#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SSU72	29101	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	1480325	1480325	+	Silent	SNP	C	C	T	rs138912153		TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr1:1480325C>T	ENST00000291386.3	-	3	593	c.282G>A	c.(280-282)cgG>cgA	p.R94R		NM_014188.2	NP_054907.1	Q9NP77	SSU72_HUMAN	SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae)	94					dephosphorylation of RNA polymerase II C-terminal domain (GO:0070940)|mRNA polyadenylation (GO:0006378)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)			large_intestine(2)|lung(5)	7	all_cancers(77;0.00125)|all_epithelial(69;0.000703)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.03e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;5.04e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.72e-23)|GBM - Glioblastoma multiforme(42;1.2e-07)|Colorectal(212;0.000188)|COAD - Colon adenocarcinoma(227;0.000214)|Kidney(185;0.00254)|STAD - Stomach adenocarcinoma(132;0.00645)|BRCA - Breast invasive adenocarcinoma(365;0.00837)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		ATCTTTCTGGCCGGGGCTTGA	0.478																																					p.R94R		.											.	SSU72-90	0			c.G282A						.						183.0	192.0	189.0					1																	1480325		2203	4300	6503	SO:0001819	synonymous_variant	29101	exon3			TTCTGGCCGGGGC	AJ276409	CCDS32.1	1p36	2010-03-24	2006-04-04		ENSG00000160075	ENSG00000160075			25016	protein-coding gene	gene with protein product			"""Ssu72 RNA polymerase II CTD phosphatase homolog (yeast)"""			15125841, 15659578	Standard	NM_014188		Approved	HSPC182	uc001agd.3	Q9NP77	OTTHUMG00000000576	ENST00000291386.3:c.282G>A	1.37:g.1480325C>T		Somatic	265	0		WXS	Illumina HiSeq	Phase_I	197	71	NM_014188	0	0	100	166	66	Q9BZS6|Q9H933	Silent	SNP	ENST00000291386.3	37	CCDS32.1																																																																																			C|1.000;A|0.000		0.478	SSU72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001366.1	NM_014188	
TMEM52	339456	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	1849335	1849335	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr1:1849335G>T	ENST00000310991.3	-	5	623	c.616C>A	c.(616-618)Cct>Act	p.P206T	TMEM52_ENST00000378602.3_Missense_Mutation_p.P191T	NM_178545.3	NP_848640.1	Q8NDY8	TMM52_HUMAN	transmembrane protein 52	206						integral component of membrane (GO:0016021)				NS(1)|prostate(1)|stomach(1)	3	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.82e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.75e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		GGGGCACCAGGGCTACAAGGT	0.617																																					p.P206T		.											.	TMEM52-68	0			c.C616A						.						94.0	106.0	102.0					1																	1849335		2203	4300	6503	SO:0001583	missense	339456	exon5			CACCAGGGCTACA	AJ278736	CCDS35.1	1p36.33	2008-02-05			ENSG00000178821	ENSG00000178821			27916	protein-coding gene	gene with protein product							Standard	NM_178545		Approved		uc001aij.2	Q8NDY8	OTTHUMG00000000944	ENST00000310991.3:c.616C>A	1.37:g.1849335G>T	ENSP00000311122:p.Pro206Thr	Somatic	165	1		WXS	Illumina HiSeq	Phase_I	150	53	NM_178545	0	0	1	4	3	Q4VXS6|Q6UX25	Missense_Mutation	SNP	ENST00000310991.3	37	CCDS35.1	.	.	.	.	.	.	.	.	.	.	.	14.32	2.500213	0.44455	.	.	ENSG00000178821	ENST00000378602;ENST00000310991	T;T	0.38560	1.13;1.34	3.67	1.68	0.24146	.	1.510860	0.05074	N	0.482172	T	0.23330	0.0564	N	0.08118	0	0.09310	N	1	B;B	0.30709	0.035;0.291	B;B	0.26693	0.017;0.072	T	0.25467	-1.0131	10	0.87932	D	0	1.4905	4.9634	0.14078	0.118:0.0:0.6558:0.2262	.	206;191	Q8NDY8;Q8NDY8-2	TMM52_HUMAN;.	T	191;206	ENSP00000367865:P191T;ENSP00000311122:P206T	ENSP00000311122:P206T	P	-	1	0	TMEM52	1839195	0.047000	0.20315	0.006000	0.13384	0.013000	0.08279	0.367000	0.20382	0.273000	0.22049	-1.334000	0.01262	CCT	.		0.617	TMEM52-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000002781.1	NM_178545	
CELA3B	23436	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	22310247	22310247	+	Silent	SNP	C	C	T			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr1:22310247C>T	ENST00000337107.6	+	5	442	c.423C>T	c.(421-423)ctC>ctT	p.L141L		NM_007352.2	NP_031378.1	P08861	CEL3B_HUMAN	chymotrypsin-like elastase family, member 3B	141	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cholesterol metabolic process (GO:0008203)|proteolysis (GO:0006508)		peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			breast(2)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	8						CCGTCCAGCTCGCCTCACTCC	0.632																																					p.L141L		.											.	CELA3B-91	0			c.C423T						.						96.0	77.0	83.0					1																	22310247		2203	4300	6503	SO:0001819	synonymous_variant	23436	exon5			CCAGCTCGCCTCA	M18692	CCDS219.1	1p36.12	2009-05-05	2009-05-05	2009-05-05	ENSG00000219073	ENSG00000219073	3.4.21.70		15945	protein-coding gene	gene with protein product	"""proteinase E"", ""elastase 1"", ""cholesterol-binding pancreatic protease"", ""pancreatic endopeptidase E"""		"""elastase 3B, pancreatic"""	ELA3B		2826474, 2460440	Standard	NM_007352		Approved	CBPP	uc001bfk.3	P08861	OTTHUMG00000002758	ENST00000337107.6:c.423C>T	1.37:g.22310247C>T		Somatic	136	0		WXS	Illumina HiSeq	Phase_I	119	38	NM_007352	0	0	0	0	0	B2RE44|P11423|Q5VU28|Q5VU29|Q5VU30	Silent	SNP	ENST00000337107.6	37	CCDS219.1																																																																																			.		0.632	CELA3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007797.1	NM_007352	
ASAP3	55616	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	23759922	23759922	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr1:23759922T>A	ENST00000336689.3	-	21	2167	c.2123A>T	c.(2122-2124)gAg>gTg	p.E708V	ASAP3_ENST00000495646.1_Missense_Mutation_p.E212V|ASAP3_ENST00000437606.2_Missense_Mutation_p.E699V	NM_017707.3	NP_060177.2	Q8TDY4	ASAP3_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 3	708					cell migration (GO:0016477)|positive regulation of ARF GTPase activity (GO:0032850)|regulation of stress fiber assembly (GO:0051492)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	24						ACCCACCTTCTCTTCCTCATC	0.622																																					p.E708V		.											.	ASAP3-155	0			c.A2123T						.						73.0	72.0	72.0					1																	23759922		2203	4300	6503	SO:0001583	missense	55616	exon21			ACCTTCTCTTCCT	AK000206	CCDS235.1, CCDS44087.1	1p36.13	2013-01-10	2008-10-09	2008-09-22	ENSG00000088280	ENSG00000088280		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	14987	protein-coding gene	gene with protein product	"""centaurin, beta 6"""		"""development and differentiation enhancing factor-like 1"""	DDEFL1		14654939	Standard	NM_017707		Approved	FLJ20199, UPLC1, CENTB6	uc001bha.2	Q8TDY4	OTTHUMG00000003234	ENST00000336689.3:c.2123A>T	1.37:g.23759922T>A	ENSP00000338769:p.Glu708Val	Somatic	119	0		WXS	Illumina HiSeq	Phase_I	90	47	NM_017707	0	0	1	2	1	B3KRW0|B4DHH4|Q6P9F4|Q86UY1|Q9NXK2	Missense_Mutation	SNP	ENST00000336689.3	37	CCDS235.1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.453556	0.84209	.	.	ENSG00000088280	ENST00000538685;ENST00000495646;ENST00000336689;ENST00000465372;ENST00000437606	T;T;T	0.56941	1.77;0.43;0.43	4.69	4.69	0.59074	.	3.712730	0.00567	N	0.000291	T	0.65228	0.2671	L	0.27053	0.805	0.58432	D	0.999999	D;D;D;D	0.76494	0.996;0.996;0.981;0.999	P;D;P;P	0.65874	0.892;0.939;0.77;0.905	T	0.50215	-0.8854	10	0.72032	D	0.01	.	13.4102	0.60938	0.0:0.0:0.0:1.0	.	699;577;231;708	Q8TDY4-3;B4DRP2;Q9NXH7;Q8TDY4	.;.;.;ASAP3_HUMAN	V	231;212;708;35;699	ENSP00000436150:E212V;ENSP00000338769:E708V;ENSP00000408826:E699V	ENSP00000338769:E708V	E	-	2	0	ASAP3	23632509	1.000000	0.71417	0.999000	0.59377	0.950000	0.60333	7.415000	0.80131	2.104000	0.64026	0.459000	0.35465	GAG	.		0.622	ASAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008916.2	NM_017707	
CSMD2	114784	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	33985175	33985175	+	Silent	SNP	T	T	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr1:33985175T>A	ENST00000373381.4	-	70	11015	c.10839A>T	c.(10837-10839)acA>acT	p.T3613T		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	3469						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CCATGATGTCTGTGGGCTGGA	0.592																																					p.T3469T		.											.	CSMD2-103	0			c.A10407T						.						287.0	241.0	256.0					1																	33985175		2203	4300	6503	SO:0001819	synonymous_variant	114784	exon69			GATGTCTGTGGGC	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.10839A>T	1.37:g.33985175T>A		Somatic	330	0		WXS	Illumina HiSeq	Phase_I	235	90	NM_052896	0	0	0	0	0	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	ENST00000373381.4	37																																																																																				.		0.592	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896	
YBX1	4904	hgsc.bcm.edu	37	1	43166452	43166452	+	Splice_Site	SNP	G	G	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr1:43166452G>A	ENST00000321358.7	+	7	880	c.741G>A	c.(739-741)agG>agA	p.R247R		NM_004559.3	NP_004550.2	P67809	YBOX1_HUMAN	Y box binding protein 1	247					CRD-mediated mRNA stabilization (GO:0070934)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|histone pre-mRNA 3'end processing complex (GO:0071204)|intracellular membrane-bounded organelle (GO:0043231)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|U12-type spliceosomal complex (GO:0005689)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)			large_intestine(2)|lung(4)|ovary(4)|prostate(4)|upper_aerodigestive_tract(2)	16	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				TTCATTGCAGGGGCCCTCCTC	0.483																																					p.R247R		.											.	YBX1-95	0			c.G741A						.						26.0	24.0	25.0					1																	43166452		2203	4300	6503	SO:0001630	splice_region_variant	4904	exon7			TTGCAGGGGCCCT	BC013838	CCDS470.1	1p34	2008-02-05	2005-08-11	2005-08-11	ENSG00000065978	ENSG00000065978			8014	protein-coding gene	gene with protein product		154030	"""nuclease sensitive element binding protein 1"""	NSEP1		1891370, 3174636	Standard	NM_004559		Approved	YB-1, YB1, DBPB, NSEP-1, MDR-NF1, BP-8, CSDB, CSDA2	uc001chs.3	P67809	OTTHUMG00000007523	ENST00000321358.7:c.741-1G>A	1.37:g.43166452G>A		Somatic	20	1		WXS	Illumina HiSeq	Phase_I	24	5	NM_004559	0	0	2	2	0	P16990|P16991|Q14972|Q15325|Q5FVF0	Silent	SNP	ENST00000321358.7	37	CCDS470.1	.	.	.	.	.	.	.	.	.	.	G	12.06	1.823775	0.32237	.	.	ENSG00000065978	ENST00000318612;ENST00000436427	.	.	.	5.35	3.41	0.39046	.	.	.	.	.	T	0.58278	0.2111	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52155	-0.8613	4	.	.	.	.	8.8138	0.34983	0.1925:0.0:0.8075:0.0	.	.	.	.	E	238;297	.	.	G	+	2	0	YBX1	42939039	1.000000	0.71417	0.998000	0.56505	0.858000	0.48976	4.943000	0.63554	0.571000	0.29365	0.552000	0.68991	GGG	.		0.483	YBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019786.2	NM_004559	Silent
IGSF3	3321	hgsc.bcm.edu	37	1	117122273	117122273	+	Silent	SNP	G	G	A	rs562520690|rs114783166	byFrequency	TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr1:117122273G>A	ENST00000369486.3	-	10	3840	c.3075C>T	c.(3073-3075)gaC>gaT	p.D1025D	IGSF3_ENST00000369483.1_Silent_p.D1045D|IGSF3_ENST00000318837.6_Silent_p.D1045D	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	1025	Ig-like C2-type 8.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		CTGTTGGgtcgtcgtcgtcgt	0.637																																					p.D1045D		.											.	IGSF3-92	0			c.C3135T						.	G	,	0,4406		0,0,2203	30.0	30.0	30.0		3075,3135	-6.0	0.0	1	dbSNP_133	30	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous,coding-synonymous	IGSF3	NM_001007237.1,NM_001542.2	,	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	,	1025/1195,1045/1215	117122273	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	3321	exon11			TGGGTCGTCGTCG	AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.3075C>T	1.37:g.117122273G>A		Somatic	33	0		WXS	Illumina HiSeq	Phase_I	24	2	NM_001542	0	0	11	11	0	A6NJZ6|A6NMC7	Silent	SNP	ENST00000369486.3	37	CCDS30813.1																																																																																			G|1.000;A|0.000		0.637	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542	
TTF2	8458	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	117618867	117618867	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr1:117618867C>G	ENST00000369466.4	+	6	1385	c.1341C>G	c.(1339-1341)atC>atG	p.I447M		NM_003594.3	NP_003585.3	Q9UNY4	TTF2_HUMAN	transcription termination factor, RNA polymerase II	447					ATP catabolic process (GO:0006200)|DNA-templated transcription, termination (GO:0006353)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(24)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	50	Lung SC(450;0.225)	all_cancers(81;4.23e-06)|all_epithelial(167;3.65e-07)|all_lung(203;2.81e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0553)|Colorectal(144;0.179)|LUSC - Lung squamous cell carcinoma(189;0.19)		TCAAACAAATCCAGGAGCTGG	0.478																																					p.I447M		.											.	TTF2-91	0			c.C1341G						.						101.0	95.0	97.0					1																	117618867		2203	4300	6503	SO:0001583	missense	8458	exon6			ACAAATCCAGGAG	AF073771	CCDS892.1	1p13.1	2014-02-18			ENSG00000116830	ENSG00000116830			12398	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 6"""	604718				9748214	Standard	NM_003594		Approved	HuF2, ZGRF6	uc001egy.3	Q9UNY4	OTTHUMG00000012030	ENST00000369466.4:c.1341C>G	1.37:g.117618867C>G	ENSP00000358478:p.Ile447Met	Somatic	75	0		WXS	Illumina HiSeq	Phase_I	48	19	NM_003594	0	0	2	5	3	A8K4Q2|O75921|Q5T2K7|Q5VVU8|Q8N6I8	Missense_Mutation	SNP	ENST00000369466.4	37	CCDS892.1	.	.	.	.	.	.	.	.	.	.	C	13.01	2.109329	0.37242	.	.	ENSG00000116830	ENST00000369466	D	0.88975	-2.45	5.41	-4.64	0.03349	.	0.000000	0.37906	N	0.001883	D	0.84379	0.5459	M	0.70595	2.14	0.34103	D	0.662138	D;D	0.67145	0.996;0.979	P;P	0.61800	0.894;0.857	T	0.77988	-0.2380	10	0.72032	D	0.01	-12.3789	1.4425	0.02357	0.2154:0.3707:0.1077:0.3062	.	447;447	Q9UNY4;Q9UNY4-2	TTF2_HUMAN;.	M	447	ENSP00000358478:I447M	ENSP00000358478:I447M	I	+	3	3	TTF2	117420390	0.918000	0.31147	0.794000	0.32065	0.071000	0.16799	-0.183000	0.09712	-0.727000	0.04888	0.561000	0.74099	ATC	.		0.478	TTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033277.3		
S100A3	6274	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	153520171	153520171	+	Missense_Mutation	SNP	G	G	C	rs199928185		TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr1:153520171G>C	ENST00000368713.3	-	3	489	c.293C>G	c.(292-294)cCc>cGc	p.P98R	S100A4_ENST00000481009.1_5'Flank|S100A4_ENST00000368714.1_Intron|S100A4_ENST00000368715.1_5'Flank|S100A4_ENST00000368716.4_5'Flank|S100A4_ENST00000354332.4_5'Flank|S100A3_ENST00000368712.1_Missense_Mutation_p.P98R	NM_002960.1	NP_002951.1	P33764	S10A3_HUMAN	S100 calcium binding protein A3	98						cytoplasm (GO:0005737)|nucleolus (GO:0005730)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(1)|liver(1)|lung(1)	3	all_lung(78;5.98e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTGGGAGCAGGGGGGCTCTGA	0.612																																					p.P98R		.											.	S100A3-90	0			c.C293G						.						87.0	84.0	85.0					1																	153520171		2203	4300	6503	SO:0001583	missense	6274	exon3			GAGCAGGGGGGCT	BC012893	CCDS1043.1	1q21	2008-02-05	2001-11-28		ENSG00000188015	ENSG00000188015		"""S100 calcium binding proteins"""	10493	protein-coding gene	gene with protein product		176992	"""S100 calcium-binding protein A3"""	S100E		8341667	Standard	NM_002960		Approved		uc001fca.1	P33764	OTTHUMG00000013550	ENST00000368713.3:c.293C>G	1.37:g.153520171G>C	ENSP00000357702:p.Pro98Arg	Somatic	116	0		WXS	Illumina HiSeq	Phase_I	105	52	NM_002960	0	0	1	2	1	D3DV51|Q6FGE4	Missense_Mutation	SNP	ENST00000368713.3	37	CCDS1043.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	G	11.31	1.599880	0.28534	.	.	ENSG00000188015	ENST00000368713;ENST00000368712	T;T	0.12569	2.67;2.67	5.02	4.1	0.47936	EF-hand-like domain (1);	0.459781	0.18636	N	0.135449	T	0.04634	0.0126	L	0.40543	1.245	0.32452	N	0.545297	P	0.41313	0.745	B	0.33295	0.161	T	0.16660	-1.0395	10	0.87932	D	0	.	11.2746	0.49159	0.0:0.0:0.8178:0.1822	.	98	P33764	S10A3_HUMAN	R	98	ENSP00000357702:P98R;ENSP00000357701:P98R	ENSP00000357701:P98R	P	-	2	0	S100A3	151786795	1.000000	0.71417	0.975000	0.42487	0.086000	0.17979	2.842000	0.48230	1.208000	0.43306	0.655000	0.94253	CCC	G|0.999;C|0.001		0.612	S100A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000037726.1	NM_002960	
RRNAD1	51093	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	156706431	156706431	+	Silent	SNP	T	T	C			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr1:156706431T>C	ENST00000368216.4	+	8	1944	c.1314T>C	c.(1312-1314)caT>caC	p.H438H	RRNAD1_ENST00000476229.1_Missense_Mutation_p.C154R|MRPL24_ENST00000478899.1_5'Flank|RRNAD1_ENST00000481920.1_Intron|RRNAD1_ENST00000368218.4_Missense_Mutation_p.C277R	NM_015997.3	NP_057081.3	Q96FB5	RRNAD_HUMAN	ribosomal RNA adenine dimethylase domain containing 1	438						integral component of membrane (GO:0016021)	rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)	9						CAGGTTTCCATGCTGAGCTCC	0.532																																					p.C277R		.											.	RRNAD1-90	0			c.T829C						.						132.0	123.0	126.0					1																	156706431		2203	4300	6503	SO:0001819	synonymous_variant	51093	exon7			TTTCCATGCTGAG	BC011382	CCDS1154.1, CCDS44246.1	1q23.1	2011-01-28	2011-01-28	2011-01-28	ENSG00000143303	ENSG00000143303			24273	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 66"""	C1orf66		10810093, 310876	Standard	NM_015997		Approved	CGI-41	uc001fpu.3	Q96FB5	OTTHUMG00000041302	ENST00000368216.4:c.1314T>C	1.37:g.156706431T>C		Somatic	154	0		WXS	Illumina HiSeq	Phase_I	135	52	NM_001142560	0	0	8	9	1	D3DVC7|Q4VX71|Q5SZ03|Q9Y358	Missense_Mutation	SNP	ENST00000368216.4	37	CCDS1154.1	.	.	.	.	.	.	.	.	.	.	T	13.71	2.319855	0.41096	.	.	ENSG00000143303	ENST00000368218;ENST00000476229	.	.	.	5.87	0.792	0.18625	.	.	.	.	.	T	0.25232	0.0613	.	.	.	0.36802	D	0.885409	B	0.06786	0.001	B	0.01281	0.0	T	0.08638	-1.0712	7	0.87932	D	0	-4.8252	4.626	0.12479	0.0:0.2522:0.2302:0.5176	.	277	Q4VX71	.	R	277;154	.	ENSP00000357201:C277R	C	+	1	0	RRNAD1	154973055	0.996000	0.38824	1.000000	0.80357	0.386000	0.30323	0.158000	0.16422	0.158000	0.19367	0.533000	0.62120	TGC	.		0.532	RRNAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098973.1	NM_015997	
PRRC2C	23215	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	171482181	171482181	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr1:171482181C>G	ENST00000338920.4	+	3	391	c.154C>G	c.(154-156)Cgg>Ggg	p.R52G	PRRC2C_ENST00000392078.3_Missense_Mutation_p.R54G|PRRC2C_ENST00000476522.1_3'UTR|PRRC2C_ENST00000426496.2_Missense_Mutation_p.R52G|PRRC2C_ENST00000367742.3_Missense_Mutation_p.R54G	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	52					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										CGGTATTTCACGGCGTATGCC	0.403																																					p.R52G		.											.	.	0			c.C154G						.						115.0	110.0	112.0					1																	171482181		2203	4300	6503	SO:0001583	missense	23215	exon3			ATTTCACGGCGTA	AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.154C>G	1.37:g.171482181C>G	ENSP00000343629:p.Arg52Gly	Somatic	65	0		WXS	Illumina HiSeq	Phase_I	56	20	NM_015172	0	0	6	15	9	Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Missense_Mutation	SNP	ENST00000338920.4	37	CCDS1296.2	.	.	.	.	.	.	.	.	.	.	C	12.62	1.993708	0.35131	.	.	ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920	T;T;T;T	0.51817	0.69;0.69;0.69;0.69	5.82	2.79	0.32731	BAT2, N-terminal (1);	0.000000	0.43579	D	0.000551	T	0.61110	0.2321	M	0.81341	2.54	0.54753	D	0.999983	D;D;D	0.89917	0.999;1.0;0.98	D;D;P	0.79108	0.943;0.992;0.749	T	0.69665	-0.5084	10	0.87932	D	0	.	15.4227	0.75025	0.5817:0.4183:0.0:0.0	.	52;54;52	Q9Y520-4;E7EPN9;Q9Y520	.;.;PRC2C_HUMAN	G	54;52;52;54;52	ENSP00000375928:R54G;ENSP00000410219:R52G;ENSP00000356716:R54G;ENSP00000343629:R52G	ENSP00000343629:R52G	R	+	1	2	PRRC2C	169748805	0.984000	0.35163	0.999000	0.59377	0.992000	0.81027	2.586000	0.46119	0.312000	0.23038	-0.169000	0.13324	CGG	.		0.403	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314826.4	NM_015172	
TRIM11	81559	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	228584695	228584695	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr1:228584695G>T	ENST00000284551.6	-	5	1090	c.812C>A	c.(811-813)aCc>aAc	p.T271N	RP11-245P10.8_ENST00000602963.1_RNA|TRIM11_ENST00000460651.1_5'UTR|TRIM11_ENST00000366699.3_Missense_Mutation_p.T271N|TRIM11_ENST00000493030.2_Missense_Mutation_p.T146N	NM_145214.2	NP_660215.1	Q96F44	TRI11_HUMAN	tripartite motif containing 11	271	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of neurogenesis (GO:0050768)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of viral entry into host cell (GO:0046598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|skin(1)	18		Prostate(94;0.0724)				CCTGCACACGGTCCTCAGCTC	0.627																																					p.T271N		.											.	TRIM11-658	0			c.C812A						.						85.0	85.0	85.0					1																	228584695		2203	4300	6503	SO:0001583	missense	81559	exon5			CACACGGTCCTCA	AF220125	CCDS31048.1	1q42.13	2013-01-09	2011-01-25		ENSG00000154370	ENSG00000154370		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16281	protein-coding gene	gene with protein product		607868	"""tripartite motif-containing 11"""			11331580	Standard	NM_145214		Approved	RNF92, BIA1	uc001hss.3	Q96F44	OTTHUMG00000039773	ENST00000284551.6:c.812C>A	1.37:g.228584695G>T	ENSP00000284551:p.Thr271Asn	Somatic	101	0		WXS	Illumina HiSeq	Phase_I	80	35	NM_145214	0	0	5	8	3	A6NKE2|B2RB82|B3KUS3|B4DX88|Q5VSU1|Q8NCA6|Q9C022	Missense_Mutation	SNP	ENST00000284551.6	37	CCDS31048.1	.	.	.	.	.	.	.	.	.	.	G	18.10	3.549179	0.65311	.	.	ENSG00000154370	ENST00000284551;ENST00000366699	T;T	0.06768	3.26;3.26	4.97	4.97	0.65823	B30.2/SPRY domain (1);	0.000000	0.41605	D	0.000853	T	0.19127	0.0459	L	0.41079	1.255	0.34988	D	0.754698	D;D;P	0.89917	1.0;1.0;0.781	D;D;B	0.97110	1.0;1.0;0.248	T	0.11108	-1.0601	10	0.26408	T	0.33	.	14.103	0.65070	0.0:0.0:1.0:0.0	.	270;271;271	Q96F44-3;Q96F44-2;Q96F44	.;.;TRI11_HUMAN	N	271	ENSP00000284551:T271N;ENSP00000355660:T271N	ENSP00000284551:T271N	T	-	2	0	TRIM11	226651318	0.932000	0.31603	0.909000	0.35828	0.546000	0.35178	1.634000	0.37123	2.482000	0.83794	0.313000	0.20887	ACC	.		0.627	TRIM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095995.3	NM_145214	
NFKB2	4791	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	104158555	104158555	+	Missense_Mutation	SNP	G	G	A	rs45580031		TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr10:104158555G>A	ENST00000369966.3	+	12	1301	c.1051G>A	c.(1051-1053)Ggg>Agg	p.G351R	NFKB2_ENST00000428099.1_Missense_Mutation_p.G351R|NFKB2_ENST00000336486.5_3'UTR|NFKB2_ENST00000189444.6_Missense_Mutation_p.G351R	NM_001077494.2	NP_001070962.1	Q00653	NFKB2_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)	351	GRR.|Gly-rich.		G -> R (in dbSNP:rs45580031). {ECO:0000269|Ref.7}.		extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|spleen development (GO:0048536)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|skin(2)	23		Colorectal(252;0.00957)		Epithelial(162;3.4e-08)|all cancers(201;6.41e-07)	Acetylsalicylic acid(DB00945)|Glucosamine(DB01296)	CCAGCCCTTCGGGGGTGGCTC	0.627			T	IGH@	B-NHL																																p.G351R		.		Dom	yes		10	10q24	4791	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)		L	.	NFKB2-522	0			c.G1051A						.						23.0	25.0	24.0					10																	104158555		1910	4115	6025	SO:0001583	missense	4791	exon12			CCCTTCGGGGGTG	X61498	CCDS41564.1, CCDS41565.1	10q24	2013-01-10			ENSG00000077150	ENSG00000077150		"""Ankyrin repeat domain containing"""	7795	protein-coding gene	gene with protein product		164012				1876189	Standard	XM_005269860		Approved	LYT-10, p52, p105, NF-kB2	uc001kvb.4	Q00653	OTTHUMG00000018962	ENST00000369966.3:c.1051G>A	10.37:g.104158555G>A	ENSP00000358983:p.Gly351Arg	Somatic	54	0		WXS	Illumina HiSeq	Phase_I	35	16	NM_001077494	0	0	15	25	10	A8K9D9|D3DR83|Q04860|Q9BU75|Q9H471|Q9H472	Missense_Mutation	SNP	ENST00000369966.3	37	CCDS41564.1	.	.	.	.	.	.	.	.	.	.	G	14.96	2.691545	0.48097	.	.	ENSG00000077150	ENST00000428099;ENST00000369966;ENST00000336486;ENST00000189444	D;D;D	0.86164	-2.08;-2.08;-2.08	4.56	4.56	0.56223	Immunoglobulin E-set (1);	0.220426	0.45126	D	0.000387	D	0.90686	0.7078	L	0.42245	1.32	0.48341	D	0.999631	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.89788	0.3966	10	0.36615	T	0.2	.	17.5171	0.87777	0.0:0.0:1.0:0.0	.	351;351;351	D3DR86;Q00653;A8K9D9	.;NFKB2_HUMAN;.	R	351	ENSP00000410256:G351R;ENSP00000358983:G351R;ENSP00000189444:G351R	ENSP00000189444:G351R	G	+	1	0	NFKB2	104148545	1.000000	0.71417	0.993000	0.49108	0.956000	0.61745	4.681000	0.61663	2.387000	0.81309	0.561000	0.74099	GGG	G|0.993;C|0.007		0.627	NFKB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050080.2		
