#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PRKCZ	5590	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	2066777	2066777	+	5'UTR	SNP	C	C	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr1:2066777C>T	ENST00000400921.2	+	0	545				PRKCZ_ENST00000400920.1_5'UTR	NM_001033581.1	NP_001028753.1	Q05513	KPCZ_HUMAN	protein kinase C, zeta						actin cytoskeleton reorganization (GO:0031532)|activation of phospholipase D activity (GO:0031584)|activation of protein kinase B activity (GO:0032148)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|inflammatory response (GO:0006954)|insulin receptor signaling pathway (GO:0008286)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|membrane hyperpolarization (GO:0060081)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of apoptotic process (GO:0043066)|negative regulation of hydrolase activity (GO:0051346)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of protein complex assembly (GO:0031333)|neuron projection extension (GO:1990138)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glucose import (GO:0046326)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of interleukin-10 secretion (GO:2001181)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T-helper 2 cell cytokine production (GO:2000553)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|protein heterooligomerization (GO:0051291)|protein kinase C signaling (GO:0070528)|protein localization to plasma membrane (GO:0072659)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vesicle transport along microtubule (GO:0047496)	apical cortex (GO:0045179)|apical plasma membrane (GO:0016324)|axon hillock (GO:0043203)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|myelin sheath abaxonal region (GO:0035748)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)	ATP binding (GO:0005524)|insulin receptor substrate binding (GO:0043560)|potassium channel regulator activity (GO:0015459)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(4)|endometrium(1)|large_intestine(5)|lung(5)|stomach(1)	18	all_cancers(77;0.000177)|all_epithelial(69;6.41e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.96e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.3e-23)|GBM - Glioblastoma multiforme(42;2.85e-08)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00294)|BRCA - Breast invasive adenocarcinoma(365;0.00493)|STAD - Stomach adenocarcinoma(132;0.00669)|KIRC - Kidney renal clear cell carcinoma(229;0.0411)|Lung(427;0.213)	Tamoxifen(DB00675)	AAGCCAAGCGCTTTAACAGGG	0.552																																					p.R137R		.											.	PRKCZ-1465	0			c.C411T						.						48.0	48.0	48.0					1																	2066777		2203	4300	6503	SO:0001623	5_prime_UTR_variant	5590	exon5			CAAGCGCTTTAAC	BC014270	CCDS37.1, CCDS41229.1, CCDS55563.1	1p36.33-p36.2	2009-07-10			ENSG00000067606	ENSG00000067606	2.7.11.1		9412	protein-coding gene	gene with protein product		176982					Standard	NM_001242874		Approved	PKC2	uc001aiq.3	Q05513	OTTHUMG00000001238	ENST00000400921.2:c.-139C>T	1.37:g.2066777C>T		Somatic	41	0		WXS	Illumina HiSeq	Phase_I	32	18	NM_002744	0	0	0	0	0	A8K4N0|A8MU64|B7Z2J7|E9PCW2|Q15207|Q5SYT5|Q969S4	Silent	SNP	ENST00000400921.2	37	CCDS41229.1																																																																																			.		0.552	PRKCZ-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000098533.3	NM_002744	
LRRC8C	84230	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	90180077	90180077	+	Missense_Mutation	SNP	A	A	G	rs113075842		TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr1:90180077A>G	ENST00000370454.4	+	3	2203	c.1948A>G	c.(1948-1950)Acc>Gcc	p.T650A	RP11-302M6.4_ENST00000370453.5_Intron|LRRC8C_ENST00000479252.1_Intron	NM_032270.4	NP_115646	Q8TDW0	LRC8C_HUMAN	leucine rich repeat containing 8 family, member C	650					fat cell differentiation (GO:0045444)|ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	28		all_lung(203;0.126)		all cancers(265;0.00756)|Epithelial(280;0.0313)		TAACAGCATCACCTACATCCC	0.418																																					p.T650A													.	LRRC8C-97	0			c.A1948G						.						60.0	56.0	57.0					1																	90180077		2203	4300	6503	SO:0001583	missense	84230	exon3			AGCATCACCTACA		CCDS725.1	1p22.2	2011-02-10			ENSG00000171488	ENSG00000171488			25075	protein-coding gene	gene with protein product	"""hypothetical protein AD158"""	612889				11230166	Standard	NM_032270		Approved	AD158	uc001dnl.4	Q8TDW0	OTTHUMG00000010305	ENST00000370454.4:c.1948A>G	1.37:g.90180077A>G	ENSP00000359483:p.Thr650Ala	Somatic	115	2		WXS	Illumina HiSeq	Phase_I	118	37	NM_032270	0	0	0	0	0	B3KXS9|Q29RV6|Q9H075	Missense_Mutation	SNP	ENST00000370454.4	37	CCDS725.1	.	.	.	.	.	.	.	.	.	.	A	0.055	-1.238065	0.01493	.	.	ENSG00000171488	ENST00000370454	T	0.27104	1.69	5.86	-1.34	0.09143	.	0.278989	0.45126	N	0.000389	T	0.03739	0.0106	L	0.38175	1.15	0.32260	N	0.57027	B	0.06786	0.001	B	0.11329	0.006	T	0.44003	-0.9356	10	0.02654	T	1	.	5.6923	0.17837	0.5841:0.0:0.302:0.1139	.	650	Q8TDW0	LRC8C_HUMAN	A	650	ENSP00000359483:T650A	ENSP00000359483:T650A	T	+	1	0	LRRC8C	89952665	1.000000	0.71417	0.987000	0.45799	0.979000	0.70002	1.267000	0.33050	-0.390000	0.07774	0.528000	0.53228	ACC	A|0.500;G|0.500		0.418	LRRC8C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028435.2	NM_032270	
ZNF644	84146	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	91403569	91403569	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr1:91403569G>T	ENST00000370440.1	-	4	3378	c.3161C>A	c.(3160-3162)tCa>tAa	p.S1054*	ZNF644_ENST00000361321.5_Intron|ZNF644_ENST00000467231.1_Intron|ZNF644_ENST00000337393.5_Nonsense_Mutation_p.S1054*|ZNF644_ENST00000347275.5_Intron			Q9H582	ZN644_HUMAN	zinc finger protein 644	1054					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|large_intestine(10)|lung(21)|ovary(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	47		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		AACATGATTTGATAATCCAAT	0.363																																					p.S1054X		.											.	ZNF644-155	0			c.C3161A						.						81.0	80.0	81.0					1																	91403569		2203	4300	6503	SO:0001587	stop_gained	84146	exon4			TGATTTGATAATC	AB033047	CCDS731.1, CCDS732.1	1p22.2	2008-02-05			ENSG00000122482	ENSG00000122482			29222	protein-coding gene	gene with protein product		614159				10574462	Standard	NM_032186		Approved	KIAA1221, BM-005, MGC60165, MGC70410	uc001dnw.3	Q9H582	OTTHUMG00000010078	ENST00000370440.1:c.3161C>A	1.37:g.91403569G>T	ENSP00000359469:p.Ser1054*	Somatic	38	0		WXS	Illumina HiSeq	Phase_I	37	16	NM_201269	0	0	4	5	1	A2RU71|Q2TAM0|Q5TCC0|Q6BEP7|Q6P446|Q6PI06|Q7LG67|Q9ULJ9	Nonsense_Mutation	SNP	ENST00000370440.1	37	CCDS731.1	.	.	.	.	.	.	.	.	.	.	G	41	9.121790	0.99073	.	.	ENSG00000122482	ENST00000370440;ENST00000337393;ENST00000536941	.	.	.	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.694	20.1634	0.98142	0.0:0.0:1.0:0.0	.	.	.	.	X	1054;1054;626	.	ENSP00000337008:S1054X	S	-	2	0	ZNF644	91176157	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.294000	0.96088	2.773000	0.95371	0.655000	0.94253	TCA	.		0.363	ZNF644-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027846.2	NM_032186	
ADORA3	140	broad.mit.edu	37	1	112026372	112026372	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr1:112026372G>T	ENST00000369716.4	-	6	1114	c.981C>A	c.(979-981)aaC>aaA	p.N327K	ADORA3_ENST00000369717.4_Missense_Mutation_p.N246K	NM_020683.6	NP_065734.5	P33765	AA3R_HUMAN	adenosine A3 receptor	0					activation of adenylate cyclase activity (GO:0007190)|histamine secretion by mast cell (GO:0002553)|inflammatory response (GO:0006954)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of mucus secretion (GO:0070257)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of heart contraction (GO:0008016)|response to wounding (GO:0009611)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	G-protein coupled adenosine receptor activity (GO:0001609)			NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|skin(1)	12		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)		all cancers(265;0.0185)|Colorectal(144;0.0186)|Lung(183;0.0238)|COAD - Colon adenocarcinoma(174;0.0644)|Epithelial(280;0.0872)|LUSC - Lung squamous cell carcinoma(189;0.134)	Adenosine(DB00640)|Aminophylline(DB01223)|Enprofylline(DB00824)	GCTTCAAAGTGTTGCCTACTT	0.418																																					p.N327K													.	ADORA3-156	0			c.C981A						.						79.0	72.0	74.0					1																	112026372		2203	4300	6503	SO:0001583	missense	140	exon6			CAAAGTGTTGCCT	BC029831	CCDS838.1, CCDS839.1, CCDS41369.1	1p13.2	2014-09-17			ENSG00000121933	ENSG00000121933		"""GPCR / Class A : Adenosine receptors"", ""Immunoglobulin superfamily / V-set domain containing"""	268	protein-coding gene	gene with protein product		600445				7607699	Standard	NM_020683		Approved	AD026	uc001ebf.3	P33765	OTTHUMG00000011957	ENST00000369716.4:c.981C>A	1.37:g.112026372G>T	ENSP00000358730:p.Asn327Lys	Somatic	96	0		WXS	Illumina HiSeq	Phase_I	110	5	NM_020683	0	0	1	1	0	A2A3P4|Q6UWU0|Q9BYZ1	Missense_Mutation	SNP	ENST00000369716.4	37	CCDS838.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.003|0.003	-2.506372|-2.506372	0.00155|0.00155	.|.	.|.	ENSG00000121933|ENSG00000121933	ENST00000369717;ENST00000369716;ENST00000355437;ENST00000443498|ENST00000414219	T;T|.	0.52526|.	2.44;0.66|.	4.6|4.6	2.62|2.62	0.31277|0.31277	.|.	0.961032|.	0.08574|.	N|.	0.925613|.	T|T	0.05318|0.05318	0.0141|0.0141	N|N	0.02916|0.02916	-0.46|-0.46	0.09310|0.09310	N|N	0.999998|0.999998	B;B|.	0.16396|.	0.017;0.001|.	B;B|.	0.15052|.	0.012;0.003|.	T|T	0.41342|0.41342	-0.9514|-0.9514	10|5	0.35671|.	T|.	0.21|.	-3.9086|-3.9086	11.1339|11.1339	0.48362|0.48362	0.0:0.3595:0.6405:0.0|0.0:0.3595:0.6405:0.0	.|.	246;327|.	Q5QNY7;P33765-2|.	.;.|.	K|K	246;327;158;152|187	ENSP00000358731:N246K;ENSP00000358730:N327K|.	ENSP00000347612:N158K|.	N|T	-|-	3|2	2|0	ADORA3|ADORA3	111827895|111827895	0.003000|0.003000	0.15002|0.15002	0.002000|0.002000	0.10522|0.10522	0.088000|0.088000	0.18126|0.18126	0.073000|0.073000	0.14640|0.14640	0.595000|0.595000	0.29777|0.29777	0.655000|0.655000	0.94253|0.94253	AAC|ACA	.		0.418	ADORA3-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000157679.1	NM_000677, NM_020683	
SUSD4	55061	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	223536686	223536686	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr1:223536686T>C	ENST00000343846.3	-	1	715	c.82A>G	c.(82-84)Aga>Gga	p.R28G	SUSD4_ENST00000494793.2_Missense_Mutation_p.R28G|SUSD4_ENST00000366877.3_Missense_Mutation_p.R28G|SUSD4_ENST00000454695.2_5'UTR|SUSD4_ENST00000344029.6_Missense_Mutation_p.R28G|SUSD4_ENST00000484758.2_Missense_Mutation_p.R28G|SUSD4_ENST00000366878.4_Missense_Mutation_p.R28G|SUSD4_ENST00000478605.1_5'UTR			Q5VX71	SUSD4_HUMAN	sushi domain containing 4	28						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|skin(1)	17				GBM - Glioblastoma multiforme(131;0.0611)		GCCAAGAGTCTCTGGGGGGAC	0.597																																					p.R28G		.											.	SUSD4-68	0			c.A82G						.						32.0	32.0	32.0					1																	223536686		2202	4299	6501	SO:0001583	missense	55061	exon2			AGAGTCTCTGGGG	AK096265	CCDS31034.1, CCDS41471.1	1q41	2008-05-14			ENSG00000143502	ENSG00000143502			25470	protein-coding gene	gene with protein product		615827				12477932	Standard	NM_017982		Approved	FLJ10052	uc001hny.4	Q5VX71	OTTHUMG00000037936	ENST00000343846.3:c.82A>G	1.37:g.223536686T>C	ENSP00000344219:p.Arg28Gly	Somatic	142	0		WXS	Illumina HiSeq	Phase_I	132	44	NM_017982	0	0	0	0	0	D3DTB9|Q6UX62|Q9BSR0|Q9NWG0	Missense_Mutation	SNP	ENST00000343846.3	37	CCDS41471.1	.	.	.	.	.	.	.	.	.	.	T	18.90	3.722459	0.68959	.	.	ENSG00000143502	ENST00000343846;ENST00000366878;ENST00000542750;ENST00000271787;ENST00000344029;ENST00000342943;ENST00000366877	T;T;T	0.38560	1.18;1.18;1.13	4.86	4.86	0.63082	.	0.000000	0.46758	D	0.000278	T	0.43322	0.1242	N	0.14661	0.345	0.31376	N	0.679575	D;D;D	0.63880	0.987;0.992;0.993	D;D;P	0.71656	0.942;0.974;0.787	T	0.50939	-0.8768	10	0.66056	D	0.02	-11.375	8.8024	0.34916	0.0:0.0:0.1902:0.8098	.	28;28;28	B7Z369;Q5VX71-3;Q5VX71	.;.;SUSD4_HUMAN	G	28	ENSP00000344219:R28G;ENSP00000355843:R28G;ENSP00000339926:R28G	ENSP00000271787:R28G	R	-	1	2	SUSD4	221603309	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	3.992000	0.56980	1.800000	0.52685	0.459000	0.35465	AGA	.		0.597	SUSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092592.2	NM_017982	
SNAP47	116841	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	227935595	227935595	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr1:227935595T>A	ENST00000366759.4	+	2	707	c.293T>A	c.(292-294)aTa>aAa	p.I98K	SNAP47-AS1_ENST00000413347.2_RNA|SNAP47_ENST00000366760.1_Intron|SNAP47_ENST00000315781.5_Missense_Mutation_p.I98K	NM_053052.3	NP_444280.2	Q5SQN1	SNP47_HUMAN	synaptosomal-associated protein, 47kDa	98					long-term synaptic potentiation (GO:0060291)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)				endometrium(1)|large_intestine(5)|liver(2)|lung(6)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	17						CTCTCCAGCATAGTTGAGATC	0.532																																					p.I98K													.	SNAP47-91	0			c.T293A						.						58.0	57.0	57.0					1																	227935595		2203	4300	6503	SO:0001583	missense	116841	exon2			CCAGCATAGTTGA	AY090635	CCDS1562.1	1q42.13	2013-10-11	2008-10-27	2008-10-27	ENSG00000143740	ENSG00000143740			30669	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 142"""	C1orf142		16621800	Standard	NM_053052		Approved	SVAP1, SNAP-47	uc001hrf.2	Q5SQN1	OTTHUMG00000037697	ENST00000366759.4:c.293T>A	1.37:g.227935595T>A	ENSP00000355721:p.Ile98Lys	Somatic	98	1		WXS	Illumina HiSeq	Phase_I	86	37	NM_053052	0	0	10	19	9	B6EDE0|Q5HYB5|Q5TBZ3|Q8N558|Q8TB31|Q8TCW8|Q8WV46|Q96CQ3|Q96FE1|Q96I66|Q96NU3|Q9BT10|Q9BVB2	Missense_Mutation	SNP	ENST00000366759.4	37	CCDS1562.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.94|14.94	2.684882|2.684882	0.47991|0.47991	.|.	.|.	ENSG00000143740|ENSG00000143740	ENST00000426344|ENST00000366759;ENST00000315781	.|T;T	.|0.22539	.|1.95;1.95	4.08|4.08	4.08|4.08	0.47627|0.47627	.|.	.|0.111196	.|0.64402	.|D	.|0.000014	T|T	0.43144|0.43144	0.1234|0.1234	M|M	0.77616|0.77616	2.38|2.38	0.42430|0.42430	D|D	0.99267|0.99267	.|D;D	.|0.67145	.|0.989;0.996	.|P;D	.|0.65010	.|0.885;0.931	T|T	0.47086|0.47086	-0.9144|-0.9144	5|10	.|0.87932	.|D	.|0	-1.6503|-1.6503	11.0526|11.0526	0.47898|0.47898	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|98;98	.|Q5SQN1;Q5SQN1-2	.|SNP47_HUMAN;.	Q|K	89|98	.|ENSP00000355721:I98K;ENSP00000314157:I98K	.|ENSP00000314157:I98K	H|I	+|+	3|2	2|0	SNAP47|SNAP47	226002218|226002218	0.999000|0.999000	0.42202|0.42202	0.004000|0.004000	0.12327|0.12327	0.004000|0.004000	0.04260|0.04260	7.222000|7.222000	0.78025|0.78025	1.716000|1.716000	0.51395|0.51395	0.482000|0.482000	0.46254|0.46254	CAT|ATA	.		0.532	SNAP47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091961.1	NM_053052	
ARHGAP22	58504	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	49659052	49659052	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr10:49659052C>G	ENST00000249601.4	-	9	1416	c.1120G>C	c.(1120-1122)Gag>Cag	p.E374Q	ARHGAP22_ENST00000435790.2_Missense_Mutation_p.E380Q|ARHGAP22_ENST00000374170.1_Missense_Mutation_p.E215Q|ARHGAP22_ENST00000374172.1_Missense_Mutation_p.E265Q|ARHGAP22_ENST00000417247.2_Missense_Mutation_p.E284Q|ARHGAP22_ENST00000477708.2_Missense_Mutation_p.E207Q|ARHGAP22_ENST00000417912.2_Missense_Mutation_p.E390Q	NM_001256024.1|NM_021226.3	NP_001242953.1|NP_067049.2	Q7Z5H3	RHG22_HUMAN	Rho GTPase activating protein 22	374					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			endometrium(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CTGGTGACCTCCTCGGAGCCC	0.731																																					p.E390Q		.											.	ARHGAP22-228	0			c.G1168C						.						8.0	9.0	9.0					10																	49659052		2008	4065	6073	SO:0001583	missense	58504	exon9			TGACCTCCTCGGA	AY324801	CCDS7227.1, CCDS58079.1, CCDS58080.1, CCDS58081.1	10q11.23	2013-01-10			ENSG00000128805	ENSG00000128805		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	30320	protein-coding gene	gene with protein product		610585				8619474	Standard	NM_021226		Approved	RhoGAP2	uc010qgm.3	Q7Z5H3	OTTHUMG00000018176	ENST00000249601.4:c.1120G>C	10.37:g.49659052C>G	ENSP00000249601:p.Glu374Gln	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	60	25	NM_001256024	0	0	2	2	0	A0AVP7|A5YM75|B4DED8|B9EGA0|C9JDM2|O00152|Q6ZSB0	Missense_Mutation	SNP	ENST00000249601.4	37	CCDS7227.1	.	.	.	.	.	.	.	.	.	.	C	18.24	3.580505	0.65992	.	.	ENSG00000128805	ENST00000249601;ENST00000374172;ENST00000374170;ENST00000477708;ENST00000417247;ENST00000435790;ENST00000417912	T;T;T;T;T;T;T	0.37915	2.7;2.36;1.17;1.51;2.34;2.66;2.7	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.62196	0.2408	M	0.81942	2.565	0.50039	D	0.999846	P;D;D;D;D;D	0.89917	0.621;1.0;0.972;1.0;0.959;1.0	B;D;P;D;P;D	0.74348	0.326;0.972;0.742;0.959;0.882;0.983	T	0.66352	-0.5945	10	0.59425	D	0.04	.	15.8862	0.79251	0.0:1.0:0.0:0.0	.	380;374;390;374;284;207	B4DED8;A6NDI7;Q7Z5H3-2;Q7Z5H3;Q7Z5H3-3;D6R9V6	.;.;.;RHG22_HUMAN;.;.	Q	374;265;215;207;284;380;390	ENSP00000249601:E374Q;ENSP00000363287:E265Q;ENSP00000363285:E215Q;ENSP00000422868:E207Q;ENSP00000410054:E284Q;ENSP00000416701:E380Q;ENSP00000412461:E390Q	ENSP00000249601:E374Q	E	-	1	0	ARHGAP22	49329058	1.000000	0.71417	0.573000	0.28510	0.349000	0.29174	6.759000	0.74934	2.440000	0.82611	0.313000	0.20887	GAG	.		0.731	ARHGAP22-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000358767.1	NM_021226	
DNA2	1763	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	70209856	70209856	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr10:70209856T>C	ENST00000358410.3	-	6	918	c.868A>G	c.(868-870)Aca>Gca	p.T290A	DNA2_ENST00000399179.2_Missense_Mutation_p.T290A|DNA2_ENST00000399180.2_Missense_Mutation_p.T376A	NM_001080449.2	NP_001073918.2	P51530	DNA2_HUMAN	DNA replication helicase/nuclease 2	290	Nuclease activity. {ECO:0000250}.				ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication, Okazaki fragment processing (GO:0033567)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|mitochondrial DNA repair (GO:0043504)|mitochondrial DNA replication (GO:0006264)|mitotic cell cycle (GO:0000278)|positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	mitochondrial nucleoid (GO:0042645)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|5'-flap endonuclease activity (GO:0017108)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|nuclease activity (GO:0004518)|single-stranded DNA-dependent ATPase activity (GO:0043142)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)	20						TTGTATTTTGTTTTATACCCT	0.343																																					p.T290A													.	.	0			c.A868G						.						92.0	81.0	84.0					10																	70209856		1824	4080	5904	SO:0001583	missense	1763	exon6			ATTTTGTTTTATA	D42046	CCDS44415.1, CCDS44415.2	10q21.3-q22.1	2013-05-13	2013-05-13	2008-01-08	ENSG00000138346	ENSG00000138346			2939	protein-coding gene	gene with protein product		601810	"""DNA2 DNA replication helicase 2-like (yeast)"", ""DNA replication helicase 2 homolog (yeast)"""	DNA2L		8938459, 17032657, 23352259	Standard	NM_001080449		Approved	KIAA0083	uc031pvh.1	P51530	OTTHUMG00000018352	ENST00000358410.3:c.868A>G	10.37:g.70209856T>C	ENSP00000351185:p.Thr290Ala	Somatic	97	1		WXS	Illumina HiSeq	Phase_I	87	37	NM_001080449	0	0	0	0	0	Q2NKM1|Q5TC49|Q5TC50|Q6P455|Q6PI80|Q7Z6H9|Q8N346	Missense_Mutation	SNP	ENST00000358410.3	37		.	.	.	.	.	.	.	.	.	.	T	3.741	-0.053473	0.07362	.	.	ENSG00000138346	ENST00000551118;ENST00000399180;ENST00000399179;ENST00000358410	D;D;D	0.93859	-2.79;-3.3;-2.78	5.1	0.0178	0.14113	.	0.664334	0.14826	N	0.296148	D	0.83096	0.5180	N	0.16790	0.44	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.002	T	0.67929	-0.5543	10	0.17369	T	0.5	.	6.2667	0.20930	0.1275:0.4247:0.0:0.4477	.	290;290	F8VR31;P51530	.;DNA2L_HUMAN	A	290;376;290;290	ENSP00000382133:T376A;ENSP00000382132:T290A;ENSP00000351185:T290A	ENSP00000351185:T290A	T	-	1	0	DNA2	69879862	0.024000	0.19004	0.024000	0.17045	0.954000	0.61252	0.114000	0.15520	0.021000	0.15133	0.533000	0.62120	ACA	.		0.343	DNA2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000048334.2		
ZNF408	79797	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	46726233	46726233	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr11:46726233A>C	ENST00000311764.2	+	5	1213	c.983A>C	c.(982-984)cAg>cCg	p.Q328P		NM_001184751.1|NM_024741.2	NP_001171680.1|NP_079017.1	Q9H9D4	ZN408_HUMAN	zinc finger protein 408	328					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CCTGGAGCCCAGCAGTCTGGC	0.647																																					p.Q328P	Pancreas(79;698 1390 6545 18745 34127)|Esophageal Squamous(120;1014 1625 12837 24601 49525)												.	ZNF408-90	0			c.A983C						.						66.0	63.0	64.0					11																	46726233		2201	4299	6500	SO:0001583	missense	79797	exon5			GAGCCCAGCAGTC	AF346626	CCDS7923.1	11p11.2	2008-02-05			ENSG00000175213	ENSG00000175213		"""Zinc fingers, C2H2-type"""	20041	protein-coding gene	gene with protein product						15231747	Standard	NM_024741		Approved	FLJ12827	uc010rgw.2	Q9H9D4	OTTHUMG00000166568	ENST00000311764.2:c.983A>C	11.37:g.46726233A>C	ENSP00000309606:p.Gln328Pro	Somatic	56	1		WXS	Illumina HiSeq	Phase_I	49	17	NM_024741	0	0	5	12	7		Missense_Mutation	SNP	ENST00000311764.2	37	CCDS7923.1	.	.	.	.	.	.	.	.	.	.	A	13.66	2.304535	0.40795	.	.	ENSG00000175213	ENST00000311764	T	0.11385	2.78	5.7	0.326	0.15908	.	0.378186	0.19372	N	0.115863	T	0.05640	0.0148	L	0.34521	1.04	0.09310	N	1	B;B	0.31485	0.325;0.325	B;B	0.19391	0.025;0.025	T	0.30621	-0.9972	10	0.56958	D	0.05	-6.3858	1.7903	0.03050	0.3665:0.1419:0.0796:0.412	.	320;328	B4DXY4;Q9H9D4	.;ZN408_HUMAN	P	328	ENSP00000309606:Q328P	ENSP00000309606:Q328P	Q	+	2	0	ZNF408	46682809	0.001000	0.12720	0.076000	0.20297	0.071000	0.16799	0.395000	0.20850	0.372000	0.24591	0.383000	0.25322	CAG	.		0.647	ZNF408-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390485.2	NM_024741	
