7G5|Q5T7G6|Q96AW2|Q9BQ12	Missense_Mutation	SNP	ENST00000376588.3	37	CCDS6660.1	.	.	.	.	.	.	.	.	.	.	G	36	5.622463	0.96660	.	.	ENSG00000135069	ENST00000421149;ENST00000347159;ENST00000376588	T;T	0.67171	-0.25;-0.25	5.59	5.59	0.84812	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);Aminotransferase, class V/Cysteine desulfurase (1);	0.000000	0.85682	D	0.000000	D	0.83289	0.5222	M	0.83118	2.625	0.80722	D	1	D;P	0.89917	1.0;0.937	D;P	0.65443	0.935;0.549	D	0.85369	0.1112	10	0.87932	D	0	-0.1772	19.5905	0.95508	0.0:0.0:1.0:0.0	.	213;213	Q9Y617-2;Q9Y617	.;SERC_HUMAN	H	37;213;213	ENSP00000317606:R213H;ENSP00000365773:R213H	ENSP00000317606:R213H	R	+	2	0	PSAT1	80113217	1.000000	0.71417	0.923000	0.36655	0.975000	0.68041	9.409000	0.97331	2.638000	0.89438	0.557000	0.71058	CGT		0.522	PSAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052777.1		NM_021154	
PSD4	23550	hgsc.bcm.edu	37	2	113940101	113940101	+	Missense_Mutation	SNP	A	A	C			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr2:113940101A>C	ENST00000245796.6	+	2	263	c.68A>C	c.(67-69)gAc>gCc	p.D23A	PSD4_ENST00000465917.1_3'UTR|PSD4_ENST00000441564.3_Missense_Mutation_p.D23A	NM_012455.2	NP_036587.2	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4	23					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			cervix(1)|endometrium(2)|large_intestine(4)|lung(13)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TACTTGGGAGACAGCCTGGAG	0.607																																																	0													73.0	68.0	70.0					2																	113940101		2203	4300	6503	SO:0001583	missense	23550			U63127	CCDS33276.1	2q13	2013-01-10			ENSG00000125637	ENSG00000125637		"""Pleckstrin homology (PH) domain containing"""	19096	protein-coding gene	gene with protein product		614442				12082148	Standard	XM_005263634		Approved	TIC, EFA6B	uc002tjc.3	Q8NDX1	OTTHUMG00000153339	ENST00000245796.6:c.68A>C	2.37:g.113940101A>C	ENSP00000245796:p.Asp23Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A6NEG7|A8K1Y0|O95621|Q4ZG34|Q6GPH8|Q8IYP4	Missense_Mutation	SNP	ENST00000245796.6	37	CCDS33276.1	.	.	.	.	.	.	.	.	.	.	A	11.09	1.537664	0.27475	.	.	ENSG00000125637	ENST00000245796;ENST00000441564	T;T	0.27104	1.69;1.71	5.0	2.58	0.30949	.	0.603757	0.15793	N	0.244327	T	0.17450	0.0419	L	0.27053	0.805	0.80722	D	1	P;B	0.36909	0.573;0.437	B;B	0.38378	0.272;0.14	T	0.04840	-1.0923	10	0.62326	D	0.03	.	6.0879	0.19978	0.7955:0.0:0.2045:0.0	.	23;23	Q8NDX1-2;Q8NDX1	.;PSD4_HUMAN	A	23	ENSP00000245796:D23A;ENSP00000413997:D23A	ENSP00000245796:D23A	D	+	2	0	PSD4	113656572	0.734000	0.28142	0.747000	0.31113	0.188000	0.23474	1.109000	0.31135	0.726000	0.32339	0.379000	0.24179	GAC		0.607	PSD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330789.1		NM_012455	
PTPRC	5788	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	198687389	198687389	+	Missense_Mutation	SNP	C	C	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr1:198687389C>A	ENST00000367376.2	+	14	1782	c.1611C>A	c.(1609-1611)ttC>ttA	p.F537L	PTPRC_ENST00000352140.3_Missense_Mutation_p.F489L|PTPRC_ENST00000348564.6_Missense_Mutation_p.F378L|PTPRC_ENST00000442510.2_Missense_Mutation_p.F539L|PTPRC_ENST00000594404.1_Missense_Mutation_p.F376L	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	537	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						ATTGCGATTTCCGTGTAAAAG	0.383																																																	0													67.0	64.0	65.0					1																	198687389		2203	4300	6503	SO:0001583	missense	5788			Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.1611C>A	1.37:g.198687389C>A	ENSP00000356346:p.Phe537Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A8K7W6|Q16614|Q9H0Y6	Missense_Mutation	SNP	ENST00000367376.2	37		.	.	.	.	.	.	.	.	.	.	C	16.99	3.274124	0.59649	.	.	ENSG00000081237	ENST00000367376;ENST00000367366;ENST00000352140;ENST00000535566;ENST00000530727;ENST00000442510;ENST00000367367;ENST00000348564	T	0.56275	0.47	4.52	-2.6	0.06190	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.50627	D	0.000103	T	0.68146	0.2969	M	0.85197	2.74	0.18873	N	0.999984	D;D;D;D;D	0.89917	0.972;0.995;1.0;1.0;1.0	D;D;D;D;D	0.81914	0.924;0.974;0.995;0.995;0.995	T	0.61667	-0.7016	10	0.62326	D	0.03	.	9.5819	0.39493	0.0:0.2983:0.0:0.7017	.	473;473;378;489;537	F5GXZ3;B4DSZ5;B1ALS3;E9PC28;P08575	.;.;.;.;PTPRC_HUMAN	L	539;473;489;489;423;537;471;376	ENSP00000193532:F489L	ENSP00000306782:F376L	F	+	3	2	PTPRC	196954012	0.001000	0.12720	0.001000	0.08648	0.004000	0.04260	-0.637000	0.05459	-0.369000	0.08028	0.585000	0.79938	TTC		0.383	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding				
RELN	5649	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	103130250	103130250	+	Silent	SNP	G	G	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr7:103130250G>T	ENST00000428762.1	-	60	9861	c.9702C>A	c.(9700-9702)ctC>ctA	p.L3234L	CTB-107G13.1_ENST00000422488.1_RNA|RELN_ENST00000424685.2_Silent_p.L3234L|RELN_ENST00000343529.5_Silent_p.L3234L	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	3234	EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00076}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		GCCCGCTGCAGAGCTTGGGGC	0.552																																					NSCLC(146;835 1944 15585 22231 52158)												0													102.0	76.0	85.0					7																	103130250		2203	4300	6503	SO:0001819	synonymous_variant	5649				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.9702C>A	7.37:g.103130250G>T		Somatic		WXS	Illumina HiSeq	Phase_I	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Silent	SNP	ENST00000428762.1	37	CCDS47680.1																																																																																				0.552	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1		NM_005045	