SMC3	9126	hgsc.bcm.edu	37	10	112342364	112342364	+	Silent	SNP	A	A	G			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr10:112342364A>G	ENST00000361804.4	+	10	894	c.768A>G	c.(766-768)ttA>ttG	p.L256L		NM_005445.3	NP_005436.1	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	256					DNA repair (GO:0006281)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid cohesion (GO:0007064)|mitotic spindle organization (GO:0007052)|negative regulation of DNA endoreduplication (GO:0032876)|regulation of DNA replication (GO:0006275)|signal transduction (GO:0007165)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	basement membrane (GO:0005604)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cohesin core heterodimer (GO:0008280)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear matrix (GO:0016363)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|dynein binding (GO:0045502)|microtubule motor activity (GO:0003777)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		CCAGACAATTAAGAGATGCTC	0.323																																					p.L256L		.											.	SMC3-92	0			c.A768G						.						76.0	76.0	76.0					10																	112342364		2203	4300	6503	SO:0001819	synonymous_variant	9126	exon10			ACAATTAAGAGAT	AF020043	CCDS31285.1	10q25	2014-09-17	2006-07-06	2006-07-06	ENSG00000108055	ENSG00000108055		"""Structural maintenance of chromosomes proteins"", ""Proteoglycans / Extracellular Matrix : Other"""	2468	protein-coding gene	gene with protein product	"""bamacan proteoglycan"""	606062	"""chondroitin sulfate proteoglycan 6 (bamacan)"""	CSPG6		9506951, 10358101	Standard	NM_005445		Approved	HCAP, BAM, SMC3L1, bamacan	uc001kze.3	Q9UQE7	OTTHUMG00000019042	ENST00000361804.4:c.768A>G	10.37:g.112342364A>G		Somatic	36	0		WXS	Illumina HiSeq	Phase_I	40	2	NM_005445	0	0	26	26	0	A8K156|O60464|Q5T482	Silent	SNP	ENST00000361804.4	37	CCDS31285.1																																																																																			.		0.323	SMC3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050337.1	NM_005445	
TCERG1L	256536	broad.mit.edu	37	10	133058651	133058651	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr10:133058651C>T	ENST00000368642.4	-	4	812	c.727G>A	c.(727-729)Gcc>Acc	p.A243T		NM_174937.3	NP_777597.2	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like	243	Poly-Ala.									cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	31		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)		gcggcggcggcggtggcgatg	0.677																																					p.A243T													.	TCERG1L-138	0			c.G727A						.						16.0	18.0	17.0					10																	133058651		2197	4281	6478	SO:0001583	missense	256536	exon4			CGGCGGCGGTGGC	AK096269	CCDS7662.2	10q26.3	2006-04-12			ENSG00000176769	ENSG00000176769			23533	protein-coding gene	gene with protein product							Standard	NM_174937		Approved	FLJ38950	uc001lkp.3	Q5VWI1	OTTHUMG00000019276	ENST00000368642.4:c.727G>A	10.37:g.133058651C>T	ENSP00000357631:p.Ala243Thr	Somatic	12	0		WXS	Illumina HiSeq	Phase_I	7	2	NM_174937	0	0	0	0	0	Q5VWI2|Q86XM8	Missense_Mutation	SNP	ENST00000368642.4	37	CCDS7662.2	.	.	.	.	.	.	.	.	.	.	C	8.982	0.975564	0.18736	.	.	ENSG00000176769	ENST00000368642	T	0.25749	1.78	2.46	1.55	0.23275	.	0.337771	0.24623	N	0.036941	T	0.13415	0.0325	L	0.29908	0.895	0.09310	N	1	B	0.27264	0.173	B	0.13407	0.009	T	0.17048	-1.0382	9	.	.	.	-7.7013	5.3468	0.16014	0.0:0.8345:0.0:0.1655	.	243	Q5VWI1	TCRGL_HUMAN	T	243	ENSP00000357631:A243T	.	A	-	1	0	TCERG1L	132948641	0.023000	0.18921	0.003000	0.11579	0.001000	0.01503	0.210000	0.17455	0.577000	0.29470	-0.150000	0.13652	GCC	.		0.677	TCERG1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091619.2	NM_174937	
TMEM132A	54972	hgsc.bcm.edu	37	11	60702116	60702116	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr11:60702116C>G	ENST00000453848.2	+	9	1874	c.1716C>G	c.(1714-1716)gaC>gaG	p.D572E	TMEM132A_ENST00000005286.4_Missense_Mutation_p.D573E			Q24JP5	T132A_HUMAN	transmembrane protein 132A	572						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|prostate(1)|skin(3)	32						TTGGCCCCGACTGGCTGCTAG	0.741																																					p.D573E		.											.	TMEM132A-227	0			c.C1719G						.						8.0	11.0	10.0					11																	60702116		2098	4120	6218	SO:0001583	missense	54972	exon9			CCCCGACTGGCTG	AK000546	CCDS7997.1, CCDS44618.1	11q12.2	2006-03-02	2006-03-02	2006-03-02	ENSG00000006118	ENSG00000006118			31092	protein-coding gene	gene with protein product			"""heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) binding protein 1"""	HSPA5BP1		12514190, 10997877	Standard	NM_017870		Approved	GBP, FLJ20539	uc001nqi.3	Q24JP5	OTTHUMG00000167803	ENST00000453848.2:c.1716C>G	11.37:g.60702116C>G	ENSP00000405823:p.Asp572Glu	Somatic	12	0		WXS	Illumina HiSeq	Phase_I	15	2	NM_017870	0	0	5	5	0	Q69YU7|Q86VZ8|Q86W97|Q9H8K3|Q9HCI9|Q9NWY0	Missense_Mutation	SNP	ENST00000453848.2	37	CCDS44618.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.00|15.00	2.704676|2.704676	0.48412|0.48412	.|.	.|.	ENSG00000006118|ENSG00000006118	ENST00000444690;ENST00000453848;ENST00000005286|ENST00000540112	T;T|.	0.18657|.	2.2;2.2|.	4.16|4.16	0.0201|0.0201	0.14123|0.14123	.|.	0.415295|.	0.22719|.	N|.	0.056480|.	T|T	0.43055|0.43055	0.1230|0.1230	M|M	0.66297|0.66297	2.02|2.02	0.23693|0.23693	N|N	0.99709|0.99709	P;P|.	0.48230|.	0.884;0.907|.	P;P|.	0.53490|.	0.636;0.727|.	T|T	0.37911|0.37911	-0.9685|-0.9685	10|5	0.87932|.	D|.	0|.	.|.	5.2995|5.2995	0.15770|0.15770	0.0:0.4215:0.2573:0.3212|0.0:0.4215:0.2573:0.3212	.|.	572;573|.	Q24JP5;Q24JP5-2|.	T132A_HUMAN;.|.	E|S	323;572;573|1	ENSP00000405823:D572E;ENSP00000005286:D573E|.	ENSP00000005286:D573E|.	D|T	+|+	3|2	2|0	TMEM132A|TMEM132A	60458692|60458692	0.278000|0.278000	0.24230|0.24230	0.275000|0.275000	0.24674|0.24674	0.253000|0.253000	0.25986|0.25986	-0.198000|-0.198000	0.09505|0.09505	0.018000|0.018000	0.15052|0.15052	0.467000|0.467000	0.42956|0.42956	GAC|ACT	.		0.741	TMEM132A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000396352.1	NM_017870	
CTSC	1075	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	88045694	88045694	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr11:88045694G>C	ENST00000227266.5	-	3	461	c.347C>G	c.(346-348)aCt>aGt	p.T116S		NM_001814.4	NP_001805	P53634	CATC_HUMAN	cathepsin C	116					aging (GO:0007568)|immune response (GO:0006955)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of proteolysis involved in cellular protein catabolic process (GO:1903052)|proteolysis (GO:0006508)|response to organic substance (GO:0010033)|T cell mediated cytotoxicity (GO:0001913)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|membrane (GO:0016020)	chaperone binding (GO:0051087)|chloride ion binding (GO:0031404)|cysteine-type peptidase activity (GO:0008234)|peptidase activator activity involved in apoptotic process (GO:0016505)|phosphatase binding (GO:0019902)|serine-type endopeptidase activity (GO:0004252)			large_intestine(7)|lung(8)|ovary(2)|prostate(3)|skin(2)	22		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				GTTGCAGTAAGTGGTCACCTT	0.458																																					p.T116S		.											.	CTSC-90	0			c.C347G						.						204.0	192.0	196.0					11																	88045694		2201	4299	6500	SO:0001583	missense	1075	exon3			CAGTAAGTGGTCA	AK223038	CCDS8282.1, CCDS31654.1, CCDS44693.1	11q14.2	2014-09-17			ENSG00000109861	ENSG00000109861	3.4.14.1	"""Cathepsins"""	2528	protein-coding gene	gene with protein product	"""dipeptidyl peptidase 1"""	602365		PLS, PALS		7649281, 9092576	Standard	NM_148170		Approved	DPP1	uc001pck.4	P53634	OTTHUMG00000167290	ENST00000227266.5:c.347C>G	11.37:g.88045694G>C	ENSP00000227266:p.Thr116Ser	Somatic	316	0		WXS	Illumina HiSeq	Phase_I	283	119	NM_001814	0	0	333	613	280	A8K7V2|B5MDD5|Q2HIY8|Q53G93|Q71E75|Q71E76|Q7M4N9|Q7Z3G7|Q7Z5U7|Q8WY99|Q8WYA7|Q8WYA8	Missense_Mutation	SNP	ENST00000227266.5	37	CCDS8282.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.162|0.162	-1.079798|-1.079798	0.01888|0.01888	.|.	.|.	ENSG00000109861|ENSG00000109861	ENST00000527018|ENST00000393302;ENST00000227266	.|D	.|0.84442	.|-1.85	5.97|5.97	4.11|4.11	0.48088|0.48088	.|Cathepsin C exclusion (1);	.|0.073747	.|0.85682	.|N	.|0.000000	T|T	0.48259|0.48259	0.1490|0.1490	N|N	0.00050|0.00050	-2.41|-2.41	0.80722|0.80722	D|D	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.54036|0.54036	-0.8353|-0.8353	5|9	.|.	.|.	.|.	.|.	12.6204|12.6204	0.56600|0.56600	0.1313:0.7414:0.1273:0.0|0.1313:0.7414:0.1273:0.0	.|.	.|116	.|P53634	.|CATC_HUMAN	V|S	73|99;116	.|ENSP00000227266:T116S	.|.	L|T	-|-	1|2	0|0	CTSC|CTSC	87685342|87685342	1.000000|1.000000	0.71417|0.71417	0.987000|0.987000	0.45799|0.45799	0.133000|0.133000	0.20885|0.20885	3.944000|3.944000	0.56629|0.56629	0.878000|0.878000	0.35920|0.35920	-0.783000|-0.783000	0.03347|0.03347	CTT|ACT	.		0.458	CTSC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394019.2	NM_001814	
MAML2	84441	hgsc.bcm.edu	37	11	95825424	95825424	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr11:95825424G>T	ENST00000524717.1	-	2	3055	c.1771C>A	c.(1771-1773)Cag>Aag	p.Q591K		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	591					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				tgttgctgctgttgctgTTGG	0.517			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.Q591K		.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	.	MAML2-850	0			c.C1771A						.						53.0	58.0	56.0					11																	95825424		2172	4257	6429	SO:0001583	missense	84441	exon2			GCTGCTGTTGCTG	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1771C>A	11.37:g.95825424G>T	ENSP00000434552:p.Gln591Lys	Somatic	10	2		WXS	Illumina HiSeq	Phase_I	6	2	NM_032427	0	0	9	9	0	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Missense_Mutation	SNP	ENST00000524717.1	37	CCDS44714.1	.	.	.	.	.	.	.	.	.	.	G	6.985	0.551899	0.13374	.	.	ENSG00000184384	ENST00000524717;ENST00000440572	T;T	0.75154	-0.91;-0.91	4.16	4.16	0.48862	.	0.641420	0.14538	N	0.313463	T	0.65719	0.2718	L	0.48642	1.525	0.36744	D	0.882387	B	0.23316	0.083	B	0.18871	0.023	T	0.62695	-0.6800	10	0.09084	T	0.74	-0.3554	14.8068	0.69962	0.0:0.0:1.0:0.0	.	591	Q8IZL2	MAML2_HUMAN	K	591	ENSP00000434552:Q591K;ENSP00000412394:Q591K	ENSP00000412394:Q591K	Q	-	1	0	MAML2	95465072	1.000000	0.71417	0.944000	0.38274	0.017000	0.09413	3.476000	0.53143	2.151000	0.67156	0.555000	0.69702	CAG	.		0.517	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
ROBO3	64221	hgsc.bcm.edu	37	11	124739923	124739923	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr11:124739923C>T	ENST00000397801.1	+	4	917	c.725C>T	c.(724-726)gCg>gTg	p.A242V	ROBO3_ENST00000538940.1_Missense_Mutation_p.A220V	NM_022370.3	NP_071765.2	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3 (Drosophila)	242	Ig-like C2-type 2.				axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|neuron migration (GO:0001764)	axon (GO:0030424)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	35	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		TCCAACATGGCGGGAGAACGG	0.522																																					p.A242V		.											.	ROBO3-113	0			c.C725T						.						75.0	94.0	88.0					11																	124739923		2061	4202	6263	SO:0001583	missense	64221	exon4			ACATGGCGGGAGA	AK024697	CCDS44755.1	11q24	2013-02-11	2001-11-28		ENSG00000154134	ENSG00000154134		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13433	protein-coding gene	gene with protein product		608630	"""roundabout (axon guidance receptor, Drosophila) homolog 3"", ""horizontal gaze palsy with progressive scoliosis"""	HGPPS		15105459	Standard	NM_022370		Approved	RBIG1, FLJ21044, HGPS	uc001qbc.3	Q96MS0	OTTHUMG00000165934	ENST00000397801.1:c.725C>T	11.37:g.124739923C>T	ENSP00000380903:p.Ala242Val	Somatic	68	0		WXS	Illumina HiSeq	Phase_I	59	3	NM_022370	0	0	0	0	0		Missense_Mutation	SNP	ENST00000397801.1	37	CCDS44755.1	.	.	.	.	.	.	.	.	.	.	C	10.82	1.457128	0.26161	.	.	ENSG00000154134	ENST00000397801;ENST00000538940	T;T	0.66995	-0.24;-0.24	4.72	4.72	0.59763	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.33309	U	0.005056	T	0.38983	0.1061	N	0.16743	0.435	0.80722	D	1	P	0.35923	0.528	B	0.31495	0.131	T	0.46965	-0.9153	10	0.02654	T	1	.	6.8425	0.23971	0.0:0.7707:0.0:0.2293	.	242	Q96MS0	ROBO3_HUMAN	V	242;220	ENSP00000380903:A242V;ENSP00000441797:A220V	ENSP00000380903:A242V	A	+	2	0	ROBO3	124245133	1.000000	0.71417	0.997000	0.53966	0.794000	0.44872	4.851000	0.62896	2.340000	0.79590	0.462000	0.41574	GCG	.		0.522	ROBO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387091.1	XM_370663	
FGF6	2251	hgsc.bcm.edu	37	12	4554425	4554425	+	Silent	SNP	G	G	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr12:4554425G>A	ENST00000228837.2	-	1	355	c.312C>T	c.(310-312)ggC>ggT	p.G104G		NM_020996.1	NP_066276.2	P10767	FGF6_HUMAN	fibroblast growth factor 6	104					angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|myoblast differentiation (GO:0045445)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|sarcolemma (GO:0042383)	growth factor activity (GO:0008083)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)			CGCTGATCCGGCCGTCGGGGA	0.622																																					p.G104G		.											.	FGF6-659	0			c.C312T						.						37.0	34.0	35.0					12																	4554425		2203	4300	6503	SO:0001819	synonymous_variant	2251	exon1			GATCCGGCCGTCG	X63454	CCDS8527.1	12p13	2014-01-30				ENSG00000111241		"""Endogenous ligands"""	3684	protein-coding gene	gene with protein product		134921				16597617	Standard	NM_020996		Approved		uc001qmr.1	P10767		ENST00000228837.2:c.312C>T	12.37:g.4554425G>A		Somatic	39	0		WXS	Illumina HiSeq	Phase_I	21	2	NM_020996	0	0	0	0	0	Q0VAE1	Silent	SNP	ENST00000228837.2	37	CCDS8527.1																																																																																			.		0.622	FGF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398939.1	NM_020996	
DIP2B	57609	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	51102296	51102296	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr12:51102296C>A	ENST00000301180.5	+	22	2634	c.2600C>A	c.(2599-2601)cCt>cAt	p.P867H		NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)	867						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						GAACAAAGACCTGATGCTTCT	0.502																																					p.P867H		.											.	DIP2B-95	0			c.C2600A						.						262.0	192.0	215.0					12																	51102296		2203	4300	6503	SO:0001583	missense	57609	exon22			AAAGACCTGATGC	AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.2600C>A	12.37:g.51102296C>A	ENSP00000301180:p.Pro867His	Somatic	15	0		WXS	Illumina HiSeq	Phase_I	17	9	NM_173602	0	0	4	8	4	Q6B011|Q8N1L5|Q8NB38	Missense_Mutation	SNP	ENST00000301180.5	37	CCDS31799.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.337555	0.81911	.	.	ENSG00000066084	ENST00000301180	T	0.12465	2.68	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.44953	0.1318	M	0.87456	2.885	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.48581	-0.9023	10	0.66056	D	0.02	-15.6463	18.0462	0.89332	0.0:1.0:0.0:0.0	.	867	Q9P265	DIP2B_HUMAN	H	867	ENSP00000301180:P867H	ENSP00000301180:P867H	P	+	2	0	DIP2B	49388563	1.000000	0.71417	0.968000	0.41197	0.855000	0.48748	5.912000	0.69948	2.826000	0.97356	0.491000	0.48974	CCT	.		0.502	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404243.1	NM_173602	
LETMD1	25875	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	51450186	51450186	+	Silent	SNP	G	G	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr12:51450186G>A	ENST00000262055.4	+	7	855	c.816G>A	c.(814-816)ttG>ttA	p.L272L	LETMD1_ENST00000548516.1_3'UTR|LETMD1_ENST00000547008.1_Silent_p.L148L|LETMD1_ENST00000550929.1_Silent_p.L216L|LETMD1_ENST00000418425.2_Silent_p.L285L|LETMD1_ENST00000380123.2_3'UTR|LETMD1_ENST00000552739.1_Silent_p.L155L	NM_015416.4	NP_056231.3	Q6P1Q0	LTMD1_HUMAN	LETM1 domain containing 1	272	LETM1.					integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)				central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(4)|skin(1)|urinary_tract(3)	16						CTCCCTTGTTGAGACATCGTT	0.493																																					p.L285L		.											.	LETMD1-90	0			c.G855A						.						174.0	148.0	156.0					12																	51450186		2203	4300	6503	SO:0001819	synonymous_variant	25875	exon7			CTTGTTGAGACAT	AF195651	CCDS8806.1, CCDS58231.1, CCDS73469.1	12q13.13	2006-04-12				ENSG00000050426			24241	protein-coding gene	gene with protein product	"""cervical cancer 1 protooncogene"""					12879013, 12061725	Standard	NM_015416		Approved	HCCR1	uc009zlw.3	Q6P1Q0	OTTHUMG00000169538	ENST00000262055.4:c.816G>A	12.37:g.51450186G>A		Somatic	230	0		WXS	Illumina HiSeq	Phase_I	171	71	NM_001243689	0	0	44	76	32	A6NER7|B3KXK7|Q6X2E4|Q6X2E5|Q7L2G9|Q7L690|Q8WXW6|Q96PK7|Q9BY59|Q9Y3X3	Silent	SNP	ENST00000262055.4	37	CCDS8806.1	.	.	.	.	.	.	.	.	.	.	G	17.27	3.347756	0.61183	.	.	ENSG00000050426	ENST00000553043	.	.	.	5.49	3.69	0.42338	.	.	.	.	.	T	0.47192	0.1432	.	.	.	0.80722	D	1	B;B	0.14438	0.01;0.001	B;B	0.14578	0.011;0.004	T	0.44345	-0.9334	7	0.87932	D	0	-8.0385	7.6315	0.28243	0.3175:0.0:0.6825:0.0	.	110;110	B7Z9A7;F8W6J0	.;.	K	41	.	ENSP00000369478:E110K	E	+	1	0	LETMD1	49736453	1.000000	0.71417	0.675000	0.29917	0.599000	0.36880	1.036000	0.30228	0.822000	0.34565	-0.137000	0.14449	GAG	.		0.493	LETMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404710.1	NM_015416	
OR6C1	390321	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	55714436	55714436	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr12:55714436A>G	ENST00000379668.2	+	1	91	c.53A>G	c.(52-54)gAc>gGc	p.D18G		NM_001005182.1	NP_001005182.1	Q96RD1	OR6C1_HUMAN	olfactory receptor, family 6, subfamily C, member 1	18						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(5)|liver(2)|lung(13)|ovary(1)|upper_aerodigestive_tract(1)	25						TTAACAGATGACCCAAATTTT	0.413																																					p.D18G		.											.	OR6C1-69	0			c.A53G						.						76.0	76.0	76.0					12																	55714436		2203	4300	6503	SO:0001583	missense	390321	exon1			CAGATGACCCAAA	AF399506	CCDS31818.1	12q13.13	2012-08-09			ENSG00000205330	ENSG00000205330		"""GPCR / Class A : Olfactory receptors"""	8355	protein-coding gene	gene with protein product							Standard	NM_001005182		Approved	OST267	uc010spi.2	Q96RD1	OTTHUMG00000168102	ENST00000379668.2:c.53A>G	12.37:g.55714436A>G	ENSP00000368990:p.Asp18Gly	Somatic	135	1		WXS	Illumina HiSeq	Phase_I	119	42	NM_001005182	0	0	0	0	0	B2RNM0	Missense_Mutation	SNP	ENST00000379668.2	37	CCDS31818.1	.	.	.	.	.	.	.	.	.	.	a	12.44	1.937163	0.34189	.	.	ENSG00000205330	ENST00000379668	T	0.01335	5.0	5.21	5.21	0.72293	.	0.092850	0.46442	D	0.000284	T	0.03220	0.0094	M	0.64567	1.98	0.30407	N	0.779456	B	0.34372	0.451	B	0.41946	0.371	T	0.01524	-1.1333	10	0.87932	D	0	.	9.7369	0.40392	0.7226:0.2774:0.0:0.0	.	18	Q96RD1	OR6C1_HUMAN	G	18	ENSP00000368990:D18G	ENSP00000368990:D18G	D	+	2	0	OR6C1	54000703	0.000000	0.05858	0.981000	0.43875	0.598000	0.36846	0.070000	0.14573	2.185000	0.69588	0.374000	0.22700	GAC	.		0.413	OR6C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398152.1	NM_001005182	
STAB2	55576	hgsc.bcm.edu	37	12	104139037	104139037	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr12:104139037T>C	ENST00000388887.2	+	57	6322	c.6118T>C	c.(6118-6120)Tcg>Ccg	p.S2040P	RP11-341G23.4_ENST00000551299.1_RNA	NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						GACAGGCCCCTCGTGTGACAC	0.597																																					p.S2040P		.											.	STAB2-104	0			c.T6118C						.						63.0	53.0	56.0					12																	104139037		2203	4300	6503	SO:0001583	missense	55576	exon57			GGCCCCTCGTGTG	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.6118T>C	12.37:g.104139037T>C	ENSP00000373539:p.Ser2040Pro	Somatic	28	0		WXS	Illumina HiSeq	Phase_I	40	2	NM_017564	0	0	0	0	0		Missense_Mutation	SNP	ENST00000388887.2	37	CCDS31888.1	.	.	.	.	.	.	.	.	.	.	T	7.308	0.614348	0.14129	.	.	ENSG00000136011	ENST00000388887;ENST00000258495	T	0.35421	1.31	4.31	4.31	0.51392	Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	1.146940	0.06472	U	0.731372	T	0.35653	0.0939	M	0.65677	2.01	0.21445	N	0.999682	B	0.32160	0.358	B	0.30495	0.116	T	0.32613	-0.9900	10	0.29301	T	0.29	.	5.0961	0.14735	0.0:0.2553:0.0:0.7447	.	2040	Q8WWQ8	STAB2_HUMAN	P	2040;727	ENSP00000373539:S2040P	ENSP00000258495:S727P	S	+	1	0	STAB2	102663167	0.559000	0.26562	0.974000	0.42286	0.006000	0.05464	0.318000	0.19504	1.716000	0.51395	0.451000	0.29950	TCG	.		0.597	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1		
NCOR2	9612	hgsc.bcm.edu	37	12	124887102	124887102	+	Silent	SNP	C	C	T	rs7488825		TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr12:124887102C>T	ENST00000405201.1	-	14	1488	c.1488G>A	c.(1486-1488)caG>caA	p.Q496Q	NCOR2_ENST00000397355.1_Silent_p.Q496Q|NCOR2_ENST00000404621.1_Silent_p.Q495Q|NCOR2_ENST00000429285.2_Silent_p.Q495Q|NCOR2_ENST00000356219.3_Silent_p.Q496Q|NCOR2_ENST00000404121.2_Silent_p.Q66Q			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	496	Poly-Gln.				cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		gctgttgttgctgctgctgTC	0.627																																					p.Q496Q		.											.	NCOR2-229	0			c.G1488A						.						9.0	10.0	9.0					12																	124887102		2049	4171	6220	SO:0001819	synonymous_variant	9612	exon16			TTGTTGCTGCTGC	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.1488G>A	12.37:g.124887102C>T		Somatic	12	1		WXS	Illumina HiSeq	Phase_I	10	2	NM_006312	0	0	0	0	0	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Silent	SNP	ENST00000405201.1	37	CCDS41858.2																																																																																			.		0.627	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312	
TDRD3	81550	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	61034625	61034625	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr13:61034625G>A	ENST00000196169.3	+	4	813	c.25G>A	c.(25-27)Ggt>Agt	p.G9S	TDRD3_ENST00000463109.1_3'UTR|TDRD3_ENST00000377894.2_Missense_Mutation_p.G9S|TDRD3_ENST00000377881.2_Missense_Mutation_p.G9S|TDRD3_ENST00000535286.1_Missense_Mutation_p.G102S	NM_001146071.1|NM_030794.2	NP_001139543.1|NP_110421.1	Q9H7E2	TDRD3_HUMAN	tudor domain containing 3	9					chromatin modification (GO:0016568)|regulation of RNA biosynthetic process (GO:2001141)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|methylated histone binding (GO:0035064)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	40		Prostate(109;0.173)|Breast(118;0.174)		GBM - Glioblastoma multiforme(99;0.000291)		GATGACTGATGGTCATATAAG	0.358																																					p.G102S	Colon(36;164 906 35820 50723)	.											.	TDRD3-516	0			c.G304A						.						123.0	111.0	115.0					13																	61034625		2203	4300	6503	SO:0001583	missense	81550	exon4			ACTGATGGTCATA	AK023578	CCDS9441.1, CCDS53872.1	13q14.3	2013-01-23			ENSG00000083544	ENSG00000083544		"""Tudor domain containing"""	20612	protein-coding gene	gene with protein product		614392					Standard	NM_030794		Approved	FLJ21007	uc010aeg.3	Q9H7E2	OTTHUMG00000017007	ENST00000196169.3:c.25G>A	13.37:g.61034625G>A	ENSP00000196169:p.Gly9Ser	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	111	23	NM_001146070	0	0	6	7	1	B2MWP9|Q53XA6|Q6P992	Missense_Mutation	SNP	ENST00000196169.3	37	CCDS9441.1	.	.	.	.	.	.	.	.	.	.	G	36	5.652402	0.96724	.	.	ENSG00000083544	ENST00000196169;ENST00000377881;ENST00000377894;ENST00000535286;ENST00000377882	D;D;D;D	0.99924	-7.4;-7.4;-7.4;-8.02	6.06	6.06	0.98353	.	0.048957	0.85682	N	0.000000	D	0.99937	0.9972	M	0.91920	3.255	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96414	0.9306	10	0.87932	D	0	-15.3725	20.6397	0.99537	0.0:0.0:1.0:0.0	.	102;9;9	Q9H7E2-3;Q9H7E2-2;Q9H7E2	.;.;TDRD3_HUMAN	S	9;9;9;102;9	ENSP00000196169:G9S;ENSP00000367113:G9S;ENSP00000367126:G9S;ENSP00000440190:G102S	ENSP00000196169:G9S	G	+	1	0	TDRD3	59932626	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.880000	0.98712	0.650000	0.86243	GGT	.		0.358	TDRD3-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045175.2	NM_030794	