PPP1CA	5499	ucsc.edu;bcgsc.ca	37	11	67168351	67168351	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr11:67168351A>C	ENST00000376745.4	-	3	375	c.227T>G	c.(226-228)tTt>tGt	p.F76C	PPP1CA_ENST00000312989.7_Missense_Mutation_p.F87C|PPP1CA_ENST00000532446.1_5'UTR|PPP1CA_ENST00000358239.4_Missense_Mutation_p.F32C	NM_001008709.1|NM_002708.3	NP_001008709.1|NP_002699.1	P62136	PP1A_HUMAN	protein phosphatase 1, catalytic subunit, alpha isozyme	76					branching morphogenesis of an epithelial tube (GO:0048754)|cell cycle (GO:0007049)|cell division (GO:0051301)|circadian regulation of gene expression (GO:0032922)|entrainment of circadian clock by photoperiod (GO:0043153)|glycogen metabolic process (GO:0005977)|lung development (GO:0030324)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein dephosphorylation (GO:0006470)|regulation of circadian rhythm (GO:0042752)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of glycogen catabolic process (GO:0005981)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)|triglyceride catabolic process (GO:0019433)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|MLL5-L complex (GO:0070688)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein phosphatase type 1 complex (GO:0000164)|PTW/PP1 phosphatase complex (GO:0072357)	metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)|protein serine/threonine phosphatase activity (GO:0004722)|ribonucleoprotein complex binding (GO:0043021)			breast(1)|lung(2)|pancreas(1)|urinary_tract(3)	7			BRCA - Breast invasive adenocarcinoma(15;8.53e-07)			GCCATACTCAAATAGTCGCAG	0.572																																					p.F87C													.	PPP1CA-659	0			c.T260G						.						103.0	100.0	101.0					11																	67168351		2200	4295	6495	SO:0001583	missense	5499	exon3			TACTCAAATAGTC		CCDS8160.1, CCDS8161.1, CCDS31618.1	11q13	2013-01-18	2010-03-05			ENSG00000172531	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9281	protein-coding gene	gene with protein product		176875	"""protein phosphatase 1, catalytic subunit, alpha isoform"""	PPP1A			Standard	NM_002708		Approved	PP1A, PP-1A, PP1alpha	uc001oku.1	P62136		ENST00000376745.4:c.227T>G	11.37:g.67168351A>C	ENSP00000365936:p.Phe76Cys	Somatic	109	2		WXS	Illumina HiSeq		76	22	NM_001008709	0	0	117	214	97	A6NNR3|B2R908|P08129|P20653|P22802|Q07161	Missense_Mutation	SNP	ENST00000376745.4	37	CCDS8160.1	.	.	.	.	.	.	.	.	.	.	A	17.50	3.406139	0.62288	.	.	ENSG00000172531	ENST00000312989;ENST00000451458;ENST00000376745;ENST00000358239;ENST00000527663;ENST00000546202;ENST00000542876	D;D;D;D;T;T	0.93076	-3.16;-3.16;-3.16;-3.16;3.2;3.2	5.08	5.08	0.68730	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (2);Metallophosphoesterase domain (1);	0.118294	0.56097	D	0.000028	D	0.98406	0.9470	H	0.99859	4.855	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.986;1.0;1.0	D;D;D;P;D;D	0.97110	1.0;1.0;0.999;0.865;0.999;0.998	D	0.99044	1.0825	10	0.87932	D	0	.	13.8572	0.63534	1.0:0.0:0.0:0.0	.	173;173;76;32;87;85	B3KXM2;E9PDP1;P62136;A6NNR3;Q07161;F8W0W8	.;.;PP1A_HUMAN;.;.;.	C	87;173;76;32;76;161;173	ENSP00000326031:F87C;ENSP00000365936:F76C;ENSP00000350974:F32C;ENSP00000431146:F76C;ENSP00000439568:F161C;ENSP00000438409:F173C	ENSP00000326031:F87C	F	-	2	0	PPP1CA	66924927	1.000000	0.71417	0.057000	0.19452	0.078000	0.17371	9.311000	0.96282	1.903000	0.55091	0.460000	0.39030	TTT	.		0.572	PPP1CA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395487.1	NM_002708	
CAPN5	726	broad.mit.edu	37	11	76823693	76823693	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr11:76823693G>A	ENST00000278559.3	+	4	545	c.356G>A	c.(355-357)gGc>gAc	p.G119D	CAPN5_ENST00000456580.2_Missense_Mutation_p.G159D|CAPN5_ENST00000531028.1_Intron|CAPN5_ENST00000529629.1_Missense_Mutation_p.G119D	NM_004055.4	NP_004046.2	O15484	CAN5_HUMAN	calpain 5	119	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(1)|breast(2)|endometrium(2)|large_intestine(7)|lung(17)|urinary_tract(1)	30						GCCTACGCGGGCATCTTCCAC	0.607																																					p.G119D													.	CAPN5-90	0			c.G356A						.						115.0	95.0	102.0					11																	76823693		2200	4292	6492	SO:0001583	missense	726	exon4			ACGCGGGCATCTT		CCDS8248.1	11q14	2014-01-29				ENSG00000149260			1482	protein-coding gene	gene with protein product		602537	"""vitreoretinopathy, neovascular inflammatory"""	VRNI		9503024, 9367857, 23055945	Standard	NM_004055		Approved	nCL-3, HTRA3, ADNIV	uc001oxx.3	O15484		ENST00000278559.3:c.356G>A	11.37:g.76823693G>A	ENSP00000278559:p.Gly119Asp	Somatic	98	0		WXS	Illumina HiSeq	Phase_I	74	4	NM_004055	0	0	39	39	0	O00263	Missense_Mutation	SNP	ENST00000278559.3	37	CCDS8248.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.854437	0.91355	.	.	ENSG00000149260	ENST00000278559;ENST00000530987;ENST00000360841;ENST00000529629;ENST00000456580;ENST00000544318	T;T;T	0.58797	0.31;0.31;0.31	4.16	4.16	0.48862	Peptidase C2, calpain, catalytic domain (3);	0.056550	0.64402	D	0.000001	D	0.85860	0.5795	H	0.99347	4.525	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.92129	0.5710	10	0.87932	D	0	.	15.6119	0.76727	0.0:0.0:1.0:0.0	.	157;159;159;119	Q59GM2;E7EV01;Q6ZRM8;O15484	.;.;.;CAN5_HUMAN	D	119;88;159;119;159;159	ENSP00000278559:G119D;ENSP00000432332:G119D;ENSP00000409996:G159D	ENSP00000278559:G119D	G	+	2	0	CAPN5	76501341	1.000000	0.71417	0.972000	0.41901	0.978000	0.69477	9.543000	0.98089	2.139000	0.66308	0.561000	0.74099	GGC	.		0.607	CAPN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382564.2	NM_004055	
MAML2	84441	broad.mit.edu	37	11	95825221	95825221	+	Silent	SNP	C	C	T	rs571656416	byFrequency	TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr11:95825221C>T	ENST00000524717.1	-	2	3258	c.1974G>A	c.(1972-1974)caG>caA	p.Q658Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	658					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgctgctgctgttgttgct	0.527			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid								C|||	4	0.000798722	0.0015	0.0	5008	,	,		17889	0.002		0.0	False		,,,				2504	0.0				p.Q658Q				Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	.	MAML2-850	0			c.G1974A						.																																			SO:0001819	synonymous_variant	84441	exon2			CTGCTGCTGTTGT	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1974G>A	11.37:g.95825221C>T		Somatic	59	1		WXS	Illumina HiSeq	Phase_I	54	3	NM_032427	0	0	7	7	0	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																			.		0.527	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
GRIA4	2893	bcgsc.ca	37	11	105623882	105623882	+	Silent	SNP	A	A	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr11:105623882A>T	ENST00000530497.1	+	3	423	c.423A>T	c.(421-423)gcA>gcT	p.A141A	GRIA4_ENST00000282499.5_Silent_p.A141A|GRIA4_ENST00000428631.2_Silent_p.A141A|GRIA4_ENST00000525187.1_Silent_p.A141A|GRIA4_ENST00000393127.2_Silent_p.A141A|GRIA4_ENST00000393125.2_Silent_p.A141A			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	141					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		TACGAGGAGCACTCTTGAGTT	0.468																																					p.A141A													.	GRIA4-230	0			c.A423T						.						168.0	140.0	149.0					11																	105623882		2202	4299	6501	SO:0001819	synonymous_variant	2893	exon4			AGGAGCACTCTTG	U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.423A>T	11.37:g.105623882A>T		Somatic	123	3		WXS	Illumina HiSeq	Phase_1	132	39	NM_001077244	0	0	0	0	0	Q86XE8	Silent	SNP	ENST00000530497.1	37	CCDS8333.1																																																																																			.		0.468	GRIA4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388593.1		
DDN	23109	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	49390815	49390815	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr12:49390815A>T	ENST00000421952.2	-	2	1865	c.1844T>A	c.(1843-1845)gTg>gAg	p.V615E	RP11-386G11.5_ENST00000547866.1_RNA|RP11-386G11.3_ENST00000549516.1_RNA|RP11-386G11.5_ENST00000552284.1_RNA|RP11-386G11.5_ENST00000552933.1_RNA|RP11-386G11.5_ENST00000547395.1_RNA	NM_015086.1	NP_055901.2	O94850	DEND_HUMAN	dendrin	615	Interaction with CD2AP and NPHS1. {ECO:0000250}.					cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|stomach(1)	8						GATACGGGACACGGCTTCTCG	0.721																																					p.V615E		.											.	DDN-90	0			c.T1844A						.						5.0	5.0	5.0					12																	49390815		2080	4038	6118	SO:0001583	missense	23109	exon2			CGGGACACGGCTT	AB018292	CCDS31791.2	12q13	2008-02-05			ENSG00000181418	ENSG00000181418			24458	protein-coding gene	gene with protein product		610588					Standard	NM_015086		Approved	KIAA0749	uc001rsv.1	O94850	OTTHUMG00000156183	ENST00000421952.2:c.1844T>A	12.37:g.49390815A>T	ENSP00000390590:p.Val615Glu	Somatic	25	0		WXS	Illumina HiSeq	Phase_I	28	13	NM_015086	0	0	0	0	0		Missense_Mutation	SNP	ENST00000421952.2	37	CCDS31791.2	.	.	.	.	.	.	.	.	.	.	A	24.9	4.581706	0.86748	.	.	ENSG00000181418	ENST00000421952	T	0.58940	0.3	4.12	4.12	0.48240	.	0.000000	0.41396	D	0.000887	T	0.63462	0.2513	L	0.32530	0.975	0.43936	D	0.99659	D	0.76494	0.999	D	0.71656	0.974	T	0.66783	-0.5836	10	0.87932	D	0	-0.1503	11.4668	0.50243	1.0:0.0:0.0:0.0	.	615	O94850	DEND_HUMAN	E	615	ENSP00000390590:V615E	ENSP00000390590:V615E	V	-	2	0	DDN	47677082	0.983000	0.35010	1.000000	0.80357	0.979000	0.70002	1.446000	0.35090	2.105000	0.64084	0.459000	0.35465	GTG	.		0.721	DDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343335.1		
LRIG3	121227	broad.mit.edu	37	12	59274493	59274493	+	Silent	SNP	G	G	A	rs566187872		TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr12:59274493G>A	ENST00000320743.3	-	13	1957	c.1671C>T	c.(1669-1671)ggC>ggT	p.G557G	LRIG3_ENST00000379141.4_Silent_p.G497G	NM_153377.4	NP_700356.2	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like domains 3	557	Ig-like C2-type 1.				otolith morphogenesis (GO:0032474)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)			LRIG3/ROS1(2)	breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(12)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48			GBM - Glioblastoma multiforme(1;1.17e-18)			CCATCACCTCGCCACCTTGGG	0.483			T	ROS1	NSCLC								G|||	1	0.000199681	0.0	0.0	5008	,	,		20461	0.0		0.0	False		,,,				2504	0.001				p.G557G				Dom	yes		12	12q14.1	121227	leucine-rich repeats and immunoglobulin-like domains 3		E	.	LRIG3-229	0			c.C1671T						.						123.0	104.0	111.0					12																	59274493		2203	4300	6503	SO:0001819	synonymous_variant	121227	exon13			CACCTCGCCACCT	AY505340	CCDS8960.1, CCDS44933.1	12q13.2	2013-01-11				ENSG00000139263		"""Immunoglobulin superfamily / I-set domain containing"""	30991	protein-coding gene	gene with protein product		608870					Standard	NM_153377		Approved	FLJ90440, KIAA3016	uc001sqr.4	Q6UXM1	OTTHUMG00000169940	ENST00000320743.3:c.1671C>T	12.37:g.59274493G>A		Somatic	103	0		WXS	Illumina HiSeq	Phase_I	159	4	NM_153377	0	0	6	6	0	Q6UXL7|Q8NC72	Silent	SNP	ENST00000320743.3	37	CCDS8960.1																																																																																			.		0.483	LRIG3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406623.1	NM_153377	
LYZ	4069	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	69743944	69743944	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr12:69743944G>T	ENST00000261267.2	+	2	261	c.193G>T	c.(193-195)Gct>Tct	p.A65S	LYZ_ENST00000549690.1_Missense_Mutation_p.A65S|LYZ_ENST00000548839.1_Missense_Mutation_p.A65S	NM_000239.2	NP_000230.1	P61626	LYSC_HUMAN	lysozyme	65					cell wall macromolecule catabolic process (GO:0016998)|cytolysis (GO:0019835)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|retina homeostasis (GO:0001895)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|lysozyme activity (GO:0003796)			endometrium(2)|lung(1)|upper_aerodigestive_tract(1)	4	all_epithelial(5;2.98e-35)|Lung NSC(4;9.93e-33)|all_lung(4;5.66e-31)|Breast(13;2.56e-06)|Esophageal squamous(21;0.187)		Epithelial(6;8.26e-19)|BRCA - Breast invasive adenocarcinoma(5;8.5e-10)|Lung(24;9.68e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00503)|OV - Ovarian serous cystadenocarcinoma(12;0.00691)|LUSC - Lung squamous cell carcinoma(43;0.24)|Kidney(9;0.241)		L-Aspartic Acid(DB00128)	AAACTACAATGCTGGAGACAG	0.408																																					p.A65S													.	LYZ-226	0			c.G193T						.						142.0	126.0	131.0					12																	69743944		2203	4300	6503	SO:0001583	missense	4069	exon2			TACAATGCTGGAG	X14008	CCDS8989.1	12q15	2014-09-17	2010-04-29			ENSG00000090382	3.2.1.17		6740	protein-coding gene	gene with protein product	"""renal amyloidosis"""	153450	"""lysozyme (renal amyloidosis)"""			8464497, 2546758	Standard	NM_000239		Approved		uc001suw.2	P61626	OTTHUMG00000169342	ENST00000261267.2:c.193G>T	12.37:g.69743944G>T	ENSP00000261267:p.Ala65Ser	Somatic	139	1		WXS	Illumina HiSeq	Phase_I	207	65	NM_000239	0	0	314	314	0	P00695|Q13170|Q9UCF8	Missense_Mutation	SNP	ENST00000261267.2	37	CCDS8989.1	.	.	.	.	.	.	.	.	.	.	G	3.494	-0.103183	0.06967	.	.	ENSG00000090382	ENST00000261267;ENST00000549690;ENST00000548839	T;T;T	0.74106	-0.81;-0.81;-0.81	5.94	2.04	0.26737	Lysozyme-like domain (1);	0.583053	0.18063	N	0.152887	T	0.45994	0.1370	N	0.04090	-0.28	0.18873	N	0.999986	B	0.02656	0.0	B	0.04013	0.001	T	0.25641	-1.0126	9	.	.	.	.	6.1029	0.20057	0.1274:0.4297:0.3725:0.0704	.	65	P61626	LYSC_HUMAN	S	65	ENSP00000261267:A65S;ENSP00000449898:A65S;ENSP00000449969:A65S	.	A	+	1	0	LYZ	68030211	0.000000	0.05858	0.049000	0.19019	0.034000	0.12701	-0.307000	0.08167	0.408000	0.25621	-0.855000	0.03028	GCT	.		0.408	LYZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403624.2	NM_000239	
ZIC2	7546	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	100635322	100635322	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr13:100635322G>A	ENST00000376335.3	+	1	1297	c.1004G>A	c.(1003-1005)tGc>tAc	p.C335Y		NM_007129.3	NP_009060.2	O95409	ZIC2_HUMAN	Zic family member 2	335			C -> F (in HPE5). {ECO:0000269|PubMed:19177455}.		brain development (GO:0007420)|developmental pigmentation (GO:0048066)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|retinal ganglion cell axon guidance (GO:0031290)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(2)|liver(2)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CCCTTCCCCTGCCCCTTCCCG	0.617																																					p.C335Y	Pancreas(97;119 1522 31925 44771 48764)	.											.	ZIC2-90	0			c.G1004A						.						81.0	89.0	86.0					13																	100635322		2203	4300	6503	SO:0001583	missense	7546	exon1			TCCCCTGCCCCTT	AF104902	CCDS9495.1	13q32	2013-01-08	2011-05-19		ENSG00000043355	ENSG00000043355		"""Zinc fingers, C2H2-type"""	12873	protein-coding gene	gene with protein product	"""Zinc finger protein of the cerebellum 2"""	603073	"""Zic family member 2 (odd-paired Drosophila homolog)"", ""Zic family member 2 (odd-paired homolog, Drosophila)"""			9771712	Standard	NM_007129		Approved	HPE5	uc001von.3	O95409	OTTHUMG00000017279	ENST00000376335.3:c.1004G>A	13.37:g.100635322G>A	ENSP00000365514:p.Cys335Tyr	Somatic	114	0		WXS	Illumina HiSeq	Phase_I	87	26	NM_007129	0	0	0	0	0	Q5VYA9|Q9H309	Missense_Mutation	SNP	ENST00000376335.3	37	CCDS9495.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.224811	0.79576	.	.	ENSG00000043355	ENST00000376335;ENST00000397444	D	0.85088	-1.94	4.69	4.69	0.59074	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.93798	0.8017	M	0.90705	3.14	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.94910	0.8064	10	0.87932	D	0	.	18.1567	0.89693	0.0:0.0:1.0:0.0	.	335	O95409	ZIC2_HUMAN	Y	335;84	ENSP00000365514:C335Y	ENSP00000365514:C335Y	C	+	2	0	ZIC2	99433323	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.601000	0.98297	2.610000	0.88304	0.561000	0.74099	TGC	.		0.617	ZIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045618.2	NM_007129	
SCFD1	23256	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	31175075	31175075	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr14:31175075A>T	ENST00000458591.2	+	18	1764	c.1537A>T	c.(1537-1539)Acc>Tcc	p.T513S	SCFD1_ENST00000544052.2_Missense_Mutation_p.T446S|SCFD1_ENST00000554486.1_3'UTR|SCFD1_ENST00000396629.2_Missense_Mutation_p.T421S|SCFD1_ENST00000541123.1_Missense_Mutation_p.T328S|SCFD1_ENST00000421551.3_Missense_Mutation_p.T454S	NM_016106.3	NP_057190.2	Q8WVM8	SCFD1_HUMAN	sec1 family domain containing 1	513					post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|regulation of ER to Golgi vesicle-mediated transport (GO:0060628)|response to hypoxia (GO:0001666)|response to toxic substance (GO:0009636)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle docking involved in exocytosis (GO:0006904)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|Golgi transport complex (GO:0017119)|Golgi-associated vesicle (GO:0005798)|plasma membrane (GO:0005886)	syntaxin binding (GO:0019905)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)	13	Hepatocellular(127;0.0877)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)	GBM - Glioblastoma multiforme(265;0.0181)		TGGCAGCACTACCACTAAACC	0.373																																					p.T513S		.											.	SCFD1-226	0			c.A1537T						.						84.0	87.0	86.0					14																	31175075		2203	4300	6503	SO:0001583	missense	23256	exon18			AGCACTACCACTA	AF110646	CCDS9639.1, CCDS45092.1, CCDS58308.1	14q12	2006-04-04	2004-01-15	2004-01-16	ENSG00000092108	ENSG00000092108			20726	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 163"""	C14orf163			Standard	NM_016106		Approved	RA410, KIAA0917, STXBP1L2, SLY1	uc001wqm.2	Q8WVM8	OTTHUMG00000029420	ENST00000458591.2:c.1537A>T	14.37:g.31175075A>T	ENSP00000390783:p.Thr513Ser	Somatic	58	0		WXS	Illumina HiSeq	Phase_I	70	20	NM_016106	0	1	14	26	11	A8K2Z5|B7Z4U7|B7Z594|O60754|O94990|Q7Z529|Q9BZI3|Q9UNL3|Q9Y6A8	Missense_Mutation	SNP	ENST00000458591.2	37	CCDS9639.1	.	.	.	.	.	.	.	.	.	.	A	9.070	0.996695	0.19043	.	.	ENSG00000092108	ENST00000458591;ENST00000544052;ENST00000421551;ENST00000541123;ENST00000396629	T;T;T;T;T	0.75704	-0.96;-0.96;-0.96;-0.96;-0.96	5.71	4.58	0.56647	.	0.244841	0.38548	N	0.001656	T	0.38188	0.1031	N	0.00985	-1.075	0.33038	D	0.531027	B;B;B;B	0.06786	0.001;0.0;0.001;0.0	B;B;B;B	0.12156	0.003;0.002;0.007;0.005	T	0.43589	-0.9382	10	0.15499	T	0.54	-35.8251	3.8893	0.09111	0.7124:0.0:0.2876:0.0	.	454;446;421;513	B7Z738;B7Z4U7;B7Z594;Q8WVM8	.;.;.;SCFD1_HUMAN	S	513;446;454;328;421	ENSP00000390783:T513S;ENSP00000443010:T446S;ENSP00000388078:T454S;ENSP00000443537:T328S;ENSP00000379870:T421S	ENSP00000309417:T521S	T	+	1	0	SCFD1	30244826	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	3.464000	0.53057	2.175000	0.68902	0.477000	0.44152	ACC	.		0.373	SCFD1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276612.3	NM_182835	
TMEM260	54916	broad.mit.edu;bcgsc.ca	37	14	57072352	57072352	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr14:57072352A>C	ENST00000261556.6	+	5	709	c.587A>C	c.(586-588)tAt>tCt	p.Y196S	TMEM260_ENST00000536419.1_5'UTR|TMEM260_ENST00000538838.1_Missense_Mutation_p.Y196S	NM_017799.3	NP_060269.3	Q9NX78	TM260_HUMAN	transmembrane protein 260	196						integral component of membrane (GO:0016021)											ATAATACTCTATGTTTTGTGC	0.264																																					p.Y196S													.	.	0			c.A587C						.						123.0	137.0	132.0					14																	57072352		2202	4297	6499	SO:0001583	missense	0	exon5			TACTCTATGTTTT	AK000399	CCDS9727.2	14q22.2	2013-03-08	2013-03-08	2013-03-08	ENSG00000070269	ENSG00000070269			20185	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 101"""	C14orf101			Standard	XR_245695		Approved	FLJ20392	uc001xcm.3	Q9NX78	OTTHUMG00000152337	ENST00000261556.6:c.587A>C	14.37:g.57072352A>C	ENSP00000261556:p.Tyr196Ser	Somatic	105	2		WXS	Illumina HiSeq	Phase_I	112	42	NM_017799	0	0	3	7	4	A8KAN4|B3KPF5|Q86XE1	Missense_Mutation	SNP	ENST00000261556.6	37	CCDS9727.2	.	.	.	.	.	.	.	.	.	.	A	24.3	4.517688	0.85495	.	.	ENSG00000070269	ENST00000261556;ENST00000538838	T;T	0.44482	1.46;0.92	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.63486	0.2515	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.63171	-0.6697	10	0.39692	T	0.17	-13.4379	15.8297	0.78741	1.0:0.0:0.0:0.0	.	196	Q9NX78	CN101_HUMAN	S	196	ENSP00000261556:Y196S;ENSP00000441934:Y196S	ENSP00000261556:Y196S	Y	+	2	0	C14orf101	56142105	1.000000	0.71417	0.987000	0.45799	0.926000	0.56050	7.193000	0.77780	2.138000	0.66242	0.451000	0.29950	TAT	.		0.264	TMEM260-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276924.1	NM_017799	
ZFYVE26	23503	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	68252617	68252617	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr14:68252617C>T	ENST00000347230.4	-	18	3400	c.3262G>A	c.(3262-3264)Gat>Aat	p.D1088N	ZFYVE26_ENST00000555452.1_Missense_Mutation_p.D1088N	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	1088					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		AGGACCTGATCTAGCTGCTGG	0.557																																					p.D1088N		.											.	ZFYVE26-162	0			c.G3262A						.						218.0	222.0	221.0					14																	68252617		2203	4300	6503	SO:0001583	missense	23503	exon18			CCTGATCTAGCTG	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.3262G>A	14.37:g.68252617C>T	ENSP00000251119:p.Asp1088Asn	Somatic	116	0		WXS	Illumina HiSeq	Phase_I	80	26	NM_015346	0	0	1	3	2	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	ENST00000347230.4	37	CCDS9788.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.817287	0.90790	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000555452	T;T	0.30981	1.66;1.51	5.38	5.38	0.77491	.	0.530450	0.20377	N	0.093539	T	0.36908	0.0984	L	0.47716	1.5	0.40782	D	0.983189	P;P	0.39480	0.675;0.546	B;B	0.43658	0.426;0.164	T	0.21621	-1.0240	10	0.59425	D	0.04	0.0013	16.9198	0.86161	0.0:1.0:0.0:0.0	.	1088;1088	G3V2D8;Q68DK2	.;ZFY26_HUMAN	N	1088;1067;1088	ENSP00000251119:D1088N;ENSP00000450603:D1088N	ENSP00000251119:D1088N	D	-	1	0	ZFYVE26	67322370	0.998000	0.40836	0.480000	0.27341	0.939000	0.58152	3.840000	0.55843	2.512000	0.84698	0.655000	0.94253	GAT	.		0.557	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346	
