#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CPSF3L	54973	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	1248497	1248497	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr1:1248497A>G	ENST00000435064.1	-	11	1131	c.1049T>C	c.(1048-1050)aTg>aCg	p.M350T	CPSF3L_ENST00000450926.2_Missense_Mutation_p.M328T|CPSF3L_ENST00000462432.1_5'UTR|CPSF3L_ENST00000545578.1_Missense_Mutation_p.M321T|CPSF3L_ENST00000421495.2_Missense_Mutation_p.M92T|CPSF3L_ENST00000540437.1_Missense_Mutation_p.M356T|CPSF3L_ENST00000411962.1_Missense_Mutation_p.M252T|CPSF3L_ENST00000419704.1_Missense_Mutation_p.M249T	NM_001256460.1|NM_017871.5	NP_001243389.1|NP_060341.2	Q5TA45	INT11_HUMAN	cleavage and polyadenylation specific factor 3-like	350					snRNA processing (GO:0016180)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|integrator complex (GO:0032039)	hydrolase activity (GO:0016787)			endometrium(4)|kidney(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(3)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;6.71e-35)|OV - Ovarian serous cystadenocarcinoma(86;4.35e-21)|Colorectal(212;0.000166)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.00235)|BRCA - Breast invasive adenocarcinoma(365;0.00255)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0349)|Lung(427;0.201)		GTAGCCGGGCATGATGACCTG	0.677																																					p.M356T		.											.	CPSF3L-90	0			c.T1067C						.						22.0	21.0	21.0					1																	1248497		2196	4288	6484	SO:0001583	missense	54973	exon13			CCGGGCATGATGA	AL136813	CCDS21.1, CCDS57959.1, CCDS57960.1, CCDS57961.1, CCDS72678.1	1p36.33	2008-02-05			ENSG00000127054	ENSG00000127054			26052	protein-coding gene	gene with protein product	"""integrator complex subunit 11"""	611354				15684398, 16239144	Standard	NM_001256456		Approved	FLJ20542, RC-68, CPSF73L, INT11, INTS11	uc001aee.2	Q5TA45	OTTHUMG00000003330	ENST00000435064.1:c.1049T>C	1.37:g.1248497A>G	ENSP00000413493:p.Met350Thr	Somatic	37	0		WXS	Illumina HiSeq	Phase_I	31	12	NM_001256456	0	0	4	7	3	A8K5S2|B3KPR3|B4DM87|G3V1S5|Q5TA46|Q5TA48|Q5TA52|Q5TA53|Q5TA54|Q7L3D7|Q96HY1|Q9BW36|Q9H0F9|Q9H8R5|Q9HAA6|Q9NWX9	Missense_Mutation	SNP	ENST00000435064.1	37	CCDS21.1	.	.	.	.	.	.	.	.	.	.	A	17.07	3.295485	0.60086	.	.	ENSG00000127054	ENST00000435064;ENST00000411962;ENST00000294579;ENST00000419704;ENST00000540437;ENST00000450926;ENST00000545578	T;T;T;T;T	0.46451	0.95;0.95;0.95;0.95;0.87	5.48	5.48	0.80851	Beta-Casp domain (1);	0.000000	0.85682	D	0.000000	T	0.62085	0.2399	M	0.78049	2.395	0.80722	D	1	P;P;P;P;P;P	0.51933	0.696;0.741;0.949;0.936;0.837;0.741	P;P;P;P;P;P	0.57960	0.535;0.665;0.83;0.738;0.617;0.665	T	0.67632	-0.5621	10	0.87932	D	0	-54.7181	15.5355	0.75998	1.0:0.0:0.0:0.0	.	328;321;252;249;356;350	Q5TA45-3;B4DM87;C9IYS7;Q5TA45-2;G3V1S5;Q5TA45	.;.;.;.;.;INT11_HUMAN	T	350;252;243;249;356;328;321	ENSP00000413493:M350T;ENSP00000404886:M249T;ENSP00000445001:M356T;ENSP00000392848:M328T;ENSP00000444672:M321T	ENSP00000294579:M243T	M	-	2	0	CPSF3L	1238360	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	8.568000	0.90741	2.077000	0.62373	0.460000	0.39030	ATG	.		0.677	CPSF3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009360.2	NM_017871	
PLCH2	9651	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	2430213	2430213	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr1:2430213A>G	ENST00000419816.2	+	18	2654	c.2380A>G	c.(2380-2382)Att>Gtt	p.I794V	PLCH2_ENST00000378486.3_Missense_Mutation_p.I794V|PLCH2_ENST00000378488.3_Missense_Mutation_p.I758V|PLCH2_ENST00000449969.1_Missense_Mutation_p.I767V|PLCH2_ENST00000288766.5_Missense_Mutation_p.I82V			O75038	PLCH2_HUMAN	phospholipase C, eta 2	794	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(3)|skin(1)	20	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)		GGTGGAGATCATTGGGCTCCC	0.657																																					p.I794V		.											.	PLCH2-229	0			c.A2380G						.						28.0	32.0	31.0					1																	2430213		2068	4190	6258	SO:0001583	missense	9651	exon18			GAGATCATTGGGC	AB007919	CCDS59959.1	1p36.32	2013-01-10	2006-03-16	2006-03-16	ENSG00000149527	ENSG00000149527	3.1.4.11	"""EF-hand domain containing"""	29037	protein-coding gene	gene with protein product		612836	"""phospholipase C-like 4"""	PLCL4		15899900	Standard	XM_006711054		Approved	KIAA0450, PLCeta2, RP3-395M20.1, PLC-eta2	uc001aji.1	O75038	OTTHUMG00000000719	ENST00000419816.2:c.2380A>G	1.37:g.2430213A>G	ENSP00000389803:p.Ile794Val	Somatic	39	0		WXS	Illumina HiSeq	Phase_I	31	14	NM_014638	0	0	0	0	0	A2VCM3|B9DI80|Q3LUA8|Q86XJ2|Q86XU1|Q86YU7|Q8TEH5|Q8WUS6	Missense_Mutation	SNP	ENST00000419816.2	37		.	.	.	.	.	.	.	.	.	.	A	21.1	4.104041	0.76983	.	.	ENSG00000149527	ENST00000449969;ENST00000378486;ENST00000378488;ENST00000288766;ENST00000378483;ENST00000343889;ENST00000278878	T;T;T;T	0.13538	2.58;2.58;2.58;2.58	4.93	4.93	0.64822	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.25005	0.0607	L	0.28400	0.85	0.48632	D	0.999685	P;P;D;P	0.69078	0.938;0.938;0.997;0.938	P;P;D;P	0.77557	0.679;0.842;0.99;0.842	T	0.01661	-1.1301	10	0.52906	T	0.07	.	13.39	0.60818	1.0:0.0:0.0:0.0	.	641;546;767;794	B9DI81;B9DI82;O75038-2;O75038	.;.;.;PLCH2_HUMAN	V	767;794;758;82;80;641;546	ENSP00000397289:I767V;ENSP00000367747:I794V;ENSP00000367749:I758V;ENSP00000288766:I82V	ENSP00000278878:I546V	I	+	1	0	PLCH2	2420073	1.000000	0.71417	0.993000	0.49108	0.499000	0.33736	5.860000	0.69546	1.845000	0.53610	0.459000	0.35465	ATT	.		0.657	PLCH2-009	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467514.1	NM_014638	
KIAA1522	57648	broad.mit.edu	37	1	33237860	33237860	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr1:33237860G>A	ENST00000373480.1	+	6	3006	c.2903G>A	c.(2902-2904)cGc>cAc	p.R968H	KIAA1522_ENST00000401073.2_Missense_Mutation_p.R1027H|YARS_ENST00000469100.1_5'Flank|KIAA1522_ENST00000294521.3_Intron|KIAA1522_ENST00000373481.3_Missense_Mutation_p.R979H	NM_001198972.1	NP_001185901.1	Q9P206	K1522_HUMAN	KIAA1522	968	Pro-rich.									breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)				CCTGTGGCCCGCAAGCCGTCT	0.662																																					p.R1027H													.	KIAA1522-90	0			c.G3080A						.						30.0	36.0	34.0					1																	33237860		1900	4100	6000	SO:0001583	missense	57648	exon6			TGGCCCGCAAGCC	AL713671	CCDS41298.1, CCDS55588.1, CCDS55589.1	1p35.1	2009-02-18			ENSG00000162522	ENSG00000162522			29301	protein-coding gene	gene with protein product						10819331	Standard	NM_020888		Approved		uc001bvu.1	Q9P206	OTTHUMG00000008088	ENST00000373480.1:c.2903G>A	1.37:g.33237860G>A	ENSP00000362579:p.Arg968His	Somatic	122	0		WXS	Illumina HiSeq	Phase_I	78	5	NM_020888	0	0	57	57	0	B4DQU8|B5MDY0|C9JH84|Q8TCQ0	Missense_Mutation	SNP	ENST00000373480.1	37	CCDS55588.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.043295	0.75732	.	.	ENSG00000162522	ENST00000401073;ENST00000373481;ENST00000373480	T;T;T	0.16597	2.33;2.34;2.35	5.05	4.14	0.48551	.	0.086750	0.45867	D	0.000333	T	0.20941	0.0504	M	0.61703	1.905	0.30845	N	0.73524	D;D;D	0.57257	0.979;0.979;0.979	P;P;P	0.46049	0.502;0.502;0.502	T	0.16541	-1.0399	10	0.46703	T	0.11	-11.6125	8.9717	0.35910	0.2107:0.0:0.7892:0.0	.	979;968;1027	Q9P206-3;Q9P206;Q9P206-2	.;K1522_HUMAN;.	H	1027;979;968	ENSP00000383851:R1027H;ENSP00000362580:R979H;ENSP00000362579:R968H	ENSP00000362579:R968H	R	+	2	0	KIAA1522	33010447	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	3.416000	0.52707	1.503000	0.48686	0.650000	0.86243	CGC	.		0.662	KIAA1522-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022130.1		
HMGB4	127540	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	34329977	34329977	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr1:34329977C>T	ENST00000522796.1	+	4	2090	c.185C>T	c.(184-186)gCc>gTc	p.A62V	HMGB4_ENST00000519684.1_Missense_Mutation_p.A62V|HMGB4_ENST00000425537.1_3'UTR|CSMD2_ENST00000373381.4_Intron			Q8WW32	HMGB4_HUMAN	high mobility group box 4	62						chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(1)|large_intestine(1)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				AAATATGAAGCCCTGGCCAAA	0.463																																					p.A62V		.											.	HMGB4-90	0			c.C185T						.						120.0	135.0	130.0					1																	34329977		2203	4300	6503	SO:0001583	missense	127540	exon2			ATGAAGCCCTGGC		CCDS30668.1	1p35.1	2011-07-01	2011-04-05		ENSG00000176256	ENSG00000176256		"""High-mobility group / Canonical"""	24954	protein-coding gene	gene with protein product			"""high-mobility group box 4"""				Standard	NR_033264		Approved	FLJ40388	uc001bxp.3	Q8WW32	OTTHUMG00000013143	ENST00000522796.1:c.185C>T	1.37:g.34329977C>T	ENSP00000430919:p.Ala62Val	Somatic	189	0		WXS	Illumina HiSeq	Phase_I	133	55	NM_145205	0	0	0	0	0	B2R4X7|Q0QWA4	Missense_Mutation	SNP	ENST00000522796.1	37	CCDS30668.1	.	.	.	.	.	.	.	.	.	.	C	18.07	3.542128	0.65198	.	.	ENSG00000176256	ENST00000519684;ENST00000522796	T;T	0.14144	2.53;2.53	5.58	0.467	0.16721	.	0.232725	0.37053	N	0.002268	T	0.18002	0.0432	M	0.68317	2.08	0.31177	N	0.702474	P	0.40931	0.733	P	0.46758	0.526	T	0.09662	-1.0664	10	0.87932	D	0	.	4.817	0.13372	0.4359:0.4072:0.0:0.1569	.	62	B2R4X7	.	V	62	ENSP00000429214:A62V;ENSP00000430919:A62V	ENSP00000429214:A62V	A	+	2	0	HMGB4	34102564	0.991000	0.36638	0.082000	0.20525	0.854000	0.48673	2.434000	0.44802	-0.049000	0.13379	-0.192000	0.12808	GCC	.		0.463	HMGB4-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375773.1	NM_145205	
SFPQ	6421	broad.mit.edu	37	1	35658464	35658464	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr1:35658464G>T	ENST00000357214.5	-	1	285	c.187C>A	c.(187-189)Ccg>Acg	p.P63T		NM_005066.2	NP_005057.1	P23246	SFPQ_HUMAN	splicing factor proline/glutamine-rich	63	Gln/Glu/Pro-rich.|Poly-Pro.				alternative mRNA splicing, via spliceosome (GO:0000380)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H3 deacetylation (GO:0070932)|mRNA processing (GO:0006397)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902177)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|histone deacetylase binding (GO:0042826)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)		SFPQ/TFE3(6)	NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(4)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.196)				TGTGGAGGCGGTGGCGGGATC	0.711			T	TFE3	papillary renal cell																																p.P63T				Dom	yes		1	1p34.3	6421	splicing factor proline/glutamine rich(polypyrimidine tract binding protein associated)		E	.	SFPQ-231	0			c.C187A						.						12.0	14.0	13.0					1																	35658464		2026	4094	6120	SO:0001583	missense	6421	exon1			GAGGCGGTGGCGG	X70944	CCDS388.1	1p34.3	2014-06-13	2010-05-04		ENSG00000116560	ENSG00000116560		"""RNA binding motif (RRM) containing"""	10774	protein-coding gene	gene with protein product	"""polypyrimidine tract binding protein associated"", ""protein phosphatase 1, regulatory subunit 140"""	605199	"""splicing factor proline/glutamine rich (polypyrimidine tract-binding protein-associated)"""			8449401	Standard	NM_005066		Approved	PSF, PPP1R140	uc001bys.3	P23246	OTTHUMG00000004157	ENST00000357214.5:c.187C>A	1.37:g.35658464G>T	ENSP00000349748:p.Pro63Thr	Somatic	16	0		WXS	Illumina HiSeq	Phase_I	16	4	NM_005066	0	0	7	24	17	P30808|Q5SZ71	Missense_Mutation	SNP	ENST00000357214.5	37	CCDS388.1	.	.	.	.	.	.	.	.	.	.	G	10.60	1.394973	0.25205	.	.	ENSG00000116560	ENST00000357214	T	0.24151	1.87	3.54	1.62	0.23740	.	0.430740	0.23744	N	0.044992	T	0.11452	0.0279	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.19877	-1.0292	10	0.66056	D	0.02	-0.0031	1.1679	0.01819	0.201:0.1743:0.4468:0.1779	.	63	P23246	SFPQ_HUMAN	T	63	ENSP00000349748:P63T	ENSP00000349748:P63T	P	-	1	0	SFPQ	35431051	0.922000	0.31269	0.465000	0.27155	0.454000	0.32378	2.084000	0.41625	0.207000	0.20607	0.485000	0.47835	CCG	.		0.711	SFPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011984.4	NM_005066	
SSBP3	23648	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	54870254	54870254	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr1:54870254C>T	ENST00000371320.3	-	3	596	c.186G>A	c.(184-186)tgG>tgA	p.W62*	SSBP3_ENST00000371319.3_Nonsense_Mutation_p.W62*|SSBP3_ENST00000417664.2_De_novo_Start_OutOfFrame|SSBP3_ENST00000357475.4_Nonsense_Mutation_p.W62*	NM_145716.2	NP_663768.1	Q9BWW4	SSBP3_HUMAN	single stranded DNA binding protein 3	62					head morphogenesis (GO:0060323)|hematopoietic progenitor cell differentiation (GO:0002244)|midbrain-hindbrain boundary initiation (GO:0021547)|positive regulation of anterior head development (GO:2000744)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prechordal plate formation (GO:0021501)|protein complex assembly (GO:0006461)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|protein complex (GO:0043234)	single-stranded DNA binding (GO:0003697)			central_nervous_system(2)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	11						CTTACCACCACCACGAGTGCA	0.507																																					p.W62X		.											.	SSBP3-90	0			c.G186A						.						88.0	76.0	80.0					1																	54870254		2203	4300	6503	SO:0001587	stop_gained	23648	exon3			CCACCACCACGAG		CCDS590.1, CCDS591.1, CCDS30726.1	1p32.3	2008-02-05	2001-11-28		ENSG00000157216	ENSG00000157216			15674	protein-coding gene	gene with protein product		607390	"""single-stranded DNA-binding protein 3"""			12079286	Standard	NM_145716		Approved	CSDP, SSDP, FLJ10355, SSDP1	uc001cxe.4	Q9BWW4	OTTHUMG00000008264	ENST00000371320.3:c.186G>A	1.37:g.54870254C>T	ENSP00000360371:p.Trp62*	Somatic	149	0		WXS	Illumina HiSeq	Phase_I	68	19	NM_001009955	0	0	0	0	0	A8K0A9|Q5T860|Q5T861|Q9BTM0|Q9BWW3	Nonsense_Mutation	SNP	ENST00000371320.3	37	CCDS591.1	.	.	.	.	.	.	.	.	.	.	C	43	10.209365	0.99360	.	.	ENSG00000157216	ENST00000371320;ENST00000371319;ENST00000357475	.	.	.	5.03	5.03	0.67393	.	0.000000	0.64402	U	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.2803	18.3392	0.90299	0.0:1.0:0.0:0.0	.	.	.	.	X	62	.	ENSP00000350067:W62X	W	-	3	0	SSBP3	54642842	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.556000	0.82233	2.502000	0.84385	0.561000	0.74099	TGG	.		0.507	SSBP3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022721.1	NM_018070	
SLC9C2	284525	ucsc.edu	37	1	173490537	173490537	+	Splice_Site	SNP	T	T	C	rs377309633		TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr1:173490537T>C	ENST00000367714.3	-	22	3064	c.2642A>G	c.(2641-2643)gAa>gGa	p.E881G	SLC9C2_ENST00000466087.1_5'UTR	NM_178527.3	NP_848622.2	Q5TAH2	SL9C2_HUMAN	solute carrier family 9, member C2 (putative)	881					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)										TTTGGCTCTTTCCTGAGTGGG	0.313																																					p.E881G													.	.	0			c.A2642G						.	T	GLY/GLU	2,4404	2.1+/-5.4	0,2,2201	54.0	54.0	54.0		2642	5.2	1.0	1		54	0,8598		0,0,4299	no	missense-near-splice	SLC9A11	NM_178527.3	98	0,2,6500	CC,CT,TT		0.0,0.0454,0.0154	probably-damaging	881/1125	173490537	2,13002	2203	4299	6502	SO:0001630	splice_region_variant	284525	exon22			GCTCTTTCCTGAG	AK128104	CCDS1308.1	1q25.1	2013-07-18	2013-07-18	2012-03-22	ENSG00000162753	ENSG00000162753		"""Solute carriers"""	28664	protein-coding gene	gene with protein product			"""solute carrier family 9, isoform 11"", ""solute carrier family 9, member 11"", ""solute carrier family 9, member C2"""	SLC9A11			Standard	NM_178527		Approved	MGC43026	uc001giz.2	Q5TAH2	OTTHUMG00000034800	ENST00000367714.3:c.2641-1A>G	1.37:g.173490537T>C		Somatic	48	0		WXS	Illumina HiSeq		39	4	NM_178527	0	0	0	0	0	Q86UF3	Missense_Mutation	SNP	ENST00000367714.3	37	CCDS1308.1	.	.	.	.	.	.	.	.	.	.	T	15.45	2.838389	0.51057	4.54E-4	0.0	ENSG00000162753	ENST00000367714	T	0.43688	0.94	5.18	5.18	0.71444	Cyclic nucleotide-binding-like (1);Cyclic nucleotide-binding domain (1);	0.217466	0.31909	N	0.006861	T	0.47673	0.1458	M	0.68952	2.095	0.80722	D	1	D	0.69078	0.997	P	0.60789	0.879	T	0.53479	-0.8433	10	0.59425	D	0.04	-12.5633	11.4178	0.49962	0.0:0.0:0.0:1.0	.	881	Q5TAH2	S9A11_HUMAN	G	881	ENSP00000356687:E881G	ENSP00000356687:E881G	E	-	2	0	SLC9A11	171757160	1.000000	0.71417	0.991000	0.47740	0.100000	0.18952	4.140000	0.58031	1.966000	0.57179	0.482000	0.46254	GAA	.		0.313	SLC9C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084205.1	NM_178527	Missense_Mutation
COLGALT2	23127	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	183944269	183944269	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr1:183944269G>C	ENST00000361927.4	-	3	825	c.454C>G	c.(454-456)Ctt>Gtt	p.L152V	COLGALT2_ENST00000546159.1_Missense_Mutation_p.L152V	NM_015101.2	NP_055916.1	Q8IYK4	GT252_HUMAN	collagen beta(1-O)galactosyltransferase 2	152					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)	procollagen galactosyltransferase activity (GO:0050211)										GCAGTTCGAAGGGCTGCCTGT	0.438																																					p.L152V		.											.	.	0			c.C454G						.						119.0	113.0	115.0					1																	183944269		2203	4300	6503	SO:0001583	missense	23127	exon3			TTCGAAGGGCTGC	AF288389	CCDS1360.1	1q25	2013-02-27	2013-02-27	2013-02-27	ENSG00000198756	ENSG00000198756			16790	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 17"", ""glycosyltransferase 25 domain containing 2"""	C1orf17, GLT25D2		19075007	Standard	XM_005245008		Approved	KIAA0584	uc001gqr.3	Q8IYK4	OTTHUMG00000035460	ENST00000361927.4:c.454C>G	1.37:g.183944269G>C	ENSP00000354960:p.Leu152Val	Somatic	150	0		WXS	Illumina HiSeq	Phase_I	99	35	NM_015101	0	0	0	0	0	O60327|Q9BZR0	Missense_Mutation	SNP	ENST00000361927.4	37	CCDS1360.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.519102	0.85495	.	.	ENSG00000198756	ENST00000546159;ENST00000361927	T;T	0.62364	0.03;0.03	5.2	5.2	0.72013	.	0.000000	0.64402	D	0.000001	T	0.80889	0.4710	M	0.89840	3.065	0.80722	D	1	D;D	0.67145	0.993;0.996	P;D	0.67725	0.873;0.953	D	0.84426	0.0574	10	0.87932	D	0	.	12.479	0.55831	0.0768:0.0:0.9232:0.0	.	152;152	F5H3T5;Q8IYK4	.;GT252_HUMAN	V	152	ENSP00000439112:L152V;ENSP00000354960:L152V	ENSP00000354960:L152V	L	-	1	0	GLT25D2	182210892	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.705000	0.84606	2.583000	0.87209	0.650000	0.86243	CTT	.		0.438	COLGALT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086128.1	NM_015101	
HMCN1	83872	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	186083139	186083139	+	Silent	SNP	G	G	A			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr1:186083139G>A	ENST00000271588.4	+	73	11389	c.11160G>A	c.(11158-11160)caG>caA	p.Q3720Q	HMCN1_ENST00000367492.2_Silent_p.Q3720Q	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3720	Ig-like C2-type 36.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GGGGCCCCCAGAGCCTTGTAA	0.423																																					p.Q3720Q		.											.	HMCN1-113	0			c.G11160A						.						114.0	133.0	127.0					1																	186083139		2203	4300	6503	SO:0001819	synonymous_variant	83872	exon73			CCCCCAGAGCCTT	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.11160G>A	1.37:g.186083139G>A		Somatic	278	0		WXS	Illumina HiSeq	Phase_I	208	69	NM_031935	0	0	0	0	0	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	ENST00000271588.4	37	CCDS30956.1																																																																																			.		0.423	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
AKR1C3	8644	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	5139704	5139704	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr10:5139704G>C	ENST00000380554.3	+	3	983	c.331G>C	c.(331-333)Gtt>Ctt	p.V111L	AKR1C3_ENST00000605149.1_Missense_Mutation_p.V88L|AKR1C3_ENST00000439082.2_5'UTR|AKR1C3_ENST00000470862.2_3'UTR	NM_001253908.1|NM_003739.5	NP_001240837.1|NP_003730.4	P42330	AK1C3_HUMAN	aldo-keto reductase family 1, member C3	111					arachidonic acid metabolic process (GO:0019369)|cellular response to cadmium ion (GO:0071276)|cellular response to calcium ion (GO:0071277)|cellular response to corticosteroid stimulus (GO:0071384)|cellular response to jasmonic acid stimulus (GO:0071395)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to reactive oxygen species (GO:0034614)|cellular response to starvation (GO:0009267)|cyclooxygenase pathway (GO:0019371)|daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)|farnesol catabolic process (GO:0016488)|G-protein coupled receptor signaling pathway (GO:0007186)|keratinocyte differentiation (GO:0030216)|male gonad development (GO:0008584)|multicellular organismal macromolecule metabolic process (GO:0044259)|negative regulation of retinoic acid biosynthetic process (GO:1900053)|oxidation-reduction process (GO:0055114)|phototransduction, visible light (GO:0007603)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|progesterone metabolic process (GO:0042448)|prostaglandin metabolic process (GO:0006693)|protein import into nucleus, translocation (GO:0000060)|regulation of retinoic acid receptor signaling pathway (GO:0048385)|regulation of testosterone biosynthetic process (GO:2000224)|renal absorption (GO:0070293)|response to nutrient (GO:0007584)|response to prostaglandin (GO:0034694)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|testosterone biosynthetic process (GO:0061370)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)	15-hydroxyprostaglandin-D dehydrogenase (NADP+) activity (GO:0047020)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|aldo-keto reductase (NADP) activity (GO:0004033)|androsterone dehydrogenase activity (GO:0047023)|delta4-3-oxosteroid 5beta-reductase activity (GO:0047787)|dihydrotestosterone 17-beta-dehydrogenase activity (GO:0035410)|geranylgeranyl reductase activity (GO:0045550)|indanol dehydrogenase activity (GO:0047718)|ketoreductase activity (GO:0045703)|ketosteroid monooxygenase activity (GO:0047086)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|phenanthrene 9,10-monooxygenase activity (GO:0018636)|prostaglandin D2 11-ketoreductase activity (GO:0036131)|prostaglandin F receptor activity (GO:0004958)|prostaglandin-F synthase activity (GO:0047017)|retinal dehydrogenase activity (GO:0001758)|retinol dehydrogenase activity (GO:0004745)|testosterone 17-beta-dehydrogenase (NADP+) activity (GO:0047045)|testosterone dehydrogenase (NAD+) activity (GO:0047035)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|skin(1)	14					Bimatoprost(DB00905)|Doxorubicin(DB00997)	ATTGGACTATGTTGACCTCTA	0.403																																					p.V111L		.											.	AKR1C3-515	0			c.G331C						.						146.0	138.0	141.0					10																	5139704		2203	4300	6503	SO:0001583	missense	8644	exon3			GACTATGTTGACC	L43839	CCDS7063.1, CCDS73062.1	10p15-p14	2012-12-04	2012-12-04		ENSG00000196139	ENSG00000196139	1.1.1.213, 1.1.1.188	"""Aldo-keto reductases"""	386	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase X"", ""prostaglandin F synthase"", ""3-alpha hydroxysteroid dehydrogenase, type II"""	603966	"""hydroxysteroid (17-beta) dehydrogenase 5"", ""aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II)"""	HSD17B5		7650035, 9792917	Standard	NM_003739		Approved	KIAA0119, DDX, HAKRB, PGFS	uc021pml.1	P42330	OTTHUMG00000017585	ENST00000380554.3:c.331G>C	10.37:g.5139704G>C	ENSP00000369927:p.Val111Leu	Somatic	96	0		WXS	Illumina HiSeq	Phase_I	89	40	NM_001253908	0	0	31	80	49	A8K2V0|B4DL37|Q5T2L1|Q96DJ1|Q96KI8|Q99530|Q9UCX1|Q9UII3|Q9UKL9	Missense_Mutation	SNP	ENST00000380554.3	37	CCDS7063.1	.	.	.	.	.	.	.	.	.	.	G	0.014	-1.596157	0.00857	.	.	ENSG00000196139	ENST00000380554	T	0.47528	0.84	1.62	0.671	0.17929	NADP-dependent oxidoreductase domain (3);	0.237158	0.29558	N	0.011809	T	0.23410	0.0566	N	0.17564	0.495	0.80722	D	1	B;B;B	0.23249	0.082;0.005;0.005	B;B;B	0.30251	0.113;0.046;0.046	T	0.06972	-1.0797	10	0.07325	T	0.83	.	4.0982	0.10002	0.3926:0.0:0.6074:0.0	.	111;111;111	B4DKT3;P42330;Q2XPP3	.;AK1C3_HUMAN;.	L	111	ENSP00000369927:V111L	ENSP00000369927:V111L	V	+	1	0	AKR1C3	5129704	1.000000	0.71417	0.072000	0.20136	0.187000	0.23431	2.141000	0.42168	0.234000	0.21139	0.305000	0.20034	GTT	.		0.403	AKR1C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046533.2	NM_003739	