RALGAPA1	253959	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	14	36104756	36104756	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr14:36104756G>C	ENST00000389698.3	-	31	4597	c.4207C>G	c.(4207-4209)Cct>Gct	p.P1403A	RALGAPA1_ENST00000258840.6_Missense_Mutation_p.P1450A|RALGAPA1_ENST00000307138.6_Missense_Mutation_p.P1403A|RALGAPA1_ENST00000382366.3_Missense_Mutation_p.P1416A	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)	1403	Minimal domain that binds to TCF3/E12. {ECO:0000250}.				activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						GTCTTTAGAGGTAAGGCCATG	0.363																																					p.P1403A		.											.	RALGAPA1-138	0			c.C4207G						.						49.0	46.0	47.0					14																	36104756		2203	4296	6499	SO:0001583	missense	253959	exon31			TTAGAGGTAAGGC	AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.4207C>G	14.37:g.36104756G>C	ENSP00000374348:p.Pro1403Ala	Somatic	51	0		WXS	Illumina HiSeq	Phase_I	33	15	NM_194301	0	0	2	3	1	A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Missense_Mutation	SNP	ENST00000389698.3	37	CCDS32065.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.520063	0.85495	.	.	ENSG00000174373	ENST00000389698;ENST00000307138;ENST00000335518;ENST00000258840;ENST00000554259;ENST00000382366;ENST00000553892	T;T;T;T;T;T	0.66280	-0.2;-0.2;-0.2;1.52;-0.2;-0.2	5.41	5.41	0.78517	.	0.100260	0.64402	D	0.000001	T	0.81187	0.4770	M	0.81112	2.525	0.80722	D	1	D;D;D;P	0.89917	1.0;1.0;0.98;0.855	D;D;P;P	0.91635	0.999;0.999;0.885;0.667	T	0.81604	-0.0857	10	0.51188	T	0.08	-15.3316	19.5739	0.95434	0.0:0.0:1.0:0.0	.	1450;1416;1403;1403	Q6GYQ0-6;B9EK38;Q6GYQ0-2;Q6GYQ0	.;.;.;RGPA1_HUMAN	A	1403;1403;1403;1450;41;1416;1450	ENSP00000374348:P1403A;ENSP00000302647:P1403A;ENSP00000258840:P1450A;ENSP00000451133:P41A;ENSP00000371803:P1416A;ENSP00000451877:P1450A	ENSP00000258840:P1450A	P	-	1	0	RALGAPA1	35174507	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.934000	0.92915	2.691000	0.91804	0.563000	0.77884	CCT	.		0.363	RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409829.1	XM_210022	
PSMC6	5706	hgsc.bcm.edu	37	14	53194309	53194309	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr14:53194309T>G	ENST00000606149.1	+	14	1160	c.1144T>G	c.(1144-1146)Tct>Gct	p.S382A	PSMC6_ENST00000445930.2_Missense_Mutation_p.S396A|STYX_ENST00000442123.2_5'Flank|PSMC6_ENST00000557557.1_3'UTR|STYX_ENST00000354586.4_5'Flank	NM_002806.3	NP_002797.3	P62333	PRS10_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 6	382					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein binding, bridging (GO:0030674)			breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	19	Breast(41;0.176)					GAAGCTGGAGTCTAAATTGGA	0.353																																					p.S396A		.											.	PSMC6-91	0			c.T1186G						.						86.0	86.0	86.0					14																	53194309		2203	4300	6503	SO:0001583	missense	5706	exon14			CTGGAGTCTAAAT		CCDS9710.2	14q22.1	2010-04-21			ENSG00000100519	ENSG00000100519		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9553	protein-coding gene	gene with protein product		602708				8674546, 9473509	Standard	NM_002806		Approved	p42	uc010tqx.2	P62333	OTTHUMG00000152333	ENST00000606149.1:c.1144T>G	14.37:g.53194309T>G	ENSP00000475721:p.Ser382Ala	Somatic	110	0		WXS	Illumina HiSeq	Phase_I	85	5	NM_002806	0	0	46	46	0	B2R975|P49719|Q6IBU3|Q92524	Missense_Mutation	SNP	ENST00000606149.1	37		.	.	.	.	.	.	.	.	.	.	T	16.47	3.131801	0.56828	.	.	ENSG00000100519	ENST00000445930	D	0.93659	-3.26	5.3	5.3	0.74995	.	0.101354	0.64402	D	0.000001	D	0.90696	0.7081	L	0.42581	1.335	0.80722	D	1	B	0.16603	0.018	B	0.24848	0.056	D	0.87242	0.2267	10	0.35671	T	0.21	.	15.5436	0.76077	0.0:0.0:0.0:1.0	.	382	P62333	PRS10_HUMAN	A	396	ENSP00000401802:S396A	ENSP00000401802:S396A	S	+	1	0	PSMC6	52264059	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.627000	0.83176	2.123000	0.65237	0.528000	0.53228	TCT	.		0.353	PSMC6-018	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000470741.1	NM_002806	
UBE3A	7337	hgsc.bcm.edu	37	15	25615995	25615995	+	Silent	SNP	A	A	G			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr15:25615995A>G	ENST00000397954.2	-	4	1334	c.1335T>C	c.(1333-1335)ccT>ccC	p.P445P	UBE3A_ENST00000232165.3_Silent_p.P442P|UBE3A_ENST00000566215.1_Silent_p.P422P|SNHG14_ENST00000554726.1_RNA|UBE3A_ENST00000438097.1_Silent_p.P422P|UBE3A_ENST00000428984.2_Silent_p.P422P			Q05086	UBE3A_HUMAN	ubiquitin protein ligase E3A	445	Interaction with HCV core protein.				androgen receptor signaling pathway (GO:0030521)|brain development (GO:0007420)|ovarian follicle development (GO:0001541)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland growth (GO:0060736)|protein autoubiquitination (GO:0051865)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|proteolysis (GO:0006508)|sperm entry (GO:0035037)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(13)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	38		all_cancers(20;3.47e-21)|Breast(32;0.00123)		all cancers(64;2.78e-08)|Epithelial(43;8.85e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0155)|Lung(196;0.0616)		ACTCTTCAAAAGGGATAAGTG	0.358																																					p.P445P		.											.	UBE3A-660	0			c.T1335C						.						33.0	33.0	33.0					15																	25615995		2202	4298	6500	SO:0001819	synonymous_variant	7337	exon7			TTCAAAAGGGATA	AF002224	CCDS32177.1, CCDS45191.1, CCDS45192.1	15q11.2	2014-09-17	2008-07-31		ENSG00000114062	ENSG00000114062	6.3.2.19		12496	protein-coding gene	gene with protein product	"""Angelman syndrome"""	601623	"""human papilloma virus E6-associated protein"""	EPVE6AP, HPVE6A		8221889	Standard	NM_130838		Approved	AS, ANCR, E6-AP, FLJ26981	uc001zas.3	Q05086		ENST00000397954.2:c.1335T>C	15.37:g.25615995A>G		Somatic	58	1		WXS	Illumina HiSeq	Phase_I	40	2	NM_000462	0	0	9	9	0	A8K8Z9|P78355|Q93066|Q9UEP4|Q9UEP5|Q9UEP6|Q9UEP7|Q9UEP8|Q9UEP9	Silent	SNP	ENST00000397954.2	37	CCDS45192.1																																																																																			.		0.358	UBE3A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000434203.1	NM_000462	
MGA	23269	hgsc.bcm.edu	37	15	42041519	42041519	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr15:42041519C>G	ENST00000570161.1	+	16	5714	c.5714C>G	c.(5713-5715)tCt>tGt	p.S1905C	MGA_ENST00000219905.7_Missense_Mutation_p.S1905C|MGA_ENST00000545763.1_Missense_Mutation_p.S1696C|MGA_ENST00000566586.1_Missense_Mutation_p.S1696C|MGA_ENST00000389936.4_Missense_Mutation_p.S1866C			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CTGAGGATTTCTCCTCCTGAA	0.458																																					p.S1905C		.											.	MGA-522	0			c.C5714G						.						86.0	78.0	81.0					15																	42041519		1894	4107	6001	SO:0001583	missense	23269	exon17			GGATTTCTCCTCC	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.5714C>G	15.37:g.42041519C>G	ENSP00000457035:p.Ser1905Cys	Somatic	66	0		WXS	Illumina HiSeq	Phase_I	39	2	NM_001164273	0	0	8	8	0	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000570161.1	37	CCDS55959.1	.	.	.	.	.	.	.	.	.	.	C	16.00	2.999116	0.54147	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	T;T;T	0.28454	1.61;1.61;1.61	5.72	5.72	0.89469	.	0.000000	0.49305	D	0.000156	T	0.39937	0.1097	N	0.19112	0.55	0.27919	N	0.938318	D;D;D;D	0.89917	1.0;1.0;0.999;0.999	D;D;D;D	0.79784	0.972;0.988;0.993;0.993	T	0.30475	-0.9977	10	0.87932	D	0	.	13.1246	0.59346	0.0:0.927:0.0:0.073	.	521;1696;1905;1866	B4DVS1;F5H7K2;E7ENI0;Q8IWI9	.;.;.;MGAP_HUMAN	C	1905;1866;1696	ENSP00000219905:S1905C;ENSP00000374586:S1866C;ENSP00000442467:S1696C	ENSP00000219905:S1905C	S	+	2	0	MGA	39828811	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.086000	0.57664	2.704000	0.92352	0.563000	0.77884	TCT	.		0.458	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1	
DUOXA2	405753	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	45410080	45410080	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr15:45410080C>A	ENST00000323030.5	+	6	1221	c.936C>A	c.(934-936)gaC>gaA	p.D312E	DUOXA1_ENST00000430224.2_Intron|DUOXA1_ENST00000559014.1_Intron|DUOXA1_ENST00000558996.1_3'UTR|DUOXA1_ENST00000267803.4_Intron	NM_207581.3	NP_997464.2	Q1HG44	DOXA2_HUMAN	dual oxidase maturation factor 2	312					hydrogen peroxide metabolic process (GO:0042743)|protein transport (GO:0015031)|regulation of inflammatory response (GO:0050727)|regulation of thyroid hormone generation (GO:2000609)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)							all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;2.88e-18)|GBM - Glioblastoma multiforme(94;3.95e-07)|COAD - Colon adenocarcinoma(120;0.0652)|Colorectal(133;0.0659)		CTCTCCCAGACTTAAAATGTA	0.627											OREG0023102	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D312E		.											.	DUOXA2-226	0			c.C936A						.						56.0	67.0	63.0					15																	45410080		2198	4298	6496	SO:0001583	missense	405753	exon6			CCCAGACTTAAAA	BX537581	CCDS10118.2	15q21.1	2008-10-30		2006-07-25	ENSG00000140274	ENSG00000140274			32698	protein-coding gene	gene with protein product		612772				16651268	Standard	NM_207581		Approved		uc001zuo.3	Q1HG44	OTTHUMG00000131354	ENST00000323030.5:c.936C>A	15.37:g.45410080C>A	ENSP00000319705:p.Asp312Glu	Somatic	140	0	931	WXS	Illumina HiSeq	Phase_I	113	48	NM_207581	0	0	0	0	0	B2RPI9|H0YNQ6	Missense_Mutation	SNP	ENST00000323030.5	37	CCDS10118.2	.	.	.	.	.	.	.	.	.	.	C	11.80	1.747884	0.30955	.	.	ENSG00000140274	ENST00000323030	T	0.58060	0.36	4.74	1.8	0.24995	.	0.658067	0.14730	N	0.301826	T	0.27278	0.0669	N	0.08118	0	0.09310	N	0.999998	B	0.06786	0.001	B	0.08055	0.003	T	0.13737	-1.0498	10	0.44086	T	0.13	-18.3106	4.3109	0.10971	0.1793:0.6307:0.0:0.19	.	312	Q1HG44	DOXA2_HUMAN	E	312	ENSP00000319705:D312E	ENSP00000319705:D312E	D	+	3	2	DUOXA2	43197372	0.001000	0.12720	0.004000	0.12327	0.047000	0.14425	0.068000	0.14531	0.310000	0.22990	0.561000	0.74099	GAC	.		0.627	DUOXA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254142.1	NM_207581	
MYO9A	4649	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	72172105	72172105	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr15:72172105T>C	ENST00000356056.5	-	30	6168	c.5696A>G	c.(5695-5697)gAa>gGa	p.E1899G	MYO9A_ENST00000444904.1_Missense_Mutation_p.E1880G|MYO9A_ENST00000564571.1_Missense_Mutation_p.E1899G|MYO9A_ENST00000424560.1_Missense_Mutation_p.E1970G	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	1899	Tail.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						CTGCCGAAATTCCTTCAGGGC	0.363																																					p.E1899G		.											.	MYO9A-93	0			c.A5696G						.						108.0	106.0	107.0					15																	72172105		2199	4297	6496	SO:0001583	missense	4649	exon30			CGAAATTCCTTCA	AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.5696A>G	15.37:g.72172105T>C	ENSP00000348349:p.Glu1899Gly	Somatic	88	0		WXS	Illumina HiSeq	Phase_I	76	35	NM_006901	0	0	4	5	1	B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	ENST00000356056.5	37	CCDS10239.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.414821	0.83449	.	.	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904	T;T;T	0.14893	2.47;2.47;2.47	4.73	4.73	0.59995	.	.	.	.	.	T	0.42899	0.1223	M	0.79258	2.445	0.58432	D	0.999997	D;D	0.89917	1.0;0.997	D;P	0.79108	0.992;0.848	T	0.43956	-0.9359	9	0.62326	D	0.03	.	14.5012	0.67722	0.0:0.0:0.0:1.0	.	1970;1899	B2RTY4-4;B2RTY4	.;MYO9A_HUMAN	G	1899;1970;1880	ENSP00000348349:E1899G;ENSP00000399162:E1970G;ENSP00000398250:E1880G	ENSP00000348349:E1899G	E	-	2	0	MYO9A	69959159	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.593000	0.82686	1.903000	0.55091	0.528000	0.53228	GAA	.		0.363	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257308.1	NM_006901	
TMEM204	79652	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	1604905	1604905	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr16:1604905A>T	ENST00000566264.1	+	3	1262	c.559A>T	c.(559-561)Atc>Ttc	p.I187F	TMEM204_ENST00000253934.5_Missense_Mutation_p.I187F|IFT140_ENST00000426508.2_Intron|IFT140_ENST00000439987.2_Intron	NM_024600.5	NP_078876.2	Q9BSN7	TM204_HUMAN	transmembrane protein 204	187					lymph vessel development (GO:0001945)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)|response to stress (GO:0006950)|smooth muscle cell differentiation (GO:0051145)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|cervix(1)|endometrium(1)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	11		Hepatocellular(780;0.219)				AGCCATGCTCATCTGGAACAT	0.597																																					p.I187F		.											.	TMEM204-90	0			c.A559T						.						57.0	62.0	60.0					16																	1604905		2025	4177	6202	SO:0001583	missense	79652	exon3			ATGCTCATCTGGA		CCDS42098.1	16p13.3	2008-02-05	2008-01-08	2008-01-08		ENSG00000131634			14158	protein-coding gene	gene with protein product		611002	"""chromosome 16 open reading frame 30"""	C16orf30			Standard	NM_024600		Approved	FLJ20898	uc002cmc.3	Q9BSN7		ENST00000566264.1:c.559A>T	16.37:g.1604905A>T	ENSP00000454945:p.Ile187Phe	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	85	23	NM_024600	0	0	2	2	0	D3DU76|Q3KRC1|Q9H7G5	Missense_Mutation	SNP	ENST00000566264.1	37	CCDS42098.1	.	.	.	.	.	.	.	.	.	.	a	19.43	3.826453	0.71143	.	.	ENSG00000131634	ENST00000253934	T	0.56275	0.47	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.63212	0.2492	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.66925	-0.5800	10	0.87932	D	0	-17.5451	16.269	0.82606	1.0:0.0:0.0:0.0	.	187	Q9BSN7	TM204_HUMAN	F	187	ENSP00000253934:I187F	ENSP00000253934:I187F	I	+	1	0	TMEM204	1544906	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.882000	0.92420	2.241000	0.73720	0.529000	0.55759	ATC	.		0.597	TMEM204-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432610.1	NM_024600	
SCNN1B	6338	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	23387095	23387095	+	Missense_Mutation	SNP	C	C	T	rs372303239		TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr16:23387095C>T	ENST00000343070.2	+	8	1365	c.1189C>T	c.(1189-1191)Cgt>Tgt	p.R397C	SCNN1B_ENST00000568923.1_Missense_Mutation_p.R370C|SCNN1B_ENST00000307331.5_Missense_Mutation_p.R442C|SCNN1B_ENST00000568085.1_Missense_Mutation_p.R361C	NM_000336.2	NP_000327.2	P51168	SCNNB_HUMAN	sodium channel, non-voltage-gated 1, beta subunit	397					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|WW domain binding (GO:0050699)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)	CCACATGATCCGTAACTGCAA	0.597																																					p.R397C		.											.	SCNN1B-157	0			c.C1189T						.		CYS/ARG	1,4393	2.1+/-5.4	0,1,2196	191.0	152.0	165.0		1189	2.5	0.7	16		165	0,8600		0,0,4300	no	missense	SCNN1B	NM_000336.2	180	0,1,6496	TT,TC,CC		0.0,0.0228,0.0077	possibly-damaging	397/641	23387095	1,12993	2197	4300	6497	SO:0001583	missense	6338	exon8			ATGATCCGTAACT	X87159	CCDS10609.1	16p12.2-p12.1	2012-02-28	2012-02-28		ENSG00000168447	ENSG00000168447		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10600	protein-coding gene	gene with protein product	"""Liddle syndrome"""	600760	"""sodium channel, nonvoltage-gated 1, beta"", ""sodium channel, non-voltage-gated 1, beta"""				Standard	NM_000336		Approved	ENaCbeta	uc002dln.3	P51168	OTTHUMG00000131608	ENST00000343070.2:c.1189C>T	16.37:g.23387095C>T	ENSP00000345751:p.Arg397Cys	Somatic	124	0		WXS	Illumina HiSeq	Phase_I	179	42	NM_000336	0	0	0	0	0	C5HTZ2|O60891|Q96KG2|Q9UJ32|Q9UMU5	Missense_Mutation	SNP	ENST00000343070.2	37	CCDS10609.1	.	.	.	.	.	.	.	.	.	.	c	11.77	1.739120	0.30774	2.28E-4	0.0	ENSG00000168447	ENST00000343070;ENST00000307331	T;T	0.64618	-0.11;-0.11	4.65	2.53	0.30540	Na+ channel, amiloride-sensitive, conserved site (1);	1.865040	0.02752	N	0.117609	T	0.67832	0.2935	L	0.48642	1.525	0.09310	N	1	P	0.36171	0.541	P	0.46275	0.51	T	0.58031	-0.7708	10	0.87932	D	0	-11.3583	9.6889	0.40116	0.0:0.7032:0.2048:0.0921	.	397	P51168	SCNNB_HUMAN	C	397;442	ENSP00000345751:R397C;ENSP00000302874:R442C	ENSP00000302874:R442C	R	+	1	0	SCNN1B	23294596	0.007000	0.16637	0.690000	0.30148	0.144000	0.21451	1.280000	0.33202	1.065000	0.40693	0.651000	0.88453	CGT	.		0.597	SCNN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254495.2		
ELMO3	79767	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	67236622	67236622	+	Silent	SNP	T	T	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr16:67236622T>A	ENST00000360833.1	+	14	1656	c.1599T>A	c.(1597-1599)acT>acA	p.T533T	MIR328_ENST00000385213.1_RNA|ELMO3_ENST00000477898.1_Silent_p.T384T|ELMO3_ENST00000393997.2_Silent_p.T550T			Q96BJ8	ELMO3_HUMAN	engulfment and cell motility 3	497					apoptotic process (GO:0006915)|phagocytosis (GO:0006909)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				cervix(2)|kidney(4)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(3)	18		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00067)|Epithelial(162;0.00442)|all cancers(182;0.0417)		ATGCGCTCACTTATGGGGAGG	0.647																																					p.T550T		.											.	ELMO3-90	0			c.T1650A						.						42.0	49.0	46.0					16																	67236622		2076	4215	6291	SO:0001819	synonymous_variant	79767	exon15			GCTCACTTATGGG		CCDS10833.2	16q22.1	2010-03-18	2006-01-20		ENSG00000102890	ENSG00000102890		"""Engulfment and cell motility proteins"""	17289	protein-coding gene	gene with protein product		606422	"""engulfment and cell motility 3 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_024712		Approved	FLJ13824, CED12, ELMO-3, CED-12	uc002esa.3	Q96BJ8	OTTHUMG00000133570	ENST00000360833.1:c.1599T>A	16.37:g.67236622T>A		Somatic	91	0		WXS	Illumina HiSeq	Phase_I	69	44	NM_024712	0	0	6	25	19	B4DV86|Q9H8A5	Silent	SNP	ENST00000360833.1	37																																																																																				.		0.647	ELMO3-001	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000257667.2	NM_024712	
DEF8	54849	hgsc.bcm.edu;broad.mit.edu	37	16	90023966	90023966	+	Silent	SNP	G	G	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr16:90023966G>A	ENST00000268676.7	+	5	542	c.453G>A	c.(451-453)gaG>gaA	p.E151E	DEF8_ENST00000418391.2_Silent_p.E90E|DEF8_ENST00000563795.1_Silent_p.E90E|DEF8_ENST00000563594.1_Silent_p.E90E|DEF8_ENST00000567874.1_Silent_p.E30E|DEF8_ENST00000569453.1_Silent_p.E90E|DEF8_ENST00000570182.1_Silent_p.E80E	NM_207514.2	NP_997397.1	Q6ZN54	DEFI8_HUMAN	differentially expressed in FDCP 8 homolog (mouse)	151					intracellular signal transduction (GO:0035556)		zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	12		all_cancers(9;7.59e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.0019)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0274)		AGGCGATCGAGGAGTGCAAGC	0.647																																					p.E151E		.											.	DEF8-68	0			c.G453A						.						27.0	24.0	25.0					16																	90023966		2185	4291	6476	SO:0001819	synonymous_variant	54849	exon5			GATCGAGGAGTGC	AK131370	CCDS10989.1, CCDS45555.1, CCDS58493.1, CCDS58494.1, CCDS58495.1, CCDS58496.1	16q24.3	2011-01-31			ENSG00000140995	ENSG00000140995			25969	protein-coding gene	gene with protein product						12477932	Standard	NM_207514		Approved	FLJ20186	uc002fpn.2	Q6ZN54	OTTHUMG00000138989	ENST00000268676.7:c.453G>A	16.37:g.90023966G>A		Somatic	14	0		WXS	Illumina HiSeq	Phase_I	16	5	NM_207514	0	0	43	56	13	B3KT65|B4DK62|B4E0S9|B7Z3H6|H3BUG7|Q8N8N3|Q9NXL0	Silent	SNP	ENST00000268676.7	37	CCDS10989.1																																																																																			.		0.647	DEF8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000272878.1	NM_207514	
TEKT1	83659	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	17	6703554	6703554	+	Splice_Site	SNP	C	C	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr17:6703554C>A	ENST00000338694.2	-	8	1179		c.e8-1		TEKT1_ENST00000535086.1_Splice_Site	NM_053285.1	NP_444515.1	Q969V4	TEKT1_HUMAN	tektin 1							cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)				NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)	20		Myeloproliferative disorder(207;0.0255)				TTCCTTCAATCTAGGAGAAAG	0.463																																					.		.											.	TEKT1-92	0			c.1050-1G>T						.						55.0	53.0	53.0					17																	6703554		2203	4300	6503	SO:0001630	splice_region_variant	83659	exon9			TTCAATCTAGGAG		CCDS11083.1	17p13.2	2011-05-23			ENSG00000167858	ENSG00000167858			15534	protein-coding gene	gene with protein product		609002				11606253	Standard	NM_053285		Approved		uc002gdt.3	Q969V4	OTTHUMG00000102063	ENST00000338694.2:c.1050-1G>T	17.37:g.6703554C>A		Somatic	82	0		WXS	Illumina HiSeq	Phase_I	101	29	NM_053285	0	0	0	0	0	D3DTM7	Splice_Site	SNP	ENST00000338694.2	37	CCDS11083.1	.	.	.	.	.	.	.	.	.	.	C	14.52	2.558722	0.45590	.	.	ENSG00000167858	ENST00000338694;ENST00000535086	.	.	.	5.75	5.75	0.90469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.8163	0.88635	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TEKT1	6644278	1.000000	0.71417	0.148000	0.22405	0.065000	0.16274	5.783000	0.68982	2.885000	0.99019	0.655000	0.94253	.	.		0.463	TEKT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219867.2	NM_053285	Intron
POLR2A	5430	bcgsc.ca	37	17	7402776	7402776	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr17:7402776G>A	ENST00000322644.6	+	10	2036	c.1637G>A	c.(1636-1638)cGc>cAc	p.R546H	POLR2A_ENST00000572844.1_Missense_Mutation_p.R546H	NM_000937.4	NP_000928	P24928	RPB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	546					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA-directed RNA polymerase activity (GO:0003968)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(17)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	50		Prostate(122;0.173)				ACAGCAGTGCGCAAATTCACC	0.577																																					p.R546H													.	POLR2A-91	0			c.G1637A						.						103.0	91.0	95.0					17																	7402776		2203	4300	6503	SO:0001583	missense	5430	exon10			CAGTGCGCAAATT			17p13.1	2013-01-21	2002-08-29		ENSG00000181222	ENSG00000181222	2.7.7.6	"""RNA polymerase subunits"""	9187	protein-coding gene	gene with protein product	"""DNA-directed RNA polymerase II largest subunit, RNA polymerase II 220 kd subunit"", ""RNA polymerase II subunit B1"""	180660	"""polymerase (RNA) II (DNA directed) polypeptide A (220kD)"""	POLR2			Standard	NM_000937		Approved	POLRA, RPB1	uc002ghf.4	P24928	OTTHUMG00000177594	ENST00000322644.6:c.1637G>A	17.37:g.7402776G>A	ENSP00000314949:p.Arg546His	Somatic	53	0		WXS	Illumina HiSeq	Phase_1	79	5	NM_000937	0	0	62	62	0	A6NN93|B9EH88|Q6NX41	Missense_Mutation	SNP	ENST00000322644.6	37	CCDS32548.1	.	.	.	.	.	.	.	.	.	.	G	34	5.375047	0.95923	.	.	ENSG00000181222	ENST00000535204;ENST00000322644	T	0.78816	-1.21	6.04	6.04	0.98038	RNA polymerase Rpb1, domain 3 (1);RNA polymerase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.90181	0.6931	M	0.89968	3.075	0.80722	D	1	D;D	0.76494	0.958;0.999	P;D	0.64776	0.657;0.929	D	0.91231	0.5014	10	0.87932	D	0	-10.3575	19.3663	0.94464	0.0:0.0:1.0:0.0	.	546;546	P24928;Q6NX41	RPB1_HUMAN;.	H	502;546	ENSP00000314949:R546H	ENSP00000314949:R546H	R	+	2	0	SLC35G6	7343500	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.165000	0.94761	2.873000	0.98535	0.563000	0.77884	CGC	.		0.577	POLR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437967.1	NM_000937	
RAI1	10743	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	17701717	17701717	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr17:17701717G>A	ENST00000353383.1	+	3	5924	c.5455G>A	c.(5455-5457)Gcc>Acc	p.A1819T	RAI1_ENST00000261641.6_Intron	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	1819					circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		CGGCGGGGAGGCCCAGGAGCA	0.692																																					p.A1819T		.											.	RAI1-91	0			c.G5455A						.						15.0	17.0	16.0					17																	17701717		2196	4296	6492	SO:0001583	missense	10743	exon3			GGGGAGGCCCAGG	AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.5455G>A	17.37:g.17701717G>A	ENSP00000323074:p.Ala1819Thr	Somatic	37	0		WXS	Illumina HiSeq	Phase_I	26	17	NM_030665	0	0	4	26	22	Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Missense_Mutation	SNP	ENST00000353383.1	37	CCDS11188.1	.	.	.	.	.	.	.	.	.	.	G	3.249	-0.153699	0.06585	.	.	ENSG00000108557	ENST00000353383;ENST00000395776	T	0.65364	-0.15	4.42	0.819	0.18785	.	0.164676	0.41605	N	0.000849	T	0.24928	0.0605	N	0.01576	-0.805	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.04900	-1.0919	10	0.09843	T	0.71	.	5.4772	0.16702	0.6904:0.146:0.1635:0.0	.	1819	Q7Z5J4	RAI1_HUMAN	T	1819	ENSP00000323074:A1819T	ENSP00000323074:A1819T	A	+	1	0	RAI1	17642442	1.000000	0.71417	0.989000	0.46669	0.093000	0.18481	3.093000	0.50217	-0.047000	0.13423	-0.367000	0.07326	GCC	.		0.692	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131775.1	NM_030665	