RPL4	6124	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	66795006	66795006	+	Missense_Mutation	SNP	T	T	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr15:66795006T>A	ENST00000307961.6	-	4	457	c.365A>T	c.(364-366)tAc>tTc	p.Y122F	ZWILCH_ENST00000535141.2_5'Flank|SNORD16_ENST00000362803.1_RNA|SNORD18C_ENST00000362704.1_RNA|RPL4_ENST00000564517.1_5'Flank|ZWILCH_ENST00000446801.2_5'Flank|ZWILCH_ENST00000307897.5_5'Flank|ZWILCH_ENST00000565627.1_5'Flank|RPL4_ENST00000568588.1_Missense_Mutation_p.Y28F|SNORD18A_ENST00000363753.1_RNA|SNORD18B_ENST00000365659.1_RNA	NM_000968.3	NP_000959.2	P36578	RL4_HUMAN	ribosomal protein L4	122					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|stomach(1)|urinary_tract(1)	17						ACAGATGGCGTATCGTTTTTG	0.453																																																	0													123.0	113.0	117.0					15																	66795006		2201	4299	6500	SO:0001583	missense	6124			AB007167	CCDS10218.1	15q22	2011-04-06			ENSG00000174444	ENSG00000174444		"""L ribosomal proteins"""	10353	protein-coding gene	gene with protein product	"""60S ribosomal protein L4"""	180479				9582194, 8268230	Standard	NM_000968		Approved	L4	uc002apv.3	P36578	OTTHUMG00000133193	ENST00000307961.6:c.365A>T	15.37:g.66795006T>A	ENSP00000311430:p.Tyr122Phe	Somatic		WXS	Illumina HiSeq	Phase_I	A8K502|P39029|Q4VBR0|Q969Z9	Missense_Mutation	SNP	ENST00000307961.6	37	CCDS10218.1	.	.	.	.	.	.	.	.	.	.	T	14.07	2.425716	0.43020	.	.	ENSG00000174444	ENST00000307961;ENST00000432669	.	.	.	4.39	4.39	0.52855	Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (1);Ribosomal protein L4 domain (2);	0.000000	0.85682	D	0.000000	T	0.54498	0.1862	L	0.39898	1.24	0.80722	D	1	B;B	0.12013	0.002;0.005	B;B	0.26416	0.028;0.069	T	0.51741	-0.8667	9	0.31617	T	0.26	-5.0986	14.1025	0.65065	0.0:0.0:0.0:1.0	.	122;122	B4DFI6;P36578	.;RL4_HUMAN	F	122	.	ENSP00000311430:Y122F	Y	-	2	0	RPL4	64582060	1.000000	0.71417	0.853000	0.33588	0.894000	0.52154	7.596000	0.82721	1.974000	0.57490	0.533000	0.62120	TAC		0.453	RPL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256903.2		NM_000968	
SCN5A	6331	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	38622777	38622777	+	Missense_Mutation	SNP	T	T	C			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr3:38622777T>C	ENST00000333535.4	-	17	3022	c.2873A>G	c.(2872-2874)aAc>aGc	p.N958S	SCN5A_ENST00000449557.2_Missense_Mutation_p.N958S|SCN5A_ENST00000414099.2_Missense_Mutation_p.N958S|SCN5A_ENST00000443581.1_Missense_Mutation_p.N958S|SCN5A_ENST00000425664.1_Missense_Mutation_p.N958S|SCN5A_ENST00000450102.2_Missense_Mutation_p.N958S|SCN5A_ENST00000451551.2_Missense_Mutation_p.N958S|SCN5A_ENST00000413689.1_Missense_Mutation_p.N958S|SCN5A_ENST00000423572.2_Missense_Mutation_p.N958S|SCN5A_ENST00000455624.2_Missense_Mutation_p.N958S			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	958					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	CAGCTGGAGGTTGTTCATCTC	0.597																																																	0													33.0	34.0	34.0					3																	38622777		2079	4240	6319	SO:0001583	missense	6331			AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.2873A>G	3.37:g.38622777T>C	ENSP00000328968:p.Asn958Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	ENST00000333535.4	37	CCDS46796.1	.	.	.	.	.	.	.	.	.	.	T	19.29	3.798756	0.70567	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.87650	-2.28;-2.28;-2.28;-2.28;-2.28;-2.28;-2.28;-2.28;-2.28;-2.28	4.59	4.59	0.56863	Sodium ion transport-associated (1);	0.097333	0.64402	D	0.000001	D	0.93615	0.7961	M	0.86028	2.79	0.43283	D	0.995258	P;D;P;P;P;D;P	0.76494	0.63;0.999;0.884;0.825;0.63;0.999;0.791	B;D;B;B;B;D;B	0.85130	0.191;0.992;0.301;0.285;0.191;0.997;0.187	D	0.94622	0.7814	10	0.87932	D	0	.	14.1663	0.65477	0.0:0.0:0.0:1.0	.	958;958;958;958;958;958;958	E9PEF3;E9PHB6;Q14524-6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;.;SCN5A_HUMAN;.;.	S	958	ENSP00000398962:N958S;ENSP00000398266:N958S;ENSP00000410257:N958S;ENSP00000388797:N958S;ENSP00000397915:N958S;ENSP00000416634:N958S;ENSP00000328968:N958S;ENSP00000399524:N958S;ENSP00000403355:N958S;ENSP00000413996:N958S	ENSP00000328968:N958S	N	-	2	0	SCN5A	38597781	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.868000	0.87116	1.945000	0.56424	0.533000	0.62120	AAC		0.597	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1		NM_198056	
SERPINB13	5275	hgsc.bcm.edu;ucsc.edu	37	18	61255961	61255961	+	Frame_Shift_Del	DEL	G	G	-	rs35760977|rs143447794		TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr18:61255961delG	ENST00000344731.5	+	2	162	c.60delG	c.(58-60)aagfs	p.K21fs	SERPINB13_ENST00000269489.5_Frame_Shift_Del_p.K21fs	NM_012397.3	NP_036529.1	Q9UIV8	SPB13_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 13	21					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|urinary_tract(1)	25						AAGAGCTGAAGAAAACAAATG	0.488																																																	0													96.0	93.0	94.0					18																	61255961		2203	4300	6503	SO:0001589	frameshift_variant	5275			AF169949, BC101821	CCDS11985.1	18q21.33	2014-02-18	2005-08-18		ENSG00000197641	ENSG00000197641		"""Serine (or cysteine) peptidase inhibitors"""	8944	protein-coding gene	gene with protein product		604445	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 13"""	PI13		9297979, 10512713, 24172014	Standard	NM_012397		Approved	HUR7, hurpin, headpin	uc002ljc.3	Q9UIV8	OTTHUMG00000060406	ENST00000344731.5:c.60delG	18.37:g.61255961delG	ENSP00000341584:p.Lys21fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K2Q8|Q3MII2|Q9HCX1|Q9UBW1|Q9UKG0	Frame_Shift_Del	DEL	ENST00000344731.5	37	CCDS11985.1																																																																																				0.488	SERPINB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133798.1		NM_012397	
