#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AGRN	375790	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	987003	987003	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr1:987003C>A	ENST00000379370.2	+	32	5591	c.5541C>A	c.(5539-5541)ttC>ttA	p.F1847L		NM_198576.3	NP_940978.2	O00468	AGRIN_HUMAN	agrin	1851	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|clustering of voltage-gated sodium channels (GO:0045162)|extracellular matrix organization (GO:0030198)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuromuscular junction development (GO:0007528)|neurotransmitter receptor metabolic process (GO:0045213)|phototransduction, visible light (GO:0007603)|plasma membrane organization (GO:0007009)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of synaptic growth at neuromuscular junction (GO:0045887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor clustering (GO:0043113)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synapse organization (GO:0050808)	basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acetylcholine receptor regulator activity (GO:0030548)|calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|dystroglycan binding (GO:0002162)|heparan sulfate proteoglycan binding (GO:0043395)|laminin binding (GO:0043236)|sialic acid binding (GO:0033691)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	42	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		CCGGGGGATTCTCAGGACCGC	0.711																																					p.F1847L		.											.	AGRN-136	0			c.C5541A						.						24.0	25.0	25.0					1																	987003		2199	4296	6495	SO:0001583	missense	375790	exon32			GGGATTCTCAGGA	XM_372195	CCDS30551.1	1p36.33	2014-09-17		2007-02-16	ENSG00000188157	ENSG00000188157		"""Proteoglycans / Extracellular Matrix : Other"""	329	protein-coding gene	gene with protein product	"""agrin proteoglycan"""	103320				1851019, 12270958	Standard	NM_198576		Approved	AGRIN	uc001ack.2	O00468	OTTHUMG00000040778	ENST00000379370.2:c.5541C>A	1.37:g.987003C>A	ENSP00000368678:p.Phe1847Leu	Somatic	17	0		WXS	Illumina HiSeq	Phase_I	54	19	NM_198576	0	1	148	246	97	Q5SVA1|Q5SVA2|Q60FE1|Q7KYS8|Q8N4J5|Q96IC1|Q9BTD4	Missense_Mutation	SNP	ENST00000379370.2	37	CCDS30551.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.64|15.64	2.893312|2.893312	0.52121|0.52121	.|.	.|.	ENSG00000188157|ENSG00000188157	ENST00000379370;ENST00000379364|ENST00000419249	D|.	0.94000|.	-3.33|.	4.96|4.96	4.05|4.05	0.47172|0.47172	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);EGF (1);Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.75177|0.75177	0.3814|0.3814	M|M	0.83118|0.83118	2.625|2.625	0.58432|0.58432	D|D	0.999995|0.999995	D|.	0.61080|.	0.989|.	P|.	0.62298|.	0.9|.	T|T	0.76782|0.76782	-0.2832|-0.2832	10|5	0.48119|.	T|.	0.1|.	-27.1498|-27.1498	12.382|12.382	0.55311|0.55311	0.0:0.9177:0.0:0.0823|0.0:0.9177:0.0:0.0823	.|.	1847|.	O00468|.	AGRIN_HUMAN|.	L|I	1847;190|150	ENSP00000368678:F1847L|.	ENSP00000368671:F190L|.	F|L	+|+	3|1	2|0	AGRN|AGRN	976866|976866	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.032000|0.032000	0.12392|0.12392	2.087000|2.087000	0.41653|0.41653	1.112000|1.112000	0.41740|0.41740	0.555000|0.555000	0.69702|0.69702	TTC|CTC	.		0.711	AGRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097990.2	NM_198576	
KLHL21	9903	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	6659179	6659179	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr1:6659179T>C	ENST00000377658.4	-	2	1406	c.1355A>G	c.(1354-1356)gAc>gGc	p.D452G	KLHL21_ENST00000463043.1_Missense_Mutation_p.D85G|KLHL21_ENST00000377663.3_Missense_Mutation_p.D452G|KLHL21_ENST00000467612.1_Missense_Mutation_p.D85G	NM_014851.2	NP_055666.2	Q9UJP4	KLH21_HUMAN	kelch-like family member 21	452					chromosome passenger complex localization to spindle midzone (GO:0035853)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|regulation of cytokinesis (GO:0032465)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|polar microtubule (GO:0005827)				central_nervous_system(1)|endometrium(1)|kidney(1)|lung(3)|prostate(2)	8	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.36e-07)|COAD - Colon adenocarcinoma(227;1.4e-05)|Kidney(185;4.95e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000528)|KIRC - Kidney renal clear cell carcinoma(229;0.000927)|STAD - Stomach adenocarcinoma(132;0.0172)|READ - Rectum adenocarcinoma(331;0.0644)		CTGGCCGCAGTCCACCAGCGA	0.642																																					p.D452G		.											.	KLHL21-514	0			c.A1355G						.						47.0	45.0	46.0					1																	6659179		2203	4300	6503	SO:0001583	missense	9903	exon2			CCGCAGTCCACCA	AK090472	CCDS30575.1	1p36	2013-01-30	2013-01-30		ENSG00000162413	ENSG00000162413		"""Kelch-like"", ""BTB/POZ domain containing"""	29041	protein-coding gene	gene with protein product			"""kelch-like 21 (Drosophila)"""				Standard	XM_005263542		Approved	KIAA0469	uc001aoa.3	Q9UJP4	OTTHUMG00000001437	ENST00000377658.4:c.1355A>G	1.37:g.6659179T>C	ENSP00000366886:p.Asp452Gly	Somatic	90	0		WXS	Illumina HiSeq	Phase_I	170	56	NM_014851	0	0	3	5	2	B3KQP2|O75057|Q5SY26|Q5SY28|Q8N4I6|Q8NF10	Missense_Mutation	SNP	ENST00000377658.4	37	CCDS30575.1	.	.	.	.	.	.	.	.	.	.	T	13.54	2.269130	0.40095	.	.	ENSG00000162413	ENST00000377658;ENST00000377663	T;T	0.74209	-0.72;-0.82	5.14	3.99	0.46301	Galactose oxidase, beta-propeller (1);	0.179251	0.64402	D	0.000019	T	0.54013	0.1832	N	0.08118	0	0.31114	N	0.70964	B;B	0.28933	0.02;0.228	B;B	0.30855	0.007;0.121	T	0.55036	-0.8203	10	0.27082	T	0.32	.	11.6365	0.51207	0.0:0.0:0.1489:0.851	.	452;452	Q9UJP4;Q9UJP4-2	KLH21_HUMAN;.	G	452	ENSP00000366886:D452G;ENSP00000366891:D452G	ENSP00000366886:D452G	D	-	2	0	KLHL21	6581766	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	3.336000	0.52113	0.877000	0.35895	0.533000	0.62120	GAC	.		0.642	KLHL21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004188.1	NM_014851	