ALDH3A2	224	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	19566808	19566808	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr17:19566808A>G	ENST00000176643.6	+	7	1549	c.1103A>G	c.(1102-1104)cAt>cGt	p.H368R	ALDH3A2_ENST00000571163.1_Missense_Mutation_p.H41R|ALDH3A2_ENST00000581518.1_Missense_Mutation_p.H368R|SNORA31_ENST00000516540.1_RNA|ALDH3A2_ENST00000395575.2_Missense_Mutation_p.H368R|ALDH3A2_ENST00000579855.1_Missense_Mutation_p.H368R|ALDH3A2_ENST00000339618.4_Missense_Mutation_p.H368R			P51648	AL3A2_HUMAN	aldehyde dehydrogenase 3 family, member A2	368					cellular aldehyde metabolic process (GO:0006081)|central nervous system development (GO:0007417)|epidermis development (GO:0008544)|oxidation-reduction process (GO:0055114)|peripheral nervous system development (GO:0007422)|phytol metabolic process (GO:0033306)|sesquiterpenoid metabolic process (GO:0006714)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)|peroxisome (GO:0005777)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)|long-chain-alcohol oxidase activity (GO:0046577)|long-chain-aldehyde dehydrogenase activity (GO:0050061)|medium-chain-aldehyde dehydrogenase activity (GO:0052814)			endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(2)|ovary(2)|prostate(1)	13	all_cancers(12;1.39e-05)|all_epithelial(12;0.00158)|Breast(13;0.245)					TCGCATAACCATAAGGTAAGC	0.358																																					p.H368R		.											.	ALDH3A2-228	0			c.A1103G						.						77.0	76.0	76.0					17																	19566808		2203	4300	6503	SO:0001583	missense	224	exon7			ATAACCATAAGGT	L47162	CCDS11210.1, CCDS32589.1	17p11.2	2010-05-07			ENSG00000072210	ENSG00000072210	1.2.1.3	"""Aldehyde dehydrogenases"""	403	protein-coding gene	gene with protein product	"""fatty aldehyde dehydrogenase"""	609523		SLS, ALDH10		7894487	Standard	NM_000382		Approved	FALDH	uc002gwa.1	P51648	OTTHUMG00000059471	ENST00000176643.6:c.1103A>G	17.37:g.19566808A>G	ENSP00000176643:p.His368Arg	Somatic	78	0		WXS	Illumina HiSeq	Phase_I	82	37	NM_001031806	0	0	1	1	0	Q6I9T3|Q93011|Q96J37	Missense_Mutation	SNP	ENST00000176643.6	37	CCDS11210.1	.	.	.	.	.	.	.	.	.	.	A	6.134	0.392977	0.11638	.	.	ENSG00000072210	ENST00000176643;ENST00000395575;ENST00000339618	T;T;T	0.75367	-0.93;-0.93;-0.93	5.12	2.89	0.33648	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.561400	0.20786	N	0.085705	T	0.41581	0.1165	N	0.01003	-1.06	0.09310	N	0.99999	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.0	T	0.33163	-0.9879	10	0.33141	T	0.24	-1.3235	7.2008	0.25879	0.7763:0.147:0.0766:0.0	.	368;368	P51648;P51648-2	AL3A2_HUMAN;.	R	368	ENSP00000176643:H368R;ENSP00000378942:H368R;ENSP00000345774:H368R	ENSP00000176643:H368R	H	+	2	0	ALDH3A2	19507400	0.592000	0.26832	0.274000	0.24659	0.402000	0.30811	2.992000	0.49417	0.289000	0.22422	0.455000	0.32223	CAT	.		0.358	ALDH3A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132268.1		
ASIC2	40	hgsc.bcm.edu	37	17	31618997	31618997	+	Intron	SNP	C	C	A	rs112647385	byFrequency	TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr17:31618997C>A	ENST00000359872.6	-	2	1317				ASIC2_ENST00000448983.1_5'Flank|ASIC2_ENST00000225823.2_Missense_Mutation_p.R46L	NM_001094.4	NP_001085.2	Q16515	ASIC2_HUMAN	acid-sensing (proton-gated) ion channel 2						central nervous system development (GO:0007417)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|ion transmembrane transport (GO:0034220)|monovalent inorganic cation transport (GO:0015672)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|phototransduction (GO:0007602)|positive regulation of synapse assembly (GO:0051965)|protein localization to synapse (GO:0035418)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of membrane potential (GO:0042391)|regulation of systemic arterial blood pressure by aortic arch baroreceptor feedback (GO:0003026)|regulation of vasoconstriction (GO:0019229)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|sensory perception of sound (GO:0007605)|sensory perception of sour taste (GO:0050915)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)|voltage-gated sodium channel activity (GO:0005248)									Amiloride(DB00594)	CTGCAGCGCCCGCTCGCCGCC	0.806													C|||	1091	0.217851	0.112	0.1902	5008	,	,		5226	0.3194		0.2664	False		,,,				2504	0.226				p.R46L		.											.	.	0			c.G137T						.						1.0	2.0	2.0					17																	31618997		903	2226	3129	SO:0001627	intron_variant	40	exon1			AGCGCCCGCTCGC	AL834182	CCDS11276.1, CCDS42296.1	17q11.2-q12	2012-02-23	2012-02-22	2012-02-22	ENSG00000108684	ENSG00000108684		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	99	protein-coding gene	gene with protein product	"""degenerin"""	601784	"""amiloride-sensitive cation channel 1, neuronal"""	ACCN, ACCN1		8921408	Standard	NM_183377		Approved	ASIC2a, BNC1, BNaC1, hBNaC1, MDEG	uc002hhu.3	Q16515	OTTHUMG00000132885	ENST00000359872.6:c.556-179912G>T	17.37:g.31618997C>A		Somatic	0	0		WXS	Illumina HiSeq	Phase_I	3	3	NM_183377	0	0	0	0	0	E9PBX2|Q13553|Q6DJU1|Q8N3E2	Missense_Mutation	SNP	ENST00000359872.6	37	CCDS42296.1	567	0.25961538461538464	84	0.17073170731707318	81	0.22375690607734808	197	0.34440559440559443	205	0.2704485488126649	C	13.69	2.313571	0.40996	.	.	ENSG00000108684	ENST00000225823	T	0.65178	-0.14	4.45	-0.0635	0.13776	.	1.386070	0.04769	N	0.427624	T	0.00012	0.0000	N	0.08118	0	0.58432	P	5.000000000032756E-6	B	0.17038	0.02	B	0.10450	0.005	T	0.17715	-1.0360	9	0.29301	T	0.29	-24.8125	4.0823	0.09932	0.0:0.3667:0.3479:0.2854	.	46	E9PBX2	.	L	46	ENSP00000225823:R46L	ENSP00000225823:R46L	R	-	2	0	ACCN1	28643110	0.458000	0.25760	0.926000	0.36857	0.865000	0.49528	1.119000	0.31258	0.274000	0.22072	0.306000	0.20318	CGG	C|0.740;A|0.260		0.806	ASIC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447552.1	NM_183377, NM_001094	
TAF15	8148	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	34171754	34171754	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr17:34171754G>A	ENST00000588240.1	+	15	1566	c.1451G>A	c.(1450-1452)gGt>gAt	p.G484D	TAF15_ENST00000592237.1_Intron|TAF15_ENST00000311979.3_Missense_Mutation_p.G481D	NM_003487.3|NM_139215.2	NP_003478.1|NP_631961.1	Q16514	TAF12_HUMAN	TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa	0					chromatin organization (GO:0006325)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone H3 acetylation (GO:0043966)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of RNA biosynthetic process (GO:2001141)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)		TAF15/NR4A3(33)	lung(1)|ovary(1)|skin(2)|stomach(1)	5		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		ggagatcgaggtggctatgga	0.617			T	"""TEC, CHN1, ZNF384"""	"""extraskeletal myxoid chondrosarcomas, ALL"""																																p.G484D		.		Dom	yes		17	17q11.1-q11.2	8148	"""TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa"""		"""L, M"""	.	TAF15-723	0			c.G1451A						.						69.0	59.0	62.0					17																	34171754		2203	4300	6503	SO:0001583	missense	8148	exon15			ATCGAGGTGGCTA	U51334	CCDS32623.1, CCDS59279.1	17q11.1-q11.2	2013-02-12	2002-08-29	2001-12-07		ENSG00000270647		"""RNA binding motif (RRM) containing"""	11547	protein-coding gene	gene with protein product		601574	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, N, 68kD (RNA-binding protein 56)"""	TAF2N		8954779, 9795213	Standard	NM_003487		Approved	hTAFII68, RBP56, Npl3	uc002hkd.4	Q92804		ENST00000588240.1:c.1451G>A	17.37:g.34171754G>A	ENSP00000466950:p.Gly484Asp	Somatic	21	0		WXS	Illumina HiSeq	Phase_I	36	17	NM_139215	0	0	68	199	131	D3DPM5|Q15775|Q5T077	Missense_Mutation	SNP	ENST00000588240.1	37	CCDS32623.1	.	.	.	.	.	.	.	.	.	.	G	14.70	2.613730	0.46631	.	.	ENSG00000172660	ENST00000311979;ENST00000536077	D	0.95171	-3.63	4.33	3.36	0.38483	.	.	.	.	.	D	0.88250	0.6386	N	0.22421	0.69	0.35491	D	0.798963	P;P	0.39282	0.536;0.666	B;B	0.35240	0.097;0.198	D	0.89286	0.3615	9	0.87932	D	0	.	9.8408	0.40998	0.1042:0.0:0.8958:0.0	.	484;481	Q92804;Q92804-2	RBP56_HUMAN;.	D	484;287	ENSP00000309558:G484D	ENSP00000309558:G484D	G	+	2	0	TAF15	31195867	0.956000	0.32656	0.753000	0.31225	0.954000	0.61252	3.509000	0.53386	0.943000	0.37553	0.467000	0.42956	GGT	.		0.617	TAF15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449134.1	NM_139215	
KRTAP4-5	85289	hgsc.bcm.edu	37	17	39305510	39305510	+	Silent	SNP	G	G	A	rs539184974	byFrequency	TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr17:39305510G>A	ENST00000343246.4	-	1	544	c.510C>T	c.(508-510)tgC>tgT	p.C170C		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	170					aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			AGGGGCGGGGGCAGGTGGAGA	0.537													G|||	3	0.000599042	0.0	0.0014	5008	,	,		20131	0.0		0.002	False		,,,				2504	0.0				p.C170C		.											.	KRTAP4-5-90	0			c.C510T						.						38.0	29.0	32.0					17																	39305510		2203	4300	6503	SO:0001819	synonymous_variant	85289	exon1			GCGGGGGCAGGTG	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.510C>T	17.37:g.39305510G>A		Somatic	31	2		WXS	Illumina HiSeq	Phase_I	27	3	NM_033188	0	0	0	0	0		Silent	SNP	ENST00000343246.4	37	CCDS32650.1																																																																																			.		0.537	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
HELZ	9931	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	65074431	65074431	+	Silent	SNP	G	G	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr17:65074431G>A	ENST00000358691.5	-	33	5932	c.5766C>T	c.(5764-5766)ctC>ctT	p.L1922L	HELZ_ENST00000580168.1_Silent_p.L1923L	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	1922						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					GTTCCTGGAAGAGAGACAGAG	0.522																																					p.L1922L		.											.	HELZ-92	0			c.C5766T						.						44.0	46.0	45.0					17																	65074431		1860	4094	5954	SO:0001819	synonymous_variant	9931	exon33			CTGGAAGAGAGAC	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.5766C>T	17.37:g.65074431G>A		Somatic	128	0		WXS	Illumina HiSeq	Phase_I	124	35	NM_014877	0	0	4	7	3	I6L9H4	Silent	SNP	ENST00000358691.5	37	CCDS42374.1																																																																																			.		0.522	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	NM_014877	
SLC25A10	1468	broad.mit.edu	37	17	79687107	79687107	+	Nonstop_Mutation	SNP	A	A	C			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr17:79687107A>C	ENST00000350690.5	+	11	950	c.864A>C	c.(862-864)tgA>tgC	p.*288C	SLC25A10_ENST00000541223.1_Nonstop_Mutation_p.*443C|SLC25A10_ENST00000571730.1_Nonstop_Mutation_p.*443C|SLC25A10_ENST00000331531.5_Nonstop_Mutation_p.*297C|SLC25A10_ENST00000545862.1_Nonstop_Mutation_p.*245C	NM_001270953.1|NM_012140.4	NP_001257882.1|NP_036272.2	Q9UBX3	DIC_HUMAN	solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10	0					carbohydrate metabolic process (GO:0005975)|cellular nitrogen compound metabolic process (GO:0034641)|dicarboxylic acid transport (GO:0006835)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|ion transport (GO:0006811)|mitochondrial transport (GO:0006839)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	dicarboxylic acid transmembrane transporter activity (GO:0005310)	p.*288C(1)		endometrium(1)|lung(9)|ovary(1)|prostate(1)|skin(2)	14	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0117)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)		Succinic acid(DB00139)	TGCCATCCTGACCAGCCGTGG	0.607																																					p.X297C													.	SLC25A10-90	1	Nonstop extension(1)	lung(1)	c.A891C						.						39.0	38.0	38.0					17																	79687107		2202	4300	6502	SO:0001578	stop_lost	1468	exon11			ATCCTGACCAGCC		CCDS11786.1, CCDS59301.1, CCDS74176.1	17q25.3	2013-07-15			ENSG00000183048	ENSG00000183048		"""Solute carriers"""	10980	protein-coding gene	gene with protein product		606794		DIC		9733776, 10072589	Standard	NM_001270953		Approved		uc031rew.1	Q9UBX3	OTTHUMG00000178173	ENST00000350690.5:c.864A>C	17.37:g.79687107A>C	ENSP00000345580:p.*288Cysext*14	Somatic	63	9		WXS	Illumina HiSeq	Phase_I	80	14	NM_001270888	0	0	74	78	4	Q542Z3|Q96BA1|Q96IP1	Missense_Mutation	SNP	ENST00000350690.5	37	CCDS11786.1	.	.	.	.	.	.	.	.	.	.	A	16.85	3.235774	0.58886	.	.	ENSG00000183048	ENST00000541223;ENST00000331531;ENST00000350690;ENST00000545862	.	.	.	4.35	3.25	0.37280	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.9301	0.41517	0.9158:0.0:0.0842:0.0	.	.	.	.	C	443;297;288;245	.	.	X	+	3	0	SLC25A10	77297512	1.000000	0.71417	0.903000	0.35520	0.516000	0.34256	4.848000	0.62874	1.600000	0.50102	0.528000	0.53228	TGA	.		0.607	SLC25A10-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000440816.1		
SMCHD1	23347	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	2718194	2718194	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr18:2718194C>T	ENST00000320876.6	+	18	2637	c.2299C>T	c.(2299-2301)Caa>Taa	p.Q767*	RP11-703M24.5_ENST00000583546.1_RNA|SMCHD1_ENST00000261598.8_Nonsense_Mutation_p.Q767*	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	767					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						GCATATTAGTCAACATGGAGG	0.284																																					p.Q767X		.											.	SMCHD1-46	0			c.C2299T						.						91.0	85.0	87.0					18																	2718194		1809	4065	5874	SO:0001587	stop_gained	23347	exon18			ATTAGTCAACATG	AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.2299C>T	18.37:g.2718194C>T	ENSP00000326603:p.Gln767*	Somatic	46	0		WXS	Illumina HiSeq	Phase_I	46	19	NM_015295	0	0	0	0	0	O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Nonsense_Mutation	SNP	ENST00000320876.6	37	CCDS45822.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.313068	0.81358	.	.	ENSG00000101596	ENST00000320876;ENST00000261598	.	.	.	5.62	5.62	0.85841	.	0.063495	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-12.072	19.6473	0.95784	0.0:1.0:0.0:0.0	.	.	.	.	X	767	.	ENSP00000261598:Q767X	Q	+	1	0	SMCHD1	2708194	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.933000	0.70130	2.650000	0.89964	0.591000	0.81541	CAA	.		0.284	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441082.2		
TCF4	6925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	52921812	52921812	+	Silent	SNP	A	A	G			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr18:52921812A>G	ENST00000356073.4	-	15	1877	c.1266T>C	c.(1264-1266)atT>atC	p.I422I	TCF4_ENST00000568740.1_Silent_p.I397I|TCF4_ENST00000537856.3_Silent_p.I292I|TCF4_ENST00000564403.2_Silent_p.I428I|TCF4_ENST00000564228.1_Silent_p.I351I|TCF4_ENST00000540999.1_Silent_p.I398I|TCF4_ENST00000566286.1_Silent_p.I419I|TCF4_ENST00000457482.3_Silent_p.I262I|TCF4_ENST00000570177.2_Silent_p.I292I|TCF4_ENST00000398339.1_Silent_p.I524I|TCF4_ENST00000570287.2_Silent_p.I262I|TCF4_ENST00000543082.1_Silent_p.I380I|TCF4_ENST00000544241.2_Silent_p.I351I|TCF4_ENST00000565018.2_Silent_p.I422I|TCF4_ENST00000566279.1_Silent_p.I362I|TCF4_ENST00000354452.3_Silent_p.I422I|TCF4_ENST00000564999.1_Silent_p.I422I|TCF4_ENST00000568673.1_Silent_p.I398I|TCF4_ENST00000567880.1_Silent_p.I362I|TCF4_ENST00000561992.1_Silent_p.I292I|TCF4_ENST00000561831.3_Silent_p.I262I|TCF4_ENST00000563760.1_5'UTR|TCF4_ENST00000537578.1_Silent_p.I398I	NM_003199.2	NP_003190.1	P15884	ITF2_HUMAN	transcription factor 4	422					DNA-templated transcription, initiation (GO:0006352)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein-DNA complex assembly (GO:0065004)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity (GO:0001011)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TFIIB-class binding transcription factor activity (GO:0001087)|TFIIB-class transcription factor binding (GO:0001093)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	41				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		GAGAAGGTCCAATGATTCCAT	0.493																																					p.I524I		.											.	TCF4-523	0			c.T1572C						.						118.0	106.0	110.0					18																	52921812		2203	4300	6503	SO:0001819	synonymous_variant	6925	exon16			AGGTCCAATGATT	M74719	CCDS11960.1, CCDS42438.1, CCDS58623.1, CCDS58624.1, CCDS58625.1, CCDS58626.1, CCDS58627.1, CCDS58628.1, CCDS58629.1, CCDS58630.1, CCDS58631.1, CCDS59321.1	18q21.1	2013-05-21			ENSG00000196628	ENSG00000196628		"""Basic helix-loop-helix proteins"""	11634	protein-coding gene	gene with protein product		602272				9302263, 2308860	Standard	NM_001083962		Approved	SEF2-1B, ITF2, bHLHb19, E2-2	uc002lga.3	P15884	OTTHUMG00000132713	ENST00000356073.4:c.1266T>C	18.37:g.52921812A>G		Somatic	52	0		WXS	Illumina HiSeq	Phase_I	53	22	NM_001243226	0	0	0	0	0	B3KT62|B3KUC0|B4DT37|B4DUG3|B7Z5M6|B7Z6Y1|G0LNT9|G0LNU0|G0LNU1|G0LNU2|G0LNU4|G0LNU5|G0LNU8|G0LNU9|G0LNV0|G0LNV1|G0LNV2|H3BPQ1|Q08AP2|Q08AP3|Q15439|Q15440|Q15441	Silent	SNP	ENST00000356073.4	37	CCDS11960.1																																																																																			.		0.493	TCF4-002	KNOWN	upstream_uORF|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256014.1	NM_003199	
APC2	10297	hgsc.bcm.edu	37	19	1460857	1460857	+	Splice_Site	SNP	G	G	T			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr19:1460857G>T	ENST00000535453.1	+	11	3234		c.e11+1		APC2_ENST00000233607.2_Splice_Site|CTB-25B13.12_ENST00000588225.1_RNA|APC2_ENST00000238483.4_Splice_Site			P02655	APOC2_HUMAN	adenomatosis polyposis coli 2						cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|chylomicron remnant clearance (GO:0034382)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle clearance (GO:0034384)|lipid catabolic process (GO:0016042)|lipoprotein metabolic process (GO:0042157)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of receptor-mediated endocytosis (GO:0048261)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipid catabolic process (GO:0060697)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)|very-low-density lipoprotein particle remodeling (GO:0034372)	chylomicron (GO:0042627)|early endosome (GO:0005769)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate-density lipoprotein particle (GO:0034363)|low-density lipoprotein particle (GO:0034362)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	lipase inhibitor activity (GO:0055102)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|kidney(4)|large_intestine(2)|lung(5)|pancreas(1)|skin(2)	18		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTCCACCAGGTACAGGGCGG	0.697																																					.		.											.	APC2-290	0			c.1521+1G>T						.						23.0	27.0	26.0					19																	1460857		2200	4295	6495	SO:0001630	splice_region_variant	10297	exon12			CACCAGGTACAGG		CCDS12068.1	19p13.3	2013-02-14			ENSG00000115266	ENSG00000115266		"""Armadillo repeat containing"""	24036	protein-coding gene	gene with protein product	"""adenomatous polyposis coli like"""	612034				9823329, 10021369	Standard	XM_005259475		Approved	APCL	uc002lsr.1	O95996		ENST00000535453.1:c.1521+1G>T	19.37:g.1460857G>T		Somatic	66	0		WXS	Illumina HiSeq	Phase_I	51	3	NM_005883	0	0	11	11	0	C0JYY4|Q9BS39|Q9UDE3|Q9UNK3	Splice_Site	SNP	ENST00000535453.1	37	CCDS12068.1	.	.	.	.	.	.	.	.	.	.	G	11.96	1.794659	0.31777	.	.	ENSG00000115266	ENST00000233607;ENST00000238483;ENST00000535453	.	.	.	4.07	1.92	0.25849	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.8948	0.35458	0.1893:0.0:0.8107:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	APC2	1411857	1.000000	0.71417	0.989000	0.46669	0.477000	0.33069	5.418000	0.66429	0.384000	0.24942	-0.251000	0.11542	.	.		0.697	APC2-004	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449539.2	NM_005883	Intron
KHSRP	8570	hgsc.bcm.edu	37	19	6420477	6420477	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr19:6420477G>C	ENST00000398148.3	-	5	523	c.431C>G	c.(430-432)tCa>tGa	p.S144*		NM_003685.2	NP_003676.2	Q92945	FUBP2_HUMAN	KH-type splicing regulatory protein	144	Gly-rich.|KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.				gene expression (GO:0010467)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of miRNA metabolic process (GO:2000628)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|transcription, DNA-templated (GO:0006351)	cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(3)|liver(1)|lung(6)|skin(1)|soft_tissue(1)	17						TTCTGTCATTGAAGTCCTGTA	0.577																																					p.S144X	Colon(55;593 1006 2067 9135 22980)	.											.	KHSRP-226	0			c.C431G						.						59.0	64.0	62.0					19																	6420477		2038	4196	6234	SO:0001587	stop_gained	8570	exon5			GTCATTGAAGTCC	U94832	CCDS45936.1	19p13.3	2010-11-23	2008-02-04		ENSG00000088247	ENSG00000088247			6316	protein-coding gene	gene with protein product	"""FUSE binding protein 2"""	603445				9136930, 8940189	Standard	NM_003685		Approved	KSRP, FBP2, FUBP2	uc002mer.4	Q92945		ENST00000398148.3:c.431C>G	19.37:g.6420477G>C	ENSP00000381216:p.Ser144*	Somatic	38	0		WXS	Illumina HiSeq	Phase_I	38	2	NM_003685	0	0	2	2	0	O00301|Q59EZ9|Q5U4P6|Q9UNT5|Q9UQH5	Nonsense_Mutation	SNP	ENST00000398148.3	37	CCDS45936.1	.	.	.	.	.	.	.	.	.	.	G	36	5.747406	0.96882	.	.	ENSG00000088247	ENST00000398148;ENST00000201886;ENST00000424942	.	.	.	4.88	3.85	0.44370	.	0.391333	0.26478	N	0.024152	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	.	11.8559	0.52437	0.0857:0.0:0.9143:0.0	.	.	.	.	X	144;144;100	.	ENSP00000201886:S144X	S	-	2	0	KHSRP	6371477	0.995000	0.38212	0.891000	0.34965	0.736000	0.42039	3.476000	0.53143	1.266000	0.44231	0.655000	0.94253	TCA	.		0.577	KHSRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453305.1		
FBN3	84467	hgsc.bcm.edu	37	19	8203361	8203361	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr19:8203361C>A	ENST00000600128.1	-	9	1367	c.953G>T	c.(952-954)tGc>tTc	p.C318F	FBN3_ENST00000601739.1_Missense_Mutation_p.C318F|FBN3_ENST00000270509.2_Missense_Mutation_p.C318F			Q75N90	FBN3_HUMAN	fibrillin 3	318	TB 2.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						CCTGTCACAGCAGCACTGCCT	0.662																																					p.C318F		.											.	FBN3-100	0			c.G953T						.						26.0	29.0	28.0					19																	8203361		2203	4298	6501	SO:0001583	missense	84467	exon8			TCACAGCAGCACT		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.953G>T	19.37:g.8203361C>A	ENSP00000470498:p.Cys318Phe	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	39	2	NM_032447	0	0	0	0	0	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	ENST00000600128.1	37	CCDS12196.1	.	.	.	.	.	.	.	.	.	.	c	19.80	3.895457	0.72639	.	.	ENSG00000142449	ENST00000270509	D	0.99875	-7.4	4.06	4.06	0.47325	Matrix fibril-associated (3);TGF-beta binding (1);	0.000000	0.85682	U	0.000000	D	0.99883	0.9944	M	0.92738	3.34	0.49483	D	0.999794	D	0.89917	1.0	D	0.91635	0.999	D	0.96243	0.9177	10	0.56958	D	0.05	.	16.1794	0.81889	0.0:1.0:0.0:0.0	.	318	Q75N90	FBN3_HUMAN	F	318	ENSP00000270509:C318F	ENSP00000270509:C318F	C	-	2	0	FBN3	8109361	1.000000	0.71417	1.000000	0.80357	0.661000	0.39034	7.232000	0.78116	1.974000	0.57490	0.556000	0.70494	TGC	.		0.662	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2	NM_032447	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	9056220	9056220	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr19:9056220G>C	ENST00000397910.4	-	3	31429	c.31226C>G	c.(31225-31227)aCa>aGa	p.T10409R		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10411	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ACTTGTCACTGTTCCCAGCTC	0.473																																					p.T10409R		.											.	MUC16-566	0			c.C31226G						.						201.0	199.0	200.0					19																	9056220		2020	4181	6201	SO:0001583	missense	94025	exon3			GTCACTGTTCCCA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.31226C>G	19.37:g.9056220G>C	ENSP00000381008:p.Thr10409Arg	Somatic	268	0		WXS	Illumina HiSeq	Phase_I	246	94	NM_024690	0	0	0	0	0	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	7.773	0.707853	0.15239	.	.	ENSG00000181143	ENST00000397910	T	0.02525	4.26	3.94	-6.08	0.02151	.	.	.	.	.	T	0.01489	0.0048	N	0.19112	0.55	.	.	.	B	0.33044	0.395	B	0.27076	0.076	T	0.43798	-0.9369	8	0.87932	D	0	.	0.9223	0.01318	0.1739:0.2499:0.196:0.3802	.	10409	B5ME49	.	R	10409	ENSP00000381008:T10409R	ENSP00000381008:T10409R	T	-	2	0	MUC16	8917220	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.198000	0.01239	-1.038000	0.03279	-0.181000	0.13052	ACA	.		0.473	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
CHERP	10523	hgsc.bcm.edu	37	19	16640580	16640580	+	Silent	SNP	T	T	C	rs528619775	byFrequency	TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr19:16640580T>C	ENST00000198939.6	-	8	1077	c.1041A>G	c.(1039-1041)caA>caG	p.Q347Q	CHERP_ENST00000546361.2_Silent_p.Q336Q|CTD-3222D19.2_ENST00000409035.1_Intron					calcium homeostasis endoplasmic reticulum protein									p.Q336Q(2)		endometrium(3)|kidney(2)|large_intestine(4)|lung(9)|ovary(2)|stomach(1)|urinary_tract(3)	24						gctgctgctgttgctgctgct	0.667													T|||	23	0.00459265	0.0129	0.0043	5008	,	,		16097	0.001		0.001	False		,,,				2504	0.001				p.Q336Q		.											.	CHERP-92	2	Substitution - coding silent(2)	lung(2)	c.A1008G						.						21.0	29.0	26.0					19																	16640580		2193	4293	6486	SO:0001819	synonymous_variant	10523	exon8			CTGCTGTTGCTGC	U94836	CCDS42518.1	19p13.1	2013-01-28				ENSG00000085872		"""G patch domain containing"""	16930	protein-coding gene	gene with protein product						8896557, 10794731	Standard	NM_006387		Approved	ERPROT213-21, DAN16	uc002nei.1	Q8IWX8	OTTHUMG00000169304	ENST00000198939.6:c.1041A>G	19.37:g.16640580T>C		Somatic	36	1		WXS	Illumina HiSeq	Phase_I	38	2	NM_006387	0	1	96	4806	4709		Silent	SNP	ENST00000198939.6	37																																																																																				.		0.667	CHERP-003	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000403372.1	NM_006387	