SLC29A4	222962	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	5330777	5330777	+	Missense_Mutation	SNP	G	G	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr7:5330777G>A	ENST00000396872.3	+	4	485	c.324G>A	c.(322-324)atG>atA	p.M108I	SLC29A4_ENST00000297195.4_Missense_Mutation_p.M108I|SLC29A4_ENST00000406453.3_Missense_Mutation_p.M108I			Q7RTT9	S29A4_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 4	108					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nucleoside transmembrane transporter activity (GO:0005337)			breast(1)|cervix(2)|kidney(7)|large_intestine(1)|liver(1)|lung(7)|urinary_tract(1)	20		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0903)|OV - Ovarian serous cystadenocarcinoma(56;2.65e-15)	Metformin(DB00331)	TGTTTGACATGAGCCTCACCT	0.627																																																	0													101.0	86.0	91.0					7																	5330777		2203	4300	6503	SO:0001583	missense	222962			AK075422	CCDS5340.1, CCDS75561.1	7p22.2	2013-07-17	2013-07-17		ENSG00000164638	ENSG00000164638		"""Solute carriers"""	23097	protein-coding gene	gene with protein product		609149	"""solute carrier family 29 (nucleoside transporters), member 4"""			12838422	Standard	NM_153247		Approved	FLJ34923, ENT4	uc003soc.3	Q7RTT9	OTTHUMG00000023797	ENST00000396872.3:c.324G>A	7.37:g.5330777G>A	ENSP00000380081:p.Met108Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q6PJ08|Q86WY8|Q8NAR3|Q8NBM2	Missense_Mutation	SNP	ENST00000396872.3	37	CCDS5340.1	.	.	.	.	.	.	.	.	.	.	.	16.76	3.211572	0.58343	.	.	ENSG00000164638	ENST00000434816;ENST00000396872;ENST00000444741;ENST00000297195;ENST00000406453	T;T;T;T;T	0.30981	1.51;1.51;1.51;1.51;1.51	4.5	3.6	0.41247	Major facilitator superfamily domain, general substrate transporter (1);	0.090555	0.85682	D	0.000000	T	0.32255	0.0823	M	0.66439	2.03	0.58432	D	0.999992	P;P	0.42941	0.794;0.696	B;B	0.39805	0.31;0.156	T	0.11421	-1.0588	10	0.48119	T	0.1	-12.217	11.6887	0.51503	0.0:0.0:0.8222:0.1778	.	108;108	Q7RTT9-2;Q7RTT9	.;S29A4_HUMAN	I	108	ENSP00000406803:M108I;ENSP00000380081:M108I;ENSP00000413271:M108I;ENSP00000297195:M108I;ENSP00000385845:M108I	ENSP00000297195:M108I	M	+	3	0	SLC29A4	5297303	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.907000	0.63300	0.854000	0.35336	0.556000	0.70494	ATG		0.627	SLC29A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060118.6		NM_153247	
SLC39A7	7922	hgsc.bcm.edu;ucsc.edu	37	6	33169301	33169307	+	Frame_Shift_Del	DEL	CCATGGC	CCATGGC	-			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	CCATGGC	CCATGGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr6:33169301_33169307delCCATGGC	ENST00000374677.3	+	1	652_658	c.279_285delCCATGGC	c.(277-285)agccatggcfs	p.SHG93fs	RXRB_ENST00000544186.1_5'Flank|RNY4P10_ENST00000365571.1_RNA|SLC39A7_ENST00000374675.3_Frame_Shift_Del_p.SHG93fs|RXRB_ENST00000413614.2_5'Flank|RXRB_ENST00000374680.3_5'Flank|RXRB_ENST00000374685.4_5'Flank	NM_006979.2	NP_008910.2	Q92504	S39A7_HUMAN	solute carrier family 39 (zinc transporter), member 7	93	His-rich.				transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion transmembrane transporter activity (GO:0046873)			NS(1)|breast(3)|endometrium(2)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	18						ATGGCCATAGCCATGGCTACTCCCATG	0.556																																																	0																																										SO:0001589	frameshift_variant	7922			AF117221	CCDS43453.1	6p21.3	2014-01-28		2003-10-27	ENSG00000112473	ENSG00000112473		"""Solute carriers"""	4927	protein-coding gene	gene with protein product		601416	"""HLA class II region expressed gene KE4"""	HKE4		8812499, 1855816, 19246244, 15705588	Standard	NM_006979		Approved	H2-KE4, D6S2244E, KE4, RING5, ZIP7	uc003odf.3	Q92504	OTTHUMG00000031238	ENST00000374677.3:c.279_285delCCATGGC	6.37:g.33169301_33169307delCCATGGC	ENSP00000363809:p.Ser93fs	Somatic		WXS	Illumina HiSeq	Phase_I	B0UXF6|Q5STP8|Q9UIQ0	Frame_Shift_Del	DEL	ENST00000374677.3	37	CCDS43453.1																																																																																				0.556	SLC39A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076499.2		NM_006979	
SLC4A3	6508	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	220493280	220493280	+	Missense_Mutation	SNP	C	C	T	rs150796797	byFrequency	TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr2:220493280C>T	ENST00000358055.3	+	3	717	c.205C>T	c.(205-207)Cgg>Tgg	p.R69W	SLC4A3_ENST00000497589.1_3'UTR|AC009955.8_ENST00000455896.1_RNA|SLC4A3_ENST00000373760.2_Missense_Mutation_p.R69W|SLC4A3_ENST00000373762.3_Missense_Mutation_p.R69W|SLC4A3_ENST00000273063.6_Missense_Mutation_p.R69W|SLC4A3_ENST00000317151.3_Missense_Mutation_p.R69W			P48751	B3A3_HUMAN	solute carrier family 4 (anion exchanger), member 3	69					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	51		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTACAGCGAGCGGGACTTTGA	0.657																																																	0								C	TRP/ARG,TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	32.0	38.0	36.0		205,205	3.2	1.0	2	dbSNP_134	36	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	SLC4A3	NM_005070.3,NM_201574.2	101,101	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging,probably-damaging	69/1233,69/1260	220493280	2,13004	2203	4300	6503	SO:0001583	missense	6508				CCDS2445.1, CCDS2446.1	2q35	2013-07-19	2013-07-19		ENSG00000114923	ENSG00000114923		"""Solute carriers"""	11029	protein-coding gene	gene with protein product	"""Anion exchanger 3, neuronal"""	106195	"""solute carrier family 4, anion exchanger, member 3"""			8001971	Standard	NM_005070		Approved	AE3, SLC2C	uc002vmo.4	P48751	OTTHUMG00000059238	ENST00000358055.3:c.205C>T	2.37:g.220493280C>T	ENSP00000350756:p.Arg69Trp	Somatic		WXS	Illumina HiSeq	Phase_I	A6H8L2|A8K1Q9|B7ZVX6|B9EGD1|Q6YIQ9	Missense_Mutation	SNP	ENST00000358055.3	37	CCDS2445.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.107395	0.77096	2.27E-4	1.16E-4	ENSG00000114923	ENST00000358055;ENST00000373760;ENST00000273063;ENST00000373762;ENST00000317151	T;T;T;T;T	0.75050	-0.89;-0.89;-0.9;-0.9;-0.89	4.19	3.22	0.36961	.	0.138177	0.47093	D	0.000241	T	0.75049	0.3797	L	0.40543	1.245	0.40787	D	0.983226	D;D	0.76494	0.993;0.999	P;P	0.59546	0.639;0.859	T	0.77300	-0.2639	10	0.87932	D	0	.	8.9855	0.35992	0.3523:0.6477:0.0:0.0	.	69;69	P48751;P48751-3	B3A3_HUMAN;.	W	69	ENSP00000350756:R69W;ENSP00000362865:R69W;ENSP00000273063:R69W;ENSP00000362867:R69W;ENSP00000314006:R69W	ENSP00000273063:R69W	R	+	1	2	SLC4A3	220201524	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.769000	0.38522	2.165000	0.68154	0.462000	0.41574	CGG		0.657	SLC4A3-009	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316472.1		NM_005070	