TACR2	6865	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	71175766	71175766	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr10:71175766A>T	ENST00000373306.4	-	1	857	c.314T>A	c.(313-315)tTc>tAc	p.F105Y		NM_001057.2	NP_001048.2	P21452	NK2R_HUMAN	tachykinin receptor 2	105					excretion (GO:0007588)|intestine smooth muscle contraction (GO:0014827)|muscle contraction (GO:0006936)|negative regulation of luteinizing hormone secretion (GO:0033685)|operant conditioning (GO:0035106)|positive regulation of acetylcholine secretion, neurotransmission (GO:0014057)|positive regulation of uterine smooth muscle contraction (GO:0070474)|positive regulation of vascular permeability (GO:0043117)|prolactin secretion (GO:0070459)|tachykinin receptor signaling pathway (GO:0007217)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	substance K receptor activity (GO:0016497)|tachykinin receptor activity (GO:0004995)			endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	11						GAAGTAGCAGAAGGCACGGCC	0.552																																					p.F105Y		.											.	TACR2-522	0			c.T314A						.						92.0	81.0	85.0					10																	71175766		2203	4300	6503	SO:0001583	missense	6865	exon1			TAGCAGAAGGCAC		CCDS7293.1	10q22.1	2012-09-20			ENSG00000075073	ENSG00000075073		"""GPCR / Class A : Tachykinin receptors"""	11527	protein-coding gene	gene with protein product		162321		TAC2R, NKNAR			Standard	NM_001057		Approved	SKR, NK2R	uc001jpn.2	P21452	OTTHUMG00000018377	ENST00000373306.4:c.314T>A	10.37:g.71175766A>T	ENSP00000362403:p.Phe105Tyr	Somatic	53	0		WXS	Illumina HiSeq	Phase_I	43	19	NM_001057	0	0	0	0	0	A8K7I1|Q4QRI5|Q8NGQ8|Q9UDE6|Q9UDE7	Missense_Mutation	SNP	ENST00000373306.4	37	CCDS7293.1	.	.	.	.	.	.	.	.	.	.	A	7.919	0.738168	0.15574	.	.	ENSG00000075073	ENST00000373306	T	0.38240	1.15	5.18	5.18	0.71444	GPCR, rhodopsin-like superfamily (1);	0.063724	0.64402	D	0.000003	T	0.11922	0.0290	N	0.01493	-0.835	0.42246	D	0.99195	B	0.22146	0.065	B	0.20577	0.03	T	0.20140	-1.0284	10	0.02654	T	1	.	10.5582	0.45129	0.8559:0.0:0.0:0.1441	.	105	P21452	NK2R_HUMAN	Y	105	ENSP00000362403:F105Y	ENSP00000362403:F105Y	F	-	2	0	TACR2	70845772	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.205000	0.51090	2.093000	0.63338	0.460000	0.39030	TTC	.		0.552	TACR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048411.1		
MRPL17	63875	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	6703594	6703594	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr11:6703594G>A	ENST00000288937.6	-	3	387	c.283C>T	c.(283-285)Cct>Tct	p.P95S	MRPL17_ENST00000532676.1_5'UTR	NM_022061.3	NP_071344.1	Q9NRX2	RM17_HUMAN	mitochondrial ribosomal protein L17	95					translation (GO:0006412)	mitochondrial inner membrane (GO:0005743)|ribosome (GO:0005840)	protein domain specific binding (GO:0019904)|structural constituent of ribosome (GO:0003735)			lung(4)	4		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TTGTACCGAGGGGCCAGTACT	0.473																																					p.P95S		.											.	MRPL17-90	0			c.C283T						.						115.0	114.0	114.0					11																	6703594		2201	4296	6497	SO:0001583	missense	63875	exon3			ACCGAGGGGCCAG	AB051620	CCDS31412.1	11p15.5-p15.4	2012-09-13				ENSG00000158042		"""Mitochondrial ribosomal proteins / large subunits"""	14053	protein-coding gene	gene with protein product		611830					Standard	NM_022061		Approved	RPML26, MRP-L26	uc001men.2	Q9NRX2		ENST00000288937.6:c.283C>T	11.37:g.6703594G>A	ENSP00000288937:p.Pro95Ser	Somatic	197	0		WXS	Illumina HiSeq	Phase_I	141	48	NM_022061	0	0	42	73	31	D3DQU3|Q6IAH8|Q96Q53|Q9C066	Missense_Mutation	SNP	ENST00000288937.6	37	CCDS31412.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.970737	0.74246	.	.	ENSG00000158042	ENST00000288937;ENST00000532203	.	.	.	5.73	5.73	0.89815	.	0.051442	0.85682	D	0.000000	D	0.83275	0.5219	M	0.85041	2.73	0.58432	D	0.999999	P	0.52061	0.95	D	0.65010	0.931	D	0.85197	0.1013	9	0.72032	D	0.01	-5.0434	17.4724	0.87649	0.0:0.0:1.0:0.0	.	95	Q9NRX2	RM17_HUMAN	S	95;72	.	ENSP00000288937:P95S	P	-	1	0	MRPL17	6660170	1.000000	0.71417	0.999000	0.59377	0.565000	0.35776	6.015000	0.70791	2.720000	0.93068	0.555000	0.69702	CCT	.		0.473	MRPL17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384544.1	NM_022061	
DCDC1	341019	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	30902745	30902745	+	Silent	SNP	G	G	T			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr11:30902745G>T	ENST00000597505.1	-	35	5183	c.5184C>A	c.(5182-5184)gtC>gtA	p.V1728V				P59894	DCDC1_HUMAN	doublecortin domain containing 1	234					intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					ACACACAGATGACCATATCTC	0.453																																					p.V835V		.											.	DCDC5-23	0			c.C2505A						.						113.0	109.0	110.0					11																	30902745		1954	4159	6113	SO:0001819	synonymous_variant	100506627	exon18			ACAGATGACCATA	AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000597505.1:c.5184C>A	11.37:g.30902745G>T		Somatic	61	0		WXS	Illumina HiSeq	Phase_I	56	25	NM_020869	0	0	1	1	0	A6PVL6|B7WNX6|Q6ZU04	Silent	SNP	ENST00000597505.1	37																																																																																				.		0.453	DCDC1-010	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000463167.1	NM_181807	
DYNC2H1	79659	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	102987369	102987369	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr11:102987369T>C	ENST00000375735.2	+	5	836	c.692T>C	c.(691-693)gTa>gCa	p.V231A	DYNC2H1_ENST00000398093.3_Missense_Mutation_p.V231A|DYNC2H1_ENST00000334267.7_Missense_Mutation_p.V231A	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	231	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		CAGGATGTTGTAGATGATGTG	0.343																																					p.V231A		.											.	DYNC2H1-68	0			c.T692C						.						187.0	184.0	185.0					11																	102987369		1897	4123	6020	SO:0001583	missense	79659	exon5			ATGTTGTAGATGA	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.692T>C	11.37:g.102987369T>C	ENSP00000364887:p.Val231Ala	Somatic	180	1		WXS	Illumina HiSeq	Phase_I	127	56	NM_001377	0	0	2	2	0	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	37	CCDS53701.1	.	.	.	.	.	.	.	.	.	.	T	15.48	2.845053	0.51164	.	.	ENSG00000187240	ENST00000375735;ENST00000334267;ENST00000398093	T;T;T	0.59224	0.28;0.28;0.28	5.55	5.55	0.83447	Dynein heavy chain, domain-1 (1);	.	.	.	.	T	0.66886	0.2835	L	0.50919	1.6	0.44899	D	0.99791	D;B;P	0.63880	0.993;0.056;0.481	P;B;B	0.57720	0.826;0.088;0.217	T	0.67237	-0.5721	9	0.45353	T	0.12	.	15.7067	0.77588	0.0:0.0:0.0:1.0	.	231;231;231	Q8NCM8-3;Q8NCM8;Q8NCM8-2	.;DYHC2_HUMAN;.	A	231	ENSP00000364887:V231A;ENSP00000334021:V231A;ENSP00000381167:V231A	ENSP00000334021:V231A	V	+	2	0	DYNC2H1	102492579	1.000000	0.71417	0.996000	0.52242	0.934000	0.57294	7.698000	0.84413	2.104000	0.64026	0.528000	0.53228	GTA	.		0.343	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	
FDXACB1	91893	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	111749725	111749725	+	Silent	SNP	A	A	G			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr11:111749725A>G	ENST00000260257.4	-	1	179	c.132T>C	c.(130-132)gaT>gaC	p.D44D	ALG9_ENST00000527377.1_5'Flank|C11orf1_ENST00000529270.1_5'Flank|C11orf1_ENST00000530214.1_5'Flank|FDXACB1_ENST00000542429.1_5'UTR|C11orf1_ENST00000260276.3_5'Flank|ALG9_ENST00000524880.1_Silent_p.D44D|C11orf1_ENST00000528125.1_5'UTR	NM_138378.2	NP_612387.1	Q9BRP7	FDXA1_HUMAN	ferredoxin-fold anticodon binding domain containing 1	44					phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA processing (GO:0008033)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|phenylalanine-tRNA ligase activity (GO:0004826)|tRNA binding (GO:0000049)			endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(3)	19						AGGCCAGTGGATCCCGAGCCA	0.667											OREG0021330	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D44D		.											.	FDXACB1-22	0			c.T132C						.						16.0	22.0	20.0					11																	111749725		1936	4151	6087	SO:0001819	synonymous_variant	91893	exon1			CAGTGGATCCCGA		CCDS44729.1	11q23.1	2011-04-15			ENSG00000255561	ENSG00000255561			25110	protein-coding gene	gene with protein product	"""hypothetical protein BC006136"""						Standard	NR_038364		Approved	LOC91893, hCG_2033039	uc001pmc.4	Q9BRP7	OTTHUMG00000166795	ENST00000260257.4:c.132T>C	11.37:g.111749725A>G		Somatic	28	0	1437	WXS	Illumina HiSeq	Phase_I	25	11	NM_138378	0	0	2	3	1	A0PJW7|B4DUU2	Silent	SNP	ENST00000260257.4	37	CCDS44729.1																																																																																			.		0.667	FDXACB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391497.1	NM_138378	
DDX12P	440081	ucsc.edu	37	12	9578131	9578131	+	IGR	SNP	G	G	A			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr12:9578131G>A								RP13-735L24.1 (27918 upstream) : SNORA75 (19522 downstream)																							GGAAGCCTTCGATGTGCATCA	0.617																																					.													.	.	0			.						.						67.0	74.0	72.0					12																	9578131		692	1591	2283	SO:0001628	intergenic_variant	440081	.			GCCTTCGATGTGC																													12.37:g.9578131G>A		Somatic	69	0		WXS	Illumina HiSeq		62	2	.	0	0	5	5	0		RNA	SNP		37																																																																																				.	0	0.617								
GUCY2C	2984	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	14772233	14772233	+	Silent	SNP	A	A	C			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr12:14772233A>C	ENST00000261170.3	-	24	2923	c.2787T>G	c.(2785-2787)gcT>gcG	p.A929A	RP11-695J4.2_ENST00000545424.1_RNA|RP11-695J4.2_ENST00000542401.1_RNA	NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	929	Guanylate cyclase. {ECO:0000255|PROSITE- ProRule:PRU00099}.				intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)			breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	CAACTCCAGCAGCACAGGGAC	0.483																																					p.A929A		.											.	GUCY2C-338	0			c.T2787G						.						95.0	93.0	93.0					12																	14772233		2203	4300	6503	SO:0001819	synonymous_variant	2984	exon24			TCCAGCAGCACAG		CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.2787T>G	12.37:g.14772233A>C		Somatic	82	0		WXS	Illumina HiSeq	Phase_I	91	29	NM_004963	0	0	6	16	10	B2RMY6	Silent	SNP	ENST00000261170.3	37	CCDS8664.1																																																																																			.		0.483	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400835.1		
CNTN1	1272	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	41316146	41316146	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr12:41316146C>T	ENST00000551295.2	+	5	433	c.316C>T	c.(316-318)Cag>Tag	p.Q106*	CNTN1_ENST00000360099.3_Nonsense_Mutation_p.Q106*|CNTN1_ENST00000547702.1_Nonsense_Mutation_p.Q106*|CNTN1_ENST00000348761.2_Nonsense_Mutation_p.Q95*|CNTN1_ENST00000547849.1_Nonsense_Mutation_p.Q106*|CNTN1_ENST00000347616.1_Nonsense_Mutation_p.Q106*	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	106	Ig-like C2-type 1.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				CCCTGACAAACAGAAAGATGC	0.398																																					p.Q106X		.											.	CNTN1-1149	0			c.C316T						.						138.0	123.0	128.0					12																	41316146		2203	4300	6503	SO:0001587	stop_gained	1272	exon5			GACAAACAGAAAG	Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.316C>T	12.37:g.41316146C>T	ENSP00000447006:p.Gln106*	Somatic	69	0		WXS	Illumina HiSeq	Phase_I	84	38	NM_001256063	0	0	0	0	0	A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Nonsense_Mutation	SNP	ENST00000551295.2	37	CCDS8737.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.063249	0.76187	.	.	ENSG00000018236	ENST00000547702;ENST00000551295;ENST00000547849;ENST00000347616;ENST00000360099;ENST00000348761	.	.	.	5.65	4.74	0.60224	.	0.687302	0.15218	N	0.274073	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	.	7.1246	0.25465	0.0:0.7637:0.0:0.2363	.	.	.	.	X	106;106;106;106;106;95	.	ENSP00000325660:Q106X	Q	+	1	0	CNTN1	39602413	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	1.250000	0.32850	2.833000	0.97629	0.585000	0.79938	CAG	.		0.398	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403692.2	NM_001843	
KIF5A	3798	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	57975209	57975209	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr12:57975209C>T	ENST00000455537.2	+	25	3041	c.2767C>T	c.(2767-2769)Cgg>Tgg	p.R923W	KIF5A_ENST00000286452.5_Missense_Mutation_p.R834W	NM_004984.2	NP_004975.2	Q12840	KIF5A_HUMAN	kinesin family member 5A	923	Globular.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein localization (GO:0008104)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(32)|ovary(2)|prostate(2)|skin(2)	62						CAAACCCGTCCGGCCTGGCCA	0.547																																					p.R923W		.											.	KIF5A-517	0			c.C2767T						.						74.0	75.0	75.0					12																	57975209		2203	4300	6503	SO:0001583	missense	3798	exon25			CCCGTCCGGCCTG	U06698	CCDS8945.1	12q13.13	2011-07-15	2004-02-13			ENSG00000155980		"""Kinesins"""	6323	protein-coding gene	gene with protein product		602821	"""spastic paraplegia 10 (autosomal dominant)"""	SPG10		9858832, 10441583, 16489470	Standard	NM_004984		Approved	D12S1889, NKHC, MY050	uc001sor.1	Q12840	OTTHUMG00000170143	ENST00000455537.2:c.2767C>T	12.37:g.57975209C>T	ENSP00000408979:p.Arg923Trp	Somatic	150	0		WXS	Illumina HiSeq	Phase_I	125	50	NM_004984	0	0	0	0	0	A6H8M5|Q4LE26	Missense_Mutation	SNP	ENST00000455537.2	37	CCDS8945.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.159251	0.78226	.	.	ENSG00000155980	ENST00000455537;ENST00000286452;ENST00000547989	T;T	0.81078	-1.38;-1.45	4.52	3.59	0.41128	.	0.201593	0.32343	N	0.006224	D	0.86715	0.5999	M	0.64404	1.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.71184	0.972;0.972	D	0.87757	0.2596	10	0.87932	D	0	.	12.7339	0.57212	0.1717:0.8283:0.0:0.0	.	834;923	B7Z2M7;Q12840	.;KIF5A_HUMAN	W	923;834;17	ENSP00000408979:R923W;ENSP00000286452:R834W	ENSP00000286452:R834W	R	+	1	2	KIF5A	56261476	1.000000	0.71417	0.989000	0.46669	0.881000	0.50899	5.716000	0.68437	1.212000	0.43366	0.561000	0.74099	CGG	.		0.547	KIF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407634.1	NM_004984	
NAV3	89795	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	78604234	78604234	+	Silent	SNP	C	C	T			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr12:78604234C>T	ENST00000397909.2	+	40	7268	c.7095C>T	c.(7093-7095)tgC>tgT	p.C2365C	NAV3_ENST00000541270.1_Silent_p.C195C|NAV3_ENST00000228327.6_Silent_p.C2343C|NAV3_ENST00000536525.2_Silent_p.C2343C|NAV3_ENST00000266692.7_Silent_p.C2166C			Q8IVL0	NAV3_HUMAN	neuron navigator 3	2365						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						CACAAAGCTGCGACAGCGAAA	0.403										HNSCC(70;0.22)																											p.C2343C		.											.	NAV3-279	0			c.C7029T						.						55.0	58.0	57.0					12																	78604234		1952	4172	6124	SO:0001819	synonymous_variant	89795	exon39			AAGCTGCGACAGC	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.7095C>T	12.37:g.78604234C>T		Somatic	59	0		WXS	Illumina HiSeq	Phase_I	71	26	NM_014903	0	0	0	0	0	Q8NFW7|Q9Y2E7	Silent	SNP	ENST00000397909.2	37		.	.	.	.	.	.	.	.	.	.	C	0.069	-1.207030	0.01568	.	.	ENSG00000067798	ENST00000552895;ENST00000551162	.	.	.	5.35	-7.82	0.01205	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-2.2288	19.8674	0.96824	0.0:0.1434:0.0:0.8566	.	.	.	.	X	1238;233	.	.	R	+	1	2	NAV3	77128365	0.348000	0.24861	0.594000	0.28785	0.129000	0.20672	-0.324000	0.07986	-1.610000	0.01583	-2.173000	0.00322	CGA	.		0.403	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383	
KIAA1033	23325	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	105527569	105527569	+	Silent	SNP	C	C	G			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr12:105527569C>G	ENST00000332180.5	+	14	1308	c.1221C>G	c.(1219-1221)gtC>gtG	p.V407V		NM_015275.1	NP_056090.1			KIAA1033											breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	41						CTTACTACGTCTTTGTGAGCT	0.323																																					p.V407V		.											.	KIAA1033-91	0			c.C1221G						.						177.0	171.0	173.0					12																	105527569		1859	4091	5950	SO:0001819	synonymous_variant	23325	exon14			CTACGTCTTTGTG	AB028956	CCDS41826.1, CCDS73514.1	12q24.11	2014-05-09				ENSG00000136051			29174	protein-coding gene	gene with protein product		615748				20376207, 20498093, 21498477	Standard	XM_005268742		Approved	SWIP	uc001tld.3	Q2M389		ENST00000332180.5:c.1221C>G	12.37:g.105527569C>G		Somatic	139	1		WXS	Illumina HiSeq	Phase_I	119	29	NM_015275	0	0	9	16	7		Silent	SNP	ENST00000332180.5	37	CCDS41826.1																																																																																			.		0.323	KIAA1033-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406138.4	NM_015275	
KCTD4	386618	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	45768535	45768535	+	Silent	SNP	G	G	A			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr13:45768535G>A	ENST00000379108.1	-	1	317	c.168C>T	c.(166-168)gaC>gaT	p.D56D	KCTD4_ENST00000405872.1_Silent_p.D56D|GTF2F2_ENST00000340473.6_Intron			Q8WVF5	KCTD4_HUMAN	potassium channel tetramerization domain containing 4	56	BTB.				protein homooligomerization (GO:0051260)					breast(1)|endometrium(1)|large_intestine(2)|lung(4)	8		Lung NSC(96;6.55e-05)|Breast(139;0.00378)|Prostate(109;0.00438)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000249)|BRCA - Breast invasive adenocarcinoma(63;0.207)		CAAGGAAAGTGTCTGGGTACT	0.413																																					p.D56D		.											.	KCTD4-90	0			c.C168T						.						266.0	265.0	265.0					13																	45768535		2203	4300	6503	SO:0001819	synonymous_variant	386618	exon2			GAAAGTGTCTGGG	BC018063	CCDS9396.1	13q14.12-q14.13	2013-06-20	2013-06-20		ENSG00000180332	ENSG00000180332			23227	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 4"""				Standard	NM_198404		Approved	bA321C24.3	uc001uzx.4	Q8WVF5	OTTHUMG00000016844	ENST00000379108.1:c.168C>T	13.37:g.45768535G>A		Somatic	288	0		WXS	Illumina HiSeq	Phase_I	182	55	NM_198404	0	0	0	0	0	Q5W0P9	Silent	SNP	ENST00000379108.1	37	CCDS9396.1																																																																																			.		0.413	KCTD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044757.1		
NEMF	9147	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	50256253	50256253	+	Silent	SNP	C	C	T			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr14:50256253C>T	ENST00000298310.5	-	27	3107	c.2658G>A	c.(2656-2658)caG>caA	p.Q886Q	NEMF_ENST00000382135.2_Silent_p.Q86Q|NEMF_ENST00000545773.1_Silent_p.Q844Q|NEMF_ENST00000556925.1_5'UTR|NEMF_ENST00000546046.1_Silent_p.Q865Q			O60524	NEMF_HUMAN	nuclear export mediator factor	886					nuclear export (GO:0051168)	nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(13)|liver(1)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	36						CTTCTTCATCCTGGTCTTTGT	0.328																																					p.Q886Q		.											.	NEMF-90	0			c.G2658A						.						130.0	123.0	125.0					14																	50256253		2203	4300	6503	SO:0001819	synonymous_variant	9147	exon27			TTCATCCTGGTCT	AF039687	CCDS9694.1	14q21.3	2012-11-19	2011-01-31	2011-01-31	ENSG00000165525	ENSG00000165525			10663	protein-coding gene	gene with protein product		608378	"""serologically defined colon cancer antigen 1"""	SDCCAG1		9610721, 10575219	Standard	XR_429334		Approved	NY-CO-1, FLJ10051	uc001wxc.3	O60524	OTTHUMG00000170857	ENST00000298310.5:c.2658G>A	14.37:g.50256253C>T		Somatic	89	0		WXS	Illumina HiSeq	Phase_I	63	17	NM_004713	0	0	6	13	7	A0JLQ3|B3KSK1|B4DDL3|B4DHA9|B4E3F3|Q32Q66|Q8WW70|Q9NWG1	Silent	SNP	ENST00000298310.5	37	CCDS9694.1																																																																																			.		0.328	NEMF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410798.1	NM_004713	