EXD2	55218	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	69697234	69697234	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr14:69697234G>C	ENST00000409018.3	+	4	764	c.636G>C	c.(634-636)gaG>gaC	p.E212D	EXD2_ENST00000409675.1_Missense_Mutation_p.E87D|EXD2_ENST00000409949.1_Missense_Mutation_p.E87D|EXD2_ENST00000492815.1_3'UTR|EXD2_ENST00000449989.1_Missense_Mutation_p.E87D|EXD2_ENST00000409014.1_Missense_Mutation_p.E87D|EXD2_ENST00000312994.5_Missense_Mutation_p.E212D|EXD2_ENST00000409242.1_Missense_Mutation_p.E87D	NM_001193361.1	NP_001180290.1	Q9NVH0	EXD2_HUMAN	exonuclease 3'-5' domain containing 2	212	3'-5' exonuclease.						3'-5' exonuclease activity (GO:0008408)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(7)|prostate(1)|urinary_tract(1)	14						CCCTCGCTGAGACTGTTTTGA	0.448																																					p.E212D		.											.	.	0			c.G636C						.						178.0	168.0	172.0					14																	69697234		2203	4300	6503	SO:0001583	missense	55218	exon4			CGCTGAGACTGTT	AK001600	CCDS9793.1, CCDS53902.1	14q24.1	2009-02-24	2009-02-24	2009-02-24	ENSG00000081177	ENSG00000081177			20217	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 114"", ""exonuclease 3'-5' domain-like 2"""	C14orf114, EXDL2			Standard	NM_018199		Approved	FLJ10738	uc001xkv.3	Q9NVH0	OTTHUMG00000154496	ENST00000409018.3:c.636G>C	14.37:g.69697234G>C	ENSP00000387331:p.Glu212Asp	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	68	21	NM_001193361	0	0	6	18	12	B4DIH6|G5E947|Q6AWB6|Q8N3D3	Missense_Mutation	SNP	ENST00000409018.3	37	CCDS53902.1	.	.	.	.	.	.	.	.	.	.	G	17.93	3.507951	0.64410	.	.	ENSG00000081177	ENST00000409018;ENST00000193422;ENST00000409014;ENST00000409675;ENST00000409949;ENST00000409242;ENST00000312994;ENST00000413191;ENST00000449989	T;T;T;T;T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17;-0.17;-0.17;-0.17;-0.17	5.33	2.49	0.30216	-5&apos (1);Ribonuclease H-like (1); exonuclease (1);3&apos (1);	0.093871	0.64402	D	0.000001	T	0.70640	0.3247	M	0.75884	2.315	0.40602	D	0.981598	P;P	0.51057	0.941;0.908	P;P	0.58520	0.84;0.781	T	0.68637	-0.5356	10	0.33141	T	0.24	-25.4424	9.0491	0.36365	0.373:0.0:0.627:0.0	.	212;87	G5E947;Q9NVH0	.;EXD2_HUMAN	D	212;212;87;87;87;87;212;87;87	ENSP00000387331:E212D;ENSP00000386915:E87D;ENSP00000386762:E87D;ENSP00000386632:E87D;ENSP00000386839:E87D;ENSP00000313140:E212D;ENSP00000409089:E87D;ENSP00000392177:E87D	ENSP00000193422:E212D	E	+	3	2	EXD2	68766987	1.000000	0.71417	0.970000	0.41538	0.840000	0.47671	2.350000	0.44063	0.742000	0.32697	-0.136000	0.14681	GAG	.		0.448	EXD2-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000335504.1		
ADAM20	8748	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	70989617	70989617	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr14:70989617A>C	ENST00000256389.3	-	2	2252	c.2008T>G	c.(2008-2010)Tgc>Ggc	p.C670G	RP11-486O13.4_ENST00000556646.1_lincRNA	NM_003814.4	NP_003805.3	O43506	ADA20_HUMAN	ADAM metallopeptidase domain 20	620					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(1)|skin(2)	27			KIRC - Kidney renal clear cell carcinoma(12;0.133)|Kidney(31;0.188)	all cancers(60;0.00294)|BRCA - Breast invasive adenocarcinoma(234;0.00668)|OV - Ovarian serous cystadenocarcinoma(108;0.0344)		TTACGGATGCAGATCTTTTCT	0.463																																					p.C670G		.											.	ADAM20-226	0			c.T2008G						.						416.0	313.0	348.0					14																	70989617		2203	4300	6503	SO:0001583	missense	8748	exon2			GGATGCAGATCTT	AF029899	CCDS32111.1	14q24.2	2012-04-30	2005-08-18		ENSG00000134007	ENSG00000134007		"""ADAM metallopeptidase domain containing"""	199	protein-coding gene	gene with protein product		603712	"""a disintegrin and metalloproteinase domain 20"""			9469942	Standard	NM_003814		Approved		uc001xme.3	O43506	OTTHUMG00000167548	ENST00000256389.3:c.2008T>G	14.37:g.70989617A>C	ENSP00000256389:p.Cys670Gly	Somatic	122	0		WXS	Illumina HiSeq	Phase_I	103	36	NM_003814	0	0	0	0	0	Q6GTZ1|Q9UKJ9	Missense_Mutation	SNP	ENST00000256389.3	37	CCDS32111.1	.	.	.	.	.	.	.	.	.	.	A	16.18	3.051177	0.55218	.	.	ENSG00000134007	ENST00000256389	T	0.02763	4.17	4.67	4.67	0.58626	ADAM, cysteine-rich (1);	0.000000	0.42682	D	0.000667	T	0.17066	0.0410	M	0.86805	2.84	0.20196	N	0.999929	D	0.89917	1.0	D	0.91635	0.999	T	0.03166	-1.1065	10	0.87932	D	0	.	12.6491	0.56751	1.0:0.0:0.0:0.0	.	620	O43506	ADA20_HUMAN	G	670	ENSP00000256389:C670G	ENSP00000256389:C670G	C	-	1	0	ADAM20	70059370	0.764000	0.28473	0.184000	0.23157	0.040000	0.13550	4.075000	0.57584	1.856000	0.53863	0.460000	0.39030	TGC	.		0.463	ADAM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395004.2		
ELMSAN1	91748	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	74206660	74206660	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr14:74206660A>T	ENST00000286523.5	-	2	834	c.52T>A	c.(52-54)Ttc>Atc	p.F18I	ELMSAN1_ENST00000486739.1_5'Flank|ELMSAN1_ENST00000394071.2_Missense_Mutation_p.F18I	NM_194278.3	NP_919254.2	Q6PJG2	EMSA1_HUMAN	ELM2 and Myb/SANT-like domain containing 1	18					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)										TGGCCCCCGAAGAGGCAACGC	0.652																																					p.F18I		.											.	.	0			c.T52A						.						44.0	48.0	47.0					14																	74206660		2203	4300	6503	SO:0001583	missense	91748	exon2			CCCCGAAGAGGCA	BF971739	CCDS9819.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000156030	ENSG00000156030			19853	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 117"", ""chromosome 14 open reading frame 43"""	C14orf117, C14orf43			Standard	NM_194278		Approved	LSR68	uc001xou.3	Q6PJG2	OTTHUMG00000150359	ENST00000286523.5:c.52T>A	14.37:g.74206660A>T	ENSP00000286523:p.Phe18Ile	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	39	15	NM_194278	0	0	2	3	1	Q6PK13|Q6PK59|Q6ZS23	Missense_Mutation	SNP	ENST00000286523.5	37	CCDS9819.1	.	.	.	.	.	.	.	.	.	.	A	15.41	2.824093	0.50739	.	.	ENSG00000156030	ENST00000394071;ENST00000286523;ENST00000423556;ENST00000435371;ENST00000421708	T;T;T;T	0.21734	2.0;2.0;2.0;1.99	4.96	4.96	0.65561	.	0.081627	0.51477	D	0.000084	T	0.15089	0.0364	N	0.24115	0.695	0.47737	D	0.999504	B;B	0.31318	0.319;0.319	B;B	0.27608	0.081;0.081	T	0.05666	-1.0871	10	0.72032	D	0.01	-4.5629	13.0167	0.58762	1.0:0.0:0.0:0.0	.	18;18	A0PJD3;Q6PJG2	.;CN043_HUMAN	I	18	ENSP00000377634:F18I;ENSP00000286523:F18I;ENSP00000407767:F18I;ENSP00000402380:F18I	ENSP00000286523:F18I	F	-	1	0	C14orf43	73276413	1.000000	0.71417	1.000000	0.80357	0.719000	0.41307	6.822000	0.75277	2.089000	0.63090	0.402000	0.26972	TTC	.		0.652	ELMSAN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317793.1	NM_194278	
BCL2L10	10017	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	52404725	52404725	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr15:52404725A>T	ENST00000561198.1	-	1	240	c.199T>A	c.(199-201)Tac>Aac	p.Y67N	BCL2L10_ENST00000260442.3_Missense_Mutation_p.Y67N			Q9HD36	B2L10_HUMAN	BCL2-like 10 (apoptosis facilitator)	57					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|female gamete generation (GO:0007292)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	2				all cancers(107;0.0148)		TAGCCGAGGTAGGCGGAGAAA	0.716																																					p.Y67N		.											.	BCL2L10-227	0			c.T199A						.						12.0	15.0	14.0					15																	52404725		2182	4283	6465	SO:0001583	missense	10017	exon1			CGAGGTAGGCGGA	AF285092	CCDS10148.1	15q21	2007-03-02			ENSG00000137875	ENSG00000137875			993	protein-coding gene	gene with protein product		606910				9829980, 9878060	Standard	NM_020396		Approved	Diva, Boo, BCL-B	uc002abq.3	Q9HD36	OTTHUMG00000131893	ENST00000561198.1:c.199T>A	15.37:g.52404725A>T	ENSP00000453562:p.Tyr67Asn	Somatic	61	0		WXS	Illumina HiSeq	Phase_I	31	12	NM_020396	0	0	1	1	0	Q3SX80|Q52LQ9|Q8TCS9	Missense_Mutation	SNP	ENST00000561198.1	37		.	.	.	.	.	.	.	.	.	.	A	16.67	3.188072	0.57909	.	.	ENSG00000137875	ENST00000260442	T	0.11930	2.73	4.61	2.26	0.28386	Apoptosis regulator, Bcl-2, BH (2);	1.152810	0.06639	N	0.760739	T	0.27559	0.0677	L	0.51422	1.61	0.09310	N	1	D	0.63880	0.993	D	0.65987	0.94	T	0.13229	-1.0517	10	0.66056	D	0.02	.	5.067	0.14587	0.7532:0.0:0.2468:0.0	.	57	Q9HD36	B2L10_HUMAN	N	67	ENSP00000260442:Y67N	ENSP00000260442:Y67N	Y	-	1	0	BCL2L10	50192017	0.000000	0.05858	0.003000	0.11579	0.015000	0.08874	0.370000	0.20433	0.800000	0.34041	0.533000	0.62120	TAC	.		0.716	BCL2L10-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000419386.1		
ULK3	25989	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	75132623	75132623	+	Silent	SNP	C	C	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr15:75132623C>T	ENST00000440863.2	-	6	739	c.648G>A	c.(646-648)agG>agA	p.R216R	ULK3_ENST00000568667.1_Silent_p.R227R|ULK3_ENST00000569437.1_Silent_p.R216R	NM_001099436.1	NP_001092906	Q6PHR2	ULK3_HUMAN	unc-51 like kinase 3	216	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|cellular senescence (GO:0090398)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|protein autophosphorylation (GO:0046777)|regulation of autophagy (GO:0010506)	ATG1/UKL1 signaling complex (GO:0034273)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)	2						CCGAGAACGACCTGGAGGCAA	0.652																																					p.R216R		.											.	ULK3-290	0			c.G648A						.						25.0	27.0	26.0					15																	75132623		1915	4138	6053	SO:0001819	synonymous_variant	25989	exon6			GAACGACCTGGAG	BC048289		15q24.1	2013-07-02	2013-07-02			ENSG00000140474			19703	protein-coding gene	gene with protein product		613472	"""unc-51-like kinase 3 (C. elegans)"""				Standard	XM_005254289		Approved	DKFZP434C131, FLJ90566	uc010bkf.1	Q6PHR2		ENST00000440863.2:c.648G>A	15.37:g.75132623C>T		Somatic	41	0		WXS	Illumina HiSeq	Phase_I	40	16	NM_001099436	0	0	11	14	3	B2RXK3|B4DRQ7|D3DW68|Q9NPN5|Q9UFS4	Silent	SNP	ENST00000440863.2	37	CCDS45305.1																																																																																			.		0.652	ULK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000421734.4	NM_015518	
CLDN9	9080	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	3063765	3063765	+	Silent	SNP	C	C	A			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr16:3063765C>A	ENST00000445369.2	+	1	1309	c.402C>A	c.(400-402)atC>atA	p.I134I		NM_020982.3	NP_066192.1	O95484	CLD9_HUMAN	claudin 9	134					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(2)|large_intestine(1)|lung(5)|prostate(2)	10						TGGTGCTCATCCCTGTGTGCT	0.662																																					p.I134I		.											.	CLDN9-90	0			c.C402A						.						82.0	80.0	81.0					16																	3063765		2198	4300	6498	SO:0001819	synonymous_variant	9080	exon1			GCTCATCCCTGTG	AJ130941	CCDS10487.1	16p13.3	2008-08-01			ENSG00000213937	ENSG00000213937		"""Claudins"""	2051	protein-coding gene	gene with protein product		615799				9441748, 18234789	Standard	NM_020982		Approved		uc010uwo.1	O95484	OTTHUMG00000129000	ENST00000445369.2:c.402C>A	16.37:g.3063765C>A		Somatic	82	0		WXS	Illumina HiSeq	Phase_I	102	55	NM_020982	0	0	0	0	0		Silent	SNP	ENST00000445369.2	37	CCDS10487.1																																																																																			.		0.662	CLDN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250989.1	NM_020982	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000584811.1_5'UTR	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.	0			c.G152A						.						274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	201158	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr	Somatic	295	15		WXS	Illumina HiSeq		448	24	NM_145301	0	0	3	35	32	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT	.		0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
RPL19	6143	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	37358657	37358657	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr17:37358657C>T	ENST00000225430.4	+	3	262	c.200C>T	c.(199-201)aCc>aTc	p.T67I	RPL19_ENST00000582193.1_Missense_Mutation_p.T65I|RPL19_ENST00000579260.1_Missense_Mutation_p.T65I|RPL19_ENST00000579374.1_Missense_Mutation_p.T64I	NM_000981.3	NP_000972.1	P84098	RL19_HUMAN	ribosomal protein L19	67					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			kidney(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	7						CGGAAAAACACCTTGGCCCGC	0.522																																					p.T67I													.	RPL19-90	0			c.C200T						.						62.0	62.0	62.0					17																	37358657		1915	4111	6026	SO:0001583	missense	6143	exon3			AAAACACCTTGGC		CCDS42312.1	17q12	2012-09-20			ENSG00000108298	ENSG00000108298		"""L ribosomal proteins"""	10312	protein-coding gene	gene with protein product	"""60S ribosomal protein L19"", ""ribosomal protein L19, cytosolic, N-terminus truncated"""	180466				1577483	Standard	XM_005257564		Approved	FLJ27452, MGC71997, DKFZp779D216, L19	uc002hrq.1	P84098	OTTHUMG00000178979	ENST00000225430.4:c.200C>T	17.37:g.37358657C>T	ENSP00000225430:p.Thr67Ile	Somatic	100	1		WXS	Illumina HiSeq	Phase_I	118	61	NM_000981	2	1	1108	2449	1338	B2R4K2|P14118|P22908|Q502Y6|Q7Z6E4	Missense_Mutation	SNP	ENST00000225430.4	37	CCDS42312.1	.	.	.	.	.	.	.	.	.	.	c	16.65	3.181855	0.57800	.	.	ENSG00000108298	ENST00000225430	.	.	.	5.44	5.44	0.79542	Ribosomal protein L19/L19e (2);	0.000000	0.85682	D	0.000000	T	0.64670	0.2619	L	0.46614	1.455	0.80722	D	1	B	0.15473	0.013	B	0.24848	0.056	T	0.59107	-0.7516	9	0.37606	T	0.19	.	19.2827	0.94058	0.0:1.0:0.0:0.0	.	67	P84098	RL19_HUMAN	I	67	.	ENSP00000225430:T67I	T	+	2	0	RPL19	34612183	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	4.870000	0.63035	2.545000	0.85829	0.655000	0.94253	ACC	.		0.522	RPL19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000444190.1	NM_000981	
KRT35	3886	bcgsc.ca	37	17	39636925	39636925	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr17:39636925G>T	ENST00000393989.1	-	1	467	c.425C>A	c.(424-426)cCt>cAt	p.P142H	KRT35_ENST00000246639.2_Missense_Mutation_p.P112H	NM_002280.4	NP_002271.3	Q92764	KRT35_HUMAN	keratin 35	142	Linker 1.|Rod.				anatomical structure morphogenesis (GO:0009653)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	29		Breast(137;0.000286)				CTGGTAGTCAGGGCACATGTA	0.582																																					p.P142H													.	KRT35-92	0			c.C425A						.						78.0	83.0	81.0					17																	39636925		2203	4300	6503	SO:0001583	missense	3886	exon1			TAGTCAGGGCACA	X90762	CCDS11394.2	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000197079	ENSG00000197079		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6453	protein-coding gene	gene with protein product	"""hard keratin type I 5"""	602764	"""keratin, hair, acidic, 5"""	KRTHA5		8823373, 16831889	Standard	NM_002280		Approved	Ha-5	uc002hws.3	Q92764	OTTHUMG00000133425	ENST00000393989.1:c.425C>A	17.37:g.39636925G>T	ENSP00000377558:p.Pro142His	Somatic	54	0		WXS	Illumina HiSeq	Phase_1	43	4	NM_002280	0	0	0	0	0	O76012|Q92651	Missense_Mutation	SNP	ENST00000393989.1	37	CCDS11394.2	.	.	.	.	.	.	.	.	.	.	G	13.63	2.295516	0.40594	.	.	ENSG00000197079	ENST00000246639;ENST00000393989	D;D	0.88896	-2.44;-2.44	5.18	5.18	0.71444	Filament (1);	0.000000	0.64402	D	0.000013	D	0.92648	0.7664	M	0.71296	2.17	0.09310	N	1	D	0.89917	1.0	D	0.79108	0.992	D	0.85570	0.1233	10	0.36615	T	0.2	.	10.7023	0.45934	0.0:0.1414:0.7124:0.1462	.	142	Q92764	KRT35_HUMAN	H	112;142	ENSP00000246639:P112H;ENSP00000377558:P142H	ENSP00000246639:P112H	P	-	2	0	KRT35	36890451	0.000000	0.05858	0.879000	0.34478	0.801000	0.45260	0.314000	0.19432	2.689000	0.91719	0.511000	0.50034	CCT	.		0.582	KRT35-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_002280	
TOB1	10140	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	48941072	48941072	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr17:48941072T>A	ENST00000268957.3	-	3	735	c.307A>T	c.(307-309)Att>Ttt	p.I103F	TOB1_ENST00000509385.1_5'UTR|TOB1_ENST00000499247.2_Missense_Mutation_p.I103F|TOB1-AS1_ENST00000416263.3_RNA	NM_001243877.1	NP_001230806.1	P50616	TOB1_HUMAN	transducer of ERBB2, 1	103					negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060212)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of translation (GO:0017148)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of signal transduction (GO:0009967)|SMAD protein import into nucleus (GO:0007184)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	receptor tyrosine kinase binding (GO:0030971)|SH3/SH2 adaptor activity (GO:0005070)|transcription corepressor activity (GO:0003714)			breast(1)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			TTTTCACCAATTTGGTAAGAA	0.423											OREG0024576	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I103F	NSCLC(144;643 1919 24513 29423 40686)												.	TOB1-226	0			c.A307T						.						145.0	133.0	137.0					17																	48941072		2203	4300	6503	SO:0001583	missense	10140	exon2			CACCAATTTGGTA	D38305	CCDS11576.1	17q21.33	2012-08-14			ENSG00000141232	ENSG00000141232			11979	protein-coding gene	gene with protein product		605523		TROB1		8632892, 17785442	Standard	NM_005749		Approved	TOB, TROB	uc002isw.3	P50616	OTTHUMG00000162277	ENST00000268957.3:c.307A>T	17.37:g.48941072T>A	ENSP00000268957:p.Ile103Phe	Somatic	134	1	958	WXS	Illumina HiSeq	Phase_I	182	45	NM_005749	0	1	73	105	31	B2R9T0|D3DTY3|Q4KMQ0	Missense_Mutation	SNP	ENST00000268957.3	37	CCDS11576.1	.	.	.	.	.	.	.	.	.	.	T	16.91	3.252047	0.59212	.	.	ENSG00000141232	ENST00000499247;ENST00000268957	T;T	0.54279	0.58;0.58	5.69	5.69	0.88448	Anti-proliferative protein (4);	0.000000	0.85682	D	0.000000	T	0.51500	0.1678	L	0.58583	1.82	0.80722	D	1	P	0.43750	0.816	B	0.39027	0.288	T	0.58907	-0.7553	10	0.72032	D	0.01	.	15.942	0.79763	0.0:0.0:0.0:1.0	.	103	P50616	TOB1_HUMAN	F	103	ENSP00000427695:I103F;ENSP00000268957:I103F	ENSP00000268957:I103F	I	-	1	0	TOB1	46296071	1.000000	0.71417	0.986000	0.45419	0.997000	0.91878	7.698000	0.84413	2.162000	0.67917	0.533000	0.62120	ATT	.		0.423	TOB1-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000368364.1		
SMG8	55181	hgsc.bcm.edu	37	17	57288259	57288259	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr17:57288259C>A	ENST00000543872.2	+	2	1111	c.847C>A	c.(847-849)Caa>Aaa	p.Q283K	SMG8_ENST00000578922.1_Missense_Mutation_p.Q283K|SMG8_ENST00000580498.1_Intron|SMG8_ENST00000300917.5_Missense_Mutation_p.Q283K|CTD-2510F5.6_ENST00000577660.1_Intron			Q8ND04	SMG8_HUMAN	SMG8 nonsense mediated mRNA decay factor	283					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of protein kinase activity (GO:0045859)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)				NS(1)|breast(5)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	33						TCCTCGGAACCAAGACCCAGC	0.517																																					p.Q283K		.											.	SMG8-93	0			c.C847A						.						66.0	73.0	70.0					17																	57288259		2203	4300	6503	SO:0001583	missense	55181	exon1			CGGAACCAAGACC	AL834490	CCDS11615.1	17q23.2	2013-07-02	2013-07-02	2011-06-21					25551	protein-coding gene	gene with protein product		613175	"""chromosome 17 open reading frame 71"", ""smg-8 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf71		19417104	Standard	NM_018149		Approved	FLJ10587, FLJ23205	uc002ixi.3	Q8ND04		ENST00000543872.2:c.847C>A	17.37:g.57288259C>A	ENSP00000438748:p.Gln283Lys	Somatic	41	0		WXS	Illumina HiSeq	Phase_I	74	5	NM_018149	0	0	4	4	0	Q8N5U5|Q8TDN0|Q9H5P5|Q9NVQ1	Missense_Mutation	SNP	ENST00000543872.2	37	CCDS11615.1	.	.	.	.	.	.	.	.	.	.	C	8.062	0.768336	0.15983	.	.	ENSG00000167447	ENST00000300917;ENST00000543872	T;T	0.41400	1.0;1.0	5.88	5.88	0.94601	.	0.345316	0.35179	N	0.003390	T	0.37732	0.1014	L	0.40543	1.245	0.43852	D	0.99644	B	0.19583	0.037	B	0.15052	0.012	T	0.09250	-1.0683	10	0.22706	T	0.39	-16.8779	19.2147	0.93772	0.0:1.0:0.0:0.0	.	283	Q8ND04	SMG8_HUMAN	K	283	ENSP00000300917:Q283K;ENSP00000438748:Q283K	ENSP00000300917:Q283K	Q	+	1	0	SMG8	54643041	0.999000	0.42202	1.000000	0.80357	0.961000	0.63080	3.993000	0.56987	2.769000	0.95229	0.655000	0.94253	CAA	.		0.517	SMG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445960.2	NM_018149	
DDX5	1655	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	62496852	62496852	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr17:62496852G>C	ENST00000225792.5	-	12	1657	c.1256C>G	c.(1255-1257)cCt>cGt	p.P419R	MIR5047_ENST00000579212.1_RNA|MIR3064_ENST00000581130.1_RNA|DDX5_ENST00000580026.1_5'UTR|DDX5_ENST00000578804.1_Missense_Mutation_p.P419R|DDX5_ENST00000450599.2_Missense_Mutation_p.P340R	NM_004396.3	NP_004387.1	P17844	DDX5_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 5	419	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cell growth (GO:0016049)|circadian rhythm (GO:0007623)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of osteoblast differentiation (GO:0045667)|regulation of skeletal muscle cell differentiation (GO:2001014)|regulation of viral genome replication (GO:0045069)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA helicase activity (GO:0003724)|transcription coactivator activity (GO:0003713)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	19	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			TGAGGAGTTAGGGTAGTCATA	0.403			T	ETV4	prostate																																p.P419R	NSCLC(22;406 813 4871 19580 40307)			Dom	yes		17	17q21	1655	DEAD (Asp-Glu-Ala-Asp) box polypeptide 5		E	.	DDX5-228	0			c.C1256G						.						140.0	124.0	129.0					17																	62496852		2203	4300	6503	SO:0001583	missense	1655	exon12			GAGTTAGGGTAGT	AF015812	CCDS11659.1	17q21	2012-07-27	2012-02-23		ENSG00000108654	ENSG00000108654		"""DEAD-boxes"""	2746	protein-coding gene	gene with protein product		180630	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 5 (RNA helicase, 68kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 5"""	HLR1, G17P1		22156369, 18698352	Standard	NM_004396		Approved	p68	uc002jek.2	P17844	OTTHUMG00000178936	ENST00000225792.5:c.1256C>G	17.37:g.62496852G>C	ENSP00000225792:p.Pro419Arg	Somatic	109	1		WXS	Illumina HiSeq	Phase_I	116	29	NM_004396	0	0	114	166	52	B4DLW8|B5BU21|D3DU32|E7ETL9|O75681|Q53Y61	Missense_Mutation	SNP	ENST00000225792.5	37	CCDS11659.1	.	.	.	.	.	.	.	.	.	.	G	10.25	1.299147	0.23650	.	.	ENSG00000108654	ENST00000540698;ENST00000450599;ENST00000225792	.	.	.	5.73	5.73	0.89815	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.91788	0.7402	H	0.99286	4.5	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.997	D	0.94552	0.7754	9	0.87932	D	0	-9.6298	20.2602	0.98440	0.0:0.0:1.0:0.0	.	340;419;419	B4DLW8;B5BUE6;P17844	.;.;DDX5_HUMAN	R	419;349;408	.	ENSP00000225792:P408R	P	-	2	0	DDX5	59927314	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.175000	0.94831	2.861000	0.98227	0.655000	0.94253	CCT	.		0.403	DDX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444030.1	NM_004396	