INPP5B	3633	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	38343988	38343988	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr1:38343988A>G	ENST00000373026.1	-	15	1789	c.1789T>C	c.(1789-1791)Tgc>Cgc	p.C597R	INPP5B_ENST00000373024.3_Missense_Mutation_p.C517R|INPP5B_ENST00000458109.2_3'UTR|INPP5B_ENST00000373023.2_Missense_Mutation_p.C597R|INPP5B_ENST00000373027.1_Missense_Mutation_p.C353R			P32019	I5P2_HUMAN	inositol polyphosphate-5-phosphatase, 75kDa	597	5-phosphatase. {ECO:0000250}.|Substrate binding.			GSDDWDTSEKCRAPAWCDRI -> RALTTGIPVRSAVLLPG VIGF (in Ref. 5; AA sequence). {ECO:0000305}.	in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol dephosphorylation (GO:0046856)|regulation of protein processing (GO:0070613)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|metal ion binding (GO:0046872)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)			breast(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(9)|urinary_tract(1)	15	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				GGAGCACGGCACTTCTCACTG	0.547																																					p.C517R		.											.	INPP5B-227	0			c.T1549C						.						66.0	67.0	67.0					1																	38343988		2087	4203	6290	SO:0001583	missense	3633	exon16			CACGGCACTTCTC	M74161	CCDS41306.1, CCDS72760.1	1p34	2008-02-05	2002-08-29		ENSG00000204084	ENSG00000204084	3.1.3.56		6077	protein-coding gene	gene with protein product		147264	"""inositol polyphosphate-5-phosphatase, 75kD"""			1718960	Standard	NM_005540		Approved		uc001ccg.1	P32019	OTTHUMG00000004436	ENST00000373026.1:c.1789T>C	1.37:g.38343988A>G	ENSP00000362117:p.Cys597Arg	Somatic	42	0		WXS	Illumina HiSeq	Phase_I	80	19	NM_005540	0	0	0	0	0	C9J6U5|Q5VSG9|Q5VSH0|Q5VSH1|Q658Q5|Q6P6D4|Q6PD53|Q86YE1	Missense_Mutation	SNP	ENST00000373026.1	37		.	.	.	.	.	.	.	.	.	.	A	19.27	3.796203	0.70567	.	.	ENSG00000204084	ENST00000373027;ENST00000373023;ENST00000373029;ENST00000373026;ENST00000373024	T;T;T;T	0.79554	-1.28;-1.28;-1.28;-1.28	5.43	5.43	0.79202	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);	0.000000	0.85682	D	0.000000	D	0.83473	0.5262	L	0.33624	1.015	0.80722	D	1	D;P	0.89917	1.0;0.861	D;B	0.68765	0.96;0.31	T	0.82133	-0.0608	10	0.30854	T	0.27	.	15.4883	0.75584	1.0:0.0:0.0:0.0	.	597;517	P32019;P32019-2	I5P2_HUMAN;.	R	353;597;597;597;517	ENSP00000362118:C353R;ENSP00000362114:C597R;ENSP00000362117:C597R;ENSP00000362115:C517R	ENSP00000362114:C597R	C	-	1	0	INPP5B	38116575	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	8.855000	0.92236	2.078000	0.62432	0.460000	0.39030	TGC	.		0.547	INPP5B-003	KNOWN	non_canonical_conserved|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000012968.1	NM_005540	
PTGFR	5737	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	78959108	78959108	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr1:78959108T>C	ENST00000370757.3	+	2	917	c.680T>C	c.(679-681)cTt>cCt	p.L227P	PTGFR_ENST00000370758.1_Missense_Mutation_p.L227P|PTGFR_ENST00000370756.3_Missense_Mutation_p.L227P	NM_000959.3	NP_000950.1	P43088	PF2R_HUMAN	prostaglandin F receptor (FP)	227					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|parturition (GO:0007567)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	prostaglandin F receptor activity (GO:0004958)			breast(6)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	33				Colorectal(170;0.248)	Bimatoprost(DB00905)|Dinoprost Tromethamine(DB01160)|Latanoprost(DB00654)|Tafluprost(DB08819)|Travoprost(DB00287)	GGAATTACACTTTTAAGAGTT	0.383																																					p.L227P		.											.	PTGFR-527	0			c.T680C						.						58.0	60.0	59.0					1																	78959108		2203	4300	6503	SO:0001583	missense	5737	exon2			TTACACTTTTAAG	AF004021	CCDS686.1, CCDS30759.1	1p31.1	2012-08-08			ENSG00000122420	ENSG00000122420		"""GPCR / Class A : Prostanoid receptors"""	9600	protein-coding gene	gene with protein product		600563				8300593, 7759114	Standard	XM_006710781		Approved	FP	uc001din.3	P43088	OTTHUMG00000009644	ENST00000370757.3:c.680T>C	1.37:g.78959108T>C	ENSP00000359793:p.Leu227Pro	Somatic	54	0		WXS	Illumina HiSeq	Phase_I	133	39	NM_000959	0	0	0	0	0	A8K9Y0|Q2KHP3|Q6RYQ6|Q9P1X4	Missense_Mutation	SNP	ENST00000370757.3	37	CCDS686.1	.	.	.	.	.	.	.	.	.	.	T	19.84	3.901960	0.72754	.	.	ENSG00000122420	ENST00000370758;ENST00000370757;ENST00000370756	T;T;T	0.52754	0.65;0.65;0.65	5.85	5.85	0.93711	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.63954	0.2555	M	0.76170	2.325	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.68685	-0.5343	10	0.87932	D	0	-21.0338	16.5479	0.84454	0.0:0.0:0.0:1.0	.	227;227	P43088;P43088-2	PF2R_HUMAN;.	P	227	ENSP00000359794:L227P;ENSP00000359793:L227P;ENSP00000359792:L227P	ENSP00000359792:L227P	L	+	2	0	PTGFR	78731696	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.698000	0.84413	2.371000	0.80710	0.533000	0.62120	CTT	.		0.383	PTGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026582.1	NM_000959	
PTGFR	5737	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	78959111	78959111	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr1:78959111T>C	ENST00000370757.3	+	2	920	c.683T>C	c.(682-684)tTa>tCa	p.L228S	PTGFR_ENST00000370758.1_Missense_Mutation_p.L228S|PTGFR_ENST00000370756.3_Missense_Mutation_p.L228S	NM_000959.3	NP_000950.1	P43088	PF2R_HUMAN	prostaglandin F receptor (FP)	228					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|parturition (GO:0007567)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	prostaglandin F receptor activity (GO:0004958)			breast(6)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	33				Colorectal(170;0.248)	Bimatoprost(DB00905)|Dinoprost Tromethamine(DB01160)|Latanoprost(DB00654)|Tafluprost(DB08819)|Travoprost(DB00287)	ATTACACTTTTAAGAGTTAAA	0.388																																					p.L228S		.											.	PTGFR-527	0			c.T683C						.						57.0	59.0	58.0					1																	78959111		2203	4300	6503	SO:0001583	missense	5737	exon2			CACTTTTAAGAGT	AF004021	CCDS686.1, CCDS30759.1	1p31.1	2012-08-08			ENSG00000122420	ENSG00000122420		"""GPCR / Class A : Prostanoid receptors"""	9600	protein-coding gene	gene with protein product		600563				8300593, 7759114	Standard	XM_006710781		Approved	FP	uc001din.3	P43088	OTTHUMG00000009644	ENST00000370757.3:c.683T>C	1.37:g.78959111T>C	ENSP00000359793:p.Leu228Ser	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	131	38	NM_000959	0	0	0	0	0	A8K9Y0|Q2KHP3|Q6RYQ6|Q9P1X4	Missense_Mutation	SNP	ENST00000370757.3	37	CCDS686.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.020614	0.75275	.	.	ENSG00000122420	ENST00000370758;ENST00000370757;ENST00000370756	T;T;T	0.39997	1.05;1.05;1.05	5.85	5.85	0.93711	GPCR, rhodopsin-like superfamily (1);	0.074264	0.56097	D	0.000033	T	0.50514	0.1620	L	0.52573	1.65	0.54753	D	0.999985	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.989	T	0.45731	-0.9241	10	0.40728	T	0.16	-5.6031	16.5479	0.84454	0.0:0.0:0.0:1.0	.	228;228	P43088;P43088-2	PF2R_HUMAN;.	S	228	ENSP00000359794:L228S;ENSP00000359793:L228S;ENSP00000359792:L228S	ENSP00000359792:L228S	L	+	2	0	PTGFR	78731699	1.000000	0.71417	0.995000	0.50966	0.988000	0.76386	7.643000	0.83403	2.371000	0.80710	0.533000	0.62120	TTA	.		0.388	PTGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026582.1	NM_000959	
