#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SDC3	9672	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	31347253	31347253	+	Silent	SNP	G	G	T			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr1:31347253G>T	ENST00000339394.6	-	4	1227	c.1053C>A	c.(1051-1053)ccC>ccA	p.P351P	SDC3_ENST00000336798.7_Silent_p.P293P|SDC3_ENST00000471567.1_5'Flank	NM_014654.3	NP_055469.3	O75056	SDC3_HUMAN	syndecan 3	351					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Myeloproliferative disorder(586;0.0393)|Colorectal(325;0.0466)|all_neural(195;0.0966)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)		STAD - Stomach adenocarcinoma(196;0.0197)|READ - Rectum adenocarcinoma(331;0.0649)		GGGCACCCTTGGGCAGTGTCC	0.632																																					p.P351P		.											.	SDC3-227	0			c.C1053A						.						76.0	83.0	81.0					1																	31347253		2203	4300	6503	SO:0001819	synonymous_variant	9672	exon4			ACCCTTGGGCAGT	AF248634	CCDS30661.1	1p35.2	2013-09-19	2007-02-15		ENSG00000162512	ENSG00000162512		"""Proteoglycans / Cell Surface : Syndecans"""	10660	protein-coding gene	gene with protein product	"""syndecan proteoglycan 3"""	186357	"""syndecan 3 (N-syndecan)"""			1556152, 11527150	Standard	NM_014654		Approved	N-syndecan, SYND3	uc001bse.2	O75056	OTTHUMG00000043646	ENST00000339394.6:c.1053C>A	1.37:g.31347253G>T		Somatic	85	0		WXS	Illumina HiSeq	Phase_I	96	31	NM_014654	0	0	13	15	2	Q5T1Z6|Q5T1Z7|Q96CT3|Q96PR8	Silent	SNP	ENST00000339394.6	37	CCDS30661.1																																																																																			.		0.632	SDC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102017.1	NM_014654	
PPIE	10450	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	40211152	40211152	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr1:40211152G>A	ENST00000324379.5	+	7	509	c.490G>A	c.(490-492)Gtc>Atc	p.V164I	PPIE_ENST00000470213.1_Intron|PPIE_ENST00000480169.1_3'UTR|PPIE_ENST00000356511.2_Missense_Mutation_p.V164I|PPIE_ENST00000372830.1_Missense_Mutation_p.V164I	NM_006112.3	NP_006103.1	Q9UNP9	PPIE_HUMAN	peptidylprolyl isomerase E (cyclophilin E)	164	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				mRNA splicing, via spliceosome (GO:0000398)|positive regulation of viral genome replication (GO:0045070)|protein folding (GO:0006457)|regulation of transcription, DNA-templated (GO:0006355)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	cyclosporin A binding (GO:0016018)|nucleotide binding (GO:0000166)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			kidney(3)|large_intestine(2)|lung(2)|prostate(1)|urinary_tract(1)	9	all_cancers(7;1.63e-13)|all_lung(5;2.27e-16)|all_epithelial(6;1.35e-15)|Lung NSC(20;1.49e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;2.7e-17)|all cancers(16;5.5e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			GCGTTCTGATGTCGTGCCCAT	0.572																																					p.V164I		.											.	PPIE-90	0			c.G490A						.						67.0	55.0	59.0					1																	40211152		2203	4300	6503	SO:0001583	missense	10450	exon7			TCTGATGTCGTGC	AF042385	CCDS442.1, CCDS443.1, CCDS53299.1	1p32	2013-02-12			ENSG00000084072	ENSG00000084072		"""RNA binding motif (RRM) containing"""	9258	protein-coding gene	gene with protein product	"""peptidyl-prolyl cis-trans isomerase E"", ""cyclophilin 33"", ""cyclophilin E"", ""PPIase E"", ""rotamase E"", ""peptidylprolyl isomerase E, isoform 1"""	602435				9747881	Standard	NM_203456		Approved	CyP-33, MGC3736, MGC111222	uc001cdw.3	Q9UNP9	OTTHUMG00000009248	ENST00000324379.5:c.490G>A	1.37:g.40211152G>A	ENSP00000312769:p.Val164Ile	Somatic	49	0		WXS	Illumina HiSeq	Phase_I	36	20	NM_006112	0	0	27	42	15	B2R971|O43634|O43635|Q32Q72|Q3S611|Q5TGA0|Q5TGA2|Q5TGA3|Q9UIZ5	Missense_Mutation	SNP	ENST00000324379.5	37	CCDS443.1	.	.	.	.	.	.	.	.	.	.	G	12.11	1.839855	0.32513	.	.	ENSG00000084072	ENST00000324379;ENST00000356511;ENST00000497370;ENST00000372835;ENST00000372830	T;T;T;T;T	0.22134	1.97;1.97;1.97;1.97;1.97	5.0	0.793	0.18632	Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (4);Cyclophilin-like (1);	0.135859	0.50627	D	0.000102	T	0.11750	0.0286	N	0.20357	0.565	0.47862	D	0.999531	B;B;B;B	0.17667	0.001;0.023;0.001;0.001	B;B;B;B	0.21917	0.01;0.037;0.005;0.009	T	0.13710	-1.0499	10	0.28530	T	0.3	-14.2927	8.5189	0.33264	0.4795:0.0:0.5205:0.0	.	85;164;164;164	B4E3F2;Q5TGA3;Q9UNP9-2;Q9UNP9	.;.;.;PPIE_HUMAN	I	164;164;98;113;164	ENSP00000312769:V164I;ENSP00000348904:V164I;ENSP00000433475:V98I;ENSP00000361925:V113I;ENSP00000361918:V164I	ENSP00000312769:V164I	V	+	1	0	PPIE	39983739	0.996000	0.38824	0.443000	0.26883	0.786000	0.44442	2.773000	0.47686	0.320000	0.23234	-0.251000	0.11542	GTC	.		0.572	PPIE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025642.2	NM_006112	
PPT1	5538	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	40536545	40536545	+	IGR	SNP	C	C	T			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr1:40536545C>T	ENST00000433473.3	-	0	2740				CAP1_ENST00000372802.1_Missense_Mutation_p.T412I|PPT1_ENST00000372775.2_5'Flank|CAP1_ENST00000372805.3_Missense_Mutation_p.T413I|CAP1_ENST00000372798.1_Missense_Mutation_p.T412I|CAP1_ENST00000340450.3_Missense_Mutation_p.T412I|CAP1_ENST00000479759.1_3'UTR|CAP1_ENST00000372792.2_Missense_Mutation_p.T413I|CAP1_ENST00000372797.3_Missense_Mutation_p.T413I	NM_000310.3	NP_000301.1	P50897	PPT1_HUMAN	palmitoyl-protein thioesterase 1						adult locomotory behavior (GO:0008344)|associative learning (GO:0008306)|brain development (GO:0007420)|cell death (GO:0008219)|cellular protein catabolic process (GO:0044257)|cofactor metabolic process (GO:0051186)|cofactor transport (GO:0051181)|grooming behavior (GO:0007625)|lipid catabolic process (GO:0016042)|lysosomal lumen acidification (GO:0007042)|membrane raft organization (GO:0031579)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of neuron apoptotic process (GO:0043524)|nervous system development (GO:0007399)|neuron development (GO:0048666)|neurotransmitter secretion (GO:0007269)|pinocytosis (GO:0006907)|positive regulation of pinocytosis (GO:0048549)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein catabolic process (GO:0030163)|protein depalmitoylation (GO:0002084)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|regulation of phospholipase A2 activity (GO:0032429)|regulation of synapse structure and activity (GO:0050803)|sphingolipid catabolic process (GO:0030149)|visual perception (GO:0007601)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)	palmitoyl-(protein) hydrolase activity (GO:0008474)|palmitoyl-CoA hydrolase activity (GO:0016290)			endometrium(5)|large_intestine(1)|lung(3)|ovary(1)|stomach(1)	11	Lung NSC(20;3.43e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1e-18)|Epithelial(16;3.6e-17)|all cancers(16;1.1e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			ATCAACAAAACAGATGGCTGC	0.463																																					p.T413I		.											.	CAP1-91	0			c.C1238T						.						138.0	126.0	130.0					1																	40536545		1891	4123	6014	SO:0001628	intergenic_variant	10487	exon12			ACAAAACAGATGG	U44772	CCDS447.1, CCDS44119.1	1p32	2014-09-17	2008-07-31		ENSG00000131238	ENSG00000131238	3.1.2.22		9325	protein-coding gene	gene with protein product	"""ceroid-lipofuscinosis, neuronal 1, infantile"""	600722		PPT		7637805, 8325646	Standard	NM_000310		Approved	CLN1, INCL	uc001cfb.2	P50897	OTTHUMG00000004495		1.37:g.40536545C>T		Somatic	126	0		WXS	Illumina HiSeq	Phase_I	128	48	NM_006367	0	0	121	188	67	B4DY24|Q6FGQ4	Missense_Mutation	SNP	ENST00000433473.3	37	CCDS447.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.618558	0.87460	.	.	ENSG00000131236	ENST00000372797;ENST00000372802;ENST00000372792;ENST00000538246;ENST00000372798;ENST00000340450;ENST00000372805	T;T;T;T;T;T	0.10382	2.89;2.88;2.89;2.88;2.88;2.89	5.55	5.55	0.83447	CARP motif (1);Cyclase-associated protein CAP/septum formation inhibitor MinC, C-terminal (1);Adenylate cyclase-associated CAP, C-terminal (2);C-CAP/cofactor C-like domain (1);	0.000000	0.85682	D	0.000000	T	0.37517	0.1006	M	0.79805	2.47	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.79784	0.993;0.989	T	0.04467	-1.0949	10	0.56958	D	0.05	-5.8536	18.6642	0.91483	0.0:1.0:0.0:0.0	.	360;413	E7ENY9;Q01518	.;CAP1_HUMAN	I	413;412;413;390;412;412;413	ENSP00000361883:T413I;ENSP00000361888:T412I;ENSP00000361878:T413I;ENSP00000361884:T412I;ENSP00000344832:T412I;ENSP00000361891:T413I	ENSP00000344832:T412I	T	+	2	0	CAP1	40309132	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.511000	0.81718	2.890000	0.99128	0.585000	0.79938	ACA	.		0.463	PPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000013126.2	NM_000310	
ZFP69	339559	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	40961061	40961061	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr1:40961061G>T	ENST00000372706.1	+	6	1917	c.911G>T	c.(910-912)tGt>tTt	p.C304F	ZFP69_ENST00000372705.3_Missense_Mutation_p.C304F|RP11-656D10.3_ENST00000450713.1_RNA			Q49AA0	ZFP69_HUMAN	ZFP69 zinc finger protein	304					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										TGTAAGGAATGTGGAAGGGCC	0.388																																					p.C304F		.											.	.	0			c.G911T						.						60.0	58.0	59.0					1																	40961061		2203	4300	6503	SO:0001583	missense	339559	exon6			AGGAATGTGGAAG	AK122618	CCDS30686.1	1p34.2	2013-01-09	2012-11-27	2012-11-27	ENSG00000187815	ENSG00000187815		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	24708	protein-coding gene	gene with protein product	"""ZFP69 zinc finger protein A"""		"""zinc finger protein 642"""	ZNF642			Standard	XM_005270808		Approved	ZKSCAN23A, FLJ16030, ZFP69A, ZSCAN54A	uc001cfo.3	Q49AA0	OTTHUMG00000007303	ENST00000372706.1:c.911G>T	1.37:g.40961061G>T	ENSP00000361791:p.Cys304Phe	Somatic	62	0		WXS	Illumina HiSeq	Phase_I	66	22	NM_198494	0	0	3	4	1	Q5SWM5|Q6ZWK8	Missense_Mutation	SNP	ENST00000372706.1	37	CCDS30686.1	.	.	.	.	.	.	.	.	.	.	G	19.32	3.804872	0.70682	.	.	ENSG00000187815	ENST00000372706;ENST00000372705	D;D	0.85861	-2.04;-2.04	4.79	4.79	0.61399	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.47093	D	0.000241	D	0.95326	0.8483	H	0.98155	4.16	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96405	0.9300	10	0.87932	D	0	-9.3418	16.1533	0.81636	0.0:0.0:1.0:0.0	.	304	Q49AA0	ZN642_HUMAN	F	304	ENSP00000361791:C304F;ENSP00000361790:C304F	ENSP00000361790:C304F	C	+	2	0	ZNF642	40733648	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.601000	0.98297	2.941000	0.99782	0.655000	0.94253	TGT	.		0.388	ZFP69-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019082.1	NM_198494	
OSBPL9	114883	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	52256297	52256297	+	IGR	SNP	C	C	A	rs147279713		TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr1:52256297C>A	ENST00000428468.1	+	0	2893				NRD1_ENST00000485608.1_5'UTR|NRD1_ENST00000354831.7_Nonsense_Mutation_p.E1094*|NRD1_ENST00000539524.1_Nonsense_Mutation_p.E962*|NRD1_ENST00000352171.7_Nonsense_Mutation_p.E1026*			Q96SU4	OSBL9_HUMAN	oxysterol binding protein-like 9						lipid transport (GO:0006869)	cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(3)|pancreas(1)|prostate(3)|skin(1)	18						TCCTCACACTCCTTCAGCTTG	0.527																																					p.E1094X		.											.	NRD1-90	0			c.G3280T						.						151.0	113.0	126.0					1																	52256297		2203	4300	6503	SO:0001628	intergenic_variant	4898	exon31			CACACTCCTTCAG	AF392445	CCDS558.1, CCDS41332.1, CCDS41333.1, CCDS41334.1, CCDS41332.2, CCDS41332.3, CCDS41333.2, CCDS44145.1, CCDS55598.1	1p32.3	2013-01-10			ENSG00000117859	ENSG00000117859		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16386	protein-coding gene	gene with protein product		606737					Standard	NM_148904		Approved		uc001csu.3	Q96SU4	OTTHUMG00000008234		1.37:g.52256297C>A		Somatic	58	0		WXS	Illumina HiSeq	Phase_I	58	26	NM_002525	0	0	38	47	9	B1AKJ8|B3KPQ4|D3DQ31|Q5TFC0|Q6IA67|Q86YQ3|Q8NB17|Q8TAS8|Q96SK4|Q9H9X2	Nonsense_Mutation	SNP	ENST00000428468.1	37	CCDS41332.3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	6.320771|6.320771	0.97471|0.97471	.|.	.|.	ENSG00000078618|ENSG00000078618	ENST00000352171;ENST00000354831;ENST00000539524;ENST00000371665;ENST00000546169|ENST00000440943	.|.	.|.	.|.	5.53|5.53	5.53|5.53	0.82687|0.82687	.|.	0.050156|.	0.85682|.	D|.	0.000000|.	.|T	.|0.75598	.|0.3871	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.72590	.|-0.4247	.|4	0.02654|.	T|.	1|.	-15.9931|-15.9931	19.6556|19.6556	0.95837|0.95837	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|V	1026;1094;962;428;1026|412	.|.	ENSP00000262679:E1026X|.	E|G	-|-	1|2	0|0	NRD1|NRD1	52028885|52028885	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	7.287000|7.287000	0.78681|0.78681	2.882000|2.882000	0.98803|0.98803	0.655000|0.655000	0.94253|0.94253	GAG|GGA	C|0.999;T|0.000		0.527	OSBPL9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000022584.4		
AHCYL1	10768	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	110561173	110561173	+	Splice_Site	SNP	G	G	A			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr1:110561173G>A	ENST00000369799.5	+	13	1585		c.e13-1		AHCYL1_ENST00000359172.3_Splice_Site|AHCYL1_ENST00000393614.4_Splice_Site	NM_001242673.1|NM_001242674.1|NM_006621.5	NP_001229602.1|NP_001229603.1|NP_006612.2	O43865	SAHH2_HUMAN	adenosylhomocysteinase-like 1						mRNA polyadenylation (GO:0006378)|one-carbon metabolic process (GO:0006730)|positive regulation of sodium ion transport (GO:0010765)|protein export from nucleus (GO:0006611)|regulation of anion transport (GO:0044070)|regulation of ion transmembrane transporter activity (GO:0032412)|regulation of mRNA 3'-end processing (GO:0031440)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	adenosylhomocysteinase activity (GO:0004013)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)	18		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0259)|Colorectal(144;0.123)|all cancers(265;0.134)|Epithelial(280;0.141)|LUSC - Lung squamous cell carcinoma(189;0.143)		CTTCCTTTCAGACCAGCCTCC	0.498																																					.		.											.	AHCYL1-91	0			c.1219-1G>A						.						77.0	62.0	67.0					1																	110561173		2203	4300	6503	SO:0001630	splice_region_variant	10768	exon13			CTTTCAGACCAGC	U82761	CCDS818.1, CCDS55620.1	1p13	2014-06-12	2009-06-12		ENSG00000168710	ENSG00000168710			344	protein-coding gene	gene with protein product	"""inositol 1,4,5-trisphosphate receptor-binding protein"", ""protein phosphatase 1, regulatory subunit 78"""	607826	"""S-adenosylhomocysteine hydrolase-like 1"""			11904675, 16754674, 12525476	Standard	NM_006621		Approved	XPVKONA, IRBIT, PPP1R78	uc001dyx.3	O43865	OTTHUMG00000011652	ENST00000369799.5:c.1219-1G>A	1.37:g.110561173G>A		Somatic	35	0		WXS	Illumina HiSeq	Phase_I	39	16	NM_006621	0	0	0	0	0	B4E168|Q2TAJ6|Q502W8|Q5VSM0|Q6P171|Q96PK4|Q9UG84	Splice_Site	SNP	ENST00000369799.5	37	CCDS818.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.444478	0.83993	.	.	ENSG00000168710	ENST00000369799;ENST00000359172;ENST00000393614	.	.	.	5.42	5.42	0.78866	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2323	0.93845	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AHCYL1	110362696	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.869000	0.99810	2.541000	0.85698	0.655000	0.94253	.	.		0.498	AHCYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032243.1		Intron
SF3B4	10262	broad.mit.edu	37	1	149897857	149897857	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr1:149897857G>A	ENST00000271628.8	-	4	1368	c.784C>T	c.(784-786)Ccc>Tcc	p.P262S	MTMR11_ENST00000492824.1_5'Flank	NM_005850.4	NP_005841.1	Q15427	SF3B4_HUMAN	splicing factor 3b, subunit 4, 49kDa	262	Poly-Pro.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(1)	17	Breast(34;0.0009)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			GGTGGTGGGGGCATGGCTGGG	0.637																																					p.P262S													.	SF3B4-91	0			c.C784T						.						18.0	18.0	18.0					1																	149897857		2200	4298	6498	SO:0001583	missense	10262	exon4			GTGGGGGCATGGC	L35013	CCDS72900.1	1q21.2	2013-02-12	2002-08-29		ENSG00000143368	ENSG00000143368		"""RNA binding motif (RRM) containing"""	10771	protein-coding gene	gene with protein product		605593	"""splicing factor 3b, subunit 4, 49kD"""			7958871	Standard	NM_005850		Approved	SAP49, SF3b49, Hsh49	uc001etk.2	Q15427	OTTHUMG00000012208	ENST00000271628.8:c.784C>T	1.37:g.149897857G>A	ENSP00000271628:p.Pro262Ser	Somatic	34	0		WXS	Illumina HiSeq	Phase_I	44	4	NM_005850	0	0	58	58	0	Q5SZ63	Missense_Mutation	SNP	ENST00000271628.8	37	CCDS941.1	.	.	.	.	.	.	.	.	.	.	G	15.82	2.947232	0.53186	.	.	ENSG00000143368	ENST00000271628	T	0.29142	1.58	4.33	4.33	0.51752	.	0.000000	0.64402	D	0.000001	T	0.34745	0.0908	L	0.47016	1.485	0.58432	D	0.999994	D;P	0.63880	0.993;0.909	D;P	0.70227	0.968;0.641	T	0.02301	-1.1180	10	0.27082	T	0.32	.	14.0104	0.64493	0.0:0.0:1.0:0.0	.	262;262	Q53FG6;Q15427	.;SF3B4_HUMAN	S	262	ENSP00000271628:P262S	ENSP00000271628:P262S	P	-	1	0	SF3B4	148164481	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	4.536000	0.60636	2.387000	0.81309	0.462000	0.41574	CCC	.		0.637	SF3B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033753.1	NM_005850	
HRNR	388697	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	152188167	152188167	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr1:152188167A>G	ENST00000368801.2	-	3	6013	c.5938T>C	c.(5938-5940)Tat>Cat	p.Y1980H	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	1980					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCAGACTCATATGGGCCACGG	0.592																																					p.Y1980H		.											.	HRNR-93	0			c.T5938C						.						141.0	245.0	210.0					1																	152188167		2174	4288	6462	SO:0001583	missense	388697	exon3			ACTCATATGGGCC	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.5938T>C	1.37:g.152188167A>G	ENSP00000357791:p.Tyr1980His	Somatic	1429	1		WXS	Illumina HiSeq	Phase_I	1470	83	NM_001009931	0	0	1	1	0	Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	37	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	G	5.689	0.311642	0.10789	.	.	ENSG00000197915	ENST00000368801	T	0.01538	4.79	3.19	-1.26	0.09376	.	.	.	.	.	T	0.00241	0.0007	N	0.03050	-0.425	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33471	-0.9867	9	0.14656	T	0.56	.	3.9881	0.09525	0.3563:0.3518:0.2919:0.0	.	1980	Q86YZ3	HORN_HUMAN	H	1980	ENSP00000357791:Y1980H	ENSP00000357791:Y1980H	Y	-	1	0	HRNR	150454791	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.676000	0.05221	-0.112000	0.11979	-0.394000	0.06481	TAT	.		0.592	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868	
COPA	1314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	160305059	160305059	+	Silent	SNP	A	A	G			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr1:160305059A>G	ENST00000241704.7	-	4	511	c.282T>C	c.(280-282)gaT>gaC	p.D94D	COPA_ENST00000368069.3_Silent_p.D94D	NM_001098398.1|NM_004371.3	NP_001091868.1|NP_004362.2	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha	94					COPI coating of Golgi vesicle (GO:0048205)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|pancreatic juice secretion (GO:0030157)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(2)	46	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TGCGAATATAATCTAAGTGCC	0.388																																					p.D94D		.											.	COPA-92	0			c.T282C						.						65.0	58.0	61.0					1																	160305059		2203	4300	6503	SO:0001819	synonymous_variant	1314	exon4			AATATAATCTAAG	U24105	CCDS1202.1, CCDS41424.1	1q23.2	2014-01-30			ENSG00000122218	ENSG00000122218		"""WD repeat domain containing"", ""Endogenous ligands"""	2230	protein-coding gene	gene with protein product	"""proxenin"", ""xenin"""	601924				8647451	Standard	NM_004371		Approved	HEP-COP	uc001fvv.4	P53621	OTTHUMG00000033111	ENST00000241704.7:c.282T>C	1.37:g.160305059A>G		Somatic	35	0		WXS	Illumina HiSeq	Phase_I	28	14	NM_001098398	0	0	20	34	14	Q5T201|Q8IXZ9	Silent	SNP	ENST00000241704.7	37	CCDS1202.1																																																																																			.		0.388	COPA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080638.1	NM_004371	
RBM17	84991	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	6157469	6157469	+	Missense_Mutation	SNP	T	T	C	rs200401715		TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr10:6157469T>C	ENST00000446108.1	+	12	1800	c.1156T>C	c.(1156-1158)Ttc>Ctc	p.F386L	RBM17_ENST00000476706.1_3'UTR|RBM17_ENST00000379888.4_Missense_Mutation_p.F386L	NM_001145547.1	NP_001139019.1	Q96I25	SPF45_HUMAN	RNA binding motif protein 17	386					alternative mRNA splicing, via spliceosome (GO:0000380)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(3)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(2)|lung(4)|prostate(1)|urinary_tract(2)	19						AAAAGCATGTTTCTACAATTT	0.398																																					p.F386L		.											.	RBM17-90	0			c.T1156C						.						191.0	186.0	188.0					10																	6157469		2203	4300	6503	SO:0001583	missense	84991	exon12			GCATGTTTCTACA	AF083384	CCDS7077.1	10p15.1	2013-01-28			ENSG00000134453	ENSG00000134453		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	16944	protein-coding gene	gene with protein product	"""splicing factor 45kDa"""	606935				9731529	Standard	NM_032905		Approved	SPF45, MGC14439	uc001ijb.3	Q96I25	OTTHUMG00000017618	ENST00000446108.1:c.1156T>C	10.37:g.6157469T>C	ENSP00000388638:p.Phe386Leu	Somatic	203	0		WXS	Illumina HiSeq	Phase_I	186	84	NM_001145547	0	0	18	32	14	Q96GY6	Missense_Mutation	SNP	ENST00000446108.1	37	CCDS7077.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	T	28.4	4.917499	0.92249	.	.	ENSG00000134453	ENST00000379888;ENST00000446108	.	.	.	5.09	5.09	0.68999	Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	T	0.77525	0.4143	M	0.71296	2.17	0.80722	D	1	D	0.71674	0.998	D	0.77004	0.989	T	0.79112	-0.1937	9	0.51188	T	0.08	-11.255	15.189	0.73028	0.0:0.0:0.0:1.0	.	386	Q96I25	SPF45_HUMAN	L	386	.	ENSP00000369218:F386L	F	+	1	0	RBM17	6197475	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.290000	0.78711	2.038000	0.60285	0.533000	0.62120	TTC	T|1.000;C|0.000		0.398	RBM17-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046635.1	NM_032905	
NUDT5	11164	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	12226925	12226925	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr10:12226925C>G	ENST00000491614.1	-	3	489	c.94G>C	c.(94-96)Gaa>Caa	p.E32Q	NUDT5_ENST00000378927.3_Missense_Mutation_p.E32Q|NUDT5_ENST00000378937.3_Missense_Mutation_p.E32Q|NUDT5_ENST00000378940.3_Missense_Mutation_p.E32Q|NUDT5_ENST00000378952.3_5'UTR|NUDT5_ENST00000537776.1_Missense_Mutation_p.E32Q			Q9UKK9	NUDT5_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 5	32					D-ribose catabolic process (GO:0019303)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide metabolic process (GO:0009117)|ribonucleoside diphosphate catabolic process (GO:0009191)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)	ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)|magnesium ion binding (GO:0000287)|nucleoside-diphosphatase activity (GO:0017110)|snoRNA binding (GO:0030515)			breast(1)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)	8		Renal(717;0.228)				GTTGTTTTTTCAAGCTTGACC	0.313																																					p.E32Q		.											.	NUDT5-92	0			c.G94C						.						95.0	90.0	92.0					10																	12226925		2203	4299	6502	SO:0001583	missense	11164	exon3			TTTTTTCAAGCTT	AF155832	CCDS7089.1	10p14	2008-05-14			ENSG00000165609	ENSG00000165609		"""Nudix motif containing"""	8052	protein-coding gene	gene with protein product		609230				10373642	Standard	NM_014142		Approved	hYSAH1, YSA1H	uc001ilj.3	Q9UKK9	OTTHUMG00000017682	ENST00000491614.1:c.94G>C	10.37:g.12226925C>G	ENSP00000419628:p.Glu32Gln	Somatic	26	0		WXS	Illumina HiSeq	Phase_I	35	16	NM_014142	0	0	22	32	10	A8K516|Q6IAG0|Q9UH49	Missense_Mutation	SNP	ENST00000491614.1	37	CCDS7089.1	.	.	.	.	.	.	.	.	.	.	C	14.70	2.614095	0.46631	.	.	ENSG00000165609	ENST00000491614;ENST00000378929;ENST00000378937;ENST00000537776;ENST00000378940;ENST00000378927;ENST00000444732	T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92	5.87	5.87	0.94306	NUDIX hydrolase domain (1);NUDIX hydrolase domain-like (1);	0.044865	0.85682	D	0.000000	T	0.45377	0.1339	L	0.39514	1.22	0.45914	D	0.998752	D;D	0.65815	0.995;0.993	P;P	0.54889	0.763;0.647	T	0.08289	-1.0729	10	0.17832	T	0.49	-36.1269	13.3498	0.60595	0.0:0.9242:0.0:0.0758	.	32;32	A6NCQ0;Q9UKK9	.;NUDT5_HUMAN	Q	32	ENSP00000419628:E32Q;ENSP00000368219:E32Q;ENSP00000445116:E32Q;ENSP00000368222:E32Q;ENSP00000368209:E32Q	ENSP00000368209:E32Q	E	-	1	0	NUDT5	12266931	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.053000	0.57427	2.941000	0.99782	0.655000	0.94253	GAA	.		0.313	NUDT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046811.1		