VRK1	7443	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	97321567	97321567	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr14:97321567T>A	ENST00000216639.3	+	8	732	c.583T>A	c.(583-585)Ttg>Atg	p.L195M		NM_003384.2	NP_003375.1	Q99986	VRK1_HUMAN	vaccinia related kinase 1	195	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				Golgi disassembly (GO:0090166)|histone H3-S10 phosphorylation (GO:0043987)|histone H3-T3 phosphorylation (GO:0072355)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic nuclear envelope reassembly (GO:0007084)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi stack (GO:0005795)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone kinase activity (H3-S10 specific) (GO:0035175)|histone kinase activity (H3-T3 specific) (GO:0072354)|nucleosomal histone binding (GO:0031493)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|endometrium(1)|large_intestine(5)|lung(3)|skin(1)|stomach(1)	12		Melanoma(154;0.155)		COAD - Colon adenocarcinoma(157;0.234)		ATAGGTGTACTTGGTAGATTA	0.388																																					p.L195M		.											.	VRK1-358	0			c.T583A						.						199.0	195.0	196.0					14																	97321567		2203	4300	6503	SO:0001583	missense	7443	exon8			GTGTACTTGGTAG	AB000449	CCDS9947.1	14q32.2	2012-07-05			ENSG00000100749	ENSG00000100749			12718	protein-coding gene	gene with protein product		602168				9344656	Standard	XM_006720247		Approved		uc001yft.3	Q99986	OTTHUMG00000171459	ENST00000216639.3:c.583T>A	14.37:g.97321567T>A	ENSP00000216639:p.Leu195Met	Somatic	134	0		WXS	Illumina HiSeq	Phase_I	105	46	NM_003384	0	0	0	0	0	Q3SYL2	Missense_Mutation	SNP	ENST00000216639.3	37	CCDS9947.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.34|19.34	3.808500|3.808500	0.70797|0.70797	.|.	.|.	ENSG00000100749|ENSG00000100749	ENST00000557222|ENST00000216639	.|T	.|0.72835	.|-0.69	5.95|5.95	1.04|1.04	0.20106|0.20106	.|Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.81024|0.81024	0.4737|0.4737	M|M	0.76938|0.76938	2.355|2.355	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	T|T	0.78823|0.78823	-0.2052|-0.2052	6|10	.|0.66056	.|D	.|0.02	-11.377|-11.377	9.4931|9.4931	0.38971|0.38971	0.0:0.2599:0.0:0.7401|0.0:0.2599:0.0:0.7401	.|.	.|195	.|Q99986	.|VRK1_HUMAN	H|M	51|195	.|ENSP00000216639:L195M	.|ENSP00000216639:L195M	L|L	+|+	2|1	0|2	VRK1|VRK1	96391320|96391320	0.992000|0.992000	0.36948|0.36948	0.995000|0.995000	0.50966|0.50966	0.985000|0.985000	0.73830|0.73830	0.976000|0.976000	0.29462|0.29462	-0.050000|-0.050000	0.13356|0.13356	0.533000|0.533000	0.62120|0.62120	CTT|TTG	.		0.388	VRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413520.1	NM_003384	
ZNF609	23060	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	64791991	64791991	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr15:64791991T>C	ENST00000326648.3	+	1	501	c.373T>C	c.(373-375)Tca>Cca	p.S125P	ZNF609_ENST00000416172.1_Missense_Mutation_p.S125P	NM_015042.1	NP_055857.1	O15014	ZN609_HUMAN	zinc finger protein 609	125						nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GCAGGGGCGCTCAGGAGATGG	0.567																																					p.S125P		.											.	ZNF609-92	0			c.T373C						.						44.0	48.0	46.0					15																	64791991		2203	4300	6503	SO:0001583	missense	23060	exon1			GGGCGCTCAGGAG	BC014251	CCDS32270.1	15q22.1	2008-05-02				ENSG00000180357		"""Zinc fingers, C2H2-type"""	29003	protein-coding gene	gene with protein product						9205841	Standard	NM_015042		Approved	KIAA0295	uc002ann.3	O15014		ENST00000326648.3:c.373T>C	15.37:g.64791991T>C	ENSP00000316527:p.Ser125Pro	Somatic	54	0		WXS	Illumina HiSeq	Phase_I	62	18	NM_015042	0	0	4	7	3	Q0D2I2	Missense_Mutation	SNP	ENST00000326648.3	37	CCDS32270.1	.	.	.	.	.	.	.	.	.	.	.	5.590	0.293619	0.10567	.	.	ENSG00000180357	ENST00000416172;ENST00000326648	T	0.42513	0.97	5.5	3.1	0.35709	.	0.722344	0.13093	N	0.414351	T	0.24699	0.0599	N	0.16368	0.405	0.40301	D	0.97861	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.05241	-1.0897	10	0.21540	T	0.41	-18.1137	8.0215	0.30412	0.0:0.0671:0.2567:0.6762	.	125;125	E7ERY8;O15014	.;ZN609_HUMAN	P	125	ENSP00000316527:S125P	ENSP00000316527:S125P	S	+	1	0	ZNF609	62579044	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	1.673000	0.37534	0.419000	0.25927	-0.322000	0.08575	TCA	.		0.567	ZNF609-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418130.1	XM_042833	
CLCN7	1186	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	1505793	1505793	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr16:1505793C>T	ENST00000382745.4	-	11	1525	c.920G>A	c.(919-921)gGg>gAg	p.G307E	CLCN7_ENST00000448525.1_Missense_Mutation_p.G283E|CLCN7_ENST00000262318.8_Missense_Mutation_p.G283E	NM_001287.5	NP_001278.1	P51798	CLCN7_HUMAN	chloride channel, voltage-sensitive 7	307					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|response to pH (GO:0009268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(2)|central_nervous_system(3)|endometrium(3)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|skin(2)	24		Hepatocellular(780;0.0893)				GAACAGGACCCCACCTGGAAG	0.642																																					p.G307E		.											.	CLCN7-92	0			c.G920A						.						89.0	74.0	79.0					16																	1505793		2199	4300	6499	SO:0001583	missense	1186	exon11			AGGACCCCACCTG	Z67743	CCDS32361.1, CCDS45378.1	16p13	2012-09-26	2012-02-23		ENSG00000103249	ENSG00000103249		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ion channels / Chloride channels : Voltage-sensitive"""	2025	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 63"""	602727	"""chloride channel 7"""			8543009	Standard	NM_001114331		Approved	CLC-7, OPTA2, CLC7, ClC-7, PPP1R63	uc002clv.3	P51798	OTTHUMG00000044467	ENST00000382745.4:c.920G>A	16.37:g.1505793C>T	ENSP00000372193:p.Gly307Glu	Somatic	63	0		WXS	Illumina HiSeq	Phase_I	73	43	NM_001287	0	0	0	0	0	A6NEJ7|A8K5T9|A8K7X1|B3KPN3|E9PDB9|Q9NYX5	Missense_Mutation	SNP	ENST00000382745.4	37	CCDS32361.1	.	.	.	.	.	.	.	.	.	.	C	19.58	3.854384	0.71719	.	.	ENSG00000103249	ENST00000448525;ENST00000262318;ENST00000382745;ENST00000428756	D;D	0.98701	-5.08;-5.08	5.13	5.13	0.70059	Chloride channel, core (2);	0.000000	0.85682	D	0.000000	D	0.99530	0.9832	H	0.98426	4.23	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97845	1.0271	10	0.87932	D	0	-37.9855	17.1357	0.86739	0.0:1.0:0.0:0.0	.	283;307	E9PDB9;P51798	.;CLCN7_HUMAN	E	283;260;307;249	ENSP00000410907:G283E;ENSP00000372193:G307E	ENSP00000262318:G260E	G	-	2	0	CLCN7	1445794	1.000000	0.71417	0.996000	0.52242	0.531000	0.34715	7.468000	0.80943	2.387000	0.81309	0.313000	0.20887	GGG	.		0.642	CLCN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103598.2	NM_001287	
TEKT5	146279	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	10721483	10721483	+	Missense_Mutation	SNP	C	C	T	rs200414450	byFrequency	TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr16:10721483C>T	ENST00000283025.2	-	7	1486	c.1415G>A	c.(1414-1416)cGt>cAt	p.R472H	TEKT5_ENST00000574923.1_5'UTR	NM_144674.1	NP_653275.1	Q96M29	TEKT5_HUMAN	tektin 5	472						cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)				breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)	34						GAAGGTCTTACGCATGCCCAT	0.617													C|||	2	0.000399361	0.0	0.0	5008	,	,		16561	0.002		0.0	False		,,,				2504	0.0				p.R472H		.											.	TEKT5-92	0			c.G1415A						.						70.0	65.0	67.0					16																	10721483		2197	4300	6497	SO:0001583	missense	146279	exon7			GTCTTACGCATGC		CCDS10542.1	16p13.13	2014-01-21			ENSG00000153060	ENSG00000153060			26554	protein-coding gene	gene with protein product							Standard	NM_144674		Approved	FLJ32871, CT149	uc002czz.1	Q96M29	OTTHUMG00000129750	ENST00000283025.2:c.1415G>A	16.37:g.10721483C>T	ENSP00000283025:p.Arg472His	Somatic	118	0		WXS	Illumina HiSeq	Phase_I	128	11	NM_144674	0	0	0	0	0	A1L3Z3	Missense_Mutation	SNP	ENST00000283025.2	37	CCDS10542.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	29.9	5.045589	0.93685	.	.	ENSG00000153060	ENST00000283025	T	0.06218	3.33	4.99	4.99	0.66335	.	0.000000	0.56097	D	0.000032	T	0.31734	0.0806	M	0.90252	3.1	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.26155	-1.0111	10	0.87932	D	0	-21.4482	15.0558	0.71912	0.0:1.0:0.0:0.0	.	472	Q96M29	TEKT5_HUMAN	H	472	ENSP00000283025:R472H	ENSP00000283025:R472H	R	-	2	0	TEKT5	10628984	1.000000	0.71417	0.998000	0.56505	0.956000	0.61745	7.211000	0.77933	2.329000	0.79093	0.505000	0.49811	CGT	C|0.999;T|0.000		0.617	TEKT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251963.1	NM_144674	
EEF2K	29904	ucsc.edu	37	16	22295229	22295229	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr16:22295229C>T	ENST00000263026.5	+	18	2564	c.2090C>T	c.(2089-2091)gCa>gTa	p.A697V	RP11-141O15.1_ENST00000568125.1_RNA	NM_013302.3	NP_037434	O00418	EF2K_HUMAN	eukaryotic elongation factor-2 kinase	697					insulin receptor signaling pathway (GO:0008286)|protein autophosphorylation (GO:0046777)|regulation of protein autophosphorylation (GO:0031952)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|elongation factor-2 kinase activity (GO:0004686)|protein kinase activity (GO:0004672)|translation factor activity, nucleic acid binding (GO:0008135)			breast(1)|central_nervous_system(1)|endometrium(8)|large_intestine(2)|lung(13)|ovary(1)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(48;0.0223)		ACCCAGGCAGCAGAGGCAGCG	0.562																																					p.A697V	NSCLC(195;1411 2157 20319 27471 51856)												.	EEF2K-856	0			c.C2090T						.						30.0	25.0	26.0					16																	22295229		2193	4294	6487	SO:0001583	missense	29904	exon18			AGGCAGCAGAGGC	U93850	CCDS10604.1	16p12	2008-02-05			ENSG00000103319	ENSG00000103319			24615	protein-coding gene	gene with protein product		606968				9144159, 12051769	Standard	NM_013302		Approved	eEF-2K	uc002dki.3	O00418	OTTHUMG00000094771	ENST00000263026.5:c.2090C>T	16.37:g.22295229C>T	ENSP00000263026:p.Ala697Val	Somatic	33	0		WXS	Illumina HiSeq		10	2	NM_013302	0	0	6	7	1	Q8N588	Missense_Mutation	SNP	ENST00000263026.5	37	CCDS10604.1	.	.	.	.	.	.	.	.	.	.	C	35	5.595420	0.96602	.	.	ENSG00000103319	ENST00000263026	T	0.58506	0.33	5.71	5.71	0.89125	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.76421	0.3985	M	0.65975	2.015	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.77531	-0.2553	10	0.87932	D	0	-7.1515	19.8575	0.96767	0.0:1.0:0.0:0.0	.	697	O00418	EF2K_HUMAN	V	697	ENSP00000263026:A697V	ENSP00000263026:A697V	A	+	2	0	EEF2K	22202730	1.000000	0.71417	0.734000	0.30879	0.993000	0.82548	7.416000	0.80143	2.698000	0.92095	0.561000	0.74099	GCA	.		0.562	EEF2K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211580.2	NM_013302	
CIAPIN1	57019	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	57463170	57463170	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr16:57463170C>T	ENST00000569979.1	-	6	699	c.653G>A	c.(652-654)cGc>cAc	p.R218H	CIAPIN1_ENST00000567518.1_Missense_Mutation_p.R271H|CIAPIN1_ENST00000568940.1_Silent_p.P245P|CIAPIN1_ENST00000569370.1_Silent_p.P245P|CIAPIN1_ENST00000569246.1_5'Flank|CIAPIN1_ENST00000394391.4_Missense_Mutation_p.R284H|CIAPIN1_ENST00000565961.1_Silent_p.P218P					cytokine induced apoptosis inhibitor 1											cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	10						GCTGGCACAGCGGAAGGCATC	0.532																																					p.R284H		.											.	CIAPIN1-90	0			c.G851A						.						56.0	57.0	57.0					16																	57463170		2015	4178	6193	SO:0001583	missense	57019	exon9			GCACAGCGGAAGG	AF248964	CCDS10781.2	16q21	2012-09-20			ENSG00000005194	ENSG00000005194			28050	protein-coding gene	gene with protein product		608943				10493829, 11230166	Standard	XM_005256061		Approved	Anamorsin	uc002ell.1	Q6FI81	OTTHUMG00000133457	ENST00000569979.1:c.653G>A	16.37:g.57463170C>T	ENSP00000458000:p.Arg218His	Somatic	83	0		WXS	Illumina HiSeq	Phase_I	73	38	NM_020313	1	0	49	121	71		Missense_Mutation	SNP	ENST00000569979.1	37		.	.	.	.	.	.	.	.	.	.	C	34	5.381122	0.95945	.	.	ENSG00000005194	ENST00000394391	T	0.68181	-0.31	4.73	4.73	0.59995	.	0.000000	0.85682	D	0.000000	D	0.87184	0.6114	H	0.95539	3.685	0.53688	D	0.99997	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.91214	0.5001	10	0.72032	D	0.01	-16.045	17.0668	0.86561	0.0:1.0:0.0:0.0	.	271;284	Q6FI81-3;Q6FI81	.;CPIN1_HUMAN	H	284	ENSP00000377914:R284H	ENSP00000377914:R284H	R	-	2	0	CIAPIN1	56020671	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.141000	0.77330	2.347000	0.79759	0.561000	0.74099	CGC	.		0.532	CIAPIN1-010	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000432580.1	NM_020313	
DNAH2	146754	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	7727461	7727461	+	Missense_Mutation	SNP	G	G	A	rs368019673		TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr17:7727461G>A	ENST00000572933.1	+	76	12961	c.11501G>A	c.(11500-11502)cGa>cAa	p.R3834Q	DNAH2_ENST00000389173.2_Missense_Mutation_p.R3834Q			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	3834	AAA 6. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TCAACCCCACGATCCCCACTC	0.597																																					p.R3834Q		.											.	DNAH2-102	0			c.G11501A						.	G	GLN/ARG	0,4406		0,0,2203	103.0	87.0	93.0		11501	4.1	0.2	17		93	1,8599	1.2+/-3.3	0,1,4299	no	missense	DNAH2	NM_020877.2	43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	3834/4428	7727461	1,13005	2203	4300	6503	SO:0001583	missense	146754	exon75			CCCCACGATCCCC	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.11501G>A	17.37:g.7727461G>A	ENSP00000458355:p.Arg3834Gln	Somatic	180	0		WXS	Illumina HiSeq	Phase_I	205	26	NM_020877	0	0	0	0	0	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	37	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	G	11.61	1.690038	0.29962	0.0	1.16E-4	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.08193	3.12	5.03	4.06	0.47325	Dynein heavy chain (1);	0.102365	0.48286	D	0.000190	T	0.04227	0.0117	N	0.25201	0.72	0.44985	D	0.998	B;B	0.32829	0.227;0.386	B;B	0.22753	0.024;0.041	T	0.42396	-0.9454	10	0.10111	T	0.7	.	8.878	0.35356	0.1665:0.0:0.8335:0.0	.	3795;3834	Q9P225-2;Q9P225	.;DYH2_HUMAN	Q	3795;3834	ENSP00000373825:R3834Q	ENSP00000353818:R3795Q	R	+	2	0	DNAH2	7668186	0.186000	0.23225	0.167000	0.22817	0.981000	0.71138	2.589000	0.46145	2.350000	0.79820	0.511000	0.50034	CGA	.		0.597	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
EFCAB5	374786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	28407885	28407885	+	Silent	SNP	G	G	C			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr17:28407885G>C	ENST00000394835.3	+	17	3504	c.3312G>C	c.(3310-3312)ctG>ctC	p.L1104L	EFCAB5_ENST00000394832.2_Intron|EFCAB5_ENST00000320856.5_Silent_p.L980L	NM_198529.3	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5	1104							calcium ion binding (GO:0005509)			breast(7)|endometrium(2)|kidney(4)|large_intestine(11)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						GTTCATTCCTGGCTCTGCCTC	0.438																																					p.L1104L		.											.	EFCAB5-70	0			c.G3312C						.						91.0	88.0	89.0					17																	28407885		1881	4112	5993	SO:0001819	synonymous_variant	374786	exon17			ATTCCTGGCTCTG	AL833911	CCDS11254.2, CCDS54103.1	17q11.2	2013-01-10			ENSG00000176927	ENSG00000176927		"""EF-hand domain containing"""	24801	protein-coding gene	gene with protein product							Standard	NM_198529		Approved	FLJ46247	uc002het.3	A4FU69	OTTHUMG00000132753	ENST00000394835.3:c.3312G>C	17.37:g.28407885G>C		Somatic	82	0		WXS	Illumina HiSeq	Phase_I	63	24	NM_198529	0	0	0	0	0	B2RPN0|B4DS75|B4DZR5|F5GYL2|Q0VD68|Q6ZRM6|Q8NDG9	Silent	SNP	ENST00000394835.3	37	CCDS11254.2																																																																																			.		0.438	EFCAB5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256120.4	NM_198529	
HELZ	9931	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	65214853	65214853	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr17:65214853T>G	ENST00000358691.5	-	4	234	c.68A>C	c.(67-69)gAa>gCa	p.E23A	HELZ_ENST00000580168.1_Missense_Mutation_p.E23A|HELZ_ENST00000580662.1_5'UTR	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	23						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					GAGGGCCATTTCATAGTCCTG	0.473																																					p.E23A		.											.	HELZ-92	0			c.A68C						.						127.0	119.0	121.0					17																	65214853		1892	4130	6022	SO:0001583	missense	9931	exon4			GCCATTTCATAGT	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.68A>C	17.37:g.65214853T>G	ENSP00000351524:p.Glu23Ala	Somatic	120	0		WXS	Illumina HiSeq	Phase_I	142	34	NM_014877	0	0	5	5	0	I6L9H4	Missense_Mutation	SNP	ENST00000358691.5	37	CCDS42374.1	.	.	.	.	.	.	.	.	.	.	t	15.08	2.728346	0.48833	.	.	ENSG00000198265	ENST00000358691;ENST00000417253	T;T	0.75589	-0.95;-0.95	5.27	5.27	0.74061	.	0.046820	0.85682	D	0.000000	T	0.70692	0.3253	L	0.29908	0.895	0.58432	D	0.999999	B;P;B	0.48503	0.247;0.911;0.247	B;P;B	0.47941	0.078;0.562;0.078	T	0.75019	-0.3465	10	0.66056	D	0.02	-4.8435	15.1782	0.72931	0.0:0.0:0.0:1.0	.	23;23;23	B7ZLW2;F8WBX6;P42694	.;.;HELZ_HUMAN	A	23	ENSP00000351524:E23A;ENSP00000411144:E23A	ENSP00000351524:E23A	E	-	2	0	HELZ	62645315	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	7.414000	0.80117	1.980000	0.57719	0.455000	0.32223	GAA	.		0.473	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	NM_014877	
COG1	9382	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	71199203	71199203	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr17:71199203C>A	ENST00000299886.4	+	8	2218	c.2138C>A	c.(2137-2139)gCc>gAc	p.A713D		NM_018714.2	NP_061184.1	Q8WTW3	COG1_HUMAN	component of oligomeric golgi complex 1	713					Golgi organization (GO:0007030)|intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18			LUSC - Lung squamous cell carcinoma(166;0.197)			CTGGCCACAGCCACCAGCTGG	0.512																																					p.A713D		.											.	COG1-91	0			c.C2138A						.						80.0	74.0	76.0					17																	71199203		2203	4300	6503	SO:0001583	missense	9382	exon8			CCACAGCCACCAG		CCDS11692.1	17q25.1	2008-05-14	2002-05-28	2002-05-31		ENSG00000166685		"""Components of oligomeric golgi complex"""	6545	protein-coding gene	gene with protein product		606973	"""low density lipoprotein receptor defect B complementing"""	LDLB		9927668	Standard	NM_018714		Approved	KIAA1381	uc002jjg.3	Q8WTW3		ENST00000299886.4:c.2138C>A	17.37:g.71199203C>A	ENSP00000299886:p.Ala713Asp	Somatic	83	0		WXS	Illumina HiSeq	Phase_I	87	58	NM_018714	0	0	8	39	31	Q9NPV9|Q9P2G6	Missense_Mutation	SNP	ENST00000299886.4	37	CCDS11692.1	.	.	.	.	.	.	.	.	.	.	C	18.47	3.632096	0.67015	.	.	ENSG00000166685	ENST00000438720;ENST00000299886	T;T	0.25414	1.8;1.81	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.54581	0.1867	M	0.75447	2.3	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	T	0.37572	-0.9700	10	0.35671	T	0.21	-30.898	20.8794	0.99867	0.0:1.0:0.0:0.0	.	713;713;713	E9PBL8;Q8WTW3;Q4G0L8	.;COG1_HUMAN;.	D	713	ENSP00000400111:A713D;ENSP00000299886:A713D	ENSP00000299886:A713D	A	+	2	0	COG1	68710798	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.456000	0.80751	2.941000	0.99782	0.655000	0.94253	GCC	.		0.512	COG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441638.1		
FDXR	2232	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	72861043	72861043	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr17:72861043A>C	ENST00000293195.5	-	7	698	c.620T>G	c.(619-621)aTc>aGc	p.I207S	FDXR_ENST00000413947.2_Missense_Mutation_p.I238S|FDXR_ENST00000582944.1_Missense_Mutation_p.I199S|FDXR_ENST00000581530.1_Missense_Mutation_p.I213S|FDXR_ENST00000581969.1_5'Flank|FDXR_ENST00000583917.1_Missense_Mutation_p.I208S|FDXR_ENST00000420580.2_Missense_Mutation_p.I167S|FDXR_ENST00000442102.2_Missense_Mutation_p.I250S|FDXR_ENST00000455107.2_Missense_Mutation_p.I163S|FDXR_ENST00000544854.1_Missense_Mutation_p.I155S	NM_001258014.1|NM_004110.3|NM_024417.2	NP_001244943.1|NP_004101.2|NP_077728.2	P22570	ADRO_HUMAN	ferredoxin reductase	207					cholesterol metabolic process (GO:0008203)|generation of precursor metabolites and energy (GO:0006091)|NADPH oxidation (GO:0070995)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ferredoxin-NADP+ reductase activity (GO:0004324)|NADPH binding (GO:0070402)|NADPH-adrenodoxin reductase activity (GO:0015039)			central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	16	all_lung(278;0.172)|Lung NSC(278;0.207)				Flavin adenine dinucleotide(DB03147)	TGCCTTCGTGATGTCCGTTCT	0.592											OREG0024720	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I250S		.											.	FDXR-226	0			c.T749G						.						96.0	80.0	86.0					17																	72861043		2203	4300	6503	SO:0001583	missense	2232	exon7			TTCGTGATGTCCG	J03826	CCDS11707.1, CCDS58591.1, CCDS58592.1, CCDS58593.1, CCDS58594.1, CCDS58595.1, CCDS58596.1	17q25.1	2013-06-18			ENSG00000161513	ENSG00000161513	1.18.1.6		3642	protein-coding gene	gene with protein product	"""adrenodoxin-NADP(+) reductase"", ""adrenodoxin reductase"""	103270		ADXR		2969697	Standard	NM_001258014		Approved		uc010wrl.2	P22570	OTTHUMG00000179026	ENST00000293195.5:c.620T>G	17.37:g.72861043A>C	ENSP00000293195:p.Ile207Ser	Somatic	80	0	1140	WXS	Illumina HiSeq	Phase_I	102	54	NM_001258012	0	0	0	1	1	B4DDI7|B4DHX5|B4DQQ4|B4DX24|B7Z7G2|E7EQC1|Q13716|Q4PJI0|Q9BU12	Missense_Mutation	SNP	ENST00000293195.5	37	CCDS58593.1	.	.	.	.	.	.	.	.	.	.	a	15.15	2.747032	0.49257	.	.	ENSG00000161513	ENST00000420580;ENST00000544854;ENST00000293195;ENST00000455107;ENST00000442102;ENST00000413947	T;T;T;T;T	0.74315	-0.83;-0.83;-0.83;-0.83;-0.83	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.89931	0.6858	H	0.94345	3.525	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D	0.97110	0.992;0.983;0.984;1.0;0.996;0.984;0.978;1.0;0.978;0.996	D	0.92675	0.6153	10	0.87932	D	0	-11.7911	15.4798	0.75517	1.0:0.0:0.0:0.0	.	167;250;238;205;155;238;207;199;207;213	B4DQQ4;B4DHX5;E7EQC1;B4DDI9;B7Z7G2;B4DDI7;Q6GSK2;B4DX24;P22570;P22570-2	.;.;.;.;.;.;.;.;ADRO_HUMAN;.	S	167;155;213;163;250;238	ENSP00000414172:I167S;ENSP00000445432:I155S;ENSP00000390875:I163S;ENSP00000416515:I250S;ENSP00000408595:I238S	ENSP00000293195:I213S	I	-	2	0	FDXR	70372638	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	5.738000	0.68613	2.145000	0.66743	0.454000	0.30748	ATC	.		0.592	FDXR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000444449.1	NM_004110	
