#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CHD5	26038	ucsc.edu	37	1	6211114	6211114	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr1:6211114C>A	ENST00000262450.3	-	7	1071	c.972G>T	c.(970-972)aaG>aaT	p.K324N	CHD5_ENST00000378021.1_5'UTR	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		TGCGCCTCCTCTTGCTCTTCT	0.592																																					p.K324N													.	CHD5-719	0			c.G972T						.						99.0	92.0	94.0					1																	6211114		2203	4300	6503	SO:0001583	missense	26038	exon7			CCTCCTCTTGCTC	AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.972G>T	1.37:g.6211114C>A	ENSP00000262450:p.Lys324Asn	Somatic	64	0		WXS	Illumina HiSeq		40	4	NM_015557	0	0	0	0	0	A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	ENST00000262450.3	37	CCDS57.1	.	.	.	.	.	.	.	.	.	.	c	12.21	1.870305	0.33069	.	.	ENSG00000116254	ENST00000262450	D	0.85411	-1.98	4.0	4.0	0.46444	Zinc finger, FYVE/PHD-type (1);	0.378995	0.23849	U	0.043961	T	0.76133	0.3945	L	0.41824	1.3	0.80722	D	1	B	0.33694	0.421	B	0.29862	0.108	T	0.73310	-0.4023	10	0.29301	T	0.29	-23.3491	9.9406	0.41578	0.0:0.9028:0.0:0.0972	.	324	Q8TDI0	CHD5_HUMAN	N	324	ENSP00000262450:K324N	ENSP00000262450:K324N	K	-	3	2	CHD5	6133701	1.000000	0.71417	0.997000	0.53966	0.942000	0.58702	1.776000	0.38594	1.974000	0.57490	0.457000	0.33378	AAG	.		0.592	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002823.2	NM_015557	
CLCA2	9635	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	86890015	86890015	+	Silent	SNP	C	C	T			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr1:86890015C>T	ENST00000370565.4	+	1	247	c.85C>T	c.(85-87)Ctg>Ttg	p.L29L		NM_006536.5	NP_006527.1	Q9UQC9	CLCA2_HUMAN	chloride channel accessory 2	29					cell adhesion (GO:0007155)|transport (GO:0006810)	cell junction (GO:0030054)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)|ligand-gated ion channel activity (GO:0015276)			NS(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	42		Lung NSC(277;0.238)		all cancers(265;0.0233)|Epithelial(280;0.0452)		ACTCCCATTCCTGGGAGCTGG	0.443																																					p.L29L	Melanoma(157;1000 1898 5363 5664 48018)|Ovarian(88;135 1366 2838 28875 34642)	.											.	CLCA2-155	0			c.C85T						.						113.0	103.0	106.0					1																	86890015		2203	4300	6503	SO:0001819	synonymous_variant	9635	exon1			CCATTCCTGGGAG		CCDS708.1	1p22.3	2012-02-26	2009-01-29		ENSG00000137975	ENSG00000137975			2016	protein-coding gene	gene with protein product		604003	"""chloride channel, calcium activated, family member 2"", ""chloride channel regulator 2"""				Standard	NM_006536		Approved	CLCRG2	uc001dlr.4	Q9UQC9	OTTHUMG00000010256	ENST00000370565.4:c.85C>T	1.37:g.86890015C>T		Somatic	47	0		WXS	Illumina HiSeq	Phase_I	55	35	NM_006536	0	0	0	0	0	A8K2T3|Q9Y6N2	Silent	SNP	ENST00000370565.4	37	CCDS708.1																																																																																			.		0.443	CLCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028284.1	NM_006536	
ADAR	103	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	154574741	154574741	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr1:154574741A>G	ENST00000368474.4	-	2	576	c.377T>C	c.(376-378)cTt>cCt	p.L126P	ADAR_ENST00000292205.5_Missense_Mutation_p.L169P|ADAR_ENST00000471068.1_5'UTR|ADAR_ENST00000368471.3_5'UTR	NM_001111.4|NM_015840.3|NM_015841.3	NP_001102|NP_056655.2|NP_056656.2	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific	126					adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|miRNA loading onto RISC involved in gene silencing by miRNA (GO:0035280)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of viral genome replication (GO:0045071)|positive regulation of viral genome replication (GO:0045070)|pre-miRNA processing (GO:0031054)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(4)|prostate(2)|skin(2)	51	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		ATGTGAGGAAAGGCAATCAAC	0.537																																					p.L126P		.											.	ADAR-157	0			c.T377C						.						63.0	65.0	64.0					1																	154574741		2203	4300	6503	SO:0001583	missense	103	exon2			GAGGAAAGGCAAT	BC038227	CCDS1071.1, CCDS30879.1	1q21.3	2012-03-22			ENSG00000160710	ENSG00000160710	3.5.4.-		225	protein-coding gene	gene with protein product		146920	"""interferon-induced protein 4"""	IFI4, G1P1		7972084	Standard	NM_001111		Approved	ADAR1	uc001ffh.3	P55265	OTTHUMG00000037261	ENST00000368474.4:c.377T>C	1.37:g.154574741A>G	ENSP00000357459:p.Leu126Pro	Somatic	94	0		WXS	Illumina HiSeq	Phase_I	41	24	NM_001111	0	0	5	24	19	B1AQQ9|B1AQR0|D3DV76|O15223|O43859|O43860|Q9BYM3|Q9BYM4	Missense_Mutation	SNP	ENST00000368474.4	37	CCDS1071.1	.	.	.	.	.	.	.	.	.	.	A	14.52	2.559114	0.45590	.	.	ENSG00000160710	ENST00000292205;ENST00000368474;ENST00000529168	T;T;T	0.79749	-1.3;-1.3;-1.3	4.47	4.47	0.54385	.	0.972834	0.08506	N	0.935700	D	0.86167	0.5868	M	0.63843	1.955	0.54753	D	0.999983	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.85130	0.991;0.991;0.997	T	0.82985	-0.0185	10	0.87932	D	0	-16.02	13.8697	0.63610	1.0:0.0:0.0:0.0	.	126;126;126	P55265-3;P55265-2;P55265	.;.;DSRAD_HUMAN	P	169;126;121	ENSP00000292205:L169P;ENSP00000357459:L126P;ENSP00000431794:L121P	ENSP00000292205:L169P	L	-	2	0	ADAR	152841365	0.992000	0.36948	0.866000	0.34008	0.393000	0.30537	5.187000	0.65087	1.992000	0.58205	0.402000	0.26972	CTT	.		0.537	ADAR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090691.2	NM_001111	
THNSL1	79896	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	25312238	25312238	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr10:25312238C>T	ENST00000524413.1	+	3	433	c.86C>T	c.(85-87)gCa>gTa	p.A29V	THNSL1_ENST00000376356.4_Missense_Mutation_p.A29V			Q8IYQ7	THNS1_HUMAN	threonine synthase-like 1 (S. cerevisiae)	29						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(5)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	28					L-Threonine(DB00156)	GATAAACATGCACAGCGATTT	0.363																																					p.A29V		.											.	THNSL1-91	0			c.C86T						.						97.0	99.0	98.0					10																	25312238		2203	4300	6503	SO:0001583	missense	79896	exon3			AACATGCACAGCG	AK025655	CCDS7147.1	10p12.31	2008-02-05	2007-06-20		ENSG00000185875	ENSG00000185875			26160	protein-coding gene	gene with protein product		611260	"""threonine synthase-like 1 (bacterial)"""			12477932	Standard	NM_024838		Approved	FLJ22002	uc001isi.4	Q8IYQ7	OTTHUMG00000017828	ENST00000524413.1:c.86C>T	10.37:g.25312238C>T	ENSP00000434887:p.Ala29Val	Somatic	80	0		WXS	Illumina HiSeq	Phase_I	118	48	NM_024838	0	0	1	2	1	B3KWL1|D3DRV3|Q5VV21	Missense_Mutation	SNP	ENST00000524413.1	37	CCDS7147.1	.	.	.	.	.	.	.	.	.	.	C	1.381	-0.583490	0.03827	.	.	ENSG00000185875	ENST00000524413;ENST00000376356	T;T	0.07444	3.19;3.19	5.87	1.3	0.21679	.	1.328470	0.05152	N	0.496208	T	0.03263	0.0095	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.37596	-0.9699	10	0.02654	T	1	-32.9386	0.8315	0.01132	0.1692:0.23:0.1664:0.4344	.	29	Q8IYQ7	THNS1_HUMAN	V	29	ENSP00000434887:A29V;ENSP00000365534:A29V	ENSP00000365534:A29V	A	+	2	0	THNSL1	25352244	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.012000	0.13287	-0.006000	0.14370	0.557000	0.71058	GCA	.		0.363	THNSL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394913.1	NM_024838	
OR4A5	81318	hgsc.bcm.edu	37	11	51411515	51411515	+	Missense_Mutation	SNP	G	G	A	rs370100509		TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr11:51411515G>A	ENST00000319760.6	-	1	933	c.881C>T	c.(880-882)gCt>gTt	p.A294V		NM_001005272.3	NP_001005272.3	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A, member 5	294						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(28)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	49		all_lung(304;0.236)				TTTTTCTATAGCATTTCTCAT	0.358													.|||	1	0.000199681	0.0008	0.0	5008	,	,		18032	0.0		0.0	False		,,,				2504	0.0				p.A294V		.											.	OR4A5-92	0			c.C881T						.	G	VAL/ALA	1,4395		0,1,2197	27.0	29.0	28.0		881	1.2	0.0	11		28	0,8588		0,0,4294	no	missense	OR4A5	NM_001005272.3	64	0,1,6491	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	294/316	51411515	1,12983	2198	4294	6492	SO:0001583	missense	81318	exon1			TCTATAGCATTTC	AB065506	CCDS73289.1	11p11.12	2012-08-09			ENSG00000221840	ENSG00000221840		"""GPCR / Class A : Olfactory receptors"""	15162	protein-coding gene	gene with protein product							Standard	NM_001005272		Approved		uc001nhi.2	Q8NH83	OTTHUMG00000166764	ENST00000319760.6:c.881C>T	11.37:g.51411515G>A	ENSP00000367664:p.Ala294Val	Somatic	5	1		WXS	Illumina HiSeq	Phase_I	38	16	NM_001005272	0	0	0	0	0	Q6IF84	Missense_Mutation	SNP	ENST00000319760.6	37	CCDS31497.1	.	.	.	.	.	.	.	.	.	.	.	8.667	0.901998	0.17760	2.27E-4	0.0	ENSG00000221840	ENST00000319760	T	0.44881	0.91	2.2	1.19	0.21007	.	0.000000	0.47093	D	0.000248	T	0.43233	0.1238	L	0.58583	1.82	0.09310	N	1	D	0.54397	0.966	P	0.49597	0.616	T	0.32268	-0.9913	10	0.62326	D	0.03	.	8.3068	0.32047	0.0:0.2632:0.7367:0.0	.	294	Q8NH83	OR4A5_HUMAN	V	294	ENSP00000367664:A294V	ENSP00000367664:A294V	A	-	2	0	OR4A5	51268091	0.001000	0.12720	0.032000	0.17829	0.332000	0.28634	0.866000	0.27954	0.438000	0.26450	0.162000	0.16502	GCT	.		0.358	OR4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391399.1	NM_001005272	
MYO7A	4647	broad.mit.edu	37	11	76888670	76888670	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr11:76888670A>T	ENST00000409709.3	+	19	2535	c.2263A>T	c.(2263-2265)Atc>Ttc	p.I755F	MYO7A_ENST00000458637.2_Missense_Mutation_p.I755F|MYO7A_ENST00000409893.1_Missense_Mutation_p.I755F|MYO7A_ENST00000409619.2_Missense_Mutation_p.I744F	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	755	IQ 1. {ECO:0000255|PROSITE- ProRule:PRU00116}.				actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						TCAGAAAGTCATCCGGGGATT	0.582																																					p.I755F													.	MYO7A-138	0			c.A2263T						.						89.0	95.0	93.0					11																	76888670		2112	4222	6334	SO:0001583	missense	4647	exon19			AAAGTCATCCGGG	U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.2263A>T	11.37:g.76888670A>T	ENSP00000386331:p.Ile755Phe	Somatic	30	0		WXS	Illumina HiSeq	Phase_I	11	3	NM_001127179	0	0	1	2	1	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Missense_Mutation	SNP	ENST00000409709.3	37	CCDS53683.1	.	.	.	.	.	.	.	.	.	.	A	17.00	3.277306	0.59758	.	.	ENSG00000137474	ENST00000409709;ENST00000409893;ENST00000458637;ENST00000409619;ENST00000358342;ENST00000343356;ENST00000341717;ENST00000343419	T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56	5.03	5.03	0.67393	.	0.072532	0.56097	D	0.000033	T	0.51109	0.1655	N	0.16656	0.425	0.49915	D	0.999833	B;B;B	0.31485	0.012;0.002;0.325	B;B;B	0.34301	0.025;0.014;0.179	T	0.49890	-0.8891	10	0.30078	T	0.28	.	5.4705	0.16668	0.7727:0.0:0.2273:0.0	.	755;755;755	B9A012;F8VUN5;Q13402	.;.;MYO7A_HUMAN	F	755;755;755;744;754;754;631;754	ENSP00000386331:I755F;ENSP00000386689:I755F;ENSP00000392185:I755F;ENSP00000386635:I744F	ENSP00000345075:I631F	I	+	1	0	MYO7A	76566318	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.048000	0.64238	1.910000	0.55303	0.443000	0.29094	ATC	.		0.582	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328133.1	NM_000260	
CCDC84	338657	broad.mit.edu;ucsc.edu	37	11	118869166	118869166	+	Silent	SNP	C	C	T			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr11:118869166C>T	ENST00000334418.1	+	2	203	c.147C>T	c.(145-147)cgC>cgT	p.R49R	RP11-110I1.12_ENST00000526453.1_lincRNA	NM_198489.1	NP_940891.1	Q86UT8	CCD84_HUMAN	coiled-coil domain containing 84	49										breast(1)|kidney(1)|large_intestine(1)|liver(1)|ovary(1)	5	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_neural(223;0.224)|all_hematologic(192;0.243)		BRCA - Breast invasive adenocarcinoma(274;7.72e-05)		AGGCCATCCGCGCCGCTCAGG	0.662																																					p.R49R													.	CCDC84-91	0			c.C147T						.						22.0	23.0	23.0					11																	118869166		2199	4295	6494	SO:0001819	synonymous_variant	338657	exon2			CATCCGCGCCGCT	AB094093	CCDS8405.1	11q23.3	2006-03-13			ENSG00000186166	ENSG00000186166			30460	protein-coding gene	gene with protein product							Standard	NM_198489		Approved	DLNB14	uc001pul.3	Q86UT8	OTTHUMG00000166348	ENST00000334418.1:c.147C>T	11.37:g.118869166C>T		Somatic	30	0		WXS	Illumina HiSeq	Phase_I	22	5	NM_198489	0	0	2	7	5		Silent	SNP	ENST00000334418.1	37	CCDS8405.1																																																																																			.		0.662	CCDC84-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389315.1	NM_198489	
TULP3	7289	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	3048537	3048537	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr12:3048537A>C	ENST00000448120.2	+	11	1307	c.1256A>C	c.(1255-1257)aAc>aCc	p.N419T	TULP3_ENST00000397132.2_Missense_Mutation_p.N419T	NM_003324.4	NP_003315.2	O75386	TULP3_HUMAN	tubby like protein 3	419					anterior/posterior pattern specification (GO:0009952)|bone development (GO:0060348)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|central nervous system neuron differentiation (GO:0021953)|embryonic camera-type eye development (GO:0031076)|embryonic digit morphogenesis (GO:0042733)|embryonic neurocranium morphogenesis (GO:0048702)|G-protein coupled receptor signaling pathway (GO:0007186)|ganglion development (GO:0061548)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of transcription, DNA-templated (GO:0006355)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cilium (GO:0005929)|extracellular region (GO:0005576)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	enzyme binding (GO:0019899)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein complex binding (GO:0032403)			endometrium(1)|large_intestine(4)|lung(13)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			CTGGATTACAACTACCCACTT	0.443																																					p.N419T		.											.	TULP3-226	0			c.A1256C						.						313.0	257.0	276.0					12																	3048537		2203	4300	6503	SO:0001583	missense	7289	exon11			ATTACAACTACCC	AF045583	CCDS8519.1, CCDS53737.1	12p13	2014-02-21			ENSG00000078246	ENSG00000078246		"""Intraflagellar transport homologs"""	12425	protein-coding gene	gene with protein product		604730				9828123	Standard	NM_003324		Approved	TUBL3	uc001qlj.2	O75386	OTTHUMG00000168152	ENST00000448120.2:c.1256A>C	12.37:g.3048537A>C	ENSP00000410051:p.Asn419Thr	Somatic	170	0		WXS	Illumina HiSeq	Phase_I	165	48	NM_003324	0	0	32	61	29	B3KNB7|B7Z6A2|D3DUQ4|F8WBZ9|Q8N5B0	Missense_Mutation	SNP	ENST00000448120.2	37	CCDS8519.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.02|12.02	1.811439|1.811439	0.32053|0.32053	.|.	.|.	ENSG00000078246|ENSG00000078246	ENST00000228245;ENST00000542730;ENST00000448120;ENST00000397132|ENST00000541678;ENST00000538704	D;D|.	0.85088|.	-1.94;-1.94|.	5.64|5.64	1.97|1.97	0.26223|0.26223	Tubby, C-terminal (3);|.	0.134805|.	0.64402|.	D|.	0.000003|.	T|T	0.52661|0.52661	0.1748|0.1748	L|L	0.42487|0.42487	1.325|1.325	0.47214|0.47214	D|D	0.999359|0.999359	B;B;B|.	0.34161|.	0.051;0.078;0.439|.	B;B;B|.	0.40982|.	0.14;0.345;0.332|.	T|T	0.36138|0.36138	-0.9760|-0.9760	9|5	.|.	.|.	.|.	1.337|1.337	8.4366|8.4366	0.32791|0.32791	0.7077:0.0:0.2923:0.0|0.7077:0.0:0.2923:0.0	.|.	243;419;419|.	B7Z1E7;O75386;F8WBZ9|.	.;TULP3_HUMAN;.|.	T|H	419;243;419;419|95;84	ENSP00000410051:N419T;ENSP00000380321:N419T|.	.|.	N|Q	+|+	2|3	0|2	TULP3|TULP3	2918798|2918798	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.640000|0.640000	0.38277|0.38277	1.203000|1.203000	0.32284|0.32284	0.089000|0.089000	0.17243|0.17243	-0.589000|-0.589000	0.04120|0.04120	AAC|CAA	.		0.443	TULP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000398468.1	NM_003324	
ACAD10	80724	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	112183962	112183962	+	Silent	SNP	T	T	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr12:112183962T>C	ENST00000313698.4	+	14	2285	c.2130T>C	c.(2128-2130)gcT>gcC	p.A710A	ACAD10_ENST00000392636.2_Silent_p.A312A|ACAD10_ENST00000413681.3_3'UTR|ACAD10_ENST00000455480.2_Silent_p.A741A	NM_025247.5	NP_079523.3	Q6JQN1	ACD10_HUMAN	acyl-CoA dehydrogenase family, member 10	710						mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|hydrolase activity (GO:0016787)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(17)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(5)	47						AAGCCAAAGCTGAAGGACTTT	0.433																																					p.A741A		.											.	ACAD10-92	0			c.T2223C						.						88.0	88.0	88.0					12																	112183962		2203	4300	6503	SO:0001819	synonymous_variant	80724	exon15			CAAAGCTGAAGGA	AY323912	CCDS31903.1, CCDS44973.1	12q24.12	2012-10-02	2010-04-30		ENSG00000111271	ENSG00000111271			21597	protein-coding gene	gene with protein product		611181	"""acyl-Coenzyme A dehydrogenase family, member 10"""			15560374	Standard	NM_025247		Approved	MGC5601	uc009zvx.3	Q6JQN1	OTTHUMG00000169602	ENST00000313698.4:c.2130T>C	12.37:g.112183962T>C		Somatic	132	0		WXS	Illumina HiSeq	Phase_I	101	34	NM_001136538	0	0	8	27	19	G3XAJ0|Q8N828|Q8NAP2|Q96BX5	Silent	SNP	ENST00000313698.4	37	CCDS31903.1																																																																																			.		0.433	ACAD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368307.1	NM_025247	
GAS6	2621	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	114523928	114523928	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr13:114523928T>C	ENST00000327773.6	-	15	2092	c.1946A>G	c.(1945-1947)aAc>aGc	p.N649S	GAS6_ENST00000355761.4_Missense_Mutation_p.N595S|GAS6_ENST00000450766.1_Missense_Mutation_p.N376S|GAS6_ENST00000357389.3_Missense_Mutation_p.N692S|GAS6-AS1_ENST00000458001.1_RNA|GAS6_ENST00000418959.3_Missense_Mutation_p.N350S	NM_000820.2	NP_000811.1	Q14393	GAS6_HUMAN	growth arrest-specific 6	692	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				activation of protein kinase B activity (GO:0032148)|apoptotic cell clearance (GO:0043277)|B cell chemotaxis (GO:0035754)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-substrate adhesion (GO:0031589)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|cellular response to growth factor stimulus (GO:0071363)|cellular response to interferon-alpha (GO:0035457)|cellular response to starvation (GO:0009267)|cellular response to vitamin K (GO:0071307)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|extracellular matrix assembly (GO:0085029)|fusion of virus membrane with host plasma membrane (GO:0019064)|hematopoietic stem cell migration to bone marrow (GO:0097241)|leukocyte migration (GO:0050900)|macrophage cytokine production (GO:0010934)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biomineral tissue development (GO:0070168)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-6 secretion (GO:1900165)|negative regulation of oligodendrocyte apoptotic process (GO:1900142)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of renal albumin absorption (GO:2000533)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|peptidyl-glutamic acid carboxylation (GO:0017187)|peptidyl-serine phosphorylation (GO:0018105)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of gene expression (GO:0010628)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phagocytosis (GO:0050766)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of TOR signaling (GO:0032008)|post-translational protein modification (GO:0043687)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|protein targeting to plasma membrane (GO:0072661)|proteolysis (GO:0006508)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|viral entry into host cell (GO:0046718)|viral genome replication (GO:0019079)	cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|platelet alpha granule lumen (GO:0031093)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|phosphatidylserine binding (GO:0001786)|protein tyrosine kinase activator activity (GO:0030296)|receptor agonist activity (GO:0048018)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|voltage-gated calcium channel activity (GO:0005245)			central_nervous_system(4)|ovary(1)	5	Lung NSC(43;0.00976)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0176)|all_epithelial(44;0.0104)|all_lung(25;0.0249)|Lung NSC(25;0.0908)|Breast(118;0.188)				CAGCCTCCGGTTGACCTCCAG	0.662																																					p.N649S		.											.	GAS6-650	0			c.A1946G						.						51.0	45.0	47.0					13																	114523928		2202	4299	6501	SO:0001583	missense	2621	exon15			CTCCGGTTGACCT		CCDS45072.1	13q34	2008-07-18			ENSG00000183087	ENSG00000183087			4168	protein-coding gene	gene with protein product	"""AXL stimulatory factor"""	600441		AXLLG		8336730	Standard	NM_000820		Approved	AXSF, FLJ34709, DKFZp666G247	uc001vud.3	Q14393	OTTHUMG00000017395	ENST00000327773.6:c.1946A>G	13.37:g.114523928T>C	ENSP00000331831:p.Asn649Ser	Somatic	69	0		WXS	Illumina HiSeq	Phase_I	52	23	NM_000820	0	0	22	39	17	B3KRQ7|B3KVL4|E9PBL7|Q6IMN1|Q7Z7N3	Missense_Mutation	SNP	ENST00000327773.6	37	CCDS45072.1	.	.	.	.	.	.	.	.	.	.	T	12.32	1.901729	0.33535	.	.	ENSG00000183087	ENST00000357389;ENST00000355761;ENST00000450766;ENST00000418959;ENST00000327773	D;D;D;D;D	0.83075	-1.68;-1.68;-1.68;-1.68;-1.68	4.72	3.54	0.40534	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	T	0.79924	0.4530	M	0.83223	2.63	0.44547	D	0.997504	P;B;B	0.41214	0.742;0.015;0.1	B;B;B	0.32864	0.154;0.026;0.01	T	0.78204	-0.2295	9	0.62326	D	0.03	-27.6441	8.071	0.30689	0.0:0.1832:0.0:0.8168	.	692;376;649	Q14393;B3KVL4;Q14393-2	GAS6_HUMAN;.;.	S	692;595;376;350;649	ENSP00000349962:N692S;ENSP00000348003:N595S;ENSP00000416498:N376S;ENSP00000400117:N350S;ENSP00000331831:N649S	ENSP00000331831:N649S	N	-	2	0	GAS6	113590015	0.993000	0.37304	0.858000	0.33744	0.120000	0.20174	2.505000	0.45424	0.664000	0.31047	0.379000	0.24179	AAC	.		0.662	GAS6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000045946.2	NM_000820	