HSPA14	51182	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	14896200	14896200	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr10:14896200T>A	ENST00000378372.3	+	9	1050	c.811T>A	c.(811-813)Tct>Act	p.S271T		NM_016299.2	NP_057383.2	Q0VDF9	HSP7E_HUMAN	heat shock 70kDa protein 14	271					'de novo' cotranslational protein folding (GO:0051083)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)			breast(4)|endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)	17						AGCGAAACATTCTTTGTCAAC	0.373																																					p.S271T		.											.	HSPA14-291	0			c.T811A						.						154.0	147.0	149.0					10																	14896200		2203	4300	6503	SO:0001583	missense	51182	exon9			AAACATTCTTTGT	AF112210	CCDS7103.1, CCDS60487.1	10p13	2011-09-02			ENSG00000187522	ENSG00000187522		"""Heat shock proteins / HSP70"""	29526	protein-coding gene	gene with protein product		610369				12477932	Standard	NM_016299		Approved	HSP70-4, HSP70L1	uc001ind.4	Q0VDF9	OTTHUMG00000017712	ENST00000378372.3:c.811T>A	10.37:g.14896200T>A	ENSP00000367623:p.Ser271Thr	Somatic	98	0		WXS	Illumina HiSeq	Phase_I	91	12	NM_016299	0	0	9	10	1	A8K8F8|B0YIY9|Q9P0X2|Q9UI07	Missense_Mutation	SNP	ENST00000378372.3	37	CCDS7103.1	.	.	.	.	.	.	.	.	.	.	T	4.451	0.083454	0.08533	.	.	ENSG00000187522	ENST00000378372	T	0.00949	5.51	5.53	4.37	0.52481	.	0.173267	0.52532	D	0.000061	T	0.00468	0.0015	N	0.01515	-0.825	0.80722	D	1	B	0.14438	0.01	B	0.17433	0.018	T	0.46803	-0.9165	10	0.02654	T	1	-8.9176	11.4861	0.50354	0.0:0.0:0.2868:0.7132	.	271	Q0VDF9	HSP7E_HUMAN	T	271	ENSP00000367623:S271T	ENSP00000367623:S271T	S	+	1	0	HSPA14	14936206	1.000000	0.71417	0.998000	0.56505	0.981000	0.71138	2.499000	0.45372	0.916000	0.36871	0.533000	0.62120	TCT	.		0.373	HSPA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046910.1	NM_016299	
FAM13C	220965	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	61112192	61112192	+	Silent	SNP	C	C	A			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr10:61112192C>A	ENST00000373868.2	-	3	249	c.162G>T	c.(160-162)ctG>ctT	p.L54L	FAM13C_ENST00000442566.3_Silent_p.L54L|FAM13C_ENST00000277705.6_Silent_p.L54L|FAM13C_ENST00000435852.2_Silent_p.L54L|FAM13C_ENST00000373867.3_5'UTR|FAM13C_ENST00000419214.2_Silent_p.L54L|FAM13C_ENST00000422313.2_Silent_p.L54L|FAM13C_ENST00000468840.2_5'UTR	NM_198215.3	NP_937858.2	Q8NE31	FA13C_HUMAN	family with sequence similarity 13, member C	54										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GCTCTTCTACCAGAGCCCCTG	0.502																																					p.L54L		.											.	FAM13C-70	0			c.G162T						.						30.0	33.0	32.0					10																	61112192		2203	4300	6503	SO:0001819	synonymous_variant	220965	exon3			TTCTACCAGAGCC	U79304	CCDS31207.1, CCDS44406.1, CCDS7255.1, CCDS53538.1	10q21	2009-09-15	2009-01-20	2009-01-20	ENSG00000148541	ENSG00000148541			19371	protein-coding gene	gene with protein product			"""family with sequence similarity 13, member C1"""	FAM13C1			Standard	NM_001001971		Approved		uc001jkn.3	Q8NE31	OTTHUMG00000018277	ENST00000373868.2:c.162G>T	10.37:g.61112192C>A		Somatic	26	0		WXS	Illumina HiSeq	Phase_I	37	13	NM_198215	0	0	0	0	0	B7ZB77|Q5T631|Q6P2M3|Q99787	Silent	SNP	ENST00000373868.2	37	CCDS7255.1																																																																																			.		0.502	FAM13C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048162.2		
CPEB3	22849	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	93999658	93999658	+	Silent	SNP	A	A	C			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr10:93999658A>C	ENST00000265997.4	-	2	622	c.450T>G	c.(448-450)acT>acG	p.T150T	CPEB3_ENST00000412050.4_Silent_p.T150T	NM_014912.4	NP_055727.3	Q8NE35	CPEB3_HUMAN	cytoplasmic polyadenylation element binding protein 3	150	Pro-rich.				3'-UTR-mediated mRNA destabilization (GO:0061158)|cellular response to amino acid stimulus (GO:0071230)|long-term memory (GO:0007616)|negative regulation of cytoplasmic translational elongation (GO:1900248)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translation (GO:0017148)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of mRNA polyadenylation (GO:1900365)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|regulation of dendritic spine development (GO:0060998)|regulation of synaptic plasticity (GO:0048167)|translation (GO:0006412)	apical dendrite (GO:0097440)|CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuron projection (GO:0043005)|nucleus (GO:0005634)|synapse (GO:0045202)	mRNA 3'-UTR AU-rich region binding (GO:0035925)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|translation factor activity, nucleic acid binding (GO:0008135)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(5)|skin(2)|upper_aerodigestive_tract(2)	18		Colorectal(252;0.0869)				GCGGGGAGAAAGTGCCTCCGA	0.677																																					p.T150T		.											.	CPEB3-90	0			c.T450G						.						39.0	36.0	37.0					10																	93999658		2203	4300	6503	SO:0001819	synonymous_variant	22849	exon2			GGAGAAAGTGCCT	AB023157	CCDS31246.1, CCDS53553.1	10q23.33	2013-02-12			ENSG00000107864	ENSG00000107864		"""RNA binding motif (RRM) containing"""	21746	protein-coding gene	gene with protein product		610606				10231032, 12672660	Standard	NM_014912		Approved	KIAA0940	uc001khw.2	Q8NE35	OTTHUMG00000018756	ENST00000265997.4:c.450T>G	10.37:g.93999658A>C		Somatic	38	0		WXS	Illumina HiSeq	Phase_I	30	9	NM_014912	0	0	0	2	2	Q5T389|Q9NQJ7|Q9Y2E9	Silent	SNP	ENST00000265997.4	37	CCDS31246.1																																																																																			.		0.677	CPEB3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049387.2	NM_014912	
TLL2	7093	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	98145849	98145849	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr10:98145849G>C	ENST00000357947.3	-	15	2201	c.1976C>G	c.(1975-1977)tCc>tGc	p.S659C		NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	659	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		AAACTGAAGGGAGATCCGGTA	0.517																																					p.S659C		.											.	TLL2-93	0			c.C1976G						.						99.0	94.0	95.0					10																	98145849		2203	4300	6503	SO:0001583	missense	7093	exon15			TGAAGGGAGATCC	AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.1976C>G	10.37:g.98145849G>C	ENSP00000350630:p.Ser659Cys	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	71	14	NM_012465	0	0	0	0	0	A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Missense_Mutation	SNP	ENST00000357947.3	37	CCDS7449.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.617588	0.87359	.	.	ENSG00000095587	ENST00000357947	T	0.19669	2.13	4.77	4.77	0.60923	CUB (5);	0.000000	0.45126	D	0.000385	T	0.49406	0.1555	M	0.80332	2.49	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.48269	-0.9050	10	0.42905	T	0.14	.	17.3218	0.87238	0.0:0.0:1.0:0.0	.	659	Q9Y6L7	TLL2_HUMAN	C	659	ENSP00000350630:S659C	ENSP00000350630:S659C	S	-	2	0	TLL2	98135839	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.601000	0.98297	2.651000	0.90000	0.585000	0.79938	TCC	.		0.517	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049608.1		
GBF1	8729	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	104139057	104139057	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr10:104139057A>G	ENST00000369983.3	+	34	4768	c.4508A>G	c.(4507-4509)cAc>cGc	p.H1503R		NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1	1503					COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		GACCTGATGCACACCCTGCAC	0.587																																					p.H1503R		.											.	GBF1-91	0			c.A4508G						.						71.0	64.0	66.0					10																	104139057		2203	4300	6503	SO:0001583	missense	8729	exon34			TGATGCACACCCT	D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.4508A>G	10.37:g.104139057A>G	ENSP00000359000:p.His1503Arg	Somatic	128	0		WXS	Illumina HiSeq	Phase_I	107	13	NM_004193	0	0	31	38	7	Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Missense_Mutation	SNP	ENST00000369983.3	37	CCDS7533.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.132469	0.77662	.	.	ENSG00000107862	ENST00000369983	T	0.12039	2.72	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.36524	0.0970	M	0.71581	2.175	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.981	D;D;D	0.69824	0.959;0.961;0.966	T	0.12889	-1.0530	10	0.72032	D	0.01	-12.8919	15.3201	0.74115	1.0:0.0:0.0:0.0	.	1499;1499;1503	Q149P1;Q149P0;Q92538	.;.;GBF1_HUMAN	R	1503	ENSP00000359000:H1503R	ENSP00000359000:H1503R	H	+	2	0	GBF1	104129047	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.097000	0.94193	2.200000	0.70718	0.459000	0.35465	CAC	.		0.587	GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050051.1		
OR5M3	219482	broad.mit.edu	37	11	56237295	56237295	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr11:56237295G>A	ENST00000312240.2	-	1	719	c.679C>T	c.(679-681)Cgc>Tgc	p.R227C		NM_001004742.2	NP_001004742.2	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M, member 3	227						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(15)|ovary(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	37	Esophageal squamous(21;0.00448)					TCTGCTGAGCGCATTCGCAGA	0.418																																					p.R227C													.	OR5M3-70	0			c.C679T						.						62.0	60.0	61.0					11																	56237295		2201	4292	6493	SO:0001583	missense	219482	exon1			CTGAGCGCATTCG	AB065746	CCDS31532.1	11q11	2012-08-09			ENSG00000174937	ENSG00000174937		"""GPCR / Class A : Olfactory receptors"""	14806	protein-coding gene	gene with protein product							Standard	NM_001004742		Approved		uc010rjk.2	Q8NGP4	OTTHUMG00000166875	ENST00000312240.2:c.679C>T	11.37:g.56237295G>A	ENSP00000312208:p.Arg227Cys	Somatic	86	0		WXS	Illumina HiSeq	Phase_I	97	4	NM_001004742	0	0	0	0	0	B2RNM7|Q6IEW4|Q96RC0	Missense_Mutation	SNP	ENST00000312240.2	37	CCDS31532.1	.	.	.	.	.	.	.	.	.	.	G	4.920	0.170929	0.09391	.	.	ENSG00000174937	ENST00000312240	T	0.40225	1.04	5.08	4.17	0.49024	GPCR, rhodopsin-like superfamily (1);	0.719989	0.11980	N	0.510873	T	0.46600	0.1401	M	0.83223	2.63	0.09310	N	1	B	0.11235	0.004	B	0.13407	0.009	T	0.46386	-0.9195	10	0.59425	D	0.04	0.0056	7.8533	0.29468	0.1885:0.0:0.8115:0.0	.	227	Q8NGP4	OR5M3_HUMAN	C	227	ENSP00000312208:R227C	ENSP00000312208:R227C	R	-	1	0	OR5M3	55993871	0.000000	0.05858	0.100000	0.21137	0.125000	0.20455	0.066000	0.14489	1.122000	0.41944	0.549000	0.68633	CGC	.		0.418	OR5M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391639.1	NM_001004742	
PGA3	643834	hgsc.bcm.edu	37	11	60975055	60975055	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr11:60975055A>G	ENST00000325558.6	+	4	609	c.424A>G	c.(424-426)Atg>Gtg	p.M142V	PGA3_ENST00000543125.1_5'Flank	NM_001079807.1	NP_001073275.1	P0DJD8	PEPA3_HUMAN	pepsinogen 3, group I (pepsinogen A)	142					digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(1)|lung(1)|ovary(1)|skin(2)	5						CACCGGCAGCATGACAGGCAT	0.587																																					p.M142V		.											.	PGA3-24	0			c.A424G						.						1.0	1.0	1.0					11																	60975055		814	1066	1880	SO:0001583	missense	643834	exon4			GGCAGCATGACAG	AL832946	CCDS31574.1	11q13	2006-12-13			ENSG00000229859	ENSG00000229859	3.4.23.1		8885	protein-coding gene	gene with protein product		169710				6300126	Standard	NM_001079807		Approved		uc001nqx.3	P0DJD8	OTTHUMG00000168071	ENST00000325558.6:c.424A>G	11.37:g.60975055A>G	ENSP00000322192:p.Met142Val	Somatic	598	0		WXS	Illumina HiSeq	Phase_I	575	67	NM_001079807	0	0	0	0	0	A8K749|B2R7D6|B7ZW75|P00790|Q7M4R0|Q8N1E3	Missense_Mutation	SNP	ENST00000325558.6	37	CCDS31574.1	.	.	.	.	.	.	.	.	.	.	A	14.42	2.528985	0.44969	.	.	ENSG00000229859	ENST00000325558;ENST00000439843;ENST00000543609;ENST00000543349;ENST00000543505	T;T;T	0.55052	0.54;0.54;0.54	3.59	2.46	0.29980	.	0.055879	0.64402	D	0.000002	T	0.36110	0.0955	N	0.25286	0.73	0.80722	D	1	B	0.29253	0.239	B	0.31191	0.125	T	0.15954	-1.0419	10	0.49607	T	0.09	.	8.7363	0.34530	0.9076:0.0:0.0924:0.0	.	142	F8WAB4	.	V	142;142;1;69;69	ENSP00000322192:M142V;ENSP00000442525:M69V;ENSP00000443732:M69V	ENSP00000322192:M142V	M	+	1	0	PGA3	60731631	1.000000	0.71417	0.104000	0.21259	0.506000	0.33950	4.784000	0.62411	0.587000	0.29643	0.254000	0.18369	ATG	.		0.587	PGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397955.2	NM_001079807	
ALDH3B1	221	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	67787234	67787234	+	Silent	SNP	A	A	T			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr11:67787234A>T	ENST00000539229.1	+	7	644	c.528A>T	c.(526-528)ctA>ctT	p.L176L	ALDH3B1_ENST00000342456.6_Silent_p.L140L|ALDH3B1_ENST00000007633.8_Silent_p.L176L|ALDH3B1_ENST00000434449.1_3'UTR|ALDH3B1_ENST00000316367.6_Silent_p.L176L	NM_001161473.1	NP_001154945.1	P43353	AL3B1_HUMAN	aldehyde dehydrogenase 3 family, member B1	177					alcohol metabolic process (GO:0006066)|aldehyde catabolic process (GO:0046185)|cellular response to oxidative stress (GO:0034599)|ethanol catabolic process (GO:0006068)|lipid metabolic process (GO:0006629)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	3-chloroallyl aldehyde dehydrogenase activity (GO:0004028)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)										GGCAGCTGCTAGAGCACAGGT	0.657																																					.													.	.	0			.						.						97.0	111.0	107.0					11																	67787234		2200	4294	6494	SO:0001819	synonymous_variant	221	.			GCTGCTAGAGCAC	U10868	CCDS73335.1, CCDS73336.1	11q13	2010-04-27			ENSG00000006534	ENSG00000006534	1.2.1.5	"""Aldehyde dehydrogenases"""	410	protein-coding gene	gene with protein product	"""aldehyde dehydrogenase 7"", ""aldehyde dehydrogenase 3B1"""	600466		ALDH7		9161417, 7828891	Standard	NM_000694		Approved		uc001ona.3	P43353	OTTHUMG00000154910	ENST00000539229.1:c.528A>T	11.37:g.67787234A>T		Somatic	216	1		WXS	Illumina HiSeq	Phase_I	199	82	.	0	0	32	47	15	A3FMP9|Q53XL5|Q8N515|Q96CK8	Silent	SNP	ENST00000539229.1	37																																																																																				.		0.657	ALDH3B1-204	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_000694	
RAB38	23682	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	87908439	87908439	+	Silent	SNP	G	G	A			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr11:87908439G>A	ENST00000243662.6	-	1	196	c.114C>T	c.(112-114)taC>taT	p.Y38Y	MIR3166_ENST00000577344.1_RNA	NM_022337.2	NP_071732.1	P57729	RAB38_HUMAN	RAB38, member RAS oncogene family	38					endosome to melanosome transport (GO:0035646)|GTP catabolic process (GO:0006184)|melanosome organization (GO:0032438)|phagosome acidification (GO:0090383)|platelet dense granule organization (GO:0060155)|protein localization to membrane (GO:0072657)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|early endosome (GO:0005769)|melanosome (GO:0042470)|membrane (GO:0016020)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	AP-1 adaptor complex binding (GO:0035650)|AP-3 adaptor complex binding (GO:0035651)|GTP binding (GO:0005525)|GTP-dependent protein binding (GO:0030742)|GTPase activity (GO:0003924)|protein complex binding (GO:0032403)			large_intestine(2)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				TTGTGGCCCGGTAGTGCGAAG	0.612																																					p.Y38Y		.											.	RAB38-290	0			c.C114T						.						109.0	78.0	88.0					11																	87908439		2201	4299	6500	SO:0001819	synonymous_variant	23682	exon1			GGCCCGGTAGTGC	AF235022	CCDS8281.1	11q14	2008-05-14			ENSG00000123892	ENSG00000123892		"""RAB, member RAS oncogene"""	9776	protein-coding gene	gene with protein product		606281				10910072	Standard	NM_022337		Approved	NY-MEL-1	uc001pcj.2	P57729	OTTHUMG00000167288	ENST00000243662.6:c.114C>T	11.37:g.87908439G>A		Somatic	71	0		WXS	Illumina HiSeq	Phase_I	53	20	NM_022337	0	0	0	0	0	Q53XK7	Silent	SNP	ENST00000243662.6	37	CCDS8281.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.90|19.90	3.912749|3.912749	0.72983|0.72983	.|.	.|.	ENSG00000123892|ENSG00000123892	ENST00000531138|ENST00000526372	.|.	.|.	.|.	5.2|5.2	5.2|5.2	0.72013|0.72013	.|.	.|.	.|.	.|.	.|.	T|T	0.74846|0.74846	0.3770|0.3770	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.73173|0.73173	-0.4066|-0.4066	4|4	.|.	.|.	.|.	-2.7885|-2.7885	18.9316|18.9316	0.92568|0.92568	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	S|I	55|55	.|.	.|.	P|T	-|-	1|2	0|0	RAB38|RAB38	87548087|87548087	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	6.504000|6.504000	0.73704|0.73704	2.691000|2.691000	0.91804|0.91804	0.655000|0.655000	0.94253|0.94253	CCG|ACC	.		0.612	RAB38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394015.2		
NXPE4	54827	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	114450961	114450961	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr11:114450961C>T	ENST00000375478.3	-	5	1172	c.992G>A	c.(991-993)aGt>aAt	p.S331N	NXPE4_ENST00000424261.2_Missense_Mutation_p.S47N	NM_001077639.1	NP_001071107.1	Q6UWF7	NXPE4_HUMAN	neurexophilin and PC-esterase domain family, member 4	331						extracellular vesicular exosome (GO:0070062)											TGTAGCCAAACTACAGGAGAC	0.443																																					p.S331N		.											.	.	0			c.G992A						.						187.0	175.0	179.0					11																	114450961		1880	4122	6002	SO:0001583	missense	54827	exon5			GCCAAACTACAGG	AK000134	CCDS41718.1, CCDS44737.1	11q23.3	2012-06-14	2012-06-11	2012-06-11	ENSG00000137634	ENSG00000137634			23117	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 33"", ""family with sequence similarity 55, member D"""	C11orf33, FAM55D		20056006	Standard	NM_017678		Approved	FLJ20127	uc001ppc.3	Q6UWF7	OTTHUMG00000168291	ENST00000375478.3:c.992G>A	11.37:g.114450961C>T	ENSP00000364627:p.Ser331Asn	Somatic	123	0		WXS	Illumina HiSeq	Phase_I	134	54	NM_001077639	0	0	0	0	0	Q6QDB4|Q9NXP5	Missense_Mutation	SNP	ENST00000375478.3	37	CCDS41718.1	.	.	.	.	.	.	.	.	.	.	C	7.005	0.555720	0.13436	.	.	ENSG00000137634	ENST00000424261;ENST00000375478	T;T	0.13901	2.55;2.81	5.31	-0.797	0.10909	.	0.305202	0.31519	N	0.007506	T	0.07098	0.0180	L	0.40543	1.245	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.36553	-0.9743	10	0.09338	T	0.73	.	2.9753	0.05935	0.3243:0.2745:0.0:0.4012	.	331	Q6UWF7	FA55D_HUMAN	N	47;331	ENSP00000401503:S47N;ENSP00000364627:S331N	ENSP00000364627:S331N	S	-	2	0	FAM55D	113956171	0.159000	0.22864	0.003000	0.11579	0.936000	0.57629	0.469000	0.22067	0.168000	0.19655	0.655000	0.94253	AGT	.		0.443	NXPE4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399179.1	NM_017678	
DSCAML1	57453	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	117308640	117308640	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr11:117308640T>C	ENST00000321322.6	-	25	4584	c.4583A>G	c.(4582-4584)gAg>gGg	p.E1528G	DSCAML1_ENST00000527706.1_Missense_Mutation_p.E1258G	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1468	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		CTCGATGATCTCGCTGATGCG	0.657																																					p.E1528G		.											.	DSCAML1-159	0			c.A4583G						.						80.0	62.0	68.0					11																	117308640		2201	4296	6497	SO:0001583	missense	57453	exon25			ATGATCTCGCTGA		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.4583A>G	11.37:g.117308640T>C	ENSP00000315465:p.Glu1528Gly	Somatic	39	0		WXS	Illumina HiSeq	Phase_I	28	12	NM_020693	0	0	1	2	1	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	37	CCDS8384.1	.	.	.	.	.	.	.	.	.	.	T	17.75	3.465316	0.63513	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.56444	0.46;0.46	4.18	4.18	0.49190	Fibronectin, type III (2);Immunoglobulin-like fold (1);	.	.	.	.	T	0.60170	0.2248	M	0.86740	2.835	0.80722	D	1	B	0.18461	0.028	B	0.24394	0.053	T	0.65878	-0.6061	9	0.72032	D	0.01	.	13.7305	0.62785	0.0:0.0:0.0:1.0	.	1468	Q8TD84	DSCL1_HUMAN	G	1258;1528;1235	ENSP00000434335:E1258G;ENSP00000315465:E1528G	ENSP00000315465:E1528G	E	-	2	0	DSCAML1	116813850	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.785000	0.85724	1.878000	0.54408	0.454000	0.30748	GAG	.		0.657	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693	
ARF3	377	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	49334777	49334777	+	Silent	SNP	T	T	C			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr12:49334777T>C	ENST00000256682.4	-	2	436	c.102A>G	c.(100-102)ctA>ctG	p.L34L	RP11-302B13.5_ENST00000398092.4_Silent_p.L34L|AC073610.5_ENST00000537495.1_5'Flank|ARF3_ENST00000541967.1_5'Flank|ARF3_ENST00000541959.1_Silent_p.L34L|ARF3_ENST00000447318.2_Silent_p.L34L	NM_001659.2	NP_001650.1	P61204	ARF3_HUMAN	ADP-ribosylation factor 3	34					GTP catabolic process (GO:0006184)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|lung(2)|skin(1)	4						TCAGCTTGTATAGGATGGTGG	0.552																																					p.L34L	Pancreas(189;1862 2134 4419 30933 49364)	.											.	ARF3-227	0			c.A102G						.						246.0	205.0	219.0					12																	49334777		2203	4300	6503	SO:0001819	synonymous_variant	377	exon2			CTTGTATAGGATG	M74491	CCDS8774.1	12q13.12	2013-01-22			ENSG00000134287	ENSG00000134287		"""ADP-ribosylation factors"""	654	protein-coding gene	gene with protein product	"""small GTP binding protein"""	103190				8661066	Standard	NM_001659		Approved		uc001rsr.2	P61204	OTTHUMG00000168080	ENST00000256682.4:c.102A>G	12.37:g.49334777T>C		Somatic	228	0		WXS	Illumina HiSeq	Phase_I	295	98	NM_001659	0	0	0	0	0	A8K6G8|B7ZB63|P16587	Silent	SNP	ENST00000256682.4	37	CCDS8774.1																																																																																			.		0.552	ARF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258242.2	NM_001659	
KCNH3	23416	broad.mit.edu	37	12	49951572	49951572	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr12:49951572G>A	ENST00000257981.6	+	15	3348	c.3088G>A	c.(3088-3090)Gca>Aca	p.A1030T	MCRS1_ENST00000547182.1_5'Flank	NM_012284.1	NP_036416.1	Q9ULD8	KCNH3_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 3	1030	Pro-rich.				potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36						GACTGGGCCCGCAGAGCCTGT	0.682																																					p.A1030T													.	KCNH3-90	0			c.G3088A						.						23.0	25.0	24.0					12																	49951572		2203	4300	6503	SO:0001583	missense	23416	exon15			GGGCCCGCAGAGC	AB022696	CCDS8786.1	12q13	2012-07-05				ENSG00000135519		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6252	protein-coding gene	gene with protein product		604527				10455180, 16382104	Standard	NM_012284		Approved	Kv12.2, BEC1, elk2	uc001ruh.1	Q9ULD8	OTTHUMG00000169517	ENST00000257981.6:c.3088G>A	12.37:g.49951572G>A	ENSP00000257981:p.Ala1030Thr	Somatic	82	1		WXS	Illumina HiSeq	Phase_I	84	4	NM_012284	0	0	1	1	0	Q9UQ06	Missense_Mutation	SNP	ENST00000257981.6	37	CCDS8786.1	.	.	.	.	.	.	.	.	.	.	C	16.40	3.113917	0.56398	.	.	ENSG00000135519	ENST00000257981	D	0.98617	-5.03	5.02	2.2	0.27929	.	0.179966	0.27340	N	0.019813	D	0.92437	0.7599	N	0.08118	0	0.35870	D	0.828135	B	0.02656	0.0	B	0.01281	0.0	D	0.84384	0.0551	10	0.19590	T	0.45	.	2.103	0.03684	0.1596:0.5137:0.1544:0.1723	.	1030	Q9ULD8	KCNH3_HUMAN	T	1030	ENSP00000257981:A1030T	ENSP00000257981:A1030T	A	+	1	0	KCNH3	48237839	0.025000	0.19082	0.264000	0.24511	0.986000	0.74619	-0.005000	0.12855	0.042000	0.15717	-0.216000	0.12614	GCA	.		0.682	KCNH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404571.2	NM_012284	
SYNE2	23224	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	64633956	64633956	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr14:64633956T>A	ENST00000344113.4	+	91	16823	c.16611T>A	c.(16609-16611)caT>caA	p.H5537Q	SYNE2_ENST00000554584.1_Missense_Mutation_p.H5412Q|SYNE2_ENST00000394768.2_Missense_Mutation_p.H1922Q|SYNE2_ENST00000358025.3_Missense_Mutation_p.H5537Q|SYNE2_ENST00000555002.1_Missense_Mutation_p.H2171Q|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000357395.3_Missense_Mutation_p.H1922Q	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	5537					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AATAGAATCATGTGCTGGCAC	0.378																																					p.H5537Q		.											.	SYNE2-164	0			c.T16611A						.						46.0	47.0	46.0					14																	64633956		2203	4300	6503	SO:0001583	missense	23224	exon91			GAATCATGTGCTG	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.16611T>A	14.37:g.64633956T>A	ENSP00000341781:p.His5537Gln	Somatic	29	0		WXS	Illumina HiSeq	Phase_I	51	14	NM_182914	0	0	0	0	0	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	37	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	T	3.587	-0.084487	0.07097	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768	T;T;T;T;T;T	0.55234	0.84;4.13;0.83;0.53;4.19;4.13	5.78	-2.01	0.07410	.	0.246206	0.28241	N	0.016071	T	0.32224	0.0822	L	0.39245	1.2	0.58432	D	0.999999	B;B;B;B	0.25772	0.004;0.112;0.008;0.134	B;B;B;B	0.26864	0.007;0.032;0.011;0.074	T	0.04053	-1.0981	10	0.17369	T	0.5	.	3.6697	0.08269	0.1137:0.4232:0.1908:0.2723	.	1922;5412;5537;5537	Q8WXH0-7;G3V5X4;Q8WXH0;Q8WXH0-2	.;.;SYNE2_HUMAN;.	Q	5537;1922;5537;5412;5418;2171;1922	ENSP00000350719:H5537Q;ENSP00000349969:H1922Q;ENSP00000341781:H5537Q;ENSP00000452570:H5412Q;ENSP00000450831:H2171Q;ENSP00000378249:H1922Q	ENSP00000261678:H5418Q	H	+	3	2	SYNE2	63703709	0.000000	0.05858	0.820000	0.32676	0.932000	0.56968	-3.318000	0.00514	-0.265000	0.09352	0.533000	0.62120	CAT	.		0.378	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