EMILIN2	84034	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	2913257	2913257	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr18:2913257G>T	ENST00000254528.3	+	8	3176	c.3017G>T	c.(3016-3018)gGg>gTg	p.G1006V	EMILIN2_ENST00000308080.5_3'UTR	NM_032048.2	NP_114437.2	Q9BXX0	EMIL2_HUMAN	elastin microfibril interfacer 2	1006	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				cell adhesion (GO:0007155)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)			breast(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(4)	48				READ - Rectum adenocarcinoma(2;0.1)		GGGGGCCCGGGGGCATTCCAC	0.607																																					p.G1006V		.											.	EMILIN2-93	0			c.G3017T						.						41.0	43.0	43.0					18																	2913257		2203	4300	6503	SO:0001583	missense	84034	exon8			GCCCGGGGGCATT	AF270513	CCDS11828.1	18p11.3	2008-02-05			ENSG00000132205	ENSG00000132205		"""EMI domain containing"""	19881	protein-coding gene	gene with protein product		608928					Standard	NM_032048		Approved	FLJ33200, FOAP-10	uc002kln.3	Q9BXX0	OTTHUMG00000128525	ENST00000254528.3:c.3017G>T	18.37:g.2913257G>T	ENSP00000254528:p.Gly1006Val	Somatic	76	0		WXS	Illumina HiSeq	Phase_I	49	13	NM_032048	0	0	2	4	2	B2RMY3|Q8NBH3|Q96JQ4	Missense_Mutation	SNP	ENST00000254528.3	37	CCDS11828.1	.	.	.	.	.	.	.	.	.	.	G	15.97	2.989478	0.53934	.	.	ENSG00000132205	ENST00000254528;ENST00000308080	T	0.74842	-0.88	5.61	5.61	0.85477	Tumour necrosis factor-like (2);Complement C1q protein (2);	0.000000	0.85682	D	0.000000	D	0.83087	0.5178	L	0.48174	1.505	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.79771	-0.1663	10	0.33940	T	0.23	-34.4219	20.0086	0.97443	0.0:0.0:1.0:0.0	.	1006	Q9BXX0	EMIL2_HUMAN	V	1006;283	ENSP00000254528:G1006V	ENSP00000254528:G1006V	G	+	2	0	EMILIN2	2903257	1.000000	0.71417	0.301000	0.25044	0.022000	0.10575	5.618000	0.67722	2.808000	0.96608	0.655000	0.94253	GGG	.		0.607	EMILIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250337.2	NM_032048	
CCDC178	374864	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	30926327	30926327	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr18:30926327T>C	ENST00000383096.3	-	9	688	c.506A>G	c.(505-507)gAg>gGg	p.E169G	CCDC178_ENST00000579947.1_Missense_Mutation_p.E169G|CCDC178_ENST00000406524.2_Missense_Mutation_p.E169G|CCDC178_ENST00000403303.1_Missense_Mutation_p.E169G|CCDC178_ENST00000579916.1_Intron|CCDC178_ENST00000300227.8_Missense_Mutation_p.E169G|CCDC178_ENST00000402325.1_Missense_Mutation_p.E169G|CCDC178_ENST00000583930.1_Missense_Mutation_p.E169G			Q5BJE1	CC178_HUMAN	coiled-coil domain containing 178	169																	ACGAATGGCCTCTGAGAGCAA	0.343																																					p.E169G		.											.	.	0			c.A506G						.						93.0	88.0	90.0					18																	30926327		2203	4300	6503	SO:0001583	missense	374864	exon8			ATGGCCTCTGAGA	AK126038	CCDS11906.1, CCDS42424.1	18q12.1	2012-10-15	2012-10-15	2012-10-15	ENSG00000166960	ENSG00000166960			29588	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 34"""	C18orf34			Standard	NM_198995		Approved	FLJ44050	uc002kxn.2	Q5BJE1	OTTHUMG00000132279	ENST00000383096.3:c.506A>G	18.37:g.30926327T>C	ENSP00000372576:p.Glu169Gly	Somatic	79	0		WXS	Illumina HiSeq	Phase_I	83	26	NM_001105528	0	0	0	0	0	A6NDC6|J3KS92|Q6ZP67|Q6ZU20	Missense_Mutation	SNP	ENST00000383096.3	37	CCDS42424.1	.	.	.	.	.	.	.	.	.	.	T	9.274	1.046438	0.19748	.	.	ENSG00000166960	ENST00000403303;ENST00000383096;ENST00000300227;ENST00000406524;ENST00000402325;ENST00000399177	T;T;T;T;T;T	0.57107	1.82;1.82;1.83;1.82;1.83;0.42	5.59	4.36	0.52297	.	.	.	.	.	T	0.65133	0.2662	L	0.54323	1.7	0.31006	N	0.719736	D;D;D;D	0.89917	1.0;0.996;0.996;0.996	D;D;D;D	0.74674	0.984;0.944;0.944;0.944	T	0.65520	-0.6148	9	0.59425	D	0.04	-20.3796	10.1932	0.43039	0.0:0.0:0.1668:0.8332	.	169;169;169;169	F8W7A7;B5MD75;Q5BJE1-2;Q5BJE1	.;.;.;CR034_HUMAN	G	169	ENSP00000385591:E169G;ENSP00000372576:E169G;ENSP00000300227:E169G;ENSP00000385867:E169G;ENSP00000385234:E169G;ENSP00000382130:E169G	ENSP00000300227:E169G	E	-	2	0	C18orf34	29180325	1.000000	0.71417	0.996000	0.52242	0.418000	0.31294	3.210000	0.51129	2.129000	0.65627	0.455000	0.32223	GAG	.		0.343	CCDC178-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255373.2	NM_198995	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	9059472	9059472	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr19:9059472G>T	ENST00000397910.4	-	3	28177	c.27974C>A	c.(27973-27975)gCc>gAc	p.A9325D		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9327	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGAAGAGATGGCTTCTGTCCT	0.507																																					p.A9325D		.											.	MUC16-566	0			c.C27974A						.						162.0	157.0	158.0					19																	9059472		1993	4179	6172	SO:0001583	missense	94025	exon3			GAGATGGCTTCTG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.27974C>A	19.37:g.9059472G>T	ENSP00000381008:p.Ala9325Asp	Somatic	199	0		WXS	Illumina HiSeq	Phase_I	143	69	NM_024690	0	0	0	0	0	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	5.093	0.202874	0.09704	.	.	ENSG00000181143	ENST00000397910	T	0.02812	4.15	2.43	-4.86	0.03132	.	.	.	.	.	T	0.02727	0.0082	N	0.19112	0.55	.	.	.	P	0.52316	0.952	P	0.50049	0.629	T	0.26677	-1.0096	8	0.87932	D	0	.	4.6628	0.12650	0.5463:0.176:0.2777:0.0	.	9325	B5ME49	.	D	9325	ENSP00000381008:A9325D	ENSP00000381008:A9325D	A	-	2	0	MUC16	8920472	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-1.962000	0.01514	-1.169000	0.02772	-0.382000	0.06688	GCC	.		0.507	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ZNF317	57693	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	9271676	9271676	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr19:9271676G>A	ENST00000247956.6	+	7	1660	c.1355G>A	c.(1354-1356)gGg>gAg	p.G452E	ZNF317_ENST00000360385.3_Missense_Mutation_p.G420E	NM_020933.4	NP_065984.3	Q96PQ6	ZN317_HUMAN	zinc finger protein 317	452					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	27						GATCTCTGCGGGAAAGCTTTC	0.547																																					p.G452E		.											.	ZNF317-90	0			c.G1355A						.						62.0	59.0	60.0					19																	9271676		2203	4300	6503	SO:0001583	missense	57693	exon7			TCTGCGGGAAAGC	AF275255	CCDS12210.1, CCDS54213.1	19p13	2013-01-08				ENSG00000130803		"""Zinc fingers, C2H2-type"", ""-"""	13507	protein-coding gene	gene with protein product		613864				10997877, 11688974	Standard	NM_020933		Approved		uc002mku.3	Q96PQ6		ENST00000247956.6:c.1355G>A	19.37:g.9271676G>A	ENSP00000247956:p.Gly452Glu	Somatic	67	0		WXS	Illumina HiSeq	Phase_I	58	20	NM_020933	0	0	3	6	3	Q6DCA9|Q96PM0|Q96PM1|Q96PT2|Q9HCI4	Missense_Mutation	SNP	ENST00000247956.6	37	CCDS12210.1	.	.	.	.	.	.	.	.	.	.	G	19.27	3.795593	0.70452	.	.	ENSG00000130803	ENST00000247956;ENST00000360385	T;T	0.07114	3.22;3.22	3.04	3.04	0.35103	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.43260	D	0.000600	T	0.22627	0.0546	L	0.59436	1.845	0.47009	D	0.999286	D;D	0.89917	1.0;0.994	D;D	0.83275	0.996;0.924	T	0.01013	-1.1481	10	0.59425	D	0.04	-30.6663	12.2796	0.54757	0.0:0.0:1.0:0.0	.	420;452	Q96PQ6-2;Q96PQ6	.;ZN317_HUMAN	E	452;420	ENSP00000247956:G452E;ENSP00000353554:G420E	ENSP00000247956:G452E	G	+	2	0	ZNF317	9132676	0.999000	0.42202	0.881000	0.34555	0.542000	0.35054	3.149000	0.50655	2.031000	0.59945	0.491000	0.48974	GGG	.		0.547	ZNF317-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000448995.1	NM_020933	
C19orf57	79173	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	13996869	13996869	+	Splice_Site	SNP	C	C	G			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr19:13996869C>G	ENST00000586783.1	-	6	1668		c.e6-1		C19orf57_ENST00000346736.2_Splice_Site|C19orf57_ENST00000591586.1_Splice_Site|C19orf57_ENST00000454313.1_Splice_Site			Q0VDD7	CS057_HUMAN	chromosome 19 open reading frame 57						multicellular organismal development (GO:0007275)					breast(2)|kidney(1)|lung(3)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(19;2e-21)			AAGGAAAGAGCTGGAAAGAGA	0.632																																					.		.											.	C19orf57-93	0			c.1669-1G>C						.						33.0	34.0	34.0					19																	13996869		2203	4300	6503	SO:0001630	splice_region_variant	79173	exon8			AAAGAGCTGGAAA	BC012945	CCDS12299.1	19p13.12	2012-10-26			ENSG00000132016	ENSG00000132016			28153	protein-coding gene	gene with protein product						8228263	Standard	NM_024323		Approved	MGC11271	uc002mxl.1	Q0VDD7	OTTHUMG00000181851	ENST00000586783.1:c.1669-1G>C	19.37:g.13996869C>G		Somatic	58	0		WXS	Illumina HiSeq	Phase_I	58	21	NM_024323	0	0	0	0	0	Q13411|Q8N825|Q96D63|Q9BU49	Splice_Site	SNP	ENST00000586783.1	37		.	.	.	.	.	.	.	.	.	.	C	9.061	0.994432	0.19043	.	.	ENSG00000132016	ENST00000454313;ENST00000346736	.	.	.	3.01	3.01	0.34805	.	.	.	.	.	.	.	.	.	.	.	0.45762	D	0.998659	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.7555	0.40500	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	C19orf57	13857869	0.176000	0.23096	0.016000	0.15963	0.050000	0.14768	2.605000	0.46283	2.000000	0.58554	0.563000	0.77884	.	.		0.632	C19orf57-003	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000457947.1	NM_024323	Intron
CD22	933	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	35828752	35828752	+	Silent	SNP	C	C	T			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr19:35828752C>T	ENST00000085219.5	+	5	879	c.813C>T	c.(811-813)aaC>aaT	p.N271N	CD22_ENST00000536635.2_Silent_p.N271N|CD22_ENST00000419549.2_Silent_p.N99N|CD22_ENST00000544992.2_Silent_p.N271N|CD22_ENST00000270311.6_Silent_p.N151N|CD22_ENST00000594250.1_Intron|CD22_ENST00000341773.6_Intron	NM_001771.3	NP_001762.2	P20273	CD22_HUMAN	CD22 molecule	271	Ig-like C2-type 2.				cell adhesion (GO:0007155)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			breast(2)|endometrium(2)|kidney(3)|large_intestine(14)|lung(21)|ovary(5)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	54	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			GCAGCAGCAACCCGGAGTACA	0.567																																					p.N271N	Ovarian(42;1009 1133 23674 26041)	.											.	CD22-526	0			c.C813T						.						90.0	75.0	80.0					19																	35828752		2203	4300	6503	SO:0001819	synonymous_variant	933	exon5			CAGCAACCCGGAG	X52785	CCDS12457.1, CCDS54247.1, CCDS54248.1, CCDS54249.1, CCDS62634.1	19q13.1	2013-01-29	2006-03-28		ENSG00000012124	ENSG00000012124		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1643	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 2"""	107266	"""CD22 antigen"""			8496602, 1691828	Standard	NM_001185099		Approved	SIGLEC-2, SIGLEC2	uc010edt.3	P20273		ENST00000085219.5:c.813C>T	19.37:g.35828752C>T		Somatic	107	0		WXS	Illumina HiSeq	Phase_I	77	32	NM_001185100	0	0	1	1	0	F5GYU4|F5H7U3|O95699|O95701|O95702|O95703|Q01665|Q32M46|Q92872|Q92873|Q9UQA6|Q9UQA7|Q9UQA8|Q9UQA9|Q9UQB0|Q9Y2A6	Silent	SNP	ENST00000085219.5	37	CCDS12457.1																																																																																			.		0.567	CD22-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466099.1	NM_001771	
SCAF1	58506	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	50161552	50161552	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr19:50161552A>C	ENST00000360565.3	+	11	3959	c.3835A>C	c.(3835-3837)Aag>Cag	p.K1279Q	IRF3_ENST00000599680.1_5'Flank	NM_021228.2	NP_067051.2	Q9H7N4	SFR19_HUMAN	SR-related CTD-associated factor 1	1279	Necessary for interaction with the CTD domain of POLR2A.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	20		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00113)|GBM - Glioblastoma multiforme(134;0.0204)		CTACTTCCGCAAGCACGGTCG	0.701																																					p.K1279Q		.											.	SCAF1-68	0			c.A3835C						.						20.0	18.0	19.0					19																	50161552		2196	4296	6492	SO:0001583	missense	58506	exon11			TTCCGCAAGCACG	AK024444	CCDS33074.1	19q13.3-q13.4	2011-01-10			ENSG00000126461	ENSG00000126461			30403	protein-coding gene	gene with protein product						11461075	Standard	NM_021228		Approved	SR-A1, FLJ00034	uc002poq.3	Q9H7N4		ENST00000360565.3:c.3835A>C	19.37:g.50161552A>C	ENSP00000353769:p.Lys1279Gln	Somatic	28	0		WXS	Illumina HiSeq	Phase_I	20	10	NM_021228	0	0	18	34	16	Q7Z5V7|Q8WVA1|Q9NR59	Missense_Mutation	SNP	ENST00000360565.3	37	CCDS33074.1	.	.	.	.	.	.	.	.	.	.	A	19.04	3.749503	0.69533	.	.	ENSG00000126461	ENST00000360565	T	0.50548	0.74	4.94	4.94	0.65067	.	0.000000	0.41001	D	0.000978	T	0.62575	0.2439	L	0.52905	1.665	0.45076	D	0.998095	D	0.76494	0.999	D	0.71656	0.974	T	0.65800	-0.6080	10	0.72032	D	0.01	-23.9463	13.702	0.62616	1.0:0.0:0.0:0.0	.	1279	Q9H7N4	SFR19_HUMAN	Q	1279	ENSP00000353769:K1279Q	ENSP00000353769:K1279Q	K	+	1	0	SCAF1	54853364	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.499000	0.90494	2.064000	0.61679	0.533000	0.62120	AAG	.		0.701	SCAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465764.1	NM_021228	
LILRB1	10859	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	55144006	55144006	+	Silent	SNP	C	C	A			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr19:55144006C>A	ENST00000396331.1	+	7	1110	c.753C>A	c.(751-753)ggC>ggA	p.G251G	LILRB1_ENST00000427581.2_Silent_p.G287G|LILRB1_ENST00000434867.2_Silent_p.G251G|LILRB1_ENST00000448689.1_Silent_p.G251G|LILRB1_ENST00000396321.2_Silent_p.G251G|LILRB1_ENST00000396315.1_Silent_p.G251G|LILRB1_ENST00000418536.2_Silent_p.G251G|LILRB1_ENST00000396332.4_Silent_p.G251G|LILRB1_ENST00000396317.1_Silent_p.G251G|LILRB1_ENST00000324602.7_Silent_p.G251G|LILRB1_ENST00000396327.3_Silent_p.G251G	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1	251	Ig-like C2-type 3.				cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		CTGATGCTGGCTACAACAGAT	0.572										HNSCC(37;0.09)																											p.G251G		.											.	LILRB1-137	0			c.C753A						.						100.0	105.0	103.0					19																	55144006		2203	4300	6503	SO:0001819	synonymous_variant	10859	exon6			TGCTGGCTACAAC	AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.753C>A	19.37:g.55144006C>A		Somatic	173	0		WXS	Illumina HiSeq	Phase_I	110	44	NM_001081637	0	0	2	2	0	A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Silent	SNP	ENST00000396331.1	37	CCDS42617.1																																																																																			.		0.572	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140796.4		
ZNF543	125919	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	57839968	57839968	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr19:57839968G>A	ENST00000321545.4	+	4	1483	c.1138G>A	c.(1138-1140)Gca>Aca	p.A380T		NM_213598.3	NP_998763.2	Q08ER8	ZN543_HUMAN	zinc finger protein 543	380					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(2)|large_intestine(8)|lung(11)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	28		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TTGCGAGAGTGCAGACCTCAT	0.512																																					p.A380T		.											.	ZNF543-92	0			c.G1138A						.						84.0	73.0	76.0					19																	57839968		2203	4300	6503	SO:0001583	missense	125919	exon4			GAGAGTGCAGACC	AL834534	CCDS33130.1	19q13.43	2013-01-08				ENSG00000178229		"""Zinc fingers, C2H2-type"", ""-"""	25281	protein-coding gene	gene with protein product							Standard	NM_213598		Approved	DKFZp434H055	uc002qoi.2	Q08ER8		ENST00000321545.4:c.1138G>A	19.37:g.57839968G>A	ENSP00000322545:p.Ala380Thr	Somatic	119	0		WXS	Illumina HiSeq	Phase_I	83	35	NM_213598	0	0	0	1	1	Q495U9|Q495V0|Q6ZMP4|Q8NCX4	Missense_Mutation	SNP	ENST00000321545.4	37	CCDS33130.1	.	.	.	.	.	.	.	.	.	.	G	2.550	-0.304214	0.05495	.	.	ENSG00000178229	ENST00000321545	T	0.15139	2.45	3.14	-2.57	0.06248	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.10337	0.0253	N	0.25825	0.765	0.09310	N	1	B	0.21071	0.051	B	0.14023	0.01	T	0.32188	-0.9916	9	0.42905	T	0.14	.	7.5755	0.27933	0.138:0.0:0.7015:0.1605	.	380	Q08ER8	ZN543_HUMAN	T	380	ENSP00000322545:A380T	ENSP00000322545:A380T	A	+	1	0	ZNF543	62531780	0.000000	0.05858	0.000000	0.03702	0.661000	0.39034	-1.477000	0.02331	-0.214000	0.10078	0.561000	0.74099	GCA	.		0.512	ZNF543-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465780.1	XM_064865	
PROM2	150696	hgsc.bcm.edu	37	2	95952306	95952306	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr2:95952306A>G	ENST00000317620.9	+	17	2160	c.2027A>G	c.(2026-2028)cAg>cGg	p.Q676R	PROM2_ENST00000542147.1_Missense_Mutation_p.Q627R|PROM2_ENST00000317668.4_Missense_Mutation_p.Q676R|PROM2_ENST00000403131.2_Missense_Mutation_p.Q676R	NM_001165978.1	NP_001159450.1	Q8N271	PROM2_HUMAN	prominin 2	676					negative regulation of caveolin-mediated endocytosis (GO:2001287)|negative regulation of pinocytosis (GO:0048550)|positive regulation of cell projection organization (GO:0031346)|positive regulation of protein phosphorylation (GO:0001934)|regulation of Cdc42 GTPase activity (GO:0043088)	cell projection (GO:0042995)|cell surface (GO:0009986)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|microspike (GO:0044393)|microvillus (GO:0005902)|prominosome (GO:0071914)	cholesterol binding (GO:0015485)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	32						GTCGTCCCCCAGCAGAGCCTT	0.602																																					p.Q676R		.											.	PROM2-91	0			c.A2027G						.						47.0	47.0	47.0					2																	95952306		2203	4300	6503	SO:0001583	missense	150696	exon17			TCCCCCAGCAGAG	AF245303	CCDS2012.1	2q11.1	2008-02-05			ENSG00000155066	ENSG00000155066			20685	protein-coding gene	gene with protein product						12514187	Standard	NM_001165978		Approved		uc002sui.3	Q8N271	OTTHUMG00000130393	ENST00000317620.9:c.2027A>G	2.37:g.95952306A>G	ENSP00000318270:p.Gln676Arg	Somatic	86	0		WXS	Illumina HiSeq	Phase_I	55	3	NM_001165977	0	0	0	0	0	A8K2V1|Q2HIX6|Q8NB84|Q8TAE2	Missense_Mutation	SNP	ENST00000317620.9	37	CCDS2012.1	.	.	.	.	.	.	.	.	.	.	A	14.08	2.429550	0.43122	.	.	ENSG00000155066	ENST00000403131;ENST00000317668;ENST00000317620;ENST00000542147	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	4.66	2.13	0.27403	.	0.420605	0.22357	N	0.061138	T	0.55194	0.1905	M	0.74881	2.28	0.28303	N	0.923033	D	0.69078	0.997	D	0.68192	0.956	T	0.48456	-0.9034	10	0.72032	D	0.01	-21.7999	3.8144	0.08809	0.7096:0.0:0.1034:0.187	.	676	Q8N271	PROM2_HUMAN	R	676;676;676;627	ENSP00000385716:Q676R;ENSP00000318520:Q676R;ENSP00000318270:Q676R;ENSP00000442542:Q627R	ENSP00000318270:Q676R	Q	+	2	0	PROM2	95316033	0.996000	0.38824	0.862000	0.33874	0.470000	0.32858	1.552000	0.36244	0.827000	0.34685	0.368000	0.22195	CAG	.		0.602	PROM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252771.1	NM_144707	
GCC2	9648	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	109109239	109109239	+	Silent	SNP	C	C	T			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr2:109109239C>T	ENST00000309863.6	+	19	5154	c.4440C>T	c.(4438-4440)acC>acT	p.T1480T		NM_181453.3	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain containing 2	1480					Golgi ribbon formation (GO:0090161)|late endosome to Golgi transport (GO:0034499)|microtubule anchoring (GO:0034453)|microtubule organizing center organization (GO:0031023)|protein localization to Golgi apparatus (GO:0034067)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|recycling endosome to Golgi transport (GO:0071955)|regulation of protein exit from endoplasmic reticulum (GO:0070861)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	identical protein binding (GO:0042802)			breast(8)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	54						ATGAACCGACCACAAGAAGTA	0.373																																					p.T1480T		.											.	GCC2-91	0			c.C4440T						.						85.0	85.0	85.0					2																	109109239		2203	4300	6503	SO:0001819	synonymous_variant	9648	exon19			ACCGACCACAAGA	BC020645	CCDS33268.1	2q12.3	2008-02-05	2004-03-05		ENSG00000135968	ENSG00000135968			23218	protein-coding gene	gene with protein product		612711	"""GRIP and coiled-coil domain-containing 2"""			12446665	Standard	NM_181453		Approved	GCC185, KIAA0336	uc002tec.3	Q8IWJ2	OTTHUMG00000153214	ENST00000309863.6:c.4440C>T	2.37:g.109109239C>T		Somatic	73	0		WXS	Illumina HiSeq	Phase_I	45	21	NM_181453	0	0	0	0	0	A6H8X8|O15045|Q4ZG46|Q8TDH3|Q9H2G8	Silent	SNP	ENST00000309863.6	37	CCDS33268.1																																																																																			.		0.373	GCC2-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358516.3	NM_014635	