RBM23	55147	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	23374814	23374814	+	Splice_Site	SNP	C	C	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr14:23374814C>G	ENST00000359890.3	-	6	651		c.e6+1		RBM23_ENST00000555209.1_Intron|RBM23_ENST00000542016.2_Splice_Site|RBM23_ENST00000346528.5_Intron|RBM23_ENST00000556984.1_5'Flank|RBM23_ENST00000399922.2_Splice_Site	NM_001077351.1	NP_001070819.1	Q86U06	RBM23_HUMAN	RNA binding motif protein 23						mRNA processing (GO:0006397)	membrane (GO:0016020)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(3)|kidney(2)|lung(3)|prostate(1)|skin(1)	10	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.0128)		TATCAACCCACCTGACTGGGC	0.378																																					.		.											.	RBM23-91	0			c.407+1G>C						.						90.0	80.0	83.0					14																	23374814		1844	4103	5947	SO:0001630	splice_region_variant	55147	exon6			AACCCACCTGACT	AF275678	CCDS41919.1, CCDS41920.1, CCDS41921.1	14q11.1	2014-07-03	2004-04-23	2004-04-23		ENSG00000100461		"""RNA binding motif (RRM) containing"""	20155	protein-coding gene	gene with protein product	"""coactivator of activating protein-1 and estrogen recep- tors beta"""		"""RNA-binding region (RNP1, RRM) containing 4"""	RNPC4		15694343	Standard	NM_018107		Approved	FLJ10482, CAPERbeta	uc001whg.3	Q86U06		ENST00000359890.3:c.455+1G>C	14.37:g.23374814C>G		Somatic	99	0		WXS	Illumina HiSeq	Phase_I	40	26	NM_018107	0	0	0	2	2	D3DS32|Q8ND16|Q8TB88|Q8WY40|Q9BUJ1|Q9NVV7	Splice_Site	SNP	ENST00000359890.3	37	CCDS41921.1	.	.	.	.	.	.	.	.	.	.	C	16.23	3.065110	0.55432	.	.	ENSG00000100461	ENST00000359890;ENST00000338980;ENST00000399922	.	.	.	4.88	3.99	0.46301	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.2615	0.54652	0.0:0.9161:0.0:0.0839	.	.	.	.	.	-1	.	.	.	-	.	.	RBM23	22444654	1.000000	0.71417	0.998000	0.56505	0.851000	0.48451	3.163000	0.50763	1.422000	0.47177	0.655000	0.94253	.	.		0.378	RBM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000413545.3		Intron
MYEF2	50804	ucsc.edu	37	15	48446066	48446066	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr15:48446066C>T	ENST00000324324.7	-	10	1289	c.1010G>A	c.(1009-1011)gGa>gAa	p.G337E	MYEF2_ENST00000267836.6_Missense_Mutation_p.G337E	NM_016132.3	NP_057216	Q9P2K5	MYEF2_HUMAN	myelin expression factor 2	337	Gly-rich.				myotube differentiation (GO:0014902)|neuron differentiation (GO:0030182)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31		all_lung(180;0.00217)		all cancers(107;3.73e-10)|GBM - Glioblastoma multiforme(94;7.81e-07)		CGGACCAAGTCCCATCCCAAT	0.388																																					p.G337E													.	MYEF2-523	0			c.G1010A						.						71.0	66.0	67.0					15																	48446066		2198	4297	6495	SO:0001583	missense	50804	exon10			CCAAGTCCCATCC	AB037762	CCDS32230.1, CCDS73722.1	15q15.1	2013-07-16				ENSG00000104177		"""RNA binding motif (RRM) containing"""	17940	protein-coding gene	gene with protein product						10718198, 2601707	Standard	XM_005254422		Approved	MEF-2, FLJ11213, KIAA1341, HsT18564	uc001zwi.4	Q9P2K5		ENST00000324324.7:c.1010G>A	15.37:g.48446066C>T	ENSP00000316950:p.Gly337Glu	Somatic	20	0		WXS	Illumina HiSeq		35	4	NM_016132	0	0	11	11	0	A7MCZ9|C9J921|C9K0J4|Q6NUM5|Q7L388|Q7Z4B7|Q9H922|Q9NUQ1	Missense_Mutation	SNP	ENST00000324324.7	37	CCDS32230.1	.	.	.	.	.	.	.	.	.	.	C	33	5.289700	0.95546	.	.	ENSG00000104177	ENST00000324324;ENST00000267836	T;T	0.28895	2.15;1.59	5.97	5.97	0.96955	.	0.093530	0.64402	D	0.000001	T	0.57975	0.2090	M	0.67700	2.07	0.80722	D	1	D;D	0.89917	1.0;0.998	D;P	0.97110	1.0;0.881	T	0.56866	-0.7908	10	0.87932	D	0	-11.7251	20.4324	0.99085	0.0:1.0:0.0:0.0	.	337;337	Q9P2K5-2;Q9P2K5	.;MYEF2_HUMAN	E	337	ENSP00000316950:G337E;ENSP00000267836:G337E	ENSP00000267836:G337E	G	-	2	0	MYEF2	46233358	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.395000	0.79876	2.833000	0.97629	0.585000	0.79938	GGA	.		0.388	MYEF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000416909.2	NM_016132	
SMG1	23049	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	18840922	18840922	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr16:18840922G>T	ENST00000446231.2	-	54	9701	c.9289C>A	c.(9289-9291)Cta>Ata	p.L3097I	SMG1_ENST00000389467.3_Missense_Mutation_p.L3097I			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	3097					DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						TGGTTGGGTAGCCCTATCAAG	0.468																																					p.L3097I		.											.	SMG1-1160	0			c.C9289A						.						58.0	57.0	57.0					16																	18840922		1905	4128	6033	SO:0001583	missense	23049	exon54			TGGGTAGCCCTAT	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.9289C>A	16.37:g.18840922G>T	ENSP00000402515:p.Leu3097Ile	Somatic	38	0		WXS	Illumina HiSeq	Phase_I	70	40	NM_015092	0	0	11	32	21	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	ENST00000446231.2	37	CCDS45430.1	.	.	.	.	.	.	.	.	.	.	G	14.36	2.510741	0.44660	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.01005	5.45;5.45	6.07	5.11	0.69529	.	0.000000	0.53938	D	0.000041	T	0.00875	0.0029	N	0.12182	0.205	0.41248	D	0.986699	B	0.13145	0.007	B	0.15484	0.013	T	0.67565	-0.5638	10	0.20519	T	0.43	.	16.7418	0.85461	0.0:0.0:0.8697:0.1303	.	3097	Q96Q15	SMG1_HUMAN	I	3097	ENSP00000402515:L3097I;ENSP00000374118:L3097I	ENSP00000374118:L3097I	L	-	1	2	SMG1	18748423	1.000000	0.71417	0.831000	0.32960	0.967000	0.64934	6.417000	0.73337	1.558000	0.49541	0.585000	0.79938	CTA	.		0.468	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	NM_015092	
CMTR2	55783	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	71317552	71317552	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr16:71317552C>T	ENST00000338099.5	-	3	2608	c.2272G>A	c.(2272-2274)Gag>Aag	p.E758K	CMTR2_ENST00000434935.2_Missense_Mutation_p.E758K			Q8IYT2	CMTR2_HUMAN	cap methyltransferase 2	758					7-methylguanosine mRNA capping (GO:0006370)|cap2 mRNA methylation (GO:0097310)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	mRNA (nucleoside-2'-O-)-methyltransferase activity (GO:0004483)										TCTTCTCTCTCTCTTTGAATA	0.373																																					p.E758K		.											.	FTSJD1-91	0			c.G2272A						.						38.0	42.0	41.0					16																	71317552		2198	4300	6498	SO:0001583	missense	55783	exon3			CTCTCTCTCTTTG	BC035005	CCDS10898.1	16q22.2	2013-07-23	2013-07-23	2013-07-23	ENSG00000180917	ENSG00000180917			25635	protein-coding gene	gene with protein product	"""adrift homolog (Drosophila)"""		"""FtsJ methyltransferase domain containing 1"""	FTSJD1		21310715	Standard	NM_018348		Approved	FLJ11171, AFT, MTr2	uc010cga.3	Q8IYT2	OTTHUMG00000137587	ENST00000338099.5:c.2272G>A	16.37:g.71317552C>T	ENSP00000337512:p.Glu758Lys	Somatic	31	0		WXS	Illumina HiSeq	Phase_I	67	17	NM_018348	0	0	16	23	7	B2RCD5|D3DWS1|Q8NE77|Q8NFR5|Q9H8Z4|Q9NUS3|Q9NXF5	Missense_Mutation	SNP	ENST00000338099.5	37	CCDS10898.1	.	.	.	.	.	.	.	.	.	.	C	14.34	2.507361	0.44558	.	.	ENSG00000180917	ENST00000338099;ENST00000434935	T;T	0.15603	2.41;2.41	5.8	4.8	0.61643	.	0.225081	0.35677	N	0.003053	T	0.09555	0.0235	N	0.17082	0.46	0.32079	N	0.593443	B	0.21071	0.051	B	0.17979	0.02	T	0.07214	-1.0784	10	0.27785	T	0.31	-35.113	7.8477	0.29435	0.0:0.6486:0.2684:0.083	.	758	Q8IYT2	FTSJ1_HUMAN	K	758	ENSP00000337512:E758K;ENSP00000411148:E758K	ENSP00000337512:E758K	E	-	1	0	FTSJD1	69875053	0.991000	0.36638	1.000000	0.80357	0.802000	0.45316	1.495000	0.35627	2.741000	0.93983	0.585000	0.79938	GAG	.		0.373	CMTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268984.2	NM_018348	
PLCG2	5336	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	81990321	81990321	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr16:81990321T>G	ENST00000359376.3	+	32	3806	c.3592T>G	c.(3592-3594)Tcc>Gcc	p.S1198A		NM_002661.3	NP_002652.2	P16885	PLCG2_HUMAN	phospholipase C, gamma 2 (phosphatidylinositol-specific)	1198					B cell differentiation (GO:0030183)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid catabolic process (GO:0009395)|platelet activation (GO:0030168)|release of sequestered calcium ion into cytosol (GO:0051209)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(18)|lung(21)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	58						GGAACTTTACTCCTCCTGTCG	0.527																																					p.S1198A		.											.	PLCG2-892	0			c.T3592G						.						59.0	61.0	61.0					16																	81990321		1979	4160	6139	SO:0001583	missense	5336	exon32			CTTTACTCCTCCT		CCDS42204.1	16q24.1	2014-09-17				ENSG00000197943	3.1.4.11	"""SH2 domain containing"""	9066	protein-coding gene	gene with protein product		600220				7835906	Standard	XR_248240		Approved		uc002fgt.3	P16885		ENST00000359376.3:c.3592T>G	16.37:g.81990321T>G	ENSP00000352336:p.Ser1198Ala	Somatic	67	0		WXS	Illumina HiSeq	Phase_I	77	28	NM_002661	0	0	6	6	0	D3DUL3|Q3ZTS2|Q59H45|Q969T5	Missense_Mutation	SNP	ENST00000359376.3	37	CCDS42204.1	.	.	.	.	.	.	.	.	.	.	T	9.506	1.104525	0.20632	.	.	ENSG00000197943	ENST00000359376	T	0.65732	-0.17	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.53658	0.1810	L	0.52573	1.65	0.45205	D	0.998216	B	0.16166	0.016	B	0.12156	0.007	T	0.50224	-0.8853	10	0.10111	T	0.7	.	13.9529	0.64129	0.0:0.0:0.0:1.0	.	1198	P16885	PLCG2_HUMAN	A	1198	ENSP00000352336:S1198A	ENSP00000352336:S1198A	S	+	1	0	PLCG2	80547822	0.988000	0.35896	0.980000	0.43619	0.866000	0.49608	2.961000	0.49168	2.106000	0.64143	0.454000	0.30748	TCC	.		0.527	PLCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432429.1		
ZNHIT3	9326	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	34849806	34849806	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr17:34849806A>G	ENST00000225410.4	+	4	307	c.242A>G	c.(241-243)gAt>gGt	p.D81G	ZNHIT3_ENST00000590858.1_Intron|RNA5SP439_ENST00000517103.1_RNA|ZNHIT3_ENST00000592616.1_Missense_Mutation_p.D81G|ZNHIT3_ENST00000588253.1_5'UTR|ZNHIT3_ENST00000490126.2_5'UTR	NM_004773.2	NP_004764.1	Q15649	ZNHI3_HUMAN	zinc finger, HIT-type containing 3	81					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			lung(1)|pancreas(1)|prostate(1)	3		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0188)		CTCAATAGTGATGAGGAAGAA	0.373																																					p.D81G	Pancreas(89;112 2361 26810)	.											.	ZNHIT3-90	0			c.A242G						.						152.0	148.0	149.0					17																	34849806		2203	4300	6503	SO:0001583	missense	9326	exon4			ATAGTGATGAGGA	L40410	CCDS11312.1, CCDS62156.1	17q21.1	2014-04-10	2010-09-15	2005-09-08	ENSG00000108278	ENSG00000273611		"""Zinc fingers, HIT-type"""	12309	protein-coding gene	gene with protein product		604500	"""thyroid hormone receptor interactor 3"", ""zinc finger, HIT type 3"""	TRIP3		7776974	Standard	NM_004773		Approved		uc002hms.1	Q15649	OTTHUMG00000188436	ENST00000225410.4:c.242A>G	17.37:g.34849806A>G	ENSP00000225410:p.Asp81Gly	Somatic	128	0		WXS	Illumina HiSeq	Phase_I	162	65	NM_004773	0	0	39	59	20	A8K493|K7EQP1|Q8WVJ3	Missense_Mutation	SNP	ENST00000225410.4	37	CCDS11312.1	.	.	.	.	.	.	.	.	.	.	A	11.65	1.700781	0.30142	.	.	ENSG00000108278	ENST00000225410	.	.	.	6.02	4.94	0.65067	.	0.084595	0.85682	D	0.000000	T	0.69584	0.3127	M	0.72353	2.195	0.80722	D	1	D	0.76494	0.999	D	0.64144	0.922	T	0.68387	-0.5422	9	0.37606	T	0.19	-14.422	9.5969	0.39580	0.8443:0.0:0.0:0.1557	.	81	Q15649	ZNHI3_HUMAN	G	81	.	ENSP00000225410:D81G	D	+	2	0	ZNHIT3	31923919	1.000000	0.71417	1.000000	0.80357	0.398000	0.30690	5.963000	0.70372	1.084000	0.41184	-0.327000	0.08410	GAT	.		0.373	ZNHIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256697.1	NM_004773	
DLX3	1747	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	48072053	48072053	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr17:48072053G>C	ENST00000434704.2	-	1	535	c.310C>G	c.(310-312)Cca>Gca	p.P104A	DLX3_ENST00000512495.2_5'Flank|RP11-1094H24.3_ENST00000511867.1_lincRNA	NM_005220.2	NP_005211.1	O60479	DLX3_HUMAN	distal-less homeobox 3	104					blood vessel development (GO:0001568)|odontoblast differentiation (GO:0071895)|odontogenesis of dentin-containing tooth (GO:0042475)|placenta development (GO:0001890)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	12						TCCTGGGCTGGCAGCGGCTGC	0.622																																					p.P104A		.											.	DLX3-90	0			c.C310G						.						22.0	28.0	26.0					17																	48072053		2195	4295	6490	SO:0001583	missense	1747	exon1			GGGCTGGCAGCGG		CCDS11556.1	17q21.33	2011-06-20	2005-12-22			ENSG00000064195		"""Homeoboxes / ANTP class : NKL subclass"""	2916	protein-coding gene	gene with protein product		600525	"""distal-less homeo box 3"""			7613049	Standard	NM_005220		Approved		uc002ipy.3	O60479		ENST00000434704.2:c.310C>G	17.37:g.48072053G>C	ENSP00000389870:p.Pro104Ala	Somatic	69	0		WXS	Illumina HiSeq	Phase_I	51	25	NM_005220	0	0	0	0	0	B3KQL6	Missense_Mutation	SNP	ENST00000434704.2	37	CCDS11556.1	.	.	.	.	.	.	.	.	.	.	G	13.39	2.222006	0.39300	.	.	ENSG00000064195	ENST00000434704	D	0.91945	-2.94	5.01	5.01	0.66863	Homeodomain-like (1);	0.078892	0.53938	D	0.000057	D	0.86029	0.5835	N	0.21240	0.645	0.80722	D	1	B	0.11235	0.004	B	0.24006	0.05	T	0.80538	-0.1338	10	0.24483	T	0.36	-29.5674	13.6755	0.62451	0.0:0.0:1.0:0.0	.	104	O60479	DLX3_HUMAN	A	104	ENSP00000389870:P104A	ENSP00000389870:P104A	P	-	1	0	DLX3	45427052	1.000000	0.71417	1.000000	0.80357	0.865000	0.49528	4.079000	0.57613	2.617000	0.88574	0.491000	0.48974	CCA	.		0.622	DLX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366307.1		
TBCD	6904	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	80885835	80885835	+	Silent	SNP	G	G	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr17:80885835G>C	ENST00000355528.4	+	30	2794	c.2664G>C	c.(2662-2664)cgG>cgC	p.R888R	TBCD_ENST00000539345.2_Silent_p.R888R	NM_005993.4	NP_005984.3	Q9BTW9	TBCD_HUMAN	tubulin folding cofactor D	888					'de novo' posttranslational protein folding (GO:0051084)|adherens junction assembly (GO:0034333)|cellular protein metabolic process (GO:0044267)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of microtubule polymerization (GO:0031115)|positive regulation of GTPase activity (GO:0043547)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|tight junction (GO:0005923)	beta-tubulin binding (GO:0048487)|chaperone binding (GO:0051087)|GTPase activator activity (GO:0005096)					Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			TGCTGGCTCGGAGCCAGCCTG	0.642																																					p.R888R		.											.	TBCD-22	0			c.G2664C						.						57.0	60.0	59.0					17																	80885835		2056	4211	6267	SO:0001819	synonymous_variant	6904	exon30			GGCTCGGAGCCAG	BC003094	CCDS45818.1	17q25.3	2006-11-21	2006-11-21			ENSG00000141556			11581	protein-coding gene	gene with protein product		604649	"""tubulin-specific chaperone d"""				Standard	NM_005993		Approved		uc002kfz.3	Q9BTW9		ENST00000355528.4:c.2664G>C	17.37:g.80885835G>C		Somatic	108	0		WXS	Illumina HiSeq	Phase_I	97	33	NM_005993	0	0	48	79	31	O95458|Q7L8K1|Q8IXP6|Q8NAX0|Q8WYH4|Q96E74|Q9UF82|Q9UG46|Q9Y2J3	Silent	SNP	ENST00000355528.4	37	CCDS45818.1																																																																																			.		0.642	TBCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439415.1	NM_005993	
NPC1	4864	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	21128030	21128030	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr18:21128030G>T	ENST00000269228.5	-	11	2251	c.1697C>A	c.(1696-1698)cCt>cAt	p.P566H	NPC1_ENST00000540608.1_5'UTR|NPC1_ENST00000412552.2_Intron	NM_000271.4	NP_000262.2	O15118	NPC1_HUMAN	Niemann-Pick disease, type C1	566					adult walking behavior (GO:0007628)|autophagy (GO:0006914)|bile acid metabolic process (GO:0008206)|cellular response to low-density lipoprotein particle stimulus (GO:0071404)|cellular response to steroid hormone stimulus (GO:0071383)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endocytosis (GO:0006897)|establishment of protein localization to membrane (GO:0090150)|lysosomal transport (GO:0007041)|membrane raft organization (GO:0031579)|negative regulation of cell death (GO:0060548)|negative regulation of macroautophagy (GO:0016242)|protein glycosylation (GO:0006486)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|membrane raft (GO:0045121)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	cholesterol binding (GO:0015485)|hedgehog receptor activity (GO:0008158)|receptor activity (GO:0004872)|sterol transporter activity (GO:0015248)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(10)|lung(13)|ovary(2)|stomach(1)	38	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)					ATTATTGACAGGGAAGGTAAT	0.423																																					p.P566H		.											.	NPC1-92	0			c.C1697A						.						153.0	147.0	149.0					18																	21128030		2203	4300	6503	SO:0001583	missense	4864	exon11			TTGACAGGGAAGG	AF002020	CCDS11878.1	18q11.2	2014-06-17			ENSG00000141458	ENSG00000141458			7897	protein-coding gene	gene with protein product		607623				8446622	Standard	NM_000271		Approved		uc002kum.4	O15118	OTTHUMG00000131873	ENST00000269228.5:c.1697C>A	18.37:g.21128030G>T	ENSP00000269228:p.Pro566His	Somatic	207	0		WXS	Illumina HiSeq	Phase_I	184	72	NM_000271	0	0	2	9	7	B4DET3|Q9P130	Missense_Mutation	SNP	ENST00000269228.5	37	CCDS11878.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.682504	0.88542	.	.	ENSG00000141458	ENST00000269228;ENST00000540608	D	0.93811	-3.29	5.72	4.85	0.62838	.	0.000000	0.85682	D	0.000000	D	0.95906	0.8667	M	0.81942	2.565	0.80722	D	1	D	0.63880	0.993	P	0.58928	0.848	D	0.96104	0.9071	10	0.66056	D	0.02	-8.8197	14.813	0.70010	0.0692:0.0:0.9308:0.0	.	566	O15118	NPC1_HUMAN	H	566;411	ENSP00000269228:P566H	ENSP00000269228:P566H	P	-	2	0	NPC1	19382028	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.865000	0.87049	1.417000	0.47077	0.563000	0.77884	CCT	.		0.423	NPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254823.2	NM_000271	
RNF165	494470	hgsc.bcm.edu;bcgsc.ca	37	18	44013357	44013357	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr18:44013357A>G	ENST00000269439.7	+	2	317	c.266A>G	c.(265-267)cAg>cGg	p.Q89R	RNF165_ENST00000543885.1_Intron	NM_152470.2	NP_689683.2	Q6ZSG1	RN165_HUMAN	ring finger protein 165	89							zinc ion binding (GO:0008270)			NS(1)|large_intestine(4)|lung(6)	11				READ - Rectum adenocarcinoma(1;0.0873)		CCCACCCTGCAGTTCCAGGAC	0.697																																					p.Q89R		.											.	RNF165-90	0			c.A266G						.						35.0	34.0	34.0					18																	44013357		2203	4300	6503	SO:0001583	missense	494470	exon2			CCCTGCAGTTCCA	BC012190	CCDS32823.1, CCDS58621.1	18q21.1	2014-01-03			ENSG00000141622	ENSG00000141622		"""RING-type (C3HC4) zinc fingers"""	31696	protein-coding gene	gene with protein product							Standard	NR_046357		Approved	ARKL2, RNF111L2	uc002lcb.1	Q6ZSG1		ENST00000269439.7:c.266A>G	18.37:g.44013357A>G	ENSP00000269439:p.Gln89Arg	Somatic	58	0		WXS	Illumina HiSeq	Phase_I	58	16	NM_152470	0	0	0	0	0	B3KVD1	Missense_Mutation	SNP	ENST00000269439.7	37	CCDS32823.1	.	.	.	.	.	.	.	.	.	.	A	9.420	1.082835	0.20309	.	.	ENSG00000141622	ENST00000269439	T	0.18657	2.2	5.48	4.27	0.50696	.	0.146503	0.47093	D	0.000241	T	0.18676	0.0448	L	0.47716	1.5	0.80722	D	1	B	0.26445	0.149	B	0.28784	0.094	T	0.03717	-1.1010	10	0.12766	T	0.61	-5.9439	13.0518	0.58958	0.8124:0.1876:0.0:0.0	.	89	Q6ZSG1	RN165_HUMAN	R	89	ENSP00000269439:Q89R	ENSP00000269439:Q89R	Q	+	2	0	RNF165	42267355	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.579000	0.46059	2.086000	0.62901	0.455000	0.32223	CAG	.		0.697	RNF165-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445358.1	NM_152470	
GRIN3B	116444	hgsc.bcm.edu	37	19	1005500	1005500	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr19:1005500T>C	ENST00000234389.3	+	3	2019	c.2000T>C	c.(1999-2001)gTc>gCc	p.V667A	AC004528.4_ENST00000588380.1_RNA	NM_138690.1	NP_619635.1	O60391	NMD3B_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3B	667					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|protein insertion into membrane (GO:0051205)|regulation of calcium ion transport (GO:0051924)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|neurotransmitter receptor activity (GO:0030594)			breast(1)|kidney(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000226)|all_lung(49;0.000353)|Breast(49;0.00066)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CTGGCTGCCGTCATGGTCGGG	0.687																																					p.V667A		.											.	GRIN3B-90	0			c.T2000C						.						39.0	39.0	39.0					19																	1005500		2203	4300	6503	SO:0001583	missense	116444	exon3			CTGCCGTCATGGT		CCDS32861.1	19p13.3	2014-05-06			ENSG00000116032	ENSG00000116032		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16768	protein-coding gene	gene with protein product		606651					Standard	XM_003403700		Approved	GluN3B	uc002lqo.1	O60391	OTTHUMG00000181904	ENST00000234389.3:c.2000T>C	19.37:g.1005500T>C	ENSP00000234389:p.Val667Ala	Somatic	57	0		WXS	Illumina HiSeq	Phase_I	37	2	NM_138690	0	0	62	62	0	Q5EAK7|Q7RTW9	Missense_Mutation	SNP	ENST00000234389.3	37	CCDS32861.1	.	.	.	.	.	.	.	.	.	.	T	17.64	3.439672	0.63067	.	.	ENSG00000116032	ENST00000234389	T	0.54675	0.56	4.36	4.36	0.52297	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.70448	0.3225	M	0.73962	2.25	0.43613	D	0.995987	D	0.89917	1.0	D	0.87578	0.998	T	0.74156	-0.3756	10	0.66056	D	0.02	.	12.4232	0.55532	0.0:0.0:0.0:1.0	.	667	O60391	NMD3B_HUMAN	A	667	ENSP00000234389:V667A	ENSP00000234389:V667A	V	+	2	0	GRIN3B	956500	1.000000	0.71417	1.000000	0.80357	0.475000	0.33008	6.137000	0.71710	1.635000	0.50512	0.254000	0.18369	GTC	.		0.687	GRIN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103923.2		