FBLN5	10516	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	92349359	92349359	+	Silent	SNP	G	G	T			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr14:92349359G>T	ENST00000342058.4	-	8	1394	c.801C>A	c.(799-801)ggC>ggA	p.G267G	FBLN5_ENST00000267620.10_Silent_p.G308G|FBLN5_ENST00000556154.1_Silent_p.G272G	NM_006329.3	NP_006320.2	Q9UBX5	FBLN5_HUMAN	fibulin 5	267	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell-matrix adhesion (GO:0007160)|elastic fiber assembly (GO:0048251)|extracellular matrix organization (GO:0030198)|protein localization to cell surface (GO:0034394)|regulation of cell growth (GO:0001558)|regulation of removal of superoxide radicals (GO:2000121)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein C-terminus binding (GO:0008022)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(11)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	28		all_cancers(154;0.0722)				AGAAGTATGTGCCGGGCTGGT	0.562																																					p.G267G		.											.	FBLN5-134	0			c.C801A						.						140.0	120.0	126.0					14																	92349359		2203	4300	6503	SO:0001819	synonymous_variant	10516	exon8			GTATGTGCCGGGC	AJ133490	CCDS9898.1	14q31	2014-09-17				ENSG00000140092		"""Fibulins"""	3602	protein-coding gene	gene with protein product		604580				10640802	Standard	NM_006329		Approved	EVEC, UP50, DANCE, ARMD3	uc001xzx.4	Q9UBX5		ENST00000342058.4:c.801C>A	14.37:g.92349359G>T		Somatic	97	0		WXS	Illumina HiSeq	Phase_I	93	39	NM_006329	0	0	6	7	1	O75966|Q6IAL4|Q6UWA3	Silent	SNP	ENST00000342058.4	37	CCDS9898.1																																																																																			.		0.562	FBLN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411787.1		
VPS39	23339	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	42462024	42462024	+	Silent	SNP	G	G	T			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr15:42462024G>T	ENST00000348544.4	-	13	1163	c.1164C>A	c.(1162-1164)ccC>ccA	p.P388P	VPS39_ENST00000318006.5_Silent_p.P377P			Q96JC1	VPS39_HUMAN	vacuolar protein sorting 39 homolog (S. cerevisiae)	388					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	endosome (GO:0005768)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	small GTPase regulator activity (GO:0005083)			breast(2)|kidney(5)|large_intestine(4)|lung(8)|ovary(1)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_cancers(109;6.78e-16)|all_epithelial(112;1.81e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;3.05e-06)		TGTAGTCTGTGGGCAGCAGGT	0.493																																					p.P377P		.											.	VPS39-229	0			c.C1131A						.						110.0	104.0	106.0					15																	42462024		2203	4299	6502	SO:0001819	synonymous_variant	23339	exon12			GTCTGTGGGCAGC	AF280814	CCDS10083.1, CCDS73710.1	15q14	2008-02-05	2006-12-19		ENSG00000166887	ENSG00000166887			20593	protein-coding gene	gene with protein product		612188	"""vacuolar protein sorting 39 (yeast)"""			11448994	Standard	XM_005254259		Approved	KIAA0770, VAM6	uc001zpc.3	Q96JC1	OTTHUMG00000130467	ENST00000348544.4:c.1164C>A	15.37:g.42462024G>T		Somatic	89	0		WXS	Illumina HiSeq	Phase_I	73	33	NM_015289	0	0	16	26	10	O94869|Q71SQ6|Q7Z3V3|Q96B93|Q96RM0	Silent	SNP	ENST00000348544.4	37	CCDS10083.1																																																																																			.		0.493	VPS39-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000420472.1	NM_015289	
HYKK	123688	hgsc.bcm.edu;broad.mit.edu	37	15	78807316	78807316	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr15:78807316G>A	ENST00000569878.1	+	2	344	c.344G>A	c.(343-345)gGc>gAc	p.G115D	HYKK_ENST00000388988.4_Missense_Mutation_p.G115D|HYKK_ENST00000360519.3_Missense_Mutation_p.G115D|HYKK_ENST00000408962.2_Missense_Mutation_p.G115D|HYKK_ENST00000566332.1_Missense_Mutation_p.G115D|HYKK_ENST00000563233.1_Missense_Mutation_p.G115D			A2RU49	HYKK_HUMAN	hydroxylysine kinase	115						cytoplasm (GO:0005737)	hydroxylysine kinase activity (GO:0047992)										TTAGATAGTGGCTCTGAAATC	0.378																																					p.G115D		.											.	AGPHD1-90	0			c.G344A						.						37.0	34.0	35.0					15																	78807316		1823	4075	5898	SO:0001583	missense	123688	exon3			ATAGTGGCTCTGA	BC132753, BC144383, BM045979	CCDS42063.1, CCDS45318.1	15q25.1	2013-06-11	2013-06-11	2013-06-11	ENSG00000188266	ENSG00000188266	2.7.1.81		34403	protein-coding gene	gene with protein product	"""5-hydroxylysine kinase"""	614681	"""aminoglycoside phosphotransferase domain containing 1"""	AGPHD1		18780872, 22241472	Standard	NM_001013619		Approved	LOC123688	uc010unc.2	A2RU49		ENST00000569878.1:c.344G>A	15.37:g.78807316G>A	ENSP00000455459:p.Gly115Asp	Somatic	29	0		WXS	Illumina HiSeq	Phase_I	21	6	NM_001013619	0	0	0	0	0	B7ZMA5|F8W6X5|Q6ZTN0	Missense_Mutation	SNP	ENST00000569878.1	37	CCDS42063.1	.	.	.	.	.	.	.	.	.	.	G	15.22	2.768497	0.49680	.	.	ENSG00000188266	ENST00000408962;ENST00000388988;ENST00000360519	.	.	.	5.72	4.79	0.61399	Aminoglycoside phosphotransferase (1);Protein kinase-like domain (1);	0.054660	0.64402	D	0.000001	T	0.61527	0.2354	M	0.69823	2.125	0.53688	D	0.999975	B;B	0.29301	0.002;0.241	B;B	0.31245	0.02;0.126	T	0.62378	-0.6867	9	0.51188	T	0.08	-16.0178	11.2908	0.49250	0.0692:0.1272:0.8036:0.0	.	115;115	A2RU49;A2RU49-3	AGPD1_HUMAN;.	D	115	.	ENSP00000353710:G115D	G	+	2	0	AGPHD1	76594371	1.000000	0.71417	0.709000	0.30452	0.972000	0.66771	4.688000	0.61715	1.395000	0.46643	0.561000	0.74099	GGC	.		0.378	HYKK-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435834.1	NM_001013619	
POLG	5428	hgsc.bcm.edu;broad.mit.edu	37	15	89865055	89865055	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr15:89865055T>C	ENST00000268124.5	-	16	2843	c.2510A>G	c.(2509-2511)tAt>tGt	p.Y837C	POLG_ENST00000442287.2_Missense_Mutation_p.Y837C	NM_001126131.1|NM_002693.2	NP_001119603.1|NP_002684.1	P54098	DPOG1_HUMAN	polymerase (DNA directed), gamma	837					aging (GO:0007568)|base-excision repair, gap-filling (GO:0006287)|cell death (GO:0008219)|DNA metabolic process (GO:0006259)|DNA-dependent DNA replication (GO:0006261)|mitochondrial DNA replication (GO:0006264)	extracellular vesicular exosome (GO:0070062)|gamma DNA polymerase complex (GO:0005760)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|exonuclease activity (GO:0004527)|protease binding (GO:0002020)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(3)|urinary_tract(2)	33	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)			GATGGCCCCATAGAGGCCTTC	0.627								DNA polymerases (catalytic subunits)																													p.Y837C	Colon(73;648 1203 11348 18386 27782)	.											.	POLG-228	0			c.A2510G						.						58.0	60.0	59.0					15																	89865055		2200	4299	6499	SO:0001583	missense	5428	exon16			GCCCCATAGAGGC	X98093	CCDS10350.1	15q24	2014-09-17			ENSG00000140521	ENSG00000140521		"""DNA polymerases"""	9179	protein-coding gene	gene with protein product		174763				9465903	Standard	NM_002693		Approved	POLG1, POLGA	uc002bnr.4	P54098	OTTHUMG00000149646	ENST00000268124.5:c.2510A>G	15.37:g.89865055T>C	ENSP00000268124:p.Tyr837Cys	Somatic	112	0		WXS	Illumina HiSeq	Phase_I	111	6	NM_002693	0	0	20	22	2	Q8NFM2|Q92515	Missense_Mutation	SNP	ENST00000268124.5	37	CCDS10350.1	.	.	.	.	.	.	.	.	.	.	T	15.12	2.739682	0.49045	.	.	ENSG00000140521	ENST00000268124;ENST00000442287	D;D	0.98400	-4.91;-4.91	5.37	4.24	0.50183	DNA-directed DNA polymerase, family A, palm domain (1);	0.113436	0.64402	N	0.000007	D	0.97040	0.9033	M	0.70595	2.14	0.80722	D	1	B	0.29301	0.241	B	0.33042	0.157	D	0.95347	0.8443	10	0.56958	D	0.05	-8.8443	10.8623	0.46833	0.0:0.0742:0.0:0.9258	.	837	P54098	DPOG1_HUMAN	C	837	ENSP00000268124:Y837C;ENSP00000399851:Y837C	ENSP00000268124:Y837C	Y	-	2	0	POLG	87666059	1.000000	0.71417	0.862000	0.33874	0.941000	0.58515	4.816000	0.62642	0.893000	0.36288	0.459000	0.35465	TAT	.		0.627	POLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000312854.2	NM_002693	
NOL3	8996	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	67208730	67208730	+	Silent	SNP	G	G	A			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr16:67208730G>A	ENST00000568146.1	+	3	545	c.492G>A	c.(490-492)cgG>cgA	p.R164R	KIAA0895L_ENST00000563831.2_5'Flank|NOL3_ENST00000268605.7_Missense_Mutation_p.E168K|NOL3_ENST00000432069.2_Missense_Mutation_p.E168K|NOL3_ENST00000564053.1_Missense_Mutation_p.E230K			O60936	NOL3_HUMAN	nucleolar protein 3 (apoptosis repressor with CARD domain)	164					apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of gene expression (GO:0010468)|response to hypoxia (GO:0001666)|response to injury involved in regulation of muscle adaptation (GO:0014876)|RNA splicing (GO:0008380)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|sarcoplasm (GO:0016528)	identical protein binding (GO:0042802)|RNA binding (GO:0003723)			ovary(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)		GGctgaaccggagccggagcc	0.682																																					p.E230K		.											.	NOL3-227	0			c.G688A						.						20.0	30.0	26.0					16																	67208730		2034	4211	6245	SO:0001819	synonymous_variant	8996	exon5			GAACCGGAGCCGG	AF043244	CCDS42176.1, CCDS58473.1, CCDS61960.1	16q22.1	2008-08-27				ENSG00000140939			7869	protein-coding gene	gene with protein product		605235				9560245	Standard	NM_001276312		Approved	ARC, NOP30, MYP, CARD2	uc010vjd.3	O60936		ENST00000568146.1:c.492G>A	16.37:g.67208730G>A		Somatic	32	0		WXS	Illumina HiSeq	Phase_I	36	5	NM_001276319	0	0	83	93	10	B4DFL0|O60937	Missense_Mutation	SNP	ENST00000568146.1	37	CCDS58473.1	.	.	.	.	.	.	.	.	.	.	g	11.53	1.665514	0.29604	.	.	ENSG00000140939	ENST00000432069;ENST00000268605	T;T	0.72167	-0.63;-0.63	1.38	0.29	0.15728	.	2.201480	0.01451	N	0.015497	T	0.50205	0.1602	.	.	.	0.09310	N	1	B	0.23854	0.092	B	0.12837	0.008	T	0.29912	-0.9996	9	0.17369	T	0.5	-9.4969	4.2104	0.10509	0.2347:0.0:0.7653:0.0	.	230	B4DFL0	.	K	168	ENSP00000399831:E168K;ENSP00000268605:E168K	ENSP00000268605:E168K	E	+	1	0	NOL3	65766231	0.024000	0.19004	0.003000	0.11579	0.030000	0.12068	0.709000	0.25734	0.155000	0.19261	0.430000	0.28490	GAG	.		0.682	NOL3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000422746.1		
CDYL2	124359	hgsc.bcm.edu;broad.mit.edu	37	16	80654830	80654830	+	Silent	SNP	G	G	T			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr16:80654830G>T	ENST00000570137.2	-	4	992	c.837C>A	c.(835-837)atC>atA	p.I279I	CDYL2_ENST00000566173.1_Silent_p.I280I|CDYL2_ENST00000563890.1_Silent_p.I280I|CDYL2_ENST00000562812.1_Silent_p.I280I	NM_152342.2	NP_689555.2	Q8N8U2	CDYL2_HUMAN	chromodomain protein, Y-like 2	279						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	21						CTTCTTTCATGATCTGCCGGC	0.582																																					p.I279I		.											.	CDYL2-90	0			c.C837A						.						38.0	33.0	35.0					16																	80654830		2203	4300	6503	SO:0001819	synonymous_variant	124359	exon4			TTTCATGATCTGC	AK096185	CCDS32493.1	16q23.2	2008-02-05	2003-09-12			ENSG00000166446			23030	protein-coding gene	gene with protein product			"""chromodomain Y-like protein 2"""			12837688	Standard	NM_152342		Approved	FLJ38866	uc002ffs.3	Q8N8U2		ENST00000570137.2:c.837C>A	16.37:g.80654830G>T		Somatic	24	0		WXS	Illumina HiSeq	Phase_I	32	7	NM_152342	0	0	0	0	0	Q7Z5I8	Silent	SNP	ENST00000570137.2	37	CCDS32493.1																																																																																			.		0.582	CDYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434727.2	NM_152342	
ADAD2	161931	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	84228709	84228709	+	Silent	SNP	G	G	A	rs369199969		TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr16:84228709G>A	ENST00000315906.5	+	4	694	c.642G>A	c.(640-642)gcG>gcA	p.A214A	RP11-486L19.2_ENST00000536986.1_RNA|RP11-486L19.2_ENST00000569834.1_RNA|RP11-486L19.2_ENST00000561900.1_RNA|RP11-486L19.2_ENST00000565643.1_RNA|ADAD2_ENST00000268624.3_Silent_p.A286A	NM_001145400.1	NP_001138872.1	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2	214					RNA processing (GO:0006396)		adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|skin(1)	13						GCTGCGCAGCGTTGGTGAGCG	0.637																																					p.A286A		.											.	ADAD2-68	0			c.G858A						.						45.0	47.0	46.0					16																	84228709		2200	4300	6500	SO:0001819	synonymous_variant	161931	exon5			CGCAGCGTTGGTG	AF447586	CCDS10944.1, CCDS45536.1	16q24.1	2007-05-31			ENSG00000140955	ENSG00000140955			30714	protein-coding gene	gene with protein product							Standard	NM_139174		Approved	TENRL, FLJ00337	uc002fhr.2	Q8NCV1	OTTHUMG00000137637	ENST00000315906.5:c.642G>A	16.37:g.84228709G>A		Somatic	77	0		WXS	Illumina HiSeq	Phase_I	86	21	NM_139174	0	0	0	0	0	B2RCL6|Q8NA94	Silent	SNP	ENST00000315906.5	37	CCDS45536.1																																																																																			.		0.637	ADAD2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433385.1	NM_139174	
GP1BA	2811	hgsc.bcm.edu	37	17	4837204	4837204	+	Silent	SNP	C	C	T			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr17:4837204C>T	ENST00000329125.5	+	2	1380	c.1305C>T	c.(1303-1305)acC>acT	p.T435T		NM_000173.5	NP_000164.5	P07359	GP1BA_HUMAN	glycoprotein Ib (platelet), alpha polypeptide	435	Pro/Thr-rich.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|fibrinolysis (GO:0042730)|platelet activation (GO:0030168)|regulation of blood coagulation (GO:0030193)|thrombin receptor signaling pathway (GO:0070493)	anchored component of external side of plasma membrane (GO:0031362)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	thrombin receptor activity (GO:0015057)			central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(5)|stomach(1)|urinary_tract(1)	20						ccagcccgaccaccccagagc	0.736																																					p.T435T		.											.	.	0			c.C1305T						.						2.0	3.0	3.0					17																	4837204		1158	2894	4052	SO:0001819	synonymous_variant	2811	exon2			CCCGACCACCCCA		CCDS54068.1	17p13.2	2014-09-17			ENSG00000185245	ENSG00000185245		"""CD molecules"""	4439	protein-coding gene	gene with protein product		606672		GP1B		3353370	Standard	NM_000173		Approved	CD42b	uc021tnz.1	P07359	OTTHUMG00000177946	ENST00000329125.5:c.1305C>T	17.37:g.4837204C>T		Somatic	7	2		WXS	Illumina HiSeq	Phase_I	10	5	NM_000173	0	0	0	0	0	E7ES66|Q14441|Q16469|Q8N1F3|Q8NG39|Q9HDC7|Q9UEK1|Q9UQS4	Silent	SNP	ENST00000329125.5	37	CCDS54068.1																																																																																			.		0.736	GP1BA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439889.1		
C17orf62	79415	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	17	80405459	80405459	+	Missense_Mutation	SNP	C	C	T	rs142773924		TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr17:80405459C>T	ENST00000437807.2	-	4	441	c.124G>A	c.(124-126)Gga>Aga	p.G42R	C17orf62_ENST00000342572.8_Intron|C17orf62_ENST00000578913.1_Missense_Mutation_p.G42R|C17orf62_ENST00000577732.1_Missense_Mutation_p.G42R|C17orf62_ENST00000306645.5_Missense_Mutation_p.G42R|C17orf62_ENST00000434650.2_Intron|C17orf62_ENST00000577436.1_Intron|C17orf62_ENST00000336995.7_5'UTR|C17orf62_ENST00000583617.1_Missense_Mutation_p.G42R|C17orf62_ENST00000578919.1_Missense_Mutation_p.G42R|C17orf62_ENST00000585080.1_Missense_Mutation_p.G42R|C17orf62_ENST00000585064.1_Missense_Mutation_p.G42R|C17orf62_ENST00000583359.1_5'UTR	NM_001193653.1|NM_001193657.1	NP_001180582.1|NP_001180586.1	Q9BQA9	CQ062_HUMAN	chromosome 17 open reading frame 62	42						integral component of membrane (GO:0016021)				breast(2)|large_intestine(2)|skin(2)|urinary_tract(2)	8	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			GCTTTACCTCCGCTGTAGTAG	0.542													C|||	1	0.000199681	0.0	0.0	5008	,	,		13456	0.001		0.0	False		,,,				2504	0.0				p.G42R		.											.	C17orf62-90	0			c.G124A						.						21.0	19.0	19.0					17																	80405459		2201	4293	6494	SO:0001583	missense	79415	exon4			TACCTCCGCTGTA	AK074950	CCDS32776.1, CCDS45817.1	17q25.3	2014-06-09			ENSG00000178927	ENSG00000178927			28672	protein-coding gene	gene with protein product							Standard	NM_001100407		Approved	MGC4368, FLJ90469	uc021ufr.1	Q9BQA9		ENST00000437807.2:c.124G>A	17.37:g.80405459C>T	ENSP00000388909:p.Gly42Arg	Somatic	33	0		WXS	Illumina HiSeq	Phase_I	42	11	NM_001193657	0	0	0	0	0	E1B6X3|Q96NR1	Missense_Mutation	SNP	ENST00000437807.2	37	CCDS32776.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	15.31	2.795825	0.50208	.	.	ENSG00000178927	ENST00000437807;ENST00000306645	.	.	.	4.61	4.61	0.57282	.	.	.	.	.	T	0.60340	0.2261	L	0.56769	1.78	0.80722	D	1	D	0.62365	0.991	P	0.53518	0.728	T	0.56854	-0.7910	8	0.21540	T	0.41	.	9.7894	0.40697	0.0:0.9038:0.0:0.0962	.	42	Q9BQA9	CQ062_HUMAN	R	42	.	ENSP00000307765:G42R	G	-	1	0	C17orf62	77998748	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	3.580000	0.53907	2.113000	0.64589	0.561000	0.74099	GGA	A|0.000;C|1.000;T|0.000		0.542	C17orf62-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443260.1	NM_001033046	
NCLN	56926	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	3192650	3192650	+	Missense_Mutation	SNP	G	G	A	rs200277850		TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr19:3192650G>A	ENST00000246117.4	+	2	798	c.367G>A	c.(367-369)Gtc>Atc	p.V123I	NCLN_ENST00000590671.1_Missense_Mutation_p.V49I	NM_020170.3	NP_064555.2	Q969V3	NCLN_HUMAN	nicalin	123					regulation of signal transduction (GO:0009966)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				kidney(1)|lung(3)|skin(1)	5		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.83e-113)|Epithelial(107;1.65e-111)|all cancers(105;1.53e-103)|BRCA - Breast invasive adenocarcinoma(158;0.00139)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCCCAGGACGTCGTCCGGGT	0.697													G|||	1	0.000199681	0.0	0.0014	5008	,	,		12285	0.0		0.0	False		,,,				2504	0.0				p.V123I		.											.	NCLN-90	0			c.G367A						.	G	ILE/VAL	1,4293		0,1,2146	11.0	12.0	12.0		367	2.1	0.7	19		12	0,8446		0,0,4223	no	missense	NCLN	NM_020170.3	29	0,1,6369	AA,AG,GG		0.0,0.0233,0.0078	benign	123/564	3192650	1,12739	2147	4223	6370	SO:0001583	missense	56926	exon2			CAGGACGTCGTCC	BC025926	CCDS32869.1	19p13.3	2010-08-13	2010-08-13			ENSG00000125912			26923	protein-coding gene	gene with protein product	"""nicastrin-like protein"""	609156	"""nicalin homolog (zebrafish)"""			11230166	Standard	NM_020170		Approved	NICALIN, NET59	uc002lxi.3	Q969V3		ENST00000246117.4:c.367G>A	19.37:g.3192650G>A	ENSP00000246117:p.Val123Ile	Somatic	47	0		WXS	Illumina HiSeq	Phase_I	23	11	NM_020170	0	0	0	0	0	D6W613|O75252|Q6FI60|Q6ZMB7|Q8TAT7|Q96H48|Q96IS7|Q9BQH9|Q9BTX4|Q9NPP2	Missense_Mutation	SNP	ENST00000246117.4	37	CCDS32869.1	5	0.0022893772893772895	2	0.0040650406504065045	1	0.0027624309392265192	2	0.0034965034965034965	0	0.0	G	10.20	1.283531	0.23392	2.33E-4	0.0	ENSG00000125912	ENST00000246117	T	0.30448	1.53	4.24	2.09	0.27110	.	0.344674	0.29715	N	0.011386	T	0.11922	0.0290	N	0.12831	0.26	0.30808	N	0.739163	B	0.09022	0.002	B	0.04013	0.001	T	0.32877	-0.9890	10	0.02654	T	1	-15.9979	6.4264	0.21772	0.3116:0.0:0.6884:0.0	.	123	Q969V3	NCLN_HUMAN	I	123	ENSP00000246117:V123I	ENSP00000246117:V123I	V	+	1	0	NCLN	3143650	1.000000	0.71417	0.696000	0.30242	0.916000	0.54674	3.340000	0.52143	0.770000	0.33336	0.555000	0.69702	GTC	G|0.998;A|0.002		0.697	NCLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452545.1	NM_020170	
ZNF709	163051	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	12576137	12576137	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr19:12576137T>G	ENST00000397732.3	-	4	770	c.599A>C	c.(598-600)gAa>gCa	p.E200A	CTD-3105H18.18_ENST00000598753.1_Intron|ZNF709_ENST00000428311.1_Missense_Mutation_p.E200A	NM_152601.3	NP_689814.1	Q8N972	ZN709_HUMAN	zinc finger protein 709	200					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(3)|upper_aerodigestive_tract(3)	6						CTTCCCACATTCCTTACATTC	0.413																																					p.E200A	GBM(33;565 669 12371 29134 51667)	.											.	ZNF709-90	0			c.A599C						.						94.0	100.0	98.0					19																	12576137		2202	4300	6502	SO:0001583	missense	163051	exon4			CCACATTCCTTAC	AK095600	CCDS42504.1	19p13.2	2013-01-08			ENSG00000242852	ENSG00000242852		"""Zinc fingers, C2H2-type"", ""-"""	20629	protein-coding gene	gene with protein product							Standard	NM_152601		Approved	FLJ38281	uc002mtv.4	Q8N972	OTTHUMG00000156406	ENST00000397732.3:c.599A>C	19.37:g.12576137T>G	ENSP00000380840:p.Glu200Ala	Somatic	92	0		WXS	Illumina HiSeq	Phase_I	81	30	NM_152601	4	0	9	13	0	A8K4E6	Missense_Mutation	SNP	ENST00000397732.3	37	CCDS42504.1	.	.	.	.	.	.	.	.	.	.	T	17.48	3.399242	0.62177	.	.	ENSG00000242852;ENSG00000196826	ENST00000397732;ENST00000428311	T;T	0.06933	3.24;3.24	2.86	0.618	0.17624	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12305	0.0299	L	0.58354	1.805	0.09310	N	1	B	0.26002	0.139	B	0.40101	0.319	T	0.42378	-0.9455	9	0.59425	D	0.04	.	4.2166	0.10537	0.1786:0.1098:0.0:0.7115	.	200	Q8N972	ZN709_HUMAN	A	200	ENSP00000380840:E200A;ENSP00000404127:E200A	ENSP00000404127:E200A	E	-	2	0	ZNF709;CTD-2192J16.17	12437137	0.001000	0.12720	0.001000	0.08648	0.909000	0.53808	1.145000	0.31577	0.059000	0.16252	0.260000	0.18958	GAA	.		0.413	ZNF709-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344088.1	NM_152601	
PKN1	5585	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	14581037	14581037	+	Missense_Mutation	SNP	G	G	T	rs149980109		TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr19:14581037G>T	ENST00000242783.6	+	19	2521	c.2356G>T	c.(2356-2358)Gtg>Ttg	p.V786L	PKN1_ENST00000342216.4_Missense_Mutation_p.V792L	NM_002741.3	NP_002732.3	Q16512	PKN1_HUMAN	protein kinase N1	786	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|epithelial cell migration (GO:0010631)|histone H3-T11 phosphorylation (GO:0035407)|hyperosmotic response (GO:0006972)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|GTP-Rho binding (GO:0017049)|histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)|histone kinase activity (H3-T11 specific) (GO:0035402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			breast(3)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)	31						GGCCCCTGAGGTGCTGACGGA	0.647																																					p.V792L	NSCLC(185;2539 2965 10733 52867)												.	PKN1-1481	0			c.G2374T						.						87.0	97.0	94.0					19																	14581037		2203	4300	6503	SO:0001583	missense	5585	exon19			CCTGAGGTGCTGA	S75546	CCDS42513.1, CCDS42514.1	19p13.12	2008-05-14	2004-07-01	2004-07-01	ENSG00000123143	ENSG00000123143			9405	protein-coding gene	gene with protein product		601032	"""protein kinase C-like 1"""	PRKCL1		9570957	Standard	NM_002741		Approved	DBK, PRK1, PKN, MGC46204, PAK1	uc002myq.3	Q16512	OTTHUMG00000039611	ENST00000242783.6:c.2356G>T	19.37:g.14581037G>T	ENSP00000242783:p.Val786Leu	Somatic	90	0		WXS	Illumina HiSeq	Phase_I	65	7	NM_213560	0	0	203	275	72	A8K7W5|B2R9R4|B3KVN3|Q15143|Q504U4|Q8IUV5|Q9UD44	Missense_Mutation	SNP	ENST00000242783.6	37	CCDS42513.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.186864	0.78789	.	.	ENSG00000123143	ENST00000242783;ENST00000342216	T;T	0.68479	-0.33;-0.33	3.91	3.91	0.45181	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	U	0.000012	T	0.74023	0.3662	L	0.39326	1.205	0.41792	D	0.989871	D;D	0.63046	0.99;0.992	D;D	0.76071	0.978;0.987	T	0.77582	-0.2534	10	0.87932	D	0	-29.2807	13.7643	0.62986	0.0:0.0:1.0:0.0	.	792;786	Q16512-2;Q16512	.;PKN1_HUMAN	L	786;792	ENSP00000242783:V786L;ENSP00000343325:V792L	ENSP00000242783:V786L	V	+	1	0	PKN1	14442037	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	7.709000	0.84645	2.184000	0.69523	0.491000	0.48974	GTG	G|0.999;A|0.000		0.647	PKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095510.1	NM_002741, NM_213560	
NOTCH3	4854	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	15303027	15303027	+	Silent	SNP	G	G	T	rs116044239		TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr19:15303027G>T	ENST00000263388.2	-	4	498	c.423C>A	c.(421-423)cgC>cgA	p.R141R		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	141	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.		R -> C (in CADASIL). {ECO:0000269|PubMed:10227618, ECO:0000269|PubMed:10371548, ECO:0000269|PubMed:10854111, ECO:0000269|PubMed:11102981, ECO:0000269|PubMed:11755616, ECO:0000269|PubMed:15229130, ECO:0000269|PubMed:15364702, ECO:0000269|PubMed:16009764, ECO:0000269|PubMed:9388399}.		forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			AGCAGAGGAAGCGTCCATCGG	0.701																																					p.R141R		.											.	NOTCH3-855	0			c.C423A						.						20.0	22.0	22.0					19																	15303027		2201	4296	6497	SO:0001819	synonymous_variant	4854	exon4			GAGGAAGCGTCCA	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.423C>A	19.37:g.15303027G>T		Somatic	34	0		WXS	Illumina HiSeq	Phase_I	28	10	NM_000435	0	0	3	3	0	Q9UEB3|Q9UPL3|Q9Y6L8	Silent	SNP	ENST00000263388.2	37	CCDS12326.1																																																																																			G|0.995;A|0.005		0.701	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1	NM_000435	
CLIP3	25999	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	36515358	36515358	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr19:36515358A>C	ENST00000360535.4	-	7	1085	c.858T>G	c.(856-858)aaT>aaG	p.N286K	AC002116.7_ENST00000586962.1_RNA|CLIP3_ENST00000593074.1_Missense_Mutation_p.N286K	NM_015526.2	NP_056341.1	Q96DZ5	CLIP3_HUMAN	CAP-GLY domain containing linker protein 3	286					chaperone-mediated protein transport (GO:0072321)|fat cell differentiation (GO:0045444)|membrane biogenesis (GO:0044091)|negative regulation of microtubule polymerization (GO:0031115)|peptidyl-L-cysteine S-palmitoylation (GO:0018230)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endocytosis (GO:0045807)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein phosphorylation (GO:0001934)	early endosome membrane (GO:0031901)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|trans-Golgi network (GO:0005802)|trans-Golgi network membrane (GO:0032588)	ganglioside binding (GO:0035594)|microtubule binding (GO:0008017)			cervix(1)|endometrium(6)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	23	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			TAAGCATGAGATTGCCTGGGA	0.617																																					p.N286K		.											.	CLIP3-94	0			c.T858G						.						122.0	105.0	111.0					19																	36515358		2203	4300	6503	SO:0001583	missense	25999	exon6			CATGAGATTGCCT	AJ427922	CCDS12486.1	19q13.12	2014-08-12			ENSG00000105270	ENSG00000105270		"""Ankyrin repeat domain containing"""	24314	protein-coding gene	gene with protein product	"""CLIP-170-related"", ""restin-like 1"""	607382				11854307	Standard	NM_015526		Approved	CLIPR-59, RSNL1	uc002ocz.2	Q96DZ5	OTTHUMG00000181747	ENST00000360535.4:c.858T>G	19.37:g.36515358A>C	ENSP00000353732:p.Asn286Lys	Somatic	122	0		WXS	Illumina HiSeq	Phase_I	70	30	NM_001199570	0	0	0	0	0	A8K0E4|Q8WWL1|Q96C99|Q9UFT7	Missense_Mutation	SNP	ENST00000360535.4	37	CCDS12486.1	.	.	.	.	.	.	.	.	.	.	A	8.190	0.795873	0.16327	.	.	ENSG00000105270	ENST00000360535;ENST00000544037;ENST00000534959	T	0.74842	-0.88	5.88	0.203	0.15195	Cytoskeleton-associated protein, Gly-rich domain (1);	0.000000	0.85682	D	0.000000	T	0.47173	0.1431	N	0.17082	0.46	0.52099	D	0.999948	B	0.32781	0.384	B	0.33196	0.159	T	0.46596	-0.9180	10	0.02654	T	1	-19.5733	5.4011	0.16297	0.3499:0.1781:0.472:0.0	.	286	Q96DZ5	CLIP3_HUMAN	K	286;168;262	ENSP00000353732:N286K	ENSP00000353732:N286K	N	-	3	2	CLIP3	41207198	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	0.954000	0.29175	-0.068000	0.12953	0.482000	0.46254	AAT	.		0.617	CLIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457426.1	NM_015526	