STAT6	6778	hgsc.bcm.edu	37	12	57499020	57499021	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr12:57499020_57499021insG	ENST00000300134.3	-	9	1239_1240	c.914_915insC	c.(913-915)ccafs	p.P305fs	STAT6_ENST00000537215.2_Frame_Shift_Ins_p.P195fs|STAT6_ENST00000454075.3_Frame_Shift_Ins_p.P305fs|STAT6_ENST00000556155.1_Frame_Shift_Ins_p.P305fs|STAT6_ENST00000543873.2_Frame_Shift_Ins_p.P305fs|STAT6_ENST00000538913.2_Frame_Shift_Ins_p.P195fs	NM_001178078.1|NM_003153.4	NP_001171549.1|NP_003144.3	P42226	STAT6_HUMAN	signal transducer and activator of transcription 6, interleukin-4 induced	305					cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|mammary gland epithelial cell proliferation (GO:0033598)|mammary gland morphogenesis (GO:0060443)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of isotype switching to IgE isotypes (GO:0048295)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|T-helper 1 cell lineage commitment (GO:0002296)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane raft (GO:0045121)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein phosphatase binding (GO:0019903)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	28						GAGGCTTGGCTGGGGCCCCCAG	0.629																																																	0																																										SO:0001589	frameshift_variant	6778			BC005823, BQ028928	CCDS8931.1, CCDS53804.1	12q13	2013-02-14				ENSG00000166888		"""SH2 domain containing"""	11368	protein-coding gene	gene with protein product		601512				9605853, 8085155	Standard	NM_003153		Approved	D12S1644, IL-4-STAT	uc001sna.3	P42226		ENST00000300134.3:c.915dupC	12.37:g.57499024_57499024dupG	ENSP00000300134:p.Pro305fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K316|B7ZA27|F5GXI9|Q5FBW5|Q71UP4	Frame_Shift_Ins	INS	ENST00000300134.3	37	CCDS8931.1																																																																																				0.629	STAT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412248.3		NM_003153	
TMEM8A	58986	hgsc.bcm.edu	37	16	422040	422041	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr16:422040_422041insG	ENST00000431232.2	-	13	2422_2423	c.2262_2263insC	c.(2260-2265)ccctgcfs	p.C755fs	MRPL28_ENST00000429738.1_5'Flank|MRPL28_ENST00000389675.2_5'Flank|MRPL28_ENST00000199706.8_5'Flank|TMEM8A_ENST00000250930.3_Frame_Shift_Ins_p.C562fs	NM_021259.2	NP_067082.2	Q9HCN3	TMM8A_HUMAN	transmembrane protein 8A	755					cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)				central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)|prostate(1)	14						TGATAGTGGCAGGGGAATTTCT	0.634																																																	0																																										SO:0001589	frameshift_variant	58986			AB045292	CCDS10407.1	16p13.3	2009-06-12	2009-06-12	2009-06-12	ENSG00000129925	ENSG00000129925			17205	protein-coding gene	gene with protein product			"""transmembrane protein 6"", ""transmembrane protein 8 (five membrane-spanning domains)"""	TMEM6, TMEM8		11006113	Standard	NM_021259		Approved	M83	uc002cgu.4	Q9HCN3	OTTHUMG00000047996	ENST00000431232.2:c.2263dupC	16.37:g.422044_422044dupG	ENSP00000401338:p.Cys755fs	Somatic		WXS	Illumina HiSeq	Phase_I	D3DU49|Q4TT35|Q8WU24|Q96S25|Q9BR03|Q9BT97|Q9H7B9	Frame_Shift_Ins	INS	ENST00000431232.2	37	CCDS10407.1																																																																																				0.634	TMEM8A-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000109257.2		NM_021259	
TRPM6	140803	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	77417087	77417087	+	Missense_Mutation	SNP	T	T	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr9:77417087T>A	ENST00000360774.1	-	16	1973	c.1736A>T	c.(1735-1737)aAg>aTg	p.K579M	TRPM6_ENST00000451710.3_Missense_Mutation_p.K579M|TRPM6_ENST00000449912.2_Missense_Mutation_p.K574M|TRPM6_ENST00000376864.4_Missense_Mutation_p.K579M|RN7SKP47_ENST00000365347.1_RNA|TRPM6_ENST00000376871.3_Intron|TRPM6_ENST00000376872.3_Intron|TRPM6_ENST00000361255.3_Missense_Mutation_p.K574M	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	579					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						GACTATAGACTTTTCCTGTTG	0.343																																																	0													51.0	48.0	49.0					9																	77417087		2203	4300	6503	SO:0001583	missense	140803			AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.1736A>T	9.37:g.77417087T>A	ENSP00000354006:p.Lys579Met	Somatic		WXS	Illumina HiSeq	Phase_I	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	ENST00000360774.1	37	CCDS6647.1	.	.	.	.	.	.	.	.	.	.	T	14.44	2.537224	0.45176	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000449912;ENST00000361255;ENST00000376864;ENST00000312449;ENST00000448641	T;T;T;T;T	0.76316	-1.01;-1.01;-1.01;-1.01;-1.01	5.28	4.12	0.48240	.	0.749945	0.13193	N	0.406569	T	0.82107	0.4965	M	0.63428	1.95	0.42070	D	0.9912	D;B	0.67145	0.996;0.106	P;B	0.57776	0.827;0.089	T	0.79640	-0.1719	10	0.87932	D	0	.	7.3543	0.26711	0.1291:0.0718:0.0:0.7991	.	579;574	Q9BX84;Q9BX84-3	TRPM6_HUMAN;.	M	579;579;574;574;579;242;242	ENSP00000354006:K579M;ENSP00000407341:K579M;ENSP00000396672:K574M;ENSP00000354962:K574M;ENSP00000366060:K579M	ENSP00000309693:K242M	K	-	2	0	TRPM6	76606907	0.994000	0.37717	0.975000	0.42487	0.627000	0.37826	2.163000	0.42377	0.815000	0.34398	-0.480000	0.04831	AAG		0.343	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1		NM_017662	
