#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TCTEX1D4	343521	hgsc.bcm.edu	37	1	45271914	45271914	+	Missense_Mutation	SNP	C	C	A	rs17886308	byFrequency	TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr1:45271914C>A	ENST00000339355.2	-	1	433	c.427G>T	c.(427-429)Gac>Tac	p.D143Y	BTBD19_ENST00000453418.1_5'Flank|BTBD19_ENST00000450269.1_5'Flank|BTBD19_ENST00000409335.2_5'Flank|TCTEX1D4_ENST00000372200.1_Missense_Mutation_p.D143Y			Q5JR98	TC1D4_HUMAN	Tctex1 domain containing 4	143						acrosomal vesicle (GO:0001669)|axoneme (GO:0005930)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)	protein phosphatase 1 binding (GO:0008157)			pancreas(1)	1	Acute lymphoblastic leukemia(166;0.155)					GCGGCCTCGTCGCTGGAGTAG	0.726													C|||	17	0.00339457	0.0121	0.0014	5008	,	,		10391	0.0		0.0	False		,,,				2504	0.0				p.D143Y		.											.	TCTEX1D4-91	0			c.G427T						.	C	TYR/ASP	20,3036		0,20,1508	2.0	3.0	3.0		427	-11.1	0.0	1	dbSNP_124	3	1,6517		0,1,3258	no	missense	TCTEX1D4	NM_001013632.2	160	0,21,4766	AA,AC,CC		0.0153,0.6545,0.2193	benign	143/222	45271914	21,9553	1528	3259	4787	SO:0001583	missense	343521	exon2			CCTCGTCGCTGGA	BC092499	CCDS30699.1	1p34.1	2007-12-17				ENSG00000188396			32315	protein-coding gene	gene with protein product	"""novel Tctex-1 family domain-containing protein"""	611713				12477932	Standard	XM_006710614		Approved		uc001cmp.3	Q5JR98		ENST00000339355.2:c.427G>T	1.37:g.45271914C>A	ENSP00000341803:p.Asp143Tyr	Somatic	5	1		WXS	Illumina HiSeq	Phase_I	6	2	NM_001013632	0	0	0	0	0		Missense_Mutation	SNP	ENST00000339355.2	37	CCDS30699.1	6	0.0027472527472527475	5	0.01016260162601626	1	0.0027624309392265192	0	0.0	0	0.0	C	14.07	2.425354	0.43020	0.006545	1.53E-4	ENSG00000188396	ENST00000339355;ENST00000372200	T;T	0.31769	1.48;1.48	5.54	-11.1	0.00147	.	1.665700	0.03319	N	0.191643	T	0.08846	0.0219	N	0.12746	0.255	0.09310	N	1	B	0.13594	0.008	B	0.23150	0.044	T	0.27020	-1.0086	10	0.48119	T	0.1	0.2504	0.8024	0.01077	0.3558:0.1086:0.1938:0.3418	rs17886308	143	Q5JR98	TC1D4_HUMAN	Y	143	ENSP00000341803:D143Y;ENSP00000361274:D143Y	ENSP00000341803:D143Y	D	-	1	0	TCTEX1D4	45044501	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.985000	0.00319	-3.696000	0.00119	-0.263000	0.10527	GAC	C|0.997;A|0.003		0.726	TCTEX1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023733.1	NM_001013632	
AKR1A1	10327	hgsc.bcm.edu	37	1	46033809	46033809	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr1:46033809A>G	ENST00000372070.3	+	6	1259	c.512A>G	c.(511-513)gAc>gGc	p.D171G	AKR1A1_ENST00000351829.4_Missense_Mutation_p.D171G|AKR1A1_ENST00000473038.1_3'UTR	NM_001202413.1|NM_001202414.1|NM_006066.3	NP_001189342.1|NP_001189343.1|NP_006057.1	P14550	AK1A1_HUMAN	aldo-keto reductase family 1, member A1 (aldehyde reductase)	171					aldehyde catabolic process (GO:0046185)|cellular aldehyde metabolic process (GO:0006081)|D-glucuronate catabolic process (GO:0042840)|glucose metabolic process (GO:0006006)|L-ascorbic acid biosynthetic process (GO:0019853)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|electron carrier activity (GO:0009055)|L-glucuronate reductase activity (GO:0047939)			lung(3)|prostate(1)|urinary_tract(1)	5	Acute lymphoblastic leukemia(166;0.155)				Doxorubicin(DB00997)	CAGATTGATGACATACTCAGT	0.567																																					p.D171G		.											.	AKR1A1-226	0			c.A512G						.						89.0	73.0	78.0					1																	46033809		2203	4300	6503	SO:0001583	missense	10327	exon6			TTGATGACATACT	J04794	CCDS523.1	1p33-p32	2010-04-08			ENSG00000117448	ENSG00000117448	1.1.1.2	"""Aldo-keto reductases"""	380	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 3"""	103830				2498333, 10393438	Standard	NM_001202414		Approved	ALR, DD3	uc001coe.3	P14550	OTTHUMG00000007740	ENST00000372070.3:c.512A>G	1.37:g.46033809A>G	ENSP00000361140:p.Asp171Gly	Somatic	41	0		WXS	Illumina HiSeq	Phase_I	39	2	NM_006066	0	0	110	110	0	A8KAL8|D3DQ04|Q6IAZ4	Missense_Mutation	SNP	ENST00000372070.3	37	CCDS523.1	.	.	.	.	.	.	.	.	.	.	A	29.5	5.012973	0.93346	.	.	ENSG00000117448	ENST00000372070;ENST00000351829	T;T	0.24908	1.83;1.83	5.75	5.75	0.90469	NADP-dependent oxidoreductase domain (3);	0.041179	0.85682	N	0.000000	T	0.49609	0.1567	M	0.73962	2.25	0.80722	D	1	D	0.61080	0.989	D	0.63192	0.912	T	0.48779	-0.9005	10	0.46703	T	0.11	.	16.1191	0.81329	1.0:0.0:0.0:0.0	.	171	P14550	AK1A1_HUMAN	G	171	ENSP00000361140:D171G;ENSP00000312606:D171G	ENSP00000312606:D171G	D	+	2	0	AKR1A1	45806396	1.000000	0.71417	0.982000	0.44146	0.881000	0.50899	9.249000	0.95470	2.204000	0.70986	0.529000	0.55759	GAC	.		0.567	AKR1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020851.1	NM_006066	
STRIP1	85369	hgsc.bcm.edu	37	1	110583300	110583300	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr1:110583300T>C	ENST00000369795.3	+	6	647	c.625T>C	c.(625-627)Tcc>Ccc	p.S209P	STRIP1_ENST00000369796.1_Missense_Mutation_p.S114P	NM_033088.3	NP_149079.2	Q5VSL9	STRP1_HUMAN	striatin interacting protein 1	209					cortical actin cytoskeleton organization (GO:0030866)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)											GCCTGCCATCTCCCTGGCTGA	0.567																																					p.S209P		.											.	.	0			c.T625C						.						33.0	28.0	30.0					1																	110583300		2203	4300	6503	SO:0001583	missense	85369	exon6			GCCATCTCCCTGG	AK027649	CCDS30798.1, CCDS59197.1	1p13.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000143093	ENSG00000143093			25916	protein-coding gene	gene with protein product	"""FAR11 factor arrest 11 homolog A (yeast)"""		"""family with sequence similarity 40, member A"""	FAM40A		11214970, 12588993, 22782902, 22298706, 18782753	Standard	NM_033088		Approved	FLJ14743, KIAA1761, FAR11A	uc001dza.2	Q5VSL9	OTTHUMG00000170607	ENST00000369795.3:c.625T>C	1.37:g.110583300T>C	ENSP00000358810:p.Ser209Pro	Somatic	30	0		WXS	Illumina HiSeq	Phase_I	28	2	NM_033088	0	0	1	1	0	Q0V925|Q5VSL8|Q658K2|Q6ZV31|Q8N598|Q96SN2|Q9C0A2	Missense_Mutation	SNP	ENST00000369795.3	37	CCDS30798.1	.	.	.	.	.	.	.	.	.	.	T	34	5.317204	0.95682	.	.	ENSG00000143093	ENST00000369796;ENST00000369795	T;T	0.50813	0.73;0.73	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.66867	0.2833	M	0.86651	2.83	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.79108	0.982;0.992	T	0.69075	-0.5241	10	0.37606	T	0.19	-27.1676	16.6438	0.85155	0.0:0.0:0.0:1.0	.	114;209	Q5VSL9-2;Q5VSL9	.;FA40A_HUMAN	P	114;209	ENSP00000358811:S114P;ENSP00000358810:S209P	ENSP00000358810:S209P	S	+	1	0	FAM40A	110384823	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.534000	0.82004	2.333000	0.79357	0.533000	0.62120	TCC	.		0.567	STRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032213.1	NM_033088	
DUSP27	92235	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	167097085	167097085	+	Missense_Mutation	SNP	A	A	C	rs377480316		TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr1:167097085A>C	ENST00000361200.2	+	6	2883	c.2717A>C	c.(2716-2718)aAa>aCa	p.K906T	DUSP27_ENST00000485151.1_Intron|DUSP27_ENST00000271385.5_Missense_Mutation_p.K906T|DUSP27_ENST00000443333.1_Missense_Mutation_p.K906T			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	906	Ser-rich.				protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						AATTCCCAGAAACCTGAAACA	0.493																																					p.K906T		.											.	DUSP27-71	0			c.A2717C						.	A	THR/LYS	0,4406		0,0,2203	87.0	77.0	81.0		2717	1.5	1.0	1		81	1,8599	1.2+/-3.3	0,1,4299	no	missense	DUSP27	NM_001080426.1	78	0,1,6502	CC,CA,AA		0.0116,0.0,0.0077	probably-damaging	906/1159	167097085	1,13005	2203	4300	6503	SO:0001583	missense	92235	exon5			CCCAGAAACCTGA	AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.2717A>C	1.37:g.167097085A>C	ENSP00000354483:p.Lys906Thr	Somatic	66	0		WXS	Illumina HiSeq	Phase_I	56	5	NM_001080426	0	0	0	0	0	A0AUM4|Q9C074	Missense_Mutation	SNP	ENST00000361200.2	37	CCDS30932.1	.	.	.	.	.	.	.	.	.	.	A	13.84	2.356232	0.41700	0.0	1.16E-4	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	T;T;T	0.04454	3.62;3.62;3.62	5.25	1.46	0.22682	.	0.874767	0.09948	N	0.735044	T	0.01905	0.0060	M	0.65975	2.015	0.09310	N	1	P	0.35433	0.501	B	0.27608	0.081	T	0.42899	-0.9424	10	0.87932	D	0	-19.6906	5.4857	0.16749	0.6201:0.1386:0.2413:0.0	.	906	Q5VZP5	DUS27_HUMAN	T	906	ENSP00000354483:K906T;ENSP00000271385:K906T;ENSP00000404874:K906T	ENSP00000271385:K906T	K	+	2	0	DUSP27	165363709	0.258000	0.24033	0.973000	0.42090	0.754000	0.42855	1.679000	0.37597	0.315000	0.23110	-0.269000	0.10298	AAA	.		0.493	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1	NM_001080426	
C1orf106	55765	hgsc.bcm.edu	37	1	200860815	200860815	+	Silent	SNP	A	A	G			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr1:200860815A>G	ENST00000367342.4	+	1	347	c.147A>G	c.(145-147)agA>agG	p.R49R		NM_018265.3	NP_060735.3	Q3KP66	CA106_HUMAN	chromosome 1 open reading frame 106	49										endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(2)	21						GCGGCGCCAGAGCTCCATGGG	0.692																																					p.R63R		.											.	C1orf106-93	0			c.A189G						.						14.0	15.0	15.0					1																	200860815		2194	4288	6482	SO:0001819	synonymous_variant	55765	exon1			CGCCAGAGCTCCA	AK001763	CCDS44292.1	1q32.1	2011-02-15			ENSG00000163362	ENSG00000163362			25599	protein-coding gene	gene with protein product						14702039	Standard	NM_018265		Approved	FLJ10901	uc001gvo.4	Q3KP66	OTTHUMG00000035789	ENST00000367342.4:c.147A>G	1.37:g.200860815A>G		Somatic	7	0		WXS	Illumina HiSeq	Phase_I	8	2	NM_018265	0	0	0	0	0	B4E1K9|E9PFY0|Q9NV65|Q9NVI0	Silent	SNP	ENST00000367342.4	37																																																																																				.		0.692	C1orf106-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000087057.2	NM_018265	
IRF2BP2	359948	hgsc.bcm.edu	37	1	234744215	234744215	+	Silent	SNP	G	G	A			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr1:234744215G>A	ENST00000366609.3	-	1	1056	c.1026C>T	c.(1024-1026)aaC>aaT	p.N342N	IRF2BP2_ENST00000366610.3_Intron|IRF2BP2_ENST00000491430.1_5'Flank|RP4-781K5.2_ENST00000436039.1_RNA	NM_182972.2	NP_892017.2	Q7Z5L9	I2BP2_HUMAN	interferon regulatory factor 2 binding protein 2	342					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11	Ovarian(103;0.0303)	all_cancers(173;0.0236)|Prostate(94;0.0115)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)|Epithelial(3;6.2e-05)			CGTTGGCCCCGTTGGCCTCGA	0.617																																					p.N342N		.											.	IRF2BP2-90	0			c.C1026T						.						19.0	20.0	20.0					1																	234744215		2202	4298	6500	SO:0001819	synonymous_variant	359948	exon1			GGCCCCGTTGGCC	AY278023	CCDS1602.1, CCDS41475.1	1q42.3	2008-02-05			ENSG00000168264	ENSG00000168264			21729	protein-coding gene	gene with protein product		615332				12799427	Standard	NM_182972		Approved	IRF-2BP2	uc001hwg.3	Q7Z5L9	OTTHUMG00000037981	ENST00000366609.3:c.1026C>T	1.37:g.234744215G>A		Somatic	27	0		WXS	Illumina HiSeq	Phase_I	21	2	NM_182972	0	0	66	66	0	B1AM35|B1AM36|Q6P083|Q7Z5L8|Q8N351|Q8WUH8	Silent	SNP	ENST00000366609.3	37	CCDS1602.1																																																																																			.		0.617	IRF2BP2-002	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000092705.1	NM_182972	
TAF10	6881	hgsc.bcm.edu	37	11	6632632	6632632	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr11:6632632A>G	ENST00000299424.4	-	3	916	c.439T>C	c.(439-441)Tca>Cca	p.S147P	TAF10_ENST00000531760.1_5'UTR|RP11-732A19.2_ENST00000527398.1_RNA	NM_006284.3	NP_006275.1	Q12962	TAF10_HUMAN	TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 30kDa	147					chromatin organization (GO:0006325)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone deubiquitination (GO:0016578)|histone H3 acetylation (GO:0043966)|protein homooligomerization (GO:0051260)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|perinuclear region of cytoplasm (GO:0048471)|STAGA complex (GO:0030914)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|RNA polymerase binding (GO:0070063)|transcription coactivator activity (GO:0003713)						Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.0481)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.129)		CGTGGGTCTGAGGCCTCAAAG	0.488																																					p.S147P		.											.	TAF10-90	0			c.T439C						.						87.0	83.0	84.0					11																	6632632		2201	4296	6497	SO:0001583	missense	6881	exon3			GGTCTGAGGCCTC	U13991, U25816	CCDS7769.1	11p15.5-p15.2	2006-11-14	2002-08-29	2001-12-07	ENSG00000166337	ENSG00000166337			11543	protein-coding gene	gene with protein product		600475	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, H, 30kD"""	TAF2H, TAF2A		7923369	Standard	NM_006284		Approved	TAFII30	uc001mej.2	Q12962	OTTHUMG00000133402	ENST00000299424.4:c.439T>C	11.37:g.6632632A>G	ENSP00000299424:p.Ser147Pro	Somatic	61	0		WXS	Illumina HiSeq	Phase_I	49	3	NM_006284	0	0	0	0	0	O00703|Q13175|Q6FH13	Missense_Mutation	SNP	ENST00000299424.4	37	CCDS7769.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.082995	0.76642	.	.	ENSG00000166337	ENST00000299424	T	0.47869	0.83	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.42698	0.1214	L	0.33189	0.99	0.80722	D	1	P	0.42248	0.774	P	0.44897	0.463	T	0.34153	-0.9840	10	0.42905	T	0.14	-5.9082	12.7863	0.57507	1.0:0.0:0.0:0.0	.	147	Q12962	TAF10_HUMAN	P	147	ENSP00000299424:S147P	ENSP00000299424:S147P	S	-	1	0	TAF10	6589208	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.372000	0.73123	2.116000	0.64780	0.482000	0.46254	TCA	.		0.488	TAF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257259.2	NM_006284	