MGAT5B	146664	broad.mit.edu	37	17	74944059	74944059	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr17:74944059G>T	ENST00000569840.2	+	17	2645	c.2071G>T	c.(2071-2073)Gcc>Tcc	p.A691S	RP11-87G24.3_ENST00000564292.1_RNA|MGAT5B_ENST00000428789.2_Missense_Mutation_p.A700S|MGAT5B_ENST00000301618.4_Missense_Mutation_p.A689S	NM_001199172.1	NP_001186101.1	Q3V5L5	MGT5B_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B	691					protein N-linked glycosylation (GO:0006487)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(15)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CGCCCTGCGGGCCTGGCTGGC	0.701																																					p.A700S													.	MGAT5B-93	0			c.G2098T						.						21.0	22.0	22.0					17																	74944059		2200	4298	6498	SO:0001583	missense	146664	exon15			CTGCGGGCCTGGC	AB109185	CCDS11751.1, CCDS45788.1, CCDS59299.1	17q25.3	2013-02-25	2005-11-16		ENSG00000167889	ENSG00000167889		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	24140	protein-coding gene	gene with protein product		612441	"""mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isoenzyme B"""			14617637, 14623122	Standard	NM_001199172		Approved	GnT-IX, FLJ25132, GnT-VB	uc002jth.3	Q3V5L5	OTTHUMG00000177278	ENST00000569840.2:c.2071G>T	17.37:g.74944059G>T	ENSP00000456037:p.Ala691Ser	Somatic	45	2		WXS	Illumina HiSeq	Phase_I	46	7	NM_198955	0	0	0	0	0	Q6P3S8|Q6P6B3|Q766X5|Q76D04|Q96LS2	Missense_Mutation	SNP	ENST00000569840.2	37	CCDS59299.1	.	.	.	.	.	.	.	.	.	.	G	14.49	2.549882	0.45383	.	.	ENSG00000167889	ENST00000301618;ENST00000428789	T;T	0.43688	0.94;0.94	4.66	4.66	0.58398	.	0.238298	0.34411	N	0.003988	T	0.34600	0.0903	L	0.29908	0.895	0.33183	D	0.549746	P;P;P	0.41848	0.571;0.634;0.763	B;B;B	0.39119	0.163;0.085;0.291	T	0.54463	-0.8290	10	0.62326	D	0.03	-28.8763	16.5725	0.84622	0.0:0.0:1.0:0.0	.	96;700;689	Q3V5L5-4;Q3V5L5-2;Q3V5L5-5	.;.;.	S	689;700	ENSP00000301618:A689S;ENSP00000391227:A700S	ENSP00000301618:A689S	A	+	1	0	MGAT5B	72455654	1.000000	0.71417	1.000000	0.80357	0.658000	0.38924	4.928000	0.63447	2.129000	0.65627	0.557000	0.71058	GCC	.		0.701	MGAT5B-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460624.2	NM_144677	
DNAH17	8632	bcgsc.ca	37	17	76565539	76565539	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr17:76565539C>T	ENST00000585328.1	-	8	1239	c.1115G>A	c.(1114-1116)gGc>gAc	p.G372D	DNAH17_ENST00000389840.5_Missense_Mutation_p.G372D	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	372	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			CAGGGAGATGCCACTCAGGAC	0.522																																					p.G372D													.	DNAH17-142	0			c.G1115A						.						86.0	65.0	72.0					17																	76565539		2203	4300	6503	SO:0001583	missense	8632	exon8			GAGATGCCACTCA	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.1115G>A	17.37:g.76565539C>T	ENSP00000465516:p.Gly372Asp	Somatic	81	0		WXS	Illumina HiSeq	Phase_1	121	6	NM_173628	0	0	0	0	0	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	ENST00000585328.1	37		.	.	.	.	.	.	.	.	.	.	C	9.643	1.139584	0.21205	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.53857	0.6	4.65	2.59	0.31030	.	0.966446	0.08432	N	0.946763	T	0.50205	0.1602	L	0.51422	1.61	0.23168	N	0.998186	B	0.22276	0.067	B	0.29077	0.098	T	0.49744	-0.8907	10	0.87932	D	0	.	9.3745	0.38275	0.0:0.8257:0.0:0.1743	.	74	Q9UFH2-4	.	D	372	ENSP00000374490:G372D	ENSP00000300671:G372D	G	-	2	0	DNAH17	74077134	0.052000	0.20516	0.458000	0.27068	0.040000	0.13550	0.159000	0.16442	0.373000	0.24621	0.561000	0.74099	GGC	.		0.522	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628	
RAB31	11031	broad.mit.edu	37	18	9815181	9815181	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr18:9815181G>T	ENST00000578921.1	+	5	583	c.342G>T	c.(340-342)atG>atT	p.M114I		NM_006868.3	NP_006859.2	Q13636	RAB31_HUMAN	RAB31, member RAS oncogene family	113					cellular response to insulin stimulus (GO:0032869)|Golgi to plasma membrane protein transport (GO:0043001)|GTP catabolic process (GO:0006184)|phagosome maturation (GO:0090382)|receptor internalization (GO:0031623)|regulated secretory pathway (GO:0045055)|small GTPase mediated signal transduction (GO:0007264)	early endosome (GO:0005769)|phagocytic vesicle (GO:0045335)|trans-Golgi network membrane (GO:0032588)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(2)|endometrium(2)|large_intestine(2)|lung(3)|skin(1)	10						ACATTGTAATGGCCATCGCTG	0.403																																					p.M114I													.	RAB31-205	0			c.G342T						.						78.0	81.0	80.0					18																	9815181		1960	4133	6093	SO:0001583	missense	11031	exon5			TGTAATGGCCATC	U59877	CCDS45826.1	18p11.22	2014-03-18			ENSG00000168461	ENSG00000168461		"""RAB, member RAS oncogene"""	9771	protein-coding gene	gene with protein product		605694				8863739	Standard	NM_006868		Approved	Rab22B	uc002kog.2	Q13636	OTTHUMG00000178513	ENST00000578921.1:c.342G>T	18.37:g.9815181G>T	ENSP00000461945:p.Met114Ile	Somatic	72	0		WXS	Illumina HiSeq	Phase_I	86	4	NM_006868	0	0	34	34	0	B2RBT7|Q15770|Q9HC00	Missense_Mutation	SNP	ENST00000578921.1	37	CCDS45826.1	.	.	.	.	.	.	.	.	.	.	G	5.185	0.219743	0.09863	.	.	ENSG00000168461	ENST00000306096;ENST00000435762	.	.	.	5.64	5.64	0.86602	Small GTP-binding protein domain (1);	0.045250	0.85682	D	0.000000	T	0.21921	0.0528	N	0.00408	-1.53	0.48341	D	0.999635	B	0.02656	0.0	B	0.11329	0.006	T	0.34079	-0.9843	8	.	.	.	-7.9846	18.8461	0.92208	0.0:0.0:1.0:0.0	.	113	Q13636	RAB31_HUMAN	I	114;105	.	.	M	+	3	0	RAB31	9805181	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.944000	0.49034	2.820000	0.97059	0.655000	0.94253	ATG	.		0.403	RAB31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442280.3		
POLRMT	5442	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	623528	623528	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr19:623528T>C	ENST00000588649.2	-	6	1300	c.1216A>G	c.(1216-1218)Atg>Gtg	p.M406V	LLNLR-299G3.1_ENST00000607288.1_RNA	NM_005035.3	NP_005026.3	O00411	RPOM_HUMAN	polymerase (RNA) mitochondrial (DNA directed)	406					gene expression (GO:0010467)|transcription from mitochondrial promoter (GO:0006390)|transcription initiation from mitochondrial promoter (GO:0006391)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(3)|large_intestine(1)|lung(9)|ovary(1)|pancreas(2)|prostate(1)|stomach(1)	20		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCAGCTCCATGTGGAGCTGC	0.632																																					p.M406V		.											.	POLRMT-92	0			c.A1216G						.						54.0	50.0	51.0					19																	623528		2203	4300	6503	SO:0001583	missense	5442	exon6			GCTCCATGTGGAG		CCDS12036.1	19p13.3	2010-10-22			ENSG00000099821	ENSG00000099821	2.7.7.6		9200	protein-coding gene	gene with protein product		601778				9097968	Standard	NM_005035		Approved	h-mtRPOL, APOLMT, MTRNAP, MTRPOL	uc002lpf.1	O00411		ENST00000588649.2:c.1216A>G	19.37:g.623528T>C	ENSP00000465759:p.Met406Val	Somatic	71	0		WXS	Illumina HiSeq	Phase_I	52	11	NM_005035	0	0	13	18	5	O60370	Missense_Mutation	SNP	ENST00000588649.2	37	CCDS12036.1	.	.	.	.	.	.	.	.	.	.	.	0.013	-1.639596	0.00799	.	.	ENSG00000099821	ENST00000215591	T	0.39056	1.1	4.63	-4.26	0.03755	.	0.752409	0.12789	N	0.438968	T	0.08935	0.0221	N	0.01446	-0.86	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31280	-0.9949	10	0.02654	T	1	-12.8428	0.5899	0.00726	0.249:0.2907:0.1226:0.3377	.	406	O00411	RPOM_HUMAN	V	406	ENSP00000215591:M406V	ENSP00000215591:M406V	M	-	1	0	POLRMT	574528	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-1.196000	0.03041	-0.378000	0.07918	-2.005000	0.00442	ATG	.		0.632	POLRMT-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452172.3	NM_005035	
KEAP1	9817	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	10610566	10610566	+	Silent	SNP	G	G	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr19:10610566G>T	ENST00000171111.5	-	2	691	c.144C>A	c.(142-144)ggC>ggA	p.G48G	KEAP1_ENST00000588024.1_5'Flank|KEAP1_ENST00000393623.2_Silent_p.G48G	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	48					cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	AGGTGCGGTTGCCATGCTGGG	0.627																																					p.G48G		.											.	KEAP1-637	0			c.C144A						.						136.0	108.0	118.0					19																	10610566		2203	4300	6503	SO:0001819	synonymous_variant	9817	exon2			GCGGTTGCCATGC	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.144C>A	19.37:g.10610566G>T		Somatic	62	0		WXS	Illumina HiSeq	Phase_I	63	24	NM_012289	0	0	12	19	7	B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Silent	SNP	ENST00000171111.5	37	CCDS12239.1																																																																																			.		0.627	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289	
RFX1	5989	broad.mit.edu;ucsc.edu	37	19	14080923	14080923	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr19:14080923T>C	ENST00000254325.4	-	10	1613	c.1379A>G	c.(1378-1380)tAc>tGc	p.Y460C		NM_002918.4	NP_002909.4	P22670	RFX1_HUMAN	regulatory factor X, 1 (influences HLA class II expression)	460					immune response (GO:0006955)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(19;6.67e-23)			GTAGTGGCAGTAGAGGGTGCT	0.627																																					p.Y460C													.	RFX1-92	0			c.A1379G						.						80.0	76.0	78.0					19																	14080923		2203	4300	6503	SO:0001583	missense	5989	exon10			TGGCAGTAGAGGG		CCDS12301.1	19p13.1	2008-07-17				ENSG00000132005			9982	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 1"", ""enhancer factor C"", ""MHC class II regulatory factor RFX"""	600006				1505960, 8289803	Standard	NM_002918		Approved	EF-C	uc002mxv.3	P22670		ENST00000254325.4:c.1379A>G	19.37:g.14080923T>C	ENSP00000254325:p.Tyr460Cys	Somatic	106	1		WXS	Illumina HiSeq	Phase_I	102	4	NM_002918	0	0	6	9	3		Missense_Mutation	SNP	ENST00000254325.4	37	CCDS12301.1	.	.	.	.	.	.	.	.	.	.	T	24.5	4.538770	0.85917	.	.	ENSG00000132005	ENST00000254325	D	0.91521	-2.86	5.41	5.41	0.78517	Winged helix-turn-helix transcription repressor DNA-binding (1);DNA-binding RFX (1);	0.000000	0.85682	D	0.000000	D	0.96552	0.8875	H	0.94345	3.525	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97588	1.0115	10	0.87932	D	0	-16.4954	14.4299	0.67243	0.0:0.0:0.0:1.0	.	460	P22670	RFX1_HUMAN	C	460	ENSP00000254325:Y460C	ENSP00000254325:Y460C	Y	-	2	0	RFX1	13941923	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.973000	0.88032	2.059000	0.61396	0.460000	0.39030	TAC	.		0.627	RFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458510.1	NM_002918	
KMT2B	9757	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	36229181	36229181	+	Splice_Site	SNP	A	A	G			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr19:36229181A>G	ENST00000222270.7	+	37	7872		c.e37-1		KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000420124.1_Splice_Site|IGFLR1_ENST00000587101.1_5'Flank	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B						chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										TCATCCCTGCAGGGCATCGGG	0.602																																					.		.											.	MLL4-697	0			c.7873-2A>G						.						60.0	68.0	65.0					19																	36229181		2182	4290	6472	SO:0001630	splice_region_variant	8085	exon37			CCCTGCAGGGCAT	AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.7873-1A>G	19.37:g.36229181A>G		Somatic	56	0		WXS	Illumina HiSeq	Phase_I	36	15	NM_014727	0	0	0	3	3	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Splice_Site	SNP	ENST00000222270.7	37	CCDS46055.1	.	.	.	.	.	.	.	.	.	.	A	12.28	1.890467	0.33348	.	.	ENSG00000105663	ENST00000222270;ENST00000420124	.	.	.	5.42	5.42	0.78866	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4398	0.67309	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AD000671.1	40921021	1.000000	0.71417	0.916000	0.36221	0.245000	0.25701	9.339000	0.96797	2.063000	0.61619	0.379000	0.24179	.	.		0.602	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014727	Intron
TIMM50	92609	broad.mit.edu	37	19	39971399	39971399	+	5'Flank	SNP	A	A	C			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr19:39971399A>C	ENST00000607714.1	+	0	0				TIMM50_ENST00000314349.4_Missense_Mutation_p.H72P|TIMM50_ENST00000544017.1_5'Flank|TIMM50_ENST00000599794.1_5'Flank			Q3ZCQ8	TIM50_HUMAN	translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae)						cellular protein metabolic process (GO:0044267)|mitochondrial membrane organization (GO:0007006)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein targeting to mitochondrion (GO:0006626)|release of cytochrome c from mitochondria (GO:0001836)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial inner membrane presequence translocase complex (GO:0005744)|mitochondrion (GO:0005739)|nuclear speck (GO:0016607)	interleukin-2 receptor binding (GO:0005134)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|ribonucleoprotein complex binding (GO:0043021)|RNA binding (GO:0003723)			NS(1)|endometrium(3)|large_intestine(5)|lung(3)|ovary(1)|prostate(1)	14	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;5.89e-26)|all cancers(26;1.96e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			GCTTCCGTCCACCCGCCCCTC	0.697																																					p.H72P													.	TIMM50-91	0			c.A215C						.						24.0	29.0	28.0					19																	39971399		2197	4300	6497	SO:0001631	upstream_gene_variant	92609	exon1			CCGTCCACCCGCC	BC009072	CCDS33023.1	19q13.2	2010-06-21	2006-04-04		ENSG00000105197	ENSG00000105197		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	23656	protein-coding gene	gene with protein product		607381	"""translocase of inner mitochondrial membrane 50 homolog (yeast)"""			12437925	Standard	NM_001001563		Approved	TIM50L	uc002olu.1	Q3ZCQ8			19.37:g.39971399A>C	Exception_encountered	Somatic	72	12		WXS	Illumina HiSeq	Phase_I	68	17	NM_001001563	0	0	0	0	0	Q330K1|Q6QA00|Q96FJ5|Q96GY2|Q9H370	Missense_Mutation	SNP	ENST00000607714.1	37		.	.	.	.	.	.	.	.	.	.	A	11.34	1.610993	0.28712	.	.	ENSG00000105197	ENST00000314349	.	.	.	3.79	-5.34	0.02705	.	0.896444	0.09581	N	0.782788	T	0.28466	0.0704	N	0.08118	0	0.33969	D	0.646621	B	0.25105	0.118	B	0.25884	0.064	T	0.28744	-1.0034	8	.	.	.	-2.5013	14.058	0.64781	0.2434:0.0:0.7566:0.0	.	72	Q3ZCQ8-2	.	P	72	.	.	H	+	2	0	TIMM50	44663239	0.013000	0.17824	0.005000	0.12908	0.060000	0.15804	-0.673000	0.05239	-1.401000	0.02058	-0.609000	0.04063	CAC	.		0.697	TIMM50-021	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470728.1	NM_001001563	
CEACAM16	388551	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	45211204	45211204	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr19:45211204G>A	ENST00000405314.2	+	5	1109	c.1012G>A	c.(1012-1014)Gtg>Atg	p.V338M	CTB-171A8.1_ENST00000590796.1_RNA|CEACAM16_ENST00000587331.1_Missense_Mutation_p.V338M			Q2WEN9	CEA16_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 16	338					sensory perception of sound (GO:0007605)	extracellular region (GO:0005576)|stereocilium bundle tip (GO:0032426)				endometrium(3)|large_intestine(2)|lung(3)|ovary(1)	9	Lung NSC(12;0.000698)|all_lung(12;0.002)	Prostate(69;0.0376)|Ovarian(192;0.231)				AACACTGACCGTGCAGGGCTA	0.672																																					p.V338M													.	CEACAM16-23	0			c.G1012A						.						15.0	17.0	16.0					19																	45211204		2147	4237	6384	SO:0001583	missense	388551	exon6			CTGACCGTGCAGG		CCDS54278.1	19q13.31	2014-01-27			ENSG00000213892	ENSG00000213892		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31948	protein-coding gene	gene with protein product		614591				21368133	Standard	NM_001039213		Approved	DFNA4B	uc010xxd.2	Q2WEN9	OTTHUMG00000151519	ENST00000405314.2:c.1012G>A	19.37:g.45211204G>A	ENSP00000385576:p.Val338Met	Somatic	111	1		WXS	Illumina HiSeq	Phase_I	87	25	NM_001039213	0	0	0	0	0	A7LI12	Missense_Mutation	SNP	ENST00000405314.2	37	CCDS54278.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.098930	0.76870	.	.	ENSG00000213892	ENST00000396750;ENST00000405314	T	0.01902	4.57	5.87	5.87	0.94306	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.15046	0.0363	M	0.85099	2.735	0.34882	D	0.74467	D	0.89917	1.0	D	0.83275	0.996	T	0.01858	-1.1259	9	0.66056	D	0.02	-24.0687	15.7789	0.78243	0.0:0.0:1.0:0.0	.	397	Q2WEN9	CEA16_HUMAN	M	403;338	ENSP00000385576:V338M	ENSP00000379974:V403M	V	+	1	0	CEACAM16	49903044	0.992000	0.36948	0.599000	0.28851	0.752000	0.42762	4.967000	0.63722	2.788000	0.95919	0.650000	0.86243	GTG	.		0.672	CEACAM16-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		XM_371177	
ATRAID	51374	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	27436144	27436144	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr2:27436144A>G	ENST00000606999.1	+	2	257	c.199A>G	c.(199-201)Aat>Gat	p.N67D	SLC5A6_ENST00000310574.3_5'Flank|ATRAID_ENST00000405489.3_Missense_Mutation_p.N9D|SLC5A6_ENST00000408041.1_5'Flank|ATRAID_ENST00000380171.3_Missense_Mutation_p.N122D	NM_001170795.1	NP_001164266.1	Q6UW56	ARAID_HUMAN	all-trans retinoic acid-induced differentiation factor	67					cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)											TTGCTGCCTGAATCAGAAGGG	0.468																																					p.N122D													.	.	0			c.A364G						.						84.0	82.0	82.0					2																	27436144		2203	4300	6503	SO:0001583	missense	51374	exon2			TGCCTGAATCAGA	BC021237	CCDS1741.1, CCDS46243.1, CCDS62877.1	2p23.3	2012-08-01	2012-07-30	2012-07-30	ENSG00000138085	ENSG00000138085			24090	protein-coding gene	gene with protein product	"""apoptosis-related protein 3"""		"""chromosome 2 open reading frame 28"""	C2orf28		17524364, 21723284	Standard	NM_016085		Approved	HSPC013, p18, APR3	uc002rjf.3	Q6UW56	OTTHUMG00000128405	ENST00000606999.1:c.199A>G	2.37:g.27436144A>G	ENSP00000476080:p.Asn67Asp	Somatic	74	1		WXS	Illumina HiSeq	Phase_I	83	23	NM_080592	0	0	306	437	131	A8C1S2|A8K779|Q96FF6|Q96RT2|Q9Y2R7|Q9Y5L7	Missense_Mutation	SNP	ENST00000606999.1	37		.	.	.	.	.	.	.	.	.	.	A	15.74	2.922795	0.52653	.	.	ENSG00000138085	ENST00000380171;ENST00000405489;ENST00000419744	T;T	0.43294	1.6;0.95	5.14	3.95	0.45737	.	0.376184	0.29791	N	0.011188	T	0.34861	0.0912	L	0.50333	1.59	0.25876	N	0.983648	B;P	0.43352	0.358;0.804	B;B	0.40066	0.116;0.318	T	0.17289	-1.0374	10	0.38643	T	0.18	1.3171	8.1132	0.30926	0.906:0.0:0.094:0.0	.	67;122	Q6UW56;Q6UW56-3	APR3_HUMAN;.	D	122;9;9	ENSP00000369518:N122D;ENSP00000384033:N9D	ENSP00000369518:N122D	N	+	1	0	C2orf28	27289648	0.851000	0.29673	1.000000	0.80357	0.993000	0.82548	1.004000	0.29822	0.869000	0.35703	0.459000	0.35465	AAT	.		0.468	ATRAID-007	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470709.1	NM_016085	
FAM98A	25940	broad.mit.edu	37	2	33810281	33810281	+	Silent	SNP	T	T	C			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr2:33810281T>C	ENST00000238823.8	-	8	1259	c.1119A>G	c.(1117-1119)ggA>ggG	p.G373G	FAM98A_ENST00000441530.2_Silent_p.G178G|FAM98A_ENST00000498340.1_5'Flank|FAM98A_ENST00000403368.1_3'UTR			Q8NCA5	FA98A_HUMAN	family with sequence similarity 98, member A	374	Gly-rich.						poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(1)	24	all_hematologic(175;0.115)					TTCCTCTTCCTCCCCCTCGGC	0.562																																					p.G373G													.	FAM98A-91	0			c.A1119G						.						228.0	186.0	200.0					2																	33810281		2203	4300	6503	SO:0001819	synonymous_variant	25940	exon8			TCTTCCTCCCCCT		CCDS33179.1	2p22.3	2006-11-29		2005-11-20	ENSG00000119812	ENSG00000119812			24520	protein-coding gene	gene with protein product						12477932	Standard	NM_015475		Approved	DKFZP564F0522	uc002rpa.1	Q8NCA5	OTTHUMG00000152152	ENST00000238823.8:c.1119A>G	2.37:g.33810281T>C		Somatic	73	4		WXS	Illumina HiSeq	Phase_I	124	7	NM_015475	0	0	49	49	0	B2RNA2|Q9Y3Y6	Silent	SNP	ENST00000238823.8	37	CCDS33179.1																																																																																			.		0.562	FAM98A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325457.2	NM_015475	
TMEM178A	130733	broad.mit.edu	37	2	39934299	39934299	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr2:39934299G>T	ENST00000281961.2	+	3	681	c.625G>T	c.(625-627)Gtg>Ttg	p.V209L	TMEM178A_ENST00000482239.1_3'UTR	NM_152390.2	NP_689603.2	Q8NBL3	T178A_HUMAN	transmembrane protein 178A	209						integral component of membrane (GO:0016021)											GACCCAGCACGTGGCTGGACT	0.602																																					p.V209L													.	.	0			c.G625T						.						63.0	54.0	57.0					2																	39934299		2203	4300	6503	SO:0001583	missense	130733	exon3			CAGCACGTGGCTG	BC029530	CCDS1804.1	2p22.1	2012-06-29	2012-06-29	2012-06-29	ENSG00000152154	ENSG00000152154			28517	protein-coding gene	gene with protein product			"""transmembrane protein 178"""	TMEM178		12975309	Standard	NM_001167959		Approved	MGC33926	uc002rrt.3	Q8NBL3	OTTHUMG00000128591	ENST00000281961.2:c.625G>T	2.37:g.39934299G>T	ENSP00000281961:p.Val209Leu	Somatic	64	0		WXS	Illumina HiSeq	Phase_I	101	3	NM_152390	0	0	1	1	0	Q6UWI6|Q8N6N4	Missense_Mutation	SNP	ENST00000281961.2	37	CCDS1804.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.791631	0.90367	.	.	ENSG00000152154	ENST00000281961	T	0.64803	-0.12	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.57695	0.2071	L	0.41492	1.28	0.58432	D	0.999996	P	0.47677	0.899	P	0.44394	0.448	T	0.57093	-0.7870	9	.	.	.	-11.7503	16.2065	0.82133	0.0:0.0:1.0:0.0	.	209	Q8NBL3	TM178_HUMAN	L	209	ENSP00000281961:V209L	.	V	+	1	0	TMEM178	39787803	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.824000	0.69279	2.433000	0.82419	0.650000	0.86243	GTG	.		0.602	TMEM178A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250445.2	NM_152390	
