#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CROCC	9696	hgsc.bcm.edu	37	1	17263238	17263238	+	Missense_Mutation	SNP	G	G	C	rs202121748		TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr1:17263238G>C	ENST00000375541.5	+	9	1132	c.1063G>C	c.(1063-1065)Gca>Cca	p.A355P	CROCC_ENST00000467938.1_3'UTR	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		CCGGGCCGAGGCAGCCCTGGA	0.697																																					p.A355P		.											.	CROCC-137	0			c.G1063C						.						15.0	15.0	15.0					1																	17263238		2194	4274	6468	SO:0001583	missense	9696	exon9			GCCGAGGCAGCCC	AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.1063G>C	1.37:g.17263238G>C	ENSP00000364691:p.Ala355Pro	Somatic	81	1		WXS	Illumina HiSeq	Phase_I	32	2	NM_014675	0	0	2	2	0		Missense_Mutation	SNP	ENST00000375541.5	37	CCDS30616.1	.	.	.	.	.	.	.	.	.	.	G	9.902	1.207111	0.22205	.	.	ENSG00000058453	ENST00000375541;ENST00000445545	T	0.10573	2.86	3.91	2.98	0.34508	.	.	.	.	.	T	0.13927	0.0337	L	0.38531	1.155	0.27212	N	0.959891	P;P;D	0.54207	0.955;0.904;0.965	B;B;P	0.51229	0.347;0.347;0.663	T	0.10590	-1.0623	9	0.31617	T	0.26	.	10.8238	0.46620	0.0962:0.0:0.9038:0.0	.	218;218;355	A1L0S8;A1L0S9;Q5TZA2	.;.;CROCC_HUMAN	P	355;236	ENSP00000364691:A355P	ENSP00000364691:A355P	A	+	1	0	CROCC	17135825	1.000000	0.71417	0.064000	0.19789	0.141000	0.21300	4.821000	0.62679	0.970000	0.38263	0.462000	0.41574	GCA	.		0.697	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006249.2	NM_014675	
ARHGEF10L	55160	bcgsc.ca	37	1	17939552	17939552	+	Splice_Site	SNP	G	G	T	rs76330277		TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr1:17939552G>T	ENST00000361221.3	+	8	768		c.e8-1		ARHGEF10L_ENST00000434513.1_Splice_Site|ARHGEF10L_ENST00000375420.3_Intron|ARHGEF10L_ENST00000452522.1_Intron|ARHGEF10L_ENST00000375415.1_Intron	NM_018125.3	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10-like							cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	43		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)		TGGGGCTCCAGCTTTCTCCAG	0.557																																					.													.	ARHGEF10L-292	0			c.610-1G>T						.						110.0	113.0	112.0					1																	17939552		2203	4300	6503	SO:0001630	splice_region_variant	55160	exon8			GCTCCAGCTTTCT	AB046846	CCDS182.1, CCDS30617.1	1p36.13	2011-11-16			ENSG00000074964	ENSG00000074964		"""Rho guanine nucleotide exchange factors"""	25540	protein-coding gene	gene with protein product	"""GrinchGEF"""	612494				10997877, 16112081	Standard	XM_005245923		Approved	FLJ10521, KIAA1626	uc001ban.3	Q9HCE6	OTTHUMG00000002514	ENST00000361221.3:c.610-1G>T	1.37:g.17939552G>T		Somatic	195	0		WXS	Illumina HiSeq	Phase_1	166	6	NM_018125	0	0	0	0	0	B7ZKS1|Q17RW1|Q3YFJ4|Q5VXI5|Q5VXI6|Q66K51|Q6P0L7|Q8NAV5|Q9NVT3	Splice_Site	SNP	ENST00000361221.3	37	CCDS182.1	.	.	.	.	.	.	.	.	.	.	g	19.87	3.906931	0.72868	.	.	ENSG00000074964	ENST00000361221;ENST00000434513	.	.	.	4.94	4.94	0.65067	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8542	0.70323	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ARHGEF10L	17812139	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.141000	0.89618	2.279000	0.76181	0.558000	0.71614	.	.		0.557	ARHGEF10L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007147.1	NM_018125	Intron
LDLRAP1	26119	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	25889193	25889193	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr1:25889193A>G	ENST00000374338.4	+	5	637	c.518A>G	c.(517-519)cAg>cGg	p.Q173R	LDLRAP1_ENST00000488127.1_3'UTR	NM_015627.2	NP_056442.2	Q5SW96	ARH_HUMAN	low density lipoprotein receptor adaptor protein 1	173	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				amyloid precursor protein metabolic process (GO:0042982)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|positive regulation of cholesterol metabolic process (GO:0090205)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of signal transduction (GO:0009967)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|regulation of protein binding (GO:0043393)|transport (GO:0006810)	axon (GO:0030424)|basal plasma membrane (GO:0009925)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|early endosome (GO:0005769)|neurofilament (GO:0005883)|recycling endosome (GO:0055037)	AP-2 adaptor complex binding (GO:0035612)|beta-amyloid binding (GO:0001540)|clathrin adaptor activity (GO:0035615)|clathrin binding (GO:0030276)|low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphotyrosine binding (GO:0001784)|receptor signaling complex scaffold activity (GO:0030159)|signaling adaptor activity (GO:0035591)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)|urinary_tract(1)	9		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.63e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000728)|STAD - Stomach adenocarcinoma(196;0.000766)|BRCA - Breast invasive adenocarcinoma(304;0.000969)|GBM - Glioblastoma multiforme(114;0.00914)|READ - Rectum adenocarcinoma(331;0.0649)		GAGTTTTGGCAGGTGTCCAAG	0.572																																					p.Q173R		.											.	LDLRAP1-91	0			c.A518G						.						139.0	124.0	129.0					1																	25889193		2203	4300	6503	SO:0001583	missense	26119	exon5			TTTGGCAGGTGTC	BC029770	CCDS30639.1	1p36-p35	2014-09-17			ENSG00000157978	ENSG00000157978			18640	protein-coding gene	gene with protein product		605747					Standard	NM_015627		Approved	ARH, ARH2, FHCB1, FHCB2, MGC34705, DKFZp586D0624	uc001bkl.4	Q5SW96	OTTHUMG00000007386	ENST00000374338.4:c.518A>G	1.37:g.25889193A>G	ENSP00000363458:p.Gln173Arg	Somatic	77	0		WXS	Illumina HiSeq	Phase_I	68	28	NM_015627	0	0	0	0	0	A2BHI5|Q6TQS9|Q8N2Y0|Q9UFI9	Missense_Mutation	SNP	ENST00000374338.4	37	CCDS30639.1	.	.	.	.	.	.	.	.	.	.	A	19.60	3.858315	0.71834	.	.	ENSG00000157978	ENST00000374338	T	0.64260	-0.09	5.56	5.56	0.83823	Phosphotyrosine interaction domain (1);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.65101	0.2659	L	0.49350	1.555	0.58432	D	0.999998	B	0.25105	0.118	B	0.39339	0.297	T	0.63950	-0.6521	10	0.45353	T	0.12	-17.9581	14.8888	0.70590	1.0:0.0:0.0:0.0	.	173	Q5SW96	ARH_HUMAN	R	173	ENSP00000363458:Q173R	ENSP00000363458:Q173R	Q	+	2	0	LDLRAP1	25761780	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.809000	0.91944	2.117000	0.64856	0.454000	0.30748	CAG	.		0.572	LDLRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019350.3	NM_015627	
GTF2B	2959	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	89325567	89325567	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr1:89325567T>C	ENST00000370500.5	-	5	651	c.533A>G	c.(532-534)aAa>aGa	p.K178R	GTF2B_ENST00000494819.1_5'UTR	NM_001514.5	NP_001505.1	Q00403	TF2B_HUMAN	general transcription factor IIB	178					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	nucleoplasm (GO:0005654)	core promoter binding (GO:0001047)|thyroid hormone receptor binding (GO:0046966)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	10		Lung NSC(277;0.123)		all cancers(265;0.0131)|Epithelial(280;0.0255)		AAACTTACCTTTAAATGTCCT	0.418																																					p.K178R		.											.	GTF2B-154	0			c.A533G						.						118.0	124.0	122.0					1																	89325567		2203	4300	6503	SO:0001583	missense	2959	exon5			TTACCTTTAAATG	M76766	CCDS715.1	1p22-p21	2010-03-23			ENSG00000137947	ENSG00000137947		"""General transcription factors"""	4648	protein-coding gene	gene with protein product		189963				1876184, 8162052	Standard	NM_001514		Approved	TFIIB	uc001dmo.4	Q00403	OTTHUMG00000010611	ENST00000370500.5:c.533A>G	1.37:g.89325567T>C	ENSP00000359531:p.Lys178Arg	Somatic	121	0		WXS	Illumina HiSeq	Phase_I	101	46	NM_001514	0	0	0	0	0	A8K1A7|Q5JS30	Missense_Mutation	SNP	ENST00000370500.5	37	CCDS715.1	.	.	.	.	.	.	.	.	.	.	T	22.6	4.308867	0.81247	.	.	ENSG00000137947	ENST00000370500;ENST00000448623;ENST00000418217	T;T;T	0.51574	0.77;0.7;0.7	5.52	5.52	0.82312	Transcription factor TFIIB, cyclin-related (1);Cyclin-like (3);	0.000000	0.85682	D	0.000000	T	0.52933	0.1765	L	0.48174	1.505	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.50171	-0.8859	10	0.34782	T	0.22	-32.0439	15.9344	0.79691	0.0:0.0:0.0:1.0	.	178	Q00403	TF2B_HUMAN	R	178;177;173	ENSP00000359531:K178R;ENSP00000415741:K177R;ENSP00000402345:K173R	ENSP00000359531:K178R	K	-	2	0	GTF2B	89098155	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	7.587000	0.82613	2.214000	0.71695	0.482000	0.46254	AAA	.		0.418	GTF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029279.1	NM_001514	
TARS2	80222	hgsc.bcm.edu	37	1	150469382	150469382	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr1:150469382A>T	ENST00000369064.3	+	9	1052	c.1018A>T	c.(1018-1020)Agg>Tgg	p.R340W	TARS2_ENST00000369054.2_Intron|TARS2_ENST00000463555.1_Intron|TARS2_ENST00000438568.2_3'UTR|TARS2_ENST00000606933.1_Intron	NM_025150.3	NP_079426.2	Q9BW92	SYTM_HUMAN	threonyl-tRNA synthetase 2, mitochondrial (putative)	340					gene expression (GO:0010467)|mitochondrial threonyl-tRNA aminoacylation (GO:0070159)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|threonine-tRNA ligase activity (GO:0004829)			cervix(1)|endometrium(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	35	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.51e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)		L-Threonine(DB00156)	GGCGTTTATCAGGGTAAGGGG	0.542																																					p.R340W		.											.	TARS2-91	0			c.A1018T						.						57.0	50.0	52.0					1																	150469382		2203	4300	6503	SO:0001583	missense	80222	exon9			TTTATCAGGGTAA	BC007824	CCDS952.1, CCDS60251.1, CCDS60252.1	1q21.2	2012-10-26	2007-02-23	2007-02-23	ENSG00000143374	ENSG00000143374	6.1.1.3	"""Aminoacyl tRNA synthetases / Class II"""	30740	protein-coding gene	gene with protein product	"""threonine tRNA ligase 2, mitochondrial"""	612805	"""threonyl-tRNA synthetase-like 1"""	TARSL1			Standard	NM_001271895		Approved	FLJ12528	uc001euq.4	Q9BW92	OTTHUMG00000012809	ENST00000369064.3:c.1018A>T	1.37:g.150469382A>T	ENSP00000358060:p.Arg340Trp	Somatic	45	0		WXS	Illumina HiSeq	Phase_I	51	3	NM_025150	0	0	0	0	0	Q53GW7|Q96I50|Q9H9V2	Missense_Mutation	SNP	ENST00000369064.3	37	CCDS952.1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.522343	0.85600	.	.	ENSG00000143374	ENST00000369064	T	0.71934	-0.61	5.39	4.23	0.50019	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (G/ H/ P/ S), conserved domain (1);	0.113939	0.64402	D	0.000016	T	0.78997	0.4372	M	0.85197	2.74	0.80722	D	1	D	0.67145	0.996	D	0.64687	0.928	T	0.82760	-0.0298	10	0.87932	D	0	-1.4334	11.7094	0.51616	0.722:0.278:0.0:0.0	.	340	Q9BW92	SYTM_HUMAN	W	340	ENSP00000358060:R340W	ENSP00000358060:R340W	R	+	1	2	TARS2	148736006	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.446000	0.60014	1.012000	0.39366	0.533000	0.62120	AGG	.		0.542	TARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035847.1	NM_025150	
GOLPH3L	55204	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	150634375	150634375	+	Silent	SNP	A	A	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr1:150634375A>T	ENST00000271732.3	-	4	389	c.345T>A	c.(343-345)ggT>ggA	p.G115G	GOLPH3L_ENST00000540514.1_Silent_p.G71G	NM_018178.5	NP_060648.2	Q9H4A5	GLP3L_HUMAN	golgi phosphoprotein 3-like	115					Golgi organization (GO:0007030)|positive regulation of protein secretion (GO:0050714)	Golgi membrane (GO:0000139)|trans-Golgi network membrane (GO:0032588)	phosphatidylinositol-4-phosphate binding (GO:0070273)			breast(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)	8	all_cancers(9;3.09e-52)|all_epithelial(9;4.47e-43)|all_lung(15;1.09e-34)|Lung NSC(24;4.04e-31)|Breast(34;0.000615)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;1.2e-23)|all cancers(9;4.81e-23)|OV - Ovarian serous cystadenocarcinoma(6;1.93e-15)|BRCA - Breast invasive adenocarcinoma(12;0.000479)|LUSC - Lung squamous cell carcinoma(543;0.171)			GTAAAACATCACCTGTTGGGC	0.383																																					p.G115G		.											.	GOLPH3L-91	0			c.T345A						.						167.0	160.0	162.0					1																	150634375		2203	4300	6503	SO:0001819	synonymous_variant	55204	exon4			AACATCACCTGTT	AJ296153	CCDS966.1	1q21	2008-02-05			ENSG00000143457	ENSG00000143457			24882	protein-coding gene	gene with protein product		612208					Standard	NM_018178		Approved	GPP34R	uc001evj.2	Q9H4A5	OTTHUMG00000035009	ENST00000271732.3:c.345T>A	1.37:g.150634375A>T		Somatic	92	0		WXS	Illumina HiSeq	Phase_I	110	39	NM_018178	0	0	1	7	6	B1AN09|B7Z6N3|Q9NVK0	Silent	SNP	ENST00000271732.3	37	CCDS966.1																																																																																			.		0.383	GOLPH3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084734.1	NM_018178	
DENND4B	9909	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	153915526	153915526	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr1:153915526A>T	ENST00000361217.4	-	3	816	c.398T>A	c.(397-399)cTg>cAg	p.L133Q		NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	133	MABP. {ECO:0000255|PROSITE- ProRule:PRU00831}.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TGGAGGGGCCAGGTTTGCTGA	0.637																																					p.L133Q		.											.	DENND4B-69	0			c.T398A						.						62.0	73.0	70.0					1																	153915526		1957	4140	6097	SO:0001583	missense	9909	exon3			GGGGCCAGGTTTG	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.398T>A	1.37:g.153915526A>T	ENSP00000354597:p.Leu133Gln	Somatic	103	0		WXS	Illumina HiSeq	Phase_I	74	26	NM_014856	0	0	9	12	3	Q5T4K0	Missense_Mutation	SNP	ENST00000361217.4	37	CCDS44228.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.259272	0.80246	.	.	ENSG00000198837	ENST00000361217;ENST00000368646	T;T	0.24908	1.83;1.83	4.69	4.69	0.59074	MABP domain (1);	.	.	.	.	T	0.36690	0.0976	L	0.61218	1.895	0.58432	D	0.999992	D	0.76494	0.999	D	0.68765	0.96	T	0.28004	-1.0057	9	0.87932	D	0	-3.5699	13.2559	0.60079	1.0:0.0:0.0:0.0	.	133	O75064	DEN4B_HUMAN	Q	133;144	ENSP00000354597:L133Q;ENSP00000357635:L144Q	ENSP00000354597:L133Q	L	-	2	0	DENND4B	152182150	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.891000	0.92485	1.946000	0.56461	0.460000	0.39030	CTG	.		0.637	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2	XM_375806	
BRINP3	339479	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	190068039	190068039	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr1:190068039G>C	ENST00000367462.3	-	8	1641	c.1410C>G	c.(1408-1410)agC>agG	p.S470R	BRINP3_ENST00000534846.1_Missense_Mutation_p.S368R	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	470					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											AGAGCCCCTGGCTGAGCATGT	0.577																																					p.S470R		.											.	FAM5C-228	0			c.C1410G						.						100.0	101.0	101.0					1																	190068039		2203	4300	6503	SO:0001583	missense	339479	exon8			CCCCTGGCTGAGC	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.1410C>G	1.37:g.190068039G>C	ENSP00000356432:p.Ser470Arg	Somatic	244	0		WXS	Illumina HiSeq	Phase_I	170	40	NM_199051	0	0	0	0	0	B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	ENST00000367462.3	37	CCDS1373.1	.	.	.	.	.	.	.	.	.	.	G	9.011	0.982421	0.18889	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	T;T	0.42131	0.98;0.98	5.75	3.56	0.40772	Epidermal growth factor-like (1);	0.146558	0.64402	D	0.000008	T	0.35219	0.0924	L	0.53249	1.67	0.45883	D	0.998734	P;P	0.43701	0.815;0.718	B;B	0.39258	0.295;0.154	T	0.12218	-1.0556	10	0.25751	T	0.34	-10.9852	11.0596	0.47940	0.177:0.0:0.823:0.0	.	368;470	B7Z260;Q76B58	.;FAM5C_HUMAN	R	470;368	ENSP00000356432:S470R;ENSP00000438022:S368R	ENSP00000356432:S470R	S	-	3	2	FAM5C	188334662	1.000000	0.71417	1.000000	0.80357	0.662000	0.39071	1.416000	0.34759	1.440000	0.47531	-0.229000	0.12294	AGC	.		0.577	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051	
PCNXL2	80003	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	233190130	233190130	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr1:233190130T>C	ENST00000258229.9	-	25	4469	c.4235A>G	c.(4234-4236)aAc>aGc	p.N1412S	PCNXL2_ENST00000344698.2_Missense_Mutation_p.N64S	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	1412						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				AGAGCTGTAGTTGCCCCAACG	0.438																																					p.N1412S		.											.	PCNXL2-91	0			c.A4235G						.						67.0	65.0	66.0					1																	233190130		1887	4122	6009	SO:0001583	missense	80003	exon25			CTGTAGTTGCCCC	AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.4235A>G	1.37:g.233190130T>C	ENSP00000258229:p.Asn1412Ser	Somatic	34	0		WXS	Illumina HiSeq	Phase_I	43	19	NM_014801	0	0	3	3	0	O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	ENST00000258229.9	37	CCDS44335.1	.	.	.	.	.	.	.	.	.	.	T	17.63	3.437330	0.62955	.	.	ENSG00000135749	ENST00000344698;ENST00000258229	T;T	0.24151	1.87;3.01	4.97	2.65	0.31530	.	0.042018	0.85682	D	0.000000	T	0.23846	0.0577	L	0.42487	1.325	0.80722	D	1	B;P	0.52692	0.434;0.955	B;P	0.45449	0.263;0.481	T	0.02705	-1.1121	10	0.87932	D	0	.	8.878	0.35356	0.0:0.154:0.0:0.846	.	1412;64	A6NKB5;A6NKB5-3	PCX2_HUMAN;.	S	64;1412	ENSP00000340759:N64S;ENSP00000258229:N1412S	ENSP00000258229:N1412S	N	-	2	0	PCNXL2	231256753	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	4.826000	0.62715	0.862000	0.35528	0.533000	0.62120	AAC	.		0.438	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092480.3	NM_014801	
CUBN	8029	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	17157562	17157562	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr10:17157562A>G	ENST00000377833.4	-	7	693	c.628T>C	c.(628-630)Tgt>Cgt	p.C210R		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	210	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TTGGATGCACACTGGGGTCCG	0.542																																					p.C210R		.											.	CUBN-166	0			c.T628C						.						147.0	123.0	131.0					10																	17157562		2203	4300	6503	SO:0001583	missense	8029	exon7			ATGCACACTGGGG	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.628T>C	10.37:g.17157562A>G	ENSP00000367064:p.Cys210Arg	Somatic	92	0		WXS	Illumina HiSeq	Phase_I	110	37	NM_001081	0	0	3	9	6	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	A	16.02	3.003508	0.54254	.	.	ENSG00000107611	ENST00000377833	D	0.91521	-2.86	5.75	5.75	0.90469	EGF-like region, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.50627	D	0.000104	D	0.97362	0.9137	H	0.98276	4.19	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98939	1.0790	10	0.87932	D	0	.	15.7034	0.77558	1.0:0.0:0.0:0.0	.	210	O60494	CUBN_HUMAN	R	210	ENSP00000367064:C210R	ENSP00000367064:C210R	C	-	1	0	CUBN	17197568	1.000000	0.71417	1.000000	0.80357	0.059000	0.15707	7.574000	0.82434	2.197000	0.70478	0.533000	0.62120	TGT	.		0.542	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
COMMD3	23412	hgsc.bcm.edu	37	10	22605388	22605388	+	Silent	SNP	G	G	A			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr10:22605388G>A	ENST00000376836.3	+	1	486	c.42G>A	c.(40-42)ctG>ctA	p.L14L	COMMD3-BMI1_ENST00000463409.2_3'UTR|COMMD3-BMI1_ENST00000602390.1_Silent_p.L14L	NM_012071.3	NP_036203.1	Q9UBI1	COMD3_HUMAN	COMM domain containing 3	14										kidney(2)|lung(2)|ovary(1)	5						TCCAGATGCTGGCGGATCCCC	0.647																																					p.L14L		.											.	.	0			c.G42A						.						58.0	36.0	43.0					10																	22605388		2072	4086	6158	SO:0001819	synonymous_variant	0	exon1			GATGCTGGCGGAT	AY542159	CCDS7137.1	10p12.2	2012-09-20	2004-02-13	2004-02-18	ENSG00000148444	ENSG00000148444			23332	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 8"""	C10orf8		11042152, 15799966	Standard	NM_012071		Approved	BUP		Q9UBI1	OTTHUMG00000017806	ENST00000376836.3:c.42G>A	10.37:g.22605388G>A		Somatic	2	2		WXS	Illumina HiSeq	Phase_I	8	6	NM_001204062	0	0	17	32	15	D3DRU7|Q5T8Y9	Silent	SNP	ENST00000376836.3	37	CCDS7137.1	.	.	.	.	.	.	.	.	.	.	G	5.041	0.193236	0.09599	.	.	ENSG00000148444	ENST00000456711;ENST00000444869	.	.	.	4.8	3.89	0.44902	.	.	.	.	.	T	0.58892	0.2154	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56257	-0.8009	4	.	.	.	-21.0468	8.8553	0.35225	0.1748:0.0:0.8252:0.0	.	.	.	.	S	15;14	.	.	G	+	1	0	COMMD3	22645394	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	0.939000	0.28978	1.384000	0.46424	-0.140000	0.14226	GGC	.		0.647	COMMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047159.1	NM_012071	
MYO3A	53904	hgsc.bcm.edu	37	10	26459400	26459400	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr10:26459400C>A	ENST00000265944.5	+	29	3496	c.3330C>A	c.(3328-3330)aaC>aaA	p.N1110K	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	1110	IQ 2. {ECO:0000255|PROSITE- ProRule:PRU00116}.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						ACATGAAAAACACAGCAGTAA	0.328																																					p.N1110K		.											.	MYO3A-1007	0			c.C3330A						.						70.0	65.0	66.0					10																	26459400		2203	4299	6502	SO:0001583	missense	53904	exon29			GAAAAACACAGCA	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.3330C>A	10.37:g.26459400C>A	ENSP00000265944:p.Asn1110Lys	Somatic	33	0		WXS	Illumina HiSeq	Phase_I	33	2	NM_017433	0	0	0	0	0	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	37	CCDS7148.1	.	.	.	.	.	.	.	.	.	.	C	4.358	0.066012	0.08388	.	.	ENSG00000095777	ENST00000265944	T	0.75821	-0.97	5.03	-1.66	0.08265	.	0.221408	0.52532	D	0.000064	T	0.59582	0.2204	L	0.55481	1.735	0.09310	N	1	B	0.34264	0.446	B	0.32677	0.15	T	0.50816	-0.8783	10	0.44086	T	0.13	.	3.6725	0.08279	0.101:0.4666:0.0993:0.333	.	1110	Q8NEV4	MYO3A_HUMAN	K	1110	ENSP00000265944:N1110K	ENSP00000265944:N1110K	N	+	3	2	MYO3A	26499406	0.060000	0.20803	0.001000	0.08648	0.062000	0.15995	0.198000	0.17217	0.023000	0.15187	-0.136000	0.14681	AAC	.		0.328	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433	
IDE	3416	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	94239044	94239044	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr10:94239044T>C	ENST00000265986.6	-	15	1930	c.1874A>G	c.(1873-1875)tAt>tGt	p.Y625C	IDE_ENST00000371581.5_Missense_Mutation_p.Y70C|IDE_ENST00000496903.1_Intron	NM_004969.3	NP_004960.2	P14735	IDE_HUMAN	insulin-degrading enzyme	625					beta-amyloid metabolic process (GO:0050435)|bradykinin catabolic process (GO:0010815)|determination of adult lifespan (GO:0008340)|hormone catabolic process (GO:0042447)|insulin catabolic process (GO:1901143)|insulin metabolic process (GO:1901142)|insulin receptor signaling pathway (GO:0008286)|negative regulation of proteolysis (GO:0045861)|positive regulation of protein oligomerization (GO:0032461)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein homotetramerization (GO:0051289)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|ubiquitin homeostasis (GO:0010992)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|beta-amyloid binding (GO:0001540)|beta-endorphin binding (GO:0031626)|glycoprotein binding (GO:0001948)|insulin binding (GO:0043559)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|urinary_tract(2)	33					"""""""Insulin(DB00071)|Bacitracin(DB00626)|Insulin Regular(DB00030)"""	ATACATCCCATAGATGGTATT	0.408																																					p.Y625C		.											.	IDE-92	0			c.A1874G						.						172.0	149.0	157.0					10																	94239044		2203	4300	6503	SO:0001583	missense	3416	exon15			ATCCCATAGATGG	M21188	CCDS7421.1, CCDS53554.1	10q23-q25	2007-03-27			ENSG00000119912	ENSG00000119912			5381	protein-coding gene	gene with protein product	"""insulysin"""	146680				2293021	Standard	NM_004969		Approved		uc001kia.3	P14735	OTTHUMG00000018759	ENST00000265986.6:c.1874A>G	10.37:g.94239044T>C	ENSP00000265986:p.Tyr625Cys	Somatic	117	0		WXS	Illumina HiSeq	Phase_I	140	57	NM_004969	0	0	0	0	0	B2R721|B7ZAU2|D3DR35|Q5T5N2	Missense_Mutation	SNP	ENST00000265986.6	37	CCDS7421.1	.	.	.	.	.	.	.	.	.	.	T	14.39	2.522510	0.44866	.	.	ENSG00000119912	ENST00000265986;ENST00000371581	T;T	0.40756	1.02;1.02	5.64	5.64	0.86602	Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.140820	0.49305	D	0.000142	T	0.40956	0.1138	M	0.64170	1.965	0.80722	D	1	P	0.38370	0.628	B	0.33890	0.172	T	0.34601	-0.9822	10	0.38643	T	0.18	-12.9568	15.5248	0.75894	0.0:0.0:0.0:1.0	.	625	P14735	IDE_HUMAN	C	625;70	ENSP00000265986:Y625C;ENSP00000360637:Y70C	ENSP00000265986:Y625C	Y	-	2	0	IDE	94229024	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.152000	0.67230	0.533000	0.62120	TAT	.		0.408	IDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049393.1	NM_004969	
SLC22A8	9376	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	62782340	62782340	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr11:62782340T>C	ENST00000336232.2	-	2	226	c.91A>G	c.(91-93)Atg>Gtg	p.M31V	SLC22A8_ENST00000430500.2_Missense_Mutation_p.M31V|SLC22A8_ENST00000535878.1_Intron|SLC22A8_ENST00000545207.1_Intron|SLC22A8_ENST00000311438.8_Missense_Mutation_p.M31V	NM_001184732.1|NM_001184736.1|NM_004254.3	NP_001171661.1|NP_001171665.1|NP_004245.2	Q8TCC7	S22A8_HUMAN	solute carrier family 22 (organic anion transporter), member 8	31					glutathione transport (GO:0034635)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|organic anion transmembrane transporter activity (GO:0008514)|quaternary ammonium group transmembrane transporter activity (GO:0015651)			endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	28					Aciclovir(DB00787)|Adefovir Dipivoxil(DB00718)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Aspartame(DB00168)|Baclofen(DB00181)|Benzylpenicillin(DB01053)|Bumetanide(DB00887)|Cefacetrile(DB01414)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefazolin(DB01327)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Ceftriaxone(DB01212)|Cephalexin(DB00567)|Cilastatin(DB01597)|Cimetidine(DB00501)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Doxycycline(DB00254)|Enalapril(DB00584)|Estradiol(DB00783)|Famotidine(DB00927)|Furosemide(DB00695)|Ganciclovir(DB01004)|Guanidine(DB00536)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|L-Carnitine(DB00583)|Liothyronine(DB00279)|Liotrix(DB01583)|Melatonin(DB01065)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Minocycline(DB01017)|Novobiocin(DB01051)|Oseltamivir(DB00198)|Ouabain(DB01092)|Oxytetracycline(DB00595)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Ranitidine(DB00863)|Salicylic acid(DB00936)|Saxagliptin(DB06335)|Succinic acid(DB00139)|Tenofovir(DB00300)|Tenoxicam(DB00469)|Testosterone(DB00624)|Tetracycline(DB00759)|Valaciclovir(DB00577)|Valproic Acid(DB00313)|Zidovudine(DB00495)	TGGTTGGCCATGTTGAGGATC	0.617																																					p.M31V		.											.	SLC22A8-93	0			c.A91G						.						183.0	179.0	181.0					11																	62782340		2201	4298	6499	SO:0001583	missense	9376	exon2			TGGCCATGTTGAG	AF097491, BC022387	CCDS8042.1, CCDS53643.1, CCDS53644.1	11q12.3	2013-05-22			ENSG00000149452	ENSG00000149452		"""Solute carriers"""	10972	protein-coding gene	gene with protein product		607581				10049739	Standard	NM_004254		Approved	OAT3	uc001nwo.3	Q8TCC7	OTTHUMG00000167768	ENST00000336232.2:c.91A>G	11.37:g.62782340T>C	ENSP00000337335:p.Met31Val	Somatic	289	0		WXS	Illumina HiSeq	Phase_I	256	85	NM_001184732	0	0	0	0	0	B4DPH7|F5GWA8|F5H5J1|O95820|Q59EW9|Q96TC1	Missense_Mutation	SNP	ENST00000336232.2	37	CCDS8042.1	.	.	.	.	.	.	.	.	.	.	T	12.68	2.009360	0.35415	.	.	ENSG00000149452	ENST00000336232;ENST00000540631;ENST00000311438;ENST00000430500	T;T;T	0.53206	0.63;0.63;0.63	4.76	2.38	0.29361	.	0.446155	0.25666	N	0.029103	T	0.26484	0.0647	N	0.21282	0.65	0.24143	N	0.995726	B;B	0.18968	0.032;0.01	B;B	0.21917	0.037;0.016	T	0.23726	-1.0180	10	0.08381	T	0.77	.	6.2794	0.20999	0.153:0.0:0.1774:0.6696	.	31;31	Q8TCC7-2;Q8TCC7	.;S22A8_HUMAN	V	31	ENSP00000337335:M31V;ENSP00000311463:M31V;ENSP00000398548:M31V	ENSP00000311463:M31V	M	-	1	0	SLC22A8	62538916	0.007000	0.16637	0.736000	0.30914	0.989000	0.77384	0.313000	0.19415	0.303000	0.22785	0.533000	0.62120	ATG	.		0.617	SLC22A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396191.1	NM_004254	
PITPNM1	9600	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	67263727	67263727	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr11:67263727T>C	ENST00000534749.1	-	14	2427	c.2239A>G	c.(2239-2241)Aag>Gag	p.K747E	PITPNM1_ENST00000436757.2_Missense_Mutation_p.K746E|PITPNM1_ENST00000356404.3_Missense_Mutation_p.K747E|PITPNM1_ENST00000526450.1_5'Flank			O00562	PITM1_HUMAN	phosphatidylinositol transfer protein, membrane-associated 1	747	DDHD. {ECO:0000255|PROSITE- ProRule:PRU00378}.				brain development (GO:0007420)|lipid metabolic process (GO:0006629)|phospholipid transport (GO:0015914)|phototransduction (GO:0007602)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol transporter activity (GO:0008526)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(3)	18						GCCTGGAACTTCGGGGCCAGC	0.642																																					p.K747E	GBM(28;144 709 4607 5525)	.											.	PITPNM1-227	0			c.A2239G						.						41.0	42.0	42.0					11																	67263727		2200	4294	6494	SO:0001583	missense	9600	exon15			GGAACTTCGGGGC	X98654	CCDS31620.1, CCDS44659.1	11q13	2008-07-21		2003-05-16	ENSG00000110697	ENSG00000110697			9003	protein-coding gene	gene with protein product	"""PYK2 N-terminal domain-interacting receptor 2"", ""retinal degeneration B alpha 1"""	608794		PITPNM		9680295	Standard	NM_004910		Approved	DRES9, NIR2, RDGB1, RDGBA1, Rd9, RDGB	uc001oly.3	O00562	OTTHUMG00000167675	ENST00000534749.1:c.2239A>G	11.37:g.67263727T>C	ENSP00000437286:p.Lys747Glu	Somatic	110	0		WXS	Illumina HiSeq	Phase_I	73	36	NM_004910	0	0	9	30	21	A6NME4|Q6T7X3|Q8TBN3|Q9BZ73	Missense_Mutation	SNP	ENST00000534749.1	37	CCDS31620.1	.	.	.	.	.	.	.	.	.	.	T	11.84	1.758047	0.31137	.	.	ENSG00000110697	ENST00000534749;ENST00000436757;ENST00000356404	T;T;T	0.39787	1.06;1.06;1.06	4.43	3.29	0.37713	DDHD (2);	0.329601	0.26757	N	0.022648	T	0.26195	0.0639	N	0.13235	0.315	0.28852	N	0.896001	P;P	0.36712	0.51;0.566	B;B	0.40702	0.228;0.338	T	0.10086	-1.0645	10	0.46703	T	0.11	-28.7945	6.0013	0.19521	0.0:0.089:0.1682:0.7428	.	746;747	O00562-2;O00562	.;PITM1_HUMAN	E	747;746;747	ENSP00000437286:K747E;ENSP00000398787:K746E;ENSP00000348772:K747E	ENSP00000348772:K747E	K	-	1	0	PITPNM1	67020303	0.737000	0.28175	1.000000	0.80357	0.378000	0.30076	0.802000	0.27069	0.837000	0.34925	-0.429000	0.05907	AAG	.		0.642	PITPNM1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395520.1	NM_004910	