TRPV5	56302	hgsc.bcm.edu;ucsc.edu	37	7	142609708	142609708	+	Frame_Shift_Del	DEL	G	G	-	rs369197446		TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr7:142609708delG	ENST00000265310.1	-	13	2076	c.1728delC	c.(1726-1728)gccfs	p.A576fs		NM_019841.4	NP_062815.2	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel, subfamily V, member 5	576					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|ion transmembrane transport (GO:0034220)|protein tetramerization (GO:0051262)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(14)|lung(32)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	67	Melanoma(164;0.059)					CGCCCATCATGGCGATGAACA	0.542																																																	0													132.0	115.0	120.0					7																	142609708		2203	4300	6503	SO:0001589	frameshift_variant	56302			AJ271207	CCDS5875.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000127412	ENSG00000127412		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	3145	protein-coding gene	gene with protein product		606679	"""epithelial calcium channel 1"""	ECAC1		10944439, 10945469, 16382100	Standard	NM_019841		Approved	CaT2	uc003wby.1	Q9NQA5	OTTHUMG00000157157	ENST00000265310.1:c.1728delC	7.37:g.142609708delG	ENSP00000265310:p.Ala576fs	Somatic		WXS	Illumina HiSeq	Phase_I	A4D2H7|E9PBZ6|Q8N4C1|Q8NDW5|Q8NDX7|Q8NDX8|Q96PM6	Frame_Shift_Del	DEL	ENST00000265310.1	37	CCDS5875.1																																																																																				0.542	TRPV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347660.1		NM_019841	
TTYH1	57348	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	54942314	54942314	+	Missense_Mutation	SNP	C	C	G			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr19:54942314C>G	ENST00000376530.3	+	10	1173	c.1070C>G	c.(1069-1071)aCa>aGa	p.T357R	TTYH1_ENST00000301194.4_Missense_Mutation_p.T357R|TTYH1_ENST00000376531.3_Missense_Mutation_p.T357R|TTYH1_ENST00000391739.3_Missense_Mutation_p.D387E|AC008746.3_ENST00000457113.1_RNA|TTYH1_ENST00000489425.1_3'UTR	NM_001201461.1|NM_020659.3	NP_001188390.1|NP_065710.1	Q9H313	TTYH1_HUMAN	tweety family member 1	357					cell-substrate adhesion (GO:0031589)|chloride transport (GO:0006821)|filopodium assembly (GO:0046847)|ion transmembrane transport (GO:0034220)|iron ion transmembrane transport (GO:0034755)|iron ion transport (GO:0006826)|mitotic nuclear division (GO:0007067)|regulation of anion transport (GO:0044070)|single organismal cell-cell adhesion (GO:0016337)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|filopodium membrane (GO:0031527)|filopodium tip (GO:0032433)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum membrane (GO:0030868)	calcium ion binding (GO:0005509)|iron ion transmembrane transporter activity (GO:0005381)|volume-sensitive chloride channel activity (GO:0072320)			endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0767)		CTGAATGTGACAGAAGGAAAT	0.617																																																	0													96.0	90.0	92.0					19																	54942314		2203	4300	6503	SO:0001583	missense	57348			AF177909	CCDS12893.1, CCDS33106.1, CCDS56102.1	19q13.4	2013-09-02	2013-09-02		ENSG00000167614	ENSG00000167614			13476	protein-coding gene	gene with protein product		605784	"""tweety (Drosophila) homolog 1"", ""tweety homolog 1 (Drosophila)"""			10950931	Standard	NM_020659		Approved		uc002qfr.3	Q9H313	OTTHUMG00000065544	ENST00000376530.3:c.1070C>G	19.37:g.54942314C>G	ENSP00000365713:p.Thr357Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B0VJY3|B0VJY4|B0VJY5|B2VAL9|Q5U682|Q68A17|Q6L750|Q6ZTE5|Q8WUU2	Missense_Mutation	SNP	ENST00000376530.3	37	CCDS12893.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.31|19.31	3.802634|3.802634	0.70682|0.70682	.|.	.|.	ENSG00000167614|ENSG00000167614	ENST00000391739|ENST00000301194;ENST00000376530;ENST00000376531	T|T;T;T	0.24723|0.15603	1.84|2.41;2.41;2.41	4.07|4.07	4.07|4.07	0.47477|0.47477	.|.	.|0.122750	.|0.53938	.|D	.|0.000052	T|T	0.41351|0.41351	0.1155|0.1155	M|M	0.75615|0.75615	2.305|2.305	0.24118|0.24118	N|N	0.995812|0.995812	B|D;D;D;D	0.26002|0.89917	0.139|1.0;1.0;1.0;0.999	B|D;D;D;D	0.22601|0.83275	0.04|0.995;0.988;0.988;0.996	T|T	0.17137|0.17137	-1.0379|-1.0379	9|10	0.10902|0.72032	T|D	0.67|0.01	-9.7568|-9.7568	14.152|14.152	0.65392|0.65392	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	387|269;357;357;357	B7Z1H9|Q9H313-5;Q9H313-2;Q9H313-3;Q9H313	.|.;.;.;TTYH1_HUMAN	E|R	387|357	ENSP00000375619:D387E|ENSP00000301194:T357R;ENSP00000365713:T357R;ENSP00000365714:T357R	ENSP00000375619:D387E|ENSP00000301194:T357R	D|T	+|+	3|2	2|0	TTYH1|TTYH1	59634126|59634126	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	5.924000|5.924000	0.70054|0.70054	2.254000|2.254000	0.74563|0.74563	0.561000|0.561000	0.74099|0.74099	GAC|ACA		0.617	TTYH1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140498.1			
UBR5	51366	hgsc.bcm.edu	37	8	103307655	103307656	+	Frame_Shift_Ins	INS	-	-	G	rs376691139		TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr8:103307655_103307656insG	ENST00000520539.1	-	30	4523_4524	c.3917_3918insC	c.(3916-3918)acafs	p.T1306fs	UBR5_ENST00000220959.4_Frame_Shift_Ins_p.T1306fs|UBR5_ENST00000521922.1_Frame_Shift_Ins_p.T1300fs|UBR5_ENST00000519528.1_5'Flank	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	1306					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)			NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			CAGGACTGGCTGTTTTTCGGTT	0.401																																					Ovarian(131;96 1741 5634 7352 27489)												0																																										SO:0001589	frameshift_variant	51366			AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.3918dupC	8.37:g.103307656_103307656dupG	ENSP00000429084:p.Thr1306fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2RP24|J3KMW7|O94970|Q9NPL3	Frame_Shift_Ins	INS	ENST00000520539.1	37	CCDS34933.1																																																																																				0.401	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380075.2		NM_015902	