ZNF93	81931	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	20044771	20044771	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr19:20044771C>T	ENST00000343769.5	+	4	1035	c.1007C>T	c.(1006-1008)aCt>aTt	p.T336I	AC007204.2_ENST00000592245.1_lincRNA	NM_031218.3	NP_112495.2	P35789	ZNF93_HUMAN	zinc finger protein 93	336					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(2)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	24						AGAATTCATACTGGAGAGAAA	0.378																																					p.T336I		.											.	ZNF93-91	0			c.C1007T						.						57.0	57.0	57.0					19																	20044771		2203	4300	6503	SO:0001583	missense	81931	exon4			TTCATACTGGAGA	M61873	CCDS32973.1	19p12	2014-02-12	2006-05-12		ENSG00000184635	ENSG00000184635		"""Zinc fingers, C2H2-type"", ""-"""	13169	protein-coding gene	gene with protein product		603975	"""zinc finger protein 505"", ""zinc finger protein 93 (HTF34)"""	ZNF505		8467795, 2023909	Standard	NM_031218		Approved	HPF34, TF34, FLJ12488	uc002non.3	P35789	OTTHUMG00000182371	ENST00000343769.5:c.1007C>T	19.37:g.20044771C>T	ENSP00000342002:p.Thr336Ile	Somatic	53	0		WXS	Illumina HiSeq	Phase_I	53	21	NM_031218	0	0	27	28	1	A6NMY2|B9EGT2|Q8N8Q4|Q9H9X5|Q9Y2N8	Missense_Mutation	SNP	ENST00000343769.5	37	CCDS32973.1	.	.	.	.	.	.	.	.	.	.	c	17.57	3.422998	0.62733	.	.	ENSG00000184635	ENST00000343769;ENST00000427325	T	0.25749	1.78	0.85	0.85	0.18980	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.46521	0.1397	M	0.77103	2.36	0.28256	N	0.925036	D	0.71674	0.998	D	0.76575	0.988	T	0.30208	-0.9986	9	0.87932	D	0	.	6.9971	0.24789	0.0:1.0:0.0:0.0	.	336	P35789	ZNF93_HUMAN	I	336	ENSP00000342002:T336I	ENSP00000342002:T336I	T	+	2	0	ZNF93	19905771	0.931000	0.31567	0.796000	0.32109	0.795000	0.44927	1.895000	0.39778	0.192000	0.20272	0.195000	0.17529	ACT	.		0.378	ZNF93-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460808.2	NM_031218	
AGBL5	60509	hgsc.bcm.edu	37	2	27291528	27291528	+	Silent	SNP	A	A	G			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr2:27291528A>G	ENST00000360131.4	+	13	2430	c.2271A>G	c.(2269-2271)ggA>ggG	p.G757G		NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	757					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGTCCTCTGGAGACAAACCAG	0.512																																					p.G757G		.											.	AGBL5-154	0			c.A2271G						.						78.0	79.0	79.0					2																	27291528		2203	4300	6503	SO:0001819	synonymous_variant	60509	exon13			CTCTGGAGACAAA	BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.2271A>G	2.37:g.27291528A>G		Somatic	57	0		WXS	Illumina HiSeq	Phase_I	38	2	NM_021831	0	0	20	20	0	A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Silent	SNP	ENST00000360131.4	37	CCDS1732.3																																																																																			.		0.512	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000309033.1	NM_021831	
SLC8A1	6546	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	40405590	40405590	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr2:40405590T>C	ENST00000403092.1	-	3	1885	c.1852A>G	c.(1852-1854)Aaa>Gaa	p.K618E	SLC8A1-AS1_ENST00000599268.1_RNA|SLC8A1_ENST00000542756.1_Missense_Mutation_p.K618E|SLC8A1-AS1_ENST00000599740.1_RNA|SLC8A1_ENST00000405901.3_Missense_Mutation_p.K618E|SLC8A1_ENST00000406785.2_Intron|SLC8A1_ENST00000332839.4_Missense_Mutation_p.K618E|SLC8A1-AS1_ENST00000597170.1_RNA|SLC8A1-AS1_ENST00000596532.1_RNA|SLC8A1_ENST00000406391.2_Intron|SLC8A1-AS1_ENST00000593848.1_RNA|SLC8A1-AS1_ENST00000597385.1_RNA|SLC8A1_ENST00000408028.2_Intron|SLC8A1-AS1_ENST00000598247.1_RNA|SLC8A1_ENST00000542024.1_Intron|SLC8A1-AS1_ENST00000599956.1_RNA|SLC8A1-AS1_ENST00000444629.1_RNA|SLC8A1-AS1_ENST00000435515.1_RNA|SLC8A1_ENST00000402441.1_Intron|SLC8A1-AS1_ENST00000593878.1_RNA|SLC8A1-AS1_ENST00000601679.1_RNA|SLC8A1_ENST00000405269.1_Intron			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	618	Calx-beta 2.				blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	GTCTTGTTTTTCTCATACTCC	0.468																																					p.K618E		.											.	SLC8A1-93	0			c.A1852G						.						239.0	235.0	237.0					2																	40405590		2203	4300	6503	SO:0001583	missense	6546	exon2			TGTTTTTCTCATA		CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.1852A>G	2.37:g.40405590T>C	ENSP00000384763:p.Lys618Glu	Somatic	270	0		WXS	Illumina HiSeq	Phase_I	241	108	NM_021097	0	0	0	0	0	A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	ENST00000403092.1	37	CCDS1806.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.338174	0.81911	.	.	ENSG00000183023	ENST00000378715;ENST00000542756;ENST00000403092;ENST00000405901;ENST00000332839	T;T;T;T	0.28069	1.63;1.63;1.63;1.63	5.39	5.39	0.77823	Na-Ca exchanger/integrin-beta4 (2);	0.000000	0.85682	D	0.000000	T	0.49423	0.1556	L	0.52011	1.625	0.80722	D	1	P;D	0.89917	0.917;1.0	P;D	0.91635	0.721;0.999	T	0.50800	-0.8785	10	0.87932	D	0	.	13.3557	0.60627	0.0:0.0:0.0:1.0	.	618;618	F6VPY9;P32418	.;NAC1_HUMAN	E	618	ENSP00000440727:K618E;ENSP00000384763:K618E;ENSP00000385678:K618E;ENSP00000332931:K618E	ENSP00000332931:K618E	K	-	1	0	SLC8A1	40259094	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.587000	0.82613	2.028000	0.59812	0.482000	0.46254	AAA	.		0.468	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097	
FBXO11	80204	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	48049436	48049436	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr2:48049436A>C	ENST00000403359.3	-	13	1695	c.1623T>G	c.(1621-1623)aaT>aaG	p.N541K	FBXO11_ENST00000402508.1_Missense_Mutation_p.N457K|FBXO11_ENST00000434523.2_5'UTR|FBXO11_ENST00000316377.4_Missense_Mutation_p.N457K	NM_001190274.1	NP_001177203.1	Q86XK2	FBX11_HUMAN	F-box protein 11	541					cellular protein modification process (GO:0006464)|peptidyl-arginine N-methylation (GO:0035246)|protein ubiquitination (GO:0016567)|sensory perception of sound (GO:0007605)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	protein-arginine N-methyltransferase activity (GO:0016274)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.0?(2)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	26		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TAAATATAGAATTTCCCCTAT	0.343			"""Mis, F, D"""		DLBCL																																p.N541K		.		Rec	yes		2	2p16.3	80204	F-box protein 11		L	.	FBXO11-659	2	Whole gene deletion(2)	haematopoietic_and_lymphoid_tissue(2)	c.T1623G						.						51.0	51.0	51.0					2																	48049436		2202	4298	6500	SO:0001583	missense	80204	exon13			TATAGAATTTCCC	AF174599	CCDS1837.1, CCDS54357.1	2p16.3	2014-01-29	2008-06-23	2008-06-23	ENSG00000138081	ENSG00000138081		"""Ubiquitin protein ligase E3 component n-recognins"", ""F-boxes /  ""other"""""	13590	protein-coding gene	gene with protein product	"""ubiquitin protein ligase E3 component n-recognin 6"""	607871	"""F-box only protein 11"""			10531035, 16487488, 18162545	Standard	NM_025133		Approved	FBX11, UBR6	uc002rwe.3	Q86XK2	OTTHUMG00000129130	ENST00000403359.3:c.1623T>G	2.37:g.48049436A>C	ENSP00000384823:p.Asn541Lys	Somatic	54	0		WXS	Illumina HiSeq	Phase_I	54	19	NM_001190274	0	0	0	0	0	A1L491|Q52ZP1|Q53EP7|Q53RT5|Q8IXG3|Q96E90|Q9H6V8|Q9H9L1|Q9NR14|Q9UFK1|Q9UHI1|Q9UKC2	Missense_Mutation	SNP	ENST00000403359.3	37	CCDS54357.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.6|20.6	4.023026|4.023026	0.75275|0.75275	.|.	.|.	ENSG00000138081|ENSG00000138081	ENST00000493962|ENST00000402508;ENST00000403359;ENST00000316377	.|D;D;D	.|0.89485	.|-2.52;-1.81;-2.52	5.42|5.42	5.42|5.42	0.78866|0.78866	.|Pectin lyase fold/virulence factor (1);Carbohydrate-binding/sugar hydrolysis domain (1);F-box domain, Skp2-like (1);Pectin lyase fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.93135|0.93135	0.7814|0.7814	M|M	0.92459|0.92459	3.31|3.31	0.80722|0.80722	D|D	1|1	.|B	.|0.26258	.|0.145	.|B	.|0.37304	.|0.246	D|D	0.92695|0.92695	0.6170|0.6170	5|10	.|0.66056	.|D	.|0.02	-16.8508|-16.8508	15.4471|15.4471	0.75238|0.75238	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|541	.|Q86XK2	.|FBX11_HUMAN	V|K	333|457;541;457	.|ENSP00000385398:N457K;ENSP00000384823:N541K;ENSP00000323822:N457K	.|ENSP00000323822:N457K	F|N	-|-	1|3	0|2	FBXO11|FBXO11	47902940|47902940	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	4.344000|4.344000	0.59354|0.59354	2.039000|2.039000	0.60335|0.60335	0.533000|0.533000	0.62120|0.62120	TTC|AAT	.		0.343	FBXO11-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251181.3	NM_012167, NM_018693, NM_025133	
CTLA4	1493	hgsc.bcm.edu	37	2	204735645	204735645	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr2:204735645T>C	ENST00000302823.3	+	2	603	c.446T>C	c.(445-447)aTt>aCt	p.I149T	CTLA4_ENST00000472206.1_Intron|CTLA4_ENST00000427473.2_Missense_Mutation_p.I112T|CTLA4_ENST00000295854.6_Missense_Mutation_p.I149T|CTLA4_ENST00000487393.1_Intron	NM_005214.4	NP_005205.2	P16410	CTLA4_HUMAN	cytotoxic T-lymphocyte-associated protein 4	149					B cell receptor signaling pathway (GO:0050853)|cellular response to DNA damage stimulus (GO:0006974)|immune response (GO:0006955)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of immune response (GO:0050777)|negative regulation of regulatory T cell differentiation (GO:0045590)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of apoptotic process (GO:0043065)|T cell costimulation (GO:0031295)	clathrin-coated endocytic vesicle (GO:0045334)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)				large_intestine(4)|lung(4)|skin(1)	9					Ipilimumab(DB06186)	GGAACCCAGATTTATGTAATT	0.473																																					p.I149T		.											.	CTLA4-90	0			c.T446C						.						56.0	53.0	54.0					2																	204735645		2203	4300	6503	SO:0001583	missense	1493	exon2			CCCAGATTTATGT		CCDS2362.1, CCDS42803.1	2q33	2014-02-03			ENSG00000163599	ENSG00000163599		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	2505	protein-coding gene	gene with protein product		123890	"""celiac disease 3"", ""insulin-dependent diabetes mellitus 12"""	CELIAC3, IDDM12		3220103, 8817351	Standard	NM_005214		Approved	CD152, CD, GSE, CD28, ICOS	uc002vak.2	P16410	OTTHUMG00000132877	ENST00000302823.3:c.446T>C	2.37:g.204735645T>C	ENSP00000303939:p.Ile149Thr	Somatic	43	0		WXS	Illumina HiSeq	Phase_I	39	2	NM_005214	0	0	0	0	0	A0N1S0|E9PDH0|O95653|Q0PP65|Q52MC1|Q53TD5|Q5S005|Q8WXJ1|Q96P43|Q9UKN9	Missense_Mutation	SNP	ENST00000302823.3	37	CCDS2362.1	.	.	.	.	.	.	.	.	.	.	T	14.32	2.501240	0.44455	.	.	ENSG00000163599	ENST00000302823;ENST00000295854;ENST00000427473	T;T;T	0.46063	0.88;0.88;0.88	5.34	5.34	0.76211	Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.124068	0.52532	D	0.000063	T	0.65585	0.2705	M	0.77616	2.38	0.40810	D	0.983413	D;D	0.89917	0.999;1.0	D;D	0.97110	1.0;0.997	T	0.71656	-0.4527	10	0.87932	D	0	-14.9442	14.4845	0.67606	0.0:0.0:0.0:1.0	.	149;149	Q8TDA6;P16410	.;CTLA4_HUMAN	T	149;149;112	ENSP00000303939:I149T;ENSP00000295854:I149T;ENSP00000409707:I112T	ENSP00000295854:I149T	I	+	2	0	CTLA4	204443890	1.000000	0.71417	1.000000	0.80357	0.107000	0.19398	5.303000	0.65738	2.015000	0.59207	0.533000	0.62120	ATT	.		0.473	CTLA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256365.1	NM_005214	
FRG1B	284802	bcgsc.ca	37	20	29628225	29628225	+	Splice_Site	SNP	A	A	G			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr20:29628225A>G	ENST00000278882.3	+	6	608		c.e6-1		FRG1B_ENST00000439954.2_Splice_Site|FRG1B_ENST00000358464.4_Splice_Site			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B											endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TGTTTCACTTAGGGGAAAATG	0.358																																					.													.	FRG1B-22	0			c.529-2A>G						.																																			SO:0001630	splice_region_variant	284802	exon5			TCACTTAGGGGAA			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.229-1A>G	20.37:g.29628225A>G		Somatic	245	6		WXS	Illumina HiSeq	Phase_1	261	16	NR_003579	0	0	0	0	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	.	8.410	0.843922	0.16963	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	.	.	.	1.89	1.89	0.25635	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.7774	0.29046	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FRG1B	28241886	1.000000	0.71417	0.998000	0.56505	0.247000	0.25773	7.946000	0.87746	1.131000	0.42111	0.147000	0.16070	.	.		0.358	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	Intron
KCNB1	3745	hgsc.bcm.edu	37	20	48098853	48098853	+	Silent	SNP	C	C	G			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr20:48098853C>G	ENST00000371741.4	-	1	331	c.165G>C	c.(163-165)acG>acC	p.T55T		NM_004975.2	NP_004966.1	Q14721	KCNB1_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 1	55					energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|dendrite membrane (GO:0032590)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(22)|pancreas(2)|prostate(7)|skin(4)|stomach(1)|urinary_tract(1)	53			BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Dalfampridine(DB06637)	TGCCCAGCCGCGTGCGGGGCA	0.672																																					p.T55T		.											.	KCNB1-92	0			c.G165C						.						15.0	15.0	15.0					20																	48098853		2167	4240	6407	SO:0001819	synonymous_variant	3745	exon1			CAGCCGCGTGCGG	AF026005	CCDS13418.1	20q13.2	2012-07-05			ENSG00000158445	ENSG00000158445		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6231	protein-coding gene	gene with protein product		600397				7774931, 16382104	Standard	NM_004975		Approved	Kv2.1	uc002xur.1	Q14721	OTTHUMG00000033051	ENST00000371741.4:c.165G>C	20.37:g.48098853C>G		Somatic	26	0		WXS	Illumina HiSeq	Phase_I	26	2	NM_004975	0	0	1	1	0	Q14193	Silent	SNP	ENST00000371741.4	37	CCDS13418.1																																																																																			.		0.672	KCNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080374.3	NM_004975	
MRGBP	55257	hgsc.bcm.edu	37	20	61427956	61427956	+	Silent	SNP	G	G	A	rs374837545		TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr20:61427956G>A	ENST00000370487.3	+	1	152	c.81G>A	c.(79-81)gaG>gaA	p.E27E		NM_018270.4	NP_060740.1	Q9NV56	MRGBP_HUMAN	MRG/MORF4L binding protein	27					chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	H4/H2A histone acetyltransferase complex (GO:0043189)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											CGGCGGAGGAGACAGTGGTGT	0.776																																					p.E27E		.											.	.	0			c.G81A						.	G		0,4168		0,0,2084	16.0	16.0	16.0		81	0.7	1.0	20		16	4,8196		0,4,4096	no	coding-synonymous	C20orf20	NM_018270.4		0,4,6180	AA,AG,GG		0.0488,0.0,0.0323		27/205	61427956	4,12364	2084	4100	6184	SO:0001819	synonymous_variant	55257	exon1			GGAGGAGACAGTG	AK001776	CCDS13503.1	20q13.33	2012-10-29	2012-10-29	2012-10-29	ENSG00000101189	ENSG00000101189			15866	protein-coding gene	gene with protein product		611157	"""chromosome 20 open reading frame 20"""	C20orf20		12963728	Standard	NM_018270		Approved	FLJ10914, MRG15BP, Eaf7	uc002ydi.3	Q9NV56	OTTHUMG00000032940	ENST00000370487.3:c.81G>A	20.37:g.61427956G>A		Somatic	2	0		WXS	Illumina HiSeq	Phase_I	5	2	NM_018270	0	0	4	9	5	A8C4L5	Silent	SNP	ENST00000370487.3	37	CCDS13503.1																																																																																			.		0.776	MRGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080080.1	NM_018270	
SYNJ1	8867	hgsc.bcm.edu	37	21	34029042	34029042	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr21:34029042T>C	ENST00000322229.7	-	20	2749	c.2750A>G	c.(2749-2751)gAg>gGg	p.E917G	SYNJ1_ENST00000464778.1_5'UTR|SYNJ1_ENST00000357345.3_Missense_Mutation_p.E917G|SYNJ1_ENST00000382491.3_Missense_Mutation_p.E912G|SYNJ1_ENST00000382499.2_Missense_Mutation_p.E956G|SYNJ1_ENST00000433931.2_Missense_Mutation_p.E956G			O43426	SYNJ1_HUMAN	synaptojanin 1	917	Pro-rich.|RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cell death (GO:0008219)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of synaptic vesicle uncoating (GO:1903390)|regulation of synaptic vesicle membrane organization (GO:1901632)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)	cytosol (GO:0005829)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|lung(11)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	57						CTGCAGAAGCTCATCAATCAA	0.333																																					p.E956G		.											.	SYNJ1-232	0			c.A2867G						.						43.0	44.0	43.0					21																	34029042		2202	4300	6502	SO:0001583	missense	8867	exon21			AGAAGCTCATCAA	AF009040	CCDS33539.1, CCDS33540.1, CCDS33539.2, CCDS33540.2, CCDS54483.1	21q22.2	2008-06-23			ENSG00000159082	ENSG00000159082			11503	protein-coding gene	gene with protein product		604297				9428629, 10773674	Standard	NM_203446		Approved	INPP5G	uc002yqh.2	O43426	OTTHUMG00000064926	ENST00000322229.7:c.2750A>G	21.37:g.34029042T>C	ENSP00000322234:p.Glu917Gly	Somatic	52	0		WXS	Illumina HiSeq	Phase_I	38	2	NM_203446	0	0	4	4	0	O43425|O94984|Q4KMR1	Missense_Mutation	SNP	ENST00000322229.7	37	CCDS54484.1	.	.	.	.	.	.	.	.	.	.	T	17.97	3.517716	0.64634	.	.	ENSG00000159082	ENST00000382491;ENST00000357345;ENST00000382499;ENST00000433931;ENST00000322229	D;D;D;D;D	0.94417	-2.55;-3.41;-3.42;-2.63;-2.64	5.35	5.35	0.76521	Domain of unknown function DUF1866 (1);Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.146900	0.64402	D	0.000012	D	0.93687	0.7983	L	0.55481	1.735	0.58432	D	0.999999	B;P;B;P;P	0.39480	0.17;0.607;0.218;0.607;0.675	B;B;B;B;B	0.43155	0.124;0.41;0.167;0.41;0.23	D	0.94197	0.7446	10	0.72032	D	0.01	.	15.3206	0.74117	0.0:0.0:0.0:1.0	.	912;956;917;917;917	B9EGN3;C9JFZ1;O43426-2;O43426;O43426-4	.;.;.;SYNJ1_HUMAN;.	G	912;917;956;956;917	ENSP00000371931:E912G;ENSP00000349903:E917G;ENSP00000371939:E956G;ENSP00000409667:E956G;ENSP00000322234:E917G	ENSP00000322234:E917G	E	-	2	0	SYNJ1	32950913	1.000000	0.71417	0.999000	0.59377	0.971000	0.66376	6.109000	0.71528	2.027000	0.59764	0.402000	0.26972	GAG	.		0.333	SYNJ1-201	KNOWN	basic|CCDS	protein_coding	protein_coding			
DNMT3L	29947	hgsc.bcm.edu	37	21	45668957	45668957	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr21:45668957G>C	ENST00000418993.1	-	11	1430	c.947C>G	c.(946-948)tCc>tGc	p.S316C	AP001059.5_ENST00000442785.1_RNA|DNMT3L_ENST00000270172.3_Missense_Mutation_p.S316C	NM_175867.2	NP_787063.1	Q9UJW3	DNM3L_HUMAN	DNA (cytosine-5-)-methyltransferase 3-like	316					chorionic trophoblast cell differentiation (GO:0060718)|DNA methylation (GO:0006306)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|placenta development (GO:0001890)|positive regulation of catalytic activity (GO:0043085)|regulation of gene expression by genetic imprinting (GO:0006349)|spermatogenesis (GO:0007283)	condensed nuclear chromosome (GO:0000794)|cytosol (GO:0005829)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(3)	11				Colorectal(79;0.0165)|READ - Rectum adenocarcinoma(84;0.0781)		ATTCTGCAAGGATCCGCCGTG	0.637																																					p.S316C		.											.	DNMT3L-228	0			c.C947G						.						59.0	46.0	50.0					21																	45668957		2203	4300	6503	SO:0001583	missense	29947	exon11			TGCAAGGATCCGC	AF194032	CCDS13705.1	21q22.3	2008-07-31			ENSG00000142182	ENSG00000142182			2980	protein-coding gene	gene with protein product	"""cytosine-5-methyltransferase 3-like protein"", ""human cytosine-5-methyltransferase 3-like protein"""	606588				10857753	Standard	NM_013369		Approved	MGC1090	uc002zeh.2	Q9UJW3	OTTHUMG00000086914	ENST00000418993.1:c.947C>G	21.37:g.45668957G>C	ENSP00000412862:p.Ser316Cys	Somatic	25	0		WXS	Illumina HiSeq	Phase_I	28	2	NM_013369	0	0	1	1	0	E9PB42|Q9BUJ4	Missense_Mutation	SNP	ENST00000418993.1	37	CCDS46650.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.458|8.458	0.854735|0.854735	0.17106|0.17106	.|.	.|.	ENSG00000142182|ENSG00000142182	ENST00000436357|ENST00000270172;ENST00000418993	.|T;T	.|0.35605	.|1.3;1.3	3.03|3.03	-3.77|-3.77	0.04346|0.04346	.|.	.|1.415870	.|0.04503	.|N	.|0.381631	T|T	0.17280|0.17280	0.0415|0.0415	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|B;B	.|0.21452	.|0.056;0.056	.|B;B	.|0.08055	.|0.003;0.003	T|T	0.21930|0.21930	-1.0231|-1.0231	5|10	.|0.72032	.|D	.|0.01	-3.1172|-3.1172	4.5041|4.5041	0.11879|0.11879	0.6019:0.0:0.2301:0.168|0.6019:0.0:0.2301:0.168	.|.	.|316;316	.|Q9UJW3-2;Q9UJW3	.|.;DNM3L_HUMAN	A|C	111|316	.|ENSP00000270172:S316C;ENSP00000412862:S316C	.|ENSP00000270172:S316C	P|S	-|-	1|2	0|0	DNMT3L|DNMT3L	44493385|44493385	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-0.047000|-0.047000	0.11963|0.11963	-0.950000|-0.950000	0.03659|0.03659	-0.244000|-0.244000	0.11960|0.11960	CCT|TCC	.		0.637	DNMT3L-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000195820.1	NM_013369	
SBF1	6305	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	50903300	50903300	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr22:50903300G>A	ENST00000390679.3	-	13	1563	c.1379C>T	c.(1378-1380)cCc>cTc	p.P460L	SBF1_ENST00000380817.3_Missense_Mutation_p.P460L|SBF1_ENST00000348911.6_Missense_Mutation_p.P461L			O95248	MTMR5_HUMAN	SET binding factor 1	460					cell death (GO:0008219)|positive regulation of Rab GTPase activity (GO:0032851)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(8)|large_intestine(3)|lung(18)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	43		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		GACACGCTGGGGGTGGTTCTC	0.642																																					p.P460L		.											.	SBF1-90	0			c.C1379T						.						46.0	51.0	49.0					22																	50903300		2127	4220	6347	SO:0001583	missense	6305	exon13			CGCTGGGGGTGGT	U93181	CCDS14091.1, CCDS14091.2	22q13.33	2013-01-10			ENSG00000100241	ENSG00000100241		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	10542	protein-coding gene	gene with protein product	"""myotubularin related 5"", ""DENN/MADD domain containing 7A"""	603560				9537414, 9736772	Standard	NM_002972		Approved	MTMR5, DENND7A	uc003blh.3	O95248	OTTHUMG00000150204	ENST00000390679.3:c.1379C>T	22.37:g.50903300G>A	ENSP00000375097:p.Pro460Leu	Somatic	78	0		WXS	Illumina HiSeq	Phase_I	68	25	NM_002972	0	0	9	22	13	A6PVG9|O60228|Q5JXD8|Q5PPM2|Q96GR9|Q9UGB8	Missense_Mutation	SNP	ENST00000390679.3	37		.	.	.	.	.	.	.	.	.	.	G	19.24	3.789727	0.70337	.	.	ENSG00000100241	ENST00000380817;ENST00000348911;ENST00000356279;ENST00000337034;ENST00000390679	D;D;D	0.86769	-2.16;-2.16;-2.17	4.17	4.17	0.49024	.	0.269330	0.29767	N	0.011248	D	0.87822	0.6274	L	0.49126	1.545	0.58432	D	0.999996	B;P;D	0.56746	0.021;0.873;0.977	B;P;P	0.55923	0.029;0.466;0.787	D	0.86760	0.1966	10	0.44086	T	0.13	.	9.8481	0.41039	0.0:0.0:0.6463:0.3537	.	460;461;460	O95248;G5E933;O95248-4	MTMR5_HUMAN;.;.	L	460;461;471;470;460	ENSP00000370196:P460L;ENSP00000252027:P461L;ENSP00000375097:P460L	ENSP00000336522:P470L	P	-	2	0	SBF1	49250166	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	3.603000	0.54074	2.156000	0.67533	0.591000	0.81541	CCC	.		0.642	SBF1-201	KNOWN	basic	protein_coding	protein_coding			
