#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CSMD2	114784	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	34052133	34052133	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr1:34052133T>A	ENST00000373381.4	-	46	7198	c.7022A>T	c.(7021-7023)cAg>cTg	p.Q2341L		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2343	Sushi 13. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TCCTTCAAACTGCAGGTAGGT	0.493																																					p.Q2343L		.											.	CSMD2-103	0			c.A7028T						.						105.0	96.0	99.0					1																	34052133		2203	4300	6503	SO:0001583	missense	114784	exon47			TCAAACTGCAGGT	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.7022A>T	1.37:g.34052133T>A	ENSP00000362479:p.Gln2341Leu	Somatic	180	0		WXS	Illumina HiSeq	Phase_I	230	98	NM_052896	0	0	0	0	0	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373381.4	37		.	.	.	.	.	.	.	.	.	.	T	18.56	3.650854	0.67472	.	.	ENSG00000121904	ENST00000373381	T	0.66815	-0.23	5.83	5.83	0.93111	Complement control module (2);Sushi/SCR/CCP (3);	0.061993	0.64402	D	0.000004	T	0.65565	0.2703	M	0.64260	1.97	0.80722	D	1	B;B	0.11235	0.004;0.004	B;B	0.24006	0.05;0.029	T	0.60682	-0.7215	10	0.27082	T	0.32	.	15.3817	0.74661	0.0:0.0:0.0:1.0	.	2343;2341	Q7Z408;E7EUA6	CSMD2_HUMAN;.	L	2341	ENSP00000362479:Q2341L	ENSP00000241312:Q2343L	Q	-	2	0	CSMD2	33824720	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.018000	0.70811	2.227000	0.72691	0.528000	0.53228	CAG	.		0.493	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896	
KIAA0754	643314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	39878312	39878312	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr1:39878312C>T	ENST00000530275.1	+	1	2162	c.1967C>T	c.(1966-1968)tCa>tTa	p.S656L	MACF1_ENST00000372915.3_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000567887.1_Intron|MACF1_ENST00000289893.4_Intron|MACF1_ENST00000564288.1_Intron|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000539005.1_Intron	NM_015038.1	NP_055853.1	O94854	K0754_HUMAN	KIAA0754	656										central_nervous_system(1)|large_intestine(6)|skin(1)	8	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GTGGCATCATCAGAGGGAGGG	0.428																																					p.S792L		.											.	.	0			c.C2375T						.						85.0	83.0	84.0					1																	39878312		1910	4132	6042	SO:0001583	missense	643314	exon1			CATCATCAGAGGG			1p34.2	2009-07-09				ENSG00000255103			29111	protein-coding gene	gene with protein product						9872452	Standard	NM_015038		Approved		uc009vvt.1	O94854		ENST00000530275.1:c.1967C>T	1.37:g.39878312C>T	ENSP00000431179:p.Ser656Leu	Somatic	45	0		WXS	Illumina HiSeq	Phase_I	57	17	NM_015038	0	0	0	3	3	E9PMC2|Q6ZSB2	Missense_Mutation	SNP	ENST00000530275.1	37		.	.	.	.	.	.	.	.	.	.	C	10.93	1.491329	0.26774	.	.	ENSG00000255103	ENST00000530275	D	0.86230	-2.09	5.48	-0.479	0.12089	.	.	.	.	.	T	0.74489	0.3723	N	0.24115	0.695	0.09310	N	1	B	0.11235	0.004	B	0.11329	0.006	T	0.63047	-0.6724	9	0.87932	D	0	.	2.2667	0.04080	0.1278:0.5256:0.1262:0.2204	.	656	O94854	K0754_HUMAN	L	656	ENSP00000431179:S656L	ENSP00000431179:S656L	S	+	2	0	RP4-562N20.1	39650899	0.000000	0.05858	0.032000	0.17829	0.874000	0.50279	-0.517000	0.06275	0.188000	0.20168	0.655000	0.94253	TCA	.		0.428	KIAA0754-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000392100.1	NM_015038	
STXBP3	6814	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	109338856	109338856	+	Splice_Site	SNP	G	G	C			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr1:109338856G>C	ENST00000370008.3	+	14	1161	c.1111G>C	c.(1111-1113)Gac>Cac	p.D371H		NM_007269.2	NP_009200.2	O00186	STXB3_HUMAN	syntaxin binding protein 3	371					blood coagulation (GO:0007596)|membrane organization (GO:0061024)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|neutrophil degranulation (GO:0043312)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein heterooligomerization (GO:0051291)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin binding (GO:0019905)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(3)|urinary_tract(1)	13		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)		TTTCATTAAGGACCTGGCACT	0.358																																					p.D371H		.											.	STXBP3-93	0			c.G1111C						.						54.0	54.0	54.0					1																	109338856		2203	4300	6503	SO:0001630	splice_region_variant	6814	exon14			ATTAAGGACCTGG	D63506	CCDS790.1	1p13.3	2008-02-05			ENSG00000116266	ENSG00000116266			11446	protein-coding gene	gene with protein product		608339				10194441	Standard	NM_007269		Approved	UNC-18C	uc001dvy.3	O00186	OTTHUMG00000011122	ENST00000370008.3:c.1111-1G>C	1.37:g.109338856G>C		Somatic	156	0		WXS	Illumina HiSeq	Phase_I	205	53	NM_007269	0	0	0	0	0	A8K269|A8K5K7|Q53FW1|Q86YJ3|Q9UPD7	Missense_Mutation	SNP	ENST00000370008.3	37	CCDS790.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.298070	0.81025	.	.	ENSG00000116266	ENST00000370008	T	0.79247	-1.25	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	D	0.89114	0.6623	M	0.87547	2.89	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88884	0.3341	9	.	.	.	-7.6976	20.1392	0.98050	0.0:0.0:1.0:0.0	.	371	O00186	STXB3_HUMAN	H	371	ENSP00000359025:D371H	.	D	+	1	0	STXBP3	109140379	1.000000	0.71417	1.000000	0.80357	0.847000	0.48162	8.716000	0.91420	2.751000	0.94390	0.591000	0.81541	GAC	.		0.358	STXBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030591.1	NM_007269	Missense_Mutation
CSGALNACT2	55454	broad.mit.edu	37	10	43659419	43659419	+	Missense_Mutation	SNP	G	G	T	rs79064394		TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr10:43659419G>T	ENST00000374466.3	+	5	1421	c.1086G>T	c.(1084-1086)ttG>ttT	p.L362F		NM_018590.3	NP_061060.3	Q8N6G5	CGAT2_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 2	362					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|dermatan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050652)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)	p.L362F(5)		endometrium(12)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						GAGAGGTCTTGATGTTTTTCT	0.433																																					p.L362F													.	CSGALNACT2-69	5	Substitution - Missense(5)	endometrium(4)|kidney(1)	c.G1086T						.						223.0	221.0	222.0					10																	43659419		2203	4300	6503	SO:0001583	missense	55454	exon5			GGTCTTGATGTTT	AF116646	CCDS7201.1	10q11.21	2013-02-19			ENSG00000169826	ENSG00000169826		"""Beta 4-glycosyltransferases"""	24292	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase 2"""					12446672	Standard	NM_018590		Approved	GALNACT2, MGC40204, PRO0082, GALNACT-2	uc001jan.4	Q8N6G5	OTTHUMG00000018023	ENST00000374466.3:c.1086G>T	10.37:g.43659419G>T	ENSP00000363590:p.Leu362Phe	Somatic	143	1		WXS	Illumina HiSeq	Phase_I	134	4	NM_018590	0	0	3	3	0	B3KWL7|Q6MZJ5|Q6MZP6|Q8TCH4|Q9P1I6	Missense_Mutation	SNP	ENST00000374466.3	37	CCDS7201.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.499782	0.85176	.	.	ENSG00000169826	ENST00000374466	T	0.27256	1.68	6.08	5.17	0.71159	.	0.064535	0.64402	D	0.000004	T	0.57359	0.2048	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.63721	-0.6573	10	0.87932	D	0	-11.7375	14.8306	0.70146	0.0683:0.0:0.9317:0.0	.	362	Q8N6G5	CGAT2_HUMAN	F	362	ENSP00000363590:L362F	ENSP00000363590:L362F	L	+	3	2	CSGALNACT2	42979425	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.683000	0.37638	2.894000	0.99253	0.591000	0.81541	TTG	.		0.433	CSGALNACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047693.1	NM_018590	
AIFM2	84883	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	71874678	71874678	+	Missense_Mutation	SNP	G	G	A	rs376374471		TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr10:71874678G>A	ENST00000307864.1	-	8	1181	c.968C>T	c.(967-969)cCg>cTg	p.P323L	AIFM2_ENST00000373248.1_Missense_Mutation_p.P323L|AIFM2_ENST00000482166.1_5'UTR	NM_001198696.1|NM_032797.5	NP_001185625.1|NP_116186.1	Q9BRQ8	AIFM2_HUMAN	apoptosis-inducing factor, mitochondrion-associated, 2	323					apoptotic mitochondrial changes (GO:0008637)|positive regulation of apoptotic process (GO:0043065)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	DNA binding (GO:0003677)|electron-transferring-flavoprotein dehydrogenase activity (GO:0004174)|flavin adenine dinucleotide binding (GO:0050660)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|skin(2)|urinary_tract(2)	16						TCTCTTACCCGGCTTGTAGGC	0.547																																					p.P323L		.											.	AIFM2-90	0			c.C968T						.	G	LEU/PRO,LEU/PRO	0,4406		0,0,2203	29.0	30.0	30.0		968,968	5.8	1.0	10		30	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense	AIFM2	NM_001198696.1,NM_032797.5	98,98	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	possibly-damaging,possibly-damaging	323/374,323/374	71874678	2,13004	2203	4300	6503	SO:0001583	missense	84883	exon8			TTACCCGGCTTGT	AK027403	CCDS7297.1	10q22.2	2006-11-16	2006-11-16	2006-11-16	ENSG00000042286	ENSG00000042286			21411	protein-coding gene	gene with protein product		605159	"""apoptosis-inducing factor (AIF)-like mitochondrion-associated inducer of death"""	AMID		12135761, 11980907, 15958387	Standard	NM_001198696		Approved	FLJ14497, PRG3	uc001jqp.2	Q9BRQ8	OTTHUMG00000018398	ENST00000307864.1:c.968C>T	10.37:g.71874678G>A	ENSP00000312370:p.Pro323Leu	Somatic	88	0		WXS	Illumina HiSeq	Phase_I	60	16	NM_001198696	0	0	0	0	0	B3KXI0|Q63Z39	Missense_Mutation	SNP	ENST00000307864.1	37	CCDS7297.1	.	.	.	.	.	.	.	.	.	.	G	18.31	3.594868	0.66219	0.0	2.33E-4	ENSG00000042286	ENST00000373248;ENST00000307864;ENST00000395039	T;T	0.35421	1.31;1.31	5.8	5.8	0.92144	.	0.052232	0.85682	D	0.000000	T	0.32255	0.0823	M	0.64567	1.98	0.80722	D	1	P	0.39748	0.686	B	0.29598	0.104	T	0.17077	-1.0381	10	0.12766	T	0.61	-6.747	17.8576	0.88771	0.0:0.0:1.0:0.0	.	323	Q9BRQ8	AIFM2_HUMAN	L	323;323;286	ENSP00000362345:P323L;ENSP00000312370:P323L	ENSP00000312370:P323L	P	-	2	0	AIFM2	71544684	1.000000	0.71417	0.996000	0.52242	0.199000	0.23934	8.579000	0.90781	2.758000	0.94735	0.563000	0.77884	CCG	.		0.547	AIFM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048487.1	NM_032797	
FERMT3	83706	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	63990576	63990576	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr11:63990576G>T	ENST00000279227.5	+	14	1834	c.1739G>T	c.(1738-1740)cGc>cTc	p.R580L	FERMT3_ENST00000345728.5_Missense_Mutation_p.R576L|TRPT1_ENST00000540472.1_5'Flank	NM_178443.2	NP_848537.1	Q86UX7	URP2_HUMAN	fermitin family member 3	580					integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|platelet aggregation (GO:0070527)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|podosome (GO:0002102)	integrin binding (GO:0005178)			breast(1)|cervix(1)|endometrium(4)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	18						CGACTGATCCGCATCGACTTG	0.622																																					p.R580L		.											.	FERMT3-23	0			c.G1739T						.						109.0	83.0	92.0					11																	63990576		2201	4296	6497	SO:0001583	missense	83706	exon14			TGATCCGCATCGA	L25343	CCDS8059.1, CCDS8060.1	11q13.1	2014-09-17	2010-06-24		ENSG00000149781	ENSG00000149781		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	23151	protein-coding gene	gene with protein product	"""kindlin-3"""	607901	"""fermitin family homolog 3 (Drosophila)"""				Standard	NM_178443		Approved	URP2, KIND3, MIG2B, MGC10966, MIG-2, UNC112C	uc001nym.2	Q86UX7	OTTHUMG00000167790	ENST00000279227.5:c.1739G>T	11.37:g.63990576G>T	ENSP00000279227:p.Arg580Leu	Somatic	222	0		WXS	Illumina HiSeq	Phase_I	170	65	NM_178443	0	0	17	17	0	Q8IUA1|Q8N207|Q9BT48	Missense_Mutation	SNP	ENST00000279227.5	37	CCDS8060.1	.	.	.	.	.	.	.	.	.	.	G	35	5.437985	0.96168	.	.	ENSG00000149781	ENST00000345728;ENST00000279227;ENST00000545896	T;T;T	0.73575	-0.76;-0.76;-0.76	5.19	5.19	0.71726	Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	D	0.86908	0.6046	M	0.81802	2.56	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.993	D	0.87510	0.2439	10	0.52906	T	0.07	-23.8856	17.8551	0.88760	0.0:0.0:1.0:0.0	.	576;580	Q86UX7-2;Q86UX7	.;URP2_HUMAN	L	576;580;97	ENSP00000339950:R576L;ENSP00000279227:R580L;ENSP00000440209:R97L	ENSP00000279227:R580L	R	+	2	0	FERMT3	63747152	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	9.411000	0.97342	2.591000	0.87537	0.561000	0.74099	CGC	.		0.622	FERMT3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000396297.1	NM_031471	
SLCO1B3	28234	ucsc.edu	37	12	21030729	21030729	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr12:21030729A>G	ENST00000381545.3	+	10	1213	c.994A>G	c.(994-996)Atc>Gtc	p.I332V	SLCO1B3_ENST00000261196.2_Missense_Mutation_p.I332V|LST3_ENST00000540229.1_Missense_Mutation_p.I332V|LST3_ENST00000381541.3_Intron|SLCO1B7_ENST00000554957.1_Intron|SLCO1B3_ENST00000553473.1_Missense_Mutation_p.I332V	NM_019844.3	NP_062818.1	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family, member 1B3	332					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(23)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(2)	63	Esophageal squamous(101;0.149)				Atorvastatin(DB01076)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Digoxin(DB00390)|Docetaxel(DB01248)|Estradiol(DB00783)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Olmesartan(DB00275)|Ouabain(DB01092)|Paclitaxel(DB01229)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Rosuvastatin(DB01098)|Valsartan(DB00177)	TTTGAAAAGCATCCTTACCAA	0.249																																					p.I332V													.	SLCO1B3-155	0			c.A994G						.						104.0	100.0	101.0					12																	21030729		2203	4300	6503	SO:0001583	missense	28234	exon10			AAAAGCATCCTTA		CCDS8684.1	12p12	2013-05-22	2003-11-25	2003-11-26		ENSG00000111700		"""Solute carriers"""	10961	protein-coding gene	gene with protein product		605495	"""solute carrier family 21 (organic anion transporter), member 8"""	SLC21A8			Standard	NM_019844		Approved	OATP8, OATP1B3	uc001rel.4	Q9NPD5	OTTHUMG00000169011	ENST00000381545.3:c.994A>G	12.37:g.21030729A>G	ENSP00000370956:p.Ile332Val	Somatic	47	0		WXS	Illumina HiSeq		44	4	NM_019844	0	0	0	0	0	E7EMT8|Q5JAR4	Missense_Mutation	SNP	ENST00000381545.3	37	CCDS8684.1	.	.	.	.	.	.	.	.	.	.	.	8.568	0.879456	0.17467	.	.	ENSG00000111700;ENSG00000111700;ENSG00000111700;ENSG00000111700;ENSG00000257046	ENST00000261196;ENST00000381545;ENST00000553473;ENST00000544370;ENST00000540229	T;T;T;T;T	0.80304	0.38;0.38;0.38;-1.36;0.38	3.13	-1.66	0.08265	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.224065	0.38058	N	0.001824	T	0.76485	0.3994	M	0.77820	2.39	0.80722	D	1	B;B;B	0.32409	0.37;0.001;0.001	B;B;B	0.35727	0.209;0.016;0.016	T	0.66244	-0.5972	10	0.49607	T	0.09	.	7.0333	0.24979	0.4897:0.4173:0.093:0.0	.	332;332;332	Q5JAR4;B3KP78;Q9NPD5	.;.;SO1B3_HUMAN	V	332;332;332;156;332	ENSP00000261196:I332V;ENSP00000370956:I332V;ENSP00000451758:I332V;ENSP00000443225:I156V;ENSP00000441269:I332V	ENSP00000441269:I332V	I	+	1	0	SLCO1B3;RP11-545J16.1	20921996	0.102000	0.21896	0.884000	0.34674	0.142000	0.21351	0.482000	0.22276	-0.498000	0.06632	-2.470000	0.00202	ATC	.		0.249	SLCO1B3-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401936.1	NM_019844	
KRT8	3856	broad.mit.edu	37	12	53298675	53298675	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr12:53298675A>C	ENST00000552551.1	-	2	523	c.91T>G	c.(91-93)Tcc>Gcc	p.S31A	KRT8_ENST00000552150.1_Missense_Mutation_p.S59A|KRT8_ENST00000546897.1_Missense_Mutation_p.S31A|KRT8_ENST00000293308.6_Missense_Mutation_p.S31A			P05787	K2C8_HUMAN	keratin 8	31	Head.|Ser-rich.				cell differentiation involved in embryonic placenta development (GO:0060706)|extrinsic apoptotic signaling pathway (GO:0097191)|hepatocyte apoptotic process (GO:0097284)|response to hydrostatic pressure (GO:0051599)|response to other organism (GO:0051707)|sarcomere organization (GO:0045214)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	scaffold protein binding (GO:0097110)|structural molecule activity (GO:0005198)	p.S31A(4)		endometrium(5)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(357;0.108)	Tenecteplase(DB00031)	CTGATGCGGGAACCGGGCCCA	0.662																																					p.S59A													.	KRT8-92	4	Substitution - Missense(4)	endometrium(2)|prostate(1)|liver(1)	c.T175G						.						12.0	14.0	13.0					12																	53298675		2120	4158	6278	SO:0001583	missense	3856	exon2			TGCGGGAACCGGG	BC000654	CCDS8841.1, CCDS58234.1	12q13.13	2013-01-16			ENSG00000170421	ENSG00000170421		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6446	protein-coding gene	gene with protein product		148060				2434381, 1705144, 16831889	Standard	NM_002273		Approved	CARD2, K8, CK8, CYK8, K2C8, KO	uc009zmk.1	P05787	OTTHUMG00000169881	ENST00000552551.1:c.91T>G	12.37:g.53298675A>C	ENSP00000447566:p.Ser31Ala	Somatic	42	1		WXS	Illumina HiSeq	Phase_I	105	9	NM_001256282	1	0	510	511	0	A8K4H3|B0AZN5|F8VXB4|Q14099|Q14716|Q14717|Q53GJ0|Q6DHW5|Q6GMY0|Q6P4C7|Q96J60	Missense_Mutation	SNP	ENST00000552551.1	37	CCDS8841.1	.	.	.	.	.	.	.	.	.	.	-	0.012	-1.651707	0.00785	.	.	ENSG00000170421	ENST00000552551;ENST00000293308;ENST00000547916;ENST00000546897;ENST00000552150;ENST00000546826;ENST00000548998;ENST00000547413;ENST00000546542	T;T;T;T;T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37	4.05	-8.11	0.01082	.	0.706613	0.13676	N	0.370518	T	0.40619	0.1124	N	0.01197	-0.965	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.43589	-0.9382	10	0.05351	T	0.99	.	6.5956	0.22672	0.4212:0.312:0.0:0.2668	.	59;31;31	F8VXB4;F8VU64;P05787	.;.;K2C8_HUMAN	A	31;31;31;31;59;31;71;31;109	ENSP00000447566:S31A;ENSP00000293308:S31A;ENSP00000447402:S31A;ENSP00000449404:S59A;ENSP00000447881:S31A;ENSP00000447040:S71A;ENSP00000448681:S31A;ENSP00000450228:S109A	ENSP00000293308:S31A	S	-	1	0	KRT8	51584942	0.005000	0.15991	0.000000	0.03702	0.065000	0.16274	-0.018000	0.12568	-3.264000	0.00201	-0.290000	0.09829	TCC	.		0.662	KRT8-001	KNOWN	alternative_5_UTR|overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406385.1	NM_002273	