MICALCL	84953	hgsc.bcm.edu	37	11	12316364	12316364	+	Silent	SNP	T	T	C	rs200708492		TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr11:12316364T>C	ENST00000256186.2	+	3	1677	c.1386T>C	c.(1384-1386)ccT>ccC	p.P462P		NM_032867.2	NP_116256.2	Q6ZW33	MICLK_HUMAN	MICAL C-terminal like	462	Poly-Pro.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	mitogen-activated protein kinase binding (GO:0051019)	p.P462P(2)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(5)|lung(5)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	30				Epithelial(150;0.00177)		ctcctcctcctcctcctcctc	0.582																																					p.P462P		.											.	MICALCL-91	2	Substitution - coding silent(2)	ovary(2)	c.T1386C						.						9.0	10.0	9.0					11																	12316364		1919	4019	5938	SO:0001819	synonymous_variant	84953	exon3			TCCTCCTCCTCCT	BK000463	CCDS41620.1	11p15.3	2005-11-01			ENSG00000133808	ENSG00000133808			25933	protein-coding gene	gene with protein product		612355				12110185	Standard	NM_032867		Approved	FLJ14966	uc001mkg.1	Q6ZW33	OTTHUMG00000165777	ENST00000256186.2:c.1386T>C	11.37:g.12316364T>C		Somatic	34	2		WXS	Illumina HiSeq	Phase_I	25	3	NM_032867	0	0	86	86	0	Q7RTP7|Q96JU6	Silent	SNP	ENST00000256186.2	37	CCDS41620.1																																																																																			T|0.994;C|0.006		0.582	MICALCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386164.1	NM_032867	
LRFN4	78999	hgsc.bcm.edu	37	11	66627272	66627272	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr11:66627272T>A	ENST00000309602.4	+	2	1757	c.1514T>A	c.(1513-1515)cTg>cAg	p.L505Q	PC_ENST00000393955.2_Intron|PC_ENST00000393958.2_Intron|LRFN4_ENST00000393952.3_Intron|PC_ENST00000393960.1_Intron	NM_024036.4	NP_076941.2	Q6PJG9	LRFN4_HUMAN	leucine rich repeat and fibronectin type III domain containing 4	505						integral component of membrane (GO:0016021)				breast(1)|lung(1)|prostate(1)	3						GCCTCGCCCCTGTGCCACGCC	0.706																																					p.L505Q		.											.	LRFN4-90	0			c.T1514A						.						28.0	23.0	25.0					11																	66627272		2190	4291	6481	SO:0001583	missense	78999	exon2			CGCCCCTGTGCCA	BC007718	CCDS8153.1	11q13.1	2013-02-11				ENSG00000173621		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	28456	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 6"""	612810				16495444, 16828986	Standard	NM_024036		Approved	MGC3103, SALM3., FIGLER6	uc001ojr.3	Q6PJG9		ENST00000309602.4:c.1514T>A	11.37:g.66627272T>A	ENSP00000312535:p.Leu505Gln	Somatic	16	0		WXS	Illumina HiSeq	Phase_I	26	2	NM_024036	0	0	27	27	0	Q4VBZ3|Q59GV4|Q8N644|Q9BWJ0	Missense_Mutation	SNP	ENST00000309602.4	37	CCDS8153.1	.	.	.	.	.	.	.	.	.	.	T	3.096	-0.185884	0.06340	.	.	ENSG00000173621	ENST00000309602	T	0.45276	0.9	4.71	4.71	0.59529	.	0.279394	0.19674	N	0.108672	T	0.13798	0.0334	N	0.01168	-0.975	0.80722	D	1	B	0.12013	0.005	B	0.11329	0.006	T	0.12268	-1.0554	10	0.08837	T	0.75	.	7.7816	0.29068	0.1863:0.0:0.0:0.8137	.	505	Q6PJG9	LRFN4_HUMAN	Q	505	ENSP00000312535:L505Q	ENSP00000312535:L505Q	L	+	2	0	LRFN4	66383848	0.002000	0.14202	0.997000	0.53966	0.717000	0.41224	-0.124000	0.10595	1.771000	0.52183	0.379000	0.24179	CTG	.		0.706	LRFN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393127.1	NM_024036	
MMP13	4322	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	102826393	102826393	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr11:102826393C>A	ENST00000260302.3	-	1	70	c.42G>T	c.(40-42)tgG>tgT	p.W14C	MMP13_ENST00000340273.4_Missense_Mutation_p.W14C	NM_002427.3	NP_002418.1	P45452	MMP13_HUMAN	matrix metallopeptidase 13 (collagenase 3)	14					bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cartilage development (GO:0051216)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|skin(1)|stomach(1)	27		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0144)	Marimastat(DB00786)	GACAATGAGTCCAGCTCAAGA	0.507																																					p.W14C		.											.	MMP13-229	0			c.G42T						.						94.0	94.0	94.0					11																	102826393		2202	4299	6501	SO:0001583	missense	4322	exon1			ATGAGTCCAGCTC	X75308	CCDS8324.1	11q22.3	2014-01-30	2005-08-08		ENSG00000137745	ENSG00000137745		"""Endogenous ligands"""	7159	protein-coding gene	gene with protein product	"""collagenase 3"""	600108	"""matrix metalloproteinase 13 (collagenase 3)"""			8207000	Standard	NM_002427		Approved	CLG3	uc001phl.3	P45452	OTTHUMG00000165850	ENST00000260302.3:c.42G>T	11.37:g.102826393C>A	ENSP00000260302:p.Trp14Cys	Somatic	114	0		WXS	Illumina HiSeq	Phase_I	101	10	NM_002427	0	0	0	0	0	A8K846|B2RCZ3|Q6NWN6	Missense_Mutation	SNP	ENST00000260302.3	37	CCDS8324.1	.	.	.	.	.	.	.	.	.	.	C	6.549	0.469578	0.12461	.	.	ENSG00000137745	ENST00000260302;ENST00000546012;ENST00000340273	T;T	0.15139	2.64;2.45	5.87	5.87	0.94306	.	0.442712	0.26311	N	0.025120	T	0.11024	0.0269	N	0.14661	0.345	0.47994	D	0.999562	P	0.48640	0.913	B	0.40741	0.339	T	0.03306	-1.1050	10	0.45353	T	0.12	.	11.7621	0.51910	0.1372:0.7305:0.1323:0.0	.	14	P45452	MMP13_HUMAN	C	14	ENSP00000260302:W14C;ENSP00000339672:W14C	ENSP00000260302:W14C	W	-	3	0	MMP13	102331603	0.998000	0.40836	0.987000	0.45799	0.168000	0.22595	1.956000	0.40382	2.941000	0.99782	0.655000	0.94253	TGG	.		0.507	MMP13-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386648.1	NM_002427	
GRAMD1B	57476	hgsc.bcm.edu	37	11	123448255	123448255	+	Silent	SNP	G	G	A	rs374298813		TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr11:123448255G>A	ENST00000529750.1	+	2	531	c.204G>A	c.(202-204)caG>caA	p.Q68Q	GRAMD1B_ENST00000456860.2_Silent_p.Q68Q|GRAMD1B_ENST00000322282.7_Silent_p.Q68Q	NM_020716.1	NP_065767.1	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B	68						integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		GCTCCTCCCAGTCCGGCCGGA	0.662											OREG0021454	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q68Q		.											.	GRAMD1B-69	0			c.G204A						.	G		1,4051		0,1,2025	13.0	18.0	16.0		204	4.9	1.0	11		16	0,8346		0,0,4173	no	coding-synonymous	GRAMD1B	NM_020716.1		0,1,6198	AA,AG,GG		0.0,0.0247,0.0081		68/739	123448255	1,12397	2026	4173	6199	SO:0001819	synonymous_variant	57476	exon2			CTCCCAGTCCGGC	AB033027	CCDS53720.1, CCDS66253.1, CCDS66254.1	11q24.1	2005-11-02				ENSG00000023171			29214	protein-coding gene	gene with protein product						10574462	Standard	NM_001286564		Approved	KIAA1201	uc001pyx.2	Q3KR37		ENST00000529750.1:c.204G>A	11.37:g.123448255G>A		Somatic	5	2	1526	WXS	Illumina HiSeq	Phase_I	8	3	NM_020716	0	0	1	1	0	Q6UW85|Q9ULL9	Silent	SNP	ENST00000529750.1	37	CCDS53720.1																																																																																			.		0.662	GRAMD1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387404.2	XM_370660	
CACNA1C	775	hgsc.bcm.edu;broad.mit.edu	37	12	2614092	2614092	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr12:2614092G>T	ENST00000347598.4	+	8	1198	c.1198G>T	c.(1198-1200)Gtt>Ttt	p.V400F	CACNA1C_ENST00000335762.5_Missense_Mutation_p.V400F|CACNA1C_ENST00000399637.1_Missense_Mutation_p.V400F|CACNA1C_ENST00000402845.3_Missense_Mutation_p.V400F|CACNA1C_ENST00000399641.1_Intron|CACNA1C_ENST00000399606.1_Missense_Mutation_p.V400F|CACNA1C_ENST00000399629.1_Missense_Mutation_p.V400F|CACNA1C_ENST00000327702.7_Missense_Mutation_p.V400F|CACNA1C_ENST00000399634.1_Intron|CACNA1C_ENST00000399638.1_Missense_Mutation_p.V400F|CACNA1C_ENST00000399617.1_Intron|CACNA1C_ENST00000399649.1_Missense_Mutation_p.V400F|CACNA1C_ENST00000344100.3_Missense_Mutation_p.V400F|CACNA1C_ENST00000399655.1_Missense_Mutation_p.V400F|CACNA1C_ENST00000399621.1_Missense_Mutation_p.V400F|CACNA1C_ENST00000491104.1_Intron|CACNA1C_ENST00000399595.1_Missense_Mutation_p.V400F|CACNA1C_ENST00000406454.3_Intron|CACNA1C_ENST00000480911.1_Missense_Mutation_p.V400F|CACNA1C_ENST00000399597.1_Missense_Mutation_p.V400F|CACNA1C_ENST00000399591.1_Missense_Mutation_p.V400F|CACNA1C_ENST00000399601.1_Missense_Mutation_p.V400F|CACNA1C_ENST00000399644.1_Missense_Mutation_p.V400F|CACNA1C_ENST00000399603.1_Intron	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	400					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	ACTTAACTTGGTTCTCGGTGT	0.398																																					p.V400F		.											.	CACNA1C-34	0			c.G1198T						.						111.0	106.0	108.0					12																	2614092		1895	4137	6032	SO:0001583	missense	775	exon8			AACTTGGTTCTCG	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.1198G>T	12.37:g.2614092G>T	ENSP00000266376:p.Val400Phe	Somatic	28	0		WXS	Illumina HiSeq	Phase_I	22	8	NM_001129831	0	0	0	0	0	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000347598.4	37	CCDS44788.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.221092	0.79464	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000480911;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399595	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.96104	-3.91;-3.91;-3.91;-3.91;-3.91;-3.91;-3.91;-3.91;-3.91;-3.91;-3.91;-3.91;-3.91;-3.91;-3.91;-3.91;-3.91;-3.91	5.27	5.27	0.74061	Ion transport (1);	.	.	.	.	D	0.96247	0.8776	L	0.35249	1.045	0.80722	D	1	D;D;D;D;D;D;D;P;D;D;D;D;D;D;D;D;D;D;D	0.89917	0.999;1.0;0.995;0.999;1.0;1.0;1.0;0.659;0.997;1.0;0.999;0.998;0.999;0.987;0.998;1.0;1.0;0.998;1.0	D;D;D;D;D;D;D;P;D;D;D;D;D;P;D;D;D;D;D	0.91635	0.996;0.997;0.934;0.995;0.999;0.997;0.999;0.835;0.975;0.999;0.999;0.925;0.998;0.805;0.991;0.999;0.999;0.991;0.997	D	0.96063	0.9040	9	0.46703	T	0.11	.	19.0978	0.93260	0.0:0.0:1.0:0.0	.	400;397;400;400;400;400;400;400;400;400;400;400;400;400;400;400;400;400;400	Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-11;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	F	400	ENSP00000336982:V400F;ENSP00000382563:V400F;ENSP00000437936:V400F;ENSP00000382552:V400F;ENSP00000382547:V400F;ENSP00000382506:V400F;ENSP00000382530:V400F;ENSP00000382546:V400F;ENSP00000382500:V400F;ENSP00000266376:V400F;ENSP00000382515:V400F;ENSP00000382510:V400F;ENSP00000341092:V400F;ENSP00000382537:V400F;ENSP00000329877:V400F;ENSP00000382557:V400F;ENSP00000385724:V400F;ENSP00000382504:V400F	ENSP00000329877:V400F	V	+	1	0	CACNA1C	2484353	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.657000	0.98554	2.735000	0.93741	0.655000	0.94253	GTT	.		0.398	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719	
KRAS	3845	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12D	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	.		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	.	KRAS-92875	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35A						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	ACGCCACCAGCTC	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	12.37:g.25398284C>T	ENSP00000256078:p.Gly12Asp	Somatic	29	0		WXS	Illumina HiSeq	Phase_I	37	19	NM_004985	0	0	6	10	4	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	.		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
TUBA1B	10376	hgsc.bcm.edu	37	12	49522587	49522587	+	Silent	SNP	G	G	A			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr12:49522587G>A	ENST00000336023.5	-	4	604	c.510C>T	c.(508-510)tcC>tcT	p.S170S	RP11-386G11.10_ENST00000547387.1_RNA|RP11-386G11.10_ENST00000552893.1_RNA|RP11-386G11.10_ENST00000547712.1_RNA|RP11-386G11.10_ENST00000551496.1_RNA|RP11-386G11.10_ENST00000548149.1_RNA	NM_006082.2	NP_006073.2	P68363	TBA1B_HUMAN	tubulin, alpha 1b	170					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cellular response to interleukin-4 (GO:0071353)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule cytoskeleton organization (GO:0000226)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(2)|cervix(1)|endometrium(3)|large_intestine(2)|lung(4)	12						CTGGGTAAATGGAGAACTCCA	0.532																																					p.S170S		.											.	TUBA1B-90	0			c.C510T						.						44.0	62.0	56.0					12																	49522587		2203	4296	6499	SO:0001819	synonymous_variant	10376	exon4			GTAAATGGAGAAC	AF081484	CCDS31792.1	12q13.12	2007-02-12				ENSG00000123416		"""Tubulins"""	18809	protein-coding gene	gene with protein product	"""tubulin, alpha, ubiquitous"""	602530				12054644, 6646120	Standard	NM_006082		Approved	K-ALPHA-1	uc001rtm.3	P68363	OTTHUMG00000170410	ENST00000336023.5:c.510C>T	12.37:g.49522587G>A		Somatic	104	0		WXS	Illumina HiSeq	Phase_I	96	5	NM_006082	0	0	1	1	0	P04687|P05209|Q27I68|Q8WU19	Silent	SNP	ENST00000336023.5	37	CCDS31792.1																																																																																			.		0.532	TUBA1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409005.1	NM_006082	