USH2A	7399	hgsc.bcm.edu;ucsc.edu	37	1	216051167	216051168	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr1:216051167_216051168insT	ENST00000307340.3	-	43	8999_9000	c.8613_8614insA	c.(8611-8616)gaagatfs	p.D2872fs	USH2A_ENST00000366943.2_Frame_Shift_Ins_p.D2872fs	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2872	Fibronectin type-III 15. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CGATTTAAATCTTCTGGGGGAT	0.381										HNSCC(13;0.011)																																							0																																										SO:0001589	frameshift_variant	7399			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.8614dupA	1.37:g.216051169_216051169dupT	ENSP00000305941:p.Asp2872fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VVM9|Q6S362|Q9NS27	Frame_Shift_Ins	INS	ENST00000307340.3	37	CCDS31025.1																																																																																				0.381	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1		NM_007123	
USP22	23326	broad.mit.edu;ucsc.edu	37	17	20931913	20931913	+	Silent	SNP	G	G	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr17:20931913G>A	ENST00000261497.4	-	2	449	c.246C>T	c.(244-246)ttC>ttT	p.F82F	USP22_ENST00000455117.2_5'UTR|USP22_ENST00000537526.2_Silent_p.F70F	NM_015276.1	NP_056091.1	Q9UPT9	UBP22_HUMAN	ubiquitin specific peptidase 22	82					cell cycle (GO:0007049)|chromatin organization (GO:0006325)|embryo development (GO:0009790)|histone deubiquitination (GO:0016578)|histone H4 acetylation (GO:0043967)|histone ubiquitination (GO:0016574)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|protein deubiquitination (GO:0016579)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	SAGA complex (GO:0000124)	enzyme binding (GO:0019899)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|transcription coactivator activity (GO:0003713)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)	15						TGAAACAGCCGAAGAAGACAC	0.552																																																	0													79.0	82.0	81.0					17																	20931913		1998	4168	6166	SO:0001819	synonymous_variant	23326			AB028986	CCDS42285.1	17p11.2	2006-11-24	2005-08-08		ENSG00000124422	ENSG00000124422		"""Ubiquitin-specific peptidases"""	12621	protein-coding gene	gene with protein product		612116	"""ubiquitin specific protease 22"", ""ubiquitin specific peptidase 3-like"""	USP3L		12838346	Standard	NM_015276		Approved	KIAA1063	uc002gym.4	Q9UPT9	OTTHUMG00000133621	ENST00000261497.4:c.246C>T	17.37:g.20931913G>A		Somatic		WXS	Illumina GAIIx	Phase_I	A0JNS3|Q2NLE2|Q6MZY4|Q8TBS8|Q96IW5	Silent	SNP	ENST00000261497.4	37	CCDS42285.1																																																																																				0.552	USP22-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444169.1			
WNT2	7472	broad.mit.edu;hgsc.bcm.edu	37	7	116963052	116963052	+	5'UTR	SNP	C	C	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr7:116963052C>A	ENST00000265441.3	-	0	291				AC002465.2_ENST00000436097.1_RNA	NM_003391.2	NP_003382.1	P09544	WNT2_HUMAN	wingless-type MMTV integration site family member 2						atrial cardiac muscle tissue morphogenesis (GO:0055009)|canonical Wnt signaling pathway (GO:0060070)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|iris morphogenesis (GO:0061072)|labyrinthine layer blood vessel development (GO:0060716)|lens development in camera-type eye (GO:0002088)|lung development (GO:0030324)|lung induction (GO:0060492)|mammary gland epithelium development (GO:0061180)|neuron differentiation (GO:0030182)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			breast(2)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|ovary(3)|prostate(1)|skin(2)	31	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		ATATTAACCCCCTTGCGTCTG	0.642																																																	0																																										SO:0001623	5_prime_UTR_variant	7472			X07876	CCDS5771.1	7q31	2013-02-28			ENSG00000105989	ENSG00000105989		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12780	protein-coding gene	gene with protein product	"""secreted growth factor"""	147870		INT1L1		2971536	Standard	NM_003391		Approved	IRP	uc003viz.3	P09544	OTTHUMG00000023428	ENST00000265441.3:c.-9G>T	7.37:g.116963052C>A		Somatic		WXS	Illumina HiSeq	Phase_I	A4D0V1|Q75N05|Q9UDP9	RNA	SNP	ENST00000265441.3	37	CCDS5771.1																																																																																				0.642	WNT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059749.3		NM_003391	
ZFP82	284406	hgsc.bcm.edu;ucsc.edu	37	19	36884285	36884292	+	Frame_Shift_Del	DEL	AAAGGCCT	AAAGGCCT	-	rs370159081		TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	AAAGGCCT	AAAGGCCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr19:36884285_36884292delAAAGGCCT	ENST00000392161.3	-	5	1192_1199	c.950_957delAGGCCTTT	c.(949-957)aaggcctttfs	p.KAF317fs	ZFP82_ENST00000392171.1_Frame_Shift_Del_p.KAF317fs	NM_133466.2	NP_597723.1	Q8N141	ZFP82_HUMAN	ZFP82 zinc finger protein	317					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						AGCCACACAAAAAGGCCTTCCCACATTC	0.452																																																	0																																										SO:0001589	frameshift_variant	284406			AL834267	CCDS12493.1	19q13.13	2013-01-08	2012-11-27	2008-07-01		ENSG00000181007		"""Zinc fingers, C2H2-type"", ""-"""	28682	protein-coding gene	gene with protein product			"""zinc finger protein 545"", ""zinc finger protein 82 homolog (mouse)"", ""zinc finger protein 82"""	ZNF545		11853319	Standard	NM_133466		Approved	MGC45380, KIAA1948	uc002ody.1	Q8N141		ENST00000392161.3:c.950_957delAGGCCTTT	19.37:g.36884285_36884292delAAAGGCCT	ENSP00000431265:p.Lys317fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NC63|Q8TF53	Frame_Shift_Del	DEL	ENST00000392161.3	37	CCDS12493.1																																																																																				0.452	ZFP82-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109552.2		NM_133466	