SLC6A17	388662	hgsc.bcm.edu	37	1	110740214	110740214	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr1:110740214A>G	ENST00000331565.4	+	11	2293	c.1808A>G	c.(1807-1809)aAg>aGg	p.K603R		NM_001010898.2	NP_001010898.1	Q9H1V8	S6A17_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 17	603					alanine transport (GO:0032328)|glycine transport (GO:0015816)|leucine transport (GO:0015820)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)		GCCTGGATCAAGGAGGAGGTG	0.582											OREG0013652	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K603R		.											.	SLC6A17-92	0			c.A1808G						.						24.0	27.0	26.0					1																	110740214		2203	4300	6503	SO:0001583	missense	388662	exon11			GGATCAAGGAGGA		CCDS30799.1	1p13.2	2013-07-19	2013-07-19		ENSG00000197106	ENSG00000197106		"""Solute carriers"""	31399	protein-coding gene	gene with protein product		610299	"""solute carrier family 6 (neurotransmitter transporter), member 17"", ""solute carrier family 6, member 17"""				Standard	NM_001010898		Approved		uc009wfq.3	Q9H1V8	OTTHUMG00000011761	ENST00000331565.4:c.1808A>G	1.37:g.110740214A>G	ENSP00000330199:p.Lys603Arg	Somatic	7	0	1429	WXS	Illumina HiSeq	Phase_I	22	11	NM_001010898	0	0	0	0	0	A6NEA8|A8K1R7|B9EIR5|Q5T5Q9	Missense_Mutation	SNP	ENST00000331565.4	37	CCDS30799.1	.	.	.	.	.	.	.	.	.	.	A	11.56	1.673675	0.29693	.	.	ENSG00000197106	ENST00000331565;ENST00000450985	T	0.74315	-0.83	5.03	2.63	0.31362	.	0.288442	0.37669	N	0.001989	T	0.23727	0.0574	N	0.04508	-0.205	0.26690	N	0.971361	B	0.02656	0.0	B	0.09377	0.004	T	0.29941	-0.9995	10	0.15066	T	0.55	.	7.503	0.27528	0.6046:0.0:0.3954:0.0	.	603	Q9H1V8	S6A17_HUMAN	R	603	ENSP00000330199:K603R	ENSP00000330199:K603R	K	+	2	0	SLC6A17	110541737	0.080000	0.21391	0.999000	0.59377	0.978000	0.69477	1.878000	0.39608	0.235000	0.21160	0.455000	0.32223	AAG	.		0.582	SLC6A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032550.2	XM_371280	
PDE4DIP	9659	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	144874782	144874782	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr1:144874782C>T	ENST00000369354.3	-	30	5015	c.4826G>A	c.(4825-4827)aGc>aAc	p.S1609N	RP4-791M13.5_ENST00000531288.1_RNA|PDE4DIP_ENST00000369359.4_Missense_Mutation_p.S1745N|PDE4DIP_ENST00000530740.1_Missense_Mutation_p.S1745N|PDE4DIP_ENST00000524974.1_5'UTR|PDE4DIP_ENST00000369356.4_Missense_Mutation_p.S1609N|PDE4DIP_ENST00000313382.9_Missense_Mutation_p.S1565N|AL138796.1_ENST00000582173.1_RNA			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	1609	NBPF. {ECO:0000255|PROSITE- ProRule:PRU00647}.				cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		GAAAGAGGTGCTGCTGGGAGA	0.537			T	PDGFRB	MPD																																p.S1609N		.		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	.	PDE4DIP-663	0			c.G4826A						.						253.0	241.0	245.0					1																	144874782		2203	4296	6499	SO:0001583	missense	9659	exon30			GAGGTGCTGCTGG	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.4826G>A	1.37:g.144874782C>T	ENSP00000358360:p.Ser1609Asn	Somatic	92	0		WXS	Illumina HiSeq	Phase_I	170	24	NM_014644	0	0	1	1	0	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000369354.3	37	CCDS30824.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.058459	0.76074	.	.	ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000530740;ENST00000369359	T;T;T;T;T	0.01767	4.65;4.76;4.76;4.73;4.78	5.91	2.8	0.32819	DUF1220 (2);	.	.	.	.	T	0.01558	0.0050	L	0.61218	1.895	0.80722	D	1	P;P	0.40970	0.634;0.734	B;B	0.43575	0.3;0.424	T	0.57046	-0.7878	9	0.56958	D	0.05	.	10.7557	0.46234	0.1347:0.622:0.2433:0.0	.	1565;1609	Q5VU43-3;Q5VU43	.;MYOME_HUMAN	N	1565;1609;1609;1745;1745	ENSP00000327209:S1565N;ENSP00000358360:S1609N;ENSP00000358363:S1609N;ENSP00000435654:S1745N;ENSP00000358366:S1745N	ENSP00000327209:S1565N	S	-	2	0	PDE4DIP	143586139	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	4.387000	0.59626	0.794000	0.33899	0.650000	0.86243	AGC	.		0.537	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359	
CELF3	11189	hgsc.bcm.edu	37	1	151678722	151678722	+	Silent	SNP	T	T	C			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr1:151678722T>C	ENST00000290583.4	-	10	1897	c.1104A>G	c.(1102-1104)caA>caG	p.Q368Q	RP11-98D18.1_ENST00000457548.1_RNA|CELF3_ENST00000392706.3_Silent_p.Q163Q|CELF3_ENST00000470688.1_5'UTR|CELF3_ENST00000290585.4_Silent_p.Q318Q	NM_001172648.1|NM_007185.4	NP_001166119.1|NP_009116.3	Q5SZQ8	CELF3_HUMAN	CUGBP, Elav-like family member 3	368	Gln-rich.				mRNA splicing, via spliceosome (GO:0000398)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	21						gctgctgctgttgctgctgct	0.657																																					p.Q368Q		.											.	CELF3-91	0			c.A1104G						.						19.0	20.0	20.0					1																	151678722		2200	4297	6497	SO:0001819	synonymous_variant	11189	exon10			CTGCTGTTGCTGC	U80759	CCDS1002.1, CCDS53367.1	1q21	2013-02-12	2010-02-19	2010-02-19	ENSG00000159409	ENSG00000159409		"""Trinucleotide (CAG) repeat containing"", ""RNA binding motif (RRM) containing"""	11967	protein-coding gene	gene with protein product	"""expanded repeat domain, CAG/CTG 4"", ""CAG repeat domain"", ""CUG-BP and ETR-3 like factor 3"""	612678	"""trinucleotide repeat containing 4"""	TNRC4		9225980	Standard	XM_005244859		Approved	CAGH4, BRUNOL1, ERDA4, MGC57297	uc001eys.2	Q5SZQ8	OTTHUMG00000013064	ENST00000290583.4:c.1104A>G	1.37:g.151678722T>C		Somatic	23	0		WXS	Illumina HiSeq	Phase_I	34	4	NM_007185	0	0	3	105	102	B7ZKK6|O15414|Q499Y6|Q5SZQ7|Q6NVK0|Q8IZ98|Q9BZC2|Q9HB30	Silent	SNP	ENST00000290583.4	37	CCDS1002.1	.	.	.	.	.	.	.	.	.	.	.	4.938	0.174339	0.09391	.	.	ENSG00000159409	ENST00000420342	.	.	.	3.25	1.39	0.22231	.	.	.	.	.	T	0.36496	0.0969	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.19943	-1.0290	4	.	.	.	-0.0118	5.4728	0.16680	0.0:0.7409:0.0:0.2591	.	.	.	.	S	369	.	.	N	-	2	0	CELF3	149945346	0.076000	0.21285	1.000000	0.80357	0.644000	0.38419	-0.812000	0.04496	0.416000	0.25844	-0.389000	0.06534	AAC	.		0.657	CELF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036663.2	NM_007185	
ASPM	259266	broad.mit.edu	37	1	197111690	197111690	+	Silent	SNP	G	G	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr1:197111690G>T	ENST00000367409.4	-	3	1948	c.1692C>A	c.(1690-1692)ccC>ccA	p.P564P	ASPM_ENST00000294732.7_Silent_p.P564P	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	564					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						TTGTCGAAGAGGGTGTTACCT	0.343																																					p.P564P													.	ASPM-615	0			c.C1692A						.						118.0	124.0	122.0					1																	197111690		2203	4300	6503	SO:0001819	synonymous_variant	259266	exon3			CGAAGAGGGTGTT	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.1692C>A	1.37:g.197111690G>T		Somatic	56	0		WXS	Illumina HiSeq	Phase_I	133	7	NM_001206846	0	0	0	0	0	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Silent	SNP	ENST00000367409.4	37	CCDS1389.1																																																																																			.		0.343	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136	