ASAP2	8853	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	9515054	9515054	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr2:9515054T>C	ENST00000281419.3	+	17	2067	c.1727T>C	c.(1726-1728)aTc>aCc	p.I576T	ASAP2_ENST00000315273.4_Missense_Mutation_p.I576T	NM_003887.2	NP_003878.1	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 2	576					positive regulation of catalytic activity (GO:0043085)|regulation of ARF GTPase activity (GO:0032312)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|enzyme activator activity (GO:0008047)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	36						ACGGAAAAAATCCCACTGGCC	0.473																																					p.I576T		.											.	ASAP2-90	0			c.T1727C						.						86.0	87.0	86.0					2																	9515054		2203	4300	6503	SO:0001583	missense	8853	exon17			AAAAAATCCCACT	AB007860	CCDS1661.1, CCDS46224.1	2p24	2013-01-10	2008-09-22	2008-09-22	ENSG00000151693	ENSG00000151693		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2721	protein-coding gene	gene with protein product	"""centaurin, beta 3"""	603817	"""development and differentiation enhancing factor 2"""	DDEF2		10022920, 9455477	Standard	NM_003887		Approved	KIAA0400, PAP, SHAG1, CENTB3	uc002qzh.2	O43150	OTTHUMG00000117485	ENST00000281419.3:c.1727T>C	2.37:g.9515054T>C	ENSP00000281419:p.Ile576Thr	Somatic	107	0		WXS	Illumina HiSeq	Phase_I	126	51	NM_001135191	0	0	2	4	2	D6W4Y8	Missense_Mutation	SNP	ENST00000281419.3	37	CCDS1661.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.279137	0.80692	.	.	ENSG00000151693	ENST00000281419;ENST00000315273	T;T	0.66099	-0.19;-0.19	5.4	5.4	0.78164	Ankyrin repeat-containing domain (1);	0.146210	0.64402	D	0.000013	T	0.73401	0.3582	L	0.47716	1.5	0.80722	D	1	D;D	0.65815	0.986;0.995	P;D	0.77004	0.904;0.989	T	0.74074	-0.3782	10	0.48119	T	0.1	.	15.4253	0.75045	0.0:0.0:0.0:1.0	.	576;576	O43150-2;O43150	.;ASAP2_HUMAN	T	576	ENSP00000281419:I576T;ENSP00000316404:I576T	ENSP00000281419:I576T	I	+	2	0	ASAP2	9432505	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.691000	0.84191	2.039000	0.60335	0.533000	0.62120	ATC	.		0.473	ASAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000237522.1	NM_003887	
TCF23	150921	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	27373231	27373231	+	Nonsense_Mutation	SNP	A	A	T			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr2:27373231A>T	ENST00000296096.5	+	2	593	c.463A>T	c.(463-465)Aag>Tag	p.K155*		NM_175769.2	NP_786951.1	Q7RTU1	TCF23_HUMAN	transcription factor 23	155					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)	nucleus (GO:0005634)				large_intestine(2)|lung(11)|prostate(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCACCCTCTCAAGGTAAGTCA	0.622																																					p.K155X		.											.	TCF23-90	0			c.A463T						.						100.0	109.0	106.0					2																	27373231		2203	4300	6503	SO:0001587	stop_gained	150921	exon2			CCTCTCAAGGTAA	AC013403	CCDS33163.1	2p23.3	2013-05-21			ENSG00000163792	ENSG00000163792		"""Basic helix-loop-helix proteins"""	18602	protein-coding gene	gene with protein product		609635				11701948, 10652346	Standard	NM_175769		Approved	OUT, bHLHa24	uc010ylg.2	Q7RTU1	OTTHUMG00000152031	ENST00000296096.5:c.463A>T	2.37:g.27373231A>T	ENSP00000296096:p.Lys155*	Somatic	391	0		WXS	Illumina HiSeq	Phase_I	260	107	NM_175769	0	0	0	0	0	B2RNZ3	Nonsense_Mutation	SNP	ENST00000296096.5	37	CCDS33163.1	.	.	.	.	.	.	.	.	.	.	A	37	6.018528	0.97205	.	.	ENSG00000163792	ENST00000296096	.	.	.	5.66	5.66	0.87406	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-25.5975	13.8444	0.63459	1.0:0.0:0.0:0.0	.	.	.	.	X	155	.	ENSP00000296096:K155X	K	+	1	0	TCF23	27226735	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	8.489000	0.90461	2.164000	0.68074	0.459000	0.35465	AAG	.		0.622	TCF23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324980.1	NM_175769	
SPTBN1	6711	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	54852000	54852000	+	Silent	SNP	C	C	T			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr2:54852000C>T	ENST00000356805.4	+	11	1523	c.1242C>T	c.(1240-1242)ctC>ctT	p.L414L	SPTBN1_ENST00000333896.5_Silent_p.L401L	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	414					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			GGAATGAGCTCATAAGACAGG	0.493																																					p.L414L		.											.	SPTBN1-140	0			c.C1242T						.						76.0	73.0	74.0					2																	54852000		2203	4300	6503	SO:0001819	synonymous_variant	6711	exon11			TGAGCTCATAAGA		CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.1242C>T	2.37:g.54852000C>T		Somatic	65	0		WXS	Illumina HiSeq	Phase_I	58	10	NM_003128	0	0	43	54	11	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Silent	SNP	ENST00000356805.4	37	CCDS33198.1																																																																																			.		0.493	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3		
RGPD3	653489	broad.mit.edu	37	2	107049631	107049631	+	Silent	SNP	C	C	T			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr2:107049631C>T	ENST00000409886.3	-	16	2403	c.2316G>A	c.(2314-2316)gcG>gcA	p.A772A	RGPD3_ENST00000304514.7_Silent_p.A772A	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	772					protein targeting to Golgi (GO:0000042)			p.A772A(4)		breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						TTTCTGAATCCGCATTTCGCA	0.373																																					p.A772A													.	RGPD3-23	4	Substitution - coding silent(4)	kidney(2)|endometrium(2)	c.G2316A						.						81.0	68.0	72.0					2																	107049631		692	1590	2282	SO:0001819	synonymous_variant	653489	exon16			TGAATCCGCATTT		CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.2316G>A	2.37:g.107049631C>T		Somatic	339	1		WXS	Illumina HiSeq	Phase_I	358	5	NM_001144013	0	0	0	9	9	B8ZZM4	Silent	SNP	ENST00000409886.3	37	CCDS46379.1																																																																																			.		0.373	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000329975.1	XM_929931	
RGPD3	653489	broad.mit.edu	37	2	107049681	107049681	+	Missense_Mutation	SNP	T	T	C	rs369310197		TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr2:107049681T>C	ENST00000409886.3	-	16	2353	c.2266A>G	c.(2266-2268)Aac>Gac	p.N756D	RGPD3_ENST00000304514.7_Missense_Mutation_p.N756D	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	756					protein targeting to Golgi (GO:0000042)			p.N756D(6)		breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						TCACTATAGTTTTCGAGTTCC	0.373																																					p.N756D													.	RGPD3-23	6	Substitution - Missense(6)	endometrium(6)	c.A2266G						.						164.0	133.0	142.0					2																	107049681		692	1590	2282	SO:0001583	missense	653489	exon16			TATAGTTTTCGAG		CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.2266A>G	2.37:g.107049681T>C	ENSP00000386588:p.Asn756Asp	Somatic	480	0		WXS	Illumina HiSeq	Phase_I	452	4	NM_001144013	0	0	0	13	13	B8ZZM4	Missense_Mutation	SNP	ENST00000409886.3	37	CCDS46379.1	.	.	.	.	.	.	.	.	.	.	.	0.003	-2.481585	0.00163	.	.	ENSG00000153165	ENST00000409886;ENST00000452099;ENST00000304514	T;T	0.23754	1.89;1.89	2.34	2.34	0.29019	.	.	.	.	.	T	0.07638	0.0192	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.37979	-0.9682	9	0.02654	T	1	-2.2547	7.1228	0.25454	0.0:0.8499:0.0:0.1501	.	756	A6NKT7	RGPD3_HUMAN	D	756;514;756	ENSP00000386588:N756D;ENSP00000303659:N756D	ENSP00000303659:N756D	N	-	1	0	RGPD3	106416113	0.974000	0.33945	0.242000	0.24170	0.003000	0.03518	4.107000	0.57811	0.325000	0.23359	-1.206000	0.01644	AAC	T|1.000;|0.000		0.373	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000329975.1	XM_929931	
RANBP2	5903	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	109380509	109380509	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr2:109380509T>G	ENST00000283195.6	+	20	3640	c.3514T>G	c.(3514-3516)Ttt>Gtt	p.F1172V		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	1172	RanBD1 1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						CGGTCCTCACTTTGAGCCTGT	0.428																																					p.F1172V		.											.	RANBP2-675	0			c.T3514G						.						117.0	109.0	112.0					2																	109380509		2203	4299	6502	SO:0001583	missense	5903	exon20			CCTCACTTTGAGC	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.3514T>G	2.37:g.109380509T>G	ENSP00000283195:p.Phe1172Val	Somatic	132	0		WXS	Illumina HiSeq	Phase_I	148	58	NM_006267	0	0	1	2	1	Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	ENST00000283195.6	37	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	T	16.12	3.034233	0.54896	.	.	ENSG00000153201	ENST00000283195	T	0.39787	1.06	5.57	5.57	0.84162	Pleckstrin homology-type (1);Ran binding protein 1 (2);	.	.	.	.	T	0.64951	0.2645	M	0.74258	2.255	0.50039	D	0.999845	D	0.76494	0.999	D	0.79784	0.993	T	0.67684	-0.5607	9	0.54805	T	0.06	-23.4766	15.7401	0.77887	0.0:0.0:0.0:1.0	.	1172	P49792	RBP2_HUMAN	V	1172	ENSP00000283195:F1172V	ENSP00000283195:F1172V	F	+	1	0	RANBP2	108746941	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	8.040000	0.89188	2.107000	0.64212	0.528000	0.53228	TTT	.		0.428	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
ANKRD30BL	554226	broad.mit.edu	37	2	132911181	132911181	+	Intron	SNP	G	G	A			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr2:132911181G>A	ENST00000409867.1	-	4	864				RNU6-1132P_ENST00000459214.1_RNA|ANKRD30BL_ENST00000470729.1_Intron			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						TCCACATGTAGCTTCAGCACA	0.383																																					.													.	.	0			.						.																																			SO:0001627	intron_variant	554226	.			CATGTAGCTTCAG			2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.614+1053C>T	2.37:g.132911181G>A		Somatic	23	0		WXS	Illumina HiSeq	Phase_I	34	12	.	0	0	0	0	0	B8ZZL7	RNA	SNP	ENST00000409867.1	37																																																																																				.		0.383	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331353.2	NR_027019	
LRP1B	53353	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	141816463	141816463	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr2:141816463G>C	ENST00000389484.3	-	9	2368	c.1397C>G	c.(1396-1398)aCt>aGt	p.T466S		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	466					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TGTTGGTTGAGTTCTTTTTTG	0.353										TSP Lung(27;0.18)																											p.T466S	Colon(99;50 2074 2507 20106)	.											.	LRP1B-311	0			c.C1397G						.						83.0	82.0	82.0					2																	141816463		2201	4298	6499	SO:0001583	missense	53353	exon9			GGTTGAGTTCTTT	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.1397C>G	2.37:g.141816463G>C	ENSP00000374135:p.Thr466Ser	Somatic	28	0		WXS	Illumina HiSeq	Phase_I	31	14	NM_018557	0	0	0	0	0	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	G	7.474	0.647368	0.14516	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.97575	-4.44	5.45	2.69	0.31865	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.247105	0.32028	U	0.006685	D	0.93032	0.7782	L	0.33245	0.995	0.09310	N	1	B	0.17038	0.02	B	0.16722	0.016	D	0.84920	0.0853	10	0.40728	T	0.16	.	9.4538	0.38743	0.2856:0.0:0.7144:0.0	.	466	Q9NZR2	LRP1B_HUMAN	S	466;404	ENSP00000374135:T466S	ENSP00000374135:T466S	T	-	2	0	LRP1B	141532933	0.582000	0.26749	0.952000	0.39060	0.309000	0.27889	1.212000	0.32394	0.287000	0.22375	0.462000	0.41574	ACT	.		0.353	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
LRP1B	53353	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	141816476	141816476	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr2:141816476A>T	ENST00000389484.3	-	9	2355	c.1384T>A	c.(1384-1386)Tat>Aat	p.Y462N		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	462					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CTTTTTTGATAAATTCGGATT	0.343										TSP Lung(27;0.18)																											p.Y462N	Colon(99;50 2074 2507 20106)	.											.	LRP1B-311	0			c.T1384A						.						82.0	82.0	82.0					2																	141816476		2201	4297	6498	SO:0001583	missense	53353	exon9			TTTGATAAATTCG	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.1384T>A	2.37:g.141816476A>T	ENSP00000374135:p.Tyr462Asn	Somatic	28	0		WXS	Illumina HiSeq	Phase_I	30	10	NM_018557	0	0	0	0	0	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	A	17.26	3.345446	0.61073	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.97404	-4.37	5.45	5.45	0.79879	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.000000	0.64402	U	0.000004	D	0.98588	0.9528	M	0.89095	3.005	0.58432	D	0.999994	D	0.76494	0.999	D	0.83275	0.996	D	0.99589	1.0975	10	0.62326	D	0.03	.	15.5201	0.75859	1.0:0.0:0.0:0.0	.	462	Q9NZR2	LRP1B_HUMAN	N	462;400	ENSP00000374135:Y462N	ENSP00000374135:Y462N	Y	-	1	0	LRP1B	141532946	1.000000	0.71417	0.974000	0.42286	0.256000	0.26092	8.865000	0.92300	2.080000	0.62538	0.379000	0.24179	TAT	.		0.343	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
PYGB	5834	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	25271238	25271238	+	Missense_Mutation	SNP	G	G	A	rs139162483		TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr20:25271238G>A	ENST00000216962.4	+	16	2059	c.1949G>A	c.(1948-1950)cGt>cAt	p.R650H		NM_002862.3	NP_002853.2	P11216	PYGB_HUMAN	phosphorylase, glycogen; brain	650					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	glycogen phosphorylase activity (GO:0008184)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	31						GAGAACTACCGTGTGTCCTTG	0.552																																					p.R650H		.											.	PYGB-91	0			c.G1949A						.	G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	225.0	198.0	207.0		1949	4.1	0.9	20	dbSNP_134	207	0,8600		0,0,4300	no	missense	PYGB	NM_002862.3	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	650/844	25271238	1,13005	2203	4300	6503	SO:0001583	missense	5834	exon16			ACTACCGTGTGTC		CCDS13171.1	20p11.21	2013-03-01			ENSG00000100994	ENSG00000100994	2.4.1.1	"""Glycogen phosphorylases"""	9723	protein-coding gene	gene with protein product	"""glycogen phosphorylase, brain form"""	138550					Standard	NM_002862		Approved		uc002wup.3	P11216	OTTHUMG00000032117	ENST00000216962.4:c.1949G>A	20.37:g.25271238G>A	ENSP00000216962:p.Arg650His	Somatic	231	0		WXS	Illumina HiSeq	Phase_I	272	161	NM_002862	0	0	57	225	168	Q96AK1|Q9NPX8	Missense_Mutation	SNP	ENST00000216962.4	37	CCDS13171.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.5|28.5	4.923497|4.923497	0.92319|0.92319	2.27E-4|2.27E-4	0.0|0.0	ENSG00000100994|ENSG00000100994	ENST00000216962|ENST00000428458	D|.	0.93488|.	-3.23|.	4.1|4.1	4.1|4.1	0.47936|0.47936	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.86447|0.86447	0.5935|0.5935	H|H	0.94698|0.94698	3.57|3.57	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.68483|.	0.958|.	D|D	0.90808|0.90808	0.4699|0.4699	10|5	0.66056|.	D|.	0.02|.	-11.4783|-11.4783	16.4812|16.4812	0.84158|0.84158	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	650|.	P11216|.	PYGB_HUMAN|.	H|M	650|69	ENSP00000216962:R650H|.	ENSP00000216962:R650H|.	R|V	+|+	2|1	0|0	PYGB|PYGB	25219238|25219238	1.000000|1.000000	0.71417|0.71417	0.947000|0.947000	0.38551|0.38551	0.941000|0.941000	0.58515|0.58515	7.643000|7.643000	0.83403|0.83403	2.286000|2.286000	0.76751|0.76751	0.563000|0.563000	0.77884|0.77884	CGT|GTG	G|1.000;A|0.000		0.552	PYGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078415.2	NM_002862	
KIF3B	9371	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	30897803	30897803	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr20:30897803G>A	ENST00000375712.3	+	2	390	c.223G>A	c.(223-225)Gag>Aag	p.E75K	KIF3B_ENST00000418717.2_5'Flank	NM_004798.3	NP_004789.1	O15066	KIF3B_HUMAN	kinesin family member 3B	75	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|determination of left/right symmetry (GO:0007368)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic centrosome separation (GO:0007100)|mitotic spindle organization (GO:0007052)|plus-end-directed vesicle transport along microtubule (GO:0072383)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|plus-end kinesin complex (GO:0005873)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|Rho GTPase binding (GO:0017048)			NS(2)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(5)|lung(9)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			ACTGTACGATGAGACGTTCCG	0.488																																					p.E75K		.											.	KIF3B-517	0			c.G223A						.						157.0	136.0	143.0					20																	30897803		2203	4300	6503	SO:0001583	missense	9371	exon2			TACGATGAGACGT	AB002357	CCDS13200.1	20q11.21	2012-08-01			ENSG00000101350	ENSG00000101350		"""Kinesins"""	6320	protein-coding gene	gene with protein product		603754				9205841	Standard	NM_004798		Approved	KIAA0359, FLA8, KLP-11	uc002wxq.3	O15066	OTTHUMG00000032214	ENST00000375712.3:c.223G>A	20.37:g.30897803G>A	ENSP00000364864:p.Glu75Lys	Somatic	100	0		WXS	Illumina HiSeq	Phase_I	149	84	NM_004798	0	0	7	37	30	B2RMP4|B4DSR5|E1P5M5	Missense_Mutation	SNP	ENST00000375712.3	37	CCDS13200.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.493801	0.84962	.	.	ENSG00000101350	ENST00000375712	T	0.74842	-0.88	4.76	4.76	0.60689	Kinesin, motor domain (4);	0.000000	0.85682	D	0.000000	T	0.72471	0.3464	L	0.39692	1.235	0.80722	D	1	B;P	0.42620	0.02;0.785	B;P	0.44990	0.023;0.466	T	0.73464	-0.3974	10	0.42905	T	0.14	.	18.3265	0.90256	0.0:0.0:1.0:0.0	.	75;75	B4DYF2;O15066	.;KIF3B_HUMAN	K	75	ENSP00000364864:E75K	ENSP00000364864:E75K	E	+	1	0	KIF3B	30361464	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.601000	0.98297	2.630000	0.89119	0.561000	0.74099	GAG	.		0.488	KIF3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078619.1	NM_004798	
MROH8	140699	broad.mit.edu;ucsc.edu	37	20	35800375	35800375	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr20:35800375A>T	ENST00000400441.3	-	4	464	c.465T>A	c.(463-465)agT>agA	p.S155R	MROH8_ENST00000217333.8_Missense_Mutation_p.S70R|MROH8_ENST00000441008.2_Missense_Mutation_p.S141R			Q9H579	MROH8_HUMAN	maestro heat-like repeat family member 8	75																	CAATGGCCTCACTGAGCGGGT	0.468																																					.													.	.	0			.						.						67.0	67.0	67.0					20																	35800375		1957	4141	6098	SO:0001583	missense	140699	.			GGCCTCACTGAGC	AL136172		20q11.22	2012-12-19	2012-12-19	2012-12-19	ENSG00000101353	ENSG00000101353		"""maestro heat-like repeat containing"""	16125	protein-coding gene	gene with protein product	"""hypothetical protein LOC140699"""		"""chromosome 20 open reading frame 131"", ""chromosome 20 open reading frame 132"""	C20orf131, C20orf132		11780052, 15635413	Standard	NM_152503		Approved	dJ621N11.4, dJ621N11.3	uc010zvu.2	Q9H579	OTTHUMG00000032407	ENST00000400441.3:c.465T>A	20.37:g.35800375A>T	ENSP00000383291:p.Ser155Arg	Somatic	13	0		WXS	Illumina HiSeq	Phase_I	20	11	.	0	0	1	4	3	Q5JYQ6	Missense_Mutation	SNP	ENST00000400441.3	37		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	A|A|A	12.30|12.30|12.30	1.896945|1.896945|1.896945	0.33535|0.33535|0.33535	.|.|.	.|.|.	ENSG00000101353|ENSG00000101353|ENSG00000101353	ENST00000441008;ENST00000400441;ENST00000217333|ENST00000343811;ENST00000400440|ENST00000421643	T;T;T|.|.	0.03831|.|.	4.08;4.36;3.79|.|.	5.08|5.08|5.08	-5.56|-5.56|-5.56	0.02529|0.02529|0.02529	.|.|.	2.060200|.|.	0.01818|.|.	N|.|.	0.033895|.|.	T|T|.	0.30947|0.30947|.	0.0781|0.0781|.	L|L|L	0.40543|0.40543|0.40543	1.245|1.245|1.245	0.09310|0.09310|0.09310	N|N|N	1|1|1	B;B;B|.|.	0.26002|.|.	0.139;0.067;0.032|.|.	B;B;B|.|.	0.26969|.|.	0.055;0.074;0.075|.|.	T|T|.	0.31971|0.31971|.	-0.9924|-0.9924|.	10|5|.	0.15952|.|.	T|.|.	0.53|.|.	2.848|2.848|2.848	7.2508|7.2508|7.2508	0.26148|0.26148|0.26148	0.3825:0.0:0.4868:0.1307|0.3825:0.0:0.4868:0.1307|0.3825:0.0:0.4868:0.1307	.|.|.	155;75;165|.|.	E7ETR9;Q9H579;Q6PF12|.|.	.;CT132_HUMAN;.|.|.	R|E|R	141;155;70|182;186|192	ENSP00000392144:S141R;ENSP00000383291:S155R;ENSP00000217333:S70R|.|.	ENSP00000217333:S70R|.|.	S|V|X	-|-|-	3|2|1	2|0|0	C20orf132|C20orf132|C20orf132	35233789|35233789|35233789	0.000000|0.000000|0.000000	0.05858|0.05858|0.05858	0.000000|0.000000|0.000000	0.03702|0.03702|0.03702	0.018000|0.018000|0.018000	0.09664|0.09664|0.09664	-1.008000|-1.008000|-1.008000	0.03663|0.03663|0.03663	-1.661000|-1.661000|-1.661000	0.01484|0.01484|0.01484	-0.669000|-0.669000|-0.669000	0.03829|0.03829|0.03829	AGT|GTG|TGA	.		0.468	MROH8-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_152503	
SDC4	6385	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	43959164	43959164	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr20:43959164C>A	ENST00000372733.3	-	4	326	c.287G>T	c.(286-288)gGg>gTg	p.G96V	SDC4_ENST00000537976.1_Missense_Mutation_p.G24V	NM_002999.3	NP_002990.2	P31431	SDC4_HUMAN	syndecan 4	96					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stress fiber assembly (GO:0051496)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|costamere (GO:0043034)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	thrombospondin receptor activity (GO:0070053)	p.G96E(1)	SDC4/ROS1(7)	NS(1)|breast(1)|endometrium(1)|large_intestine(2)	5		Myeloproliferative disorder(115;0.0122)				GACTTGGCTCCCAGACCCTGC	0.532			T	ROS1	NSCLC																																p.G96V		.		Dom	yes		20	20q12	6385	syndecan 4		E	.	SDC4-90	1	Substitution - Missense(1)	endometrium(1)	c.G287T						.						86.0	73.0	77.0					20																	43959164		2203	4300	6503	SO:0001583	missense	6385	exon4			TGGCTCCCAGACC	X67016, D13292	CCDS13350.1	20q12	2010-03-25	2007-02-15		ENSG00000124145	ENSG00000124145		"""Proteoglycans / Cell Surface : Syndecans"""	10661	protein-coding gene	gene with protein product	"""syndecan proteoglycan 4"""	600017	"""syndecan 4 (amphiglycan, ryudocan)"""			7916598, 1500433	Standard	NM_002999		Approved	SYND4, amphiglycan, ryudocan	uc002xnu.3	P31431	OTTHUMG00000033083	ENST00000372733.3:c.287G>T	20.37:g.43959164C>A	ENSP00000361818:p.Gly96Val	Somatic	52	0		WXS	Illumina HiSeq	Phase_I	66	17	NM_002999	1	0	316	442	125	O00773|Q16833|Q53FN9|Q6FGN3	Missense_Mutation	SNP	ENST00000372733.3	37	CCDS13350.1	.	.	.	.	.	.	.	.	.	.	C	1.625	-0.520393	0.04171	.	.	ENSG00000124145	ENST00000372733;ENST00000537976	T	0.29917	1.55	5.68	3.56	0.40772	.	0.486350	0.18834	N	0.129888	T	0.25457	0.0619	L	0.44542	1.39	0.25579	N	0.986817	B	0.10296	0.003	B	0.14023	0.01	T	0.13469	-1.0508	10	0.29301	T	0.29	-21.9327	11.2249	0.48877	0.143:0.7246:0.1323:0.0	.	96	P31431	SDC4_HUMAN	V	96;24	ENSP00000361818:G96V	ENSP00000361818:G96V	G	-	2	0	SDC4	43392578	0.042000	0.20092	0.902000	0.35471	0.284000	0.27059	0.780000	0.26760	1.334000	0.45468	0.561000	0.74099	GGG	.		0.532	SDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080515.1	NM_002999	
ARFGEF2	10564	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	47628619	47628619	+	Silent	SNP	C	C	A	rs371146257		TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr20:47628619C>A	ENST00000371917.4	+	28	3916	c.3916C>A	c.(3916-3918)Cgg>Agg	p.R1306R		NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)	1306					endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)			breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			TGAGAGGCCTCGGGTTCGTTT	0.512																																					p.R1306R	Esophageal Squamous(176;1738 1974 26285 33069 35354)	.											.	ARFGEF2-358	0			c.C3916A						.						89.0	85.0	86.0					20																	47628619		2203	4300	6503	SO:0001819	synonymous_variant	10564	exon28			AGGCCTCGGGTTC	AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.3916C>A	20.37:g.47628619C>A		Somatic	97	0		WXS	Illumina HiSeq	Phase_I	109	61	NM_006420	0	0	0	0	0	Q5TFT9|Q9NTS1	Silent	SNP	ENST00000371917.4	37	CCDS13411.1																																																																																			.		0.512	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079627.1	NM_006420	