PCF11	51585	hgsc.bcm.edu	37	11	82877237	82877237	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr11:82877237A>G	ENST00000298281.4	+	5	1750	c.1298A>G	c.(1297-1299)gAg>gGg	p.E433G		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	433	Lys-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						GATAAAGATGAGCACATGAAG	0.348																																					p.E433G		.											.	PCF11-23	0			c.A1298G						.						80.0	77.0	78.0					11																	82877237		1876	4113	5989	SO:0001583	missense	51585	exon5			AAGATGAGCACAT	AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.1298A>G	11.37:g.82877237A>G	ENSP00000298281:p.Glu433Gly	Somatic	20	0		WXS	Illumina HiSeq	Phase_I	25	2	NM_015885	0	0	3	3	0	A6H8W7|O43671|Q6P0X8	Missense_Mutation	SNP	ENST00000298281.4	37	CCDS44689.1	.	.	.	.	.	.	.	.	.	.	A	19.73	3.881854	0.72294	.	.	ENSG00000165494	ENST00000298281;ENST00000530660;ENST00000530304	T;T;T	0.53640	1.6;0.61;0.61	6.07	6.07	0.98685	.	0.000000	0.64402	D	0.000012	T	0.57227	0.2039	L	0.32530	0.975	0.49299	D	0.999772	D;B	0.76494	0.999;0.083	D;B	0.75484	0.986;0.077	T	0.54403	-0.8299	9	.	.	.	.	14.3816	0.66914	1.0:0.0:0.0:0.0	.	433;433	E9PQ01;O94913	.;PCF11_HUMAN	G	433	ENSP00000298281:E433G;ENSP00000434540:E433G;ENSP00000431567:E433G	.	E	+	2	0	PCF11	82554885	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.999000	0.88496	2.326000	0.78906	0.533000	0.62120	GAG	.		0.348	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392548.2	NM_015885	
ALG9	79796	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	111715419	111715419	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr11:111715419A>G	ENST00000531154.1	-	9	882	c.410T>C	c.(409-411)aTt>aCt	p.I137T	ALG9_ENST00000527228.1_5'UTR|ALG9_ENST00000398006.2_Missense_Mutation_p.I137T|ALG9_ENST00000524880.1_3'UTR	NM_024740.2	NP_079016.2	Q9H6U8	ALG9_HUMAN	ALG9, alpha-1,2-mannosyltransferase	308					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	dol-P-Man:Man(6)GlcNAc(2)-PP-Dol alpha-1,2-mannosyltransferase activity (GO:0052926)|dol-P-Man:Man(8)GlcNAc(2)-PP-Dol alpha-1,2-mannosyltransferase activity (GO:0052918)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.81e-07)|BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|all cancers(92;1.3e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0587)		AAATCCATTAATTAAATAGAA	0.393																																					p.I308T		.											.	ALG9-91	0			c.T923C						.						91.0	86.0	88.0					11																	111715419		1836	4091	5927	SO:0001583	missense	79796	exon10			CCATTAATTAAAT		CCDS41714.1, CCDS53709.1, CCDS73379.1, CCDS73380.1	11q23	2013-02-26	2013-02-26	2004-08-26	ENSG00000086848	ENSG00000086848	2.4.1.259, 2.4.1.261	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	15672	protein-coding gene	gene with protein product	"""dolichyl-P-Man:Man(6)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase"", ""dolichyl-P-Man:Man(8)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase"", ""dol-P-Man dependent alpha-1,2-mannosyltransferase"""	606941	"""disrupted in bipolar affective disorder 1"", ""asparagine-linked glycosylation 9 homolog (yeast, alpha 1,2 mannosyltransferase)"", ""asparagine-linked glycosylation 9, alpha- 1,2-mannosyltransferase homolog (S. cerevisiae, alpha- 1,2-mannosyltransferase)"", ""asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae)"""	DIBD1		12030331, 15148656	Standard	NM_024740		Approved		uc021qql.1	Q9H6U8	OTTHUMG00000166819	ENST00000531154.1:c.410T>C	11.37:g.111715419A>G	ENSP00000435517:p.Ile137Thr	Somatic	80	0		WXS	Illumina HiSeq	Phase_I	83	38	NM_001077690	0	0	3	6	3	Q6ZMD5|Q7Z4R4|Q96GS7|Q96PB9|Q9H068	Missense_Mutation	SNP	ENST00000531154.1	37	CCDS41714.1	.	.	.	.	.	.	.	.	.	.	A	16.28	3.077619	0.55753	.	.	ENSG00000086848	ENST00000531154;ENST00000398006;ENST00000428306	T;T	0.63417	-0.04;-0.04	5.69	5.69	0.88448	.	0.149147	0.64402	D	0.000012	T	0.67878	0.2940	L	0.60455	1.87	0.51767	D	0.999935	P;B;B;P	0.41080	0.549;0.068;0.055;0.737	B;B;B;P	0.49301	0.272;0.068;0.076;0.606	T	0.63782	-0.6559	10	0.22109	T	0.4	-13.3791	15.9548	0.79880	1.0:0.0:0.0:0.0	.	137;308;541;308	B4DQI3;Q9H6U8-3;B4DYW0;Q9H6U8	.;.;.;ALG9_HUMAN	T	137;137;541	ENSP00000435517:I137T;ENSP00000381090:I137T	ENSP00000381090:I137T	I	-	2	0	ALG9	111220629	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.161000	0.77505	2.171000	0.68590	0.528000	0.53228	ATT	.		0.393	ALG9-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000391485.1	NM_024740	
CACNA1C	775	hgsc.bcm.edu	37	12	2795428	2795428	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr12:2795428A>G	ENST00000347598.4	+	47	5921	c.5921A>G	c.(5920-5922)cAt>cGt	p.H1974R	CACNA1C_ENST00000399621.1_Missense_Mutation_p.H1945R|CACNA1C_ENST00000402845.3_Missense_Mutation_p.H1945R|CACNA1C-AS1_ENST00000501371.1_RNA|CACNA1C_ENST00000344100.3_Missense_Mutation_p.H1967R|CACNA1C_ENST00000399595.1_Missense_Mutation_p.H1934R|CACNA1C_ENST00000399603.1_Missense_Mutation_p.H1926R|CACNA1C_ENST00000399638.1_Missense_Mutation_p.H1954R|CACNA1C_ENST00000399649.1_Missense_Mutation_p.H1932R|CACNA1C_ENST00000399606.1_Missense_Mutation_p.H1946R|CACNA1C_ENST00000399641.1_Missense_Mutation_p.H1926R|CACNA1C_ENST00000399597.1_Missense_Mutation_p.H1926R|CACNA1C_ENST00000399634.1_Missense_Mutation_p.H1997R|CACNA1C_ENST00000399644.1_Missense_Mutation_p.H1926R|CACNA1C_ENST00000335762.5_Missense_Mutation_p.H1951R|CACNA1C_ENST00000399601.1_Missense_Mutation_p.H1926R|CACNA1C_ENST00000327702.7_Missense_Mutation_p.H1961R|CACNA1C_ENST00000399617.1_Missense_Mutation_p.H1961R|CACNA1C_ENST00000399629.1_Missense_Mutation_p.H1943R|CACNA1C_ENST00000406454.3_Missense_Mutation_p.H1997R|CACNA1C_ENST00000399655.1_Missense_Mutation_p.H1926R|CACNA1C_ENST00000399637.1_Missense_Mutation_p.H1945R|CACNA1C_ENST00000399591.1_Missense_Mutation_p.H1934R	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	2009					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CATCTGGTTCATCATCAGGTA	0.567																																					p.H2009R		.											.	CACNA1C-34	0			c.A6026G						.						93.0	96.0	95.0					12																	2795428		1976	4136	6112	SO:0001583	missense	775	exon48			TGGTTCATCATCA	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.5921A>G	12.37:g.2795428A>G	ENSP00000266376:p.His1974Arg	Somatic	172	2		WXS	Illumina HiSeq	Phase_I	215	11	NM_199460	0	0	0	1	1	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000347598.4	37	CCDS44788.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.137578	0.77775	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.52983	0.64;0.64;0.64;0.64;0.64;0.64;0.64;0.64;0.64;0.64;0.64;0.64;0.64;0.64;0.64;0.64;0.64;0.64;0.64;0.64;0.64;0.64	4.82	4.82	0.62117	.	0.600028	0.16837	N	0.197501	T	0.66761	0.2822	M	0.65975	2.015	0.44149	D	0.996944	P;D;D;B;D;D;D;D;D;B;D;D;D;D;D;D;D;P;D;B;D;D;D;D;D	0.71674	0.902;0.997;0.984;0.315;0.99;0.997;0.993;0.997;0.976;0.36;0.998;0.991;0.996;0.995;0.973;0.995;0.996;0.877;0.994;0.006;0.964;0.997;0.997;0.998;0.984	P;P;D;B;D;D;P;D;P;B;D;P;D;D;D;D;D;P;D;B;P;D;D;D;D	0.81914	0.63;0.85;0.964;0.109;0.983;0.995;0.879;0.995;0.792;0.069;0.995;0.84;0.99;0.995;0.921;0.967;0.99;0.533;0.983;0.012;0.786;0.995;0.995;0.969;0.964	T	0.68614	-0.5362	10	0.62326	D	0.03	.	14.527	0.67894	1.0:0.0:0.0:0.0	.	617;1967;1923;2009;1961;1945;1926;1943;1954;1926;1946;1926;1957;1974;1926;1961;1997;1934;1932;1934;1915;1945;1945;1926;1926	B7Z7Z5;Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	R	1951;1926;1926;1954;1926;1945;1945;1934;1926;1974;1946;1926;1967;1943;1961;1932;1945;1926;1997;1961;1997;1934;1827	ENSP00000336982:H1951R;ENSP00000382563:H1926R;ENSP00000382552:H1926R;ENSP00000382547:H1954R;ENSP00000382506:H1926R;ENSP00000382530:H1945R;ENSP00000382546:H1945R;ENSP00000382500:H1934R;ENSP00000382549:H1926R;ENSP00000266376:H1974R;ENSP00000382515:H1946R;ENSP00000382510:H1926R;ENSP00000341092:H1967R;ENSP00000382537:H1943R;ENSP00000329877:H1961R;ENSP00000382557:H1932R;ENSP00000385724:H1945R;ENSP00000382512:H1926R;ENSP00000382542:H1997R;ENSP00000382526:H1961R;ENSP00000385896:H1997R;ENSP00000382504:H1934R	ENSP00000323129:H1827R	H	+	2	0	CACNA1C	2665689	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	8.652000	0.91083	2.023000	0.59567	0.477000	0.44152	CAT	.		0.567	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719	
NCAPD2	9918	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	6638743	6638743	+	Silent	SNP	C	C	A			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr12:6638743C>A	ENST00000315579.5	+	28	4436	c.3637C>A	c.(3637-3639)Cgg>Agg	p.R1213R	NCAPD2_ENST00000545962.1_Silent_p.R1168R|RP5-940J5.3_ENST00000537921.1_RNA	NM_014865.3	NP_055680.3	Q15021	CND1_HUMAN	non-SMC condensin I complex, subunit D2	1213					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|condensin core heterodimer (GO:0000797)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|pronucleus (GO:0045120)	histone binding (GO:0042393)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	48						GCTGTGTCAGCGGTTCCGCAC	0.602																																					p.R1213R		.											.	NCAPD2-660	0			c.C3637A						.						95.0	82.0	86.0					12																	6638743		2203	4300	6503	SO:0001819	synonymous_variant	9918	exon28			TGTCAGCGGTTCC	D63880	CCDS8548.1	12p13.31	2008-02-04			ENSG00000010292	ENSG00000010292			24305	protein-coding gene	gene with protein product	"""chromosome condensation related SMC associated protein 1"""	615638				8590280, 10958694	Standard	NM_014865		Approved	CNAP1, hCAP-D2, CAP-D2, KIAA0159	uc001qoo.2	Q15021	OTTHUMG00000168513	ENST00000315579.5:c.3637C>A	12.37:g.6638743C>A		Somatic	116	0		WXS	Illumina HiSeq	Phase_I	114	20	NM_014865	0	0	23	32	9	D3DUR4|Q8N6U3	Silent	SNP	ENST00000315579.5	37	CCDS8548.1																																																																																			.		0.602	NCAPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399964.1	NM_014865	
OS9	10956	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	58087952	58087952	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr12:58087952C>T	ENST00000315970.7	+	1	49	c.8C>T	c.(7-9)gCg>gTg	p.A3V	OS9_ENST00000389146.6_Missense_Mutation_p.A3V|OS9_ENST00000439210.2_Missense_Mutation_p.A3V|RP11-571M6.7_ENST00000549477.1_RNA|OS9_ENST00000389142.5_Missense_Mutation_p.A3V|OS9_ENST00000257966.8_Missense_Mutation_p.A3V|OS9_ENST00000435406.2_Missense_Mutation_p.A3V|OS9_ENST00000551035.1_Missense_Mutation_p.A3V|OS9_ENST00000413095.2_Missense_Mutation_p.A3V|OS9_ENST00000552285.1_Missense_Mutation_p.A3V	NM_001017958.2|NM_006812.3	NP_001017958.1|NP_006803.1	Q13438	OS9_HUMAN	osteosarcoma amplified 9, endoplasmic reticulum lectin	3					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein retention in ER lumen (GO:0006621)|protein targeting (GO:0006605)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum lumen (GO:0005788)|Hrd1p ubiquitin ligase complex (GO:0000836)	carbohydrate binding (GO:0030246)|glycoprotein binding (GO:0001948)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	21	all_neural(12;0.00548)|Glioma(12;0.0126)|Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			AAGATGGCGGCGGAAACGCTG	0.582																																					p.A3V		.											.	OS9-493	0			c.C8T						.						135.0	134.0	134.0					12																	58087952		2203	4300	6503	SO:0001583	missense	10956	exon1			TGGCGGCGGAAAC	AB002806	CCDS31843.1, CCDS31844.1, CCDS31845.1, CCDS31846.1, CCDS58246.1, CCDS58247.1, CCDS58248.1, CCDS58249.1	12q13	2009-08-26	2009-08-26						16994	protein-coding gene	gene with protein product	"""endoplasmic reticulum lectin 2"", ""erlectin 2"""	609677				8634085, 9498564, 19346256, 18264092	Standard	NM_006812		Approved	OS-9, ERLEC2	uc001spj.3	Q13438	OTTHUMG00000170284	ENST00000315970.7:c.8C>T	12.37:g.58087952C>T	ENSP00000318165:p.Ala3Val	Somatic	192	1		WXS	Illumina HiSeq	Phase_I	253	70	NM_001261423	0	0	11	15	4	A6NDD1|A6NFR7|A6NLB2|A8K5Q9|B4DE28|B4DPX1|B4E1I6|E7ENT8|E7EW91|F8VUH2|G3XA88|O00579|Q6IBL2|Q8IZ58|Q9BW99	Missense_Mutation	SNP	ENST00000315970.7	37	CCDS31843.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.205750	0.79127	.	.	ENSG00000135506	ENST00000552285;ENST00000315970;ENST00000547079;ENST00000439210;ENST00000389146;ENST00000413095;ENST00000551035;ENST00000257966;ENST00000435406;ENST00000550372;ENST00000389142	T;T;T;T;T;T;T;T;T;T	0.51574	1.54;1.55;0.7;1.42;1.48;1.3;1.73;1.54;1.69;1.48	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.52597	0.1744	N	0.19112	0.55	0.47949	D	0.999556	D;D;D;B;B;B;B;B	0.76494	0.998;0.999;0.995;0.002;0.004;0.001;0.002;0.003	P;D;P;B;B;B;B;B	0.64506	0.845;0.926;0.772;0.005;0.002;0.002;0.001;0.001	T	0.56475	-0.7973	10	0.62326	D	0.03	-0.3422	16.1626	0.81731	0.0:1.0:0.0:0.0	.	3;3;3;3;3;3;3;3	E7EW91;F8VUH2;B4E321;G3XA88;E9PEY5;Q9BW99;A6NLB2;Q13438	.;.;.;.;.;.;.;OS9_HUMAN	V	3	ENSP00000450010:A3V;ENSP00000318165:A3V;ENSP00000447031:A3V;ENSP00000407360:A3V;ENSP00000373798:A3V;ENSP00000413112:A3V;ENSP00000447866:A3V;ENSP00000257966:A3V;ENSP00000389632:A3V;ENSP00000373794:A3V	ENSP00000257966:A3V	A	+	2	0	OS9	56374219	0.963000	0.33076	1.000000	0.80357	0.894000	0.52154	1.435000	0.34969	2.756000	0.94617	0.563000	0.77884	GCG	.		0.582	OS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408344.1	NM_006812	
ESD	2098	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	47345616	47345616	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr13:47345616A>G	ENST00000378720.3	-	10	966	c.784T>C	c.(784-786)Tac>Cac	p.Y262H	ESD_ENST00000378697.1_Missense_Mutation_p.Y233H	NM_001984.1	NP_001975.1	P10768	ESTD_HUMAN	esterase D	262					formaldehyde catabolic process (GO:0046294)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carboxylic ester hydrolase activity (GO:0052689)|hydrolase activity, acting on ester bonds (GO:0016788)|methylumbelliferyl-acetate deacetylase activity (GO:0047374)|S-formylglutathione hydrolase activity (GO:0018738)			endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)	9		all_lung(13;3.54e-08)|Lung NSC(96;9.1e-06)|Breast(56;0.000148)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)		GBM - Glioblastoma multiforme(144;2.66e-05)	Glutathione(DB00143)	ATGAAGTAGTAGCTATGATCA	0.328																																					p.Y262H		.											.	ESD-91	0			c.T784C						.						152.0	154.0	153.0					13																	47345616		2203	4296	6499	SO:0001583	missense	2098	exon10			AGTAGTAGCTATG	M13450	CCDS9404.1	13q14.1-q14.2	2014-05-13	2010-05-07		ENSG00000139684	ENSG00000139684	3.1.2.12		3465	protein-coding gene	gene with protein product	"""S-formylglutathione hydrolase"""	133280	"""esterase D/formylglutathione hydrolase"""				Standard	NM_001984		Approved		uc001vbn.3	P10768	OTTHUMG00000016878	ENST00000378720.3:c.784T>C	13.37:g.47345616A>G	ENSP00000367992:p.Tyr262His	Somatic	52	0		WXS	Illumina HiSeq	Phase_I	83	21	NM_001984	0	0	111	208	97	Q5TBU8|Q5TBV0|Q5TBV2|Q9BVJ2	Missense_Mutation	SNP	ENST00000378720.3	37	CCDS9404.1	.	.	.	.	.	.	.	.	.	.	A	25.9	4.686182	0.88639	.	.	ENSG00000139684	ENST00000378720;ENST00000378697	T;T	0.37584	1.19;1.19	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.72104	0.3419	H	0.95539	3.685	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81052	-0.1107	10	0.87932	D	0	-15.2421	16.0034	0.80327	1.0:0.0:0.0:0.0	.	262	P10768	ESTD_HUMAN	H	262;233	ENSP00000367992:Y262H;ENSP00000367969:Y233H	ENSP00000367969:Y233H	Y	-	1	0	ESD	46243617	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.060000	0.93907	2.371000	0.80710	0.533000	0.62120	TAC	.		0.328	ESD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044826.1		
ATP7B	540	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	52511445	52511445	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr13:52511445T>G	ENST00000242839.4	-	19	4144	c.3988A>C	c.(3988-3990)Att>Ctt	p.I1330L	ATP7B_ENST00000400366.3_Missense_Mutation_p.I1219L|ATP7B_ENST00000448424.2_Missense_Mutation_p.I1252L|ATP7B_ENST00000418097.2_Missense_Mutation_p.I1265L|ATP7B_ENST00000400370.3_Missense_Mutation_p.I900L|ATP7B_ENST00000417240.2_Missense_Mutation_p.I541L|ATP7B_ENST00000344297.5_Missense_Mutation_p.I1123L	NM_000053.3	NP_000044.2	P35670	ATP7B_HUMAN	ATPase, Cu++ transporting, beta polypeptide	1330					cellular copper ion homeostasis (GO:0006878)|cellular zinc ion homeostasis (GO:0006882)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|intracellular copper ion transport (GO:0015680)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|response to copper ion (GO:0046688)|sequestering of calcium ion (GO:0051208)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|mitochondrion (GO:0005739)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper-exporting ATPase activity (GO:0004008)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(23)|ovary(1)|prostate(3)|skin(4)|stomach(2)	55		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)	Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	AGGTTATAAATCAGTGCCAGG	0.532									Wilson disease																												p.I1330L		.											.	ATP7B-92	0			c.A3988C						.						104.0	109.0	107.0					13																	52511445		2043	4195	6238	SO:0001583	missense	540	exon19	Familial Cancer Database		TATAAATCAGTGC	U11700	CCDS41892.1, CCDS45049.1, CCDS58293.1	13q14.3	2012-10-22	2005-11-29		ENSG00000123191	ENSG00000123191	3.6.3.4	"""ATPases / P-type"""	870	protein-coding gene	gene with protein product	"""Wilson disease"", ""copper pump 2"", ""copper-transporting ATPase 2"""	606882	"""ATPase, Cu++ transporting, beta polypeptide (Wilson disease)"""	WND		8298641, 8298639	Standard	NM_000053		Approved		uc001vfw.2	P35670	OTTHUMG00000017406	ENST00000242839.4:c.3988A>C	13.37:g.52511445T>G	ENSP00000242839:p.Ile1330Leu	Somatic	83	0		WXS	Illumina HiSeq	Phase_I	76	33	NM_000053	0	0	6	9	3	Q16318|Q16319|Q4U3V3|Q59FJ9|Q5T7X7	Missense_Mutation	SNP	ENST00000242839.4	37	CCDS41892.1	.	.	.	.	.	.	.	.	.	.	T	17.72	3.459608	0.63401	.	.	ENSG00000123191	ENST00000242839;ENST00000400366;ENST00000344297;ENST00000417240;ENST00000448424;ENST00000400370;ENST00000418097	D;D;D;D;D;D;D	0.99158	-5.5;-5.5;-5.5;-2.36;-5.5;-5.5;-5.5	5.34	5.34	0.76211	HAD-like domain (1);	0.000000	0.85682	D	0.000000	D	0.98689	0.9560	L	0.42008	1.315	0.80722	D	1	D;B;D;B;D;P;D;D	0.56521	0.974;0.191;0.976;0.447;0.976;0.678;0.976;0.974	D;B;P;B;P;P;P;P	0.66716	0.946;0.145;0.741;0.285;0.741;0.646;0.741;0.677	D	0.99474	1.0946	10	0.40728	T	0.16	-22.351	15.6255	0.76851	0.0:0.0:0.0:1.0	.	1252;1282;1265;541;900;1219;1123;1330	E7ET55;B7ZLR4;F5H748;E7EQQ2;F5H562;P35670-3;P35670-2;P35670	.;.;.;.;.;.;.;ATP7B_HUMAN	L	1330;1219;1123;541;1252;900;1265	ENSP00000242839:I1330L;ENSP00000383217:I1219L;ENSP00000342559:I1123L;ENSP00000390360:I541L;ENSP00000416738:I1252L;ENSP00000383221:I900L;ENSP00000393343:I1265L	ENSP00000242839:I1330L	I	-	1	0	ATP7B	51409446	1.000000	0.71417	0.983000	0.44433	0.966000	0.64601	6.243000	0.72384	2.144000	0.66660	0.533000	0.62120	ATT	.		0.532	ATP7B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045981.1	NM_000053	
BAZ1A	11177	hgsc.bcm.edu	37	14	35270380	35270380	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr14:35270380T>G	ENST00000382422.2	-	7	1208	c.881A>C	c.(880-882)aAa>aCa	p.K294T	BAZ1A_ENST00000358716.4_Missense_Mutation_p.K294T|AL355885.1_ENST00000581314.1_RNA|BAZ1A_ENST00000360310.1_Missense_Mutation_p.K294T			Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	294					chromatin remodeling (GO:0006338)|DNA-dependent DNA replication (GO:0006261)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	ACF complex (GO:0016590)|CHRAC (GO:0008623)|nuclear chromosome (GO:0000228)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(2)|large_intestine(7)|lung(19)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		AAGAGTCTGTTTATTAGCAAC	0.308																																					p.K294T		.											.	BAZ1A-291	0			c.A881C						.						79.0	78.0	78.0					14																	35270380		2203	4297	6500	SO:0001583	missense	11177	exon8			GTCTGTTTATTAG	AB032252	CCDS9651.1, CCDS41943.1	14q13.2	2013-01-28			ENSG00000198604	ENSG00000198604		"""Zinc fingers, PHD-type"""	960	protein-coding gene	gene with protein product		605680				10662543	Standard	NM_013448		Approved	hACF1, ACF1, WALp1, WCRF180	uc001wsk.3	Q9NRL2	OTTHUMG00000140216	ENST00000382422.2:c.881A>C	14.37:g.35270380T>G	ENSP00000371859:p.Lys294Thr	Somatic	27	0		WXS	Illumina HiSeq	Phase_I	25	2	NM_182648	0	0	4	4	0	Q9NZ15|Q9P065|Q9UIG1|Q9Y3V3	Missense_Mutation	SNP	ENST00000382422.2	37	CCDS9651.1	.	.	.	.	.	.	.	.	.	.	T	16.07	3.019343	0.54576	.	.	ENSG00000198604	ENST00000358716;ENST00000382422;ENST00000360310	T;T;T	0.61158	0.13;0.13;0.13	5.13	3.89	0.44902	.	0.581293	0.17894	N	0.158411	T	0.43433	0.1247	L	0.47716	1.5	0.51482	D	0.999924	P;P	0.47910	0.902;0.651	B;B	0.33392	0.163;0.078	T	0.51236	-0.8731	10	0.59425	D	0.04	.	9.6276	0.39761	0.0:0.0:0.1753:0.8247	.	294;294	Q9NRL2-2;Q9NRL2	.;BAZ1A_HUMAN	T	294	ENSP00000351555:K294T;ENSP00000371859:K294T;ENSP00000353458:K294T	ENSP00000351555:K294T	K	-	2	0	BAZ1A	34340131	0.997000	0.39634	0.990000	0.47175	0.462000	0.32619	1.307000	0.33516	2.054000	0.61138	0.377000	0.23210	AAA	.		0.308	BAZ1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276646.1		
SERPINA10	51156	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	94756790	94756790	+	Silent	SNP	C	C	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr14:94756790C>T	ENST00000393096.1	-	2	606	c.141G>A	c.(139-141)gaG>gaA	p.E47E	SERPINA10_ENST00000554173.1_Silent_p.E47E|SERPINA10_ENST00000261994.4_Silent_p.E47E|SERPINA10_ENST00000554723.1_Silent_p.E87E	NM_016186.2	NP_057270.1	Q9UK55	ZPI_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10	47					blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)			haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	33		all_cancers(154;0.105)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)		CTTCCTCTTCCTCCTTGGGAG	0.622																																					p.E47E		.											.	SERPINA10-228	0			c.G141A						.						39.0	38.0	38.0					14																	94756790		2203	4300	6503	SO:0001819	synonymous_variant	51156	exon2			CTCTTCCTCCTTG	AF181467	CCDS9923.1	14q32.13	2014-02-18	2005-08-18		ENSG00000140093	ENSG00000140093		"""Serine (or cysteine) peptidase inhibitors"""	15996	protein-coding gene	gene with protein product		605271	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10"""			10460162, 9689066, 24172014	Standard	NM_016186		Approved	PZI, ZPI	uc001yct.3	Q9UK55	OTTHUMG00000171345	ENST00000393096.1:c.141G>A	14.37:g.94756790C>T		Somatic	54	0		WXS	Illumina HiSeq	Phase_I	33	13	NM_001100607	0	0	0	0	0	A5Z2A5|Q6UWX9|Q86U20	Silent	SNP	ENST00000393096.1	37	CCDS9923.1																																																																																			.		0.622	SERPINA10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413061.1	NM_016186	
MYO1E	4643	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	59515313	59515313	+	Silent	SNP	C	C	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr15:59515313C>G	ENST00000288235.4	-	9	1254	c.855G>C	c.(853-855)ctG>ctC	p.L285L	MYO1E_ENST00000558814.1_5'UTR	NM_004998.3	NP_004989.2	Q12965	MYO1E_HUMAN	myosin IE	285	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(6)|lung(10)|pancreas(2)|prostate(1)|urinary_tract(1)	33				all cancers(107;0.207)		TGATGTTTCCCAGGTGGAGAA	0.507																																					p.L285L													.	MYO1E-514	0			c.G855C						.						110.0	88.0	96.0					15																	59515313		2190	4290	6480	SO:0001819	synonymous_variant	4643	exon9			GTTTCCCAGGTGG	U14391	CCDS32254.1	15q21-q22	2011-09-27				ENSG00000157483		"""Myosins / Myosin superfamily : Class I"""	7599	protein-coding gene	gene with protein product	"""myosin-IC"""	601479				8884266	Standard	NM_004998		Approved	MYO1C, HuncM-IC, MGC104638	uc002aga.4	Q12965		ENST00000288235.4:c.855G>C	15.37:g.59515313C>G		Somatic	65	0		WXS	Illumina HiSeq	Phase_I	59	8	NM_004998	0	0	31	37	6	Q14778	Silent	SNP	ENST00000288235.4	37	CCDS32254.1																																																																																			.		0.507	MYO1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416024.1	NM_004998	
RORA	6095	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	60849084	60849084	+	Intron	SNP	T	T	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr15:60849084T>C	ENST00000335670.6	-	3	297				RP11-219B17.1_ENST00000559824.1_RNA|RORA_ENST00000261523.5_Missense_Mutation_p.E88G|RORA_ENST00000449337.2_Intron|RORA_ENST00000309157.4_Intron|RORA_ENST00000560004.1_Intron|RP11-219B17.1_ENST00000558235.1_RNA	NM_134261.2	NP_599023.1	P35398	RORA_HUMAN	RAR-related orphan receptor A						angiogenesis (GO:0001525)|cellular response to hypoxia (GO:0071456)|cellular response to sterol (GO:0036315)|cerebellar granule cell precursor proliferation (GO:0021930)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|circadian regulation of gene expression (GO:0032922)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|muscle cell differentiation (GO:0042692)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|nitric oxide biosynthetic process (GO:0006809)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of cholesterol homeostasis (GO:2000188)|regulation of glucose metabolic process (GO:0010906)|regulation of macrophage activation (GO:0043030)|regulation of smoothened signaling pathway (GO:0008589)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription involved in cell fate commitment (GO:0060850)|regulation of transcription, DNA-templated (GO:0006355)|T-helper 17 cell differentiation (GO:0072539)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	direct ligand regulated sequence-specific DNA binding transcription factor activity (GO:0098531)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|oxysterol binding (GO:0008142)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator binding (GO:0001223)|transcription corepressor binding (GO:0001222)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	21						TTCCTTATCTTCCTTTTGTGA	0.403																																					p.E88G		.											.	RORA-290	0			c.A263G						.						325.0	278.0	294.0					15																	60849084		2203	4300	6503	SO:0001627	intron_variant	6095	exon3			TTATCTTCCTTTT	U04897	CCDS10177.1, CCDS10178.1, CCDS10179.1, CCDS45271.1	15q21-q22	2013-01-16			ENSG00000069667	ENSG00000069667		"""Nuclear hormone receptors"""	10258	protein-coding gene	gene with protein product		600825				7926749	Standard	NM_134261		Approved	RZRA, ROR1, ROR2, ROR3, NR1F1	uc002agv.3	P35398	OTTHUMG00000132769	ENST00000335670.6:c.197-25034A>G	15.37:g.60849084T>C		Somatic	129	0		WXS	Illumina HiSeq	Phase_I	169	83	NM_134260	0	0	0	0	0	P35397|P35399|P45445|Q495X4|Q96H83	Missense_Mutation	SNP	ENST00000335670.6	37	CCDS10177.1	.	.	.	.	.	.	.	.	.	.	T	11.19	1.566201	0.27915	.	.	ENSG00000069667	ENST00000261523	D	0.94457	-3.43	4.3	3.17	0.36434	.	2.259680	0.02344	N	0.075239	D	0.87815	0.6272	N	0.08118	0	0.09310	N	1	B	0.13594	0.008	B	0.14578	0.011	T	0.77749	-0.2471	10	0.22706	T	0.39	.	7.854	0.29472	0.0:0.0:0.2396:0.7604	.	88	P35398	RORA_HUMAN	G	88	ENSP00000261523:E88G	ENSP00000261523:E88G	E	-	2	0	RORA	58636376	0.028000	0.19301	0.012000	0.15200	0.033000	0.12548	0.610000	0.24253	0.985000	0.38656	0.533000	0.62120	GAA	.		0.403	RORA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256142.2		
DENND4A	10260	hgsc.bcm.edu	37	15	66010115	66010115	+	Splice_Site	SNP	C	C	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr15:66010115C>G	ENST00000431932.2	-	13	2016		c.e13+1		DENND4A_ENST00000443035.3_Splice_Site|MIR4511_ENST00000582784.1_RNA	NM_005848.3	NP_005839.3	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A						positive regulation of Rab GTPase activity (GO:0032851)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(11)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	51						CAGTCACTCACCTTGTAGGGC	0.383																																					.		.											.	DENND4A-229	0			c.1807+1G>C						.						53.0	54.0	53.0					15																	66010115		1852	4108	5960	SO:0001630	splice_region_variant	10260	exon14			CACTCACCTTGTA	AF534403	CCDS45285.1, CCDS53949.1	15q22.31	2012-10-03	2006-01-27	2006-01-27				"""DENN/MADD domain containing"""	24321	protein-coding gene	gene with protein product		600382	"""c-myc promoter binding protein"""	MYCPBP		8056341, 12906859	Standard	NM_005848		Approved	IRLB	uc002api.3	Q7Z401		ENST00000431932.2:c.1807+1G>C	15.37:g.66010115C>G		Somatic	14	0		WXS	Illumina HiSeq	Phase_I	21	2	NM_001144823	0	0	0	0	0	E7EPL3|Q14655|Q86T77|Q8IVX2|Q8NB93	Splice_Site	SNP	ENST00000431932.2	37	CCDS45285.1	.	.	.	.	.	.	.	.	.	.	C	19.13	3.768120	0.69878	.	.	ENSG00000174485	ENST00000443035;ENST00000431932	.	.	.	5.32	5.32	0.75619	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0056	0.92849	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DENND4A	63797169	1.000000	0.71417	1.000000	0.80357	0.567000	0.35839	7.814000	0.86154	2.464000	0.83262	0.467000	0.42956	.	.		0.383	DENND4A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419611.1	NM_005848	Intron