OBSCN	84033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	228520936	228520936	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr1:228520936G>C	ENST00000422127.1	+	58	15812	c.15768G>C	c.(15766-15768)gaG>gaC	p.E5256D	OBSCN_ENST00000366707.4_Missense_Mutation_p.E2890D|OBSCN_ENST00000284548.11_Missense_Mutation_p.E5256D|OBSCN_ENST00000570156.2_Missense_Mutation_p.E6213D|OBSCN_ENST00000366709.4_Missense_Mutation_p.E2375D	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5256					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CCACTGATGAGGGCCAGCTGC	0.632																																					p.E6213D		.											.	OBSCN-403	0			c.G18639C						.						14.0	16.0	15.0					1																	228520936		1999	4165	6164	SO:0001583	missense	84033	exon69			TGATGAGGGCCAG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.15768G>C	1.37:g.228520936G>C	ENSP00000409493:p.Glu5256Asp	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	140	50	NM_001271223	0	0	0	0	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	G	17.79	3.475444	0.63737	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.65364	0.27;-0.15;-0.1;0.41	5.29	-2.78	0.05859	.	0.204869	0.40818	N	0.001014	T	0.30039	0.0752	N	0.04880	-0.145	0.34900	D	0.746403	B;B	0.16166	0.009;0.016	B;B	0.19148	0.011;0.024	T	0.01684	-1.1296	10	0.44086	T	0.13	.	2.9874	0.05972	0.3769:0.104:0.4128:0.1063	.	5256;5256	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	D	5256;5256;2890;2375	ENSP00000284548:E5256D;ENSP00000409493:E5256D;ENSP00000355668:E2890D;ENSP00000355670:E2375D	ENSP00000284548:E5256D	E	+	3	2	OBSCN	226587559	0.939000	0.31865	0.987000	0.45799	0.212000	0.24457	-0.019000	0.12546	-0.128000	0.11641	-0.254000	0.11334	GAG	.		0.632	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
FMN2	56776	broad.mit.edu	37	1	240371139	240371139	+	Silent	SNP	C	C	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr1:240371139C>T	ENST00000319653.9	+	5	3257	c.3027C>T	c.(3025-3027)ccC>ccT	p.P1009P		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1009	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CGGGCATACCCCCTCCTCCCC	0.731																																					p.P1009P													.	FMN2-145	0			c.C3027T						.																																			SO:0001819	synonymous_variant	56776	exon5			CATACCCCCTCCT	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.3027C>T	1.37:g.240371139C>T		Somatic	59	1		WXS	Illumina HiSeq	Phase_I	104	8	NM_020066	0	0	0	0	0	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Silent	SNP	ENST00000319653.9	37	CCDS31069.2																																																																																			.		0.731	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
SKIDA1	387640	hgsc.bcm.edu	37	10	21805486	21805486	+	Silent	SNP	C	C	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr10:21805486C>T	ENST00000449193.2	-	4	3518	c.1266G>A	c.(1264-1266)gaG>gaA	p.E422E	SKIDA1_ENST00000487107.1_5'Flank|SKIDA1_ENST00000444772.3_Silent_p.E343E	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	341						nucleus (GO:0005634)		p.E422E(2)									cctcttcctcctcctcctcct	0.632																																					p.E422E		.											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1266A						.						5.0	6.0	6.0					10																	21805486		1988	4108	6096	SO:0001819	synonymous_variant	387640	exon4			TTCCTCCTCCTCC	AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1266G>A	10.37:g.21805486C>T		Somatic	35	0		WXS	Illumina HiSeq	Phase_I	53	7	NM_207371	0	0	2	2	0	B1ANA5|Q6ZMX4|Q8N3C3	Silent	SNP	ENST00000449193.2	37	CCDS44363.1																																																																																			.		0.632	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286950.2	NM_207371	
BMS1	9790	broad.mit.edu;bcgsc.ca	37	10	43294061	43294061	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr10:43294061G>T	ENST00000374518.5	+	12	2298	c.2235G>T	c.(2233-2235)tgG>tgT	p.W745C		NM_014753.3	NP_055568.3	Q14692	BMS1_HUMAN	BMS1 ribosome biogenesis factor	745					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(23)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						CCCATGACTGGGATTTAGAGG	0.428																																					p.W745C													.	BMS1-93	0			c.G2235T						.						91.0	97.0	95.0					10																	43294061		2203	4300	6503	SO:0001583	missense	9790	exon12			TGACTGGGATTTA	BC043345	CCDS7199.1	10q11.21	2013-05-01	2013-05-01	2007-03-20	ENSG00000165733	ENSG00000165733			23505	protein-coding gene	gene with protein product		611448	"""BMS1-like, ribosome assembly protein (yeast)"", ""BMS1 homolog, ribosome assembly protein (yeast)"""	BMS1L		11779832	Standard	NM_014753		Approved	KIAA0187	uc001jaj.3	Q14692	OTTHUMG00000018020	ENST00000374518.5:c.2235G>T	10.37:g.43294061G>T	ENSP00000363642:p.Trp745Cys	Somatic	80	0		WXS	Illumina HiSeq	Phase_I	173	7	NM_014753	0	0	0	0	0	Q5QPT5|Q86XJ9	Missense_Mutation	SNP	ENST00000374518.5	37	CCDS7199.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.986911	0.74589	.	.	ENSG00000165733	ENST00000374518	T	0.53857	0.6	5.92	5.92	0.95590	.	0.060191	0.64402	D	0.000001	T	0.76314	0.3970	M	0.79805	2.47	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.77219	-0.2668	10	0.66056	D	0.02	.	20.3734	0.98896	0.0:0.0:1.0:0.0	.	745	Q14692	BMS1_HUMAN	C	745	ENSP00000363642:W745C	ENSP00000363642:W745C	W	+	3	0	BMS1	42614067	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	9.218000	0.95166	2.820000	0.97059	0.650000	0.86243	TGG	.		0.428	BMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047690.2	NM_014753	
C10orf12	26148	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	98741939	98741939	+	Silent	SNP	T	T	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr10:98741939T>G	ENST00000286067.2	+	1	899	c.792T>G	c.(790-792)tcT>tcG	p.S264S		NM_015652.2	NP_056467.2	Q8N655	CJ012_HUMAN	chromosome 10 open reading frame 12	264										NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(3)|prostate(2)|skin(2)|stomach(4)	45		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		AAATCACCTCTCACGAGGAAG	0.512																																					p.S264S		.											.	C10orf12-92	0			c.T792G						.						89.0	90.0	90.0					10																	98741939		2203	4300	6503	SO:0001819	synonymous_variant	26148	exon1			CACCTCTCACGAG	BC024315	CCDS7452.1	10q24.2	2014-03-11			ENSG00000155640	ENSG00000155640			23420	protein-coding gene	gene with protein product						24550272	Standard	NM_015652		Approved	DKFZP564P1916, FLJ13022	uc001kmv.3	Q8N655	OTTHUMG00000018840	ENST00000286067.2:c.792T>G	10.37:g.98741939T>G		Somatic	65	0		WXS	Illumina HiSeq	Phase_I	110	37	NM_015652	0	0	0	0	0	Q9H945|Q9Y457	Silent	SNP	ENST00000286067.2	37	CCDS7452.1																																																																																			.		0.512	C10orf12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049627.1	NM_015652	