TIMELESS	8914	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	56814422	56814422	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr12:56814422T>G	ENST00000553532.1	-	26	3309	c.3159A>C	c.(3157-3159)gaA>gaC	p.E1053D	TIMELESS_ENST00000554616.1_Missense_Mutation_p.E550D|TIMELESS_ENST00000229201.4_Missense_Mutation_p.E1052D					timeless circadian clock											NS(1)|breast(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(8)|lung(14)|ovary(7)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	49						TTTCCATGGCTTCCTCATTTT	0.507																																					p.E1053D		.											.	TIMELESS-159	0			c.A3159C						.						133.0	109.0	117.0					12																	56814422		2203	4300	6503	SO:0001583	missense	8914	exon26			CATGGCTTCCTCA	AF098162	CCDS8918.1	12q13.3	2012-12-14	2012-12-14		ENSG00000111602	ENSG00000111602			11813	protein-coding gene	gene with protein product	"""Tof1 homolog (S. cerevisiae)"", ""timeless circadian clock 1"""	603887	"""timeless (Drosophila) homolog"", ""timeless homolog (Drosophila)"""			9856465	Standard	NM_003920		Approved	hTIM, TIM, TIM1	uc001slf.2	Q9UNS1	OTTHUMG00000170600	ENST00000553532.1:c.3159A>C	12.37:g.56814422T>G	ENSP00000450607:p.Glu1053Asp	Somatic	203	0		WXS	Illumina HiSeq	Phase_I	270	135	NM_003920	0	0	1	8	7		Missense_Mutation	SNP	ENST00000553532.1	37	CCDS8918.1	.	.	.	.	.	.	.	.	.	.	T	9.732	1.162558	0.21538	.	.	ENSG00000111602	ENST00000229201;ENST00000553532;ENST00000554616	T;T;T	0.15487	2.42;2.42;2.42	5.34	2.91	0.33838	Timeless C-terminal (1);	0.056591	0.64402	D	0.000002	T	0.11024	0.0269	L	0.41961	1.31	0.23589	N	0.99734	B	0.09022	0.002	B	0.14578	0.011	T	0.21348	-1.0248	10	0.15066	T	0.55	-17.0728	4.1508	0.10237	0.3164:0.094:0.0:0.5895	.	1053	Q9UNS1	TIM_HUMAN	D	1052;1053;550	ENSP00000229201:E1052D;ENSP00000450607:E1053D;ENSP00000450848:E550D	ENSP00000229201:E1053D	E	-	3	2	TIMELESS	55100689	0.994000	0.37717	1.000000	0.80357	0.959000	0.62525	0.126000	0.15769	2.150000	0.67090	0.459000	0.35465	GAA	.		0.507	TIMELESS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409771.1	NM_003920	
SLC6A15	55117	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	85279278	85279278	+	Silent	SNP	A	A	G			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr12:85279278A>G	ENST00000266682.5	-	4	1051	c.510T>C	c.(508-510)tcT>tcC	p.S170S	SLC6A15_ENST00000551388.1_Intron|SLC6A15_ENST00000552192.1_Silent_p.S63S|SLC6A15_ENST00000450363.3_Silent_p.S170S	NM_182767.5	NP_877499.1	Q9H2J7	S6A15_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 15	170					amino acid transport (GO:0006865)|ion transport (GO:0006811)|leucine transport (GO:0015820)|neurotransmitter transport (GO:0006836)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)|proline:sodium symporter activity (GO:0005298)			kidney(1)|large_intestine(18)|lung(15)|ovary(1)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	44						GAAAAGACTGAGAAAAATAAA	0.368																																					p.S170S		.											.	SLC6A15-93	0			c.T510C						.						95.0	94.0	94.0					12																	85279278		2203	4300	6503	SO:0001819	synonymous_variant	55117	exon4			AGACTGAGAAAAA	AF265577	CCDS9026.1, CCDS9027.1, CCDS53816.1	12q21.31	2013-07-15	2008-09-02		ENSG00000072041	ENSG00000072041		"""Solute carriers"""	13621	protein-coding gene	gene with protein product	"""homolog of rat orphan transporter v7-3"", ""sodium/chloride dependent neurotransmitter transporter Homo sapiens orphan neurotransmitter transporter NTT7"""	607971	"""solute carrier family 6 (neurotransmitter transporter), member 15"""			10471414, 11112352, 16185194	Standard	NM_182767		Approved	hv7-3, NTT73, FLJ10316, V7-3, SBAT1	uc001szv.4	Q9H2J7	OTTHUMG00000169742	ENST00000266682.5:c.510T>C	12.37:g.85279278A>G		Somatic	193	0		WXS	Illumina HiSeq	Phase_I	232	62	NM_018057	0	0	0	0	0	A8K592|B7Z2P7|E7ESJ5|Q9H9F5	Silent	SNP	ENST00000266682.5	37	CCDS9026.1																																																																																			.		0.368	SLC6A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405678.1	NM_018057, NM_182767	
GOLGA3	2802	broad.mit.edu	37	12	133359035	133359035	+	Silent	SNP	C	C	T			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr12:133359035C>T	ENST00000450791.2	-	16	3495	c.3312G>A	c.(3310-3312)gaG>gaA	p.E1104E	GOLGA3_ENST00000456883.2_Silent_p.E1104E|GOLGA3_ENST00000204726.3_Silent_p.E1104E			Q08378	GOGA3_HUMAN	golgin A3	1104					intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		TGTTTGACTCCTCAAGGCGTT	0.473																																					p.E1104E													.	GOLGA3-95	0			c.G3312A						.						151.0	148.0	149.0					12																	133359035		2203	4300	6503	SO:0001819	synonymous_variant	2802	exon17			TGACTCCTCAAGG	AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.3312G>A	12.37:g.133359035C>T		Somatic	144	0		WXS	Illumina HiSeq	Phase_I	175	4	NM_005895	0	0	2	2	0	A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Silent	SNP	ENST00000450791.2	37	CCDS9281.1																																																																																			.		0.473	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397569.2	NM_005895	
VWA8	23078	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	42185853	42185853	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr13:42185853G>C	ENST00000379310.3	-	39	4804	c.4736C>G	c.(4735-4737)gCa>gGa	p.A1579G		NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	1579						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)										ACCCAGGCCTGCCGTGTCTCT	0.522																																					p.A1579G		.											.	.	0			c.C4736G						.						53.0	56.0	55.0					13																	42185853		1917	4129	6046	SO:0001583	missense	23078	exon39			AGGCCTGCCGTGT	AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.4736C>G	13.37:g.42185853G>C	ENSP00000368612:p.Ala1579Gly	Somatic	94	0		WXS	Illumina HiSeq	Phase_I	108	33	NM_015058	0	0	4	11	7	O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Missense_Mutation	SNP	ENST00000379310.3	37	CCDS41881.1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.015419	0.93404	.	.	ENSG00000102763	ENST00000251030;ENST00000379310	T	0.16457	2.34	5.95	5.95	0.96441	.	0.110644	0.64402	D	0.000012	T	0.46521	0.1397	M	0.87180	2.865	0.80722	D	1	D	0.67145	0.996	P	0.58266	0.836	T	0.50931	-0.8769	10	0.87932	D	0	.	19.9739	0.97296	0.0:0.0:1.0:0.0	.	1579	A3KMH1	K0564_HUMAN	G	1483;1579	ENSP00000368612:A1579G	ENSP00000251030:A1483G	A	-	2	0	KIAA0564	41083853	1.000000	0.71417	0.920000	0.36463	0.903000	0.53119	9.577000	0.98196	2.826000	0.97356	0.563000	0.77884	GCA	.		0.522	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354828.2	NM_015058	
TUBGCP3	10426	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	113140459	113140459	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr13:113140459C>G	ENST00000261965.3	-	22	2758	c.2572G>C	c.(2572-2574)Gtg>Ctg	p.V858L		NM_006322.4	NP_006313.1	Q96CW5	GCP3_HUMAN	tubulin, gamma complex associated protein 3	858					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|single fertilization (GO:0007338)	centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|polar microtubule (GO:0005827)|spindle (GO:0005819)	gamma-tubulin binding (GO:0043015)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|prostate(3)|urinary_tract(1)	25	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)					AACTGCTGCACGATACCCTAA	0.458																																					p.V858L		.											.	TUBGCP3-90	0			c.G2572C						.						26.0	24.0	25.0					13																	113140459		2203	4297	6500	SO:0001583	missense	10426	exon22			GCTGCACGATACC	AF042378	CCDS9525.1, CCDS66584.1, CCDS73599.1	13q34	2008-07-18			ENSG00000126216	ENSG00000126216			18598	protein-coding gene	gene with protein product	"""spindle pole body protein"""					9566967, 9566969	Standard	XM_005268293		Approved	GCP3, Spc98p, SPBC98	uc001vse.1	Q96CW5	OTTHUMG00000017367	ENST00000261965.3:c.2572G>C	13.37:g.113140459C>G	ENSP00000261965:p.Val858Leu	Somatic	343	0		WXS	Illumina HiSeq	Phase_I	281	103	NM_006322	0	0	3	3	0	O43631|O60852|O60853|Q5T8L2|Q7Z4K1|Q96I79	Missense_Mutation	SNP	ENST00000261965.3	37	CCDS9525.1	.	.	.	.	.	.	.	.	.	.	C	11.93	1.786517	0.31593	.	.	ENSG00000126216	ENST00000261965	T	0.21932	1.98	4.55	4.55	0.56014	.	0.000000	0.85682	D	0.000000	T	0.22820	0.0551	L	0.58669	1.825	0.80722	D	1	P;P	0.45827	0.867;0.732	B;B	0.41946	0.371;0.371	T	0.08166	-1.0735	10	0.07990	T	0.79	-24.5804	17.6998	0.88291	0.0:1.0:0.0:0.0	.	848;858	B4DYP7;Q96CW5	.;GCP3_HUMAN	L	858	ENSP00000261965:V858L	ENSP00000261965:V858L	V	-	1	0	TUBGCP3	112188460	1.000000	0.71417	0.894000	0.35097	0.023000	0.10783	7.085000	0.76875	2.216000	0.71823	0.655000	0.94253	GTG	.		0.458	TUBGCP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045825.2	NM_006322	
PRKD1	5587	bcgsc.ca	37	14	30068292	30068292	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr14:30068292C>T	ENST00000331968.5	-	15	2336	c.2107G>A	c.(2107-2109)Gtt>Att	p.V703I	PRKD1_ENST00000415220.2_Missense_Mutation_p.V711I	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1	703	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)	p.V703I(2)		NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		TCACAGTGAACGATATTTTTA	0.388																																					p.V703I													.	PRKD1-1534	2	Substitution - Missense(2)	large_intestine(2)	c.G2107A						.						129.0	128.0	128.0					14																	30068292		2203	4300	6503	SO:0001583	missense	5587	exon15			AGTGAACGATATT		CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.2107G>A	14.37:g.30068292C>T	ENSP00000333568:p.Val703Ile	Somatic	74	0		WXS	Illumina HiSeq	Phase_1	69	4	NM_002742	0	0	23	23	0	A6NL64|B2RAF6	Missense_Mutation	SNP	ENST00000331968.5	37	CCDS9637.1	.	.	.	.	.	.	.	.	.	.	C	35	5.505666	0.96371	.	.	ENSG00000184304	ENST00000331968;ENST00000415220	D;D	0.81579	-1.51;-1.51	5.58	5.58	0.84498	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	T	0.81451	0.4825	N	0.13140	0.3	0.80722	D	1	D	0.58970	0.984	P	0.60886	0.88	D	0.84005	0.0345	10	0.62326	D	0.03	-15.9558	19.9348	0.97133	0.0:1.0:0.0:0.0	.	703	Q15139	KPCD1_HUMAN	I	703;711	ENSP00000333568:V703I;ENSP00000390535:V711I	ENSP00000333568:V703I	V	-	1	0	PRKD1	29138043	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.720000	0.84759	2.789000	0.95967	0.591000	0.81541	GTT	.		0.388	PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276611.2	NM_002742	
LTK	4058	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	41798200	41798200	+	Silent	SNP	G	G	T			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr15:41798200G>T	ENST00000263800.6	-	12	1641	c.1545C>A	c.(1543-1545)gcC>gcA	p.A515A	LTK_ENST00000561619.1_Silent_p.A213A|LTK_ENST00000453182.2_Intron|LTK_ENST00000355166.5_Silent_p.A454A	NM_002344.5	NP_002335.2	P29376	LTK_HUMAN	leukocyte receptor tyrosine kinase	515	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|cellular response to retinoic acid (GO:0071300)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of neuron projection development (GO:0010976)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(16)|skin(3)|urinary_tract(1)	26		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)		OV - Ovarian serous cystadenocarcinoma(18;2.1e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)		CATGGCCCAGGGCTCTGCAGG	0.597										TSP Lung(18;0.14)																											p.A515A													.	LTK-1377	0			c.C1545A						.						67.0	64.0	65.0					15																	41798200		2203	4300	6503	SO:0001819	synonymous_variant	4058	exon12			GCCCAGGGCTCTG	D16105	CCDS10077.1, CCDS10078.1, CCDS45237.1	15q15.1-q21.1	2009-07-10	2008-01-23		ENSG00000062524	ENSG00000062524	2.7.10.1		6721	protein-coding gene	gene with protein product		151520	"""leukocyte tyrosine kinase"""			2320375	Standard	NM_206961		Approved	TYK1	uc001zoa.3	P29376	OTTHUMG00000130339	ENST00000263800.6:c.1545C>A	15.37:g.41798200G>T		Somatic	146	1		WXS	Illumina HiSeq	Phase_I	137	65	NM_002344	0	0	0	0	0	A6NNJ8|B4DL89|E9PFX4	Silent	SNP	ENST00000263800.6	37	CCDS10077.1																																																																																			.		0.597	LTK-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252690.2		
ANKRD34C	390616	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	79587095	79587095	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr15:79587095G>A	ENST00000558647.2	+	1	1469	c.1469G>A	c.(1468-1470)gGc>gAc	p.G490D	ANKRD34C_ENST00000421388.2_Missense_Mutation_p.G490D			P0C6C1	AN34C_HUMAN	ankyrin repeat domain 34C	490										endometrium(3)|kidney(1)|skin(1)	5						CTTGCTAGTGGCTTAAAATCT	0.428																																					p.G490D													.	.	0			c.G1469A						.						90.0	74.0	79.0					15																	79587095		685	1584	2269	SO:0001583	missense	390616	exon2			CTAGTGGCTTAAA		CCDS53965.1	15q25.1	2013-01-10			ENSG00000235711	ENSG00000235711		"""Ankyrin repeat domain containing"""	33888	protein-coding gene	gene with protein product							Standard	NM_001146341		Approved		uc002bet.3	P0C6C1		ENST00000558647.2:c.1469G>A	15.37:g.79587095G>A	ENSP00000454921:p.Gly490Asp	Somatic	71	1		WXS	Illumina HiSeq	Phase_I	61	17	NM_001146341	0	0	0	0	0	H3BNM1	Missense_Mutation	SNP	ENST00000558647.2	37	CCDS53965.1	.	.	.	.	.	.	.	.	.	.	G	15.06	2.720412	0.48728	.	.	ENSG00000235711	ENST00000421388	T	0.21734	1.99	4.72	4.72	0.59763	.	.	.	.	.	T	0.28797	0.0714	M	0.73217	2.22	0.38394	D	0.945492	B	0.26445	0.149	B	0.29440	0.102	T	0.24083	-1.0170	9	0.87932	D	0	.	15.2172	0.73277	0.0:0.0:1.0:0.0	.	490	P0C6C1	AN34C_HUMAN	D	490	ENSP00000401089:G490D	ENSP00000401089:G490D	G	+	2	0	ANKRD34C	77374150	1.000000	0.71417	0.938000	0.37757	0.124000	0.20399	6.883000	0.75595	2.428000	0.82296	0.655000	0.94253	GGC	.		0.428	ANKRD34C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416713.2	NM_001146341	
CHTF18	63922	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	839242	839242	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr16:839242G>T	ENST00000262315.9	+	3	382	c.319G>T	c.(319-321)Gtc>Ttc	p.V107F	RPUSD1_ENST00000561734.1_5'Flank|CHTF18_ENST00000317063.6_Missense_Mutation_p.V304F|RPUSD1_ENST00000567114.1_5'Flank|CHTF18_ENST00000455171.2_Missense_Mutation_p.V135F|RPUSD1_ENST00000565809.1_5'Flank|CHTF18_ENST00000491530.1_3'UTR|RPUSD1_ENST00000007264.2_5'Flank	NM_022092.2	NP_071375.1	Q8WVB6	CTF18_HUMAN	CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)	107					cell cycle (GO:0007049)|DNA replication (GO:0006260)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(1)|kidney(3)|liver(2)|lung(4)|prostate(1)	11		Hepatocellular(780;0.00335)				GCTGCAGGTGGTCAAGAGGCT	0.692																																					p.V107F													.	CHTF18-227	0			c.G319T						.						12.0	15.0	14.0					16																	839242		1934	4078	6012	SO:0001583	missense	63922	exon3			CAGGTGGTCAAGA	BC018184	CCDS45371.1	16p13.3	2010-04-21	2003-12-09		ENSG00000127586	ENSG00000127586		"""ATPases / AAA-type"""	18435	protein-coding gene	gene with protein product		613201	"""chromosome 16 open reading frame 41"""	C16orf41		12171929	Standard	NM_022092		Approved	CHL12, C321D2.4, Ctf18	uc002cke.4	Q8WVB6	OTTHUMG00000047838	ENST00000262315.9:c.319G>T	16.37:g.839242G>T	ENSP00000262315:p.Val107Phe	Somatic	188	1		WXS	Illumina HiSeq	Phase_I	270	141	NM_022092	0	0	0	1	1	B7ZBA2|D3DU68|Q7Z6Y4|Q7Z6Y6|Q9BR83|Q9BRG5|Q9H7K3	Missense_Mutation	SNP	ENST00000262315.9	37	CCDS45371.1	.	.	.	.	.	.	.	.	.	.	G	10.20	1.285452	0.23478	.	.	ENSG00000127586	ENST00000317063;ENST00000455171;ENST00000262315	T;T;T	0.13089	2.67;2.62;2.76	5.07	3.09	0.35607	.	1.527240	0.04025	N	0.300464	T	0.11196	0.0273	L	0.39397	1.21	0.21915	N	0.999474	P;B;B	0.45428	0.858;0.046;0.03	B;B;B	0.36845	0.234;0.04;0.017	T	0.26052	-1.0114	10	0.09590	T	0.72	-22.4866	8.536	0.33364	0.0813:0.0:0.7654:0.1532	.	107;135;107	B4DEY3;Q8WVB6-2;Q8WVB6	.;.;CTF18_HUMAN	F	304;135;107	ENSP00000313029:V304F;ENSP00000406252:V135F;ENSP00000262315:V107F	ENSP00000262315:V107F	V	+	1	0	CHTF18	779243	0.968000	0.33430	0.048000	0.18961	0.065000	0.16274	3.655000	0.54460	0.528000	0.28580	0.511000	0.50034	GTC	.		0.692	CHTF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109061.3	NM_022092	
SMG1	23049	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	18849889	18849889	+	Silent	SNP	A	A	G			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr16:18849889A>G	ENST00000446231.2	-	43	7480	c.7068T>C	c.(7066-7068)aaT>aaC	p.N2356N	SMG1_ENST00000389467.3_Silent_p.N2356N			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	2356	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						CAAAGCAAACATTGTAATCTA	0.328																																					p.N2356N		.											.	SMG1-1160	0			c.T7068C						.						147.0	136.0	139.0					16																	18849889		1828	4078	5906	SO:0001819	synonymous_variant	23049	exon43			GCAAACATTGTAA	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.7068T>C	16.37:g.18849889A>G		Somatic	113	0		WXS	Illumina HiSeq	Phase_I	177	42	NM_015092	0	0	4	5	1	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Silent	SNP	ENST00000446231.2	37	CCDS45430.1																																																																																			.		0.328	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	NM_015092	
PRDM7	11105	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	90127013	90127013	+	Silent	SNP	C	C	A			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr16:90127013C>A	ENST00000449207.2	-	9	988	c.969G>T	c.(967-969)cgG>cgT	p.R323R	PRDM7_ENST00000325921.6_Intron|PRDM7_ENST00000407825.1_Intron	NM_001098173.1	NP_001091643.1	Q9NQW5	PRDM7_HUMAN	PR domain containing 7	323	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleic acid binding (GO:0003676)			lung(2)|ovary(2)|stomach(1)	5		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0278)		CTTCATCATCCCGGGCACAGT	0.542																																					p.R323R													.	PRDM7-92	0			c.G969T						.						76.0	75.0	75.0					16																	90127013		1940	4123	6063	SO:0001819	synonymous_variant	11105	exon9			ATCATCCCGGGCA	AF274347	CCDS45557.1	16q24.3	2013-01-09			ENSG00000126856	ENSG00000126856		"""Zinc fingers, C2H2-type"", ""-"""	9351	protein-coding gene	gene with protein product		609759				17916234	Standard	NM_001098173		Approved	ZNF910	uc010cje.3	Q9NQW5	OTTHUMG00000138990	ENST00000449207.2:c.969G>T	16.37:g.90127013C>A		Somatic	349	1		WXS	Illumina HiSeq	Phase_I	417	111	NM_001098173	0	0	0	0	0	A4Q9G8|Q08EM4|Q9NQW4	Silent	SNP	ENST00000449207.2	37	CCDS45557.1																																																																																			.		0.542	PRDM7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420560.1		