CLEC4F	165530	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	71036918	71036918	+	Silent	SNP	G	G	A			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr2:71036918G>A	ENST00000272367.2	-	6	1687	c.1611C>T	c.(1609-1611)tcC>tcT	p.S537S	CLEC4F_ENST00000426626.1_Silent_p.S537S	NM_001258027.1|NM_173535.2	NP_001244956.1|NP_775806.2	Q8N1N0	CLC4F_HUMAN	C-type lectin domain family 4, member F	537	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				endocytosis (GO:0006897)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			endometrium(1)|large_intestine(5)|lung(18)|ovary(5)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	37						TCCAGCGCCAGGAGCCCTCTG	0.552																																					p.S537S	Colon(107;10 2157 6841 26035)	.											.	CLEC4F-95	0			c.C1611T						.						156.0	141.0	146.0					2																	71036918		2203	4300	6503	SO:0001819	synonymous_variant	165530	exon6			GCGCCAGGAGCCC	AK096429	CCDS1910.1	2p13.3	2008-02-05	2005-02-09	2005-02-11	ENSG00000152672	ENSG00000152672		"""C-type lectin domain containing"""	25357	protein-coding gene	gene with protein product			"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 13"""	CLECSF13		8889548, 1846367	Standard	NM_001258027		Approved	FLJ39110, KCLR	uc002shf.3	Q8N1N0	OTTHUMG00000129713	ENST00000272367.2:c.1611C>T	2.37:g.71036918G>A		Somatic	57	0		WXS	Illumina HiSeq	Phase_I	88	25	NM_173535	0	0	0	0	0	A4QPA5	Silent	SNP	ENST00000272367.2	37	CCDS1910.1																																																																																			.		0.552	CLEC4F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251922.1	NM_173535	
RMND5A	64795	broad.mit.edu;bcgsc.ca	37	2	86947925	86947925	+	Silent	SNP	G	G	A			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr2:86947925G>A	ENST00000283632.4	+	1	630	c.135G>A	c.(133-135)caG>caA	p.Q45Q	CHMP3_ENST00000439940.2_Intron|RNF103-CHMP3_ENST00000604011.1_Intron	NM_022780.3	NP_073617.1	Q9H871	RMD5A_HUMAN	required for meiotic nuclear division 5 homolog A (S. cerevisiae)	45										kidney(1)|liver(2)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	17						AGATCCTGCAGAGCCACGGTA	0.726																																					p.Q45Q													.	RMND5A-92	0			c.G135A						.						13.0	16.0	15.0					2																	86947925		2174	4283	6457	SO:0001819	synonymous_variant	64795	exon1			CCTGCAGAGCCAC	BC012165	CCDS1991.1	2p11.2	2012-07-20			ENSG00000153561	ENSG00000153561			25850	protein-coding gene	gene with protein product	"""GID complex subunit 2 homolog A"""					12477932	Standard	NM_022780		Approved	FLJ13910, RMD5, GID2, GID2A	uc002srs.4	Q9H871	OTTHUMG00000130262	ENST00000283632.4:c.135G>A	2.37:g.86947925G>A		Somatic	94	1		WXS	Illumina HiSeq	Phase_I	52	22	NM_022780	0	0	0	0	0	D6W5M6|Q6NTF0|Q9H6W5|Q9H9H2	Silent	SNP	ENST00000283632.4	37	CCDS1991.1																																																																																			.		0.726	RMND5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252591.2	NM_022780	
SCN3A	6328	ucsc.edu;bcgsc.ca	37	2	165948982	165948982	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr2:165948982A>G	ENST00000360093.3	-	27	5080	c.4589T>C	c.(4588-4590)aTc>aCc	p.I1530T	SCN3A_ENST00000409101.3_Missense_Mutation_p.I1481T|SCN3A_ENST00000540861.1_Missense_Mutation_p.I13T|AC013463.2_ENST00000431341.1_RNA|SCN3A_ENST00000283254.7_Missense_Mutation_p.I1530T|SCN3A_ENST00000465043.1_5'UTR	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	1530					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CATGATGCTGATATCAAAGAC	0.388																																					p.I1530T													.	SCN3A-141	0			c.T4589C						.						133.0	108.0	117.0					2																	165948982		2203	4300	6503	SO:0001583	missense	6328	exon27			ATGCTGATATCAA	AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.4589T>C	2.37:g.165948982A>G	ENSP00000353206:p.Ile1530Thr	Somatic	180	4		WXS	Illumina HiSeq		228	125	NM_006922	0	0	0	0	0	Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	ENST00000360093.3	37		.	.	.	.	.	.	.	.	.	.	A	27.2	4.812464	0.90707	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000540861	D;D;D;D	0.97480	-4.4;-4.4;-4.4;-4.4	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	D	0.98776	0.9588	M	0.92738	3.34	0.58432	D	0.999999	D;D;D	0.71674	0.996;0.997;0.998	D;D;D	0.77557	0.99;0.963;0.948	D	0.99581	1.0973	10	0.59425	D	0.04	.	16.4053	0.83662	1.0:0.0:0.0:0.0	.	1481;1481;1530	Q9NY46-2;Q9NY46-4;Q9NY46-3	.;.;.	T	1530;1530;1481;13	ENSP00000353206:I1530T;ENSP00000283254:I1530T;ENSP00000386726:I1481T;ENSP00000439920:I13T	ENSP00000283254:I1530T	I	-	2	0	SCN3A	165657228	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.287000	0.95975	2.333000	0.79357	0.482000	0.46254	ATC	.		0.388	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922	
SCN1A	6323	ucsc.edu;bcgsc.ca	37	2	166892799	166892799	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr2:166892799G>A	ENST00000303395.4	-	16	3187	c.3188C>T	c.(3187-3189)tCc>tTc	p.S1063F	AC010127.3_ENST00000599041.1_RNA|AC010127.3_ENST00000595268.1_RNA|AC010127.3_ENST00000595647.1_RNA|AC010127.3_ENST00000597623.1_RNA|SCN1A_ENST00000375405.3_Missense_Mutation_p.S1052F|SCN1A_ENST00000409050.1_Missense_Mutation_p.S1035F|SCN1A_ENST00000423058.2_Missense_Mutation_p.S1063F			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1063					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGTATGATTGGACATACAACT	0.313																																					p.S1063F													.	SCN1A-147	0			c.C3188T						.						131.0	122.0	125.0					2																	166892799		2203	4299	6502	SO:0001583	missense	6323	exon16			TGATTGGACATAC	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.3188C>T	2.37:g.166892799G>A	ENSP00000303540:p.Ser1063Phe	Somatic	179	3		WXS	Illumina HiSeq		224	54	NM_001165963	0	0	0	0	0	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	ENST00000303395.4	37	CCDS54413.1	.	.	.	.	.	.	.	.	.	.	G	16.73	3.204104	0.58234	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.84442	-1.85;-1.85;-1.85;-1.85	5.44	5.44	0.79542	Sodium ion transport-associated (1);	0.261229	0.34245	N	0.004126	T	0.81278	0.4789	L	0.54323	1.7	0.44627	D	0.997601	P;B;B	0.41313	0.745;0.0;0.274	B;B;B	0.36719	0.231;0.001;0.179	D	0.83562	0.0107	10	0.72032	D	0.01	.	12.914	0.58195	0.0747:0.0:0.9253:0.0	.	1052;1035;1063	P35498-2;E9PG49;P35498	.;.;SCN1A_HUMAN	F	1063;1063;1052;1035	ENSP00000407030:S1063F;ENSP00000303540:S1063F;ENSP00000364554:S1052F;ENSP00000386312:S1035F	ENSP00000303540:S1063F	S	-	2	0	SCN1A	166601045	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.520000	0.67080	2.709000	0.92574	0.655000	0.94253	TCC	.		0.313	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920	
SPEG	10290	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	220342479	220342479	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr2:220342479T>C	ENST00000312358.7	+	21	4930	c.4798T>C	c.(4798-4800)Ttt>Ctt	p.F1600L	SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	1600					cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		ACTCAGCGACTTTTATGACAT	0.612																																					p.F1600L													.	SPEG-383	0			c.T4798C						.						85.0	93.0	90.0					2																	220342479		2025	4169	6194	SO:0001583	missense	10290	exon21			AGCGACTTTTATG	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.4798T>C	2.37:g.220342479T>C	ENSP00000311684:p.Phe1600Leu	Somatic	68	1		WXS	Illumina HiSeq	Phase_I	85	46	NM_005876	0	0	0	0	0	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	ENST00000312358.7	37	CCDS42824.1	.	.	.	.	.	.	.	.	.	.	T	13.20	2.167160	0.38217	.	.	ENSG00000072195	ENST00000312358;ENST00000265327	T	0.38887	1.11	4.84	4.84	0.62591	Protein kinase-like domain (1);	0.182541	0.26453	N	0.024291	T	0.35219	0.0924	L	0.40543	1.245	0.80722	D	1	B	0.25904	0.137	B	0.28465	0.09	T	0.12091	-1.0561	10	0.26408	T	0.33	.	13.4398	0.61106	0.0:0.0:0.0:1.0	.	1600	Q15772	SPEG_HUMAN	L	1600	ENSP00000311684:F1600L	ENSP00000265327:F1600L	F	+	1	0	SPEG	220050723	0.996000	0.38824	0.989000	0.46669	0.935000	0.57460	1.911000	0.39937	2.148000	0.66965	0.533000	0.62120	TTT	.		0.612	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876	
KIF1A	547	hgsc.bcm.edu	37	2	241696843	241696843	+	Intron	SNP	C	C	A	rs537608637|rs10594016|rs533559120		TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr2:241696843C>A	ENST00000320389.7	-	25	2714				KIF1A_ENST00000498729.2_Missense_Mutation_p.E917D	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A						anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		cctcctcatcctcctcctcct	0.682													C|||	1	0.000199681	0.0	0.0014	5008	,	,		8551	0.0		0.0	False		,,,				2504	0.0				p.E917D		.											.	KIF1A-91	0			c.G2751T						.																																			SO:0001627	intron_variant	547	exon27			CTCATCCTCCTCC	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.2555+933G>T	2.37:g.241696843C>A		Somatic	74	0		WXS	Illumina HiSeq	Phase_I	98	5	NM_001244008	0	0	3	3	0	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	ENST00000320389.7	37	CCDS46561.1	.	.	.	.	.	.	.	.	.	.	C	8.327	0.825706	0.16749	.	.	ENSG00000130294	ENST00000498729;ENST00000373308;ENST00000404283	T;T	0.73047	-0.63;-0.71	4.04	3.16	0.36331	.	.	.	.	.	T	0.50429	0.1615	.	.	.	0.27599	N	0.949023	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.21690	-1.0238	8	0.08381	T	0.77	.	12.6857	0.56946	0.1669:0.833:0.0:0.0	.	917;917	F5H045;Q12756-2	.;.	D	917	ENSP00000438388:E917D;ENSP00000384231:E917D	ENSP00000362405:E917D	E	-	3	2	KIF1A	241345516	0.997000	0.39634	0.999000	0.59377	0.888000	0.51559	0.203000	0.17315	0.685000	0.31468	-0.372000	0.07161	GAG	.		0.682	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	NM_138483	
PASK	23178	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	242082279	242082279	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr2:242082279G>T	ENST00000405260.1	-	2	867	c.169C>A	c.(169-171)Ctc>Atc	p.L57I	PASK_ENST00000539818.1_Intron|PASK_ENST00000358649.4_Missense_Mutation_p.L57I|PASK_ENST00000234040.4_Missense_Mutation_p.L57I|PASK_ENST00000544142.1_Missense_Mutation_p.D5E|PASK_ENST00000403638.3_Missense_Mutation_p.L57I	NM_001252120.1	NP_001239049.1	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	57					negative regulation of glycogen biosynthetic process (GO:0045719)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of energy homeostasis (GO:2000505)|regulation of glucagon secretion (GO:0070092)|regulation of respiratory gaseous exchange (GO:0043576)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(20)|ovary(4)|prostate(4)|skin(1)|stomach(1)|urinary_tract(2)	53		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		CTCTGGCAGAGTCTGGAAAGC	0.562																																					p.L57I													.	PASK-536	0			c.C169A						.						85.0	73.0	77.0					2																	242082279		2203	4300	6503	SO:0001583	missense	23178	exon2			GGCAGAGTCTGGA	U79240	CCDS2545.1, CCDS58758.1, CCDS58759.1	2q37.3	2008-05-23			ENSG00000115687	ENSG00000115687			17270	protein-coding gene	gene with protein product		607505				11688972, 11459942, 15148392	Standard	NM_001252119		Approved	PASKIN, KIAA0135, STK37	uc010fzl.2	Q96RG2	OTTHUMG00000133392	ENST00000405260.1:c.169C>A	2.37:g.242082279G>T	ENSP00000384016:p.Leu57Ile	Somatic	53	2		WXS	Illumina HiSeq	Phase_I	56	30	NM_001252122	0	0	1	2	1	G5E9F1|Q05BE4|Q68DY3|Q6GSJ5|Q86XH6|Q99763|Q9UFR7	Missense_Mutation	SNP	ENST00000405260.1	37	CCDS2545.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.67|17.67	3.446805|3.446805	0.63178|0.63178	.|.	.|.	ENSG00000115687|ENSG00000115687	ENST00000544142|ENST00000234040;ENST00000405260;ENST00000358649;ENST00000403638;ENST00000452907	T|T;T;T;T	0.67523|0.75154	-0.27|-0.91;-0.91;-0.87;0.06	4.39|4.39	4.39|4.39	0.52855|0.52855	.|.	.|0.000000	.|0.41001	.|D	.|0.000973	D|D	0.83147|0.83147	0.5191|0.5191	M|M	0.61703|0.61703	1.905|1.905	0.80722|0.80722	D|D	1|1	B|D;D;D;D	0.27732|0.89917	0.187|0.999;0.999;1.0;0.999	B|D;D;D;D	0.27500|0.83275	0.08|0.994;0.996;0.996;0.994	D|D	0.84236|0.84236	0.0469|0.0469	9|10	0.87932|0.59425	D|D	0|0.04	.|.	13.1962|13.1962	0.59740|0.59740	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	5|57;57;57;57	F5GYW7|B7Z7R6;Q96RG2-2;G5E9F1;Q96RG2	.|.;.;.;PASK_HUMAN	E|I	5|57	ENSP00000441374:D5E|ENSP00000234040:L57I;ENSP00000384016:L57I;ENSP00000351475:L57I;ENSP00000384438:L57I	ENSP00000441374:D5E|ENSP00000234040:L57I	D|L	-|-	3|1	2|0	PASK|PASK	241730952|241730952	1.000000|1.000000	0.71417|0.71417	0.934000|0.934000	0.37439|0.37439	0.435000|0.435000	0.31806|0.31806	4.949000|4.949000	0.63596|0.63596	2.382000|2.382000	0.81193|0.81193	0.561000|0.561000	0.74099|0.74099	GAC|CTC	.		0.562	PASK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000323753.1	NM_015148	
HDLBP	3069	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	242196033	242196033	+	Silent	SNP	T	T	C	rs200251201		TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr2:242196033T>C	ENST00000391975.1	-	6	866	c.639A>G	c.(637-639)ttA>ttG	p.L213L	HDLBP_ENST00000427183.2_Silent_p.L249L|HDLBP_ENST00000391976.2_Silent_p.L213L|HDLBP_ENST00000310931.4_Silent_p.L213L	NM_203346.3	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein	213	KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)	cytoplasm (GO:0005737)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)			breast(7)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		CAGAGATGAGTAAGACTTCAT	0.567																																					p.L249L		.											.	HDLBP-290	0			c.A747G						.						176.0	156.0	163.0					2																	242196033		2203	4300	6503	SO:0001819	synonymous_variant	3069	exon7			GATGAGTAAGACT		CCDS2547.1, CCDS58760.1	2q37.3	2008-07-18	2008-07-18		ENSG00000115677	ENSG00000115677			4857	protein-coding gene	gene with protein product		142695	"""vigilin"""	VGL		1318310, 8390966	Standard	NM_005336		Approved	HBP	uc002waz.3	Q00341	OTTHUMG00000133391	ENST00000391975.1:c.639A>G	2.37:g.242196033T>C		Somatic	119	0		WXS	Illumina HiSeq	Phase_I	131	35	NM_001243900	0	0	84	114	30	B4DTQ2|E7EM71|Q53QU2|Q9UCY3	Silent	SNP	ENST00000391975.1	37	CCDS2547.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	4.630|4.630	0.117115|0.117115	0.08881|0.08881	.|.	.|.	ENSG00000115677|ENSG00000115677	ENST00000373292|ENST00000453141	.|.	.|.	.|.	5.79|5.79	-0.967|-0.967	0.10316|0.10316	.|.	.|.	.|.	.|.	.|.	T|T	0.42223|0.42223	0.1193|0.1193	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.29701|0.29701	-1.0003|-1.0003	4|4	.|.	.|.	.|.	-20.9924|-20.9924	2.4822|2.4822	0.04590|0.04590	0.1601:0.3764:0.3089:0.1546|0.1601:0.3764:0.3089:0.1546	.|.	.|.	.|.	.|.	A|C	91|114	.|.	.|.	T|Y	-|-	1|2	0|0	HDLBP|HDLBP	241844706|241844706	0.522000|0.522000	0.26266|0.26266	0.991000|0.991000	0.47740|0.47740	0.427000|0.427000	0.31564|0.31564	-0.124000|-0.124000	0.10595|0.10595	0.095000|0.095000	0.17434|0.17434	-0.326000|-0.326000	0.08463|0.08463	ACT|TAC	T|0.999;C|0.001		0.567	HDLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257245.5	NM_203346	
FRG1B	284802	bcgsc.ca	37	20	29623218	29623218	+	Silent	SNP	A	A	G	rs368763678	byFrequency	TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr20:29623218A>G	ENST00000278882.3	+	3	410	c.30A>G	c.(28-30)acA>acG	p.T10T	FRG1B_ENST00000439954.2_Missense_Mutation_p.N12D|FRG1B_ENST00000358464.4_Silent_p.T10T			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	10								p.T10T(4)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TGCACTCGACAATGGTCTTTT	0.408													.|||	318	0.0634984	0.0212	0.0692	5008	,	,		48514	0.0228		0.1431	False		,,,				2504	0.0767				.													.	FRG1B-22	4	Substitution - coding silent(4)	endometrium(2)|kidney(2)	.						.																																			SO:0001819	synonymous_variant	284802	.			CTCGACAATGGTC			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.30A>G	20.37:g.29623218A>G		Somatic	733	20		WXS	Illumina HiSeq	Phase_1	805	44	.	0	0	42	53	11	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	a	9.656	1.142954	0.21205	.	.	ENSG00000149531	ENST00000439954	T	0.51817	0.69	1.93	1.93	0.25924	.	.	.	.	.	T	0.50803	0.1637	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50242	-0.8851	6	0.48119	T	0.1	.	7.8149	0.29254	1.0:0.0:0.0:0.0	.	.	.	.	D	12	ENSP00000408863:N12D	ENSP00000408863:N12D	N	+	1	0	FRG1B	28236879	1.000000	0.71417	1.000000	0.80357	0.105000	0.19272	7.836000	0.86788	1.147000	0.42369	0.347000	0.21830	AAT	.		0.408	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
COL9A3	1299	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	61467549	61467549	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr20:61467549G>T	ENST00000343916.3	+	28	1415	c.1412G>T	c.(1411-1413)cGa>cTa	p.R471L	COL9A3_ENST00000462700.1_3'UTR	NM_001853.3	NP_001844.3	Q14050	CO9A3_HUMAN	collagen, type IX, alpha 3	471	Triple-helical region 3 (COL3).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female gonad development (GO:0008585)|male gonad development (GO:0008584)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(1)|endometrium(3)|large_intestine(1)|lung(18)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	28	Breast(26;5.68e-08)					TCTGGCAGTCGAGGGGAGCTG	0.716																																					p.R471L		.											.	COL9A3-514	0			c.G1412T						.						18.0	24.0	22.0					20																	61467549		2201	4297	6498	SO:0001583	missense	1299	exon28			GCAGTCGAGGGGA	AK075240	CCDS13505.1	20q13.3	2013-01-16			ENSG00000092758	ENSG00000092758		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2219	protein-coding gene	gene with protein product	"""collagen type IX proteoglycan"""	120270				8586434, 1429648	Standard	NM_001853		Approved	IDD, MED, EDM3, FLJ90759, DJ885L7.4.1	uc002ydm.3	Q14050	OTTHUMG00000032938	ENST00000343916.3:c.1412G>T	20.37:g.61467549G>T	ENSP00000341640:p.Arg471Leu	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	81	22	NM_001853	0	0	0	0	0	Q13681|Q9H4G9|Q9UPE2	Missense_Mutation	SNP	ENST00000343916.3	37	CCDS13505.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.448038	0.84101	.	.	ENSG00000092758	ENST00000343916	D	0.93712	-3.27	4.63	4.63	0.57726	.	0.283555	0.33127	N	0.005250	D	0.95367	0.8496	L	0.53729	1.69	0.46241	D	0.998947	D	0.89917	1.0	D	0.73380	0.98	D	0.94429	0.7648	10	0.32370	T	0.25	.	17.4821	0.87675	0.0:0.0:1.0:0.0	.	471	Q14050	CO9A3_HUMAN	L	471	ENSP00000341640:R471L	ENSP00000341640:R471L	R	+	2	0	COL9A3	60937994	1.000000	0.71417	0.984000	0.44739	0.994000	0.84299	7.254000	0.78329	2.117000	0.64856	0.561000	0.74099	CGA	.		0.716	COL9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080071.2	NM_001853	
GABPA	2551	bcgsc.ca	37	21	27130324	27130324	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr21:27130324C>A	ENST00000354828.3	+	6	1084	c.557C>A	c.(556-558)cCc>cAc	p.P186H	GABPA_ENST00000400075.3_Missense_Mutation_p.P186H	NM_001197297.1	NP_001184226.1	Q06546	GABPA_HUMAN	GA binding protein transcription factor, alpha subunit 60kDa	186	PNT. {ECO:0000255|PROSITE- ProRule:PRU00762}.				cell differentiation (GO:0030154)|in utero embryonic development (GO:0001701)|negative regulation of megakaryocyte differentiation (GO:0045653)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(5)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	24						TTTCTAGATCCCATACAGTGG	0.398																																					p.P186H													.	GABPA-227	0			c.C557A						.						64.0	64.0	64.0					21																	27130324		2203	4300	6503	SO:0001583	missense	2551	exon6			TAGATCCCATACA		CCDS13575.1	21q21-q22.1	2008-07-31	2002-08-29		ENSG00000154727	ENSG00000154727			4071	protein-coding gene	gene with protein product	"""human nuclear respiratory factor-2 subunit alpha"", ""nuclear respiratory factor 2 alpha subunit"""	600609	"""GA-binding protein transcription factor, alpha subunit (60kD)"""			8441384	Standard	NM_002040		Approved	E4TF1A, NFT2, NRF2, E4TF1-60, NRF2A	uc002yly.4	Q06546	OTTHUMG00000078443	ENST00000354828.3:c.557C>A	21.37:g.27130324C>A	ENSP00000346886:p.Pro186His	Somatic	212	6		WXS	Illumina HiSeq	Phase_1	245	85	NM_001197297	0	0	0	0	0	Q12939	Missense_Mutation	SNP	ENST00000354828.3	37	CCDS13575.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.565778	0.86439	.	.	ENSG00000154727	ENST00000354828;ENST00000400075	T;T	0.68479	-0.33;-0.33	5.39	5.39	0.77823	Sterile alpha motif/pointed domain (2);Pointed domain (3);	0.000000	0.85682	D	0.000000	D	0.86585	0.5968	M	0.92367	3.3	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89198	0.3555	10	0.87932	D	0	.	18.9426	0.92610	0.0:1.0:0.0:0.0	.	186	Q06546	GABPA_HUMAN	H	186	ENSP00000346886:P186H;ENSP00000382948:P186H	ENSP00000346886:P186H	P	+	2	0	GABPA	26052195	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.241000	0.78201	2.809000	0.96659	0.467000	0.42956	CCC	.		0.398	GABPA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171365.1	NM_002040	
DIP2A	23181	bcgsc.ca	37	21	47961748	47961748	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr21:47961748G>T	ENST00000417564.2	+	18	2137	c.2116G>T	c.(2116-2118)Gat>Tat	p.D706Y	DIP2A_ENST00000457905.3_Missense_Mutation_p.D706Y|DIP2A_ENST00000466639.1_Missense_Mutation_p.D663Y|DIP2A_ENST00000435722.3_Missense_Mutation_p.D706Y|DIP2A_ENST00000427143.2_Missense_Mutation_p.D642Y|DIP2A_ENST00000318711.7_Missense_Mutation_p.D707Y|DIP2A_ENST00000400274.1_Missense_Mutation_p.D702Y			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	706					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		TATCAGAGTGGATACTGAAGA	0.468																																					p.D706Y													.	DIP2A-24	0			c.G2116T						.						122.0	127.0	126.0					21																	47961748		1972	4176	6148	SO:0001583	missense	23181	exon18			AGAGTGGATACTG	AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.2116G>T	21.37:g.47961748G>T	ENSP00000392066:p.Asp706Tyr	Somatic	100	0		WXS	Illumina HiSeq	Phase_1	105	5	NM_206891	0	0	2	2	0	A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Missense_Mutation	SNP	ENST00000417564.2	37	CCDS46655.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.983767	0.74474	.	.	ENSG00000160305	ENST00000400274;ENST00000427143;ENST00000318711;ENST00000358985;ENST00000457905;ENST00000466639;ENST00000435722;ENST00000417564	T;T;T;T;T;T;T	0.26957	1.74;1.7;1.74;1.71;1.75;1.72;1.74	5.36	5.36	0.76844	AMP-dependent synthetase/ligase (1);	0.112204	0.64402	D	0.000018	T	0.58366	0.2117	M	0.87180	2.865	0.80722	D	1	P;P;D;P;P;P;P	0.89917	0.943;0.786;1.0;0.888;0.779;0.942;0.937	P;P;D;P;P;P;P	0.91635	0.776;0.75;0.999;0.898;0.776;0.819;0.69	T	0.63972	-0.6516	10	0.54805	T	0.06	-11.6569	18.1299	0.89598	0.0:0.0:1.0:0.0	.	707;642;663;642;706;706;706	E9PER1;E7EMA5;Q14689-3;B4E0F0;Q14689;Q14689-4;Q14689-2	.;.;.;.;DIP2A_HUMAN;.;.	Y	702;642;707;663;706;663;706;706	ENSP00000383133:D702Y;ENSP00000400528:D642Y;ENSP00000323633:D707Y;ENSP00000393434:D706Y;ENSP00000430249:D663Y;ENSP00000415089:D706Y;ENSP00000392066:D706Y	ENSP00000323633:D707Y	D	+	1	0	DIP2A	46786176	1.000000	0.71417	0.408000	0.26446	0.435000	0.31806	4.770000	0.62309	2.525000	0.85131	0.650000	0.86243	GAT	.		0.468	DIP2A-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376736.1	NM_015151	