C15orf39	56905	bcgsc.ca	37	15	75499127	75499127	+	Silent	SNP	C	C	A			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr15:75499127C>A	ENST00000360639.2	+	2	1058	c.738C>A	c.(736-738)ccC>ccA	p.P246P	C15orf39_ENST00000394987.4_Silent_p.P246P|C15orf39_ENST00000567617.1_Silent_p.P246P			Q6ZRI6	CO039_HUMAN	chromosome 15 open reading frame 39	246						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(2)|endometrium(3)|large_intestine(4)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	16						CTGAGGGGCCCTCAAGTCCTT	0.637																																					p.P246P													.	C15orf39-90	0			c.C738A						.						41.0	45.0	43.0					15																	75499127		2197	4295	6492	SO:0001819	synonymous_variant	56905	exon2			GGGGCCCTCAAGT	AK128205	CCDS10276.1	15q23	2013-03-14	2005-10-24		ENSG00000167173	ENSG00000167173			24497	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 38~Name Same As HGNC:28782"""				Standard	NM_015492		Approved	DKFZP434H132, FLJ46337	uc002azq.4	Q6ZRI6	OTTHUMG00000142820	ENST00000360639.2:c.738C>A	15.37:g.75499127C>A		Somatic	83	0		WXS	Illumina HiSeq	Phase_1	67	4	NM_015492	0	0	2	2	0	B3KWI3|C9J888|Q71JB1|Q7L3S0|Q8N3F2|Q96FB6|Q9NTU5	Silent	SNP	ENST00000360639.2	37	CCDS10276.1																																																																																			.		0.637	C15orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286410.1	NM_015492	
GFER	2671	hgsc.bcm.edu	37	16	2034408	2034408	+	Missense_Mutation	SNP	G	G	C	rs375792737	byFrequency	TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr16:2034408G>C	ENST00000248114.6	+	1	195	c.189G>C	c.(187-189)gaG>gaC	p.E63D	GFER_ENST00000567719.1_5'Flank|GFER_ENST00000569451.1_Missense_Mutation_p.E63D|NOXO1_ENST00000354249.4_5'Flank|NOXO1_ENST00000356120.4_5'Flank|AC005606.14_ENST00000564438.1_lincRNA	NM_005262.2	NP_005253.3	P55789	ALR_HUMAN	growth factor, augmenter of liver regeneration	63					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|protein disulfide oxidoreductase activity (GO:0015035)|thiol oxidase activity (GO:0016972)			endometrium(1)|large_intestine(1)|lung(3)	5					Flavin adenine dinucleotide(DB03147)	CTGTCGCCGAGGACGCCTCCC	0.746													g|||	3	0.000599042	0.0	0.0014	5008	,	,		7495	0.0		0.002	False		,,,				2504	0.0				p.E63D		.											.	GFER-90	0			c.G189C						.		ASP/GLU	1,2865		0,1,1432	2.0	2.0	2.0		189	2.9	0.0	16		2	2,6508		0,2,3253	no	missense	GFER	NM_005262.2	45	0,3,4685	CC,CG,GG		0.0307,0.0349,0.032	benign	63/206	2034408	3,9373	1433	3255	4688	SO:0001583	missense	2671	exon1			CGCCGAGGACGCC	BC002429	CCDS32368.1	16p13.3-p13.12	2011-06-22	2008-08-01		ENSG00000127554	ENSG00000127554			4236	protein-coding gene	gene with protein product	"""ERV1 homolog (S. cerevisiae)"""	600924	"""growth factor, erv1 (S. cerevisiae)-like (augmenter of liver regeneration)"""			8575761	Standard	NM_005262		Approved	HSS, ERV1, ALR, HERV1, HPO1, HPO2	uc002cob.3	P55789		ENST00000248114.6:c.189G>C	16.37:g.2034408G>C	ENSP00000248114:p.Glu63Asp	Somatic	4	1		WXS	Illumina HiSeq	Phase_I	9	7	NM_005262	0	0	2	10	8	Q53YM6|Q8TAH6|Q9H290|Q9UK40	Missense_Mutation	SNP	ENST00000248114.6	37	CCDS32368.1	.	.	.	.	.	.	.	.	.	.	g	9.647	1.140479	0.21205	3.49E-4	3.07E-4	ENSG00000127554	ENST00000248114	T	0.64085	-0.08	3.85	2.87	0.33458	.	.	.	.	.	T	0.43567	0.1253	N	0.22421	0.69	0.24325	N	0.995023	B	0.24186	0.099	B	0.19946	0.027	T	0.20140	-1.0284	9	0.12430	T	0.62	.	10.074	0.42349	0.0:0.0:0.7985:0.2015	.	63	P55789	ALR_HUMAN	D	63	ENSP00000248114:E63D	ENSP00000248114:E63D	E	+	3	2	GFER	1974409	0.000000	0.05858	0.002000	0.10522	0.164000	0.22412	-0.657000	0.05335	0.791000	0.33826	0.493000	0.49557	GAG	.		0.746	GFER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434243.1	NM_005262	
GFER	2671	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	2035934	2035934	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr16:2035934A>C	ENST00000248114.6	+	3	529	c.523A>C	c.(523-525)Aat>Cat	p.N175H	GFER_ENST00000567719.1_Missense_Mutation_p.N100H|GFER_ENST00000569451.1_Missense_Mutation_p.Q109P|AC005606.14_ENST00000564438.1_lincRNA	NM_005262.2	NP_005253.3	P55789	ALR_HUMAN	growth factor, augmenter of liver regeneration	175	ERV/ALR sulfhydryl oxidase. {ECO:0000255|PROSITE-ProRule:PRU00654}.				cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|protein disulfide oxidoreductase activity (GO:0015035)|thiol oxidase activity (GO:0016972)			endometrium(1)|large_intestine(1)|lung(3)	5					Flavin adenine dinucleotide(DB03147)	CCACCTGCACAATGAAGTGAA	0.587																																					p.N175H		.											.	GFER-90	0			c.A523C						.						95.0	91.0	92.0					16																	2035934		2198	4299	6497	SO:0001583	missense	2671	exon3			CTGCACAATGAAG	BC002429	CCDS32368.1	16p13.3-p13.12	2011-06-22	2008-08-01		ENSG00000127554	ENSG00000127554			4236	protein-coding gene	gene with protein product	"""ERV1 homolog (S. cerevisiae)"""	600924	"""growth factor, erv1 (S. cerevisiae)-like (augmenter of liver regeneration)"""			8575761	Standard	NM_005262		Approved	HSS, ERV1, ALR, HERV1, HPO1, HPO2	uc002cob.3	P55789		ENST00000248114.6:c.523A>C	16.37:g.2035934A>C	ENSP00000248114:p.Asn175His	Somatic	185	0		WXS	Illumina HiSeq	Phase_I	201	121	NM_005262	0	0	13	47	34	Q53YM6|Q8TAH6|Q9H290|Q9UK40	Missense_Mutation	SNP	ENST00000248114.6	37	CCDS32368.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	19.71|19.71	3.878702|3.878702	0.72294|0.72294	.|.	.|.	ENSG00000127554|ENSG00000127554	ENST00000248114|ENST00000425414	T|.	0.79454|.	-1.27|.	4.43|4.43	4.43|4.43	0.53597|0.53597	Erv1/Alr (3);ERV/ALR sulphydryl oxidase (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.87799|0.87799	0.6268|0.6268	H|H	0.97852|0.97852	4.09|4.09	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	D|D	0.91675|0.91675	0.5353|0.5353	10|6	0.87932|0.72032	D|D	0|0.01	-22.5825|-22.5825	13.1409|13.1409	0.59434|0.59434	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	101;175|.	Q9UQK8;P55789|.	.;ALR_HUMAN|.	H|P	175|94	ENSP00000248114:N175H|.	ENSP00000248114:N175H|ENSP00000396950:Q94P	N|Q	+|+	1|2	0|0	GFER|GFER	1975935|1975935	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.444000|0.444000	0.32077|0.32077	6.743000|6.743000	0.74848|0.74848	1.763000|1.763000	0.52060|0.52060	0.418000|0.418000	0.28097|0.28097	AAT|CAA	.		0.587	GFER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434243.1	NM_005262	
GFER	2671	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	2035967	2035967	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr16:2035967T>A	ENST00000248114.6	+	3	562	c.556T>A	c.(556-558)Ttc>Atc	p.F186I	GFER_ENST00000567719.1_Missense_Mutation_p.F111I|GFER_ENST00000569451.1_3'UTR|AC005606.14_ENST00000564438.1_lincRNA	NM_005262.2	NP_005253.3	P55789	ALR_HUMAN	growth factor, augmenter of liver regeneration	186	ERV/ALR sulfhydryl oxidase. {ECO:0000255|PROSITE-ProRule:PRU00654}.				cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|protein disulfide oxidoreductase activity (GO:0015035)|thiol oxidase activity (GO:0016972)			endometrium(1)|large_intestine(1)|lung(3)	5					Flavin adenine dinucleotide(DB03147)	CAAGCCTGACTTCGACTGCTC	0.612																																					p.F186I		.											.	GFER-90	0			c.T556A						.						93.0	87.0	89.0					16																	2035967		2198	4300	6498	SO:0001583	missense	2671	exon3			CCTGACTTCGACT	BC002429	CCDS32368.1	16p13.3-p13.12	2011-06-22	2008-08-01		ENSG00000127554	ENSG00000127554			4236	protein-coding gene	gene with protein product	"""ERV1 homolog (S. cerevisiae)"""	600924	"""growth factor, erv1 (S. cerevisiae)-like (augmenter of liver regeneration)"""			8575761	Standard	NM_005262		Approved	HSS, ERV1, ALR, HERV1, HPO1, HPO2	uc002cob.3	P55789		ENST00000248114.6:c.556T>A	16.37:g.2035967T>A	ENSP00000248114:p.Phe186Ile	Somatic	182	1		WXS	Illumina HiSeq	Phase_I	171	101	NM_005262	0	0	13	57	44	Q53YM6|Q8TAH6|Q9H290|Q9UK40	Missense_Mutation	SNP	ENST00000248114.6	37	CCDS32368.1	.	.	.	.	.	.	.	.	.	.	t	33	5.218249	0.95104	.	.	ENSG00000127554	ENST00000248114	T	0.64803	-0.12	4.43	4.43	0.53597	Erv1/Alr (3);ERV/ALR sulphydryl oxidase (1);	0.000000	0.85682	D	0.000000	D	0.84951	0.5586	H	0.97077	3.935	0.80722	D	1	D;D	0.89917	0.985;1.0	D;D	0.81914	0.982;0.995	D	0.89667	0.3881	10	0.87932	D	0	-13.6696	13.1409	0.59434	0.0:0.0:0.0:1.0	.	112;186	Q9UQK8;P55789	.;ALR_HUMAN	I	186	ENSP00000248114:F186I	ENSP00000248114:F186I	F	+	1	0	GFER	1975968	1.000000	0.71417	0.993000	0.49108	0.876000	0.50452	7.301000	0.78850	1.763000	0.52060	0.418000	0.28097	TTC	.		0.612	GFER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434243.1	NM_005262	
BFAR	51283	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	14755823	14755823	+	Silent	SNP	G	G	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr16:14755823G>T	ENST00000261658.2	+	6	1135	c.858G>T	c.(856-858)ctG>ctT	p.L286L	BFAR_ENST00000563971.1_Silent_p.L161L|BFAR_ENST00000426842.2_Silent_p.L158L	NM_016561.2	NP_057645.1	Q9NZS9	BFAR_HUMAN	bifunctional apoptosis regulator	286					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	structural molecule activity (GO:0005198)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)	11						TGCTCTACCTGTACCTGTTTG	0.567																																					p.L286L		.											.	BFAR-92	0			c.G858T						.						237.0	201.0	213.0					16																	14755823		2197	4300	6497	SO:0001819	synonymous_variant	51283	exon6			CTACCTGTACCTG	AF173003	CCDS10554.1	16p13.2	2013-01-10			ENSG00000103429	ENSG00000103429		"""RING-type (C3HC4) zinc fingers"", ""Sterile alpha motif (SAM) domain containing"""	17613	protein-coding gene	gene with protein product						10716992	Standard	NM_016561		Approved	BAR, RNF47	uc002dco.3	Q9NZS9	OTTHUMG00000129848	ENST00000261658.2:c.858G>T	16.37:g.14755823G>T		Somatic	211	0		WXS	Illumina HiSeq	Phase_I	280	161	NM_016561	0	0	15	50	35	A8K4Z9|B4DUT0|D3DUG8	Silent	SNP	ENST00000261658.2	37	CCDS10554.1																																																																																			.		0.567	BFAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252088.1	NM_016561	
XYLT1	64131	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	17202725	17202725	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr16:17202725C>A	ENST00000261381.6	-	12	2791	c.2707G>T	c.(2707-2709)Gag>Tag	p.E903*		NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	903					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)	p.E903Q(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						AGCCATCCCTCCAGCGCTGTG	0.667																																					p.E903X		.											.	XYLT1-94	2	Substitution - Missense(2)	lung(2)	c.G2707T						.						71.0	63.0	66.0					16																	17202725		2197	4300	6497	SO:0001587	stop_gained	64131	exon12			ATCCCTCCAGCGC	AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.2707G>T	16.37:g.17202725C>A	ENSP00000261381:p.Glu903*	Somatic	98	0		WXS	Illumina HiSeq	Phase_I	125	9	NM_022166	0	0	9	9	0	Q9H1B6	Nonsense_Mutation	SNP	ENST00000261381.6	37	CCDS10569.1	.	.	.	.	.	.	.	.	.	.	C	40	8.341779	0.98769	.	.	ENSG00000103489	ENST00000261381	.	.	.	5.7	5.7	0.88788	.	0.042979	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-47.0445	18.8196	0.92090	0.0:1.0:0.0:0.0	.	.	.	.	X	903	.	ENSP00000261381:E903X	E	-	1	0	XYLT1	17110226	1.000000	0.71417	0.995000	0.50966	0.811000	0.45836	5.784000	0.68990	2.675000	0.91044	0.655000	0.94253	GAG	.		0.667	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	NM_022166	
SLC12A4	6560	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	67982000	67982000	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr16:67982000G>A	ENST00000316341.3	-	14	1951	c.1811C>T	c.(1810-1812)aCc>aTc	p.T604I	SLC12A4_ENST00000541864.2_Missense_Mutation_p.T573I|SLC12A4_ENST00000537830.2_Missense_Mutation_p.T598I|SLC12A4_ENST00000338335.3_Missense_Mutation_p.T604I|SLC12A4_ENST00000422611.2_Missense_Mutation_p.T606I|SLC12A4_ENST00000572037.1_Missense_Mutation_p.T556I|SLC12A4_ENST00000576616.1_Missense_Mutation_p.T604I	NM_001145961.1|NM_005072.4	NP_001139433.1|NP_005063.1	Q9UP95	S12A4_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 4	604					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|prostate(4)|skin(2)|urinary_tract(3)	29		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	CCAGTTGGGGGTCCTCAGGAG	0.617																																					p.T606I		.											.	SLC12A4-91	0			c.C1817T						.						86.0	87.0	87.0					16																	67982000		2198	4300	6498	SO:0001583	missense	6560	exon13			TTGGGGGTCCTCA		CCDS10855.1, CCDS54030.1, CCDS54031.1, CCDS54032.1	16q22.1	2013-07-18	2013-07-18		ENSG00000124067	ENSG00000124067		"""Solute carriers"""	10913	protein-coding gene	gene with protein product		604119				8663127	Standard	NM_005072		Approved	KCC1	uc010ceu.2	Q9UP95	OTTHUMG00000137535	ENST00000316341.3:c.1811C>T	16.37:g.67982000G>A	ENSP00000318557:p.Thr604Ile	Somatic	244	0		WXS	Illumina HiSeq	Phase_I	263	64	NM_001145962	0	0	31	53	22	B4DF69|B4DR04|B4DZ82|B7ZAV0|F5H066|F5H0S9|F5H3C0|O60632|O75893|Q13953|Q96LD5	Missense_Mutation	SNP	ENST00000316341.3	37	CCDS10855.1	.	.	.	.	.	.	.	.	.	.	G	35	5.548568	0.96488	.	.	ENSG00000124067	ENST00000422611;ENST00000541864;ENST00000537830;ENST00000338335;ENST00000316341	D;D;D;D;D	0.98531	-4.98;-4.98;-4.98;-4.98;-4.98	5.82	5.82	0.92795	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.98957	0.9645	M	0.79805	2.47	0.80722	D	1	B;P;D;P;P;P	0.69078	0.338;0.917;0.997;0.511;0.511;0.76	B;P;D;B;B;P	0.71184	0.373;0.783;0.972;0.373;0.281;0.507	D	0.99808	1.1039	10	0.87932	D	0	.	20.0953	0.97838	0.0:0.0:1.0:0.0	.	606;604;573;598;604;604	F5H3C0;B4DF30;F5H066;F5H0S9;Q9UP95-2;Q9UP95	.;.;.;.;.;S12A4_HUMAN	I	606;573;598;604;604	ENSP00000395983:T606I;ENSP00000438334:T573I;ENSP00000445962:T598I;ENSP00000343374:T604I;ENSP00000318557:T604I	ENSP00000318557:T604I	T	-	2	0	SLC12A4	66539501	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.807000	0.99171	2.767000	0.95098	0.655000	0.94253	ACC	.		0.617	SLC12A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268864.4	NM_005072	
CNTNAP4	85445	bcgsc.ca	37	16	76389341	76389341	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr16:76389341G>C	ENST00000476707.1	+	2	471	c.332G>C	c.(331-333)aGc>aCc	p.S111T	CNTNAP4_ENST00000478060.1_Missense_Mutation_p.S83T|CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000377504.4_Missense_Mutation_p.S107T|CNTNAP4_ENST00000307431.8_Missense_Mutation_p.S107T			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	108	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)				breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						TGGGTGACCAGCTACCTCCTG	0.488																																					p.S83T													.	CNTNAP4-70	0			c.G248C						.						99.0	89.0	92.0					16																	76389341		2198	4300	6498	SO:0001583	missense	85445	exon3			TGACCAGCTACCT	AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.332G>C	16.37:g.76389341G>C	ENSP00000417628:p.Ser111Thr	Somatic	88	0		WXS	Illumina HiSeq	Phase_1	153	5	NM_138994	0	0	0	0	0	E9PFZ6|Q86YZ7	Missense_Mutation	SNP	ENST00000476707.1	37		.	.	.	.	.	.	.	.	.	.	G	20.6	4.022868	0.75275	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	D;D;D;D	0.98264	-4.83;-4.83;-4.83;-4.83	4.8	4.8	0.61643	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.137286	0.33438	N	0.004903	D	0.98807	0.9598	.	.	.	0.36845	D	0.8876	D;D;P;D	0.76494	0.992;0.999;0.949;0.99	D;D;P;D	0.75484	0.959;0.986;0.883;0.969	D	0.99953	1.1571	9	0.59425	D	0.04	.	15.7228	0.77728	0.0:0.0:1.0:0.0	.	83;111;83;108	E9PFZ6;E9PDN6;Q96M80;Q9C0A0	.;.;.;CNTP4_HUMAN	T	107;107;83;111	ENSP00000306893:S107T;ENSP00000439733:S107T;ENSP00000418741:S83T;ENSP00000417628:S111T	ENSP00000306893:S107T	S	+	2	0	CNTNAP4	74946842	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.268000	0.58883	2.655000	0.90218	0.591000	0.81541	AGC	.		0.488	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1	NM_033401	
CLUH	23277	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	2595388	2595388	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr17:2595388G>T	ENST00000570628.2	-	23	3552	c.3447C>A	c.(3445-3447)caC>caA	p.H1149Q	CLUH_ENST00000435359.1_Missense_Mutation_p.H1149Q|CLUH_ENST00000538975.1_Missense_Mutation_p.H1149Q			O75153	CLU_HUMAN	clustered mitochondria (cluA/CLU1) homolog	1149					intracellular distribution of mitochondria (GO:0048312)	cytoplasm (GO:0005737)											CGACAAGGTGGTGGCTGCCGG	0.687																																					p.H1149Q		.											.	.	0			c.C3447A						.						9.0	10.0	10.0					17																	2595388		1998	4151	6149	SO:0001583	missense	23277	exon23			AAGGTGGTGGCTG	AB014564	CCDS45572.1	17p13.3	2012-12-18	2012-11-30	2012-11-30	ENSG00000132361	ENSG00000132361			29094	protein-coding gene	gene with protein product			"""KIAA0664"""	KIAA0664			Standard	XM_005256567		Approved	CLU1	uc002fuy.1	O75153	OTTHUMG00000177575	ENST00000570628.2:c.3447C>A	17.37:g.2595388G>T	ENSP00000458986:p.His1149Gln	Somatic	19	0		WXS	Illumina HiSeq	Phase_I	13	9	NM_015229	0	0	0	0	0	Q6AHY2|Q6P3X7|Q6ZUG8|Q8N4U7|Q9BTA3|Q9H979	Missense_Mutation	SNP	ENST00000570628.2	37	CCDS45572.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.989729	0.74589	.	.	ENSG00000132361	ENST00000435359;ENST00000322335;ENST00000538975	D;D	0.93953	-3.32;-3.32	4.81	4.81	0.61882	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	D	0.94961	0.8370	L	0.49350	1.555	0.58432	D	0.999994	P;D	0.61697	0.629;0.99	P;D	0.66351	0.542;0.943	D	0.95039	0.8176	10	0.59425	D	0.04	.	15.1886	0.73025	0.0:0.0:1.0:0.0	.	1149;1150	O75153;C9J6D7	K0664_HUMAN;.	Q	1149;1150;1149	ENSP00000388872:H1149Q;ENSP00000439628:H1149Q	ENSP00000320468:H1150Q	H	-	3	2	KIAA0664	2542138	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	3.158000	0.50723	2.494000	0.84150	0.549000	0.68633	CAC	.		0.687	CLUH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437807.2	NM_015229	
NDEL1	81565	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	8350137	8350137	+	Silent	SNP	T	T	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr17:8350137T>C	ENST00000334527.7	+	4	503	c.306T>C	c.(304-306)agT>agC	p.S102S	NDEL1_ENST00000585098.1_Intron|NDEL1_ENST00000299734.7_Silent_p.S102S|NDEL1_ENST00000380025.4_Silent_p.S102S|NDEL1_ENST00000402554.3_Silent_p.S102S	NM_030808.4	NP_110435.1	Q9GZM8	NDEL1_HUMAN	nudE neurodevelopment protein 1-like 1	102	Interaction with KATNB1. {ECO:0000250}.|Self-association. {ECO:0000250}.				activation of Cdc42 GTPase activity (GO:0032864)|central nervous system neuron axonogenesis (GO:0021955)|centrosome localization (GO:0051642)|cerebral cortex radially oriented cell migration (GO:0021799)|chromosome segregation (GO:0007059)|inner cell mass cell proliferation (GO:0001833)|mitotic cell cycle (GO:0000278)|mitotic centrosome separation (GO:0007100)|neurofilament cytoskeleton organization (GO:0060052)|neuron migration (GO:0001764)|neuron projection extension (GO:1990138)|nuclear envelope disassembly (GO:0051081)|positive regulation of axon extension (GO:0045773)|positive regulation of axon regeneration (GO:0048680)|retrograde axon cargo transport (GO:0008090)|vesicle transport along microtubule (GO:0047496)	axon hillock (GO:0043203)|cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|neurofilament cytoskeleton (GO:0060053)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)	oligopeptidase activity (GO:0070012)			large_intestine(6)|lung(4)|skin(3)	13						ATGATTTAAGTCAGACTCGGG	0.463																																					p.S102S		.											.	NDEL1-90	0			c.T306C						.						114.0	104.0	107.0					17																	8350137		2203	4300	6503	SO:0001819	synonymous_variant	81565	exon4			TTTAAGTCAGACT	AF182078	CCDS11143.1, CCDS32564.1	17p13.1	2013-08-06	2013-08-06	2003-04-16	ENSG00000166579	ENSG00000166579			17620	protein-coding gene	gene with protein product		607538	"""nudE nuclear distribution gene E homolog (A. nidulans)-like 1"", ""nudE nuclear distribution E homolog (A. nidulans)-like 1"""			11163260, 11163259	Standard	NM_001025579		Approved	NUDEL, MITAP1, NDE1L1, NDE2	uc002glj.4	Q9GZM8	OTTHUMG00000108193	ENST00000334527.7:c.306T>C	17.37:g.8350137T>C		Somatic	64	0		WXS	Illumina HiSeq	Phase_I	115	60	NM_001025579	0	0	1	9	8	B3KP93|D3DTS0|J3QT32|Q86T80|Q8TAR7|Q9UH50	Silent	SNP	ENST00000334527.7	37	CCDS11143.1																																																																																			.		0.463	NDEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226999.2	NM_030808	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000519970.1_Intron|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.	0			c.G152A						.						274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	201158	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr	Somatic	216	34		WXS	Illumina HiSeq		443	56	NM_145301	0	0	3	38	35	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT	.		0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
SLFN12	55106	bcgsc.ca	37	17	33749975	33749975	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr17:33749975C>A	ENST00000394562.1	-	4	596	c.73G>T	c.(73-75)Gag>Tag	p.E25*	SLFN12_ENST00000452764.3_Nonsense_Mutation_p.E25*|SLFN12_ENST00000460530.1_5'Flank|SLFN12_ENST00000304905.5_Nonsense_Mutation_p.E25*			Q8IYM2	SLN12_HUMAN	schlafen family member 12	25							ATP binding (GO:0005524)			breast(1)|kidney(2)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	18		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CTACTGTTCTCTCCAAGAGTG	0.433																																					p.E25X													.	SLFN12-91	0			c.G73T						.						144.0	133.0	137.0					17																	33749975		2203	4300	6503	SO:0001587	stop_gained	55106	exon2			TGTTCTCTCCAAG	AK001122	CCDS11295.1	17q12	2006-04-05			ENSG00000172123	ENSG00000172123			25500	protein-coding gene	gene with protein product		614955				12477932	Standard	NM_018042		Approved	FLJ10260	uc002hji.4	Q8IYM2	OTTHUMG00000132952	ENST00000394562.1:c.73G>T	17.37:g.33749975C>A	ENSP00000378063:p.Glu25*	Somatic	156	0		WXS	Illumina HiSeq	Phase_1	236	7	NM_018042	0	0	3	3	0	A8K711|Q9NP47	Nonsense_Mutation	SNP	ENST00000394562.1	37	CCDS11295.1	.	.	.	.	.	.	.	.	.	.	c	25.5	4.647477	0.87958	.	.	ENSG00000172123	ENST00000394562;ENST00000304905;ENST00000452764;ENST00000447040;ENST00000445092	.	.	.	3.2	1.06	0.20224	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	5.4878	0.16759	0.0:0.7164:0.0:0.2836	.	.	.	.	X	25	.	ENSP00000302077:E25X	E	-	1	0	SLFN12	30774088	0.000000	0.05858	0.007000	0.13788	0.332000	0.28634	0.103000	0.15292	0.163000	0.19507	0.436000	0.28706	GAG	.		0.433	SLFN12-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256491.1	NM_018042	
IGFBP4	3487	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	38612795	38612795	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr17:38612795A>G	ENST00000269593.4	+	4	1012	c.737A>G	c.(736-738)gAg>gGg	p.E246G	IGFBP4_ENST00000542955.1_Missense_Mutation_p.E146G	NM_001552.2	NP_001543.2	P22692	IBP4_HUMAN	insulin-like growth factor binding protein 4	246	Thyroglobulin type-1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|DNA metabolic process (GO:0006259)|inflammatory response (GO:0006954)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of MAPK cascade (GO:0043410)|regulation of cell growth (GO:0001558)|regulation of glucose metabolic process (GO:0010906)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|endometrium(1)|kidney(1)|large_intestine(2)	5		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			CCAAAGGGGGAGCTGGACTGC	0.657																																					p.E246G	GBM(160;940 3581 26177)	.											.	IGFBP4-522	0			c.A737G						.						37.0	41.0	40.0					17																	38612795		2202	4300	6502	SO:0001583	missense	3487	exon4			AGGGGGAGCTGGA	M38177	CCDS11367.1	17q21.2	2014-09-16	2001-11-28		ENSG00000141753	ENSG00000141753			5473	protein-coding gene	gene with protein product	"""IGF-binding protein 4"""	146733	"""insulin-like growth factor-binding protein 4"""			1707125, 1704481	Standard	NM_001552		Approved	IBP4, BP-4, HT29-IGFBP, IGFBP-4	uc002hus.3	P22692	OTTHUMG00000133326	ENST00000269593.4:c.737A>G	17.37:g.38612795A>G	ENSP00000269593:p.Glu246Gly	Somatic	116	1		WXS	Illumina HiSeq	Phase_I	108	24	NM_001552	1	0	187	257	69	A0N9W2|B4E351|Q5U012|Q9UCL6	Missense_Mutation	SNP	ENST00000269593.4	37	CCDS11367.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.158984	0.78226	.	.	ENSG00000141753	ENST00000542955;ENST00000269593	T;T	0.65549	-0.16;-0.16	5.29	5.29	0.74685	Thyroglobulin type-1 (5);	0.117947	0.56097	D	0.000022	T	0.63022	0.2476	L	0.49350	1.555	0.43417	D	0.995564	P	0.43231	0.801	P	0.46510	0.519	T	0.65833	-0.6072	10	0.54805	T	0.06	-21.3132	12.7751	0.57443	1.0:0.0:0.0:0.0	.	246	P22692	IBP4_HUMAN	G	146;246	ENSP00000437734:E146G;ENSP00000269593:E246G	ENSP00000269593:E246G	E	+	2	0	IGFBP4	35866321	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.850000	0.86915	1.991000	0.58162	0.533000	0.62120	GAG	.		0.657	IGFBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257134.1	NM_001552	
ACLY	47	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	40025023	40025023	+	Silent	SNP	T	T	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr17:40025023T>C	ENST00000352035.2	-	28	3280	c.3150A>G	c.(3148-3150)gaA>gaG	p.E1050E	ACLY_ENST00000588779.1_5'UTR|ACLY_ENST00000590151.1_Silent_p.E1050E|ACLY_ENST00000353196.1_Silent_p.E1040E|ACLY_ENST00000537919.1_Silent_p.E779E|ACLY_ENST00000393896.2_Silent_p.E1040E	NM_001096.2	NP_001087.2	P53396	ACLY_HUMAN	ATP citrate lyase	1050					ATP catabolic process (GO:0006200)|cellular carbohydrate metabolic process (GO:0044262)|cellular lipid metabolic process (GO:0044255)|citrate metabolic process (GO:0006101)|coenzyme A metabolic process (GO:0015936)|energy reserve metabolic process (GO:0006112)|lipid biosynthetic process (GO:0008610)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	citrate lyase complex (GO:0009346)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP citrate synthase activity (GO:0003878)|cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)		NTN1/ACLY(2)	breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	28		Breast(137;0.000143)				TGTCAATATATTCATCAGCTT	0.438																																					p.E1050E	Colon(64;807 1396 15971 30971)	.											.	ACLY-228	0			c.A3150G						.						157.0	139.0	145.0					17																	40025023		2203	4300	6503	SO:0001819	synonymous_variant	47	exon28			AATATATTCATCA	X64330	CCDS11412.1, CCDS11413.1	17q21.2	2010-04-27			ENSG00000131473	ENSG00000131473	2.3.3.8		115	protein-coding gene	gene with protein product	"""ATP citrate synthase"""	108728				1371749, 8088842	Standard	NM_001096		Approved	ATPCL, CLATP, ACL	uc002hyg.3	P53396	OTTHUMG00000133507	ENST00000352035.2:c.3150A>G	17.37:g.40025023T>C		Somatic	110	0		WXS	Illumina HiSeq	Phase_I	180	46	NM_001096	0	0	103	148	45	B4DIM0|B4E3P0|Q13037|Q9BRL0	Silent	SNP	ENST00000352035.2	37	CCDS11412.1																																																																																			.		0.438	ACLY-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257465.1	NM_001096	
NACA2	342538	ucsc.edu	37	17	59668191	59668191	+	Silent	SNP	C	C	T	rs373217743		TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr17:59668191C>T	ENST00000521764.1	-	1	372	c.351G>A	c.(349-351)tcG>tcA	p.S117S		NM_199290.3	NP_954984.1	Q9H009	NACA2_HUMAN	nascent polypeptide-associated complex alpha subunit 2	117	NAC-A/B. {ECO:0000255|PROSITE- ProRule:PRU00507}.				myoblast migration (GO:0051451)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	12	all_epithelial(1;3.12e-14)					TGTAGGCATCCGAAGCAGGGC	0.443																																					p.S117S													.	NACA2-91	0			c.G351A						.						168.0	168.0	168.0					17																	59668191		2203	4300	6503	SO:0001819	synonymous_variant	342538	exon1			GGCATCCGAAGCA	BC062710	CCDS11630.1	17q23.3	2014-01-28	2007-04-20	2007-04-20		ENSG00000253506			23290	protein-coding gene	gene with protein product	"""alpha-NAC protein"""	609274	"""nascent-polypeptide-associated complex alpha polypeptide-like"""	NACAL		12406326	Standard	NM_199290		Approved	MGC71999	uc002izj.2	Q9H009		ENST00000521764.1:c.351G>A	17.37:g.59668191C>T		Somatic	209	1		WXS	Illumina HiSeq		378	1	NM_199290	0	0	0	0	0	Q2VIR9	Silent	SNP	ENST00000521764.1	37	CCDS11630.1																																																																																			.		0.443	NACA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255437.2	NM_199290	