CAMTA2	23125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	4872081	4872081	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr17:4872081T>A	ENST00000348066.3	-	23	3702	c.3579A>T	c.(3577-3579)gaA>gaT	p.E1193D	CAMTA2_ENST00000572543.1_Missense_Mutation_p.E1198D|RP5-1050D4.3_ENST00000576752.1_RNA|SPAG7_ENST00000573366.1_5'Flank|SPAG7_ENST00000206020.3_5'Flank|SPAG7_ENST00000571023.1_5'Flank|SPAG7_ENST00000575142.1_5'Flank|CAMTA2_ENST00000414043.3_Missense_Mutation_p.R1216W|CAMTA2_ENST00000358183.4_Missense_Mutation_p.E1186D|CAMTA2_ENST00000361571.5_Missense_Mutation_p.E1192D|CAMTA2_ENST00000381311.5_Missense_Mutation_p.E1188D	NM_015099.3	NP_055914.2	O94983	CMTA2_HUMAN	calmodulin binding transcription activator 2	1193					cardiac muscle hypertrophy in response to stress (GO:0014898)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						GGGGAAGCCCTTCCAGCTCCT	0.612																																					p.R1216W		.											.	CAMTA2-91	0			c.A3646T						.						51.0	56.0	55.0					17																	4872081		2203	4300	6503	SO:0001583	missense	23125	exon23			AAGCCCTTCCAGC	AB020716	CCDS11063.1, CCDS54071.1, CCDS54072.1, CCDS54073.1	17p13.3	2004-09-01			ENSG00000108509	ENSG00000108509			18807	protein-coding gene	gene with protein product		611508				11925432	Standard	NM_015099		Approved	KIAA0909	uc010cku.2	O94983	OTTHUMG00000099417	ENST00000348066.3:c.3579A>T	17.37:g.4872081T>A	ENSP00000321813:p.Glu1193Asp	Somatic	81	0		WXS	Illumina HiSeq	Phase_I	88	24	NM_001171167	0	0	9	21	12	B9EGL0|D3DTL5|E7EWU5|Q7Z6M8|Q8N3V0|Q8NDG4|Q96G17	Missense_Mutation	SNP	ENST00000348066.3	37	CCDS11063.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.8|20.8	4.044334|4.044334	0.75732|0.75732	.|.	.|.	ENSG00000108509|ENSG00000108509	ENST00000381311;ENST00000361571;ENST00000358183;ENST00000348066|ENST00000414043	T;T;T;T|T	0.40756|0.13538	1.4;1.02;1.4;1.05|2.58	4.7|4.7	-0.79|-0.79	0.10932|0.10932	.|.	0.542415|.	0.14944|.	N|.	0.289350|.	T|T	0.06508|0.06508	0.0167|0.0167	L|L	0.27053|0.27053	0.805|0.805	0.24084|0.24084	N|N	0.995937|0.995937	D;P;D|P	0.56035|0.41643	0.974;0.956;0.974|0.758	D;D;D|B	0.70487|0.30251	0.969;0.931;0.953|0.113	T|T	0.30238|0.30238	-0.9985|-0.9985	10|9	0.62326|0.87932	D|D	0.03|0	0.022|0.022	3.8552|3.8552	0.08973|0.08973	0.0:0.2518:0.4031:0.3451|0.0:0.2518:0.4031:0.3451	.|.	1188;1193;1192|1216	O94983-3;O94983;O94983-4|E7EWU5	.;CMTA2_HUMAN;.|.	D|W	1188;1192;1186;1193|1216	ENSP00000370712:E1188D;ENSP00000354828:E1192D;ENSP00000350910:E1186D;ENSP00000321813:E1193D|ENSP00000412886:R1216W	ENSP00000321813:E1193D|ENSP00000412886:R1216W	E|R	-|-	3|1	2|2	CAMTA2|CAMTA2	4812805|4812805	0.276000|0.276000	0.24211|0.24211	0.999000|0.999000	0.59377|0.59377	0.928000|0.928000	0.56348|0.56348	0.041000|0.041000	0.13927|0.13927	0.162000|0.162000	0.19483|0.19483	0.460000|0.460000	0.39030|0.39030	GAA|AGG	.		0.612	CAMTA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216876.1	NM_015099	
SSH2	85464	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	27958364	27958364	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr17:27958364C>T	ENST00000269033.3	-	15	3918	c.3767G>A	c.(3766-3768)cGc>cAc	p.R1256H	RP11-68I3.2_ENST00000581474.1_RNA|SSH2_ENST00000540801.1_Missense_Mutation_p.R1283H	NM_001282129.1|NM_033389.2	NP_001269058.1|NP_203747.2	Q76I76	SSH2_HUMAN	slingshot protein phosphatase 2	1256					actin cytoskeleton organization (GO:0030036)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)		SSH2/SUZ12(2)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						AGAAGCTGAGCGCCTCATTTG	0.532																																					p.R1256H		.											.	SSH2-92	0			c.G3767A						.						103.0	102.0	102.0					17																	27958364		2203	4300	6503	SO:0001583	missense	85464	exon15			GCTGAGCGCCTCA	AB072359	CCDS11253.1, CCDS74024.1	17q11.2	2013-03-05	2013-03-05		ENSG00000141298	ENSG00000141298		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30580	protein-coding gene	gene with protein product		606779	"""slingshot homolog 2 (Drosophila)"""			11832213, 11214970	Standard	XM_005258059		Approved	KIAA1725	uc002heo.1	Q76I76	OTTHUMG00000132752	ENST00000269033.3:c.3767G>A	17.37:g.27958364C>T	ENSP00000269033:p.Arg1256His	Somatic	93	0		WXS	Illumina HiSeq	Phase_I	136	81	NM_033389	0	0	3	10	7	Q8TDB5|Q8WYL1|Q8WYL2|Q96F40|Q96H36|Q9C0D8	Missense_Mutation	SNP	ENST00000269033.3	37	CCDS11253.1	.	.	.	.	.	.	.	.	.	.	C	15.98	2.991842	0.54041	.	.	ENSG00000141298	ENST00000269033;ENST00000540801	T;T	0.45668	0.89;0.89	6.17	5.19	0.71726	.	0.253540	0.39407	N	0.001375	T	0.34337	0.0894	L	0.39397	1.21	0.80722	D	1	P;B	0.35192	0.489;0.357	B;B	0.29663	0.105;0.048	T	0.17592	-1.0364	10	0.54805	T	0.06	-7.483	14.755	0.69557	0.0:0.9289:0.0:0.0711	.	1283;1256	F5H527;Q76I76	.;SSH2_HUMAN	H	1256;1283	ENSP00000269033:R1256H;ENSP00000444743:R1283H	ENSP00000269033:R1256H	R	-	2	0	SSH2	24982490	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.058000	0.57463	1.560000	0.49568	0.655000	0.94253	CGC	.		0.532	SSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256116.1	NM_033389	
SLFN13	146857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	33772567	33772567	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr17:33772567T>C	ENST00000285013.6	-	3	408	c.133A>G	c.(133-135)Aga>Gga	p.R45G	SLFN13_ENST00000533791.1_Missense_Mutation_p.R45G|SLFN13_ENST00000542635.1_Missense_Mutation_p.R45G|SLFN13_ENST00000526861.1_Missense_Mutation_p.R45G|SLFN13_ENST00000534689.1_Intron|SLFN13_ENST00000360502.2_Intron	NM_144682.5	NP_653283.3	Q68D06	SLN13_HUMAN	schlafen family member 13	45						intracellular (GO:0005622)	ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(1)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	31				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		CGTATAACTCTCGCCCTCTCT	0.498																																					p.R45G		.											.	SLFN13-91	0			c.A133G						.						108.0	111.0	110.0					17																	33772567		2203	4300	6503	SO:0001583	missense	146857	exon3			TAACTCTCGCCCT	AL832726	CCDS32620.1	17q12	2006-04-05				ENSG00000154760			26481	protein-coding gene	gene with protein product		614957				9846487	Standard	NM_144682		Approved	FLJ31952	uc002hjl.2	Q68D06		ENST00000285013.6:c.133A>G	17.37:g.33772567T>C	ENSP00000285013:p.Arg45Gly	Somatic	73	0		WXS	Illumina HiSeq	Phase_I	88	46	NM_144682	0	0	2	7	5	E1P645|Q658M1|Q6ZS51|Q96A81	Missense_Mutation	SNP	ENST00000285013.6	37	CCDS32620.1	.	.	.	.	.	.	.	.	.	.	T	11.35	1.611668	0.28712	.	.	ENSG00000154760	ENST00000285013;ENST00000526861;ENST00000542635;ENST00000524511	T;T;T;T	0.23950	4.48;4.48;4.48;1.88	3.28	3.28	0.37604	.	0.641780	0.12846	U	0.434341	T	0.22820	0.0551	M	0.62723	1.935	0.09310	N	1	B	0.33694	0.421	B	0.24006	0.05	T	0.13202	-1.0518	10	0.46703	T	0.11	.	8.1521	0.31148	0.0:0.0:0.0:1.0	.	45	Q68D06	SLN13_HUMAN	G	45	ENSP00000285013:R45G;ENSP00000434439:R45G;ENSP00000444016:R45G;ENSP00000433181:R45G	ENSP00000285013:R45G	R	-	1	2	SLFN13	30796680	0.001000	0.12720	0.000000	0.03702	0.122000	0.20287	1.012000	0.29924	1.481000	0.48307	0.172000	0.16884	AGA	.		0.498	SLFN13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381883.1	NM_144682	
LASP1	3927	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	37070728	37070728	+	Splice_Site	SNP	G	G	A			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr17:37070728G>A	ENST00000318008.6	+	5	839	c.508G>A	c.(508-510)Gtt>Att	p.V170I	LASP1_ENST00000433206.2_Splice_Site_p.V114I|LASP1_ENST00000435347.3_Splice_Site_p.V170I	NM_006148.2	NP_006139.1	Q14847	LASP1_HUMAN	LIM and SH3 protein 1	170					ion transport (GO:0006811)|positive regulation of signal transduction (GO:0009967)	cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	ion transmembrane transporter activity (GO:0015075)|SH3/SH2 adaptor activity (GO:0005070)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(2)|lung(4)|urinary_tract(2)	9						CAGTGCCCCGGGTGAGTGCAG	0.657			T	MLL	AML																																p.V170I		.		Dom	yes		17	17q11-q21.3	3927	LIM and SH3 protein 1		L	.	LASP1-522	0			c.G508A						.						24.0	30.0	28.0					17																	37070728		2202	4299	6501	SO:0001630	splice_region_variant	3927	exon5			GCCCCGGGTGAGT		CCDS11331.1, CCDS62164.1	17q11-q21.3	2008-07-18			ENSG00000002834	ENSG00000002834			6513	protein-coding gene	gene with protein product		602920				7490069	Standard	NM_006148		Approved	MLN50, Lasp-1	uc010cvq.3	Q14847	OTTHUMG00000133182	ENST00000318008.6:c.508+1G>A	17.37:g.37070728G>A		Somatic	50	0		WXS	Illumina HiSeq	Phase_I	100	50	NM_006148	0	0	0	0	0	B4DGQ0|Q96ED2|Q96IG0	Missense_Mutation	SNP	ENST00000318008.6	37	CCDS11331.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.080367	0.76528	.	.	ENSG00000002834	ENST00000318008;ENST00000433206;ENST00000435347;ENST00000419929	T;T;T;T	0.39997	1.17;1.05;1.17;2.67	5.24	5.24	0.73138	.	0.969776	0.08459	N	0.942649	T	0.33411	0.0862	N	0.24115	0.695	0.41878	D	0.990301	B;B	0.32302	0.363;0.018	B;B	0.24701	0.055;0.016	T	0.11397	-1.0589	10	0.31617	T	0.26	.	17.3957	0.87444	0.0:0.0:1.0:0.0	.	114;170	B4DGQ0;Q14847	.;LASP1_HUMAN	I	170;114;170;134	ENSP00000325240:V170I;ENSP00000401048:V114I;ENSP00000392853:V170I;ENSP00000391897:V134I	ENSP00000325240:V170I	V	+	1	0	LASP1	34324254	1.000000	0.71417	0.713000	0.30519	0.712000	0.41017	4.856000	0.62932	2.431000	0.82371	0.563000	0.77884	GTT	.		0.657	LASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256890.3	NM_006148	Missense_Mutation
KRT35	3886	hgsc.bcm.edu	37	17	39633816	39633816	+	Missense_Mutation	SNP	A	A	C	rs200529540		TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr17:39633816A>C	ENST00000393989.1	-	6	1216	c.1174T>G	c.(1174-1176)Tgt>Ggt	p.C392G	KRT35_ENST00000246639.2_Missense_Mutation_p.C362G	NM_002280.4	NP_002271.3	Q92764	KRT35_HUMAN	keratin 35	392	Coil 2.|Rod.				anatomical structure morphogenesis (GO:0009653)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	29		Breast(137;0.000286)				TTGATCTCACACTCCAGCCGG	0.602													A|||	1	0.000199681	0.0008	0.0	5008	,	,		17752	0.0		0.0	False		,,,				2504	0.0				p.C392G		.											.	KRT35-92	0			c.T1174G						.						69.0	69.0	69.0					17																	39633816		2203	4300	6503	SO:0001583	missense	3886	exon6			TCTCACACTCCAG	X90762	CCDS11394.2	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000197079	ENSG00000197079		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6453	protein-coding gene	gene with protein product	"""hard keratin type I 5"""	602764	"""keratin, hair, acidic, 5"""	KRTHA5		8823373, 16831889	Standard	NM_002280		Approved	Ha-5	uc002hws.3	Q92764	OTTHUMG00000133425	ENST00000393989.1:c.1174T>G	17.37:g.39633816A>C	ENSP00000377558:p.Cys392Gly	Somatic	88	0		WXS	Illumina HiSeq	Phase_I	119	6	NM_002280	0	0	0	0	0	O76012|Q92651	Missense_Mutation	SNP	ENST00000393989.1	37	CCDS11394.2	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	A	1.976	-0.435352	0.04669	.	.	ENSG00000197079	ENST00000246639;ENST00000393989	D;D	0.88586	-2.4;-2.4	4.95	-9.89	0.00464	Filament (1);	0.589135	0.17355	N	0.177272	T	0.76033	0.3931	L	0.27053	0.805	0.20196	N	0.999928	B	0.06786	0.001	B	0.06405	0.002	T	0.50849	-0.8779	10	0.22706	T	0.39	.	14.2893	0.66265	0.116:0.7368:0.0646:0.0826	.	392	Q92764	KRT35_HUMAN	G	362;392	ENSP00000246639:C362G;ENSP00000377558:C392G	ENSP00000246639:C362G	C	-	1	0	KRT35	36887342	0.000000	0.05858	0.054000	0.19295	0.517000	0.34286	-3.318000	0.00514	-2.252000	0.00699	-0.460000	0.05396	TGT	A|0.999;C|0.000		0.602	KRT35-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_002280	
KRT13	3860	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	39661375	39661375	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr17:39661375T>A	ENST00000246635.3	-	1	474	c.428A>T	c.(427-429)cAg>cTg	p.Q143L	KRT13_ENST00000336861.3_Missense_Mutation_p.Q143L|KRT13_ENST00000587544.1_Missense_Mutation_p.Q143L|KRT13_ENST00000587118.1_5'Flank|AC019349.5_ENST00000411759.1_RNA	NM_153490.2	NP_705694	P13646	K1C13_HUMAN	keratin 13	143	Linker 1.|Rod.				cellular response to retinoic acid (GO:0071300)|cytoskeleton organization (GO:0007010)|response to radiation (GO:0009314)|tongue morphogenesis (GO:0043587)	extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	33		Breast(137;0.000286)				AGCTGGGCTCTGCTTCAGGTG	0.617																																					p.Q143L		.											.	KRT13-95	0			c.A428T						.						112.0	104.0	107.0					17																	39661375		2203	4300	6503	SO:0001583	missense	3860	exon1			GGGCTCTGCTTCA		CCDS11396.1, CCDS11397.1	17q21.2	2013-06-20			ENSG00000171401	ENSG00000171401		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6415	protein-coding gene	gene with protein product	"""keratin, type I cytoskeletal 13"", ""cytokeratin 13"""	148065				16831889	Standard	NM_153490		Approved	K13, CK13, MGC3781, MGC161462	uc002hwu.1	P13646	OTTHUMG00000133434	ENST00000246635.3:c.428A>T	17.37:g.39661375T>A	ENSP00000246635:p.Gln143Leu	Somatic	171	0		WXS	Illumina HiSeq	Phase_I	248	155	NM_002274	0	0	0	0	0	Q53G54|Q6AZK5|Q8N240	Missense_Mutation	SNP	ENST00000246635.3	37	CCDS11396.1	.	.	.	.	.	.	.	.	.	.	T	14.15	2.448953	0.43531	.	.	ENSG00000171401	ENST00000246635;ENST00000336861;ENST00000157775	D;D	0.89196	-2.48;-2.48	4.9	4.9	0.64082	Filament (1);	0.152962	0.30244	N	0.010071	D	0.94663	0.8279	M	0.87381	2.88	0.35788	D	0.822162	D;D;D;D	0.67145	0.979;0.996;0.989;0.996	P;D;D;D	0.71870	0.905;0.975;0.925;0.975	D	0.97698	1.0183	10	0.62326	D	0.03	.	14.6956	0.69118	0.0:0.0:0.0:1.0	.	131;143;143;143	P13646-2;A1A4E9;P13646-3;P13646	.;.;.;K1C13_HUMAN	L	143;143;131	ENSP00000246635:Q143L;ENSP00000336604:Q143L	ENSP00000157775:Q131L	Q	-	2	0	KRT13	36914901	0.975000	0.34042	0.999000	0.59377	0.052000	0.14988	3.295000	0.51794	2.073000	0.62155	0.533000	0.62120	CAG	.		0.617	KRT13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257297.1	NM_153490	
SCRN2	90507	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	45918192	45918192	+	Silent	SNP	A	A	G			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr17:45918192A>G	ENST00000290216.9	-	2	143	c.18T>C	c.(16-18)ccT>ccC	p.P6P	SCRN2_ENST00000584123.1_Silent_p.P14P|SCRN2_ENST00000407215.3_Silent_p.P6P	NM_001145023.1|NM_138355.3	NP_001138495.1|NP_612364.2	Q96FV2	SCRN2_HUMAN	secernin 2	6						extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)			cervix(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	14						ATGGGGAGTCAGGGCTCGACG	0.662																																					p.P6P		.											.	SCRN2-91	0			c.T18C						.						25.0	31.0	29.0					17																	45918192		2203	4299	6502	SO:0001819	synonymous_variant	90507	exon2			GGAGTCAGGGCTC	BC002980	CCDS11519.1, CCDS45723.1	17q21	2008-02-05							30381	protein-coding gene	gene with protein product		614966				12221138	Standard	NM_001145023		Approved		uc002imd.3	Q96FV2		ENST00000290216.9:c.18T>C	17.37:g.45918192A>G		Somatic	188	0		WXS	Illumina HiSeq	Phase_I	243	48	NM_138355	0	0	18	21	3	A8K3N1|B7Z8S7|E9PBV5|Q96AC3|Q9BU04	Silent	SNP	ENST00000290216.9	37	CCDS11519.1																																																																																			.		0.662	SCRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441383.1	NM_138355	
AP3D1	8943	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	2130440	2130440	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr19:2130440G>A	ENST00000345016.5	-	6	790	c.559C>T	c.(559-561)Cgg>Tgg	p.R187W	AP3D1_ENST00000590683.1_5'Flank|AP3D1_ENST00000350812.6_Intron|AP3D1_ENST00000355272.6_Missense_Mutation_p.R187W|AP3D1_ENST00000356926.4_Intron	NM_003938.6	NP_003929.4	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1 subunit	187					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|endosome to melanosome transport (GO:0035646)|eye pigment biosynthetic process (GO:0006726)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein localization to membrane (GO:0072657)|protein localization to organelle (GO:0033365)|regulation of sequestering of zinc ion (GO:0061088)|synaptic vesicle membrane organization (GO:0048499)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane coat (GO:0030117)|terminal bouton (GO:0043195)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(23)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCCTTCAGCCGGGGAAAGGCA	0.597																																					p.R187W		.											.	AP3D1-90	0			c.C559T						.						90.0	101.0	97.0					19																	2130440		2034	4183	6217	SO:0001583	missense	8943	exon6			TCAGCCGGGGAAA	U91930	CCDS42459.1, CCDS58638.1	19p13.3	2014-09-04			ENSG00000065000	ENSG00000065000			568	protein-coding gene	gene with protein product		607246				9151686, 9303295	Standard	NM_003938		Approved	ADTD	uc002lva.4	O14617	OTTHUMG00000180354	ENST00000345016.5:c.559C>T	19.37:g.2130440G>A	ENSP00000344055:p.Arg187Trp	Somatic	123	0		WXS	Illumina HiSeq	Phase_I	106	6	NM_001261826	0	0	45	48	3	O00202|O75262|Q59HF5|Q96G11|Q9H3C6	Missense_Mutation	SNP	ENST00000345016.5	37	CCDS42459.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.333240	0.81801	.	.	ENSG00000065000	ENST00000345016;ENST00000355272;ENST00000343722	T;T	0.28255	1.62;1.62	4.61	4.61	0.57282	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.65059	0.2655	M	0.92459	3.31	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77004	0.95;0.989	T	0.76187	-0.3051	10	0.87932	D	0	-30.4076	16.444	0.83910	0.0:0.0:1.0:0.0	.	187;187	O14617-5;O14617	.;AP3D1_HUMAN	W	187	ENSP00000344055:R187W;ENSP00000347416:R187W	ENSP00000341579:R187W	R	-	1	2	AP3D1	2081440	1.000000	0.71417	0.999000	0.59377	0.961000	0.63080	6.998000	0.76277	2.116000	0.64780	0.542000	0.68232	CGG	.		0.597	AP3D1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450912.1		
ZNF564	163050	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	12639471	12639471	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr19:12639471G>T	ENST00000339282.7	-	2	239	c.43C>A	c.(43-45)Ctt>Att	p.L15I	CTD-2192J16.21_ENST00000601420.1_RNA|CTD-2192J16.20_ENST00000593682.1_3'UTR|ZNF709_ENST00000428311.1_Intron	NM_144976.3	NP_659413.1	Q8TBZ8	ZN564_HUMAN	zinc finger protein 564	15	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18						CACTCCTCAAGTGTGAAGTTC	0.468																																					p.L15I		.											.	ZNF564-91	0			c.C43A						.						91.0	92.0	91.0					19																	12639471		2203	4300	6503	SO:0001583	missense	163050	exon2			CCTCAAGTGTGAA	BC028367	CCDS42505.1	19p13.2	2013-09-19			ENSG00000249709	ENSG00000249709		"""Zinc fingers, C2H2-type"", ""-"""	31106	protein-coding gene	gene with protein product							Standard	NM_144976		Approved	MGC26914		Q8TBZ8	OTTHUMG00000156418	ENST00000339282.7:c.43C>A	19.37:g.12639471G>T	ENSP00000340004:p.Leu15Ile	Somatic	94	0		WXS	Illumina HiSeq	Phase_I	86	18	NM_144976	0	0	1	1	0	B9EGT4|Q6P1K6	Missense_Mutation	SNP	ENST00000339282.7	37	CCDS42505.1	.	.	.	.	.	.	.	.	.	.	G	10.57	1.387425	0.25031	.	.	ENSG00000249709	ENST00000339282	T	0.01838	4.61	1.99	0.862	0.19056	Krueppel-associated box (4);	.	.	.	.	T	0.04724	0.0128	M	0.84683	2.71	0.20926	N	0.999823	B	0.29909	0.261	B	0.33196	0.159	T	0.28235	-1.0050	9	0.52906	T	0.07	.	4.2715	0.10789	0.0:0.2591:0.4772:0.2636	.	15	Q8TBZ8	ZN564_HUMAN	I	15	ENSP00000340004:L15I	ENSP00000340004:L15I	L	-	1	0	ZNF564	12500471	0.000000	0.05858	0.452000	0.26994	0.655000	0.38815	-0.253000	0.08794	0.174000	0.19809	0.442000	0.29010	CTT	.		0.468	ZNF564-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344120.2	NM_144976	