ATG7	10533	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	11600049	11600049	+	IGR	SNP	G	G	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr3:11600049G>A	ENST00000354449.3	+	0	4959				VGLL4_ENST00000404339.1_Missense_Mutation_p.S290F|VGLL4_ENST00000273038.3_Missense_Mutation_p.S285F|VGLL4_ENST00000430365.2_Missense_Mutation_p.S291F|VGLL4_ENST00000451674.2_Missense_Mutation_p.S205F|VGLL4_ENST00000413604.1_Missense_Mutation_p.S226F|VGLL4_ENST00000424529.2_Missense_Mutation_p.S201F	NM_006395.2	NP_006386.1	O95352	ATG7_HUMAN	autophagy related 7						adult walking behavior (GO:0007628)|C-terminal protein lipidation (GO:0006501)|cardiac muscle cell development (GO:0055013)|cellular amino acid metabolic process (GO:0006520)|cellular protein modification process (GO:0006464)|cellular response to hyperoxia (GO:0071455)|cellular response to nitrogen starvation (GO:0006995)|cellular response to starvation (GO:0009267)|central nervous system neuron axonogenesis (GO:0021955)|cerebellar Purkinje cell layer development (GO:0021680)|cerebral cortex development (GO:0021987)|late nucleophagy (GO:0044805)|liver development (GO:0001889)|membrane fusion (GO:0061025)|mitochondrion degradation (GO:0000422)|mitochondrion organization (GO:0007005)|negative regulation of apoptotic process (GO:0043066)|negative stranded viral RNA replication (GO:0039689)|neurological system process (GO:0050877)|piecemeal microautophagy of nucleus (GO:0034727)|positive regulation of apoptotic process (GO:0043065)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein modification process (GO:0031401)|post-embryonic development (GO:0009791)|protein catabolic process (GO:0030163)|protein lipidation (GO:0006497)|protein modification by small protein conjugation (GO:0032446)|protein transport (GO:0015031)|pyramidal neuron development (GO:0021860)|regulation of protein ubiquitination (GO:0031396)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|pre-autophagosomal structure (GO:0000407)	Atg12 activating enzyme activity (GO:0019778)|Atg8 activating enzyme (GO:0019779)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)|ubiquitin activating enzyme activity (GO:0004839)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	34						CACAGAGGGGGAGTGACTGTG	0.572																																					p.S291F		.											.	VGLL4-91	0			c.C872T						.						43.0	49.0	47.0					3																	11600049		2203	4299	6502	SO:0001628	intergenic_variant	9686	exon5			GAGGGGGAGTGAC	AF094516	CCDS2605.1, CCDS46752.1, CCDS46753.1	3p25.3-p25.2	2014-02-18	2012-06-06	2005-09-11	ENSG00000197548	ENSG00000197548		"""Ubiquitin-like modifier activating enzymes"""	16935	protein-coding gene	gene with protein product	"""ubiquitin-activating enzyme E1-like protein"""	608760	"""APG7 autophagy 7-like (S. cerevisiae)"", ""ATG7 autophagy related 7 homolog (S. cerevisiae)"""	APG7L		10233149	Standard	NM_006395		Approved	GSA7, DKFZp434N0735	uc003bwc.3	O95352	OTTHUMG00000129740		3.37:g.11600049G>A		Somatic	97	0		WXS	Illumina HiSeq	Phase_I	101	18	NM_001128219	0	0	55	64	9	B4E170|E9PB95|Q7L8L0|Q9BWP2|Q9UFH4	Missense_Mutation	SNP	ENST00000354449.3	37	CCDS2605.1	.	.	.	.	.	.	.	.	.	.	G	17.27	3.347047	0.61183	.	.	ENSG00000144560	ENST00000273038;ENST00000413604;ENST00000451674;ENST00000424529;ENST00000430365;ENST00000404339	T;T;T	0.60672	0.23;0.26;0.17	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	T	0.74696	0.3750	M	0.62723	1.935	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.998;0.998;0.998;0.998;0.998	T	0.77851	-0.2434	10	0.87932	D	0	-39.5652	18.3059	0.90180	0.0:0.0:1.0:0.0	.	291;205;201;290;285	G5E9M7;Q14135-6;Q14135-5;G5E9F4;Q14135	.;.;.;.;VGLL4_HUMAN	F	285;226;205;201;291;290	ENSP00000273038:S285F;ENSP00000404251:S291F;ENSP00000384705:S290F	ENSP00000273038:S285F	S	-	2	0	VGLL4	11575049	1.000000	0.71417	0.967000	0.41034	0.519000	0.34347	7.672000	0.83956	2.321000	0.78463	0.563000	0.77884	TCC	.		0.572	ATG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251951.3	NM_006395	
B4GALT4	8702	bcgsc.ca	37	3	118945881	118945881	+	Silent	SNP	C	C	T			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr3:118945881C>T	ENST00000483209.1	-	4	902	c.261G>A	c.(259-261)caG>caA	p.Q87Q	B4GALT4_ENST00000393765.2_Silent_p.Q87Q|B4GALT4_ENST00000467604.1_Silent_p.Q87Q|B4GALT4_ENST00000359213.3_Silent_p.Q87Q|B4GALT4_ENST00000471675.1_Silent_p.Q40Q|B4GALT4-AS1_ENST00000470790.1_RNA|B4GALT4_ENST00000460321.1_5'UTR			O60513	B4GT4_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4	87					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|membrane lipid metabolic process (GO:0006643)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)|N-acetyllactosamine synthase activity (GO:0003945)			breast(2)|endometrium(1)|large_intestine(1)|lung(6)|skin(2)|stomach(2)	14				GBM - Glioblastoma multiforme(114;0.222)	N-Acetyl-D-glucosamine(DB00141)	TGAGCTTGCTCTGGCCTCCTA	0.443																																					p.Q87Q													.	B4GALT4-90	0			c.G261A						.						91.0	90.0	90.0					3																	118945881		2203	4300	6503	SO:0001819	synonymous_variant	8702	exon5			CTTGCTCTGGCCT	AF022367	CCDS2986.1	3q13.3	2013-02-19			ENSG00000121578	ENSG00000121578		"""Beta 4-glycosyltransferases"""	927	protein-coding gene	gene with protein product		604015				9597550	Standard	NM_003778		Approved	beta4Gal-T4	uc003eci.3	O60513	OTTHUMG00000159358	ENST00000483209.1:c.261G>A	3.37:g.118945881C>T		Somatic	60	0		WXS	Illumina HiSeq	Phase_1	77	4	NM_212543	0	0	0	0	0	Q68D68|Q9BSW3|Q9C078	Silent	SNP	ENST00000483209.1	37	CCDS2986.1																																																																																			.		0.443	B4GALT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354925.2	NM_003778	
ITGB5	3693	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	124487860	124487860	+	Splice_Site	SNP	C	C	T	rs375122712		TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr3:124487860C>T	ENST00000296181.4	-	12	2313	c.2017G>A	c.(2017-2019)Gtg>Atg	p.V673M	ITGB5_ENST00000461306.1_5'UTR	NM_002213.3	NP_002204.2	P18084	ITB5_HUMAN	integrin, beta 5	673					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|epithelial cell-cell adhesion (GO:0090136)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alphav-beta5 complex (GO:0034684)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	30				GBM - Glioblastoma multiforme(114;0.163)		GCACACTCACCGATGGTGTCC	0.587																																					p.V673M		.											.	ITGB5-227	0			c.G2017A						.	C	MET/VAL	1,4405	2.1+/-5.4	0,1,2202	131.0	113.0	119.0		2017	4.3	1.0	3		119	0,8600		0,0,4300	no	missense-near-splice	ITGB5	NM_002213.3	21	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	673/800	124487860	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	3693	exon12			ACTCACCGATGGT	J05633	CCDS3030.1	3q21.2	2010-03-23			ENSG00000082781	ENSG00000082781		"""Integrins"""	6160	protein-coding gene	gene with protein product		147561				2211615	Standard	NM_002213		Approved		uc003eho.3	P18084	OTTHUMG00000159432	ENST00000296181.4:c.2017+1G>A	3.37:g.124487860C>T		Somatic	71	0		WXS	Illumina HiSeq	Phase_I	101	29	NM_002213	0	0	0	1	1	B0LPF8|B2RD70	Missense_Mutation	SNP	ENST00000296181.4	37	CCDS3030.1	.	.	.	.	.	.	.	.	.	.	C	14.77	2.633900	0.47049	2.27E-4	0.0	ENSG00000082781	ENST00000296181	D	0.90261	-2.64	5.29	4.34	0.51931	Integrin beta subunit, tail (2);	0.762691	0.12573	N	0.457111	D	0.83151	0.5192	L	0.29908	0.895	0.38470	D	0.94744	B	0.20052	0.041	B	0.18561	0.022	T	0.76046	-0.3102	9	.	.	.	.	8.2832	0.31913	0.0:0.8282:0.0:0.1718	.	673	P18084	ITB5_HUMAN	M	673	ENSP00000296181:V673M	.	V	-	1	0	ITGB5	125970550	0.915000	0.31059	1.000000	0.80357	0.994000	0.84299	1.262000	0.32992	2.761000	0.94854	0.655000	0.94253	GTG	.		0.587	ITGB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355286.3	NM_002213	Missense_Mutation
FGFR3	2261	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	1807787	1807787	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr4:1807787A>G	ENST00000260795.2	+	13	1948	c.1846A>G	c.(1846-1848)Agg>Ggg	p.R616G	FGFR3_ENST00000340107.4_Missense_Mutation_p.R618G|FGFR3_ENST00000440486.2_Missense_Mutation_p.R616G|FGFR3_ENST00000412135.2_Missense_Mutation_p.R504G|FGFR3_ENST00000481110.2_Missense_Mutation_p.R617G|FGFR3_ENST00000352904.1_Missense_Mutation_p.R504G			P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3	616	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				alveolar secondary septum development (GO:0061144)|axonogenesis involved in innervation (GO:0060385)|bone maturation (GO:0070977)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cell-cell signaling (GO:0007267)|central nervous system myelination (GO:0022010)|chondrocyte differentiation (GO:0002062)|chondrocyte proliferation (GO:0035988)|cochlea development (GO:0090102)|digestive tract morphogenesis (GO:0048546)|endochondral bone growth (GO:0003416)|endochondral ossification (GO:0001958)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell fate commitment (GO:0072148)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor apoptotic signaling pathway (GO:1902178)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear receptor cell differentiation (GO:0060113)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade (GO:0007259)|lens fiber cell development (GO:0070307)|lens morphogenesis in camera-type eye (GO:0002089)|MAPK cascade (GO:0000165)|morphogenesis of an epithelium (GO:0002009)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of developmental growth (GO:0048640)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|protein tyrosine kinase activity (GO:0004713)			NS(1)|central_nervous_system(5)|cervix(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(40)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(9)|skin(339)|soft_tissue(4)|testis(2)|upper_aerodigestive_tract(58)|urinary_tract(2607)	3091		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)|Pazopanib(DB06589)|Ponatinib(DB08901)	GTGCATCCACAGGGACCTGGC	0.642		1	"""Mis, T"""	"""IGH@, ETV6"""	"""bladder, MM, T-cell lymphoma"""		"""Hypochondroplasia, Thanatophoric dysplasia"""		Saethre-Chotzen syndrome;Muenke syndrome																												p.R618G		.		Dom	yes		4	4p16.3	2261	fibroblast growth factor receptor 3	yes	"""L, E"""	.	FGFR3-9542	0			c.A1852G						.						39.0	39.0	39.0					4																	1807787		2202	4300	6502	SO:0001583	missense	2261	exon14	Familial Cancer Database	Acrocephalosyndactyly type III;Muenke Nonsyndromic Coronal Craniosynostosis, FGFR3-related Craniosynostosis	ATCCACAGGGACC	M64347	CCDS3353.1, CCDS3354.1, CCDS54706.1	4p16.3	2013-01-11	2008-08-01		ENSG00000068078	ENSG00000068078		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3690	protein-coding gene	gene with protein product		134934	"""achondroplasia, thanatophoric dwarfism"""	ACH		1847508	Standard	NM_000142		Approved	CEK2, JTK4, CD333	uc003gdu.2	P22607	OTTHUMG00000121148	ENST00000260795.2:c.1846A>G	4.37:g.1807787A>G	ENSP00000260795:p.Arg616Gly	Somatic	59	0		WXS	Illumina HiSeq	Phase_I	27	11	NM_001163213	0	0	0	0	0	D3DVP9|D3DVQ0|Q14308|Q16294|Q16608|Q59FL9	Missense_Mutation	SNP	ENST00000260795.2	37	CCDS3353.1	.	.	.	.	.	.	.	.	.	.	a	13.53	2.264914	0.40095	.	.	ENSG00000068078	ENST00000481110;ENST00000340107;ENST00000440486;ENST00000412135;ENST00000260795;ENST00000352904	D;D;D;D;D;D	0.88354	-2.37;-2.37;-2.37;-2.37;-2.37;-2.37	4.18	1.28	0.21552	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.93559	0.7944	M	0.82433	2.59	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;0.998	D;D;D;D	0.97110	1.0;0.997;1.0;0.973	D	0.93158	0.6555	10	0.87932	D	0	.	11.472	0.50275	0.5856:0.4144:0.0:0.0	.	618;504;616;617	P22607-2;P22607-3;P22607;F8W9L4	.;.;FGFR3_HUMAN;.	G	617;618;616;504;616;504	ENSP00000420533:R617G;ENSP00000339824:R618G;ENSP00000414914:R616G;ENSP00000412903:R504G;ENSP00000260795:R616G;ENSP00000231803:R504G	ENSP00000260795:R616G	R	+	1	2	FGFR3	1777585	1.000000	0.71417	1.000000	0.80357	0.650000	0.38633	1.293000	0.33353	0.540000	0.28808	0.241000	0.17934	AGG	.		0.642	FGFR3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000241632.2	NM_000142	
SLAIN2	57606	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	48384849	48384849	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr4:48384849T>A	ENST00000264313.6	+	5	1545	c.1127T>A	c.(1126-1128)gTg>gAg	p.V376E	SLAIN2_ENST00000512093.1_Missense_Mutation_p.V183E	NM_020846.1	NP_065897.1	Q9P270	SLAI2_HUMAN	SLAIN motif family, member 2	376					cytoplasmic microtubule organization (GO:0031122)|microtubule nucleation (GO:0007020)|positive regulation of microtubule polymerization (GO:0031116)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(1)	13						TATAGTAGAGTGTCCCCACAG	0.473																																					p.V376E		.											.	.	0			c.T1127A						.						89.0	89.0	89.0					4																	48384849		1998	4164	6162	SO:0001583	missense	57606	exon5			GTAGAGTGTCCCC	BC006139	CCDS47051.1	4p12	2008-02-05	2006-09-12	2006-09-12	ENSG00000109171	ENSG00000109171			29282	protein-coding gene	gene with protein product		610492	"""KIAA1458"""	KIAA1458		16546155	Standard	NM_020846		Approved	FLJ21611	uc003gya.4	Q9P270	OTTHUMG00000161701	ENST00000264313.6:c.1127T>A	4.37:g.48384849T>A	ENSP00000264313:p.Val376Glu	Somatic	57	0		WXS	Illumina HiSeq	Phase_I	46	23	NM_020846	0	0	12	20	8	A8K4P1|Q8N5R3	Missense_Mutation	SNP	ENST00000264313.6	37	CCDS47051.1	.	.	.	.	.	.	.	.	.	.	T	4.898	0.166911	0.09339	.	.	ENSG00000109171	ENST00000264313;ENST00000512093	.	.	.	5.77	3.24	0.37175	.	0.222330	0.45867	D	0.000335	T	0.39306	0.1073	N	0.24115	0.695	0.43000	D	0.994515	B;B	0.25609	0.13;0.096	B;B	0.23574	0.047;0.026	T	0.24548	-1.0157	9	0.42905	T	0.14	-4.6941	7.659	0.28392	0.0:0.0736:0.141:0.7854	.	46;376	Q9H705;Q9P270	.;SLAI2_HUMAN	E	376;183	.	ENSP00000264313:V376E	V	+	2	0	SLAIN2	48079606	1.000000	0.71417	1.000000	0.80357	0.700000	0.40528	1.779000	0.38624	1.026000	0.39733	0.533000	0.62120	GTG	.		0.473	SLAIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365807.4	NM_020846	
MANBA	4126	hgsc.bcm.edu	37	4	103590185	103590185	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr4:103590185C>G	ENST00000226578.4	-	10	1351	c.1252G>C	c.(1252-1254)Gcc>Ccc	p.A418P	MANBA_ENST00000505239.1_Missense_Mutation_p.A361P	NM_005908.3	NP_005899.3	O00462	MANBA_HUMAN	mannosidase, beta A, lysosomal	418					cellular protein modification process (GO:0006464)|glycoprotein catabolic process (GO:0006516)|mannan catabolic process (GO:0046355)	intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)	beta-mannosidase activity (GO:0004567)|mannose binding (GO:0005537)			cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;4.44e-08)		AGGGCACAGGCAAACATAAAA	0.398																																					p.A418P		.											.	MANBA-91	0			c.G1252C						.						63.0	58.0	60.0					4																	103590185		2203	4300	6503	SO:0001583	missense	4126	exon10			CACAGGCAAACAT		CCDS3658.1	4q24	2013-09-20			ENSG00000109323	ENSG00000109323	3.2.1.25		6831	protein-coding gene	gene with protein product		609489				7876128	Standard	NM_005908		Approved		uc003hwg.3	O00462	OTTHUMG00000131123	ENST00000226578.4:c.1252G>C	4.37:g.103590185C>G	ENSP00000226578:p.Ala418Pro	Somatic	36	1		WXS	Illumina HiSeq	Phase_I	29	2	NM_005908	0	0	14	14	0	Q96BC3|Q9NYX9	Missense_Mutation	SNP	ENST00000226578.4	37	CCDS3658.1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.963262	0.92791	.	.	ENSG00000109323	ENST00000226578;ENST00000505239	D;D	0.91407	-2.84;-2.84	4.82	4.82	0.62117	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycoside hydrolase, family 2, TIM barrel (1);	0.000000	0.85682	D	0.000000	D	0.97018	0.9026	H	0.96015	3.755	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.98440	1.0586	10	0.87932	D	0	-26.6486	18.2864	0.90115	0.0:1.0:0.0:0.0	.	361;418	E9PFW2;O00462	.;MANBA_HUMAN	P	418;361	ENSP00000226578:A418P;ENSP00000427322:A361P	ENSP00000226578:A418P	A	-	1	0	MANBA	103809233	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.027000	0.76463	2.377000	0.81083	0.460000	0.39030	GCC	.		0.398	MANBA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253803.2		
TBCK	93627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	106967781	106967781	+	Silent	SNP	G	G	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr4:106967781G>A	ENST00000273980.5	-	27	3075	c.2628C>T	c.(2626-2628)ggC>ggT	p.G876G	TBCK_ENST00000432496.2_Silent_p.G876G|TBCK_ENST00000361687.4_Silent_p.G813G|TBCK_ENST00000394706.3_Silent_p.G837G|TBCK_ENST00000394708.2_Silent_p.G876G					TBC1 domain containing kinase											NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)	25						TTTTATTAATGCCACCATCTA	0.393																																					p.G876G		.											.	TBCK-336	0			c.C2628T						.						120.0	116.0	117.0					4																	106967781		2203	4300	6503	SO:0001819	synonymous_variant	93627	exon26			ATTAATGCCACCA		CCDS3673.1, CCDS54788.1, CCDS54789.1	4q24	2014-09-17			ENSG00000145348	ENSG00000145348			28261	protein-coding gene	gene with protein product						12471243	Standard	XR_427553		Approved	MGC16169, HSPC302	uc010ilv.2	Q8TEA7	OTTHUMG00000131214	ENST00000273980.5:c.2628C>T	4.37:g.106967781G>A		Somatic	66	0		WXS	Illumina HiSeq	Phase_I	50	15	NM_001163436	0	0	24	40	16		Silent	SNP	ENST00000273980.5	37	CCDS54788.1																																																																																			.		0.393	TBCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253953.4	NM_033115	
LARP7	51574	hgsc.bcm.edu	37	4	113578403	113578403	+	Splice_Site	SNP	T	T	C			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr4:113578403T>C	ENST00000344442.5	+	13	1947	c.1669T>C	c.(1669-1671)Tta>Cta	p.L557L	LARP7_ENST00000324052.6_Splice_Site_p.L557L|LARP7_ENST00000503898.1_3'UTR|LARP7_ENST00000509061.1_Splice_Site_p.L564L	NM_016648.3	NP_057732.2	Q4G0J3	LARP7_HUMAN	La ribonucleoprotein domain family, member 7	557					RNA processing (GO:0006396)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	17		Ovarian(17;0.0443)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		TTCTCTTTAGTTAATCACCAA	0.303																																					p.L564L		.											.	LARP7-93	0			c.T1690C						.						32.0	35.0	34.0					4																	113578403		2199	4292	6491	SO:0001630	splice_region_variant	51574	exon15			CTTTAGTTAATCA	AF068284	CCDS3701.2, CCDS58924.1	4q25	2013-02-12			ENSG00000174720	ENSG00000174720		"""La ribonucleoprotein domain containing"", ""RNA binding motif (RRM) containing"""	24912	protein-coding gene	gene with protein product	"""P-TEFb-interaction protein for 7SK stability"""	612026				18191186, 18249148, 18281698, 22865833, 22488152	Standard	NM_016648		Approved	HDCMA18P, PIP7S, DKFZP564K112	uc003ibb.4	Q4G0J3	OTTHUMG00000132909	ENST00000344442.5:c.1669-1T>C	4.37:g.113578403T>C		Somatic	40	0		WXS	Illumina HiSeq	Phase_I	26	2	NM_001267039	0	0	2	2	0	B2ZHN6|Q3B7A9|Q9P1S7|Q9Y3Z8	Silent	SNP	ENST00000344442.5	37	CCDS3701.2																																																																																			.		0.303	LARP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256417.2	NM_016648	Silent
FRG1	2483	hgsc.bcm.edu;broad.mit.edu	37	4	190874221	190874221	+	Splice_Site	SNP	A	A	G			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr4:190874221A>G	ENST00000226798.4	+	4	481		c.e4-1		FRG1_ENST00000514482.1_Splice_Site	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1						mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		TTTCTCCAATAGTTGATGAGG	0.294																																					.		.											.	FRG1-90	0			c.260-2A>G						.						11.0	11.0	11.0					4																	190874221		2069	4178	6247	SO:0001630	splice_region_variant	2483	exon4			TCCAATAGTTGAT	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.260-1A>G	4.37:g.190874221A>G		Somatic	87	0		WXS	Illumina HiSeq	Phase_I	62	5	NM_004477	0	0	0	0	0	A8K775	Splice_Site	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	N	14.42	2.528819	0.44969	.	.	ENSG00000109536	ENST00000226798;ENST00000531991	.	.	.	3.71	3.71	0.42584	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.0497	0.47880	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FRG1	191111215	1.000000	0.71417	0.923000	0.36655	0.650000	0.38633	5.850000	0.69473	1.645000	0.50612	0.514000	0.50259	.	.		0.294	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	Intron
SLC6A19	340024	hgsc.bcm.edu	37	5	1210657	1210657	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr5:1210657C>A	ENST00000304460.10	+	3	498	c.442C>A	c.(442-444)Ctg>Atg	p.L148M		NM_001003841.2	NP_001003841.1	Q695T7	S6A19_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 19	148					amino acid transport (GO:0006865)|ion transport (GO:0006811)|response to nutrient (GO:0007584)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|neutral amino acid transmembrane transporter activity (GO:0015175)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(25)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			CCAGGAGCCTCTGCCCTGGAG	0.552																																					p.L148M		.											.	SLC6A19-90	0			c.C442A						.						87.0	78.0	81.0					5																	1210657		2203	4300	6503	SO:0001583	missense	340024	exon3			GAGCCTCTGCCCT	AK096054	CCDS34130.1	5p15	2013-07-19			ENSG00000174358	ENSG00000174358		"""Solute carriers"""	27960	protein-coding gene	gene with protein product	"""Hartnup disease"""	608893					Standard	NM_001003841		Approved		uc003jbw.4	Q695T7	OTTHUMG00000161636	ENST00000304460.10:c.442C>A	5.37:g.1210657C>A	ENSP00000305302:p.Leu148Met	Somatic	56	0		WXS	Illumina HiSeq	Phase_I	58	3	NM_001003841	0	0	5	5	0	A8K446	Missense_Mutation	SNP	ENST00000304460.10	37	CCDS34130.1	.	.	.	.	.	.	.	.	.	.	c	19.97	3.924889	0.73213	.	.	ENSG00000174358	ENST00000304460	D	0.83837	-1.77	4.28	4.28	0.50868	.	0.000000	0.64402	D	0.000001	D	0.92831	0.7720	H	0.95437	3.67	0.52501	D	0.999952	D	0.89917	1.0	D	0.91635	0.999	D	0.93912	0.7198	10	0.87932	D	0	.	10.736	0.46126	0.0:0.911:0.0:0.089	.	148	Q695T7	S6A19_HUMAN	M	148	ENSP00000305302:L148M	ENSP00000305302:L148M	L	+	1	2	SLC6A19	1263657	0.904000	0.30761	0.875000	0.34327	0.897000	0.52465	1.923000	0.40055	2.100000	0.63781	0.472000	0.43445	CTG	.		0.552	SLC6A19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365557.1	XM_291120	
JMY	133746	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	78610483	78610483	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr5:78610483C>T	ENST00000396137.4	+	9	2930	c.2468C>T	c.(2467-2469)cCa>cTa	p.P823L	JMY_ENST00000412001.1_Intron	NM_152405.4	NP_689618.4	Q8N9B5	JMY_HUMAN	junction mediating and regulatory protein, p53 cofactor	823	Pro-rich.				'de novo' actin filament nucleation (GO:0070060)|actin polymerization-dependent cell motility (GO:0070358)|Arp2/3 complex-mediated actin nucleation (GO:0034314)|cell cycle arrest (GO:0007050)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of apoptotic process (GO:0043065)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			endometrium(4)|kidney(2)|large_intestine(2)|lung(6)|skin(1)|urinary_tract(1)	16		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;4.45e-45)|Epithelial(54;5.85e-40)|all cancers(79;2.89e-35)		cccccaccaccaccacctcTG	0.547																																					p.P823L		.											.	JMY-227	0			c.C2468T						.						17.0	17.0	17.0					5																	78610483		1826	4036	5862	SO:0001583	missense	133746	exon9			CACCACCACCACC	AK095189	CCDS4047.3	5q14.1	2010-03-23			ENSG00000152409	ENSG00000152409			28916	protein-coding gene	gene with protein product		604279				10518217	Standard	NM_152405		Approved	FLJ37870	uc003kfx.4	Q8N9B5	OTTHUMG00000131301	ENST00000396137.4:c.2468C>T	5.37:g.78610483C>T	ENSP00000379441:p.Pro823Leu	Somatic	41	0		WXS	Illumina HiSeq	Phase_I	20	7	NM_152405	0	0	1	2	1	A1L4P5|B5MDS2|B5MDT0	Missense_Mutation	SNP	ENST00000396137.4	37	CCDS4047.3	.	.	.	.	.	.	.	.	.	.	C	13.78	2.340022	0.41398	.	.	ENSG00000152409	ENST00000282259;ENST00000396137	T	0.33654	1.4	4.69	3.8	0.43715	.	0.871791	0.09687	N	0.768999	T	0.55065	0.1897	L	0.54323	1.7	0.52099	D	0.999943	D	0.89917	1.0	D	0.91635	0.999	T	0.29458	-1.0011	10	0.25106	T	0.35	.	13.6524	0.62318	0.1565:0.8435:0.0:0.0	.	823	Q8N9B5	JMY_HUMAN	L	812;823	ENSP00000379441:P823L	ENSP00000282259:P812L	P	+	2	0	JMY	78646239	0.992000	0.36948	0.018000	0.16275	0.297000	0.27493	7.110000	0.77069	0.928000	0.37168	0.650000	0.86243	CCA	.		0.547	JMY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254070.4	NM_152405	
CHSY3	337876	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	129241299	129241299	+	Silent	SNP	C	C	T			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr5:129241299C>T	ENST00000305031.4	+	1	1135	c.777C>T	c.(775-777)cgC>cgT	p.R259R	CTC-575N7.1_ENST00000503616.1_RNA|CTC-575N7.1_ENST00000515569.1_RNA	NM_175856.4	NP_787052.3	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	259					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		GGTTCATGCGCGCCGACGACG	0.562																																					p.R259R		.											.	CHSY3-25	0			c.C777T						.						105.0	108.0	107.0					5																	129241299		2203	4300	6503	SO:0001819	synonymous_variant	337876	exon1			CATGCGCGCCGAC	AB086062	CCDS34223.1	5q13	2013-02-19			ENSG00000198108	ENSG00000198108	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24293	protein-coding gene	gene with protein product		609963				12907687	Standard	XM_005271982		Approved	CSS3, CHSY-2	uc003kvd.3	Q70JA7	OTTHUMG00000163043	ENST00000305031.4:c.777C>T	5.37:g.129241299C>T		Somatic	177	2		WXS	Illumina HiSeq	Phase_I	133	40	NM_175856	0	0	0	0	0	B2RP97|Q76L22|Q86Y52	Silent	SNP	ENST00000305031.4	37	CCDS34223.1																																																																																			.		0.562	CHSY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371453.1	NM_175856	