TANGO2	128989	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	22	20030918	20030918	+	Missense_Mutation	SNP	C	C	T	rs551072560		TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr22:20030918C>T	ENST00000327374.4	+	3	275	c.97C>T	c.(97-99)Ccc>Tcc	p.P33S	TANGO2_ENST00000401833.1_Missense_Mutation_p.P74S|TANGO2_ENST00000447208.2_Missense_Mutation_p.P33S|TANGO2_ENST00000456048.1_Missense_Mutation_p.P38S|TANGO2_ENST00000479679.1_3'UTR|TANGO2_ENST00000420290.2_5'UTR|TANGO2_ENST00000434570.2_Missense_Mutation_p.P74S|TANGO2_ENST00000401886.1_Missense_Mutation_p.P33S|TANGO2_ENST00000432883.1_Missense_Mutation_p.P33S|TANGO2_ENST00000398042.2_Missense_Mutation_p.P33S	NM_001283106.1|NM_001283116.1|NM_001283148.1|NM_001283154.1|NM_152906.4	NP_001270035.1|NP_001270045.1|NP_001270077.1|NP_001270083.1|NP_690870.3	Q6ICL3	TNG2_HUMAN	transport and golgi organization 2 homolog (Drosophila)	33																	CTACAGCCGACCCTCCAAGTT	0.542													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20269	0.0		0.0	False		,,,				2504	0.0				p.P33S		.											.	.	0			c.C97T						.						139.0	142.0	141.0					22																	20030918		2203	4300	6503	SO:0001583	missense	128989	exon3			AGCCGACCCTCCA		CCDS13772.1, CCDS63404.1, CCDS63405.1, CCDS63406.1, CCDS63407.1, CCDS74821.1, CCDS74822.1	22q11.21	2012-12-13	2012-12-13	2012-12-13	ENSG00000183597	ENSG00000183597			25439	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 25"""	C22orf25		12477932	Standard	XM_005261222		Approved	DKFZp761P1121	uc002zrc.1	Q6ICL3	OTTHUMG00000150510	ENST00000327374.4:c.97C>T	22.37:g.20030918C>T	ENSP00000332721:p.Pro33Ser	Somatic	75	0		WXS	Illumina HiSeq	Phase_I	95	28	NM_152906	0	0	17	22	5	A8MUE9|B7WNV6|B7Z583|B7Z730|D3DX23|Q8IW05|Q8NAL0|Q8TCS0|Q96M16	Missense_Mutation	SNP	ENST00000327374.4	37	CCDS13772.1	.	.	.	.	.	.	.	.	.	.	C	13.72	2.320659	0.41096	.	.	ENSG00000183597	ENST00000401886;ENST00000432198;ENST00000447208;ENST00000398042;ENST00000450664;ENST00000327374;ENST00000432883;ENST00000401833;ENST00000434168;ENST00000434570;ENST00000456048	T;T;T;T;T;T;T;T;T;T;T	0.25414	1.8;1.8;1.8;1.8;1.8;1.8;1.8;1.8;1.8;1.8;1.8	4.89	3.87	0.44632	.	0.174725	0.50627	D	0.000101	T	0.57169	0.2035	M	0.92412	3.305	0.80722	D	1	D;D;D;D;D;D;D	0.76494	0.999;0.999;0.994;0.999;0.999;0.999;0.991	D;D;D;D;D;D;D	0.74674	0.984;0.984;0.932;0.984;0.984;0.975;0.933	T	0.66456	-0.5919	10	0.72032	D	0.01	-12.9932	11.3355	0.49500	0.0:0.9094:0.0:0.0906	.	33;74;33;74;33;33;33	B7Z9Q5;B7Z730;B7Z4A5;B7WNV6;Q6AHY1;Q6ICL3;Q6ICL3-2	.;.;.;.;.;CV025_HUMAN;.	S	33;33;33;33;33;33;33;74;33;74;38	ENSP00000385662:P33S;ENSP00000413850:P33S;ENSP00000389797:P33S;ENSP00000381122:P33S;ENSP00000415450:P33S;ENSP00000332721:P33S;ENSP00000402926:P33S;ENSP00000384827:P74S;ENSP00000411602:P33S;ENSP00000391262:P74S;ENSP00000403645:P38S	ENSP00000332721:P33S	P	+	1	0	C22orf25	18410918	1.000000	0.71417	0.061000	0.19648	0.149000	0.21700	4.652000	0.61454	1.197000	0.43143	-0.258000	0.10820	CCC	.		0.542	TANGO2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318689.2	NM_152906	
CELSR3	1951	bcgsc.ca	37	3	48692763	48692763	+	Silent	SNP	T	T	A			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr3:48692763T>A	ENST00000164024.4	-	5	5086	c.4806A>T	c.(4804-4806)acA>acT	p.T1602T	CELSR3_ENST00000544264.1_Silent_p.T1602T	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	1602	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		TCAGATGCACTGTATGCCATT	0.577																																					p.T1602T													.	CELSR3-523	0			c.A4806T						.						137.0	126.0	130.0					3																	48692763		2203	4300	6503	SO:0001819	synonymous_variant	1951	exon5			ATGCACTGTATGC	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.4806A>T	3.37:g.48692763T>A		Somatic	104	3		WXS	Illumina HiSeq	Phase_1	75	26	NM_001407	0	0	0	0	0	O75092	Silent	SNP	ENST00000164024.4	37	CCDS2775.1																																																																																			.		0.577	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407	
BSN	8927	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	49689059	49689059	+	Silent	SNP	C	C	A			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr3:49689059C>A	ENST00000296452.4	+	5	2184	c.2070C>A	c.(2068-2070)atC>atA	p.I690I		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	690					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		CTGACGGCATCTCTAGCTCCC	0.602																																					p.I690I													.	BSN-97	0			c.C2070A						.						97.0	88.0	91.0					3																	49689059		2203	4300	6503	SO:0001819	synonymous_variant	8927	exon5			CGGCATCTCTAGC	AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.2070C>A	3.37:g.49689059C>A		Somatic	107	1		WXS	Illumina HiSeq	Phase_I	88	35	NM_003458	0	0	0	0	0	O43161|Q7LGH3	Silent	SNP	ENST00000296452.4	37	CCDS2800.1																																																																																			.		0.602	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258164.1	NM_003458	
CADM2	253559	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	85851274	85851274	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr3:85851274G>C	ENST00000407528.2	+	2	201	c.139G>C	c.(139-141)Gat>Cat	p.D47H	CADM2_ENST00000405615.2_Missense_Mutation_p.D49H|CADM2_ENST00000383699.3_Missense_Mutation_p.D56H|CADM2-AS2_ENST00000467225.1_RNA	NM_001167674.1	NP_001161146.1	Q8N3J6	CADM2_HUMAN	cell adhesion molecule 2	47	Ig-like V-type.				adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|synapse (GO:0045202)				endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(1)|prostate(1)|skin(4)	38		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		CTGCAGGGTTGATCAAAATGA	0.408																																					p.D56H		.											.	CADM2-228	0			c.G166C						.						90.0	75.0	80.0					3																	85851274		2203	4300	6503	SO:0001583	missense	253559	exon3			AGGGTTGATCAAA	AF538973	CCDS33792.1, CCDS54613.1, CCDS54614.1	3p12.2	2013-01-11	2007-02-07	2007-02-07	ENSG00000175161	ENSG00000175161		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	29849	protein-coding gene	gene with protein product	"""nectin-like 3"""	609938	"""immunoglobulin superfamily, member 4D"""	IGSF4D			Standard	NM_153184		Approved	NECL3, Necl-3, SynCAM2	uc003dqj.3	Q8N3J6	OTTHUMG00000158990	ENST00000407528.2:c.139G>C	3.37:g.85851274G>C	ENSP00000384575:p.Asp47His	Somatic	113	0		WXS	Illumina HiSeq	Phase_I	110	6	NM_001167675	0	0	0	0	0	G3XHN7|G3XHN8|Q3KQY9|Q658Q7|Q8IZP8	Missense_Mutation	SNP	ENST00000407528.2	37	CCDS54614.1	.	.	.	.	.	.	.	.	.	.	G	17.26	3.343676	0.61073	.	.	ENSG00000175161	ENST00000383699;ENST00000407528;ENST00000405615	T;T;T	0.64991	-0.13;-0.13;-0.13	5.27	5.27	0.74061	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.162021	0.53938	D	0.000054	T	0.64811	0.2632	L	0.35542	1.07	0.80722	D	1	P;P;P	0.50066	0.805;0.854;0.931	P;P;P	0.53689	0.591;0.517;0.732	T	0.59500	-0.7443	10	0.25751	T	0.34	.	19.2384	0.93871	0.0:0.0:1.0:0.0	.	49;56;47	Q8N3J6-3;G3XHN4;Q8N3J6	.;.;CADM2_HUMAN	H	56;47;49	ENSP00000373200:D56H;ENSP00000384575:D47H;ENSP00000384193:D49H	ENSP00000373200:D56H	D	+	1	0	CADM2	85933964	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	9.420000	0.97426	2.621000	0.88768	0.544000	0.68410	GAT	.		0.408	CADM2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352822.1	NM_153184	
PROS1	5627	broad.mit.edu	37	3	93646100	93646100	+	Silent	SNP	C	C	T	rs6121		TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr3:93646100C>T	ENST00000394236.3	-	2	544	c.228G>A	c.(226-228)ccG>ccA	p.P76P	PROS1_ENST00000407433.1_5'UTR	NM_000313.3	NP_000304.2	P07225	PROS_HUMAN	protein S (alpha)	76	Gla. {ECO:0000255|PROSITE- ProRule:PRU00463}.		P -> L (in dbSNP:rs73846070). {ECO:0000269|PubMed:10613647, ECO:0000269|PubMed:15712227, ECO:0000269|PubMed:7803790}.		blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|negative regulation of endopeptidase activity (GO:0010951)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|endopeptidase inhibitor activity (GO:0004866)			endometrium(3)|kidney(5)|large_intestine(8)|lung(26)|ovary(1)|skin(2)|urinary_tract(1)	46					Drotrecogin alfa(DB00055)|Menadione(DB00170)|Sodium Tetradecyl Sulfate(DB00464)	TTACCGTTTCCGGGTCATTTT	0.388																																					p.P76P													.	PROS1-153	0			c.G228A						.						102.0	100.0	101.0					3																	93646100		2203	4300	6503	SO:0001819	synonymous_variant	5627	exon2			CGTTTCCGGGTCA		CCDS2923.1	3q11.1	2013-06-03			ENSG00000184500	ENSG00000184500			9456	protein-coding gene	gene with protein product		176880		PROS		214811, 1833851	Standard	NM_000313		Approved		uc003drb.4	P07225	OTTHUMG00000150354	ENST00000394236.3:c.228G>A	3.37:g.93646100C>T		Somatic	91	0		WXS	Illumina HiSeq	Phase_I	119	4	NM_000313	0	0	0	0	0	A8KAC9|D3DN28|Q15518|Q7Z715|Q9UCZ8	Silent	SNP	ENST00000394236.3	37	CCDS2923.1																																																																																			C|0.999;A|0.001		0.388	PROS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317762.1	NM_000313	
SPICE1	152185	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	113176133	113176133	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr3:113176133C>T	ENST00000295872.4	-	13	1766	c.1507G>A	c.(1507-1509)Gaa>Aaa	p.E503K		NM_144718.3	NP_653319.1	Q8N0Z3	SPICE_HUMAN	spindle and centriole associated protein 1	503					metaphase plate congression (GO:0051310)|regulation of centriole replication (GO:0046599)|spindle assembly involved in mitosis (GO:0090307)	centriole (GO:0005814)|centrosome (GO:0005813)|spindle (GO:0005819)				NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(3)|large_intestine(9)|lung(10)|ovary(2)|skin(2)|urinary_tract(1)	33						GGCAACTCTTCCTGTGGGAAT	0.448																																					p.E503K													.	SPICE1-70	0			c.G1507A						.						102.0	101.0	101.0					3																	113176133		2203	4300	6503	SO:0001583	missense	152185	exon13			ACTCTTCCTGTGG	AY099107	CCDS2973.1	3q13.2	2010-09-01	2010-09-01	2010-09-01	ENSG00000163611	ENSG00000163611			25083	protein-coding gene	gene with protein product	"""spindle and centriole protein"""	613447	"""coiled-coil domain containing 52"""	CCDC52		20736305	Standard	NM_144718		Approved	SPICE	uc003eag.4	Q8N0Z3	OTTHUMG00000159261	ENST00000295872.4:c.1507G>A	3.37:g.113176133C>T	ENSP00000295872:p.Glu503Lys	Somatic	109	1		WXS	Illumina HiSeq	Phase_I	116	46	NM_144718	0	0	3	9	6	D3DN72|Q8WUX6	Missense_Mutation	SNP	ENST00000295872.4	37	CCDS2973.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.006842	0.74932	.	.	ENSG00000163611	ENST00000295872	T	0.36878	1.23	5.63	4.75	0.60458	.	0.237434	0.37483	N	0.002065	T	0.39759	0.1090	M	0.65975	2.015	0.39240	D	0.963841	P;P	0.50156	0.932;0.872	P;P	0.45856	0.495;0.495	T	0.41645	-0.9497	10	0.54805	T	0.06	-13.2604	9.489	0.38948	0.0:0.9063:0.0:0.0937	.	399;503	B3KX77;Q8N0Z3	.;SPICE_HUMAN	K	503	ENSP00000295872:E503K	ENSP00000295872:E503K	E	-	1	0	SPICE1	114658823	1.000000	0.71417	1.000000	0.80357	0.535000	0.34838	2.750000	0.47500	2.659000	0.90383	0.561000	0.74099	GAA	.		0.448	SPICE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354177.2	NM_144718	
ALDH1L1	10840	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	125826081	125826081	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr3:125826081A>C	ENST00000393434.2	-	21	2705	c.2356T>G	c.(2356-2358)Ttt>Gtt	p.F786V	ALDH1L1_ENST00000472186.1_Missense_Mutation_p.F786V|ALDH1L1_ENST00000452905.2_Missense_Mutation_p.F685V|ALDH1L1_ENST00000273450.3_Missense_Mutation_p.F796V|ALDH1L1_ENST00000393431.2_3'UTR|ALDH1L1-AS1_ENST00000512384.1_RNA	NM_012190.3	NP_036322.2	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	786	Aldehyde dehydrogenase.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	catalytic activity (GO:0003824)|formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(5)|large_intestine(10)|lung(22)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	52				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	GTTGGCTCAAAGAAGAACCCT	0.557																																					p.F796V		.											.	ALDH1L1-156	0			c.T2386G						.						130.0	115.0	120.0					3																	125826081		2203	4300	6503	SO:0001583	missense	10840	exon21			GCTCAAAGAAGAA	AF052732	CCDS3034.1, CCDS58850.1, CCDS58851.1	3q21.2	2010-07-19		2005-01-27	ENSG00000144908	ENSG00000144908	1.5.1.6	"""Aldehyde dehydrogenases"""	3978	protein-coding gene	gene with protein product	"""cytosolic 10-formyltetrahydrofolate dehydrogenase"""	600249	"""formyltetrahydrofolate dehydrogenase"""	FTHFD			Standard	NM_012190		Approved	10-fTHF	uc031sbp.1	O75891	OTTHUMG00000125551	ENST00000393434.2:c.2356T>G	3.37:g.125826081A>C	ENSP00000377083:p.Phe786Val	Somatic	32	0		WXS	Illumina HiSeq	Phase_I	56	36	NM_001270364	0	0	0	0	0	B4DG36|E9PBX3|Q68CS1	Missense_Mutation	SNP	ENST00000393434.2	37	CCDS3034.1	.	.	.	.	.	.	.	.	.	.	A	11.51	1.660489	0.29515	.	.	ENSG00000144908	ENST00000273450;ENST00000472186;ENST00000452905;ENST00000393434	T;T;T;T	0.73363	-0.74;-0.74;-0.74;-0.74	3.98	3.98	0.46160	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.85682	D	0.000000	T	0.56093	0.1962	N	0.00450	-1.49	0.80722	D	1	P;D;P	0.54772	0.755;0.968;0.501	P;D;P	0.63793	0.81;0.918;0.673	T	0.65203	-0.6225	10	0.27082	T	0.32	.	10.8723	0.46891	1.0:0.0:0.0:0.0	.	685;321;786	E9PBX3;Q6ZV71;O75891	.;.;AL1L1_HUMAN	V	796;786;685;786	ENSP00000273450:F796V;ENSP00000420293:F786V;ENSP00000395881:F685V;ENSP00000377083:F786V	ENSP00000273450:F796V	F	-	1	0	ALDH1L1	127308771	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	2.579000	0.46059	1.677000	0.50941	0.260000	0.18958	TTT	.		0.557	ALDH1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354391.1	NM_012190	
PRKCI	5584	bcgsc.ca	37	3	170002334	170002334	+	Silent	SNP	T	T	C			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr3:170002334T>C	ENST00000295797.4	+	12	1458	c.1153T>C	c.(1153-1155)Tta>Cta	p.L385L		NM_002740.5	NP_002731.4	P41743	KPCI_HUMAN	protein kinase C, iota	385	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin filament organization (GO:0007015)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell junction organization (GO:0045216)|cellular response to insulin stimulus (GO:0032869)|cytoskeleton organization (GO:0007010)|establishment of apical/basal cell polarity (GO:0035089)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|eye photoreceptor cell development (GO:0042462)|Golgi vesicle budding (GO:0048194)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of glucose import (GO:0046326)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein phosphorylation (GO:0006468)|protein targeting to membrane (GO:0006612)|response to interleukin-1 (GO:0070555)|secretion (GO:0046903)|tight junction assembly (GO:0070830)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|Schmidt-Lanterman incisure (GO:0043220)	ATP binding (GO:0005524)|phospholipid binding (GO:0005543)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(16)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	36	all_cancers(22;6.45e-23)|all_epithelial(15;8.52e-28)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)		Tamoxifen(DB00675)	GGACAATGTATTACTGGACTC	0.338																																					p.L385L													.	PRKCI-1378	0			c.T1153C						.						61.0	61.0	61.0					3																	170002334		2203	4299	6502	SO:0001819	synonymous_variant	5584	exon12			AATGTATTACTGG		CCDS3212.2	3q26.3	2008-07-18			ENSG00000163558	ENSG00000163558	2.7.11.13		9404	protein-coding gene	gene with protein product		600539		DXS1179E		7607695, 11978974	Standard	NM_002740		Approved	PKCI	uc003fgs.2	P41743	OTTHUMG00000150214	ENST00000295797.4:c.1153T>C	3.37:g.170002334T>C		Somatic	553	9		WXS	Illumina HiSeq	Phase_1	800	449	NM_002740	0	0	5	17	12	D3DNQ4|Q8WW06	Silent	SNP	ENST00000295797.4	37	CCDS3212.2																																																																																			.		0.338	PRKCI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316866.3	NM_002740	
HTT	3064	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	3230734	3230734	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr4:3230734T>C	ENST00000355072.5	+	59	8252	c.8107T>C	c.(8107-8109)Tcc>Ccc	p.S2703P	HTT_ENST00000513806.1_3'UTR	NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	2703					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		GGTGGTCAGATCCGTAAGTGA	0.602																																					p.S2703P													.	HTT-281	0			c.T8107C						.						84.0	88.0	87.0					4																	3230734		2182	4272	6454	SO:0001583	missense	3064	exon59			GTCAGATCCGTAA	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.8107T>C	4.37:g.3230734T>C	ENSP00000347184:p.Ser2703Pro	Somatic	55	1		WXS	Illumina HiSeq	Phase_I	54	21	NM_002111	0	0	0	0	0	Q9UQB7	Missense_Mutation	SNP	ENST00000355072.5	37	CCDS43206.1	.	.	.	.	.	.	.	.	.	.	T	19.84	3.901641	0.72754	.	.	ENSG00000197386	ENST00000355072	T	0.08458	3.09	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.20129	0.0484	M	0.73962	2.25	0.80722	D	1	D	0.58620	0.983	P	0.50590	0.645	T	0.01301	-1.1391	10	0.87932	D	0	.	14.7618	0.69612	0.0:0.0:0.0:1.0	.	2703	P42858	HD_HUMAN	P	2703	ENSP00000347184:S2703P	ENSP00000347184:S2703P	S	+	1	0	HTT	3200532	1.000000	0.71417	0.609000	0.28983	0.275000	0.26752	7.679000	0.84048	1.904000	0.55121	0.460000	0.39030	TCC	.		0.602	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
DDX60L	91351	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	4	169382991	169382991	+	Silent	SNP	C	C	T	rs17612630	byFrequency	TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr4:169382991C>T	ENST00000511577.1	-	5	712	c.465G>A	c.(463-465)acG>acA	p.T155T	DDX60L_ENST00000505890.1_Silent_p.T155T|DDX60L_ENST00000260184.7_Silent_p.T155T			Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	155							ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		TAAAAAGGTACGTTTGTAAAT	0.368																																					p.T155T		.											.	DDX60L-69	0			c.G465A						.						59.0	53.0	55.0					4																	169382991		1850	4090	5940	SO:0001819	synonymous_variant	91351	exon5			AAGGTACGTTTGT	AK092461	CCDS47161.1	4q32.3	2008-01-08				ENSG00000181381			26429	protein-coding gene	gene with protein product							Standard	XM_005263341		Approved	FLJ31033	uc003irq.4	Q5H9U9		ENST00000511577.1:c.465G>A	4.37:g.169382991C>T		Somatic	108	0		WXS	Illumina HiSeq	Phase_I	93	21	NM_001012967	0	0	2	5	3	Q96ND6	Silent	SNP	ENST00000511577.1	37																																																																																				C|0.904;A|0.096		0.368	DDX60L-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000364839.1	NM_001012967	
SLC12A7	10723	broad.mit.edu	37	5	1087140	1087140	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr5:1087140A>C	ENST00000264930.5	-	6	596	c.553T>G	c.(553-555)Tcc>Gcc	p.S185A		NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	185					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	ATGTAGTAGGACCCGCCAGCT	0.637																																					p.S185A													.	SLC12A7-138	0			c.T553G						.						21.0	22.0	22.0					5																	1087140		2197	4295	6492	SO:0001583	missense	10723	exon6			AGTAGGACCCGCC	AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.553T>G	5.37:g.1087140A>C	ENSP00000264930:p.Ser185Ala	Somatic	113	11		WXS	Illumina HiSeq	Phase_I	110	20	NM_006598	0	0	0	0	0	A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Missense_Mutation	SNP	ENST00000264930.5	37	CCDS34129.1	.	.	.	.	.	.	.	.	.	.	A	10.43	1.348266	0.24426	.	.	ENSG00000113504	ENST00000264930;ENST00000343658	D	0.98550	-4.99	3.93	3.93	0.45458	Amino acid permease domain (1);	0.067957	0.64402	N	0.000008	D	0.92916	0.7746	N	0.11106	0.095	0.53005	D	0.999961	B	0.15141	0.012	B	0.19946	0.027	D	0.89124	0.3505	10	0.07644	T	0.81	.	11.8847	0.52596	1.0:0.0:0.0:0.0	.	185	Q9Y666	S12A7_HUMAN	A	185	ENSP00000264930:S185A	ENSP00000264930:S185A	S	-	1	0	SLC12A7	1140140	1.000000	0.71417	0.996000	0.52242	0.228000	0.25075	6.424000	0.73366	1.562000	0.49601	0.459000	0.35465	TCC	.		0.637	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366446.2	NM_006598	
LIFR	3977	bcgsc.ca	37	5	38506175	38506175	+	Splice_Site	SNP	A	A	C			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr5:38506175A>C	ENST00000263409.4	-	9	1285	c.1123T>G	c.(1123-1125)Ttt>Gtt	p.F375V	LIFR_ENST00000503088.1_5'UTR|LIFR_ENST00000453190.2_Splice_Site_p.F375V	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha	375	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)			NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					TTTCCTGAAAAACTGTTAATT	0.254			T	PLAG1	salivary adenoma																																p.F375V	Melanoma(13;4 730 6426 9861 34751)			Dom	yes		5	5p13-p12	3977	leukemia inhibitory factor receptor		E	.	LIFR-1173	0			c.T1123G						.						35.0	37.0	37.0					5																	38506175		2200	4289	6489	SO:0001630	splice_region_variant	3977	exon9			CTGAAAAACTGTT	X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.1122-1T>G	5.37:g.38506175A>C		Somatic	294	5		WXS	Illumina HiSeq	Phase_1	274	92	NM_002310	0	0	0	0	0	Q6LCD9	Missense_Mutation	SNP	ENST00000263409.4	37	CCDS3927.1	.	.	.	.	.	.	.	.	.	.	A	14.64	2.597226	0.46318	.	.	ENSG00000113594	ENST00000263409;ENST00000453190	T;T	0.34472	1.36;1.36	5.45	2.84	0.33178	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.829009	0.11140	N	0.595326	T	0.37320	0.0999	M	0.78637	2.42	0.31000	N	0.720443	B	0.16802	0.019	B	0.17098	0.017	T	0.38757	-0.9646	10	0.21540	T	0.41	-21.4042	7.9903	0.30237	0.547:0.0:0.0:0.453	.	375	P42702	LIFR_HUMAN	V	375	ENSP00000263409:F375V;ENSP00000398368:F375V	ENSP00000263409:F375V	F	-	1	0	LIFR	38541932	1.000000	0.71417	0.996000	0.52242	0.972000	0.66771	2.188000	0.42612	0.856000	0.35383	0.533000	0.62120	TTT	.		0.254	LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253823.1	NM_002310	Missense_Mutation