ZNF493	284443	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	21606232	21606232	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr19:21606232A>C	ENST00000355504.4	+	2	653	c.387A>C	c.(385-387)agA>agC	p.R129S	CTD-2561J22.3_ENST00000600810.1_Intron|ZNF493_ENST00000392288.2_Missense_Mutation_p.R257S	NM_175910.6	NP_787106.4	Q6ZR52	ZN493_HUMAN	zinc finger protein 493	129					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	30						CACATAAGAGAATTCATACTG	0.378																																					p.R257S		.											.	ZNF493-516	0			c.A771C						.						38.0	41.0	40.0					19																	21606232		2203	4296	6499	SO:0001583	missense	284443	exon4			TAAGAGAATTCAT	AK093823, BC006408, BC022394	CCDS12412.1, CCDS42536.1, CCDS12411.1	19p12	2013-01-08			ENSG00000196268	ENSG00000196268		"""Zinc fingers, C2H2-type"", ""-"""	23708	protein-coding gene	gene with protein product							Standard	NM_001076678		Approved	FLJ36504	uc002npw.3	Q6ZR52	OTTHUMG00000141297	ENST00000355504.4:c.387A>C	19.37:g.21606232A>C	ENSP00000347691:p.Arg129Ser	Somatic	91	0		WXS	Illumina HiSeq	Phase_I	72	38	NM_001076678	0	0	3	6	3	G5E974|Q59GM3|Q6ZSF6|Q8N1Z6|Q8N965|Q9BR99	Missense_Mutation	SNP	ENST00000355504.4	37	CCDS12412.1	.	.	.	.	.	.	.	.	.	.	N	9.658	1.143276	0.21205	.	.	ENSG00000196268	ENST00000392288;ENST00000355504	T;T	0.24151	1.87;1.87	0.927	-1.44	0.08856	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.41581	0.1165	M	0.79258	2.445	0.80722	D	1	D;P	0.71674	0.998;0.932	D;B	0.66084	0.941;0.317	T	0.34204	-0.9838	9	0.66056	D	0.02	.	5.0403	0.14456	0.7906:0.0:0.2094:0.0	.	129;257	Q6ZR52;Q6ZR52-2	ZN493_HUMAN;.	S	257;129	ENSP00000376110:R257S;ENSP00000347691:R129S	ENSP00000347691:R129S	R	+	3	2	ZNF493	21398072	0.000000	0.05858	0.035000	0.18076	0.033000	0.12548	-4.038000	0.00308	-0.593000	0.05844	-0.586000	0.04128	AGA	.		0.378	ZNF493-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000280563.1	NM_175910	
ATP6V1B1	525	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	71188132	71188132	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr2:71188132A>T	ENST00000234396.4	+	7	740	c.667A>T	c.(667-669)Atc>Ttc	p.I223F	ATP6V1B1_ENST00000412314.1_Missense_Mutation_p.I223F|AC007040.11_ENST00000606025.1_Intron	NM_001692.3	NP_001683.2	P15313	VATB1_HUMAN	ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1	223					ATP hydrolysis coupled proton transport (GO:0015991)|ATP metabolic process (GO:0046034)|calcium ion homeostasis (GO:0055074)|cellular iron ion homeostasis (GO:0006879)|excretion (GO:0007588)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|ossification (GO:0001503)|pH reduction (GO:0045851)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|regulation of pH (GO:0006885)|sensory perception of sound (GO:0007605)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lateral plasma membrane (GO:0016328)|microvillus (GO:0005902)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	ATP binding (GO:0005524)|hydrogen ion transmembrane transporter activity (GO:0015078)|hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances (GO:0016820)			endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|prostate(1)|skin(1)	19						CAACTTCGCCATCGTCTTTGC	0.587																																					p.I223F		.											.	ATP6V1B1-91	0			c.A667T						.						94.0	63.0	74.0					2																	71188132		2203	4300	6503	SO:0001583	missense	525	exon7			TTCGCCATCGTCT	AF107466	CCDS1912.1	2p13	2010-04-21	2008-07-31	2002-05-10	ENSG00000116039	ENSG00000116039	3.6.3.14	"""ATPases / V-type"""	853	protein-coding gene	gene with protein product	"""Renal tubular acidosis with deafness"""	192132	"""vacuolar proton pump 3"""	VPP3, ATP6B1		9916796, 2527371	Standard	XM_005264368		Approved	VATB, RTA1B, Vma2	uc002shj.3	P15313	OTTHUMG00000129711	ENST00000234396.4:c.667A>T	2.37:g.71188132A>T	ENSP00000234396:p.Ile223Phe	Somatic	219	1		WXS	Illumina HiSeq	Phase_I	279	158	NM_001692	0	0	0	5	5	Q53FY0|Q6P4H6	Missense_Mutation	SNP	ENST00000234396.4	37	CCDS1912.1	.	.	.	.	.	.	.	.	.	.	A	24.5	4.541872	0.85917	.	.	ENSG00000116039	ENST00000234396;ENST00000483246;ENST00000412314;ENST00000454446	D;D;D	0.81908	-1.55;-1.55;-1.55	5.04	5.04	0.67666	ATPase, F1/V1/A1 complex, alpha/beta subunit, nucleotide-binding domain (1);	0.000000	0.64402	D	0.000011	D	0.91036	0.7180	M	0.84585	2.705	0.80722	D	1	D;D;D	0.67145	0.996;0.979;0.979	D;D;D	0.74674	0.984;0.93;0.93	D	0.92308	0.5855	10	0.87932	D	0	-35.7839	12.7736	0.57436	1.0:0.0:0.0:0.0	.	198;223;223	B4DWH7;C9JL73;P15313	.;.;VATB1_HUMAN	F	223;198;223;240	ENSP00000234396:I223F;ENSP00000388353:I223F;ENSP00000408361:I240F	ENSP00000234396:I223F	I	+	1	0	ATP6V1B1	71041640	1.000000	0.71417	0.999000	0.59377	0.683000	0.39861	7.140000	0.77322	2.133000	0.65898	0.533000	0.62120	ATC	.		0.587	ATP6V1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251920.2	NM_001692	
CCDC74A	90557	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	132290624	132290624	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr2:132290624A>G	ENST00000295171.6	+	7	1127	c.989A>G	c.(988-990)aAg>aGg	p.K330R	CCDC74A_ENST00000467992.2_3'UTR|CCDC74A_ENST00000409856.3_Missense_Mutation_p.K264R	NM_001258304.1|NM_001258305.1|NM_138770.2	NP_001245233.1|NP_001245234.1|NP_620125.1	Q96AQ1	CC74A_HUMAN	coiled-coil domain containing 74A	330										endometrium(4)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19						GTCTCCACCAAGAGCCTCTCC	0.637																																					p.K330R		.											.	CCDC74A-69	0			c.A989G						.						55.0	62.0	60.0					2																	132290624		2202	4280	6482	SO:0001583	missense	90557	exon7			CCACCAAGAGCCT		CCDS2167.1, CCDS58732.1, CCDS74578.1	2q21.1	2008-02-05		2006-02-16	ENSG00000163040	ENSG00000163040			25197	protein-coding gene	gene with protein product						12477932	Standard	NM_138770		Approved	FLJ40345	uc002ttb.4	Q96AQ1	OTTHUMG00000131667	ENST00000295171.6:c.989A>G	2.37:g.132290624A>G	ENSP00000295171:p.Lys330Arg	Somatic	456	0		WXS	Illumina HiSeq	Phase_I	473	177	NM_138770	0	0	42	66	24	Q6P4I5	Missense_Mutation	SNP	ENST00000295171.6	37	CCDS2167.1	.	.	.	.	.	.	.	.	.	.	.	9.783	1.175737	0.21704	.	.	ENSG00000163040	ENST00000295171;ENST00000409856	T;T	0.32988	1.43;1.43	3.07	3.07	0.35406	.	0.000000	0.34603	U	0.003821	T	0.46229	0.1382	L	0.56769	1.78	0.32221	N	0.57519	D;P	0.67145	0.996;0.927	D;D	0.75484	0.986;0.953	T	0.55379	-0.8150	10	0.66056	D	0.02	.	7.967	0.30104	1.0:0.0:0.0:0.0	.	264;330	Q96AQ1-2;Q96AQ1	.;CC74A_HUMAN	R	330;264	ENSP00000295171:K330R;ENSP00000387009:K264R	ENSP00000295171:K330R	K	+	2	0	CCDC74A	132007094	0.982000	0.34865	0.108000	0.21378	0.014000	0.08584	1.298000	0.33412	1.179000	0.42884	0.352000	0.21897	AAG	.		0.637	CCDC74A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254570.2	NM_138770	
EEF1B2	1933	broad.mit.edu	37	2	207025358	207025358	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr2:207025358A>G	ENST00000392222.2	+	2	502	c.127A>G	c.(127-129)Agc>Ggc	p.S43G	NDUFS1_ENST00000423725.1_5'Flank|NDUFS1_ENST00000440274.1_5'Flank|NDUFS1_ENST00000455934.2_5'Flank|NDUFS1_ENST00000449699.1_5'Flank|EEF1B2_ENST00000392221.1_Missense_Mutation_p.S43G|NDUFS1_ENST00000457011.1_5'Flank|EEF1B2_ENST00000236957.5_Missense_Mutation_p.S43G|SNORA41_ENST00000384675.1_RNA|NDUFS1_ENST00000233190.6_5'Flank|SNORD51_ENST00000384320.2_RNA|NDUFS1_ENST00000432169.1_5'Flank	NM_001959.3	NP_001950.1	P24534	EF1B_HUMAN	eukaryotic translation elongation factor 1 beta 2	43	GST C-terminal.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)	translation elongation factor activity (GO:0003746)	p.S43G(4)		breast(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(6)	16						AGCCGTGTCCAGCCCACCGCC	0.468																																					p.S43G													.	EEF1B2-227	4	Substitution - Missense(4)	endometrium(2)|lung(1)|kidney(1)	c.A127G						.						109.0	99.0	102.0					2																	207025358		2203	4300	6503	SO:0001583	missense	1933	exon3			GTGTCCAGCCCAC	X60489	CCDS2367.1	2q33.3	2011-04-28			ENSG00000114942	ENSG00000114942			3208	protein-coding gene	gene with protein product		600655				8250921	Standard	NM_001959		Approved		uc002vbf.1	P24534	OTTHUMG00000132891	ENST00000392222.2:c.127A>G	2.37:g.207025358A>G	ENSP00000376056:p.Ser43Gly	Somatic	199	2		WXS	Illumina HiSeq	Phase_I	246	7	NM_021121	0	0	332	332	0	A8K795|Q6IBH9	Missense_Mutation	SNP	ENST00000392222.2	37	CCDS2367.1	.	.	.	.	.	.	.	.	.	.	A	0.014	-1.585588	0.00872	.	.	ENSG00000114942	ENST00000236957;ENST00000392221;ENST00000392222;ENST00000445505	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.47	0.911	0.19343	Glutathione S-transferase, C-terminal-like (2);	0.442134	0.26800	N	0.022437	T	0.19846	0.0477	N	0.16098	0.37	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.18745	-1.0327	10	0.17832	T	0.49	-2.1703	6.3337	0.21285	0.2348:0.0:0.6384:0.1268	.	43	P24534	EF1B_HUMAN	G	43	ENSP00000236957:S43G;ENSP00000376055:S43G;ENSP00000376056:S43G;ENSP00000407730:S43G	ENSP00000236957:S43G	S	+	1	0	EEF1B2	206733603	0.049000	0.20398	0.145000	0.22337	0.051000	0.14879	0.879000	0.28146	-0.027000	0.13873	-0.252000	0.11476	AGC	.		0.468	EEF1B2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336436.1	NM_001037663	
EEF1B2	1933	broad.mit.edu	37	2	207025366	207025366	+	Silent	SNP	G	G	A			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr2:207025366G>A	ENST00000392222.2	+	2	510	c.135G>A	c.(133-135)ccG>ccA	p.P45P	NDUFS1_ENST00000423725.1_5'Flank|NDUFS1_ENST00000440274.1_5'Flank|NDUFS1_ENST00000455934.2_5'Flank|NDUFS1_ENST00000449699.1_5'Flank|EEF1B2_ENST00000392221.1_Silent_p.P45P|NDUFS1_ENST00000457011.1_5'Flank|EEF1B2_ENST00000236957.5_Silent_p.P45P|SNORA41_ENST00000384675.1_RNA|NDUFS1_ENST00000233190.6_5'Flank|SNORD51_ENST00000384320.2_RNA|NDUFS1_ENST00000432169.1_5'Flank	NM_001959.3	NP_001950.1	P24534	EF1B_HUMAN	eukaryotic translation elongation factor 1 beta 2	45	GST C-terminal.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)	translation elongation factor activity (GO:0003746)	p.P45P(5)		breast(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(6)	16						CCAGCCCACCGCCTGCCGACT	0.448																																					p.P45P													.	EEF1B2-227	5	Substitution - coding silent(5)	kidney(2)|endometrium(2)|lung(1)	c.G135A						.						109.0	99.0	102.0					2																	207025366		2203	4300	6503	SO:0001819	synonymous_variant	1933	exon3			CCCACCGCCTGCC	X60489	CCDS2367.1	2q33.3	2011-04-28			ENSG00000114942	ENSG00000114942			3208	protein-coding gene	gene with protein product		600655				8250921	Standard	NM_001959		Approved		uc002vbf.1	P24534	OTTHUMG00000132891	ENST00000392222.2:c.135G>A	2.37:g.207025366G>A		Somatic	206	1		WXS	Illumina HiSeq	Phase_I	250	7	NM_021121	0	0	264	264	0	A8K795|Q6IBH9	Silent	SNP	ENST00000392222.2	37	CCDS2367.1																																																																																			.		0.448	EEF1B2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336436.1	NM_001037663	
PTPRN	5798	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	220161482	220161482	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr2:220161482C>T	ENST00000295718.2	-	16	2539	c.2299G>A	c.(2299-2301)Gcc>Acc	p.A767T	AC114803.3_ENST00000417355.1_RNA|PTPRN_ENST00000497977.1_5'Flank|PTPRN_ENST00000423636.2_Missense_Mutation_p.A677T|MIR153-1_ENST00000384914.1_RNA|PTPRN_ENST00000409251.3_Missense_Mutation_p.A738T	NM_002846.3	NP_002837.1	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	767	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cytokine-mediated signaling pathway (GO:0019221)|peptidyl-tyrosine dephosphorylation (GO:0035335)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)	integral component of plasma membrane (GO:0005887)	spectrin binding (GO:0030507)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(3)|prostate(4)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		ATGGGGCTGGCGTTGATGTAA	0.607																																					p.A767T		.											.	PTPRN-229	0			c.G2299A						.						116.0	99.0	104.0					2																	220161482		2203	4300	6503	SO:0001583	missense	5798	exon16			GGCTGGCGTTGAT		CCDS2440.1, CCDS56167.1, CCDS56168.1	2q35-q36.1	2011-06-09			ENSG00000054356	ENSG00000054356		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9676	protein-coding gene	gene with protein product		601773				8024693	Standard	NM_001199763		Approved	IA-2	uc002vkz.3	Q16849	OTTHUMG00000133129	ENST00000295718.2:c.2299G>A	2.37:g.220161482C>T	ENSP00000295718:p.Ala767Thr	Somatic	125	0		WXS	Illumina HiSeq	Phase_I	199	46	NM_002846	0	0	0	0	0	B4DK12|F5GZS3|Q08319|Q53QD6|Q6NSL1	Missense_Mutation	SNP	ENST00000295718.2	37	CCDS2440.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.590157	0.86851	.	.	ENSG00000054356	ENST00000409251;ENST00000295718;ENST00000539342;ENST00000537666	T;T;T	0.59364	0.27;0.27;0.27	4.24	4.24	0.50183	Protein-tyrosine phosphatase, receptor/non-receptor type (4);	0.151418	0.41938	D	0.000789	D	0.85221	0.5647	H	0.98594	4.275	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.956;0.998	D	0.91588	0.5284	10	0.87932	D	0	.	16.4513	0.83991	0.0:1.0:0.0:0.0	.	738;767	Q6NSL1;Q16849	.;PTPRN_HUMAN	T	738;767;738;677	ENSP00000386638:A738T;ENSP00000295718:A767T;ENSP00000444244:A677T	ENSP00000295718:A767T	A	-	1	0	PTPRN	219869726	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	7.198000	0.77823	2.187000	0.69744	0.563000	0.77884	GCC	.		0.607	PTPRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256819.2		
DOCK10	55619	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	225688235	225688235	+	Missense_Mutation	SNP	C	C	T	rs371861682		TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr2:225688235C>T	ENST00000258390.7	-	28	3233	c.3166G>A	c.(3166-3168)Gtt>Att	p.V1056I	DOCK10_ENST00000409592.3_Missense_Mutation_p.V1050I	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1056					regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.V1054F(1)		NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		AATCTGGCAACGCTGTGGTTT	0.413																																					p.V1056I		.											.	DOCK10-92	1	Substitution - Missense(1)	breast(1)	c.G3166A						.	C	ILE/VAL	0,3770		0,0,1885	191.0	181.0	184.0		3166	4.2	0.8	2		184	2,8232		0,2,4115	no	missense	DOCK10	NM_014689.2	29	0,2,6000	TT,TC,CC		0.0243,0.0,0.0167	benign	1056/2187	225688235	2,12002	1885	4117	6002	SO:0001583	missense	55619	exon28			TGGCAACGCTGTG	AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.3166G>A	2.37:g.225688235C>T	ENSP00000258390:p.Val1056Ile	Somatic	191	0		WXS	Illumina HiSeq	Phase_I	224	121	NM_014689	0	0	3	3	0	B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	ENST00000258390.7	37	CCDS46528.1	.	.	.	.	.	.	.	.	.	.	C	13.62	2.292507	0.40594	0.0	2.43E-4	ENSG00000135905	ENST00000409592;ENST00000258390	T;T	0.67171	3.85;-0.25	6.0	4.2	0.49525	.	0.302824	0.35349	N	0.003275	T	0.55146	0.1902	L	0.38838	1.175	0.21933	N	0.999469	B;B	0.12013	0.005;0.001	B;B	0.08055	0.002;0.003	T	0.49542	-0.8929	10	0.49607	T	0.09	.	10.9896	0.47541	0.0:0.7834:0.0:0.2166	.	1056;1050	Q96BY6;B3FL70	DOC10_HUMAN;.	I	1050;1056	ENSP00000386694:V1050I;ENSP00000258390:V1056I	ENSP00000258390:V1056I	V	-	1	0	DOCK10	225396479	0.057000	0.20700	0.828000	0.32881	0.970000	0.65996	0.541000	0.23207	0.862000	0.35528	0.643000	0.83706	GTT	.		0.413	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331246.1		
SP140L	93349	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	231264856	231264856	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr2:231264856T>A	ENST00000415673.2	+	15	1298	c.1212T>A	c.(1210-1212)gaT>gaA	p.D404E	SP140L_ENST00000444636.1_Missense_Mutation_p.D404E|SP140L_ENST00000243810.6_Missense_Mutation_p.D404E|SP140L_ENST00000396563.4_Missense_Mutation_p.D369E	NM_138402.4	NP_612411.4	Q9H930	SP14L_HUMAN	SP140 nuclear body protein-like	404						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(7)|prostate(1)|skin(1)	20						GAAACTTGGATGAGTGTGAGG	0.512																																					p.D404E		.											.	SP140L-23	0			c.T1212A						.						181.0	183.0	182.0					2																	231264856		2043	4208	6251	SO:0001583	missense	93349	exon15			CTTGGATGAGTGT	BC004921	CCDS46538.1	2q37.1	2013-01-28			ENSG00000185404	ENSG00000185404		"""Zinc fingers, PHD-type"""	25105	protein-coding gene	gene with protein product						12477932	Standard	NM_138402		Approved		uc010fxm.1	Q9H930	OTTHUMG00000153730	ENST00000415673.2:c.1212T>A	2.37:g.231264856T>A	ENSP00000397911:p.Asp404Glu	Somatic	237	0		WXS	Illumina HiSeq	Phase_I	389	213	NM_138402	0	0	0	1	1	Q2M375|Q4ZG65|Q9BSP3	Missense_Mutation	SNP	ENST00000415673.2	37	CCDS46538.1	.	.	.	.	.	.	.	.	.	.	T	15.61	2.883793	0.51908	.	.	ENSG00000185404	ENST00000444636;ENST00000415673;ENST00000243810;ENST00000396563	D;D;D;D	0.87571	-2.27;-2.27;-2.27;-2.27	3.5	-2.37	0.06643	.	.	.	.	.	T	0.81235	0.4780	L	0.52126	1.63	0.09310	N	1	P;P	0.45044	0.849;0.663	B;P	0.45794	0.382;0.493	T	0.71507	-0.4572	9	0.72032	D	0.01	.	0.2987	0.00269	0.1938:0.243:0.1988:0.3644	.	369;404	Q9H930-2;Q9H930-4	.;.	E	404;404;404;369	ENSP00000395195:D404E;ENSP00000397911:D404E;ENSP00000243810:D404E;ENSP00000379811:D369E	ENSP00000243810:D404E	D	+	3	2	SP140L	230973100	0.000000	0.05858	0.000000	0.03702	0.084000	0.17831	-1.650000	0.01991	-0.178000	0.10672	-0.415000	0.06103	GAT	.		0.512	SP140L-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374538.1	NM_138402	