TTN	7273	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	179611391	179611391	+	Intron	SNP	G	G	C			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr2:179611391G>C	ENST00000591111.1	-	46	10585				TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590773.1_RNA|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000342992.6_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000589042.1_Intron|TTN_ENST00000360870.5_Missense_Mutation_p.Q5246E|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTCCTTTTTGAATGTTAGAA	0.388																																					p.Q5246E		.											.	TTN-636	0			c.C15736G						.						136.0	129.0	131.0					2																	179611391		2203	4300	6503	SO:0001627	intron_variant	7273	exon46			CTTTTTGAATGTT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10361-4743C>G	2.37:g.179611391G>C		Somatic	63	0		WXS	Illumina HiSeq	Phase_I	92	40	NM_133379	0	0	0	0	0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	3.110	-0.182790	0.06340	.	.	ENSG00000155657	ENST00000360870;ENST00000306136	T	0.65916	-0.18	5.95	5.95	0.96441	.	.	.	.	.	T	0.48352	0.1495	L	0.49778	1.585	0.80722	D	1	P	0.39282	0.666	B	0.28916	0.096	T	0.53063	-0.8491	9	0.02654	T	1	.	15.7227	0.77724	0.0:0.0:0.802:0.198	.	5246	Q8WZ42-6	.	E	5246;527	ENSP00000354117:Q5246E	ENSP00000304714:Q527E	Q	-	1	0	TTN	179319636	0.997000	0.39634	0.984000	0.44739	0.974000	0.67602	2.850000	0.48294	2.825000	0.97269	0.655000	0.94253	CAA	.		0.388	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
RAPH1	65059	broad.mit.edu	37	2	204305768	204305768	+	Silent	SNP	A	A	G			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr2:204305768A>G	ENST00000319170.5	-	14	2444	c.2145T>C	c.(2143-2145)ccT>ccC	p.P715P	ABI2_ENST00000295851.5_3'UTR|RAPH1_ENST00000457812.1_Intron|RAPH1_ENST00000374493.3_Silent_p.P767P	NM_213589.1	NP_998754.1	Q70E73	RAPH1_HUMAN	Ras association (RalGDS/AF-6) and pleckstrin homology domains 1	715					axon extension (GO:0048675)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(5)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						ggggtggaggagggggagggg	0.622																																					p.P715P													.	RAPH1-1151	0			c.T2145C						.						15.0	20.0	18.0					2																	204305768		2144	4244	6388	SO:0001819	synonymous_variant	65059	exon14			TGGAGGAGGGGGA	AJ584699	CCDS2359.1, CCDS2360.1	2q33	2013-01-10	2003-11-25	2003-11-26	ENSG00000173166	ENSG00000173166		"""Pleckstrin homology (PH) domain containing"""	14436	protein-coding gene	gene with protein product	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 18"""	609035	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 9"""	ALS2CR9, ALS2CR18			Standard	NM_203365		Approved	KIAA1681	uc002vad.3	Q70E73	OTTHUMG00000132876	ENST00000319170.5:c.2145T>C	2.37:g.204305768A>G		Somatic	72	4		WXS	Illumina HiSeq	Phase_I	58	12	NM_213589	0	0	0	0	0	Q96Q37|Q9C0I2	Silent	SNP	ENST00000319170.5	37	CCDS2359.1																																																																																			.		0.622	RAPH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256363.2	NM_025252	
GPR1	2825	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	207040930	207040930	+	Silent	SNP	G	G	A			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr2:207040930G>A	ENST00000407325.2	-	3	1404	c.1042C>T	c.(1042-1044)Ctg>Ttg	p.L348L	GPR1_ENST00000437420.1_Silent_p.L348L	NM_001098199.1|NM_001261452.1|NM_001261453.1|NM_001261454.1|NM_001261455.1|NM_005279.3	NP_001091669.1|NP_001248381.1|NP_001248382.1|NP_001248383.1|NP_001248384.1|NP_005270.2	P46091	GPR1_HUMAN	G protein-coupled receptor 1	348					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(7)|skin(1)	18		Lung NSC(271;7.93e-06)|Renal(323;0.000147)|Hepatocellular(293;0.000888)		UCEC - Uterine corpus endometrioid carcinoma (47;0.000241)|Epithelial(149;1.91e-37)|STAD - Stomach adenocarcinoma(1183;0.00178)|Lung(261;0.111)|LUSC - Lung squamous cell carcinoma(261;0.184)		AGGAGACACAGATTCTTGGTT	0.428																																					p.L348L		.											.	GPR1-90	0			c.C1042T						.						64.0	61.0	62.0					2																	207040930		2203	4300	6503	SO:0001819	synonymous_variant	2825	exon3			GACACAGATTCTT		CCDS2368.1	2q33.3	2014-01-30			ENSG00000183671	ENSG00000183671		"""GPCR / Class A : Orphans"""	4463	protein-coding gene	gene with protein product		600239				7851889	Standard	NM_005279		Approved		uc031rqv.1	P46091	OTTHUMG00000132894	ENST00000407325.2:c.1042C>T	2.37:g.207040930G>A		Somatic	63	0		WXS	Illumina HiSeq	Phase_I	46	17	NM_001098199	0	0	0	0	0	A5JUU6|A8K4L1|Q53TR9|Q6NVX4	Silent	SNP	ENST00000407325.2	37	CCDS2368.1																																																																																			.		0.428	GPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256394.2	NM_001098199	
RBM44	375316	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	238722326	238722326	+	Splice_Site	SNP	G	G	T			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr2:238722326G>T	ENST00000444524.2	+	2	201		c.e2+1		RBM44_ENST00000316997.4_Splice_Site|RBM44_ENST00000409864.1_Splice_Site			Q6ZP01	RBM44_HUMAN	RNA binding motif protein 44							cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)	nucleotide binding (GO:0000166)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)			breast(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(7)|ovary(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;3.74e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.3e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000118)|Lung(119;0.0112)|LUSC - Lung squamous cell carcinoma(224;0.0266)		CTCCAAAAAGGTAAGGGTCTA	0.448																																					.		.											.	RBM44-26	0			c.76+1G>T						.						55.0	57.0	57.0					2																	238722326		1917	4134	6051	SO:0001630	splice_region_variant	375316	exon2			AAAAAGGTAAGGG	AK097730	CCDS46554.1	2q37.3	2013-02-12			ENSG00000177483	ENSG00000177483		"""RNA binding motif (RRM) containing"""	24756	protein-coding gene	gene with protein product							Standard	NM_001080504		Approved	FLJ40411	uc002vxi.4	Q6ZP01	OTTHUMG00000152937	ENST00000444524.2:c.201+1G>T	2.37:g.238722326G>T		Somatic	51	0		WXS	Illumina HiSeq	Phase_I	31	16	NM_001080504	0	0	0	0	0	A0AUW3	Splice_Site	SNP	ENST00000444524.2	37		.	.	.	.	.	.	.	.	.	.	G	10.22	1.289839	0.23478	.	.	ENSG00000177483	ENST00000316997;ENST00000409864	.	.	.	4.25	4.25	0.50352	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.4628	0.55741	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RBM44	238387065	1.000000	0.71417	0.956000	0.39512	0.166000	0.22503	3.694000	0.54742	2.660000	0.90430	0.655000	0.94253	.	.		0.448	RBM44-003	PUTATIVE	basic|exp_conf	processed_transcript	protein_coding	OTTHUMT00000400909.1	NM_001080504	Intron
GDF5	8200	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	34021936	34021936	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr20:34021936G>T	ENST00000374372.1	-	4	1780	c.1277C>A	c.(1276-1278)gCt>gAt	p.A426D	GDF5_ENST00000374369.3_Missense_Mutation_p.A426D|GDF5OS_ENST00000374375.1_5'UTR			P43026	GDF5_HUMAN	growth differentiation factor 5	426					cell-cell signaling (GO:0007267)|chondrocyte differentiation (GO:0002062)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix organization (GO:0030198)|forelimb morphogenesis (GO:0035136)|growth (GO:0040007)|hindlimb morphogenesis (GO:0035137)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuron differentiation (GO:0045666)|regulation of multicellular organism growth (GO:0040014)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	growth factor activity (GO:0008083)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(9)|skin(3)	26	Lung NSC(9;0.00642)|all_lung(11;0.0094)		BRCA - Breast invasive adenocarcinoma(18;0.00663)			GCAGTGGAAAGCCTCGTACTC	0.582																																					p.A426D		.											.	GDF5-226	0			c.C1277A						.						133.0	115.0	121.0					20																	34021936		2203	4300	6503	SO:0001583	missense	8200	exon2			TGGAAAGCCTCGT	X80915	CCDS13254.1	20q11.2	2008-05-22	2007-04-12		ENSG00000125965	ENSG00000125965			4220	protein-coding gene	gene with protein product	"""cartilage-derived morphogenetic protein-1"""	601146				9288091, 9288098	Standard	NM_000557		Approved	CDMP1, BMP14	uc002xck.1	P43026	OTTHUMG00000032341	ENST00000374372.1:c.1277C>A	20.37:g.34021936G>T	ENSP00000363492:p.Ala426Asp	Somatic	89	1		WXS	Illumina HiSeq	Phase_I	72	27	NM_000557	0	0	3	3	0	E1P5Q2|Q96SB1	Missense_Mutation	SNP	ENST00000374372.1	37	CCDS13254.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.369453	0.82463	.	.	ENSG00000125965	ENST00000374369;ENST00000374372	D;D	0.86769	-2.17;-2.17	4.4	4.4	0.53042	Transforming growth factor beta, conserved site (1);Transforming growth factor-beta, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.95981	0.8691	H	0.97587	4.035	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97808	1.0249	10	0.87932	D	0	.	17.1668	0.86818	0.0:0.0:1.0:0.0	.	426;426	F1T0J1;P43026	.;GDF5_HUMAN	D	426	ENSP00000363489:A426D;ENSP00000363492:A426D	ENSP00000363489:A426D	A	-	2	0	GDF5	33485350	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.657000	0.98554	2.266000	0.75297	0.462000	0.41574	GCT	.		0.582	GDF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078875.2		
ZNF335	63925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	44578919	44578919	+	Silent	SNP	G	G	C			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr20:44578919G>C	ENST00000322927.2	-	22	3526	c.3426C>G	c.(3424-3426)acC>acG	p.T1142T	ZNF335_ENST00000426788.1_Silent_p.T987T	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	1142					brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				TTGGGGTCTGGGTAGGGGCCC	0.612																																					p.T1142T		.											.	ZNF335-94	0			c.C3426G						.						90.0	93.0	92.0					20																	44578919		2203	4300	6503	SO:0001819	synonymous_variant	63925	exon22			GGTCTGGGTAGGG	AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.3426C>G	20.37:g.44578919G>C		Somatic	133	0		WXS	Illumina HiSeq	Phase_I	97	30	NM_022095	0	0	8	13	5	B4DLG7|Q548D0|Q9H684	Silent	SNP	ENST00000322927.2	37	CCDS13389.1																																																																																			.		0.612	ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079553.1	NM_022095	
PARD6B	84612	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	49366295	49366295	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr20:49366295A>G	ENST00000371610.2	+	3	632	c.389A>G	c.(388-390)cAt>cGt	p.H130R	PARD6B_ENST00000396039.1_Intron	NM_032521.2	NP_115910.1	Q9BYG5	PAR6B_HUMAN	par-6 family cell polarity regulator beta	130	Interaction with PARD3 and CDC42. {ECO:0000250}.				axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell junction assembly (GO:0034329)|cell-cell junction assembly (GO:0007043)|cell-cell junction organization (GO:0045216)|establishment or maintenance of cell polarity (GO:0007163)|protein complex assembly (GO:0006461)|regulation of cell migration (GO:0030334)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)		p.H130R(1)		NS(1)|breast(1)|endometrium(1)|kidney(4)|lung(3)|urinary_tract(1)	11						AAAAAGCCACATATAGTCATT	0.403																																					p.H130R		.											.	PARD6B-91	1	Substitution - Missense(1)	kidney(1)	c.A389G						.						76.0	74.0	75.0					20																	49366295		2203	4300	6503	SO:0001583	missense	84612	exon3			AGCCACATATAGT	AB044555	CCDS33485.1	20q13.13	2013-08-28	2013-08-28		ENSG00000124171	ENSG00000124171			16245	protein-coding gene	gene with protein product		608975	"""par-6 (partitioning defective 6, C.elegans) homolog beta"", ""par-6 partitioning defective 6 homolog beta (C. elegans)"""			11260256	Standard	NM_032521		Approved	PAR-6B	uc002xvo.3	Q9BYG5	OTTHUMG00000032732	ENST00000371610.2:c.389A>G	20.37:g.49366295A>G	ENSP00000360672:p.His130Arg	Somatic	77	0		WXS	Illumina HiSeq	Phase_I	48	16	NM_032521	0	0	5	15	10	A2A2A7|Q9Y510	Missense_Mutation	SNP	ENST00000371610.2	37	CCDS33485.1	.	.	.	.	.	.	.	.	.	.	A	11.30	1.597328	0.28445	.	.	ENSG00000124171	ENST00000371610	T	0.41400	1.0	5.6	5.6	0.85130	.	0.151580	0.64402	D	0.000014	T	0.36991	0.0987	L	0.43152	1.355	0.80722	D	1	B	0.06786	0.001	B	0.09377	0.004	T	0.11421	-1.0588	10	0.25106	T	0.35	-32.4385	15.7847	0.78294	1.0:0.0:0.0:0.0	.	130	Q9BYG5	PAR6B_HUMAN	R	130	ENSP00000360672:H130R	ENSP00000360672:H130R	H	+	2	0	PARD6B	48799702	0.992000	0.36948	0.650000	0.29550	0.857000	0.48899	3.467000	0.53078	2.135000	0.66039	0.533000	0.62120	CAT	.		0.403	PARD6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079697.2	NM_032521	
BAGE2	85319	hgsc.bcm.edu	37	21	11097541	11097541	+	RNA	SNP	C	C	A			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr21:11097541C>A	ENST00000470054.1	-	0	324							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		aagaacgaaactcACAGAGCT	0.562																																					.		.											.	.	0			c.119+2G>T						.						29.0	40.0	36.0					21																	11097541		1319	2455	3774			574	exon3			ACGAAACTCACAG	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11097541C>A		Somatic	37	1		WXS	Illumina HiSeq	Phase_I	31	3	NM_001187	0	0	0	0	0	A8K925|Q08ER0	Splice_Site	SNP	ENST00000470054.1	37																																																																																				.		0.562	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000157417.3	NM_182482	
GAL3ST1	9514	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	30951203	30951203	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr22:30951203C>G	ENST00000402321.1	-	3	1326	c.1009G>C	c.(1009-1011)Gcc>Ccc	p.A337P	GAL3ST1_ENST00000406361.1_Missense_Mutation_p.A337P|GAL3ST1_ENST00000406955.1_Missense_Mutation_p.A337P|GAL3ST1_ENST00000401975.1_Missense_Mutation_p.A337P|GAL3ST1_ENST00000402369.1_Missense_Mutation_p.A337P|GAL3ST1_ENST00000338911.5_Missense_Mutation_p.A337P|GAL3ST1_ENST00000443111.2_Missense_Mutation_p.A337P			Q99999	G3ST1_HUMAN	galactose-3-O-sulfotransferase 1	337					galactosylceramide biosynthetic process (GO:0006682)|glycosphingolipid metabolic process (GO:0006687)|myelination (GO:0042552)|protein N-linked glycosylation (GO:0006487)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|sphingolipid metabolic process (GO:0006665)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	galactosylceramide sulfotransferase activity (GO:0001733)|sulfotransferase activity (GO:0008146)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	21						CGCTCGTTGGCATGGCGCAGG	0.721																																					p.A337P		.											.	GAL3ST1-90	0			c.G1009C						.						20.0	22.0	21.0					22																	30951203		2199	4288	6487	SO:0001583	missense	9514	exon4			CGTTGGCATGGCG	D88667	CCDS13879.1	22q12.2	2007-04-02			ENSG00000128242	ENSG00000128242		"""Sulfotransferases, membrane-bound"""	24240	protein-coding gene	gene with protein product	"""cerebroside (3' phosphoadenylylsulfate:galactosylceramide 3') sulfotransferase"""	602300				9847074, 9030544	Standard	NM_004861		Approved	CST	uc003aii.1	Q99999	OTTHUMG00000151200	ENST00000402321.1:c.1009G>C	22.37:g.30951203C>G	ENSP00000385735:p.Ala337Pro	Somatic	23	0		WXS	Illumina HiSeq	Phase_I	25	13	NM_004861	0	0	5	13	8	Q96C63	Missense_Mutation	SNP	ENST00000402321.1	37	CCDS13879.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.017684	0.75161	.	.	ENSG00000128242	ENST00000406955;ENST00000402321;ENST00000402369;ENST00000401975;ENST00000338911;ENST00000406361;ENST00000443111	T;T;T;T;T;T;T	0.17691	2.26;2.26;2.26;2.26;2.26;2.26;2.26	5.55	5.55	0.83447	.	0.225320	0.47455	D	0.000227	T	0.24547	0.0595	L	0.55990	1.75	0.80722	D	1	P	0.43938	0.822	P	0.48425	0.577	T	0.00557	-1.1672	10	0.30854	T	0.27	-13.5376	12.4548	0.55697	0.0:0.9221:0.0:0.0779	.	337	Q99999	G3ST1_HUMAN	P	337	ENSP00000385825:A337P;ENSP00000385735:A337P;ENSP00000384122:A337P;ENSP00000384388:A337P;ENSP00000343234:A337P;ENSP00000385207:A337P;ENSP00000402587:A337P	ENSP00000343234:A337P	A	-	1	0	GAL3ST1	29281203	0.970000	0.33590	0.958000	0.39756	0.894000	0.52154	2.095000	0.41729	2.615000	0.88500	0.561000	0.74099	GCC	.		0.721	GAL3ST1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321745.1	NM_004861	
CARD10	29775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	37914027	37914027	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr22:37914027G>C	ENST00000403299.1	-	3	540	c.324C>G	c.(322-324)ttC>ttG	p.F108L	CARD10_ENST00000251973.5_Missense_Mutation_p.F108L			Q9BWT7	CAR10_HUMAN	caspase recruitment domain family, member 10	108	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein complex assembly (GO:0006461)|regulation of apoptotic process (GO:0042981)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)	receptor signaling complex scaffold activity (GO:0030159)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	17	Melanoma(58;0.0574)					TGAGCAGCGTGAAGTGTTCGG	0.622																																					p.F108L		.											.	CARD10-662	0			c.C324G						.						94.0	80.0	85.0					22																	37914027		2203	4300	6503	SO:0001583	missense	29775	exon2			CAGCGTGAAGTGT	AF086324	CCDS13948.1	22q13.1	2008-05-22			ENSG00000100065	ENSG00000100065			16422	protein-coding gene	gene with protein product		607209				11259443, 11356195	Standard	NM_014550		Approved	CARMA3, BIMP1	uc003asu.1	Q9BWT7	OTTHUMG00000150592	ENST00000403299.1:c.324C>G	22.37:g.37914027G>C	ENSP00000384570:p.Phe108Leu	Somatic	93	0		WXS	Illumina HiSeq	Phase_I	60	13	NM_014550	0	0	14	32	18	Q14CQ8|Q5TFG6|Q8NC81|Q9UGR5|Q9UGR6|Q9Y3H0	Missense_Mutation	SNP	ENST00000403299.1	37	CCDS13948.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.694688	0.88830	.	.	ENSG00000100065	ENST00000403299;ENST00000251973	T;T	0.20069	2.1;2.1	4.67	3.64	0.41730	DEATH-like (2);Caspase Recruitment (2);	0.151059	0.46442	D	0.000290	T	0.20007	0.0481	L	0.47716	1.5	0.46774	D	0.99919	P	0.40000	0.698	B	0.38683	0.279	T	0.02713	-1.1120	10	0.66056	D	0.02	-23.0196	11.2943	0.49269	0.0863:0.0:0.9137:0.0	.	108	Q9BWT7	CAR10_HUMAN	L	108	ENSP00000384570:F108L;ENSP00000251973:F108L	ENSP00000251973:F108L	F	-	3	2	CARD10	36243973	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	4.159000	0.58157	1.061000	0.40601	0.462000	0.41574	TTC	.		0.622	CARD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318997.1	NM_014550	
GORASP1	64689	hgsc.bcm.edu	37	3	39148980	39148980	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr3:39148980T>C	ENST00000319283.3	-	1	874	c.53A>G	c.(52-54)cAc>cGc	p.H18R	TTC21A_ENST00000431162.2_5'Flank|GORASP1_ENST00000479927.1_Missense_Mutation_p.H18R|TTC21A_ENST00000301819.6_5'Flank|TTC21A_ENST00000440121.1_5'Flank|GORASP1_ENST00000422110.2_Missense_Mutation_p.H18R	NM_031899.2	NP_114105.1	Q9BQQ3	GORS1_HUMAN	golgi reassembly stacking protein 1, 65kDa	18	PDZ.				Golgi organization (GO:0007030)|mitotic cell cycle (GO:0000278)|negative regulation of dendrite morphogenesis (GO:0050774)|protein transport (GO:0015031)	Golgi membrane (GO:0000139)				central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(1)|ovary(3)|urinary_tract(1)	14				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		CCCGTGGAGGTGGAAGCCCTC	0.786																																					p.H18R		.											.	GORASP1-92	0			c.A53G						.						2.0	2.0	2.0					3																	39148980		1235	2829	4064	SO:0001583	missense	64689	exon1			TGGAGGTGGAAGC	AJ409349	CCDS2681.1, CCDS63596.1, CCDS63597.1	3p22-p21.33	2008-04-23	2002-08-29	2002-05-24	ENSG00000114745	ENSG00000114745			16769	protein-coding gene	gene with protein product		606867	"""golgi phosphoprotein 5"""	GOLPH5			Standard	NM_001278789		Approved	GRASP65, P65, FLJ23443	uc003ciw.1	Q9BQQ3	OTTHUMG00000131292	ENST00000319283.3:c.53A>G	3.37:g.39148980T>C	ENSP00000313869:p.His18Arg	Somatic	9	0		WXS	Illumina HiSeq	Phase_I	11	3	NM_031899	0	0	0	0	0	B3KWC8|Q3SYG7|Q8N272|Q96H42	Missense_Mutation	SNP	ENST00000319283.3	37	CCDS2681.1	.	.	.	.	.	.	.	.	.	.	T	15.29	2.789611	0.50102	.	.	ENSG00000114745	ENST00000319283;ENST00000422110;ENST00000479927;ENST00000427459;ENST00000411813;ENST00000441081	T;T;T;T	0.50813	1.62;0.74;0.73;1.62	4.39	1.84	0.25277	PDZ/DHR/GLGF (1);	0.106695	0.64402	U	0.000006	T	0.52354	0.1729	L	0.58669	1.825	0.24833	N	0.992513	D;P;B	0.56035	0.974;0.688;0.024	P;B;B	0.56700	0.804;0.408;0.035	T	0.42616	-0.9441	10	0.87932	D	0	-8.72	6.2398	0.20785	0.1409:0.0812:0.0:0.7779	.	18;18;18	B4E1H8;B3KPY8;Q9BQQ3	.;.;GORS1_HUMAN	R	18	ENSP00000313869:H18R;ENSP00000395709:H18R;ENSP00000419123:H18R;ENSP00000398673:H18R	ENSP00000313869:H18R	H	-	2	0	GORASP1	39123984	1.000000	0.71417	1.000000	0.80357	0.288000	0.27193	2.916000	0.48813	0.518000	0.28383	0.397000	0.26171	CAC	.		0.786	GORASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254060.1		
RAD54L2	23132	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	51697207	51697207	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr3:51697207C>G	ENST00000409535.2	+	22	4300	c.4175C>G	c.(4174-4176)tCc>tGc	p.S1392C	RAD54L2_ENST00000296477.3_Missense_Mutation_p.S1086C	NM_015106.2	NP_055921.2	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2 (S. cerevisiae)	1392						nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|transcription cofactor activity (GO:0003712)			NS(2)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|liver(2)|lung(9)|ovary(4)|skin(2)	31				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		CCACTCCTGTCCGAGCCGAGG	0.567																																					p.S1392C		.											.	RAD54L2-93	0			c.C4175G						.						153.0	132.0	139.0					3																	51697207		2203	4300	6503	SO:0001583	missense	23132	exon22			TCCTGTCCGAGCC	AB018352	CCDS33765.2	3p21.2	2006-01-17			ENSG00000164080	ENSG00000164080			29123	protein-coding gene	gene with protein product						9872452	Standard	NM_015106		Approved	KIAA0809, SRISNF2L	uc011bdt.2	Q9Y4B4	OTTHUMG00000152936	ENST00000409535.2:c.4175C>G	3.37:g.51697207C>G	ENSP00000386520:p.Ser1392Cys	Somatic	183	0		WXS	Illumina HiSeq	Phase_I	123	48	NM_015106	0	0	3	4	1	Q8TB57|Q9BV54	Missense_Mutation	SNP	ENST00000409535.2	37	CCDS33765.2	.	.	.	.	.	.	.	.	.	.	C	17.44	3.390512	0.62066	.	.	ENSG00000164080	ENST00000409535;ENST00000296477	D;D	0.94092	-3.24;-3.35	5.56	5.56	0.83823	.	0.324591	0.28927	N	0.013698	D	0.85643	0.5744	N	0.08118	0	0.80722	D	1	P;P	0.46327	0.661;0.876	B;B	0.36289	0.221;0.221	D	0.88801	0.3285	10	0.72032	D	0.01	-4.0774	18.5281	0.90980	0.0:1.0:0.0:0.0	.	1392;981	Q9Y4B4;B3KV54	ARIP4_HUMAN;.	C	1392;1086	ENSP00000386520:S1392C;ENSP00000296477:S1086C	ENSP00000296477:S1086C	S	+	2	0	RAD54L2	51672247	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.158000	0.58150	2.609000	0.88269	0.655000	0.94253	TCC	.		0.567	RAD54L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328700.2	NM_015106	