SBNO2	22904	ucsc.edu;bcgsc.ca	37	19	1106396	1106396	+	IGR	SNP	C	C	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr19:1106396C>G	ENST00000361757.3	-	0	4922				GPX4_ENST00000589115.1_Intron|GPX4_ENST00000354171.8_Intron	NM_014963.2	NP_055778.2	Q9Y2G9	SBNO2_HUMAN	strawberry notch homolog 2 (Drosophila)						bone mineralization (GO:0030282)|bone trabecula morphogenesis (GO:0061430)|macrophage activation involved in immune response (GO:0002281)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoclast fusion (GO:0072675)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of inflammatory response (GO:0050727)|transcription, DNA-templated (GO:0006351)					NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGTCTCTCCACAGTTCCTCAT	0.662																																					.													.	GPX4-90	0			.						.						54.0	62.0	60.0					19																	1106396		2043	4188	6231	SO:0001628	intergenic_variant	2879	.			TCTCCACAGTTCC	AK074102	CCDS45894.1, CCDS45895.1	19p13.3	2008-02-05	2006-10-06	2006-10-06		ENSG00000064932			29158	protein-coding gene	gene with protein product		615729	"""KIAA0963"""	KIAA0963		10231032	Standard	NM_014963		Approved	FLJ00173, Stno, Sno	uc002lrk.4	Q9Y2G9			19.37:g.1106396C>G		Somatic	116	0		WXS	Illumina HiSeq		52	7	.	0	0	7	106	99	A8K8P2|B3KWJ1|O75257|Q3KQX0|Q8TEM0	Missense_Mutation	SNP	ENST00000361757.3	37	CCDS45894.1																																																																																			.		0.662	SBNO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458065.2	NM_014963	
LDLR	3949	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	11216253	11216253	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr19:11216253A>C	ENST00000558518.1	+	4	858	c.671A>C	c.(670-672)gAc>gCc	p.D224A	LDLR_ENST00000558013.1_Missense_Mutation_p.D224A|LDLR_ENST00000557933.1_Missense_Mutation_p.D224A|LDLR_ENST00000455727.2_Intron|LDLR_ENST00000535915.1_Missense_Mutation_p.D183A|LDLR_ENST00000545707.1_Intron	NM_000527.4|NM_001195798.1	NP_000518.1|NP_001182727.1	P01130	LDLR_HUMAN	low density lipoprotein receptor	224	LDL-receptor class A 5. {ECO:0000255|PROSITE-ProRule:PRU00124}.		D -> G (in Italy-2).|D -> N (in Portugal).|D -> V (in FH; Cologne patient). {ECO:0000269|PubMed:7649546}.		cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endocytosis (GO:0006897)|intestinal cholesterol absorption (GO:0030299)|lipid metabolic process (GO:0006629)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle clearance (GO:0034383)|phospholipid transport (GO:0015914)|phototransduction, visible light (GO:0007603)|positive regulation of triglyceride biosynthetic process (GO:0010867)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol homeostasis (GO:2000188)|regulation of phosphatidylcholine catabolic process (GO:0010899)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|low-density lipoprotein particle (GO:0034362)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|glycoprotein binding (GO:0001948)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|very-low-density lipoprotein particle receptor activity (GO:0030229)	p.?(1)		breast(2)|endometrium(2)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Lung NSC(9;0.000245)|Renal(1328;0.0007)|Hepatocellular(1079;0.0524)		GBM - Glioblastoma multiforme(1328;1.36e-05)|STAD - Stomach adenocarcinoma(1328;0.000766)|Lung(535;0.197)	Porfimer(DB00707)	GACTGCAAGGACAAATCTGAC	0.647																																					p.D224A	GBM(18;201 575 7820 21545)	.											.	LDLR-94	1	Unknown(1)	lung(1)	c.A671C	GRCh37	CM920421|CM950756|CM994425	LDLR	M		.						31.0	36.0	34.0					19																	11216253		2202	4299	6501	SO:0001583	missense	3949	exon4			GCAAGGACAAATC	AY114155	CCDS12254.1, CCDS56083.1, CCDS56084.1, CCDS56085.1, CCDS58651.1	19p13.2	2014-09-17	2008-08-01		ENSG00000130164	ENSG00000130164		"""Low density lipoprotein receptors"""	6547	protein-coding gene	gene with protein product	"""familial hypercholesterolemia"""	606945					Standard	NM_000527		Approved	LDLCQ2	uc002mqk.4	P01130		ENST00000558518.1:c.671A>C	19.37:g.11216253A>C	ENSP00000454071:p.Asp224Ala	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	66	28	NM_001195798	0	0	0	0	0	B4DII3|B4DJZ8|B4DR00|B4DTQ3|C0JYY8|H0YLU8|H0YNT7|Q53ZD9|Q59FQ1|Q9UDH7	Missense_Mutation	SNP	ENST00000558518.1	37	CCDS12254.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.301164	0.81136	.	.	ENSG00000130164	ENST00000252444;ENST00000535915	D;D	0.99220	-5.58;-4.44	5.6	5.6	0.85130	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.64402	D	0.000010	D	0.99677	0.9879	H	0.98407	4.225	0.80722	D	1	P;D;D;D	0.71674	0.917;0.998;0.996;0.998	D;D;D;D	0.83275	0.92;0.996;0.99;0.99	D	0.97323	0.9945	10	0.87932	D	0	.	14.7566	0.69569	1.0:0.0:0.0:0.0	.	103;183;236;224	B4DII3;B4DTQ3;Q59FQ1;P01130	.;.;.;LDLR_HUMAN	A	224;183	ENSP00000252444:D224A;ENSP00000440520:D183A	ENSP00000252444:D224A	D	+	2	0	LDLR	11077253	1.000000	0.71417	1.000000	0.80357	0.511000	0.34104	9.228000	0.95250	2.139000	0.66308	0.482000	0.46254	GAC	.		0.647	LDLR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415973.2		
AP1M1	8907	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	16339616	16339616	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr19:16339616C>G	ENST00000291439.3	+	9	1373	c.924C>G	c.(922-924)aaC>aaG	p.N308K	AP1M1_ENST00000444449.2_Missense_Mutation_p.N320K|AP1M1_ENST00000429941.2_Intron|AP1M1_ENST00000541844.1_Missense_Mutation_p.N236K|AP1M1_ENST00000590756.1_Missense_Mutation_p.N236K	NM_032493.3	NP_115882.1	Q9BXS5	AP1M1_HUMAN	adaptor-related protein complex 1, mu 1 subunit	308	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|trans-Golgi network membrane (GO:0032588)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(3)|prostate(2)	21						CAACAGCCAACAACGTGGAGA	0.617																																					p.N320K		.											.	AP1M1-156	0			c.C960G						.						173.0	116.0	135.0					19																	16339616		2203	4300	6503	SO:0001583	missense	8907	exon10			AGCCAACAACGTG		CCDS12342.1, CCDS46008.1	19p13.12	2008-05-23							13667	protein-coding gene	gene with protein product		603535				9653655, 17988225	Standard	NM_032493		Approved	AP47, CLAPM2	uc002ndv.2	Q9BXS5		ENST00000291439.3:c.924C>G	19.37:g.16339616C>G	ENSP00000291439:p.Asn308Lys	Somatic	78	0		WXS	Illumina HiSeq	Phase_I	56	19	NM_001130524	0	0	76	135	59	Q4TTY5	Missense_Mutation	SNP	ENST00000291439.3	37	CCDS12342.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.429106	0.83667	.	.	ENSG00000072958	ENST00000444449;ENST00000291439;ENST00000541844	T;T;T	0.18502	2.21;2.21;2.21	3.64	3.64	0.41730	Clathrin adaptor, mu subunit, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.40347	0.1113	M	0.70787	2.145	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.39901	-0.9591	10	0.62326	D	0.03	-49.532	14.4911	0.67651	0.0:1.0:0.0:0.0	.	320;308	Q4TTY5;Q9BXS5	.;AP1M1_HUMAN	K	320;308;236	ENSP00000388996:N320K;ENSP00000291439:N308K;ENSP00000445682:N236K	ENSP00000291439:N308K	N	+	3	2	AP1M1	16200616	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.764000	0.55264	1.871000	0.54225	0.561000	0.74099	AAC	.		0.617	AP1M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460492.1	NM_032493	
ZNF99	7652	broad.mit.edu	37	19	22941129	22941129	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr19:22941129T>G	ENST00000596209.1	-	4	1672	c.1582A>C	c.(1582-1584)Aag>Cag	p.K528Q	ZNF99_ENST00000397104.3_Missense_Mutation_p.K437Q	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	528					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				TGAATTATCTTATGTTTTCTA	0.333																																					p.K528Q													.	ZNF99-24	0			c.A1582C						.																																			SO:0001583	missense	7652	exon4			TTATCTTATGTTT	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.1582A>C	19.37:g.22941129T>G	ENSP00000472969:p.Lys528Gln	Somatic	48	1		WXS	Illumina HiSeq	Phase_I	77	3	NM_001080409	0	0	0	0	0	M0R335	Missense_Mutation	SNP	ENST00000596209.1	37	CCDS59369.1	.	.	.	.	.	.	.	.	.	.	-	0.033	-1.323055	0.01320	.	.	ENSG00000213973	ENST00000397104	T	0.18016	2.24	1.29	-1.59	0.08453	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.15262	0.0368	N	0.20610	0.595	0.09310	N	1	D	0.56035	0.974	P	0.62184	0.899	T	0.07195	-1.0785	9	0.02654	T	1	.	7.2218	0.25992	0.0:0.0:0.6996:0.3004	.	437	A8MXY4	ZNF99_HUMAN	Q	437	ENSP00000380293:K437Q	ENSP00000380293:K437Q	K	-	1	0	ZNF99	22732969	0.000000	0.05858	0.001000	0.08648	0.045000	0.14185	-1.164000	0.03135	-0.293000	0.08986	0.329000	0.21502	AAG	.		0.333	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124	
ZNF99	7652	hgsc.bcm.edu;broad.mit.edu	37	19	22941154	22941154	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr19:22941154C>G	ENST00000596209.1	-	4	1647	c.1557G>C	c.(1555-1557)aaG>aaC	p.K519N	ZNF99_ENST00000397104.3_Missense_Mutation_p.K428N	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	519					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				CTGAGAAATGCTTAAAAGCTT	0.353																																					p.K519N		.											.	ZNF99-24	0			c.G1557C						.						36.0	37.0	37.0					19																	22941154		2012	4190	6202	SO:0001583	missense	7652	exon4			GAAATGCTTAAAA	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.1557G>C	19.37:g.22941154C>G	ENSP00000472969:p.Lys519Asn	Somatic	44	1		WXS	Illumina HiSeq	Phase_I	63	4	NM_001080409	0	0	0	0	0	M0R335	Missense_Mutation	SNP	ENST00000596209.1	37	CCDS59369.1	.	.	.	.	.	.	.	.	.	.	-	0.006	-2.118307	0.00349	.	.	ENSG00000213973	ENST00000397104	T	0.07567	3.18	1.16	-2.32	0.06745	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04634	0.0126	L	0.33753	1.03	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.46721	-0.9171	9	0.14252	T	0.57	.	1.8516	0.03170	0.1596:0.3714:0.3123:0.1568	.	428	A8MXY4	ZNF99_HUMAN	N	428	ENSP00000380293:K428N	ENSP00000380293:K428N	K	-	3	2	ZNF99	22732994	0.000000	0.05858	0.002000	0.10522	0.184000	0.23303	-7.212000	0.00041	-1.397000	0.02068	-1.031000	0.02408	AAG	.		0.353	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124	
IRF2BP1	26145	ucsc.edu	37	19	46388582	46388582	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr19:46388582G>A	ENST00000302165.3	-	1	794	c.451C>T	c.(451-453)Cga>Tga	p.R151*		NM_015649.1	NP_056464.1	Q8IU81	I2BP1_HUMAN	interferon regulatory factor 2 binding protein 1	151					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)			cervix(1)|kidney(1)|lung(2)	4		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00442)|GBM - Glioblastoma multiforme(486;0.0402)|Epithelial(262;0.231)		AAGGCCCTTCGCGCCCCCTCA	0.721																																					p.R151X													.	IRF2BP1-90	0			c.C451T						.						16.0	17.0	16.0					19																	46388582		2190	4269	6459	SO:0001587	stop_gained	26145	exon1			CCCTTCGCGCCCC	AY278022	CCDS12678.1	19q13.32	2008-02-05							21728	protein-coding gene	gene with protein product		615331				12799427	Standard	NM_015649		Approved	DKFZP434M154, IRF-2BP1	uc002pds.1	Q8IU81		ENST00000302165.3:c.451C>T	19.37:g.46388582G>A	ENSP00000307265:p.Arg151*	Somatic	36	0		WXS	Illumina HiSeq		23	4	NM_015649	0	0	15	15	0	Q53EL7|Q6DC95|Q9BRZ9|Q9Y4P4	Nonsense_Mutation	SNP	ENST00000302165.3	37	CCDS12678.1	.	.	.	.	.	.	.	.	.	.	G	38	6.745799	0.97809	.	.	ENSG00000170604	ENST00000302165	.	.	.	4.47	4.47	0.54385	.	0.096786	0.39544	U	0.001322	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.6658	0.68907	0.0:0.0:1.0:0.0	.	.	.	.	X	151	.	ENSP00000307265:R151X	R	-	1	2	IRF2BP1	51080422	0.088000	0.21588	0.928000	0.36995	0.960000	0.62799	1.596000	0.36718	2.306000	0.77630	0.462000	0.41574	CGA	.		0.721	IRF2BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461683.1	NM_015649	
NOVA2	4858	broad.mit.edu;bcgsc.ca	37	19	46443735	46443735	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr19:46443735A>G	ENST00000263257.5	-	4	1059	c.865T>C	c.(865-867)Tac>Cac	p.Y289H		NM_002516.2	NP_002507.1	Q9UNW9	NOVA2_HUMAN	neuro-oncological ventral antigen 2	289	Ala-rich.				regulation of RNA metabolic process (GO:0051252)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(3)|large_intestine(5)|lung(13)	21		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00245)|GBM - Glioblastoma multiforme(486;0.0782)|Epithelial(262;0.179)		TTGTAGCCGTAACTTGCCAGC	0.731																																					p.Y289H													.	NOVA2-226	0			c.T865C						.						15.0	11.0	13.0					19																	46443735		2152	4236	6388	SO:0001583	missense	4858	exon4			AGCCGTAACTTGC	U70477	CCDS12679.1	19q13.3	2008-07-17				ENSG00000104967			7887	protein-coding gene	gene with protein product	"""neuro-oncological ventral antigen 3"""	601991		NOVA3		9344654, 10368286	Standard	NM_002516		Approved	ANOVA	uc002pdv.2	Q9UNW9		ENST00000263257.5:c.865T>C	19.37:g.46443735A>G	ENSP00000263257:p.Tyr289His	Somatic	21	0		WXS	Illumina HiSeq	Phase_I	24	4	NM_002516	0	0	0	0	0	O43267|Q9UEA1	Missense_Mutation	SNP	ENST00000263257.5	37	CCDS12679.1	.	.	.	.	.	.	.	.	.	.	A	14.47	2.545341	0.45280	.	.	ENSG00000104967	ENST00000263257	T	0.47177	0.85	3.3	3.3	0.37823	.	0.000000	0.64402	D	0.000001	T	0.58652	0.2137	M	0.73217	2.22	0.46317	D	0.998985	D	0.65815	0.995	P	0.57911	0.829	T	0.60840	-0.7183	10	0.51188	T	0.08	-6.8358	9.7035	0.40200	1.0:0.0:0.0:0.0	.	289	Q9UNW9	NOVA2_HUMAN	H	289	ENSP00000263257:Y289H	ENSP00000263257:Y289H	Y	-	1	0	NOVA2	51135575	1.000000	0.71417	0.990000	0.47175	0.995000	0.86356	8.193000	0.89719	1.399000	0.46721	0.392000	0.25879	TAC	.		0.731	NOVA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437210.2	NM_002516	
TBC1D8	11138	hgsc.bcm.edu	37	2	101706726	101706726	+	Silent	SNP	G	G	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr2:101706726G>C	ENST00000376840.4	-	2	227	c.228C>G	c.(226-228)ccC>ccG	p.P76P	TBC1D8_ENST00000409318.1_Silent_p.P76P			O95759	TBCD8_HUMAN	TBC1 domain family, member 8 (with GRAM domain)	76					blood circulation (GO:0008015)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	32						CACATGCTATGGGAGAATAAA	0.502																																					p.P76P		.											.	TBC1D8-25	0			c.C228G						.						53.0	53.0	53.0					2																	101706726		1892	4112	6004	SO:0001819	synonymous_variant	11138	exon2			TGCTATGGGAGAA	AB024057	CCDS46375.1	2q12.1	2011-11-30			ENSG00000204634	ENSG00000204634			17791	protein-coding gene	gene with protein product	"""BUB2-like protein 1"", ""vascular Rab-GAP/TBC-containing protein"""					10373574	Standard	NM_001102426		Approved	HBLP1, VRP, AD3	uc010fiv.3	O95759	OTTHUMG00000153040	ENST00000376840.4:c.228C>G	2.37:g.101706726G>C		Somatic	64	0		WXS	Illumina HiSeq	Phase_I	44	3	NM_001102426	0	0	1	1	0	A6NDL4|A8K9W1|B9A6K4|Q53SQ4|Q9UQ32	Silent	SNP	ENST00000376840.4	37	CCDS46375.1																																																																																			.		0.502	TBC1D8-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376092.1	NM_007063	
GORASP2	26003	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	171806790	171806790	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr2:171806790T>C	ENST00000234160.4	+	4	1240	c.425T>C	c.(424-426)gTc>gCc	p.V142A	GORASP2_ENST00000493692.1_3'UTR|GORASP2_ENST00000452526.2_Missense_Mutation_p.V154A	NM_001201428.1|NM_015530.4	NP_001188357.1|NP_056345.3	Q9H8Y8	GORS2_HUMAN	golgi reassembly stacking protein 2, 55kDa	142					mitotic cell cycle (GO:0000278)|organelle organization (GO:0006996)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	14						GCAGATACAGTCATGAATGAG	0.368																																					p.V142A		.											.	GORASP2-135	0			c.T425C						.						72.0	73.0	73.0					2																	171806790		2203	4300	6503	SO:0001583	missense	26003	exon4			ATACAGTCATGAA		CCDS33325.1	2q31.1	2012-09-20	2002-08-29		ENSG00000115806	ENSG00000115806			17500	protein-coding gene	gene with protein product		608693	"""golgi reassembly stacking protein 2, 55 kDa"""			10487747	Standard	NM_015530		Approved	GRASP55, GRS2, GOLPH6	uc002ugj.3	Q9H8Y8	OTTHUMG00000154072	ENST00000234160.4:c.425T>C	2.37:g.171806790T>C	ENSP00000234160:p.Val142Ala	Somatic	29	0		WXS	Illumina HiSeq	Phase_I	76	32	NM_015530	0	0	0	0	0	B4DKT0|Q53TE3|Q96I74|Q96K84|Q9H946|Q9UFW4	Missense_Mutation	SNP	ENST00000234160.4	37	CCDS33325.1	.	.	.	.	.	.	.	.	.	.	T	18.25	3.583219	0.65992	.	.	ENSG00000115806	ENST00000234160;ENST00000452526	T;T	0.31247	1.5;1.5	5.95	5.95	0.96441	PDZ/DHR/GLGF (1);	0.116778	0.64402	D	0.000018	T	0.44201	0.1282	M	0.73753	2.245	0.58432	D	0.999992	B;B;B	0.23591	0.045;0.088;0.035	B;B;B	0.36845	0.107;0.168;0.234	T	0.35201	-0.9798	10	0.45353	T	0.12	-6.4014	16.4069	0.83677	0.0:0.0:0.0:1.0	.	98;154;142	B4DNR1;B4DKT0;Q9H8Y8	.;.;GORS2_HUMAN	A	142;154	ENSP00000234160:V142A;ENSP00000410208:V154A	ENSP00000234160:V142A	V	+	2	0	GORASP2	171515036	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	4.174000	0.58256	2.272000	0.75746	0.460000	0.39030	GTC	.		0.368	GORASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333719.2		
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	179411556	179411556	+	Silent	SNP	A	A	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr2:179411556A>G	ENST00000591111.1	-	291	89900	c.89676T>C	c.(89674-89676)gaT>gaC	p.D29892D	TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000342175.6_Silent_p.D22660D|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Silent_p.D31533D|TTN_ENST00000342992.6_Silent_p.D28965D|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|RP11-65L3.2_ENST00000603415.1_RNA|TTN_ENST00000359218.5_Silent_p.D22593D|TTN_ENST00000460472.2_Silent_p.D22468D|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000419746.1_RNA			Q8WZ42	TITIN_HUMAN	titin	29892	Fibronectin type-III 118. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGCTGCCTCCATCATACGCTG	0.498																																					p.D31533D		.											.	TTN-636	0			c.T94599C						.						60.0	61.0	61.0					2																	179411556		2069	4216	6285	SO:0001819	synonymous_variant	7273	exon341			GCCTCCATCATAC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.89676T>C	2.37:g.179411556A>G		Somatic	17	0		WXS	Illumina HiSeq	Phase_I	44	22	NM_001267550	0	0	0	0	0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																				.		0.498	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
SF3B1	23451	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	198269882	198269882	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr2:198269882G>C	ENST00000335508.6	-	11	1548	c.1457C>G	c.(1456-1458)aCa>aGa	p.T486R	SF3B1_ENST00000462613.1_5'Flank|SNORA4_ENST00000365564.1_RNA	NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	486	Interaction with PPP1R8.				anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)			NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			TGGACTAAGTGTTGATTCATC	0.289			Mis		myelodysplastic syndrome																																p.T486R		.		Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	.	SF3B1-140	0			c.C1457G						.						51.0	54.0	53.0					2																	198269882		2201	4295	6496	SO:0001583	missense	23451	exon11			CTAAGTGTTGATT	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.1457C>G	2.37:g.198269882G>C	ENSP00000335321:p.Thr486Arg	Somatic	29	0		WXS	Illumina HiSeq	Phase_I	42	4	NM_012433	0	0	108	108	0	E9PCH3	Missense_Mutation	SNP	ENST00000335508.6	37	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	G	15.77	2.931911	0.52866	.	.	ENSG00000115524	ENST00000335508	.	.	.	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.53334	0.1790	L	0.27053	0.805	0.80722	D	1	B	0.23806	0.091	B	0.23275	0.045	T	0.44817	-0.9303	9	0.35671	T	0.21	.	19.9254	0.97100	0.0:0.0:1.0:0.0	.	486	O75533	SF3B1_HUMAN	R	486	.	ENSP00000335321:T486R	T	-	2	0	SF3B1	197978127	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.721000	0.98766	2.710000	0.92621	0.655000	0.94253	ACA	.		0.289	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		
SATB2	23314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	200193570	200193570	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr2:200193570C>A	ENST00000417098.1	-	8	2053	c.1237G>T	c.(1237-1239)Gta>Tta	p.V413L	SATB2_ENST00000443023.1_Missense_Mutation_p.V354L|SATB2_ENST00000260926.5_Missense_Mutation_p.V413L|RP11-486F17.1_ENST00000489557.2_RNA|SATB2_ENST00000457245.1_Missense_Mutation_p.V413L|SATB2_ENST00000428695.1_Missense_Mutation_p.V295L	NM_001172509.1	NP_001165980.1	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	413					cartilage development (GO:0051216)|cellular response to organic substance (GO:0071310)|chromatin remodeling (GO:0006338)|embryonic pattern specification (GO:0009880)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|osteoblast development (GO:0002076)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(40)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						CTCAGGTTTACTAGAAGAGAC	0.488																																					p.V413L	Colon(30;262 767 11040 24421 36230)	.											.	SATB2-91	0			c.G1237T						.						93.0	87.0	89.0					2																	200193570		2203	4300	6503	SO:0001583	missense	23314	exon9			GGTTTACTAGAAG	AB028957	CCDS2327.1	2q33.1	2011-06-20	2007-02-15		ENSG00000119042	ENSG00000119042		"""Homeoboxes / CUT class"""	21637	protein-coding gene	gene with protein product		608148	"""SATB family member 2"""				Standard	NM_015265		Approved	KIAA1034, FLJ21474	uc002uva.2	Q9UPW6	OTTHUMG00000132767	ENST00000417098.1:c.1237G>T	2.37:g.200193570C>A	ENSP00000401112:p.Val413Leu	Somatic	16	0		WXS	Illumina HiSeq	Phase_I	46	11	NM_015265	0	0	8	16	8	A8K5Z8|Q3ZB87|Q4V763	Missense_Mutation	SNP	ENST00000417098.1	37	CCDS2327.1	.	.	.	.	.	.	.	.	.	.	C	31	5.081487	0.94050	.	.	ENSG00000119042	ENST00000417098;ENST00000443023;ENST00000260926;ENST00000428695;ENST00000457245	T;T;T;T;T	0.54675	0.58;0.59;0.58;0.56;0.58	4.98	4.98	0.66077	Homeodomain protein CUT (2);Lambda repressor-like, DNA-binding (2);	0.000000	0.85682	D	0.000000	T	0.71273	0.3320	M	0.63428	1.95	0.80722	D	1	D;D	0.69078	0.997;0.996	D;D	0.87578	0.992;0.998	T	0.73030	-0.4111	10	0.66056	D	0.02	-10.9637	18.8143	0.92071	0.0:1.0:0.0:0.0	.	295;413	Q3ZB87;Q9UPW6	.;SATB2_HUMAN	L	413;354;413;295;413	ENSP00000401112:V413L;ENSP00000388764:V354L;ENSP00000260926:V413L;ENSP00000388581:V295L;ENSP00000405420:V413L	ENSP00000260926:V413L	V	-	1	0	SATB2	199901815	1.000000	0.71417	0.995000	0.50966	0.983000	0.72400	7.609000	0.82925	2.747000	0.94245	0.650000	0.86243	GTA	.		0.488	SATB2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256140.1	NM_015265	