FAM182A	284800	broad.mit.edu	37	20	26061818	26061818	+	RNA	SNP	G	G	C	rs112101451		TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr20:26061818G>C	ENST00000376398.2	+	0	838					NR_026713.1		Q5T1J6	F182A_HUMAN	family with sequence similarity 182, member A											breast(1)|endometrium(2)|kidney(1)	4						GATTTCTCCTGCTTAGAAATG	0.463																																					.													.	.	0			.						.						12.0	11.0	11.0					20																	26061818		692	1579	2271			284800	.			TCTCCTGCTTAGA	AL391119		20p11	2013-03-18	2008-08-05	2008-08-05	ENSG00000125804	ENSG00000125804			16222	other	unknown			"""chromosome 20 open reading frame 91"""	C20orf91			Standard	NR_026713		Approved	bB329D4.1, C20orf91A	uc010gdq.3	Q5T1J6	OTTHUMG00000032144		20.37:g.26061818G>C		Somatic	111	1		WXS	Illumina HiSeq	Phase_I	88	3	.	0	0	0	0	0	A2RRD0|Q8N947	RNA	SNP	ENST00000376398.2	37		.	.	.	.	.	.	.	.	.	.	N	7.694	0.691703	0.15039	.	.	ENSG00000125804	ENST00000376398;ENST00000246000	.	.	.	0.368	0.368	0.16146	.	.	.	.	.	T	0.47322	0.1439	.	.	.	0.30118	N	0.805912	.	.	.	.	.	.	T	0.53092	-0.8487	4	0.87932	D	0	.	.	.	.	.	.	.	.	S	57	.	ENSP00000246000:C57S	C	+	2	0	FAM182A	26009818	1.000000	0.71417	0.427000	0.26684	0.468000	0.32798	0.774000	0.26675	0.451000	0.26802	0.123000	0.15791	TGC	G|0.994;C|0.006		0.463	FAM182A-001	KNOWN	basic	lincRNA	processed_transcript	OTTHUMT00000078473.2		
TTI1	9675	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	36641648	36641648	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr20:36641648G>C	ENST00000373448.2	-	3	809	c.571C>G	c.(571-573)Cca>Gca	p.P191A	TTI1_ENST00000449821.1_Missense_Mutation_p.P191A|TTI1_ENST00000487362.1_Intron|TTI1_ENST00000373447.3_Missense_Mutation_p.P191A	NM_014657.1	NP_055472.1	O43156	TTI1_HUMAN	TELO2 interacting protein 1	191					regulation of TOR signaling (GO:0032006)	cytoplasm (GO:0005737)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)				breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	47						AATGACCTTGGATGGTCCTGA	0.423																																					p.P191A		.											.	TTI1-94	0			c.C571G						.						61.0	62.0	62.0					20																	36641648		2203	4300	6503	SO:0001583	missense	9675	exon3			ACCTTGGATGGTC	BC013121	CCDS13300.1	20q11.23	2011-11-10	2011-11-10	2010-06-22	ENSG00000101407	ENSG00000101407			29029	protein-coding gene	gene with protein product	"""smg-10 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	614425	"""KIAA0406"", ""Tel2 interacting protein 1 homolog (S. pombe)"""	KIAA0406		9455477, 20427287, 20371770	Standard	NM_014657		Approved	smg-10	uc002xhl.3	O43156	OTTHUMG00000032433	ENST00000373448.2:c.571C>G	20.37:g.36641648G>C	ENSP00000362547:p.Pro191Ala	Somatic	65	0		WXS	Illumina HiSeq	Phase_I	64	20	NM_014657	0	0	2	5	3	D6W4K3|Q5JX67|Q96A38|Q9BR47|Q9H4K0	Missense_Mutation	SNP	ENST00000373448.2	37	CCDS13300.1	.	.	.	.	.	.	.	.	.	.	G	9.292	1.050781	0.19827	.	.	ENSG00000101407	ENST00000373448;ENST00000373447;ENST00000449821	T;T;T	0.13307	2.6;2.6;2.6	5.32	5.32	0.75619	Armadillo-like helical (1);Armadillo-type fold (1);	0.056167	0.64402	D	0.000001	T	0.20455	0.0492	M	0.63428	1.95	0.31399	N	0.676886	D	0.56521	0.976	P	0.49085	0.6	T	0.07443	-1.0772	10	0.07813	T	0.8	-22.5589	16.312	0.82874	0.0:0.0:1.0:0.0	.	191	O43156	TTI1_HUMAN	A	191	ENSP00000362547:P191A;ENSP00000362546:P191A;ENSP00000407270:P191A	ENSP00000362546:P191A	P	-	1	0	TTI1	36075062	0.927000	0.31430	1.000000	0.80357	0.958000	0.62258	1.398000	0.34554	2.767000	0.95098	0.555000	0.69702	CCA	.		0.423	TTI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079138.2	NM_014657	
TSHZ2	128553	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	51871576	51871576	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr20:51871576G>A	ENST00000371497.5	+	2	2466	c.1579G>A	c.(1579-1581)Gcc>Acc	p.A527T	TSHZ2_ENST00000329613.6_Missense_Mutation_p.A524T|TSHZ2_ENST00000603338.2_Missense_Mutation_p.A524T|RP4-678D15.1_ENST00000606932.1_RNA	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	527					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			TGTCACCACAGCCATCAACAA	0.522																																					p.A527T		.											.	TSHZ2-232	0			c.G1579A						.						50.0	54.0	53.0					20																	51871576		2203	4300	6503	SO:0001583	missense	128553	exon2			ACCACAGCCATCA	AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.1579G>A	20.37:g.51871576G>A	ENSP00000360552:p.Ala527Thr	Somatic	66	0		WXS	Illumina HiSeq	Phase_I	67	24	NM_173485	0	0	0	0	0	B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	SNP	ENST00000371497.5	37	CCDS33490.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.906244	0.92107	.	.	ENSG00000182463	ENST00000371497;ENST00000329613;ENST00000450262	T;T	0.50001	0.76;0.76	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.72334	0.3447	M	0.79123	2.44	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.73678	-0.3907	10	0.87932	D	0	-23.9458	20.3655	0.98876	0.0:0.0:1.0:0.0	.	527	Q9NRE2	TSH2_HUMAN	T	527;524;53	ENSP00000360552:A527T;ENSP00000333114:A524T	ENSP00000333114:A524T	A	+	1	0	TSHZ2	51304983	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.470000	0.97683	2.822000	0.97130	0.643000	0.83706	GCC	.		0.522	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	NM_173485	
IFNAR1	3454	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	34725063	34725063	+	Splice_Site	SNP	G	G	A			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr21:34725063G>A	ENST00000270139.3	+	9	1295		c.e9-1		IFNAR1_ENST00000442357.2_Splice_Site|IFNAR1_ENST00000416947.2_Splice_Site	NM_000629.2	NP_000620.2	P17181	INAR1_HUMAN	interferon (alpha, beta and omega) receptor 1						cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to virus (GO:0009615)|T cell activation (GO:0042110)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	type I interferon receptor activity (GO:0004905)			breast(2)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|skin(2)	14					"""""""Interferon Alfa-2a(DB00034)|""""Interferon Alfa-2b(DB00105)|Interferon alfa-n1(DB00011)|Interferon alfa-n3(DB00018)|Interferon alfacon-1(DB00069)|Interferon beta-1a(DB00060)|Interferon beta-1b(DB00068)|Natural alpha interferon(DB05258)|Peginterferon alfa-2a(DB00008)|Peginterferon alfa-2b(DB00022)"""	ATATTTTCTAGAGAAAAATTA	0.328																																					.	Esophageal Squamous(73;817 1211 32990 35667 42746)	.											.	IFNAR1-91	0			c.1144-1G>A						.						34.0	39.0	38.0					21																	34725063		2200	4297	6497	SO:0001630	splice_region_variant	3454	exon9			TTTCTAGAGAAAA		CCDS13624.1	21q22.1	2008-05-02			ENSG00000142166	ENSG00000142166		"""Interferons"""	5432	protein-coding gene	gene with protein product		107450		IFNAR		8181059	Standard	NM_000629		Approved	IFRC	uc002yrn.3	P17181	OTTHUMG00000065126	ENST00000270139.3:c.1144-1G>A	21.37:g.34725063G>A		Somatic	16	0		WXS	Illumina HiSeq	Phase_I	18	14	NM_000629	0	0	0	0	0	B2R6L9|B4DNT3|D3DSF0|Q53GW9|Q53H11|Q6PKD7|Q7M4L2|Q8WTZ2	Splice_Site	SNP	ENST00000270139.3	37	CCDS13624.1	.	.	.	.	.	.	.	.	.	.	G	14.82	2.650324	0.47362	.	.	ENSG00000142166	ENST00000416947;ENST00000270139;ENST00000442357	.	.	.	5.48	4.56	0.56223	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.3702	0.55250	0.0:0.1684:0.8316:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	IFNAR1	33646933	0.956000	0.32656	0.594000	0.28785	0.331000	0.28603	4.213000	0.58520	2.562000	0.86427	0.650000	0.86243	.	.		0.328	IFNAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139823.4		Intron
TRIOBP	11078	hgsc.bcm.edu	37	22	38119757	38119757	+	Missense_Mutation	SNP	A	A	T	rs71322688|rs67890459|rs199535040|rs55745992	byFrequency	TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr22:38119757A>T	ENST00000406386.3	+	7	1449	c.1194A>T	c.(1192-1194)caA>caT	p.Q398H		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	398					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					GAACCACTCAACGAGAGAATT	0.547																																					p.Q398H		.											.	TRIOBP-136	0			c.A1194T						.						118.0	99.0	106.0					22																	38119757		1848	3567	5415	SO:0001583	missense	11078	exon7			CACTCAACGAGAG	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.1194A>T	22.37:g.38119757A>T	ENSP00000384312:p.Gln398His	Somatic	1	0		WXS	Illumina HiSeq	Phase_I	13	6	NM_001039141	0	0	0	0	0	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	37	CCDS43015.1	.	.	.	.	.	.	.	.	.	.	A	13.81	2.346788	0.41599	.	.	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.34275	1.37	2.47	-1.65	0.08291	.	.	.	.	.	T	0.42177	0.1191	L	0.44542	1.39	0.09310	N	0.999998	D	0.54964	0.969	P	0.62382	0.901	T	0.32402	-0.9908	9	0.49607	T	0.09	.	6.5071	0.22202	0.6093:0.0:0.3907:0.0	.	398	Q9H2D6	TARA_HUMAN	H	398	ENSP00000384312:Q398H	ENSP00000384312:Q398H	Q	+	3	2	TRIOBP	36449703	.	.	0.034000	0.17996	0.078000	0.17371	.	.	-0.503000	0.06586	0.113000	0.15668	CAA	.		0.547	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
FAM227A	646851	broad.mit.edu	37	22	39032548	39032548	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr22:39032548T>G	ENST00000535113.1	-	6	1030	c.427A>C	c.(427-429)Agc>Cgc	p.S143R	FAM227A_ENST00000540952.1_5'UTR|FAM227A_ENST00000406767.2_Missense_Mutation_p.S137R|FAM227A_ENST00000355830.6_Missense_Mutation_p.S137R	NM_001013647.1	NP_001013669.1	F5H4B4	F227A_HUMAN	family with sequence similarity 227, member A	143																	GGCTTGGAGCTGTTGAAGTTG	0.478																																					p.S143R													.	.	0			c.A427C						.						126.0	105.0	111.0					22																	39032548		692	1591	2283	SO:0001583	missense	646851	exon6			TGGAGCTGTTGAA			22q13.1	2012-07-04			ENSG00000184949	ENSG00000184949			44197	protein-coding gene	gene with protein product							Standard	NM_001013647		Approved		uc011anw.1	F5H4B4	OTTHUMG00000151133	ENST00000535113.1:c.427A>C	22.37:g.39032548T>G	ENSP00000445093:p.Ser143Arg	Somatic	145	0		WXS	Illumina HiSeq	Phase_I	126	4	NM_001013647	0	0	1	1	0	B0QY52|B7Z7C6|Q5TG08	Missense_Mutation	SNP	ENST00000535113.1	37		.	.	.	.	.	.	.	.	.	.	T	14.27	2.485036	0.44147	.	.	ENSG00000184949	ENST00000535113;ENST00000355830;ENST00000406767;ENST00000466655	.	.	.	5.39	-3.76	0.04359	.	2.160390	0.01503	N	0.017569	T	0.30324	0.0761	L	0.40543	1.245	0.09310	N	1	P;P	0.44627	0.839;0.804	B;B	0.40228	0.323;0.195	T	0.45614	-0.9249	9	0.52906	T	0.07	-6.0261	8.8243	0.35045	0.0:0.5817:0.1298:0.2885	.	137;143	Q5TG08;F5H4B4	YV009_HUMAN;.	R	143;137;137;50	.	ENSP00000348086:S137R	S	-	1	0	RP1-199H16.5	37362494	0.000000	0.05858	0.000000	0.03702	0.058000	0.15608	-0.919000	0.04017	-0.536000	0.06298	0.379000	0.24179	AGC	.		0.478	FAM227A-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001013647	
SMC1B	27127	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	45748333	45748333	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr22:45748333G>T	ENST00000357450.4	-	22	3422	c.3423C>A	c.(3421-3423)caC>caA	p.H1141Q	SMC1B_ENST00000404354.3_Intron	NM_148674.3	NP_683515.3	Q8NDV3	SMC1B_HUMAN	structural maintenance of chromosomes 1B	1141	Ala/Asp-rich (DA-box).				meiotic nuclear division (GO:0007126)|sister chromatid cohesion (GO:0007062)	chromosome, centromeric region (GO:0000775)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)	ATP binding (GO:0005524)|DNA binding (GO:0003677)	p.H1143Q(1)		breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		GACCTTACCTGTGCACAGCAA	0.443																																					p.H1141Q		.											.	SMC1B-229	1	Substitution - Missense(1)	ovary(1)	c.C3423A						.						74.0	73.0	74.0					22																	45748333		1908	4110	6018	SO:0001583	missense	27127	exon22			TTACCTGTGCACA	AJ504806	CCDS43027.1, CCDS74876.1	22q13	2006-07-06	2006-07-06	2006-07-06	ENSG00000077935	ENSG00000077935		"""Structural maintenance of chromosomes proteins"""	11112	protein-coding gene	gene with protein product		608685	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 2 (yeast)"""	SMC1L2		10591208, 11564881	Standard	XM_005261566		Approved	bK268H5	uc003bgc.3	Q8NDV3	OTTHUMG00000151334	ENST00000357450.4:c.3423C>A	22.37:g.45748333G>T	ENSP00000350036:p.His1141Gln	Somatic	116	0		WXS	Illumina HiSeq	Phase_I	113	32	NM_148674	0	0	0	0	0	A0AV46|B0QY23|B0QY24|Q5TIC3|Q6ZUF9|Q9Y3G5	Missense_Mutation	SNP	ENST00000357450.4	37	CCDS43027.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.092182	0.76756	.	.	ENSG00000077935	ENST00000357450	T	0.65549	-0.16	6.17	1.52	0.23074	.	0.090318	0.48767	D	0.000179	T	0.64349	0.2590	L	0.59912	1.85	0.80722	D	1	D	0.57257	0.979	P	0.54026	0.74	T	0.65038	-0.6265	10	0.56958	D	0.05	.	8.4322	0.32764	0.1878:0.111:0.7013:0.0	.	1141	Q8NDV3-3	.	Q	1141	ENSP00000350036:H1141Q	ENSP00000350036:H1141Q	H	-	3	2	SMC1B	44126997	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	4.612000	0.61169	0.948000	0.37687	0.655000	0.94253	CAC	.		0.443	SMC1B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322256.2	NM_148674	
OXTR	5021	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	8809352	8809352	+	Silent	SNP	G	G	T			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr3:8809352G>T	ENST00000316793.3	-	3	1146	c.522C>A	c.(520-522)atC>atA	p.I174I	CAV3_ENST00000472766.1_Intron	NM_000916.3	NP_000907.2	P30559	OXYR_HUMAN	oxytocin receptor	174					cell surface receptor signaling pathway (GO:0007166)|digestive tract development (GO:0048565)|eating behavior (GO:0042755)|ERK1 and ERK2 cascade (GO:0070371)|estrous cycle phase (GO:0060206)|female pregnancy (GO:0007565)|heart development (GO:0007507)|lactation (GO:0007595)|maternal behavior (GO:0042711)|maternal process involved in parturition (GO:0060137)|memory (GO:0007613)|muscle contraction (GO:0006936)|negative regulation of gastric acid secretion (GO:0060455)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of norepinephrine secretion (GO:0010701)|positive regulation of penile erection (GO:0060406)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of uterine smooth muscle contraction (GO:0070474)|response to amphetamine (GO:0001975)|response to anoxia (GO:0034059)|response to cocaine (GO:0042220)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to peptide hormone (GO:0043434)|response to progesterone (GO:0032570)|sleep (GO:0030431)|social behavior (GO:0035176)|sperm ejaculation (GO:0042713)|suckling behavior (GO:0001967)|telencephalon development (GO:0021537)	apical plasma membrane (GO:0016324)|cell-cell adherens junction (GO:0005913)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	oxytocin receptor activity (GO:0004990)|peptide hormone binding (GO:0017046)|vasopressin receptor activity (GO:0005000)			NS(1)|endometrium(2)|large_intestine(4)|lung(5)|urinary_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(96;0.15)	Carbetocin(DB01282)|Oxytocin(DB00107)	GCAGAGAGAAGATGTGCACCT	0.692																																					p.I174I		.											.	OXTR-68	0			c.C522A						.						34.0	39.0	37.0					3																	8809352		2203	4300	6503	SO:0001819	synonymous_variant	5021	exon3			AGAGAAGATGTGC		CCDS2570.1	3p25	2012-08-08			ENSG00000180914	ENSG00000180914		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	8529	protein-coding gene	gene with protein product		167055				1313946	Standard	NM_000916		Approved		uc003brc.3	P30559	OTTHUMG00000090537	ENST00000316793.3:c.522C>A	3.37:g.8809352G>T		Somatic	86	0		WXS	Illumina HiSeq	Phase_I	187	101	NM_000916	0	0	0	0	0	Q15071	Silent	SNP	ENST00000316793.3	37	CCDS2570.1																																																																																			.		0.692	OXTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207061.2		
FNDC3B	64778	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	171969140	171969140	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr3:171969140T>A	ENST00000336824.4	+	6	698	c.599T>A	c.(598-600)aTc>aAc	p.I200N	FNDC3B_ENST00000415807.2_Missense_Mutation_p.I200N|FNDC3B_ENST00000416957.1_Missense_Mutation_p.I200N	NM_001135095.1	NP_001128567.1	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	200					cell migration (GO:0016477)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast proliferation (GO:0048146)|substrate adhesion-dependent cell spreading (GO:0034446)|Type II pneumocyte differentiation (GO:0060510)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(26)|ovary(3)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	69	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		GACCGCCAGATCGATCGCCAG	0.463																																					p.I200N													.	FNDC3B-155	0			c.T599A						.						66.0	67.0	67.0					3																	171969140		2203	4300	6503	SO:0001583	missense	64778	exon6			GCCAGATCGATCG	AF543840	CCDS3217.1	3q26.31	2013-11-06			ENSG00000075420	ENSG00000075420		"""Fibronectin type III domain containing"""	24670	protein-coding gene	gene with protein product		611909				15527760	Standard	NM_022763		Approved	FAD104, DKFZp762K137, FLJ23399, PRO4979, YVTM2421	uc003fhy.3	Q53EP0	OTTHUMG00000156761	ENST00000336824.4:c.599T>A	3.37:g.171969140T>A	ENSP00000338523:p.Ile200Asn	Somatic	111	1		WXS	Illumina HiSeq	Phase_I	162	92	NM_001135095	0	0	5	14	9	B2RB36|B3KXR8|D3DNQ7|Q5U5T8|Q6PIJ3|Q6UXG1|Q6UXZ5|Q8IXB2|Q8NBU7|Q96D78|Q9H5I7|Q9NSQ8	Missense_Mutation	SNP	ENST00000336824.4	37	CCDS3217.1	.	.	.	.	.	.	.	.	.	.	T	15.34	2.805927	0.50421	.	.	ENSG00000075420	ENST00000415807;ENST00000336824;ENST00000416957;ENST00000443501	T;T;T;T	0.30714	1.52;1.52;1.52;1.52	5.78	4.43	0.53597	.	0.228496	0.44483	D	0.000441	T	0.24005	0.0581	L	0.40543	1.245	0.80722	D	1	B;B	0.32160	0.358;0.147	B;B	0.30179	0.112;0.063	T	0.04537	-1.0944	10	0.27082	T	0.32	-20.4035	12.3626	0.55211	0.0:0.0762:0.0:0.9238	.	200;200	Q53EP0-2;Q53EP0	.;FND3B_HUMAN	N	200;200;200;173	ENSP00000411242:I200N;ENSP00000338523:I200N;ENSP00000389094:I200N;ENSP00000389064:I173N	ENSP00000338523:I200N	I	+	2	0	FNDC3B	173451834	1.000000	0.71417	0.982000	0.44146	0.988000	0.76386	3.590000	0.53979	2.205000	0.71048	0.482000	0.46254	ATC	.		0.463	FNDC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345618.2	NM_022763	