MITF	4286	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	69928532	69928532	+	Nonsense_Mutation	SNP	A	A	T			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr3:69928532A>T	ENST00000448226.2	+	2	479	c.352A>T	c.(352-354)Aag>Tag	p.K118*	MITF_ENST00000328528.6_Nonsense_Mutation_p.K117*|MITF_ENST00000394355.2_Nonsense_Mutation_p.K93*|MITF_ENST00000314589.5_Nonsense_Mutation_p.K102*|MITF_ENST00000472437.1_Nonsense_Mutation_p.K66*|MITF_ENST00000352241.4_Nonsense_Mutation_p.K118*			O75030	MITF_HUMAN	microphthalmia-associated transcription factor	118					bone remodeling (GO:0046849)|camera-type eye development (GO:0043010)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cell fate commitment (GO:0045165)|melanocyte differentiation (GO:0030318)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(6)|stomach(1)|urinary_tract(2)	30		Lung NSC(201;0.0384)|Prostate(884;0.0526)		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)		GGAAGTCCTTAAGGTACGTGA	0.478			A		melanoma		"""Waardenburg syndrome type 2, Tietz syndrome"""																														p.K118X	Melanoma(29;269 969 31479 41502 42961)	.		Dom	yes		3	3p14.1	4286	microphthalmia-associated transcription factor	yes	E	.	MITF-524	0			c.A352T						.						53.0	59.0	57.0					3																	69928532		2104	4227	6331	SO:0001587	stop_gained	4286	exon2			GTCCTTAAGGTAC		CCDS2913.1, CCDS43106.1, CCDS43107.1, CCDS46865.1, CCDS46866.1, CCDS46866.2, CCDS54607.1, CCDS74962.1	3p14.1-p12.3	2014-09-17			ENSG00000187098	ENSG00000187098		"""Basic helix-loop-helix proteins"""	7105	protein-coding gene	gene with protein product	"""homolog of mouse microphthalmia"""	156845	"""Waardenburg syndrome, type 2A"""	WS2A, WS2		8069297, 7874167, 7951321	Standard	NM_198159		Approved	MI, bHLHe32	uc003dnz.3	O75030	OTTHUMG00000149921	ENST00000448226.2:c.352A>T	3.37:g.69928532A>T	ENSP00000391803:p.Lys118*	Somatic	35	0		WXS	Illumina HiSeq	Phase_I	35	19	NM_198159	0	0	0	0	0	B4DJL2|D3K197|E9PFN0|Q14841|Q9P2V0|Q9P2V1|Q9P2V2|Q9P2Y8	Nonsense_Mutation	SNP	ENST00000448226.2	37		.	.	.	.	.	.	.	.	.	.	A	33	5.248140	0.95305	.	.	ENSG00000187098	ENST00000352241;ENST00000448226;ENST00000429090;ENST00000433517;ENST00000472437;ENST00000457080;ENST00000328528;ENST00000451708;ENST00000314589;ENST00000394355	.	.	.	6.02	6.02	0.97574	.	0.088619	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5446	0.84426	1.0:0.0:0.0:0.0	.	.	.	.	X	118;118;66;66;66;117;117;102;102;93	.	.	K	+	1	0	MITF	70011222	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	8.923000	0.92808	2.311000	0.77944	0.533000	0.62120	AAG	.		0.478	MITF-007	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000313947.1	NM_198159	
NXPE3	91775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	101520832	101520832	+	Splice_Site	SNP	A	A	T			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr3:101520832A>T	ENST00000491511.2	+	5	1803	c.847A>T	c.(847-849)Agt>Tgt	p.S283C	NXPE3_ENST00000422132.1_Splice_Site_p.S283C|NXPE3_ENST00000477909.1_Splice_Site_p.S283C|NXPE3_ENST00000273347.5_Splice_Site_p.S283C	NM_001134456.1	NP_001127928.1	Q969Y0	NXPE3_HUMAN	neurexophilin and PC-esterase domain family, member 3	283						extracellular region (GO:0005576)											TTTCTTCCAGAGGTATGTACT	0.443																																					p.S283C		.											.	.	0			c.A847T						.						92.0	98.0	96.0					3																	101520832		2177	4287	6464	SO:0001630	splice_region_variant	91775	exon5			TTCCAGAGGTATG	AK054664	CCDS2945.1	3q12.3	2012-06-14	2012-06-11	2012-06-11	ENSG00000144815	ENSG00000144815			28238	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member C"""	FAM55C		12975309	Standard	NM_001134456		Approved	MGC15606	uc003dvn.3	Q969Y0	OTTHUMG00000159179	ENST00000491511.2:c.848+1A>T	3.37:g.101520832A>T		Somatic	233	0		WXS	Illumina HiSeq	Phase_I	174	65	NM_145037	0	0	1	2	1	A8K0X4|D3DN53|Q7Z2S8	Missense_Mutation	SNP	ENST00000491511.2	37	CCDS2945.1	.	.	.	.	.	.	.	.	.	.	A	25.8	4.677582	0.88445	.	.	ENSG00000144815	ENST00000273347;ENST00000491511;ENST00000477909;ENST00000422132	T;T;T;T	0.13420	2.59;2.59;2.59;2.59	5.8	5.8	0.92144	.	0.197973	0.64402	D	0.000006	T	0.37461	0.1004	M	0.69823	2.125	0.58432	D	0.999999	D	0.76494	0.999	D	0.71656	0.974	T	0.10941	-1.0608	10	0.66056	D	0.02	-3.0682	16.1475	0.81580	1.0:0.0:0.0:0.0	.	283	Q969Y0	FA55C_HUMAN	C	283	ENSP00000273347:S283C;ENSP00000417485:S283C;ENSP00000418369:S283C;ENSP00000396421:S283C	ENSP00000273347:S283C	S	+	1	0	FAM55C	103003522	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	9.300000	0.96151	2.213000	0.71641	0.528000	0.53228	AGT	.		0.443	NXPE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353711.2	NM_145037	Missense_Mutation
AP2M1	1173	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	183898969	183898969	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr3:183898969T>C	ENST00000292807.5	+	7	810	c.662T>C	c.(661-663)gTt>gCt	p.V221A	AP2M1_ENST00000439647.1_Missense_Mutation_p.V219A|EIF2B5_ENST00000444495.1_Intron|AP2M1_ENST00000382456.3_Missense_Mutation_p.V219A|AP2M1_ENST00000411763.2_Missense_Mutation_p.V246A|AP2M1_ENST00000461733.1_3'UTR	NM_004068.3	NP_004059.2	Q96CW1	AP2M1_HUMAN	adaptor-related protein complex 2, mu 1 subunit	221	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of protein localization to plasma membrane (GO:1903077)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|transporter activity (GO:0005215)			endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(1)	18	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.92e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GACAAGATTGTTATTGAAAAG	0.562																																					p.V219A		.											.	AP2M1-90	0			c.T656C						.						145.0	153.0	151.0					3																	183898969		2060	4205	6265	SO:0001583	missense	1173	exon6			AGATTGTTATTGA	U36188	CCDS43177.1, CCDS43178.1	3q28	2008-07-18			ENSG00000161203	ENSG00000161203			564	protein-coding gene	gene with protein product	"""clathrin-associated/assembly/adaptor protein, medium 1"", ""plasma membrane adaptor AP-2 50kDA protein"", ""clathrin coat adaptor protein AP50"", ""clathrin adaptor complex AP2, mu subunit"", ""HA2 50 kDA subunit"", ""clathrin assembly protein complex 2 medium chain"", ""AP-2 mu 2 chain"""	601024		CLAPM1		8595912	Standard	NM_004068		Approved	AP50, mu2	uc003fmw.3	Q96CW1	OTTHUMG00000156822	ENST00000292807.5:c.662T>C	3.37:g.183898969T>C	ENSP00000292807:p.Val221Ala	Somatic	257	0		WXS	Illumina HiSeq	Phase_I	197	87	NM_001025205	0	1	121	243	121	A6NE12|D3DNT1|P20172|P53679	Missense_Mutation	SNP	ENST00000292807.5	37	CCDS43177.1	.	.	.	.	.	.	.	.	.	.	T	15.88	2.963122	0.53507	.	.	ENSG00000161203	ENST00000382456;ENST00000411763;ENST00000292807;ENST00000540821;ENST00000539646;ENST00000439647	T;T;T;T	0.18657	2.2;2.2;2.2;2.2	6.07	4.91	0.64330	Clathrin adaptor, mu subunit, C-terminal (3);	0.164876	0.53938	D	0.000053	T	0.33059	0.0850	M	0.67569	2.06	0.58432	D	0.999999	B;B;B;B	0.26602	0.003;0.076;0.154;0.127	B;B;B;B	0.41174	0.039;0.349;0.198;0.125	T	0.09122	-1.0689	10	0.46703	T	0.11	.	12.1758	0.54184	0.0:0.0663:0.0:0.9337	.	111;91;221;219	B7Z4N2;B4DTI4;Q96CW1;Q96CW1-2	.;.;AP2M1_HUMAN;.	A	219;246;221;161;206;219	ENSP00000371894:V219A;ENSP00000403362:V246A;ENSP00000292807:V221A;ENSP00000409081:V219A	ENSP00000292807:V221A	V	+	2	0	AP2M1	185381663	1.000000	0.71417	0.993000	0.49108	0.920000	0.55202	7.375000	0.79646	1.119000	0.41883	-0.256000	0.11100	GTT	.		0.562	AP2M1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000346013.1	NM_004068	
FIP1L1	81608	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	54266007	54266007	+	Splice_Site	SNP	G	G	C			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr4:54266007G>C	ENST00000337488.6	+	10	1009		c.e10+1		FIP1L1_ENST00000358575.5_Splice_Site|FIP1L1_ENST00000306932.6_Splice_Site|FIP1L1_ENST00000507922.1_Splice_Site|FIP1L1_ENST00000507166.1_Splice_Site	NM_030917.3	NP_112179.2	Q6UN15	FIP1_HUMAN	factor interacting with PAPOLA and CPSF1						mRNA processing (GO:0006397)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			large_intestine(3)|liver(1)|ovary(1)|skin(1)	6			GBM - Glioblastoma multiforme(3;3.31e-36)|LUSC - Lung squamous cell carcinoma(32;0.0134)			CACCGAGCAGGTTAGTTACAT	0.363			T	PDGFRA	idiopathic hypereosinophilic syndrome																																.		.		Dom	yes		4	4q12	81608	FIP1 like 1 (S. cerevisiae)		L	.	FIP1L1-1083	0			c.701+1G>C						.						132.0	128.0	129.0					4																	54266007		2203	4300	6503	SO:0001630	splice_region_variant	81608	exon8			GAGCAGGTTAGTT	AF161429	CCDS3491.1, CCDS47055.1, CCDS47056.1	4q12	2013-06-18	2013-06-18		ENSG00000145216	ENSG00000145216			19124	protein-coding gene	gene with protein product		607686	"""FIP1 like 1 (S. cerevisiae)"", ""FIP1L1 cleavage and polyadenylation specific factor subunit"""			11230166, 14749727	Standard	NM_030917		Approved	DKFZp586K0717, FIP1	uc003hae.3	Q6UN15	OTTHUMG00000128701	ENST00000337488.6:c.815+1G>C	4.37:g.54266007G>C		Somatic	142	0		WXS	Illumina HiSeq	Phase_I	76	31	NM_001134938	0	0	0	7	7	B4DIR3|G3XAD6|Q0VGE0|Q499Y4|Q49AU3|Q7Z608|Q8WVN3|Q96F80|Q9H077	Splice_Site	SNP	ENST00000337488.6	37	CCDS3491.1	.	.	.	.	.	.	.	.	.	.	G	16.44	3.122802	0.56613	.	.	ENSG00000145216	ENST00000337488;ENST00000358575;ENST00000507922;ENST00000306932;ENST00000507166	.	.	.	5.38	5.38	0.77491	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5077	0.95125	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FIP1L1	53960764	1.000000	0.71417	1.000000	0.80357	0.625000	0.37756	7.864000	0.87037	2.683000	0.91414	0.655000	0.94253	.	.		0.363	FIP1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250602.1	NM_030917	Intron
PLRG1	5356	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	155465648	155465648	+	Silent	SNP	T	T	C			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr4:155465648T>C	ENST00000499023.2	-	7	669	c.543A>G	c.(541-543)aaA>aaG	p.K181K	PLRG1_ENST00000302078.5_Silent_p.K172K|PLRG1_ENST00000393905.2_Silent_p.K181K|RNU6-1285P_ENST00000363480.1_RNA	NM_001201564.1|NM_002669.3	NP_001188493.1|NP_002660.1	O43660	PLRG1_HUMAN	pleiotropic regulator 1	181					mRNA splicing, via spliceosome (GO:0000398)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|protein localization to nucleus (GO:0034504)|regulation of RNA biosynthetic process (GO:2001141)|signal transduction (GO:0007165)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)|transcription corepressor activity (GO:0003714)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|skin(1)|urinary_tract(1)	22	all_hematologic(180;0.215)	Renal(120;0.0854)				TTGTAGGGGCTTTTTTAGCCA	0.408																																					p.K181K		.											.	PLRG1-90	0			c.A543G						.						139.0	140.0	139.0					4																	155465648		2203	4300	6503	SO:0001819	synonymous_variant	5356	exon7			AGGGGCTTTTTTA	AF044333	CCDS34083.1, CCDS56341.1	4q31.2-q32.1	2013-01-10	2011-05-19		ENSG00000171566	ENSG00000171566		"""WD repeat domain containing"""	9089	protein-coding gene	gene with protein product	"""transport and golgi organization 4 homolog (Drosophila)"""	605961	"""pleiotropic regulator 1 (PRL1, Arabidopsis homolog)"", ""pleiotropic regulator 1 (PRL1 homolog, Arabidopsis)"""				Standard	NM_002669		Approved	PRL1, Prp46, PRPF46, Cwc1, TANGO4	uc003iny.3	O43660	OTTHUMG00000161411	ENST00000499023.2:c.543A>G	4.37:g.155465648T>C		Somatic	97	0		WXS	Illumina HiSeq	Phase_I	66	25	NM_002669	0	0	15	34	19	B3KMK4|Q3KQY5|Q8WUD8	Silent	SNP	ENST00000499023.2	37	CCDS34083.1																																																																																			.		0.408	PLRG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364824.1	NM_002669	
PCSK1	5122	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	95761622	95761622	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr5:95761622C>G	ENST00000311106.3	-	3	535	c.298G>C	c.(298-300)Gaa>Caa	p.E100Q	PCSK1_ENST00000508626.1_Missense_Mutation_p.E53Q|CTD-2337A12.1_ENST00000502645.2_RNA	NM_000439.4|NM_001177876.1	NP_000430.3|NP_001171347.1	P29120	NEC1_HUMAN	proprotein convertase subtilisin/kexin type 1	100					cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|metabolic process (GO:0008152)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of insulin secretion (GO:0050796)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	36		all_cancers(142;2.67e-06)|all_epithelial(76;6.92e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0112)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;3.44e-16)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TACTGTTGTTCAGCCCATATC	0.383																																					p.E100Q		.											.	PCSK1-92	0			c.G298C						.						141.0	129.0	133.0					5																	95761622		2203	4300	6503	SO:0001583	missense	5122	exon3			GTTGTTCAGCCCA		CCDS4081.1, CCDS54881.1	5q15-q21	2008-07-18			ENSG00000175426	ENSG00000175426			8743	protein-coding gene	gene with protein product	"""prohormone convertase 3"", ""prohormone convertase 1"", ""neuroendocrine convertase 1"", ""proprotein convertase 1"""	162150		NEC1		1765368	Standard	NM_000439		Approved	PC1, PC3, SPC3	uc003kls.2	P29120	OTTHUMG00000122089	ENST00000311106.3:c.298G>C	5.37:g.95761622C>G	ENSP00000308024:p.Glu100Gln	Somatic	50	0		WXS	Illumina HiSeq	Phase_I	40	16	NM_000439	0	0	0	0	0	B7Z8T7|E9PHA1|P78478|Q92532	Missense_Mutation	SNP	ENST00000311106.3	37	CCDS4081.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.305017	0.81247	.	.	ENSG00000175426	ENST00000311106;ENST00000508626;ENST00000509190	T;T;T	0.33216	1.42;1.42;2.19	5.63	5.63	0.86233	Proteinase inhibitor, propeptide (1);	0.000000	0.85682	D	0.000000	T	0.35740	0.0942	L	0.39633	1.23	0.58432	D	0.999997	D	0.53312	0.959	P	0.49887	0.625	T	0.01613	-1.1312	10	0.15066	T	0.55	-30.1455	19.6351	0.95728	0.0:1.0:0.0:0.0	.	100	P29120	NEC1_HUMAN	Q	100;53;100	ENSP00000308024:E100Q;ENSP00000421600:E53Q;ENSP00000427294:E100Q	ENSP00000308024:E100Q	E	-	1	0	PCSK1	95787378	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.393000	0.79851	2.805000	0.96524	0.655000	0.94253	GAA	.		0.383	PCSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242851.1	NM_000439	
FAM71B	153745	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	156590018	156590018	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr5:156590018G>C	ENST00000302938.4	-	2	1353	c.1258C>G	c.(1258-1260)Ccc>Gcc	p.P420A		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	420						nucleus (GO:0005634)				NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TCAGCACTGGGCTGGGAAACT	0.488																																					p.P420A		.											.	FAM71B-96	0			c.C1258G						.						102.0	103.0	102.0					5																	156590018		2203	4300	6503	SO:0001583	missense	153745	exon2			CACTGGGCTGGGA		CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.1258C>G	5.37:g.156590018G>C	ENSP00000305596:p.Pro420Ala	Somatic	137	0		WXS	Illumina HiSeq	Phase_I	113	54	NM_130899	0	0	0	0	0	Q1EDD9|Q8TC64|Q96LY8	Missense_Mutation	SNP	ENST00000302938.4	37	CCDS4335.1	.	.	.	.	.	.	.	.	.	.	G	0.013	-1.631608	0.00813	.	.	ENSG00000170613	ENST00000302938	T	0.17528	2.27	4.4	-1.91	0.07641	.	0.847983	0.09952	N	0.734546	T	0.10035	0.0246	L	0.48877	1.53	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.42849	-0.9427	10	0.07482	T	0.82	-0.6432	2.0469	0.03562	0.1:0.2599:0.2424:0.3977	.	420	Q8TC56	FA71B_HUMAN	A	420	ENSP00000305596:P420A	ENSP00000305596:P420A	P	-	1	0	FAM71B	156522596	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.057000	0.11768	-0.177000	0.10690	-0.291000	0.09656	CCC	.		0.488	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252570.2	NM_130899	
C6orf136	221545	broad.mit.edu	37	6	30615105	30615105	+	Intron	SNP	A	A	G			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr6:30615105A>G	ENST00000376473.5	+	1	231				C6orf136_ENST00000293604.6_Missense_Mutation_p.R33G|C6orf136_ENST00000528347.2_5'Flank|C6orf136_ENST00000376471.4_Intron|C6orf136_ENST00000493705.1_Intron|AL662800.2_ENST00000583820.1_RNA	NM_001109938.2	NP_001103408.1	Q5SQH8	CF136_HUMAN	chromosome 6 open reading frame 136							mitochondrion (GO:0005739)				endometrium(1)|large_intestine(2)|lung(6)|ovary(1)	10						AGAGGGAGGGAGGAGAGGGGG	0.736																																					p.R33G													.	C6orf136-90	0			c.A97G						.						11.0	13.0	13.0					6																	30615105		1739	3893	5632	SO:0001627	intron_variant	221545	exon1			GGAGGGAGGAGAG	BC016167	CCDS4684.1, CCDS43443.1, CCDS4684.2, CCDS54979.1	6p21.32	2012-02-06			ENSG00000204564	ENSG00000204564			21301	protein-coding gene	gene with protein product							Standard	NM_001109938		Approved	Em:AB023049.8	uc003nqx.4	Q5SQH8	OTTHUMG00000031221	ENST00000376473.5:c.72+25A>G	6.37:g.30615105A>G		Somatic	44	0		WXS	Illumina HiSeq	Phase_I	33	8	NM_001161376	0	0	0	0	0	A9R9P9|F8VX15|Q5SU01|Q6ZSB7|Q8TB84	Missense_Mutation	SNP	ENST00000376473.5	37	CCDS43443.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.959015	0.74016	.	.	ENSG00000204564	ENST00000293604	.	.	.	5.16	-1.74	0.08056	.	.	.	.	.	T	0.04679	0.0127	N	0.08118	0	0.19300	N	0.999978	B	0.02656	0.0	B	0.01281	0.0	T	0.42849	-0.9427	7	.	.	.	.	5.8169	0.18497	0.4504:0.1339:0.4157:0.0	.	33	F8VX15	.	G	33	.	.	R	+	1	2	C6orf136	30723084	0.004000	0.15560	0.000000	0.03702	0.005000	0.04900	-0.181000	0.09740	-0.148000	0.11234	-0.408000	0.06270	AGG	.		0.736	C6orf136-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076457.4	NM_145029	
BAK1	578	hgsc.bcm.edu;broad.mit.edu	37	6	33543199	33543199	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr6:33543199G>A	ENST00000374467.3	-	4	474	c.226C>T	c.(226-228)Cgg>Tgg	p.R76W	BAK1_ENST00000442998.2_Missense_Mutation_p.R76W|BAK1_ENST00000360661.5_Missense_Mutation_p.R76W	NM_001188.3	NP_001179.1	Q16611	BAK_HUMAN	BCL2-antagonist/killer 1	76					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|aging (GO:0007568)|apoptotic process (GO:0006915)|apoptotic process involved in patterning of blood vessels (GO:1902262)|apoptotic signaling pathway (GO:0097190)|B cell apoptotic process (GO:0001783)|B cell homeostasis (GO:0001782)|B cell negative selection (GO:0002352)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular response to mechanical stimulus (GO:0071260)|cellular response to UV (GO:0034644)|endocrine pancreas development (GO:0031018)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|establishment or maintenance of transmembrane electrochemical gradient (GO:0010248)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fibroblast apoptotic process (GO:0044346)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|limb morphogenesis (GO:0035108)|mitochondrial fusion (GO:0008053)|myeloid cell homeostasis (GO:0002262)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of gene expression (GO:0010629)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of endoplasmic reticulum unfolded protein response (GO:1900103)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of proteolysis (GO:0045862)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|post-embryonic camera-type eye morphogenesis (GO:0048597)|regulation of cell cycle (GO:0051726)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|release of cytochrome c from mitochondria (GO:0001836)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to fungus (GO:0009620)|response to gamma radiation (GO:0010332)|response to hydrogen peroxide (GO:0042542)|response to mycotoxin (GO:0010046)|response to organic cyclic compound (GO:0014070)|response to UV-C (GO:0010225)|thymocyte apoptotic process (GO:0070242)|vagina development (GO:0060068)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|pore complex (GO:0046930)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			large_intestine(1)|lung(1)|ovary(1)|skin(1)	4						GCGAGCTGCCGTCCCACCTGC	0.617																																					p.R76W		.											.	BAK1-638	0			c.C226T						.						106.0	81.0	89.0					6																	33543199		2203	4300	6503	SO:0001583	missense	578	exon4			GCTGCCGTCCCAC	U23765	CCDS4781.1	6p21.31	2014-03-07			ENSG00000030110	ENSG00000030110			949	protein-coding gene	gene with protein product		600516		CDN1		7715730, 7715731	Standard	NM_001188		Approved	BCL2L7, BAK	uc003oes.3	Q16611	OTTHUMG00000014530	ENST00000374467.3:c.226C>T	6.37:g.33543199G>A	ENSP00000363591:p.Arg76Trp	Somatic	109	1		WXS	Illumina HiSeq	Phase_I	88	5	NM_001188	0	0	14	14	0	C0H5Y7|Q6I9T6|Q92533	Missense_Mutation	SNP	ENST00000374467.3	37	CCDS4781.1	.	.	.	.	.	.	.	.	.	.	G	16.28	3.079097	0.55753	.	.	ENSG00000030110	ENST00000374460;ENST00000374467;ENST00000442998;ENST00000360661	T;T;T	0.04654	3.58;3.58;3.58	4.41	2.63	0.31362	Apoptosis regulator, Bcl-2, BH3 motif, conserved site (1);	0.110712	0.39341	N	0.001388	T	0.06690	0.0171	M	0.64997	1.995	0.33612	D	0.603652	D;D	0.89917	1.0;1.0	D;D	0.81914	0.984;0.995	T	0.09640	-1.0665	10	0.87932	D	0	-19.7966	3.741	0.08530	0.2039:0.0:0.6032:0.1929	.	76;76	B4E0L2;Q16611	.;BAK_HUMAN	W	56;76;76;76	ENSP00000363591:R76W;ENSP00000391258:R76W;ENSP00000353878:R76W	ENSP00000353878:R76W	R	-	1	2	BAK1	33651177	0.936000	0.31750	0.523000	0.27875	0.957000	0.61999	1.834000	0.39171	0.517000	0.28361	0.543000	0.68304	CGG	.		0.617	BAK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040202.1	NM_001188	