RAD9B	144715	hgsc.bcm.edu	37	12	110960047	110960047	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr12:110960047A>C	ENST00000409778.3	+	8	773	c.749A>C	c.(748-750)aAa>aCa	p.K250T	RAD9B_ENST00000409246.1_Missense_Mutation_p.K247T|RAD9B_ENST00000409425.1_Missense_Mutation_p.K247T|RAD9B_ENST00000392672.4_Missense_Mutation_p.K319T|RAD9B_ENST00000409300.1_Missense_Mutation_p.K319T			Q6WBX8	RAD9B_HUMAN	RAD9 homolog B (S. pombe)	316					DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)	checkpoint clamp complex (GO:0030896)|nucleoplasm (GO:0005654)				endometrium(1)|large_intestine(2)|lung(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	7						TGTATTTCAAAAAAAGCAGCA	0.408																																					p.K319T		.											.	RAD9B-228	0			c.A956C						.						43.0	42.0	42.0					12																	110960047		2203	4300	6503	SO:0001583	missense	144715	exon10			TTTCAAAAAAAGC		CCDS9148.2, CCDS66469.1, CCDS73526.1, CCDS73527.1	12q24.13	2008-12-15	2008-12-15		ENSG00000151164	ENSG00000151164			21700	protein-coding gene	gene with protein product		608368					Standard	NM_152442		Approved	FLJ40346	uc001trf.4	Q6WBX8	OTTHUMG00000152952	ENST00000409778.3:c.749A>C	12.37:g.110960047A>C	ENSP00000386697:p.Lys250Thr	Somatic	21	0		WXS	Illumina HiSeq	Phase_I	34	2	NM_152442	0	0	1	1	0	Q5U5K0|Q6NVJ1|Q6ZVT7|Q8N7T9|Q96LI8	Missense_Mutation	SNP	ENST00000409778.3	37		.	.	.	.	.	.	.	.	.	.	G	8.034	0.762320	0.15914	.	.	ENSG00000151164	ENST00000409246;ENST00000392672;ENST00000409300;ENST00000409425;ENST00000409778	T;T;T;T;T	0.23754	1.89;2.22;2.22;1.89;2.15	5.12	2.05	0.26809	.	0.435152	0.23142	N	0.051460	T	0.10766	0.0263	N	0.19112	0.55	0.09310	N	1	B;B;B	0.12013	0.0;0.005;0.0	B;B;B	0.09377	0.0;0.004;0.001	T	0.21930	-1.0231	10	0.12103	T	0.63	-10.2776	1.3704	0.02210	0.1914:0.1717:0.4596:0.1774	.	250;319;316	B4DYM6;B4DX60;Q6WBX8	.;.;RAD9B_HUMAN	T	247;319;319;247;250	ENSP00000387329:K247T;ENSP00000376440:K319T;ENSP00000386434:K319T;ENSP00000386629:K247T;ENSP00000386697:K250T	ENSP00000376440:K319T	K	+	2	0	RAD9B	109444430	0.111000	0.22076	0.035000	0.18076	0.357000	0.29423	0.805000	0.27112	0.647000	0.30713	-0.215000	0.12644	AAA	.		0.408	RAD9B-009	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404634.1	NM_152442	
MTUS2	23281	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	29599704	29599704	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr13:29599704C>T	ENST00000431530.3	+	1	957	c.899C>T	c.(898-900)tCg>tTg	p.S300L		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	290						cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)	p.S300L(2)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						ACTTTGGCATCGAAGGAAATC	0.507																																					p.S300L		.											.	MTUS2-218	2	Substitution - Missense(2)	endometrium(1)|central_nervous_system(1)	c.C899T						.						40.0	40.0	40.0					13																	29599704		2007	4188	6195	SO:0001583	missense	23281	exon1			TGGCATCGAAGGA	AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.899C>T	13.37:g.29599704C>T	ENSP00000392057:p.Ser300Leu	Somatic	32	0		WXS	Illumina HiSeq	Phase_I	32	9	NM_001033602	0	0	0	0	0	A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	ENST00000431530.3	37	CCDS45022.1	.	.	.	.	.	.	.	.	.	.	c	10.58	1.391325	0.25118	.	.	ENSG00000132938	ENST00000431530	T	0.13089	2.62	5.49	0.716	0.18191	.	0.981254	0.08305	N	0.966293	T	0.06096	0.0158	N	0.03115	-0.41	0.09310	N	1	B	0.21309	0.054	B	0.12156	0.007	T	0.44128	-0.9348	9	.	.	.	.	10.4835	0.44708	0.0:0.587:0.0:0.413	.	290	Q5JR59	MTUS2_HUMAN	L	300	ENSP00000392057:S300L	.	S	+	2	0	MTUS2	28497704	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	0.040000	0.13905	0.015000	0.14971	0.561000	0.74099	TCG	.		0.507	MTUS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044336.3	XM_166270	
NYNRIN	57523	hgsc.bcm.edu	37	14	24879003	24879003	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr14:24879003T>C	ENST00000382554.3	+	4	2321	c.2003T>C	c.(2002-2004)gTa>gCa	p.V668A		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	668					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						GCTCCCAAAGTACCTGTGACC	0.567																																					p.V668A		.											.	NYNRIN-3	0			c.T2003C						.						40.0	45.0	43.0					14																	24879003		1944	4140	6084	SO:0001583	missense	57523	exon4			CCAAAGTACCTGT	AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.2003T>C	14.37:g.24879003T>C	ENSP00000371994:p.Val668Ala	Somatic	24	1		WXS	Illumina HiSeq	Phase_I	26	4	NM_025081	0	0	1	1	0	Q6P153|Q86TR3|Q9HAC4	Missense_Mutation	SNP	ENST00000382554.3	37	CCDS45090.1	.	.	.	.	.	.	.	.	.	.	T	2.483	-0.319315	0.05386	.	.	ENSG00000205978	ENST00000382554	T	0.07688	3.17	3.23	2.32	0.28847	.	.	.	.	.	T	0.03477	0.0100	N	0.04508	-0.205	0.21355	N	0.999711	B	0.02656	0.0	B	0.01281	0.0	T	0.46148	-0.9212	9	0.12103	T	0.63	.	7.9246	0.29867	0.0:0.8644:0.0:0.1356	.	668	Q9P2P1	NYNRI_HUMAN	A	668	ENSP00000371994:V668A	ENSP00000371994:V668A	V	+	2	0	NYNRIN	23948843	0.993000	0.37304	0.508000	0.27688	0.206000	0.24218	1.627000	0.37050	0.904000	0.36572	-0.366000	0.07423	GTA	.		0.567	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412939.1		
ARHGAP5	394	hgsc.bcm.edu	37	14	32561433	32561433	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr14:32561433A>G	ENST00000345122.3	+	2	1873	c.1558A>G	c.(1558-1560)Aca>Gca	p.T520A	ARHGAP5_ENST00000432921.1_Missense_Mutation_p.T520A|ARHGAP5_ENST00000396582.2_Intron|ARHGAP5_ENST00000433497.1_Intron|ARHGAP5_ENST00000539826.2_Missense_Mutation_p.T520A|ARHGAP5_ENST00000556611.1_Missense_Mutation_p.T520A	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	520	FF 4.				cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)	p.T520A(1)		NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		TGAAATTCATACAGTTCTGAG	0.333																																					p.T520A	NSCLC(9;77 350 3443 29227 41353)	.											.	ARHGAP5-94	1	Substitution - Missense(1)	urinary_tract(1)	c.A1558G						.						30.0	30.0	30.0					14																	32561433		2201	4292	6493	SO:0001583	missense	394	exon2			ATTCATACAGTTC	U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.1558A>G	14.37:g.32561433A>G	ENSP00000371897:p.Thr520Ala	Somatic	54	0		WXS	Illumina HiSeq	Phase_I	55	7	NM_001173	0	0	4	4	0	A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Missense_Mutation	SNP	ENST00000345122.3	37	CCDS32062.1	.	.	.	.	.	.	.	.	.	.	A	2.843	-0.240070	0.05944	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000345122;ENST00000432921	T;T;T;T	0.27104	1.69;1.69;1.69;1.69	6.02	6.02	0.97574	FF domain (2);	0.265604	0.44688	D	0.000429	T	0.08403	0.0209	N	0.01352	-0.895	0.28157	N	0.929162	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.14117	-1.0484	10	0.27785	T	0.31	.	6.4383	0.21835	0.8146:0.0:0.1854:0.0	.	520;520	Q13017-2;Q13017	.;RHG05_HUMAN	A	520	ENSP00000452222:T520A;ENSP00000441692:T520A;ENSP00000371897:T520A;ENSP00000393307:T520A	ENSP00000371897:T520A	T	+	1	0	ARHGAP5	31631184	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.726000	0.47302	2.299000	0.77371	0.528000	0.53228	ACA	.		0.333	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409735.1	NM_001030055	
SLC8A3	6547	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	70527578	70527578	+	Silent	SNP	C	C	T	rs376675749		TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr14:70527578C>T	ENST00000381269.2	-	3	2616	c.1863G>A	c.(1861-1863)ccG>ccA	p.P621P	SLC8A3_ENST00000394330.2_Intron|SLC8A3_ENST00000216568.7_5'UTR|SLC8A3_ENST00000533541.1_Intron|SLC8A3_ENST00000357887.3_Intron|SLC8A3_ENST00000356921.2_Silent_p.P621P|SLC8A3_ENST00000534137.1_Silent_p.P621P|SLC8A3_ENST00000533899.1_5'UTR|SLC8A3_ENST00000528359.1_Intron	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	621					blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		CCATCCATTTCGGTTCACCAA	0.343																																					p.P621P		.											.	SLC8A3-225	0			c.G1863A						.	C	,,,,,	2,4404	4.2+/-10.8	0,2,2201	167.0	144.0	152.0		,,1863,1863,,1863	5.9	1.0	14		152	0,8600		0,0,4300	no	utr-5,intron,coding-synonymous,coding-synonymous,intron,coding-synonymous	SLC8A3	NM_001130417.1,NM_033262.3,NM_058240.2,NM_182932.1,NM_182936.1,NM_183002.1	,,,,,	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	,,,,,	,,621/925,621/922,,621/928	70527578	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	6547	exon3			CCATTTCGGTTCA	AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.1863G>A	14.37:g.70527578C>T		Somatic	101	0		WXS	Illumina HiSeq	Phase_I	71	22	NM_183002	0	0	0	0	0	Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Silent	SNP	ENST00000381269.2	37	CCDS35498.1																																																																																			.		0.343	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390736.1		
TRIP11	9321	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	92470654	92470654	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr14:92470654T>A	ENST00000267622.4	-	11	4039	c.3666A>T	c.(3664-3666)gaA>gaT	p.E1222D		NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	1222					protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		GCTTCCACTCTTCCATTTTCT	0.443			T	PDGFRB	AML																																p.E1222D	Ovarian(84;609 1888 9852 42686)	.		Dom	yes		14	14q31-q32	9321	thyroid hormone receptor interactor 11		L	.	TRIP11-1400	0			c.A3666T						.						79.0	72.0	75.0					14																	92470654		2203	4300	6503	SO:0001583	missense	9321	exon11			CCACTCTTCCATT	L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.3666A>T	14.37:g.92470654T>A	ENSP00000267622:p.Glu1222Asp	Somatic	78	0		WXS	Illumina HiSeq	Phase_I	64	28	NM_004239	0	0	7	11	4	B2RUT2|O14689|O15154|O95949	Missense_Mutation	SNP	ENST00000267622.4	37	CCDS9899.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.88|11.88	1.771464|1.771464	0.31320|0.31320	.|.	.|.	ENSG00000100815|ENSG00000100815	ENST00000267622;ENST00000542257|ENST00000554357	T|.	0.05786|.	3.39|.	5.46|5.46	-4.33|-4.33	0.03677|0.03677	.|.	0.112824|.	0.64402|.	D|.	0.000015|.	T|.	0.44664|.	0.1304|.	L|L	0.32530|0.32530	0.975|0.975	0.41458|0.41458	D|D	0.988026|0.988026	D;D|.	0.89917|.	0.986;1.0|.	P;D|.	0.91635|.	0.78;0.999|.	T|.	0.32745|.	-0.9895|.	10|.	0.52906|.	T|.	0.07|.	.|.	8.2632|8.2632	0.31797|0.31797	0.119:0.4845:0.0:0.3964|0.119:0.4845:0.0:0.3964	.|.	958;1222|.	F5H1Z0;Q15643|.	.;TRIPB_HUMAN|.	D|X	1222;958|938	ENSP00000267622:E1222D|.	ENSP00000267622:E1222D|.	E|R	-|-	3|1	2|2	TRIP11|TRIP11	91540407|91540407	0.238000|0.238000	0.23825|0.23825	0.822000|0.822000	0.32727|0.32727	0.150000|0.150000	0.21749|0.21749	-0.435000|-0.435000	0.06931|0.06931	-1.215000|-1.215000	0.02610|0.02610	-0.624000|-0.624000	0.04008|0.04008	GAA|AGA	.		0.443	TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411823.1		
ADSSL1	122622	hgsc.bcm.edu	37	14	105196230	105196230	+	Start_Codon_SNP	SNP	A	A	G	rs386781068|rs80097179	byFrequency	TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr14:105196230A>G	ENST00000332972.5	+	1	160	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	ADSSL1_ENST00000330877.2_Intron	NM_199165.1	NP_954634.1			adenylosuccinate synthase like 1											central_nervous_system(1)|cervix(1)|kidney(1)|lung(5)|ovary(2)|prostate(1)	11		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00153)|OV - Ovarian serous cystadenocarcinoma(23;0.0148)|Epithelial(46;0.0396)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.18)		tggcgtcggcatggtggggag	0.721																																					p.M1V		.											.	ADSSL1-515	0			c.A1G						.						19.0	18.0	18.0					14																	105196230		2042	3956	5998	SO:0001582	initiator_codon_variant	122622	exon1			GTCGGCATGGTGG	AK095921	CCDS9990.1, CCDS9991.1	14q32.33	2010-08-05			ENSG00000185100	ENSG00000185100			20093	protein-coding gene	gene with protein product		612498					Standard	NM_199165		Approved	FLJ38602	uc001ype.3	Q8N142		ENST00000332972.5:c.1A>G	14.37:g.105196230A>G	ENSP00000333019:p.Met1Val	Somatic	1	1		WXS	Illumina HiSeq	Phase_I	7	4	NM_199165	0	0	0	0	0		Missense_Mutation	SNP	ENST00000332972.5	37	CCDS9991.1	.	.	.	.	.	.	.	.	.	.	a	0.001	-3.492339	0.00011	.	.	ENSG00000185100	ENST00000332972	T	0.41400	1.0	0.158	-0.317	0.12736	.	.	.	.	.	T	0.27454	0.0674	.	.	.	0.09310	N	0.999992	B	0.10296	0.003	B	0.01281	0.0	T	0.26395	-1.0104	7	0.87932	D	0	-24.6368	.	.	.	.	1	Q8N142-2	.	V	1	ENSP00000333019:M1V	ENSP00000333019:M1V	M	+	1	0	ADSSL1	104267275	0.222000	0.23652	0.018000	0.16275	0.006000	0.05464	-2.212000	0.01225	-1.178000	0.02741	-1.194000	0.01681	ATG	A|0.640;C|0.360		0.721	ADSSL1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410531.1		Missense_Mutation
ATP10A	57194	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	25972305	25972305	+	Splice_Site	SNP	A	A	T			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr15:25972305A>T	ENST00000356865.6	-	4	959		c.e4+1			NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A						ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		GCCCGAGCCTACCTGCGTAGA	0.517																																					.		.											.	ATP10A-139	0			c.847+2T>A						.						102.0	81.0	88.0					15																	25972305		2203	4300	6503	SO:0001630	splice_region_variant	57194	exon5			GAGCCTACCTGCG	AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.847+1T>A	15.37:g.25972305A>T		Somatic	86	0		WXS	Illumina HiSeq	Phase_I	81	36	NM_024490	0	0	0	0	0	Q4G0S9|Q969I4	Splice_Site	SNP	ENST00000356865.6	37	CCDS32178.1	.	.	.	.	.	.	.	.	.	.	A	24.3	4.514606	0.85389	.	.	ENSG00000206190	ENST00000356865	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3129	0.74048	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ATP10A	23523398	1.000000	0.71417	0.995000	0.50966	0.813000	0.45954	8.600000	0.90860	2.033000	0.60031	0.460000	0.39030	.	.		0.517	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	NM_024490	Intron