CSNK1D	1453	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	80202675	80202675	+	Silent	SNP	C	C	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr17:80202675C>T	ENST00000314028.6	-	9	1579	c.1230G>A	c.(1228-1230)caG>caA	p.Q410Q	CSNK1D_ENST00000392334.2_3'UTR|CSNK1D_ENST00000398519.5_Intron	NM_001893.4	NP_001884.2	P48730	KC1D_HUMAN	casein kinase 1, delta	410					circadian regulation of gene expression (GO:0032922)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|signal transduction (GO:0007165)|spindle assembly (GO:0051225)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle (GO:0005819)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|peptide binding (GO:0042277)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			breast(2)|large_intestine(2)|lung(7)	11	Breast(20;0.00136)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.227)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0155)			GCACGACAGACTGAAGACCAC	0.557											OREG0024822	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q410Q		.											.	CSNK1D-909	0			c.G1230A						.						115.0	85.0	95.0					17																	80202675		2203	4300	6503	SO:0001819	synonymous_variant	1453	exon9			GACAGACTGAAGA		CCDS11805.1, CCDS11806.1	17q25	2013-01-17				ENSG00000141551			2452	protein-coding gene	gene with protein product		600864				7797465	Standard	NM_001893		Approved	HCKID, CKID, CKIdelta	uc002kej.3	P48730		ENST00000314028.6:c.1230G>A	17.37:g.80202675C>T		Somatic	92	0	1196	WXS	Illumina HiSeq	Phase_I	98	47	NM_001893	0	0	31	105	74	A2I2P2|Q96KZ6|Q9BTN5	Silent	SNP	ENST00000314028.6	37	CCDS11805.1																																																																																			.		0.557	CSNK1D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442632.1	NM_139062	
DSG3	1830	hgsc.bcm.edu	37	18	29054160	29054160	+	Silent	SNP	A	A	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr18:29054160A>G	ENST00000257189.4	+	15	2261	c.2178A>G	c.(2176-2178)ggA>ggG	p.G726G		NM_001944.2	NP_001935.2	P32926	DSG3_HUMAN	desmoglein 3	726					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(28)|ovary(4)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			CTAAGCTTGGAGCAGCCACTG	0.507																																					p.G726G		.											.	DSG3-98	0			c.A2178G						.						99.0	85.0	90.0					18																	29054160		2203	4300	6503	SO:0001819	synonymous_variant	1830	exon15			GCTTGGAGCAGCC	M76482	CCDS11898.1	18q12.1	2010-06-24	2010-06-24		ENSG00000134757	ENSG00000134757		"""Cadherins / Major cadherins"""	3050	protein-coding gene	gene with protein product	"""pemphigus vulgaris antigen"""	169615	"""desmoglein 3 (pemphigus vulgaris antigen)"""			1601426	Standard	NM_001944		Approved	CDHF6	uc002kws.3	P32926	OTTHUMG00000131985	ENST00000257189.4:c.2178A>G	18.37:g.29054160A>G		Somatic	72	0		WXS	Illumina HiSeq	Phase_I	49	3	NM_001944	0	0	1	1	0	A8K2V2	Silent	SNP	ENST00000257189.4	37	CCDS11898.1																																																																																			.		0.507	DSG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254949.1	NM_001944	
SETBP1	26040	hgsc.bcm.edu	37	18	42532691	42532691	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr18:42532691A>G	ENST00000282030.5	+	4	3682	c.3386A>G	c.(3385-3387)cAg>cGg	p.Q1129R		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	1129						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		GGTGACATGCAGCCTTCTCTG	0.532									Schinzel-Giedion syndrome																												p.Q1129R		.											.	SETBP1-155	0			c.A3386G						.						108.0	87.0	94.0					18																	42532691		2203	4300	6503	SO:0001583	missense	26040	exon4	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	ACATGCAGCCTTC	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.3386A>G	18.37:g.42532691A>G	ENSP00000282030:p.Gln1129Arg	Somatic	91	0		WXS	Illumina HiSeq	Phase_I	57	3	NM_015559	0	0	5	5	0	A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	ENST00000282030.5	37	CCDS11923.2	.	.	.	.	.	.	.	.	.	.	A	10.09	1.254514	0.22965	.	.	ENSG00000152217	ENST00000282030	T	0.68765	-0.35	5.88	4.72	0.59763	.	0.141871	0.52532	D	0.000074	T	0.49406	0.1555	L	0.29908	0.895	0.31120	N	0.708952	P	0.41848	0.763	B	0.36608	0.229	T	0.51325	-0.8720	10	0.09084	T	0.74	.	13.285	0.60237	0.8676:0.1324:0.0:0.0	.	1129	Q9Y6X0	SETBP_HUMAN	R	1129	ENSP00000282030:Q1129R	ENSP00000282030:Q1129R	Q	+	2	0	SETBP1	40786689	1.000000	0.71417	0.996000	0.52242	0.940000	0.58332	6.468000	0.73551	1.043000	0.40175	0.459000	0.35465	CAG	.		0.532	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4	NM_001130110	
SMARCA4	6597	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	11132430	11132430	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr19:11132430A>T	ENST00000429416.3	+	20	2927	c.2646A>T	c.(2644-2646)gaA>gaT	p.E882D	SMARCA4_ENST00000344626.4_Missense_Mutation_p.E882D|SMARCA4_ENST00000413806.3_Missense_Mutation_p.E882D|SMARCA4_ENST00000450717.3_Missense_Mutation_p.E882D|SMARCA4_ENST00000590574.1_Missense_Mutation_p.E882D|SMARCA4_ENST00000444061.3_Missense_Mutation_p.E882D|SMARCA4_ENST00000589677.1_Missense_Mutation_p.E882D|SMARCA4_ENST00000358026.2_Missense_Mutation_p.E882D|SMARCA4_ENST00000541122.2_Missense_Mutation_p.E882D	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	882	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				TTGTGGACGAAGGTCACCGCA	0.632			"""F, N, Mis"""		NSCLC																																p.E882D		.		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	.	SMARCA4-1523	1	Unknown(1)	lung(1)	c.A2646T						.						77.0	61.0	67.0					19																	11132430		2202	4300	6502	SO:0001583	missense	6597	exon19			GGACGAAGGTCAC	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.2646A>T	19.37:g.11132430A>T	ENSP00000395654:p.Glu882Asp	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	34	11	NM_003072	0	0	24	40	16	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	37	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	A	19.43	3.825530	0.71143	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	D;D;D;D;D;D;D	0.99652	-6.3;-6.3;-6.3;-6.3;-6.3;-6.3;-6.3	4.66	-2.31	0.06765	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.99778	0.9908	H	0.99825	4.815	0.50313	D	0.999868	D;D;D;D;D;D;D;D	0.89917	0.999;0.999;0.999;0.999;0.999;1.0;0.999;0.999	D;D;D;D;D;D;D;D	0.97110	0.994;0.994;0.994;0.992;0.981;1.0;0.994;0.994	D	0.98030	1.0376	10	0.87932	D	0	-29.2033	10.9557	0.47356	0.5266:0.0:0.4734:0.0	.	882;882;882;882;882;102;882;882	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;B4E0F1;A7E2E1;P51532	.;.;.;.;.;.;.;SMCA4_HUMAN	D	882;882;946;882;882;882;882;882	ENSP00000395654:E882D;ENSP00000350720:E882D;ENSP00000343896:E882D;ENSP00000445036:E882D;ENSP00000392837:E882D;ENSP00000397783:E882D;ENSP00000414727:E882D	ENSP00000343896:E882D	E	+	3	2	SMARCA4	10993430	0.554000	0.26522	0.953000	0.39169	0.784000	0.44337	-0.089000	0.11180	-0.861000	0.04094	-0.256000	0.11100	GAA	.		0.632	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072	
PPP6R1	22870	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	55752903	55752903	+	Nonsense_Mutation	SNP	A	A	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr19:55752903A>T	ENST00000412770.2	-	8	1516	c.950T>A	c.(949-951)tTg>tAg	p.L317*	PPP6R1_ENST00000587283.1_Nonsense_Mutation_p.L317*	NM_014931.3	NP_055746.3	Q9UPN7	PP6R1_HUMAN	protein phosphatase 6, regulatory subunit 1	317	Interaction with PPP6C.				regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)	protein phosphatase binding (GO:0019903)			breast(1)	1						TAGGGCGTGCAAGGCGCCCAC	0.672																																					p.L317X		.											.	PPP6R1-67	0			c.T950A						.						16.0	20.0	19.0					19																	55752903		2009	4156	6165	SO:0001587	stop_gained	22870	exon8			GCGTGCAAGGCGC	AB029038	CCDS46186.1	19q13.42	2012-04-17	2010-06-28	2010-06-28	ENSG00000105063	ENSG00000105063		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	29195	protein-coding gene	gene with protein product		610875	"""KIAA1115"", ""SAPS domain family, member 1"""	KIAA1115, SAPS1		16769727	Standard	NM_014931		Approved	SAP190	uc002qjw.4	Q9UPN7		ENST00000412770.2:c.950T>A	19.37:g.55752903A>T	ENSP00000414202:p.Leu317*	Somatic	20	0		WXS	Illumina HiSeq	Phase_I	15	4	NM_014931	0	0	35	35	0	Q2M2H3|Q504V2|Q6NVJ6|Q9BU97	Nonsense_Mutation	SNP	ENST00000412770.2	37	CCDS46186.1	.	.	.	.	.	.	.	.	.	.	A	36	5.920878	0.97105	.	.	ENSG00000105063	ENST00000412770	.	.	.	4.31	4.31	0.51392	.	0.000000	0.41938	D	0.000783	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.1454	11.7405	0.51790	1.0:0.0:0.0:0.0	.	.	.	.	X	317	.	ENSP00000414202:L317X	L	-	2	0	PPP6R1	60444715	1.000000	0.71417	0.898000	0.35279	0.236000	0.25371	4.122000	0.57910	1.937000	0.56155	0.379000	0.24179	TTG	.		0.672	PPP6R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452663.1	NM_014931	
TEKT4	150483	ucsc.edu;bcgsc.ca	37	2	95540716	95540716	+	Silent	SNP	G	G	A			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr2:95540716G>A	ENST00000295201.4	+	4	1046	c.909G>A	c.(907-909)cgG>cgA	p.R303R	AC097374.2_ENST00000568768.1_RNA	NM_144705.2	NP_653306.1	Q8WW24	TEKT4_HUMAN	tektin 4	303					cell projection organization (GO:0030030)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	28						AGGACGCGCGGTACAAGCTGC	0.662																																					p.R303R													.	TEKT4-155	0			c.G909A						.						26.0	33.0	31.0					2																	95540716		2197	4299	6496	SO:0001819	synonymous_variant	150483	exon4			CGCGCGGTACAAG	AK097438	CCDS2005.1	2q11.2	2008-02-05			ENSG00000163060	ENSG00000163060			31012	protein-coding gene	gene with protein product							Standard	XM_005263876		Approved	MGC27019	uc002stw.1	Q8WW24	OTTHUMG00000130396	ENST00000295201.4:c.909G>A	2.37:g.95540716G>A		Somatic	40	0		WXS	Illumina HiSeq		20	4	NM_144705	0	0	0	0	0		Silent	SNP	ENST00000295201.4	37	CCDS2005.1																																																																																			.		0.662	TEKT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252777.1	NM_144705	
NCKAP5	344148	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	133721438	133721438	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr2:133721438T>G	ENST00000409261.1	-	8	807	c.434A>C	c.(433-435)aAg>aCg	p.K145T	NCKAP5_ENST00000317721.6_Missense_Mutation_p.K145T|NCKAP5_ENST00000409213.1_Missense_Mutation_p.K145T|NCKAP5_ENST00000405974.3_Missense_Mutation_p.K145T	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	145										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						CTCTGACAGCTTTTCCTGAAG	0.428																																					p.K145T		.											.	.	0			c.A434C						.						142.0	136.0	138.0					2																	133721438		1861	4093	5954	SO:0001583	missense	344148	exon8			GACAGCTTTTCCT	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.434A>C	2.37:g.133721438T>G	ENSP00000387128:p.Lys145Thr	Somatic	94	0		WXS	Illumina HiSeq	Phase_I	105	38	NM_207481	0	0	0	0	0	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	T	12.36	1.913961	0.33815	.	.	ENSG00000176771	ENST00000409261;ENST00000409213;ENST00000317721;ENST00000405974;ENST00000537661;ENST00000542834	T;T;T;T	0.48522	2.8;0.81;2.8;0.81	5.0	-0.271	0.12922	.	.	.	.	.	T	0.25717	0.0626	N	0.14661	0.345	0.09310	N	1	B;B;B	0.24823	0.0;0.001;0.112	B;B;B	0.24394	0.002;0.003;0.053	T	0.17440	-1.0369	9	0.38643	T	0.18	.	4.4156	0.11454	0.0:0.1923:0.3253:0.4823	.	120;145;145	O14513-3;O14513-2;O14513	.;.;NCKP5_HUMAN	T	145;145;145;145;145;120	ENSP00000387128:K145T;ENSP00000386952:K145T;ENSP00000380603:K145T;ENSP00000385692:K145T	ENSP00000380603:K145T	K	-	2	0	NCKAP5	133437908	0.968000	0.33430	0.029000	0.17559	0.554000	0.35429	1.269000	0.33074	-0.107000	0.12088	-0.321000	0.08615	AAG	.		0.428	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481	
ACVR2A	92	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	148677893	148677893	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr2:148677893G>A	ENST00000241416.7	+	8	1693	c.1057G>A	c.(1057-1059)Gca>Aca	p.A353T	ACVR2A_ENST00000404590.1_Missense_Mutation_p.A353T|ACVR2A_ENST00000535787.1_Missense_Mutation_p.A245T	NM_001278579.1|NM_001278580.1|NM_001616.3	NP_001265508.1|NP_001265509.1|NP_001607.1	P27037	AVR2A_HUMAN	activin A receptor, type IIA	353	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|determination of left/right symmetry (GO:0007368)|embryonic skeletal system development (GO:0048706)|gastrulation with mouth forming second (GO:0001702)|mesoderm development (GO:0007498)|penile erection (GO:0043084)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|regulation of BMP signaling pathway (GO:0030510)|regulation of nitric-oxide synthase activity (GO:0050999)|Sertoli cell proliferation (GO:0060011)|sperm ejaculation (GO:0042713)|spermatogenesis (GO:0007283)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|coreceptor activity (GO:0015026)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(5)|large_intestine(14)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(8)	45				BRCA - Breast invasive adenocarcinoma(221;0.0969)		TGGCAAGTCTGCAGGCGATAC	0.383																																					p.A353T		.											.	ACVR2A-831	0			c.G1057A						.						87.0	89.0	89.0					2																	148677893		2203	4300	6503	SO:0001583	missense	92	exon8			AAGTCTGCAGGCG		CCDS33301.1, CCDS63030.1	2q22.2-q23.3	2008-02-05	2005-05-10	2005-05-10	ENSG00000121989	ENSG00000121989			173	protein-coding gene	gene with protein product		102581	"""activin A receptor, type II"""	ACVR2		1314589, 10702675	Standard	NM_001278579		Approved	ACTRII	uc002twh.3	P27037	OTTHUMG00000150603	ENST00000241416.7:c.1057G>A	2.37:g.148677893G>A	ENSP00000241416:p.Ala353Thr	Somatic	67	0		WXS	Illumina HiSeq	Phase_I	94	34	NM_001616	0	0	1	4	3	B2RAB8|B4DWQ2|D3DP85|Q53TH4|Q6NWV2|Q92474	Missense_Mutation	SNP	ENST00000241416.7	37	CCDS33301.1	.	.	.	.	.	.	.	.	.	.	G	16.14	3.039512	0.55003	.	.	ENSG00000121989	ENST00000241416;ENST00000535787;ENST00000404590	T;T;T	0.65732	-0.17;-0.17;-0.17	5.42	5.42	0.78866	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.38188	0.1031	N	0.02345	-0.59	0.80722	D	1	B	0.11235	0.004	B	0.13407	0.009	T	0.26849	-1.0091	10	0.34782	T	0.22	.	15.113	0.72375	0.0:0.1411:0.8589:0.0	.	353	P27037	AVR2A_HUMAN	T	353;245;353	ENSP00000241416:A353T;ENSP00000439988:A245T;ENSP00000384338:A353T	ENSP00000241416:A353T	A	+	1	0	ACVR2A	148394363	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.587000	0.67510	2.699000	0.92147	0.655000	0.94253	GCA	.		0.383	ACVR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319051.1	NM_001616	
NEB	4703	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	152482148	152482148	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr2:152482148A>G	ENST00000172853.10	-	67	9770	c.9623T>C	c.(9622-9624)tTa>tCa	p.L3208S	NEB_ENST00000604864.1_Missense_Mutation_p.L3451S|NEB_ENST00000427231.2_Missense_Mutation_p.L3451S|NEB_ENST00000603639.1_Missense_Mutation_p.L3451S|NEB_ENST00000409198.1_Missense_Mutation_p.L3208S|NEB_ENST00000397345.3_Missense_Mutation_p.L3451S			P20929	NEBU_HUMAN	nebulin	3208					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TTCTGTGTATAAGCGCTGTGA	0.358																																					p.L3451S		.											.	NEB-145	0			c.T10352C						.						74.0	67.0	69.0					2																	152482148		1835	4090	5925	SO:0001583	missense	4703	exon71			GTGTATAAGCGCT	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.9623T>C	2.37:g.152482148A>G	ENSP00000172853:p.Leu3208Ser	Somatic	11	0		WXS	Illumina HiSeq	Phase_I	28	10	NM_001271208	0	0	0	0	0	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37		.	.	.	.	.	.	.	.	.	.	A	18.62	3.662545	0.67700	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.53206	0.63;0.63;0.63;0.63	4.98	4.98	0.66077	.	0.086330	0.48286	D	0.000195	T	0.66366	0.2782	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.70285	-0.4914	10	0.72032	D	0.01	.	14.6222	0.68594	1.0:0.0:0.0:0.0	.	3208	P20929	NEBU_HUMAN	S	3208;3451;3451;3208	ENSP00000386259:L3208S;ENSP00000380505:L3451S;ENSP00000416578:L3451S;ENSP00000172853:L3208S	ENSP00000172853:L3208S	L	-	2	0	NEB	152190394	0.060000	0.20803	1.000000	0.80357	0.993000	0.82548	2.165000	0.42396	1.996000	0.58369	0.455000	0.32223	TTA	.		0.358	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
SSFA2	6744	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	182778659	182778659	+	Splice_Site	SNP	A	A	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr2:182778659A>T	ENST00000431877.2	+	10	1753	c.1574A>T	c.(1573-1575)cAg>cTg	p.Q525L	SSFA2_ENST00000409136.1_Splice_Site_p.Q34L|SSFA2_ENST00000409001.1_Splice_Site_p.Q525L|SSFA2_ENST00000320370.7_Splice_Site_p.Q525L|SSFA2_ENST00000428267.2_Splice_Site_p.Q372L	NM_001130445.1	NP_001123917.1	P28290	SSFA2_HUMAN	sperm specific antigen 2	525						cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(18)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	38			OV - Ovarian serous cystadenocarcinoma(117;0.0856)			AATCATCTTCAGGTAAAATTT	0.318																																					p.Q525L		.											.	SSFA2-153	0			c.A1574T						.						90.0	83.0	85.0					2																	182778659		2203	4300	6503	SO:0001630	splice_region_variant	6744	exon10			ATCTTCAGGTAAA	M61199	CCDS2284.1, CCDS46467.1, CCDS74611.1	2q32.1	2012-02-01			ENSG00000138434	ENSG00000138434			11319	protein-coding gene	gene with protein product	"""cleavage signal-1 protein"", ""KRAS-induced actin-interacting protein"", ""sperm associated antigen 13"""	118990				1555770	Standard	XM_005246812		Approved	CS-1, SPAG13, KRAP, KIAA1927	uc002uoh.3	P28290	OTTHUMG00000132584	ENST00000431877.2:c.1575+1A>T	2.37:g.182778659A>T		Somatic	26	0		WXS	Illumina HiSeq	Phase_I	43	22	NM_001130445	0	0	0	0	0	A8K6T0|Q68DA6|Q7Z7L2|Q8N1L3|Q8N263|Q8N7H2|Q8NEN5|Q96E36|Q96PW1	Missense_Mutation	SNP	ENST00000431877.2	37	CCDS46467.1	.	.	.	.	.	.	.	.	.	.	A	14.18	2.458095	0.43634	.	.	ENSG00000138434	ENST00000431877;ENST00000320370;ENST00000409001;ENST00000428267;ENST00000409136	T;T;T;T;T	0.15834	2.64;2.41;2.64;2.64;2.39	5.13	2.62	0.31277	.	0.553772	0.19548	N	0.111640	T	0.15565	0.0375	L	0.45581	1.43	0.58432	D	0.999999	B;B;B;B	0.19583	0.037;0.011;0.011;0.021	B;B;B;B	0.22386	0.039;0.009;0.009;0.009	T	0.05115	-1.0905	10	0.27785	T	0.31	-4.9981	10.8683	0.46869	0.7739:0.0:0.0:0.2261	.	372;525;525;525	E7END2;E9PHV5;P28290;P28290-3	.;.;SSFA2_HUMAN;.	L	525;525;525;372;34	ENSP00000388731:Q525L;ENSP00000314669:Q525L;ENSP00000387319:Q525L;ENSP00000409867:Q372L;ENSP00000386916:Q34L	ENSP00000314669:Q525L	Q	+	2	0	SSFA2	182486904	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	5.823000	0.69272	0.310000	0.22990	0.455000	0.32223	CAG	.		0.318	SSFA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255793.2	NM_006751	Missense_Mutation
ICOS	29851	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	204822592	204822592	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr2:204822592A>C	ENST00000316386.6	+	4	639	c.572A>C	c.(571-573)aAa>aCa	p.K191T	ICOS_ENST00000435193.1_Intron	NM_012092.3	NP_036224.1	Q9Y6W8	ICOS_HUMAN	inducible T-cell co-stimulator	191					immune response (GO:0006955)|single organismal cell-cell adhesion (GO:0016337)|T cell costimulation (GO:0031295)|T cell tolerance induction (GO:0002517)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|large_intestine(1)|lung(4)	6						ACAGCCAAAAAATCTAGACTC	0.388																																					p.K191T		.											.	ICOS-90	0			c.A572C						.						86.0	85.0	86.0					2																	204822592		2203	4300	6503	SO:0001583	missense	29851	exon4			CCAAAAAATCTAG	AB023135	CCDS2363.1	2q33	2014-09-17			ENSG00000163600	ENSG00000163600		"""CD molecules"""	5351	protein-coding gene	gene with protein product	"""activation-inducible lymphocyte immunomediatory molecule"""	604558				9930702, 10617205	Standard	NM_012092		Approved	AILIM, CD278	uc002vam.3	Q9Y6W8	OTTHUMG00000132880	ENST00000316386.6:c.572A>C	2.37:g.204822592A>C	ENSP00000319476:p.Lys191Thr	Somatic	45	0		WXS	Illumina HiSeq	Phase_I	86	36	NM_012092	0	0	0	0	0	Q8N6W8	Missense_Mutation	SNP	ENST00000316386.6	37	CCDS2363.1	.	.	.	.	.	.	.	.	.	.	A	18.24	3.581135	0.65992	.	.	ENSG00000163600	ENST00000316386	.	.	.	5.73	3.24	0.37175	.	0.180516	0.37577	N	0.002037	T	0.41696	0.1170	M	0.72118	2.19	0.09310	N	0.999993	B;B	0.19583	0.037;0.037	B;B	0.17433	0.018;0.018	T	0.33979	-0.9847	9	0.30078	T	0.28	-32.144	5.7144	0.17952	0.6551:0.157:0.0:0.188	.	191;191	Q53QY6;Q9Y6W8	.;ICOS_HUMAN	T	191	.	ENSP00000319476:K191T	K	+	2	0	ICOS	204530837	0.794000	0.28838	0.002000	0.10522	0.508000	0.34012	1.387000	0.34430	0.383000	0.24910	0.383000	0.25322	AAA	.		0.388	ICOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256369.1	NM_012092	
ACADL	33	hgsc.bcm.edu	37	2	211068079	211068079	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr2:211068079A>C	ENST00000233710.3	-	8	1187	c.960T>G	c.(958-960)ttT>ttG	p.F320L	AC006994.2_ENST00000412065.1_RNA	NM_001608.3	NP_001599.1	P28330	ACADL_HUMAN	acyl-CoA dehydrogenase, long chain	320					carnitine catabolic process (GO:0042413)|carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid catabolic process (GO:0044242)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|long-chain fatty acid catabolic process (GO:0042758)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of fatty acid oxidation (GO:0046322)|oxidation-reduction process (GO:0055114)|protein homotetramerization (GO:0051289)|regulation of cholesterol metabolic process (GO:0090181)|small molecule metabolic process (GO:0044281)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|fatty-acyl-CoA binding (GO:0000062)|flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)|palmitoyl-CoA oxidase activity (GO:0016401)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	14		Renal(323;0.202)		Epithelial(149;0.00631)|Lung(261;0.0438)|LUSC - Lung squamous cell carcinoma(261;0.0466)|all cancers(144;0.0621)		CTGTTTTGCCAAAAGCTTTTC	0.368																																					p.F320L		.											.	ACADL-90	0			c.T960G						.						111.0	97.0	102.0					2																	211068079		2203	4300	6503	SO:0001583	missense	33	exon8			TTTGCCAAAAGCT	M74096	CCDS2389.1	2q34	2012-07-13	2010-04-30		ENSG00000115361	ENSG00000115361	1.3.99.13		88	protein-coding gene	gene with protein product		609576	"""acyl-Coenzyme A dehydrogenase, long chain"""			1774065	Standard	NM_001608		Approved	LCAD, ACAD4	uc002vdz.4	P28330	OTTHUMG00000132989	ENST00000233710.3:c.960T>G	2.37:g.211068079A>C	ENSP00000233710:p.Phe320Leu	Somatic	16	0		WXS	Illumina HiSeq	Phase_I	31	2	NM_001608	0	0	12	12	0	B2R8T3|Q8IUN8	Missense_Mutation	SNP	ENST00000233710.3	37	CCDS2389.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.372516	0.82573	.	.	ENSG00000115361	ENST00000233710	D	0.97328	-4.34	5.43	5.43	0.79202	Acyl-CoA dehydrogenase/oxidase C-terminal (2);Acyl-CoA oxidase/dehydrogenase, type 1 (1);	0.000000	0.85682	D	0.000000	D	0.98871	0.9618	H	0.97103	3.94	0.58432	D	0.999998	D	0.61697	0.99	P	0.62014	0.897	D	0.99521	1.0958	10	0.87932	D	0	.	15.4826	0.75539	1.0:0.0:0.0:0.0	.	320	P28330	ACADL_HUMAN	L	320	ENSP00000233710:F320L	ENSP00000233710:F320L	F	-	3	2	ACADL	210776324	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	2.209000	0.42806	2.055000	0.61198	0.332000	0.21555	TTT	.		0.368	ACADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256561.2	NM_001608	
DNPEP	23549	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	220239739	220239739	+	Silent	SNP	G	G	A			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr2:220239739G>A	ENST00000273075.4	-	14	1465	c.1245C>T	c.(1243-1245)ctC>ctT	p.L415L	DNPEP_ENST00000373972.1_Silent_p.L340L|DNPEP_ENST00000490371.1_5'UTR|DNPEP_ENST00000523282.1_Silent_p.L423L	NM_012100.2	NP_036232	Q9ULA0	DNPEP_HUMAN	aspartyl aminopeptidase	405					peptide metabolic process (GO:0006518)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Renal(207;0.0474)		Epithelial(149;1.09e-06)|all cancers(144;0.000179)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCCGGACCATGAGATCCTAGG	0.582																																					p.L415L		.											.	DNPEP-90	0			c.C1245T						.						54.0	57.0	56.0					2																	220239739		1995	4197	6192	SO:0001819	synonymous_variant	23549	exon14			GACCATGAGATCC		CCDS42823.1	2q36.1	2008-05-22			ENSG00000123992	ENSG00000123992			2981	protein-coding gene	gene with protein product		611367				9632644	Standard	NM_012100		Approved	DAP, ASPEP	uc002vle.2	Q9ULA0	OTTHUMG00000058919	ENST00000273075.4:c.1245C>T	2.37:g.220239739G>A		Somatic	56	0		WXS	Illumina HiSeq	Phase_I	60	23	NM_012100	0	0	0	0	0	Q9BW44|Q9NUV5	Silent	SNP	ENST00000273075.4	37	CCDS42823.1	.	.	.	.	.	.	.	.	.	.	G	9.087	1.000674	0.19121	.	.	ENSG00000123992	ENST00000337010	.	.	.	5.38	4.5	0.54988	.	.	.	.	.	T	0.72518	0.3470	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.72830	-0.4174	4	.	.	.	-23.6962	16.3965	0.83607	0.0:0.1313:0.8686:0.0	.	.	.	.	L	415	.	.	S	-	2	0	DNPEP	219947983	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	3.609000	0.54117	1.492000	0.48499	0.655000	0.94253	TCA	.		0.582	DNPEP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000130212.1	NM_012100	
DNMT3B	1789	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	31375212	31375212	+	Silent	SNP	G	G	A	rs376501500		TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr20:31375212G>A	ENST00000328111.2	+	6	930	c.609G>A	c.(607-609)ccG>ccA	p.P203P	DNMT3B_ENST00000375623.4_Silent_p.P161P|DNMT3B_ENST00000353855.2_Silent_p.P203P|DNMT3B_ENST00000348286.2_Silent_p.P203P|DNMT3B_ENST00000201963.3_Silent_p.P215P|DNMT3B_ENST00000443239.3_Silent_p.P161P|DNMT3B_ENST00000456297.2_Silent_p.P127P|DNMT3B_ENST00000344505.4_Silent_p.P203P	NM_006892.3	NP_008823.1	Q9UBC3	DNM3B_HUMAN	DNA (cytosine-5-)-methyltransferase 3 beta	203	Interaction with DNMT1 and DNMT3A.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation on cytosine within a CG sequence (GO:0010424)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of neuron differentiation (GO:0045666)|protein complex localization (GO:0031503)|regulation of gene expression by genetic imprinting (GO:0006349)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA-methyltransferase activity (GO:0009008)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)|unmethylated CpG binding (GO:0045322)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(16)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TGGAGTCCCCGCAGGTGGAGG	0.637																																					p.P215P		.											.	DNMT3B-660	0			c.G645A						.	G	,,,,,	1,4405	2.1+/-5.4	0,1,2202	52.0	51.0	51.0		483,381,609,609,609,645	-7.6	0.0	20		51	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	DNMT3B	NM_001207055.1,NM_001207056.1,NM_006892.3,NM_175848.1,NM_175849.1,NM_175850.2	,,,,,	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	,,,,,	161/729,127/695,203/854,203/834,203/771,215/846	31375212	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	1789	exon6			GTCCCCGCAGGTG		CCDS13204.1, CCDS13205.1, CCDS13206.1, CCDS13207.1, CCDS56183.1, CCDS56184.1	20q11.2	2014-09-17			ENSG00000088305	ENSG00000088305			2979	protein-coding gene	gene with protein product		602900				9662389, 10433969	Standard	NM_006892		Approved		uc002wyc.3	Q9UBC3	OTTHUMG00000032226	ENST00000328111.2:c.609G>A	20.37:g.31375212G>A		Somatic	79	0		WXS	Illumina HiSeq	Phase_I	87	50	NM_175850	0	0	0	5	5	A2A2E2|B4DSM8|B4DSU1|E1P5M6|E1P5M7|E7EN63|E9PBF2|Q9UBD4|Q9UJQ5|Q9UKA6|Q9UNE5|Q9Y5R9|Q9Y5S0	Silent	SNP	ENST00000328111.2	37	CCDS13205.1																																																																																			.		0.637	DNMT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078643.2	NM_006892	
NCOA6	23054	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	33330861	33330861	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr20:33330861T>C	ENST00000374796.2	-	12	5769	c.3199A>G	c.(3199-3201)Aga>Gga	p.R1067G	NCOA6_ENST00000359003.2_Missense_Mutation_p.R1067G			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	1067	NCOA1-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						ATGGGCATTCTCTGGGAGTCG	0.537																																					p.R1067G		.											.	NCOA6-292	0			c.A3199G						.						112.0	117.0	115.0					20																	33330861		2203	4300	6503	SO:0001583	missense	23054	exon11			GCATTCTCTGGGA	AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.3199A>G	20.37:g.33330861T>C	ENSP00000363929:p.Arg1067Gly	Somatic	220	0		WXS	Illumina HiSeq	Phase_I	349	214	NM_014071	0	0	2	16	14	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Missense_Mutation	SNP	ENST00000374796.2	37	CCDS13241.1	.	.	.	.	.	.	.	.	.	.	T	16.24	3.067284	0.55539	.	.	ENSG00000198646	ENST00000374796;ENST00000359003	T;T	0.52526	0.66;0.66	5.82	5.82	0.92795	.	0.000000	0.64402	D	0.000001	T	0.56396	0.1982	L	0.32530	0.975	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.54827	-0.8235	10	0.38643	T	0.18	-10.3259	12.8878	0.58053	0.0:0.0:0.1444:0.8556	.	1067	Q14686	NCOA6_HUMAN	G	1067	ENSP00000363929:R1067G;ENSP00000351894:R1067G	ENSP00000351894:R1067G	R	-	1	2	NCOA6	32794522	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.049000	0.57397	2.225000	0.72522	0.460000	0.39030	AGA	.		0.537	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078811.2	NM_014071	
ARFGEF2	10564	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	47628617	47628617	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr20:47628617C>A	ENST00000371917.4	+	28	3914	c.3914C>A	c.(3913-3915)cCt>cAt	p.P1305H		NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)	1305					endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)			breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			TCTGAGAGGCCTCGGGTTCGT	0.512																																					p.P1305H	Esophageal Squamous(176;1738 1974 26285 33069 35354)	.											.	ARFGEF2-358	0			c.C3914A						.						93.0	88.0	90.0					20																	47628617		2203	4300	6503	SO:0001583	missense	10564	exon28			AGAGGCCTCGGGT	AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.3914C>A	20.37:g.47628617C>A	ENSP00000360985:p.Pro1305His	Somatic	95	0		WXS	Illumina HiSeq	Phase_I	215	55	NM_006420	0	0	0	0	0	Q5TFT9|Q9NTS1	Missense_Mutation	SNP	ENST00000371917.4	37	CCDS13411.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.767327	0.90020	.	.	ENSG00000124198	ENST00000371917	T	0.56611	0.45	5.46	5.46	0.80206	Armadillo-type fold (1);	0.050275	0.85682	D	0.000000	T	0.77246	0.4102	M	0.87827	2.91	0.80722	D	1	D	0.89917	1.0	D	0.70935	0.971	T	0.81337	-0.0978	10	0.87932	D	0	.	19.3208	0.94237	0.0:1.0:0.0:0.0	.	1305	Q9Y6D5	BIG2_HUMAN	H	1305	ENSP00000360985:P1305H	ENSP00000360985:P1305H	P	+	2	0	ARFGEF2	47062024	1.000000	0.71417	1.000000	0.80357	0.750000	0.42670	7.747000	0.85070	2.557000	0.86248	0.561000	0.74099	CCT	.		0.512	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079627.1	NM_006420	