NOP58	51602	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	203155146	203155146	+	Silent	SNP	T	T	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr2:203155146T>C	ENST00000264279.5	+	7	826	c.600T>C	c.(598-600)gaT>gaC	p.D200D	SNORD11B_ENST00000607707.1_RNA|SNORD11_ENST00000459124.1_RNA	NM_015934.3	NP_057018.1	Q9Y2X3	NOP58_HUMAN	NOP58 ribonucleoprotein	200					cell growth (GO:0016049)|rRNA processing (GO:0006364)|snRNP protein import into nucleus (GO:0006608)	box C/D snoRNP complex (GO:0031428)|Cajal body (GO:0015030)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|pre-snoRNP complex (GO:0070761)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			breast(2)|cervix(1)|endometrium(3)|large_intestine(4)|lung(4)|prostate(2)	16						TTATTTCAGATAATTTAACAT	0.323																																					p.D200D		.											.	NOP58-90	0			c.T600C						.						92.0	98.0	96.0					2																	203155146		2203	4299	6502	SO:0001819	synonymous_variant	51602	exon7			TTCAGATAATTTA		CCDS2353.1	2q33.1	2012-12-10	2012-12-10		ENSG00000055044	ENSG00000055044			29926	protein-coding gene	gene with protein product			"""NOP58 ribonucleoprotein homolog (yeast)"""			10606270, 10925205	Standard	NM_015934		Approved	NOP5, HSPC120	uc002uzb.3	Q9Y2X3	OTTHUMG00000132840	ENST00000264279.5:c.600T>C	2.37:g.203155146T>C		Somatic	58	0		WXS	Illumina HiSeq	Phase_I	76	31	NM_015934	0	0	10	24	14	Q53SA4|Q6PK08|Q9P036|Q9UFN3	Silent	SNP	ENST00000264279.5	37	CCDS2353.1																																																																																			.		0.323	NOP58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256313.2	NM_015934	
UBOX5	22888	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	3102965	3102965	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr20:3102965G>A	ENST00000217173.2	-	3	791	c.320C>T	c.(319-321)cCa>cTa	p.P107L	UBOX5-AS1_ENST00000446537.1_RNA|UBOX5_ENST00000348031.2_Missense_Mutation_p.P107L	NM_001267584.1|NM_014948.3	NP_001254513.1|NP_055763.1			U-box domain containing 5											endometrium(1)|kidney(2)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)|skin(1)	20						TGGGACAGATGGCTCAGCTGG	0.567																																					p.P107L		.											.	UBOX5-227	0			c.C320T						.						59.0	59.0	59.0					20																	3102965		2203	4300	6503	SO:0001583	missense	22888	exon3			ACAGATGGCTCAG	AB020667	CCDS13046.1, CCDS13047.1	20p13	2013-01-28			ENSG00000185019	ENSG00000185019		"""RING-type (C3HC4) zinc fingers"", ""U-box domain containing"""	17777	protein-coding gene	gene with protein product						11274149	Standard	NM_014948		Approved	UIP5, KIAA0860, Ubce7ip5, RNF37	uc002whw.4	O94941	OTTHUMG00000031731	ENST00000217173.2:c.320C>T	20.37:g.3102965G>A	ENSP00000217173:p.Pro107Leu	Somatic	116	0		WXS	Illumina HiSeq	Phase_I	73	23	NM_014948	0	0	6	8	2		Missense_Mutation	SNP	ENST00000217173.2	37	CCDS13046.1	.	.	.	.	.	.	.	.	.	.	G	9.568	1.120384	0.20877	.	.	ENSG00000185019	ENST00000217173;ENST00000348031	T;T	0.29397	1.57;1.57	4.8	2.74	0.32292	.	0.705996	0.12704	U	0.446080	T	0.22859	0.0552	L	0.44542	1.39	0.29757	N	0.835874	B;B;B	0.13145	0.004;0.003;0.007	B;B;B	0.08055	0.003;0.002;0.003	T	0.13176	-1.0519	10	0.38643	T	0.18	-0.4251	5.1325	0.14917	0.1731:0.0:0.5509:0.276	.	107;107;107	Q53GQ5;Q86X87;O94941	.;.;RNF37_HUMAN	L	107	ENSP00000217173:P107L;ENSP00000311726:P107L	ENSP00000217173:P107L	P	-	2	0	UBOX5	3050965	0.241000	0.23857	0.305000	0.25099	0.964000	0.63967	0.662000	0.25038	1.232000	0.43678	0.563000	0.77884	CCA	.		0.567	UBOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077706.2	NM_014948	
NFATC2	4773	ucsc.edu	37	20	50049132	50049132	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr20:50049132G>A	ENST00000396009.3	-	9	2413	c.2194C>T	c.(2194-2196)Cgc>Tgc	p.R732C	NFATC2_ENST00000414705.1_Missense_Mutation_p.R712C|NFATC2_ENST00000609943.1_Missense_Mutation_p.R712C|NFATC2_ENST00000609507.1_Missense_Mutation_p.R513C|NFATC2_ENST00000610033.1_Missense_Mutation_p.R513C|NFATC2_ENST00000371564.3_Missense_Mutation_p.R732C	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	732					B cell receptor signaling pathway (GO:0050853)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/NFATC2(9)	breast(2)|endometrium(7)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	53	Hepatocellular(150;0.248)					AGCCCCGTGCGGAACTGCTGG	0.682																																					p.R732C													.	NFATC2-92	0			c.C2194T						.						23.0	28.0	26.0					20																	50049132		2203	4299	6502	SO:0001583	missense	4773	exon9			CCGTGCGGAACTG	U43342, U43341	CCDS13437.1, CCDS33488.1, CCDS46614.1, CCDS68156.1, CCDS68157.1	20q13.2	2009-11-24			ENSG00000101096	ENSG00000101096		"""Nuclear factor of activated T-cells"""	7776	protein-coding gene	gene with protein product		600490				8202141	Standard	NM_012340		Approved	NF-ATP, NFATp, NFAT1	uc002xwd.4	Q13469	OTTHUMG00000032747	ENST00000396009.3:c.2194C>T	20.37:g.50049132G>A	ENSP00000379330:p.Arg732Cys	Somatic	57	0		WXS	Illumina HiSeq		35	4	NM_012340	0	0	2	2	0	B5B2N8|B5B2N9|B5B2P0|B5B2P2|B5B2P3|Q13468|Q5TFW7|Q5TFW8|Q9NPX6|Q9NQH3|Q9UJR2	Missense_Mutation	SNP	ENST00000396009.3	37	CCDS13437.1	.	.	.	.	.	.	.	.	.	.	G	17.66	3.443944	0.63067	.	.	ENSG00000101096	ENST00000371564;ENST00000396009;ENST00000414705	T;T;T	0.15487	2.42;2.42;2.43	5.45	5.45	0.79879	.	0.112084	0.64402	D	0.000013	T	0.38026	0.1025	L	0.48642	1.525	0.51233	D	0.999917	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	P;D;D;P	0.79784	0.891;0.993;0.95;0.899	T	0.05649	-1.0872	10	0.62326	D	0.03	-25.2951	19.296	0.94122	0.0:0.0:1.0:0.0	.	712;712;732;732	B5B2N9;B5B2P2;Q13469;B5B2N8	.;.;NFAC2_HUMAN;.	C	732;732;712	ENSP00000360619:R732C;ENSP00000379330:R732C;ENSP00000396471:R712C	ENSP00000360619:R732C	R	-	1	0	NFATC2	49482539	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	5.521000	0.67086	2.563000	0.86464	0.650000	0.86243	CGC	.		0.682	NFATC2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079730.2	NM_012340	
BCAS1	8537	bcgsc.ca	37	20	52645037	52645037	+	Missense_Mutation	SNP	T	T	C	rs143209009		TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr20:52645037T>C	ENST00000395961.3	-	4	783	c.617A>G	c.(616-618)aAg>aGg	p.K206R	BCAS1_ENST00000371435.2_Missense_Mutation_p.K206R|BCAS1_ENST00000371440.3_Missense_Mutation_p.K206R|BCAS1_ENST00000411563.1_Missense_Mutation_p.K109R	NM_003657.2	NP_003648.2	O75363	BCAS1_HUMAN	breast carcinoma amplified sequence 1	206						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(23)|ovary(2)|skin(2)|stomach(1)|urinary_tract(1)	37	Breast(2;9.53e-15)|Lung NSC(4;5.57e-06)|all_lung(4;1.44e-05)		STAD - Stomach adenocarcinoma(23;0.116)|Colorectal(105;0.198)			ACCTGGCACCTTTTCCTGTCC	0.552																																					p.K206R													.	BCAS1-652	0			c.A617G						.	T	ARG/LYS	0,4406		0,0,2203	227.0	209.0	215.0		617	2.8	0.0	20	dbSNP_134	215	1,8599		0,1,4299	no	missense	BCAS1	NM_003657.2	26	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	benign	206/585	52645037	1,13005	2203	4300	6503	SO:0001583	missense	8537	exon4			GGCACCTTTTCCT	AF041260	CCDS13444.1	20q13.2	2006-11-10			ENSG00000064787	ENSG00000064787			974	protein-coding gene	gene with protein product		602968				9671742	Standard	NM_003657		Approved	NABC1, AIBC1	uc002xws.2	O75363	OTTHUMG00000032772	ENST00000395961.3:c.617A>G	20.37:g.52645037T>C	ENSP00000379290:p.Lys206Arg	Somatic	239	0		WXS	Illumina HiSeq	Phase_1	231	6	NM_003657	0	0	0	0	0	A0AVG5|Q68CZ3	Missense_Mutation	SNP	ENST00000395961.3	37	CCDS13444.1	.	.	.	.	.	.	.	.	.	.	T	11.18	1.562939	0.27915	0.0	1.16E-4	ENSG00000064787	ENST00000448484;ENST00000371440;ENST00000448710;ENST00000395961;ENST00000371435;ENST00000411563	T;T;T;T;T	0.05717	3.4;3.4;3.4;3.4;3.4	5.11	2.78	0.32641	.	0.711180	0.13859	N	0.357813	T	0.10121	0.0248	L	0.47716	1.5	0.09310	N	1	D;B;B;B;B;B	0.58268	0.982;0.386;0.386;0.119;0.342;0.342	P;B;B;B;B;B	0.52758	0.708;0.178;0.178;0.079;0.131;0.131	T	0.22347	-1.0219	10	0.37606	T	0.19	-1.5339	5.4467	0.16539	0.0:0.0934:0.1763:0.7303	.	109;206;206;206;206;206	B4E2C4;B2RCQ5;O75363-2;G3XAF7;A0AVG7;O75363	.;.;.;.;.;BCAS1_HUMAN	R	68;206;84;206;206;109	ENSP00000396361:K68R;ENSP00000360495:K206R;ENSP00000379290:K206R;ENSP00000360490:K206R;ENSP00000397442:K109R	ENSP00000360490:K206R	K	-	2	0	BCAS1	52078444	0.004000	0.15560	0.015000	0.15790	0.008000	0.06430	1.170000	0.31883	0.344000	0.23847	0.460000	0.39030	AAG	T|1.000;C|0.000		0.552	BCAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079766.2	NM_003657	
TAF4	6874	hgsc.bcm.edu	37	20	60585136	60585136	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr20:60585136A>G	ENST00000252996.4	-	4	1726	c.1727T>C	c.(1726-1728)gTa>gCa	p.V576A	TAF4_ENST00000609045.1_5'UTR	NM_003185.3	NP_003176.2	O00268	TAF4_HUMAN	TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa	576					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			CGCCCCTGGTACCGTGCGCTG	0.617																																					p.V576A		.											.	TAF4-93	0			c.T1727C						.						97.0	77.0	84.0					20																	60585136		2203	4300	6503	SO:0001583	missense	6874	exon4			CCTGGTACCGTGC	Y11354	CCDS33500.1	20q13.33	2010-02-26	2002-08-29	2002-01-18	ENSG00000130699	ENSG00000130699			11537	protein-coding gene	gene with protein product		601796	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C1, 130kD"""	TAF4A, TAF2C1, TAF2C		8942982, 9192867	Standard	NM_003185		Approved	TAFII130, TAFII135	uc002ybs.3	O00268	OTTHUMG00000032893	ENST00000252996.4:c.1727T>C	20.37:g.60585136A>G	ENSP00000252996:p.Val576Ala	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	49	3	NM_003185	1	0	11	12	0	A6NGD9|Q5TBP6|Q99721|Q9BR40|Q9BX42	Missense_Mutation	SNP	ENST00000252996.4	37	CCDS33500.1	.	.	.	.	.	.	.	.	.	.	A	8.390	0.839537	0.16891	.	.	ENSG00000130699	ENST00000252996;ENST00000436129	T;T	0.23348	1.92;1.91	4.8	3.65	0.41850	.	0.449437	0.23513	N	0.047377	T	0.15782	0.0380	L	0.44542	1.39	0.43471	D	0.995686	P	0.34699	0.464	B	0.28709	0.093	T	0.03739	-1.1008	10	0.02654	T	1	-10.3553	10.7964	0.46464	0.8585:0.0:0.0:0.1414	.	576	O00268	TAF4_HUMAN	A	576;440	ENSP00000252996:V576A;ENSP00000399091:V440A	ENSP00000252996:V576A	V	-	2	0	TAF4	60018531	1.000000	0.71417	0.628000	0.29241	0.112000	0.19704	6.400000	0.73252	1.805000	0.52779	0.260000	0.18958	GTA	.		0.617	TAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079968.2	NM_003185	
SETD4	54093	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	37418117	37418117	+	Silent	SNP	T	T	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr21:37418117T>C	ENST00000399215.1	-	5	1861	c.489A>G	c.(487-489)agA>agG	p.R163R	SETD4_ENST00000332131.4_Silent_p.R163R|SETD4_ENST00000399208.2_Silent_p.R163R|SETD4_ENST00000399212.1_Silent_p.R139R|SETD4_ENST00000399201.1_Silent_p.R139R|SETD4_ENST00000481477.1_5'UTR|SETD4_ENST00000399205.1_Silent_p.R139R|SETD4_ENST00000399207.1_Silent_p.R163R			Q9NVD3	SETD4_HUMAN	SET domain containing 4	163	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.						methyltransferase activity (GO:0008168)			autonomic_ganglia(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)	15						GCACGTGGGCTCTCTGCTCTT	0.502																																					p.R163R		.											.	SETD4-154	0			c.A489G						.						99.0	112.0	107.0					21																	37418117		2203	4300	6503	SO:0001819	synonymous_variant	54093	exon6			GTGGGCTCTCTGC	AK001660	CCDS13640.1, CCDS42923.1, CCDS74791.1, CCDS74792.1	21q22.13	2006-02-15	2006-02-15	2006-02-15	ENSG00000185917	ENSG00000185917			1258	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 27"", ""chromosome 21 open reading frame 18"""	C21orf27, C21orf18			Standard	XM_005261000		Approved		uc021wiy.1	Q9NVD3	OTTHUMG00000086483	ENST00000399215.1:c.489A>G	21.37:g.37418117T>C		Somatic	200	0		WXS	Illumina HiSeq	Phase_I	204	90	NM_001007259	0	0	14	24	10	B4DT14|D3DSG2|D3DSG4|Q8NE19|Q9BU46	Silent	SNP	ENST00000399215.1	37	CCDS13640.1																																																																																			.		0.502	SETD4-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194456.1	NM_017438	
SIK1	150094	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	44841223	44841223	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr21:44841223T>C	ENST00000270162.6	-	6	656	c.524A>G	c.(523-525)aAg>aGg	p.K175R		NM_173354.3	NP_775490.2	P57059	SIK1_HUMAN	salt-inducible kinase 1	175	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac muscle cell differentiation (GO:0055007)|cell cycle (GO:0007049)|entrainment of circadian clock by photoperiod (GO:0043153)|intracellular signal transduction (GO:0035556)|negative regulation of CREB transcription factor activity (GO:0032792)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of triglyceride biosynthetic process (GO:0010868)|positive regulation of anoikis (GO:2000210)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell differentiation (GO:0045595)|regulation of mitotic cell cycle (GO:0007346)|regulation of myotube differentiation (GO:0010830)|regulation of sodium ion transport (GO:0002028)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|cAMP response element binding protein binding (GO:0008140)|magnesium ion binding (GO:0000287)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)|testis(2)|urinary_tract(1)	21					Dabrafenib(DB08912)	CTCTCCTGACTTGTAGAAATT	0.567																																					p.K175R		.											.	SIK1-346	0			c.A524G						.						51.0	61.0	58.0					21																	44841223		2203	4299	6502	SO:0001583	missense	150094	exon6			CCTGACTTGTAGA	BC038504	CCDS33575.1	21q22.3	2008-12-23	2008-12-23	2008-12-23	ENSG00000142178	ENSG00000142178			11142	protein-coding gene	gene with protein product	"""myocardial SNF1-like kinase"""	605705	"""SNF1-like kinase"""	SNF1LK		7893599	Standard	NM_173354		Approved	msk	uc002zdf.2	P57059	OTTHUMG00000086874	ENST00000270162.6:c.524A>G	21.37:g.44841223T>C	ENSP00000270162:p.Lys175Arg	Somatic	168	0		WXS	Illumina HiSeq	Phase_I	119	46	NM_173354	0	0	4	4	0	A6NC84|Q5R2V5|Q6ZNL8|Q86YJ2	Missense_Mutation	SNP	ENST00000270162.6	37	CCDS33575.1	.	.	.	.	.	.	.	.	.	.	T	17.40	3.379901	0.61845	.	.	ENSG00000142178	ENST00000270162	T	0.66280	-0.2	5.08	5.08	0.68730	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.208643	0.49916	D	0.000136	T	0.45677	0.1354	N	0.12182	0.205	0.45150	D	0.998166	B	0.24721	0.11	B	0.25759	0.063	T	0.40664	-0.9551	10	0.37606	T	0.19	.	14.8612	0.70382	0.0:0.0:0.0:1.0	.	175	P57059	SIK1_HUMAN	R	175	ENSP00000270162:K175R	ENSP00000270162:K175R	K	-	2	0	SIK1	43665651	1.000000	0.71417	0.886000	0.34754	0.944000	0.59088	5.865000	0.69583	1.909000	0.55274	0.459000	0.35465	AAG	.		0.567	SIK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195654.1	NM_173354	
PHF21B	112885	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	45312440	45312440	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr22:45312440G>T	ENST00000313237.5	-	4	434	c.284C>A	c.(283-285)cCc>cAc	p.P95H	PHF21B_ENST00000403565.1_5'UTR|PHF21B_ENST00000447824.3_Missense_Mutation_p.P83H|PHF21B_ENST00000404079.2_Missense_Mutation_p.P83H|PHF21B_ENST00000396103.3_Missense_Mutation_p.P95H	NM_138415.4	NP_612424.1	Q96EK2	PF21B_HUMAN	PHD finger protein 21B	95							zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(14)|ovary(2)|prostate(1)|skin(2)	25		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)		GAATGTTGGGGGCTGCTTGGG	0.647																																					p.P95H		.											.	PHF21B-93	0			c.C284A						.						43.0	48.0	46.0					22																	45312440		2202	4300	6502	SO:0001583	missense	112885	exon4			GTTGGGGGCTGCT	AK091480	CCDS14061.1, CCDS56234.1, CCDS63504.1	22q13.31	2013-01-28			ENSG00000056487	ENSG00000056487		"""Zinc fingers, PHD-type"""	25161	protein-coding gene	gene with protein product			"""PHD finger protein 4"""	PHF4		12477932	Standard	NM_138415		Approved	BHC80L, FLJ34161	uc011aql.2	Q96EK2	OTTHUMG00000151199	ENST00000313237.5:c.284C>A	22.37:g.45312440G>T	ENSP00000324403:p.Pro95His	Somatic	134	0		WXS	Illumina HiSeq	Phase_I	85	30	NM_138415	0	0	0	0	0	B0QYW3|B0QYW4|B3KRU4|B7Z4F8|Q5TFL2|Q6ICC0	Missense_Mutation	SNP	ENST00000313237.5	37	CCDS14061.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.671013	0.88348	.	.	ENSG00000056487	ENST00000313237;ENST00000396103;ENST00000404079;ENST00000447824;ENST00000420689	T;T;T;T;T	0.24538	1.85;1.85;1.85;1.85;1.85	5.06	5.06	0.68205	.	0.076937	0.51477	D	0.000089	T	0.47619	0.1455	L	0.54323	1.7	0.47065	D	0.999309	D;D;D;D	0.89917	0.999;0.999;1.0;0.999	D;D;D;P	0.68621	0.919;0.959;0.943;0.885	T	0.48636	-0.9018	10	0.87932	D	0	0.0639	18.4696	0.90767	0.0:0.0:1.0:0.0	.	83;95;83;95	B7Z657;Q96EK2-3;B7Z4F8;Q96EK2	.;.;.;PF21B_HUMAN	H	95;95;83;83;83	ENSP00000324403:P95H;ENSP00000379410:P95H;ENSP00000385105:P83H;ENSP00000388619:P83H;ENSP00000401294:P83H	ENSP00000324403:P95H	P	-	2	0	PHF21B	43691104	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.530000	0.90606	2.346000	0.79739	0.655000	0.94253	CCC	.		0.647	PHF21B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321731.2	NM_138415	
GALNT15	117248	hgsc.bcm.edu	37	3	16217029	16217029	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr3:16217029G>C	ENST00000339732.5	+	1	874	c.371G>C	c.(370-372)aGg>aCg	p.R124T	GALNT15_ENST00000437509.1_Missense_Mutation_p.R124T|GALNT15_ENST00000470031.1_3'UTR	NM_054110.4	NP_473451.3	Q8N3T1	GLT15_HUMAN	polypeptide N-acetylgalactosaminyltransferase 15	124					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)										AAGCAGCCAAGGAGGCAGGAT	0.632																																					p.R124T		.											.	.	0			c.G371C						.						27.0	26.0	27.0					3																	16217029		2203	4300	6503	SO:0001583	missense	117248	exon1			AGCCAAGGAGGCA	AY358443	CCDS33711.1	3p25.1	2014-03-13	2014-03-13	2013-01-25	ENSG00000131386	ENSG00000131386	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	21531	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 15"""	615131	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 2"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"""	GALNTL2		12975309, 14702039, 15147861	Standard	NM_054110		Approved	GALNT7, pp-GalNAc-T15	uc003car.4	Q8N3T1	OTTHUMG00000156893	ENST00000339732.5:c.371G>C	3.37:g.16217029G>C	ENSP00000344260:p.Arg124Thr	Somatic	42	0		WXS	Illumina HiSeq	Phase_I	36	2	NM_054110	0	0	4	4	0	A6NMN1|B2R638|F1LIP6|Q86T60|Q96C46|Q96DJ5	Missense_Mutation	SNP	ENST00000339732.5	37	CCDS33711.1	.	.	.	.	.	.	.	.	.	.	G	9.292	1.050880	0.19827	.	.	ENSG00000131386	ENST00000339732;ENST00000437509	T;T	0.57436	0.63;0.4	4.14	1.3	0.21679	.	3.749960	0.01401	U	0.013600	T	0.40498	0.1119	L	0.29908	0.895	0.22562	N	0.998987	B	0.32245	0.361	B	0.30646	0.118	T	0.17471	-1.0368	10	0.14252	T	0.57	.	8.0521	0.30583	0.2627:0.0:0.7373:0.0	.	124	Q8N3T1	GLTL2_HUMAN	T	124	ENSP00000344260:R124T;ENSP00000395873:R124T	ENSP00000344260:R124T	R	+	2	0	GALNTL2	16192033	0.828000	0.29307	0.047000	0.18901	0.887000	0.51463	0.959000	0.29240	0.049000	0.15920	0.442000	0.29010	AGG	.		0.632	GALNT15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346483.2	NM_054110	
PBRM1	55193	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	52588791	52588791	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr3:52588791G>T	ENST00000296302.7	-	27	4559	c.4558C>A	c.(4558-4560)Ccc>Acc	p.P1520T	PBRM1_ENST00000337303.4_Intron|PBRM1_ENST00000409767.1_Intron|PBRM1_ENST00000356770.4_Missense_Mutation_p.P1433T|PBRM1_ENST00000409114.3_Intron|PBRM1_ENST00000410007.1_Missense_Mutation_p.P1440T|PBRM1_ENST00000409057.1_Missense_Mutation_p.P1465T|PBRM1_ENST00000394830.3_Missense_Mutation_p.P1413T|SMIM4_ENST00000476842.1_Intron|RNU6-856P_ENST00000516959.1_RNA			Q86U86	PB1_HUMAN	polybromo 1	1520	Pro-rich.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		AGATGGTGGGGTGGAGGCCCC	0.582			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																p.P1413T		.		Rec	yes		3	3p21	55193	polybromo 1		E	.	PBRM1-575	0			c.C4237A						.						46.0	46.0	46.0					3																	52588791		2203	4300	6503	SO:0001583	missense	55193	exon27			GGTGGGGTGGAGG	BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.4558C>A	3.37:g.52588791G>T	ENSP00000296302:p.Pro1520Thr	Somatic	47	0		WXS	Illumina HiSeq	Phase_I	39	19	NM_018313	0	0	2	6	4	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Missense_Mutation	SNP	ENST00000296302.7	37		.	.	.	.	.	.	.	.	.	.	G	15.23	2.771379	0.49680	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000409057;ENST00000410007	T;T;T;T;T	0.34859	1.35;1.34;1.39;1.35;1.35	5.75	5.75	0.90469	.	0.192124	0.47455	D	0.000227	T	0.21761	0.0524	N	0.08118	0	0.80722	D	1	B;B;B;B;B	0.32829	0.386;0.386;0.386;0.267;0.386	B;B;B;B;B	0.31101	0.124;0.124;0.124;0.058;0.086	T	0.08411	-1.0723	10	0.22706	T	0.39	-8.6684	18.1254	0.89584	0.0:0.0:1.0:0.0	.	1440;1413;1465;1520;1433	Q86U86-9;Q86U86-4;Q86U86-2;Q86U86;Q86U86-3	.;.;.;PB1_HUMAN;.	T	1433;1413;1520;1465;1440	ENSP00000349213:P1433T;ENSP00000378307:P1413T;ENSP00000296302:P1520T;ENSP00000386593:P1465T;ENSP00000386529:P1440T	ENSP00000296302:P1520T	P	-	1	0	PBRM1	52563831	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.959000	0.63666	2.696000	0.92011	0.655000	0.94253	CCC	.		0.582	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1	NM_018165	