TBC1D2B	23102	hgsc.bcm.edu	37	15	78290635	78290635	+	Missense_Mutation	SNP	C	C	T	rs200408968		TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr15:78290635C>T	ENST00000300584.3	-	13	2758	c.2759G>A	c.(2758-2760)cGa>cAa	p.R920Q	TBC1D2B_ENST00000492078.1_5'UTR|TBC1D2B_ENST00000409931.3_Missense_Mutation_p.D903N	NM_015079.5|NM_144572.1	NP_055894.6|NP_653173.1	Q9UPU7	TBD2B_HUMAN	TBC1 domain family, member 2B	920							Rab GTPase activator activity (GO:0005097)	p.D903N(3)|p.R920Q(1)		breast(3)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(2)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	26						GTAGGCGCGTCGGTTCCGGAT	0.617																																					p.R920Q		.											.	TBC1D2B-136	4	Substitution - Missense(4)	cervix(2)|upper_aerodigestive_tract(1)|ovary(1)	c.G2759A						.						39.0	33.0	35.0					15																	78290635		2196	4291	6487	SO:0001583	missense	23102	exon13			GCGCGTCGGTTCC	AB028978	CCDS32301.2, CCDS45314.1	15q24.3-q25.1	2005-11-29			ENSG00000167202	ENSG00000167202			29183	protein-coding gene	gene with protein product						10470851	Standard	NM_015079		Approved	KIAA1055	uc002bcy.4	Q9UPU7	OTTHUMG00000152885	ENST00000300584.3:c.2759G>A	15.37:g.78290635C>T	ENSP00000300584:p.Arg920Gln	Somatic	21	1		WXS	Illumina HiSeq	Phase_I	16	4	NM_144572	0	0	13	13	0	A7MD42|Q8N1F9|Q9NXM0	Missense_Mutation	SNP	ENST00000300584.3	37	CCDS45314.1	88|88	0.040293040293040296|0.040293040293040296	2|2	0.0040650406504065045|0.0040650406504065045	10|10	0.027624309392265192|0.027624309392265192	8|8	0.013986013986013986|0.013986013986013986	68|68	0.08970976253298153|0.08970976253298153	c|c	22.6|22.6	4.311579|4.311579	0.81358|0.81358	.|.	.|.	ENSG00000167202|ENSG00000167202	ENST00000418039;ENST00000409931|ENST00000300584	T|T	0.11712|0.09445	2.75|2.98	4.48|4.48	4.48|4.48	0.54585|0.54585	.|.	0.787190|.	0.11177|.	N|.	0.591392|.	T|T	0.00608|0.00608	0.0020|0.0020	.|.	.|.	.|.	0.26703|0.26703	N|N	0.971136|0.971136	B|D	0.30193|0.57257	0.272|0.979	B|P	0.18561|0.51833	0.022|0.681	T|T	0.06807|0.06807	-1.0806|-1.0806	9|8	0.02654|0.23891	T|T	1|0.37	.|.	16.1645|16.1645	0.81745|0.81745	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	903|920	Q9UPU7-2|Q9UPU7	.|TBD2B_HUMAN	N|Q	802;903|920	ENSP00000387165:D903N|ENSP00000300584:R920Q	ENSP00000387165:D903N|ENSP00000300584:R920Q	D|R	-|-	1|2	0|0	TBC1D2B|TBC1D2B	76077690|76077690	1.000000|1.000000	0.71417|0.71417	0.990000|0.990000	0.47175|0.47175	0.855000|0.855000	0.48748|0.48748	6.002000|6.002000	0.70693|0.70693	2.033000|2.033000	0.60031|0.60031	0.479000|0.479000	0.44913|0.44913	GAC|CGA	C|0.960;T|0.040		0.617	TBC1D2B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000328369.3	NM_015079	
ADAMTS7	11173	hgsc.bcm.edu	37	15	79051886	79051886	+	Silent	SNP	G	G	A			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr15:79051886G>A	ENST00000388820.4	-	24	5148	c.4938C>T	c.(4936-4938)tgC>tgT	p.C1646C		NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	1646	PLAC. {ECO:0000255|PROSITE- ProRule:PRU00233}.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.C1646C(4)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						GCAGCGTCTCGCAGAACCCGA	0.701																																					p.C1646C		.											.	ADAMTS7-226	4	Substitution - coding silent(4)	prostate(2)|lung(1)|kidney(1)	c.C4938T						.						10.0	11.0	11.0					15																	79051886		2150	4223	6373	SO:0001819	synonymous_variant	11173	exon24			CGTCTCGCAGAAC	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.4938C>T	15.37:g.79051886G>A		Somatic	29	0		WXS	Illumina HiSeq	Phase_I	18	3	NM_014272	0	0	0	0	0	Q14F51|Q6P7J9	Silent	SNP	ENST00000388820.4	37	CCDS32303.1																																																																																			.		0.701	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
CEMP1	752014	hgsc.bcm.edu	37	16	2580428	2580428	+	Missense_Mutation	SNP	C	C	T	rs141294706	byFrequency	TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr16:2580428C>T	ENST00000567119.1	-	1	981	c.647G>A	c.(646-648)cGa>cAa	p.R216Q	AMDHD2_ENST00000302956.4_3'UTR|AMDHD2_ENST00000565570.1_3'UTR|MIR3178_ENST00000581887.1_RNA|CEMP1_ENST00000565480.1_Intron|CEMP1_ENST00000382350.1_Missense_Mutation_p.R216Q|AMDHD2_ENST00000413459.3_Nonsense_Mutation_p.R485*	NM_001048212.3	NP_001041677.1	Q6PRD7	CEMP1_HUMAN	cementum protein 1	216						cytoplasm (GO:0005737)				lung(1)|skin(1)	2						TGAACAGCTTCGAGGCGGGTG	0.612													C|||	2	0.000399361	0.0015	0.0	5008	,	,		18808	0.0		0.0	False		,,,				2504	0.0				p.R485X		.											.	AMDHD2-155	0			c.C1453T						.	C	stop/ARG,GLN/ARG	7,3973		0,7,1983	42.0	46.0	45.0		1453,647	-3.4	0.0	16	dbSNP_134	45	0,8348		0,0,4174	yes	stop-gained,missense	AMDHD2,CEMP1	NM_001145815.1,NM_001048212.3	,43	0,7,6157	TT,TC,CC		0.0,0.1759,0.0568	,benign	485/595,216/248	2580428	7,12321	1990	4174	6164	SO:0001583	missense	51005	exon11			CAGCTTCGAGGCG	AY584596	CCDS42108.1	16p13.3	2006-09-22							32553	protein-coding gene	gene with protein product	"""cementum protein-23"""	611113				16263347	Standard	NM_001048212		Approved	CP-23	uc002cqr.3	Q6PRD7		ENST00000567119.1:c.647G>A	16.37:g.2580428C>T	ENSP00000457380:p.Arg216Gln	Somatic	54	0		WXS	Illumina HiSeq	Phase_I	48	4	NM_001145815	0	0	5	7	2	B2RUY1	Nonsense_Mutation	SNP	ENST00000567119.1	37	CCDS42108.1	5|5	0.0022893772893772895|0.0022893772893772895	5|5	0.01016260162601626|0.01016260162601626	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	C|C	36|36	5.917064|5.917064	0.97099|0.97099	0.001759|0.001759	0.0|0.0	ENSG00000205923|ENSG00000162066	ENST00000382350|ENST00000413459	T|.	0.55588|.	0.51|.	1.71|1.71	-3.43|-3.43	0.04810|0.04810	.|.	.|.	.|.	.|.	.|.	T|.	0.09158|.	0.0226|.	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B|.	0.06786|.	0.001|.	B|.	0.01281|.	0.0|.	T|.	0.32851|.	-0.9891|.	9|.	0.87932|0.02654	D|T	0|1	.|.	7.5486|7.5486	0.27781|0.27781	0.0:0.7123:0.0:0.2877|0.0:0.7123:0.0:0.2877	.|.	216|.	Q6PRD7|.	CEMP1_HUMAN|.	Q|X	216|485	ENSP00000371787:R216Q|.	ENSP00000371787:R216Q|ENSP00000391596:R485X	R|R	-|+	2|1	0|2	CEMP1|AMDHD2	2520429|2520429	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.011000|0.011000	0.07611|0.07611	-2.151000|-2.151000	0.01289|0.01289	-0.863000|-0.863000	0.04084|0.04084	-0.416000|-0.416000	0.06073|0.06073	CGA|CGA	C|0.998;T|0.002		0.612	CEMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435686.1	NM_001048212	
SMG1	23049	hgsc.bcm.edu	37	16	18849419	18849419	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr16:18849419G>C	ENST00000446231.2	-	45	7742	c.7330C>G	c.(7330-7332)Cag>Gag	p.Q2444E	SMG1_ENST00000389467.3_Missense_Mutation_p.Q2444E			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	2444	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						CTCTCGGCCTGCTGGCCACCT	0.587																																					p.Q2444E		.											.	SMG1-1160	0			c.C7330G						.																																			SO:0001583	missense	23049	exon45			CGGCCTGCTGGCC	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.7330C>G	16.37:g.18849419G>C	ENSP00000402515:p.Gln2444Glu	Somatic	38	0		WXS	Illumina HiSeq	Phase_I	39	3	NM_015092	0	0	7	7	0	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	ENST00000446231.2	37	CCDS45430.1	.	.	.	.	.	.	.	.	.	.	G	19.63	3.862987	0.71949	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.01076	5.37;5.37	5.72	5.72	0.89469	Protein kinase-like domain (1);Armadillo-type fold (1);Phosphatidylinositol 3-/4-kinase, catalytic (2);	0.000000	0.64402	D	0.000004	T	0.02767	0.0083	N	0.17474	0.49	0.50467	D	0.999876	P	0.49447	0.924	P	0.62298	0.9	T	0.76542	-0.2921	10	0.18276	T	0.48	.	20.244	0.98389	0.0:0.0:1.0:0.0	.	2444	Q96Q15	SMG1_HUMAN	E	2444	ENSP00000402515:Q2444E;ENSP00000374118:Q2444E	ENSP00000374118:Q2444E	Q	-	1	0	SMG1	18756920	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	9.793000	0.99091	2.865000	0.98341	0.655000	0.94253	CAG	.		0.587	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	NM_015092	
SRCAP	10847	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	30718524	30718524	+	Silent	SNP	G	G	T			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr16:30718524G>T	ENST00000262518.4	+	5	712	c.327G>T	c.(325-327)cgG>cgT	p.R109R	SRCAP_ENST00000395059.2_Silent_p.R109R|SRCAP_ENST00000344771.4_Silent_p.R109R	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	109					histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			TCGAGACTCGGATTGCTGAGC	0.547																																					p.R109R		.											.	SRCAP-94	0			c.G327T						.						69.0	69.0	69.0					16																	30718524		1987	4166	6153	SO:0001819	synonymous_variant	10847	exon5			GACTCGGATTGCT	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.327G>T	16.37:g.30718524G>T		Somatic	77	0		WXS	Illumina HiSeq	Phase_I	90	34	NM_006662	0	0	4	6	2	B0JZA6|O15026|Q7Z744|Q9Y5L9	Silent	SNP	ENST00000262518.4	37	CCDS10689.2																																																																																			.		0.547	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
SRCAP	10847	bcgsc.ca	37	16	30727477	30727477	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr16:30727477T>C	ENST00000262518.4	+	17	2969	c.2584T>C	c.(2584-2586)Tcc>Ccc	p.S862P	SRCAP_ENST00000395059.2_Missense_Mutation_p.S862P|SRCAP_ENST00000344771.4_Missense_Mutation_p.S862P	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	862					histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CTGCAGGCTCTCCAAGCGTCA	0.517																																					p.S862P													.	SRCAP-94	0			c.T2584C						.						137.0	119.0	125.0					16																	30727477		2197	4300	6497	SO:0001583	missense	10847	exon17			AGGCTCTCCAAGC	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.2584T>C	16.37:g.30727477T>C	ENSP00000262518:p.Ser862Pro	Somatic	103	0		WXS	Illumina HiSeq	Phase_1	112	5	NM_006662	0	0	5	5	0	B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	ENST00000262518.4	37	CCDS10689.2	.	.	.	.	.	.	.	.	.	.	T	18.97	3.735012	0.69189	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	T;T;T	0.79749	-1.3;-1.3;-1.3	5.25	5.25	0.73442	SNF2-related (1);	0.000000	0.53938	D	0.000054	D	0.89577	0.6755	M	0.80982	2.52	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	D	0.90981	0.4827	10	0.87932	D	0	-15.3089	14.2776	0.66191	0.0:0.0:0.0:1.0	.	862;862;862	Q6ZRS2-3;Q6ZRS2-2;Q6ZRS2	.;.;SRCAP_HUMAN	P	862	ENSP00000262518:S862P;ENSP00000378499:S862P;ENSP00000343042:S862P	ENSP00000262518:S862P	S	+	1	0	SRCAP	30634978	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.712000	0.84684	2.201000	0.70794	0.459000	0.35465	TCC	.		0.517	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
FHOD1	29109	hgsc.bcm.edu	37	16	67267851	67267851	+	Silent	SNP	A	A	G	rs370696219		TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr16:67267851A>G	ENST00000258201.4	-	13	2002	c.1755T>C	c.(1753-1755)ccT>ccC	p.P585P		NM_013241.2	NP_037373.2	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	585	FH1.|Poly-Pro.				positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			breast(4)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	34		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		GAAGTGGGGGAGGGGGGGGTA	0.622																																					p.P585P		.											.	FHOD1-221	0			c.T1755C						.						9.0	11.0	10.0					16																	67267851		2142	4120	6262	SO:0001819	synonymous_variant	29109	exon13			TGGGGGAGGGGGG	AF113615	CCDS10834.1	16q22	2008-02-22			ENSG00000135723	ENSG00000135723			17905	protein-coding gene	gene with protein product		606881				10352228, 16112087	Standard	NM_013241		Approved	FHOS	uc002esl.3	Q9Y613	OTTHUMG00000137521	ENST00000258201.4:c.1755T>C	16.37:g.67267851A>G		Somatic	35	1		WXS	Illumina HiSeq	Phase_I	42	4	NM_013241	0	0	0	0	0	Q59F76|Q6Y1F2|Q76MS8|Q8N521	Silent	SNP	ENST00000258201.4	37	CCDS10834.1																																																																																			.		0.622	FHOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268844.2		
TBC1D29	26083	hgsc.bcm.edu	37	17	28890334	28890334	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr17:28890334G>A	ENST00000580161.1	+	6	2841	c.344G>A	c.(343-345)aGg>aAg	p.R115K	RP11-218M11.1_ENST00000563063.1_lincRNA|TBC1D29_ENST00000579181.1_Missense_Mutation_p.R115K|TBC1D29_ENST00000584297.1_3'UTR			Q9UFV1	TBC29_HUMAN	TBC1 domain family, member 29	115							Rab GTPase activator activity (GO:0005097)			breast(1)|kidney(1)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Myeloproliferative disorder(56;0.0255)				ACTCCTCCAAGGGTGCCAGGA	0.572																																					p.R115K		.											.	TBC1D29-22	0			c.G344A						.						64.0	57.0	60.0					17																	28890334		2203	4300	6503	SO:0001583	missense	26083	exon5			CTCCAAGGGTGCC	BC096718	CCDS32606.1	17q11.2	2014-09-04			ENSG00000266733	ENSG00000266733			24509	protein-coding gene	gene with protein product						12618308	Standard	XM_006721805		Approved	DKFZP434O047	uc002hfh.3	Q9UFV1	OTTHUMG00000178857	ENST00000580161.1:c.344G>A	17.37:g.28890334G>A	ENSP00000462799:p.Arg115Lys	Somatic	78	0		WXS	Illumina HiSeq	Phase_I	76	4	NM_015594	0	0	0	0	0		Missense_Mutation	SNP	ENST00000580161.1	37	CCDS32606.1	.	.	.	.	.	.	.	.	.	.	.	11.00	1.509043	0.27036	.	.	ENSG00000197689	ENST00000329040	.	.	.	.	.	.	.	.	.	.	.	T	0.11410	0.0278	N	0.08118	0	0.18873	N	0.999982	B	0.28667	0.219	B	0.32090	0.14	T	0.31888	-0.9927	7	0.06625	T	0.88	.	2.665	0.05041	0.4896:0.0:0.5104:0.0	.	115	Q9UFV1	TBC29_HUMAN	K	115	.	ENSP00000330052:R115K	R	+	2	0	TBC1D29	25914460	0.034000	0.19679	0.031000	0.17742	0.031000	0.12232	0.975000	0.29449	0.107000	0.17824	0.109000	0.15622	AGG	.		0.572	TBC1D29-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443632.1	NM_015594	