CDH26	60437	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	58569544	58569544	+	Splice_Site	SNP	G	G	C			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr20:58569544G>C	ENST00000244047.5	+	11	1977	c.1666G>C	c.(1666-1668)Ggt>Cgt	p.G556R	CDH26_ENST00000350849.6_5'Flank|CDH26_ENST00000244049.3_5'Flank|CDH26_ENST00000497614.1_3'UTR|CDH26_ENST00000348616.4_Splice_Site_p.G556R			Q8IXH8	CAD26_HUMAN	cadherin 26	556					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(11)|lung(14)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	44	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			GAGAAATTGGGGTGAGTTTTT	0.433																																					p.G556R		.											.	CDH26-93	0			c.G1666C						.						34.0	33.0	33.0					20																	58569544		2203	4300	6503	SO:0001630	splice_region_variant	60437	exon11			AATTGGGGTGAGT	AF169690, AK055202	CCDS13485.1, CCDS13486.1	20q13.33	2010-01-26	2009-11-20		ENSG00000124215	ENSG00000124215		"""Cadherins / Major cadherins"""	15902	protein-coding gene	gene with protein product			"""cadherin-like 26"""				Standard	NM_177980		Approved	VR20	uc002ybe.3	Q8IXH8	OTTHUMG00000032874	ENST00000244047.5:c.1666+1G>C	20.37:g.58569544G>C		Somatic	62	0		WXS	Illumina HiSeq	Phase_I	74	24	NM_177980	0	0	0	0	0	A2A2M5|B3KNX3|Q6P5Y6|Q8TCH3|Q9BQN4|Q9NRU1	Missense_Mutation	SNP	ENST00000244047.5	37		.	.	.	.	.	.	.	.	.	.	G	16.64	3.180551	0.57800	.	.	ENSG00000124215	ENST00000244047;ENST00000348616	T;T	0.72835	-0.69;-0.69	4.35	4.35	0.52113	Cadherin-like (1);	0.391569	0.24463	N	0.038317	D	0.83436	0.5254	M	0.74258	2.255	0.49687	D	0.999815	D;D	0.89917	0.999;1.0	D;D	0.85130	0.973;0.997	D	0.86131	0.1575	10	0.87932	D	0	.	15.6637	0.77209	0.0:0.0:1.0:0.0	.	556;556	Q8IXH8;Q8IXH8-4	CAD26_HUMAN;.	R	556	ENSP00000244047:G556R;ENSP00000339390:G556R	ENSP00000244047:G556R	G	+	1	0	CDH26	58002939	1.000000	0.71417	0.388000	0.26195	0.582000	0.36321	5.190000	0.65104	1.954000	0.56735	0.655000	0.94253	GGT	.		0.433	CDH26-201	KNOWN	basic	protein_coding	protein_coding		NM_177980	Missense_Mutation
NCAM2	4685	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	22849618	22849618	+	Missense_Mutation	SNP	A	A	G	rs201923816		TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr21:22849618A>G	ENST00000400546.1	+	15	2152	c.1903A>G	c.(1903-1905)Aag>Gag	p.K635E	NCAM2_ENST00000284894.7_Missense_Mutation_p.K493E	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	635	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		ACAGAAAGATAAGGAAGACCA	0.338																																					p.K635E		.											.	NCAM2-94	0			c.A1903G						.						80.0	74.0	76.0					21																	22849618		1822	4085	5907	SO:0001583	missense	4685	exon15			AAAGATAAGGAAG		CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.1903A>G	21.37:g.22849618A>G	ENSP00000383392:p.Lys635Glu	Somatic	45	0		WXS	Illumina HiSeq	Phase_I	36	12	NM_004540	0	0	0	0	0	A8MQ06|B7Z841|Q7Z7F2	Missense_Mutation	SNP	ENST00000400546.1	37	CCDS42910.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.069133	0.76301	.	.	ENSG00000154654	ENST00000400546;ENST00000284894	T;T	0.51574	0.7;0.7	5.8	5.8	0.92144	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.52517	0.1739	N	0.15975	0.35	0.80722	D	1	D;D	0.62365	0.991;0.991	D;D	0.81914	0.995;0.995	T	0.58912	-0.7552	10	0.56958	D	0.05	-27.6898	14.9715	0.71238	1.0:0.0:0.0:0.0	.	493;635	B7Z5K2;O15394	.;NCAM2_HUMAN	E	635;493	ENSP00000383392:K635E;ENSP00000284894:K493E	ENSP00000284894:K493E	K	+	1	0	NCAM2	21771489	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.306000	0.72810	2.213000	0.71641	0.528000	0.53228	AAG	A|0.999;G|0.001		0.338	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000170915.1	NM_004540	
MRPL40	64976	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	19423455	19423455	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr22:19423455G>T	ENST00000333130.3	+	4	1244	c.591G>T	c.(589-591)aaG>aaT	p.K197N	MRPL40_ENST00000443660.1_3'UTR|HIRA_ENST00000546308.1_Intron|HIRA_ENST00000541063.1_Intron	NM_003776.2	NP_003767.2	Q9NQ50	RM40_HUMAN	mitochondrial ribosomal protein L40	197					anatomical structure morphogenesis (GO:0009653)	mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|upper_aerodigestive_tract(1)	2	Colorectal(54;0.0993)					ACATCACCAAGGTGTACACAC	0.502																																					p.K197N		.											.	MRPL40-90	0			c.G591T						.						116.0	106.0	109.0					22																	19423455		2203	4300	6503	SO:0001583	missense	64976	exon4			CACCAAGGTGTAC	AB051624	CCDS13760.1	22q11.2	2012-09-13	2002-11-13		ENSG00000185608	ENSG00000185608		"""Mitochondrial ribosomal proteins / large subunits"""	14491	protein-coding gene	gene with protein product		605089	"""nuclear localization signal deleted in velocardiofacial syndrome"""	NLVCF		9790763, 11543634	Standard	NM_003776		Approved	MRP-L22	uc002zpg.3	Q9NQ50	OTTHUMG00000150136	ENST00000333130.3:c.591G>T	22.37:g.19423455G>T	ENSP00000333401:p.Lys197Asn	Somatic	80	0		WXS	Illumina HiSeq	Phase_I	63	23	NM_003776	0	0	56	85	29	B3KVZ7|O95134	Missense_Mutation	SNP	ENST00000333130.3	37	CCDS13760.1	.	.	.	.	.	.	.	.	.	.	G	13.96	2.392258	0.42410	.	.	ENSG00000185608	ENST00000333130	T	0.52983	0.64	5.53	2.23	0.28157	.	0.102989	0.64402	D	0.000005	T	0.66247	0.2770	M	0.85542	2.76	0.45502	D	0.998462	D	0.76494	0.999	D	0.77557	0.99	T	0.67473	-0.5662	10	0.72032	D	0.01	-26.3156	7.4919	0.27466	0.4243:0.0:0.5757:0.0	.	197	Q9NQ50	RM40_HUMAN	N	197	ENSP00000333401:K197N	ENSP00000333401:K197N	K	+	3	2	MRPL40	17803455	1.000000	0.71417	1.000000	0.80357	0.113000	0.19764	1.675000	0.37555	0.898000	0.36418	0.655000	0.94253	AAG	.		0.502	MRPL40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316491.2	NM_003776	
KLHL22	84861	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	20796432	20796432	+	Silent	SNP	G	G	C	rs149300605		TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr22:20796432G>C	ENST00000328879.4	-	7	1989	c.1833C>G	c.(1831-1833)gcC>gcG	p.A611A	KLHL22_ENST00000440659.2_Silent_p.A468A	NM_032775.3	NP_116164.2	Q53GT1	KLH22_HUMAN	kelch-like family member 22	611					cell division (GO:0051301)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|protein monoubiquitination (GO:0006513)	centrosome (GO:0005813)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|polar microtubule (GO:0005827)				breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|skin(2)|upper_aerodigestive_tract(1)	20	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			AGTCCGGGTCGGCCTGGCTGC	0.647																																					p.A611A		.											.	KLHL22-278	0			c.C1833G						.						29.0	30.0	30.0					22																	20796432		2203	4300	6503	SO:0001819	synonymous_variant	84861	exon7			CGGGTCGGCCTGG		CCDS13780.1	22q11.21	2013-01-30	2013-01-30		ENSG00000099910	ENSG00000099910		"""Kelch-like"", ""BTB/POZ domain containing"""	25888	protein-coding gene	gene with protein product			"""kelch-like 22 (Drosophila)"""			12477932	Standard	NM_032775		Approved	FLJ14360, KELCHL	uc002zsl.2	Q53GT1	OTTHUMG00000150778	ENST00000328879.4:c.1833C>G	22.37:g.20796432G>C		Somatic	65	0		WXS	Illumina HiSeq	Phase_I	67	26	NM_032775	0	0	6	14	8	A8K3Q4|A8MTV3|B7Z2G1|D3DX30|Q96B68|Q96KC6	Silent	SNP	ENST00000328879.4	37	CCDS13780.1																																																																																			G|1.000;A|0.000		0.647	KLHL22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320045.2	NM_032775	
CELSR1	9620	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	46765598	46765598	+	Silent	SNP	A	A	G			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr22:46765598A>G	ENST00000262738.3	-	26	7862	c.7863T>C	c.(7861-7863)gcT>gcC	p.A2621A		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	2621					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		CGATTATAACAGCTCCGATGG	0.627																																					p.A2621A		.											.	CELSR1-525	0			c.T7863C						.						55.0	54.0	54.0					22																	46765598		2203	4300	6503	SO:0001819	synonymous_variant	9620	exon26			TATAACAGCTCCG	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.7863T>C	22.37:g.46765598A>G		Somatic	78	0		WXS	Illumina HiSeq	Phase_I	63	24	NM_014246	0	0	0	0	0	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Silent	SNP	ENST00000262738.3	37	CCDS14076.1																																																																																			.		0.627	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1	NM_014246	
MIOX	55586	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	50926723	50926723	+	Silent	SNP	G	G	T			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr22:50926723G>T	ENST00000216075.6	+	5	434	c.360G>T	c.(358-360)ggG>ggT	p.G120G	MIOX_ENST00000395733.3_Missense_Mutation_p.G131V|MIOX_ENST00000395732.3_Silent_p.G120G	NM_017584.5	NP_060054.4	Q9UGB7	MIOX_HUMAN	myo-inositol oxygenase	120					inositol catabolic process (GO:0019310)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)	aldo-keto reductase (NADP) activity (GO:0004033)|ferric iron binding (GO:0008199)|inositol oxygenase activity (GO:0050113)|NADP binding (GO:0050661)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen (GO:0016701)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	13		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		ACCTCGTCGGGCTCCTGCACG	0.652																																					p.G120G		.											.	MIOX-90	0			c.G360T						.						57.0	55.0	56.0					22																	50926723		2203	4300	6503	SO:0001819	synonymous_variant	55586	exon5			CGTCGGGCTCCTG	AF197129	CCDS14092.1	22q13.3	2008-06-11	2005-06-15	2005-06-15	ENSG00000100253	ENSG00000100253			14522	protein-coding gene	gene with protein product	"""kidney-specific protein 32"""	606774	"""aldehyde reductase (aldose reductase) like 6"""	ALDRL6		10944187, 11716759	Standard	NM_017584		Approved		uc003bll.1	Q9UGB7	OTTHUMG00000150207	ENST00000216075.6:c.360G>T	22.37:g.50926723G>T		Somatic	65	0		WXS	Illumina HiSeq	Phase_I	38	16	NM_017584	0	1	355	755	399	Q05DJ6|Q5S8C9|Q9BZZ1|Q9UHB8	Silent	SNP	ENST00000216075.6	37	CCDS14092.1	.	.	.	.	.	.	.	.	.	.	G	13.57	2.277251	0.40294	.	.	ENSG00000100253	ENST00000395733	.	.	.	4.4	2.3	0.28687	.	0.000000	0.85682	D	0.000000	T	0.42988	0.1227	.	.	.	0.80722	D	1	B	0.20671	0.047	B	0.17979	0.02	T	0.37150	-0.9718	8	0.87932	D	0	-5.0893	3.2524	0.06819	0.2255:0.0:0.5677:0.2069	.	131	Q9UGB7-2	.	V	131	.	ENSP00000379082:G131V	G	+	2	0	MIOX	49273589	0.998000	0.40836	0.980000	0.43619	0.906000	0.53458	0.593000	0.23999	0.468000	0.27243	0.436000	0.28706	GGC	.		0.652	MIOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316835.1	NM_017584	
HYAL2	8692	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	50357591	50357591	+	Silent	SNP	C	C	T			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr3:50357591C>T	ENST00000447092.1	-	1	2622	c.330G>A	c.(328-330)cgG>cgA	p.R110R	HYAL2_ENST00000357750.4_Silent_p.R110R|HYAL2_ENST00000395139.3_Silent_p.R110R|TUSC2_ENST00000462137.1_5'UTR|HYAL2_ENST00000442581.1_Silent_p.R110R			Q12891	HYAL2_HUMAN	hyaluronoglucosaminidase 2	110					carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to interleukin-1 (GO:0071347)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to UV-B (GO:0071493)|defense response to virus (GO:0051607)|fusion of virus membrane with host plasma membrane (GO:0019064)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|hematopoietic progenitor cell differentiation (GO:0002244)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|kidney development (GO:0001822)|monocyte activation (GO:0042117)|multicellular organismal aging (GO:0010259)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of cell growth (GO:0030308)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein tyrosine kinase activity (GO:0061099)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of urine volume (GO:0035810)|renal water absorption (GO:0070295)|response to antibiotic (GO:0046677)|response to reactive oxygen species (GO:0000302)|response to virus (GO:0009615)|skeletal system morphogenesis (GO:0048705)|small molecule metabolic process (GO:0044281)|transformation of host cell by virus (GO:0019087)|viral entry into host cell (GO:0046718)	anchored component of external side of plasma membrane (GO:0031362)|anchored component of plasma membrane (GO:0046658)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|lysosome (GO:0005764)|membrane raft (GO:0045121)|microvillus (GO:0005902)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|hyaluronic acid binding (GO:0005540)|hyaluronoglucuronidase activity (GO:0033906)|hyalurononglucosaminidase activity (GO:0004415)|receptor signaling protein tyrosine kinase inhibitor activity (GO:0030294)|receptor tyrosine kinase binding (GO:0030971)|transforming growth factor beta binding (GO:0050431)|virus receptor activity (GO:0001618)			breast(1)|endometrium(2)|kidney(1)|ovary(1)|prostate(1)|skin(1)	7				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		GCAGCATCTTCCGGTGTGCCC	0.597																																					p.R110R		.											.	HYAL2-279	0			c.G330A						.						79.0	71.0	74.0					3																	50357591		2203	4300	6503	SO:0001819	synonymous_variant	8692	exon3			CATCTTCCGGTGT	AJ000099	CCDS2818.1	3p21.3	2008-07-18			ENSG00000068001	ENSG00000068001			5321	protein-coding gene	gene with protein product	"""lysosomal hyaluronidase"", ""PH-20 homolog"", ""hyaluronidase 2"""	603551				9712871, 9790770	Standard	NM_003773		Approved	LuCa-2, LUCA2	uc003czv.3	Q12891	OTTHUMG00000156876	ENST00000447092.1:c.330G>A	3.37:g.50357591C>T		Somatic	105	0		WXS	Illumina HiSeq	Phase_I	87	30	NM_033158	0	0	21	36	15	B3KRZ2|O15177|Q9BW29	Silent	SNP	ENST00000447092.1	37	CCDS2818.1																																																																																			.		0.597	HYAL2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346391.1	NM_003773	
CACNA1D	776	broad.mit.edu	37	3	53808687	53808687	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr3:53808687C>T	ENST00000350061.5	+	34	4695	c.4184C>T	c.(4183-4185)gCg>gTg	p.A1395V	CACNA1D_ENST00000422281.2_Missense_Mutation_p.A1380V|CACNA1D_ENST00000288139.4_Missense_Mutation_p.A1415V|CACNA1D_ENST00000540742.1_Missense_Mutation_p.A287V	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	1395					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)	p.A1415V(1)		breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TTTCCCCAGGCGGTGCTGCTG	0.547																																					p.A1415V													.	CACNA1D-100	1	Substitution - Missense(1)	prostate(1)	c.C4244T						.						113.0	112.0	112.0					3																	53808687		2203	4300	6503	SO:0001583	missense	776	exon35			CCCAGGCGGTGCT	AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.4184C>T	3.37:g.53808687C>T	ENSP00000288133:p.Ala1395Val	Somatic	80	0		WXS	Illumina HiSeq	Phase_I	103	4	NM_000720	0	0	10	10	0	B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Missense_Mutation	SNP	ENST00000350061.5	37	CCDS46848.1	.	.	.	.	.	.	.	.	.	.	C	35	5.440507	0.96168	.	.	ENSG00000157388	ENST00000350061;ENST00000288139;ENST00000422281;ENST00000481478;ENST00000540742	D;D;D;D;D	0.98901	-5.22;-5.22;-5.22;-5.22;-5.22	6.17	6.17	0.99709	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99606	0.9857	H	0.98818	4.34	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.985;0.998;0.995;0.999	D	0.97737	1.0206	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	1380;287;1088;1395;1415	B0FYA3;F5H313;Q59GD8;Q01668;Q01668-2	.;.;.;CAC1D_HUMAN;.	V	1395;1415;1380;1088;287	ENSP00000288133:A1395V;ENSP00000288139:A1415V;ENSP00000409174:A1380V;ENSP00000418014:A1088V;ENSP00000438229:A287V	ENSP00000288139:A1415V	A	+	2	0	CACNA1D	53783727	1.000000	0.71417	0.989000	0.46669	0.895000	0.52256	7.800000	0.85949	2.941000	0.99782	0.655000	0.94253	GCG	.		0.547	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	NM_000720	
MITF	4286	ucsc.edu	37	3	69988280	69988280	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr3:69988280C>T	ENST00000448226.2	+	4	741	c.614C>T	c.(613-615)gCa>gTa	p.A205V	MITF_ENST00000314589.5_Missense_Mutation_p.A189V|MITF_ENST00000328528.6_Missense_Mutation_p.A204V|MITF_ENST00000472437.1_Missense_Mutation_p.A153V|MITF_ENST00000531774.1_Missense_Mutation_p.A42V|MITF_ENST00000394351.3_Missense_Mutation_p.A98V|MITF_ENST00000394355.2_Missense_Mutation_p.A180V|MITF_ENST00000314557.6_Missense_Mutation_p.A98V|MITF_ENST00000352241.4_Missense_Mutation_p.A205V			O75030	MITF_HUMAN	microphthalmia-associated transcription factor	205					bone remodeling (GO:0046849)|camera-type eye development (GO:0043010)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cell fate commitment (GO:0045165)|melanocyte differentiation (GO:0030318)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(6)|stomach(1)|urinary_tract(2)	30		Lung NSC(201;0.0384)|Prostate(884;0.0526)		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)		CAAAACAGGGCAGAGAGCGAG	0.418			A		melanoma		"""Waardenburg syndrome type 2, Tietz syndrome"""																														p.A205V	Melanoma(29;269 969 31479 41502 42961)			Dom	yes		3	3p14.1	4286	microphthalmia-associated transcription factor	yes	E	.	MITF-524	0			c.C614T						.						102.0	98.0	99.0					3																	69988280		2203	4300	6503	SO:0001583	missense	4286	exon4			ACAGGGCAGAGAG		CCDS2913.1, CCDS43106.1, CCDS43107.1, CCDS46865.1, CCDS46866.1, CCDS46866.2, CCDS54607.1, CCDS74962.1	3p14.1-p12.3	2014-09-17			ENSG00000187098	ENSG00000187098		"""Basic helix-loop-helix proteins"""	7105	protein-coding gene	gene with protein product	"""homolog of mouse microphthalmia"""	156845	"""Waardenburg syndrome, type 2A"""	WS2A, WS2		8069297, 7874167, 7951321	Standard	NM_198159		Approved	MI, bHLHe32	uc003dnz.3	O75030	OTTHUMG00000149921	ENST00000448226.2:c.614C>T	3.37:g.69988280C>T	ENSP00000391803:p.Ala205Val	Somatic	38	0		WXS	Illumina HiSeq		36	4	NM_198159	0	0	17	17	0	B4DJL2|D3K197|E9PFN0|Q14841|Q9P2V0|Q9P2V1|Q9P2V2|Q9P2Y8	Missense_Mutation	SNP	ENST00000448226.2	37		.	.	.	.	.	.	.	.	.	.	C	9.959	1.222404	0.22457	.	.	ENSG00000187098	ENST00000352241;ENST00000448226;ENST00000433517;ENST00000472437;ENST00000328528;ENST00000451708;ENST00000314589;ENST00000394355;ENST00000314557;ENST00000394351;ENST00000531774	T;T;T;T;T;T;T;T;T;T	0.23348	2.74;2.24;2.52;2.73;1.91;2.73;2.74;2.52;1.92;2.5	5.98	0.676	0.17958	.	0.791935	0.11257	N	0.583025	T	0.12135	0.0295	N	0.08118	0	0.21147	N	0.999773	B;B;B;B;B;B;B	0.09022	0.0;0.001;0.001;0.0;0.002;0.001;0.0	B;B;B;B;B;B;B	0.08055	0.001;0.003;0.002;0.002;0.001;0.001;0.0	T	0.35301	-0.9794	9	.	.	.	.	10.3394	0.43868	0.0:0.5304:0.0:0.4696	.	153;98;98;180;189;204;205	E9PFN0;O75030-9;O75030-10;O75030-4;O75030-8;O75030-6;O75030-2	.;.;.;.;.;.;.	V	205;205;97;153;204;189;189;180;98;98;42	ENSP00000295600:A205V;ENSP00000391803:A205V;ENSP00000418845:A153V;ENSP00000327867:A204V;ENSP00000398639:A189V;ENSP00000324443:A189V;ENSP00000377884:A180V;ENSP00000324246:A98V;ENSP00000377880:A98V;ENSP00000435909:A42V	.	A	+	2	0	MITF	70070970	0.007000	0.16637	0.657000	0.29651	0.370000	0.29829	-0.088000	0.11198	0.048000	0.15891	-0.133000	0.14855	GCA	.		0.418	MITF-007	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000313947.1	NM_198159	
MFN1	55669	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	179076735	179076735	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr3:179076735A>C	ENST00000471841.1	+	4	482	c.356A>C	c.(355-357)gAt>gCt	p.D119A	MFN1_ENST00000280653.7_Missense_Mutation_p.D119A|MFN1_ENST00000263969.5_Missense_Mutation_p.D119A	NM_033540.2	NP_284941	Q8IWA4	MFN1_HUMAN	mitofusin 1	119	Dynamin-type G.				mitochondrial fusion (GO:0008053)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(3)|prostate(1)|urinary_tract(1)	31	all_cancers(143;1.67e-16)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.00225)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			GAAGGAACTGATGGAGATAAA	0.378																																					p.D119A		.											.	MFN1-155	0			c.A356C						.						150.0	139.0	143.0					3																	179076735		2203	4300	6503	SO:0001583	missense	55669	exon4			GAACTGATGGAGA	AF054986	CCDS3228.1	3q26.32	2006-12-13			ENSG00000171109	ENSG00000171109			18262	protein-coding gene	gene with protein product		608506				8358434, 11181170	Standard	NM_033540		Approved	FLJ20693	uc003fjs.3	Q8IWA4	OTTHUMG00000157385	ENST00000471841.1:c.356A>C	3.37:g.179076735A>C	ENSP00000420617:p.Asp119Ala	Somatic	64	0		WXS	Illumina HiSeq	Phase_I	81	27	NM_033540	0	0	10	15	5	B2RAR1|D3DNR6|O15323|O60639|Q9BZB5|Q9NWQ2	Missense_Mutation	SNP	ENST00000471841.1	37	CCDS3228.1	.	.	.	.	.	.	.	.	.	.	A	19.42	3.824508	0.71143	.	.	ENSG00000171109	ENST00000471841;ENST00000280653;ENST00000539169;ENST00000467174;ENST00000263969	D;D;D;D	0.96830	-4.14;-4.14;-4.14;-4.14	5.86	5.86	0.93980	Dynamin, GTPase domain (1);	0.045333	0.85682	D	0.000000	D	0.97932	0.9320	M	0.80508	2.5	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.71656	0.974;0.964	D	0.97957	1.0335	10	0.42905	T	0.14	-26.3212	16.5602	0.84551	1.0:0.0:0.0:0.0	.	147;119	Q4AEJ4;Q8IWA4	.;MFN1_HUMAN	A	119	ENSP00000420617:D119A;ENSP00000280653:D119A;ENSP00000419134:D119A;ENSP00000263969:D119A	ENSP00000263969:D119A	D	+	2	0	MFN1	180559429	1.000000	0.71417	0.998000	0.56505	0.943000	0.58893	8.904000	0.92590	2.367000	0.80283	0.528000	0.53228	GAT	.		0.378	MFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348654.2	NM_017927	
USP13	8975	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	179426711	179426711	+	Silent	SNP	C	C	A			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr3:179426711C>A	ENST00000263966.3	+	6	1242	c.771C>A	c.(769-771)gcC>gcA	p.A257A	USP13_ENST00000496897.1_Silent_p.A192A|USP13_ENST00000482333.1_3'UTR	NM_003940.2	NP_003931.2	Q92995	UBP13_HUMAN	ubiquitin specific peptidase 13 (isopeptidase T-3)	257					autophagy (GO:0006914)|cell proliferation (GO:0008283)|melanocyte differentiation (GO:0030318)|protein K63-linked deubiquitination (GO:0070536)|protein stabilization (GO:0050821)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	46	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			ACCCACTAGCCGTGAAACTGG	0.547																																					p.A257A		.											.	USP13-659	0			c.C771A						.						75.0	70.0	71.0					3																	179426711		2203	4300	6503	SO:0001819	synonymous_variant	8975	exon6			ACTAGCCGTGAAA	U75362	CCDS3235.1	3q26.2-q26.3	2008-04-11	2005-08-08		ENSG00000058056	ENSG00000058056		"""Ubiquitin-specific peptidases"""	12611	protein-coding gene	gene with protein product		603591	"""ubiquitin specific protease 13 (isopeptidase T-3)"""			12838346	Standard	NM_003940		Approved	IsoT-3	uc003fkh.3	Q92995	OTTHUMG00000157783	ENST00000263966.3:c.771C>A	3.37:g.179426711C>A		Somatic	92	0		WXS	Illumina HiSeq	Phase_I	73	33	NM_003940	0	0	1	2	1	A8K2S3|B4DYF3|D3DNS2|Q96B25	Silent	SNP	ENST00000263966.3	37	CCDS3235.1																																																																																			.		0.547	USP13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349617.1		
CPN2	1370	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	194062198	194062198	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr3:194062198G>T	ENST00000323830.3	-	2	1323	c.1234C>A	c.(1234-1236)Cag>Aag	p.Q412K	CPN2_ENST00000429275.1_Missense_Mutation_p.Q412K	NM_001080513.2	NP_001073982	P22792	CPN2_HUMAN	carboxypeptidase N, polypeptide 2	412	LRRCT.				protein stabilization (GO:0050821)|regulation of catalytic activity (GO:0050790)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	enzyme regulator activity (GO:0030234)			breast(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|ovary(5)|prostate(1)	27	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.65e-05)		TCGGTGTACTGCTGCAGCCAG	0.602																																					p.Q412K		.											.	CPN2-73	0			c.C1234A						.						62.0	64.0	63.0					3																	194062198		2203	4300	6503	SO:0001583	missense	1370	exon2			TGTACTGCTGCAG	J05158	CCDS33920.1	3q29	2012-02-10	2007-02-23		ENSG00000178772	ENSG00000178772	3.4.17.3		2313	protein-coding gene	gene with protein product		603104	"""carboxypeptidase N, polypeptide 2, 83kD"""	ACBP		2378615, 9628828	Standard	XM_005269280		Approved		uc003fts.3	P22792	OTTHUMG00000156047	ENST00000323830.3:c.1234C>A	3.37:g.194062198G>T	ENSP00000319464:p.Gln412Lys	Somatic	84	0		WXS	Illumina HiSeq	Phase_I	76	28	NM_001080513	0	0	1	2	1	B2RPE7|Q86SU4|Q8N5V4	Missense_Mutation	SNP	ENST00000323830.3	37	CCDS33920.1	.	.	.	.	.	.	.	.	.	.	G	2.132	-0.398880	0.04865	.	.	ENSG00000178772	ENST00000323830;ENST00000429275	T;T	0.24151	1.87;1.87	5.56	1.46	0.22682	Cysteine-rich flanking region, C-terminal (1);	0.280456	0.19931	N	0.102851	T	0.10981	0.0268	N	0.25094	0.71	0.09310	N	1	B	0.21071	0.051	B	0.16722	0.016	T	0.32955	-0.9887	10	0.05436	T	0.98	.	4.2056	0.10486	0.0732:0.3827:0.2364:0.3077	.	412	P22792	CPN2_HUMAN	K	412	ENSP00000319464:Q412K;ENSP00000402232:Q412K	ENSP00000319464:Q412K	Q	-	1	0	CPN2	195543893	0.000000	0.05858	0.002000	0.10522	0.124000	0.20399	-0.469000	0.06648	0.787000	0.33731	-0.165000	0.13383	CAG	.		0.602	CPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342856.2	NM_001080513	