IL17RB	55540	hgsc.bcm.edu	37	3	53891719	53891719	+	Splice_Site	SNP	T	T	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr3:53891719T>C	ENST00000288167.3	+	8	756		c.e8+2		RP11-884K10.7_ENST00000607783.1_RNA	NM_018725.3	NP_061195.2	Q9NRM6	I17RB_HUMAN	interleukin 17 receptor B						cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|regulation of cell growth (GO:0001558)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	cytokine receptor activity (GO:0004896)			breast(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)	13				BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)		ACGGTGCAGGTAAAGTTCAGT	0.468																																					.		.											.	IL17RB-229	0			c.747+2T>C						.						134.0	114.0	121.0					3																	53891719		2203	4300	6503	SO:0001630	splice_region_variant	55540	exon8			TGCAGGTAAAGTT	AF212365	CCDS2874.1	3p21.1	2008-02-05		2003-07-09	ENSG00000056736	ENSG00000056736		"""Interleukins and interleukin receptors"""	18015	protein-coding gene	gene with protein product		605458	"""interleukin 17B receptor"""	IL17BR		10749887, 10815801	Standard	NM_018725		Approved	IL17RH1, EVI27, CRL4	uc003dha.3	Q9NRM6	OTTHUMG00000158280	ENST00000288167.3:c.747+2T>C	3.37:g.53891719T>C		Somatic	64	0		WXS	Illumina HiSeq	Phase_I	57	3	NM_018725	0	0	215	215	0	Q9BPZ0|Q9NRL4|Q9NRM5	Splice_Site	SNP	ENST00000288167.3	37	CCDS2874.1	.	.	.	.	.	.	.	.	.	.	T	11.90	1.775436	0.31411	.	.	ENSG00000056736	ENST00000288167;ENST00000494338	.	.	.	4.76	3.61	0.41365	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.4365	0.27158	0.0:0.1013:0.0:0.8987	.	.	.	.	.	-1	.	.	.	+	.	.	IL17RB	53866759	1.000000	0.71417	0.981000	0.43875	0.380000	0.30137	3.510000	0.53393	0.940000	0.37473	0.533000	0.62120	.	.		0.468	IL17RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350563.1	NM_172234	Intron
ADCY5	111	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	123010068	123010068	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr3:123010068C>T	ENST00000462833.1	-	18	4431	c.3219G>A	c.(3217-3219)atG>atA	p.M1073I	ADCY5_ENST00000309879.5_Missense_Mutation_p.M723I|ADCY5_ENST00000491190.1_Missense_Mutation_p.M731I	NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	1073	Guanylate cyclase 2. {ECO:0000255|PROSITE-ProRule:PRU00099}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		TGGAGGCGAACATGACCGCCA	0.582																																					p.M1073I													.	ADCY5-94	0			c.G3219A						.						103.0	82.0	89.0					3																	123010068		2203	4300	6503	SO:0001583	missense	111	exon18			GGCGAACATGACC	U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.3219G>A	3.37:g.123010068C>T	ENSP00000419361:p.Met1073Ile	Somatic	102	0		WXS	Illumina HiSeq	Phase_I	74	24	NM_183357	0	0	0	0	0	B7Z8A6|Q7RTV7|Q8NFM3	Missense_Mutation	SNP	ENST00000462833.1	37	CCDS3022.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.315002	0.81358	.	.	ENSG00000173175	ENST00000462833;ENST00000491190;ENST00000309879	T;T;T	0.30182	1.54;1.54;1.54	4.53	4.53	0.55603	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.85682	D	0.000000	T	0.45994	0.1370	L	0.46670	1.46	0.58432	D	0.999998	D;D	0.57899	0.959;0.981	P;P	0.61070	0.86;0.883	T	0.34354	-0.9832	10	0.41790	T	0.15	.	17.4829	0.87679	0.0:1.0:0.0:0.0	.	1073;731	O95622;B3KWA8	ADCY5_HUMAN;.	I	1073;731;723	ENSP00000419361:M1073I;ENSP00000418537:M731I;ENSP00000308685:M723I	ENSP00000308685:M723I	M	-	3	0	ADCY5	124492758	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	5.758000	0.68776	2.362000	0.80069	0.563000	0.77884	ATG	.		0.582	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355889.4	XM_171048	
CLDN18	51208	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	137742626	137742626	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr3:137742626A>T	ENST00000183605.5	+	2	573	c.347A>T	c.(346-348)aAc>aTc	p.N116I	CLDN18_ENST00000343735.4_Missense_Mutation_p.N116I	NM_016369.3	NP_057453.1	P56856	CLD18_HUMAN	claudin 18	116					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(1)|large_intestine(2)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	6						GCCAAAGCCAACATGACACTG	0.502																																					p.N116I		.											.	CLDN18-92	0			c.A347T						.						105.0	85.0	92.0					3																	137742626		2203	4300	6503	SO:0001583	missense	51208	exon2			AAGCCAACATGAC	AF221069, AY102073	CCDS3095.1, CCDS33862.1	3q	2008-08-27			ENSG00000066405	ENSG00000066405		"""Claudins"""	2039	protein-coding gene	gene with protein product		609210	"""surfactant associated protein J"""	SFTPJ			Standard	NM_001002026		Approved		uc003ero.1	P56856	OTTHUMG00000159762	ENST00000183605.5:c.347A>T	3.37:g.137742626A>T	ENSP00000183605:p.Asn116Ile	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	68	22	NM_016369	0	0	0	0	0	A5PL21|Q96PH4	Missense_Mutation	SNP	ENST00000183605.5	37	CCDS3095.1	.	.	.	.	.	.	.	.	.	.	A	15.24	2.774666	0.49786	.	.	ENSG00000066405	ENST00000343735;ENST00000183605;ENST00000536138	D;D	0.85773	-1.98;-2.03	5.43	4.25	0.50352	.	0.400442	0.26013	N	0.026870	T	0.79684	0.4488	L	0.31065	0.9	0.36035	D	0.839645	P;P	0.38250	0.487;0.624	B;B	0.41332	0.285;0.354	T	0.81972	-0.0688	10	0.48119	T	0.1	.	12.5759	0.56363	0.861:0.139:0.0:0.0	.	116;116	P56856;P56856-2	CLD18_HUMAN;.	I	116;116;105	ENSP00000340939:N116I;ENSP00000183605:N116I	ENSP00000183605:N116I	N	+	2	0	CLDN18	139225316	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.836000	0.55813	0.878000	0.35920	0.528000	0.53228	AAC	.		0.502	CLDN18-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000357199.2	NM_001002026	
TMEM41A	90407	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	185209397	185209397	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr3:185209397T>A	ENST00000421852.1	-	5	818	c.723A>T	c.(721-723)aaA>aaT	p.K241N	TMEM41A_ENST00000475480.1_Intron|TMEM41A_ENST00000296254.3_3'UTR	NM_080652.3	NP_542383.1	Q96HV5	TM41A_HUMAN	transmembrane protein 41A	241						integral component of membrane (GO:0016021)				large_intestine(1)|lung(2)|skin(1)	4	all_cancers(143;7.78e-11)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)			TCTGACTAAATTTTTTAATGA	0.408																																					p.K241N		.											.	TMEM41A-90	0			c.A723T						.						115.0	114.0	115.0					3																	185209397		2203	4300	6503	SO:0001583	missense	90407	exon5			ACTAAATTTTTTA	BC019884	CCDS3271.1	3q27.2	2006-04-12			ENSG00000163900	ENSG00000163900			30544	protein-coding gene	gene with protein product						12975309	Standard	NM_080652		Approved	MGC15397	uc003fpj.2	Q96HV5	OTTHUMG00000156660	ENST00000421852.1:c.723A>T	3.37:g.185209397T>A	ENSP00000406885:p.Lys241Asn	Somatic	75	0		WXS	Illumina HiSeq	Phase_I	95	41	NM_080652	0	0	11	19	8	A8K4B3|D3DNU2|Q6ZMJ0	Missense_Mutation	SNP	ENST00000421852.1	37	CCDS3271.1	.	.	.	.	.	.	.	.	.	.	T	14.08	2.427515	0.43122	.	.	ENSG00000163900	ENST00000421852	.	.	.	6.08	-4.0	0.04057	.	0.341077	0.31772	N	0.007083	T	0.54078	0.1836	M	0.76574	2.34	0.80722	D	1	B	0.14805	0.011	B	0.17433	0.018	T	0.42916	-0.9423	9	0.29301	T	0.29	-18.9262	10.7523	0.46216	0.0:0.4413:0.0938:0.4649	.	241	Q96HV5	TM41A_HUMAN	N	241	.	ENSP00000406885:K241N	K	-	3	2	TMEM41A	186692091	0.000000	0.05858	0.846000	0.33378	0.988000	0.76386	-1.837000	0.01689	-0.284000	0.09102	0.533000	0.62120	AAA	.		0.408	TMEM41A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345174.1	NM_080652	
ZNF718	255403	hgsc.bcm.edu	37	4	154974	154974	+	lincRNA	SNP	G	G	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr4:154974G>C	ENST00000510175.1	+	0	409							Q3SXZ3	ZN718_HUMAN	zinc finger protein 718						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)						all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0681)|Epithelial(2;0.0838)|all cancers(2;0.135)|LUSC - Lung squamous cell carcinoma(95;0.18)		AAGATATACTGGAGATAAAAC	0.308																																					p.G167R		.											.	.	0			c.G499C						.						19.0	20.0	19.0					4																	154974		1949	4164	6113			255403	exon4			TATACTGGAGATA	AK096662	CCDS75078.1, CCDS75079.1	4p16.3	2011-05-24			ENSG00000250312	ENSG00000250312		"""Zinc fingers, C2H2-type"""	26889	protein-coding gene	gene with protein product							Standard	XM_005278364		Approved	FLJ90036	uc003fzt.4	Q3SXZ3	OTTHUMG00000159873		4.37:g.154974G>C		Somatic	5	0		WXS	Illumina HiSeq	Phase_I	11	2	NM_001039127	0	0	3	3	0	Q3SXZ4|Q3SXZ5	Missense_Mutation	SNP	ENST00000510175.1	37																																																																																				.		0.308	ZNF718-002	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000357865.3	NM_001039127	
NOP14	8602	ucsc.edu	37	4	2945921	2945921	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr4:2945921C>A	ENST00000314262.6	-	13	1818	c.1770G>T	c.(1768-1770)aaG>aaT	p.K590N	NOP14-AS1_ENST00000515194.1_RNA|NOP14-AS1_ENST00000503709.1_RNA|NOP14_ENST00000502735.1_Missense_Mutation_p.K590N|NOP14-AS1_ENST00000505731.1_RNA|NOP14-AS1_ENST00000507702.1_RNA|NOP14_ENST00000416614.2_Missense_Mutation_p.K590N|NOP14_ENST00000398071.4_Missense_Mutation_p.K590N|NOP14_ENST00000507120.1_5'Flank|NOP14-AS1_ENST00000512712.2_RNA	NM_003703.1	NP_003694.1	P78316	NOP14_HUMAN	NOP14 nucleolar protein	590					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|ribosomal small subunit biogenesis (GO:0042274)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|membrane (GO:0016020)|mitochondrion (GO:0005739)|Noc4p-Nop14p complex (GO:0030692)|nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			NS(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(12)|pancreas(1)|skin(1)|urinary_tract(1)	30						CGAACAGGCCCTTCACCACGT	0.522																																					p.K590N													.	NOP14-91	0			c.G1770T						.						78.0	71.0	74.0					4																	2945921		2203	4300	6503	SO:0001583	missense	8602	exon13			CAGGCCCTTCACC	AB000467	CCDS33945.1	4p16.3	2012-12-10	2012-12-10	2008-10-13	ENSG00000087269	ENSG00000087269			16821	protein-coding gene	gene with protein product	"""NOP14 homolog (S. cerevisiae)"""	611526	"""chromosome 4 open reading frame 9"", ""nucleolar protein 14"", ""nucleolar protein 14 homolog (yeast)"", ""NOP14 nucleolar protein homolog (yeast)"""	C4orf9, NOL14		9734812, 11694595	Standard	XR_241655		Approved	RES4-25, UTP2	uc003ggj.1	P78316	OTTHUMG00000159911	ENST00000314262.6:c.1770G>T	4.37:g.2945921C>A	ENSP00000315674:p.Lys590Asn	Somatic	79	0		WXS	Illumina HiSeq		46	5	NM_003703	0	0	8	8	0	D3DVR6|Q7LGI5|Q7Z6K0|Q8TBR6	Missense_Mutation	SNP	ENST00000314262.6	37	CCDS33945.1	.	.	.	.	.	.	.	.	.	.	C	16.59	3.164355	0.57476	.	.	ENSG00000087269	ENST00000416614;ENST00000314262;ENST00000502735;ENST00000398071;ENST00000546137	T;T;T;T	0.32023	1.47;1.47;1.47;1.47	5.47	1.29	0.21616	.	0.216546	0.38381	N	0.001709	T	0.49440	0.1557	M	0.81942	2.565	0.51012	D	0.999909	D;D;D	0.71674	0.998;0.994;0.997	D;P;D	0.70016	0.96;0.871;0.967	T	0.45833	-0.9234	10	0.87932	D	0	-41.0339	6.0194	0.19620	0.1282:0.4985:0.0:0.3733	.	383;590;590	Q96GC8;E9PFK5;P78316	.;.;NOP14_HUMAN	N	590;590;590;590;489	ENSP00000405068:K590N;ENSP00000315674:K590N;ENSP00000427415:K590N;ENSP00000381146:K590N	ENSP00000315674:K590N	K	-	3	2	NOP14	2915719	0.227000	0.23707	0.987000	0.45799	0.892000	0.51952	-0.491000	0.06474	0.296000	0.22592	-0.258000	0.10820	AAG	.		0.522	NOP14-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000358135.2	NM_003703	
ATP10D	57205	broad.mit.edu	37	4	47538506	47538506	+	Silent	SNP	C	C	A			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr4:47538506C>A	ENST00000273859.3	+	8	1337	c.1068C>A	c.(1066-1068)ccC>ccA	p.P356P	ATP10D_ENST00000504445.1_Silent_p.P356P	NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	356					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.P356P(1)		NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						TCAATGTTCCCGAGCCTGATG	0.358																																					p.P356P													.	ATP10D-93	1	Substitution - coding silent(1)	kidney(1)	c.C1068A						.						262.0	259.0	260.0					4																	47538506		2203	4300	6503	SO:0001819	synonymous_variant	57205	exon8			TGTTCCCGAGCCT	AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.1068C>A	4.37:g.47538506C>A		Somatic	101	0		WXS	Illumina HiSeq	Phase_I	284	9	NM_020453	0	0	17	17	0	A2RRC8|D6REN2|Q8NC70|Q96SR3	Silent	SNP	ENST00000273859.3	37	CCDS3476.1																																																																																			.		0.358	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216900.1	NM_020453	
SLC10A6	345274	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	87749228	87749228	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr4:87749228G>C	ENST00000273905.6	-	4	826	c.679C>G	c.(679-681)Ctg>Gtg	p.L227V	SLC10A6_ENST00000505535.1_Intron	NM_197965.2	NP_932069.1	Q3KNW5	SOAT_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 6	227					sodium-dependent organic anion transport (GO:0043251)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid:sodium symporter activity (GO:0008508)|sodium-dependent organic anion transmembrane transporter activity (GO:0043250)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)	9		Acute lymphoblastic leukemia(40;0.244)|all_hematologic(202;0.248)		OV - Ovarian serous cystadenocarcinoma(123;0.00099)		CTGATGGTCAGAAGGGTGATG	0.498																																					p.L227V		.											.	SLC10A6-22	0			c.C679G						.						89.0	81.0	84.0					4																	87749228		2203	4300	6503	SO:0001583	missense	345274	exon4			TGGTCAGAAGGGT	AJ583502	CCDS3614.1	4q22.1	2013-07-18	2013-07-18		ENSG00000145283	ENSG00000145283		"""Solute carriers"""	30603	protein-coding gene	gene with protein product		613366				15020217, 17491011	Standard	NM_197965		Approved	SOAT	uc003hqd.2	Q3KNW5	OTTHUMG00000130596	ENST00000273905.6:c.679C>G	4.37:g.87749228G>C	ENSP00000273905:p.Leu227Val	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	45	16	NM_197965	0	0	0	0	0	Q70EX7	Missense_Mutation	SNP	ENST00000273905.6	37	CCDS3614.1	.	.	.	.	.	.	.	.	.	.	G	12.68	2.010693	0.35511	.	.	ENSG00000145283	ENST00000273905	T	0.78816	-1.21	5.28	3.48	0.39840	.	0.167902	0.30320	N	0.009895	T	0.67477	0.2897	L	0.54323	1.7	0.28830	N	0.897216	P	0.42357	0.777	B	0.39339	0.297	T	0.66118	-0.6003	10	0.49607	T	0.09	-15.0839	4.1624	0.10291	0.1683:0.0:0.6333:0.1984	.	227	Q3KNW5	SOAT_HUMAN	V	227	ENSP00000273905:L227V	ENSP00000273905:L227V	L	-	1	2	SLC10A6	87968252	0.998000	0.40836	0.998000	0.56505	0.705000	0.40729	1.536000	0.36072	2.736000	0.93811	0.655000	0.94253	CTG	.		0.498	SLC10A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253043.2	NM_197965	
CAMK2D	817	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	114434488	114434488	+	Silent	SNP	G	G	A			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr4:114434488G>A	ENST00000342666.5	-	12	941	c.942C>T	c.(940-942)ttC>ttT	p.F314F	CAMK2D_ENST00000394524.3_Silent_p.F314F|CAMK2D_ENST00000394522.3_Silent_p.F314F|CAMK2D_ENST00000394526.2_Silent_p.F314F|CAMK2D_ENST00000418639.2_Silent_p.F314F|CAMK2D_ENST00000505990.1_Silent_p.F314F|CAMK2D_ENST00000454265.2_Silent_p.F314F|CAMK2D_ENST00000515496.1_Silent_p.F314F|CAMK2D_ENST00000514328.1_Silent_p.F314F|CAMK2D_ENST00000379773.2_Silent_p.F314F|CAMK2D_ENST00000429180.1_Silent_p.F314F|CAMK2D_ENST00000511664.1_Silent_p.F314F|CAMK2D_ENST00000508738.1_Silent_p.F314F|CAMK2D_ENST00000296402.5_Silent_p.F314F			Q13557	KCC2D_HUMAN	calcium/calmodulin-dependent protein kinase II delta	314					calcium ion transport (GO:0006816)|cardiac muscle cell contraction (GO:0086003)|cellular response to calcium ion (GO:0071277)|cytokine-mediated signaling pathway (GO:0019221)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|G1/S transition of mitotic cell cycle (GO:0000082)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle cell action potential (GO:0098901)|regulation of cardiac muscle cell action potential involved in regulation of contraction (GO:0098909)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of cell growth (GO:0001558)|regulation of cellular localization (GO:0060341)|regulation of generation of L-type calcium current (GO:1902514)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of histone deacetylase activity (GO:1901725)|regulation of membrane depolarization (GO:0003254)|regulation of relaxation of cardiac muscle (GO:1901897)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of the force of heart contraction (GO:0002026)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|relaxation of cardiac muscle (GO:0055119)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|calcium channel complex (GO:0034704)|calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|intercalated disc (GO:0014704)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|ion channel binding (GO:0044325)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|sodium channel inhibitor activity (GO:0019871)|titin binding (GO:0031432)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	13		Ovarian(17;0.00369)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000271)		ATGTACCTGAGAAATTCCTTG	0.358																																					p.F314F		.											.	CAMK2D-334	0			c.C942T						.						94.0	93.0	93.0					4																	114434488		2203	4300	6503	SO:0001819	synonymous_variant	817	exon12			ACCTGAGAAATTC	U50361	CCDS3703.1, CCDS3704.1, CCDS43263.1, CCDS47127.1, CCDS54797.1	4q26	2008-10-30	2008-10-30		ENSG00000145349	ENSG00000145349			1462	protein-coding gene	gene with protein product		607708	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II delta"""	CAMKD			Standard	NM_001221		Approved		uc003ibi.3	Q13557	OTTHUMG00000132910	ENST00000342666.5:c.942C>T	4.37:g.114434488G>A		Somatic	84	0		WXS	Illumina HiSeq	Phase_I	113	42	NM_172128	0	0	1	2	1	A8MVS8|Q52PK4|Q59G21|Q8N553|Q9UGH6|Q9UQE9	Silent	SNP	ENST00000342666.5	37	CCDS3703.1	.	.	.	.	.	.	.	.	.	.	G	7.680	0.688715	0.14973	.	.	ENSG00000145349	ENST00000513132	.	.	.	5.36	-2.88	0.05682	.	.	.	.	.	T	0.51839	0.1698	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48031	-0.9070	4	.	.	.	.	8.2973	0.31993	0.2489:0.0:0.6045:0.1466	.	.	.	.	F	18	.	.	L	-	1	0	CAMK2D	114653937	1.000000	0.71417	0.988000	0.46212	0.671000	0.39405	2.348000	0.44045	-0.497000	0.06641	-1.284000	0.01376	CTC	.		0.358	CAMK2D-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256420.2		
TLR3	7098	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	187004092	187004092	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr4:187004092A>C	ENST00000296795.3	+	4	1356	c.1252A>C	c.(1252-1254)Aaa>Caa	p.K418Q	TLR3_ENST00000504367.1_Missense_Mutation_p.K141Q	NM_003265.2	NP_003256.1	O15455	TLR3_HUMAN	toll-like receptor 3	418					activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to drug (GO:0035690)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|cellular response to interferon-gamma (GO:0071346)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|detection of virus (GO:0009597)|extrinsic apoptotic signaling pathway (GO:0097191)|hyperosmotic response (GO:0006972)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|microglial cell activation involved in immune response (GO:0002282)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic signaling pathway (GO:0097527)|negative regulation of osteoclast differentiation (GO:0045671)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type III interferon production (GO:0034346)|response to exogenous dsRNA (GO:0043330)|signal transduction (GO:0007165)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	double-stranded RNA binding (GO:0003725)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(5)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(30;1.14e-05)|GBM - Glioblastoma multiforme(59;0.000107)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.16)		AACCAAGAATAAAATCTCAAA	0.403																																					p.K418Q		.											.	TLR3-524	0			c.A1252C						.						60.0	56.0	57.0					4																	187004092		2203	4299	6502	SO:0001583	missense	7098	exon4			AAGAATAAAATCT	U88879	CCDS3846.1	4q35	2014-09-17				ENSG00000164342		"""CD molecules"""	11849	protein-coding gene	gene with protein product		603029				9435236	Standard	NM_003265		Approved	CD283	uc003iyq.3	O15455		ENST00000296795.3:c.1252A>C	4.37:g.187004092A>C	ENSP00000296795:p.Lys418Gln	Somatic	62	0		WXS	Illumina HiSeq	Phase_I	79	26	NM_003265	0	0	11	21	10	B2RAI7|B7Z7K0|E6Y0F0|E6Y0F1|E9PGH4|Q4VAL2|Q504W0	Missense_Mutation	SNP	ENST00000296795.3	37	CCDS3846.1	.	.	.	.	.	.	.	.	.	.	A	12.05	1.822070	0.32237	.	.	ENSG00000164342	ENST00000296795;ENST00000542020;ENST00000504367	T;T	0.59083	0.29;0.29	5.78	4.59	0.56863	.	0.253731	0.46145	D	0.000313	T	0.42539	0.1207	L	0.31207	0.915	0.25382	N	0.988604	B	0.24823	0.112	B	0.29176	0.099	T	0.31998	-0.9923	10	0.37606	T	0.19	.	5.6089	0.17394	0.7025:0.1541:0.1434:0.0	.	418	O15455	TLR3_HUMAN	Q	418;418;141	ENSP00000296795:K418Q;ENSP00000423684:K141Q	ENSP00000296795:K418Q	K	+	1	0	TLR3	187241086	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	4.225000	0.58600	0.999000	0.39023	0.455000	0.32223	AAA	.		0.403	TLR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360313.4		