LYZL6	57151	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	34261844	34261844	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr17:34261844C>T	ENST00000585556.1	-	5	737	c.403G>A	c.(403-405)Ggc>Agc	p.G135S	LYZL6_ENST00000492340.2_5'Flank|LYZL6_ENST00000394523.3_Missense_Mutation_p.G135S|LYZL6_ENST00000293274.4_Missense_Mutation_p.G135S			O75951	LYZL6_HUMAN	lysozyme-like 6	135					cell wall macromolecule catabolic process (GO:0016998)	extracellular region (GO:0005576)	lysozyme activity (GO:0003796)			breast(1)|endometrium(1)|large_intestine(1)|lung(8)|stomach(1)	12				UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		AGTGGCCGGCCTGAACAGTGC	0.542																																					p.G135S		.											.	LYZL6-90	0			c.G403A						.						89.0	82.0	85.0					17																	34261844		2203	4300	6503	SO:0001583	missense	57151	exon4			GCCGGCCTGAACA	AF088219, AY742214	CCDS11302.1	17q11.2	2014-04-10			ENSG00000161572	ENSG00000275722			29614	protein-coding gene	gene with protein product		612751				10213461	Standard	NM_020426		Approved	LYC1, PRO1485, TKAL754	uc002hkj.2	O75951	OTTHUMG00000188400	ENST00000585556.1:c.403G>A	17.37:g.34261844C>T	ENSP00000468094:p.Gly135Ser	Somatic	83	0		WXS	Illumina HiSeq	Phase_I	77	19	NM_020426	0	0	0	0	0	Q6UW30	Missense_Mutation	SNP	ENST00000585556.1	37	CCDS11302.1	.	.	.	.	.	.	.	.	.	.	C	17.52	3.410784	0.62399	.	.	ENSG00000161572	ENST00000293274;ENST00000394523	T;T	0.51325	0.71;0.71	4.65	4.65	0.58169	Lysozyme-like domain (1);	0.000000	0.64402	D	0.000004	T	0.66336	0.2779	M	0.87547	2.89	0.23988	N	0.996253	D	0.57257	0.979	P	0.56088	0.791	T	0.63844	-0.6545	10	0.62326	D	0.03	-0.303	13.7598	0.62959	0.0:1.0:0.0:0.0	.	135	O75951	LYZL6_HUMAN	S	135	ENSP00000293274:G135S;ENSP00000378031:G135S	ENSP00000293274:G135S	G	-	1	0	LYZL6	31285957	0.058000	0.20735	0.004000	0.12327	0.101000	0.19017	2.826000	0.48104	2.518000	0.84900	0.563000	0.77884	GGC	.		0.542	LYZL6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256578.2	NM_020426	
CDC27	996	hgsc.bcm.edu	37	17	45234324	45234324	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr17:45234324C>T	ENST00000066544.3	-	7	890	c.797G>A	c.(796-798)cGa>cAa	p.R266Q	CDC27_ENST00000528748.1_5'Flank|CDC27_ENST00000531206.1_Missense_Mutation_p.R266Q|CDC27_ENST00000446365.2_Missense_Mutation_p.R205Q|CDC27_ENST00000527547.1_Missense_Mutation_p.R266Q	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	266					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TAATAAACTTCGACCAGTTTT	0.358																																					p.R266Q		.											.	CDC27-291	0			c.G797A						.						60.0	65.0	63.0					17																	45234324		2200	4293	6493	SO:0001583	missense	996	exon7			AAACTTCGACCAG	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.797G>A	17.37:g.45234324C>T	ENSP00000066544:p.Arg266Gln	Somatic	62	1		WXS	Illumina HiSeq	Phase_I	93	6	NM_001114091	0	0	8	8	0	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.328146	0.81690	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.69806	-0.43;-0.4;-0.17;-0.43;0.52	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.73466	0.3590	L	0.34521	1.04	0.58432	D	0.999999	D;D;D;P	0.89917	1.0;1.0;0.991;0.921	D;D;P;B	0.72338	0.95;0.977;0.724;0.153	T	0.69975	-0.4999	10	0.30854	T	0.27	-17.5002	17.2083	0.86924	0.0:1.0:0.0:0.0	.	205;266;266;266	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	Q	266;266;205;266;266	ENSP00000066544:R266Q;ENSP00000434614:R266Q;ENSP00000392802:R205Q;ENSP00000437339:R266Q;ENSP00000432105:R266Q	ENSP00000066544:R266Q	R	-	2	0	CDC27	42589323	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.320000	0.79064	2.665000	0.90641	0.460000	0.39030	CGA	.		0.358	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
PHOSPHO1	162466	broad.mit.edu	37	17	47302352	47302352	+	Silent	SNP	G	G	T			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr17:47302352G>T	ENST00000310544.4	-	3	187	c.60C>A	c.(58-60)gcC>gcA	p.A20A	PHOSPHO1_ENST00000514112.1_Silent_p.A45A|PHOSPHO1_ENST00000413580.1_Silent_p.A45A			Q8TCT1	PHOP1_HUMAN	phosphatase, orphan 1	20					bone mineralization involved in bone maturation (GO:0035630)|dephosphorylation (GO:0016311)|endochondral ossification (GO:0001958)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|regulation of bone mineralization (GO:0030500)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|phosphocholine phosphatase activity (GO:0052731)|phosphoethanolamine phosphatase activity (GO:0052732)|pyrophosphatase activity (GO:0016462)							Epithelial(5;8.1e-06)|all cancers(6;7.71e-05)		Choline(DB00122)	CGCCCTGCGCGGCCATCCTGC	0.716																																					p.A45A													.	PHOSPHO1-90	0			c.C135A						.						5.0	5.0	5.0					17																	47302352		2144	4141	6285	SO:0001819	synonymous_variant	162466	exon3			CTGCGCGGCCATC	AJ457189	CCDS11547.1, CCDS45726.1	17q21.32	2008-05-02				ENSG00000173868			16815	protein-coding gene	gene with protein product						12464021	Standard	NM_178500		Approved		uc010wlv.1	Q8TCT1		ENST00000310544.4:c.60C>A	17.37:g.47302352G>T		Somatic	11	0		WXS	Illumina HiSeq	Phase_I	6	2	NM_001143804	0	0	0	0	0	E9PAM0|Q17RU6	Silent	SNP	ENST00000310544.4	37	CCDS11547.1																																																																																			.		0.716	PHOSPHO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364467.2		
MYCBPAP	84073	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	48600413	48600413	+	Silent	SNP	A	A	T			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr17:48600413A>T	ENST00000323776.5	+	11	1662	c.1500A>T	c.(1498-1500)cgA>cgT	p.R500R	MYCBPAP_ENST00000436259.2_Silent_p.R463R	NM_032133.4	NP_115509.4			MYCBP associated protein											breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(8)|ovary(4)|pancreas(1)|skin(2)|urinary_tract(2)	31	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)			ATGACTGGCGACGGCAGCACC	0.507																																					p.R500R		.											.	MYCBPAP-230	0			c.A1500T						.						108.0	105.0	106.0					17																	48600413		2203	4300	6503	SO:0001819	synonymous_variant	84073	exon11			CTGGCGACGGCAG	BC028393	CCDS32680.2	17q21.33	2004-02-19			ENSG00000136449	ENSG00000136449			19677	protein-coding gene	gene with protein product		609835				12151104	Standard	NM_032133		Approved	AMAP-1, DKFZp434N1415	uc010wmr.2	Q8TBZ2	OTTHUMG00000157184	ENST00000323776.5:c.1500A>T	17.37:g.48600413A>T		Somatic	165	0		WXS	Illumina HiSeq	Phase_I	144	54	NM_032133	0	0	0	0	0		Silent	SNP	ENST00000323776.5	37	CCDS32680.2																																																																																			.		0.507	MYCBPAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347814.1	NM_032133	
TYMSOS	494514	hgsc.bcm.edu	37	18	658048	658048	+	Missense_Mutation	SNP	C	C	G	rs190076880	byFrequency	TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr18:658048C>G	ENST00000323813.3	-	1	292	c.200G>C	c.(199-201)aGg>aCg	p.R67T	TYMS_ENST00000323250.5_Intron|TYMS_ENST00000323274.10_Intron|C18orf56_ENST00000585033.1_Missense_Mutation_p.R67T|RP11-806L2.5_ENST00000584679.1_RNA|TYMS_ENST00000323224.7_Intron	NM_001012716.2	NP_001012734.2	Q8TAI1	TYMOS_HUMAN		67																	CCGTTTAGTCCTAACCTCAAT	0.701													C|||	26	0.00519169	0.0182	0.0029	5008	,	,		12489	0.0		0.0	False		,,,				2504	0.0				p.R67T		.											.	C18orf56-90	0			c.G200C						.	C	THR/ARG,	45,4303		0,45,2129	12.0	10.0	11.0		200,	1.8	0.0	18		11	0,8510		0,0,4255	yes	missense,intron	TYMS,C18orf56	NM_001012716.2,NM_001071.2	71,	0,45,6384	GG,GC,CC		0.0,1.035,0.35	probably-damaging,	67/124,	658048	45,12813	2174	4255	6429	SO:0001583	missense	494514	exon1			TTAGTCCTAACCT																												ENST00000323813.3:c.200G>C	18.37:g.658048C>G	ENSP00000316465:p.Arg67Thr	Somatic	8	1		WXS	Illumina HiSeq	Phase_I	13	9	NM_001012716	0	0	0	0	0	A8K1S1	Missense_Mutation	SNP	ENST00000323813.3	37		16	0.007326007326007326	15	0.03048780487804878	1	0.0027624309392265192	0	0.0	0	0.0	C	8.971	0.972911	0.18736	0.01035	0.0	ENSG00000176912	ENST00000323813	T	0.55760	0.5	2.68	1.8	0.24995	.	.	.	.	.	T	0.21841	0.0526	N	0.08118	0	0.21020	N	0.999809	D	0.65815	0.995	P	0.61003	0.882	T	0.12656	-1.0539	9	0.87932	D	0	.	7.2964	0.26395	0.0:0.8639:0.0:0.1361	.	67	Q8TAI1	CR056_HUMAN	T	67	ENSP00000316465:R67T	ENSP00000316465:R67T	R	-	2	0	C18orf56	648048	0.000000	0.05858	0.001000	0.08648	0.007000	0.05969	-0.111000	0.10807	0.697000	0.31718	0.555000	0.69702	AGG	C|0.993;G|0.007		0.701	C18orf56-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000441199.2		
ZNF431	170959	hgsc.bcm.edu	37	19	21365595	21365595	+	Silent	SNP	G	G	A			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr19:21365595G>A	ENST00000311048.7	+	5	633	c.489G>A	c.(487-489)gaG>gaA	p.E163E	ZNF431_ENST00000594425.1_Intron|ZNF431_ENST00000600692.1_3'UTR	NM_133473.2	NP_597730.2	Q8TF32	ZN431_HUMAN	zinc finger protein 431	163					cell differentiation (GO:0030154)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(7)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	23						GTTATAATGAGCTAAACCAGT	0.328																																					p.E163E		.											.	ZNF431-514	0			c.G489A						.																																			SO:0001819	synonymous_variant	170959	exon5			TAATGAGCTAAAC	AB075849	CCDS32979.1	19p12	2013-01-08				ENSG00000196705		"""Zinc fingers, C2H2-type"", ""-"""	20809	protein-coding gene	gene with protein product						11853319	Standard	NM_133473		Approved	KIAA1969	uc002npp.2	Q8TF32		ENST00000311048.7:c.489G>A	19.37:g.21365595G>A		Somatic	68	2		WXS	Illumina HiSeq	Phase_I	98	16	NM_133473	0	0	0	0	0	A8KAK7|Q8IWC4	Silent	SNP	ENST00000311048.7	37	CCDS32979.1																																																																																			.		0.328	ZNF431-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463943.1	XM_086098	
ZNF285	26974	hgsc.bcm.edu	37	19	44891126	44891126	+	Silent	SNP	T	T	A	rs553045966	byFrequency	TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr19:44891126T>A	ENST00000330997.4	-	4	1345	c.1281A>T	c.(1279-1281)ccA>ccT	p.P427P	ZNF285_ENST00000591679.1_Silent_p.P434P|CTC-512J12.6_ENST00000588212.1_Intron|ZNF285_ENST00000544719.2_Silent_p.P427P	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	427					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P427P(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						CACACCTATATGGTTTCTCCC	0.483																																					p.P427P		.											.	ZNF285-94	1	Substitution - coding silent(1)	prostate(1)	c.A1281T						.						62.0	59.0	60.0					19																	44891126		2203	4300	6503	SO:0001819	synonymous_variant	26974	exon4			CCTATATGGTTTC	AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.1281A>T	19.37:g.44891126T>A		Somatic	103	0		WXS	Illumina HiSeq	Phase_I	96	5	NM_152354	0	0	6	6	0	Q17RJ3|Q6B0A8|Q6ISR5	Silent	SNP	ENST00000330997.4	37	CCDS12638.1																																																																																			.		0.483	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443600.1	NM_152354	
GRIN2D	2906	ucsc.edu;bcgsc.ca	37	19	48908457	48908457	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr19:48908457G>A	ENST00000263269.3	+	3	1020	c.932G>A	c.(931-933)gGc>gAc	p.G311D		NM_000836.2	NP_000827.2	O15399	NMDE4_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	311					adult locomotory behavior (GO:0008344)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|regulation of sensory perception of pain (GO:0051930)|signal transduction (GO:0007165)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			autonomic_ganglia(1)|breast(6)|endometrium(2)|large_intestine(9)|lung(12)|ovary(5)|pancreas(1)|prostate(1)	37		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CGCTCGGCTGGCTGGCGGGAT	0.706																																					p.G311D													.	GRIN2D-156	0			c.G932A						.						11.0	13.0	12.0					19																	48908457		2149	4203	6352	SO:0001583	missense	2906	exon3			CGGCTGGCTGGCG	U77783	CCDS12719.1	19q13.33	2012-08-29			ENSG00000105464	ENSG00000105464		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4588	protein-coding gene	gene with protein product	"""N-methyl-d-aspartate receptor subunit 2D"""	602717		NMDAR2D		9480759, 9418891	Standard	NM_000836		Approved	GluN2D, EB11, NR2D	uc002pjc.4	O15399		ENST00000263269.3:c.932G>A	19.37:g.48908457G>A	ENSP00000263269:p.Gly311Asp	Somatic	19	0		WXS	Illumina HiSeq		13	5	NM_000836	0	0	0	0	0		Missense_Mutation	SNP	ENST00000263269.3	37	CCDS12719.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.028978	0.75504	.	.	ENSG00000105464	ENST00000263269	T	0.05025	3.51	4.45	4.45	0.53987	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	T	0.11452	0.0279	N	0.16602	0.42	0.58432	D	0.999995	D	0.89917	1.0	D	0.75484	0.986	T	0.44205	-0.9343	10	0.13470	T	0.59	.	16.2466	0.82448	0.0:0.0:1.0:0.0	.	311	O15399	NMDE4_HUMAN	D	311	ENSP00000263269:G311D	ENSP00000263269:G311D	G	+	2	0	GRIN2D	53600269	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.462000	0.66707	2.199000	0.70637	0.561000	0.74099	GGC	.		0.706	GRIN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466121.1		