PPRC1	23082	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	103906723	103906723	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr10:103906723G>A	ENST00000278070.2	+	9	4013	c.3974G>A	c.(3973-3975)cGc>cAc	p.R1325H	PPRC1_ENST00000489648.1_Intron|PPRC1_ENST00000413464.2_Intron|PPRC1_ENST00000370012.1_Missense_Mutation_p.R292H	NM_015062.3	NP_055877.3	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator-related 1	1325					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(10)|lung(19)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		AATGTCAAGCGCCATCAGGAC	0.602																																					p.R1325H		.											.	PPRC1-227	0			c.G3974A						.						59.0	57.0	58.0					10																	103906723		2203	4300	6503	SO:0001583	missense	23082	exon9			TCAAGCGCCATCA	AF325193	CCDS7529.1, CCDS73186.1	10q24.32	2013-02-12	2006-10-17		ENSG00000148840	ENSG00000148840		"""RNA binding motif (RRM) containing"""	30025	protein-coding gene	gene with protein product			"""peroxisome proliferative activated receptor, gamma, coactivator-related 1"""			9628581, 11340167	Standard	XM_005269656		Approved	PRC, KIAA0595, MGC74642	uc001kum.3	Q5VV67	OTTHUMG00000018948	ENST00000278070.2:c.3974G>A	10.37:g.103906723G>A	ENSP00000278070:p.Arg1325His	Somatic	42	0		WXS	Illumina HiSeq	Phase_I	79	22	NM_015062	0	0	6	7	1	Q5VV66|Q6P3U5|Q6P3W1|Q76N31|Q9BUJ3|Q9BZE5|Q9Y4E0	Missense_Mutation	SNP	ENST00000278070.2	37	CCDS7529.1	.	.	.	.	.	.	.	.	.	.	G	16.20	3.057347	0.55325	.	.	ENSG00000148840	ENST00000278070;ENST00000370012	T;T	0.29655	1.92;1.56	5.76	4.85	0.62838	.	0.107026	0.64402	D	0.000005	T	0.14227	0.0344	L	0.27053	0.805	0.80722	D	1	P;B	0.37141	0.584;0.449	B;B	0.24541	0.054;0.024	T	0.05971	-1.0853	10	0.22109	T	0.4	.	5.5119	0.16886	0.2641:0.0:0.7359:0.0	.	1205;1325	Q5VV67-2;Q5VV67	.;PPRC1_HUMAN	H	1325;292	ENSP00000278070:R1325H;ENSP00000359029:R292H	ENSP00000278070:R1325H	R	+	2	0	PPRC1	103896713	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.757000	0.68766	2.724000	0.93272	0.462000	0.41574	CGC	.		0.602	PPRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050021.1	NM_015062	
PDCD4	27250	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	112655819	112655819	+	Silent	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr10:112655819A>G	ENST00000280154.7	+	11	1597	c.1323A>G	c.(1321-1323)aaA>aaG	p.K441K	PDCD4_ENST00000393104.2_Silent_p.K430K|MIR4680_ENST00000580906.1_RNA	NM_001199492.1|NM_014456.4	NP_001186421.1|NP_055271.2	Q53EL6	PDCD4_HUMAN	programmed cell death 4 (neoplastic transformation inhibitor)	441	MI 2. {ECO:0000255|PROSITE- ProRule:PRU00698}.				apoptotic process (GO:0006915)|cell aging (GO:0007569)|negative regulation of cell cycle (GO:0045786)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of transcription, DNA-templated (GO:0045892)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	13		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.000526)|all cancers(201;0.00794)|BRCA - Breast invasive adenocarcinoma(275;0.125)		TAATTTCCAAACAACTCAGAG	0.358																																					p.K441K	Ovarian(115;1498 1603 9363 40056 40885)	.											.	PDCD4-291	0			c.A1323G						.						78.0	78.0	78.0					10																	112655819		2202	4300	6502	SO:0001819	synonymous_variant	27250	exon11			TTCCAAACAACTC	U83908	CCDS7567.1, CCDS44478.1	10q24	2008-08-01			ENSG00000150593	ENSG00000150593			8763	protein-coding gene	gene with protein product	"""nuclear antigen H731"""	608610				9759869	Standard	NM_014456		Approved	H731	uc001kzh.3	Q53EL6	OTTHUMG00000019048	ENST00000280154.7:c.1323A>G	10.37:g.112655819A>G		Somatic	86	0		WXS	Illumina HiSeq	Phase_I	205	64	NM_014456	0	0	13	26	13	B2RCV4|B5ME91|O15501|Q5VZS6|Q6PJI5|Q8TAR5|Q99834	Silent	SNP	ENST00000280154.7	37	CCDS7567.1																																																																																			.		0.358	PDCD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050361.1	NM_014456	
MUC2	4583	hgsc.bcm.edu;broad.mit.edu	37	11	1092948	1092948	+	Silent	SNP	C	C	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr11:1092948C>G	ENST00000441003.2	+	30	4794	c.4767C>G	c.(4765-4767)acC>acG	p.T1589T	MUC2_ENST00000359061.5_Silent_p.T1590T|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1590T(2)|p.T1589T(2)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	tcaccaccaccactacggtga	0.627																																					p.T1589T		.											.	MUC2-90	4	Substitution - coding silent(4)	endometrium(2)|kidney(2)	c.C4767G						.																																			SO:0001819	synonymous_variant	4583	exon30			CACCACCACTACG	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4767C>G	11.37:g.1092948C>G		Somatic	47	0		WXS	Illumina HiSeq	Phase_I	88	7	NM_002457	0	0	0	0	0	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.		0.627	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
KRTAP5-5	439915	broad.mit.edu	37	11	1651412	1651412	+	Silent	SNP	G	G	C	rs569811286		TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr11:1651412G>C	ENST00000399676.2	+	1	380	c.342G>C	c.(340-342)ggG>ggC	p.G114G		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	114	8 X 4 AA repeats of C-C-X-P.			Missing (in Ref. 1; BAD20201 and 2; CAF31639). {ECO:0000305}.		keratin filament (GO:0045095)		p.G114G(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CCTGTGGGGGGTCCAAGGGGG	0.706													N|||	1	0.000199681	0.0	0.0	5008	,	,		3556	0.001		0.0	False		,,,				2504	0.0				p.G114G													.	KRTAP5-5-23	1	Substitution - coding silent(1)	prostate(1)	c.G342C						.						20.0	31.0	27.0					11																	1651412		2083	4147	6230	SO:0001819	synonymous_variant	439915	exon1			TGGGGGGTCCAAG	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.342G>C	11.37:g.1651412G>C		Somatic	32	0		WXS	Illumina HiSeq	Phase_I	57	3	NM_001001480	0	0	0	0	0	A8MWN2	Silent	SNP	ENST00000399676.2	37	CCDS41592.1																																																																																			.		0.706	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1		