ZFR	51663	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	32403408	32403408	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr5:32403408G>A	ENST00000265069.8	-	8	1421	c.1319C>T	c.(1318-1320)tCa>tTa	p.S440L		NM_016107.3	NP_057191.2	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein	440					multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|upper_aerodigestive_tract(2)	32				STAD - Stomach adenocarcinoma(35;0.19)		AGTCGGCTTTGAAGCAGATAC	0.418																																					p.S440L		.											.	ZFR-90	0			c.C1319T						.						188.0	171.0	177.0					5																	32403408		2203	4300	6503	SO:0001583	missense	51663	exon8			GGCTTTGAAGCAG	AF100742	CCDS34139.1	5p15.2	2014-03-03			ENSG00000056097	ENSG00000056097			17277	protein-coding gene	gene with protein product		615635				11574164, 24482476	Standard	NM_016107		Approved	ZFR1, SPG71	uc003jhr.1	Q96KR1	OTTHUMG00000161979	ENST00000265069.8:c.1319C>T	5.37:g.32403408G>A	ENSP00000265069:p.Ser440Leu	Somatic	102	0		WXS	Illumina HiSeq	Phase_I	160	70	NM_016107	0	0	21	41	20	B2RNR5|Q05C08|Q3B7X5|Q6P5A3|Q86UA0|Q9H6V4|Q9NTI1|Q9Y687	Missense_Mutation	SNP	ENST00000265069.8	37	CCDS34139.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.934133	0.73442	.	.	ENSG00000056097	ENST00000265069;ENST00000382126	T	0.05925	3.37	5.95	5.95	0.96441	.	0.316034	0.39210	N	0.001439	T	0.09555	0.0235	L	0.43152	1.355	0.58432	D	0.999997	B	0.26935	0.164	B	0.21917	0.037	T	0.08207	-1.0733	10	0.72032	D	0.01	.	20.3719	0.98893	0.0:0.0:1.0:0.0	.	440	Q96KR1	ZFR_HUMAN	L	440;418	ENSP00000265069:S440L	ENSP00000265069:S440L	S	-	2	0	ZFR	32439165	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.494000	0.81503	2.826000	0.97356	0.491000	0.48974	TCA	.		0.418	ZFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366586.1		
PIK3R1	5295	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	67576767	67576767	+	Silent	SNP	T	T	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr5:67576767T>G	ENST00000521381.1	+	7	1465	c.849T>G	c.(847-849)acT>acG	p.T283T	PIK3R1_ENST00000521657.1_Silent_p.T283T|PIK3R1_ENST00000396611.1_Silent_p.T283T|PIK3R1_ENST00000274335.5_Silent_p.T283T	NM_181523.2	NP_852664.1	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	283	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|growth hormone receptor signaling pathway (GO:0060396)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of osteoclast differentiation (GO:0045671)|neurotrophin TRK receptor signaling pathway (GO:0048011)|NFAT protein import into nucleus (GO:0051531)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|protein phosphorylation (GO:0006468)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|membrane (GO:0016020)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	ErbB-3 class receptor binding (GO:0043125)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.0?(1)|p.?(1)		breast(12)|central_nervous_system(31)|cervix(1)|endometrium(68)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(32)|lung(10)|ovary(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	178		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoprenaline(DB01064)	CTGATAATACTGAAAACCTCA	0.328			"""Mis, F, O"""		"""gliobastoma, ovarian, colorectal"""					TCGA GBM(4;<1E-08)																											p.T283T		.		Rec	yes		5	5q13.1	5295	"""phosphoinositide-3-kinase, regulatory subunit 1 (alpha)"""		"""E, O"""	.	PIK3R1-4332	2	Whole gene deletion(1)|Unknown(1)	large_intestine(1)|lung(1)	c.T849G						.						53.0	58.0	57.0					5																	67576767		2203	4299	6502	SO:0001819	synonymous_variant	5295	exon7			TAATACTGAAAAC	M61906	CCDS3993.1, CCDS3994.1, CCDS3995.1, CCDS56374.1	5q13.1	2014-09-17	2008-02-04		ENSG00000145675	ENSG00000145675		"""SH2 domain containing"""	8979	protein-coding gene	gene with protein product		171833				1314371, 18387942	Standard	NM_181524		Approved	GRB1, p85-ALPHA, p85	uc003jva.3	P27986	OTTHUMG00000131251	ENST00000521381.1:c.849T>G	5.37:g.67576767T>G		Somatic	41	0		WXS	Illumina HiSeq	Phase_I	61	18	NM_181523	0	0	4	5	1	B3KT19|D3DWA0|E7EX19|Q15747|Q4VBZ7|Q53EM6|Q8IXA2|Q8N1C5	Silent	SNP	ENST00000521381.1	37	CCDS3993.1																																																																																			.		0.328	PIK3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254013.2	NM_181504	
PAPD4	167153	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	78975410	78975410	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr5:78975410G>C	ENST00000296783.3	+	14	1516	c.1217G>C	c.(1216-1218)aGt>aCt	p.S406T	PAPD4_ENST00000423041.2_Missense_Mutation_p.S402T|PAPD4_ENST00000428308.2_Missense_Mutation_p.S406T|PAPD4_ENST00000453514.1_Missense_Mutation_p.S406T|PAPD4_ENST00000504233.1_Missense_Mutation_p.S363T			Q6PIY7	GLD2_HUMAN	PAP associated domain containing 4	406	PAP-associated.				hematopoietic progenitor cell differentiation (GO:0002244)|histone mRNA catabolic process (GO:0071044)|mRNA processing (GO:0006397)|RNA polyadenylation (GO:0043631)	cytoplasm (GO:0005737)|nuclear RNA-directed RNA polymerase complex (GO:0031380)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)			biliary_tract(1)|breast(2)|endometrium(4)|kidney(3)|large_intestine(9)|lung(4)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Lung NSC(167;0.00293)|all_lung(232;0.00323)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;8.61e-47)|Epithelial(54;1.32e-41)|all cancers(79;2.45e-36)		AGCTGGAATAGTCAAATGATT	0.323																																					p.S406T		.											.	PAPD4-69	0			c.G1217C						.						106.0	99.0	102.0					5																	78975410		2203	4300	6503	SO:0001583	missense	167153	exon14			GGAATAGTCAAAT	AL833136	CCDS4048.1, CCDS75265.1, CCDS75266.1	5q14.1	2014-03-21			ENSG00000164329	ENSG00000164329			26776	protein-coding gene	gene with protein product	"""TUTase2"""	614121				12477932	Standard	NM_173797		Approved	FLJ38499, GLD2, TUT2	uc003kgb.2	Q6PIY7	OTTHUMG00000108163	ENST00000296783.3:c.1217G>C	5.37:g.78975410G>C	ENSP00000296783:p.Ser406Thr	Somatic	57	0		WXS	Illumina HiSeq	Phase_I	73	33	NM_173797	0	0	0	0	0	Q86WZ2|Q8N927	Missense_Mutation	SNP	ENST00000296783.3	37	CCDS4048.1	.	.	.	.	.	.	.	.	.	.	G	11.49	1.653395	0.29425	.	.	ENSG00000164329	ENST00000453514;ENST00000423041;ENST00000504233;ENST00000428308;ENST00000296783	T;T;T;T;T	0.75821	-0.97;-0.97;-0.97;-0.97;-0.97	6.06	4.2	0.49525	PAP/25A-associated (1);	0.512215	0.23215	N	0.050628	T	0.50701	0.1631	N	0.08118	0	0.22982	N	0.998471	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.06405	0.001;0.001;0.002	T	0.33954	-0.9848	10	0.30854	T	0.27	-6.8279	7.1177	0.25427	0.1866:0.1805:0.6329:0.0	.	406;402;363	Q6PIY7;Q6PIY7-2;D6RAF2	GLD2_HUMAN;.;.	T	406;402;363;406;406	ENSP00000397563:S406T;ENSP00000393412:S402T;ENSP00000421966:S363T;ENSP00000396861:S406T;ENSP00000296783:S406T	ENSP00000296783:S406T	S	+	2	0	PAPD4	79011166	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	1.626000	0.37039	1.428000	0.47296	0.655000	0.94253	AGT	.		0.323	PAPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226967.1	NM_173797	
SLIT3	6586	hgsc.bcm.edu	37	5	168112858	168112858	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr5:168112858T>C	ENST00000519560.1	-	31	3808	c.3389A>G	c.(3388-3390)aAc>aGc	p.N1130S	SLIT3_ENST00000404867.3_Missense_Mutation_p.N1130S|SLIT3_ENST00000332966.8_Missense_Mutation_p.N1137S	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	1130	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTGGGCCCCGTTCTGGCACTC	0.637																																					p.N1137S	Ovarian(29;311 847 10864 17279 24903)	.											.	SLIT3-95	0			c.A3410G						.						39.0	36.0	37.0					5																	168112858		2203	4300	6503	SO:0001583	missense	6586	exon31			GCCCCGTTCTGGC	AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.3389A>G	5.37:g.168112858T>C	ENSP00000430333:p.Asn1130Ser	Somatic	28	1		WXS	Illumina HiSeq	Phase_I	28	2	NM_001271946	0	0	5	5	0	A6H8U9|J3KNP3|O95804|Q9UFH5	Missense_Mutation	SNP	ENST00000519560.1	37	CCDS4369.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.373998	0.82573	.	.	ENSG00000184347	ENST00000519560;ENST00000332966;ENST00000404867	D;D;D	0.94828	-3.53;-3.53;-3.53	4.76	4.76	0.60689	EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.97895	0.9308	H	0.94886	3.595	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	D	0.99026	1.0819	10	0.72032	D	0.01	.	14.5675	0.68188	0.0:0.0:0.0:1.0	.	1130	O75094	SLIT3_HUMAN	S	1130;1137;1130	ENSP00000430333:N1130S;ENSP00000332164:N1137S;ENSP00000384890:N1130S	ENSP00000332164:N1137S	N	-	2	0	SLIT3	168045436	1.000000	0.71417	0.977000	0.42913	0.821000	0.46438	7.993000	0.88291	1.904000	0.55121	0.459000	0.35465	AAC	.		0.637	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4	NM_003062	
NELFE	7936	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	31922209	31922209	+	Silent	SNP	T	T	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr6:31922209T>C	ENST00000375429.3	-	8	979	c.753A>G	c.(751-753)tcA>tcG	p.S251S	MIR1236_ENST00000408340.1_RNA|NELFE_ENST00000444811.2_Silent_p.S221S|NELFE_ENST00000375425.5_Silent_p.S258S	NM_002904.5	NP_002895.3	P18615	NELFE_HUMAN	negative elongation factor complex member E	251					gene expression (GO:0010467)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)										GTTCAGGGAATGAATCCGACC	0.483																																					p.S251S		.											.	.	0			c.A753G						.						96.0	90.0	92.0					6																	31922209		2203	4300	6503	SO:0001819	synonymous_variant	7936	exon8			AGGGAATGAATCC	M33230	CCDS4730.1	6p21.3	2013-02-12	2013-01-31	2013-01-31	ENSG00000204356	ENSG00000204356		"""RNA binding motif (RRM) containing"""	13974	protein-coding gene	gene with protein product		154040	"""RD RNA-binding protein"", ""RD RNA binding protein"""	RDBP			Standard	XM_006715205		Approved	RD, D6S45, NELF-E, RDP	uc003nyk.3	P18615	OTTHUMG00000031046	ENST00000375429.3:c.753A>G	6.37:g.31922209T>C		Somatic	109	0		WXS	Illumina HiSeq	Phase_I	88	30	NM_002904	0	0	1	1	0	A2BE08|B4DUN1|B4DYX9|Q5JP74|Q5JP75|Q96F56|Q9NPK2	Silent	SNP	ENST00000375429.3	37	CCDS4730.1																																																																																			.		0.483	NELFE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076047.4		
EYS	346007	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	66204808	66204808	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr6:66204808T>G	ENST00000370621.3	-	4	1022	c.496A>C	c.(496-498)Aat>Cat	p.N166H	EYS_ENST00000370616.2_Missense_Mutation_p.N166H|EYS_ENST00000370618.3_Missense_Mutation_p.N166H|EYS_ENST00000342421.5_Missense_Mutation_p.N166H|EYS_ENST00000503581.1_Missense_Mutation_p.N166H|EYS_ENST00000393380.2_Missense_Mutation_p.N166H			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	166					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						ACTGTCACATTTAGTCGAAGT	0.423																																					p.N166H		.											.	EYS-660	0			c.A496C						.						72.0	64.0	66.0					6																	66204808		2203	4300	6503	SO:0001583	missense	346007	exon4			TCACATTTAGTCG		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.496A>C	6.37:g.66204808T>G	ENSP00000359655:p.Asn166His	Somatic	54	0		WXS	Illumina HiSeq	Phase_I	97	32	NM_001142801	0	0	0	0	0	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	ENST00000370621.3	37		.	.	.	.	.	.	.	.	.	.	T	16.65	3.181420	0.57800	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616;ENST00000393380;ENST00000342421;ENST00000370618	D;D;D;D;D;D	0.88277	-2.36;-2.36;-2.36;-2.36;-2.36;-2.36	4.54	3.34	0.38264	.	.	.	.	.	T	0.69824	0.3154	N	0.08118	0	0.21020	N	0.99981	P;P;P	0.49862	0.844;0.929;0.884	B;P;P	0.48030	0.383;0.564;0.51	T	0.64588	-0.6372	9	0.45353	T	0.12	.	9.2337	0.37453	0.0:0.0:0.1827:0.8173	.	166;166;166	Q5T1H1-1;Q5T1H1-2;Q5SZM4	.;.;.	H	166	ENSP00000424243:N166H;ENSP00000359655:N166H;ENSP00000359650:N166H;ENSP00000377042:N166H;ENSP00000341818:N166H;ENSP00000359652:N166H	ENSP00000341818:N166H	N	-	1	0	EYS	66261529	0.997000	0.39634	0.962000	0.40283	0.996000	0.88848	2.828000	0.48120	0.667000	0.31107	0.482000	0.46254	AAT	.		0.423	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
SLC22A16	85413	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	110746234	110746234	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr6:110746234C>A	ENST00000368919.3	-	8	1642	c.1576G>T	c.(1576-1578)Gaa>Taa	p.E526*	SLC22A16_ENST00000330550.4_Nonsense_Mutation_p.E492*	NM_033125.3	NP_149116.2	Q86VW1	S22AG_HUMAN	solute carrier family 22 (organic cation/carnitine transporter), member 16	526					acid secretion (GO:0046717)|amine transport (GO:0015837)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|organic cation transport (GO:0015695)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amine transmembrane transporter activity (GO:0005275)|carnitine transmembrane transporter activity (GO:0015226)|organic cation transmembrane transporter activity (GO:0015101)			breast(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	34		all_cancers(87;0.00221)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0485)|Colorectal(196;0.101)		OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.0921)|all cancers(137;0.115)	Doxorubicin(DB00997)|L-Carnitine(DB00583)	CCAAGGGTTTCTGGAAGCTTT	0.408																																					p.E526X		.											.	SLC22A16-91	0			c.G1576T						.						90.0	89.0	90.0					6																	110746234		2203	4300	6503	SO:0001587	stop_gained	85413	exon8			GGGTTTCTGGAAG		CCDS5084.1	6q21	2013-05-22	2008-01-11		ENSG00000004809	ENSG00000004809		"""Solute carriers"""	20302	protein-coding gene	gene with protein product		608276	"""solute carrier family 22 (organic cation transporter), member 16"""			12372408, 12089149, 17473959	Standard	NM_033125		Approved	FLIPT2, CT2, OKB1, OAT6	uc003puf.3	Q86VW1	OTTHUMG00000016171	ENST00000368919.3:c.1576G>T	6.37:g.110746234C>A	ENSP00000357915:p.Glu526*	Somatic	132	1		WXS	Illumina HiSeq	Phase_I	135	48	NM_033125	0	0	0	0	0	O14567|Q5JXM1|Q8IUG8|Q8IZD5|Q96M90|Q96RU0	Nonsense_Mutation	SNP	ENST00000368919.3	37	CCDS5084.1	.	.	.	.	.	.	.	.	.	.	C	38	7.112271	0.98070	.	.	ENSG00000004809	ENST00000368919;ENST00000330550	.	.	.	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.8326	0.78769	0.0:1.0:0.0:0.0	.	.	.	.	X	526;492	.	ENSP00000328583:E492X	E	-	1	0	SLC22A16	110852927	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.424000	0.66464	2.546000	0.85860	0.591000	0.81541	GAA	.		0.408	SLC22A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043428.1	NM_033125	
ETV1	2115	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	13971323	13971323	+	Silent	SNP	C	C	G	rs531769320	byFrequency	TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr7:13971323C>G	ENST00000430479.1	-	9	1273	c.606G>C	c.(604-606)acG>acC	p.T202T	ETV1_ENST00000343495.5_Silent_p.T184T|ETV1_ENST00000420159.2_Silent_p.T144T|ETV1_ENST00000405358.4_Silent_p.T216T|ETV1_ENST00000242066.5_Silent_p.T184T|ETV1_ENST00000403685.1_Silent_p.T184T|ETV1_ENST00000399357.3_Silent_p.T99T|ETV1_ENST00000476720.2_5'UTR|ETV1_ENST00000403527.1_Silent_p.T162T|ETV1_ENST00000405218.2_Silent_p.T202T|ETV1_ENST00000405192.2_Silent_p.T202T	NM_004956.4	NP_004947.2	P50549	ETV1_HUMAN	ets variant 1	202					axon guidance (GO:0007411)|cell differentiation (GO:0030154)|mechanosensory behavior (GO:0007638)|muscle organ development (GO:0007517)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		TMPRSS2/ETV1(34)|ACSL3_ENST00000357430/ETV1(2)|EWSR1/ETV1(7)|KLK2/ETV1(3)|SLC45A3/ETV1(3)|HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31						CCCTTGGCATCGTCGGCAAAG	0.502			T	"""EWSR1, TMPRSS2, SLC45A3, C15orf21, HNRNPA2B1. ACSL3"""	"""Ewing sarcoma, prostate"""																																p.T202T		.		Dom	yes		7	7p22	2115	ets variant gene 1		"""M, E"""	.	ETV1-659	0			c.G606C						.						116.0	112.0	113.0					7																	13971323		2010	4169	6179	SO:0001819	synonymous_variant	2115	exon9			TGGCATCGTCGGC		CCDS55083.1, CCDS55084.1, CCDS55085.1, CCDS55086.1, CCDS55087.1, CCDS55088.1	7p22	2008-09-12	2008-09-12		ENSG00000006468	ENSG00000006468			3490	protein-coding gene	gene with protein product		600541	"""ets variant gene 1"""			1340465	Standard	NM_004956		Approved	ER81	uc003ssw.4	P50549	OTTHUMG00000152403	ENST00000430479.1:c.606G>C	7.37:g.13971323C>G		Somatic	46	0		WXS	Illumina HiSeq	Phase_I	45	17	NM_004956	0	0	1	2	1	A4D118|B2R768|B7Z2I4|B7Z618|B7Z9P2|C9JT37|E9PHB1|F5GXR2|O75849|Q4KMQ6|Q59GA7|Q6AI30|Q9UQ71|Q9Y636	Silent	SNP	ENST00000430479.1	37	CCDS55088.1																																																																																			.		0.502	ETV1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326111.1	NM_004956	
SUN3	256979	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	48035693	48035693	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr7:48035693C>T	ENST00000297325.4	-	7	787	c.628G>A	c.(628-630)Gca>Aca	p.A210T	SUN3_ENST00000473723.1_5'UTR|SUN3_ENST00000412142.1_Missense_Mutation_p.A110T|SUN3_ENST00000453192.2_Missense_Mutation_p.A198T|SUN3_ENST00000395572.2_Missense_Mutation_p.A210T	NM_001030019.1	NP_001025190.1	Q8TAQ9	SUN3_HUMAN	Sad1 and UNC84 domain containing 3	210	SUN. {ECO:0000255|PROSITE- ProRule:PRU00802}.					integral component of membrane (GO:0016021)|SUN-KASH complex (GO:0034993)				central_nervous_system(1)|endometrium(3)|large_intestine(8)|liver(1)|lung(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TACAATTTTGCTTTATTATTT	0.299																																					p.A210T		.											.	SUN3-514	0			c.G628A						.						82.0	87.0	85.0					7																	48035693		2203	4288	6491	SO:0001583	missense	256979	exon8			ATTTTGCTTTATT	AF429967	CCDS34636.1, CCDS64647.1	7p12.3	2010-01-27	2010-01-27	2010-01-27	ENSG00000164744	ENSG00000164744			22429	protein-coding gene	gene with protein product			"""Sad1 and UNC84 domain containing 1"""	SUNC1			Standard	NM_001284350		Approved	MGC33329	uc003tof.3	Q8TAQ9	OTTHUMG00000155646	ENST00000297325.4:c.628G>A	7.37:g.48035693C>T	ENSP00000297325:p.Ala210Thr	Somatic	115	0		WXS	Illumina HiSeq	Phase_I	126	40	NM_152782	0	0	0	0	0	A4D2F3|B4DXK1|D3DVM3|E7EWC8|Q4F965|Q7Z4U8	Missense_Mutation	SNP	ENST00000297325.4	37	CCDS34636.1	.	.	.	.	.	.	.	.	.	.	C	14.27	2.484372	0.44147	.	.	ENSG00000164744	ENST00000297325;ENST00000412371;ENST00000412142;ENST00000395572;ENST00000453192;ENST00000438771	T;T;T;T;T;T	0.46063	1.83;0.88;1.84;1.83;2.42;1.84	5.25	4.37	0.52481	Sad1/UNC-like, C-terminal (1);	0.236128	0.42548	N	0.000694	T	0.35537	0.0935	L	0.49350	1.555	0.34170	D	0.669671	B;B;B	0.31503	0.047;0.326;0.192	B;B;B	0.28465	0.019;0.09;0.065	T	0.52873	-0.8517	10	0.87932	D	0	.	9.6842	0.40089	0.0:0.9039:0.0:0.0961	.	198;110;210	E7EWC8;Q8TAQ9-2;Q8TAQ9	.;.;SUN3_HUMAN	T	210;32;110;210;198;110	ENSP00000297325:A210T;ENSP00000406887:A32T;ENSP00000410204:A110T;ENSP00000378939:A210T;ENSP00000387525:A198T;ENSP00000409077:A110T	ENSP00000297325:A210T	A	-	1	0	SUN3	48002218	0.937000	0.31787	0.973000	0.42090	0.803000	0.45373	1.417000	0.34770	1.244000	0.43870	0.650000	0.86243	GCA	.		0.299	SUN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340962.1	NM_152782	
PEX1	5189	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	92151473	92151473	+	Silent	SNP	A	A	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr7:92151473A>G	ENST00000248633.4	-	2	311	c.216T>C	c.(214-216)aaT>aaC	p.N72N	PEX1_ENST00000438045.1_Silent_p.N72N|PEX1_ENST00000428214.1_Silent_p.N72N	NM_000466.2	NP_000457.1	O43933	PEX1_HUMAN	peroxisomal biogenesis factor 1	72					ATP catabolic process (GO:0006200)|microtubule-based peroxisome localization (GO:0060152)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			TTTCAGCCACATTTTCACCTT	0.408																																					p.N72N		.											.	PEX1-91	0			c.T216C						.						130.0	121.0	124.0					7																	92151473		2203	4300	6503	SO:0001819	synonymous_variant	5189	exon2			AGCCACATTTTCA	AF026086	CCDS5627.1, CCDS64710.1	7q21.2	2010-04-21	2008-08-26		ENSG00000127980	ENSG00000127980		"""ATPases / AAA-type"""	8850	protein-coding gene	gene with protein product		602136	"""peroxisome biogenesis factor 1"", ""Zellweger syndrome 1"", ""Zellweger syndrome"""	ZWS1, ZWS		9398848	Standard	NM_001282677		Approved		uc003uly.3	O43933	OTTHUMG00000023926	ENST00000248633.4:c.216T>C	7.37:g.92151473A>G		Somatic	90	0		WXS	Illumina HiSeq	Phase_I	130	55	NM_000466	0	0	3	9	6	A4D1G3|A8KA90|B4DIM7|E9PE75|Q96S71|Q96S72|Q96S73|Q99994	Silent	SNP	ENST00000248633.4	37	CCDS5627.1																																																																																			.		0.408	PEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254066.3	NM_000466	