ODAM	54959	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	71064324	71064324	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr4:71064324T>A	ENST00000396094.2	+	5	452	c.404T>A	c.(403-405)aTg>aAg	p.M135K		NM_017855.3	NP_060325.3	A1E959	ODAM_HUMAN	odontogenic, ameloblast asssociated	135	Gln-rich.				biomineral tissue development (GO:0031214)|odontogenesis of dentin-containing tooth (GO:0042475)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|fibril (GO:0043205)|nucleus (GO:0005634)				NS(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(8)|ovary(3)|skin(2)	20						TCCTTCAAAATGCCTCAAGAG	0.378																																					p.M135K		.											.	ODAM-134	0			c.T404A						.						120.0	116.0	118.0					4																	71064324		2203	4300	6503	SO:0001583	missense	54959	exon5			TCAAAATGCCTCA	AK000520	CCDS3536.2	4q13.3	2010-11-23			ENSG00000109205	ENSG00000109205			26043	protein-coding gene	gene with protein product		614843				14647039	Standard	NM_017855		Approved	APin, FLJ20513	uc003hfc.3	A1E959	OTTHUMG00000129406	ENST00000396094.2:c.404T>A	4.37:g.71064324T>A	ENSP00000379401:p.Met135Lys	Somatic	73	0		WXS	Illumina HiSeq	Phase_I	91	6	NM_017855	0	0	0	0	0	Q8WWE5|Q9NWZ9	Missense_Mutation	SNP	ENST00000396094.2	37	CCDS3536.2	.	.	.	.	.	.	.	.	.	.	T	13.87	2.366377	0.41902	.	.	ENSG00000109205	ENST00000396094;ENST00000510709;ENST00000514097	T;T	0.48522	0.81;0.81	4.82	3.65	0.41850	.	0.949132	0.08736	N	0.901245	T	0.37972	0.1023	L	0.42245	1.32	0.22754	N	0.998773	P	0.38020	0.615	B	0.32805	0.153	T	0.30592	-0.9973	10	0.72032	D	0.01	-0.3936	7.1176	0.25424	0.0:0.101:0.0:0.899	.	135	A1E959	ODAM_HUMAN	K	135;121;88	ENSP00000379401:M135K;ENSP00000426106:M88K	ENSP00000379401:M135K	M	+	2	0	ODAM	71098913	0.773000	0.28580	0.893000	0.35052	0.676000	0.39594	0.800000	0.27042	0.987000	0.38709	0.374000	0.22700	ATG	.		0.378	ODAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251562.1	NM_017855	
SLC4A4	8671	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	4	72429564	72429564	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr4:72429564A>G	ENST00000264485.5	+	24	3271	c.3154A>G	c.(3154-3156)Atg>Gtg	p.M1052V	SLC4A4_ENST00000340595.3_Missense_Mutation_p.M1008V|SLC4A4_ENST00000425175.1_Intron|SLC4A4_ENST00000351898.6_Missense_Mutation_p.M968V	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	1052					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)	p.M1008V(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	AATGGACATCATGGAACAGCA	0.358																																					p.M1052V		.											.	SLC4A4-95	1	Substitution - Missense(1)	large_intestine(1)	c.A3154G						.						152.0	158.0	156.0					4																	72429564		2203	4300	6503	SO:0001583	missense	8671	exon24			GACATCATGGAAC	AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.3154A>G	4.37:g.72429564A>G	ENSP00000264485:p.Met1052Val	Somatic	112	0		WXS	Illumina HiSeq	Phase_I	122	45	NM_001098484	0	0	12	29	17	C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Missense_Mutation	SNP	ENST00000264485.5	37	CCDS43236.1	.	.	.	.	.	.	.	.	.	.	A	7.750	0.703080	0.15172	.	.	ENSG00000080493	ENST00000264485;ENST00000351898;ENST00000340595	T;T;T	0.75154	-0.91;-0.58;-0.91	5.46	4.25	0.50352	.	0.037886	0.85682	D	0.000000	T	0.56572	0.1994	N	0.24115	0.695	0.80722	D	1	B;B;B	0.20164	0.012;0.042;0.025	B;B;B	0.21546	0.017;0.035;0.01	T	0.49643	-0.8918	10	0.02654	T	1	.	12.5178	0.56042	0.8603:0.1397:0.0:0.0	.	968;1008;1052	Q9Y6R1-4;Q9Y6R1-2;Q9Y6R1	.;.;S4A4_HUMAN	V	1052;968;1008	ENSP00000264485:M1052V;ENSP00000307349:M968V;ENSP00000344272:M1008V	ENSP00000264485:M1052V	M	+	1	0	SLC4A4	72648428	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.988000	0.76212	0.885000	0.36088	-0.619000	0.04042	ATG	.		0.358	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362090.1	NM_003759	
EXOSC9	5393	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	122724130	122724130	+	Silent	SNP	G	G	A			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr4:122724130G>A	ENST00000243498.5	+	4	450	c.342G>A	c.(340-342)aaG>aaA	p.K114K	EXOSC9_ENST00000512454.1_Silent_p.K98K|EXOSC9_ENST00000379663.3_Silent_p.K114K|EXOSC9_ENST00000509980.1_3'UTR	NM_005033.2	NP_005024.2	Q06265	EXOS9_HUMAN	exosome component 9	114	ARE binding.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|immune response (GO:0006955)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear polyadenylation-dependent rRNA catabolic process (GO:0071035)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of cell growth (GO:0030307)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|intermediate filament cytoskeleton (GO:0045111)|nuclear exosome (RNase complex) (GO:0000176)|nucleolus (GO:0005730)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|AU-rich element binding (GO:0017091)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|urinary_tract(1)	16						GAAATTCGAAGTGTATAGACA	0.393																																					p.K114K		.											.	EXOSC9-90	0			c.G342A						.						126.0	118.0	121.0					4																	122724130		2203	4300	6503	SO:0001819	synonymous_variant	5393	exon4			TTCGAAGTGTATA	M58460	CCDS3722.2, CCDS34057.1	4q27	2010-05-07	2004-06-16	2004-06-18	ENSG00000123737	ENSG00000123737	3.1.13.-		9137	protein-coding gene	gene with protein product	"""polymyositis/scleroderma autoantigen 1 (75kD)"""	606180	"""polymyositis/scleroderma autoantigen 1, 75kDa"""	PMSCL1			Standard	XR_427545		Approved	PM/Scl-75, Rrp45p, RRP45, p5, p6	uc003idz.3	Q06265	OTTHUMG00000128783	ENST00000243498.5:c.342G>A	4.37:g.122724130G>A		Somatic	74	0		WXS	Illumina HiSeq	Phase_I	69	32	NM_001034194	0	0	10	14	4	Q12883|Q4W5P5|Q86Y41|Q86Y48	Silent	SNP	ENST00000243498.5	37	CCDS3722.2																																																																																			.		0.393	EXOSC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250708.2	NM_005033	
BDP1	55814	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	70813231	70813231	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr5:70813231T>A	ENST00000358731.4	+	22	5206	c.4943T>A	c.(4942-4944)gTg>gAg	p.V1648E	BDP1_ENST00000380675.2_5'UTR	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	1648					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		CAAAGTCAGGTGGTTCTTGTA	0.308																																					p.V1648E		.											.	BDP1-92	0			c.T4943A						.						70.0	70.0	70.0					5																	70813231		1812	4074	5886	SO:0001583	missense	55814	exon22			GTCAGGTGGTTCT	AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.4943T>A	5.37:g.70813231T>A	ENSP00000351575:p.Val1648Glu	Somatic	43	0		WXS	Illumina HiSeq	Phase_I	76	32	NM_018429	0	0	0	0	0	Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Missense_Mutation	SNP	ENST00000358731.4	37	CCDS43328.1	.	.	.	.	.	.	.	.	.	.	T	2.499	-0.315545	0.05422	.	.	ENSG00000145734	ENST00000358731;ENST00000451951	T	0.11495	2.77	3.38	-3.81	0.04294	.	1.408380	0.05200	N	0.504767	T	0.08846	0.0219	L	0.54323	1.7	0.09310	N	0.999996	B;B	0.25955	0.037;0.138	B;B	0.18561	0.008;0.022	T	0.41662	-0.9496	10	0.56958	D	0.05	.	0.473	0.00535	0.1852:0.283:0.1887:0.3431	.	1648;1648	A6H8Y1;A6H8Y1-2	BDP1_HUMAN;.	E	1648;1228	ENSP00000351575:V1648E	ENSP00000351575:V1648E	V	+	2	0	BDP1	70848987	0.000000	0.05858	0.004000	0.12327	0.069000	0.16628	-0.026000	0.12392	-0.363000	0.08101	0.383000	0.25322	GTG	.		0.308	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374681.2	NM_018429	
VCAN	1462	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	82836395	82836395	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr5:82836395A>T	ENST00000265077.3	+	8	8138	c.7573A>T	c.(7573-7575)Agg>Tgg	p.R2525W	VCAN_ENST00000502527.2_Intron|VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000342785.4_Intron|VCAN_ENST00000343200.5_Missense_Mutation_p.R1538W|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000512590.2_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	2525	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	AGACCGTTTCAGGGAATTCGA	0.403																																					p.R2525W		.											.	VCAN-238	0			c.A7573T						.						53.0	54.0	54.0					5																	82836395		2203	4300	6503	SO:0001583	missense	1462	exon8			CGTTTCAGGGAAT	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.7573A>T	5.37:g.82836395A>T	ENSP00000265077:p.Arg2525Trp	Somatic	56	0		WXS	Illumina HiSeq	Phase_I	56	21	NM_004385	0	0	22	34	12	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	A	10.51	1.370274	0.24771	.	.	ENSG00000038427	ENST00000265077;ENST00000343200	T;T	0.34072	1.38;1.38	6.17	-11.7	0.00046	.	1.888030	0.01961	N	0.043346	T	0.17577	0.0422	N	0.16478	0.41	0.09310	N	1	B;B	0.12630	0.006;0.004	B;B	0.11329	0.006;0.003	T	0.16808	-1.0390	10	0.54805	T	0.06	.	4.6375	0.12531	0.2227:0.3575:0.3326:0.0872	.	1538;2525	P13611-2;P13611	.;CSPG2_HUMAN	W	2525;1538	ENSP00000265077:R2525W;ENSP00000340062:R1538W	ENSP00000265077:R2525W	R	+	1	2	VCAN	82872151	0.000000	0.05858	0.000000	0.03702	0.260000	0.26232	-0.702000	0.05069	-2.549000	0.00480	0.533000	0.62120	AGG	.		0.403	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
PCDHGA3	56112	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	140724915	140724915	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr5:140724915A>C	ENST00000253812.6	+	1	1315	c.1315A>C	c.(1315-1317)Acc>Ccc	p.T439P	PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	439	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AACTCACATCACCCTGCATGT	0.507																																					p.T439P		.											.	PCDHGA3-68	0			c.A1315C						.						99.0	110.0	106.0					5																	140724915		2101	4254	6355	SO:0001583	missense	56112	exon1			CACATCACCCTGC	AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.1315A>C	5.37:g.140724915A>C	ENSP00000253812:p.Thr439Pro	Somatic	170	1		WXS	Illumina HiSeq	Phase_I	187	32	NM_032011	0	0	1	1	0	Q9Y5D4	Missense_Mutation	SNP	ENST00000253812.6	37	CCDS47290.1	.	.	.	.	.	.	.	.	.	.	.	0.302	-0.973094	0.02215	.	.	ENSG00000254245	ENST00000253812	T	0.02552	4.25	5.59	-3.1	0.05315	Cadherin (4);Cadherin-like (1);	1.180670	0.06999	U	0.823041	T	0.03827	0.0108	M	0.75777	2.31	0.09310	N	1	B;B	0.15141	0.004;0.012	B;B	0.17979	0.008;0.02	T	0.48581	-0.9023	10	0.36615	T	0.2	.	1.0414	0.01559	0.2895:0.3371:0.17:0.2033	.	439;439	Q9Y5H0-2;Q9Y5H0	.;PCDG3_HUMAN	P	439	ENSP00000253812:T439P	ENSP00000253812:T439P	T	+	1	0	PCDHGA3	140705099	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.672000	0.05244	-0.115000	0.11915	-0.331000	0.08364	ACC	.		0.507	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377017.1	NM_018916	
PCDHGA3	56112	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	140724920	140724920	+	Silent	SNP	G	G	T	rs567477411		TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr5:140724920G>T	ENST00000253812.6	+	1	1320	c.1320G>T	c.(1318-1320)ctG>ctT	p.L440L	PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	440	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACATCACCCTGCATGTGATTG	0.502																																					p.L440L		.											.	PCDHGA3-68	0			c.G1320T						.						103.0	114.0	110.0					5																	140724920		2107	4256	6363	SO:0001819	synonymous_variant	56112	exon1			CACCCTGCATGTG	AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.1320G>T	5.37:g.140724920G>T		Somatic	176	0		WXS	Illumina HiSeq	Phase_I	205	36	NM_032011	0	0	0	0	0	Q9Y5D4	Silent	SNP	ENST00000253812.6	37	CCDS47290.1																																																																																			.		0.502	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377017.1	NM_018916	
TNIP1	10318	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	150444534	150444534	+	Silent	SNP	C	C	G			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr5:150444534C>G	ENST00000389378.2	-	2	711	c.123G>C	c.(121-123)ggG>ggC	p.G41G	TNIP1_ENST00000520931.1_Intron|TNIP1_ENST00000524280.1_Silent_p.G41G|TNIP1_ENST00000523338.1_Silent_p.G41G|TNIP1_ENST00000521591.1_Silent_p.G41G|TNIP1_ENST00000522226.1_Silent_p.G41G|TNIP1_ENST00000518977.1_Silent_p.G41G|TNIP1_ENST00000523200.1_Silent_p.G41G|TNIP1_ENST00000315050.7_Silent_p.G41G	NM_001252385.1|NM_001252393.1|NM_001258454.1|NM_006058.4	NP_001239314.1|NP_001239322.1|NP_001245383.1|NP_006049.3	Q15025	TNIP1_HUMAN	TNFAIP3 interacting protein 1	41					defense response (GO:0006952)|glycoprotein biosynthetic process (GO:0009101)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|modulation by symbiont of host I-kappaB kinase/NF-kappaB cascade (GO:0085032)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of viral genome replication (GO:0045071)|positive regulation of inflammatory response (GO:0050729)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|translation (GO:0006412)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	mitogen-activated protein kinase binding (GO:0051019)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(5)|ovary(2)|prostate(2)|skin(3)	23		Medulloblastoma(196;0.0911)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ACATCTTTATCCCTTGCATTT	0.567																																					p.G41G		.											.	TNIP1-91	0			c.G123C						.						170.0	164.0	166.0					5																	150444534		2203	4300	6503	SO:0001819	synonymous_variant	10318	exon2			CTTTATCCCTTGC	AJ011895	CCDS34280.1, CCDS58982.1, CCDS58983.1, CCDS58984.1, CCDS58985.1, CCDS75359.1	5q32-q33.1	2008-07-18							16903	protein-coding gene	gene with protein product	"""virion-associated nuclear-shuttling protein"", ""Nef-associated factor 1 SNP"""	607714				9923610, 11090181	Standard	NM_001252385		Approved	NAF1, KIAA0113, ABIN-1, VAN	uc003ltj.3	Q15025		ENST00000389378.2:c.123G>C	5.37:g.150444534C>G		Somatic	151	0		WXS	Illumina HiSeq	Phase_I	128	45	NM_001252385	0	0	0	0	0	A4F1W8|A4F1W9|A4F1X2|A4F1X4|A4F1X5|A4F1X6|A4F1X7|A4F1X9|B7Z699|E7EPY1|E7ET96|O76008|Q05KP3|Q05KP4|Q6N077|Q96EL9|Q99833|Q9H1J3	Silent	SNP	ENST00000389378.2	37	CCDS34280.1																																																																																			.		0.567	TNIP1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374914.1	NM_006058	
WWC1	23286	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	167833322	167833322	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr5:167833322A>C	ENST00000265293.4	+	6	1212	c.710A>C	c.(709-711)gAt>gCt	p.D237A	WWC1_ENST00000521089.1_Missense_Mutation_p.D237A	NM_001161661.1|NM_001161662.1|NM_015238.2	NP_001155133.1|NP_001155134.1|NP_056053.1	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1	237					cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|hippo signaling (GO:0035329)|negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of MAPK cascade (GO:0043410)|regulation of hippo signaling (GO:0035330)|regulation of intracellular transport (GO:0032386)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(1)|skin(4)	43	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		GAAAAGCAAGATCTCATTAAG	0.458																																					p.D237A		.											.	WWC1-157	0			c.A710C						.						189.0	179.0	182.0					5																	167833322		2203	4300	6503	SO:0001583	missense	23286	exon6			AGCAAGATCTCAT	AF506799	CCDS4366.1, CCDS54945.1	5q34	2014-06-13	2006-11-09		ENSG00000113645	ENSG00000113645		"""WW, C2 and coiled-coil domain containing"""	29435	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 168"""	610533	"""WW, C2 and coiled-coil domain containing 1"""			10048485, 12559952	Standard	NM_001161661		Approved	KIBRA, KIAA0869, PPP1R168	uc011den.2	Q8IX03	OTTHUMG00000130408	ENST00000265293.4:c.710A>C	5.37:g.167833322A>C	ENSP00000265293:p.Asp237Ala	Somatic	184	0		WXS	Illumina HiSeq	Phase_I	165	70	NM_015238	0	0	0	0	0	B4DK05|O94946|Q6MZX4|Q6Y2F8|Q7Z4G8|Q8WVM4|Q9BT29	Missense_Mutation	SNP	ENST00000265293.4	37	CCDS4366.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.2|24.2	4.503944|4.503944	0.85176|0.85176	.|.	.|.	ENSG00000113645|ENSG00000113645	ENST00000265293;ENST00000521089|ENST00000393895;ENST00000524228	T;T|.	0.07800|.	3.16;3.18|.	5.45|5.45	5.45|5.45	0.79879|0.79879	.|.	0.057843|.	0.64402|.	D|.	0.000002|.	T|T	0.75910|0.75910	0.3914|0.3914	M|M	0.78637|0.78637	2.42|2.42	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.60160|.	0.987;0.972;0.978;0.963|.	P;P;P;P|.	0.59012|.	0.85;0.737;0.796;0.63|.	T|T	0.77225|0.77225	-0.2666|-0.2666	10|5	0.52906|.	T|.	0.07|.	.|.	15.5264|15.5264	0.75910|0.75910	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	237;143;143;237|.	Q8IX03-2;F5H498;B3KX05;Q8IX03|.	.;.;.;KIBRA_HUMAN|.	A|S	237|198;13	ENSP00000265293:D237A;ENSP00000427772:D237A|.	ENSP00000265293:D237A|.	D|R	+|+	2|3	0|2	WWC1|WWC1	167765900|167765900	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	9.251000|9.251000	0.95483|0.95483	2.078000|2.078000	0.62432|0.62432	0.459000|0.459000	0.35465|0.35465	GAT|AGA	.		0.458	WWC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252791.2	NM_015238	
DDR1	780	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	30865203	30865203	+	Missense_Mutation	SNP	C	C	A	rs541302814		TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr6:30865203C>A	ENST00000324771.8	+	17	2593	c.2045C>A	c.(2044-2046)cCa>cAa	p.P682Q	DDR1_ENST00000376567.2_Missense_Mutation_p.P645Q|DDR1_ENST00000446312.1_3'UTR|DDR1_ENST00000376569.3_Missense_Mutation_p.P645Q|DDR1_ENST00000513240.1_Missense_Mutation_p.P688Q|DDR1_ENST00000452441.1_Missense_Mutation_p.P682Q|DDR1_ENST00000508312.1_Missense_Mutation_p.P663Q|DDR1_ENST00000376575.3_Missense_Mutation_p.P688Q|DDR1_ENST00000376570.4_Missense_Mutation_p.P645Q|DDR1_ENST00000361741.4_Missense_Mutation_p.P349Q|DDR1_ENST00000454612.2_Missense_Mutation_p.P645Q|DDR1_ENST00000418800.2_Missense_Mutation_p.P645Q|DDR1_ENST00000376568.3_Missense_Mutation_p.P682Q			Q08345	DDR1_HUMAN	discoidin domain receptor tyrosine kinase 1	682	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|ear development (GO:0043583)|embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine autophosphorylation (GO:0038083)|protein autophosphorylation (GO:0046777)|regulation of cell growth (GO:0001558)|regulation of cell-matrix adhesion (GO:0001952)|regulation of extracellular matrix disassembly (GO:0010715)|smooth muscle cell migration (GO:0014909)|smooth muscle cell-matrix adhesion (GO:0061302)|wound healing, spreading of cells (GO:0044319)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|metal ion binding (GO:0046872)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(1)|prostate(1)|skin(1)	29					Imatinib(DB00619)	CTCAAGGACCCAAACATCATT	0.547																																					p.P688Q		.											.	DDR1-1403	0			c.C2063A						.						103.0	93.0	97.0					6																	30865203		2203	4300	6503	SO:0001583	missense	780	exon14			AGGACCCAAACAT	X99031	CCDS4690.1, CCDS34385.1, CCDS47396.1, CCDS56411.1, CCDS75419.1	6p21.33	2010-02-17	2008-01-23		ENSG00000204580	ENSG00000204580	2.7.10.1	"""CD molecules"""	2730	protein-coding gene	gene with protein product		600408	"""discoidin domain receptor family, member 1"""	NTRK4, PTK3A, NEP, CAK, EDDR1		7789998	Standard	NM_001954		Approved	RTK6, CD167	uc003nrv.3	Q08345	OTTHUMG00000031236	ENST00000324771.8:c.2045C>A	6.37:g.30865203C>A	ENSP00000318217:p.Pro682Gln	Somatic	83	0		WXS	Illumina HiSeq	Phase_I	70	25	NM_013994	0	1	157	296	138	B5A975|B5A976|B7Z2K0|Q14196|Q16562|Q2L6H3|Q4LE50|Q5ST11|Q5ST12|Q6NSK4|Q9UD35|Q9UD36|Q9UD37|Q9UD86|Q9UDL2	Missense_Mutation	SNP	ENST00000324771.8	37	CCDS34385.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.6|28.6	4.933034|4.933034	0.92458|0.92458	.|.	.|.	ENSG00000204580|ENSG00000204580	ENST00000324771;ENST00000418800;ENST00000454612;ENST00000376569;ENST00000376575;ENST00000376570;ENST00000376568;ENST00000452441;ENST00000508312;ENST00000376567;ENST00000513240;ENST00000417521;ENST00000361741|ENST00000484556	D;D;D;D;D;D;D;D;D;D;D;D;D|.	0.91407|.	-2.84;-2.84;-2.84;-2.84;-2.84;-2.84;-2.84;-2.84;-2.84;-2.84;-2.84;-2.84;-2.84|.	5.39|5.39	5.39|5.39	0.77823|0.77823	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);|.	0.060949|.	0.64402|.	D|.	0.000003|.	T|T	0.65852|0.65852	0.2731|0.2731	M|M	0.64997|0.64997	1.995|1.995	0.80722|0.80722	D|D	1|1	D;P;D;D;D|.	0.89917|.	1.0;0.792;1.0;0.981;1.0|.	D;P;D;P;D|.	0.97110|.	0.999;0.643;0.999;0.888;1.0|.	T|T	0.64491|0.64491	-0.6395|-0.6395	10|5	0.56958|.	D|.	0.05|.	.|.	16.6419|16.6419	0.85128|0.85128	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	663;146;414;688;682|.	B7Z2K0;A2ABL4;A2ABM8;Q08345-5;Q08345|.	.;.;.;.;DDR1_HUMAN|.	Q|K	682;645;645;645;688;645;682;682;663;645;688;414;349|39	ENSP00000318217:P682Q;ENSP00000407699:P645Q;ENSP00000406091:P645Q;ENSP00000365753:P645Q;ENSP00000365759:P688Q;ENSP00000365754:P645Q;ENSP00000365752:P682Q;ENSP00000405039:P682Q;ENSP00000422442:P663Q;ENSP00000365751:P645Q;ENSP00000427552:P688Q;ENSP00000398682:P414Q;ENSP00000354844:P349Q|.	ENSP00000318217:P682Q|.	P|Q	+|+	2|1	0|0	DDR1|DDR1	30973182|30973182	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.974000|0.974000	0.67602|0.67602	5.959000|5.959000	0.70339|0.70339	2.525000|2.525000	0.85131|0.85131	0.462000|0.462000	0.41574|0.41574	CCA|CAA	.		0.547	DDR1-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076494.3	NM_013994	
KIFC1	3833	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	33365943	33365943	+	Splice_Site	SNP	G	G	T			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr6:33365943G>T	ENST00000428849.2	+	2	600	c.150G>T	c.(148-150)aaG>aaT	p.K50N		NM_002263.3	NP_002254.2	Q9BW19	KIFC1_HUMAN	kinesin family member C1	50					ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|spindle assembly (GO:0051225)	endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|minus-end-directed microtubule motor activity (GO:0008569)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(3)|skin(1)	13						AGCCTGAGAAGGTGAGCTGGG	0.542																																					p.K50N		.											.	KIFC1-90	0			c.G150T						.						60.0	62.0	61.0					6																	33365943		2203	4300	6503	SO:0001630	splice_region_variant	3833	exon2			TGAGAAGGTGAGC	D14678	CCDS34430.1	6p21.32	2014-05-15	2003-01-09	2003-01-10	ENSG00000237649	ENSG00000237649		"""Kinesins"""	6389	protein-coding gene	gene with protein product		603763	"""kinesin-like 2"""	KNSL2		8276466	Standard	NM_002263		Approved	HSET	uc003oef.4	Q9BW19	OTTHUMG00000031209	ENST00000428849.2:c.150+1G>T	6.37:g.33365943G>T		Somatic	60	0		WXS	Illumina HiSeq	Phase_I	49	15	NM_002263	0	0	0	0	0	O60887|Q14834|Q4KMP0|Q5SU09|Q6GMS7|Q6P4A5|Q9UQP7	Missense_Mutation	SNP	ENST00000428849.2	37	CCDS34430.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.035950	0.75617	.	.	ENSG00000237649	ENST00000428849;ENST00000450504	T	0.75260	-0.92	4.78	4.78	0.61160	.	0.217099	0.39274	N	0.001409	T	0.54334	0.1852	L	0.34521	1.04	0.43010	D	0.994544	P;P	0.43094	0.799;0.799	B;B	0.40901	0.343;0.343	T	0.61865	-0.6975	10	0.46703	T	0.11	-16.7844	13.1674	0.59579	0.0:0.0:1.0:0.0	.	50;50	B4E063;Q9BW19	.;KIFC1_HUMAN	N	50	ENSP00000393963:K50N	ENSP00000393963:K50N	K	+	3	2	KIFC1	33473921	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	4.761000	0.62243	2.493000	0.84123	0.455000	0.32223	AAG	.		0.542	KIFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076417.1	NM_002263	Missense_Mutation
PLEKHG1	57480	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	151117019	151117019	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr6:151117019T>G	ENST00000358517.2	+	5	821	c.610T>G	c.(610-612)Tat>Gat	p.Y204D	PLEKHG1_ENST00000367328.1_Missense_Mutation_p.Y204D			Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 1	204	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(19)|ovary(5)|prostate(4)|stomach(1)|urinary_tract(3)	53			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		TTATACCCAGTATTGCACTAA	0.358																																					p.Y204D		.											.	PLEKHG1-92	0			c.T610G						.						161.0	148.0	152.0					6																	151117019		2203	4300	6503	SO:0001583	missense	57480	exon6			ACCCAGTATTGCA	AB033035	CCDS34552.1	6q25.1	2013-01-11			ENSG00000120278	ENSG00000120278		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20884	protein-coding gene	gene with protein product						10574462	Standard	XM_005267064		Approved	KIAA1209, ARHGEF41	uc003qny.1	Q9ULL1	OTTHUMG00000015824	ENST00000358517.2:c.610T>G	6.37:g.151117019T>G	ENSP00000351318:p.Tyr204Asp	Somatic	127	0		WXS	Illumina HiSeq	Phase_I	114	48	NM_001029884	0	0	0	0	0	Q5T1F2	Missense_Mutation	SNP	ENST00000358517.2	37	CCDS34552.1	.	.	.	.	.	.	.	.	.	.	T	22.6	4.310648	0.81358	.	.	ENSG00000120278	ENST00000367328;ENST00000535018;ENST00000358517	D;D	0.82255	-1.59;-1.59	5.58	5.58	0.84498	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	D	0.94503	0.8230	H	0.98818	4.34	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96775	0.9571	10	0.87932	D	0	.	15.756	0.78025	0.0:0.0:0.0:1.0	.	11;204;204	Q5EBL9;Q5JYA6;Q9ULL1	.;.;PKHG1_HUMAN	D	204	ENSP00000356297:Y204D;ENSP00000351318:Y204D	ENSP00000351318:Y204D	Y	+	1	0	PLEKHG1	151158712	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.649000	0.83500	2.131000	0.65755	0.533000	0.62120	TAT	.		0.358	PLEKHG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042691.1		
MLLT4	4301	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	168349109	168349109	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr6:168349109A>T	ENST00000447894.2	+	28	3761	c.3761A>T	c.(3760-3762)gAa>gTa	p.E1254V	MLLT4_ENST00000351017.4_Missense_Mutation_p.E1261V|MLLT4_ENST00000400822.3_Missense_Mutation_p.E1253V|MLLT4_ENST00000366806.2_Missense_Mutation_p.E1254V|MLLT4_ENST00000344191.4_Missense_Mutation_p.E1254V|MLLT4_ENST00000392108.3_Missense_Mutation_p.E1254V|MLLT4_ENST00000392112.1_Missense_Mutation_p.E1237V			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	1254					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		AATTATGAGGAAAAGCCACAT	0.448			T	MLL	AL																																p.E1254V		.		Dom	yes		6	6q27	4301	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""		L	.	MLLT4-685	0			c.A3761T						.						90.0	84.0	86.0					6																	168349109		2203	4300	6503	SO:0001583	missense	4301	exon28			ATGAGGAAAAGCC	AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.3761A>T	6.37:g.168349109A>T	ENSP00000404595:p.Glu1254Val	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	53	24	NM_001040000	0	0	8	8	0	O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Missense_Mutation	SNP	ENST00000447894.2	37		.	.	.	.	.	.	.	.	.	.	A	17.88	3.496251	0.64186	.	.	ENSG00000130396	ENST00000344191;ENST00000351017;ENST00000392108;ENST00000366806;ENST00000392112;ENST00000341575;ENST00000400822;ENST00000447894	T;T;T;T;T;T;T	0.04970	3.73;3.62;3.72;3.72;3.52;3.62;3.62	5.52	5.52	0.82312	.	0.343079	0.30392	N	0.009726	T	0.05686	0.0149	L	0.57536	1.79	0.46954	D	0.999266	P;P;P;B	0.40376	0.556;0.683;0.715;0.305	B;B;B;B	0.40602	0.179;0.334;0.244;0.133	T	0.09164	-1.0687	10	0.62326	D	0.03	-23.1008	15.6454	0.77046	1.0:0.0:0.0:0.0	.	1254;1253;1254;1238	P55196;P55196-5;P55196-6;P55196-2	AFAD_HUMAN;.;.;.	V	1254;1261;1254;1254;1237;1254;1253;1254	ENSP00000341118:E1254V;ENSP00000252692:E1261V;ENSP00000375956:E1254V;ENSP00000355771:E1254V;ENSP00000375960:E1237V;ENSP00000383623:E1253V;ENSP00000404595:E1254V	ENSP00000345834:E1254V	E	+	2	0	MLLT4	168091958	1.000000	0.71417	0.894000	0.35097	0.875000	0.50365	5.595000	0.67563	2.084000	0.62774	0.533000	0.62120	GAA	.		0.448	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000372077.1	NM_005936	