PARL	55486	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	183558378	183558378	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr3:183558378A>G	ENST00000317096.4	-	7	868	c.808T>C	c.(808-810)Tat>Cat	p.Y270H	PARL_ENST00000311101.5_Missense_Mutation_p.Y220H|PARL_ENST00000435888.1_Missense_Mutation_p.Y220H	NM_018622.5	NP_061092.3	Q9H300	PARL_HUMAN	presenilin associated, rhomboid-like	270					membrane protein proteolysis (GO:0033619)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|proteolysis (GO:0006508)|regulation of protein targeting to mitochondrion (GO:1903214)|regulation of reactive oxygen species metabolic process (GO:2000377)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(3)|liver(1)|lung(6)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	17	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.21e-41)|Epithelial(37;1.34e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			GATGGTCCATATCTTCCTGTG	0.279																																					p.Y270H													.	PARL-90	0			c.T808C						.						58.0	54.0	56.0					3																	183558378		2203	4300	6503	SO:0001583	missense	55486	exon7			GTCCATATCTTCC	AF116692	CCDS3248.1, CCDS33897.1	3q27.3	2008-02-05		2006-02-28	ENSG00000175193	ENSG00000175193			18253	protein-coding gene	gene with protein product	"""rhomboid 7 homolog 1 (Drosophila)"""	607858		PSARL			Standard	XM_005247587		Approved	PRO2207, PSARL1, RHBDS1	uc003fmd.3	Q9H300	OTTHUMG00000156890	ENST00000317096.4:c.808T>C	3.37:g.183558378A>G	ENSP00000325421:p.Tyr270His	Somatic	157	1		WXS	Illumina HiSeq	Phase_I	192	65	NM_018622	0	0	36	48	12	Q96CQ4|Q9BTJ6|Q9P1E3	Missense_Mutation	SNP	ENST00000317096.4	37	CCDS3248.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.32|12.32	1.901679|1.901679	0.33535|0.33535	.|.	.|.	ENSG00000175193|ENSG00000175193	ENST00000417784;ENST00000449306|ENST00000317096;ENST00000311101;ENST00000450375;ENST00000435888	.|T;T;T;T	.|0.11930	.|2.73;2.73;2.73;2.73	5.08|5.08	5.08|5.08	0.68730|0.68730	.|Peptidase S54, rhomboid domain (1);	.|0.202877	.|0.43579	.|D	.|0.000542	T|T	0.08537|0.08537	0.0212|0.0212	N|N	0.12471|0.12471	0.22|0.22	0.41648|0.41648	D|D	0.989116|0.989116	.|B;B	.|0.12013	.|0.005;0.0	.|B;B	.|0.11329	.|0.006;0.001	T|T	0.26503|0.26503	-1.0101|-1.0101	5|10	.|0.16420	.|T	.|0.52	-14.7906|-14.7906	15.1375|15.1375	0.72579|0.72579	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|220;270	.|Q9H300-2;Q9H300	.|.;PARL_HUMAN	T|H	61;133|270;220;50;220	.|ENSP00000325421:Y270H;ENSP00000310676:Y220H;ENSP00000402689:Y50H;ENSP00000402137:Y220H	.|ENSP00000310676:Y220H	I|Y	-|-	2|1	0|0	PARL|PARL	185041072|185041072	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.953000|0.953000	0.61014|0.61014	5.259000|5.259000	0.65485|0.65485	2.042000|2.042000	0.60477|0.60477	0.460000|0.460000	0.39030|0.39030	ATA|TAT	.		0.279	PARL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346465.1	NM_018622	
WDR1	9948	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	10099338	10099338	+	Silent	SNP	A	A	G			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr4:10099338A>G	ENST00000499869.2	-	5	748	c.555T>C	c.(553-555)atT>atC	p.I185I	WDR1_ENST00000382452.2_Silent_p.I185I|WDR1_ENST00000382451.2_Intron|WDR1_ENST00000502702.1_Intron			O75083	WDR1_HUMAN	WD repeat domain 1	185			I -> V (in dbSNP:rs13441). {ECO:0000269|PubMed:15489334}.		blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|sensory perception of sound (GO:0007605)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)				endometrium(3)|lung(5)|ovary(2)|pancreas(1)|urinary_tract(1)	12				STAD - Stomach adenocarcinoma(129;0.000703)|Colorectal(103;0.0057)|LUSC - Lung squamous cell carcinoma(721;0.0232)		CACTTACGCCAATTGTGAACT	0.507																																					p.I185I		.											.	WDR1-48	0			c.T555C						.						62.0	66.0	65.0					4																	10099338		1963	4144	6107	SO:0001819	synonymous_variant	9948	exon5			TACGCCAATTGTG	AF020260	CCDS54739.1, CCDS54740.1	4p16.1	2013-01-09			ENSG00000071127	ENSG00000071127		"""WD repeat domain containing"""	12754	protein-coding gene	gene with protein product		604734				10036186	Standard	NM_017491		Approved		uc021xlv.1	O75083	OTTHUMG00000160253	ENST00000499869.2:c.555T>C	4.37:g.10099338A>G		Somatic	150	0		WXS	Illumina HiSeq	Phase_I	124	48	NM_017491	0	0	0	0	0	A8K6E9|A8MPU4|O75313|Q8N6E5|Q9UG05|Q9UG78|Q9UQE0	Silent	SNP	ENST00000499869.2	37	CCDS54740.1																																																																																			.		0.507	WDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359877.1		
FAM13A	10144	bcgsc.ca	37	4	89772288	89772288	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr4:89772288A>G	ENST00000264344.5	-	7	1097	c.890T>C	c.(889-891)cTg>cCg	p.L297P	FAM13A_ENST00000511976.1_Intron|FAM13A_ENST00000502459.1_5'UTR	NM_014883.3	NP_055698.2	O94988	FA13A_HUMAN	family with sequence similarity 13, member A	297					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	55						CTCTGGTTGCAGTACTCTGTG	0.448																																					p.L297P													.	FAM13A-70	0			c.T890C						.						120.0	125.0	123.0					4																	89772288		2203	4300	6503	SO:0001583	missense	10144	exon7			GGTTGCAGTACTC	AB020721	CCDS34029.1, CCDS43251.1, CCDS58911.1, CCDS58912.1, CCDS58913.1	4q22.1	2011-09-07	2009-01-20	2009-01-20	ENSG00000138640	ENSG00000138640		"""Rho GTPase activating proteins"""	19367	protein-coding gene	gene with protein product		613299	"""family with sequence similarity 13, member A1"""	FAM13A1			Standard	NM_014883		Approved	KIAA0914, ARHGAP48	uc003hse.2	O94988	OTTHUMG00000161006	ENST00000264344.5:c.890T>C	4.37:g.89772288A>G	ENSP00000264344:p.Leu297Pro	Somatic	60	0		WXS	Illumina HiSeq	Phase_1	70	4	NM_014883	0	0	0	0	0	B4DLC1|Q24JP0|Q5PR21|Q8NBA3	Missense_Mutation	SNP	ENST00000264344.5	37	CCDS34029.1	.	.	.	.	.	.	.	.	.	.	A	8.362	0.833254	0.16820	.	.	ENSG00000138640	ENST00000264344	T	0.19250	2.16	4.42	2.28	0.28536	.	0.539992	0.17335	N	0.177970	T	0.06325	0.0163	N	0.01352	-0.895	0.21184	N	0.999769	B	0.02656	0.0	B	0.01281	0.0	T	0.30031	-0.9992	10	0.37606	T	0.19	.	5.2731	0.15636	0.3336:0.0:0.6664:0.0	.	297	O94988	FA13A_HUMAN	P	297	ENSP00000264344:L297P	ENSP00000264344:L297P	L	-	2	0	FAM13A	89991311	0.961000	0.32948	0.011000	0.14972	0.284000	0.27059	1.335000	0.33839	0.561000	0.29186	-0.248000	0.11899	CTG	.		0.448	FAM13A-022	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363371.1		
ANK2	287	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	114277121	114277121	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr4:114277121C>A	ENST00000357077.4	+	38	7400	c.7347C>A	c.(7345-7347)caC>caA	p.H2449Q	ANK2_ENST00000394537.3_Intron|ANK2_ENST00000264366.6_Missense_Mutation_p.H2416Q|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000510275.2_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	2449					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		ACTCTTCACACAAAACCCCTG	0.502																																					p.H2449Q		.											.	ANK2-583	0			c.C7347A						.						75.0	74.0	74.0					4																	114277121		2203	4300	6503	SO:0001583	missense	287	exon38			TTCACACAAAACC	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.7347C>A	4.37:g.114277121C>A	ENSP00000349588:p.His2449Gln	Somatic	87	0		WXS	Illumina HiSeq	Phase_I	80	28	NM_001148	0	0	0	0	0	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	C	15.11	2.734944	0.48939	.	.	ENSG00000145362	ENST00000357077;ENST00000264366	T;T	0.70516	-0.48;-0.49	5.85	5.01	0.66863	.	0.000000	0.64402	D	0.000013	T	0.69015	0.3064	L	0.54323	1.7	0.80722	D	1	B;P	0.41848	0.144;0.763	B;P	0.44990	0.053;0.466	T	0.67665	-0.5612	9	.	.	.	.	11.2279	0.48895	0.0:0.8096:0.0:0.1904	.	2416;2449	Q01484;Q01484-4	ANK2_HUMAN;.	Q	2449;2416	ENSP00000349588:H2449Q;ENSP00000264366:H2416Q	.	H	+	3	2	ANK2	114496570	0.997000	0.39634	1.000000	0.80357	0.993000	0.82548	0.444000	0.21661	1.488000	0.48433	0.655000	0.94253	CAC	.		0.502	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
AHRR	57491	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	353963	353963	+	Silent	SNP	C	C	T			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr5:353963C>T	ENST00000505113.1	+	3	237	c.193C>T	c.(193-195)Ctg>Ttg	p.L65L	AHRR_ENST00000512529.1_Intron|AHRR_ENST00000316418.5_Silent_p.L65L|AHRR_ENST00000515206.1_Silent_p.L61L	NM_001242412.1	NP_001229341.1	A9YTQ3	AHRR_HUMAN	aryl-hydrocarbon receptor repressor	65	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of protein sumoylation (GO:0033235)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)	p.L61V(2)		breast(2)|endometrium(4)|large_intestine(1)|lung(12)|prostate(1)	20			Epithelial(17;0.0011)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00354)|Lung(60;0.0863)			CATCTCCAAGCTGGACAAGCT	0.592																																					p.L65L		.											.	AHRR-225	2	Substitution - Missense(2)	lung(2)	c.C193T						.						102.0	115.0	111.0					5																	353963		2130	4244	6374	SO:0001819	synonymous_variant	57491	exon3			TCCAAGCTGGACA	AB033060	CCDS43297.1, CCDS56355.1	5p15.33	2013-05-21	2003-09-11	2003-09-12	ENSG00000063438	ENSG00000063438		"""Basic helix-loop-helix proteins"""	346	protein-coding gene	gene with protein product		606517	"""aryl hydrocarbon receptor regulator"""	AHH, AHHR		1070014, 11423533	Standard	NM_020731		Approved	KIAA1234, bHLHe77	uc003jaw.3	A9YTQ3	OTTHUMG00000162171	ENST00000505113.1:c.193C>T	5.37:g.353963C>T		Somatic	147	0		WXS	Illumina HiSeq	Phase_I	193	67	NM_001242412	0	0	0	0	0	A7MBN5|D6RAZ1|Q9HAZ3|Q9ULI6	Silent	SNP	ENST00000505113.1	37	CCDS56355.1																																																																																			.		0.592	AHRR-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000367720.1	NM_020731	
TRAPPC13	80006	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	64956553	64956553	+	Nonsense_Mutation	SNP	T	T	G			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr5:64956553T>G	ENST00000399438.3	+	10	1071	c.726T>G	c.(724-726)taT>taG	p.Y242*	TRAPPC13_ENST00000438419.2_Nonsense_Mutation_p.Y242*|TRAPPC13_ENST00000505553.1_Nonsense_Mutation_p.Y236*|TRAPPC13_ENST00000231526.4_Nonsense_Mutation_p.Y236*|TRAPPC13_ENST00000545191.1_Nonsense_Mutation_p.Y243*	NM_001093755.1|NM_024941.3	NP_001087224.1|NP_079217.2	A5PLN9	TPC13_HUMAN	trafficking protein particle complex 13	242																	CAAGAGCATATTTGCAACCAA	0.408																																					p.Y242X													.	.	0			c.T726G						.						83.0	77.0	79.0					5																	64956553		1878	4116	5994	SO:0001587	stop_gained	80006	exon10			AGCATATTTGCAA		CCDS47221.1, CCDS47222.1, CCDS47223.1, CCDS58950.1	5q12.3	2013-01-31	2013-01-24	2013-01-24	ENSG00000113597	ENSG00000113597			25828	protein-coding gene	gene with protein product	"""Trs65-related"""		"""chromosome 5 open reading frame 44"""	C5orf44		12477932	Standard	NM_024941		Approved	FLJ13611, FLJ26957, MGC48585	uc010iwu.1	A5PLN9	OTTHUMG00000163649	ENST00000399438.3:c.726T>G	5.37:g.64956553T>G	ENSP00000382367:p.Tyr242*	Somatic	243	1		WXS	Illumina HiSeq	Phase_I	234	86	NM_001093755	0	0	5	8	3	Q17RZ9|Q49A23|Q4JHG0|Q6MZG4|Q8TCM2|Q9H8I3	Nonsense_Mutation	SNP	ENST00000399438.3	37	CCDS47222.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.200295	0.79015	.	.	ENSG00000113597	ENST00000399438;ENST00000438419;ENST00000231526;ENST00000505553;ENST00000545191	.	.	.	4.8	4.8	0.61643	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.6909	9.5899	0.39539	0.0:0.091:0.0:0.909	.	.	.	.	X	242;242;236;236;243	.	ENSP00000231526:Y236X	Y	+	3	2	C5orf44	64992309	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.129000	0.31381	1.913000	0.55393	0.379000	0.24179	TAT	.		0.408	TRAPPC13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000370113.1	NM_024941	
LIX1	167410	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	96443096	96443096	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr5:96443096C>A	ENST00000274382.4	-	3	650	c.355G>T	c.(355-357)Gaa>Taa	p.E119*	CTD-2215E18.1_ENST00000509481.1_Intron	NM_153234.4	NP_694966.3	Q8N485	LIX1_HUMAN	Lix1 homolog (chicken)	119										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(2)|ovary(1)	10		all_cancers(142;4.28e-07)|all_epithelial(76;1.06e-09)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0318)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.0733)		TGAACACTTTCCATAATGAAT	0.527																																					p.E119X		.											.	LIX1-92	0			c.G355T						.						109.0	102.0	105.0					5																	96443096		2203	4300	6503	SO:0001587	stop_gained	167410	exon3			CACTTTCCATAAT		CCDS4088.1	5q15	2008-03-06	2008-03-06	2005-02-07	ENSG00000145721	ENSG00000145721			18581	protein-coding gene	gene with protein product		610466	"""chromosome 5 open reading frame 11"", ""Lix1 homolog (mouse)"""	C5orf11		11731258	Standard	NM_153234		Approved		uc003kmy.4	Q8N485	OTTHUMG00000128720	ENST00000274382.4:c.355G>T	5.37:g.96443096C>A	ENSP00000274382:p.Glu119*	Somatic	131	0		WXS	Illumina HiSeq	Phase_I	137	38	NM_153234	0	0	3	5	2	A8K4R9|Q8N7I2	Nonsense_Mutation	SNP	ENST00000274382.4	37	CCDS4088.1	.	.	.	.	.	.	.	.	.	.	C	37	6.428078	0.97559	.	.	ENSG00000145721	ENST00000274382	.	.	.	6.17	6.17	0.99709	.	0.186655	0.64402	D	0.000018	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.9396	13.6552	0.62333	0.0:0.9294:0.0:0.0706	.	.	.	.	X	119	.	ENSP00000274382:E119X	E	-	1	0	LIX1	96468852	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.753000	0.38359	2.941000	0.99782	0.655000	0.94253	GAA	.		0.527	LIX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250625.1	NM_153234	
HIST1H2BN	8341	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	27806755	27806755	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr6:27806755G>A	ENST00000396980.3	+	1	316	c.316G>A	c.(316-318)Gag>Aag	p.E106K	HIST1H2AK_ENST00000330180.2_5'Flank|HIST1H2BN_ENST00000606613.1_Missense_Mutation_p.E106K	NM_003520.3	NP_003511.1	Q99877	H2B1N_HUMAN	histone cluster 1, H2bn	106					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(3)|lung(3)|prostate(1)	8						GCTGCCAGGGGAGCTGGCCAA	0.677																																					p.E106K		.											.	HIST1H2BN-68	0			c.G316A						.						57.0	61.0	60.0					6																	27806755		2203	4299	6502	SO:0001583	missense	8341	exon1			CCAGGGGAGCTGG	Z83336	CCDS4633.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000233822	ENSG00000233822		"""Histones / Replication-dependent"""	4749	protein-coding gene	gene with protein product		602801	"""H2B histone family, member D"", ""histone 1, H2bn"""	H2BFD		9439656, 12408966	Standard	NM_003520		Approved	H2B/d	uc003njv.3	Q99877	OTTHUMG00000016397	ENST00000396980.3:c.316G>A	6.37:g.27806755G>A	ENSP00000380177:p.Glu106Lys	Somatic	51	0		WXS	Illumina HiSeq	Phase_I	62	23	NM_003520	0	0	0	0	0	B2R5L4|Q494S8|Q96FB7	Missense_Mutation	SNP	ENST00000396980.3	37	CCDS4633.1	.	.	.	.	.	.	.	.	.	.	.	14.44	2.536027	0.45176	.	.	ENSG00000233822	ENST00000449538;ENST00000396980	T;T	0.78126	-1.15;-1.15	4.71	4.71	0.59529	Histone-fold (2);	0.000000	0.43747	U	0.000529	T	0.78710	0.4326	M	0.93106	3.38	0.37318	D	0.90942	B;B	0.28713	0.014;0.22	B;B	0.26202	0.009;0.067	D	0.83433	0.0039	10	0.87932	D	0	.	17.5855	0.87980	0.0:0.0:1.0:0.0	.	106;106	Q99877;B2R4S9	H2B1N_HUMAN;.	K	106	ENSP00000446031:E106K;ENSP00000380177:E106K	ENSP00000380177:E106K	E	+	1	0	HIST1H2BN	27914734	1.000000	0.71417	1.000000	0.80357	0.301000	0.27625	7.723000	0.84788	2.537000	0.85549	0.650000	0.86243	GAG	.		0.677	HIST1H2BN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043840.2	NM_003520	
PPP1R10	5514	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	30572781	30572781	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr6:30572781G>A	ENST00000376511.2	-	11	1496	c.944C>T	c.(943-945)aCg>aTg	p.T315M		NM_002714.3	NP_002705.2	Q96QC0	PP1RA_HUMAN	protein phosphatase 1, regulatory subunit 10	315	Interaction with TOX4. {ECO:0000250}.				protein import into nucleus (GO:0006606)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|nucleus (GO:0005634)|PTW/PP1 phosphatase complex (GO:0072357)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein phosphatase inhibitor activity (GO:0004864)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(3)|skin(1)	25						CTTGGCAGCCGTAGGTGACAG	0.468																																					p.T315M		.											.	PPP1R10-660	0			c.C944T						.						47.0	57.0	53.0					6																	30572781		1511	2709	4220	SO:0001583	missense	5514	exon11			GCAGCCGTAGGTG	Y13247	CCDS4681.1	6p21.3	2012-04-17	2011-10-04		ENSG00000204569	ENSG00000204569		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9284	protein-coding gene	gene with protein product	"""phosphatase 1 nuclear targeting subunit"", ""HLA-C associated transcript 53"""	603771	"""protein phosphatase 1, regulatory (inhibitor) subunit 10"""			9461602, 9784381	Standard	NM_002714		Approved	PNUTS, FB19, CAT53, p99	uc003nqn.2	Q96QC0	OTTHUMG00000031259	ENST00000376511.2:c.944C>T	6.37:g.30572781G>A	ENSP00000365694:p.Thr315Met	Somatic	73	0		WXS	Illumina HiSeq	Phase_I	89	29	NM_002714	0	0	3	4	1	O00405	Missense_Mutation	SNP	ENST00000376511.2	37	CCDS4681.1	.	.	.	.	.	.	.	.	.	.	G	16.30	3.084609	0.55861	.	.	ENSG00000204569	ENST00000376511	T	0.62498	0.02	5.06	5.06	0.68205	.	0.049773	0.85682	D	0.000000	T	0.61362	0.2341	N	0.19112	0.55	0.58432	D	0.999997	D	0.89917	1.0	D	0.83275	0.996	T	0.66799	-0.5832	10	0.56958	D	0.05	-10.3518	17.3696	0.87372	0.0:0.0:1.0:0.0	.	315	Q96QC0	PP1RA_HUMAN	M	315	ENSP00000365694:T315M	ENSP00000365694:T315M	T	-	2	0	PPP1R10	30680760	1.000000	0.71417	0.995000	0.50966	0.762000	0.43233	6.222000	0.72249	2.642000	0.89623	0.561000	0.74099	ACG	.		0.468	PPP1R10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076556.2	NM_002714	
UNC5CL	222643	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	6	40999454	40999454	+	Missense_Mutation	SNP	T	T	A	rs145811250	byFrequency	TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr6:40999454T>A	ENST00000373164.1	-	5	1145	c.1085A>T	c.(1084-1086)aAt>aTt	p.N362I	UNC5CL_ENST00000244565.3_Missense_Mutation_p.N362I|UNC5CL_ENST00000470102.1_Intron			Q8IV45	UN5CL_HUMAN	unc-5 homolog C (C. elegans)-like	362	Interaction with RELA and NFKB1.				positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of JNK cascade (GO:0046330)|proteolysis (GO:0006508)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	peptidase activity (GO:0008233)			endometrium(1)|kidney(3)|large_intestine(3)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	13	Ovarian(28;0.0418)|Colorectal(47;0.196)					AATGATCTCATTGGTTAGTGC	0.547																																					p.N362I		.											.	UNC5CL-92	0			c.A1085T						.						196.0	174.0	181.0					6																	40999454		2203	4300	6503	SO:0001583	missense	222643	exon6			ATCTCATTGGTTA	BC035284	CCDS4847.1	6p21.1	2013-10-15			ENSG00000124602	ENSG00000124602			21203	protein-coding gene	gene with protein product	"""ZU5 and death domain containing"""					14769797	Standard	NM_173561		Approved	MGC34763, ZUD	uc003opi.3	Q8IV45	OTTHUMG00000014665	ENST00000373164.1:c.1085A>T	6.37:g.40999454T>A	ENSP00000362258:p.Asn362Ile	Somatic	199	0		WXS	Illumina HiSeq	Phase_I	170	64	NM_173561	0	0	7	10	3	Q5TGU1	Missense_Mutation	SNP	ENST00000373164.1	37	CCDS4847.1	.	.	.	.	.	.	.	.	.	.	T	12.73	2.024767	0.35701	.	.	ENSG00000124602	ENST00000244565;ENST00000373164	T;T	0.14391	2.51;2.51	4.52	3.34	0.38264	.	0.124350	0.36482	N	0.002565	T	0.02649	0.0080	N	0.24115	0.695	0.37746	D	0.925799	B	0.11235	0.004	B	0.09377	0.004	T	0.35549	-0.9784	10	0.22109	T	0.4	-8.9542	6.7625	0.23548	0.0:0.1071:0.0:0.8929	.	362	Q8IV45	UN5CL_HUMAN	I	362	ENSP00000244565:N362I;ENSP00000362258:N362I	ENSP00000244565:N362I	N	-	2	0	UNC5CL	41107432	1.000000	0.71417	0.996000	0.52242	0.944000	0.59088	0.406000	0.21032	0.770000	0.33336	0.383000	0.25322	AAT	T|0.998;C|0.002		0.547	UNC5CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040491.1	NM_173561	