MYO18B	84700	hgsc.bcm.edu	37	22	26166902	26166902	+	Missense_Mutation	SNP	T	T	A	rs201482451		TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr22:26166902T>A	ENST00000407587.2	+	6	1812	c.1643T>A	c.(1642-1644)aTt>aAt	p.I548N	MYO18B_ENST00000335473.7_Missense_Mutation_p.I548N|MYO18B_ENST00000536101.1_Missense_Mutation_p.I548N			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	548						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						AGACTTTGGATTGATGCTGAC	0.577																																					p.I548N		.											.	MYO18B-142	0			c.T1643A						.						66.0	76.0	73.0					22																	26166902		2043	4039	6082	SO:0001583	missense	84700	exon6			TTTGGATTGATGC	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.1643T>A	22.37:g.26166902T>A	ENSP00000386096:p.Ile548Asn	Somatic	2	1		WXS	Illumina HiSeq	Phase_I	3	3	NM_032608	0	0	0	0	0	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	37		.	.	.	.	.	.	.	.	.	.	T	11.73	1.726167	0.30593	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	T;T;T	0.72051	-0.62;-0.62;-0.62	4.74	3.7	0.42460	.	0.683074	0.13008	N	0.421139	T	0.74489	0.3723	M	0.61703	1.905	0.28366	N	0.920238	P;P;D;D	0.53151	0.925;0.93;0.958;0.958	P;P;P;P	0.54312	0.667;0.564;0.748;0.748	T	0.66444	-0.5922	10	0.87932	D	0	.	5.9265	0.19114	0.0:0.0907:0.1667:0.7426	.	61;548;548;548	Q8IUG5-2;Q8IUG5;F5GXR6;F5GYU7	.;MY18B_HUMAN;.;.	N	548	ENSP00000441229:I548N;ENSP00000334563:I548N;ENSP00000386096:I548N	ENSP00000334563:I548N	I	+	2	0	MYO18B	24496902	0.459000	0.25768	0.173000	0.22940	0.081000	0.17604	3.482000	0.53186	0.676000	0.31285	0.260000	0.18958	ATT	.		0.577	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
APOL6	80830	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	36055131	36055131	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr22:36055131C>G	ENST00000409652.4	+	3	796	c.520C>G	c.(520-522)Ctt>Gtt	p.L174V		NM_030641.3	NP_085144.1	Q9BWW8	APOL6_HUMAN	apolipoprotein L, 6	174					lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)			haematopoietic_and_lymphoid_tissue(1)|lung(4)	5						TATCTATAATCTTAGAAACAC	0.493																																					p.L174V		.											.	APOL6-90	0			c.C520G						.						61.0	63.0	62.0					22																	36055131		2203	4300	6503	SO:0001583	missense	80830	exon3			TATAATCTTAGAA	AY014879	CCDS13919.1	22q12.3	2013-01-24			ENSG00000221963	ENSG00000221963		"""Apolipoproteins"""	14870	protein-coding gene	gene with protein product		607256				11374903, 15671246	Standard	NM_030641		Approved	APOL-VI, APOLVI	uc003aoe.3	Q9BWW8	OTTHUMG00000150615	ENST00000409652.4:c.520C>G	22.37:g.36055131C>G	ENSP00000386280:p.Leu174Val	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	72	8	NM_030641	0	0	3	3	0	Q5R3S1|Q658J1|Q8IXX6|Q9UGG1	Missense_Mutation	SNP	ENST00000409652.4	37	CCDS13919.1	.	.	.	.	.	.	.	.	.	.	C	0.284	-0.984328	0.02180	.	.	ENSG00000221963	ENST00000409652	T	0.03124	4.04	4.05	-3.17	0.05202	.	1.542230	0.03383	N	0.200606	T	0.01489	0.0048	N	0.01482	-0.84	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46331	-0.9199	10	0.11182	T	0.66	-11.6376	7.5122	0.27579	0.0:0.1896:0.5669:0.2435	.	174	Q9BWW8	APOL6_HUMAN	V	174	ENSP00000386280:L174V	ENSP00000386280:L174V	L	+	1	0	APOL6	34385077	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.171000	0.09883	-0.392000	0.07751	-1.127000	0.01993	CTT	.		0.493	APOL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319081.2	NM_030641	
GOLGB1	2804	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	121433805	121433805	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr3:121433805G>A	ENST00000340645.5	-	10	1417	c.1292C>T	c.(1291-1293)tCc>tTc	p.S431F	GOLGB1_ENST00000393667.3_Missense_Mutation_p.S436F	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	431					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		AATTTCTTTGGATTTTTGCTG	0.328																																					p.S436F		.											.	GOLGB1-161	0			c.C1307T						.						121.0	122.0	122.0					3																	121433805		2203	4300	6503	SO:0001583	missense	2804	exon10			TCTTTGGATTTTT	X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.1292C>T	3.37:g.121433805G>A	ENSP00000341848:p.Ser431Phe	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	64	32	NM_001256486	0	0	6	11	5	B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	ENST00000340645.5	37	CCDS3004.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.900|8.900	0.956079|0.956079	0.18507|0.18507	.|.	.|.	ENSG00000173230|ENSG00000173230	ENST00000489400|ENST00000340645;ENST00000393667;ENST00000494517;ENST00000426235	.|T;T;T	.|0.25414	.|2.39;2.39;1.8	4.95|4.95	2.09|2.09	0.27110|0.27110	.|.	.|0.423391	.|0.20726	.|N	.|0.086819	T|T	0.43787|0.43787	0.1263|0.1263	M|M	0.68317|0.68317	2.08|2.08	0.25739|0.25739	N|N	0.985181|0.985181	.|D;D;D;D;D	.|0.89917	.|1.0;0.999;1.0;0.999;1.0	.|D;D;D;D;D	.|0.87578	.|0.998;0.996;0.998;0.996;0.998	T|T	0.18053|0.18053	-1.0349|-1.0349	5|10	.|0.51188	.|T	.|0.08	.|.	8.2496|8.2496	0.31708|0.31708	0.0:0.3271:0.5037:0.1692|0.0:0.3271:0.5037:0.1692	.|.	.|356;395;436;436;431	.|F1T0J2;E7EU81;E7EP74;B2ZZ91;Q14789	.|.;.;.;.;GOGB1_HUMAN	S|F	302|431;436;395;243	.|ENSP00000341848:S431F;ENSP00000377275:S436F;ENSP00000418231:S395F	.|ENSP00000341848:S431F	P|S	-|-	1|2	0|0	GOLGB1|GOLGB1	122916495|122916495	0.949000|0.949000	0.32298|0.32298	0.256000|0.256000	0.24389|0.24389	0.478000|0.478000	0.33099|0.33099	1.453000|1.453000	0.35167|0.35167	0.231000|0.231000	0.21079|0.21079	-0.188000|-0.188000	0.12872|0.12872	CCA|TCC	.		0.328	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355159.1	NM_004487	
ZIC1	7545	hgsc.bcm.edu	37	3	147128606	147128606	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr3:147128606C>G	ENST00000282928.4	+	1	1436	c.707C>G	c.(706-708)gCc>gGc	p.A236G		NM_003412.3	NP_003403.2	Q15915	ZIC1_HUMAN	Zic family member 1	236					adult walking behavior (GO:0007628)|brain development (GO:0007420)|cell differentiation (GO:0030154)|inner ear morphogenesis (GO:0042472)|pattern specification process (GO:0007389)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord development (GO:0021510)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(4)|cervix(1)|endometrium(2)|large_intestine(8)|lung(38)|ovary(1)|prostate(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	63						GAGCAGCTGGCCAACCCCAAA	0.587																																					p.A236G		.											.	ZIC1-91	0			c.C707G						.						74.0	69.0	71.0					3																	147128606		2203	4300	6503	SO:0001583	missense	7545	exon1			AGCTGGCCAACCC	D76435	CCDS3136.1	3q24	2013-01-08	2011-05-19		ENSG00000152977	ENSG00000152977		"""Zinc fingers, C2H2-type"""	12872	protein-coding gene	gene with protein product		600470	"""Zic family member 1 (odd-paired Drosophila homolog)"", ""Zic family member 1 (odd-paired homolog, Drosophila)"""			8542595	Standard	NM_003412		Approved	ZIC, ZNF201	uc003ewe.3	Q15915	OTTHUMG00000159456	ENST00000282928.4:c.707C>G	3.37:g.147128606C>G	ENSP00000282928:p.Ala236Gly	Somatic	70	0		WXS	Illumina HiSeq	Phase_I	60	3	NM_003412	0	0	0	0	0	Q2M3N1	Missense_Mutation	SNP	ENST00000282928.4	37	CCDS3136.1	.	.	.	.	.	.	.	.	.	.	C	13.64	2.298325	0.40694	.	.	ENSG00000152977	ENST00000282928	D	0.96396	-4.0	3.86	3.86	0.44501	.	0.190591	0.44688	D	0.000432	D	0.91713	0.7380	N	0.12182	0.205	0.43000	D	0.994515	B	0.17038	0.02	B	0.32211	0.142	D	0.87772	0.2606	10	0.18276	T	0.48	.	16.1416	0.81528	0.0:1.0:0.0:0.0	.	236	Q15915	ZIC1_HUMAN	G	236	ENSP00000282928:A236G	ENSP00000282928:A236G	A	+	2	0	ZIC1	148611296	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.066000	0.50002	1.857000	0.53885	0.561000	0.74099	GCC	.		0.587	ZIC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355497.1	NM_003412	
TNIP2	79155	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	2746482	2746482	+	Missense_Mutation	SNP	G	G	A	rs150823075		TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr4:2746482G>A	ENST00000315423.7	-	4	934	c.848C>T	c.(847-849)gCg>gTg	p.A283V	TNIP2_ENST00000505186.1_5'UTR|TNIP2_ENST00000510267.1_Missense_Mutation_p.A176V|TNIP2_ENST00000503235.1_Intron	NM_024309.3	NP_077285.3			TNFAIP3 interacting protein 2											breast(2)|central_nervous_system(1)|large_intestine(4)|lung(6)|prostate(1)	14				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CCTGGAGGCCGCCAGCTCCTG	0.607																																					p.A283V		.											.	TNIP2-90	0			c.C848T						.	G	VAL/ALA,VAL/ALA	0,4406		0,0,2203	44.0	50.0	48.0		527,848	2.7	0.6	4	dbSNP_134	48	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	TNIP2	NM_001161527.1,NM_024309.3	64,64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	176/323,283/430	2746482	1,13005	2203	4300	6503	SO:0001583	missense	79155	exon4			GAGGCCGCCAGCT	BC002740	CCDS3362.1, CCDS54714.1, CCDS75093.1	4p16.3	2008-08-01			ENSG00000168884	ENSG00000168884			19118	protein-coding gene	gene with protein product		610669				11390377, 12933576	Standard	NM_024309		Approved	ABIN-2, MGC4289, KLIP, FLIP1	uc003gfg.2	Q8NFZ5	OTTHUMG00000090267	ENST00000315423.7:c.848C>T	4.37:g.2746482G>A	ENSP00000321203:p.Ala283Val	Somatic	124	0		WXS	Illumina HiSeq	Phase_I	107	46	NM_024309	0	0	24	42	18		Missense_Mutation	SNP	ENST00000315423.7	37	CCDS3362.1	.	.	.	.	.	.	.	.	.	.	G	11.55	1.671911	0.29693	0.0	1.16E-4	ENSG00000168884	ENST00000510267;ENST00000315423	T;T	0.46063	0.88;0.88	5.66	2.71	0.32032	.	0.165365	0.52532	D	0.000076	T	0.24928	0.0605	L	0.35723	1.085	0.80722	D	1	P	0.35155	0.487	B	0.19666	0.026	T	0.05435	-1.0885	10	0.42905	T	0.14	-8.1276	7.0861	0.25257	0.0878:0.0:0.3927:0.5195	.	283	Q8NFZ5	TNIP2_HUMAN	V	176;283	ENSP00000427613:A176V;ENSP00000321203:A283V	ENSP00000321203:A283V	A	-	2	0	TNIP2	2716280	0.729000	0.28090	0.600000	0.28864	0.114000	0.19823	1.029000	0.30140	0.754000	0.32968	0.555000	0.69702	GCG	G|1.000;A|0.000		0.607	TNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206589.5	NM_024309	
DCUN1D4	23142	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	4	52765463	52765463	+	Silent	SNP	T	T	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr4:52765463T>C	ENST00000334635.5	+	8	714	c.534T>C	c.(532-534)aaT>aaC	p.N178N	DCUN1D4_ENST00000381441.3_Silent_p.N178N|DCUN1D4_ENST00000451288.2_Silent_p.N222N|DCUN1D4_ENST00000381437.4_Silent_p.N118N	NM_001040402.1	NP_001035492.1	Q92564	DCNL4_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 4	178	DCUN1. {ECO:0000255|PROSITE- ProRule:PRU00574}.					nucleus (GO:0005634)				endometrium(2)|large_intestine(2)|lung(2)|ovary(2)|skin(1)	9			GBM - Glioblastoma multiforme(4;1.93e-11)|LUSC - Lung squamous cell carcinoma(32;0.00654)			AACTCAGAAATACTTTGGATT	0.299																																					p.N178N		.											.	DCUN1D4-92	0			c.T534C						.						39.0	41.0	41.0					4																	52765463		2201	4297	6498	SO:0001819	synonymous_variant	23142	exon8			CAGAAATACTTTG	D87466	CCDS3487.2, CCDS33982.1, CCDS75123.1	4q11	2013-06-10	2013-06-10		ENSG00000109184	ENSG00000109184			28998	protein-coding gene	gene with protein product		612977	"""DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)"""			15988528	Standard	XM_005265731		Approved	KIAA0276	uc003gze.3	Q92564	OTTHUMG00000128700	ENST00000334635.5:c.534T>C	4.37:g.52765463T>C		Somatic	17	0		WXS	Illumina HiSeq	Phase_I	25	10	NM_015115	0	0	3	4	1	B4DH25|Q7Z3F3|Q7Z6B8	Silent	SNP	ENST00000334635.5	37	CCDS33982.1																																																																																			.		0.299	DCUN1D4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250599.2	NM_015115	
PDE5A	8654	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	120446828	120446828	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr4:120446828T>A	ENST00000354960.3	-	12	1974	c.1655A>T	c.(1654-1656)cAg>cTg	p.Q552L	PDE5A_ENST00000394439.1_Missense_Mutation_p.Q500L|PDE5A_ENST00000512739.1_5'UTR|RP11-33B1.1_ENST00000498873.1_RNA|PDE5A_ENST00000264805.5_Missense_Mutation_p.Q510L	NM_001083.3	NP_001074.2	O76074	PDE5A_HUMAN	phosphodiesterase 5A, cGMP-specific	552					blood coagulation (GO:0007596)|cGMP catabolic process (GO:0046069)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of oocyte development (GO:0060282)|relaxation of cardiac muscle (GO:0055119)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|kidney(3)|large_intestine(8)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	27					Avanafil(DB06237)|Caffeine(DB00201)|Dipyridamole(DB00975)|Pentoxifylline(DB00806)|Sildenafil(DB00203)|Tadalafil(DB00820)|Theophylline(DB00277)|Udenafil(DB06267)|Vardenafil(DB00862)	TTTAAGGGTCTGGGCAGATGG	0.413																																					p.Q552L		.											.	PDE5A-90	0			c.A1655T						.						105.0	101.0	103.0					4																	120446828		2203	4300	6503	SO:0001583	missense	8654	exon12			AGGGTCTGGGCAG	D89094	CCDS3713.1, CCDS34055.1	4q27	2008-05-15			ENSG00000138735	ENSG00000138735	3.1.4.17	"""Phosphodiesterases"""	8784	protein-coding gene	gene with protein product		603310				9714779, 9642111	Standard	NM_033437		Approved		uc003idh.3	O76074	OTTHUMG00000132971	ENST00000354960.3:c.1655A>T	4.37:g.120446828T>A	ENSP00000347046:p.Gln552Leu	Somatic	61	1		WXS	Illumina HiSeq	Phase_I	104	41	NM_001083	0	0	0	0	0	A0AV69|A8K2C4|O75026|O75887|Q86UI0|Q86V66|Q9Y6Z6	Missense_Mutation	SNP	ENST00000354960.3	37	CCDS3713.1	.	.	.	.	.	.	.	.	.	.	T	19.29	3.799045	0.70567	.	.	ENSG00000138735	ENST00000354960;ENST00000394439;ENST00000264805	T;T;T	0.49720	0.77;0.77;0.77	5.06	5.06	0.68205	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	0.114545	0.64402	D	0.000012	T	0.36880	0.0983	L	0.31065	0.9	0.80722	D	1	B;B	0.16396	0.017;0.015	B;B	0.15870	0.014;0.011	T	0.12477	-1.0546	10	0.28530	T	0.3	.	14.82	0.70065	0.0:0.0:0.0:1.0	.	552;510	O76074;O76074-2	PDE5A_HUMAN;.	L	552;500;510	ENSP00000347046:Q552L;ENSP00000377957:Q500L;ENSP00000264805:Q510L	ENSP00000264805:Q510L	Q	-	2	0	PDE5A	120666276	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	1.906000	0.55180	0.533000	0.62120	CAG	.		0.413	PDE5A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256529.1	NM_001083	
TBC1D9	23158	hgsc.bcm.edu	37	4	141590820	141590820	+	Silent	SNP	G	G	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr4:141590820G>T	ENST00000442267.2	-	8	1479	c.1405C>A	c.(1405-1407)Cgg>Agg	p.R469R		NM_015130.2	NP_055945.2	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	469							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	31	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				GGAGACCGCCGCCGATACATG	0.493																																					p.R469R		.											.	TBC1D9-23	0			c.C1405A						.						49.0	55.0	53.0					4																	141590820		2044	4169	6213	SO:0001819	synonymous_variant	23158	exon8			ACCGCCGCCGATA	AB020689	CCDS47136.1	4q31.1	2013-01-10	2006-07-12		ENSG00000109436	ENSG00000109436		"""EF-hand domain containing"""	21710	protein-coding gene	gene with protein product			"""TBC1 domain family, member 9"""			12970790	Standard	NM_015130		Approved	KIAA0882, MDR1	uc010ioj.3	Q6ZT07	OTTHUMG00000161405	ENST00000442267.2:c.1405C>A	4.37:g.141590820G>T		Somatic	42	0		WXS	Illumina HiSeq	Phase_I	37	2	NM_015130	0	0	11	11	0	A6H8U8|D3DNZ1|O94958	Silent	SNP	ENST00000442267.2	37	CCDS47136.1																																																																																			.		0.493	TBC1D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364806.1	NM_015130	
HMGB2	3148	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	174254247	174254247	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr4:174254247T>C	ENST00000296503.5	-	3	1142	c.269A>G	c.(268-270)aAg>aGg	p.K90R	HMGB2_ENST00000438704.2_Missense_Mutation_p.K90R|HMGB2_ENST00000446922.2_Missense_Mutation_p.K90R			P26583	HMGB2_HUMAN	high mobility group box 2	90					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|base-excision repair, DNA ligation (GO:0006288)|cell chemotaxis (GO:0060326)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to lipopolysaccharide (GO:0071222)|chromatin organization (GO:0006325)|DNA ligation involved in DNA repair (GO:0051103)|DNA topological change (GO:0006265)|male gonad development (GO:0008584)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive chemotaxis (GO:0050918)|positive regulation of DNA binding (GO:0043388)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of nuclease activity (GO:0032075)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to steroid hormone (GO:0048545)|spermatid nucleus differentiation (GO:0007289)|V(D)J recombination (GO:0033151)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	chemoattractant activity (GO:0042056)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RAGE receptor binding (GO:0050786)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription regulatory region DNA binding (GO:0044212)	p.K90R(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|urinary_tract(3)	14		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;9.58e-18)|Epithelial(43;3.75e-16)|OV - Ovarian serous cystadenocarcinoma(60;6.24e-09)|STAD - Stomach adenocarcinoma(60;0.00273)|GBM - Glioblastoma multiforme(59;0.0064)|LUSC - Lung squamous cell carcinoma(193;0.0903)|Kidney(143;0.249)		ATTGGGGTCCTTTTTCTTCCC	0.398																																					p.K90R		.											.	HMGB2-650	1	Substitution - Missense(1)	endometrium(1)	c.A269G						.						222.0	233.0	229.0					4																	174254247		2203	4300	6503	SO:0001583	missense	3148	exon2			GGGTCCTTTTTCT		CCDS3816.1	4q31	2011-07-01	2011-04-05	2002-08-16	ENSG00000164104	ENSG00000164104		"""High-mobility group / Canonical"""	5000	protein-coding gene	gene with protein product		163906	"""high-mobility group (nonhistone chromosomal) protein 2"", ""high-mobility group box 2"""	HMG2		1754403	Standard	NM_002129		Approved		uc011ckc.1	P26583	OTTHUMG00000160799	ENST00000296503.5:c.269A>G	4.37:g.174254247T>C	ENSP00000296503:p.Lys90Arg	Somatic	226	0		WXS	Illumina HiSeq	Phase_I	276	104	NM_001130689	0	0	41	65	24	B2R4K8|D3DP37|Q5U072	Missense_Mutation	SNP	ENST00000296503.5	37	CCDS3816.1	.	.	.	.	.	.	.	.	.	.	T	14.16	2.451760	0.43531	.	.	ENSG00000164104	ENST00000296503;ENST00000446922;ENST00000438704;ENST00000506267	D;D;D;D	0.94687	-3.49;-3.49;-3.49;-3.49	5.06	5.06	0.68205	High mobility group, superfamily (1);	0.000000	0.64402	D	0.000001	D	0.96883	0.8982	M	0.81802	2.56	0.58432	D	0.99999	P	0.48350	0.909	D	0.65987	0.94	D	0.96930	0.9680	10	0.51188	T	0.08	.	14.1447	0.65344	0.0:0.0:0.0:1.0	.	90	P26583	HMGB2_HUMAN	R	90	ENSP00000296503:K90R;ENSP00000393448:K90R;ENSP00000404912:K90R;ENSP00000423001:K90R	ENSP00000296503:K90R	K	-	2	0	HMGB2	174490822	1.000000	0.71417	1.000000	0.80357	0.122000	0.20287	7.626000	0.83164	2.122000	0.65172	0.460000	0.39030	AAG	.		0.398	HMGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362362.1	NM_001130688	
SNX25	83891	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	186188140	186188140	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr4:186188140G>A	ENST00000504273.1	+	5	724	c.430G>A	c.(430-432)Gag>Aag	p.E144K	SNX25_ENST00000264694.8_Missense_Mutation_p.E144K			Q9H3E2	SNX25_HUMAN	sorting nexin 25	144	PXA. {ECO:0000255|PROSITE- ProRule:PRU00147, ECO:0000255|PROSITE- ProRule:PRU00553}.				negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein transport (GO:0015031)|receptor catabolic process (GO:0032801)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)	p.E144Q(1)		NS(1)|breast(4)|endometrium(2)|kidney(4)|large_intestine(8)|lung(13)|ovary(2)|pancreas(2)|prostate(2)|urinary_tract(2)	40		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		GCCGGTAGTGGAGTTACTGAG	0.423																																					p.E144K		.											.	SNX25-273	1	Substitution - Missense(1)	lung(1)	c.G430A						.						78.0	72.0	74.0					4																	186188140		2203	4300	6503	SO:0001583	missense	83891	exon5			GTAGTGGAGTTAC	AF113223	CCDS34116.1	4q35.1	2011-05-03			ENSG00000109762	ENSG00000109762		"""Sorting nexins"""	21883	protein-coding gene	gene with protein product						12461558	Standard	NM_031953		Approved	SBBI31	uc003ixh.3	Q9H3E2	OTTHUMG00000160475	ENST00000504273.1:c.430G>A	4.37:g.186188140G>A	ENSP00000426255:p.Glu144Lys	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	95	39	NM_031953	0	0	1	3	2	Q3ZT30|Q8N6K3	Missense_Mutation	SNP	ENST00000504273.1	37	CCDS34116.1	.	.	.	.	.	.	.	.	.	.	G	15.53	2.860679	0.51482	.	.	ENSG00000109762	ENST00000504273;ENST00000264694	T;T	0.10192	2.9;2.9	5.16	4.32	0.51571	Phox-associated domain (2);	0.188926	0.44688	D	0.000437	T	0.14227	0.0344	L	0.53249	1.67	0.42561	D	0.993145	P	0.35493	0.505	B	0.38803	0.282	T	0.04140	-1.0974	10	0.36615	T	0.2	-5.5611	13.8858	0.63708	0.0734:0.0:0.9266:0.0	.	144	Q9H3E2	SNX25_HUMAN	K	144	ENSP00000426255:E144K;ENSP00000264694:E144K	ENSP00000264694:E144K	E	+	1	0	SNX25	186425134	1.000000	0.71417	0.427000	0.26684	0.993000	0.82548	7.437000	0.80417	1.402000	0.46780	0.591000	0.81541	GAG	.		0.423	SNX25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360756.1	NM_031953	
CLPTM1L	81037	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	1323010	1323010	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr5:1323010T>C	ENST00000320895.5	-	13	1554	c.1297A>G	c.(1297-1299)Atc>Gtc	p.I433V	CLPTM1L_ENST00000506641.1_5'UTR|CLPTM1L_ENST00000507807.1_Missense_Mutation_p.I264V|CLPTM1L_ENST00000320927.6_Missense_Mutation_p.I397V	NM_030782.3	NP_110409.2	Q96KA5	CLP1L_HUMAN	CLPTM1-like	433					apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24	Lung NSC(6;5.78e-14)|all_lung(6;4.47e-13)|all_epithelial(6;4.47e-09)		Epithelial(17;0.00931)|OV - Ovarian serous cystadenocarcinoma(19;0.0116)|all cancers(22;0.0181)	KIRC - Kidney renal clear cell carcinoma(5;0.177)|Kidney(13;0.208)		AAGCTGTTGATTAACCAGGAG	0.388																																					p.I433V		.											.	CLPTM1L-153	0			c.A1297G						.						152.0	150.0	151.0					5																	1323010		2203	4300	6503	SO:0001583	missense	81037	exon13			TGTTGATTAACCA	AK027306	CCDS3862.1	5p15.33	2008-02-05			ENSG00000049656	ENSG00000049656			24308	protein-coding gene	gene with protein product	"""cisplatin resistance related protein"""	612585				11162647	Standard	NM_030782		Approved	FLJ14400, CRR9	uc003jch.3	Q96KA5	OTTHUMG00000131015	ENST00000320895.5:c.1297A>G	5.37:g.1323010T>C	ENSP00000313854:p.Ile433Val	Somatic	111	0		WXS	Illumina HiSeq	Phase_I	143	42	NM_030782	0	0	18	34	16	D3DTC1|Q658W6|Q7LG29|Q96AZ0|Q9H3N4	Missense_Mutation	SNP	ENST00000320895.5	37	CCDS3862.1	.	.	.	.	.	.	.	.	.	.	T	12.47	1.947015	0.34377	.	.	ENSG00000049656	ENST00000320895;ENST00000507807;ENST00000320927	T;T;T	0.51817	0.69;0.8;0.78	4.58	3.39	0.38822	.	0.047837	0.85682	D	0.000000	T	0.32556	0.0833	N	0.26042	0.785	0.54753	D	0.999983	B;B	0.06786	0.001;0.001	B;B	0.14023	0.005;0.01	T	0.07009	-1.0795	10	0.35671	T	0.21	-39.5635	9.5543	0.39328	0.0:0.087:0.0:0.913	.	433;264	Q96KA5;G5E9Z2	CLP1L_HUMAN;.	V	433;264;397	ENSP00000313854:I433V;ENSP00000423321:I264V;ENSP00000315196:I397V	ENSP00000313854:I433V	I	-	1	0	CLPTM1L	1376010	1.000000	0.71417	0.825000	0.32803	0.932000	0.56968	4.256000	0.58810	0.694000	0.31654	0.402000	0.26972	ATC	.		0.388	CLPTM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253649.2	NM_030782	
ADAMTS16	170690	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	5240027	5240027	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr5:5240027C>G	ENST00000274181.7	+	16	2650	c.2512C>G	c.(2512-2514)Ctg>Gtg	p.L838V		NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	838	Spacer.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						CAACGAGACACTGATTGTGGA	0.478																																					p.L838V		.											.	ADAMTS16-275	0			c.C2512G						.						86.0	83.0	84.0					5																	5240027		1878	4117	5995	SO:0001583	missense	170690	exon16			GAGACACTGATTG	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.2512C>G	5.37:g.5240027C>G	ENSP00000274181:p.Leu838Val	Somatic	127	0		WXS	Illumina HiSeq	Phase_I	135	15	NM_139056	0	0	0	0	0	C6G490|Q8IVE2	Missense_Mutation	SNP	ENST00000274181.7	37	CCDS43299.1	.	.	.	.	.	.	.	.	.	.	C	13.73	2.325582	0.41197	.	.	ENSG00000145536	ENST00000274181;ENST00000536857	T	0.61742	0.08	5.56	3.45	0.39498	ADAM-TS Spacer 1 (1);	0.000000	0.64402	D	0.000013	T	0.70325	0.3211	M	0.62266	1.93	0.48452	D	0.999658	D;D	0.89917	1.0;0.991	D;D	0.87578	0.998;0.919	T	0.69450	-0.5142	10	0.36615	T	0.2	.	12.5248	0.56079	0.0:0.8343:0.0:0.1657	.	838;838	Q8TE57;Q8TE57-2	ATS16_HUMAN;.	V	838	ENSP00000274181:L838V	ENSP00000274181:L838V	L	+	1	2	ADAMTS16	5293027	0.864000	0.29904	0.134000	0.22075	0.299000	0.27559	1.676000	0.37565	1.352000	0.45808	0.655000	0.94253	CTG	.		0.478	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056	
PDZD2	23037	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	32059458	32059458	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr5:32059458C>A	ENST00000438447.1	+	13	2702	c.2314C>A	c.(2314-2316)Ctg>Atg	p.L772M	PDZD2_ENST00000282493.3_Missense_Mutation_p.L772M			O15018	PDZD2_HUMAN	PDZ domain containing 2	772	PDZ 4. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						GGAGAGCAACCTGAGGTTTGT	0.448																																					p.L772M		.											.	PDZD2-563	0			c.C2314A						.						102.0	88.0	93.0					5																	32059458		2203	4300	6503	SO:0001583	missense	23037	exon12			AGCAACCTGAGGT	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.2314C>A	5.37:g.32059458C>A	ENSP00000402033:p.Leu772Met	Somatic	50	0		WXS	Illumina HiSeq	Phase_I	53	20	NM_178140	0	0	0	0	0	Q9BXD4	Missense_Mutation	SNP	ENST00000438447.1	37	CCDS34137.1	.	.	.	.	.	.	.	.	.	.	C	20.0	3.930044	0.73327	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.50001	0.76;0.76	5.79	3.98	0.46160	PDZ/DHR/GLGF (4);	0.000000	0.36268	N	0.002696	T	0.71896	0.3394	M	0.91249	3.19	0.40854	D	0.983775	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.77292	-0.2642	10	0.72032	D	0.01	.	10.7091	0.45973	0.0:0.8633:0.0:0.1367	.	598;772	B4E3P2;O15018	.;PDZD2_HUMAN	M	772;591;772	ENSP00000402033:L772M;ENSP00000282493:L772M	ENSP00000282493:L772M	L	+	1	2	PDZD2	32095215	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	2.741000	0.47426	2.726000	0.93360	0.655000	0.94253	CTG	.		0.448	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1		
C5orf42	65250	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	37181023	37181023	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr5:37181023C>T	ENST00000508244.1	-	26	5599	c.5506G>A	c.(5506-5508)Gta>Ata	p.V1836I	C5orf42_ENST00000425232.2_Missense_Mutation_p.V1836I|C5orf42_ENST00000274258.7_Missense_Mutation_p.V717I			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	1836						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			GGAGTTGCTACTGCAACTGAA	0.403																																					p.V1836I		.											.	C5orf42-94	0			c.G5506A						.						72.0	67.0	69.0					5																	37181023		2203	4300	6503	SO:0001583	missense	65250	exon27			TTGCTACTGCAAC		CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.5506G>A	5.37:g.37181023C>T	ENSP00000421690:p.Val1836Ile	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	65	24	NM_023073	0	0	0	0	0	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	ENST00000508244.1	37	CCDS34146.2	.	.	.	.	.	.	.	.	.	.	C	12.91	2.078569	0.36662	.	.	ENSG00000197603	ENST00000508244;ENST00000425232;ENST00000274258;ENST00000514429;ENST00000388739	T;T;T;T	0.20200	2.09;2.09;2.09;2.09	5.91	1.94	0.25998	.	2.430320	0.01888	N	0.038363	T	0.19604	0.0471	L	0.40543	1.245	0.09310	N	1	P;B	0.34724	0.465;0.386	B;B	0.31101	0.124;0.124	T	0.29119	-1.0022	10	0.26408	T	0.33	.	9.6655	0.39981	0.0:0.5185:0.4071:0.0744	.	1836;717	E9PH94;Q9H799	.;CE042_HUMAN	I	1836;1836;717;884;717	ENSP00000421690:V1836I;ENSP00000389014:V1836I;ENSP00000274258:V717I;ENSP00000424223:V884I	ENSP00000274258:V717I	V	-	1	0	C5orf42	37216780	0.021000	0.18746	0.000000	0.03702	0.019000	0.09904	0.036000	0.13819	0.067000	0.16545	0.655000	0.94253	GTA	.		0.403	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073	