OGDH	4967	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	44747234	44747234	+	Silent	SNP	T	T	C			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr7:44747234T>C	ENST00000222673.5	+	22	2892	c.2850T>C	c.(2848-2850)aaT>aaC	p.N950N	OGDH_ENST00000444676.1_Silent_p.N965N|OGDH_ENST00000449767.1_Silent_p.N946N|OGDH_ENST00000439616.2_Silent_p.N800N|OGDH_ENST00000543843.1_Silent_p.N901N|OGDH_ENST00000447398.1_Silent_p.N961N	NM_002541.3	NP_002532.2	Q02218	ODO1_HUMAN	oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)	950					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|cerebellar cortex development (GO:0021695)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hippocampus development (GO:0021766)|lysine catabolic process (GO:0006554)|NADH metabolic process (GO:0006734)|olfactory bulb mitral cell layer development (GO:0061034)|pyramidal neuron development (GO:0021860)|small molecule metabolic process (GO:0044281)|striatum development (GO:0021756)|succinyl-CoA metabolic process (GO:0006104)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)|thalamus development (GO:0021794)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)|oxoglutarate dehydrogenase complex (GO:0045252)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (NAD+) activity (GO:0034602)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	36					Valproic Acid(DB00313)	AGTACCCCAATGCTGAGCTGG	0.567																																					p.N950N		.											.	OGDH-228	0			c.T2850C						.						130.0	115.0	120.0					7																	44747234		2203	4300	6503	SO:0001819	synonymous_variant	4967	exon22			CCCCAATGCTGAG	D10523	CCDS34627.1, CCDS47580.1, CCDS55107.1	7p13-p11.2	2010-11-23			ENSG00000105953	ENSG00000105953	1.2.4.2		8124	protein-coding gene	gene with protein product		613022				8020988, 1542694	Standard	NM_002541		Approved	E1k	uc003tln.3	Q02218	OTTHUMG00000155304	ENST00000222673.5:c.2850T>C	7.37:g.44747234T>C		Somatic	186	0		WXS	Illumina HiSeq	Phase_I	239	66	NM_002541	0	0	77	114	37	B4E2U9|D3DVL0|E9PBM1|Q96DD3|Q9UDX0	Silent	SNP	ENST00000222673.5	37	CCDS34627.1																																																																																			.		0.567	OGDH-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339391.1		
GTF2IRD1	9569	hgsc.bcm.edu;broad.mit.edu	37	7	73932549	73932549	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr7:73932549G>A	ENST00000265755.3	+	5	895	c.502G>A	c.(502-504)Ggg>Agg	p.G168R	GTF2IRD1_ENST00000424337.2_Missense_Mutation_p.G168R|GTF2IRD1_ENST00000455841.2_Missense_Mutation_p.G200R|GTF2IRD1_ENST00000476977.1_Missense_Mutation_p.G168R|GTF2IRD1_ENST00000489094.1_3'UTR	NM_005685.3|NM_016328.2	NP_005676.3|NP_057412.1	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1	168					multicellular organismal development (GO:0007275)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transition between slow and fast fiber (GO:0014886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(19)|ovary(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						GGCCGTGCAGGGGCTGCCCGA	0.662																																					p.G200R		.											.	GTF2IRD1-94	0			c.G598A						.						21.0	21.0	21.0					7																	73932549		2200	4297	6497	SO:0001583	missense	9569	exon5			GTGCAGGGGCTGC	AF151354	CCDS5571.1, CCDS47613.1, CCDS56492.1	7q11.23	2008-04-18	2002-01-14		ENSG00000006704	ENSG00000006704			4661	protein-coding gene	gene with protein product	"""binding factor for early enhancer"""	604318	"""GTF2I repeat domain-containing 1"""	WBSCR11		9774679, 10198167	Standard	NM_016328		Approved	MusTRD1, RBAP2, GTF3, WBSCR12, BEN, Cream1	uc010lbq.3	Q9UHL9	OTTHUMG00000023782	ENST00000265755.3:c.502G>A	7.37:g.73932549G>A	ENSP00000265755:p.Gly168Arg	Somatic	37	1		WXS	Illumina HiSeq	Phase_I	48	3	NM_001199207	0	0	6	6	0	O95444|Q6DSU6|Q75MX7|Q86UM3|Q8WVC4|Q9UHK8|Q9UI91	Missense_Mutation	SNP	ENST00000265755.3	37	CCDS5571.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.047225	0.93740	.	.	ENSG00000006704	ENST00000265755;ENST00000455841;ENST00000424337;ENST00000476977	T;T;T;T	0.78816	-1.21;-1.21;-1.21;-1.21	4.66	4.66	0.58398	.	0.000000	0.85682	D	0.000000	D	0.88786	0.6531	M	0.82823	2.61	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.90625	0.4562	10	0.72032	D	0.01	-30.8558	16.9169	0.86153	0.0:0.0:1.0:0.0	.	200;168;168;168	Q6DSU6;E9PFE2;Q9UHL9;Q9UHL9-2	.;.;GT2D1_HUMAN;.	R	168;200;168;168	ENSP00000265755:G168R;ENSP00000397566:G200R;ENSP00000408477:G168R;ENSP00000418383:G168R	ENSP00000265755:G168R	G	+	1	0	GTF2IRD1	73570485	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.179000	0.94861	2.301000	0.77427	0.650000	0.86243	GGG	.		0.662	GTF2IRD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252654.2	NM_016328	
SSPO	23145	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	149502569	149502569	+	RNA	SNP	C	C	A			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr7:149502569C>A	ENST00000378016.2	+	0	8382							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CGGGAGGGGGCCCTGGCTGGC	0.677																																					p.G2794G		.											.	.	0			c.C8382A						.						35.0	41.0	39.0					7																	149502569		1903	4106	6009			23145	exon57			AGGGGGCCCTGGC	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149502569C>A		Somatic	69	0		WXS	Illumina HiSeq	Phase_I	85	16	NM_198455	0	0	0	0	0	Q76B61	Silent	SNP	ENST00000378016.2	37																																																																																				.		0.677	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript			
UBE3C	9690	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	156963038	156963038	+	Nonsense_Mutation	SNP	T	T	A			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr7:156963038T>A	ENST00000348165.5	+	4	596	c.236T>A	c.(235-237)tTg>tAg	p.L79*	UBE3C_ENST00000389103.4_Nonsense_Mutation_p.L36*	NM_014671.2	NP_055486.2	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	79					protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(2)|endometrium(3)|kidney(16)|large_intestine(13)|lung(25)|ovary(2)|prostate(1)|urinary_tract(1)	63		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		TGTGCTACCTTGTCACAGTCC	0.393																																					p.L79X		.											.	UBE3C-704	0			c.T236A						.						157.0	154.0	155.0					7																	156963038		2203	4300	6503	SO:0001587	stop_gained	9690	exon4			CTACCTTGTCACA	AK127280	CCDS34789.1	7q36.3	2004-05-04			ENSG00000009335	ENSG00000009335			16803	protein-coding gene	gene with protein product		614454				7584026, 11278995	Standard	NM_014671		Approved	KIAA0010, KIAA10	uc010lqs.3	Q15386	OTTHUMG00000157239	ENST00000348165.5:c.236T>A	7.37:g.156963038T>A	ENSP00000309198:p.Leu79*	Somatic	97	0		WXS	Illumina HiSeq	Phase_I	158	43	NM_014671	0	0	26	30	4	A4D235|A6NCP3|Q8TC15|Q96CR4|Q9UDU3	Nonsense_Mutation	SNP	ENST00000348165.5	37	CCDS34789.1	.	.	.	.	.	.	.	.	.	.	T	8.672	0.903131	0.17760	.	.	ENSG00000009335	ENST00000348165;ENST00000389103	.	.	.	4.82	1.18	0.20946	.	0.609361	0.15952	N	0.236699	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11182	T	0.66	.	6.478	0.22047	0.0:0.3795:0.0:0.6205	.	.	.	.	X	79;36	.	ENSP00000309198:L79X	L	+	2	0	UBE3C	156655799	0.001000	0.12720	0.000000	0.03702	0.007000	0.05969	1.040000	0.30278	-0.027000	0.13873	0.528000	0.53228	TTG	.		0.393	UBE3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348108.1	NM_014671	
KIF13B	23303	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	28991587	28991587	+	Silent	SNP	C	C	T			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr8:28991587C>T	ENST00000524189.1	-	22	2792	c.2754G>A	c.(2752-2754)ccG>ccA	p.P918P	CTD-2647L4.1_ENST00000523661.1_RNA	NM_015254.3	NP_056069.2	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	918					metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein targeting (GO:0006605)|regulation of axonogenesis (GO:0050770)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	axon (GO:0030424)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)			endometrium(6)|kidney(1)|lung(20)|urinary_tract(1)	28		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		CCATGCAGTGCGGCTCCTTGC	0.458																																					p.P918P		.											.	KIF13B-22	0			c.G2754A						.						60.0	60.0	60.0					8																	28991587		1999	4166	6165	SO:0001819	synonymous_variant	23303	exon22			GCAGTGCGGCTCC	AB014539	CCDS55217.1	8p21	2008-07-30				ENSG00000197892		"""Kinesins"""	14405	protein-coding gene	gene with protein product		607350				9734811, 10859302, 16864656	Standard	NM_015254		Approved	GAKIN, KIAA0639	uc003xhh.4	Q9NQT8		ENST00000524189.1:c.2754G>A	8.37:g.28991587C>T		Somatic	37	0		WXS	Illumina HiSeq	Phase_I	52	19	NM_015254	0	0	3	6	3	B4DGY5|B5MC45|F8VPJ2|O75134|Q9BYJ6	Silent	SNP	ENST00000524189.1	37	CCDS55217.1																																																																																			.		0.458	KIF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376878.1		
SPTLC1	10558	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	94821490	94821490	+	Silent	SNP	G	G	A			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr9:94821490G>A	ENST00000262554.2	-	7	666	c.661C>T	c.(661-663)Cta>Tta	p.L221L	SPTLC1_ENST00000482632.1_5'UTR	NM_006415.2	NP_006406.1	O15269	SPTC1_HUMAN	serine palmitoyltransferase, long chain base subunit 1	221					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphinganine biosynthetic process (GO:0046511)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|serine C-palmitoyltransferase complex (GO:0017059)|SPOTS complex (GO:0035339)	pyridoxal phosphate binding (GO:0030170)|serine C-palmitoyltransferase activity (GO:0004758)			breast(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	14					L-Serine(DB00133)	TGTTCTTTTAGTAGTCGCTCG	0.353																																					p.L221L		.											.	SPTLC1-154	0			c.C661T						.						82.0	76.0	78.0					9																	94821490		2203	4300	6503	SO:0001819	synonymous_variant	10558	exon7			CTTTTAGTAGTCG	Y08685	CCDS6692.1, CCDS6693.1	9q22.31	2014-09-17	2003-12-02		ENSG00000090054	ENSG00000090054	2.3.1.50		11277	protein-coding gene	gene with protein product		605712	"""hereditary sensory neuropathy, type 1"""	HSN1		9363775	Standard	NM_006415		Approved	LCB1, SPTI, HSAN1, hLCB1	uc004arl.1	O15269	OTTHUMG00000021047	ENST00000262554.2:c.661C>T	9.37:g.94821490G>A		Somatic	20	0		WXS	Illumina HiSeq	Phase_I	25	10	NM_006415	0	0	20	37	17	A8K681|Q5VWB4|Q96IX6	Silent	SNP	ENST00000262554.2	37	CCDS6692.1																																																																																			.		0.353	SPTLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055553.1	NM_006415	
OR1L8	138881	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	125330116	125330116	+	Missense_Mutation	SNP	C	C	T	rs377120372		TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr9:125330116C>T	ENST00000304865.2	-	1	722	c.641G>A	c.(640-642)tGc>tAc	p.C214Y		NM_001004454.1	NP_001004454.1	Q8NGR8	OR1L8_HUMAN	olfactory receptor, family 1, subfamily L, member 8	214						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20						GAAAGCAATGCAGAGAAAACG	0.438																																					p.C214Y		.											.	OR1L8-70	0			c.G641A						.						77.0	67.0	71.0					9																	125330116		2203	4300	6503	SO:0001583	missense	138881	exon1			GCAATGCAGAGAA		CCDS35124.1	9q33.2	2013-09-20			ENSG00000171496	ENSG00000171496		"""GPCR / Class A : Olfactory receptors"""	15110	protein-coding gene	gene with protein product							Standard	NM_001004454		Approved		uc004bmp.1	Q8NGR8	OTTHUMG00000020609	ENST00000304865.2:c.641G>A	9.37:g.125330116C>T	ENSP00000306607:p.Cys214Tyr	Somatic	33	0		WXS	Illumina HiSeq	Phase_I	48	23	NM_001004454	0	0	0	0	0	A3KFM3|B9EIR6|Q6IF15|Q96R79	Missense_Mutation	SNP	ENST00000304865.2	37	CCDS35124.1	.	.	.	.	.	.	.	.	.	.	C	11.71	1.720346	0.30503	.	.	ENSG00000171496	ENST00000304865	T	0.37411	1.2	4.49	-1.53	0.08611	GPCR, rhodopsin-like superfamily (1);	0.418105	0.20181	N	0.097537	T	0.49745	0.1575	L	0.55213	1.73	0.28899	N	0.893404	P	0.38167	0.621	P	0.55871	0.786	T	0.58387	-0.7645	10	0.59425	D	0.04	-12.7197	15.5399	0.76035	0.7908:0.2092:0.0:0.0	.	214	Q8NGR8	OR1L8_HUMAN	Y	214	ENSP00000306607:C214Y	ENSP00000306607:C214Y	C	-	2	0	OR1L8	124369937	0.000000	0.05858	0.169000	0.22859	0.363000	0.29612	0.406000	0.21032	-0.042000	0.13535	0.449000	0.29647	TGC	.		0.438	OR1L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053939.1		
NXT2	55916	hgsc.bcm.edu;broad.mit.edu	37	X	108780250	108780250	+	Splice_Site	SNP	G	G	A			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chrX:108780250G>A	ENST00000372106.1	+	1	146	c.15G>A	c.(13-15)ctG>ctA	p.L5L	NXT2_ENST00000218004.1_Splice_Site_p.L60L|NXT2_ENST00000372107.1_5'UTR|NXT2_ENST00000372103.1_5'Flank	NM_001242617.1	NP_001229546.1	Q9NPJ8	NXT2_HUMAN	nuclear transport factor 2-like export factor 2	5					mRNA transport (GO:0051028)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(3)|large_intestine(1)|lung(1)|ovary(1)	6						CCACGTCTCTGGTGAGTGCCT	0.642																																					p.L60L		.											.	NXT2-109	0			c.G180A						.						50.0	33.0	39.0					X																	108780250		2203	4300	6503	SO:0001630	splice_region_variant	55916	exon2			GTCTCTGGTGAGT	AF246127	CCDS14546.1, CCDS56605.1, CCDS56606.1	Xq22.3	2008-02-05			ENSG00000101888	ENSG00000101888			18151	protein-coding gene	gene with protein product		300320				11073998	Standard	NM_018698		Approved	P15-2	uc004eoe.2	Q9NPJ8	OTTHUMG00000022185	ENST00000372106.1:c.15+1G>A	X.37:g.108780250G>A		Somatic	20	0		WXS	Illumina HiSeq	Phase_I	15	6	NM_018698	0	0	0	0	0	D3DUY1|Q0VAN8|Q5JYV5|Q5JYV6|Q5JYV7|Q9H8U0|Q9NQ64|Q9NRL7|Q9Y3M4|Q9Y3M5	Silent	SNP	ENST00000372106.1	37	CCDS56605.1																																																																																			.		0.642	NXT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057886.1	NM_018698	Silent
THOC2	57187	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	122755201	122755201	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chrX:122755201T>A	ENST00000245838.8	-	31	4054	c.4023A>T	c.(4021-4023)aaA>aaT	p.K1341N	THOC2_ENST00000355725.4_Missense_Mutation_p.K1341N|THOC2_ENST00000491737.1_Missense_Mutation_p.K1226N|THOC2_ENST00000497887.1_5'Flank	NM_001081550.1	NP_001075019.1	Q8NI27	THOC2_HUMAN	THO complex 2	1341	Lys-rich.				mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			breast(2)|endometrium(13)|kidney(4)|large_intestine(11)|lung(26)|ovary(3)|skin(1)|upper_aerodigestive_tract(3)	63						TGGTCTTAAATTTCTCATCTT	0.373																																					p.K1341N		.											.	THOC2-133	0			c.A4023T						.						259.0	229.0	239.0					X																	122755201		1871	4088	5959	SO:0001583	missense	57187	exon31			CTTAAATTTCTCA	AF441770	CCDS43988.1	Xq25-q26.3	2013-02-11	2004-08-09		ENSG00000125676	ENSG00000125676		"""THO complex subunits"""	19073	protein-coding gene	gene with protein product		300395	"""chromosome X open reading frame 3"""	CXorf3		11979277	Standard	NM_001081550		Approved	THO2, dJ506G2.1	uc004etu.3	Q8NI27	OTTHUMG00000022334	ENST00000245838.8:c.4023A>T	X.37:g.122755201T>A	ENSP00000245838:p.Lys1341Asn	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	68	56	NM_001081550	0	0	0	15	15	A6NM50|Q5JZ12|Q6IN92|Q9H8I6	Missense_Mutation	SNP	ENST00000245838.8	37	CCDS43988.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.36|12.36	1.915943|1.915943	0.33815|0.33815	.|.	.|.	ENSG00000125676|ENSG00000125676	ENST00000245838;ENST00000355725;ENST00000491737|ENST00000441692	T;T;T|.	0.22539|.	1.95;1.95;1.95|.	5.32|5.32	4.16|4.16	0.48862|0.48862	.|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.51126|0.51126	0.1656|0.1656	L|L	0.36672|0.36672	1.1|1.1	0.53688|0.53688	D|D	0.999974|0.999974	P|.	0.43094|.	0.799|.	B|.	0.42692|.	0.395|.	T|T	0.40194|0.40194	-0.9576|-0.9576	9|5	.|.	.|.	.|.	-12.8428|-12.8428	8.5327|8.5327	0.33344|0.33344	0.0:0.2225:0.0:0.7775|0.0:0.2225:0.0:0.7775	.|.	1341|.	Q8NI27|.	THOC2_HUMAN|.	N|I	1341;1341;1226|109	ENSP00000245838:K1341N;ENSP00000347959:K1341N;ENSP00000419795:K1226N|.	.|.	K|N	-|-	3|2	2|0	THOC2|THOC2	122582882|122582882	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.949000|0.949000	0.60115|0.60115	1.873000|1.873000	0.39558|0.39558	0.776000|0.776000	0.33473|0.33473	0.486000|0.486000	0.48141|0.48141	AAA|AAT	.		0.373	THOC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058153.3		
RBMX	27316	hgsc.bcm.edu	37	X	135960073	135960073	+	Splice_Site	SNP	C	C	T			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chrX:135960073C>T	ENST00000320676.7	-	4	543		c.e4+1		RBMX_ENST00000562646.1_Splice_Site|RBMX_ENST00000570135.1_Intron|SNORD61_ENST00000384252.1_RNA|RBMX_ENST00000431446.3_Intron|RBMX_ENST00000565438.1_Splice_Site	NM_002139.3	NP_002130.2	P38159	RBMX_HUMAN	RNA binding motif protein, X-linked						cellular response to interleukin-1 (GO:0071347)|gene expression (GO:0010467)|membrane protein ectodomain proteolysis (GO:0006509)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|osteoblast differentiation (GO:0001649)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homooligomerization (GO:0051260)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|supraspliceosomal complex (GO:0044530)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|urinary_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					CAAGTTATTACCCATGTGTCC	0.537																																					.		.											.	RBMX-131	0			c.388+1G>A						.						66.0	64.0	65.0					X																	135960073		2203	4300	6503	SO:0001630	splice_region_variant	27316	exon5			TTATTACCCATGT		CCDS14661.1, CCDS55510.1	Xq26	2013-05-23	2003-09-12		ENSG00000147274	ENSG00000147274		"""RNA binding motif (RRM) containing"""	9910	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G"""	300199	"""RNA binding motif protein, X chromosome"""			10391206, 10391207	Standard	NM_002139		Approved	RNMX, hnRNP-G, HNRNPG	uc004fae.2	P38159	OTTHUMG00000022517	ENST00000320676.7:c.388+1G>A	X.37:g.135960073C>T		Somatic	44	1		WXS	Illumina HiSeq	Phase_I	50	4	NM_002139	0	0	0	0	0	B4E3U4|D3DWH0|E9PG86|Q5JQ67|Q8N8Y7|Q969R3	Splice_Site	SNP	ENST00000320676.7	37	CCDS14661.1	.	.	.	.	.	.	.	.	.	.	C	15.67	2.901881	0.52227	.	.	ENSG00000147274	ENST00000320676;ENST00000449161	.	.	.	4.04	4.04	0.47022	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5997	0.68432	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RBMX	135787739	.	.	1.000000	0.80357	0.740000	0.42216	.	.	2.272000	0.75746	0.504000	0.49776	.	.		0.537	RBMX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058507.1	NM_002139	Intron
PRMT6	55170	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	107600260	107600260	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr1:107600260delC	ENST00000370078.1	+	1	960	c.923delC	c.(922-924)tccfs	p.S308fs	PRMT6_ENST00000361318.5_Frame_Shift_Del_p.S249fs			Q96LA8	ANM6_HUMAN	protein arginine methyltransferase 6	308	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				base-excision repair (GO:0006284)|histone H3-R2 methylation (GO:0034970)|histone H4-R3 methylation (GO:0043985)|histone methylation (GO:0016571)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	histone binding (GO:0042393)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H2A-R3 specific) (GO:0070612)|histone methyltransferase activity (H3-R2 specific) (GO:0070611)|histone methyltransferase activity (H4-R3 specific) (GO:0044020)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)			biliary_tract(1)|breast(2)|kidney(1)|large_intestine(4)|lung(5)|urinary_tract(1)	14		all_epithelial(167;0.000429)|all_lung(203;0.00122)|Lung NSC(277;0.00185)		Lung(183;0.0305)|Epithelial(280;0.0765)|Colorectal(144;0.0998)|all cancers(265;0.14)|LUSC - Lung squamous cell carcinoma(189;0.173)|BRCA - Breast invasive adenocarcinoma(282;0.242)		CTGGTGCTGTCCACCTCGCCT	0.607																																					p.S308fs		.											.	PRMT6-90	0			c.923delC						.						44.0	48.0	47.0					1																	107600260		1973	4160	6133	SO:0001589	frameshift_variant	55170	exon1			.	AK001421	CCDS41360.1, CCDS41360.2	1p13.2	2008-02-05	2006-02-16	2006-02-16	ENSG00000198890	ENSG00000198890		"""Protein arginine methyltransferases"""	18241	protein-coding gene	gene with protein product		608274	"""HMT1 hnRNP methyltransferase-like 6 (S. cerevisiae)"""	HRMT1L6		11724789	Standard	NM_018137		Approved	FLJ10559	uc010ous.2	Q96LA8	OTTHUMG00000010964	ENST00000370078.1:c.923delC	1.37:g.107600260delC	ENSP00000359095:p.Ser308fs	Somatic	93	0		WXS	Illumina HiSeq	Phase_I	83	37	NM_018137	0	0	0	0	0	A3KME1|B4DID8|Q5T5Y5|Q6DKI4|Q9NVR8	Frame_Shift_Del	DEL	ENST00000370078.1	37	CCDS41360.2																																																																																			.		0.607	PRMT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030185.1	NM_018137	
POLR3C	10623	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	145592731	145592731	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr1:145592731delG	ENST00000334163.3	-	15	1724	c.1564delC	c.(1564-1566)ctgfs	p.L523fs	POLR3C_ENST00000369294.1_3'UTR	NM_006468.6	NP_006459.3	Q9BUI4	RPC3_HUMAN	polymerase (RNA) III (DNA directed) polypeptide C (62kD)	523					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|liver(1)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		Epithelial(2;7.55e-13)			GACTCCAGCAGGAAGATGGTT	0.438																																					p.L522fs		.											.	POLR3C-91	0			c.1564delC						.						124.0	107.0	113.0					1																	145592731		2203	4300	6503	SO:0001589	frameshift_variant	10623	exon15			.	AJ238234	CCDS72864.1	1q21	2013-01-21			ENSG00000186141	ENSG00000186141		"""RNA polymerase subunits"""	30076	protein-coding gene	gene with protein product						9171375, 12391170	Standard	NM_006468		Approved	RPC62, RPC3	uc001eoh.3	Q9BUI4	OTTHUMG00000013753	ENST00000334163.3:c.1564delC	1.37:g.145592731delG	ENSP00000334564:p.Leu523fs	Somatic	96	0		WXS	Illumina HiSeq	Phase_I	83	30	NM_006468	0	0	0	0	0	O15317|Q9Y3R6	Frame_Shift_Del	DEL	ENST00000334163.3	37	CCDS921.1																																																																																			.		0.438	POLR3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038542.1	NM_006468	
FOXJ2	55810	broad.mit.edu	37	12	8200558	8200560	+	In_Frame_Del	DEL	CAG	CAG	-	rs372118289		TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	CAG	CAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr12:8200558_8200560delCAG	ENST00000162391.3	+	7	2043_2045	c.898_900delCAG	c.(898-900)cagdel	p.Q306del	FOXJ2_ENST00000428177.2_In_Frame_Del_p.Q306del	NM_018416.2	NP_060886.1	Q9P0K8	FOXJ2_HUMAN	forkhead box J2	306	Poly-Gln.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			autonomic_ganglia(1)|large_intestine(2)|lung(6)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	16				Kidney(36;0.0944)		gccacctcaacagcagcagcagc	0.64																																					p.300_300del													.	FOXJ2-230	0			c.898_900del						.																																			SO:0001651	inframe_deletion	55810	exon7			CCTCAACAGCAGC	AF155132	CCDS8587.1	12p13.31	2006-12-15				ENSG00000065970		"""Forkhead boxes"""	24818	protein-coding gene	gene with protein product						10777590, 10966786	Standard	NM_018416		Approved	FHX	uc001qtu.3	Q9P0K8		ENST00000162391.3:c.898_900delCAG	12.37:g.8200567_8200569delCAG	ENSP00000162391:p.Gln306del	Somatic	51	0		WXS	Illumina HiSeq	Phase_I	100	9	NM_018416	0	0	0	0	0	A0AVK4|B2RMP3|Q96PS9|Q9NSN5	In_Frame_Del	DEL	ENST00000162391.3	37	CCDS8587.1																																																																																			.		0.640	FOXJ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400088.1	NM_018416	
CHD8	57680	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	21870158	21870158	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr14:21870158delG	ENST00000557364.1	-	20	4283	c.4020delC	c.(4018-4020)accfs	p.T1340fs	CHD8_ENST00000430710.3_Frame_Shift_Del_p.T1061fs|CHD8_ENST00000399982.2_Frame_Shift_Del_p.T1340fs|CHD8_ENST00000555962.1_5'UTR			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	1340					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		CAATGGTGATGGTTGTAGTTC	0.428																																					p.T1340fs		.											.	CHD8-277	0			c.4020delC						.						175.0	170.0	172.0					14																	21870158		2022	4216	6238	SO:0001589	frameshift_variant	57680	exon19			.	AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.4020delC	14.37:g.21870158delG	ENSP00000451601:p.Thr1340fs	Somatic	151	0		WXS	Illumina HiSeq	Phase_I	141	63	NM_001170629	0	0	0	0	0	Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Frame_Shift_Del	DEL	ENST00000557364.1	37	CCDS53885.1																																																																																			.		0.428	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410436.1	NM_020920	