ZNF816	125893	hgsc.bcm.edu;bcgsc.ca	37	19	53454065	53454065	+	Silent	SNP	G	G	A	rs560657768	byFrequency	TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr19:53454065G>A	ENST00000357666.4	-	5	1263	c.963C>T	c.(961-963)acC>acT	p.T321T	ZNF816_ENST00000444460.2_Silent_p.T321T|ZNF321P_ENST00000391777.3_Intron|ZNF816_ENST00000434371.2_Intron	NM_001031665.2	NP_001026835.1	Q0VGE8	ZN816_HUMAN	zinc finger protein 816	321					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(10)|lung(9)|stomach(1)|urinary_tract(2)	27						TCTCACTGAAGGTCTTGCCAC	0.438													g|||	48	0.00958466	0.034	0.0043	5008	,	,		22622	0.0		0.0	False		,,,				2504	0.0				p.T321T		.											.	ZNF816-68	0			c.C963T						.						165.0	169.0	168.0					19																	53454065		2202	4300	6502	SO:0001819	synonymous_variant	125893	exon4			ACTGAAGGTCTTG	BC063805	CCDS33096.1	19q13.41	2013-01-08	2010-07-23	2010-07-23		ENSG00000180257		"""Zinc fingers, C2H2-type"", ""-"""	26995	protein-coding gene	gene with protein product			"""zinc finger protein 816A"""	ZNF816A			Standard	NM_001031665		Approved		uc002qam.2	Q0VGE8		ENST00000357666.4:c.963C>T	19.37:g.53454065G>A		Somatic	140	2		WXS	Illumina HiSeq	Phase_I	135	11	NM_001202457	0	0	4	4	0	A8K7H5|Q3KR39|Q659B3	Silent	SNP	ENST00000357666.4	37	CCDS33096.1																																																																																			.		0.438	ZNF816-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396132.1	NM_001031665	
ZNF497	162968	hgsc.bcm.edu	37	19	58867849	58867849	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr19:58867849G>C	ENST00000311044.3	-	3	1341	c.1153C>G	c.(1153-1155)Ccc>Gcc	p.P385A	A1BG-AS1_ENST00000600379.1_RNA|A1BG-AS1_ENST00000600686.1_RNA|ZNF497_ENST00000425453.3_Missense_Mutation_p.P385A|A1BG-AS1_ENST00000593374.1_RNA|A1BG-AS1_ENST00000593960.1_RNA|CTD-2619J13.8_ENST00000599109.1_RNA|CTD-2619J13.9_ENST00000599952.1_RNA|A1BG-AS1_ENST00000599728.1_RNA|A1BG_ENST00000263100.3_5'Flank|A1BG-AS1_ENST00000595302.1_RNA|A1BG-AS1_ENST00000594950.1_RNA	NM_198458.2	NP_940860.2	Q6ZNH5	ZN497_HUMAN	zinc finger protein 497	385					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(2)|lung(3)|skin(2)	7		all_cancers(17;3.11e-12)|all_epithelial(17;9.43e-09)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0278)		CAGGCGAAGGGCTTGGCGCCC	0.711																																					p.P385A		.											.	ZNF497-90	0			c.C1153G						.						5.0	5.0	5.0					19																	58867849		2122	4162	6284	SO:0001583	missense	162968	exon2			CGAAGGGCTTGGC	AK126727	CCDS12977.1	19q13.43	2013-01-08			ENSG00000174586	ENSG00000174586		"""Zinc fingers, C2H2-type"""	23714	protein-coding gene	gene with protein product							Standard	NM_198458		Approved	FLJ44773	uc002qsi.2	Q6ZNH5		ENST00000311044.3:c.1153C>G	19.37:g.58867849G>C	ENSP00000311183:p.Pro385Ala	Somatic	6	2		WXS	Illumina HiSeq	Phase_I	10	4	NM_001207009	0	0	0	3	3	Q05AG8|Q0VF48|Q6ZTD2|Q9UIA8	Missense_Mutation	SNP	ENST00000311044.3	37	CCDS12977.1	.	.	.	.	.	.	.	.	.	.	G	15.28	2.787030	0.49997	.	.	ENSG00000174586	ENST00000311044;ENST00000425453;ENST00000391697	T;T	0.28255	1.62;1.62	0.658	0.658	0.17855	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.54046	0.1834	M	0.83483	2.645	0.24694	N	0.993296	D	0.89917	1.0	D	0.97110	1.0	T	0.37572	-0.9700	9	0.87932	D	0	.	8.7378	0.34539	0.0:0.0:1.0:0.0	.	385	Q6ZNH5	ZN497_HUMAN	A	385;385;174	ENSP00000311183:P385A;ENSP00000402815:P385A	ENSP00000311183:P385A	P	-	1	0	ZNF497	63559661	0.999000	0.42202	0.006000	0.13384	0.073000	0.16967	4.986000	0.63851	0.613000	0.30089	0.205000	0.17691	CCC	.		0.711	ZNF497-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466942.2	NM_198458	
HOXD1	3231	hgsc.bcm.edu	37	2	177053728	177053728	+	Missense_Mutation	SNP	G	G	C	rs570567019|rs577155560	byFrequency	TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr2:177053728G>C	ENST00000331462.4	+	1	422	c.199G>C	c.(199-201)Gcc>Ccc	p.A67P	HOXD-AS1_ENST00000413969.1_RNA|HOXD-AS1_ENST00000417086.1_RNA|HOXD-AS1_ENST00000425005.1_RNA|HOXD-AS1_ENST00000452365.1_RNA|HOXD-AS1_ENST00000436126.1_RNA	NM_024501.2	NP_078777.1	Q9GZZ0	HXD1_HUMAN	homeobox D1	67					embryonic skeletal system development (GO:0048706)|neuron differentiation (GO:0030182)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of pain (GO:0019233)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.00569)|Epithelial(96;0.0864)|all cancers(119;0.226)	Colorectal(32;0.0226)		ttcgcccccggccgcccccgc	0.786													G|||	304	0.0607029	0.2247	0.0101	5008	,	,		9078	0.0		0.0	False		,,,				2504	0.0				p.A67P		.											.	HOXD1-90	0			c.G199C						.						1.0	1.0	1.0					2																	177053728		630	1487	2117	SO:0001583	missense	3231	exon1			CCCCCGGCCGCCC		CCDS2271.1	2q31.1	2011-06-20	2005-12-22		ENSG00000128645	ENSG00000128645		"""Homeoboxes / ANTP class : HOXL subclass"""	5132	protein-coding gene	gene with protein product		142987	"""homeo box D1"""	HOX4, HOX4G		1973146, 1358459	Standard	NM_024501		Approved		uc002ukv.5	Q9GZZ0	OTTHUMG00000132512	ENST00000331462.4:c.199G>C	2.37:g.177053728G>C	ENSP00000328598:p.Ala67Pro	Somatic	1	0		WXS	Illumina HiSeq	Phase_I	2	2	NM_024501	0	0	0	0	0	B2RAB4	Missense_Mutation	SNP	ENST00000331462.4	37	CCDS2271.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.553|7.553	0.663178|0.663178	0.14710|0.14710	.|.	.|.	ENSG00000128645|ENSG00000128645	ENST00000331462|ENST00000375170	D|.	0.91237|.	-2.81|.	3.58|3.58	-0.609|-0.609	0.11608|0.11608	.|.	0.713207|.	0.11548|.	N|.	0.553047|.	T|T	0.20414|0.20414	0.0491|0.0491	N|N	0.19112|0.19112	0.55|0.55	0.80722|0.80722	P|P	0.0|0.0	B;B|.	0.06786|.	0.001;0.001|.	B;B|.	0.06405|.	0.002;0.002|.	T|T	0.28267|0.28267	-1.0049|-1.0049	9|5	0.28530|0.87932	T|D	0.3|0	.|.	0.59|0.59	0.00726|0.00726	0.3692:0.1717:0.2845:0.1746|0.3692:0.1717:0.2845:0.1746	.|.	67;67|.	Q96CA4;Q9GZZ0|.	.;HXD1_HUMAN|.	P|A	67|42	ENSP00000328598:A67P|.	ENSP00000328598:A67P|ENSP00000364313:G42A	A|G	+|+	1|2	0|0	HOXD1|HOXD1	176761974|176761974	0.180000|0.180000	0.23148|0.23148	0.001000|0.001000	0.08648|0.08648	0.050000|0.050000	0.14768|0.14768	0.444000|0.444000	0.21661|0.21661	-0.414000|-0.414000	0.07495|0.07495	0.491000|0.491000	0.48974|0.48974	GCC|GGC	.		0.786	HOXD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255693.2		
SMARCAL1	50485	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	217279802	217279802	+	Silent	SNP	C	C	G			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr2:217279802C>G	ENST00000357276.4	+	3	705	c.375C>G	c.(373-375)ccC>ccG	p.P125P	SMARCAL1_ENST00000358207.5_Silent_p.P125P|AC098820.2_ENST00000457694.1_RNA	NM_014140.3	NP_054859.2	Q9NZC9	SMAL1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1	125					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA metabolic process (GO:0006259)|DNA strand renaturation (GO:0000733)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|replication fork processing (GO:0031297)	nucleus (GO:0005634)|site of double-strand break (GO:0035861)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(15)|ovary(3)|prostate(1)|skin(1)	42		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		TCTCTCCTCCCTTGGCACAAA	0.507									Schimke Immuno-Osseous Dysplasia																												p.P125P		.											.	SMARCAL1-293	0			c.C375G						.						88.0	80.0	82.0					2																	217279802		2203	4300	6503	SO:0001819	synonymous_variant	50485	exon3	Familial Cancer Database	SIOD	TCCTCCCTTGGCA	AF210833	CCDS2403.1	2q35	2014-09-17			ENSG00000138375	ENSG00000138375			11102	protein-coding gene	gene with protein product	"""HepA-related protein"", ""ATP-driven annealing helicase"""	606622				10713074, 10857751, 18974355	Standard	NM_014140		Approved	HHARP, HARP	uc002vgd.4	Q9NZC9	OTTHUMG00000133055	ENST00000357276.4:c.375C>G	2.37:g.217279802C>G		Somatic	105	0		WXS	Illumina HiSeq	Phase_I	109	44	NM_014140	0	0	7	7	0	A6NEH0|Q53R00|Q96AY1|Q9NXQ5|Q9UFH3|Q9UI93	Silent	SNP	ENST00000357276.4	37	CCDS2403.1																																																																																			.		0.507	SMARCAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256671.2		
SLMO2	51012	hgsc.bcm.edu	37	20	57611524	57611524	+	Splice_Site	SNP	A	A	C			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr20:57611524A>C	ENST00000355937.4	-	5	644		c.e5+1		SLMO2_ENST00000371033.5_Splice_Site	NM_016045.2	NP_057129.2	Q9Y3B1	SLMO2_HUMAN	slowmo homolog 2 (Drosophila)						phospholipid transport (GO:0015914)	mitochondrial intermembrane space (GO:0005758)	phosphatidic acid transporter activity (GO:1990050)			endometrium(1)|lung(2)|skin(2)	5	all_lung(29;0.00711)		Colorectal(105;0.109)			AGCCTCACTTACTTTACTAGC	0.453																																					.		.											.	SLMO2-45	0			c.465+2T>G						.						110.0	100.0	103.0					20																	57611524		1975	4184	6159	SO:0001630	splice_region_variant	51012	exon6			TCACTTACTTTAC	AF151865	CCDS42893.1, CCDS58783.1	20q13.32	2008-10-22	2007-02-06	2007-02-06	ENSG00000101166	ENSG00000101166			15892	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 45"""	C20orf45			Standard	NM_016045		Approved	dJ543J19.5, PRELID3B	uc002yam.3	Q9Y3B1	OTTHUMG00000032856	ENST00000355937.4:c.465+1T>G	20.37:g.57611524A>C		Somatic	106	1		WXS	Illumina HiSeq	Phase_I	82	7	NM_016045	0	0	0	0	0	E1P5I8|Q5JX17|Q9NUL0	Splice_Site	SNP	ENST00000355937.4	37	CCDS42893.1	.	.	.	.	.	.	.	.	.	.	A	17.35	3.366553	0.61513	.	.	ENSG00000101166	ENST00000355937;ENST00000371033	.	.	.	4.84	4.84	0.62591	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8858	0.63708	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLMO2	57044919	1.000000	0.71417	0.995000	0.50966	0.611000	0.37282	8.880000	0.92407	1.935000	0.56089	0.533000	0.62120	.	.		0.453	SLMO2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079897.2	NM_016045	Intron
SLMO2	51012	hgsc.bcm.edu	37	20	57611629	57611629	+	Splice_Site	SNP	C	C	T			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr20:57611629C>T	ENST00000355937.4	-	5	541		c.e5-1		SLMO2_ENST00000371033.5_Splice_Site	NM_016045.2	NP_057129.2	Q9Y3B1	SLMO2_HUMAN	slowmo homolog 2 (Drosophila)						phospholipid transport (GO:0015914)	mitochondrial intermembrane space (GO:0005758)	phosphatidic acid transporter activity (GO:1990050)			endometrium(1)|lung(2)|skin(2)	5	all_lung(29;0.00711)		Colorectal(105;0.109)			CAAAACAGTTCTGGAACAAAA	0.368																																					.		.											.	SLMO2-45	0			c.363-1G>A						.						98.0	88.0	91.0					20																	57611629		1868	4102	5970	SO:0001630	splice_region_variant	51012	exon6			ACAGTTCTGGAAC	AF151865	CCDS42893.1, CCDS58783.1	20q13.32	2008-10-22	2007-02-06	2007-02-06	ENSG00000101166	ENSG00000101166			15892	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 45"""	C20orf45			Standard	NM_016045		Approved	dJ543J19.5, PRELID3B	uc002yam.3	Q9Y3B1	OTTHUMG00000032856	ENST00000355937.4:c.363-1G>A	20.37:g.57611629C>T		Somatic	90	0		WXS	Illumina HiSeq	Phase_I	76	4	NM_016045	0	0	0	0	0	E1P5I8|Q5JX17|Q9NUL0	Splice_Site	SNP	ENST00000355937.4	37	CCDS42893.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.102231	0.76983	.	.	ENSG00000101166	ENST00000355937;ENST00000371033	.	.	.	4.84	4.84	0.62591	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.2862	0.87142	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLMO2	57045024	1.000000	0.71417	0.999000	0.59377	0.924000	0.55760	7.421000	0.80204	2.389000	0.81357	0.655000	0.94253	.	.		0.368	SLMO2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079897.2	NM_016045	Intron
APEH	327	hgsc.bcm.edu	37	3	49723522	49723522	+	IGR	SNP	G	G	A			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr3:49723522G>A	ENST00000296456.5	+	0	3220				AC099668.5_ENST00000563780.1_RNA|MST1_ENST00000449682.2_Missense_Mutation_p.R374C|MST1_ENST00000383728.3_3'UTR|MST1_ENST00000494828.2_5'Flank	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase						beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)	p.R360C(2)		endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		TCTGTACAACGCCGGATCTGG	0.697																																					p.R374C		.											.	MST1-278	2	Substitution - Missense(2)	lung(1)|central_nervous_system(1)	c.C1120T						.						12.0	14.0	13.0					3																	49723522		2191	4284	6475	SO:0001628	intergenic_variant	4485	exon9			TACAACGCCGGAT	D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882		3.37:g.49723522G>A		Somatic	40	2		WXS	Illumina HiSeq	Phase_I	30	4	NM_020998	0	0	103	105	2	Q9BQ33|Q9P0Y2	Missense_Mutation	SNP	ENST00000296456.5	37	CCDS2801.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.037157	0.93630	.	.	ENSG00000173531	ENST00000449682	T	0.68181	-0.31	5.4	4.52	0.55395	.	0.000000	0.42682	D	0.000669	D	0.83078	0.5176	M	0.90425	3.115	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.83214	-0.0072	10	0.32370	T	0.25	.	13.2202	0.59883	0.0778:0.0:0.9222:0.0	.	374	G3XAK1	.	C	374	ENSP00000414287:R374C	ENSP00000414287:R374C	R	-	1	0	MST1	49698526	1.000000	0.71417	1.000000	0.80357	0.787000	0.44495	8.008000	0.88588	2.526000	0.85167	0.655000	0.94253	CGT	.		0.697	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346415.2		