DAB2	1601	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	39390645	39390645	+	Silent	SNP	A	A	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr5:39390645A>G	ENST00000320816.6	-	5	830	c.363T>C	c.(361-363)atT>atC	p.I121I	DAB2_ENST00000545653.1_Silent_p.I121I|DAB2_ENST00000339788.6_Silent_p.I121I|DAB2_ENST00000512525.1_5'UTR|DAB2_ENST00000509337.1_Silent_p.I121I	NM_001343.3	NP_001334.2	P98082	DAB2_HUMAN	Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)	121	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cell morphogenesis involved in differentiation (GO:0000904)|cell proliferation (GO:0008283)|cellular response to transforming growth factor beta stimulus (GO:0071560)|clathrin coat assembly (GO:0048268)|endoderm development (GO:0007492)|excretion (GO:0007588)|in utero embryonic development (GO:0001701)|leading edge cell differentiation (GO:0035026)|membrane organization (GO:0061024)|myeloid cell differentiation (GO:0030099)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein binding (GO:0032091)|negative regulation of protein localization to plasma membrane (GO:1903077)|negative regulation of transcription, DNA-templated (GO:0045892)|pinocytosis (GO:0006907)|positive regulation of cell migration (GO:0030335)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of endocytosis (GO:0045807)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor recycling (GO:0001921)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|clathrin coat of coated pit (GO:0030132)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	cargo receptor activity (GO:0038024)|clathrin adaptor activity (GO:0035615)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein C-terminus binding (GO:0008022)|SMAD binding (GO:0046332)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(9)|lung(19)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	47	all_lung(31;0.000197)		Epithelial(62;0.137)			CAATGAAAGAAATCTTATTTA	0.398																																					p.I121I		.											.	DAB2-227	0			c.T363C						.						74.0	78.0	76.0					5																	39390645		2203	4300	6503	SO:0001819	synonymous_variant	1601	exon5			GAAAGAAATCTTA	U53446	CCDS34149.1, CCDS58946.1	5p13.1	2013-10-03	2013-03-08		ENSG00000153071	ENSG00000153071			2662	protein-coding gene	gene with protein product		601236	"""disabled (Drosophila) homolog 2 (mitogen-responsive phosphoprotein)"", ""disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)"""			8660969, 9620555	Standard	NM_001343		Approved	DOC-2	uc003jlx.3	P98082	OTTHUMG00000162043	ENST00000320816.6:c.363T>C	5.37:g.39390645A>G		Somatic	62	0		WXS	Illumina HiSeq	Phase_I	78	34	NM_001343	0	0	32	52	20	A6NES5|Q13598|Q9BTY0|Q9UK04	Silent	SNP	ENST00000320816.6	37	CCDS34149.1																																																																																			.		0.398	DAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367014.1	NM_001343	
DAB2	1601	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	39394411	39394411	+	Silent	SNP	T	T	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr5:39394411T>C	ENST00000320816.6	-	2	479	c.12A>G	c.(10-12)gaA>gaG	p.E4E	DAB2_ENST00000545653.1_Silent_p.E4E|DAB2_ENST00000339788.6_Silent_p.E4E|DAB2_ENST00000512525.1_5'Flank|DAB2_ENST00000509337.1_Silent_p.E4E	NM_001343.3	NP_001334.2	P98082	DAB2_HUMAN	Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)	4					activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cell morphogenesis involved in differentiation (GO:0000904)|cell proliferation (GO:0008283)|cellular response to transforming growth factor beta stimulus (GO:0071560)|clathrin coat assembly (GO:0048268)|endoderm development (GO:0007492)|excretion (GO:0007588)|in utero embryonic development (GO:0001701)|leading edge cell differentiation (GO:0035026)|membrane organization (GO:0061024)|myeloid cell differentiation (GO:0030099)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein binding (GO:0032091)|negative regulation of protein localization to plasma membrane (GO:1903077)|negative regulation of transcription, DNA-templated (GO:0045892)|pinocytosis (GO:0006907)|positive regulation of cell migration (GO:0030335)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of endocytosis (GO:0045807)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor recycling (GO:0001921)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|clathrin coat of coated pit (GO:0030132)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	cargo receptor activity (GO:0038024)|clathrin adaptor activity (GO:0035615)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein C-terminus binding (GO:0008022)|SMAD binding (GO:0046332)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(9)|lung(19)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	47	all_lung(31;0.000197)		Epithelial(62;0.137)			TTGTTTCTACTTCGTTAGACA	0.478																																					p.E4E		.											.	DAB2-227	0			c.A12G						.						147.0	131.0	137.0					5																	39394411		2203	4300	6503	SO:0001819	synonymous_variant	1601	exon2			TTCTACTTCGTTA	U53446	CCDS34149.1, CCDS58946.1	5p13.1	2013-10-03	2013-03-08		ENSG00000153071	ENSG00000153071			2662	protein-coding gene	gene with protein product		601236	"""disabled (Drosophila) homolog 2 (mitogen-responsive phosphoprotein)"", ""disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)"""			8660969, 9620555	Standard	NM_001343		Approved	DOC-2	uc003jlx.3	P98082	OTTHUMG00000162043	ENST00000320816.6:c.12A>G	5.37:g.39394411T>C		Somatic	66	0		WXS	Illumina HiSeq	Phase_I	81	32	NM_001343	0	0	20	46	26	A6NES5|Q13598|Q9BTY0|Q9UK04	Silent	SNP	ENST00000320816.6	37	CCDS34149.1																																																																																			.		0.478	DAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367014.1	NM_001343	
PLK2	10769	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	5	57753133	57753133	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr5:57753133C>T	ENST00000274289.3	-	7	1183	c.883G>A	c.(883-885)Gca>Aca	p.A295T	PLK2_ENST00000502671.1_5'UTR	NM_001252226.1|NM_006622.3	NP_001239155.1|NP_006613.2	Q9NYY3	PLK2_HUMAN	polo-like kinase 2	295	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				G1/S transition of mitotic cell cycle (GO:0000082)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|mitotic cell cycle checkpoint (GO:0007093)|mitotic spindle organization (GO:0007052)|negative regulation of apoptotic process (GO:0043066)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein phosphorylation (GO:0006468)|Rap protein signal transduction (GO:0032486)|Ras protein signal transduction (GO:0007265)|regulation of centriole replication (GO:0046599)|regulation of synaptic plasticity (GO:0048167)	centriole (GO:0005814)|centrosome (GO:0005813)|dendrite (GO:0030425)|intracellular (GO:0005622)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			endometrium(7)|large_intestine(7)|lung(5)|ovary(3)|prostate(2)|skin(2)	26		all_cancers(5;1.76e-12)|all_epithelial(5;2.09e-13)|all_lung(5;6.64e-05)|Lung NSC(5;0.000127)|Prostate(74;0.055)|Breast(144;0.0602)|Ovarian(174;0.182)		OV - Ovarian serous cystadenocarcinoma(10;7.03e-37)		GTATACCTTGCTTCCCTTATG	0.433																																					p.A295T		.											.	PLK2-409	0			c.G883A						.						79.0	76.0	77.0					5																	57753133		2203	4300	6503	SO:0001583	missense	10769	exon7			ACCTTGCTTCCCT		CCDS3974.1, CCDS75250.1	5q12.1-q13.2	2013-01-18	2010-06-24		ENSG00000145632	ENSG00000145632			19699	protein-coding gene	gene with protein product	"""serum-inducible kinase"""	607023	"""polo-like kinase 2 (Drosophila)"""				Standard	NM_006622		Approved	SNK	uc003jrn.3	Q9NYY3	OTTHUMG00000097047	ENST00000274289.3:c.883G>A	5.37:g.57753133C>T	ENSP00000274289:p.Ala295Thr	Somatic	40	0		WXS	Illumina HiSeq	Phase_I	48	14	NM_006622	0	0	11	16	5	O60679|Q96CV7|Q9UE61	Missense_Mutation	SNP	ENST00000274289.3	37	CCDS3974.1	.	.	.	.	.	.	.	.	.	.	C	35	5.479369	0.96307	.	.	ENSG00000145632	ENST00000274289;ENST00000537944;ENST00000442330	T	0.64618	-0.11	5.27	5.27	0.74061	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.70055	0.3180	L	0.33624	1.015	0.80722	D	1	D	0.64830	0.994	D	0.65140	0.932	T	0.69363	-0.5165	10	0.40728	T	0.16	-15.6861	18.9292	0.92558	0.0:1.0:0.0:0.0	.	295	Q9NYY3	PLK2_HUMAN	T	295;295;281	ENSP00000274289:A295T	ENSP00000274289:A295T	A	-	1	0	PLK2	57788890	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.388000	0.79795	2.461000	0.83175	0.655000	0.94253	GCA	.		0.433	PLK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214150.1	NM_006622	
GPR98	84059	hgsc.bcm.edu	37	5	89949707	89949707	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr5:89949707A>G	ENST00000405460.2	+	20	4412	c.4316A>G	c.(4315-4317)tAc>tGc	p.Y1439C		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	1439					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		ATCGAATTCTACCTGGATGGA	0.408																																					p.Y1439C		.											.	GPR98-103	0			c.A4316G						.						36.0	33.0	34.0					5																	89949707		1860	4083	5943	SO:0001583	missense	84059	exon20			AATTCTACCTGGA	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.4316A>G	5.37:g.89949707A>G	ENSP00000384582:p.Tyr1439Cys	Somatic	14	1		WXS	Illumina HiSeq	Phase_I	9	2	NM_032119	0	0	0	0	0	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	A	17.45	3.392953	0.62066	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043	D	0.88354	-2.37	5.38	5.38	0.77491	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.169125	0.53938	D	0.000057	D	0.93128	0.7812	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.93579	0.6911	10	0.87932	D	0	.	11.1862	0.48657	0.8624:0.0:0.0:0.1376	.	1439	Q8WXG9	GPR98_HUMAN	C	1439	ENSP00000384582:Y1439C	ENSP00000296619:Y1439C	Y	+	2	0	GPR98	89985463	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.831000	0.69330	2.044000	0.60594	0.528000	0.53228	TAC	.		0.408	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
FBN2	2201	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	127641530	127641530	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr5:127641530G>C	ENST00000508053.1	-	49	6507	c.5533C>G	c.(5533-5535)Ctg>Gtg	p.L1845V	FBN2_ENST00000262464.4_Missense_Mutation_p.L1845V			P35556	FBN2_HUMAN	fibrillin 2	1845	EGF-like 29; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CAAACCAACAGCAGGTCATTG	0.363																																					p.L1845V		.											.	FBN2-146	0			c.C5533G						.						123.0	118.0	120.0					5																	127641530		2203	4300	6503	SO:0001583	missense	2201	exon43			CCAACAGCAGGTC	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.5533C>G	5.37:g.127641530G>C	ENSP00000424571:p.Leu1845Val	Somatic	88	0		WXS	Illumina HiSeq	Phase_I	122	11	NM_001999	0	0	0	0	0	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.015309	0.75161	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	D;D	0.95554	-3.74;-3.74	5.24	5.24	0.73138	EGF-like region, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.53938	D	0.000045	D	0.95548	0.8553	L	0.50333	1.59	0.35026	D	0.758342	D	0.55605	0.972	P	0.54346	0.749	D	0.94672	0.7857	10	0.16896	T	0.51	.	19.3745	0.94503	0.0:0.0:1.0:0.0	.	1845	P35556	FBN2_HUMAN	V	1845	ENSP00000262464:L1845V;ENSP00000424571:L1845V	ENSP00000262464:L1845V	L	-	1	2	FBN2	127669429	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	6.312000	0.72840	2.880000	0.98712	0.650000	0.86243	CTG	.		0.363	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
RUFY1	80230	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	178987050	178987050	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr5:178987050A>G	ENST00000319449.4	+	2	347	c.335A>G	c.(334-336)gAg>gGg	p.E112G	RUFY1_ENST00000437570.2_Missense_Mutation_p.E4G|RUFY1_ENST00000377001.2_Missense_Mutation_p.E112G|RUFY1_ENST00000393438.2_Missense_Mutation_p.E4G	NM_025158.4	NP_079434.3	Q96T51	RUFY1_HUMAN	RUN and FYVE domain containing 1	112					endocytosis (GO:0006897)|regulation of endocytosis (GO:0030100)	cytoplasm (GO:0005737)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	lipid binding (GO:0008289)|protein transporter activity (GO:0008565)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	26	all_cancers(89;0.00018)|all_epithelial(37;8.37e-05)|Renal(175;0.000159)|Lung NSC(126;0.00108)|all_lung(126;0.00195)	all_cancers(40;0.0322)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ATGATGGAGGAGCGTGCCAAC	0.597										HNSCC(44;0.11)																											p.E112G		.											.	RUFY1-157	0			c.A335G						.						82.0	59.0	67.0					5																	178987050		2203	4300	6503	SO:0001583	missense	80230	exon2			TGGAGGAGCGTGC	AF361055	CCDS4445.2, CCDS34312.1	5q35.3	2008-02-05			ENSG00000176783	ENSG00000176783		"""Zinc fingers, FYVE domain containing"""	19760	protein-coding gene	gene with protein product		610327				11877430	Standard	NM_001040451		Approved	FLJ22251, ZFYVE12, RABIP4	uc003mka.2	Q96T51	OTTHUMG00000130913	ENST00000319449.4:c.335A>G	5.37:g.178987050A>G	ENSP00000325594:p.Glu112Gly	Somatic	38	0		WXS	Illumina HiSeq	Phase_I	32	17	NM_025158	0	0	2	3	1	Q59FF3|Q71S93|Q9H6I3	Missense_Mutation	SNP	ENST00000319449.4	37	CCDS4445.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	34|34	5.405080|5.405080	0.96051|0.96051	.|.	.|.	ENSG00000176783|ENSG00000176783	ENST00000319449;ENST00000377001;ENST00000437570;ENST00000393438|ENST00000502984	T;T;T;T|.	0.12984|.	2.63;2.63;2.63;2.63|.	5.56|5.56	5.56|5.56	0.83823|0.83823	.|.	0.098275|.	0.64402|.	D|.	0.000002|.	T|T	0.77082|0.77082	0.4078|0.4078	M|M	0.80982|0.80982	2.52|2.52	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.87578|.	0.998|.	T|T	0.78663|0.78663	-0.2116|-0.2116	10|5	0.87932|.	D|.	0|.	-27.8219|-27.8219	15.7239|15.7239	0.77736|0.77736	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	112|.	Q96T51|.	RUFY1_HUMAN|.	G|G	112;112;4;4|70	ENSP00000325594:E112G;ENSP00000366200:E112G;ENSP00000390025:E4G;ENSP00000377087:E4G|.	ENSP00000325594:E112G|.	E|S	+|+	2|1	0|0	RUFY1|RUFY1	178919656|178919656	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	7.223000|7.223000	0.78033|0.78033	2.128000|2.128000	0.65567|0.65567	0.459000|0.459000	0.35465|0.35465	GAG|AGC	.		0.597	RUFY1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253505.2	NM_001040451	
KIF13A	63971	hgsc.bcm.edu	37	6	17771374	17771374	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr6:17771374C>G	ENST00000259711.6	-	38	4657	c.4552G>C	c.(4552-4554)Gaa>Caa	p.E1518Q	KIF13A_ENST00000378843.2_Intron|KIF13A_ENST00000378814.5_Intron|KIF13A_ENST00000378816.5_Intron|KIF13A_ENST00000378826.2_Intron	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	1518					ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			CTATTGTGTTCTACTGGCATG	0.483																																					p.E1518Q		.											.	KIF13A-137	0			c.G4552C						.						158.0	152.0	154.0					6																	17771374		2012	4187	6199	SO:0001583	missense	63971	exon38			TGTGTTCTACTGG	AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.4552G>C	6.37:g.17771374C>G	ENSP00000259711:p.Glu1518Gln	Somatic	40	0		WXS	Illumina HiSeq	Phase_I	23	2	NM_022113	0	0	6	6	0	A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Missense_Mutation	SNP	ENST00000259711.6	37	CCDS47381.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.621578	0.87460	.	.	ENSG00000137177	ENST00000502297;ENST00000259711	T;T	0.73469	1.71;-0.75	6.03	6.03	0.97812	.	0.495687	0.20555	N	0.090024	T	0.48333	0.1494	N	0.24115	0.695	0.80722	D	1	P	0.35363	0.497	B	0.26202	0.067	T	0.51826	-0.8656	10	0.21540	T	0.41	.	20.1519	0.98089	0.0:1.0:0.0:0.0	.	1518	Q9H1H9	KI13A_HUMAN	Q	522;1518	ENSP00000425616:E522Q;ENSP00000259711:E1518Q	ENSP00000259711:E1518Q	E	-	1	0	KIF13A	17879353	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.911000	0.56378	2.861000	0.98227	0.655000	0.94253	GAA	.		0.483	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039954.4		
DDAH2	23564	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	31696435	31696435	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr6:31696435C>T	ENST00000375789.2	-	2	1015	c.385G>A	c.(385-387)Gtt>Att	p.V129I	DDAH2_ENST00000375792.3_Missense_Mutation_p.V129I|DDAH2_ENST00000375787.2_Missense_Mutation_p.V129I|DDAH2_ENST00000480913.1_5'UTR			O95865	DDAH2_HUMAN	dimethylarginine dimethylaminohydrolase 2	129					arginine catabolic process (GO:0006527)|citrulline metabolic process (GO:0000052)|negative regulation of apoptotic process (GO:0043066)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of nitric oxide biosynthetic process (GO:0045429)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|catalytic activity (GO:0003824)|dimethylargininase activity (GO:0016403)			endometrium(1)|large_intestine(3)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	11					L-Citrulline(DB00155)	GTGAAGAGAACGTCAGTGCCA	0.572																																					p.V129I		.											.	DDAH2-90	0			c.G385A						.						71.0	55.0	61.0					6																	31696435		1511	2709	4220	SO:0001583	missense	23564	exon3			AGAGAACGTCAGT	AF070667	CCDS4718.1	6p21	2010-02-17			ENSG00000213722	ENSG00000213722	3.5.3.18		2716	protein-coding gene	gene with protein product		604744				10493931	Standard	XM_005248974		Approved		uc003nwq.3	O95865	OTTHUMG00000031212	ENST00000375789.2:c.385G>A	6.37:g.31696435C>T	ENSP00000364945:p.Val129Ile	Somatic	53	0		WXS	Illumina HiSeq	Phase_I	44	18	NM_013974	0	0	1	2	1	A2BEZ7	Missense_Mutation	SNP	ENST00000375789.2	37	CCDS4718.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.08|13.08	2.130498|2.130498	0.37630|0.37630	.|.	.|.	ENSG00000213722|ENSG00000213722	ENST00000437288|ENST00000375789;ENST00000375787;ENST00000375792;ENST00000416410;ENST00000436437	.|.	.|.	.|.	4.99|4.99	4.99|4.99	0.66335|0.66335	.|.	.|0.130895	.|0.50627	.|D	.|0.000101	T|T	0.32041|0.32041	0.0816|0.0816	L|L	0.45051|0.45051	1.395|1.395	0.40188|0.40188	D|D	0.977377|0.977377	.|B	.|0.33477	.|0.413	.|B	.|0.31290	.|0.127	T|T	0.28808|0.28808	-1.0032|-1.0032	5|9	.|0.38643	.|T	.|0.18	-22.272|-22.272	9.2267|9.2267	0.37412|0.37412	0.0:0.9044:0.0:0.0956|0.0:0.9044:0.0:0.0956	.|.	.|129	.|O95865	.|DDAH2_HUMAN	H|I	34|129	.|.	.|ENSP00000364943:V129I	R|V	-|-	2|1	0|0	DDAH2|DDAH2	31804414|31804414	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.892000|0.892000	0.51952|0.51952	3.286000|3.286000	0.51724|0.51724	2.585000|2.585000	0.87301|0.87301	0.655000|0.655000	0.94253|0.94253	CGT|GTT	.		0.572	DDAH2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076432.2		
GSTA1	2938	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	52658943	52658943	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr6:52658943A>G	ENST00000334575.5	-	5	549	c.394T>C	c.(394-396)Tac>Cac	p.Y132H	GSTA1_ENST00000493331.1_5'UTR	NM_145740.3	NP_665683.1	P08263	GSTA1_HUMAN	glutathione S-transferase alpha 1	132	GST C-terminal.				epithelial cell differentiation (GO:0030855)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|metabolic process (GO:0008152)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glutathione transferase activity (GO:0004364)			large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	12	Lung NSC(77;0.118)				Azathioprine(DB00993)|Busulfan(DB01008)|Glutathione(DB00143)	GCAGGGAAGTAGCGATTTTTT	0.433																																					p.Y132H		.											.	GSTA1-91	0			c.T394C						.						249.0	246.0	247.0					6																	52658943		2203	4300	6503	SO:0001583	missense	2938	exon5			GGAAGTAGCGATT		CCDS4945.1	6p12.2	2012-06-21	2008-11-26		ENSG00000243955	ENSG00000243955	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4626	protein-coding gene	gene with protein product		138359	"""glutathione S-transferase A1"""			9503014	Standard	NM_145740		Approved		uc003paz.3	P08263	OTTHUMG00000014861	ENST00000334575.5:c.394T>C	6.37:g.52658943A>G	ENSP00000335620:p.Tyr132His	Somatic	263	0		WXS	Illumina HiSeq	Phase_I	342	114	NM_145740	0	0	1	1	0	Q14750|Q5GHF8|Q5SZC1	Missense_Mutation	SNP	ENST00000334575.5	37	CCDS4945.1	.	.	.	.	.	.	.	.	.	.	a	13.85	2.359274	0.41801	.	.	ENSG00000243955	ENST00000334575	T	0.02103	4.45	2.58	2.58	0.30949	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	0.157818	0.43579	D	0.000559	T	0.04679	0.0127	M	0.76727	2.345	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.12811	-1.0533	10	0.87932	D	0	.	9.4793	0.38891	1.0:0.0:0.0:0.0	.	132	P08263	GSTA1_HUMAN	H	132	ENSP00000335620:Y132H	ENSP00000335620:Y132H	Y	-	1	0	GSTA1	52766902	0.951000	0.32395	0.003000	0.11579	0.017000	0.09413	5.478000	0.66806	0.928000	0.37168	0.164000	0.16699	TAC	.		0.433	GSTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040922.1		
KCNQ5	56479	hgsc.bcm.edu	37	6	73332281	73332281	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr6:73332281C>G	ENST00000370398.1	+	1	473	c.364C>G	c.(364-366)Ccc>Gcc	p.P122A	KCNQ5_ENST00000355635.3_Missense_Mutation_p.P122A|KCNQ5_ENST00000355194.4_Missense_Mutation_p.P122A|KCNQ5_ENST00000414165.2_Missense_Mutation_p.P122A|KCNQ5_ENST00000370392.1_Missense_Mutation_p.P122A|KCNQ5_ENST00000342056.2_Missense_Mutation_p.P122A|KCNQ5_ENST00000403813.2_Missense_Mutation_p.P122A|KCNQ5_ENST00000402622.2_Missense_Mutation_p.P122A	NM_019842.3	NP_062816.2	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 5	122					protein complex assembly (GO:0006461)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|cervix(1)|endometrium(6)|kidney(7)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	57		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)	Ezogabine(DB04953)	GCTGGAGAGACCCCGCGGCTG	0.662																																					p.P122A	GBM(142;1375 1859 14391 23261 44706)	.											.	KCNQ5-158	0			c.C364G						.						30.0	32.0	31.0					6																	73332281		2203	4300	6503	SO:0001583	missense	56479	exon1			GAGAGACCCCGCG	AF202977	CCDS4976.1, CCDS55034.1	6q14	2012-07-05			ENSG00000185760	ENSG00000185760		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6299	protein-coding gene	gene with protein product		607357				10787416, 10816588, 16382104	Standard	NM_019842		Approved	Kv7.5	uc011dyh.2	Q9NR82	OTTHUMG00000015020	ENST00000370398.1:c.364C>G	6.37:g.73332281C>G	ENSP00000359425:p.Pro122Ala	Somatic	30	0		WXS	Illumina HiSeq	Phase_I	27	2	NM_001160132	0	0	0	0	0	A6NKT6|A6PVT6|A8MSQ5|B4DS33|B5MC83|B7ZL37|F5GZV0|Q17RE1|Q5VVP3|Q86W40|Q9NRN0|Q9NYA6	Missense_Mutation	SNP	ENST00000370398.1	37	CCDS4976.1	.	.	.	.	.	.	.	.	.	.	C	16.00	2.997483	0.54147	.	.	ENSG00000185760	ENST00000342056;ENST00000451840;ENST00000355194;ENST00000370398;ENST00000370392;ENST00000402622;ENST00000355635;ENST00000403813;ENST00000414165	D;D;D;D;D;D;D;D	0.99511	-5.96;-5.96;-5.95;-5.91;-5.97;-5.95;-5.98;-6.05	4.58	3.69	0.42338	.	0.298816	0.24866	N	0.034965	D	0.99309	0.9758	M	0.75447	2.3	0.51233	D	0.999914	P;D;D;D;D;D	0.71674	0.825;0.998;0.974;0.984;0.989;0.982	P;D;P;D;D;P	0.74023	0.76;0.982;0.829;0.918;0.915;0.885	D	0.99023	1.0818	10	0.87932	D	0	-7.2859	14.5401	0.67987	0.0:0.8525:0.1475:0.0	.	122;122;122;122;122;122	F5GZV0;Q9NR82-3;A6PVT6;Q9NR82-2;Q9NR82;Q9NR82-4	.;.;.;.;KCNQ5_HUMAN;.	A	122	ENSP00000345055:P122A;ENSP00000347326:P122A;ENSP00000359425:P122A;ENSP00000359419:P122A;ENSP00000385501:P122A;ENSP00000347853:P122A;ENSP00000384453:P122A;ENSP00000409861:P122A	ENSP00000345055:P122A	P	+	1	0	KCNQ5	73389002	1.000000	0.71417	1.000000	0.80357	0.329000	0.28539	5.571000	0.67404	0.911000	0.36747	-0.305000	0.09177	CCC	.		0.662	KCNQ5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041198.3	NM_019842	
IBTK	25998	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	82904254	82904254	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr6:82904254T>G	ENST00000306270.7	-	23	3829	c.3280A>C	c.(3280-3282)Att>Ctt	p.I1094L	IBTK_ENST00000503631.1_Missense_Mutation_p.I893L|IBTK_ENST00000510291.1_Missense_Mutation_p.I1079L	NM_015525.2	NP_056340.2	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton agammaglobulinemia tyrosine kinase	1094					negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein tyrosine kinase activity (GO:0061099)|release of sequestered calcium ion into cytosol (GO:0051209)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine kinase inhibitor activity (GO:0030292)			central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(10)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	54		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		TTACTGGGAATAGGCTGTGGA	0.368																																					p.I1094L		.											.	IBTK-92	0			c.A3280C						.						92.0	95.0	94.0					6																	82904254		2203	4300	6503	SO:0001583	missense	25998	exon23			TGGGAATAGGCTG	AF235049	CCDS34490.1, CCDS75486.1	6q14.3	2013-01-10	2003-10-06	2003-10-08	ENSG00000005700	ENSG00000005700		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	17853	protein-coding gene	gene with protein product		606457	"""Bruton agammaglobulinemia tyrosine kinase inhibitor"""	BTKI		11577348	Standard	XM_006715453		Approved	DKFZP564B116, BTBD26	uc003pjl.1	Q9P2D0	OTTHUMG00000015102	ENST00000306270.7:c.3280A>C	6.37:g.82904254T>G	ENSP00000305721:p.Ile1094Leu	Somatic	42	0		WXS	Illumina HiSeq	Phase_I	49	21	NM_015525	0	0	18	30	12	Q2QKU2|Q2QKU3|Q2QKU4|Q5TFD7|Q5TFD9|Q8IUQ9|Q8IUY7|Q8TAI4|Q9HBI8|Q9Y3T8	Missense_Mutation	SNP	ENST00000306270.7	37	CCDS34490.1	.	.	.	.	.	.	.	.	.	.	T	19.68	3.873221	0.72180	.	.	ENSG00000005700	ENST00000306270;ENST00000503631;ENST00000510291	T;T;T	0.38240	1.63;1.15;1.6	5.3	4.14	0.48551	.	0.226344	0.45126	D	0.000398	T	0.41511	0.1162	M	0.66939	2.045	0.45541	D	0.998499	P;P;D;D;P	0.69078	0.677;0.937;0.997;0.962;0.937	B;P;D;P;P	0.83275	0.243;0.506;0.996;0.701;0.506	T	0.30563	-0.9974	10	0.23302	T	0.38	-15.758	11.0232	0.47730	0.0:0.0732:0.0:0.9268	.	893;1079;45;1094;1094	E9PDR5;E7EPI0;B3KX60;Q9P2D0-2;Q9P2D0	.;.;.;.;IBTK_HUMAN	L	1094;893;1079	ENSP00000305721:I1094L;ENSP00000422762:I893L;ENSP00000426405:I1079L	ENSP00000305721:I1094L	I	-	1	0	IBTK	82960973	1.000000	0.71417	0.992000	0.48379	0.918000	0.54935	3.615000	0.54167	0.963000	0.38082	0.482000	0.46254	ATT	.		0.368	IBTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041337.2	NM_015525	
KLHL32	114792	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	97562031	97562031	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr6:97562031G>T	ENST00000369261.4	+	7	1363	c.1000G>T	c.(1000-1002)Gtg>Ttg	p.V334L	KLHL32_ENST00000536676.1_Missense_Mutation_p.V298L|KLHL32_ENST00000544166.1_Intron|KLHL32_ENST00000539200.1_Missense_Mutation_p.V265L	NM_052904.3	NP_443136.2	Q96NJ5	KLH32_HUMAN	kelch-like family member 32	334										breast(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(13)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)		BRCA - Breast invasive adenocarcinoma(108;0.0558)		TCCCATGCCTGTGGGAAGGAG	0.562																																					p.V334L		.											.	KLHL32-94	0			c.G1000T						.						88.0	84.0	85.0					6																	97562031		2203	4300	6503	SO:0001583	missense	114792	exon7			ATGCCTGTGGGAA	AB067487	CCDS5038.1, CCDS69154.1, CCDS69155.1, CCDS75495.1	6q16.3	2013-02-22	2013-02-22	2007-01-09	ENSG00000186231	ENSG00000186231		"""Kelch-like"", ""BTB/POZ domain containing"""	21221	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 5"", ""KIAA1900"", ""kelch-like 32 (Drosophila)"""	BKLHD5, KIAA1900			Standard	NM_052904		Approved		uc010kcm.1	Q96NJ5	OTTHUMG00000015247	ENST00000369261.4:c.1000G>T	6.37:g.97562031G>T	ENSP00000358265:p.Val334Leu	Somatic	109	0		WXS	Illumina HiSeq	Phase_I	101	7	NM_052904	0	0	4	4	0	B7Z346|B7Z4E2|E1P528|Q5THT0|Q96PY7	Missense_Mutation	SNP	ENST00000369261.4	37	CCDS5038.1	.	.	.	.	.	.	.	.	.	.	G	15.16	2.750577	0.49257	.	.	ENSG00000186231	ENST00000369261;ENST00000536676;ENST00000539200	T;T;T	0.65916	-0.18;-0.18;-0.18	5.36	5.36	0.76844	Kelch-type beta propeller (1);	0.173711	0.52532	D	0.000077	T	0.48187	0.1486	M	0.64997	1.995	0.80722	D	1	B;B;B;B	0.11235	0.001;0.002;0.001;0.004	B;B;B;B	0.12156	0.001;0.003;0.004;0.007	T	0.48703	-0.9012	10	0.45353	T	0.12	.	14.5444	0.68017	0.0719:0.0:0.9281:0.0	.	265;298;334;334	B7Z4E2;B7Z346;Q96NJ5;Q6IQ08	.;.;KLH32_HUMAN;.	L	334;298;265	ENSP00000358265:V334L;ENSP00000440382:V298L;ENSP00000441527:V265L	ENSP00000358265:V334L	V	+	1	0	KLHL32	97668752	1.000000	0.71417	0.982000	0.44146	0.985000	0.73830	4.839000	0.62810	2.763000	0.94921	0.655000	0.94253	GTG	.		0.562	KLHL32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041570.1	NM_052904	
USP45	85015	hgsc.bcm.edu	37	6	99956502	99956502	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr6:99956502A>G	ENST00000327681.6	-	3	789	c.257T>C	c.(256-258)cTc>cCc	p.L86P	USP45_ENST00000369232.2_5'UTR|USP45_ENST00000472914.2_Missense_Mutation_p.L86P|USP45_ENST00000500704.2_Missense_Mutation_p.L86P|USP45_ENST00000392738.2_5'UTR|USP45_ENST00000369233.2_Missense_Mutation_p.L86P|USP45_ENST00000329966.6_Missense_Mutation_p.L86P|USP45_ENST00000369231.3_Missense_Mutation_p.L86P	NM_001080481.1	NP_001073950.1	Q70EL2	UBP45_HUMAN	ubiquitin specific peptidase 45	86					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(6)|lung(2)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	22		all_cancers(76;0.000208)|Acute lymphoblastic leukemia(125;8.41e-11)|all_hematologic(75;2.56e-07)|all_epithelial(107;0.122)|Colorectal(196;0.133)		BRCA - Breast invasive adenocarcinoma(108;0.0718)		GCCACACTTGAGGCACAACCA	0.368																																					p.L86P		.											.	USP45-637	0			c.T257C						.						103.0	102.0	103.0					6																	99956502		2203	4300	6503	SO:0001583	missense	85015	exon3			CACTTGAGGCACA	AL832030	CCDS34501.1	6q16.2	2008-02-05	2005-08-08		ENSG00000123552	ENSG00000123552		"""Ubiquitin-specific peptidases"""	20080	protein-coding gene	gene with protein product			"""ubiquitin specific protease 45"""			12838346	Standard	NM_001080481		Approved	MGC14793	uc003ppx.2	Q70EL2	OTTHUMG00000015267	ENST00000327681.6:c.257T>C	6.37:g.99956502A>G	ENSP00000333376:p.Leu86Pro	Somatic	19	0		WXS	Illumina HiSeq	Phase_I	38	2	NM_001080481	0	0	1	1	0	B2RXG0|Q5T062|Q86T44|Q86TC0|Q9BRU1	Missense_Mutation	SNP	ENST00000327681.6	37	CCDS34501.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.107156	0.77096	.	.	ENSG00000123552	ENST00000500704;ENST00000327681;ENST00000369233;ENST00000329966;ENST00000472914;ENST00000369231	T;T;T;T;T;T	0.63096	-0.02;-0.02;-0.02;-0.02;-0.02;-0.02	5.35	5.35	0.76521	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, UBP-type (2);	0.000000	0.64402	D	0.000001	D	0.84147	0.5408	H	0.97265	3.97	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90020	0.4127	10	0.87932	D	0	.	14.9824	0.71321	1.0:0.0:0.0:0.0	.	86;86	D6RBV3;Q70EL2	.;UBP45_HUMAN	P	86	ENSP00000424372:L86P;ENSP00000333376:L86P;ENSP00000358236:L86P;ENSP00000330540:L86P;ENSP00000423993:L86P;ENSP00000358234:L86P	ENSP00000333376:L86P	L	-	2	0	USP45	100063223	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.371000	0.90123	2.036000	0.60181	0.402000	0.26972	CTC	.		0.368	USP45-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041609.2	NM_032929	