TUSC3	7991	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	15508312	15508312	+	Missense_Mutation	SNP	G	G	A	rs371225890		TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr8:15508312G>A	ENST00000503731.1	+	3	563	c.415G>A	c.(415-417)Gtt>Att	p.V139I	TUSC3_ENST00000382020.4_Missense_Mutation_p.V139I|TUSC3_ENST00000503191.1_Intron|TUSC3_ENST00000509380.1_Missense_Mutation_p.V139I|TUSC3_ENST00000506802.1_Missense_Mutation_p.V139I	NM_006765.3	NP_006756.2	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3	139	Thioredoxin.				cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cognition (GO:0050890)|magnesium ion transport (GO:0015693)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|oligosaccharyltransferase complex (GO:0008250)	magnesium ion transmembrane transporter activity (GO:0015095)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(10)|ovary(2)	28				Colorectal(111;0.113)		GGGGACAGACGTTTTTCAGCA	0.343																																					p.V139I		.											.	TUSC3-516	0			c.G415A						.	G	ILE/VAL,ILE/VAL	0,4406		0,0,2203	239.0	237.0	238.0		415,415	3.7	1.0	8		238	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense	TUSC3	NM_006765.3,NM_178234.2	29,29	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign,benign	139/349,139/348	15508312	2,13004	2203	4300	6503	SO:0001583	missense	7991	exon3			ACAGACGTTTTTC	AK026149	CCDS5993.1, CCDS5994.1	8p22	2010-10-22			ENSG00000104723	ENSG00000104723			30242	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 3 homolog A (S. cerevisiae)"""	601385				8661104, 10097140	Standard	NM_178234		Approved	MGC13453, N33, OST3A, MRT7	uc003wwt.3	Q13454	OTTHUMG00000094803	ENST00000503731.1:c.415G>A	8.37:g.15508312G>A	ENSP00000424544:p.Val139Ile	Somatic	163	0		WXS	Illumina HiSeq	Phase_I	222	96	NM_178234	0	0	0	0	0	A8MSM0|D3DSP2|Q14911|Q14912|Q96FW0	Missense_Mutation	SNP	ENST00000503731.1	37	CCDS5994.1	.	.	.	.	.	.	.	.	.	.	G	19.34	3.809796	0.70797	0.0	2.33E-4	ENSG00000104723	ENST00000382020;ENST00000506802;ENST00000509380;ENST00000503731	T;T;T;T	0.38722	1.12;1.12;1.12;1.12	5.47	3.67	0.42095	Thioredoxin domain (1);Thioredoxin-like fold (2);	0.162707	0.53938	N	0.000046	T	0.55893	0.1949	M	0.66297	2.02	0.44323	D	0.997205	D;D;D;D;D;B	0.65815	0.971;0.995;0.981;0.977;0.995;0.004	P;P;D;P;P;B	0.65010	0.838;0.771;0.931;0.613;0.784;0.007	T	0.51411	-0.8709	10	0.27082	T	0.32	-11.5841	10.6624	0.45710	0.0719:0.1325:0.7956:0.0	.	139;139;139;139;139;139	D6RDV0;D6RIY7;Q13454-2;Q13454;D6RA37;A8MSM0	.;.;.;TUSC3_HUMAN;.;.	I	139	ENSP00000371450:V139I;ENSP00000425777:V139I;ENSP00000423426:V139I;ENSP00000424544:V139I	ENSP00000221167:V139I	V	+	1	0	TUSC3	15552683	1.000000	0.71417	0.993000	0.49108	0.970000	0.65996	7.654000	0.83653	0.780000	0.33566	0.563000	0.77884	GTT	.		0.343	TUSC3-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000365367.1	NM_006765	
PSD3	23362	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	18430149	18430149	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr8:18430149T>A	ENST00000327040.8	-	14	2775	c.2673A>T	c.(2671-2673)aaA>aaT	p.K891N	PSD3_ENST00000286485.8_Missense_Mutation_p.K357N|PSD3_ENST00000523619.1_Missense_Mutation_p.K826N|PSD3_ENST00000440756.2_Missense_Mutation_p.K893N|PSD3_ENST00000428502.2_Missense_Mutation_p.K220N	NM_015310.3	NP_056125.3	Q9NYI0	PSD3_HUMAN	pleckstrin and Sec7 domain containing 3	892	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)		CACAATTGATTTTGTTTATCC	0.433																																					p.K891N		.											.	PSD3-93	0			c.A2673T						.						167.0	173.0	171.0					8																	18430149		2203	4300	6503	SO:0001583	missense	23362	exon14			ATTGATTTTGTTT	AF243495	CCDS34854.1, CCDS43720.1	8p21.3	2013-01-10			ENSG00000156011	ENSG00000156011		"""Pleckstrin homology (PH) domain containing"""	19093	protein-coding gene	gene with protein product		614440					Standard	NM_206909		Approved	KIAA0942, HCA67, EFA6R, DKFZp761K1423	uc003wza.3	Q9NYI0	OTTHUMG00000163711	ENST00000327040.8:c.2673A>T	8.37:g.18430149T>A	ENSP00000324127:p.Lys891Asn	Somatic	115	0		WXS	Illumina HiSeq	Phase_I	225	73	NM_015310	0	0	2	3	1	A6NFQ4|E9KL50|Q6B003|Q9Y2F1	Missense_Mutation	SNP	ENST00000327040.8	37	CCDS43720.1	.	.	.	.	.	.	.	.	.	.	T	17.96	3.516949	0.64634	.	.	ENSG00000156011	ENST00000327040;ENST00000440756;ENST00000286485;ENST00000428502;ENST00000523619	T;T;T;T;T	0.79352	-1.26;-1.26;-1.26;-1.26;-1.26	5.71	2.04	0.26737	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.683311	0.11566	U	0.551222	T	0.74711	0.3752	L	0.48174	1.505	0.39428	D	0.967023	B;B;B;P	0.37688	0.423;0.423;0.048;0.605	P;P;B;B	0.45946	0.498;0.498;0.061;0.388	T	0.69647	-0.5089	10	0.72032	D	0.01	.	4.8511	0.13537	0.0:0.2364:0.1485:0.615	.	891;892;357;220	E9KL50;Q9NYI0;Q9NYI0-3;B4DKF8	.;PSD3_HUMAN;.;.	N	891;893;357;220;826	ENSP00000324127:K891N;ENSP00000401704:K893N;ENSP00000286485:K357N;ENSP00000393228:K220N;ENSP00000430640:K826N	ENSP00000286485:K357N	K	-	3	2	PSD3	18474429	0.972000	0.33761	0.998000	0.56505	0.918000	0.54935	0.105000	0.15333	0.177000	0.19895	-0.297000	0.09499	AAA	.		0.433	PSD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000374867.1	NM_015310	
TRIM35	23087	broad.mit.edu;bcgsc.ca	37	8	27168425	27168425	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr8:27168425G>T	ENST00000305364.4	-	1	411	c.328C>A	c.(328-330)Ctc>Atc	p.L110I	PTK2B_ENST00000544172.1_5'Flank|PTK2B_ENST00000338238.4_5'Flank|TRIM35_ENST00000521253.1_Missense_Mutation_p.L110I|PTK2B_ENST00000397501.1_5'Flank	NM_171982.3	NP_741983.2	Q9UPQ4	TRI35_HUMAN	tripartite motif containing 35	110					apoptotic process (GO:0006915)|innate immune response (GO:0045087)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of apoptotic process (GO:0043065)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|endometrium(6)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	14		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0213)|Epithelial(17;9.34e-10)|Colorectal(74;0.141)		AGGCAGAAGAGGCTGAGCTGT	0.697																																					p.L110I													.	TRIM35-226	0			c.C328A						.						22.0	22.0	22.0					8																	27168425		2199	4295	6494	SO:0001583	missense	23087	exon1			AGAAGAGGCTGAG	AB029021	CCDS6056.2	8p21.2	2013-01-09	2011-01-25		ENSG00000104228	ENSG00000104228		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16285	protein-coding gene	gene with protein product			"""tripartite motif-containing 35"""			11331580, 14662771, 12692137	Standard	XM_005273451		Approved	KIAA1098, MAIR, HLS5	uc003xfl.1	Q9UPQ4	OTTHUMG00000102047	ENST00000305364.4:c.328C>A	8.37:g.27168425G>T	ENSP00000301924:p.Leu110Ile	Somatic	42	0		WXS	Illumina HiSeq	Phase_I	24	9	NM_171982	0	0	5	9	4	Q86XQ0|Q8WVA4	Missense_Mutation	SNP	ENST00000305364.4	37	CCDS6056.2	.	.	.	.	.	.	.	.	.	.	G	16.69	3.192407	0.58017	.	.	ENSG00000104228	ENST00000305364;ENST00000380544;ENST00000521253	T;T	0.49720	0.77;0.77	5.5	-1.23	0.09465	Zinc finger, B-box (3);	0.346454	0.25004	N	0.033883	T	0.40932	0.1137	M	0.75777	2.31	0.23095	N	0.998305	P;B	0.43578	0.811;0.338	B;B	0.42386	0.386;0.205	T	0.35475	-0.9787	10	0.54805	T	0.06	.	1.9426	0.03350	0.1458:0.2389:0.3708:0.2446	.	110;110	E5RGB3;Q9UPQ4	.;TRI35_HUMAN	I	110	ENSP00000301924:L110I;ENSP00000428770:L110I	ENSP00000301924:L110I	L	-	1	0	TRIM35	27224342	0.052000	0.20516	0.066000	0.19879	0.473000	0.32948	0.313000	0.19415	-0.221000	0.09973	0.462000	0.41574	CTC	.		0.697	TRIM35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219848.2	NM_171982	
ZNF395	55893	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	28206721	28206721	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr8:28206721T>C	ENST00000344423.5	-	9	1482	c.1351A>G	c.(1351-1353)Agc>Ggc	p.S451G	ZNF395_ENST00000523202.1_Missense_Mutation_p.S451G|ZNF395_ENST00000523095.1_Missense_Mutation_p.S451G	NM_018660.2	NP_061130.1	Q9H8N7	ZN395_HUMAN	zinc finger protein 395	451					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(5)|large_intestine(6)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.102)|Kidney(114;0.123)|Colorectal(74;0.142)		TGGGGCTCGCTGAAGCTTAGC	0.617																																					p.S451G		.											.	ZNF395-90	0			c.A1351G						.						75.0	79.0	78.0					8																	28206721		2203	4300	6503	SO:0001583	missense	55893	exon9			GCTCGCTGAAGCT	AB044750	CCDS6067.1	8p21	2008-05-02			ENSG00000186918	ENSG00000186918		"""Zinc fingers, C2H2-type"""	18737	protein-coding gene	gene with protein product		609494				14625278	Standard	NM_018660		Approved	PRF-1, HDBP2, PBF, DKFZp434K1210	uc003xgr.3	Q9H8N7	OTTHUMG00000102137	ENST00000344423.5:c.1351A>G	8.37:g.28206721T>C	ENSP00000340494:p.Ser451Gly	Somatic	110	0		WXS	Illumina HiSeq	Phase_I	70	22	NM_018660	0	0	36	53	17	B3KUY7|D3DST4|Q6F6H2|Q9BY72|Q9NPB2|Q9NS57|Q9NS58|Q9NS59	Missense_Mutation	SNP	ENST00000344423.5	37	CCDS6067.1	.	.	.	.	.	.	.	.	.	.	T	11.12	1.544128	0.27563	.	.	ENSG00000186918	ENST00000344423;ENST00000523202;ENST00000523095	T;T;T	0.46063	0.88;0.88;0.88	5.5	4.27	0.50696	.	0.318422	0.40908	D	0.001000	T	0.19046	0.0457	N	0.05487	-0.04	0.80722	D	1	B	0.06786	0.001	B	0.08055	0.003	T	0.09335	-1.0679	10	0.09338	T	0.73	-15.6215	8.8687	0.35303	0.0:0.0:0.189:0.811	.	451	Q9H8N7	ZN395_HUMAN	G	451	ENSP00000340494:S451G;ENSP00000429640:S451G;ENSP00000428452:S451G	ENSP00000340494:S451G	S	-	1	0	ZNF395	28262640	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	3.178000	0.50879	2.099000	0.63709	0.459000	0.35465	AGC	.		0.617	ZNF395-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219976.1		
DGAT1	8694	hgsc.bcm.edu	37	8	145542536	145542536	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr8:145542536T>G	ENST00000332324.4	-	4	650	c.377A>C	c.(376-378)aAg>aCg	p.K126T	DGAT1_ENST00000527438.1_5'Flank|DGAT1_ENST00000531896.1_Missense_Mutation_p.K126T	NM_012079.4	NP_036211.2	O75907	DGAT1_HUMAN	diacylglycerol O-acyltransferase 1	126					acylglycerol acyl-chain remodeling (GO:0036155)|cellular lipid metabolic process (GO:0044255)|diacylglycerol metabolic process (GO:0046339)|glycerophospholipid biosynthetic process (GO:0046474)|lipid storage (GO:0019915)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride metabolic process (GO:0006641)|very-low-density lipoprotein particle assembly (GO:0034379)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	diacylglycerol O-acyltransferase activity (GO:0004144)|retinol O-fatty-acyltransferase activity (GO:0050252)|transferase activity, transferring acyl groups (GO:0016746)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	9	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;7.67e-40)|all cancers(56;7.88e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			ATAGGGATCCTTCAGGAACAG	0.647																																					p.K126T		.											.	.	0			c.A377C						.						29.0	32.0	31.0					8																	145542536		2202	4300	6502	SO:0001583	missense	8694	exon4			GGATCCTTCAGGA	AF059202	CCDS6420.1	8q24.3	2014-05-06	2010-06-24	2001-11-09	ENSG00000185000	ENSG00000185000	2.3.1.20		2843	protein-coding gene	gene with protein product		604900	"""diacylglycerol O-acyltransferase homolog 1 (mouse)"""			9756920	Standard	NM_012079		Approved	ARGP1, DGAT	uc003zbv.3	O75907	OTTHUMG00000174606	ENST00000332324.4:c.377A>C	8.37:g.145542536T>G	ENSP00000332258:p.Lys126Thr	Somatic	37	0		WXS	Illumina HiSeq	Phase_I	31	2	NM_012079	0	0	36	36	0	B2RWQ2|D3DWL6|Q96BB8	Missense_Mutation	SNP	ENST00000332324.4	37	CCDS6420.1	.	.	.	.	.	.	.	.	.	.	T	14.95	2.689514	0.48097	.	.	ENSG00000185000	ENST00000332324;ENST00000526479;ENST00000531896	T;T	0.34472	1.36;1.36	5.32	5.32	0.75619	.	0.051216	0.85682	D	0.000000	T	0.46927	0.1418	L	0.50333	1.59	0.53005	D	0.999964	D;B	0.53885	0.963;0.126	P;B	0.56434	0.798;0.035	T	0.33777	-0.9855	10	0.34782	T	0.22	-12.7583	13.226	0.59914	0.0:0.0:0.0:1.0	.	126;126	E9PS80;O75907	.;DGAT1_HUMAN	T	126	ENSP00000332258:K126T;ENSP00000432795:K126T	ENSP00000332258:K126T	K	-	2	0	DGAT1	145513344	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.881000	0.56152	2.025000	0.59659	0.454000	0.30748	AAG	.		0.647	DGAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382059.3	NM_012079	
ARID3C	138715	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	34622092	34622092	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr9:34622092C>T	ENST00000378909.2	-	6	1155	c.1063G>A	c.(1063-1065)Ggg>Agg	p.G355R	DCTN3_ENST00000259632.7_5'Flank|DCTN3_ENST00000341694.2_5'Flank|DCTN3_ENST00000447983.2_5'Flank|DCTN3_ENST00000378916.4_5'Flank|DCTN3_ENST00000378913.2_5'Flank|DCTN3_ENST00000477738.2_5'Flank	NM_001017363.1	NP_001017363.1	A6NKF2	ARI3C_HUMAN	AT rich interactive domain 3C (BRIGHT-like)	355	Pro-rich.|REKLES. {ECO:0000255|PROSITE- ProRule:PRU00819}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane raft (GO:0045121)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)	14	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.175)		TTAAGAGGCCCATCCAGCCGC	0.517																																					p.G355R		.											.	ARID3C-91	0			c.G1063A						.						91.0	84.0	87.0					9																	34622092		2203	4300	6503	SO:0001583	missense	138715	exon6			GAGGCCCATCCAG		CCDS35006.1	9p13.2	2013-02-07	2006-11-08		ENSG00000205143	ENSG00000205143		"""-"""	21209	protein-coding gene	gene with protein product			"""AT rich interactive domain 3C (BRIGHT- like)"""				Standard	NM_001017363		Approved		uc011lon.2	A6NKF2	OTTHUMG00000000445	ENST00000378909.2:c.1063G>A	9.37:g.34622092C>T	ENSP00000368189:p.Gly355Arg	Somatic	184	0		WXS	Illumina HiSeq	Phase_I	130	44	NM_001017363	0	0	0	0	0		Missense_Mutation	SNP	ENST00000378909.2	37	CCDS35006.1	.	.	.	.	.	.	.	.	.	.	C	13.77	2.335039	0.41398	.	.	ENSG00000205143	ENST00000378909	T	0.41065	1.01	5.03	5.03	0.67393	REKLES domain (1);	0.000000	0.47093	D	0.000254	T	0.35856	0.0946	L	0.51422	1.61	0.29866	N	0.827257	P	0.39831	0.69	B	0.35727	0.209	T	0.32481	-0.9905	10	0.17369	T	0.5	-15.5988	15.9067	0.79436	0.0:1.0:0.0:0.0	.	355	A6NKF2	ARI3C_HUMAN	R	355	ENSP00000368189:G355R	ENSP00000368189:G355R	G	-	1	0	ARID3C	34612092	0.960000	0.32886	1.000000	0.80357	0.988000	0.76386	1.491000	0.35583	2.612000	0.88384	0.549000	0.68633	GGG	.		0.517	ARID3C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348265.1	XM_071061	
RUSC2	9853	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	35547391	35547391	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr9:35547391G>C	ENST00000455600.1	+	2	1442	c.873G>C	c.(871-873)atG>atC	p.M291I		NM_001135999.1	NP_001129471	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	291						cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)	Rab GTPase binding (GO:0017137)			NS(1)|breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(4)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)			ACAACAAGATGCATGGCACCC	0.582																																					p.M291I		.											.	RUSC2-91	0			c.G873C						.						79.0	70.0	73.0					9																	35547391		2203	4300	6503	SO:0001583	missense	9853	exon2			CAAGATGCATGGC	AB002373	CCDS35008.1	9p13.2	2003-12-02			ENSG00000198853	ENSG00000198853			23625	protein-coding gene	gene with protein product		611053				9205841	Standard	NM_001135999		Approved	KIAA0375	uc003zww.3	Q8N2Y8	OTTHUMG00000019861	ENST00000455600.1:c.873G>C	9.37:g.35547391G>C	ENSP00000393922:p.Met291Ile	Somatic	150	0		WXS	Illumina HiSeq	Phase_I	93	31	NM_014806	0	0	5	14	9	A2RU62|A7E2A9|O15080|Q5W134|Q641Q6|Q6P1W7	Missense_Mutation	SNP	ENST00000455600.1	37	CCDS35008.1	.	.	.	.	.	.	.	.	.	.	G	13.78	2.339018	0.41398	.	.	ENSG00000198853	ENST00000361226;ENST00000455600;ENST00000543478	T;T	0.28069	1.63;1.63	5.61	5.61	0.85477	.	0.089636	0.85682	D	0.000000	T	0.28167	0.0695	L	0.29908	0.895	0.42729	D	0.993703	B	0.24258	0.1	B	0.24541	0.054	T	0.05338	-1.0891	10	0.62326	D	0.03	-8.6538	18.6114	0.91286	0.0:0.0:1.0:0.0	.	291	Q8N2Y8	RUSC2_HUMAN	I	291	ENSP00000355177:M291I;ENSP00000393922:M291I	ENSP00000355177:M291I	M	+	3	0	RUSC2	35537391	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.341000	0.79300	2.649000	0.89929	0.561000	0.74099	ATG	.		0.582	RUSC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052309.1	XM_048462	
NANS	54187	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	100840514	100840514	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr9:100840514A>G	ENST00000210444.5	+	4	558	c.488A>G	c.(487-489)gAc>gGc	p.D163G	TRIM14_ENST00000478530.1_5'Flank|NANS_ENST00000461452.1_3'UTR|TRIM14_ENST00000375098.3_Intron	NM_018946.3	NP_061819.2	Q9NR45	SIAS_HUMAN	N-acetylneuraminic acid synthase	163					lipopolysaccharide biosynthetic process (GO:0009103)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	N-acetylneuraminate synthase activity (GO:0050462)|N-acylneuraminate cytidylyltransferase activity (GO:0008781)|N-acylneuraminate-9-phosphate synthase activity (GO:0047444)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	11		Acute lymphoblastic leukemia(62;0.0559)				CAGTCAATGGACACCATGAAG	0.522																																					p.D163G		.											.	NANS-91	0			c.A488G						.						229.0	181.0	197.0					9																	100840514		2203	4300	6503	SO:0001583	missense	54187	exon4			CAATGGACACCAT	AF161387	CCDS6733.1	9p24.1-p23	2008-07-31	2008-07-31		ENSG00000095380	ENSG00000095380			19237	protein-coding gene	gene with protein product	"""sialic acid synthase"""	605202				10749855	Standard	NM_018946		Approved	SAS	uc004ayc.3	Q9NR45	OTTHUMG00000020341	ENST00000210444.5:c.488A>G	9.37:g.100840514A>G	ENSP00000210444:p.Asp163Gly	Somatic	167	0		WXS	Illumina HiSeq	Phase_I	127	47	NM_018946	0	0	52	63	11	B2RE98|Q8WUV9|Q9BWS6|Q9NVD4	Missense_Mutation	SNP	ENST00000210444.5	37	CCDS6733.1	.	.	.	.	.	.	.	.	.	.	A	10.92	1.487927	0.26686	.	.	ENSG00000095380	ENST00000210444;ENST00000415280	T;T	0.42900	0.96;0.96	5.32	1.49	0.22878	Aldolase-type TIM barrel (1);N-acetylneuraminic acid synthase, N-terminal (1);	0.346769	0.36167	N	0.002757	T	0.16896	0.0406	N	0.02103	-0.685	0.80722	D	1	B	0.06786	0.001	B	0.10450	0.005	T	0.05370	-1.0889	10	0.24483	T	0.36	-13.5844	11.9513	0.52956	0.5778:0.4222:0.0:0.0	.	163	Q9NR45	SIAS_HUMAN	G	163;22	ENSP00000210444:D163G;ENSP00000404107:D22G	ENSP00000210444:D163G	D	+	2	0	NANS	99880335	1.000000	0.71417	0.993000	0.49108	0.969000	0.65631	2.784000	0.47774	0.070000	0.16634	-1.293000	0.01348	GAC	.		0.522	NANS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053359.1	NM_018946	
KLHL4	56062	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	86773063	86773063	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chrX:86773063C>G	ENST00000373119.4	+	1	312	c.167C>G	c.(166-168)tCt>tGt	p.S56C	KLHL4_ENST00000373114.4_Missense_Mutation_p.S56C	NM_019117.4	NP_061990.2	Q9C0H6	KLHL4_HUMAN	kelch-like family member 4	56						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(29)|ovary(2)|prostate(1)|skin(1)	67						AAGAGCCACTCTCGGGACAGA	0.547																																					p.S56C		.											.	KLHL4-133	0			c.C167G						.						77.0	65.0	69.0					X																	86773063		2203	4300	6503	SO:0001583	missense	56062	exon1			GCCACTCTCGGGA	AF284765	CCDS14456.1, CCDS14457.1	Xq21.3	2013-01-30	2013-01-30		ENSG00000102271	ENSG00000102271		"""Kelch-like"", ""BTB/POZ domain containing"""	6355	protein-coding gene	gene with protein product		300348	"""kelch (Drosophila)-like 4"", ""kelch-like 4 (Drosophila)"""			11401425	Standard	NM_019117		Approved	KIAA1687, DKELCHL, KHL4	uc004efa.2	Q9C0H6	OTTHUMG00000021946	ENST00000373119.4:c.167C>G	X.37:g.86773063C>G	ENSP00000362211:p.Ser56Cys	Somatic	16	0		WXS	Illumina HiSeq	Phase_I	31	26	NM_019117	0	0	0	1	1	B2RTW2|Q9Y3J5	Missense_Mutation	SNP	ENST00000373119.4	37	CCDS14457.1	.	.	.	.	.	.	.	.	.	.	C	19.05	3.752200	0.69533	.	.	ENSG00000102271	ENST00000373119;ENST00000373114	T;T	0.76448	-1.02;-0.99	5.05	5.05	0.67936	.	2.035340	0.02405	N	0.081043	D	0.85894	0.5803	L	0.57536	1.79	0.58432	D	0.999993	B;P	0.42973	0.384;0.796	B;P	0.51415	0.345;0.669	T	0.71341	-0.4622	10	0.72032	D	0.01	.	16.3817	0.83467	0.0:1.0:0.0:0.0	.	56;56	Q9C0H6;Q9C0H6-2	KLHL4_HUMAN;.	C	56	ENSP00000362211:S56C;ENSP00000362206:S56C	ENSP00000362206:S56C	S	+	2	0	KLHL4	86659719	1.000000	0.71417	0.968000	0.41197	0.845000	0.48019	6.820000	0.75267	2.327000	0.79052	0.513000	0.50165	TCT	.		0.547	KLHL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057413.1		
NRK	203447	broad.mit.edu	37	X	105167297	105167297	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chrX:105167297A>G	ENST00000243300.9	+	18	3101	c.2798A>G	c.(2797-2799)gAt>gGt	p.D933G	NRK_ENST00000428173.2_Missense_Mutation_p.D934G	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	933	Asp-rich.				activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						actgatggtgatgatgatgat	0.418										HNSCC(51;0.14)																											p.D933G													.	NRK-630	0			c.A2798G						.						60.0	54.0	56.0					X																	105167297		2077	4184	6261	SO:0001583	missense	203447	exon18			ATGGTGATGATGA	BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.2798A>G	X.37:g.105167297A>G	ENSP00000434830:p.Asp933Gly	Somatic	10	0		WXS	Illumina HiSeq	Phase_I	7	2	NM_198465	0	0	0	0	0	Q32ND6|Q5H9K2|Q6ZMP2	Missense_Mutation	SNP	ENST00000243300.9	37		.	.	.	.	.	.	.	.	.	.	a	1.372	-0.585913	0.03827	.	.	ENSG00000123572	ENST00000243300;ENST00000428173	T;T	0.77098	-1.06;-1.07	2.99	2.99	0.34606	.	0.956289	0.08542	N	0.930446	T	0.59998	0.2235	N	0.19112	0.55	0.30768	N	0.743377	P;B	0.39282	0.666;0.312	B;B	0.39068	0.289;0.063	T	0.55471	-0.8136	10	0.06757	T	0.87	.	6.8474	0.23996	1.0:0.0:0.0:0.0	.	601;933	Q7Z2Y5-2;Q7Z2Y5	.;NRK_HUMAN	G	933;934	ENSP00000434830:D933G;ENSP00000438378:D934G	ENSP00000434830:D933G	D	+	2	0	NRK	105053953	0.997000	0.39634	0.399000	0.26333	0.010000	0.07245	0.334000	0.19787	1.420000	0.47138	0.483000	0.47432	GAT	.		0.418	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000106480.6	NM_198465	
GLUD2	2747	ucsc.edu	37	X	120182120	120182120	+	Silent	SNP	C	C	T			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chrX:120182120C>T	ENST00000328078.1	+	1	659	c.582C>T	c.(580-582)acC>acT	p.T194T		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	194					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						AGAACTATACCGAAAATGAAT	0.453																																					p.T194T													.	GLUD2-131	0			c.C582T						.						123.0	96.0	105.0					X																	120182120		2203	4300	6503	SO:0001819	synonymous_variant	2747	exon1			CTATACCGAAAAT	U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.582C>T	X.37:g.120182120C>T		Somatic	72	0		WXS	Illumina HiSeq		81	1	NM_012084	0	0	5	5	0	B2R8G0|Q9UDQ4	Silent	SNP	ENST00000328078.1	37	CCDS14603.1																																																																																			.		0.453	GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058133.1	NM_012084	