DNAH1	25981	hgsc.bcm.edu	37	3	52431781	52431781	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr3:52431781T>A	ENST00000420323.2	+	74	12107	c.11846T>A	c.(11845-11847)cTg>cAg	p.L3949Q		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	4014					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		ATCTTTGGCCTGCATGACAAT	0.552																																					p.L3949Q		.											.	DNAH1-67	0			c.T11846A						.						107.0	108.0	108.0					3																	52431781		2079	4206	6285	SO:0001583	missense	25981	exon74			TTGGCCTGCATGA	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.11846T>A	3.37:g.52431781T>A	ENSP00000401514:p.Leu3949Gln	Somatic	54	0		WXS	Illumina HiSeq	Phase_I	54	3	NM_015512	0	0	6	6	0	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	ENST00000420323.2	37	CCDS46842.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.289114	0.80914	.	.	ENSG00000114841	ENST00000420323;ENST00000273600	T	0.23147	1.92	5.28	5.28	0.74379	.	0.000000	0.53938	D	0.000047	T	0.51822	0.1697	M	0.76328	2.33	0.54753	D	0.999986	D;D	0.89917	1.0;0.976	D;P	0.91635	0.999;0.741	T	0.55147	-0.8186	10	0.62326	D	0.03	.	15.3898	0.74735	0.0:0.0:0.0:1.0	.	3949;4014	C9JXH6;Q9P2D7-2	.;.	Q	3949;702	ENSP00000401514:L3949Q	ENSP00000273600:L702Q	L	+	2	0	DNAH1	52406821	0.997000	0.39634	1.000000	0.80357	0.995000	0.86356	4.805000	0.62561	2.232000	0.73038	0.533000	0.62120	CTG	.		0.552	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	
VPS8	23355	hgsc.bcm.edu	37	3	184717520	184717520	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr3:184717520C>G	ENST00000437079.3	+	45	4044	c.3873C>G	c.(3871-3873)aaC>aaG	p.N1291K	VPS8_ENST00000436792.2_Missense_Mutation_p.N1289K|VPS8_ENST00000446204.2_Missense_Mutation_p.N1199K|VPS8_ENST00000287546.4_Missense_Mutation_p.N1291K	NM_001009921.2	NP_001009921.1	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog (S. cerevisiae)	1291							zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			GCCTACAAAACAAAGAATGCA	0.358																																					p.N1291K		.											.	VPS8-91	0			c.C3873G						.						86.0	79.0	81.0					3																	184717520		1890	4135	6025	SO:0001583	missense	23355	exon44			ACAAAACAAAGAA	AK056661	CCDS46972.1	3q27.2	2006-07-07	2006-07-07	2006-07-07	ENSG00000156931	ENSG00000156931			29122	protein-coding gene	gene with protein product			"""KIAA0804"""	KIAA0804		9872452	Standard	NM_001009921		Approved	FLJ32099	uc003fpb.1	Q8N3P4	OTTHUMG00000156707	ENST00000437079.3:c.3873C>G	3.37:g.184717520C>G	ENSP00000397879:p.Asn1291Lys	Somatic	34	0		WXS	Illumina HiSeq	Phase_I	29	2	NM_001009921	0	0	38	38	0	A8K8Q8|B9EIQ1|C9JB61|O94896|Q63HP2|Q9BVP9|Q9H9B0	Missense_Mutation	SNP	ENST00000437079.3	37	CCDS46971.1	.	.	.	.	.	.	.	.	.	.	C	6.399	0.441748	0.12164	.	.	ENSG00000156931	ENST00000287546;ENST00000437079;ENST00000436792;ENST00000446204	T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15	5.62	4.73	0.59995	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	0.435447	0.28908	N	0.013759	T	0.35711	0.0941	N	0.04880	-0.145	0.29946	N	0.820688	B;B;B	0.15141	0.0;0.012;0.0	B;B;B	0.20384	0.001;0.029;0.001	T	0.27606	-1.0069	10	0.10111	T	0.7	-27.2808	8.6758	0.34179	0.0:0.7772:0.0:0.2228	.	1291;1199;1289	Q8N3P4;Q8N3P4-2;Q8N3P4-3	VPS8_HUMAN;.;.	K	1291;1291;1289;1199	ENSP00000287546:N1291K;ENSP00000397879:N1291K;ENSP00000404704:N1289K;ENSP00000405483:N1199K	ENSP00000287546:N1291K	N	+	3	2	VPS8	186200214	0.998000	0.40836	1.000000	0.80357	0.974000	0.67602	0.570000	0.23653	1.344000	0.45657	0.609000	0.83330	AAC	.		0.358	VPS8-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015303	
ABCE1	6059	hgsc.bcm.edu	37	4	146033407	146033407	+	Missense_Mutation	SNP	C	C	G	rs80263613		TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr4:146033407C>G	ENST00000296577.4	+	9	1242	c.727C>G	c.(727-729)Cct>Gct	p.P243A	OTUD4_ENST00000455611.2_Intron|ABCE1_ENST00000502803.1_Intron	NM_001040876.1|NM_002940.2	NP_001035809.1|NP_002931.2	P61221	ABCE1_HUMAN	ATP-binding cassette, sub-family E (OABP), member 1	243	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				negative regulation of catalytic activity (GO:0043086)|response to virus (GO:0009615)|RNA catabolic process (GO:0006401)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|iron-sulfur cluster binding (GO:0051536)|ribonuclease inhibitor activity (GO:0008428)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|lung(5)|prostate(2)|skin(3)	18	all_hematologic(180;0.151)					GTTTGATGAGCCTTCTAGTTA	0.313																																					p.P243A		.											.	ABCE1-91	0			c.C727G						.						48.0	45.0	46.0					4																	146033407		2202	4299	6501	SO:0001583	missense	6059	exon9			GATGAGCCTTCTA	X74987	CCDS34071.1	4q31	2012-03-14			ENSG00000164163	ENSG00000164163		"""ATP binding cassette transporters / subfamily E"""	69	protein-coding gene	gene with protein product		601213		RNASEL1, RNASELI, RNS4I		7539425	Standard	NM_002940		Approved	RLI, OABP	uc003ijy.3	P61221	OTTHUMG00000161478	ENST00000296577.4:c.727C>G	4.37:g.146033407C>G	ENSP00000296577:p.Pro243Ala	Somatic	16	0		WXS	Illumina HiSeq	Phase_I	22	3	NM_002940	0	0	13	13	0	O88793|Q13181|Q13864|Q6NR76|Q96AL0|Q96B10|Q99K66	Missense_Mutation	SNP	ENST00000296577.4	37	CCDS34071.1	.	.	.	.	.	.	.	.	.	.	C	18.49	3.634942	0.67130	.	.	ENSG00000164163	ENST00000296577	D	0.96300	-3.97	5.53	5.53	0.82687	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.98760	0.9583	H	0.94658	3.565	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99180	1.0867	10	0.66056	D	0.02	-25.9378	19.8132	0.96556	0.0:1.0:0.0:0.0	.	243	P61221	ABCE1_HUMAN	A	243	ENSP00000296577:P243A	ENSP00000296577:P243A	P	+	1	0	ABCE1	146252857	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.553000	0.82203	2.753000	0.94483	0.585000	0.79938	CCT	.		0.313	ABCE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365104.1	NM_002940	
LYRM7	90624	hgsc.bcm.edu	37	5	130517930	130517930	+	Missense_Mutation	SNP	A	A	C	rs200336982	byFrequency	TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr5:130517930A>C	ENST00000379380.4	+	3	311	c.100A>C	c.(100-102)Ata>Cta	p.I34L	LYRM7_ENST00000510516.1_Intron|LYRM7_ENST00000507584.1_Missense_Mutation_p.I34L	NM_181705.2	NP_859056.2	Q5U5X0	LYRM7_HUMAN	LYR motif containing 7	34						mitochondrion (GO:0005739)				upper_aerodigestive_tract(1)	1		all_cancers(142;0.0377)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AGCAGCCAGAATAAAGATAAA	0.249													A|||	2	0.000399361	0.0008	0.0	5008	,	,		15990	0.0		0.001	False		,,,				2504	0.0				p.I34L		.											.	LYRM7-68	0			c.A100C						.	A	LEU/ILE	2,4038		0,2,2018	10.0	11.0	10.0		100	2.3	1.0	5		10	3,8299		0,3,4148	yes	missense	LYRM7	NM_181705.2	5	0,5,6166	CC,CA,AA		0.0361,0.0495,0.0405	benign	34/105	130517930	5,12337	2020	4151	6171	SO:0001583	missense	90624	exon3			GCCAGAATAAAGA	BC047079	CCDS4148.1	5q31.1	2013-05-24	2012-10-23	2006-10-17	ENSG00000186687	ENSG00000186687		"""LYR motif containing"""	28072	protein-coding gene	gene with protein product		615831	"""chromosome 5 open reading frame 31"", ""Lyrm7 homolog (mouse)"""	C5orf31		23168492	Standard	NM_181705		Approved	FLJ20796, MZM1L	uc003kvg.1	Q5U5X0	OTTHUMG00000128994	ENST00000379380.4:c.100A>C	5.37:g.130517930A>C	ENSP00000368688:p.Ile34Leu	Somatic	3	1		WXS	Illumina HiSeq	Phase_I	27	6	NM_181705	0	0	0	0	0	A8MPQ9|Q86Y68	Missense_Mutation	SNP	ENST00000379380.4	37	CCDS4148.1	2	9.157509157509158E-4	1	0.0020325203252032522	0	0.0	0	0.0	1	0.0013192612137203166	A	10.18	1.278672	0.23307	4.95E-4	3.61E-4	ENSG00000186687	ENST00000379380;ENST00000507584	T;T	0.68331	-0.32;-0.32	4.67	2.33	0.28932	.	0.563855	0.18398	N	0.142452	T	0.28001	0.0690	N	0.00538	-1.39	0.23430	N	0.997698	B	0.02656	0.0	B	0.01281	0.0	T	0.24119	-1.0169	10	0.26408	T	0.33	-13.1777	5.7836	0.18320	0.7863:0.0:0.2137:0.0	.	34	Q5U5X0	LYRM7_HUMAN	L	34	ENSP00000368688:I34L;ENSP00000423991:I34L	ENSP00000368688:I34L	I	+	1	0	LYRM7	130545829	0.969000	0.33509	1.000000	0.80357	0.992000	0.81027	0.633000	0.24598	0.548000	0.28955	0.533000	0.62120	ATA	A|0.999;C|0.001		0.249	LYRM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250983.1	NM_181705	
ANXA6	309	hgsc.bcm.edu	37	5	150518240	150518240	+	Splice_Site	SNP	G	G	T	rs188111044	byFrequency	TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr5:150518240G>T	ENST00000354546.5	-	5	544	c.317C>A	c.(316-318)tCg>tAg	p.S106*	ANXA6_ENST00000523714.1_Splice_Site_p.S74*|ANXA6_ENST00000356496.5_Splice_Site_p.S106*|ANXA6_ENST00000377751.5_Intron|ANXA6_ENST00000521512.1_Intron	NM_001155.4	NP_001146.2	P08133	ANXA6_HUMAN	annexin A6	106					calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|protein homooligomerization (GO:0051260)|regulation of muscle contraction (GO:0006937)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|cholesterol binding (GO:0015485)|GTP binding (GO:0005525)|ligand-gated ion channel activity (GO:0015276)|lipid binding (GO:0008289)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(1)|lung(9)	12		Medulloblastoma(196;0.0912)|all_hematologic(541;0.208)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ACTTCTTACCGAGATGGCATC	0.488																																					p.S106X		.											.	ANXA6-22	0			c.C317A						.						105.0	105.0	105.0					5																	150518240		1955	4147	6102	SO:0001630	splice_region_variant	309	exon5			CTTACCGAGATGG	J03578	CCDS47315.1, CCDS54941.1	5q33.1	2008-02-05			ENSG00000197043	ENSG00000197043		"""Annexins"""	544	protein-coding gene	gene with protein product		114070		ANX6		3258820	Standard	NM_001155		Approved		uc003ltl.2	P08133	OTTHUMG00000164179	ENST00000354546.5:c.318+1C>A	5.37:g.150518240G>T		Somatic	32	0		WXS	Illumina HiSeq	Phase_I	23	2	NM_001155	0	0	0	0	0	B7Z8A7|D3DQH4|E9PGK1|Q6ZT79	Nonsense_Mutation	SNP	ENST00000354546.5	37	CCDS47315.1	.	.	.	.	.	.	.	.	.	.	G	36	5.932215	0.97116	.	.	ENSG00000197043	ENST00000354546;ENST00000523714;ENST00000356496;ENST00000517486;ENST00000521749;ENST00000517757;ENST00000523164	.	.	.	5.77	5.77	0.91146	.	0.237963	0.42294	D	0.000738	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	.	14.2952	0.66308	0.0:0.0:0.8508:0.1492	.	.	.	.	X	106;74;106;106;74;74;106	.	ENSP00000346550:S106X	S	-	2	0	ANXA6	150498433	0.982000	0.34865	1.000000	0.80357	0.565000	0.35776	3.083000	0.50136	2.724000	0.93272	0.561000	0.74099	TCG	G|0.999;A|0.001		0.488	ANXA6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377668.2	NM_001155	Nonsense_Mutation
PPIL1	51645	hgsc.bcm.edu;broad.mit.edu	37	6	36842542	36842542	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr6:36842542C>T	ENST00000373699.5	-	1	258	c.7G>A	c.(7-9)Gca>Aca	p.A3T	C6orf89_ENST00000359359.2_Intron|C6orf89_ENST00000510325.2_Intron	NM_016059.4	NP_057143.1	Q9Y3C6	PPIL1_HUMAN	peptidylprolyl isomerase (cyclophilin)-like 1	3					mRNA splicing, via spliceosome (GO:0000398)|protein folding (GO:0006457)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			lung(1)|ovary(1)	2						GGGGGAATTGCCGCCATAGCG	0.637																																					p.A3T		.											.	PPIL1-91	0			c.G7A						.						27.0	31.0	30.0					6																	36842542		2203	4300	6503	SO:0001583	missense	51645	exon1			GAATTGCCGCCAT	AF090992	CCDS4826.1	6p21.1	2008-08-29			ENSG00000137168	ENSG00000137168			9260	protein-coding gene	gene with protein product		601301				10072585, 8978786	Standard	NM_016059		Approved	CYPL1	uc003omu.2	Q9Y3C6	OTTHUMG00000014612	ENST00000373699.5:c.7G>A	6.37:g.36842542C>T	ENSP00000362803:p.Ala3Thr	Somatic	38	0		WXS	Illumina HiSeq	Phase_I	27	3	NM_016059	0	0	22	22	0	O15001|Q5TDC9	Missense_Mutation	SNP	ENST00000373699.5	37	CCDS4826.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.142423	0.77888	.	.	ENSG00000137168	ENST00000373699	T	0.24151	1.87	5.49	5.49	0.81192	.	0.059397	0.64402	D	0.000004	T	0.09818	0.0241	N	0.14661	0.345	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.05257	-1.0896	10	0.72032	D	0.01	.	16.8702	0.86038	0.0:1.0:0.0:0.0	.	3	Q9Y3C6	PPIL1_HUMAN	T	3	ENSP00000362803:A3T	ENSP00000362803:A3T	A	-	1	0	PPIL1	36950520	1.000000	0.71417	0.994000	0.49952	0.675000	0.39556	6.986000	0.76200	2.596000	0.87737	0.557000	0.71058	GCA	.		0.637	PPIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040382.1		