SMG1	23049	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	18856931	18856931	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr16:18856931delC	ENST00000446231.2	-	39	6451	c.6039delG	c.(6037-6039)ttgfs	p.L2013fs	SMG1_ENST00000389467.3_Frame_Shift_Del_p.L2013fs			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	2013					DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						TGGGCTTCATCAAAGCTGTGT	0.388																																					p.L2013fs		.											.	SMG1-1160	0			c.6039delG						.						130.0	120.0	123.0					16																	18856931		1903	4130	6033	SO:0001589	frameshift_variant	23049	exon39			.	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.6039delG	16.37:g.18856931delC	ENSP00000402515:p.Leu2013fs	Somatic	99	0		WXS	Illumina HiSeq	Phase_I	140	84	NM_015092	0	0	0	0	0	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Frame_Shift_Del	DEL	ENST00000446231.2	37	CCDS45430.1																																																																																			.		0.388	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	NM_015092	
NPIPB5	100132247	broad.mit.edu	37	16	22545580	22545585	+	In_Frame_Del	DEL	AATCTC	AATCTC	-			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	AATCTC	AATCTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr16:22545580_22545585delAATCTC	ENST00000517539.1	+	8	1351_1356	c.1276_1281delAATCTC	c.(1276-1281)aatctcdel	p.NL426del	NPIPB5_ENST00000424340.1_In_Frame_Del_p.NL426del|NPIPB5_ENST00000415654.1_3'UTR			A8MRT5	NPIB5_HUMAN	nuclear pore complex interacting protein family, member B5	426	Pro-rich.					integral component of membrane (GO:0016021)											AGCGGATGATAATCTCAAGACACCTT	0.597																																					p.426_427del													.	.	0			c.1276_1281del						.			2,380		1,0,190							0.0			1	16,654		5,6,324	no	coding	LOC100132247	NM_001135865.1		6,6,514	A1A1,A1R,RR		2.3881,0.5236,1.711				18,1034				SO:0001651	inframe_deletion	0	exon7			GATGATAATCTCA		CCDS45443.1	16p12.2	2013-06-11			ENSG00000243716	ENSG00000243716			37233	protein-coding gene	gene with protein product							Standard	NM_001135865		Approved			A8MRT5	OTTHUMG00000163573	ENST00000517539.1:c.1276_1281delAATCTC	16.37:g.22545580_22545585delAATCTC	ENSP00000430633:p.Asn426_Leu427del	Somatic	160	0		WXS	Illumina HiSeq	Phase_I	203	6	NM_001135865	0	0	0	0	0	B4DK13	In_Frame_Del	DEL	ENST00000517539.1	37	CCDS45443.1																																																																																			.		0.597	NPIPB5-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374343.2	NM_001135865	
PIP5K1C	23396	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	3653310	3653310	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr19:3653310delT	ENST00000335312.3	-	7	987	c.899delA	c.(898-900)aagfs	p.K300fs	PIP5K1C_ENST00000587482.1_5'UTR|PIP5K1C_ENST00000589578.1_Frame_Shift_Del_p.K300fs|PIP5K1C_ENST00000539785.1_Frame_Shift_Del_p.K300fs|PIP5K1C_ENST00000537021.1_Frame_Shift_Del_p.K300fs	NM_001195733.1|NM_012398.2	NP_001182662.1|NP_036530.1	O60331	PI51C_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type I, gamma	300	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				actin cytoskeleton organization (GO:0030036)|adherens junction assembly (GO:0034333)|axon guidance (GO:0007411)|clathrin-mediated endocytosis (GO:0072583)|cytoskeletal anchoring at plasma membrane (GO:0007016)|neutrophil chemotaxis (GO:0030593)|phagocytosis (GO:0006909)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet aggregation (GO:0070527)|single organismal cell-cell adhesion (GO:0016337)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle exocytosis (GO:0016079)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|uropod (GO:0001931)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)			large_intestine(3)|ovary(1)|skin(3)|stomach(2)	9		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.95e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0026)|STAD - Stomach adenocarcinoma(1328;0.183)		CTGCAGCGTCTTGACCAGGGC	0.692																																					p.K300fs	Esophageal Squamous(135;99 1744 12852 27186 39851)	.											.	PIP5K1C-267	0			c.899delA						.						39.0	27.0	31.0					19																	3653310		2203	4297	6500	SO:0001589	frameshift_variant	23396	exon7			.	AB011161	CCDS32872.1, CCDS56074.1, CCDS74257.1	19p13.3	2012-10-02			ENSG00000186111	ENSG00000186111			8996	protein-coding gene	gene with protein product		606102				9535851	Standard	NM_001195733		Approved	PIP5Kgamma, KIAA0589, LCCS3	uc002lyj.2	O60331	OTTHUMG00000180870	ENST00000335312.3:c.899delA	19.37:g.3653310delT	ENSP00000335333:p.Lys300fs	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	67	24	NM_001195733	0	0	0	0	0	B7Z9E7|C6GIJ7|C6GIJ8|Q7LE07	Frame_Shift_Del	DEL	ENST00000335312.3	37	CCDS32872.1																																																																																			.		0.692	PIP5K1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453432.2	NM_012398	
FBXO36	130888	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	230861514	230861516	+	In_Frame_Del	DEL	AAT	AAT	-			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	AAT	AAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr2:230861514_230861516delAAT	ENST00000283946.3	+	3	271_273	c.253_255delAAT	c.(253-255)aatdel	p.N85del	FBXO36_ENST00000373652.3_In_Frame_Del_p.N54del|FBXO36_ENST00000409992.1_Intron	NM_174899.4	NP_777559.3	Q8NEA4	FBX36_HUMAN	F-box protein 36	85										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	7		Renal(207;0.0112)|all_lung(227;0.0179)|Lung NSC(271;0.0804)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;7.56e-14)|all cancers(144;7.74e-11)|Lung(119;0.00488)|LUSC - Lung squamous cell carcinoma(224;0.008)		CTATGTCATCAATTTGTGCAAAG	0.355																																					p.85_85del		.											.	FBXO36-227	0			c.253_255del						.																																			SO:0001651	inframe_deletion	130888	exon3			.	BC033935	CCDS2472.1	2q37.1	2008-02-05	2004-06-15		ENSG00000153832	ENSG00000153832		"""F-boxes /  ""other"""""	27020	protein-coding gene	gene with protein product		609105	"""F-box only protein 36"""			12477932	Standard	NM_174899		Approved	Fbx36, FLJ37592	uc002vqa.3	Q8NEA4	OTTHUMG00000133206	ENST00000283946.3:c.253_255delAAT	2.37:g.230861514_230861516delAAT	ENSP00000283946:p.Asn85del	Somatic	152	0		WXS	Illumina HiSeq	Phase_I	115	47	NM_174899	0	0	0	0	0	B3KVQ6|Q53TE6|Q8WWD4	In_Frame_Del	DEL	ENST00000283946.3	37	CCDS2472.1																																																																																			.		0.355	FBXO36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256919.2	NM_174899	
PARP14	54625	hgsc.bcm.edu	37	3	122433232	122433232	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr3:122433232delA	ENST00000474629.2	+	12	4222	c.3956delA	c.(3955-3957)gaafs	p.E1319fs		NM_017554.2	NP_060024.2	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	1319	Macro 3. {ECO:0000255|PROSITE- ProRule:PRU00490}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(2)|breast(5)|cervix(2)|endometrium(7)|kidney(5)|large_intestine(8)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	50				GBM - Glioblastoma multiforme(114;0.0531)		CAGGAGTGTGAAAAAAAAAAT	0.423																																					p.E1319fs		.											.	PARP14-525	0			c.3956delA						.			3,21,3610		1,0,1,3,15,1797	57.0	55.0	56.0			5.5	1.0	3		57	12,36,7812		3,1,5,1,33,3887	no	codingComplex	PARP14	NM_017554.2		4,1,6,4,48,5684	A1A1,A1A2,A1R,A2A2,A2R,RR		0.6107,0.6604,0.6264			122433232	15,57,11422	1884	4109	5993	SO:0001589	frameshift_variant	54625	exon12			.	AB033094	CCDS46894.1	3q21	2010-02-16			ENSG00000173193	ENSG00000173193		"""Poly (ADP-ribose) polymerases"""	29232	protein-coding gene	gene with protein product		610028				15273990	Standard	NM_017554		Approved	KIAA1268, pART8	uc003efq.4	Q460N5	OTTHUMG00000159552	ENST00000474629.2:c.3956delA	3.37:g.122433232delA	ENSP00000418194:p.Glu1319fs	Somatic	44	0		WXS	Illumina HiSeq	Phase_I	60	10	NM_017554	0	0	0	0	0	B4E2H0|Q460N4|Q8J027|Q9H9X9|Q9NV60|Q9ULF2	Frame_Shift_Del	DEL	ENST00000474629.2	37	CCDS46894.1																																																																																			.		0.423	PARP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356173.2	NM_017554	
CEP63	80254	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	134267996	134267996	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr3:134267996delA	ENST00000337090.3	+	10	1333	c.1160delA	c.(1159-1161)gaafs	p.E387fs	CEP63_ENST00000332047.5_Frame_Shift_Del_p.E341fs|CEP63_ENST00000513612.2_Frame_Shift_Del_p.E387fs|CEP63_ENST00000606977.1_Frame_Shift_Del_p.E387fs|CEP63_ENST00000354446.3_Frame_Shift_Del_p.E341fs|CEP63_ENST00000383229.3_Frame_Shift_Del_p.E387fs			Q96MT8	CEP63_HUMAN	centrosomal protein 63kDa	387					centriole replication (GO:0007099)|DNA damage checkpoint (GO:0000077)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|signal transduction in response to DNA damage (GO:0042770)|spindle assembly (GO:0051225)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|spindle pole (GO:0000922)				kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						CATAACAATGAATACAAAGCA	0.373																																					p.E387fs		.											.	CEP63-493	0			c.1160delA						.						98.0	89.0	92.0					3																	134267996		2203	4300	6503	SO:0001589	frameshift_variant	80254	exon11			.	AK056465	CCDS3086.1, CCDS43152.1, CCDS43153.1, CCDS43154.1	3q22.1	2014-02-20			ENSG00000182923	ENSG00000182923			25815	protein-coding gene	gene with protein product		614724				14654843, 24240477	Standard	NM_001042383		Approved	FLJ13386	uc003eqo.1	Q96MT8	OTTHUMG00000159725	ENST00000337090.3:c.1160delA	3.37:g.134267996delA	ENSP00000336524:p.Glu387fs	Somatic	38	0		WXS	Illumina HiSeq	Phase_I	52	16	NM_025180	0	0	0	0	0	D3DND8|D3DND9|D3DNE0|Q96CR0|Q9H8F5|Q9H8N0	Frame_Shift_Del	DEL	ENST00000337090.3	37	CCDS3086.1																																																																																			.		0.373	CEP63-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000470139.1	NM_025180	
SHROOM3	57619	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	77661360	77661360	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr4:77661360delG	ENST00000296043.6	+	5	2987	c.2034delG	c.(2032-2034)ctgfs	p.L678fs		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	678					actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			ACAGCAGCCTGGAGCTAGGCC	0.602																																					p.L678fs		.											.	SHROOM3-93	0			c.2034delG						.						46.0	58.0	54.0					4																	77661360		2203	4300	6503	SO:0001589	frameshift_variant	57619	exon5			.	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.2034delG	4.37:g.77661360delG	ENSP00000296043:p.Leu678fs	Somatic	156	0		WXS	Illumina HiSeq	Phase_I	165	83	NM_020859	0	0	0	0	0	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Frame_Shift_Del	DEL	ENST00000296043.6	37	CCDS3579.2																																																																																			.		0.602	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	NM_020859	
GPANK1	7918	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	31632033	31632035	+	In_Frame_Del	DEL	TTC	TTC	-	rs367920721		TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	TTC	TTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr6:31632033_31632035delTTC	ENST00000375906.1	-	3	905_907	c.221_223delGAA	c.(220-225)agaata>ata	p.R74del	GPANK1_ENST00000375900.4_In_Frame_Del_p.R74del|CSNK2B-LY6G5B-1181_ENST00000375880.2_5'Flank|CSNK2B_ENST00000375865.2_5'Flank|CSNK2B_ENST00000375882.2_5'Flank|CSNK2B_ENST00000375885.4_5'Flank|GPANK1_ENST00000375895.2_In_Frame_Del_p.R74del|GPANK1_ENST00000375896.4_In_Frame_Del_p.R74del|GPANK1_ENST00000375893.2_In_Frame_Del_p.R74del|Y_RNA_ENST00000364337.1_RNA|CSNK2B_ENST00000375866.2_5'Flank	NM_001199237.1	NP_001186166.1	O95872	GPAN1_HUMAN	G patch domain and ankyrin repeats 1	74							nucleic acid binding (GO:0003676)			central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(7)	12						GCCTTCATTATTCTTCTTTTCTT	0.507																																					p.74_75del		.											.	GPANK1-91	0			c.221_223del						.		,,,,	3,4259		1,1,2129					,,,,	-2.1	0.0			84	2,8250		0,2,4124	no	coding,coding,coding,coding,coding	GPANK1	NM_033177.3,NM_001199240.1,NM_001199239.1,NM_001199238.1,NM_001199237.1	,,,,	1,3,6253	A1A1,A1R,RR		0.0242,0.0704,0.04	,,,,	,,,,		5,12509				SO:0001651	inframe_deletion	7918	exon3			.		CCDS4711.1	6p21.3	2013-01-28	2010-11-24	2010-11-24	ENSG00000204438	ENSG00000204438		"""Ankyrin repeat domain containing"", ""G patch domain containing"""	13920	protein-coding gene	gene with protein product	"""G patch domain containing 10"", ""ankyrin repeat domain 59"""	142610	"""HLA-B associated transcript 4"""	BAT4		2911734, 2813433	Standard	NM_001199237		Approved	G5, D6S54E, GPATCH10, ANKRD59	uc021yuu.1	O95872	OTTHUMG00000031174	ENST00000375906.1:c.221_223delGAA	6.37:g.31632036_31632038delTTC	ENSP00000365071:p.Arg74del	Somatic	95	0		WXS	Illumina HiSeq	Phase_I	92	34	NM_001199238	0	0	0	0	0	A6NG25|B0UXA2|Q5SQ49	In_Frame_Del	DEL	ENST00000375906.1	37	CCDS4711.1																																																																																			.		0.507	GPANK1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000144445.2	NM_033177	
TMEM60	85025	broad.mit.edu	37	7	77423460	77423460	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr7:77423460delT	ENST00000257663.3	-	2	607	c.231delA	c.(229-231)aaafs	p.K77fs		NM_032936.3	NP_116325.1	Q9H2L4	TMM60_HUMAN	transmembrane protein 60	77						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(2)	4						GGTACCAGGCTTTTTTTTTAA	0.408																																					p.K77fs													.	TMEM60-90	0			c.231delA						.						142.0	141.0	141.0					7																	77423460		2203	4300	6503	SO:0001589	frameshift_variant	85025	exon2			CCAGGCTTTTTTT	AF260336	CCDS5593.1	7q11.23	2005-07-25	2005-07-25	2005-07-25	ENSG00000135211	ENSG00000135211			21754	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 35"""	C7orf35			Standard	NM_032936		Approved	DC32	uc003ugn.3	Q9H2L4	OTTHUMG00000130689	ENST00000257663.3:c.231delA	7.37:g.77423460delT	ENSP00000257663:p.Lys77fs	Somatic	121	0		WXS	Illumina HiSeq	Phase_I	199	8	NM_032936	0	0	0	0	0	A4D1C3|Q86UM0	Frame_Shift_Del	DEL	ENST00000257663.3	37	CCDS5593.1																																																																																			.		0.408	TMEM60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253185.2	NM_032936	
DDX58	23586	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	32467853	32467868	+	Frame_Shift_Del	DEL	AGGTGGCAATCAGAAT	AGGTGGCAATCAGAAT	-	rs61757209	byFrequency	TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	AGGTGGCAATCAGAAT	AGGTGGCAATCAGAAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr9:32467853_32467868delAGGTGGCAATCAGAAT	ENST00000379883.2	-	15	2234_2249	c.2077_2092delATTCTGATTGCCACCT	c.(2077-2094)attctgattgccacctcafs	p.ILIATS693fs	DDX58_ENST00000542096.1_Frame_Shift_Del_p.ILIATS622fs|DDX58_ENST00000379868.1_Frame_Shift_Del_p.ILIATS490fs|DDX58_ENST00000379882.1_Frame_Shift_Del_p.ILIATS648fs|DDX58_ENST00000545044.1_Frame_Shift_Del_p.ILIATS490fs	NM_014314.3	NP_055129.2	O95786	DDX58_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 58	693	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Interaction with ZC3HAV1.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell migration (GO:0030334)|regulation of type III interferon production (GO:0034344)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RIG-I signaling pathway (GO:0039529)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|identical protein binding (GO:0042802)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)		TCAGCAACTGAGGTGGCAATCAGAATATTGTGATCT	0.435																																					p.693_698del		.											.	DDX58-230	0			c.2077_2092del						.																																			SO:0001589	frameshift_variant	23586	exon15			.	AF038963	CCDS6526.1	9p12	2011-08-05			ENSG00000107201	ENSG00000107201		"""DEAD-boxes"""	19102	protein-coding gene	gene with protein product	"""RNA helicase RIG-I"", ""retinoic acid inducible gene I"""	609631				21690088	Standard	NM_014314		Approved	RIG-I, FLJ13599, DKFZp434J1111	uc003zra.3	O95786	OTTHUMG00000019746	ENST00000379883.2:c.2077_2092delATTCTGATTGCCACCT	9.37:g.32467853_32467868delAGGTGGCAATCAGAAT	ENSP00000369213:p.Ile693fs	Somatic	78	0		WXS	Illumina HiSeq	Phase_I	54	21	NM_014314	0	0	0	0	0	A2RU81|Q5HYE1|Q5VYT1|Q9NT04	Frame_Shift_Del	DEL	ENST00000379883.2	37	CCDS6526.1																																																																																			.		0.435	DDX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052011.1	NM_014314	
WWC3	55841	broad.mit.edu;bcgsc.ca	37	X	10094307	10094307	+	Frame_Shift_Del	DEL	C	C	-	rs199701428		TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chrX:10094307delC	ENST00000380861.4	+	15	2458	c.2067delC	c.(2065-2067)tacfs	p.Y689fs	WWC3_ENST00000454666.1_Frame_Shift_Del_p.Y689fs	NM_015691.3	NP_056506.2	Q9ULE0	WWC3_HUMAN	WWC family member 3	689	C2.				negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(3)|endometrium(10)|kidney(1)|large_intestine(11)|lung(17)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	52						TTCAGTTATACGTGTGTTCAG	0.572																																					p.Y689X													.	WWC3-134	0			c.2067delC						.						114.0	95.0	101.0					X																	10094307		2203	4300	6503	SO:0001589	frameshift_variant	55841	exon15			GTTATACGTGTGT	AK091936	CCDS14136.1	Xp22.32	2008-02-05			ENSG00000047644	ENSG00000047644		"""WW, C2 and coiled-coil domain containing"""	29237	protein-coding gene	gene with protein product						10574462	Standard	NM_015691		Approved	KIAA1280, BM042	uc004csx.4	Q9ULE0	OTTHUMG00000021123	ENST00000380861.4:c.2067delC	X.37:g.10094307delC	ENSP00000370242:p.Tyr689fs	Somatic	84	0		WXS	Illumina HiSeq	Phase_I	75	11	NM_015691	0	0	0	0	0	A8KA96|Q659C1|Q9BTQ1	Nonsense_Mutation	DEL	ENST00000380861.4	37	CCDS14136.1																																																																																			.		0.572	WWC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055725.1	NM_015691	
SCAPER	49855	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	76726602	76726603	+	Frame_Shift_Ins	INS	-	-	TA			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr15:76726602_76726603insTA	ENST00000563290.1	-	26	3222_3223	c.3127_3128insTA	c.(3127-3129)aaafs	p.K1043fs	SCAPER_ENST00000538941.2_Frame_Shift_Ins_p.K797fs|SCAPER_ENST00000324767.7_Frame_Shift_Ins_p.K1043fs			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	1043						endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						AAAAACTTGTTTATTTGTATTT	0.371																																					p.K1043fs		.											.	SCAPER-137	0			c.3128_3129insTA						.																																			SO:0001589	frameshift_variant	49855	exon25			.	AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.3126_3127dupTA	15.37:g.76726603_76726604dupTA	ENSP00000454973:p.Lys1043fs	Somatic	91	0		WXS	Illumina HiSeq	Phase_I	95	36	NM_020843	0	0	0	0	0	F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Frame_Shift_Ins	INS	ENST00000563290.1	37	CCDS53962.1																																																																																			.		0.371	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419698.1	NM_020843	
CHMP2A	27243	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	59063432	59063433	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr19:59063432_59063433insT	ENST00000600118.1	-	3	893_894	c.468_469insA	c.(466-471)gatgaafs	p.E157fs	CHMP2A_ENST00000601220.1_Frame_Shift_Ins_p.E157fs|CHMP2A_ENST00000312547.2_Frame_Shift_Ins_p.E157fs			O43633	CHM2A_HUMAN	charged multivesicular body protein 2A	157	Interaction with VPS4B.				endosomal transport (GO:0016197)|establishment of protein localization (GO:0045184)|membrane organization (GO:0061024)|positive regulation of viral release from host cell (GO:1902188)|protein transport (GO:0015031)|regulation of viral process (GO:0050792)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein domain specific binding (GO:0019904)			endometrium(1)|kidney(1)|large_intestine(3)|lung(2)	7		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)		CTCTCCTCTTCATCTTCCTCAT	0.505																																					p.E157fs		.											.	CHMP2A-90	0			c.469_470insA						.																																			SO:0001589	frameshift_variant	27243	exon4			.	AF042384	CCDS12986.1	19q13.43	2014-09-04	2011-09-21		ENSG00000130724	ENSG00000130724		"""Charged multivesicular body proteins"""	30216	protein-coding gene	gene with protein product	"""putative breast adenocarcinoma marker (32kD)"", ""VPS2 homolog A (S. cerevisiae)"""	610893	"""chromatin modifying protein 2A"""			15173323, 11559748	Standard	XM_005258746		Approved	BC-2, CHMP2, VPS2, VPS2A	uc002qtk.3	O43633	OTTHUMG00000183547	ENST00000600118.1:c.468_469insA	19.37:g.59063432_59063433insT	ENSP00000469240:p.Glu157fs	Somatic	281	0		WXS	Illumina HiSeq	Phase_I	216	80	NM_198426	0	0	0	0	0	B2R4W6|Q3ZTT0	Frame_Shift_Ins	INS	ENST00000600118.1	37	CCDS12986.1																																																																																			.		0.505	CHMP2A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467088.1	NM_014453	
NEUROD6	63974	broad.mit.edu	37	7	31378634	31378635	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr7:31378634_31378635insT	ENST00000297142.3	-	2	570_571	c.248_249insA	c.(247-249)aagfs	p.K83fs		NM_022728.2	NP_073565.2	Q96NK8	NDF6_HUMAN	neuronal differentiation 6	83					cell differentiation (GO:0030154)|dentate gyrus development (GO:0021542)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	32						GCTTTGTTGTCTTTTTTTTCCT	0.52																																					p.K83fs													.	NEUROD6-92	0			c.249_250insA						.																																			SO:0001589	frameshift_variant	63974	exon2			TGTTGTCTTTTTT	AF248954	CCDS5434.1	7p15.1	2013-05-21	2012-02-22		ENSG00000164600	ENSG00000164600		"""Basic helix-loop-helix proteins"""	13804	protein-coding gene	gene with protein product		611513	"""neurogenic differentiation 6"""			12357074	Standard	NM_022728		Approved	Atoh2, NEX1M, Math-2, bHLHa2, Nex1	uc003tch.4	Q96NK8	OTTHUMG00000022865	ENST00000297142.3:c.249dupA	7.37:g.31378642_31378642dupT	ENSP00000297142:p.Lys83fs	Somatic	220	0		WXS	Illumina HiSeq	Phase_I	357	0	NM_022728	0	0	0	0	0	Q548T9|Q9H3H6	Frame_Shift_Ins	INS	ENST00000297142.3	37	CCDS5434.1																																																																																			.		0.520	NEUROD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215050.1	NM_022728	
LRRC55	219527	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	56949791	56949792	+	Missense_Mutation	DNP	AA	AA	TC			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	AA	AA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr11:56949791_56949792AA>TC	ENST00000497933.1	+	1	571_572	c.424_425AA>TC	c.(424-426)AAc>TCc	p.N142S		NM_001005210.2	NP_001005210.1	Q6ZSA7	LRC55_HUMAN	leucine rich repeat containing 55	112					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(13)|ovary(2)|skin(2)	25						TTTGCACAACAACTCCTTAATG	0.584																																					p.N142S		.											.	LRRC55	0			c.A425C						.																																			SO:0001583	missense	219527	exon1			ACAACAACTCCTT		CCDS31539.1	11q12.1	2008-02-05			ENSG00000183908	ENSG00000183908			32324	protein-coding gene	gene with protein product		615213					Standard	NM_001005210		Approved	FLJ45686	uc001njl.2	Q6ZSA7	OTTHUMG00000159309	Exception_encountered	11.37:g.56949791_56949792delinsTC	ENSP00000419542:p.Asn142Ser	Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	16.0		0	0	0	0	0	A7E2U7|B2RN81	Missense_Mutation	DNP	ENST00000497933.1	37	CCDS31539.1																																																																																			.		0.584	LRRC55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354503.2	NM_001005210	
CUL9	23113	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	43153712	43153713	+	Missense_Mutation	DNP	TC	TC	CT			TCGA-A4-8517-01A-11D-2396-08	TCGA-A4-8517-10A-01D-2396-08	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d231371b-1540-4abd-bde7-41846fb8a9a1	4ccb3bcc-4c0f-4047-97fc-0515f0cf05b5	g.chr6:43153712_43153713TC>CT	ENST00000252050.4	+	4	854_855	c.770_771TC>CT	c.(769-771)tTC>tCT	p.F257S	CUL9_ENST00000354495.3_Missense_Mutation_p.F257S|CUL9_ENST00000372647.2_Missense_Mutation_p.F257S	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	257					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						AAGCTGCTTTTCTCCTTGGTGA	0.53																																					p.F257S		.											.	CUL9	0			c.C771T						.																																			SO:0001583	missense	23113	exon4			GCTTTTCTCCTTG	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	Exception_encountered	6.37:g.43153712_43153713delinsCT	ENSP00000252050:p.Phe257Ser	Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	30.0		0	0	0	0	0	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	DNP	ENST00000252050.4	37	CCDS4890.1																																																																																			.		0.530	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089	