SLC22A10	387775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	63065116	63065116	+	Silent	SNP	A	A	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr11:63065116A>T	ENST00000332793.6	+	4	749	c.747A>T	c.(745-747)ggA>ggT	p.G249G	SLC22A10_ENST00000525620.1_3'UTR|SLC22A10_ENST00000544661.1_Silent_p.G94G|SLC22A10_ENST00000526800.1_Intron|SLC22A10_ENST00000535888.1_Silent_p.G39G	NM_001039752.3	NP_001034841.3	Q63ZE4	S22AA_HUMAN	solute carrier family 22, member 10	249						integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28					Conjugated Estrogens(DB00286)|Probenecid(DB01032)|Salicylic acid(DB00936)	TAATCCTGGGAGGCTTGGCTT	0.463																																					p.G249G		.											.	SLC22A10-92	0			c.A747T						.						159.0	149.0	152.0					11																	63065116		1933	4127	6060	SO:0001819	synonymous_variant	387775	exon4			CCTGGGAGGCTTG	AP003420	CCDS41661.1	11q12.3	2013-05-22	2008-01-11		ENSG00000184999	ENSG00000184999		"""Solute carriers"""	18057	protein-coding gene	gene with protein product		607580	"""solute carrier family 22 (organic anion/cation transporter), member 10"""			11327718	Standard	NM_001039752		Approved	OAT5, hOAT5	uc009yor.3	Q63ZE4	OTTHUMG00000165197	ENST00000332793.6:c.747A>T	11.37:g.63065116A>T		Somatic	85	0		WXS	Illumina HiSeq	Phase_I	156	64	NM_001039752	0	0	0	0	0	Q68CJ0	Silent	SNP	ENST00000332793.6	37	CCDS41661.1																																																																																			.		0.463	SLC22A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382622.3	NM_001039752	
SLC22A10	387775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	63071636	63071636	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr11:63071636A>G	ENST00000332793.6	+	8	1344	c.1342A>G	c.(1342-1344)Act>Gct	p.T448A	SLC22A10_ENST00000525620.1_Intron|SLC22A10_ENST00000544661.1_Silent_p.L246L|SLC22A10_ENST00000526800.1_Intron|SLC22A10_ENST00000535888.1_Intron	NM_001039752.3	NP_001034841.3	Q63ZE4	S22AA_HUMAN	solute carrier family 22, member 10	448						integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28					Conjugated Estrogens(DB00286)|Probenecid(DB01032)|Salicylic acid(DB00936)	TTCTGCTGCTACTTTTTCCAG	0.483																																					p.T448A		.											.	SLC22A10-92	0			c.A1342G						.						212.0	217.0	215.0					11																	63071636		2073	4247	6320	SO:0001583	missense	387775	exon8			GCTGCTACTTTTT	AP003420	CCDS41661.1	11q12.3	2013-05-22	2008-01-11		ENSG00000184999	ENSG00000184999		"""Solute carriers"""	18057	protein-coding gene	gene with protein product		607580	"""solute carrier family 22 (organic anion/cation transporter), member 10"""			11327718	Standard	NM_001039752		Approved	OAT5, hOAT5	uc009yor.3	Q63ZE4	OTTHUMG00000165197	ENST00000332793.6:c.1342A>G	11.37:g.63071636A>G	ENSP00000327569:p.Thr448Ala	Somatic	41	0		WXS	Illumina HiSeq	Phase_I	75	26	NM_001039752	0	0	0	0	0	Q68CJ0	Missense_Mutation	SNP	ENST00000332793.6	37	CCDS41661.1	.	.	.	.	.	.	.	.	.	.	A	0	-2.853818	0.00066	.	.	ENSG00000184999	ENST00000332793	T	0.74526	-0.85	3.05	-6.11	0.02131	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.214933	0.39020	N	0.001483	T	0.27594	0.0678	N	0.00525	-1.395	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.33137	-0.9880	10	0.05351	T	0.99	.	5.742	0.18100	0.3421:0.0:0.1242:0.5336	.	448	Q63ZE4	S22AA_HUMAN	A	448	ENSP00000327569:T448A	ENSP00000327569:T448A	T	+	1	0	SLC22A10	62828212	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.437000	0.01018	-3.799000	0.00105	-1.485000	0.00982	ACT	.		0.483	SLC22A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382622.3	NM_001039752	
UNC93B1	81622	broad.mit.edu	37	11	67763107	67763107	+	Silent	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr11:67763107A>G	ENST00000227471.2	-	10	1414	c.1335T>C	c.(1333-1335)agT>agC	p.S445S	UNC93B1_ENST00000530331.1_5'UTR	NM_030930.2	NP_112192.2	Q9H1C4	UN93B_HUMAN	unc-93 homolog B1 (C. elegans)	446					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	early phagosome (GO:0032009)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)											TGTTCAGGGCACTGCCCACAC	0.617																																					.													.	.	0			.						.						10.0	10.0	10.0					11																	67763107		1758	3730	5488	SO:0001819	synonymous_variant	81622	.			CAGGGCACTGCCC	AJ271326	CCDS73334.1	11q13.2	2014-09-17	2001-11-28		ENSG00000110057	ENSG00000110057			13481	protein-coding gene	gene with protein product		608204	"""unc93 (C. elegans) homolog B1"""			11867227	Standard	NM_030930		Approved	UNC93	uc001omw.1	Q9H1C4	OTTHUMG00000167472	ENST00000227471.2:c.1335T>C	11.37:g.67763107A>G		Somatic	61	1		WXS	Illumina HiSeq	Phase_I	161	6	.	1	0	142	143	0	O95764|Q569H6|Q710D4	Silent	SNP	ENST00000227471.2	37																																																																																				.		0.617	UNC93B1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_030930	
NADSYN1	55191	ucsc.edu	37	11	71193000	71193000	+	Missense_Mutation	SNP	T	T	G	rs200077392		TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr11:71193000T>G	ENST00000319023.2	+	13	1267	c.1079T>G	c.(1078-1080)gTg>gGg	p.V360G	NADSYN1_ENST00000530055.1_5'UTR|NADSYN1_ENST00000539574.1_Missense_Mutation_p.V100G|NADSYN1_ENST00000526039.2_Intron	NM_018161.4	NP_060631.2	Q6IA69	NADE_HUMAN	NAD synthetase 1	360	Ligase. {ECO:0000250}.				NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds (GO:0016810)|NAD+ synthase (glutamine-hydrolyzing) activity (GO:0003952)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	25					L-Glutamine(DB00130)	AGTGGCGGGGTGGACAGCGCA	0.607																																					p.V360G	Ovarian(79;763 1781 6490 50276)												.	NADSYN1-92	0			c.T1079G						.						61.0	46.0	51.0					11																	71193000		2198	4294	6492	SO:0001583	missense	55191	exon13			GCGGGGTGGACAG	AB091316	CCDS8201.1	11q13.4	2008-02-05				ENSG00000172890			29832	protein-coding gene	gene with protein product		608285				12547821	Standard	NM_018161		Approved	FLJ10631	uc001oqn.3	Q6IA69		ENST00000319023.2:c.1079T>G	11.37:g.71193000T>G	ENSP00000326424:p.Val360Gly	Somatic	41	16		WXS	Illumina HiSeq		48	18	NM_018161	0	0	29	43	14	B3KUU4|Q86SN2|Q9HA25|Q9NVM8	Missense_Mutation	SNP	ENST00000319023.2	37	CCDS8201.1	.	.	.	.	.	.	.	.	.	.	T	18.32	3.598106	0.66332	.	.	ENSG00000172890	ENST00000319023;ENST00000539574	T;T	0.51071	0.72;0.72	4.95	4.95	0.65309	NAD/GMP synthase (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.257688	0.33327	N	0.005034	T	0.66197	0.2765	M	0.84082	2.675	0.80722	D	1	P;B	0.42620	0.785;0.036	P;B	0.55455	0.776;0.151	T	0.71151	-0.4676	10	0.72032	D	0.01	-7.1704	12.5612	0.56281	0.0:0.0:0.0:1.0	.	100;360	B3KUU4;Q6IA69	.;NADE_HUMAN	G	360;100	ENSP00000326424:V360G;ENSP00000443718:V100G	ENSP00000326424:V360G	V	+	2	0	NADSYN1	70870648	1.000000	0.71417	0.833000	0.33012	0.956000	0.61745	3.795000	0.55499	1.869000	0.54173	0.402000	0.26972	GTG	.		0.607	NADSYN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394356.1	NM_018161	