DDO	8528	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	110734538	110734538	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr6:110734538G>A	ENST00000368924.3	-	2	227	c.212C>T	c.(211-213)aCc>aTc	p.T71I	DDO_ENST00000368923.3_Missense_Mutation_p.T71I	NM_003649.2	NP_003640.2	Q99489	OXDD_HUMAN	D-aspartate oxidase	43					aspartate catabolic process (GO:0006533)|aspartate metabolic process (GO:0006531)|D-amino acid catabolic process (GO:0019478)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insemination (GO:0007320)|oxidation-reduction process (GO:0055114)	peroxisome (GO:0005777)	cofactor binding (GO:0048037)|D-aspartate oxidase activity (GO:0008445)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|pancreas(1)|skin(3)	24		all_cancers(87;3.47e-21)|all_epithelial(87;9.03e-20)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_lung(197;2.98e-05)|Lung NSC(302;3.25e-05)|Colorectal(196;3.46e-05)|Ovarian(999;0.00327)		all cancers(137;2.54e-48)|Epithelial(106;3.11e-44)|OV - Ovarian serous cystadenocarcinoma(136;2.08e-24)|BRCA - Breast invasive adenocarcinoma(108;0.000141)|GBM - Glioblastoma multiforme(226;0.00046)		CACATCACTGGTGGTATCTGG	0.493																																					p.T71I		.											.	DDO-155	0			c.C212T						.						133.0	116.0	122.0					6																	110734538		2203	4300	6503	SO:0001583	missense	8528	exon2			TCACTGGTGGTAT	D89858	CCDS5082.1, CCDS5083.1	6q22.1	2008-02-05			ENSG00000203797	ENSG00000203797	1.4.3.1		2727	protein-coding gene	gene with protein product		124450				9163533	Standard	NM_003649		Approved		uc003puc.3	Q99489	OTTHUMG00000015360	ENST00000368924.3:c.212C>T	6.37:g.110734538G>A	ENSP00000357920:p.Thr71Ile	Somatic	207	0		WXS	Illumina HiSeq	Phase_I	125	53	NM_004032	0	0	12	16	4	A8KAG4|Q5JXM4|Q5JXM5|Q5JXM6|Q8N552	Missense_Mutation	SNP	ENST00000368924.3	37	CCDS5082.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.287509	0.80803	.	.	ENSG00000203797	ENST00000368924;ENST00000368923;ENST00000368925	D;D;D	0.83250	-1.7;-1.7;-1.7	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.94221	0.8145	H	0.96777	3.88	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.95581	0.8646	10	0.72032	D	0.01	-21.4422	19.187	0.93648	0.0:0.0:1.0:0.0	.	71;71	Q99489-4;Q99489-3	.;.	I	71;71;43	ENSP00000357920:T71I;ENSP00000357919:T71I;ENSP00000357921:T43I	ENSP00000357919:T71I	T	-	2	0	DDO	110841231	1.000000	0.71417	0.997000	0.53966	0.546000	0.35178	7.120000	0.77153	2.614000	0.88457	0.655000	0.94253	ACC	.		0.493	DDO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041796.1		
AHI1	54806	broad.mit.edu	37	6	135784313	135784313	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr6:135784313T>C	ENST00000367800.4	-	6	1097	c.881A>G	c.(880-882)cAa>cGa	p.Q294R	AHI1_ENST00000327035.6_Missense_Mutation_p.Q294R|AHI1_ENST00000457866.2_Missense_Mutation_p.Q294R	NM_001134830.1	NP_001128302.1	Q8N157	AHI1_HUMAN	Abelson helper integration site 1	294	Interaction with HAP1.				cellular protein localization (GO:0034613)|central nervous system development (GO:0007417)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|cloaca development (GO:0035844)|heart looping (GO:0001947)|hindbrain development (GO:0030902)|Kupffer's vesicle development (GO:0070121)|left/right axis specification (GO:0070986)|morphogenesis of a polarized epithelium (GO:0001738)|negative regulation of apoptotic process (GO:0043066)|otic vesicle development (GO:0071599)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of polarized epithelial cell differentiation (GO:0030862)|positive regulation of receptor internalization (GO:0002092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pronephric duct morphogenesis (GO:0039023)|pronephric nephron tubule morphogenesis (GO:0039008)|protein localization to organelle (GO:0033365)|regulation of behavior (GO:0050795)|retina layer formation (GO:0010842)|specification of axis polarity (GO:0065001)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vesicle targeting (GO:0006903)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|nonmotile primary cilium (GO:0031513)|photoreceptor outer segment (GO:0001750)|primary cilium (GO:0072372)|TCTN-B9D complex (GO:0036038)		p.Q294R(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)	37	Breast(56;0.239)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00904)|OV - Ovarian serous cystadenocarcinoma(155;0.00991)		TGTATCATCTTGCATGCTGTC	0.313																																					p.Q294R													.	AHI1-227	1	Substitution - Missense(1)	kidney(1)	c.A881G						.						129.0	114.0	119.0					6																	135784313		1852	4103	5955	SO:0001583	missense	54806	exon7			TCATCTTGCATGC	AJ459824	CCDS47483.1, CCDS47484.1	6q23.2	2013-01-10	2005-11-29		ENSG00000135541	ENSG00000135541		"""WD repeat domain containing"""	21575	protein-coding gene	gene with protein product	"""Jouberin"""	608894	"""Abelson helper integration site"""			15060101, 16240161	Standard	NM_017651		Approved	FLJ20069, ORF1, JBTS3	uc003qgj.3	Q8N157	OTTHUMG00000015631	ENST00000367800.4:c.881A>G	6.37:g.135784313T>C	ENSP00000356774:p.Gln294Arg	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	49	3	NM_001134832	0	0	4	4	0	E1P584|Q4FD35|Q504T3|Q5TCP9|Q6P098|Q6PIT6|Q8NDX0|Q9H0H2	Missense_Mutation	SNP	ENST00000367800.4	37	CCDS47483.1	.	.	.	.	.	.	.	.	.	.	T	3.317	-0.139492	0.06669	.	.	ENSG00000135541	ENST00000367800;ENST00000457866;ENST00000265602;ENST00000327035;ENST00000367801;ENST00000524469	T;T;T;T;T	0.57107	0.42;0.42;0.42;1.63;0.93	4.34	2.06	0.26882	.	0.686507	0.13895	N	0.355342	T	0.26376	0.0644	L	0.51422	1.61	0.58432	D	0.999999	B;B	0.31125	0.145;0.309	B;B	0.21708	0.036;0.026	T	0.16512	-1.0400	10	0.66056	D	0.02	-4.9798	8.9169	0.35587	0.0:0.0:0.507:0.493	.	294;294	Q8N157-2;Q8N157	.;AHI1_HUMAN	R	294;294;294;294;294;276	ENSP00000356774:Q294R;ENSP00000388650:Q294R;ENSP00000265602:Q294R;ENSP00000322478:Q294R;ENSP00000433063:Q276R	ENSP00000265602:Q294R	Q	-	2	0	AHI1	135826006	0.083000	0.21467	0.245000	0.24217	0.019000	0.09904	1.142000	0.31540	0.484000	0.27630	0.383000	0.25322	CAA	.		0.313	AHI1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391948.1	NM_017651	
SYNE1	23345	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	152631610	152631610	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr6:152631610G>A	ENST00000367255.5	-	89	17541	c.16940C>T	c.(16939-16941)gCc>gTc	p.A5647V	SYNE1_ENST00000423061.1_Missense_Mutation_p.A5576V|SYNE1_ENST00000341594.5_Missense_Mutation_p.A5259V|SYNE1_ENST00000356820.4_Missense_Mutation_p.A171V|SYNE1_ENST00000448038.1_Missense_Mutation_p.A5576V|SYNE1_ENST00000265368.4_Missense_Mutation_p.A5647V	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5647					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.A5647V(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTGCTCCAAGGCAGCTTGTAA	0.433										HNSCC(10;0.0054)																											p.A5647V		.											.	SYNE1-607	2	Substitution - Missense(2)	large_intestine(2)	c.C16940T						.						104.0	103.0	103.0					6																	152631610		2203	4300	6503	SO:0001583	missense	23345	exon89			TCCAAGGCAGCTT	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.16940C>T	6.37:g.152631610G>A	ENSP00000356224:p.Ala5647Val	Somatic	86	0		WXS	Illumina HiSeq	Phase_I	50	19	NM_182961	0	0	2	4	2	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	G	22.7	4.327610	0.81690	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820	T;T;T;T;T;T	0.50548	1.38;1.38;1.38;1.38;0.74;1.38	6.06	6.06	0.98353	.	0.000000	0.64402	D	0.000009	T	0.64136	0.2571	M	0.72118	2.19	0.53688	D	0.99997	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.74348	0.961;0.961;0.983	T	0.57963	-0.7720	10	0.39692	T	0.17	.	20.6208	0.99490	0.0:0.0:1.0:0.0	.	5647;5647;5576	Q8NF91;E7EQI5;Q8NF91-4	SYNE1_HUMAN;.;.	V	5647;5576;5647;5576;5259;171	ENSP00000356224:A5647V;ENSP00000396024:A5576V;ENSP00000265368:A5647V;ENSP00000390975:A5576V;ENSP00000341887:A5259V;ENSP00000349276:A171V	ENSP00000265368:A5647V	A	-	2	0	SYNE1	152673303	1.000000	0.71417	0.811000	0.32455	0.720000	0.41350	7.876000	0.87215	2.882000	0.98803	0.655000	0.94253	GCC	.		0.433	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
CYP2W1	54905	hgsc.bcm.edu	37	7	1024913	1024913	+	Missense_Mutation	SNP	G	G	C	rs143596553		TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr7:1024913G>C	ENST00000308919.7	+	4	612	c.599G>C	c.(598-600)gGt>gCt	p.G200A	CYP2W1_ENST00000340150.6_Missense_Mutation_p.G144A	NM_017781.2	NP_060251.2	Q8TAV3	CP2W1_HUMAN	cytochrome P450, family 2, subfamily W, polypeptide 1	200					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			breast(1)|large_intestine(1)|lung(4)|urinary_tract(1)	7		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.74e-15)		TCCCTGCTGGGTCTCATCGAT	0.647																																					p.G200A		.											.	CYP2W1-90	0			c.G599C						.	G	ALA/GLY	2,4272		0,2,2135	52.0	37.0	42.0		599	3.2	0.5	7	dbSNP_134	42	0,8454		0,0,4227	no	missense	CYP2W1	NM_017781.2	60	0,2,6362	CC,CG,GG		0.0,0.0468,0.0157	benign	200/491	1024913	2,12726	2137	4227	6364	SO:0001583	missense	54905	exon4			TGCTGGGTCTCAT	AK000366	CCDS5319.2	7p22.3	2004-07-05			ENSG00000073067	ENSG00000073067		"""Cytochrome P450s"""	20243	protein-coding gene	gene with protein product		615967					Standard	XM_005249792		Approved	FLJ20359, MGC34287	uc003sjq.1	Q8TAV3	OTTHUMG00000074071	ENST00000308919.7:c.599G>C	7.37:g.1024913G>C	ENSP00000310149:p.Gly200Ala	Somatic	3	1		WXS	Illumina HiSeq	Phase_I	6	3	NM_017781	0	0	1	3	2		Missense_Mutation	SNP	ENST00000308919.7	37	CCDS5319.2	.	.	.	.	.	.	.	.	.	.	G	5.838	0.338852	0.11069	4.68E-4	0.0	ENSG00000073067	ENST00000308919;ENST00000340150	T;T	0.66638	-0.22;-0.22	5.06	3.25	0.37280	.	0.776457	0.12956	N	0.425435	T	0.53965	0.1829	L	0.33485	1.01	0.09310	N	1	B;B	0.22800	0.03;0.075	B;B	0.29524	0.038;0.103	T	0.42310	-0.9459	10	0.23302	T	0.38	.	8.1739	0.31270	0.25:0.0:0.75:0.0	.	144;200	A6NJ10;Q8TAV3	.;CP2W1_HUMAN	A	200;144	ENSP00000310149:G200A;ENSP00000344178:G144A	ENSP00000310149:G200A	G	+	2	0	CYP2W1	991439	0.008000	0.16893	0.502000	0.27614	0.938000	0.57974	1.741000	0.38238	0.536000	0.28733	0.491000	0.48974	GGT	G|1.000;C|0.000		0.647	CYP2W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157249.1	NM_017781	
ACTB	60	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	5568977	5568977	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr7:5568977T>C	ENST00000331789.5	-	3	369	c.178A>G	c.(178-180)Agc>Ggc	p.S60G	ACTB_ENST00000464611.1_5'Flank|AC006483.1_ENST00000579427.1_RNA	NM_001101.3	NP_001092.1	P63261	ACTG_HUMAN	actin, beta	60					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(2)|prostate(2)	8		Ovarian(82;0.0606)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)		CCTCTCTTGCTCTGGGCCTCG	0.587																																					p.S60G		.											.	ACTB-226	0			c.A178G						.						71.0	73.0	73.0					7																	5568977		2203	4298	6501	SO:0001583	missense	60	exon3			TCTTGCTCTGGGC	M28424	CCDS5341.1	7p22	2014-09-17			ENSG00000075624	ENSG00000075624			132	protein-coding gene	gene with protein product		102630				1505215	Standard	NM_001101		Approved		uc003sot.4	P60709	OTTHUMG00000023268	ENST00000331789.5:c.178A>G	7.37:g.5568977T>C	ENSP00000349960:p.Ser60Gly	Somatic	181	0		WXS	Illumina HiSeq	Phase_I	178	97	NM_001101	0	0	725	2053	1328	A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Missense_Mutation	SNP	ENST00000331789.5	37	CCDS5341.1	.	.	.	.	.	.	.	.	.	.	T	15.56	2.870663	0.51695	.	.	ENSG00000075624	ENST00000331789;ENST00000445914;ENST00000432588;ENST00000443528;ENST00000417101;ENST00000414620	D;D;D;D;D	0.90732	-2.72;-2.72;-2.72;-2.72;-2.72	4.91	4.91	0.64330	Actin, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.92704	0.7681	M	0.81497	2.545	0.45594	D	0.998536	P	0.35033	0.481	P	0.45195	0.473	D	0.93247	0.6631	10	0.87932	D	0	.	12.5141	0.56021	0.0:0.0:0.0:1.0	.	60	P60709	ACTB_HUMAN	G	60;60;60;60;63;60	ENSP00000349960:S60G;ENSP00000407473:S60G;ENSP00000393951:S60G;ENSP00000399487:S63G;ENSP00000401032:S60G	ENSP00000349960:S60G	S	-	1	0	ACTB	5535503	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.816000	0.86201	1.837000	0.53436	0.460000	0.39030	AGC	.		0.587	ACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059589.4	NM_001101	
PCLO	27445	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	82584714	82584714	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr7:82584714T>A	ENST00000333891.9	-	5	5892	c.5555A>T	c.(5554-5556)cAt>cTt	p.H1852L	PCLO_ENST00000423517.2_Missense_Mutation_p.H1852L	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						AGAAGATCTATGGAGCTCCTC	0.408																																					p.H1852L		.											.	PCLO-29	0			c.A5555T						.						178.0	163.0	168.0					7																	82584714		1858	4097	5955	SO:0001583	missense	27445	exon5			GATCTATGGAGCT	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.5555A>T	7.37:g.82584714T>A	ENSP00000334319:p.His1852Leu	Somatic	159	0		WXS	Illumina HiSeq	Phase_I	202	67	NM_014510	0	0	1	1	0		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	T	10.58	1.390651	0.25118	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.19938	2.11;2.12	5.57	5.57	0.84162	.	.	.	.	.	T	0.16727	0.0402	N	0.19112	0.55	0.80722	D	1	P;P	0.41848	0.763;0.763	B;B	0.39185	0.293;0.293	T	0.02860	-1.1101	9	0.87932	D	0	.	15.7247	0.77747	0.0:0.0:0.0:1.0	.	1852;1852	Q9Y6V0-5;Q9Y6V0-6	.;.	L	1783;1852;1852	ENSP00000334319:H1852L;ENSP00000388393:H1852L	ENSP00000334319:H1852L	H	-	2	0	PCLO	82422650	0.995000	0.38212	0.924000	0.36721	0.989000	0.77384	2.626000	0.46460	2.116000	0.64780	0.533000	0.62120	CAT	.		0.408	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
WDR91	29062	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	134871027	134871027	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr7:134871027A>T	ENST00000354475.4	-	15	2151	c.2120T>A	c.(2119-2121)cTa>cAa	p.L707Q	WDR91_ENST00000423565.1_Missense_Mutation_p.L672Q|WDR91_ENST00000344400.5_3'UTR	NM_014149.3	NP_054868.3	A4D1P6	WDR91_HUMAN	WD repeat domain 91	707										breast(3)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	40						GTGGCCACCTAGGCTCAAGCA	0.587																																					p.L707Q		.											.	WDR91-137	0			c.T2120A						.						73.0	60.0	65.0					7																	134871027		2203	4300	6503	SO:0001583	missense	29062	exon15			CCACCTAGGCTCA	AF161534	CCDS34758.1	7q33	2013-01-09			ENSG00000105875	ENSG00000105875		"""WD repeat domain containing"""	24997	protein-coding gene	gene with protein product						11042152, 11230166	Standard	NM_014149		Approved	HSPC049	uc003vsp.2	A4D1P6	OTTHUMG00000155414	ENST00000354475.4:c.2120T>A	7.37:g.134871027A>T	ENSP00000346466:p.Leu707Gln	Somatic	50	0		WXS	Illumina HiSeq	Phase_I	69	36	NM_014149	0	0	59	159	100	A6NK54|C9JMI4|Q6FI65|Q6MZQ1|Q6P4I1|Q96AE5|Q96G63|Q9H062|Q9H9B6|Q9NVG7|Q9NZY6	Missense_Mutation	SNP	ENST00000354475.4	37	CCDS34758.1	.	.	.	.	.	.	.	.	.	.	A	31	5.060981	0.93846	.	.	ENSG00000105875	ENST00000354475;ENST00000423565	T;T	0.68479	-0.33;-0.33	5.54	5.54	0.83059	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.80008	0.4545	L	0.61218	1.895	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82174	-0.0588	10	0.87932	D	0	-16.5822	15.6802	0.77360	1.0:0.0:0.0:0.0	.	707	A4D1P6	WDR91_HUMAN	Q	707;672	ENSP00000346466:L707Q;ENSP00000392555:L672Q	ENSP00000346466:L707Q	L	-	2	0	WDR91	134521567	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.339000	0.96797	2.103000	0.63969	0.533000	0.62120	CTA	.		0.587	WDR91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340019.1	NM_014149	
ZC2HC1A	51101	hgsc.bcm.edu	37	8	79578395	79578395	+	Silent	SNP	G	G	C			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr8:79578395G>C	ENST00000263849.4	+	1	114	c.12G>C	c.(10-12)ctG>ctC	p.L4L	ZC2HC1A_ENST00000521176.1_3'UTR	NM_016010.2	NP_057094.2	Q96GY0	ZC21A_HUMAN	zinc finger, C2HC-type containing 1A	4							metal ion binding (GO:0046872)										TGGAGGGACTGGAAGGTGAGG	0.672																																					p.L4L		.											.	.	0			c.G12C						.						112.0	84.0	93.0					8																	79578395		2187	4279	6466	SO:0001819	synonymous_variant	51101	exon1			GGGACTGGAAGGT		CCDS6223.1	8q21.11	2013-01-10	2012-02-03	2012-02-03	ENSG00000104427	ENSG00000104427		"""Zinc fingers, C2HC-type containing"""	24277	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 70"", ""family with sequence similarity 164, member A"""	C8orf70, FAM164A		10810093	Standard	NM_016010		Approved	CGI-62	uc003ybd.3	Q96GY0	OTTHUMG00000164619	ENST00000263849.4:c.12G>C	8.37:g.79578395G>C		Somatic	2	0		WXS	Illumina HiSeq	Phase_I	10	6	NM_016010	0	0	0	0	0	Q9Y372	Silent	SNP	ENST00000263849.4	37	CCDS6223.1																																																																																			.		0.672	ZC2HC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379423.2	NM_016010	
EFR3A	23167	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	132968018	132968018	+	Silent	SNP	C	C	T			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr8:132968018C>T	ENST00000254624.5	+	7	867	c.642C>T	c.(640-642)cgC>cgT	p.R214R	EFR3A_ENST00000334503.4_Silent_p.R214R|EFR3A_ENST00000519656.1_Silent_p.R178R	NM_015137.4	NP_055952.2	Q14156	EFR3A_HUMAN	EFR3 homolog A (S. cerevisiae)	214						extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|skin(1)|stomach(2)	35	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			TTTTTAGTCGCATAGGCCCTC	0.358																																					p.R214R		.											.	EFR3A-139	0			c.C642T						.						108.0	111.0	110.0					8																	132968018		2203	4300	6503	SO:0001819	synonymous_variant	23167	exon7			TAGTCGCATAGGC	D63477	CCDS34942.2	8q24.22	2008-10-23			ENSG00000132294	ENSG00000132294			28970	protein-coding gene	gene with protein product		611798				15363888	Standard	NM_015137		Approved	KIAA0143	uc003yte.3	Q14156	OTTHUMG00000150552	ENST00000254624.5:c.642C>T	8.37:g.132968018C>T		Somatic	112	0		WXS	Illumina HiSeq	Phase_I	86	26	NM_015137	0	0	0	0	0	A7MD19|Q2VPK2|Q63HL7|Q68DX1|Q6IQ18	Silent	SNP	ENST00000254624.5	37	CCDS34942.2																																																																																			.		0.358	EFR3A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318886.1	NM_015137	
USP20	10868	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	132623219	132623219	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr9:132623219T>C	ENST00000315480.4	+	7	492	c.334T>C	c.(334-336)Tcc>Ccc	p.S112P	USP20_ENST00000372429.3_Missense_Mutation_p.S112P|USP20_ENST00000358355.1_Missense_Mutation_p.S112P			Q9Y2K6	UBP20_HUMAN	ubiquitin specific peptidase 20	112					endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|urinary_tract(1)	11		Ovarian(14;0.00556)				AACACAGGACTCCCCGCCACC	0.567																																					p.S112P		.											.	USP20-658	0			c.T334C						.						146.0	150.0	149.0					9																	132623219		1918	4121	6039	SO:0001583	missense	10868	exon7			CAGGACTCCCCGC	AB023220	CCDS43892.1	9q34.2	2014-07-15	2005-08-08		ENSG00000136878	ENSG00000136878		"""Ubiquitin-specific peptidases"""	12619	protein-coding gene	gene with protein product		615143	"""ubiquitin specific protease 20"""			12838346	Standard	NM_006676		Approved	KIAA1003	uc004byr.3	Q9Y2K6	OTTHUMG00000020793	ENST00000315480.4:c.334T>C	9.37:g.132623219T>C	ENSP00000313811:p.Ser112Pro	Somatic	394	1		WXS	Illumina HiSeq	Phase_I	219	72	NM_001008563	0	0	0	0	0	Q541F1|Q8IXQ1|Q96LG5|Q9UQN8|Q9UQP0	Missense_Mutation	SNP	ENST00000315480.4	37	CCDS43892.1	.	.	.	.	.	.	.	.	.	.	T	11.93	1.787014	0.31593	.	.	ENSG00000136878	ENST00000372429;ENST00000315480;ENST00000358355	T;T;T	0.20463	2.07;2.07;2.07	5.66	1.8	0.24995	.	0.866856	0.10550	N	0.661611	T	0.16342	0.0393	L	0.46157	1.445	0.38108	D	0.937486	B	0.02656	0.0	B	0.04013	0.001	T	0.10337	-1.0634	10	0.30078	T	0.28	.	4.2306	0.10601	0.1241:0.0686:0.1298:0.6776	.	112	Q9Y2K6	UBP20_HUMAN	P	112	ENSP00000361506:S112P;ENSP00000313811:S112P;ENSP00000351122:S112P	ENSP00000313811:S112P	S	+	1	0	USP20	131663040	0.020000	0.18652	0.710000	0.30468	0.947000	0.59692	1.028000	0.30128	0.407000	0.25591	0.459000	0.35465	TCC	.		0.567	USP20-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054604.2		
MPP1	4354	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	154033610	154033610	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chrX:154033610G>T	ENST00000369534.3	-	1	186	c.39C>A	c.(37-39)agC>agA	p.S13R	MPP1_ENST00000393531.1_Missense_Mutation_p.S13R|MPP1_ENST00000413259.3_5'UTR	NM_001166460.1|NM_001166461.1|NM_002436.3	NP_001159932.1|NP_001159933.1|NP_002427.1	Q00013	EM55_HUMAN	membrane protein, palmitoylated 1, 55kDa	13					nucleotide phosphorylation (GO:0046939)|regulation of neutrophil chemotaxis (GO:0090022)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cortical cytoskeleton (GO:0030863)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(9)|ovary(2)|prostate(1)	21	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CCGTGTGCATGCTGCCCCCAC	0.667																																					p.S13R													.	MPP1-132	0			c.C39A						.						37.0	29.0	32.0					X																	154033610		2202	4299	6501	SO:0001583	missense	4354	exon1			GTGCATGCTGCCC		CCDS14762.1, CCDS55544.1, CCDS55545.1	Xq28	2008-03-04	2002-08-29		ENSG00000130830	ENSG00000130830			7219	protein-coding gene	gene with protein product		305360	"""membrane protein, palmitoylated 1 (55kD)"""	DXS552E		1713685	Standard	NM_002436		Approved	PEMP	uc004fmp.2	Q00013	OTTHUMG00000024244	ENST00000369534.3:c.39C>A	X.37:g.154033610G>T	ENSP00000358547:p.Ser13Arg	Somatic	18	0		WXS	Illumina HiSeq	Phase_I	7	7	NM_001166461	0	0	1	9	8	B4DZV5|G3XAI1|Q2TSB6|Q5J7V5	Missense_Mutation	SNP	ENST00000369534.3	37	CCDS14762.1	.	.	.	.	.	.	.	.	.	.	g	8.864	0.947541	0.18356	.	.	ENSG00000130830	ENST00000369534;ENST00000393531;ENST00000453245;ENST00000428488;ENST00000369531	T;T;T;T	0.46451	2.2;2.01;0.87;1.64	4.63	2.84	0.33178	.	0.214261	0.47852	D	0.000209	T	0.39809	0.1092	M	0.63843	1.955	0.80722	D	1	P;D;P;B	0.54964	0.624;0.969;0.785;0.437	B;P;B;B	0.45506	0.206;0.483;0.35;0.134	T	0.31475	-0.9942	10	0.87932	D	0	.	5.8086	0.18454	0.2474:0.0:0.7526:0.0	.	13;13;13;13	B4E325;C9J9J4;G3XAI1;Q00013	.;.;.;EM55_HUMAN	R	13	ENSP00000358547:S13R;ENSP00000377165:S13R;ENSP00000410888:S13R;ENSP00000358544:S13R	ENSP00000358544:S13R	S	-	3	2	MPP1	153686804	1.000000	0.71417	0.998000	0.56505	0.210000	0.24377	2.055000	0.41345	0.761000	0.33130	0.529000	0.55759	AGC	.		0.667	MPP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061191.3	NM_002436	