ACTB	60	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	5567473	5567473	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr7:5567473A>G	ENST00000331789.5	-	6	1225	c.1034T>C	c.(1033-1035)aTc>aCc	p.I345T	AC006483.1_ENST00000579427.1_RNA|ACTB_ENST00000464611.1_5'UTR	NM_001101.3	NP_001092.1	P63261	ACTG_HUMAN	actin, beta	345					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(2)|prostate(2)	8		Ovarian(82;0.0606)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)		CGAGGCCAGGATGGAGCCGCC	0.612																																					p.I345T		.											.	ACTB-226	0			c.T1034C						.						67.0	70.0	69.0					7																	5567473		2203	4300	6503	SO:0001583	missense	60	exon6			GCCAGGATGGAGC	M28424	CCDS5341.1	7p22	2014-09-17			ENSG00000075624	ENSG00000075624			132	protein-coding gene	gene with protein product		102630				1505215	Standard	NM_001101		Approved		uc003sot.4	P60709	OTTHUMG00000023268	ENST00000331789.5:c.1034T>C	7.37:g.5567473A>G	ENSP00000349960:p.Ile345Thr	Somatic	230	1		WXS	Illumina HiSeq	Phase_I	407	193	NM_001101	1	1	1389	2570	1178	A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Missense_Mutation	SNP	ENST00000331789.5	37	CCDS5341.1	.	.	.	.	.	.	.	.	.	.	A	16.84	3.232891	0.58777	.	.	ENSG00000075624	ENST00000331789;ENST00000445914;ENST00000400179;ENST00000320713	D	0.95788	-3.81	5.55	5.55	0.83447	.	0.000000	0.64402	D	0.000013	D	0.98535	0.9511	H	0.94886	3.595	0.53005	D	0.99996	P	0.40032	0.699	D	0.79108	0.992	D	0.99293	1.0899	10	0.87932	D	0	.	14.9227	0.70851	1.0:0.0:0.0:0.0	.	345	P60709	ACTB_HUMAN	T	345;321;317;264	ENSP00000349960:I345T	ENSP00000440549:I264T	I	-	2	0	ACTB	5533999	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	8.991000	0.93514	2.114000	0.64651	0.529000	0.55759	ATC	.		0.612	ACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059589.4	NM_001101	
AGK	55750	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	141352597	141352597	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr7:141352597G>C	ENST00000355413.4	+	16	1402	c.1142G>C	c.(1141-1143)gGc>gCc	p.G381A	AGK_ENST00000473247.1_Missense_Mutation_p.G353A|RP5-894A10.2_ENST00000467537.1_RNA	NM_018238.3	NP_060708.1	Q53H12	AGK_HUMAN	acylglycerol kinase	381					ceramide biosynthetic process (GO:0046513)|glycerolipid metabolic process (GO:0046486)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acylglycerol kinase activity (GO:0047620)|ATP binding (GO:0005524)|ceramide kinase activity (GO:0001729)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			breast(1)|endometrium(1)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(3)	17	Melanoma(164;0.0171)					GGAGCAGGGGGCTCTTTTAGC	0.502																																					p.G381A		.											.	AGK-290	0			c.G1142C						.						111.0	104.0	107.0					7																	141352597		2203	4300	6503	SO:0001583	missense	55750	exon16			CAGGGGGCTCTTT	BC022777	CCDS5865.1	7q34	2010-05-04	2007-01-11	2007-01-11	ENSG00000006530	ENSG00000006530	2.7.1.94		21869	protein-coding gene	gene with protein product		610345	"""multiple substrate lipid kinase"""	MULK		15252046, 15939762, 17135245	Standard	NM_018238		Approved	FLJ10842	uc003vwi.2	Q53H12	OTTHUMG00000157499	ENST00000355413.4:c.1142G>C	7.37:g.141352597G>C	ENSP00000347581:p.Gly381Ala	Somatic	102	0		WXS	Illumina HiSeq	Phase_I	189	89	NM_018238	0	0	5	13	8	Q75KN1|Q96GC3|Q9NP48	Missense_Mutation	SNP	ENST00000355413.4	37	CCDS5865.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.331077	0.81690	.	.	ENSG00000006530	ENST00000355413;ENST00000473247	T;T	0.12984	2.63;2.63	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.16428	0.0395	L	0.49126	1.545	0.80722	D	1	P	0.37663	0.604	B	0.32533	0.147	T	0.01848	-1.1261	10	0.72032	D	0.01	.	19.2669	0.93990	0.0:0.0:1.0:0.0	.	381	Q53H12	AGK_HUMAN	A	381;353	ENSP00000347581:G381A;ENSP00000420776:G353A	ENSP00000347581:G381A	G	+	2	0	AGK	140999066	1.000000	0.71417	0.986000	0.45419	0.515000	0.34225	8.920000	0.92779	2.549000	0.85964	0.655000	0.94253	GGC	.		0.502	AGK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348969.1	NM_018238	
NUGGC	389643	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	27913490	27913490	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr8:27913490T>G	ENST00000413272.2	-	10	1340	c.1198A>C	c.(1198-1200)Aaa>Caa	p.K400Q	NUGGC_ENST00000341513.6_Missense_Mutation_p.K400Q	NM_001010906.1	NP_001010906.1	Q68CJ6	SLIP_HUMAN	nuclear GTPase, germinal center associated	400					cellular response to DNA damage stimulus (GO:0006974)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)										ACCTTCAGTTTTTCCTTGAGA	0.373																																					p.K400Q		.											.	.	0			c.A1198C						.						94.0	88.0	89.0					8																	27913490		1840	4086	5926	SO:0001583	missense	389643	exon10			TCAGTTTTTCCTT	AB075870	CCDS47833.1	8p21.1	2012-06-07	2012-06-07	2012-06-07	ENSG00000189233	ENSG00000189233			33550	protein-coding gene	gene with protein product	"""speckled-like pattern in the germinal center"""		"""chromosome 8 open reading frame 80"""	C8orf80		19734146	Standard	NM_001010906		Approved	HMFN0672, SLIP-GC	uc003xgm.4	Q68CJ6	OTTHUMG00000155970	ENST00000413272.2:c.1198A>C	8.37:g.27913490T>G	ENSP00000408697:p.Lys400Gln	Somatic	62	0		WXS	Illumina HiSeq	Phase_I	37	13	NM_001010906	0	0	0	0	0	Q6ZP73	Missense_Mutation	SNP	ENST00000413272.2	37	CCDS47833.1	.	.	.	.	.	.	.	.	.	.	T	18.99	3.739734	0.69304	.	.	ENSG00000189233	ENST00000413272;ENST00000341513	T;T	0.15952	2.38;2.38	5.37	5.37	0.77165	.	0.192094	0.43919	D	0.000520	T	0.14485	0.0350	L	0.32530	0.975	0.37961	D	0.932984	P	0.47350	0.894	B	0.40444	0.329	T	0.05517	-1.0880	10	0.66056	D	0.02	-18.4502	11.7885	0.52055	0.0:0.0:0.0:1.0	.	400	Q68CJ6	SLIP_HUMAN	Q	400	ENSP00000408697:K400Q;ENSP00000345031:K400Q	ENSP00000345031:K400Q	K	-	1	0	C8orf80	27969409	0.999000	0.42202	0.999000	0.59377	0.985000	0.73830	2.663000	0.46774	2.030000	0.59900	0.455000	0.32223	AAA	.		0.373	NUGGC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000342494.1	NM_001010906	
NUGGC	389643	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	27913492	27913492	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr8:27913492T>C	ENST00000413272.2	-	10	1338	c.1196A>G	c.(1195-1197)gAa>gGa	p.E399G	NUGGC_ENST00000341513.6_Missense_Mutation_p.E399G	NM_001010906.1	NP_001010906.1	Q68CJ6	SLIP_HUMAN	nuclear GTPase, germinal center associated	399					cellular response to DNA damage stimulus (GO:0006974)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)										CTTCAGTTTTTCCTTGAGAAT	0.368																																					p.E399G		.											.	.	0			c.A1196G						.						93.0	87.0	88.0					8																	27913492		1839	4084	5923	SO:0001583	missense	389643	exon10			AGTTTTTCCTTGA	AB075870	CCDS47833.1	8p21.1	2012-06-07	2012-06-07	2012-06-07	ENSG00000189233	ENSG00000189233			33550	protein-coding gene	gene with protein product	"""speckled-like pattern in the germinal center"""		"""chromosome 8 open reading frame 80"""	C8orf80		19734146	Standard	NM_001010906		Approved	HMFN0672, SLIP-GC	uc003xgm.4	Q68CJ6	OTTHUMG00000155970	ENST00000413272.2:c.1196A>G	8.37:g.27913492T>C	ENSP00000408697:p.Glu399Gly	Somatic	62	0		WXS	Illumina HiSeq	Phase_I	36	13	NM_001010906	0	0	0	0	0	Q6ZP73	Missense_Mutation	SNP	ENST00000413272.2	37	CCDS47833.1	.	.	.	.	.	.	.	.	.	.	T	14.94	2.686312	0.47991	.	.	ENSG00000189233	ENST00000413272;ENST00000341513	T;T	0.17054	2.3;2.32	5.37	4.2	0.49525	.	0.367956	0.29205	N	0.012835	T	0.12178	0.0296	L	0.32530	0.975	0.35309	D	0.783741	B	0.32245	0.361	B	0.25140	0.058	T	0.14952	-1.0454	10	0.59425	D	0.04	-7.5105	9.3405	0.38076	0.0:0.0:0.1808:0.8192	.	399	Q68CJ6	SLIP_HUMAN	G	399	ENSP00000408697:E399G;ENSP00000345031:E399G	ENSP00000345031:E399G	E	-	2	0	C8orf80	27969411	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.756000	0.38390	0.851000	0.35264	0.455000	0.32223	GAA	.		0.368	NUGGC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000342494.1	NM_001010906	
ENPP2	5168	bcgsc.ca	37	8	120628549	120628549	+	Silent	SNP	G	G	T			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr8:120628549G>T	ENST00000075322.6	-	8	791	c.733C>A	c.(733-735)Cga>Aga	p.R245R	ENPP2_ENST00000259486.6_Silent_p.R245R|ENPP2_ENST00000522826.1_Silent_p.R245R|ENPP2_ENST00000427067.2_Silent_p.R241R	NM_001040092.2	NP_001035181.1	Q13822	ENPP2_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 2	245	Substrate binding. {ECO:0000250}.				cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylcholine catabolic process (GO:0034638)|phospholipid catabolic process (GO:0009395)|regulation of cell migration (GO:0030334)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alkylglycerophosphoethanolamine phosphodiesterase activity (GO:0047391)|calcium ion binding (GO:0005509)|hydrolase activity (GO:0016787)|lysophospholipase activity (GO:0004622)|nucleic acid binding (GO:0003676)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(30)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)	69	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			TCTCGCCCTCGCAGATGAAAA	0.373																																					p.R245R	Melanoma(20;305 879 2501 4818 31020)												.	ENPP2-292	0			c.C733A						.						123.0	110.0	114.0					8																	120628549		2203	4300	6503	SO:0001819	synonymous_variant	5168	exon8			GCCCTCGCAGATG	D45421	CCDS6329.1, CCDS34936.1, CCDS47914.1	8q24.12	2014-04-09	2008-08-01		ENSG00000136960	ENSG00000136960	3.1.4.1, 3.6.1.9		3357	protein-coding gene	gene with protein product	"""autotaxin"""	601060		PDNP2		8586446	Standard	NM_001040092		Approved	ATX, PD-IALPHA	uc003yos.2	Q13822	OTTHUMG00000164995	ENST00000075322.6:c.733C>A	8.37:g.120628549G>T		Somatic	42	0		WXS	Illumina HiSeq	Phase_1	57	4	NM_001130863	0	0	6	6	0	A8UHA1|E9PHP7|Q13827|Q14555|Q15117|Q9UCQ8|Q9UCR0|Q9UCR1|Q9UCR2|Q9UCR3|Q9UCR4	Silent	SNP	ENST00000075322.6	37	CCDS34936.1																																																																																			.		0.373	ENPP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000381390.1		
NUP188	23511	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	131735460	131735460	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr9:131735460A>G	ENST00000372577.2	+	12	1156	c.1135A>G	c.(1135-1137)Atg>Gtg	p.M379V		NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	379					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						CACTGCATGCATGTGTGTCTA	0.493																																					p.M379V		.											.	NUP188-207	0			c.A1135G						.						166.0	127.0	140.0					9																	131735460		2203	4300	6503	SO:0001583	missense	23511	exon12			GCATGCATGTGTG	D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.1135A>G	9.37:g.131735460A>G	ENSP00000361658:p.Met379Val	Somatic	66	0		WXS	Illumina HiSeq	Phase_I	57	16	NM_015354	0	0	0	2	2	Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Missense_Mutation	SNP	ENST00000372577.2	37	CCDS35156.1	.	.	.	.	.	.	.	.	.	.	A	11.66	1.706341	0.30232	.	.	ENSG00000095319	ENST00000356693;ENST00000372577	T	0.64618	-0.11	5.01	5.01	0.66863	.	0.175989	0.64402	D	0.000006	T	0.44623	0.1302	N	0.19112	0.55	0.40933	D	0.984408	B	0.11235	0.004	B	0.09377	0.004	T	0.39143	-0.9628	10	0.34782	T	0.22	0.8656	9.6632	0.39967	0.8449:0.0:0.0:0.1551	.	379	Q5SRE5	NU188_HUMAN	V	268;379	ENSP00000361658:M379V	ENSP00000349125:M268V	M	+	1	0	NUP188	130775281	1.000000	0.71417	1.000000	0.80357	0.729000	0.41735	3.448000	0.52943	2.014000	0.59158	0.451000	0.29950	ATG	.		0.493	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054529.2		
PNMA3	29944	broad.mit.edu	37	X	152226011	152226011	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chrX:152226011A>G	ENST00000370264.4	+	1	625	c.599A>G	c.(598-600)gAa>gGa	p.E200G	PNMA3_ENST00000370265.4_Missense_Mutation_p.E200G|PNMA3_ENST00000447306.1_Missense_Mutation_p.E200G			Q9UL41	PNMA3_HUMAN	paraneoplastic Ma antigen 3	200					positive regulation of apoptotic process (GO:0043065)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)	16	Acute lymphoblastic leukemia(192;6.56e-05)					cccgagggggaaaagaggcgg	0.587																																					p.E200G													.	PNMA3-600	0			c.A599G						.						65.0	64.0	64.0					X																	152226011		2203	4300	6503	SO:0001583	missense	29944	exon2			AGGGGGAAAAGAG	AF083116	CCDS35435.2, CCDS65344.1	Xq28	2012-02-09	2012-02-09		ENSG00000183837	ENSG00000183837		"""Paraneoplastic Ma antigens"""	18742	protein-coding gene	gene with protein product	"""paraneoplastic cancer-testis-brain antigen"""	300675	"""paraneoplastic antigen MA3"""			11558790	Standard	NM_013364		Approved	MA5, MA3, MGC132756, MGC132758	uc004fhc.2	Q9UL41	OTTHUMG00000024195	ENST00000370264.4:c.599A>G	X.37:g.152226011A>G	ENSP00000359286:p.Glu200Gly	Somatic	58	3		WXS	Illumina HiSeq	Phase_I	80	12	NM_013364	0	0	0	0	0	D3DWT7|Q9H0A4	Missense_Mutation	SNP	ENST00000370264.4	37	CCDS35435.2	.	.	.	.	.	.	.	.	.	.	a	13.68	2.310689	0.40895	.	.	ENSG00000183837	ENST00000370265;ENST00000447306;ENST00000370264	T;T;T	0.13538	2.58;2.58;2.58	1.98	1.98	0.26296	.	.	.	.	.	T	0.31827	0.0809	M	0.75447	2.3	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.04693	-1.0933	9	0.87932	D	0	.	5.4244	0.16417	1.0:0.0:0.0:0.0	.	200	Q9UL41	PNMA3_HUMAN	G	200	ENSP00000359288:E200G;ENSP00000407642:E200G;ENSP00000359286:E200G	ENSP00000359286:E200G	E	+	2	0	PNMA3	151976667	0.302000	0.24454	0.007000	0.13788	0.009000	0.06853	2.310000	0.43708	1.055000	0.40461	0.378000	0.23410	GAA	.		0.587	PNMA3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060946.2	NM_013364	
CFAP74	85452	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	1891408	1891409	+	IGR	DEL	GC	GC	-			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr1:1891408_1891409delGC								TMEM52 (40696 upstream) : C1orf222 (28153 downstream)																							CTCACCATCGGCTTGAAGGTGA	0.619											OREG0013001	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.585_586del		.											.	KIAA1751-69	0			c.1755_1756del						.																																			SO:0001628	intergenic_variant	85452	exon15			.																													1.37:g.1891408_1891409delGC		Somatic	259	0	599	WXS	Illumina HiSeq	Phase_I	214	77	NM_001080484	0	0	0	0	0		Frame_Shift_Del	DEL		37																																																																																				.	0	0.619								
UBR4	23352	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	19524166	19524172	+	Frame_Shift_Del	DEL	ATTACGA	ATTACGA	-	rs200068490		TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	ATTACGA	ATTACGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr1:19524166_19524172delATTACGA	ENST00000375254.3	-	7	912_918	c.885_891delTCGTAAT	c.(883-891)gttcgtaatfs	p.VRN295fs	UBR4_ENST00000375226.2_Frame_Shift_Del_p.VRN295fs|UBR4_ENST00000375267.2_Frame_Shift_Del_p.VRN295fs|UBR4_ENST00000375217.2_Frame_Shift_Del_p.VRN295fs	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	295					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CACCTTACCCATTACGAACAGCAGTGG	0.464																																					p.295_297del		.											.	UBR4-612	0			c.885_891del						.																																			SO:0001589	frameshift_variant	23352	exon7			.	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.885_891delTCGTAAT	1.37:g.19524166_19524172delATTACGA	ENSP00000364403:p.Val295fs	Somatic	100	0		WXS	Illumina HiSeq	Phase_I	77	28	NM_020765	0	0	0	0	0	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Frame_Shift_Del	DEL	ENST00000375254.3	37	CCDS189.1																																																																																			.		0.464	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
SPOCD1	90853	hgsc.bcm.edu	37	1	32266188	32266191	+	Frame_Shift_Del	DEL	CCAG	CCAG	-	rs369969025		TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	CCAG	CCAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr1:32266188_32266191delCCAG	ENST00000360482.2	-	4	1582_1585	c.1453_1456delCTGG	c.(1453-1458)ctggggfs	p.LG485fs	SPOCD1_ENST00000257100.3_5'UTR|SPOCD1_ENST00000533231.1_Frame_Shift_Del_p.LG485fs|SPOCD1_ENST00000373648.2_Intron	NM_144569.4	NP_653170.3	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1	485					negative regulation of phosphatase activity (GO:0010923)|transcription, DNA-templated (GO:0006351)					NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(1)|lung(7)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	37		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		CTGATGGCCCCCAGGAGCTGGATC	0.662																																					p.485_486del		.											.	SPOCD1-158	0			c.1453_1456del						.			0,4264		0,0,2132						5.0	1.0			16	1,8253		0,1,4126	no	frameshift	SPOCD1	NM_144569.4		0,1,6258	A1A1,A1R,RR		0.0121,0.0,0.0080				1,12517				SO:0001589	frameshift_variant	90853	exon4			.	AK058077	CCDS347.1, CCDS60066.1, CCDS72748.1	1p35.1	2014-06-13			ENSG00000134668	ENSG00000134668			26338	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 146"""					12477932	Standard	NM_144569		Approved	FLJ25348, PPP1R146	uc001bts.1	Q6ZMY3	OTTHUMG00000003879	ENST00000360482.2:c.1453_1456delCTGG	1.37:g.32266188_32266191delCCAG	ENSP00000353670:p.Leu485fs	Somatic	102	0		WXS	Illumina HiSeq	Phase_I	122	55	NM_144569	0	0	0	0	0	Q24JU3|Q6PI90|Q8N869|Q8N8U0|Q8NBC6|Q96LN6	Frame_Shift_Del	DEL	ENST00000360482.2	37	CCDS347.1																																																																																			.		0.662	SPOCD1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000381912.1	NM_144569	