IK	3550	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	140034136	140034136	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr5:140034136A>C	ENST00000417647.2	+	7	694	c.555A>C	c.(553-555)gaA>gaC	p.E185D		NM_006083.3	NP_006074.2	Q13123	RED_HUMAN	IK cytokine, down-regulator of HLA II	185	Poly-Glu.				cell-cell signaling (GO:0007267)|immune response (GO:0006955)	extracellular space (GO:0005615)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			large_intestine(1)	1		all_hematologic(541;4.8e-07)|all_lung(500;0.000434)|Lung NSC(810;0.00161)|Breast(839;0.128)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGAAAGAGGAAGAGGAACTGA	0.388																																					p.E185D		.											.	IK-67	0			c.A555C						.						44.0	44.0	44.0					5																	140034136		1831	4083	5914	SO:0001583	missense	3550	exon7			AGAGGAAGAGGAA	BC051295	CCDS47280.1	5q31.3	2008-08-07			ENSG00000113141	ENSG00000113141			5958	protein-coding gene	gene with protein product		600549				7970704	Standard	NM_006083		Approved		uc003lgq.3	Q13123	OTTHUMG00000163374	ENST00000417647.2:c.555A>C	5.37:g.140034136A>C	ENSP00000396301:p.Glu185Asp	Somatic	516	1		WXS	Illumina HiSeq	Phase_I	467	155	NM_006083	0	0	48	75	27	Q6IPD8	Missense_Mutation	SNP	ENST00000417647.2	37	CCDS47280.1	.	.	.	.	.	.	.	.	.	.	A	17.19	3.326795	0.60743	.	.	ENSG00000113141	ENST00000417647;ENST00000508301;ENST00000261812;ENST00000502899	.	.	.	5.86	1.66	0.24008	RED-like, N-terminal (1);	0.042187	0.85682	D	0.000000	T	0.32255	0.0823	N	0.17674	0.51	0.48975	D	0.999737	B;B	0.24132	0.01;0.098	B;B	0.27500	0.026;0.08	T	0.04509	-1.0946	9	0.20519	T	0.43	.	7.8062	0.29204	0.5957:0.0:0.4043:0.0	.	185;185	Q9UK43;Q13123	.;RED_HUMAN	D	185	.	ENSP00000261812:E185D	E	+	3	2	IK	140014320	0.973000	0.33851	1.000000	0.80357	0.990000	0.78478	0.251000	0.18257	0.653000	0.30826	0.460000	0.39030	GAA	.		0.388	IK-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372897.1	NM_006083	
PCDHA12	56137	broad.mit.edu	37	5	140256291	140256291	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr5:140256291G>A	ENST00000398631.2	+	1	1234	c.1234G>A	c.(1234-1236)Gcc>Acc	p.A412T	PCDHA8_ENST00000531613.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	412	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTGGACAGCGCCCTGGACCG	0.607																																					p.A412T	Pancreas(113;759 1672 13322 24104 50104)												.	.	0			c.G1234A						.						196.0	189.0	192.0					5																	140256291		2203	4300	6503	SO:0001583	missense	56137	exon1			GACAGCGCCCTGG	AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.1234G>A	5.37:g.140256291G>A	ENSP00000381628:p.Ala412Thr	Somatic	171	0		WXS	Illumina HiSeq	Phase_I	174	8	NM_018903	0	0	0	0	0	O75278|Q2M1N8	Missense_Mutation	SNP	ENST00000398631.2	37	CCDS47285.1	.	.	.	.	.	.	.	.	.	.	G	10.75	1.438589	0.25900	.	.	ENSG00000251664	ENST00000398631	T	0.02682	4.2	4.81	-1.86	0.07760	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.02304	0.0071	L	0.35593	1.075	0.09310	N	1	B;B	0.33528	0.056;0.416	B;B	0.37550	0.042;0.253	T	0.45071	-0.9286	9	0.33141	T	0.24	.	0.7087	0.00920	0.22:0.1806:0.3273:0.2721	.	412;412	Q9UN75-2;Q9UN75	.;PCDAC_HUMAN	T	412	ENSP00000381628:A412T	ENSP00000381628:A412T	A	+	1	0	PCDHA12	140236475	0.000000	0.05858	0.001000	0.08648	0.862000	0.49288	-1.193000	0.03049	-0.044000	0.13491	0.655000	0.94253	GCC	.		0.607	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372882.2	NM_018903	
PCDHGA11	56105	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	140800833	140800833	+	Silent	SNP	G	G	A			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr5:140800833G>A	ENST00000398587.2	+	1	72	c.39G>A	c.(37-39)ctG>ctA	p.L13L	PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA11_ENST00000518882.1_Silent_p.L13L|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron	NM_018914.2|NM_032092.1	NP_061737.1|NP_114481.1	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11	13					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(8)|kidney(3)|large_intestine(9)|lung(22)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAGTCGGCTGCTGCTGCTGC	0.607																																					p.L13L													.	.	0			c.G39A						.						9.0	12.0	11.0					5																	140800833		1940	4125	6065	SO:0001819	synonymous_variant	56105	exon1			TCGGCTGCTGCTG	AF152505	CCDS47294.1, CCDS54930.1, CCDS75345.1	5q31	2010-01-26			ENSG00000253873	ENSG00000253873		"""Cadherins / Protocadherins : Clustered"""	8698	other	protocadherin		606298				10380929	Standard	NM_018914		Approved	PCDH-GAMMA-A11		Q9Y5H2	OTTHUMG00000164055	ENST00000398587.2:c.39G>A	5.37:g.140800833G>A		Somatic	42	0		WXS	Illumina HiSeq	Phase_I	39	12	NM_032091	0	0	0	0	0	B7ZVY8|Q9Y5D8|Q9Y5D9	Silent	SNP	ENST00000398587.2	37	CCDS47294.1																																																																																			.		0.607	PCDHGA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376974.1	NM_018914	
CDKAL1	54901	broad.mit.edu;bcgsc.ca	37	6	20739778	20739778	+	Missense_Mutation	SNP	G	G	C	rs139954896		TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr6:20739778G>C	ENST00000378610.1	+	4	410	c.400G>C	c.(400-402)Gta>Cta	p.V134L	CDKAL1_ENST00000274695.4_Missense_Mutation_p.V134L|CDKAL1_ENST00000378624.4_Missense_Mutation_p.V64L			Q5VV42	CDKAL_HUMAN	CDK5 regulatory subunit associated protein 1-like 1	134	MTTase N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00780}.				maintenance of translational fidelity (GO:1990145)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|N6-threonylcarbomyladenosine methylthiotransferase activity (GO:0035598)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(14)|ovary(2)|stomach(1)	29	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)			CAAGAAAATCGTACTGGCTGG	0.433																																					p.V134L													.	CDKAL1-92	0			c.G400C						.						59.0	58.0	58.0					6																	20739778		2203	4300	6503	SO:0001583	missense	54901	exon6			AAAATCGTACTGG	AK000349	CCDS4546.1	6p22.2	2008-02-05			ENSG00000145996	ENSG00000145996			21050	protein-coding gene	gene with protein product		611259					Standard	NM_017774		Approved	FLJ20342	uc003ndd.2	Q5VV42	OTTHUMG00000014340	ENST00000378610.1:c.400G>C	6.37:g.20739778G>C	ENSP00000367873:p.Val134Leu	Somatic	60	1		WXS	Illumina HiSeq	Phase_I	45	11	NM_017774	0	0	2	3	1	A8K6S0|Q6P385|Q6ZR27|Q9NXB3	Missense_Mutation	SNP	ENST00000378610.1	37	CCDS4546.1	.	.	.	.	.	.	.	.	.	.	.	16.79	3.219539	0.58560	.	.	ENSG00000145996	ENST00000274695;ENST00000378624;ENST00000378610	T;T;T	0.50813	0.73;0.77;0.73	4.77	4.77	0.60923	Methylthiotransferase, N-terminal (2);	0.000000	0.64402	D	0.000001	T	0.56470	0.1987	M	0.80616	2.505	0.46749	D	0.999189	P;P	0.48998	0.918;0.592	P;P	0.54706	0.759;0.727	T	0.60301	-0.7290	10	0.42905	T	0.14	-13.099	16.602	0.84818	0.0:0.0:1.0:0.0	.	64;134	Q5VV42-2;Q5VV42	.;CDKAL_HUMAN	L	134;64;134	ENSP00000274695:V134L;ENSP00000367889:V64L;ENSP00000367873:V134L	ENSP00000274695:V134L	V	+	1	0	CDKAL1	20847757	1.000000	0.71417	0.625000	0.29200	0.147000	0.21601	8.674000	0.91191	2.192000	0.70111	0.557000	0.71058	GTA	G|1.000;A|0.000		0.433	CDKAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039986.1	NM_017774	
NFYA	4800	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	41059422	41059422	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr6:41059422G>A	ENST00000341376.6	+	7	904	c.703G>A	c.(703-705)Ggg>Agg	p.G235R	NFYA_ENST00000353205.5_Missense_Mutation_p.G206R|OARD1_ENST00000480585.1_Intron	NM_002505.4	NP_002496.1	P23511	NFYA_HUMAN	nuclear transcription factor Y, alpha	235					cellular lipid metabolic process (GO:0044255)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|small molecule metabolic process (GO:0044281)|transcription from RNA polymerase II promoter (GO:0006366)	CCAAT-binding factor complex (GO:0016602)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|large_intestine(4)|lung(2)|urinary_tract(1)	9	Ovarian(28;0.0418)|Colorectal(47;0.196)					CAATTCAGGAGGGATGGTCAT	0.418																																					p.G235R		.											.	NFYA-226	0			c.G703A						.						229.0	209.0	216.0					6																	41059422		2203	4300	6503	SO:0001583	missense	4800	exon7			TCAGGAGGGATGG		CCDS4849.1, CCDS4850.1	6p21.3	2008-11-11			ENSG00000001167	ENSG00000001167			7804	protein-coding gene	gene with protein product		189903				1774067, 9612081	Standard	NM_002505		Approved	HAP2, CBF-B, NF-YA	uc003opo.3	P23511	OTTHUMG00000014669	ENST00000341376.6:c.703G>A	6.37:g.41059422G>A	ENSP00000345702:p.Gly235Arg	Somatic	58	0		WXS	Illumina HiSeq	Phase_I	55	21	NM_002505	0	0	0	0	0	Q8IXU0	Missense_Mutation	SNP	ENST00000341376.6	37	CCDS4849.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.975651	0.92919	.	.	ENSG00000001167	ENST00000341376;ENST00000353205	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.71702	0.3371	L	0.51422	1.61	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.72364	-0.4316	9	0.62326	D	0.03	-10.6151	18.9483	0.92630	0.0:0.0:1.0:0.0	.	206;235	P23511-2;P23511	.;NFYA_HUMAN	R	235;206	.	ENSP00000345702:G235R	G	+	1	0	NFYA	41167400	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.760000	0.98935	2.720000	0.93068	0.655000	0.94253	GGG	.		0.418	NFYA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040496.1		
MAD1L1	8379	bcgsc.ca	37	7	2275155	2275155	+	5'Flank	SNP	G	G	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr7:2275155G>T	ENST00000406869.1	-	0	0				FTSJ2_ENST00000440306.2_3'UTR|MAD1L1_ENST00000265854.7_5'Flank|MAD1L1_ENST00000399654.2_5'Flank|FTSJ2_ENST00000242257.8_Missense_Mutation_p.H115N|MAD1L1_ENST00000402746.1_5'Flank|FTSJ2_ENST00000486040.1_5'UTR|FTSJ2_ENST00000407040.1_Missense_Mutation_p.H21N			Q9Y6D9	MD1L1_HUMAN	MAD1 mitotic arrest deficient-like 1 (yeast)						mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|regulation of metaphase plate congression (GO:0090235)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|spindle (GO:0005819)				central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(5)	36		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		GGGAATATGTGAAGAAGATCT	0.478																																					p.H115N													.	FTSJ2-91	0			c.C343A						.						59.0	58.0	59.0					7																	2275155		2203	4300	6503	SO:0001631	upstream_gene_variant	29960	exon3			ATATGTGAAGAAG	U33822	CCDS43539.1	7p22	2013-01-17	2001-11-28		ENSG00000002822	ENSG00000002822			6762	protein-coding gene	gene with protein product		602686	"""MAD1 (mitotic arrest deficient, yeast, homolog)-like 1"""			10049595, 9546394	Standard	XM_005249876		Approved	HsMAD1, TXBP181, MAD1, PIG9, TP53I9	uc003slg.1	Q9Y6D9	OTTHUMG00000151493		7.37:g.2275155G>T	Exception_encountered	Somatic	29	1		WXS	Illumina HiSeq	Phase_1	74	27	NM_013393	0	0	14	23	9	B3KR41|Q13312|Q75MI0|Q86UM4|Q9UNH0	Missense_Mutation	SNP	ENST00000406869.1	37	CCDS43539.1	.	.	.	.	.	.	.	.	.	.	G	12.11	1.840599	0.32513	.	.	ENSG00000122687	ENST00000242257;ENST00000407040	T;T	0.29397	1.57;1.57	5.47	5.47	0.80525	Ribosomal RNA methyltransferase RrmJ/FtsJ (1);	0.125817	0.52532	D	0.000064	T	0.21841	0.0526	N	0.16368	0.405	0.80722	D	1	B	0.12630	0.006	B	0.17722	0.019	T	0.03335	-1.1047	10	0.49607	T	0.09	13.2481	14.2064	0.65737	0.0:0.0:0.8506:0.1494	.	115	Q9UI43	RRMJ2_HUMAN	N	115;21	ENSP00000242257:H115N;ENSP00000384423:H21N	ENSP00000242257:H115N	H	-	1	0	FTSJ2	2241681	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.790000	0.55461	2.565000	0.86533	0.655000	0.94253	CAC	.		0.478	MAD1L1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322871.1	NM_003550	
NOD1	10392	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	30492406	30492406	+	Silent	SNP	G	G	A			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr7:30492406G>A	ENST00000222823.4	-	6	1152	c.627C>T	c.(625-627)tcC>tcT	p.S209S	NOD1_ENST00000423334.2_Intron	NM_006092.2	NP_006083.1	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain containing 1	209	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPK activity (GO:0000187)|apoptotic process (GO:0006915)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-8 biosynthetic process (GO:0042228)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of tumor necrosis factor production (GO:0032760)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|identical protein binding (GO:0042802)|peptidoglycan binding (GO:0042834)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|skin(2)	39						GTAGCAGCATGGACTTGCCCA	0.612																																					p.S209S		.											.	NOD1-229	0			c.C627T						.						89.0	86.0	87.0					7																	30492406		2203	4300	6503	SO:0001819	synonymous_variant	10392	exon6			CAGCATGGACTTG	AF126484	CCDS5427.1	7p15-p14	2006-12-08	2006-12-08	2006-12-08	ENSG00000106100	ENSG00000106100		"""Nucleotide-binding domain and leucine rich repeat containing"""	16390	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 1"", ""NLR family, CARD domain containing 1"""	605980	"""caspase recruitment domain family, member 4"""	CARD4		10224040, 10329646	Standard	NM_006092		Approved	NLRC1, CLR7.1	uc003tav.3	Q9Y239	OTTHUMG00000023923	ENST00000222823.4:c.627C>T	7.37:g.30492406G>A		Somatic	53	0		WXS	Illumina HiSeq	Phase_I	83	23	NM_006092	0	0	0	3	3	B4DTU3|Q549U4|Q8IWF5	Silent	SNP	ENST00000222823.4	37	CCDS5427.1																																																																																			.		0.612	NOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250443.2		
ZNF273	10793	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	64388953	64388953	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr7:64388953C>G	ENST00000476120.1	+	4	1318	c.1247C>G	c.(1246-1248)aCt>aGt	p.T416S	ZNF273_ENST00000527278.1_3'UTR|ZNF273_ENST00000319636.5_Missense_Mutation_p.T351S	NM_021148.2	NP_066971.2	Q14593	ZN273_HUMAN	zinc finger protein 273	416					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Lung NSC(55;0.0295)|all_lung(88;0.0691)				CGGTCCACAACTCTTACTAAA	0.348																																					p.T416S	Ovarian(154;605 895 6696 7659 15316 19321 21716 23848 32322 36932)	.											.	ZNF273-90	0			c.C1247G						.						40.0	44.0	42.0					7																	64388953		2203	4298	6501	SO:0001583	missense	10793	exon4			CCACAACTCTTAC	X78932	CCDS5528.2	7q11.21	2013-01-08				ENSG00000198039		"""Zinc fingers, C2H2-type"", ""-"""	13067	protein-coding gene	gene with protein product		604756				7865130	Standard	NR_003099		Approved	HZF9	uc003tto.3	Q14593		ENST00000476120.1:c.1247C>G	7.37:g.64388953C>G	ENSP00000418719:p.Thr416Ser	Somatic	103	0		WXS	Illumina HiSeq	Phase_I	169	77	NM_021148	0	0	1	1	0	B3KQZ5|Q6P3V4	Missense_Mutation	SNP	ENST00000476120.1	37	CCDS5528.2	.	.	.	.	.	.	.	.	.	.	.	5.424	0.263316	0.10294	.	.	ENSG00000198039	ENST00000476120;ENST00000319636	T;T	0.03358	3.96;3.96	1.16	1.16	0.20824	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02230	0.0069	N	0.11724	0.165	0.09310	N	1	B	0.19445	0.036	B	0.25405	0.06	T	0.50250	-0.8850	9	0.12103	T	0.63	.	7.3527	0.26700	0.0:1.0:0.0:0.0	.	416	Q14593	ZN273_HUMAN	S	416;351	ENSP00000418719:T416S;ENSP00000324518:T351S	ENSP00000324518:T351S	T	+	2	0	ZNF273	64026388	0.000000	0.05858	0.757000	0.31301	0.755000	0.42902	-6.036000	0.00084	0.202000	0.20498	0.205000	0.17691	ACT	.		0.348	ZNF273-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313502.1		
ABCB4	5244	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	87049331	87049331	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr7:87049331T>C	ENST00000265723.4	-	19	2488	c.2377A>G	c.(2377-2379)Aaa>Gaa	p.K793E	ABCB4_ENST00000358400.3_Missense_Mutation_p.K793E|ABCB4_ENST00000359206.3_Missense_Mutation_p.K793E|ABCB4_ENST00000453593.1_Missense_Mutation_p.K793E|ABCB4_ENST00000545634.1_Missense_Mutation_p.K793E	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	793	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	AGCATTGCTTTAAAAGCCATT	0.423																																					p.K793E		.											.	ABCB4-96	0			c.A2377G						.						183.0	167.0	173.0					7																	87049331		2203	4300	6503	SO:0001583	missense	5244	exon19			TTGCTTTAAAAGC	M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.2377A>G	7.37:g.87049331T>C	ENSP00000265723:p.Lys793Glu	Somatic	111	0		WXS	Illumina HiSeq	Phase_I	148	64	NM_018850	0	0	3	3	0	A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Missense_Mutation	SNP	ENST00000265723.4	37	CCDS5606.1	.	.	.	.	.	.	.	.	.	.	T	13.65	2.299295	0.40694	.	.	ENSG00000005471	ENST00000359206;ENST00000358400;ENST00000265723;ENST00000453593;ENST00000545634	D;D;D;D;D	0.89810	-2.57;-2.57;-2.57;-2.57;-2.57	6.03	2.37	0.29283	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.390503	0.30003	N	0.010651	D	0.84543	0.5495	L	0.58101	1.795	0.31324	N	0.685702	B;B;B	0.10296	0.003;0.002;0.003	B;B;B	0.16722	0.016;0.007;0.012	T	0.80286	-0.1446	10	0.62326	D	0.03	-9.0118	6.8919	0.24234	0.0:0.1317:0.1275:0.7408	.	793;793;793	A4D1D5;P21439-2;P21439	.;.;MDR3_HUMAN	E	793	ENSP00000352135:K793E;ENSP00000351172:K793E;ENSP00000265723:K793E;ENSP00000392983:K793E;ENSP00000437465:K793E	ENSP00000265723:K793E	K	-	1	0	ABCB4	86887267	0.999000	0.42202	0.992000	0.48379	0.639000	0.38242	1.584000	0.36589	0.497000	0.27926	-0.256000	0.11100	AAA	.		0.423	ABCB4-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000336083.1	NM_000443	
GIGYF1	64599	bcgsc.ca	37	7	100279776	100279776	+	Silent	SNP	C	C	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr7:100279776C>T	ENST00000275732.5	-	22	4053	c.2844G>A	c.(2842-2844)acG>acA	p.T948T	GIGYF1_ENST00000471340.2_5'Flank	NM_022574.4	NP_072096.2	O75420	PERQ1_HUMAN	GRB10 interacting GYF protein 1	948					insulin-like growth factor receptor signaling pathway (GO:0048009)					central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					TGGCTTCCAGCGTGTCCCCCA	0.592																																					p.T948T													.	GIGYF1-136	0			c.G2844A						.						70.0	73.0	72.0					7																	100279776		2203	4300	6503	SO:0001819	synonymous_variant	64599	exon22			TTCCAGCGTGTCC	AF053356	CCDS34708.1	7q22	2008-02-11	2008-02-11	2008-02-11	ENSG00000146830	ENSG00000146830			9126	protein-coding gene	gene with protein product	"""GYF domain containing 1"""	612064	"""PERQ amino acid rich, with GYF domain 1"""	PERQ1		9799793, 12771153	Standard	NM_022574		Approved	GYF1	uc003uwg.1	O75420	OTTHUMG00000157036	ENST00000275732.5:c.2844G>A	7.37:g.100279776C>T		Somatic	36	0		WXS	Illumina HiSeq	Phase_1	58	4	NM_022574	0	0	32	32	0	Q6Y7W7|Q8WZ38	Silent	SNP	ENST00000275732.5	37	CCDS34708.1																																																																																			.		0.592	GIGYF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347205.2	NM_022574	
SRRT	51593	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	100485329	100485329	+	Silent	SNP	T	T	C			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr7:100485329T>C	ENST00000347433.4	+	17	2333	c.2175T>C	c.(2173-2175)ccT>ccC	p.P725P	SRRT_ENST00000457580.2_Silent_p.P725P|SRRT_ENST00000388793.4_Silent_p.P724P|SRRT_ENST00000432932.1_Silent_p.P724P			Q9BXP5	SRRT_HUMAN	serrate, RNA effector molecule	725					cell proliferation (GO:0008283)|neuronal stem cell maintenance (GO:0097150)|primary miRNA processing (GO:0031053)|regulation of transcription, DNA-templated (GO:0006355)|response to arsenic-containing substance (GO:0046685)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						CCCAGGGTCCTGAGTTTGTGC	0.527																																					p.P725P													.	SRRT-92	0			c.T2175C						.						119.0	126.0	124.0					7																	100485329		2203	4300	6503	SO:0001819	synonymous_variant	51593	exon17			GGGTCCTGAGTTT		CCDS34709.1, CCDS47665.1, CCDS47666.1, CCDS47667.1	7q21	2014-04-14	2014-04-14		ENSG00000087087	ENSG00000087087			24101	protein-coding gene	gene with protein product	"""arsenite resistance protein"""	614469	"""serrate RNA effector molecule homolog (Arabidopsis)"""			11239002, 11230166	Standard	NM_015908		Approved	Asr2, serrate, ARS2	uc003uwy.2	Q9BXP5	OTTHUMG00000157031	ENST00000347433.4:c.2175T>C	7.37:g.100485329T>C		Somatic	123	2		WXS	Illumina HiSeq	Phase_I	189	62	NM_001128853	0	0	0	1	1	A4D2E5|A4D2E6|A6NK22|B4DJL4|B4DZA6|O95808|Q32MI4|Q6NT74|Q8TDQ5|Q9BWP6|Q9BXP4|Q9Y4S4	Silent	SNP	ENST00000347433.4	37	CCDS34709.1																																																																																			.		0.527	SRRT-004	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347168.1	NM_015908	
PPP2CB	5516	bcgsc.ca	37	8	30651447	30651447	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr8:30651447G>C	ENST00000221138.4	-	5	1174	c.724C>G	c.(724-726)Cag>Gag	p.Q242E	PPP2CB_ENST00000518564.1_Intron	NM_001009552.1	NP_001009552.1	P62714	PP2AB_HUMAN	protein phosphatase 2, catalytic subunit, beta isozyme	242					apoptotic mitochondrial changes (GO:0008637)|fibroblast growth factor receptor signaling pathway (GO:0008543)|negative regulation of Ras protein signal transduction (GO:0046580)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|regulation of gene expression (GO:0010468)|response to antibiotic (GO:0046677)|response to endoplasmic reticulum stress (GO:0034976)|response to hydrogen peroxide (GO:0042542)	chromosome, centromeric region (GO:0000775)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	9				KIRC - Kidney renal clear cell carcinoma(542;0.095)|Kidney(114;0.114)	Vitamin E(DB00163)	ATTACAAGCTGGTGGGCACGA	0.393																																					p.Q242E													.	PPP2CB-658	0			c.C724G						.						71.0	58.0	63.0					8																	30651447		2203	4300	6503	SO:0001583	missense	5516	exon5			CAAGCTGGTGGGC		CCDS6079.1	8p12	2011-05-24	2010-03-05		ENSG00000104695	ENSG00000104695	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9300	protein-coding gene	gene with protein product	"""protein phosphatase 2A catalytic subunit, beta isoform"""	176916	"""protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform"""			8383590	Standard	NM_001009552		Approved	PP2Abeta	uc003xik.3	P62714	OTTHUMG00000163949	ENST00000221138.4:c.724C>G	8.37:g.30651447G>C	ENSP00000221138:p.Gln242Glu	Somatic	380	5		WXS	Illumina HiSeq	Phase_1	350	122	NM_001009552	0	0	53	109	56	D3DSV4|P11082|Q6FHK5	Missense_Mutation	SNP	ENST00000221138.4	37	CCDS6079.1	.	.	.	.	.	.	.	.	.	.	G	17.77	3.471144	0.63625	.	.	ENSG00000104695	ENST00000221138;ENST00000406655;ENST00000520334	T;T	0.56275	0.47;0.47	5.14	4.25	0.50352	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (2);Metallophosphoesterase domain (1);	0.000000	0.85682	D	0.000000	T	0.70272	0.3205	M	0.76002	2.32	0.58432	D	0.999999	D	0.89917	1.0	D	0.78314	0.991	T	0.73978	-0.3812	10	0.87932	D	0	-12.013	13.0676	0.59043	0.0789:0.0:0.9211:0.0	.	242	P62714	PP2AB_HUMAN	E	242;242;80	ENSP00000221138:Q242E;ENSP00000430758:Q80E	ENSP00000221138:Q242E	Q	-	1	0	PPP2CB	30770989	1.000000	0.71417	1.000000	0.80357	0.655000	0.38815	7.647000	0.83462	2.536000	0.85505	0.655000	0.94253	CAG	.		0.393	PPP2CB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376527.2	NM_001009552	