RAD50	10111	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	131953819	131953819	+	Silent	SNP	A	A	G			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr5:131953819A>G	ENST00000265335.6	+	21	3609	c.3222A>G	c.(3220-3222)gcA>gcG	p.A1074A	RAD50_ENST00000378823.3_Silent_p.A935A			Q92878	RAD50_HUMAN	RAD50 homolog (S. cerevisiae)	1074					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	membrane (GO:0016020)|Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|nuclease activity (GO:0004518)|protein binding, bridging (GO:0030674)|zinc ion binding (GO:0008270)			breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ATAATTTGGCATTAGGGCGAC	0.318								Homologous recombination																													p.A1074A		.											.	RAD50-229	0			c.A3222G						.						140.0	163.0	155.0					5																	131953819		2203	4299	6502	SO:0001819	synonymous_variant	10111	exon21			TTTGGCATTAGGG	Z75311	CCDS34233.1	5q23-q31	2008-05-30	2001-11-28		ENSG00000113522	ENSG00000113522			9816	protein-coding gene	gene with protein product		604040	"""RAD50 (S. cerevisiae) homolog"""			8756642, 9705271	Standard	NM_005732		Approved	hRad50, RAD50-2	uc003kxi.3	Q92878	OTTHUMG00000059613	ENST00000265335.6:c.3222A>G	5.37:g.131953819A>G		Somatic	226	0		WXS	Illumina HiSeq	Phase_I	249	110	NM_005732	0	0	16	36	20	B9EGF5|O43254|Q6GMT7|Q6P5X3|Q9UP86	Silent	SNP	ENST00000265335.6	37	CCDS34233.1																																																																																			.		0.318	RAD50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132566.5	NM_005732	
ZNF346	23567	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	176471535	176471535	+	Splice_Site	SNP	G	G	C			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr5:176471535G>C	ENST00000358149.3	+	4	560		c.e4+1		ZNF346_ENST00000511834.1_Splice_Site|ZNF346_ENST00000503425.1_Splice_Site|ZNF346_ENST00000503039.1_Splice_Site|ZNF346_ENST00000261948.4_Splice_Site|ZNF346_ENST00000512315.1_Intron|ZNF346_ENST00000506693.1_Intron	NM_012279.2	NP_036411.1	Q9UL40	ZN346_HUMAN	zinc finger protein 346						positive regulation of apoptotic process (GO:0043065)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|prostate(1)|urinary_tract(1)	14	all_cancers(89;6.3e-05)|Renal(175;0.000269)|Lung NSC(126;0.00476)|all_lung(126;0.00806)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AAGGTGGAAGGTACTGGTTTT	0.552																																					.		.											.	ZNF346-90	0			c.517+1G>C						.						117.0	109.0	112.0					5																	176471535		2203	4300	6503	SO:0001630	splice_region_variant	23567	exon4			TGGAAGGTACTGG	AF083340	CCDS4409.1	5q35.3	2012-10-05			ENSG00000113761	ENSG00000113761			16403	protein-coding gene	gene with protein product		605308				10488071	Standard	NM_012279		Approved	JAZ, Zfp346	uc003mfi.3	Q9UL40	OTTHUMG00000130848	ENST00000358149.3:c.517+1G>C	5.37:g.176471535G>C		Somatic	81	0		WXS	Illumina HiSeq	Phase_I	80	28	NM_012279	0	0	0	1	1	B7Z367|Q68CV9|Q6ZMW1	Splice_Site	SNP	ENST00000358149.3	37	CCDS4409.1	.	.	.	.	.	.	.	.	.	.	G	5.228	0.227622	0.09916	.	.	ENSG00000113761	ENST00000358149;ENST00000503425;ENST00000261948;ENST00000511834;ENST00000503039	.	.	.	4.55	3.68	0.42216	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.8977	0.35474	0.1045:0.0:0.8955:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZNF346	176404141	1.000000	0.71417	1.000000	0.80357	0.051000	0.14879	7.687000	0.84139	1.051000	0.40369	-0.160000	0.13428	.	.		0.552	ZNF346-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253415.2	NM_012279	Intron
ECI2	10455	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	4117677	4117677	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr6:4117677C>G	ENST00000380118.3	-	9	930	c.894G>C	c.(892-894)gaG>gaC	p.E298D	ECI2_ENST00000413766.2_Missense_Mutation_p.E131D|C6orf201_ENST00000333388.5_Intron|ECI2_ENST00000380125.2_Missense_Mutation_p.E268D|ECI2_ENST00000465828.1_Missense_Mutation_p.E268D|ECI2_ENST00000361538.2_Missense_Mutation_p.E268D|C6orf201_ENST00000380175.4_Intron|C6orf201_ENST00000430835.2_Intron			O75521	ECI2_HUMAN	enoyl-CoA delta isomerase 2	298	ECH-like.				fatty acid catabolic process (GO:0009062)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	dodecenoyl-CoA delta-isomerase activity (GO:0004165)|fatty-acyl-CoA binding (GO:0000062)|receptor binding (GO:0005102)			endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	11						AAATAAGCATCTCTGTTGCCT	0.393																																					p.E298D		.											.	ECI2-90	0			c.G894C						.						86.0	90.0	89.0					6																	4117677		2203	4300	6503	SO:0001583	missense	10455	exon9			AAGCATCTCTGTT	AF069301	CCDS4490.1, CCDS43420.1, CCDS43420.2	6p24.3	2011-03-15	2011-03-15	2011-03-15	ENSG00000198721	ENSG00000198721			14601	protein-coding gene	gene with protein product	"""acyl-Coenzyme A binding domain containing 2"", "" Hepatocellular carcinoma-associated antigen 88"""	608024	"""peroxisomal D3,D2-enoyl-CoA isomerase"""	PECI		10419495	Standard	NM_206836		Approved	ACBD2, DRS1, HCA88	uc003mwf.3	O75521	OTTHUMG00000014158	ENST00000380118.3:c.894G>C	6.37:g.4117677C>G	ENSP00000369461:p.Glu298Asp	Somatic	105	0		WXS	Illumina HiSeq	Phase_I	83	29	NM_206836	0	0	3	3	0	Q5JYK5|Q5JYK7|Q7L124|Q8N0X0|Q9BUE9|Q9H0T9|Q9NQH1|Q9NYH7|Q9UN55	Missense_Mutation	SNP	ENST00000380118.3	37	CCDS43420.2	.	.	.	.	.	.	.	.	.	.	C	21.3	4.129965	0.77549	.	.	ENSG00000198721	ENST00000380118;ENST00000380125;ENST00000413766;ENST00000361538;ENST00000465828	T;T;T;T;T	0.69806	-0.43;-0.43;-0.43;-0.43;-0.43	6.16	4.39	0.52855	Crotonase, core (1);	0.145207	0.64402	D	0.000008	T	0.63498	0.2516	M	0.74389	2.26	0.80722	D	1	P	0.41524	0.753	P	0.47705	0.555	T	0.68965	-0.5270	10	0.54805	T	0.06	.	11.2609	0.49083	0.0:0.8536:0.0:0.1464	.	298	O75521	ECI2_HUMAN	D	298;268;131;268;268	ENSP00000369461:E298D;ENSP00000369468:E268D;ENSP00000406969:E131D;ENSP00000354737:E268D;ENSP00000420309:E268D	ENSP00000354737:E268D	E	-	3	2	ECI2	4062676	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.699000	0.37804	1.627000	0.50400	0.650000	0.86243	GAG	.		0.393	ECI2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039716.4	NM_006117	
CDYL	9425	hgsc.bcm.edu	37	6	4891972	4891972	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr6:4891972A>G	ENST00000328908.5	+	4	343	c.212A>G	c.(211-213)aAa>aGa	p.K71R	CDYL_ENST00000343762.5_5'UTR|CDYL_ENST00000449732.2_5'UTR|CDYL_ENST00000472453.1_Intron|CDYL_ENST00000397588.3_Missense_Mutation_p.K17R			Q9Y232	CDYL1_HUMAN	chromodomain protein, Y-like	71	Chromo. {ECO:0000255|PROSITE- ProRule:PRU00053}.|Interaction with EZH2.				regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|methylated histone binding (GO:0035064)|transcription corepressor activity (GO:0003714)			breast(2)|kidney(2)|large_intestine(9)|lung(13)|skin(1)|stomach(2)|urinary_tract(1)	30	Ovarian(93;0.11)	all_hematologic(90;0.0901)|Lung NSC(90;0.244)		OV - Ovarian serous cystadenocarcinoma(45;0.182)		GACAAAAGGAAAAATAAAAAA	0.393																																					p.K17R		.											.	CDYL-90	0			c.A50G						.						40.0	40.0	40.0					6																	4891972		2203	4300	6503	SO:0001583	missense	9425	exon2			AAAGGAAAAATAA	AF081258	CCDS4491.2, CCDS47364.1	6p25.1	2010-05-04	2003-09-12		ENSG00000153046	ENSG00000153046			1811	protein-coding gene	gene with protein product	"""CDY-like, autosomal"", ""testis-specific chromodomain Y-like protein"""	603778	"""chromodomain protein, Y chromosome-like"""			10192397	Standard	NM_001143970		Approved	DKFZP586C1622, CDYL1	uc003mwj.3	Q9Y232	OTTHUMG00000014170	ENST00000328908.5:c.212A>G	6.37:g.4891972A>G	ENSP00000330512:p.Lys71Arg	Somatic	56	1		WXS	Illumina HiSeq	Phase_I	40	2	NM_004824	0	0	3	3	0	A8K6D6|B4DLG4|Q0VDG7|Q32NC5|Q5VX99|Q6P7T5|Q9BWZ2|Q9Y424	Missense_Mutation	SNP	ENST00000328908.5	37		.	.	.	.	.	.	.	.	.	.	A	15.58	2.875807	0.51695	.	.	ENSG00000153046	ENST00000328908;ENST00000397588	T;T	0.73152	-0.72;-0.72	5.64	4.49	0.54785	Chromo domain (1);Chromo domain-like (1);Chromo domain/shadow (2);	0.150382	0.56097	D	0.000021	T	0.43344	0.1243	N	0.20685	0.6	0.80722	D	1	B;P	0.39737	0.289;0.685	B;B	0.42245	0.17;0.381	T	0.46190	-0.9209	10	0.38643	T	0.18	.	10.7779	0.46361	0.926:0.0:0.074:0.0	.	17;71	Q9Y232-2;Q9Y232	.;CDYL1_HUMAN	R	71;17	ENSP00000330512:K71R;ENSP00000380718:K17R	ENSP00000330512:K71R	K	+	2	0	CDYL	4836971	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.505000	0.53356	0.970000	0.38263	0.528000	0.53228	AAA	.		0.393	CDYL-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000039736.1	NM_004824	
TAP1	6890	broad.mit.edu;bcgsc.ca	37	6	32813531	32813531	+	Missense_Mutation	SNP	C	C	G	rs200753447	byFrequency	TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr6:32813531C>G	ENST00000354258.4	-	11	2413	c.2252G>C	c.(2251-2253)cGg>cCg	p.R751P	PSMB8_ENST00000374882.3_5'Flank|PSMB8_ENST00000395339.3_5'Flank|TAPSAR1_ENST00000453426.1_lincRNA|PSMB9_ENST00000395330.1_Intron|TAP1_ENST00000425148.2_Missense_Mutation_p.R490P|PSMB8_ENST00000374881.2_5'Flank	NM_000593.5	NP_000584.2	Q03518	TAP1_HUMAN	transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)	751	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytosol to ER transport (GO:0046967)|defense response (GO:0006952)|intracellular transport of viral protein in host cell (GO:0019060)|peptide transport (GO:0015833)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)|TAP complex (GO:0042825)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|MHC class Ib protein binding (GO:0023029)|peptide antigen binding (GO:0042605)|peptide transporter activity (GO:0015197)|protein homodimerization activity (GO:0042803)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(4)|prostate(1)|skin(1)	21					Lapatinib(DB01259)	GCGGGAGTACCGCTCAGGGCT	0.617																																					p.R751P													.	TAP1-91	0			c.G2252C						.						42.0	42.0	42.0					6																	32813531		1509	2708	4217	SO:0001583	missense	6890	exon11			GAGTACCGCTCAG		CCDS4758.1	6p21.3	2014-09-17			ENSG00000168394	ENSG00000168394		"""ATP binding cassette transporters / subfamily B"""	43	protein-coding gene	gene with protein product		170260		ABCB2		1529427, 1946428	Standard	NM_000593		Approved	PSF1, RING4, D6S114E	uc003ocg.3	Q03518	OTTHUMG00000031067	ENST00000354258.4:c.2252G>C	6.37:g.32813531C>G	ENSP00000346206:p.Arg751Pro	Somatic	61	0		WXS	Illumina HiSeq	Phase_I	46	4	NM_000593	0	0	107	107	0	Q16149|Q96CP4	Missense_Mutation	SNP	ENST00000354258.4	37	CCDS4758.1	.	.	.	.	.	.	.	.	.	.	C	5.711	0.315657	0.10789	.	.	ENSG00000168394	ENST00000354258;ENST00000425148	D;D	0.88354	-2.37;-2.36	5.85	4.07	0.47477	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.321554	0.21864	N	0.067993	T	0.73690	0.3619	L	0.52905	1.665	0.09310	N	1	B	0.33739	0.422	B	0.26969	0.075	T	0.65442	-0.6167	10	0.48119	T	0.1	-4.2561	9.0813	0.36554	0.0:0.8313:0.0:0.1687	.	751	Q03518	TAP1_HUMAN	P	751;490	ENSP00000346206:R751P;ENSP00000401919:R490P	ENSP00000346206:R751P	R	-	2	0	TAP1	32921509	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	0.193000	0.17116	0.814000	0.34374	0.643000	0.83706	CGG	C|0.999;G|0.001		0.617	TAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076087.2	NM_000593	
TIAM2	26230	bcgsc.ca	37	6	155566798	155566798	+	Silent	SNP	G	G	A	rs201618143		TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr6:155566798G>A	ENST00000461783.3	+	21	4858	c.3585G>A	c.(3583-3585)gcG>gcA	p.A1195A	TIAM2_ENST00000529824.2_Silent_p.A1195A|TIAM2_ENST00000456877.2_Silent_p.A507A|TIAM2_ENST00000456144.1_Silent_p.A1195A|TIAM2_ENST00000528391.2_Silent_p.A531A|TIAM2_ENST00000360366.4_Silent_p.A1219A|TIAM2_ENST00000367174.2_Silent_p.A571A|TIAM2_ENST00000318981.5_Silent_p.A1195A|TIAM2_ENST00000275246.7_Silent_p.A120A			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	1195	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		TTTATTACGCGGACCACTTTA	0.403																																					p.A1195A													.	TIAM2-93	0			c.G3585A						.						231.0	245.0	240.0					6																	155566798		2203	4300	6503	SO:0001819	synonymous_variant	26230	exon18			TTACGCGGACCAC		CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.3585G>A	6.37:g.155566798G>A		Somatic	337	0		WXS	Illumina HiSeq	Phase_1	270	7	NM_012454	0	0	0	0	0	B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Silent	SNP	ENST00000461783.3	37	CCDS34558.1																																																																																			G|0.999;A|0.001		0.403	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000387980.2	NM_012454	
WDR27	253769	hgsc.bcm.edu	37	6	170047892	170047892	+	Missense_Mutation	SNP	C	C	T	rs567696107		TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr6:170047892C>T	ENST00000448612.1	-	16	1743	c.1634G>A	c.(1633-1635)cGt>cAt	p.R545H	WDR27_ENST00000333572.6_Missense_Mutation_p.R545H|WDR27_ENST00000546525.1_5'UTR|WDR27_ENST00000423258.1_Missense_Mutation_p.R418H	NM_182552.4	NP_872358.4	A2RRH5	WDR27_HUMAN	WD repeat domain 27	515						nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)|skin(1)	12		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)		GCAGCATACACGTGTGCAGGT	0.597													C|||	1	0.000199681	0.0	0.0	5008	,	,		13974	0.0		0.001	False		,,,				2504	0.0				p.R545H		.											.	WDR27-69	0			c.G1634A						.						9.0	12.0	11.0					6																	170047892		2013	4158	6171	SO:0001583	missense	253769	exon16			CATACACGTGTGC	AK131435	CCDS47520.1, CCDS47520.2, CCDS56459.1	6q27	2013-01-09	2003-06-18		ENSG00000184465	ENSG00000184465		"""WD repeat domain containing"""	21248	protein-coding gene	gene with protein product							Standard	NM_182552		Approved	MGC43690	uc003qwx.3	A2RRH5	OTTHUMG00000016061	ENST00000448612.1:c.1634G>A	6.37:g.170047892C>T	ENSP00000416289:p.Arg545His	Somatic	7	2		WXS	Illumina HiSeq	Phase_I	12	8	NM_182552	0	0	5	7	2	A5PLM8|C9JGV0|Q5T066	Missense_Mutation	SNP	ENST00000448612.1	37	CCDS47520.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.93|11.93	1.787047|1.787047	0.31593|0.31593	.|.	.|.	ENSG00000184465|ENSG00000184465	ENST00000448612;ENST00000333572;ENST00000423258|ENST00000441385	T;T;D|.	0.95885|.	1.04;0.98;-3.84|.	0.235|0.235	0.235|0.235	0.15431|0.15431	.|.	0.305391|.	0.24530|.	N|.	0.037737|.	T|T	0.09335|0.09335	0.0230|0.0230	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	1|1	D;D;D|.	0.71674|.	0.983;0.998;0.998|.	B;P;P|.	0.58660|.	0.353;0.843;0.738|.	T|T	0.35276|0.35276	-0.9795|-0.9795	9|4	0.46703|.	T|.	0.11|.	0.6156|0.6156	.|.	.|.	.|.	.|.	545;418;545|.	F2Z2U5;A2RRH5-2;C9JGV0|.	.;.;.|.	H|M	545;545;418|179	ENSP00000416289:R545H;ENSP00000330265:R545H;ENSP00000397869:R418H|.	ENSP00000330265:R545H|.	R|V	-|-	2|1	0|0	WDR27|WDR27	169789817|169789817	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.001000|0.001000	0.01503|0.01503	-0.419000|-0.419000	0.07071|0.07071	0.308000|0.308000	0.22923|0.22923	0.313000|0.313000	0.20887|0.20887	CGT|GTG	.		0.597	WDR27-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000407334.1	NM_182552	
ZC3HAV1	56829	hgsc.bcm.edu	37	7	138738764	138738764	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr7:138738764C>A	ENST00000242351.5	-	11	2581	c.2265G>T	c.(2263-2265)aaG>aaT	p.K755N	ZC3HAV1_ENST00000464606.1_Missense_Mutation_p.K877N	NM_020119.3	NP_064504.2	Q7Z2W4	ZCCHV_HUMAN	zinc finger CCCH-type, antiviral 1	755	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of mRNA catabolic process (GO:0061014)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(4)|skin(1)	37						TCTTTTCAATCTTGAAATTTT	0.343																																					p.K755N		.											.	ZC3HAV1-91	0			c.G2265T						.						81.0	81.0	81.0					7																	138738764		2203	4300	6503	SO:0001583	missense	56829	exon11			TTCAATCTTGAAA	BX571742	CCDS5851.1, CCDS55171.1	7q34	2012-07-05			ENSG00000105939	ENSG00000105939		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	23721	protein-coding gene	gene with protein product	"""zinc finger antiviral protein"", "" CCCH-type zinc finger antiviral protein"""	607312				12215647, 12851707	Standard	NM_024625		Approved	ZAP, FLB6421, FLJ13288, MGC48898, ZC3HDC2, ZC3H2, PARP13	uc003vun.3	Q7Z2W4	OTTHUMG00000157471	ENST00000242351.5:c.2265G>T	7.37:g.138738764C>A	ENSP00000242351:p.Lys755Asn	Somatic	42	0		WXS	Illumina HiSeq	Phase_I	50	3	NM_020119	0	0	16	16	0	A4D1R2|A4D1S4|Q8IW57|Q8TAJ3|Q96N79|Q9H8R9|Q9P0Y7	Missense_Mutation	SNP	ENST00000242351.5	37	CCDS5851.1	.	.	.	.	.	.	.	.	.	.	C	18.39	3.613704	0.66672	.	.	ENSG00000105939	ENST00000242351;ENST00000464606	T;T	0.14640	2.49;2.49	4.7	1.71	0.24356	Poly(ADP-ribose) polymerase, catalytic domain (2);	0.296935	0.24492	N	0.038050	T	0.17066	0.0410	L	0.52573	1.65	0.80722	D	1	D	0.64830	0.994	P	0.57057	0.812	T	0.16541	-1.0399	10	0.24483	T	0.36	.	2.67	0.05064	0.1933:0.5174:0.1869:0.1024	.	755	Q7Z2W4	ZCCHV_HUMAN	N	755;877	ENSP00000242351:K755N;ENSP00000418385:K877N	ENSP00000242351:K755N	K	-	3	2	ZC3HAV1	138389304	0.967000	0.33354	1.000000	0.80357	0.941000	0.58515	0.249000	0.18216	1.156000	0.42514	0.655000	0.94253	AAG	.		0.343	ZC3HAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348915.1	NM_020119	
SGK223	157285	hgsc.bcm.edu;broad.mit.edu	37	8	8176328	8176328	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr8:8176328C>T	ENST00000520004.1	-	6	3821	c.3557G>A	c.(3556-3558)gGc>gAc	p.G1186D	SGK223_ENST00000330777.4_Missense_Mutation_p.G1186D			Q86YV5	SG223_HUMAN		1190	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										GCTGAGAGTGCCACCAGCAGG	0.766																																					p.G1186D	GBM(34;731 755 10259 33573 33867)	.											.	.	0			c.G3557A						.						5.0	6.0	5.0					8																	8176328		1668	3707	5375	SO:0001583	missense	0	exon5			AGAGTGCCACCAG																												ENST00000520004.1:c.3557G>A	8.37:g.8176328C>T	ENSP00000428054:p.Gly1186Asp	Somatic	15	0		WXS	Illumina HiSeq	Phase_I	14	4	NM_001080826	0	0	1	2	1	Q8N3N5	Missense_Mutation	SNP	ENST00000520004.1	37	CCDS43706.1	.	.	.	.	.	.	.	.	.	.	C	4.965	0.179191	0.09443	.	.	ENSG00000182319	ENST00000330777;ENST00000520004	T;T	0.60920	0.15;0.15	3.89	-7.79	0.01218	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	3.081050	0.01799	N	0.032764	T	0.37865	0.1019	N	0.14661	0.345	0.09310	N	1	B	0.33919	0.432	B	0.34093	0.175	T	0.40739	-0.9547	10	0.42905	T	0.14	.	9.7595	0.40524	0.1401:0.288:0.5719:0.0	.	1186	Q86YV5	SG223_HUMAN	D	1186	ENSP00000330930:G1186D;ENSP00000428054:G1186D	ENSP00000330930:G1186D	G	-	2	0	AC068353.1	8213738	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-2.392000	0.01056	-2.066000	0.00886	0.467000	0.42956	GGC	.		0.766	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374864.1		
B4GALT1	2683	bcgsc.ca	37	9	33135275	33135275	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr9:33135275C>T	ENST00000379731.4	-	2	746	c.560G>A	c.(559-561)cGg>cAg	p.R187Q	B4GALT1_ENST00000535206.1_Missense_Mutation_p.R187Q	NM_001497.3	NP_001488.2	P15291	B4GT1_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1	187	UDP-alpha-D-galactose binding.				acute inflammatory response (GO:0002526)|angiogenesis involved in wound healing (GO:0060055)|binding of sperm to zona pellucida (GO:0007339)|branching morphogenesis of an epithelial tube (GO:0048754)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|development of secondary sexual characteristics (GO:0045136)|epithelial cell development (GO:0002064)|extracellular matrix organization (GO:0030198)|galactose metabolic process (GO:0006012)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|lactose biosynthetic process (GO:0005989)|leukocyte migration (GO:0050900)|mammary gland development (GO:0030879)|multicellular organism reproduction (GO:0032504)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|oligosaccharide biosynthetic process (GO:0009312)|penetration of zona pellucida (GO:0007341)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|regulation of acrosome reaction (GO:0060046)|regulation of cellular component movement (GO:0051270)|single fertilization (GO:0007338)|small molecule metabolic process (GO:0044281)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|desmosome (GO:0030057)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|glycocalyx (GO:0030112)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi trans cisterna (GO:0000138)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alpha-tubulin binding (GO:0043014)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|beta-tubulin binding (GO:0048487)|galactosyltransferase activity (GO:0008378)|lactose synthase activity (GO:0004461)|manganese ion binding (GO:0030145)|N-acetyllactosamine synthase activity (GO:0003945)|protein homodimerization activity (GO:0042803)|UDP-galactosyltransferase activity (GO:0035250)			endometrium(1)|large_intestine(7)|lung(4)|prostate(1)|skin(1)	14			LUSC - Lung squamous cell carcinoma(29;0.0084)	GBM - Glioblastoma multiforme(74;0.121)	N-Acetyl-D-glucosamine(DB00141)	GTGCTCCTGCCGGTTGCGGAA	0.562																																					p.R187Q													.	B4GALT1-90	0			c.G560A						.						104.0	94.0	97.0					9																	33135275		2203	4300	6503	SO:0001583	missense	2683	exon2			TCCTGCCGGTTGC	X14085	CCDS6535.1	9p13	2013-02-19			ENSG00000086062	ENSG00000086062	2.4.1.22	"""Beta 4-glycosyltransferases"""	924	protein-coding gene	gene with protein product		137060		GGTB2		9597550	Standard	NM_001497		Approved	beta4Gal-T1	uc003zsg.2	P15291	OTTHUMG00000019764	ENST00000379731.4:c.560G>A	9.37:g.33135275C>T	ENSP00000369055:p.Arg187Gln	Somatic	102	0		WXS	Illumina HiSeq	Phase_1	63	4	NM_001497	0	0	72	72	0	B2R710|D3DRL2|Q12909|Q12910|Q12911|Q14456|Q14509|Q14523	Missense_Mutation	SNP	ENST00000379731.4	37	CCDS6535.1	.	.	.	.	.	.	.	.	.	.	C	36	5.753105	0.96890	.	.	ENSG00000086062	ENST00000535206;ENST00000379731;ENST00000541701	T;T	0.37915	1.17;1.17	5.18	5.18	0.71444	.	0.056828	0.64402	N	0.000001	T	0.70631	0.3246	H	0.94542	3.55	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.78003	-0.2374	10	0.59425	D	0.04	-19.9582	16.5567	0.84487	0.0:1.0:0.0:0.0	.	187	P15291	B4GT1_HUMAN	Q	187;187;144	ENSP00000440341:R187Q;ENSP00000369055:R187Q	ENSP00000369055:R187Q	R	-	2	0	B4GALT1	33125275	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.609000	0.82925	2.848000	0.98002	0.655000	0.94253	CGG	.		0.562	B4GALT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052039.1	NM_001497	
AGTPBP1	23287	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	88284416	88284416	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr9:88284416T>G	ENST00000357081.3	-	8	790	c.646A>C	c.(646-648)Aat>Cat	p.N216H	AGTPBP1_ENST00000337006.4_Missense_Mutation_p.N158H|AGTPBP1_ENST00000376081.4_Missense_Mutation_p.N216H|AGTPBP1_ENST00000376083.3_Missense_Mutation_p.N216H|AGTPBP1_ENST00000376109.3_Missense_Mutation_p.N268H|AGTPBP1_ENST00000432218.1_Missense_Mutation_p.N54H|AGTPBP1_ENST00000376080.1_Missense_Mutation_p.N158H|AGTPBP1_ENST00000491784.1_5'UTR			Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1	216					adult walking behavior (GO:0007628)|C-terminal protein deglutamylation (GO:0035609)|cerebellar Purkinje cell differentiation (GO:0021702)|eye photoreceptor cell differentiation (GO:0001754)|mitochondrion organization (GO:0007005)|neuromuscular process (GO:0050905)|neurotransmitter metabolic process (GO:0042133)|olfactory bulb development (GO:0021772)|protein side chain deglutamylation (GO:0035610)|retina development in camera-type eye (GO:0060041)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(12)|ovary(5)|skin(2)|urinary_tract(3)	44						AGACTGGAATTCTTCTTACTA	0.368																																					p.N216H		.											.	AGTPBP1-158	0			c.A646C						.						94.0	86.0	89.0					9																	88284416		2203	4298	6501	SO:0001583	missense	23287	exon8			TGGAATTCTTCTT	AB028958	CCDS6672.1, CCDS75854.1	9q21.33	2014-06-23			ENSG00000135049	ENSG00000135049			17258	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 1"", ""tubulinyl-Tyr carboxypeptidase"", ""carboxypeptidase-tubulin"", ""tyrosine carboxypeptidase"", ""soluble carboxypeptidase"""	606830				11083920	Standard	NM_015239		Approved	KIAA1035, Nna1, CCP1	uc010mqc.3	Q9UPW5	OTTHUMG00000020124	ENST00000357081.3:c.646A>C	9.37:g.88284416T>G	ENSP00000349592:p.Asn216His	Somatic	63	0		WXS	Illumina HiSeq	Phase_I	65	26	NM_015239	0	0	0	3	3	B4DIT6|B4DRZ8|Q5VV80|Q63HM7|Q658P5|Q6P9D6|Q9H8U6|Q9H9W8|Q9NVK1	Missense_Mutation	SNP	ENST00000357081.3	37		.	.	.	.	.	.	.	.	.	.	T	12.67	2.007766	0.35415	.	.	ENSG00000135049	ENST00000337006;ENST00000357081;ENST00000376083;ENST00000376109;ENST00000432218;ENST00000376081;ENST00000376080	T;T;T;T;T;T;T	0.52754	1.94;1.94;0.65;0.65;1.94;1.94;1.94	5.76	5.76	0.90799	Armadillo-like helical (1);Armadillo-type fold (1);	0.081135	0.85682	D	0.000000	T	0.54886	0.1886	L	0.32530	0.975	0.54753	D	0.999983	D;D;D;B	0.89917	0.998;1.0;1.0;0.235	D;D;D;B	0.77004	0.949;0.962;0.989;0.102	T	0.46830	-0.9163	10	0.08837	T	0.75	-33.4404	16.087	0.81065	0.0:0.0:0.0:1.0	.	268;216;54;216	Q9UPW5-3;Q9UPW5;B4DHX2;Q9UPW5-2	.;CBPC1_HUMAN;.;.	H	158;216;216;268;54;216;158	ENSP00000338512:N158H;ENSP00000349592:N216H;ENSP00000365251:N216H;ENSP00000365277:N268H;ENSP00000402804:N54H;ENSP00000365249:N216H;ENSP00000365248:N158H	ENSP00000338512:N158H	N	-	1	0	AGTPBP1	87474236	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	7.376000	0.79658	2.202000	0.70862	0.533000	0.62120	AAT	.		0.368	AGTPBP1-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000052893.1	NM_015239	