ZNF653	115950	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	11596575	11596575	+	Missense_Mutation	SNP	T	T	C			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr19:11596575T>C	ENST00000293771.5	-	7	1602	c.1466A>G	c.(1465-1467)aAt>aGt	p.N489S	CTC-398G3.6_ENST00000585656.1_Intron	NM_138783.3	NP_620138.2	Q96CK0	ZN653_HUMAN	zinc finger protein 653	489					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	17						ATGCACAAGATTGACGTGGTT	0.562																																					Pancreas(83;980 1446 4542 6441 43352)												0													199.0	169.0	179.0					19																	11596575		2203	4300	6503	SO:0001583	missense	115950			AY072704	CCDS12261.1	19p13.2	2013-01-08						"""Zinc fingers, C2H2-type"""	25196	protein-coding gene	gene with protein product		611371				12477932	Standard	NM_138783		Approved	Zip67	uc002mrz.2	Q96CK0		ENST00000293771.5:c.1466A>G	19.37:g.11596575T>C	ENSP00000293771:p.Asn489Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q96AS7	Missense_Mutation	SNP	ENST00000293771.5	37	CCDS12261.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.348165	0.82132	.	.	ENSG00000161914	ENST00000293771	T	0.27557	1.66	5.26	5.26	0.73747	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	T	0.51261	0.1664	L	0.59436	1.845	0.58432	D	0.999997	D	0.69078	0.997	D	0.75020	0.985	T	0.53457	-0.8436	10	0.72032	D	0.01	-65.4624	14.4764	0.67548	0.0:0.0:0.0:1.0	.	489	Q96CK0	ZN653_HUMAN	S	489	ENSP00000293771:N489S	ENSP00000293771:N489S	N	-	2	0	ZNF653	11457575	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.257000	0.78362	2.135000	0.66039	0.459000	0.35465	AAT		0.562	ZNF653-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458836.2		NM_138783	
BYSL	705	broad.mit.edu	37	6	41889389	41889389	+	Missense_Mutation	SNP	G	G	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr6:41889389G>T	ENST00000230340.4	+	1	464	c.89G>T	c.(88-90)cGg>cTg	p.R30L	MED20_ENST00000409060.1_5'Flank|MED20_ENST00000409312.1_5'Flank|MED20_ENST00000467535.1_5'Flank|MED20_ENST00000265350.4_5'Flank	NM_004053.3	NP_004044.3	Q13895	BYST_HUMAN	bystin-like	30					cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|female pregnancy (GO:0007565)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|trophectodermal cell differentiation (GO:0001829)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(5)|skin(1)	8	Colorectal(47;0.121)		STAD - Stomach adenocarcinoma(11;0.000204)|Epithelial(12;0.000473)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			AATGCGGTGCGGGCGGGGGTC	0.647											OREG0017436	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													11.0	16.0	14.0					6																	41889389		2180	4264	6444	SO:0001583	missense	705			L36720	CCDS34450.1	6p21.1	2008-08-29			ENSG00000112578	ENSG00000112578			1157	protein-coding gene	gene with protein product		603871				9925933, 17381424	Standard	NM_004053		Approved		uc003orl.3	Q13895	OTTHUMG00000014687	ENST00000230340.4:c.89G>T	6.37:g.41889389G>T	ENSP00000230340:p.Arg30Leu	Somatic	904	WXS	Illumina GAIIx	Phase_I	Q6P5W4|Q86W44|Q96IP8	Missense_Mutation	SNP	ENST00000230340.4	37	CCDS34450.1	.	.	.	.	.	.	.	.	.	.	G	19.02	3.746221	0.69418	.	.	ENSG00000112578	ENST00000230340	T	0.22134	1.97	4.87	3.92	0.45320	.	0.063968	0.64402	D	0.000005	T	0.12561	0.0305	M	0.73217	2.22	0.80722	D	1	B	0.32160	0.358	B	0.29716	0.106	T	0.04976	-1.0914	10	0.72032	D	0.01	-15.163	8.4304	0.32755	0.1591:0.0:0.8409:0.0	.	30	Q13895	BYST_HUMAN	L	30	ENSP00000230340:R30L	ENSP00000230340:R30L	R	+	2	0	BYSL	41997367	1.000000	0.71417	0.885000	0.34714	0.277000	0.26821	3.461000	0.53035	2.517000	0.84864	0.655000	0.94253	CGG		0.647	BYSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040535.2			
DLL4	54567	broad.mit.edu	37	15	41222315	41222315	+	Splice_Site	SNP	G	G	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr15:41222315G>T	ENST00000249749.5	+	2	612		c.e2+1			NM_019074.3	NP_061947.1	Q9NR61	DLL4_HUMAN	delta-like 4 (Drosophila)						angiogenesis (GO:0001525)|blood circulation (GO:0008015)|blood vessel lumenization (GO:0072554)|blood vessel remodeling (GO:0001974)|cardiac atrium morphogenesis (GO:0003209)|cardiac ventricle morphogenesis (GO:0003208)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|dorsal aorta morphogenesis (GO:0035912)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|pericardium morphogenesis (GO:0003344)|positive regulation of neural precursor cell proliferation (GO:2000179)|regulation of neural retina development (GO:0061074)|regulation of neurogenesis (GO:0050767)|signal transduction (GO:0007165)|ventral spinal cord interneuron fate commitment (GO:0060579)|ventricular trabecula myocardium morphogenesis (GO:0003222)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|Notch binding (GO:0005112)			breast(3)|large_intestine(1)	4		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.07e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.164)		CACCTGGCCGGTGAGCACAGC	0.652											OREG0023070	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													10.0	12.0	11.0					15																	41222315		1910	4101	6011	SO:0001630	splice_region_variant	54567			AF253468	CCDS45232.1	15q14	2008-07-03	2001-12-03			ENSG00000128917			2910	protein-coding gene	gene with protein product		605185	"""delta-like 4 homolog (Drosophila)"""			10837024	Standard	NM_019074		Approved		uc001zng.2	Q9NR61		ENST00000249749.5:c.336+1G>T	15.37:g.41222315G>T		Somatic	899	WXS	Illumina GAIIx	Phase_I	Q3KP23|Q9NQT9	Splice_Site	SNP	ENST00000249749.5	37	CCDS45232.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.224540	0.79576	.	.	ENSG00000128917	ENST00000249749	.	.	.	4.63	4.63	0.57726	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.025	0.89266	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DLL4	39009607	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.208000	0.95075	2.556000	0.86216	0.655000	0.94253	.		0.652	DLL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418859.1			Intron
EP400	57634	broad.mit.edu	37	12	132445443	132445443	+	Silent	SNP	A	A	C	rs562622346		TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr12:132445443A>C	ENST00000333577.4	+	2	388	c.279A>C	c.(277-279)ccA>ccC	p.P93P	EP400_ENST00000330386.6_Silent_p.P93P|EP400_ENST00000332482.4_Silent_p.P93P|EP400_ENST00000389561.2_Silent_p.P93P|EP400_ENST00000389562.2_Silent_p.P93P			Q96L91	EP400_HUMAN	E1A binding protein p400	93					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		CACTGGCCCCACTGCCGCTCC	0.622																																																	0													47.0	47.0	47.0					12																	132445443		2203	4300	6503	SO:0001819	synonymous_variant	57634			U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.279A>C	12.37:g.132445443A>C		Somatic		WXS	Illumina GAIIx	Phase_I	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37																																																																																					0.622	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			NM_015409	