MAML2	84441	broad.mit.edu	37	11	95825254	95825254	+	Silent	SNP	C	C	T	rs61749250		TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr11:95825254C>T	ENST00000524717.1	-	2	3225	c.1941G>A	c.(1939-1941)caG>caA	p.Q647Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	647					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.Q647Q(1)	CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgctgctgctgttgttgct	0.512			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.Q647Q				Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	.	MAML2-850	1	Substitution - coding silent(1)	endometrium(1)	c.G1941A						.	C		0,4198		0,0,2099	35.0	40.0	38.0		1941	1.7	0.1	11	dbSNP_129	38	5,8237		0,5,4116	no	coding-synonymous	MAML2	NM_032427.1		0,5,6215	TT,TC,CC		0.0607,0.0,0.0402		647/1157	95825254	5,12435	2099	4121	6220	SO:0001819	synonymous_variant	84441	exon2			CTGCTGCTGTTGT	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1941G>A	11.37:g.95825254C>T		Somatic	40	1		WXS	Illumina HiSeq	Phase_I	76	4	NM_032427	0	0	1	1	0	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																			.		0.512	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
NPAT	4863	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	108043550	108043550	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr11:108043550C>T	ENST00000278612.8	-	13	2266	c.2161G>A	c.(2161-2163)Gat>Aat	p.D721N	NPAT_ENST00000610253.1_5'UTR	NM_002519.2	NP_002510.2	Q14207	NPAT_HUMAN	nuclear protein, ataxia-telangiectasia locus	721					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|Gemini of coiled bodies (GO:0097504)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(21)|ovary(2)|prostate(2)|skin(5)	46		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		GGTTTATCATCAGTATTTTGG	0.428																																					p.D721N		.											.	NPAT-117	0			c.G2161A						.						120.0	110.0	113.0					11																	108043550		1892	4120	6012	SO:0001583	missense	4863	exon13			TATCATCAGTATT	X97186	CCDS41710.1	11q22-q23	2008-02-01			ENSG00000149308	ENSG00000149308			7896	protein-coding gene	gene with protein product		601448				9205109	Standard	NM_002519		Approved	E14	uc001pjz.4	Q14207	OTTHUMG00000166385	ENST00000278612.8:c.2161G>A	11.37:g.108043550C>T	ENSP00000278612:p.Asp721Asn	Somatic	36	0		WXS	Illumina HiSeq	Phase_I	66	21	NM_002519	0	0	0	0	0	A8K1V5|A8K6M2|Q13632|Q14967|Q16580|Q86W55|Q8IWE9	Missense_Mutation	SNP	ENST00000278612.8	37	CCDS41710.1	.	.	.	.	.	.	.	.	.	.	C	1.672	-0.508824	0.04231	.	.	ENSG00000149308	ENST00000278612	T	0.03982	3.74	5.55	-1.3	0.09259	.	1.001340	0.08051	N	0.996678	T	0.02418	0.0074	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.49204	-0.8964	10	0.18710	T	0.47	3.2313	6.8937	0.24245	0.1138:0.3772:0.0:0.509	.	721;721	B9EG70;Q14207	.;NPAT_HUMAN	N	721	ENSP00000278612:D721N	ENSP00000278612:D721N	D	-	1	0	NPAT	107548760	0.145000	0.22656	0.022000	0.16811	0.316000	0.28119	0.773000	0.26661	-0.127000	0.11661	-0.136000	0.14681	GAT	.		0.428	NPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389506.2	NM_002519	
BCL9L	283149	hgsc.bcm.edu	37	11	118773516	118773516	+	Silent	SNP	C	C	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr11:118773516C>A	ENST00000334801.3	-	6	1900	c.936G>T	c.(934-936)ccG>ccT	p.P312P	BCL9L_ENST00000526143.1_5'UTR	NM_182557.2	NP_872363.1	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	312	Necessary for interaction with CTNNB1. {ECO:0000250}.|Pro-rich.				canonical Wnt signaling pathway (GO:0060070)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell morphogenesis (GO:0022604)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|transcription coactivator activity (GO:0003713)			NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	56	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		TGCCAGGGGCCGGGGGTGGCG	0.731																																					p.P312P		.											.	BCL9L-229	0			c.G936T						.						5.0	7.0	6.0					11																	118773516		2014	4005	6019	SO:0001819	synonymous_variant	283149	exon6			AGGGGCCGGGGGT	AB094091	CCDS8403.1	11q23.3	2012-06-06				ENSG00000186174			23688	protein-coding gene	gene with protein product		609004				12964048	Standard	NM_182557		Approved	DLNB11	uc001pug.3	Q86UU0		ENST00000334801.3:c.936G>T	11.37:g.118773516C>A		Somatic	3	0		WXS	Illumina HiSeq	Phase_I	10	5	NM_182557	0	0	0	0	0	A1A4C1|Q67FY1|Q6ZWJ0|Q6ZWK2	Silent	SNP	ENST00000334801.3	37	CCDS8403.1																																																																																			.		0.731	BCL9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389653.1	NM_182557	
RECQL	5965	broad.mit.edu	37	12	21630777	21630777	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr12:21630777G>T	ENST00000444129.2	-	7	1295	c.827C>A	c.(826-828)aCt>aAt	p.T276N	RECQL_ENST00000421138.2_Missense_Mutation_p.T276N	NM_002907.3|NM_032941.2	NP_002898.2|NP_116559.1	P46063	RECQ1_HUMAN	RecQ helicase-like	276					DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand renaturation (GO:0000733)	membrane (GO:0016020)|nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17						AGCTGTAAAAGTAAAACACTT	0.378								Other identified genes with known or suspected DNA repair function																													p.T276N													.	RECQL-228	0			c.C827A						.						64.0	63.0	63.0					12																	21630777		2203	4300	6503	SO:0001583	missense	5965	exon8			GTAAAAGTAAAAC	D37984	CCDS31756.1	12p12.1	2014-03-07	2014-03-07	2014-03-07	ENSG00000004700	ENSG00000004700			9948	protein-coding gene	gene with protein product	"""DNA helicase Q1-like"""	600537	"""RecQ protein-like (DNA helicase Q1-like)"""			7527136, 7961977	Standard	NM_002907		Approved	RecQ1, RecQL1	uc001rex.3	P46063	OTTHUMG00000169131	ENST00000444129.2:c.827C>A	12.37:g.21630777G>T	ENSP00000416739:p.Thr276Asn	Somatic	52	0		WXS	Illumina HiSeq	Phase_I	219	4	NM_032941	0	0	4	4	0	A8K6G2	Missense_Mutation	SNP	ENST00000444129.2	37	CCDS31756.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.453790	0.84209	.	.	ENSG00000004700	ENST00000444129;ENST00000421138	T;T	0.57907	0.37;0.37	4.7	4.7	0.59300	DEAD-like helicase (1);	0.091999	0.85682	D	0.000000	T	0.60353	0.2262	M	0.70595	2.14	0.80722	D	1	P	0.51240	0.943	P	0.46850	0.529	T	0.65352	-0.6189	10	0.48119	T	0.1	-8.019	18.1964	0.89823	0.0:0.0:1.0:0.0	.	276	P46063	RECQ1_HUMAN	N	276	ENSP00000416739:T276N;ENSP00000395449:T276N	ENSP00000395449:T276N	T	-	2	0	RECQL	21522044	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.470000	0.80973	2.596000	0.87737	0.650000	0.86243	ACT	.		0.378	RECQL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402371.1	NM_002907	