PRKDC	5591	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	48809814	48809814	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr8:48809814C>G	ENST00000314191.2	-	30	3561	c.3505G>C	c.(3505-3507)Gtc>Ctc	p.V1169L	PRKDC_ENST00000523565.1_5'UTR|PRKDC_ENST00000338368.3_Missense_Mutation_p.V1169L	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	1169					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	AGCCACTTGACCAGATCCAAT	0.438								Non-homologous end-joining																													.	Esophageal Squamous(79;1091 1253 12329 31680 40677)												.	PRKDC-1515	0			.						.						203.0	195.0	197.0					8																	48809814		1902	4137	6039	SO:0001583	missense	5591	.			ACTTGACCAGATC		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.3505G>C	8.37:g.48809814C>G	ENSP00000313420:p.Val1169Leu	Somatic	73	1		WXS	Illumina HiSeq	Phase_I	67	27	.	0	0	2	3	1	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Missense_Mutation	SNP	ENST00000314191.2	37		.	.	.	.	.	.	.	.	.	.	C	29.4	5.006298	0.93287	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	T;T	0.61742	0.08;0.08	5.7	5.7	0.88788	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000001	T	0.79088	0.4387	.	.	.	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.83275	0.996;0.942	T	0.80717	-0.1258	9	0.72032	D	0.01	.	19.8316	0.96638	0.0:1.0:0.0:0.0	.	1169;1169	E7EUY0;P78527	.;PRKDC_HUMAN	L	1169	ENSP00000313420:V1169L;ENSP00000345182:V1169L	ENSP00000313420:V1169L	V	-	1	0	PRKDC	48972367	1.000000	0.71417	0.991000	0.47740	0.768000	0.43524	7.114000	0.77103	2.687000	0.91594	0.563000	0.77884	GTC	.		0.438	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001081640	
ST18	9705	broad.mit.edu	37	8	53077753	53077753	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr8:53077753G>T	ENST00000276480.7	-	12	1920	c.1237C>A	c.(1237-1239)Ccc>Acc	p.P413T		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	413					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				CCCGGCGTGGGACACTTGAGC	0.403																																					p.P413T													.	ST18-95	0			c.C1237A						.						193.0	184.0	187.0					8																	53077753		2203	4300	6503	SO:0001583	missense	9705	exon12			GCGTGGGACACTT	AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.1237C>A	8.37:g.53077753G>T	ENSP00000276480:p.Pro413Thr	Somatic	59	0		WXS	Illumina HiSeq	Phase_I	53	3	NM_014682	0	0	0	0	0	Q17RY1	Missense_Mutation	SNP	ENST00000276480.7	37	CCDS6149.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.510803	0.85389	.	.	ENSG00000147488	ENST00000276480;ENST00000517580	T;T	0.70399	0.15;-0.48	5.92	5.92	0.95590	.	0.050397	0.85682	D	0.000000	D	0.85557	0.5724	M	0.77406	2.37	0.80722	D	1	D;D	0.89917	1.0;0.984	D;P	0.91635	0.999;0.841	D	0.85728	0.1329	10	0.66056	D	0.02	-20.0237	20.3081	0.98638	0.0:0.0:1.0:0.0	.	413;413	E5RHS3;O60284	.;ST18_HUMAN	T	413	ENSP00000276480:P413T;ENSP00000428521:P413T	ENSP00000276480:P413T	P	-	1	0	ST18	53240306	1.000000	0.71417	0.997000	0.53966	0.930000	0.56654	7.925000	0.87563	2.795000	0.96236	0.655000	0.94253	CCC	.		0.403	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377867.1		
RB1CC1	9821	bcgsc.ca	37	8	53569322	53569322	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr8:53569322G>A	ENST00000025008.5	-	15	3590	c.3067C>T	c.(3067-3069)Caa>Taa	p.Q1023*	RB1CC1_ENST00000435644.2_Nonsense_Mutation_p.Q1023*|RB1CC1_ENST00000539297.1_Nonsense_Mutation_p.Q1023*|RB1CC1_ENST00000521611.1_Intron	NM_014781.4	NP_055596.3	Q8TDY2	RBCC1_HUMAN	RB1-inducible coiled-coil 1	1023					autophagic vacuole assembly (GO:0000045)|cell cycle (GO:0007049)|heart development (GO:0007507)|JNK cascade (GO:0007254)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell size (GO:0045793)|positive regulation of protein phosphorylation (GO:0001934)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)				NS(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(19)|ovary(8)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	60		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				TTAATTATTTGTTGGTTTTCC	0.343																																					p.Q1023X	GBM(180;1701 2102 13475 42023 52570)												.	RB1CC1-170	0			c.C3067T						.						88.0	98.0	95.0					8																	53569322		2203	4300	6503	SO:0001587	stop_gained	9821	exon15			TTATTTGTTGGTT	AB059622	CCDS34892.1, CCDS47856.1	8q11	2014-06-13				ENSG00000023287			15574	protein-coding gene	gene with protein product	"""200 kDa FAK family kinase-interacting protein"", ""phosphatase 1, regulatory subunit 131"""	606837				11850849, 7724523, 18443221	Standard	NM_014781		Approved	KIAA0203, Cc1, DRAGOU14, FIP200, ATG17, PPP1R131	uc003xre.4	Q8TDY2		ENST00000025008.5:c.3067C>T	8.37:g.53569322G>A	ENSP00000025008:p.Gln1023*	Somatic	101	2		WXS	Illumina HiSeq	Phase_1	103	26	NM_001083617	0	0	7	7	0	Q86YR4|Q8WVU9|Q92601	Nonsense_Mutation	SNP	ENST00000025008.5	37	CCDS34892.1	.	.	.	.	.	.	.	.	.	.	G	40	7.974633	0.98591	.	.	ENSG00000023287	ENST00000025008;ENST00000435644;ENST00000539297	.	.	.	5.05	3.19	0.36642	.	0.462954	0.25408	N	0.030888	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	-1.8988	15.3415	0.74300	0.0:0.2653:0.7347:0.0	.	.	.	.	X	1023	.	ENSP00000025008:Q1023X	Q	-	1	0	RB1CC1	53731875	0.868000	0.29978	0.034000	0.17996	0.142000	0.21351	3.458000	0.53014	0.607000	0.29982	-0.310000	0.09108	CAA	.		0.343	RB1CC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378011.1	NM_014781	
BCOR	54880	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	39932148	39932148	+	Silent	SNP	A	A	G			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chrX:39932148A>G	ENST00000378444.4	-	4	2679	c.2451T>C	c.(2449-2451)acT>acC	p.T817T	BCOR_ENST00000342274.4_Silent_p.T817T|BCOR_ENST00000397354.3_Silent_p.T817T|BCOR_ENST00000378455.4_Silent_p.T817T	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	817					heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						CGTTTGTGTCAGTTTTAGCAT	0.547			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																														p.T817T		.		Rec	yes		X	Xp11.4	54880	BCL6 corepressor	yes		.	BCOR-229	0			c.T2451C						.						89.0	87.0	88.0					X																	39932148		2202	4300	6502	SO:0001819	synonymous_variant	54880	exon4			TGTGTCAGTTTTA	AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.2451T>C	X.37:g.39932148A>G		Somatic	97	0		WXS	Illumina HiSeq	Phase_I	72	36	NM_001123385	0	0	0	3	3	D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Silent	SNP	ENST00000378444.4	37	CCDS48093.1																																																																																			.		0.547	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060666.2	NM_017745	
ZC3H11A	9877	hgsc.bcm.edu	37	1	203787783	203787786	+	Frame_Shift_Del	DEL	GACA	GACA	-			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	GACA	GACA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr1:203787783_203787786delGACA	ENST00000545588.1	+	3	3967_3970	c.140_143delGACA	c.(139-144)cgacagfs	p.RQ47fs	ZC3H11A_ENST00000367212.3_Frame_Shift_Del_p.RQ47fs|ZC3H11A_ENST00000367210.1_Frame_Shift_Del_p.RQ47fs|ZC3H11A_ENST00000332127.4_Frame_Shift_Del_p.RQ47fs|ZC3H11A_ENST00000367214.1_Frame_Shift_Del_p.RQ47fs	NM_001271675.1	NP_001258604.1	O75152	ZC11A_HUMAN	zinc finger CCCH-type containing 11A	47					poly(A)+ mRNA export from nucleus (GO:0016973)		metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)			CGCTGTTTTCGACAGGTGTGCAGG	0.426																																					p.47_48del		.											.	ZC3H11A-515	0			c.140_143del						.																																			SO:0001589	frameshift_variant	9877	exon6			.		CCDS30978.1	1q32.1	2012-07-05	2005-06-02	2005-06-02	ENSG00000058673	ENSG00000058673		"""Zinc fingers, CCCH-type domain containing"""	29093	protein-coding gene	gene with protein product		613513	"""zinc finger CCCH-type domain containing 11A"""	ZC3HDC11A		9734811	Standard	NM_014827		Approved	KIAA0663	uc001hac.3	O75152	OTTHUMG00000035909	ENST00000545588.1:c.140_143delGACA	1.37:g.203787783_203787786delGACA	ENSP00000438527:p.Arg47fs	Somatic	107	0		WXS	Illumina HiSeq	Phase_I	86	22	NM_014827	0	0	0	0	0	Q6AHY4|Q6AHY9|Q6AW79|Q6AWA1|Q6PJK4|Q86XZ7	Frame_Shift_Del	DEL	ENST00000545588.1	37	CCDS30978.1																																																																																			.		0.426	ZC3H11A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087471.3	NM_014827	
THSD1	55901	hgsc.bcm.edu;bcgsc.ca	37	13	52971551	52971551	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr13:52971551delG	ENST00000258613.4	-	3	1015	c.837delC	c.(835-837)cccfs	p.P279fs	THSD1_ENST00000349258.4_Frame_Shift_Del_p.P279fs|THSD1_ENST00000544466.1_Intron|RNY4P24_ENST00000362735.1_RNA	NM_018676.3	NP_061146.1	Q9NS62	THSD1_HUMAN	thrombospondin, type I, domain containing 1	279					hematopoietic progenitor cell differentiation (GO:0002244)	cell periphery (GO:0071944)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Breast(56;0.000207)|Lung NSC(96;0.00145)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.8e-08)		CAGGGTATCTGGGGGCCTCCT	0.537																																					p.P279fs		.											.	THSD1-94	0			c.837delC						.						75.0	74.0	74.0					13																	52971551		2203	4300	6503	SO:0001589	frameshift_variant	55901	exon3			.	AK096289	CCDS9432.1, CCDS9433.1	13q14.13	2010-04-20	2004-03-11		ENSG00000136114	ENSG00000136114			17754	protein-coding gene	gene with protein product			"""thrombospondin, type I, domain 1"""				Standard	NM_018676		Approved	TMTSP	uc001vgo.3	Q9NS62	OTTHUMG00000016963	ENST00000258613.4:c.837delC	13.37:g.52971551delG	ENSP00000258613:p.Pro279fs	Somatic	84	0		WXS	Illumina HiSeq	Phase_I	117	27	NM_018676	0	0	0	0	0	A2A3J3|B2RCF5|Q6P3U1|Q6UXZ2	Frame_Shift_Del	DEL	ENST00000258613.4	37	CCDS9432.1																																																																																			.		0.537	THSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045058.3		
FOXN1	8456	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	26851949	26851949	+	Frame_Shift_Del	DEL	C	C	-	rs548499213	byFrequency	TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr17:26851949delC	ENST00000226247.2	+	2	581	c.552delC	c.(550-552)ctcfs	p.L184fs	FOXN1_ENST00000579795.1_Frame_Shift_Del_p.L184fs	NM_003593.2	NP_003584.2	O15353	FOXN1_HUMAN	forkhead box N1	184					defense response (GO:0006952)|epidermis development (GO:0008544)|epithelial cell proliferation (GO:0050673)|hair follicle development (GO:0001942)|keratinocyte differentiation (GO:0030216)|lymphocyte homeostasis (GO:0002260)|nail development (GO:0035878)|organ morphogenesis (GO:0009887)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(3)|lung(8)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Lung NSC(42;0.00431)					GTAACGGGCTCCCCTACCCCA	0.647																																					p.L184fs		.											.	FOXN1-226	0			c.552delC						.						25.0	27.0	26.0					17																	26851949		2202	4300	6502	SO:0001589	frameshift_variant	8456	exon2			.	Y11739	CCDS11232.1	17q11-q12	2014-09-17	2003-06-12	2003-06-13	ENSG00000109101	ENSG00000109101		"""Forkhead boxes"""	12765	protein-coding gene	gene with protein product		600838	"""winged-helix nude"", ""Rowett nude"""	WHN, RONU		9321431	Standard	NM_003593		Approved	FKHL20	uc002hbj.3	O15353	OTTHUMG00000132603	ENST00000226247.2:c.552delC	17.37:g.26851949delC	ENSP00000226247:p.Leu184fs	Somatic	25	0		WXS	Illumina HiSeq	Phase_I	62	21	NM_003593	0	0	0	0	0	B2R9Q7|O15352	Frame_Shift_Del	DEL	ENST00000226247.2	37	CCDS11232.1																																																																																			.		0.647	FOXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255832.1		
YIPF3	25844	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	43483379	43483379	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr6:43483379delT	ENST00000372422.2	-	3	531	c.349delA	c.(349-351)atcfs	p.I117fs	POLR1C_ENST00000372344.2_5'Flank|POLR1C_ENST00000304004.3_5'Flank|YIPF3_ENST00000506469.1_Frame_Shift_Del_p.I123fs|POLR1C_ENST00000372389.3_5'Flank	NM_015388.3	NP_056203.2	Q9GZM5	YIPF3_HUMAN	Yip1 domain family, member 3	117					cell differentiation (GO:0030154)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|transport vesicle (GO:0030133)				large_intestine(2)|lung(4)|pancreas(1)|prostate(1)|skin(1)	9	all_cancers(18;3.79e-05)|Lung NSC(15;0.00217)|all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00736)|OV - Ovarian serous cystadenocarcinoma(102;0.0711)			GGTCTGAGGATGTCGATGTTG	0.517																																					p.I117fs		.											.	YIPF3-90	0			c.349delA						.						129.0	120.0	123.0					6																	43483379		2203	4300	6503	SO:0001589	frameshift_variant	25844	exon3			.	AK000946	CCDS4899.1	6p21.1	2009-10-06	2005-07-04	2005-07-04	ENSG00000137207	ENSG00000137207		"""Yip1 domain family"""	21023	protein-coding gene	gene with protein product		609775	"""chromosome 6 open reading frame 109"""	C6orf109			Standard	NM_015388		Approved	DKFZp566C243, KLIP1, dJ337H4.3, FinGER3	uc003ovl.2	Q9GZM5	OTTHUMG00000014738	ENST00000372422.2:c.349delA	6.37:g.43483379delT	ENSP00000361499:p.Ile117fs	Somatic	102	0		WXS	Illumina HiSeq	Phase_I	81	32	NM_015388	0	0	0	0	0	Q5JTD2|Q6FI85|Q8NI57|Q9NWE3|Q9Y3U9	Frame_Shift_Del	DEL	ENST00000372422.2	37	CCDS4899.1																																																																																			.		0.517	YIPF3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040639.2	NM_015388	
PPT1	5538	bcgsc.ca	37	1	40535490	40535491	+	IGR	INS	-	-	G	rs200369781|rs377554241|rs370362556	byFrequency	TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr1:40535490_40535491insG	ENST00000433473.3	-	0	2740				CAP1_ENST00000372797.3_Frame_Shift_Ins_p.R313fs|CAP1_ENST00000372792.2_Frame_Shift_Ins_p.R313fs|CAP1_ENST00000372805.3_Frame_Shift_Ins_p.R313fs|CAP1_ENST00000372798.1_Frame_Shift_Ins_p.R312fs|CAP1_ENST00000479759.1_3'UTR|CAP1_ENST00000340450.3_Frame_Shift_Ins_p.R312fs|CAP1_ENST00000372802.1_Frame_Shift_Ins_p.R312fs	NM_000310.3	NP_000301.1	P50897	PPT1_HUMAN	palmitoyl-protein thioesterase 1						adult locomotory behavior (GO:0008344)|associative learning (GO:0008306)|brain development (GO:0007420)|cell death (GO:0008219)|cellular protein catabolic process (GO:0044257)|cofactor metabolic process (GO:0051186)|cofactor transport (GO:0051181)|grooming behavior (GO:0007625)|lipid catabolic process (GO:0016042)|lysosomal lumen acidification (GO:0007042)|membrane raft organization (GO:0031579)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of neuron apoptotic process (GO:0043524)|nervous system development (GO:0007399)|neuron development (GO:0048666)|neurotransmitter secretion (GO:0007269)|pinocytosis (GO:0006907)|positive regulation of pinocytosis (GO:0048549)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein catabolic process (GO:0030163)|protein depalmitoylation (GO:0002084)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|regulation of phospholipase A2 activity (GO:0032429)|regulation of synapse structure and activity (GO:0050803)|sphingolipid catabolic process (GO:0030149)|visual perception (GO:0007601)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)	palmitoyl-(protein) hydrolase activity (GO:0008474)|palmitoyl-CoA hydrolase activity (GO:0016290)			endometrium(5)|large_intestine(1)|lung(3)|ovary(1)|stomach(1)	11	Lung NSC(20;3.43e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1e-18)|Epithelial(16;3.6e-17)|all cancers(16;1.1e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			ATCCCCCAAACGAGCCACAAAG	0.505																																					p.R313fs													.	CAP1-91	0			c.937_938insG						.																																			SO:0001628	intergenic_variant	10487	exon9			CCCAAACGAGCCA	U44772	CCDS447.1, CCDS44119.1	1p32	2014-09-17	2008-07-31		ENSG00000131238	ENSG00000131238	3.1.2.22		9325	protein-coding gene	gene with protein product	"""ceroid-lipofuscinosis, neuronal 1, infantile"""	600722		PPT		7637805, 8325646	Standard	NM_000310		Approved	CLN1, INCL	uc001cfb.2	P50897	OTTHUMG00000004495		1.37:g.40535491_40535491dupG		Somatic	215	1		WXS	Illumina HiSeq	Phase_1	197	22	NM_006367	0	0	0	0	0	B4DY24|Q6FGQ4	Frame_Shift_Ins	INS	ENST00000433473.3	37	CCDS447.1																																																																																			.		0.505	PPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000013126.2	NM_000310	
ATP2B1	490	hgsc.bcm.edu;bcgsc.ca	37	12	89992987	89992988	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr12:89992987_89992988insAA	ENST00000428670.3	-	20	3713_3714	c.3257_3258insTT	c.(3256-3258)ttafs	p.L1086fs	ATP2B1_ENST00000393164.2_Frame_Shift_Ins_p.L829fs|ATP2B1_ENST00000261173.2_Frame_Shift_Ins_p.L1086fs|ATP2B1_ENST00000348959.3_Frame_Shift_Ins_p.L1050fs|ATP2B1_ENST00000359142.3_Frame_Shift_Ins_p.L1086fs			P20020	AT2B1_HUMAN	ATPase, Ca++ transporting, plasma membrane 1	1086					blood coagulation (GO:0007596)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	45						CATCCTCTGCTAATTCCTCCTC	0.436																																					p.L1086fs		.											.	ATP2B1-516	0			c.3258_3259insTT						.																																			SO:0001589	frameshift_variant	490	exon19			.	J04027	CCDS9035.1, CCDS41817.1	12q21.33	2010-04-20			ENSG00000070961	ENSG00000070961	3.6.3.8	"""ATPases / P-type"""	814	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 1"""	108731				1674727	Standard	NM_001682		Approved	PMCA1	uc001tbh.3	P20020		ENST00000428670.3:c.3256_3257dupTT	12.37:g.89992988_89992989dupAA	ENSP00000392043:p.Leu1086fs	Somatic	66	0		WXS	Illumina HiSeq	Phase_I	83	30	NM_001001323	0	0	0	0	0	Q12992|Q12993|Q13819|Q13820|Q13821|Q16504|Q93082	Frame_Shift_Ins	INS	ENST00000428670.3	37	CCDS9035.1																																																																																			.		0.436	ATP2B1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406653.1	NM_001682	
ACOX2	8309	hgsc.bcm.edu;bcgsc.ca	37	3	58519841	58519842	+	Frame_Shift_Ins	INS	-	-	TATATTT			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr3:58519841_58519842insTATATTT	ENST00000302819.5	-	4	645_646	c.354_355insAAATATA	c.(352-357)atacacfs	p.H119fs	ACOX2_ENST00000459701.2_Frame_Shift_Ins_p.H119fs	NM_003500.3	NP_003491.1	Q99424	ACOX2_HUMAN	acyl-CoA oxidase 2, branched chain	119					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	3alpha,7alpha,12alpha-trihydroxy-5beta-cholestanoyl-CoA 24-hydroxylase activity (GO:0033791)|acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)|flavin adenine dinucleotide binding (GO:0050660)|pristanoyl-CoA oxidase activity (GO:0016402)|receptor binding (GO:0005102)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|prostate(1)|skin(3)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(55;0.000194)|Kidney(10;0.00255)|KIRC - Kidney renal clear cell carcinoma(10;0.00268)|OV - Ovarian serous cystadenocarcinoma(275;0.156)		AAGACTCTGTGTATATTTAAGG	0.54																																					p.H119fs		.											.	ACOX2-90	0			c.355_356insAAATATA						.																																			SO:0001589	frameshift_variant	8309	exon4			.	X95190	CCDS33775.1	3p14.3	2012-07-13	2010-04-30		ENSG00000168306	ENSG00000168306	1.17.99.3		120	protein-coding gene	gene with protein product	"""trihydroxycoprostanoyl-CoA oxidase"", ""3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholestanoyl-CoA 24-hydroxylase"""	601641	"""acyl-Coenzyme A oxidase 2, branched chain"""			8943006, 9070889	Standard	NM_003500		Approved	BRCACOX, BRCOX, THCCox	uc003dkl.3	Q99424	OTTHUMG00000159154	ENST00000302819.5:c.348_354dupAAATATA	3.37:g.58519842_58519848dupTATATTT	ENSP00000307697:p.His119fs	Somatic	81	0		WXS	Illumina HiSeq	Phase_I	65	12	NM_003500	0	0	0	0	0	A6NF16|B2R8U5	Frame_Shift_Ins	INS	ENST00000302819.5	37	CCDS33775.1																																																																																			.		0.540	ACOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353541.1		
OGDH	4967	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	44747231	44747232	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr7:44747231_44747232insA	ENST00000222673.5	+	22	2889_2890	c.2847_2848insA	c.(2848-2850)aatfs	p.N950fs	OGDH_ENST00000444676.1_Frame_Shift_Ins_p.N965fs|OGDH_ENST00000439616.2_Frame_Shift_Ins_p.N800fs|OGDH_ENST00000543843.1_Frame_Shift_Ins_p.N901fs|OGDH_ENST00000447398.1_Frame_Shift_Ins_p.N961fs|OGDH_ENST00000449767.1_Frame_Shift_Ins_p.N946fs	NM_002541.3	NP_002532.2	Q02218	ODO1_HUMAN	oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)	950					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|cerebellar cortex development (GO:0021695)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hippocampus development (GO:0021766)|lysine catabolic process (GO:0006554)|NADH metabolic process (GO:0006734)|olfactory bulb mitral cell layer development (GO:0061034)|pyramidal neuron development (GO:0021860)|small molecule metabolic process (GO:0044281)|striatum development (GO:0021756)|succinyl-CoA metabolic process (GO:0006104)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)|thalamus development (GO:0021794)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)|oxoglutarate dehydrogenase complex (GO:0045252)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (NAD+) activity (GO:0034602)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	36					Valproic Acid(DB00313)	AGAAGTACCCCAATGCTGAGCT	0.574																																					p.P949fs		.											.	OGDH-228	0			c.2847_2848insA						.																																			SO:0001589	frameshift_variant	4967	exon22			.	D10523	CCDS34627.1, CCDS47580.1, CCDS55107.1	7p13-p11.2	2010-11-23			ENSG00000105953	ENSG00000105953	1.2.4.2		8124	protein-coding gene	gene with protein product		613022				8020988, 1542694	Standard	NM_002541		Approved	E1k	uc003tln.3	Q02218	OTTHUMG00000155304	ENST00000222673.5:c.2849dupA	7.37:g.44747233_44747233dupA	ENSP00000222673:p.Asn950fs	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	102	38	NM_002541	0	0	0	0	0	B4E2U9|D3DVL0|E9PBM1|Q96DD3|Q9UDX0	Frame_Shift_Ins	INS	ENST00000222673.5	37	CCDS34627.1																																																																																			.		0.574	OGDH-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339391.1		