CDR1	1038	hgsc.bcm.edu	37	X	139866440	139866440	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chrX:139866440A>G	ENST00000370532.2	-	1	283	c.92T>C	c.(91-93)gTa>gCa	p.V31A		NM_004065.2	NP_004056.2	P51861	CDR1_HUMAN	cerebellar degeneration-related protein 1, 34kDa	31	23 X 6 AA approximate repeats.									breast(1)|endometrium(3)|large_intestine(3)|lung(11)|prostate(2)|skin(4)|urinary_tract(1)	25	Acute lymphoblastic leukemia(192;7.65e-05)	Lung SC(4;0.051)				CAACAAAGGTACGTCTTCCAA	0.448																																					p.V31A		.											.	CDR1-130	0			c.T92C						.						171.0	162.0	165.0					X																	139866440		2203	4300	6503	SO:0001583	missense	1038	exon1			AAAGGTACGTCTT		CCDS14670.1	Xq27.1	2013-06-13	2002-08-29		ENSG00000184258	ENSG00000184258			1798	protein-coding gene	gene with protein product	"""Cerebellar degeneration-related protein-1 (34kD)"""	302650	"""cerebellar degeneration-related protein (34kD)"""	CDR		2326268	Standard	NM_004065		Approved	CDR62A, CDR34	uc004fbg.1	P51861	OTTHUMG00000137398	ENST00000370532.2:c.92T>C	X.37:g.139866440A>G	ENSP00000359563:p.Val31Ala	Somatic	46	2		WXS	Illumina HiSeq	Phase_I	93	6	NM_004065	0	0	1	1	0	Q5JXH6	Missense_Mutation	SNP	ENST00000370532.2	37	CCDS14670.1	.	.	.	.	.	.	.	.	.	.	A	2.772	-0.255469	0.05829	.	.	ENSG00000184258	ENST00000370532	T	0.35048	1.33	1.84	-0.941	0.10402	.	.	.	.	.	T	0.15912	0.0383	N	0.19112	0.55	0.09310	N	1	P	0.35481	0.504	B	0.29598	0.104	T	0.14420	-1.0473	8	.	.	.	.	2.5052	0.04643	0.6001:0.0:0.1643:0.2356	.	31	P51861	CDR1_HUMAN	A	31	ENSP00000359563:V31A	.	V	-	2	0	CDR1	139694106	0.000000	0.05858	0.011000	0.14972	0.002000	0.02628	-0.414000	0.07114	-0.339000	0.08401	-1.671000	0.00744	GTA	.		0.448	CDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058583.1	NM_004065	
RNF165	494470	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	44013351	44013353	+	In_Frame_Del	DEL	CCC	CCC	-			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	CCC	CCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr18:44013351_44013353delCCC	ENST00000269439.7	+	2	311_313	c.260_262delCCC	c.(259-264)accctg>atg	p.87_88TL>M	RNF165_ENST00000543885.1_Intron	NM_152470.2	NP_689683.2	Q6ZSG1	RN165_HUMAN	ring finger protein 165	87							zinc ion binding (GO:0008270)			NS(1)|large_intestine(4)|lung(6)	11				READ - Rectum adenocarcinoma(1;0.0873)		CCGCTGCCCACCCTGCAGTTCCA	0.7																																					p.87_88del		.											.	RNF165-90	0			c.260_262del						.																																			SO:0001651	inframe_deletion	494470	exon2			.	BC012190	CCDS32823.1, CCDS58621.1	18q21.1	2014-01-03			ENSG00000141622	ENSG00000141622		"""RING-type (C3HC4) zinc fingers"""	31696	protein-coding gene	gene with protein product							Standard	NR_046357		Approved	ARKL2, RNF111L2	uc002lcb.1	Q6ZSG1		ENST00000269439.7:c.260_262delCCC	18.37:g.44013351_44013353delCCC	ENSP00000269439:p.Thr87_Leu88delinsMet	Somatic	51	0		WXS	Illumina HiSeq	Phase_I	49	15	NM_152470	0	0	0	0	0	B3KVD1	In_Frame_Del	DEL	ENST00000269439.7	37	CCDS32823.1																																																																																			.		0.700	RNF165-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445358.1	NM_152470	
SAMD4B	55095	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	39868382	39868391	+	Frame_Shift_Del	DEL	TCCCACTGAT	TCCCACTGAT	-	rs149585231		TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	TCCCACTGAT	TCCCACTGAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr19:39868382_39868391delTCCCACTGAT	ENST00000314471.6	+	10	2397_2406	c.1362_1371delTCCCACTGAT	c.(1360-1371)gctcccactgatfs	p.APTD454fs	SAMD4B_ENST00000598913.1_Frame_Shift_Del_p.APTD454fs|SAMD4B_ENST00000596368.1_Intron	NM_018028.2	NP_060498.2	Q5PRF9	SMAG2_HUMAN	sterile alpha motif domain containing 4B	454					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(1)|endometrium(5)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(2)	15	all_cancers(60;2.5e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;9.6e-28)|all cancers(26;9.14e-25)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)			CAGCTCCAGCTCCCACTGATGGCAGTGAGC	0.648																																					p.454_457del		.											.	SAMD4B-90	0			c.1362_1371del						.																																			SO:0001589	frameshift_variant	55095	exon10			.		CCDS33020.1	19q13.2	2013-01-10				ENSG00000179134		"""Sterile alpha motif (SAM) domain containing"""	25492	protein-coding gene	gene with protein product	"""smaug homolog B (Drosophila)"""					16221671	Standard	XM_005259029		Approved	FLJ10211, MGC99832, SMGB, hSmaug2	uc002olb.3	Q5PRF9		ENST00000314471.6:c.1362_1371delTCCCACTGAT	19.37:g.39868382_39868391delTCCCACTGAT	ENSP00000317224:p.Ala454fs	Somatic	110	0		WXS	Illumina HiSeq	Phase_I	61	10	NM_018028	0	0	0	0	0	A5Z0M6|Q6P194	Frame_Shift_Del	DEL	ENST00000314471.6	37	CCDS33020.1																																																																																			.		0.648	SAMD4B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464467.1	NM_018028	
DALRD3	55152	broad.mit.edu	37	3	49055671	49055671	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr3:49055671delG	ENST00000341949.4	-	2	252	c.246delC	c.(244-246)cccfs	p.P82fs	DALRD3_ENST00000440857.1_5'UTR|DALRD3_ENST00000441576.2_Frame_Shift_Del_p.P82fs|MIR191_ENST00000384873.1_RNA|NDUFAF3_ENST00000395458.2_5'Flank|DALRD3_ENST00000496568.1_5'UTR|DALRD3_ENST00000395462.4_5'UTR|NDUFAF3_ENST00000326925.6_5'Flank|DALRD3_ENST00000313778.5_5'UTR|NDUFAF3_ENST00000326912.4_5'Flank|MIR425_ENST00000362162.1_RNA	NM_001009996.1	NP_001009996.1	Q5D0E6	DALD3_HUMAN	DALR anticodon binding domain containing 3	82					arginyl-tRNA aminoacylation (GO:0006420)		arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)			breast(2)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		ACAGACCCGCGGGGGTCGGCG	0.741																																					p.P82fs													.	DALRD3-90	0			c.246delC						.						3.0	4.0	4.0					3																	49055671		1719	3615	5334	SO:0001589	frameshift_variant	55152	exon2			ACCCGCGGGGGTC	BC014099	CCDS2783.1, CCDS33754.1, CCDS63632.1	3p21.31	2005-01-10			ENSG00000178149	ENSG00000178149			25536	protein-coding gene	gene with protein product						12477932	Standard	NM_001009996		Approved	FLJ10496	uc003cvk.2	Q5D0E6	OTTHUMG00000156748	ENST00000341949.4:c.246delC	3.37:g.49055671delG	ENSP00000344989:p.Pro82fs	Somatic	5	0		WXS	Illumina HiSeq	Phase_I	6	2	NM_001009996	0	0	0	0	0	Q7Z5S7|Q86WY1|Q8N105|Q8NA89|Q9NVU8	Frame_Shift_Del	DEL	ENST00000341949.4	37	CCDS33754.1																																																																																			.		0.741	DALRD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345581.1	NM_018114	
PROM1	8842	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	15989284	15989287	+	Splice_Site	DEL	ACCA	ACCA	-			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	ACCA	ACCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr4:15989284_15989287delACCA	ENST00000510224.1	-	20	2377_2379	c.2129_2131delTGGT	c.(2128-2133)ttggta>tta	p.V711fs	PROM1_ENST00000540805.1_Splice_Site_p.V711fs|PROM1_ENST00000505450.1_Splice_Site_p.V702fs|PROM1_ENST00000447510.2_Splice_Site_p.V711fs|PROM1_ENST00000543373.1_Splice_Site_p.V702fs|PROM1_ENST00000539194.1_Splice_Site_p.V711fs|PROM1_ENST00000508167.1_Splice_Site_p.V702fs			O43490	PROM1_HUMAN	prominin 1	711					camera-type eye photoreceptor cell differentiation (GO:0060219)|glomerular parietal epithelial cell differentiation (GO:0072139)|glomerular visceral epithelial cell differentiation (GO:0072112)|photoreceptor cell maintenance (GO:0045494)|positive regulation of nephron tubule epithelial cell differentiation (GO:2000768)|retina layer formation (GO:0010842)|retina morphogenesis in camera-type eye (GO:0060042)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actinin binding (GO:0042805)|cadherin binding (GO:0045296)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|liver(1)|lung(11)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(2)	35						GTAAACCCTTACCAACAATCCATT	0.343																																					p.710_710del		.											.	PROM1-207	0			c.2129_2130del						.																																			SO:0001630	splice_region_variant	8842	exon19			.	AF027208	CCDS47029.1, CCDS54746.1, CCDS54747.1, CCDS54748.1	4p15	2013-06-06	2001-11-28	2003-03-28	ENSG00000007062	ENSG00000007062		"""CD molecules"""	9454	protein-coding gene	gene with protein product		604365	"""prominin (mouse)-like 1"", ""macular dystrophy, retinal 2"", ""Stargardt disease 4 (autosomal dominant)"""	PROML1, MCDR2, STGD4		11467842	Standard	NM_006017		Approved	AC133, CD133, RP41, CORD12	uc003goo.2	O43490	OTTHUMG00000160180	ENST00000510224.1:c.2130+1TGGT>-	4.37:g.15989284_15989287delACCA		Somatic	228	0		WXS	Illumina HiSeq	Phase_I	233	69	NM_006017	0	0	0	0	0	Q6SV49|Q6SV50|Q6SV51|Q6SV52|Q6SV53|Q96EN6	Frame_Shift_Del	DEL	ENST00000510224.1	37	CCDS47029.1																																																																																			.		0.343	PROM1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359595.2	NM_006017	Frame_Shift_Del
HDGF	3068	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	156715103	156715104	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr1:156715103_156715104insA	ENST00000357325.5	-	2	463_464	c.149_150insT	c.(148-150)ttcfs	p.F50fs	HDGF_ENST00000416666.2_Frame_Shift_Ins_p.F18fs|HDGF_ENST00000537739.1_Frame_Shift_Ins_p.F50fs|HDGF_ENST00000465180.1_5'UTR|HDGF_ENST00000368206.5_Frame_Shift_Ins_p.F66fs|HDGF_ENST00000368209.5_Frame_Shift_Ins_p.F43fs	NM_004494.2	NP_004485.1	P51858	HDGF_HUMAN	hepatoma-derived growth factor	50	PWWP. {ECO:0000255|PROSITE- ProRule:PRU00162}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to nucleus (GO:0034504)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription corepressor binding (GO:0001222)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9	all_hematologic(923;0.088)|Hepatocellular(266;0.158)	Breast(1374;0.198)		Colorectal(1306;0.018)		CGTGGGTCCCGAAAAAAAAGAC	0.564																																					p.F66fs		.											.	HDGF-226	0			c.198_199insT						.																																			SO:0001589	frameshift_variant	3068	exon2			.	D16431	CCDS1156.1, CCDS44247.1, CCDS44248.1	1q23.1	2013-10-14	2010-03-19		ENSG00000143321	ENSG00000143321			4856	protein-coding gene	gene with protein product	"""high-mobility group protein 1-like"""	600339	"""hepatoma-derived growth factor (high-mobility group protein 1-like)"""			8833162	Standard	NM_004494		Approved	HMG1L2	uc001fpy.4	P51858	OTTHUMG00000041295	ENST00000357325.5:c.150dupT	1.37:g.156715111_156715111dupA	ENSP00000349878:p.Phe50fs	Somatic	42	0		WXS	Illumina HiSeq	Phase_I	21	13	NM_001126050	0	0	0	0	0	B3KU21|D3DVC9|Q5SZ07|Q5SZ08|Q5SZ09	Frame_Shift_Ins	INS	ENST00000357325.5	37	CCDS1156.1																																																																																			.		0.564	HDGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098946.1	NM_004494	
MAST3	23031	broad.mit.edu;bcgsc.ca	37	19	18254602	18254603	+	Frame_Shift_Ins	INS	-	-	CT			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr19:18254602_18254603insCT	ENST00000262811.6	+	21	2282_2283	c.2282_2283insCT	c.(2281-2286)tcctgtfs	p.C762fs	AC007192.6_ENST00000600364.2_RNA	NM_015016.1	NP_055831.1	O60307	MAST3_HUMAN	microtubule associated serine/threonine kinase 3	762							ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(6)|ovary(4)|pancreas(1)|stomach(1)	31						TCTGGATCCTCCTGTCAGTCAT	0.599																																					p.S761fs													.	MAST3-502	0			c.2282_2283insCT						.																																			SO:0001589	frameshift_variant	23031	exon21			GATCCTCCTGTCA	AB011133	CCDS46014.1	19p13	2008-02-05				ENSG00000099308			19036	protein-coding gene	gene with protein product		612258					Standard	NM_015016		Approved	KIAA0561	uc002nhz.4	O60307		ENST00000262811.6:c.2283_2284dupCT	19.37:g.18254603_18254604dupCT	ENSP00000262811:p.Cys762fs	Somatic	37	0		WXS	Illumina HiSeq	Phase_I	23	9	NM_015016	0	0	0	0	0	Q7LDZ8|Q9UPI0	Frame_Shift_Ins	INS	ENST00000262811.6	37	CCDS46014.1																																																																																			.		0.599	MAST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466526.2	XM_038150	
HAO1	54363	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	7886831	7886832	+	In_Frame_Ins	INS	-	-	TTT			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr20:7886831_7886832insTTT	ENST00000378789.3	-	4	741_742	c.690_691insAAA	c.(688-693)tcattg>tcaAAAttg	p.230_231SL>SKL		NM_017545.2	NP_060015.1	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase (glycolate oxidase) 1	230	FMN hydroxy acid dehydrogenase. {ECO:0000255|PROSITE-ProRule:PRU00683}.				cellular nitrogen compound metabolic process (GO:0034641)|fatty acid alpha-oxidation (GO:0001561)|glycolate catabolic process (GO:0046296)|glyoxylate metabolic process (GO:0046487)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	(S)-2-hydroxy-acid oxidase activity (GO:0003973)|FMN binding (GO:0010181)|glycolate oxidase activity (GO:0008891)|glyoxylate oxidase activity (GO:0047969)|long-chain-(S)-2-hydroxy-long-chain-acid oxidase activity (GO:0052853)|medium-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052854)|receptor binding (GO:0005102)|very-long-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052852)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						ACAATTGGCAATGATGTCAGTC	0.386																																					p.L231delinsKL		.											.	HAO1-93	0			c.691_692insAAA						.																																			SO:0001652	inframe_insertion	54363	exon4			.	AL021879	CCDS13100.1	20p12	2005-01-10			ENSG00000101323	ENSG00000101323	1.1.3.15		4809	protein-coding gene	gene with protein product		605023		GOX1		9891009	Standard	NM_017545		Approved	GOX	uc002wmw.1	Q9UJM8	OTTHUMG00000031841	ENST00000378789.3:c.690_691insAAA	20.37:g.7886831_7886832insTTT	ENSP00000368066:p.Ser230_Leu231insLys	Somatic	120	0		WXS	Illumina HiSeq	Phase_I	183	51	NM_017545	0	0	0	0	0	Q14CQ0|Q9UPZ0|Q9Y3I7	In_Frame_Ins	INS	ENST00000378789.3	37	CCDS13100.1																																																																																			.		0.386	HAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077926.2		
BPIFB2	80341	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	31604905	31604906	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr20:31604905_31604906insT	ENST00000170150.3	+	7	769_770	c.574_575insT	c.(574-576)attfs	p.I192fs		NM_025227.1	NP_079503.1	Q8N4F0	BPIB2_HUMAN	BPI fold containing family B, member 2	192						extracellular vesicular exosome (GO:0070062)	lipid binding (GO:0008289)										GGGCACCTTAATTGGTAAGATC	0.619																																					p.I192fs		.											.	.	0			c.574_575insT						.																																			SO:0001589	frameshift_variant	80341	exon7			.	AF465765	CCDS13210.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000078898	ENSG00000078898		"""BPI fold containing"""	16177	protein-coding gene	gene with protein product		614108	"""bactericidal/permeability-increasing protein-like 1"""	C20orf184, BPIL1		12185532, 21787333	Standard	NM_025227		Approved	dJ726C3.2, LPLUNC2	uc002wyj.4	Q8N4F0	OTTHUMG00000032232	ENST00000170150.3:c.576dupT	20.37:g.31604907_31604907dupT	ENSP00000170150:p.Ile192fs	Somatic	143	0		WXS	Illumina HiSeq	Phase_I	111	35	NM_025227	0	0	0	0	0	Q6UWN3|Q6ZME0|Q8NFQ7	Frame_Shift_Ins	INS	ENST00000170150.3	37	CCDS13210.1																																																																																			.		0.619	BPIFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078652.2	NM_025227	
DOLK	22845	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	131708944	131708945	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr9:131708944_131708945insG	ENST00000372586.3	-	1	953_954	c.638_639insC	c.(637-639)ctgfs	p.L213fs	NUP188_ENST00000372577.2_5'Flank|RP11-101E3.5_ENST00000482796.1_Intron	NM_014908.3	NP_055723.1	Q9UPQ8	DOLK_HUMAN	dolichol kinase	213					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|dolichyl monophosphate biosynthetic process (GO:0043048)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	dolichol kinase activity (GO:0004168)			breast(1)|large_intestine(5)|lung(3)|ovary(1)|urinary_tract(1)	11						CCACCAGTGTCAGAGAGCGCTT	0.55																																					p.L213fs		.											.	DOLK-90	0			c.639_640insC						.																																			SO:0001589	frameshift_variant	22845	exon1			.	AB029017	CCDS6915.1	9q34.13	2014-09-17	2007-02-09	2007-02-09	ENSG00000175283	ENSG00000175283			23406	protein-coding gene	gene with protein product	"""dolichol kinase 1"""	610746	"""transmembrane protein 15"""	TMEM15		12975309, 16923818	Standard	NM_014908		Approved	KIAA1094, DK1	uc004bwr.3	Q9UPQ8	OTTHUMG00000020765	ENST00000372586.3:c.638_639insC	9.37:g.131708944_131708945insG	ENSP00000361667:p.Leu213fs	Somatic	146	0		WXS	Illumina HiSeq	Phase_I	105	36	NM_014908	0	0	0	0	0	Q5SRE6	Frame_Shift_Ins	INS	ENST00000372586.3	37	CCDS6915.1																																																																																			.		0.550	DOLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054515.1	NM_014908	
GAGE2D	729408	broad.mit.edu	37	X	49208295	49208296	+	In_Frame_Ins	INS	-	-	TAT	rs372553636		TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chrX:49208295_49208296insTAT	ENST00000404720.2	+	2	96_97	c.24_25insTAT	c.(25-27)tat>TATtat	p.9_9Y>YY		NM_001098407.1|NM_012196.1	NP_001091877.1|NP_036328.1	Q9UEU5	GGE2D_HUMAN	G antigen 2D	9					cellular defense response (GO:0006968)												GAAGATCGACCTATCGGCCTAG	0.465														477	0.126358	0.031	0.098	3775	,	,		26951	0.0972		0.1441	False		,,,				2504	0.1278				p.T8delinsTY													.	.	0			c.24_25insTAT						.			10,505,1500		1,1,3,4,46,330,82,490,187						-1.1	0.0			8	27,1244,2482		1,3,16,6,128,539,446,675,577	no	codingComplex	GAGE2D	NM_001098407.1		2,4,19,10,174,869,528,1165,764	A1A1,A1A2,A1R,A1,A2A2,A2R,A2,RR,R		33.8662,25.5583,30.9639				37,1749,3982				SO:0001652	inframe_insertion	729447	exon2			ATCGACCTATCGG			Xp11.23	2012-10-02			ENSG00000240257				31959	protein-coding gene	gene with protein product		300735					Standard	NM_001098407		Approved	GAGE8		Q9UEU5	OTTHUMG00000067393	ENST00000404720.2:c.25_27dupTAT	X.37:g.49208296_49208298dupTAT	ENSP00000386110:p.Tyr9dup	Somatic	601	0		WXS	Illumina HiSeq	Phase_I	542	2	NM_001127212	0	0	0	0	0	A6NG46|A6NNR8|B7ZL76|Q4V325	In_Frame_Ins	INS	ENST00000404720.2	37	CCDS43941.1																																																																																			.		0.465	GAGE2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000144212.1	NM_001098407	
COL18A1	80781	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	21	46911142	46911143	+	Missense_Mutation	DNP	GA	GA	AT			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	GA	GA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr21:46911142_46911143GA>AT	ENST00000359759.4	+	21	3337_3338	c.3316_3317GA>AT	c.(3316-3318)GAt>ATt	p.D1106I	COL18A1_ENST00000355480.5_Missense_Mutation_p.D871I|COL18A1_ENST00000400337.2_Missense_Mutation_p.D691I			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	1106	Triple-helical region 4 (COL4).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		CTTCCAGGGAGATCCAGGGAAG	0.698																																					p.D1106I		.											.	COL18A1	0			c.A2612T						.																																			SO:0001583	missense	80781	exon21			AGGGAGATCCAGG		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	Exception_encountered	21.37:g.46911142_46911143delinsAT	ENSP00000352798:p.Asp1106Ile	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	18.0		0	0	0	0	0	A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Missense_Mutation	DNP	ENST00000359759.4	37																																																																																				.		0.698	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206827.1		
CCT7	10574	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	73471795	73471796	+	Nonsense_Mutation	DNP	GC	GC	TT			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr2:73471795_73471796GC>TT	ENST00000258091.5	+	6	711_712	c.570_571GC>TT	c.(568-573)ctGCag>ctTTag	p.Q191*	CCT7_ENST00000473786.1_3'UTR|CCT7_ENST00000537131.1_Nonsense_Mutation_p.Q91*|CCT7_ENST00000539919.1_Nonsense_Mutation_p.Q147*|CCT7_ENST00000398422.2_Intron|CCT7_ENST00000538797.1_Nonsense_Mutation_p.Q63*|CCT7_ENST00000540468.1_Nonsense_Mutation_p.Q104*	NM_006429.3	NP_006420.1	Q99832	TCPH_HUMAN	chaperonin containing TCP1, subunit 7 (eta)	191					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)			breast(1)|cervix(1)|endometrium(1)|lung(3)|stomach(1)	7						ATGATTTGCTGCAGCTTAAAAT	0.495																																					p.Q191*													.	CCT7-90	0			c.C571T						.																																			SO:0001587	stop_gained	10574	exon6			TTGCTGCAGCTTA	AF026292	CCDS42696.1, CCDS46336.1, CCDS54366.1, CCDS54367.1	2p13.2	2011-09-02			ENSG00000135624	ENSG00000135624		"""Heat Shock Proteins / Chaperonins"""	1622	protein-coding gene	gene with protein product		605140				9819444	Standard	NM_006429		Approved	Ccth, Nip7-1	uc002siz.3	Q99832	OTTHUMG00000152765	Exception_encountered	2.37:g.73471795_73471796delinsTT	ENSP00000258091:p.Gln191*	Somatic	40	0		WXS	Illumina HiSeq	Phase_I	35	11	NM_006429	0	0	0	0	0	A8K7E6|A8MWI8|B7WNW9|B7Z4T9|B7Z4Z7|O14871|Q6FI26	Nonsense_Mutation	DNP	ENST00000258091.5	37	CCDS46336.1																																																																																			.		0.495	CCT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327714.2		