FLJ36000	284124	broad.mit.edu	37	17	21904204	21904204	+	lincRNA	SNP	G	G	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr17:21904204G>T	ENST00000581223.2	+	0	0					NR_027084.1																						ctgccaggacggtgttcgggt	0.677																																																	0																																												284124																															17.37:g.21904204G>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000581223.2	37																																																																																					0.677	RP11-744K17.9-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000451067.1			
GOLGA6A	342096	broad.mit.edu	37	15	74365099	74365099	+	Silent	SNP	C	C	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr15:74365099C>A	ENST00000290438.3	-	13	1525	c.1485G>T	c.(1483-1485)gtG>gtT	p.V495V	RN7SL429P_ENST00000479090.2_RNA	NM_001038640.2	NP_001033729.2	Q9NYA3	GOG6A_HUMAN	golgin A6 family, member A	495						Golgi apparatus (GO:0005794)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|liver(1)|lung(6)|prostate(1)|urinary_tract(1)	16						CAGGGAGAGCCACGAGGCTTA	0.582																																																	0													39.0	51.0	47.0					15																	74365099		2153	4293	6446	SO:0001819	synonymous_variant	342096			AF263742	CCDS32290.1	15q24.1	2013-05-10	2010-02-12	2009-09-28	ENSG00000159289	ENSG00000159289			13567	protein-coding gene	gene with protein product		610288	"""golgi autoantigen, golgin subfamily a, member 6"", ""golgi autoantigen, golgin subfamily a, 6"", ""golgi autoantigen, golgin subfamily a, 6A"""	GOLGA6		11161787	Standard	NM_001038640		Approved	GLP	uc002axa.1	Q9NYA3	OTTHUMG00000173035	ENST00000290438.3:c.1485G>T	15.37:g.74365099C>A		Somatic		WXS	Illumina GAIIx	Phase_I	A8K959|Q9NYA7	Silent	SNP	ENST00000290438.3	37	CCDS32290.1																																																																																				0.582	GOLGA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421835.1		XM_292357	
ZCCHC3	85364	broad.mit.edu	37	20	278688	278690	+	In_Frame_Del	DEL	CGG	CGG	-	rs11468351|rs5839847|rs6147263	byFrequency	TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	CGG	CGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr20:278688_278690delCGG	ENST00000382352.3	+	1	952_954	c.461_463delCGG	c.(460-465)ccggcg>ccg	p.A159del		NM_033089.6	NP_149080	Q9NUD5	ZCHC3_HUMAN	zinc finger, CCHC domain containing 3	159	Poly-Ala.						poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.A159delA(3)		endometrium(2)|large_intestine(1)|lung(3)|prostate(2)	8		all_cancers(10;0.000209)|Lung NSC(37;0.0417)|all_lung(30;0.0713)|all_epithelial(17;0.0748)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			CAGGATGAgccggcggcggcggc	0.768														4335	0.865615	0.8343	0.9395	5008	,	,		8937	0.8065		0.9423	False		,,,				2504	0.8374																3	Deletion - In frame(3)	prostate(2)|large_intestine(1)																																								SO:0001651	inframe_deletion	85364			AL034548	CCDS42844.1	20p13-p12.2	2014-04-10	2004-07-14	2004-07-14	ENSG00000177764	ENSG00000247315		"""Zinc fingers, CCHC domain containing"""	16230	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 99"""	C20orf99			Standard	NM_033089		Approved	dJ1103G7.7	uc002wdf.3	Q9NUD5	OTTHUMG00000188280	ENST00000382352.3:c.461_463delCGG	20.37:g.278697_278699delCGG	ENSP00000371789:p.Ala159del	Somatic		WXS	Illumina GAIIx	Phase_I	Q3B7J3|Q6NT79	In_Frame_Del	DEL	ENST00000382352.3	37	CCDS42844.1																																																																																				0.768	ZCCHC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077447.1			
ZNF800	168850	broad.mit.edu	37	7	127014261	127014261	+	Missense_Mutation	SNP	G	G	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	PGM	.		Illumina GAIIx	21c50574-7496-4be5-b723-1fdb980fb208	2c1405f2-a53e-43b2-843e-eebbfe8074fe	g.chr7:127014261G>A	ENST00000393313.1	-	5	1720	c.1129C>T	c.(1129-1131)Cat>Tat	p.H377Y	ZNF800_ENST00000485577.1_5'Flank|ZNF800_ENST00000265827.3_Missense_Mutation_p.H377Y|ZNF800_ENST00000393312.1_Missense_Mutation_p.H377Y			Q2TB10	ZN800_HUMAN	zinc finger protein 800	377					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(8)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	32						ATTTGCATATGTCTTTTAAGC	0.328																																						.											0													93.0	99.0	97.0					7																	127014261		2203	4299	6502	SO:0001583	missense	168850			AF218032	CCDS5795.1	7q31.33	2008-05-02			ENSG00000048405	ENSG00000048405		"""Zinc fingers, C2H2-type"""	27267	protein-coding gene	gene with protein product						12477932	Standard	NM_176814		Approved		uc003vly.1	Q2TB10	OTTHUMG00000023456	ENST00000393313.1:c.1129C>T	7.37:g.127014261G>A	ENSP00000376989:p.His377Tyr	Somatic		WXS	Illumina GAIIx	Phase_I	Q9HBN0	Missense_Mutation	SNP	ENST00000393313.1	37	CCDS5795.1	.	.	.	.	.	.	.	.	.	.	G	15.76	2.928241	0.52759	.	.	ENSG00000048405	ENST00000393313;ENST00000265827;ENST00000393312	T;T;T	0.59772	0.24;0.24;0.24	5.68	5.68	0.88126	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	T	0.63885	0.2549	N	0.19112	0.55	0.36534	D	0.870870	D;D	0.69078	0.997;0.997	D;D	0.79108	0.992;0.992	T	0.61337	-0.7083	8	.	.	.	-25.5389	18.7799	0.91928	0.0:0.0:1.0:0.0	.	280;377	B7Z4V7;Q2TB10	.;ZN800_HUMAN	Y	377	ENSP00000376989:H377Y;ENSP00000265827:H377Y;ENSP00000376988:H377Y	.	H	-	1	0	ZNF800	126801497	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.699000	0.91316	2.685000	0.91497	0.650000	0.86243	CAT		0.328	ZNF800-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141823.1		NM_176814	