FNDC7	163479	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	109265207	109265229	+	Splice_Site	DEL	GAAAACTGGTATGTAAACAAGAG	GAAAACTGGTATGTAAACAAGAG	-			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	GAAAACTGGTATGTAAACAAGAG	GAAAACTGGTATGTAAACAAGAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr1:109265207_109265229delGAAAACTGGTATGTAAACAAGAG	ENST00000370017.3	+	5	1126_1133	c.849_856delGAAAACTGGTATGTAAACAAGAG	c.(847-858)ctgaaaactggt>ctgt	p.KTG284fs	FNDC7_ENST00000271311.2_Splice_Site_p.KTG285fs	NM_001144937.1	NP_001138409.1	Q5VTL7	FNDC7_HUMAN	fibronectin type III domain containing 7	284	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.					extracellular region (GO:0005576)				breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|skin(4)|stomach(1)|urinary_tract(1)	20		all_lung(203;0.00439)|Lung NSC(277;0.00683)|all_epithelial(167;0.00728)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.173)|all cancers(265;0.244)		CAATGACCCTGAAAACTGGTATGTAAACAAGAGTGAGACTGCT	0.439																																					p.283_286del		.											.	FNDC7-92	0			c.849_856del						.																																			SO:0001630	splice_region_variant	163479	exon5			.		CCDS44185.1	1p13.3	2013-02-11			ENSG00000143107	ENSG00000143107		"""Fibronectin type III domain containing"""	26668	protein-coding gene	gene with protein product						12477932	Standard	NM_001144937		Approved	FLJ35838	uc001dvx.3	Q5VTL7	OTTHUMG00000011120	ENST00000370017.3:c.856+1GAAAACTGGTATGTAAACAAGAG>-	1.37:g.109265207_109265229delGAAAACTGGTATGTAAACAAGAG		Somatic	72	0		WXS	Illumina HiSeq	Phase_I	54	13	NM_001144937	0	0	0	0	0	A1L468|E9PAZ5|Q6PF16|Q8NA51	Frame_Shift_Del	DEL	ENST00000370017.3	37	CCDS44185.1																																																																																			.		0.439	FNDC7-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030589.4	NM_173532	Frame_Shift_Del
ANK3	288	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	61832051	61832054	+	Frame_Shift_Del	DEL	TTGT	TTGT	-	rs371964932		TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	TTGT	TTGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr10:61832051_61832054delTTGT	ENST00000280772.2	-	37	8776_8779	c.8585_8588delACAA	c.(8584-8589)aacaatfs	p.NN2862fs	ANK3_ENST00000373827.2_Intron|ANK3_ENST00000355288.2_Intron|ANK3_ENST00000503366.1_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	2862					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						CTGAGACTTATTGTTAGTGGCTCC	0.402																																					p.2862_2863del		.											.	ANK3-107	0			c.8585_8588del						.																																			SO:0001589	frameshift_variant	288	exon37			.	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.8585_8588delACAA	10.37:g.61832051_61832054delTTGT	ENSP00000280772:p.Asn2862fs	Somatic	129	0		WXS	Illumina HiSeq	Phase_I	85	13	NM_020987	0	0	0	0	0	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Frame_Shift_Del	DEL	ENST00000280772.2	37	CCDS7258.1																																																																																			.		0.402	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
ANK3	288	hgsc.bcm.edu	37	10	61832052	61832061	+	Frame_Shift_Del	DEL	TGTTAGTGGC	TGTTAGTGGC	-			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	TGTTAGTGGC	TGTTAGTGGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr10:61832052_61832061delTGTTAGTGGC	ENST00000280772.2	-	37	8769_8778	c.8578_8587delGCCACTAACA	c.(8578-8589)gccactaacaatfs	p.ATNN2860fs	ANK3_ENST00000373827.2_Intron|ANK3_ENST00000355288.2_Intron|ANK3_ENST00000503366.1_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	2860					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						TGAGACTTATTGTTAGTGGCTCCCGAACTC	0.41																																					p.2860_2863del		.											.	ANK3-107	0			c.8578_8587del						.																																			SO:0001589	frameshift_variant	288	exon37			.	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.8578_8587delGCCACTAACA	10.37:g.61832052_61832061delTGTTAGTGGC	ENSP00000280772:p.Ala2860fs	Somatic	130	0		WXS	Illumina HiSeq	Phase_I	87	18	NM_020987	0	0	0	0	0	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Frame_Shift_Del	DEL	ENST00000280772.2	37	CCDS7258.1																																																																																			.		0.410	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
ANK3	288	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	61832057	61832061	+	Frame_Shift_Del	DEL	GTGGC	GTGGC	-			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	GTGGC	GTGGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr10:61832057_61832061delGTGGC	ENST00000280772.2	-	37	8769_8773	c.8578_8582delGCCAC	c.(8578-8583)gccactfs	p.AT2860fs	ANK3_ENST00000373827.2_Intron|ANK3_ENST00000355288.2_Intron|ANK3_ENST00000503366.1_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	2860					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						CTTATTGTTAGTGGCTCCCGAACTC	0.415																																					p.2860_2861del		.											.	ANK3-107	0			c.8578_8582del						.																																			SO:0001589	frameshift_variant	288	exon37			.	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.8578_8582delGCCAC	10.37:g.61832057_61832061delGTGGC	ENSP00000280772:p.Ala2860fs	Somatic	128	0		WXS	Illumina HiSeq	Phase_I	78	13	NM_020987	0	0	0	0	0	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Frame_Shift_Del	DEL	ENST00000280772.2	37	CCDS7258.1																																																																																			.		0.415	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
MSS51	118490	hgsc.bcm.edu;bcgsc.ca	37	10	75185695	75185695	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr10:75185695delT	ENST00000372912.1	-	4	945	c.943delA	c.(943-945)actfs	p.T315fs	MSS51_ENST00000299432.2_Frame_Shift_Del_p.T315fs|AL353731.1_ENST00000584907.1_RNA			Q4VC12	MSS51_HUMAN	MSS51 mitochondrial translational activator	315					social behavior (GO:0035176)		metal ion binding (GO:0046872)										AGGGGTGAAGTTGAGGTGCTC	0.542																																					p.T315fs		.											.	.	0			c.943delA						.						85.0	75.0	78.0					10																	75185695		2203	4300	6503	SO:0001589	frameshift_variant	118490	exon5			.	AK096884	CCDS31221.1	10q22.3	2013-01-10	2013-01-10	2012-02-24	ENSG00000166343	ENSG00000166343		"""Zinc fingers, MYND-type"""	21000	protein-coding gene	gene with protein product		614773	"""zinc finger, MYND-type containing 17"", ""MSS51 mitochondrial translational activator homolog (S. cerevisiae)"""	ZMYND17		19710419	Standard	NM_001024593		Approved	FLJ39565	uc001jud.3	Q4VC12	OTTHUMG00000018464	ENST00000372912.1:c.943delA	10.37:g.75185695delT	ENSP00000362003:p.Thr315fs	Somatic	151	0		WXS	Illumina HiSeq	Phase_I	140	33	NM_001024593	0	0	0	0	0	A6NGH6|Q2VP95|Q5F2H5|Q7Z3M9|Q8N8G0	Frame_Shift_Del	DEL	ENST00000372912.1	37	CCDS31221.1																																																																																			.		0.542	MSS51-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048652.3	NM_178451	
ACSS1	84532	broad.mit.edu;bcgsc.ca	37	20	25028726	25028755	+	In_Frame_Del	DEL	GGTGATCCTCACTTCCGTTCCAGGCTCATC	GGTGATCCTCACTTCCGTTCCAGGCTCATC	-	rs144423103|rs191234596|rs559373176	byFrequency	TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	GGTGATCCTCACTTCCGTTCCAGGCTCATC	GGTGATCCTCACTTCCGTTCCAGGCTCATC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr20:25028726_25028755delGGTGATCCTCACTTCCGTTCCAGGCTCATC	ENST00000323482.4	-	2	476_505	c.397_426delGATGAGCCTGGAACGGAAGTGAGGATCACC	c.(397-426)gatgagcctggaacggaagtgaggatcaccdel	p.DEPGTEVRIT133del	ACSS1_ENST00000376726.3_In_Frame_Del_p.DEPGTEVRIT133del|ACSS1_ENST00000432802.2_In_Frame_Del_p.DEPGTEVRIT133del	NM_001252675.1|NM_032501.3	NP_001239604.1|NP_115890.2	Q9NUB1	ACS2L_HUMAN	acyl-CoA synthetase short-chain family member 1	133					acetate biosynthetic process (GO:0019413)|acetyl-CoA biosynthetic process (GO:0006085)|acetyl-CoA biosynthetic process from acetate (GO:0019427)|ethanol oxidation (GO:0006069)|propionate biosynthetic process (GO:0019542)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	mitochondrial matrix (GO:0005759)	acetate-CoA ligase activity (GO:0003987)|AMP binding (GO:0016208)|ATP binding (GO:0005524)	p.D133A(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	26					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	AGTACCTGTAGGTGATCCTCACTTCCGTTCCAGGCTCATCGCGCTCCCAG	0.574																																					p.133_142del													.	ACSS1-92	1	Substitution - Missense(1)	lung(1)	c.397_426del						.																																			SO:0001651	inframe_deletion	84532	exon2			CCTGTAGGTGATC		CCDS13167.1, CCDS58764.1, CCDS58765.1	20p11.23-p11.21	2012-07-13	2005-09-08	2005-09-08	ENSG00000154930	ENSG00000154930	6.2.1.1	"""Acyl-CoA synthetase family"""	16091	protein-coding gene	gene with protein product		614355	"""acetyl-Coenzyme A synthetase 2 (AMP forming)-like"""	ACAS2L			Standard	NM_032501		Approved	dJ568C11.3, AceCS2L, MGC33843	uc002wub.3	Q9NUB1	OTTHUMG00000032112	ENST00000323482.4:c.397_426delGATGAGCCTGGAACGGAAGTGAGGATCACC	20.37:g.25028726_25028755delGGTGATCCTCACTTCCGTTCCAGGCTCATC	ENSP00000316924:p.Asp133_Thr142del	Somatic	112	0		WXS	Illumina HiSeq	Phase_I	67	7	NM_001252677	0	0	0	0	0	B3KXL2|B4DJZ3|D3DW48|F5H6F4|F8W7Y1|Q5TF42|Q8IV99|Q8N234|Q96JI1|Q96JX6|Q9NU28	In_Frame_Del	DEL	ENST00000323482.4	37	CCDS13167.1																																																																																			.		0.574	ACSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078386.2	NM_032501	
UBA6	55236	hgsc.bcm.edu	37	4	68536261	68536261	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr4:68536261delA	ENST00000322244.5	-	8	655	c.596delT	c.(595-597)ttcfs	p.F199fs	UBA6_ENST00000420827.2_Frame_Shift_Del_p.F199fs	NM_018227.5	NP_060697.4	A0AVT1	UBA6_HUMAN	ubiquitin-like modifier activating enzyme 6	199					protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|FAT10 activating enzyme activity (GO:0019780)|ligase activity (GO:0016874)			central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(6)|liver(1)|lung(23)|skin(2)|upper_aerodigestive_tract(2)	44						TTCATCACCGAAATCACAAAA	0.269																																					p.F199fs		.											.	UBA6-90	0			c.596delT						.						91.0	94.0	93.0					4																	68536261		2203	4294	6497	SO:0001589	frameshift_variant	55236	exon8			.	AK094164	CCDS3516.1	4q13.2	2008-02-05	2007-11-30	2007-11-30	ENSG00000033178	ENSG00000033178		"""Ubiquitin-like modifier activating enzymes"""	25581	protein-coding gene	gene with protein product	"""UBA6, ubiquitin-activating enzyme E1"""	611361	"""ubiquitin-activating enzyme E1-like 2"""	UBE1L2		17580310	Standard	NM_018227		Approved	FLJ10808	uc003hdg.4	A0AVT1	OTTHUMG00000129299	ENST00000322244.5:c.596delT	4.37:g.68536261delA	ENSP00000313454:p.Phe199fs	Somatic	106	0		WXS	Illumina HiSeq	Phase_I	96	21	NM_018227	0	0	0	0	0	A6N8M7|B2RAV3|Q4W5K0|Q6UV21|Q86T78|Q86TC7|Q8N5T3|Q8N9E4|Q9H3T7|Q9NVC9	Frame_Shift_Del	DEL	ENST00000322244.5	37	CCDS3516.1																																																																																			.		0.269	UBA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251429.2	NM_018227	
UBA6	55236	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	68536260	68536261	+	Frame_Shift_Ins	INS	-	-	T	rs140398587		TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr4:68536260_68536261insT	ENST00000322244.5	-	8	655_656	c.596_597insA	c.(595-597)ttcfs	p.F199fs	UBA6_ENST00000420827.2_Frame_Shift_Ins_p.F199fs	NM_018227.5	NP_060697.4	A0AVT1	UBA6_HUMAN	ubiquitin-like modifier activating enzyme 6	199					protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|FAT10 activating enzyme activity (GO:0019780)|ligase activity (GO:0016874)			central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(6)|liver(1)|lung(23)|skin(2)|upper_aerodigestive_tract(2)	44						ATTCATCACCGAAATCACAAAA	0.267																																					p.F199fs		.											.	UBA6-90	0			c.597_598insA						.																																			SO:0001589	frameshift_variant	55236	exon8			.	AK094164	CCDS3516.1	4q13.2	2008-02-05	2007-11-30	2007-11-30	ENSG00000033178	ENSG00000033178		"""Ubiquitin-like modifier activating enzymes"""	25581	protein-coding gene	gene with protein product	"""UBA6, ubiquitin-activating enzyme E1"""	611361	"""ubiquitin-activating enzyme E1-like 2"""	UBE1L2		17580310	Standard	NM_018227		Approved	FLJ10808	uc003hdg.4	A0AVT1	OTTHUMG00000129299	ENST00000322244.5:c.596_597insA	4.37:g.68536260_68536261insT	ENSP00000313454:p.Phe199fs	Somatic	106	0		WXS	Illumina HiSeq	Phase_I	96	23	NM_018227	0	0	0	0	0	A6N8M7|B2RAV3|Q4W5K0|Q6UV21|Q86T78|Q86TC7|Q8N5T3|Q8N9E4|Q9H3T7|Q9NVC9	Frame_Shift_Ins	INS	ENST00000322244.5	37	CCDS3516.1																																																																																			.		0.267	UBA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251429.2	NM_018227	
UBA6	55236	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	68536261	68536262	+	Frame_Shift_Ins	INS	-	-	TT			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr4:68536261_68536262insTT	ENST00000322244.5	-	8	654_655	c.595_596insAA	c.(595-597)ttcfs	p.F199fs	UBA6_ENST00000420827.2_Frame_Shift_Ins_p.F199fs	NM_018227.5	NP_060697.4	A0AVT1	UBA6_HUMAN	ubiquitin-like modifier activating enzyme 6	199					protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|FAT10 activating enzyme activity (GO:0019780)|ligase activity (GO:0016874)			central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(6)|liver(1)|lung(23)|skin(2)|upper_aerodigestive_tract(2)	44						TTCATCACCGAAATCACAAAAT	0.272																																					p.F199_G200delinsX		.											.	UBA6-90	0			c.596_597insAA						.																																			SO:0001589	frameshift_variant	55236	exon8			.	AK094164	CCDS3516.1	4q13.2	2008-02-05	2007-11-30	2007-11-30	ENSG00000033178	ENSG00000033178		"""Ubiquitin-like modifier activating enzymes"""	25581	protein-coding gene	gene with protein product	"""UBA6, ubiquitin-activating enzyme E1"""	611361	"""ubiquitin-activating enzyme E1-like 2"""	UBE1L2		17580310	Standard	NM_018227		Approved	FLJ10808	uc003hdg.4	A0AVT1	OTTHUMG00000129299	ENST00000322244.5:c.595_596insAA	4.37:g.68536261_68536262insTT	ENSP00000313454:p.Phe199fs	Somatic	104	0		WXS	Illumina HiSeq	Phase_I	96	23	NM_018227	0	0	0	0	0	A6N8M7|B2RAV3|Q4W5K0|Q6UV21|Q86T78|Q86TC7|Q8N5T3|Q8N9E4|Q9H3T7|Q9NVC9	Nonsense_Mutation	INS	ENST00000322244.5	37	CCDS3516.1																																																																																			.		0.272	UBA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251429.2	NM_018227	
CCDC113	29070	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	58292369	58292370	+	Missense_Mutation	DNP	GG	GG	CT			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr16:58292369_58292370GG>CT	ENST00000219299.4	+	4	567_568	c.488_489GG>CT	c.(487-489)gGG>gCT	p.G163A	CCDC113_ENST00000443128.2_Missense_Mutation_p.G109A	NM_014157.3	NP_054876.2	Q9H0I3	CC113_HUMAN	coiled-coil domain containing 113	163						cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)				large_intestine(4)|lung(6)|ovary(1)|urinary_tract(1)	12						AAGAAGAAAGGGAGTATTTTGG	0.416																																					p.G163A		.											.	CCDC113-90	0			c.G327T						.																																			SO:0001583	missense	29070	exon3			GAAAGGGAGTATT	AL136785	CCDS10795.1, CCDS45497.1	16q21	2008-02-05			ENSG00000103021	ENSG00000103021			25002	protein-coding gene	gene with protein product						11230166, 11042152	Standard	NM_014157		Approved	HSPC065, DKFZp434N1418	uc002ene.3	Q9H0I3	OTTHUMG00000133489	Exception_encountered	16.37:g.58292369_58292370delinsCT	ENSP00000219299:p.Gly163Ala	Somatic	138.0	0.0		WXS	Illumina HiSeq	Phase_I	128.0	53.0	NM_001142302	0	0	0	0	0	B2RAQ7|B4DR20|Q9NZX2	Missense_Mutation	DNP	ENST00000219299.4	37	CCDS10795.1																																																																																			.		0.416	CCDC113-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257387.2	NM_014157	
TIMM17B	10245	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	48751030	48751031	+	Missense_Mutation	DNP	GC	GC	CT			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chrX:48751030_48751031GC>CT	ENST00000376582.3	-	7	648_649	c.500_501GC>AG	c.(499-501)aGC>aAG	p.S167K	TIMM17B_ENST00000465150.2_Missense_Mutation_p.S217K|TIMM17B_ENST00000396779.3_Missense_Mutation_p.S217K|TIMM17B_ENST00000472645.1_5'UTR|TIMM17B_ENST00000495490.2_Missense_Mutation_p.S187K	NM_005834.3	NP_005825.1	O60830	TI17B_HUMAN	translocase of inner mitochondrial membrane 17 homolog B (yeast)	167					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial inner membrane presequence translocase complex (GO:0005744)	P-P-bond-hydrolysis-driven protein transmembrane transporter activity (GO:0015450)			kidney(1)|large_intestine(1)|lung(3)|ovary(1)	6						ACTGCTGATAGCTGGGGTAGCC	0.629																																					p.S217K		.											.	TIMM17B-131	0			c.G650A						.																																			SO:0001583	missense	10245	exon8			TGATAGCTGGGGT	AF034790	CCDS14308.1, CCDS55411.1	Xp11.23	2008-02-05			ENSG00000126768	ENSG00000126768			17310	protein-coding gene	gene with protein product		300249				10339406	Standard	NM_001167947		Approved	DXS9822, JM3	uc004dla.2	O60830	OTTHUMG00000034498	ENST00000376582.3:c.500_501delinsCT	X.37:g.48751030_48751031delinsCT	ENSP00000365766:p.Ser167Lys	Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	29.0	NM_001167947	0	0	0	0	0	A8K2E2|J3KPV3|Q9UJV0	Missense_Mutation	DNP	ENST00000376582.3	37	CCDS14308.1																																																																																			.		0.629	TIMM17B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083411.2	NM_005834	
METTL8	79828	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	172195861	172195862	+	Missense_Mutation	DNP	GA	GA	AG			TCGA-A4-A4ZT-01A-11D-A26P-10	TCGA-A4-A4ZT-10A-01D-A26P-10	GA	GA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	483bb781-0179-42e1-bf9c-487b240769b8	3c59a740-98eb-4a0d-8694-ac30ab89b553	g.chr2:172195861_172195862GA>AG	ENST00000375258.4	-	4	653_654	c.438_439TC>CT	c.(436-441)tgTCct>tgCTct	p.P147S		NM_024770.3	NP_079046.2	Q9H825	METL8_HUMAN	methyltransferase like 8	147						cytoplasm (GO:0005737)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)	11						GGCACAGTAGGACAGTGCATTC	0.366																																					p.P147S													.	METTL8-91	0			.						.																																			SO:0001583	missense	79828	.			AGTAGGACAGTGC	AK024046	CCDS2242.1, CCDS2242.2	2q31.1	2012-06-12			ENSG00000123600	ENSG00000123600			25856	protein-coding gene	gene with protein product	"""tension-induced/inhibited protein"""	609525				15992539	Standard	NM_024770		Approved	FLJ13984, TIP	uc010zdo.2	Q9H825	OTTHUMG00000132261	ENST00000375258.4:c.438_439delinsAG	2.37:g.172195861_172195862delinsAG	ENSP00000364407:p.Pro147Ser	Somatic	64	0		WXS	Illumina HiSeq	Phase_I	98	22	.	0	0	0	0	0	Q53TM9|Q53TQ0	Missense_Mutation	DNP	ENST00000375258.4	37																																																																																				.		0.366	METTL8-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000255345.3	NM_024770	