RGS17	26575	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	153332802	153332802	+	Silent	SNP	A	A	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr6:153332802A>T	ENST00000367225.2	-	4	564	c.540T>A	c.(538-540)acT>acA	p.T180T	RGS17_ENST00000206262.1_Silent_p.T180T			Q9UGC6	RGS17_HUMAN	regulator of G-protein signaling 17	180	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			cervix(2)|endometrium(2)|large_intestine(4)|lung(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	14		Ovarian(120;0.126)		OV - Ovarian serous cystadenocarcinoma(155;1.09e-09)|BRCA - Breast invasive adenocarcinoma(81;0.0429)		TGTGCATTAAAGTATATATCT	0.353																																					p.T180T	Esophageal Squamous(78;500 1236 6775 24364 49058)	.											.	RGS17-227	0			c.T540A						.						59.0	60.0	59.0					6																	153332802		2203	4300	6503	SO:0001819	synonymous_variant	26575	exon5			CATTAAAGTATAT	AF202257	CCDS5244.1	6q25-q26	2009-05-29	2007-08-14		ENSG00000091844	ENSG00000091844		"""Regulators of G-protein signaling"""	14088	protein-coding gene	gene with protein product		607191	"""regulator of G-protein signalling 17"""			10419452	Standard	NM_012419		Approved	RGSZ2, RGS-17	uc003qpm.3	Q9UGC6	OTTHUMG00000015858	ENST00000367225.2:c.540T>A	6.37:g.153332802A>T		Somatic	38	0		WXS	Illumina HiSeq	Phase_I	44	10	NM_012419	0	0	0	1	1	Q5TF49|Q8TD61|Q9UJS8	Silent	SNP	ENST00000367225.2	37	CCDS5244.1																																																																																			.		0.353	RGS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042773.2		
DPY19L1	23333	hgsc.bcm.edu	37	7	35009095	35009095	+	Missense_Mutation	SNP	C	C	A	rs201226448		TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr7:35009095C>A	ENST00000310974.4	-	9	889	c.745G>T	c.(745-747)Gta>Tta	p.V249L	DPY19L1_ENST00000462134.2_5'UTR	NM_015283.1	NP_056098.1	Q2PZI1	D19L1_HUMAN	dpy-19-like 1 (C. elegans)	249						integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity, transferring glycosyl groups (GO:0016757)			endometrium(3)|kidney(5)|large_intestine(8)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	31						ATGAAAAATACATTGGAAATG	0.343																																					p.V249L		.											.	DPY19L1-68	0			c.G745T						.						89.0	83.0	84.0					7																	35009095		1848	4100	5948	SO:0001583	missense	23333	exon9			AAAATACATTGGA	AB020684	CCDS43567.1	7p14.3-p14.2	2006-04-26			ENSG00000173852	ENSG00000173852			22205	protein-coding gene	gene with protein product		613892					Standard	NM_015283		Approved	KIAA0877	uc003tem.4	Q2PZI1	OTTHUMG00000154888	ENST00000310974.4:c.745G>T	7.37:g.35009095C>A	ENSP00000308695:p.Val249Leu	Somatic	39	0		WXS	Illumina HiSeq	Phase_I	88	5	NM_015283	0	0	8	8	0	O94954|Q4G151	Missense_Mutation	SNP	ENST00000310974.4	37	CCDS43567.1	.	.	.	.	.	.	.	.	.	.	C	12.07	1.826928	0.32329	.	.	ENSG00000173852	ENST00000310974;ENST00000446375	T;T	0.54279	0.58;0.58	5.18	3.16	0.36331	.	0.395856	0.25732	N	0.028676	T	0.39118	0.1066	L	0.41027	1.25	0.37187	D	0.903762	B	0.10296	0.003	B	0.16722	0.016	T	0.25222	-1.0138	10	0.32370	T	0.25	-11.1224	6.2617	0.20903	0.0:0.6081:0.0:0.3919	.	249	Q2PZI1	D19L1_HUMAN	L	249;48	ENSP00000308695:V249L;ENSP00000400510:V48L	ENSP00000308695:V249L	V	-	1	0	DPY19L1	34975620	0.987000	0.35691	0.627000	0.29227	0.878000	0.50629	0.191000	0.17076	0.456000	0.26937	0.491000	0.48974	GTA	.		0.343	DPY19L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337506.1		
PPIA	5478	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	44839397	44839397	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr7:44839397G>T	ENST00000468812.1	+	4	331	c.286G>T	c.(286-288)Ggc>Tgc	p.G96C	PPIA_ENST00000480603.1_3'UTR|PPIA_ENST00000451562.1_Missense_Mutation_p.G96C|PPIA_ENST00000489459.1_Missense_Mutation_p.G36C|PPIA_ENST00000355968.6_Missense_Mutation_p.G36C	NM_021130.3	NP_066953.1	P62937	PPIA_HUMAN	peptidylprolyl isomerase A (cyclophilin A)	96	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				blood coagulation (GO:0007596)|entry into host cell (GO:0030260)|establishment of integrated proviral latency (GO:0075713)|leukocyte migration (GO:0050900)|lipid particle organization (GO:0034389)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of protein secretion (GO:0050714)|positive regulation of viral genome replication (GO:0045070)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|regulation of viral genome replication (GO:0045069)|RNA-dependent DNA replication (GO:0006278)|uncoating of virus (GO:0019061)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral release from host cell (GO:0019076)|virion assembly (GO:0019068)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	peptide binding (GO:0042277)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)|virion binding (GO:0046790)			breast(1)|endometrium(1)|lung(1)|urinary_tract(1)	4					Cyclosporine(DB00091)|L-Proline(DB00172)	TACGGGTCCTGGCATCTTGTC	0.483																																					p.G96C	Pancreas(95;605 727 734 1731 12572 23104 24406 38694 39103 44805)	.											.	PPIA-90	0			c.G286T						.						85.0	81.0	82.0					7																	44839397		2203	4298	6501	SO:0001583	missense	5478	exon4			GGTCCTGGCATCT	X52851	CCDS5494.1, CCDS75592.1	7p13	2010-03-23			ENSG00000196262	ENSG00000196262	5.2.1.8		9253	protein-coding gene	gene with protein product		123840				1989998, 2197089	Standard	XM_005249791		Approved	CYPA	uc003tlw.3	P62937	OTTHUMG00000023687	ENST00000468812.1:c.286G>T	7.37:g.44839397G>T	ENSP00000419425:p.Gly96Cys	Somatic	98	0		WXS	Illumina HiSeq	Phase_I	126	23	NM_021130	1	1	1692	2445	751	A8K220|P05092|Q3KQW3|Q567Q0|Q6IBU5|Q96IX3|Q9BRU4|Q9BTY9|Q9UC61	Missense_Mutation	SNP	ENST00000468812.1	37	CCDS5494.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.909500	0.92107	.	.	ENSG00000196262	ENST00000451562;ENST00000468812;ENST00000489459;ENST00000355968;ENST00000244636	T;T;T;T	0.50548	0.74;0.74;0.74;0.74	5.24	5.24	0.73138	Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (4);Cyclophilin-like (1);	0.000000	0.85682	U	0.000000	D	0.83027	0.5165	H	0.99425	4.56	0.80722	D	1	D	0.67145	0.996	D	0.74348	0.983	D	0.90988	0.4833	10	0.87932	D	0	.	18.4613	0.90739	0.0:0.0:1.0:0.0	.	96	P62937	PPIA_HUMAN	C	96;96;36;36;36	ENSP00000405975:G96C;ENSP00000419425:G96C;ENSP00000427976:G36C;ENSP00000430817:G36C	ENSP00000442606:G36C	G	+	1	0	PPIA	44805922	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.601000	0.98297	2.449000	0.82847	0.563000	0.77884	GGC	.		0.483	PPIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251293.1	NM_021130	
CTAGE15	441294	hgsc.bcm.edu	37	7	143270001	143270001	+	Missense_Mutation	SNP	C	C	T	rs201104924	byFrequency	TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr7:143270001C>T	ENST00000420911.2	+	1	1108	c.1091C>T	c.(1090-1092)gCa>gTa	p.A364V	RNU6-162P_ENST00000516228.1_RNA	NM_001008747.1	NP_001008747.1	A4D2H0	CTGEF_HUMAN	CTAGE family, member 15	364						integral component of membrane (GO:0016021)											ACTCAACAAGCATCTTTGCAA	0.299													.|||	1090	0.217652	0.171	0.3213	5008	,	,		25006	0.1002		0.3419	False		,,,				2504	0.2004				p.A364V		.											.	.	0			c.C1091T						.						2.0	2.0	2.0					7																	143270001		1060	2315	3375	SO:0001583	missense	441294	exon1			AACAAGCATCTTT		CCDS64788.1	7q35	2013-02-25	2013-02-25	2013-02-25	ENSG00000176227	ENSG00000271079			37295	protein-coding gene	gene with protein product			"""CTAGE family, member 15, pseudogene"""	CTAGE15P			Standard	NM_001008747		Approved		uc011kth.3	A4D2H0	OTTHUMG00000153233	ENST00000420911.2:c.1091C>T	7.37:g.143270001C>T	ENSP00000474204:p.Ala364Val	Somatic	28	2		WXS	Illumina HiSeq	Phase_I	57	11	NM_001008747	0	0	18	21	3	A6H8Z8	Missense_Mutation	SNP	ENST00000420911.2	37																																																																																				C|0.500;A|0.500		0.299	CTAGE15-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000330280.2	NM_001008747	
CUL1	8454	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	148495672	148495672	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr7:148495672T>C	ENST00000325222.4	+	20	2318	c.2039T>C	c.(2038-2040)tTa>tCa	p.L680S	CUL1_ENST00000602748.1_Missense_Mutation_p.L680S|CUL1_ENST00000409469.1_Missense_Mutation_p.L680S	NM_003592.2	NP_003583.2	Q13616	CUL1_HUMAN	cullin 1	680					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|viral process (GO:0016032)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|SCF ubiquitin ligase complex (GO:0019005)				breast(2)|central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(10)|liver(2)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	40	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			AGTAAGAAATTAAGGGTTAAC	0.383																																					p.L680S		.											.	CUL1-226	0			c.T2039C						.						122.0	116.0	118.0					7																	148495672		2203	4300	6503	SO:0001583	missense	8454	exon20			AGAAATTAAGGGT	U58087	CCDS34772.1	7q36.1	2011-05-24			ENSG00000055130	ENSG00000055130			2551	protein-coding gene	gene with protein product		603134				8681378	Standard	NM_003592		Approved		uc003wey.3	Q13616	OTTHUMG00000152776	ENST00000325222.4:c.2039T>C	7.37:g.148495672T>C	ENSP00000326804:p.Leu680Ser	Somatic	69	0		WXS	Illumina HiSeq	Phase_I	80	47	NM_003592	0	0	0	0	0	D3DWG3|O60719|Q08AL6|Q8IYW1	Missense_Mutation	SNP	ENST00000325222.4	37	CCDS34772.1	.	.	.	.	.	.	.	.	.	.	.	23.0	4.360805	0.82353	.	.	ENSG00000055130	ENST00000409469;ENST00000325222;ENST00000433865	T;T	0.74209	-0.82;-0.82	4.91	4.91	0.64330	Winged helix-turn-helix transcription repressor DNA-binding (1);Cullin homology (1);	0.156457	0.44483	D	0.000453	T	0.78220	0.4249	M	0.70903	2.155	0.80722	D	1	B;P	0.52316	0.148;0.952	B;P	0.49752	0.103;0.621	T	0.77411	-0.2598	10	0.29301	T	0.29	-6.0639	14.5579	0.68115	0.0:0.0:0.0:1.0	.	607;680	E7EWR0;Q13616	.;CUL1_HUMAN	S	680;680;607	ENSP00000387160:L680S;ENSP00000326804:L680S	ENSP00000326804:L680S	L	+	2	0	CUL1	148126605	1.000000	0.71417	0.998000	0.56505	0.954000	0.61252	7.693000	0.84214	1.844000	0.53588	0.379000	0.24179	TTA	.		0.383	CUL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467785.1	NM_003592	
KMT2C	58508	hgsc.bcm.edu	37	7	151927320	151927320	+	Silent	SNP	C	C	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr7:151927320C>T	ENST00000262189.6	-	17	3074	c.2856G>A	c.(2854-2856)aaG>aaA	p.K952K	KMT2C_ENST00000355193.2_Silent_p.K952K	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	952					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TCAAAGTGAACTTGTCACTGC	0.343																																					p.K952K		.											.	MLL3-1398	0			c.G2856A						.																																			SO:0001819	synonymous_variant	58508	exon17			AGTGAACTTGTCA	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.2856G>A	7.37:g.151927320C>T		Somatic	38	0		WXS	Illumina HiSeq	Phase_I	56	3	NM_170606	0	0	2	2	0	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Silent	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	C	8.122	0.781228	0.16120	.	.	ENSG00000055609	ENST00000418673	.	.	.	4.66	1.79	0.24919	.	.	.	.	.	T	0.59004	0.2162	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53989	-0.8360	4	.	.	.	.	10.3333	0.43835	0.0:0.7695:0.0:0.2305	.	.	.	.	I	108	.	.	V	-	1	0	MLL3	151558253	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.949000	0.29109	0.503000	0.28060	0.585000	0.79938	GTT	.		0.343	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
KMT2C	58508	hgsc.bcm.edu	37	7	151945349	151945349	+	Nonsense_Mutation	SNP	T	T	A	rs201039690		TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr7:151945349T>A	ENST00000262189.6	-	14	2388	c.2170A>T	c.(2170-2172)Aag>Tag	p.K724*	KMT2C_ENST00000355193.2_Nonsense_Mutation_p.K724*	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	724					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.K724*(4)									TTCTGTTCCTTTTCTCCTTGT	0.398																																					p.K724X		.											.	MLL3-1398	4	Substitution - Nonsense(4)	kidney(2)|skin(2)	c.A2170T						.						70.0	69.0	69.0					7																	151945349		2203	4300	6503	SO:0001587	stop_gained	58508	exon14			GTTCCTTTTCTCC	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.2170A>T	7.37:g.151945349T>A	ENSP00000262189:p.Lys724*	Somatic	79	1		WXS	Illumina HiSeq	Phase_I	173	13	NM_170606	0	0	0	0	0	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Nonsense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	T	37	6.120169	0.97300	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	.	.	.	5.13	-1.83	0.07833	.	0.648456	0.13994	N	0.348586	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	1.3853	0.02239	0.12:0.2536:0.2465:0.3799	.	.	.	.	X	724	.	ENSP00000262189:K724X	K	-	1	0	MLL3	151576282	0.000000	0.05858	0.029000	0.17559	0.083000	0.17756	-0.061000	0.11693	-0.613000	0.05694	-0.321000	0.08615	AAG	.		0.398	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
MFHAS1	9258	hgsc.bcm.edu;broad.mit.edu	37	8	8654999	8654999	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr8:8654999C>G	ENST00000276282.6	-	2	3587	c.3001G>C	c.(3001-3003)Gag>Cag	p.E1001Q	MFHAS1_ENST00000520091.1_5'UTR	NM_004225.2	NP_004216.2	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified sequence 1	1001		Breakpoint for translocation to form chimeric MASL1.								endometrium(1)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|stomach(1)	21		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		CTCAGCAACTCCCCTGTAGGA	0.552																																					p.E1001Q	Melanoma(103;1201 2045 17515 28966)	.											.	MFHAS1-90	0			c.G3001C						.						81.0	68.0	72.0					8																	8654999		2203	4300	6503	SO:0001583	missense	9258	exon2			GCAACTCCCCTGT	AB016816	CCDS34844.1	8p23.1	2014-03-07			ENSG00000147324	ENSG00000147324			16982	protein-coding gene	gene with protein product	"""leucine rich repeat containing 65"", ""malignant fibrous histiocytoma-amplified sequences with leucine-rich tandem repeats 1"""	605352				9973190	Standard	NM_004225		Approved	MASL1, LRRC65	uc003wsj.1	Q9Y4C4	OTTHUMG00000163676	ENST00000276282.6:c.3001G>C	8.37:g.8654999C>G	ENSP00000276282:p.Glu1001Gln	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	57	3	NM_004225	0	0	0	0	0	Q96CI0	Missense_Mutation	SNP	ENST00000276282.6	37	CCDS34844.1	.	.	.	.	.	.	.	.	.	.	C	18.02	3.529145	0.64860	.	.	ENSG00000147324	ENST00000276282	T	0.38401	1.14	5.73	5.73	0.89815	.	0.068346	0.56097	D	0.000026	T	0.56292	0.1975	L	0.54323	1.7	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.43956	-0.9359	10	0.29301	T	0.29	.	18.882	0.92358	0.0:1.0:0.0:0.0	.	1001	Q9Y4C4	MFHA1_HUMAN	Q	1001	ENSP00000276282:E1001Q	ENSP00000276282:E1001Q	E	-	1	0	MFHAS1	8692409	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.251000	0.78297	2.703000	0.92315	0.551000	0.68910	GAG	.		0.552	MFHAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374724.2	NM_004225	
SLC7A2	6542	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	17419589	17419589	+	Silent	SNP	G	G	A			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr8:17419589G>A	ENST00000494857.1	+	11	1859	c.1641G>A	c.(1639-1641)caG>caA	p.Q547Q	SLC7A2_ENST00000522656.1_Silent_p.Q547Q|SLC7A2_ENST00000398090.3_Silent_p.Q586Q|SLC7A2_ENST00000004531.10_Silent_p.Q587Q|SLC7A2_ENST00000470360.1_Silent_p.Q586Q	NM_001008539.3	NP_001008539.3	P52569	CTR2_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 2	547			Q -> L (in dbSNP:rs1981498).		amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|macrophage activation (GO:0042116)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide production involved in inflammatory response (GO:0002537)|regulation of inflammatory response (GO:0050727)|regulation of macrophage activation (GO:0043030)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	basic amino acid transmembrane transporter activity (GO:0015174)|high-affinity arginine transmembrane transporter activity (GO:0005289)|L-lysine transmembrane transporter activity (GO:0015189)|L-ornithine transmembrane transporter activity (GO:0000064)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|stomach(1)	25				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	L-Lysine(DB00123)|L-Ornithine(DB00129)	TCTGGAGGCAGCCCCAGAATC	0.468																																					p.Q587Q		.											.	SLC7A2-93	0			c.G1761A						.						89.0	79.0	83.0					8																	17419589		2203	4300	6503	SO:0001819	synonymous_variant	6542	exon10			GAGGCAGCCCCAG	D29990	CCDS6002.2, CCDS34852.1, CCDS55203.1	8p22	2013-05-22			ENSG00000003989	ENSG00000003989		"""Solute carriers"""	11060	protein-coding gene	gene with protein product		601872		ATRC2		8954799	Standard	NM_001164771		Approved	CAT-2, HCAT2	uc011kye.2	P52569	OTTHUMG00000130819	ENST00000494857.1:c.1641G>A	8.37:g.17419589G>A		Somatic	76	0		WXS	Illumina HiSeq	Phase_I	67	32	NM_001164771	0	0	0	0	0	B7ZL54|O15291|O15292|Q14CQ6|Q6NSZ7|Q86TC6	Silent	SNP	ENST00000494857.1	37	CCDS34852.1																																																																																			.		0.468	SLC7A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253367.3	NM_003046	
KIAA0196	9897	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	126085409	126085409	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr8:126085409T>G	ENST00000318410.7	-	9	1485	c.1136A>C	c.(1135-1137)cAt>cCt	p.H379P	KIAA0196_ENST00000517845.1_Missense_Mutation_p.H231P	NM_014846.3	NP_055661.3	Q12768	STRUM_HUMAN	KIAA0196	379					cell death (GO:0008219)|endosomal transport (GO:0016197)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|WASH complex (GO:0071203)				NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	42	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			GTCTGCTGTATGAAGCATCAG	0.448																																					p.H379P		.											.	KIAA0196-92	0			c.A1136C						.						117.0	101.0	106.0					8																	126085409		2203	4300	6503	SO:0001583	missense	9897	exon9			GCTGTATGAAGCA		CCDS6355.1	8q24.13	2014-05-09			ENSG00000164961	ENSG00000164961			28984	protein-coding gene	gene with protein product	"""strumpellin"""	610657	"""spastic paraplegia 8 (autosomal dominant)"""	SPG8		9973294, 17160902, 23085491	Standard	NM_014846		Approved		uc003yrt.3	Q12768	OTTHUMG00000164991	ENST00000318410.7:c.1136A>C	8.37:g.126085409T>G	ENSP00000318016:p.His379Pro	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	90	39	NM_014846	0	0	0	0	0	A8K4R7|Q3KQX5|Q8TBQ2	Missense_Mutation	SNP	ENST00000318410.7	37	CCDS6355.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.178175	0.78564	.	.	ENSG00000164961	ENST00000318410;ENST00000517845	D;D	0.89552	-2.53;-2.53	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.95211	0.8447	M	0.87971	2.92	0.80722	D	1	D	0.67145	0.996	D	0.78314	0.991	D	0.95703	0.8751	10	0.87932	D	0	-28.8795	16.8222	0.85835	0.0:0.0:0.0:1.0	.	379	Q12768	STRUM_HUMAN	P	379;231	ENSP00000318016:H379P;ENSP00000429676:H231P	ENSP00000318016:H379P	H	-	2	0	KIAA0196	126154591	1.000000	0.71417	0.164000	0.22755	0.692000	0.40212	7.950000	0.87804	2.371000	0.80710	0.533000	0.62120	CAT	.		0.448	KIAA0196-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381369.1	NM_014846	
ADCY8	114	hgsc.bcm.edu;broad.mit.edu	37	8	132052526	132052526	+	Silent	SNP	G	G	A	rs529228094	byFrequency	TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr8:132052526G>A	ENST00000286355.5	-	1	2146	c.54C>T	c.(52-54)atC>atT	p.I18I	ADCY8_ENST00000377928.3_Silent_p.I18I	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	18					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			GCGTCGGGTGGATGGTGTAGA	0.697										HNSCC(32;0.087)																											p.I18I		.											.	ADCY8-157	0			c.C54T						.						5.0	6.0	5.0					8																	132052526		2067	4086	6153	SO:0001819	synonymous_variant	114	exon1			CGGGTGGATGGTG	Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.54C>T	8.37:g.132052526G>A		Somatic	10	0		WXS	Illumina HiSeq	Phase_I	7	4	NM_001115	0	0	0	0	0		Silent	SNP	ENST00000286355.5	37	CCDS6363.1																																																																																			.		0.697	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1		
BAI1	575	hgsc.bcm.edu;broad.mit.edu	37	8	143623373	143623373	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr8:143623373G>C	ENST00000517894.1	+	28	4672	c.3778G>C	c.(3778-3780)Gag>Cag	p.E1260Q	BAI1_ENST00000323289.5_Missense_Mutation_p.E1260Q			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	1260					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					GTCTCTGCCCGAGGAGGAGAA	0.682																																					p.E1260Q		.											.	BAI1-1129	0			c.G3778C						.						11.0	14.0	13.0					8																	143623373		2083	4183	6266	SO:0001583	missense	575	exon27			CTGCCCGAGGAGG	AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.3778G>C	8.37:g.143623373G>C	ENSP00000430945:p.Glu1260Gln	Somatic	27	0		WXS	Illumina HiSeq	Phase_I	22	3	NM_001702	0	0	1	1	0		Missense_Mutation	SNP	ENST00000517894.1	37		.	.	.	.	.	.	.	.	.	.	g	15.14	2.743642	0.49151	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	T;T	0.28255	1.62;1.62	4.26	4.26	0.50523	.	0.341183	0.26349	U	0.024892	T	0.20414	0.0491	N	0.24115	0.695	0.20821	N	0.999846	P	0.43578	0.811	B	0.34301	0.179	T	0.16217	-1.0410	10	0.66056	D	0.02	.	15.6704	0.77270	0.0:0.0:1.0:0.0	.	1260	E9PBK0	.	Q	1260	ENSP00000430945:E1260Q;ENSP00000313046:E1260Q	ENSP00000313046:E1260Q	E	+	1	0	BAI1	143620375	1.000000	0.71417	0.807000	0.32361	0.825000	0.46686	7.460000	0.80816	1.910000	0.55303	0.586000	0.80456	GAG	.		0.682	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379963.3	NM_001702	
CYP11B1	1584	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	143957217	143957217	+	Silent	SNP	G	G	A			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr8:143957217G>A	ENST00000292427.4	-	6	1064	c.1032C>T	c.(1030-1032)agC>agT	p.S344S	CYP11B1_ENST00000517471.1_Silent_p.S344S|CYP11B1_ENST00000377675.3_Silent_p.S415S	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	344					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	CGGCGGCCAGGCTCTCCTGGC	0.652									Familial Hyperaldosteronism type I																												p.S344S		.											.	CYP11B1-94	0			c.C1032T						.						70.0	73.0	72.0					8																	143957217		2203	4300	6503	SO:0001819	synonymous_variant	1584	exon6	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	GGCCAGGCTCTCC	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.1032C>T	8.37:g.143957217G>A		Somatic	267	0		WXS	Illumina HiSeq	Phase_I	169	70	NM_000497	0	0	0	0	0	Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Silent	SNP	ENST00000292427.4	37	CCDS6392.1																																																																																			.		0.652	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379475.2		
NFX1	4799	bcgsc.ca	37	9	33307212	33307212	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr9:33307212T>C	ENST00000379540.3	+	5	1353	c.1291T>C	c.(1291-1293)Tgg>Cgg	p.W431R	NFX1_ENST00000318524.6_Missense_Mutation_p.W431R|NFX1_ENST00000379521.4_Missense_Mutation_p.W431R	NM_002504.4	NP_002495.2	Q12986	NFX1_HUMAN	nuclear transcription factor, X-box binding 1	431					inflammatory response (GO:0006954)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25			LUSC - Lung squamous cell carcinoma(29;0.00506)	GBM - Glioblastoma multiforme(74;0.224)		GAATCCTGAGTGGAGCAGAAA	0.413																																					p.W431R													.	NFX1-91	0			c.T1291C						.						148.0	147.0	147.0					9																	33307212		2203	4300	6503	SO:0001583	missense	4799	exon5			CCTGAGTGGAGCA	U19759	CCDS6538.1, CCDS6539.1, CCDS6540.1	9p12	2013-12-13			ENSG00000086102	ENSG00000086102			7803	protein-coding gene	gene with protein product		603255				7964459, 2511169	Standard	NM_002504		Approved	NFX2, MGC20369, Tex42, TEG-42	uc003zsq.3	Q12986	OTTHUMG00000019772	ENST00000379540.3:c.1291T>C	9.37:g.33307212T>C	ENSP00000368856:p.Trp431Arg	Somatic	117	0		WXS	Illumina HiSeq	Phase_1	141	6	NM_147134	0	0	10	10	0	A8K6H8|Q5VXW6|Q96EL5|Q9BXI1	Missense_Mutation	SNP	ENST00000379540.3	37	CCDS6538.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.223848	0.79576	.	.	ENSG00000086102	ENST00000379540;ENST00000379521;ENST00000536210;ENST00000318524	T;T;T	0.12879	2.64;2.64;2.64	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.28532	0.0706	L	0.48642	1.525	0.58432	D	0.999999	D;D;P;D;B	0.76494	0.999;0.998;0.459;0.997;0.39	D;D;B;D;B	0.71414	0.973;0.926;0.218;0.966;0.176	T	0.00975	-1.1494	10	0.33940	T	0.23	-5.1452	13.5049	0.61479	0.0:0.0:0.0:1.0	.	431;315;431;431;431	F5GXD0;A0JLR2;Q12986;Q12986-2;Q12986-3	.;.;NFX1_HUMAN;.;.	R	431	ENSP00000368856:W431R;ENSP00000368836:W431R;ENSP00000317695:W431R	ENSP00000317695:W431R	W	+	1	0	NFX1	33297212	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.751000	0.85126	2.092000	0.63282	0.477000	0.44152	TGG	.		0.413	NFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052069.1		
ANKRD18B	441459	bcgsc.ca	37	9	33572355	33572355	+	Silent	SNP	C	C	G	rs200701439		TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr9:33572355C>G	ENST00000290943.6	+	16	3129	c.3033C>G	c.(3031-3033)ctC>ctG	p.L1011L		NM_001244752.1	NP_001231681.1	A2A2Z9	AN18B_HUMAN	ankyrin repeat domain 18B	1011										NS(1)|breast(1)|endometrium(2)|lung(1)|prostate(1)|stomach(1)	7						ACTTTCTTCTCTAGAATCCAC	0.328																																					p.L1010L													.	.	0			c.C3030G						.																																			SO:0001819	synonymous_variant	441459	exon16			TCTTCTCTAGAAT			9p13.3	2013-01-10			ENSG00000230453	ENSG00000230453		"""Ankyrin repeat domain containing"""	23644	protein-coding gene	gene with protein product							Standard	NM_001244752		Approved	bA255A11.3	uc010mjw.2	A2A2Z9	OTTHUMG00000019776	ENST00000290943.6:c.3033C>G	9.37:g.33572355C>G		Somatic	25	0		WXS	Illumina HiSeq	Phase_1	39	6	NM_001244752	0	0	0	0	0		Silent	SNP	ENST00000290943.6	37																																																																																				C|0.998;G|0.002		0.328	ANKRD18B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000313729.2	XM_001718334	
SPATA31A6	389730	broad.mit.edu;bcgsc.ca	37	9	43626666	43626666	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr9:43626666G>A	ENST00000332857.6	-	4	2049	c.2021C>T	c.(2020-2022)aCc>aTc	p.T674I	SPATA31A6_ENST00000496386.1_5'Flank	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	674					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											ATTTTGTGGGGTCTCACCCAG	0.542																																					p.T674I													.	.	0			c.C2021T						.						2.0	2.0	2.0					9																	43626666		473	1329	1802	SO:0001583	missense	389730	exon4			TGTGGGGTCTCAC		CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.2021C>T	9.37:g.43626666G>A	ENSP00000329825:p.Thr674Ile	Somatic	275	1		WXS	Illumina HiSeq	Phase_I	295	126	NM_001145196	0	0	0	0	0		Missense_Mutation	SNP	ENST00000332857.6	37	CCDS47973.1	.	.	.	.	.	.	.	.	.	.	G	0.406	-0.916016	0.02415	.	.	ENSG00000185775	ENST00000332857	T	0.04970	3.52	2.27	-4.54	0.03452	.	1.619430	0.03668	N	0.243514	T	0.03434	0.0099	N	0.17082	0.46	0.09310	N	1	B	0.13145	0.007	B	0.12837	0.008	T	0.38887	-0.9640	10	0.32370	T	0.25	-0.2923	0.3687	0.00376	0.392:0.1913:0.2271:0.1896	.	674	Q5VVP1	F75A6_HUMAN	I	674	ENSP00000329825:T674I	ENSP00000329825:T674I	T	-	2	0	FAM75A6	43566662	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	0.551000	0.23361	-1.054000	0.03214	0.383000	0.25322	ACC	.		0.542	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036987.1	NM_001145196	