CCBL1	883	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	131597888	131597888	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr9:131597888T>A	ENST00000302586.3	-	10	1076	c.914A>T	c.(913-915)tAc>tTc	p.Y305F	CCBL1_ENST00000436267.2_Missense_Mutation_p.Y399F|CCBL1_ENST00000483599.1_5'UTR|CCBL1_ENST00000320665.6_Missense_Mutation_p.Y255F	NM_001122671.1|NM_004059.4	NP_001116143.1|NP_004050.3	Q16773	KAT1_HUMAN	cysteine conjugate-beta lyase, cytoplasmic	305					cellular amino acid biosynthetic process (GO:0008652)|cellular modified amino acid metabolic process (GO:0006575)|cellular nitrogen compound metabolic process (GO:0034641)|kynurenine metabolic process (GO:0070189)|L-kynurenine catabolic process (GO:0097053)|L-phenylalanine catabolic process (GO:0006559)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-S-conjugate beta-lyase activity (GO:0047804)|glutamine-phenylpyruvate transaminase activity (GO:0047316)|kynurenine-oxoglutarate transaminase activity (GO:0016212)|L-glutamine:pyruvate aminotransferase activity (GO:0047945)|L-phenylalanine-oxaloacetate transaminase activity (GO:0036141)|L-phenylalanine:pyruvate aminotransferase activity (GO:0047312)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(1)	18					L-Glutamine(DB00130)	CTGCACAAAGTAGCTGCTGGG	0.597																																					p.Y305F		.											.	CCBL1-91	0			c.A914T						.						56.0	58.0	57.0					9																	131597888		2103	4222	6325	SO:0001583	missense	883	exon10			ACAAAGTAGCTGC	Y17448	CCDS43884.1, CCDS48038.1, CCDS75915.1	9q34.11	2008-03-11	2008-03-11		ENSG00000171097	ENSG00000171097	2.6.1.64		1564	protein-coding gene	gene with protein product	"""glutamine transaminase K"", ""kyneurenine aminotransferase"""	600547	"""cysteine conjugate-beta lyase; cytoplasmic (glutamine transaminase K, kyneurenine aminotransferase)"""			7883047	Standard	NM_001122671		Approved	KATI, GTK	uc004bwh.3	Q16773	OTTHUMG00000020767	ENST00000302586.3:c.914A>T	9.37:g.131597888T>A	ENSP00000302227:p.Tyr305Phe	Somatic	63	0		WXS	Illumina HiSeq	Phase_I	57	23	NM_001122671	0	0	4	13	9	Q5T275|Q8N191	Missense_Mutation	SNP	ENST00000302586.3	37	CCDS43884.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.960807	0.74016	.	.	ENSG00000171097	ENST00000302586;ENST00000320665;ENST00000436267	D;D;D	0.90261	-2.64;-2.64;-2.64	5.3	5.3	0.74995	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.93304	0.7866	L	0.52364	1.645	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.998;0.999	D	0.92808	0.6262	10	0.40728	T	0.16	-2.7503	14.4079	0.67096	0.0:0.0:0.0:1.0	.	399;305;255;305	B7Z4W5;A8K563;Q16773-2;Q16773	.;.;.;KAT1_HUMAN	F	305;255;399	ENSP00000302227:Y305F;ENSP00000317342:Y255F;ENSP00000399415:Y399F	ENSP00000302227:Y305F	Y	-	2	0	CCBL1	130637709	1.000000	0.71417	1.000000	0.80357	0.429000	0.31625	7.196000	0.77805	1.997000	0.58415	0.358000	0.22013	TAC	.		0.597	CCBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054521.2		
LRRC8A	56262	hgsc.bcm.edu	37	9	131670920	131670920	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr9:131670920G>T	ENST00000259324.5	+	3	2000	c.1477G>T	c.(1477-1479)Gag>Tag	p.E493*	LRRC8A_ENST00000372600.4_Nonsense_Mutation_p.E493*|LRRC8A_ENST00000372599.3_Nonsense_Mutation_p.E493*	NM_001127244.1	NP_001120716.1	Q8IWT6	LRC8A_HUMAN	leucine rich repeat containing 8 family, member A	493					anion transport (GO:0006820)|cell volume homeostasis (GO:0006884)|pre-B cell differentiation (GO:0002329)|response to osmotic stress (GO:0006970)	cell surface (GO:0009986)|ion channel complex (GO:0034702)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(3)	28						CTTCCTGCGTGAGAACCTGCG	0.617																																					p.E493X		.											.	LRRC8A-90	0			c.G1477T						.						23.0	23.0	23.0					9																	131670920		2202	4300	6502	SO:0001587	stop_gained	56262	exon3			CTGCGTGAGAACC	AB037858	CCDS35155.1	9q34.2	2014-09-17	2005-06-29	2005-06-29	ENSG00000136802	ENSG00000136802			19027	protein-coding gene	gene with protein product		608360	"""leucine rich repeat containing 8"""	LRRC8			Standard	NM_001127244		Approved	KIAA1437, FLJ10337	uc010myp.3	Q8IWT6	OTTHUMG00000020766	ENST00000259324.5:c.1477G>T	9.37:g.131670920G>T	ENSP00000259324:p.Glu493*	Somatic	35	0		WXS	Illumina HiSeq	Phase_I	33	2	NM_001127244	0	0	23	23	0	Q6UXM2|Q8NCI0|Q9P2B1	Nonsense_Mutation	SNP	ENST00000259324.5	37	CCDS35155.1	.	.	.	.	.	.	.	.	.	.	G	41	8.754277	0.98941	.	.	ENSG00000136802	ENST00000372600;ENST00000372599;ENST00000259324	.	.	.	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	18.4034	0.90525	0.0:0.0:1.0:0.0	.	.	.	.	X	493	.	ENSP00000259324:E493X	E	+	1	0	LRRC8A	130710741	1.000000	0.71417	0.963000	0.40424	0.832000	0.47134	9.869000	0.99810	2.595000	0.87683	0.561000	0.74099	GAG	.		0.617	LRRC8A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054516.2	NM_019594	
GPR64	10149	hgsc.bcm.edu	37	X	19026233	19026233	+	Silent	SNP	C	C	G			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chrX:19026233C>G	ENST00000379869.3	-	19	1594	c.1431G>C	c.(1429-1431)ctG>ctC	p.L477L	GPR64_ENST00000379878.3_Silent_p.L461L|GPR64_ENST00000379873.2_Silent_p.L477L|GPR64_ENST00000356606.4_Silent_p.L463L|GPR64_ENST00000379876.1_Silent_p.L453L|GPR64_ENST00000340581.3_Intron|GPR64_ENST00000354791.3_Silent_p.L461L|GPR64_ENST00000357544.3_Silent_p.L447L|GPR64_ENST00000360279.4_Silent_p.L455L|GPR64_ENST00000357991.3_Silent_p.L474L	NM_001079858.2|NM_005756.3	NP_001073327.1|NP_005747.2	Q8IZP9	GPR64_HUMAN	G protein-coupled receptor 64	477					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)|spermatogenesis (GO:0007283)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(18)|stomach(1)|urinary_tract(1)	42	Hepatocellular(33;0.183)					CTTGGGTTTCCAGAGAAACCT	0.393																																					p.L477L		.											.	GPR64-130	0			c.G1431C						.						64.0	59.0	61.0					X																	19026233		2203	4300	6503	SO:0001819	synonymous_variant	10149	exon19			GGTTTCCAGAGAA	X81892	CCDS14191.1, CCDS43921.1, CCDS43922.1, CCDS43923.1, CCDS55376.1, CCDS55377.1, CCDS55378.1, CCDS55379.1	Xp22.13	2014-08-08			ENSG00000173698	ENSG00000173698		"""-"", ""GPCR / Class B : Orphans"""	4516	protein-coding gene	gene with protein product	"""epididymal protein 6"""	300572				9739419, 9150425	Standard	NM_005756		Approved	HE6, TM7LN2, EDDM6	uc004cyx.3	Q8IZP9	OTTHUMG00000021223	ENST00000379869.3:c.1431G>C	X.37:g.19026233C>G		Somatic	103	0		WXS	Illumina HiSeq	Phase_I	54	3	NM_001184834	0	0	0	0	0	B1AWB3|B1AWB4|B1AWB6|B1AWB7|O00406|Q14CE0|Q8IWT2|Q8IZE4|Q8IZE5|Q8IZE6|Q8IZE7|Q8IZP3|Q8IZP4	Silent	SNP	ENST00000379869.3	37	CCDS43923.1																																																																																			.		0.393	GPR64-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055970.2		
RPS6KA3	6197	hgsc.bcm.edu	37	X	20206637	20206637	+	Silent	SNP	T	T	C			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chrX:20206637T>C	ENST00000379565.3	-	8	816	c.609A>G	c.(607-609)gaA>gaG	p.E203E	RPS6KA3_ENST00000544447.1_Silent_p.E175E|RPS6KA3_ENST00000379548.4_Silent_p.E174E|RPS6KA3_ENST00000540702.1_Silent_p.E175E	NM_004586.2	NP_004577.1	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 3	203	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|central nervous system development (GO:0007417)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(14)|lung(7)|ovary(1)|stomach(1)	41					Acetylsalicylic acid(DB00945)	TGTGACCTTCTTCATCAAGAA	0.274																																					p.E203E		.											.	RPS6KA3-1504	0			c.A609G						.						23.0	21.0	21.0					X																	20206637		2176	4273	6449	SO:0001819	synonymous_variant	6197	exon8			ACCTTCTTCATCA	U08316	CCDS14197.1	Xp22.2-p22.1	2013-06-03	2002-08-29		ENSG00000177189	ENSG00000177189			10432	protein-coding gene	gene with protein product		300075	"""ribosomal protein S6 kinase, 90kD, polypeptide 3"", ""mental retardation, X-linked 19"", ""Coffin-Lowry syndrome"""	MRX19, CLS		8141249, 11896450, 16879200	Standard	XM_005274573		Approved	RSK, RSK2, HU-3	uc004czu.3	P51812	OTTHUMG00000021231	ENST00000379565.3:c.609A>G	X.37:g.20206637T>C		Somatic	32	0		WXS	Illumina HiSeq	Phase_I	15	2	NM_004586	0	0	21	21	0	B2R9V4|Q4VAP3|Q59H26|Q5JPK8|Q7Z3Z7	Silent	SNP	ENST00000379565.3	37	CCDS14197.1																																																																																			.		0.274	RPS6KA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056011.3	NM_004586	
PBDC1	51260	hgsc.bcm.edu	37	X	75394774	75394774	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chrX:75394774T>C	ENST00000373358.3	+	3	349	c.146T>C	c.(145-147)gTc>gCc	p.V49A	PBDC1_ENST00000373357.3_Missense_Mutation_p.V49A	NM_016500.3	NP_057584.2	Q9BVG4	PBDC1_HUMAN	polysaccharide biosynthesis domain containing 1	49																	CATGCTGAAGTCTATTACAAG	0.408																																					p.V49A		.											.	.	0			c.T146C						.						142.0	114.0	124.0					X																	75394774		2203	4300	6503	SO:0001583	missense	51260	exon3			CTGAAGTCTATTA	BC001220	CCDS14432.1, CCDS75995.1	Xq13.2	2012-11-28	2012-11-28	2012-11-28	ENSG00000102390	ENSG00000102390			28790	protein-coding gene	gene with protein product			"""chromosome X open reading frame 26"""	CXorf26		11042152	Standard	NM_016500		Approved	MGC874	uc004ecl.1	Q9BVG4	OTTHUMG00000021876	ENST00000373358.3:c.146T>C	X.37:g.75394774T>C	ENSP00000362456:p.Val49Ala	Somatic	88	0		WXS	Illumina HiSeq	Phase_I	39	2	NM_016500	0	0	2	2	0		Missense_Mutation	SNP	ENST00000373358.3	37	CCDS14432.1	.	.	.	.	.	.	.	.	.	.	T	17.09	3.299549	0.60195	.	.	ENSG00000102390	ENST00000373358;ENST00000373357	.	.	.	5.48	5.48	0.80851	Yst0336-like domain (1);	0.057515	0.64402	D	0.000002	T	0.53190	0.1781	L	0.60957	1.885	0.52501	D	0.999953	P	0.36483	0.555	B	0.34301	0.179	T	0.58115	-0.7693	9	0.56958	D	0.05	-14.3814	12.5925	0.56451	0.0:0.0:0.0:1.0	.	49	Q9BVG4	CX026_HUMAN	A	49	.	ENSP00000362455:V49A	V	+	2	0	CXorf26	75311176	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	4.464000	0.60134	1.949000	0.56562	0.486000	0.48141	GTC	.		0.408	PBDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057294.1	NM_016500	
COL4A6	1288	hgsc.bcm.edu	37	X	107447618	107447618	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chrX:107447618C>G	ENST00000372216.4	-	12	815	c.715G>C	c.(715-717)Gca>Cca	p.A239P	COL4A6_ENST00000334504.7_Missense_Mutation_p.A238P|COL4A6_ENST00000538570.1_Missense_Mutation_p.A238P|COL4A6_ENST00000394872.2_Missense_Mutation_p.A236P|COL4A6_ENST00000545689.1_Missense_Mutation_p.A238P	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	239	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						GGAGGTCCTGCTGGGCCAGGG	0.468									Alport syndrome with Diffuse Leiomyomatosis																												p.A239P	Melanoma(87;1895 1945 2589 7165)	.											.	COL4A6-199	0			c.G715C						.						59.0	54.0	56.0					X																	107447618		2203	4300	6503	SO:0001583	missense	1288	exon12	Familial Cancer Database		GTCCTGCTGGGCC	U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.715G>C	X.37:g.107447618C>G	ENSP00000361290:p.Ala239Pro	Somatic	67	0		WXS	Illumina HiSeq	Phase_I	29	2	NM_001847	0	0	2	2	0	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Missense_Mutation	SNP	ENST00000372216.4	37	CCDS14541.1	.	.	.	.	.	.	.	.	.	.	C	14.26	2.481671	0.44147	.	.	ENSG00000197565	ENST00000372216;ENST00000334504;ENST00000394872;ENST00000541389;ENST00000545689;ENST00000538570	D;D;D;D;D	0.94417	-3.42;-3.42;-3.3;-3.42;-3.42	5.21	5.21	0.72293	.	0.185432	0.26428	N	0.024425	D	0.88592	0.6478	N	0.00996	-1.065	0.38781	D	0.954768	D;D;D;D	0.76494	0.997;0.999;0.994;0.997	D;D;P;D	0.64410	0.925;0.925;0.844;0.925	D	0.85714	0.1321	10	0.02654	T	1	.	15.1797	0.72945	0.0:1.0:0.0:0.0	.	238;238;239;238	F5H851;F5H3Q5;Q14031;Q14031-2	.;.;CO4A6_HUMAN;.	P	239;238;236;238;238;238	ENSP00000361290:A239P;ENSP00000334733:A238P;ENSP00000378340:A236P;ENSP00000443707:A238P;ENSP00000445236:A238P	ENSP00000334733:A238P	A	-	1	0	COL4A6	107334274	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.056000	0.41355	2.498000	0.84270	0.600000	0.82982	GCA	.		0.468	COL4A6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057875.2		
SMG5	23381	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	156221203	156221203	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr1:156221203delG	ENST00000361813.5	-	20	2963	c.2819delC	c.(2818-2820)gcafs	p.A940fs	SMG5_ENST00000368267.5_Intron	NM_015327.2	NP_056142.2	Q9UPR3	SMG5_HUMAN	SMG5 nonsense mediated mRNA decay factor	940	PINc.				gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(3)|endometrium(8)|kidney(2)|large_intestine(7)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	48	Hepatocellular(266;0.158)					CCAGGCATCTGCATCCTGCCT	0.552																																					p.A940fs		.											.	SMG5-231	0			c.2819delC						.						224.0	214.0	217.0					1																	156221203		2203	4300	6503	SO:0001589	frameshift_variant	23381	exon20			.	AB029012	CCDS1137.1	1q21	2013-07-02	2013-07-02		ENSG00000198952	ENSG00000198952			24644	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog B (S. cerevisiae)"""	610962	"""smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)"""			12676087, 12699629	Standard	NM_015327		Approved	KIAA1089, LPTS-RP1, LPTSRP1, RP11-54H19.7, SMG-5, EST1B	uc001foc.4	Q9UPR3	OTTHUMG00000017491	ENST00000361813.5:c.2819delC	1.37:g.156221203delG	ENSP00000355261:p.Ala940fs	Somatic	226	0		WXS	Illumina HiSeq	Phase_I	197	69	NM_015327	0	0	0	0	0	D3DVB7|Q5QJE7|Q659C7|Q8IXC0|Q8IY09|Q96IJ7	Frame_Shift_Del	DEL	ENST00000361813.5	37	CCDS1137.1																																																																																			.		0.552	SMG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046308.1	NM_015327	
SUPT16H	11198	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	21821646	21821648	+	Splice_Site	DEL	CCT	CCT	-			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	CCT	CCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr14:21821646_21821648delCCT	ENST00000216297.2	-	25	3335_3337	c.2997_2999delAGG	c.(2995-3000)aaaggg>aag	p.G1000del		NM_007192.3	NP_009123.1	Q9Y5B9	SP16H_HUMAN	suppressor of Ty 16 homolog (S. cerevisiae)	1000	Glu-rich (acidic).				DNA repair (GO:0006281)|DNA replication (GO:0006260)|gene expression (GO:0010467)|nucleosome disassembly (GO:0006337)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_cancers(95;0.00115)		Epithelial(56;1.62e-06)|all cancers(55;1.49e-05)	GBM - Glioblastoma multiforme(265;0.0159)		TTTTTAAAAACCTTTTCGGGCTT	0.34																																					p.999_1000del		.											.	SUPT16H-90	0			c.2997_2998del						.																																			SO:0001630	splice_region_variant	11198	exon25			.	AF152961	CCDS9569.1	14q11.1	2008-08-13	2001-11-28		ENSG00000092201	ENSG00000092201			11465	protein-coding gene	gene with protein product	"""facilitates chromatin remodeling 140 kDa subunit"""	605012	"""suppressor of Ty (S.cerevisiae) 16 homolog"""			9489704, 11239457	Standard	NM_007192		Approved	FACT, FACTP140, SPT16/CDC68, FLJ14010, FLJ10857, CDC68	uc001wao.2	Q9Y5B9	OTTHUMG00000029685	ENST00000216297.2:c.2998+1AGG>-	14.37:g.21821646_21821648delCCT		Somatic	109	0		WXS	Illumina HiSeq	Phase_I	62	24	NM_007192	0	0	0	0	0	Q6GMT8|Q6P2F1|Q6PJM1|Q9NRX0	Frame_Shift_Del	DEL	ENST00000216297.2	37	CCDS9569.1																																																																																			.		0.340	SUPT16H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074025.2		In_Frame_Del
TTN	7273	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	179429832	179429834	+	In_Frame_Del	DEL	AAT	AAT	-			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	AAT	AAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr2:179429832_179429834delAAT	ENST00000591111.1	-	276	76326_76328	c.76102_76104delATT	c.(76102-76104)attdel	p.I25368del	TTN_ENST00000460472.2_In_Frame_Del_p.I17944del|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342992.6_In_Frame_Del_p.I24441del|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000589042.1_In_Frame_Del_p.I27009del|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_In_Frame_Del_p.I18136del|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_In_Frame_Del_p.I18069del|TTN-AS1_ENST00000592750.1_RNA			Q8WZ42	TITIN_HUMAN	titin	25368	Fibronectin type-III 84. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCTTCTCTACAATGTAGTTGCTT	0.443																																					p.27009_27009del		.											.	TTN-636	0			c.81025_81027del						.																																			SO:0001651	inframe_deletion	7273	exon326			.	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.76102_76104delATT	2.37:g.179429832_179429834delAAT	ENSP00000465570:p.Ile25368del	Somatic	158	0		WXS	Illumina HiSeq	Phase_I	138	58	NM_001267550	0	0	0	0	0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	In_Frame_Del	DEL	ENST00000591111.1	37																																																																																				.		0.443	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
AMPH	273	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	38431574	38431574	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr7:38431574delA	ENST00000356264.2	-	19	1868	c.1653delT	c.(1651-1653)catfs	p.H551fs	AMPH_ENST00000428293.2_Frame_Shift_Del_p.H509fs|AMPH_ENST00000325590.5_Frame_Shift_Del_p.H509fs|AMPH_ENST00000471913.1_5'Flank	NM_001635.3	NP_001626.1	P49418	AMPH_HUMAN	amphiphysin	551					endocytosis (GO:0006897)|learning (GO:0007612)|synaptic transmission (GO:0007268)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|leading edge membrane (GO:0031256)|synaptic vesicle (GO:0008021)	phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|kidney(3)|large_intestine(12)|liver(3)|lung(27)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)	62						CTTCCTCTTCATGGTTGGAGG	0.587																																					p.H551fs		.											.	AMPH-95	0			c.1653delT						.						66.0	65.0	66.0					7																	38431574		2203	4300	6503	SO:0001589	frameshift_variant	273	exon19			.		CCDS5456.1, CCDS47574.1	7p14-p13	2007-06-19	2007-06-19		ENSG00000078053	ENSG00000078053			471	protein-coding gene	gene with protein product		600418	"""amphiphysin (Stiff-Mann syndrome with breast cancer 128kD autoantigen)"", ""amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)"""			8245793	Standard	NM_139316		Approved		uc003tgu.3	P49418	OTTHUMG00000023725	ENST00000356264.2:c.1653delT	7.37:g.38431574delA	ENSP00000348602:p.His551fs	Somatic	85	0		WXS	Illumina HiSeq	Phase_I	90	55	NM_001635	0	0	0	0	0	A4D1X8|A4D1X9|O43538|Q75MJ8|Q75MK5|Q75MM3|Q8N4G0	Frame_Shift_Del	DEL	ENST00000356264.2	37	CCDS5456.1																																																																																			.		0.587	AMPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000226953.2	NM_001635	
ASNS	440	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	97482647	97482647	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr7:97482647delC	ENST00000394309.3	-	11	1761	c.1290delG	c.(1288-1290)ttgfs	p.L430fs	ASNS_ENST00000444334.1_Frame_Shift_Del_p.L409fs|ASNS_ENST00000175506.4_Frame_Shift_Del_p.L430fs|ASNS_ENST00000437628.1_Frame_Shift_Del_p.L347fs|ASNS_ENST00000422745.1_Frame_Shift_Del_p.L409fs|ASNS_ENST00000455086.1_Frame_Shift_Del_p.L347fs|ASNS_ENST00000394308.3_Frame_Shift_Del_p.L430fs	NM_133436.3	NP_597680.2	P08243	ASNS_HUMAN	asparagine synthetase (glutamine-hydrolyzing)	430	Asparagine synthetase.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|asparagine biosynthetic process (GO:0006529)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular protein metabolic process (GO:0044267)|cellular response to glucose starvation (GO:0042149)|cellular response to hormone stimulus (GO:0032870)|endoplasmic reticulum unfolded protein response (GO:0030968)|glutamine metabolic process (GO:0006541)|L-asparagine biosynthetic process (GO:0070981)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|positive regulation of mitotic cell cycle (GO:0045931)|response to amino acid (GO:0043200)|response to follicle-stimulating hormone (GO:0032354)|response to light stimulus (GO:0009416)|response to mechanical stimulus (GO:0009612)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	asparagine synthase (glutamine-hydrolyzing) activity (GO:0004066)|ATP binding (GO:0005524)|cofactor binding (GO:0048037)			ovary(1)	1	all_cancers(62;6.64e-09)|all_epithelial(64;1.58e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0342)|all_lung(186;0.0369)				Adenosine triphosphate(DB00171)|L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	GTGGCAGAGACAAGTAATAGG	0.343																																					p.L430fs	Melanoma(70;6 1280 3108 3799 51123)|GBM(6;275 291 425 9929 27738)	.											.	ASNS-91	0			c.1290delG						.						73.0	75.0	75.0					7																	97482647		2203	4300	6503	SO:0001589	frameshift_variant	440	exon11			.	M27396	CCDS5652.1, CCDS55131.1, CCDS55132.1	7q21.3	2012-10-02	2010-05-07		ENSG00000070669	ENSG00000070669	6.3.5.4		753	protein-coding gene	gene with protein product		108370	"""asparagine synthetase"""				Standard	NM_001673		Approved		uc003uov.4	P08243	OTTHUMG00000022892	ENST00000394309.3:c.1290delG	7.37:g.97482647delC	ENSP00000377846:p.Leu430fs	Somatic	72	0		WXS	Illumina HiSeq	Phase_I	109	25	NM_133436	0	0	0	0	0	A4D1I8|B4DXZ1|B7ZAA9|D6W5R3|E9PCI3|E9PCX6|P08184|Q15666|Q549T9|Q96HD0	Frame_Shift_Del	DEL	ENST00000394309.3	37	CCDS5652.1																																																																																			.		0.343	ASNS-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333645.1	NM_001673, NM_183356	
ADAM7	8756	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	24339727	24339728	+	Frame_Shift_Ins	INS	-	-	TA			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr8:24339727_24339728insTA	ENST00000175238.6	+	9	861_862	c.778_779insTA	c.(778-780)ctafs	p.L260fs	RP11-624C23.1_ENST00000519689.1_RNA|ADAM7_ENST00000380789.1_Frame_Shift_Ins_p.L260fs|RP11-624C23.1_ENST00000523578.1_RNA|ADAM7_ENST00000520720.1_Frame_Shift_Ins_p.L32fs	NM_003817.3	NP_003808.2	Q9H2U9	ADAM7_HUMAN	ADAM metallopeptidase domain 7	260	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(24)|ovary(1)|skin(15)	64		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		TAAAATAGAACTATATTCAAAT	0.307																																					p.L260fs		.											.	ADAM7-230	0			c.778_779insTA						.																																			SO:0001589	frameshift_variant	8756	exon9			.	AF090327	CCDS6045.1	8p21.2	2005-08-18	2005-08-18		ENSG00000069206	ENSG00000069206		"""ADAM metallopeptidase domain containing"""	214	protein-coding gene	gene with protein product		607310	"""a disintegrin and metalloproteinase domain 7"""				Standard	NM_003817		Approved	GP-83, EAPI	uc003xeb.3	Q9H2U9	OTTHUMG00000097859	ENST00000175238.6:c.781_782dupTA	8.37:g.24339730_24339731dupTA	ENSP00000175238:p.Leu260fs	Somatic	57	0		WXS	Illumina HiSeq	Phase_I	101	27	NM_003817	0	0	0	0	0	A8K8X7|O75959|Q6PEJ6	Frame_Shift_Ins	INS	ENST00000175238.6	37	CCDS6045.1																																																																																			.		0.307	ADAM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215150.1	NM_003817	
ZNF585A	199704	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	37642652	37642653	+	Missense_Mutation	DNP	GC	GC	TA			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr19:37642652_37642653GC>TA	ENST00000356958.4	-	5	2406_2407	c.2148_2149GC>TA	c.(2146-2151)aaGCct>aaTAct	p.716_717KP>NT	ZNF585A_ENST00000292841.5_Missense_Mutation_p.661_662KP>NT|ZNF585A_ENST00000392157.2_Missense_Mutation_p.661_662KP>NT|ZNF585A_ENST00000355533.2_Missense_Mutation_p.353_354KP>NT|ZNF585A_ENST00000588723.1_Intron			Q6P3V2	Z585A_HUMAN	zinc finger protein 585A	716					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|central_nervous_system(1)|endometrium(2)|large_intestine(17)|lung(11)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CACACGTAAGGCTTCTCTCCAG	0.45																																					p.KP716NT		.											.	ZNF585A	0			c.G1983T						.																																			SO:0001583	missense	199704	exon6			GTAAGGCTTCTCT	AK074345	CCDS12499.1, CCDS74353.1	19q13.13	2013-01-08				ENSG00000196967		"""Zinc fingers, C2H2-type"", ""-"""	26305	protein-coding gene	gene with protein product						12477932	Standard	NM_199126		Approved	FLJ23765	uc002ofn.1	Q6P3V2		ENST00000356958.4:c.2148_2149delinsTA	19.37:g.37642652_37642653delinsTA	ENSP00000349440:p.K716_P717delinsNT	Somatic	153.0	0.0		WXS	Illumina HiSeq	Phase_I	106.0	46.0		0	0	0	0	0	Q8TE95|Q96MV3	Missense_Mutation	DNP	ENST00000356958.4	37																																																																																				.		0.450	ZNF585A-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000457980.2	NM_152655	