MANSC1	54682	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	12483592	12483592	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr12:12483592delT	ENST00000535902.1	-	4	1228	c.665delA	c.(664-666)aatfs	p.N222fs	MANSC1_ENST00000396349.3_Frame_Shift_Del_p.N188fs|MANSC1_ENST00000545735.1_Frame_Shift_Del_p.N141fs			Q9H8J5	MANS1_HUMAN	MANSC domain containing 1	222						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|skin(1)|stomach(4)	23		Prostate(47;0.0865)		BRCA - Breast invasive adenocarcinoma(232;0.185)		CGCACTCACATTTTCAGGCAG	0.502																																					p.N222fs		.											.	MANSC1-90	0			c.665delA						.						101.0	106.0	104.0					12																	12483592		2203	4300	6503	SO:0001589	frameshift_variant	54682	exon4			.	AK001160	CCDS8648.1	12p13.2	2006-04-12				ENSG00000111261			25505	protein-coding gene	gene with protein product						12975309	Standard	NM_018050		Approved	FLJ10298, LOH12CR3	uc001rai.1	Q9H8J5		ENST00000535902.1:c.665delA	12.37:g.12483592delT	ENSP00000438205:p.Asn222fs	Somatic	107	0		WXS	Illumina HiSeq	Phase_I	109	37	NM_018050	0	0	0	0	0	Q8NEC1|Q9NW60	Frame_Shift_Del	DEL	ENST00000535902.1	37	CCDS8648.1																																																																																			.		0.502	MANSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400144.1	NM_018050	
ABCB9	23457	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	123429030	123429030	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr12:123429030delA	ENST00000542678.1	-	7	4126	c.1288delT	c.(1288-1290)tacfs	p.Y430fs	ABCB9_ENST00000346530.5_Intron|ABCB9_ENST00000442833.2_Frame_Shift_Del_p.Y430fs|ABCB9_ENST00000280560.8_Frame_Shift_Del_p.Y430fs|ABCB9_ENST00000540285.1_Frame_Shift_Del_p.Y430fs|ABCB9_ENST00000442028.2_Frame_Shift_Del_p.Y430fs|ABCB9_ENST00000344275.7_Frame_Shift_Del_p.Y430fs|ABCB9_ENST00000392439.3_Frame_Shift_Del_p.Y430fs|ABCB9_ENST00000541983.1_5'UTR			Q9NP78	ABCB9_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 9	430	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				peptide transport (GO:0015833)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)	integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|peptide-transporting ATPase activity (GO:0015440)|protein homodimerization activity (GO:0042803)|substrate-specific transmembrane transporter activity (GO:0022891)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)|skin(1)	18	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.84e-05)|Epithelial(86;0.000152)|BRCA - Breast invasive adenocarcinoma(302;0.111)		TGGCCCCCGTAGTAGAGGATG	0.592																																					p.Y430fs	Ovarian(49;786 1333 9175 38236)	.											.	ABCB9-90	0			c.1288delT						.						139.0	120.0	127.0					12																	123429030		2203	4300	6503	SO:0001589	frameshift_variant	23457	exon7			.	U66676	CCDS9241.1, CCDS58286.1, CCDS58287.1, CCDS58288.1	12q24	2012-03-14			ENSG00000150967	ENSG00000150967		"""ATP binding cassette transporters / subfamily B"""	50	protein-coding gene	gene with protein product		605453				8894702	Standard	NM_019625		Approved	EST122234	uc001udm.4	Q9NP78		ENST00000542678.1:c.1288delT	12.37:g.123429030delA	ENSP00000440288:p.Tyr430fs	Somatic	210	0		WXS	Illumina HiSeq	Phase_I	180	58	NM_019625	0	0	0	0	0	B4E2J0|Q5W9G7|Q769F3|Q769F4|Q96AB1|Q9P208	Frame_Shift_Del	DEL	ENST00000542678.1	37	CCDS9241.1																																																																																			.		0.592	ABCB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400956.1	NM_019624	
DUOX1	53905	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	45453182	45453182	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr15:45453182delC	ENST00000321429.4	+	30	4257	c.3850delC	c.(3850-3852)cccfs	p.P1284fs	CTD-2651B20.1_ENST00000558039.1_lincRNA|DUOX1_ENST00000389037.3_Frame_Shift_Del_p.P1284fs|DUOX1_ENST00000561166.1_Frame_Shift_Del_p.P930fs	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1	1284	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		GGAGCTGCTGCCCTCAGGTAC	0.617																																					p.P1284fs		.											.	DUOX1-142	0			c.3850delC						.						81.0	65.0	71.0					15																	45453182		2198	4298	6496	SO:0001589	frameshift_variant	53905	exon30			.	AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		ENST00000321429.4:c.3850delC	15.37:g.45453182delC	ENSP00000317997:p.Pro1284fs	Somatic	67	0		WXS	Illumina HiSeq	Phase_I	61	22	NM_017434	0	0	0	0	0	A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Frame_Shift_Del	DEL	ENST00000321429.4	37	CCDS32221.1																																																																																			.		0.617	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416251.1	NM_017434	
EXOC3L2	90332	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	45720794	45720794	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr19:45720794delG	ENST00000252482.3	-	7	838	c.811delC	c.(811-813)cggfs	p.R272fs	EXOC3L2_ENST00000413988.1_Frame_Shift_Del_p.R272fs			Q2M3D2	EX3L2_HUMAN	exocyst complex component 3-like 2	272					exocytosis (GO:0006887)	exocyst (GO:0000145)				endometrium(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00883)		ACCAGCCGCCGGAACAGCCTC	0.701																																					p.R271fs		.											.	EXOC3L2-91	0			c.811delC						.						9.0	12.0	11.0					19																	45720794		2147	4221	6368	SO:0001589	frameshift_variant	90332	exon8			.	AK093466	CCDS12657.1	19q13.32	2011-07-07			ENSG00000130201	ENSG00000130201			30162	protein-coding gene	gene with protein product						21566143	Standard	NM_138568		Approved	FLJ36147, XTP7	uc002pay.1	Q2M3D2	OTTHUMG00000155018	ENST00000252482.3:c.811delC	19.37:g.45720794delG	ENSP00000252482:p.Arg272fs	Somatic	28	0		WXS	Illumina HiSeq	Phase_I	19	10	NM_138568	0	0	0	0	0	Q8N9W2|Q96GV2	Frame_Shift_Del	DEL	ENST00000252482.3	37	CCDS12657.1																																																																																			.		0.701	EXOC3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338073.1	NM_138568	
KDM6A	7403	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	44870257	44870257	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chrX:44870257delT	ENST00000377967.4	+	5	477	c.436delT	c.(436-438)tttfs	p.F146fs	KDM6A_ENST00000382899.4_Frame_Shift_Del_p.F146fs|KDM6A_ENST00000543216.1_Frame_Shift_Del_p.F146fs|KDM6A_ENST00000536777.1_Frame_Shift_Del_p.F146fs	NM_021140.2	NP_066963.2	O15550	KDM6A_HUMAN	lysine (K)-specific demethylase 6A	146	Interaction with SUPT6H. {ECO:0000250}.				canonical Wnt signaling pathway (GO:0060070)|heart morphogenesis (GO:0003007)|histone H3-K4 methylation (GO:0051568)|in utero embryonic development (GO:0001701)|mesodermal cell differentiation (GO:0048333)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|regulation of gene expression (GO:0010468)|respiratory system process (GO:0003016)|somite rostral/caudal axis specification (GO:0032525)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.0(12)|p.0?(6)|p.?(1)		NS(1)|breast(7)|central_nervous_system(27)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(24)|kidney(24)|large_intestine(9)|liver(1)|lung(21)|oesophagus(11)|pancreas(2)|prostate(5)|skin(1)|soft_tissue(1)|urinary_tract(29)	170						TTATAATGCATTTCAGTGGTA	0.323			"""D, N, F, S"""		"""renal, oesophageal SCC, MM"""																																p.F146fs	Colon(129;1273 1667 15230 27352 52914)	.		Rec	yes		X	Xp11.2	7403	"""lysine (K)-specific demethylase 6A, UTX"""		"""E, L"""	.	KDM6A-2748	19	No detectable mRNA/protein(12)|Whole gene deletion(6)|Unknown(1)	haematopoietic_and_lymphoid_tissue(11)|oesophagus(4)|breast(2)|pancreas(2)	c.436delT						.						117.0	99.0	105.0					X																	44870257		2203	4297	6500	SO:0001589	frameshift_variant	7403	exon5			.	AF000992	CCDS14265.1	Xp11.2	2014-09-17	2009-04-17	2009-04-17	ENSG00000147050	ENSG00000147050		"""Chromatin-modifying enzymes / K-demethylases"", ""Tetratricopeptide (TTC) repeat domain containing"""	12637	protein-coding gene	gene with protein product		300128	"""ubiquitously transcribed tetratricopeptide repeat, X chromosome"""	UTX		9499428, 9381176	Standard	XM_005272655		Approved		uc004dge.4	O15550	OTTHUMG00000021402	ENST00000377967.4:c.436delT	X.37:g.44870257delT	ENSP00000367203:p.Phe146fs	Somatic	35	0		WXS	Illumina HiSeq	Phase_I	20	13	NM_021140	0	0	0	0	0	Q52LL9|Q5JVQ7	Frame_Shift_Del	DEL	ENST00000377967.4	37	CCDS14265.1																																																																																			.		0.323	KDM6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056324.1	NM_021140	
LIX1L	128077	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	145497429	145497430	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr1:145497429_145497430insT	ENST00000369308.3	+	4	708_709	c.634_635insT	c.(634-636)attfs	p.I212fs	RP11-315I20.1_ENST00000595494.1_RNA|RP11-315I20.1_ENST00000597144.1_RNA|RP11-315I20.1_ENST00000599147.1_RNA|RP11-315I20.1_ENST00000448561.1_RNA|RP11-315I20.1_ENST00000437797.1_RNA|RP11-315I20.1_ENST00000598103.1_RNA|RP11-315I20.1_ENST00000600340.1_RNA|RP11-315I20.1_ENST00000595518.1_RNA|RP11-315I20.1_ENST00000599469.1_RNA|RP11-315I20.1_ENST00000598354.1_RNA|RP11-315I20.1_ENST00000601726.1_RNA|RP11-315I20.1_ENST00000412239.1_RNA|RP11-315I20.1_ENST00000421764.1_RNA|RP11-315I20.1_ENST00000599626.1_RNA	NM_153713.1	NP_714924.1	Q8IVB5	LIX1L_HUMAN	Lix1 homolog (chicken) like	212										large_intestine(4)|lung(6)|ovary(2)|skin(1)	13	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					AAATACAGGGATTGGTGCCTTC	0.45																																					p.I212fs		.											.	LIX1L-91	0			c.634_635insT						.																																			SO:0001589	frameshift_variant	128077	exon4			.	AK128733	CCDS72873.1	1q21.1	2014-07-15	2014-07-15		ENSG00000152022	ENSG00000271601			28715	protein-coding gene	gene with protein product			"""Lix1 homolog (mouse) like"", ""Lix1 homolog (chicken)-like"""			12477932	Standard	NM_153713		Approved	MGC46719	uc001enr.3	Q8IVB5	OTTHUMG00000013741	ENST00000369308.3:c.636dupT	1.37:g.145497431_145497431dupT	ENSP00000358314:p.Ile212fs	Somatic	58	0		WXS	Illumina HiSeq	Phase_I	44	15	NM_153713	0	0	0	0	0	Q6AI36	Frame_Shift_Ins	INS	ENST00000369308.3	37	CCDS915.1																																																																																			.		0.450	LIX1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038513.1	NM_153713	
RMDN3	55177	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	41037304	41037305	+	Frame_Shift_Ins	INS	-	-	GCACT			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr15:41037304_41037305insGCACT	ENST00000260385.6	-	4	1744_1745	c.677_678insAGTGC	c.(676-678)gccfs	p.-226fs	RMDN3_ENST00000558560.1_Intron|RMDN3_ENST00000338376.3_Frame_Shift_Ins_p.-226fs			Q96TC7	RMD3_HUMAN	regulator of microtubule dynamics 3						apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|cellular calcium ion homeostasis (GO:0006874)	integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)											CAGCCTCCAGGGCACTGGAGGC	0.599																																					p.A226fs		.											.	.	0			c.678_679insAGTGC						.																																			SO:0001589	frameshift_variant	55177	exon5			.	AK001441	CCDS10063.1	15q15.1	2013-01-11	2013-01-11	2013-01-11	ENSG00000137824	ENSG00000137824			25550	protein-coding gene	gene with protein product		611873	"""family with sequence similarity 82, member A2"""	FAM82C, FAM82A2		12975309	Standard	XM_005254531		Approved	FLJ10579, PTPIP51, RMD3	uc001zmp.1	Q96TC7	OTTHUMG00000130066	ENST00000260385.6:c.673_677dupAGTGC	15.37:g.41037305_41037309dupGCACT	ENSP00000260385:p.Ala226fs	Somatic	114	0		WXS	Illumina HiSeq	Phase_I	61	16	NM_018145	0	0	0	0	0	A9UMZ9|B3KRR3|Q6ZWE9|Q96H23|Q96SD6|Q9H6G1|Q9NVQ6	Frame_Shift_Ins	INS	ENST00000260385.6	37	CCDS10063.1																																																																																			.		0.599	RMDN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252357.1	NM_018145	
KRT32	3882	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	39622089	39622090	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr17:39622089_39622090insC	ENST00000225899.3	-	3	746_747	c.643_644insG	c.(643-645)gacfs	p.D215fs	RNU2-32P_ENST00000411193.1_RNA	NM_002278.3	NP_002269.3	Q14532	K1H2_HUMAN	keratin 32	215	Coil 1B.|Rod.				epidermis development (GO:0008544)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Breast(137;0.000812)				GGCCTCCAGGTCAGCCTTGCAC	0.604																																					p.D215fs		.											.	KRT32-90	0			c.644_645insG						.																																			SO:0001589	frameshift_variant	3882	exon3			.	X90761	CCDS11393.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000108759	ENSG00000108759		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6449	protein-coding gene	gene with protein product	"""hard keratin type I"""	602760	"""keratin, hair, acidic, 2"""	KRTHA2		7556444, 8823373, 16831889	Standard	NM_002278		Approved	Ha-2	uc002hwr.3	Q14532	OTTHUMG00000133430	ENST00000225899.3:c.644dupG	17.37:g.39622090_39622090dupC	ENSP00000225899:p.Asp215fs	Somatic	120	0		WXS	Illumina HiSeq	Phase_I	146	85	NM_002278	0	0	0	0	0		Frame_Shift_Ins	INS	ENST00000225899.3	37	CCDS11393.1																																																																																			.		0.604	KRT32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257293.1	NM_002278	
ITGB4	3691	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	73752854	73752855	+	In_Frame_Ins	INS	-	-	GCTGCA	rs370378040		TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr17:73752854_73752855insGCTGCA	ENST00000200181.3	+	37	5154_5155	c.4967_4968insGCTGCA	c.(4966-4971)tcgctg>tcGCTGCAgctg	p.1659_1660insQL	GALK1_ENST00000225614.2_Intron|ITGB4_ENST00000339591.3_In_Frame_Ins_p.1642_1643insQL|ITGB4_ENST00000579662.1_In_Frame_Ins_p.1589_1590insQL|ITGB4_ENST00000450894.3_In_Frame_Ins_p.1589_1590insQL|ITGB4_ENST00000449880.2_In_Frame_Ins_p.1642_1643insQL	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	1659	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			AGCCCAGACTCGCTGCAGCTGA	0.658																																					p.S1656delinsSLQ		.											.	ITGB4-227	0			c.4967_4968insGCTGCA						.																																			SO:0001652	inframe_insertion	3691	exon37			.		CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.4968_4973dupGCTGCA	17.37:g.73752855_73752860dupGCTGCA	ENSP00000200181:p.Gln1658_Leu1659dup	Somatic	168	0		WXS	Illumina HiSeq	Phase_I	143	43	NM_000213	0	0	0	0	0	A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	In_Frame_Ins	INS	ENST00000200181.3	37	CCDS11727.1																																																																																			.		0.658	ITGB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448334.1		
BAI3	577	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	69666026	69666027	+	Frame_Shift_Ins	INS	-	-	A	rs141698131		TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr6:69666026_69666027insA	ENST00000370598.1	+	7	2127_2128	c.1306_1307insA	c.(1306-1308)gaafs	p.E436fs		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	436	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				TGGAGGCTCCGAATGCAGAGGG	0.554																																					p.E436fs		.											.	BAI3-1148	0			c.1306_1307insA						.																																			SO:0001589	frameshift_variant	577	exon7			.	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.1308dupA	6.37:g.69666028_69666028dupA	ENSP00000359630:p.Glu436fs	Somatic	37	0		WXS	Illumina HiSeq	Phase_I	53	22	NM_001704	0	0	0	0	0	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Frame_Shift_Ins	INS	ENST00000370598.1	37	CCDS4968.1																																																																																			.		0.554	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1		
DUOX1	53905	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	45456067	45456068	+	Missense_Mutation	DNP	GT	GT	TA			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	GT	GT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr15:45456067_45456068GT>TA	ENST00000321429.4	+	34	4891_4892	c.4484_4485GT>TA	c.(4483-4485)cGT>cTA	p.R1495L	CTD-2651B20.1_ENST00000558039.1_lincRNA|DUOX1_ENST00000389037.3_Missense_Mutation_p.R1495L|DUOX1_ENST00000561166.1_Missense_Mutation_p.R1141L	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1	1495					cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		CACTTTGGCCGTCCCCCCTTTG	0.55																																					p.R1495L		.											.	DUOX1	0			c.T4485A						.																																			SO:0001583	missense	53905	exon34			TGGCCGTCCCCCC	AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		Exception_encountered	15.37:g.45456067_45456068delinsTA	ENSP00000317997:p.Arg1495Leu	Somatic	213.0	0.0		WXS	Illumina HiSeq	Phase_I	134.0	58.0		0	0	0	0	0	A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Missense_Mutation	DNP	ENST00000321429.4	37	CCDS32221.1																																																																																			.		0.550	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416251.1	NM_017434	
ANKMY2	57037	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	16650259	16650260	+	Missense_Mutation	DNP	TC	TC	CT			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr7:16650259_16650260TC>CT	ENST00000306999.2	-	6	903_904	c.660_661GA>AG	c.(658-663)atGAag>atAGag	p.220_221MK>IE		NM_020319.2	NP_064715.1	Q8IV38	ANKY2_HUMAN	ankyrin repeat and MYND domain containing 2	220						cilium (GO:0005929)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|urinary_tract(1)	23	Lung NSC(10;0.103)|all_lung(11;0.204)			UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		TAATGCATCTTCATAGCCAATA	0.351																																					p.MK220IE		.											.	ANKMY2	0			c.G660A						.																																			SO:0001583	missense	57037	exon6			CATCTTCATAGCC	AK001740	CCDS5361.1	7p21	2013-01-10			ENSG00000106524	ENSG00000106524		"""Zinc fingers, MYND-type"", ""Ankyrin repeat domain containing"""	25370	protein-coding gene	gene with protein product						12477932	Standard	NM_020319		Approved	DKFZP564O043, ZMYND20	uc003sti.3	Q8IV38	OTTHUMG00000090806	ENST00000306999.2:c.660_661delinsCT	7.37:g.16650259_16650260delinsCT	ENSP00000303570:p.M220_K221delinsIE	Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	34.0		0	0	0	0	0	A4D124|Q659G1|Q96BL3	Missense_Mutation	DNP	ENST00000306999.2	37	CCDS5361.1																																																																																			.		0.351	ANKMY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207600.2	NM_020319	
SS18	6760	broad.mit.edu	37	18	23670482	23670483	+	Missense_Mutation	DNP	GA	GA	AG			TCGA-A4-7584-01A-11D-2136-08	TCGA-A4-7584-10A-01D-2136-08	GA	GA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4f7bf60-293b-44c8-a121-1d8b2c590f78	969e0233-3df2-44b1-a37c-f056f8c5ba97	g.chr18:23670482_23670483GA>AG	ENST00000415083.2	-	1	106_107	c.51_52TC>CT	c.(49-54)acTCcc>acCTcc	p.P18S	SS18_ENST00000542743.1_5'UTR|SS18_ENST00000542420.2_Intron|SS18_ENST00000539849.1_5'UTR|SS18_ENST00000269137.7_Missense_Mutation_p.P18S|SS18_ENST00000585241.1_5'UTR|SS18_ENST00000545952.1_5'UTR	NM_001007559.1|NM_005637.2	NP_001007560.1|NP_005628.2	Q15532	SSXT_HUMAN	synovial sarcoma translocation, chromosome 18	18	Transcriptional activation.				cell morphogenesis (GO:0000902)|ephrin receptor signaling pathway (GO:0048013)|intracellular signal transduction (GO:0035556)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to drug (GO:0042493)|transcription, DNA-templated (GO:0006351)	cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)		SS18/SSX2(706)|SS18/SSX1(1169)|SS18/SSX4(12)	endometrium(1)|kidney(2)|large_intestine(4)|lung(11)|ovary(1)	19	all_cancers(21;0.000194)|Lung NSC(5;0.000413)|all_lung(6;0.00118)|Ovarian(20;0.124)					ATCGCAGCGGGAGTGATCTCCC	0.683			T	"""SSX1,  SSX2"""	synovial sarcoma																																p.P21S				Dom	yes		18	18q11.2	6760	"""synovial sarcoma translocation, chromosome 18"""		M	.	SS18-1968	0			c.T51C						.																																			SO:0001583	missense	6760	exon1			AGCGGGAGTGATC	X79201	CCDS32807.1, CCDS54183.1	18q11.2	2008-07-28				ENSG00000141380			11340	protein-coding gene	gene with protein product		600192		SSXT		8152806, 7951320, 16484776	Standard	XM_005258334		Approved	SYT	uc002kvm.3	Q15532		ENST00000415083.2:c.51_52delinsAG	18.37:g.23670482_23670483delinsAG	ENSP00000414516:p.Pro18Ser	Somatic	9	0		WXS	Illumina HiSeq	Phase_I	10	4	NM_001007559	0	0	0	0	0	B0YJ95|Q16404|Q4VAX1|Q9BXC6	Missense_Mutation	DNP	ENST00000415083.2	37	CCDS32807.1																																																																																			.		0.683	SS18-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000446226.1		