TYW1	55253	hgsc.bcm.edu	37	7	66474575	66474575	+	Silent	SNP	C	C	T	rs376806090		TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr7:66474575C>T	ENST00000359626.5	+	4	443	c.279C>T	c.(277-279)ttC>ttT	p.F93F		NM_018264.2	NP_060734.2	Q9NV66	TYW1_HUMAN	tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)	93	Flavodoxin-like. {ECO:0000255|PROSITE- ProRule:PRU00088}.				tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(8)|kidney(10)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(3)|stomach(2)|urinary_tract(2)	46		Lung NSC(55;0.0846)|all_lung(88;0.183)				ATTAGGGATTCGCAACAGTTC	0.398																																					p.F93F		.											.	TYW1-91	0			c.C279T						.						134.0	119.0	124.0					7																	66474575		2203	4300	6503	SO:0001819	synonymous_variant	55253	exon4			GGGATTCGCAACA	AK001762	CCDS5538.1	7q11.21	2007-11-29	2007-11-29	2007-11-29	ENSG00000198874	ENSG00000198874			25598	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 1 homolog A (S. cerevisiae)"""	611243	"""radical S-adenosyl methionine and flavodoxin domains 1"""	RSAFD1		16162496, 17150819	Standard	NM_018264		Approved	FLJ10900, MGC23001, MGC60291, YPL207W, TYW1A	uc003tvn.4	Q9NV66	OTTHUMG00000129723	ENST00000359626.5:c.279C>T	7.37:g.66474575C>T		Somatic	62	0		WXS	Illumina HiSeq	Phase_I	99	5	NM_018264	0	0	0	0	0	Q6PJG8|Q75MG8|Q75MN3|Q86V12|Q8IVS7|Q9H9C4	Silent	SNP	ENST00000359626.5	37	CCDS5538.1																																																																																			.		0.398	TYW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251932.2	NM_018264	
SEMA3E	9723	hgsc.bcm.edu	37	7	83023612	83023612	+	Splice_Site	SNP	C	C	G			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr7:83023612C>G	ENST00000307792.3	-	13	1968		c.e13+1		SEMA3E_ENST00000427262.1_Splice_Site	NM_012431.2	NP_036563.1	O15041	SEM3E_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E						axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell-matrix adhesion (GO:0001953)|patterning of blood vessels (GO:0001569)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell shape (GO:0008360)|semaphorin-plexin signaling pathway (GO:0071526)|sprouting angiogenesis (GO:0002040)|synapse organization (GO:0050808)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(19)|ovary(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	51		Medulloblastoma(109;0.109)				acaGAACTTACCCGCTTTGAA	0.318																																					.		.											.	SEMA3E-93	0			c.1500+1G>C						.						45.0	45.0	45.0					7																	83023612		2203	4297	6500	SO:0001630	splice_region_variant	9723	exon14			AACTTACCCGCTT	AB002329	CCDS34674.1, CCDS55121.1	7q21.11	2013-01-11			ENSG00000170381	ENSG00000170381		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10727	protein-coding gene	gene with protein product	"""M-sema H"""	608166		SEMAH		9205841, 9515811	Standard	NM_012431		Approved	M-SemaK, KIAA0331, coll-5	uc003uhy.2	O15041	OTTHUMG00000154693	ENST00000307792.3:c.1500+1G>C	7.37:g.83023612C>G		Somatic	50	0		WXS	Illumina HiSeq	Phase_I	59	3	NM_012431	0	0	0	0	0	B4E1P1|Q75M94|Q75M97	Splice_Site	SNP	ENST00000307792.3	37	CCDS34674.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.677971	0.88445	.	.	ENSG00000170381	ENST00000307792;ENST00000427262;ENST00000541514	.	.	.	5.97	5.97	0.96955	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.4324	0.99085	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SEMA3E	82861548	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	6.793000	0.75130	2.833000	0.97629	0.585000	0.79938	.	.		0.318	SEMA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336606.1	NM_012431	Intron
MBLAC1	255374	hgsc.bcm.edu	37	7	99725439	99725439	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr7:99725439G>A	ENST00000398075.2	+	2	820	c.421G>A	c.(421-423)Gga>Aga	p.G141R	RP11-506M12.1_ENST00000494221.1_RNA	NM_203397.1	NP_981942.1	A4D2B0	MBLC1_HUMAN	metallo-beta-lactamase domain containing 1	141							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|skin(1)	7						CTGCCTTCCCGGAGGCCGCTA	0.736																																					p.G141R		.											.	MBLAC1-135	0			c.G421A						.						10.0	12.0	11.0					7																	99725439		1895	4100	5995	SO:0001583	missense	255374	exon2			CTTCCCGGAGGCC	BC031288	CCDS43620.1	7q22	2014-02-12	2009-04-08		ENSG00000214309	ENSG00000214309			22180	protein-coding gene	gene with protein product							Standard	XM_005250250		Approved	MGC49416	uc003utp.3	A4D2B0	OTTHUMG00000154846	ENST00000398075.2:c.421G>A	7.37:g.99725439G>A	ENSP00000381150:p.Gly141Arg	Somatic	14	0		WXS	Illumina HiSeq	Phase_I	6	2	NM_203397	0	0	3	3	0	Q8N5X8	Missense_Mutation	SNP	ENST00000398075.2	37	CCDS43620.1	.	.	.	.	.	.	.	.	.	.	G	18.33	3.600780	0.66332	.	.	ENSG00000214309	ENST00000398075	T	0.79454	-1.27	4.35	4.35	0.52113	Beta-lactamase-like (2);	0.096661	0.40302	U	0.001124	T	0.65575	0.2704	N	0.20574	0.59	0.31698	N	0.641087	P	0.52061	0.95	P	0.45099	0.469	T	0.65602	-0.6128	10	0.14252	T	0.57	.	14.7701	0.69671	0.0:0.0:1.0:0.0	.	141	A4D2B0	MBLC1_HUMAN	R	141	ENSP00000381150:G141R	ENSP00000381150:G141R	G	+	1	0	MBLAC1	99563375	1.000000	0.71417	0.993000	0.49108	0.885000	0.51271	4.846000	0.62860	2.440000	0.82611	0.561000	0.74099	GGA	.		0.736	MBLAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337353.1	NM_203397	
FBXW2	26190	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	123527053	123527053	+	Silent	SNP	G	G	A			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr9:123527053G>A	ENST00000608872.1	-	8	1336	c.1149C>T	c.(1147-1149)gaC>gaT	p.D383D	FBXW2_ENST00000340778.5_Silent_p.D318D|FBXW2_ENST00000493559.1_Intron	NM_012164.3	NP_036296.2	Q9UKT8	FBXW2_HUMAN	F-box and WD repeat domain containing 2	383					cellular protein modification process (GO:0006464)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	ubiquitin-protein transferase activity (GO:0004842)			ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	4						GGTAGCGGTTGTCAAACAGCA	0.502																																					p.D383D		.											.	FBXW2-227	0			c.C1149T						.						92.0	90.0	91.0					9																	123527053		1949	4160	6109	SO:0001819	synonymous_variant	26190	exon8			GCGGTTGTCAAAC	AF129531	CCDS43872.1	9q34	2013-01-09	2007-02-08		ENSG00000119402	ENSG00000119402		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13608	protein-coding gene	gene with protein product		609071	"""F-box and WD-40 domain protein 2"""			10531035, 10828603	Standard	NM_012164		Approved	FBW2, Md6, Fwd2	uc004bkm.1	Q9UKT8	OTTHUMG00000020576	ENST00000608872.1:c.1149C>T	9.37:g.123527053G>A		Somatic	139	0		WXS	Illumina HiSeq	Phase_I	125	11	NM_012164	0	0	27	29	2	B3KRL8|Q4VXH2|Q7Z4V6|Q8WV51|Q9HA09|Q9UKA3	Silent	SNP	ENST00000608872.1	37	CCDS43872.1																																																																																			.		0.502	FBXW2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053834.2		
PHKA2	5256	bcgsc.ca	37	X	18972370	18972370	+	Splice_Site	SNP	A	A	G			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chrX:18972370A>G	ENST00000379942.4	-	2	903		c.e2+1			NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)						carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					AGTCACTATTACCTGCTCCAG	0.537																																					.													.	PHKA2-131	0			c.237+2T>C						.						138.0	107.0	117.0					X																	18972370		2203	4300	6503	SO:0001630	splice_region_variant	5256	exon3			ACTATTACCTGCT		CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.237+1T>C	X.37:g.18972370A>G		Somatic	71	0		WXS	Illumina HiSeq	Phase_1	92	4	NM_000292	0	0	0	0	0	A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Splice_Site	SNP	ENST00000379942.4	37	CCDS14190.1	.	.	.	.	.	.	.	.	.	.	A	16.96	3.266542	0.59540	.	.	ENSG00000044446	ENST00000379942	.	.	.	5.54	4.35	0.52113	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.0604	0.47944	0.8588:0.0:0.0:0.1412	.	.	.	.	.	-1	.	.	.	-	.	.	PHKA2	18882291	1.000000	0.71417	0.991000	0.47740	0.625000	0.37756	9.284000	0.95882	0.713000	0.32060	0.486000	0.48141	.	.		0.537	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055960.1	NM_000292	Intron
RNF128	79589	hgsc.bcm.edu	37	X	106031218	106031218	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chrX:106031218T>C	ENST00000255499.2	+	4	1125	c.875T>C	c.(874-876)aTc>aCc	p.I292T	RNF128_ENST00000324342.3_Missense_Mutation_p.I266T	NM_194463.1	NP_919445.1	Q8TEB7	RN128_HUMAN	ring finger protein 128, E3 ubiquitin protein ligase	292					negative regulation of cytokine biosynthetic process (GO:0042036)	cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(6)|ovary(1)	11						TTGGTACGCATCTTAACGTGC	0.343																																					p.I292T		.											.	RNF128-227	0			c.T875C						.						207.0	163.0	178.0					X																	106031218		2202	4300	6502	SO:0001583	missense	79589	exon4			TACGCATCTTAAC	AK027169	CCDS14520.1, CCDS14521.1	Xq22.3	2013-01-09	2012-02-23		ENSG00000133135	ENSG00000133135		"""RING-type (C3HC4) zinc fingers"""	21153	protein-coding gene	gene with protein product		300439	"""ring finger protein 128"""				Standard	NM_024539		Approved	FLJ23516, GRAIL	uc004eml.3	Q8TEB7	OTTHUMG00000022151	ENST00000255499.2:c.875T>C	X.37:g.106031218T>C	ENSP00000255499:p.Ile292Thr	Somatic	29	0		WXS	Illumina HiSeq	Phase_I	26	2	NM_194463	0	0	0	0	0	A0PJI4|Q6PH80|Q6ZTJ8|Q96RF3|Q9H5E4	Missense_Mutation	SNP	ENST00000255499.2	37	CCDS14521.1	.	.	.	.	.	.	.	.	.	.	T	17.20	3.328438	0.60743	.	.	ENSG00000133135	ENST00000418562;ENST00000324342;ENST00000255499	T;T;T	0.68479	-0.33;1.08;1.08	5.26	5.26	0.73747	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, RING-H2-type (1);	0.060185	0.64402	D	0.000003	T	0.67869	0.2939	N	0.17312	0.475	0.53688	D	0.999978	D;P	0.65815	0.995;0.875	D;P	0.68039	0.955;0.729	T	0.72014	-0.4418	10	0.56958	D	0.05	.	12.9945	0.58638	0.0:0.0:0.0:1.0	.	292;266	Q8TEB7;Q8TEB7-2	RN128_HUMAN;.	T	239;266;292	ENSP00000412610:I239T;ENSP00000316127:I266T;ENSP00000255499:I292T	ENSP00000255499:I292T	I	+	2	0	RNF128	105917874	1.000000	0.71417	0.997000	0.53966	0.759000	0.43091	7.188000	0.77739	1.745000	0.51790	0.481000	0.45027	ATC	.		0.343	RNF128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057804.1	NM_024539	
BICD1	636	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	32491723	32491724	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	AT	AT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr12:32491723_32491724delAT	ENST00000281474.5	+	8	2677_2678	c.2574_2575delAT	c.(2572-2577)caatttfs	p.QF858fs	BICD1_ENST00000548411.1_Intron	NM_001714.2	NP_001705.2	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 (Drosophila)	858					anatomical structure morphogenesis (GO:0009653)|intracellular mRNA localization (GO:0008298)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900737)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein localization to organelle (GO:0033365)|regulation of proteinase activated receptor activity (GO:1900276)|RNA processing (GO:0006396)|stress granule assembly (GO:0034063)|viral process (GO:0016032)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|host cell viral assembly compartment (GO:0072517)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	cytoskeletal adaptor activity (GO:0008093)|dynactin binding (GO:0034452)|dynein binding (GO:0045502)|proteinase activated receptor binding (GO:0031871)|Rab GTPase binding (GO:0017137)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			CTGCAAGACAATTTTCACCTTC	0.406																																					p.858_859del		.											.	BICD1-153	0			c.2574_2575del						.																																			SO:0001589	frameshift_variant	636	exon8			.	U90028	CCDS8726.1, CCDS44859.1	12p11.2-p11.1	2005-01-13	2001-11-28			ENSG00000151746			1049	protein-coding gene	gene with protein product		602204	"""Bicaudal D (Drosophila) homolog 1"""			9367685	Standard	NM_001714		Approved		uc001rku.3	Q96G01	OTTHUMG00000169307	ENST00000281474.5:c.2574_2575delAT	12.37:g.32491723_32491724delAT	ENSP00000281474:p.Gln858fs	Somatic	200	0		WXS	Illumina HiSeq	Phase_I	182	62	NM_001714	0	0	0	0	0	A8K2C3|F8W113|O43892|O43893	Frame_Shift_Del	DEL	ENST00000281474.5	37	CCDS8726.1																																																																																			.		0.406	BICD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403380.1	NM_001714	
NPIPB5	100132247	broad.mit.edu	37	16	22545578	22545580	+	In_Frame_Del	DEL	ATA	ATA	-			TCGA-A4-8312-01A-11D-2396-08	TCGA-A4-8312-10A-01D-2396-08	ATA	ATA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f9961fbe-ca3b-4c52-b923-82430aef5a16	16e755f0-8784-4438-a9e3-0bc481bbaf86	g.chr16:22545578_22545580delATA	ENST00000517539.1	+	8	1349_1351	c.1274_1276delATA	c.(1273-1278)gataat>gat	p.N426del	NPIPB5_ENST00000424340.1_In_Frame_Del_p.N426del|NPIPB5_ENST00000415654.1_3'UTR			A8MRT5	NPIB5_HUMAN	nuclear pore complex interacting protein family, member B5	426	Pro-rich.					integral component of membrane (GO:0016021)											TCAGCGGATGATAATCTCAAGAC	0.586																																					p.425_426del													.	.	0			c.1274_1276del						.			72,304		29,14,145							0.0			1	29,645		11,7,319	no	coding	LOC100132247	NM_001135865.1		40,21,464	A1A1,A1R,RR		4.3027,19.1489,9.619				101,949				SO:0001651	inframe_deletion	0	exon7			CGGATGATAATCT		CCDS45443.1	16p12.2	2013-06-11			ENSG00000243716	ENSG00000243716			37233	protein-coding gene	gene with protein product							Standard	NM_001135865		Approved			A8MRT5	OTTHUMG00000163573	ENST00000517539.1:c.1274_1276delATA	16.37:g.22545578_22545580delATA	ENSP00000430633:p.Asn426del	Somatic	178	0		WXS	Illumina HiSeq	Phase_I	180	3	NM_001135865	0	0	0	0	0	B4DK13	In_Frame_Del	DEL	ENST00000517539.1	37	CCDS45443.1																																																																																			.		0.586	NPIPB5-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374343.2	NM_001135865	