TRPM3	80036	hgsc.bcm.edu	37	9	73255487	73255487	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr9:73255487G>C	ENST00000377111.2	-	10	1678	c.1435C>G	c.(1435-1437)Caa>Gaa	p.Q479E	TRPM3_ENST00000377106.1_Missense_Mutation_p.Q351E|TRPM3_ENST00000408909.2_Missense_Mutation_p.Q326E|TRPM3_ENST00000396280.5_Missense_Mutation_p.Q326E|TRPM3_ENST00000396285.1_Missense_Mutation_p.Q326E|TRPM3_ENST00000423814.3_Missense_Mutation_p.Q506E|TRPM3_ENST00000357533.2_Missense_Mutation_p.Q481E|TRPM3_ENST00000377110.3_Missense_Mutation_p.Q479E|TRPM3_ENST00000396292.4_Missense_Mutation_p.Q351E|TRPM3_ENST00000360823.2_Missense_Mutation_p.Q351E|TRPM3_ENST00000377105.1_Missense_Mutation_p.Q326E|TRPM3_ENST00000358082.3_Missense_Mutation_p.Q351E	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	504					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						GGCCACTGTTGCCCGTAAATA	0.517											OREG0019249	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q479E		.											.	TRPM3-521	0			c.C1435G						.						73.0	64.0	67.0					9																	73255487		2203	4300	6503	SO:0001583	missense	80036	exon10			ACTGTTGCCCGTA	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.1435C>G	9.37:g.73255487G>C	ENSP00000366315:p.Gln479Glu	Somatic	33	0	1143	WXS	Illumina HiSeq	Phase_I	32	2	NM_001007471	0	0	0	0	0	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	ENST00000377111.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.9|27.9	4.870372|4.870372	0.91587|0.91587	.|.	.|.	ENSG00000083067|ENSG00000083067	ENST00000396280|ENST00000377111;ENST00000377110;ENST00000377106;ENST00000360823;ENST00000377105;ENST00000357533;ENST00000408909;ENST00000396285;ENST00000396292;ENST00000358082;ENST00000423814	.|T;T;T;T;T;T;T;T;T;T;T	.|0.35605	.|1.3;1.3;1.3;1.3;1.3;1.3;1.3;1.3;1.3;1.3;1.3	5.85|5.85	5.85|5.85	0.93711|0.93711	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.60379|0.60379	0.2264|0.2264	M|M	0.83774|0.83774	2.66|2.66	0.54753|0.54753	D|D	0.999985|0.999985	.|P;P;B;B;B;B;B;D;B	.|0.54601	.|0.478;0.876;0.36;0.392;0.401;0.413;0.392;0.967;0.03	.|B;P;B;B;B;B;B;P;B	.|0.56042	.|0.191;0.596;0.138;0.086;0.19;0.269;0.086;0.79;0.057	T|T	0.60541|0.60541	-0.7243|-0.7243	5|10	.|0.44086	.|T	.|0.13	-14.0359|-14.0359	20.1731|20.1731	0.98165|0.98165	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|504;479;479;479;481;351;326;479;326	.|Q9HCF6;Q9HCF6-2;Q9HCF6-10;Q9HCF6-4;A2A3F7;A2A3F4;G5E9G1;Q9HCF6-8;A2A3F3	.|TRPM3_HUMAN;.;.;.;.;.;.;.;.	G|E	325|479;479;351;351;326;481;326;326;351;351;506	.|ENSP00000366315:Q479E;ENSP00000366314:Q479E;ENSP00000366310:Q351E;ENSP00000354066:Q351E;ENSP00000366309:Q326E;ENSP00000350140:Q481E;ENSP00000386127:Q326E;ENSP00000379581:Q326E;ENSP00000379587:Q351E;ENSP00000350791:Q351E;ENSP00000389542:Q506E	.|ENSP00000350140:Q481E	A|Q	-|-	2|1	0|0	TRPM3|TRPM3	72445307|72445307	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.476000|9.476000	0.97823|0.97823	2.768000|2.768000	0.95171|0.95171	0.655000|0.655000	0.94253|0.94253	GCA|CAA	.		0.517	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000214157.5	NM_206945	
PCSK5	5125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	78953204	78953204	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr9:78953204T>C	ENST00000545128.1	+	34	5264	c.4726T>C	c.(4726-4728)Tgc>Cgc	p.C1576R		NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	1576	CRM (Cys-rich motif).				anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						CTGCAAGGGGTGCCAGGGCCC	0.522																																					p.C1576R		.											.	PCSK5-93	0			c.T4726C						.						34.0	32.0	32.0					9																	78953204		876	1991	2867	SO:0001583	missense	5125	exon34			AAGGGGTGCCAGG		CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.4726T>C	9.37:g.78953204T>C	ENSP00000446280:p.Cys1576Arg	Somatic	47	0		WXS	Illumina HiSeq	Phase_I	35	13	NM_001190482	0	0	0	0	0	F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	ENST00000545128.1	37	CCDS55320.1	.	.	.	.	.	.	.	.	.	.	T	13.90	2.375171	0.42105	.	.	ENSG00000099139	ENST00000545128;ENST00000376754;ENST00000424854	T;T	0.74106	-0.81;-0.81	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	D	0.92577	0.7642	H	0.99391	4.545	0.80722	D	1	.	.	.	.	.	.	D	0.95696	0.8745	8	0.87932	D	0	-20.9341	15.8762	0.79166	0.0:0.0:0.0:1.0	.	.	.	.	R	1576;1306;1276	ENSP00000446280:C1576R;ENSP00000411654:C1276R	ENSP00000365945:C1306R	C	+	1	0	PCSK5	78143024	1.000000	0.71417	0.295000	0.24960	0.004000	0.04260	5.347000	0.65998	2.231000	0.72958	0.460000	0.39030	TGC	.		0.522	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
HNRNPK	3190	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	86587099	86587099	+	Silent	SNP	G	G	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr9:86587099G>T	ENST00000376264.2	-	11	909	c.651C>A	c.(649-651)ccC>ccA	p.P217P	HNRNPK_ENST00000360384.5_Silent_p.P217P|HNRNPK_ENST00000351839.3_Silent_p.P217P|RP11-575L7.8_ENST00000448389.1_RNA|HNRNPK_ENST00000376281.4_Silent_p.P217P|MIR7-1_ENST00000384871.1_RNA|HNRNPK_ENST00000376263.3_Silent_p.P217P	NM_002140.3|NM_031262.2	NP_002131.2|NP_112552.1	P61978	HNRPK_HUMAN	heterogeneous nuclear ribonucleoprotein K	217	2 X 22 AA approximate repeats.|5 X 4 AA repeats of G-X-G-G.|Interaction with ZIK1. {ECO:0000250}.|Necessary for interaction with DDX1.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of lipid transport by positive regulation of transcription from RNA polymerase II promoter (GO:0072369)|regulation of low-density lipoprotein particle clearance (GO:0010988)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|single-stranded DNA binding (GO:0003697)			endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|skin(1)|stomach(1)	19						GTCCTTTGATGGGAGACTAAA	0.403																																					p.P217P		.											.	HNRNPK-227	0			c.C651A						.						48.0	47.0	48.0					9																	86587099		2203	4300	6503	SO:0001819	synonymous_variant	3190	exon11			TTTGATGGGAGAC		CCDS6667.1, CCDS6668.1	9q21.32-q21.33	2011-10-24		2008-04-18	ENSG00000165119	ENSG00000165119			5044	protein-coding gene	gene with protein product	"""transformation upregulated nuclear protein"""	600712		HNRPK		8107114	Standard	NM_031263		Approved	CSBP, TUNP	uc004anf.4	P61978	OTTHUMG00000020107	ENST00000376264.2:c.651C>A	9.37:g.86587099G>T		Somatic	60	0		WXS	Illumina HiSeq	Phase_I	75	35	NM_031262	0	0	0	0	0	Q07244|Q15671|Q59F98|Q5T6W4|Q60577|Q922Y7|Q96J62	Silent	SNP	ENST00000376264.2	37	CCDS6667.1																																																																																			.		0.403	HNRNPK-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052846.2		
FNBP1	23048	hgsc.bcm.edu	37	9	132719674	132719674	+	Missense_Mutation	SNP	C	C	G	rs200418146		TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr9:132719674C>G	ENST00000446176.2	-	6	664	c.478G>C	c.(478-480)Gct>Cct	p.A160P	FNBP1_ENST00000420781.1_Missense_Mutation_p.A160P|FNBP1_ENST00000355681.3_Missense_Mutation_p.A160P	NM_015033.2	NP_055848.1	Q96RU3	FNBP1_HUMAN	formin binding protein 1	160	F-BAR domain.|Interaction with microtubules. {ECO:0000250}.				endocytosis (GO:0006897)	coated pit (GO:0005905)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)						Ovarian(14;0.000536)		GBM - Glioblastoma multiforme(294;0.0378)		TTGATGTCAGCGTCCATTTTC	0.483			T	MLL	AML																																p.A160P		.		Dom	yes		9	9q23	23048	formin binding protein 1 (FBP17)		L	.	.	0			c.G478C						.						129.0	126.0	127.0					9																	132719674		2056	4206	6262	SO:0001583	missense	23048	exon6			TGTCAGCGTCCAT	AB011126	CCDS48040.1	9q34	2008-02-05			ENSG00000187239	ENSG00000187239			17069	protein-coding gene	gene with protein product		606191				9628581, 11438682	Standard	XM_005251815		Approved	FBP17, KIAA0554	uc004byw.1	Q96RU3	OTTHUMG00000020800	ENST00000446176.2:c.478G>C	9.37:g.132719674C>G	ENSP00000413625:p.Ala160Pro	Somatic	48	0		WXS	Illumina HiSeq	Phase_I	37	2	NM_015033	0	0	2	2	0	O60301|Q3MIN8|Q5TC87|Q5TC88|Q6P658|Q7LGG2|Q9H8H8|Q9NWD1	Missense_Mutation	SNP	ENST00000446176.2	37	CCDS48040.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.260778	0.80246	.	.	ENSG00000187239	ENST00000372416;ENST00000446176;ENST00000420781;ENST00000372415;ENST00000355681	T;T;T	0.46819	0.86;0.86;0.86	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.67487	0.2898	M	0.72894	2.215	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.996;1.0;0.992;0.999;1.0;0.995;0.999	P;D;P;D;D;P;D	0.72625	0.833;0.978;0.802;0.963;0.978;0.903;0.96	T	0.66548	-0.5896	10	0.38643	T	0.18	-19.6827	17.3082	0.87201	0.0:1.0:0.0:0.0	.	160;160;160;160;121;160;160	B7ZL12;B7ZL13;B7ZL14;Q96RU3-3;Q5QP69;Q96RU3-2;Q96RU3	.;.;.;.;.;.;FNBP1_HUMAN	P	160	ENSP00000413625:A160P;ENSP00000407548:A160P;ENSP00000347907:A160P	ENSP00000347907:A160P	A	-	1	0	FNBP1	131759495	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	4.632000	0.61311	2.434000	0.82447	0.479000	0.44913	GCT	C|1.000;T|0.000		0.483	FNBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054630.2		
OBP2B	29989	hgsc.bcm.edu	37	9	136083879	136083879	+	Missense_Mutation	SNP	C	C	G	rs28584111		TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr9:136083879C>G	ENST00000372034.3	-	2	224	c.183G>C	c.(181-183)aaG>aaC	p.K61N	OBP2B_ENST00000372032.2_Intron|OBP2B_ENST00000461961.1_Intron	NM_014581.2	NP_055396.1	Q9NPH6	OBP2B_HUMAN	odorant binding protein 2B	61					chemosensory behavior (GO:0007635)|sensory perception of smell (GO:0007608)|transport (GO:0006810)	extracellular region (GO:0005576)	odorant binding (GO:0005549)	p.K61N(1)		central_nervous_system(2)|large_intestine(1)|lung(3)|skin(1)	7				OV - Ovarian serous cystadenocarcinoma(145;3.41e-06)|Epithelial(140;1.88e-05)		TGGCTTCCAACTTCCCACCGC	0.622																																					p.K61N		.											.	OBP2B-68	1	Substitution - Missense(1)	large_intestine(1)	c.G183C						.						124.0	110.0	115.0					9																	136083879		2203	4300	6503	SO:0001583	missense	29989	exon2			TTCCAACTTCCCA	AJ251026	CCDS6961.1	9q34	2014-01-22			ENSG00000171102	ENSG00000171102		"""Lipocalins"""	23381	protein-coding gene	gene with protein product		604606					Standard	NM_001288987		Approved	hOBPIIb, LCN14	uc004ccz.3	Q9NPH6	OTTHUMG00000020860	ENST00000372034.3:c.183G>C	9.37:g.136083879C>G	ENSP00000361104:p.Lys61Asn	Somatic	61	2		WXS	Illumina HiSeq	Phase_I	52	4	NM_014581	0	0	0	0	0	Q5VSP6|Q9NY51|Q9NY52	Missense_Mutation	SNP	ENST00000372034.3	37	CCDS6961.1	.	.	.	.	.	.	.	.	.	.	G	0.643	-0.812613	0.02798	.	.	ENSG00000171102	ENST00000372034	T	0.08458	3.09	2.31	-0.281	0.12882	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	1.089000	0.07156	N	0.849966	T	0.02230	0.0069	N	0.01122	-1.005	0.09310	N	0.999997	B	0.02656	0.0	B	0.01281	0.0	T	0.45116	-0.9283	10	0.07813	T	0.8	-15.6209	4.9518	0.14019	0.0:0.4459:0.3286:0.2255	rs28584111	61	Q9NPH6	OBP2B_HUMAN	N	61	ENSP00000361104:K61N	ENSP00000361104:K61N	K	-	3	2	OBP2B	135073700	0.003000	0.15002	0.017000	0.16124	0.019000	0.09904	0.281000	0.18810	-0.129000	0.11620	-0.335000	0.08231	AAG	.		0.622	OBP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054851.1	NM_014581	
SNAPC4	6621	hgsc.bcm.edu;broad.mit.edu	37	9	139272475	139272475	+	Silent	SNP	G	G	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr9:139272475G>T	ENST00000298532.2	-	21	4172	c.3804C>A	c.(3802-3804)gcC>gcA	p.A1268A		NM_003086.2	NP_003077.2			small nuclear RNA activating complex, polypeptide 4, 190kDa											biliary_tract(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	33		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.31e-06)|Epithelial(140;7.13e-06)		CCAGGTCCAGGGCCCCCTTCT	0.731																																					p.A1268A		.											.	SNAPC4-90	0			c.C3804A						.						4.0	5.0	5.0					9																	139272475		1776	3616	5392	SO:0001819	synonymous_variant	6621	exon21			GTCCAGGGCCCCC	AF032387	CCDS6998.1	9q34.3	2008-07-21	2002-08-29		ENSG00000165684	ENSG00000165684			11137	protein-coding gene	gene with protein product		602777	"""small nuclear RNA activating complex, polypeptide 4, 190kD"""			9418884	Standard	XM_005266096		Approved	SNAP190, PTFalpha, FLJ13451	uc004chh.3	Q5SXM2	OTTHUMG00000020929	ENST00000298532.2:c.3804C>A	9.37:g.139272475G>T		Somatic	35	0		WXS	Illumina HiSeq	Phase_I	24	8	NM_003086	0	0	1	2	1		Silent	SNP	ENST00000298532.2	37	CCDS6998.1																																																																																			.		0.731	SNAPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055071.1	NM_003086	
BCOR	54880	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	39932880	39932880	+	Silent	SNP	G	G	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chrX:39932880G>T	ENST00000378444.4	-	4	1947	c.1719C>A	c.(1717-1719)gcC>gcA	p.A573A	BCOR_ENST00000342274.4_Silent_p.A573A|BCOR_ENST00000378455.4_Silent_p.A573A|BCOR_ENST00000397354.3_Silent_p.A573A	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	573					heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						TGGCATTGGGGGCGGGTGATG	0.617			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																														p.A573A		.		Rec	yes		X	Xp11.4	54880	BCL6 corepressor	yes		.	BCOR-229	0			c.C1719A						.						72.0	62.0	65.0					X																	39932880		2202	4300	6502	SO:0001819	synonymous_variant	54880	exon4			ATTGGGGGCGGGT	AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.1719C>A	X.37:g.39932880G>T		Somatic	70	0		WXS	Illumina HiSeq	Phase_I	38	32	NM_001123385	0	0	0	9	9	D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Silent	SNP	ENST00000378444.4	37	CCDS48093.1																																																																																			.		0.617	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060666.2	NM_017745	
CXorf38	159013	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	40506303	40506303	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chrX:40506303A>G	ENST00000327877.5	-	2	333	c.307T>C	c.(307-309)Tgc>Cgc	p.C103R	CXorf38_ENST00000378426.1_5'UTR|CXorf38_ENST00000440784.2_Intron|CXorf38_ENST00000378418.2_Missense_Mutation_p.C103R|CXorf38_ENST00000378421.1_5'UTR	NM_144970.2	NP_659407.1	Q8TB03	CX038_HUMAN	chromosome X open reading frame 38	103										NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	12						CCCGGCCGGCAGTTTCCCCAG	0.622																																					p.C103R		.											.	CXorf38-131	0			c.T307C						.						26.0	27.0	26.0					X																	40506303		2202	4300	6502	SO:0001583	missense	159013	exon2			GCCGGCAGTTTCC	AL832829	CCDS14253.1	Xp11	2008-02-05			ENSG00000185753	ENSG00000185753			28589	protein-coding gene	gene with protein product							Standard	NM_144970		Approved	MGC39350	uc004dew.3	Q8TB03	OTTHUMG00000024104	ENST00000327877.5:c.307T>C	X.37:g.40506303A>G	ENSP00000330488:p.Cys103Arg	Somatic	38	0		WXS	Illumina HiSeq	Phase_I	22	14	NM_144970	0	0	0	2	2	B3KW28|D3DWB5|Q5JPF5|Q8N941	Missense_Mutation	SNP	ENST00000327877.5	37	CCDS14253.1	.	.	.	.	.	.	.	.	.	.	a	22.0	4.230190	0.79688	.	.	ENSG00000185753	ENST00000327877;ENST00000378418	T;T	0.70516	-0.49;-0.49	5.26	4.06	0.47325	.	0.123229	0.56097	D	0.000040	T	0.79003	0.4373	M	0.66939	2.045	0.80722	D	1	D	0.55385	0.971	P	0.60473	0.875	T	0.78976	-0.1991	10	0.87932	D	0	-4.1854	10.4684	0.44622	0.8383:0.1617:0.0:0.0	.	103	Q8TB03	CX038_HUMAN	R	103	ENSP00000330488:C103R;ENSP00000367674:C103R	ENSP00000330488:C103R	C	-	1	0	CXorf38	40391247	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	7.258000	0.78371	0.627000	0.30340	0.483000	0.47432	TGC	.		0.622	CXorf38-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060685.3	NM_144970	
GJB1	2705	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	70444364	70444364	+	Silent	SNP	C	C	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chrX:70444364C>T	ENST00000374022.3	+	2	902	c.807C>T	c.(805-807)acC>acT	p.T269T	GJB1_ENST00000361726.6_Silent_p.T269T|GJB1_ENST00000374029.1_Silent_p.T269T	NM_001097642.2	NP_001091111.1	P08034	CXB1_HUMAN	gap junction protein, beta 1, 32kDa	269					cell death (GO:0008219)|cell-cell signaling (GO:0007267)|gap junction assembly (GO:0016264)|membrane organization (GO:0061024)|nervous system development (GO:0007399)|protein oligomerization (GO:0051259)|purine ribonucleotide transport (GO:0015868)|transport (GO:0006810)	connexon complex (GO:0005922)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	gap junction channel activity (GO:0005243)			breast(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(1)	10	Renal(35;0.156)					GCCCTGGCACCGGGGCTGGGC	0.637																																					p.T269T		.											.	GJB1-193	0			c.C807T						.						7.0	7.0	7.0					X																	70444364		2162	4203	6365	SO:0001819	synonymous_variant	2705	exon2			TGGCACCGGGGCT	X04325	CCDS14408.1	Xq13.1	2014-09-17	2007-01-16		ENSG00000169562	ENSG00000169562		"""Ion channels / Gap junction proteins (connexins)"""	4283	protein-coding gene	gene with protein product	"""Charcot-Marie-Tooth neuropathy, X-linked"", ""connexin 32"""	304040	"""gap junction protein, beta 1, 32kD (connexin 32, Charcot-Marie-Tooth neuropathy, X-linked)"", ""gap junction protein, beta 1, 32kDa (connexin 32, Charcot-Marie-Tooth neuropathy, X-linked)"", ""gap junction protein, beta 1, 32kDa (connexin 32)"""	CMTX1, CMTX		1319395	Standard	NM_000166		Approved	CX32	uc004dzf.3	P08034	OTTHUMG00000021797	ENST00000374022.3:c.807C>T	X.37:g.70444364C>T		Somatic	19	0		WXS	Illumina HiSeq	Phase_I	10	7	NM_000166	0	0	24	32	8	B2R8R2|D3DVV2|Q5U0S4	Silent	SNP	ENST00000374022.3	37	CCDS14408.1																																																																																			.		0.637	GJB1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057133.1	NM_000166	
PASD1	139135	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	X	150828200	150828200	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chrX:150828200G>T	ENST00000370357.4	+	10	978	c.733G>T	c.(733-735)Gca>Tca	p.A245S		NM_173493.2	NP_775764.2	Q8IV76	PASD1_HUMAN	PAS domain containing 1	245						nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(3)|liver(1)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48	Acute lymphoblastic leukemia(192;6.56e-05)					AATTGATATTGCAGAGGTTGA	0.373																																					p.A245S		.											.	PASD1-133	0			c.G733T						.						200.0	160.0	173.0					X																	150828200		2203	4300	6503	SO:0001583	missense	139135	exon10			GATATTGCAGAGG	AY270020	CCDS35431.1	Xq28	2009-08-06			ENSG00000166049	ENSG00000166049			20686	protein-coding gene	gene with protein product	"""cancer/testis antigen 63"""					15122589, 15162151	Standard	NM_173493		Approved	CT63	uc004fev.4	Q8IV76	OTTHUMG00000024169	ENST00000370357.4:c.733G>T	X.37:g.150828200G>T	ENSP00000359382:p.Ala245Ser	Somatic	32	0		WXS	Illumina HiSeq	Phase_I	40	4	NM_173493	0	0	0	0	0	Q3MNE0|Q69HD7|Q8N7X9	Missense_Mutation	SNP	ENST00000370357.4	37	CCDS35431.1	.	.	.	.	.	.	.	.	.	.	g	8.919	0.960719	0.18583	.	.	ENSG00000166049	ENST00000370357	T	0.70399	-0.48	3.46	-4.06	0.03986	.	.	.	.	.	T	0.44850	0.1313	N	0.14661	0.345	0.09310	N	1	B	0.26876	0.162	B	0.19666	0.026	T	0.16897	-1.0387	9	0.27082	T	0.32	-10.8623	5.9292	0.19130	0.6076:0.0:0.245:0.1474	.	245	Q8IV76	PASD1_HUMAN	S	245	ENSP00000359382:A245S	ENSP00000359382:A245S	A	+	1	0	PASD1	150578856	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.030000	0.03581	-1.424000	0.01999	-0.925000	0.02716	GCA	.		0.373	PASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060879.2	NM_173493	
CCDC18	343099	hgsc.bcm.edu;broad.mit.edu	37	1	93680444	93680444	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr1:93680444delC	ENST00000343253.7	+	12	2139	c.1637delC	c.(1636-1638)gctfs	p.A546fs	CCDC18_ENST00000338949.4_Frame_Shift_Del_p.A346fs|CCDC18_ENST00000401026.3_Frame_Shift_Del_p.A547fs|CCDC18_ENST00000557479.1_Frame_Shift_Del_p.A665fs|CCDC18_ENST00000334652.5_5'UTR			Q5T9S5	CCD18_HUMAN	coiled-coil domain containing 18	546										breast(5)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		GTTAACATGGCTCACAGAACT	0.388																																					p.A547fs		.											.	CCDC18-138	0			c.1640delC						.						51.0	48.0	49.0					1																	93680444		1844	4098	5942	SO:0001589	frameshift_variant	343099	exon12			.			1p22.1	2008-02-05			ENSG00000122483	ENSG00000122483			30370	protein-coding gene	gene with protein product						12601173	Standard	XM_006710609		Approved	NY-SAR-41	uc021opx.1	Q5T9S5	OTTHUMG00000010598	ENST00000343253.7:c.1637delC	1.37:g.93680444delC	ENSP00000343377:p.Ala546fs	Somatic	21	0		WXS	Illumina HiSeq	Phase_I	33	11	NM_206886	0	0	0	0	0	Q6ZU17	Frame_Shift_Del	DEL	ENST00000343253.7	37																																																																																				.		0.388	CCDC18-008	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000382327.1	NM_206886	
RPTN	126638	broad.mit.edu	37	1	152127881	152127884	+	Frame_Shift_Del	DEL	TGTC	TGTC	-			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	TGTC	TGTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr1:152127881_152127884delTGTC	ENST00000316073.3	-	3	1755_1758	c.1691_1694delGACA	c.(1690-1695)agacaafs	p.RQ564fs		NM_001122965.1	NP_001116437.1	Q6XPR3	RPTN_HUMAN	repetin	564	Gln-rich.					cornified envelope (GO:0001533)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|endometrium(14)|kidney(2)|large_intestine(1)|lung(32)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	59						GCTCTGGCCTTGTCTGTCTGTCTG	0.485																																					p.564_565del													.	RPTN-68	0			c.1691_1694del						.																																			SO:0001589	frameshift_variant	126638	exon3			TGGCCTTGTCTGT	AK096436	CCDS41397.1	1q21.3	2013-01-10			ENSG00000215853	ENSG00000215853		"""EF-hand domain containing"""	26809	protein-coding gene	gene with protein product		613259				15854042	Standard	NM_001122965		Approved	FLJ39117	uc001ezs.1	Q6XPR3	OTTHUMG00000154095	ENST00000316073.3:c.1691_1694delGACA	1.37:g.152127889_152127892delTGTC	ENSP00000317895:p.Arg564fs	Somatic	695	0		WXS	Illumina HiSeq	Phase_I	758	6	NM_001122965	0	0	0	0	0	B7ZBZ3	Frame_Shift_Del	DEL	ENST00000316073.3	37	CCDS41397.1																																																																																			.		0.485	RPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333867.1	XM_371312	
FBXO42	54455	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	16577319	16577320	+	Frame_Shift_Ins	INS	-	-	TATTAAA			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr1:16577319_16577320insTATTAAA	ENST00000375592.3	-	10	2215_2216	c.1999_2000insTTTAATA	c.(1999-2001)agcfs	p.S667fs		NM_018994.1	NP_061867.1	Q6P3S6	FBX42_HUMAN	F-box protein 42	667										autonomic_ganglia(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	26		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00475)|all_lung(284;0.00671)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0193)|Colorectal(212;3.16e-07)|COAD - Colon adenocarcinoma(227;1.46e-05)|BRCA - Breast invasive adenocarcinoma(304;4.37e-05)|Kidney(64;0.000246)|KIRC - Kidney renal clear cell carcinoma(64;0.00336)|STAD - Stomach adenocarcinoma(313;0.0139)|READ - Rectum adenocarcinoma(331;0.0693)		CACAGAACTGCTATTAAATACT	0.475																																					p.S667_S668delinsIX		.											.	FBXO42-228	0			c.2000_2001insTTTAATA						.																																			SO:0001589	frameshift_variant	54455	exon10			.	BC063864	CCDS30613.1	1p36.23-p36.11	2008-02-05			ENSG00000037637	ENSG00000037637		"""F-boxes /  ""other"""""	29249	protein-coding gene	gene with protein product		609109				10718198	Standard	XM_006710698		Approved	KIAA1332, Fbx42	uc001ayg.3	Q6P3S6	OTTHUMG00000002218	ENST00000375592.3:c.1993_1999dupTTTAATA	1.37:g.16577320_16577326dupTATTAAA	ENSP00000364742:p.Ser667fs	Somatic	262	0		WXS	Illumina HiSeq	Phase_I	221	35	NM_018994	0	0	0	0	0	B3KP30|Q5TEU8|Q86XI0|Q8N3N4|Q8N5F8|Q9BRM0|Q9P2L4	Nonsense_Mutation	INS	ENST00000375592.3	37	CCDS30613.1																																																																																			.		0.475	FBXO42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006285.1		
ASAP3	55616	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	23779230	23779231	+	Frame_Shift_Ins	INS	-	-	GG			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr1:23779230_23779231insGG	ENST00000336689.3	-	4	426_427	c.382_383insCC	c.(382-384)ctgfs	p.L128fs	ASAP3_ENST00000437606.2_Frame_Shift_Ins_p.L128fs	NM_017707.3	NP_060177.2	Q8TDY4	ASAP3_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 3	128					cell migration (GO:0016477)|positive regulation of ARF GTPase activity (GO:0032850)|regulation of stress fiber assembly (GO:0051492)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	24						CAGACTGTCCAGGGGGAAAGAG	0.559																																					p.L128fs		.											.	ASAP3-155	0			c.383_384insCC						.																																			SO:0001589	frameshift_variant	55616	exon4			.	AK000206	CCDS235.1, CCDS44087.1	1p36.13	2013-01-10	2008-10-09	2008-09-22	ENSG00000088280	ENSG00000088280		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	14987	protein-coding gene	gene with protein product	"""centaurin, beta 6"""		"""development and differentiation enhancing factor-like 1"""	DDEFL1		14654939	Standard	NM_017707		Approved	FLJ20199, UPLC1, CENTB6	uc001bha.2	Q8TDY4	OTTHUMG00000003234	ENST00000336689.3:c.381_382dupCC	1.37:g.23779233_23779234dupGG	ENSP00000338769:p.Leu128fs	Somatic	233	0		WXS	Illumina HiSeq	Phase_I	214	80	NM_001143778	0	0	0	0	0	B3KRW0|B4DHH4|Q6P9F4|Q86UY1|Q9NXK2	Frame_Shift_Ins	INS	ENST00000336689.3	37	CCDS235.1																																																																																			.		0.559	ASAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008916.2	NM_017707	
HECTD2	143279	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	93252242	93252243	+	Splice_Site	INS	-	-	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr10:93252242_93252243insT	ENST00000298068.5	+	13	1526		c.e13+1		HECTD2_ENST00000446394.1_Splice_Site|HECTD2_ENST00000371667.1_Splice_Site|HECTD2_ENST00000536715.1_Splice_Site	NM_182765.3	NP_877497	Q5U5R9	HECD2_HUMAN	HECT domain containing E3 ubiquitin protein ligase 2						protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|endometrium(2)|kidney(4)|large_intestine(10)|lung(7)|skin(1)|urinary_tract(1)	27						CCAGATTATGGTAAGTATGTAA	0.312																																					.	NSCLC(12;376 469 1699 39910 41417)	.											.	HECTD2-658	0			c.1432+1->T						.																																			SO:0001630	splice_region_variant	143279	exon13			.	AK094625	CCDS7414.1, CCDS7415.1, CCDS60591.1	10q23.32	2013-09-20	2012-02-23		ENSG00000165338	ENSG00000165338			26736	protein-coding gene	gene with protein product			"""HECT domain containing 2"""			8619474, 9110174	Standard	NM_001284274		Approved	FLJ37306	uc001khl.2	Q5U5R9	OTTHUMG00000018742	ENST00000298068.5:c.1432+1->T	10.37:g.93252243_93252243dupT		Somatic	33	0		WXS	Illumina HiSeq	Phase_I	38	14	NM_182765	0	0	0	0	0	Q5VZ97|Q5VZ98|Q5VZ99|Q8N1X7|Q8TCP5	Splice_Site	INS	ENST00000298068.5	37	CCDS7414.1																																																																																			.		0.312	HECTD2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098620.1		Intron
STK24	8428	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	99114124	99114125	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr13:99114124_99114125insC	ENST00000376547.3	-	8	1137_1138	c.992_993insG	c.(991-993)ggcfs	p.G331fs	STK24_ENST00000397517.2_Frame_Shift_Ins_p.G319fs|STK24_ENST00000539966.1_Frame_Shift_Ins_p.G300fs	NM_003576.3	NP_003567.2	Q9Y6E0	STK24_HUMAN	serine/threonine kinase 24	331					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|execution phase of apoptosis (GO:0097194)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of cell migration (GO:0030336)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of axon regeneration (GO:0048679)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	17	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			CAGAATCACTGCCCCCCGAGGC	0.535																																					p.G331fs		.											.	STK24-979	0			c.993_994insG						.																																			SO:0001589	frameshift_variant	8428	exon8			.	AF024636	CCDS9488.1, CCDS32001.1, CCDS66573.1	13q31.2-q32.3	2010-06-25	2010-06-25		ENSG00000102572	ENSG00000102572			11403	protein-coding gene	gene with protein product	"""STE20-like kinase 3"", ""sterile 20-like kinase 3"""	604984	"""serine/threonine kinase 24 (Ste20, yeast homolog)"""			9353338, 10644707	Standard	NM_003576		Approved	MST-3, MST3, MST3B, STK3, STE20	uc001vnn.1	Q9Y6E0	OTTHUMG00000017250	ENST00000376547.3:c.993dupG	13.37:g.99114130_99114130dupC	ENSP00000365730:p.Gly331fs	Somatic	103	0		WXS	Illumina HiSeq	Phase_I	113	41	NM_003576	0	0	0	0	0	O14840|Q5JV92	Frame_Shift_Ins	INS	ENST00000376547.3	37	CCDS9488.1																																																																																			.		0.535	STK24-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045549.2	NM_003576	
ACMSD	130013	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	135659397	135659398	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr2:135659397_135659398insT	ENST00000356140.5	+	10	1114_1115	c.978_979insT	c.(979-981)tttfs	p.F327fs	AC016725.4_ENST00000428857.1_RNA|ACMSD_ENST00000283054.4_Frame_Shift_Ins_p.F269fs|AC016725.4_ENST00000413962.1_RNA|AC016725.4_ENST00000537615.1_RNA|ACMSD_ENST00000392928.1_Frame_Shift_Ins_p.F269fs|AC016725.4_ENST00000392929.2_RNA	NM_138326.2	NP_612199.2	Q8TDX5	ACMSD_HUMAN	aminocarboxymuconate semialdehyde decarboxylase	327					cellular nitrogen compound metabolic process (GO:0034641)|quinolinate metabolic process (GO:0046874)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aminocarboxymuconate-semialdehyde decarboxylase activity (GO:0001760)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(4)|lung(6)|skin(1)	14				BRCA - Breast invasive adenocarcinoma(221;0.115)		ATGCCCTGGCATTTTTGGGTCT	0.297																																					p.A326fs		.											.	ACMSD-91	0			c.978_979insT						.																																			SO:0001589	frameshift_variant	130013	exon10			.	AB071418	CCDS2173.2	2q21.3	2008-03-11			ENSG00000153086	ENSG00000153086	4.1.1.45		19288	protein-coding gene	gene with protein product		608889				12140278	Standard	NM_138326		Approved		uc002ttz.3	Q8TDX5	OTTHUMG00000131711	ENST00000356140.5:c.983dupT	2.37:g.135659402_135659402dupT	ENSP00000348459:p.Phe327fs	Somatic	44	0		WXS	Illumina HiSeq	Phase_I	42	18	NM_138326	0	0	0	0	0	Q3B7X3|Q53SR5|Q96KY2	Frame_Shift_Ins	INS	ENST00000356140.5	37	CCDS2173.2																																																																																			.		0.297	ACMSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254627.1		