SOX5	6660	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	23757377	23757377	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr12:23757377A>G	ENST00000451604.2	-	9	1209	c.1108T>C	c.(1108-1110)Tct>Cct	p.S370P	SOX5_ENST00000309359.1_Missense_Mutation_p.S357P|SOX5_ENST00000541536.1_Missense_Mutation_p.S357P|SOX5_ENST00000546136.1_Missense_Mutation_p.S357P|SOX5_ENST00000381381.2_Missense_Mutation_p.S357P|SOX5_ENST00000537393.1_Missense_Mutation_p.S335P|SOX5_ENST00000545921.1_Missense_Mutation_p.S360P			P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5	370					cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system neuron differentiation (GO:0021953)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte differentiation (GO:0048709)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear transcription factor complex (GO:0044798)	sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(25)|ovary(5)|skin(2)|upper_aerodigestive_tract(3)	57						CTGGTAGGAGATACAGCAGCA	0.502																																					p.S370P		.											.	SOX5-655	0			c.T1108C						.						164.0	133.0	144.0					12																	23757377		2203	4300	6503	SO:0001583	missense	6660	exon9			TAGGAGATACAGC	AB081589	CCDS8699.1, CCDS41761.1, CCDS44844.1, CCDS58216.1, CCDS58217.1	12p12.1	2010-04-20			ENSG00000134532	ENSG00000134532		"""SRY (sex determining region Y)-boxes"""	11201	protein-coding gene	gene with protein product		604975				8812465	Standard	NM_006940		Approved	L-SOX5, MGC35153	uc001rfw.3	P35711	OTTHUMG00000169026	ENST00000451604.2:c.1108T>C	12.37:g.23757377A>G	ENSP00000398273:p.Ser370Pro	Somatic	51	0		WXS	Illumina HiSeq	Phase_I	125	33	NM_006940	0	0	0	0	0	B7Z8V0|F5H5B0|Q86UK8|Q8J017|Q8J018|Q8J019|Q8J020|Q8N1D9|Q8N7E0|Q8TEA4	Missense_Mutation	SNP	ENST00000451604.2	37	CCDS8699.1	.	.	.	.	.	.	.	.	.	.	A	24.3	4.520861	0.85495	.	.	ENSG00000134532	ENST00000546136;ENST00000309359;ENST00000381381;ENST00000451604;ENST00000435266;ENST00000537393;ENST00000541536;ENST00000545921	D;D;D;D;D;D;D	0.97831	-4.54;-4.54;-4.24;-4.55;-4.56;-4.24;-4.55	6.16	6.16	0.99307	.	0.171135	0.53938	D	0.000045	D	0.98251	0.9421	M	0.64567	1.98	0.53688	D	0.999975	D;P;D	0.60160	0.987;0.945;0.978	P;D;P	0.68621	0.907;0.959;0.809	D	0.98503	1.0615	10	0.41790	T	0.15	.	16.8061	0.85666	1.0:0.0:0.0:0.0	.	335;357;370	F5H0I3;P35711-4;P35711	.;.;SOX5_HUMAN	P	357;357;357;370;322;335;357;360	ENSP00000437487:S357P;ENSP00000308927:S357P;ENSP00000370788:S357P;ENSP00000398273:S370P;ENSP00000439832:S335P;ENSP00000441973:S357P;ENSP00000443520:S360P	ENSP00000308927:S357P	S	-	1	0	SOX5	23648644	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	5.618000	0.67722	2.367000	0.80283	0.528000	0.53228	TCT	.		0.502	SOX5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402006.2	NM_006940	
ADCY6	112	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	49168249	49168249	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr12:49168249G>A	ENST00000307885.4	-	13	2913	c.2219C>T	c.(2218-2220)gCa>gTa	p.A740V	ADCY6_ENST00000550422.1_Missense_Mutation_p.A740V|MIR4701_ENST00000583094.1_RNA|ADCY6_ENST00000552090.1_5'UTR|ADCY6_ENST00000357869.3_Missense_Mutation_p.A740V	NM_015270.3	NP_056085.1	O43306	ADCY6_HUMAN	adenylate cyclase 6	740					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|dopamine receptor signaling pathway (GO:0007212)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|negative regulation of neuron projection development (GO:0010977)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(16)|prostate(1)|skin(1)|urinary_tract(1)	29						GGTGCTATGTGCCCGTGAGCG	0.537																																					p.A740V		.											.	ADCY6-90	0			c.C2219T						.						134.0	112.0	119.0					12																	49168249		2203	4300	6503	SO:0001583	missense	112	exon14			CTATGTGCCCGTG		CCDS8767.1, CCDS8768.1	12q12-q13	2013-02-04				ENSG00000174233	4.6.1.1	"""Adenylate cyclases"""	237	protein-coding gene	gene with protein product		600294					Standard	NM_015270		Approved	AC6	uc001rsh.4	O43306		ENST00000307885.4:c.2219C>T	12.37:g.49168249G>A	ENSP00000311405:p.Ala740Val	Somatic	84	0		WXS	Illumina HiSeq	Phase_I	182	88	NM_020983	0	0	4	6	2	Q9NR75|Q9UDB0	Missense_Mutation	SNP	ENST00000307885.4	37	CCDS8767.1	.	.	.	.	.	.	.	.	.	.	G	12.99	2.103172	0.37145	.	.	ENSG00000174233	ENST00000357869;ENST00000550422;ENST00000307885	T;T;T	0.39787	1.06;1.06;1.06	4.42	3.51	0.40186	.	0.303154	0.30820	N	0.008801	T	0.28896	0.0717	L	0.36672	1.1	0.28148	N	0.929491	B;B	0.26041	0.14;0.004	B;B	0.28139	0.086;0.01	T	0.18618	-1.0331	10	0.13470	T	0.59	.	8.2466	0.31693	0.202:0.0:0.798:0.0	.	740;740	O43306-2;O43306	.;ADCY6_HUMAN	V	740	ENSP00000350536:A740V;ENSP00000446730:A740V;ENSP00000311405:A740V	ENSP00000311405:A740V	A	-	2	0	ADCY6	47454516	0.679000	0.27596	1.000000	0.80357	0.892000	0.51952	2.661000	0.46758	0.963000	0.38082	0.561000	0.74099	GCA	.		0.537	ADCY6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408863.1	NM_020983	
FAM186A	121006	broad.mit.edu	37	12	50746166	50746166	+	Silent	SNP	G	G	C	rs368983791		TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr12:50746166G>C	ENST00000327337.5	-	4	4448	c.4449C>G	c.(4447-4449)ctC>ctG	p.L1483L	FAM186A_ENST00000543111.1_Silent_p.L1483L|FAM186A_ENST00000543096.1_5'Flank	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	1483								p.L1483L(2)									GCGGAGGGATGAGAGGGATCC	0.647																																					p.L1483L	NSCLC(138;1796 1887 12511 19463 37884)												.	FAM186A-68	2	Substitution - coding silent(2)	endometrium(2)	c.C4449G						.						22.0	21.0	21.0					12																	50746166		692	1591	2283	SO:0001819	synonymous_variant	121006	exon4			AGGGATGAGAGGG		CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.4449C>G	12.37:g.50746166G>C		Somatic	173	1		WXS	Illumina HiSeq	Phase_I	408	6	NM_001145475	0	0	0	0	0		Silent	SNP	ENST00000327337.5	37	CCDS44878.1																																																																																			.		0.647	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396838.1	XM_001718353	
HOXC4	3221	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	54447788	54447788	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr12:54447788T>A	ENST00000430889.2	+	1	128	c.82T>A	c.(82-84)Tac>Aac	p.Y28N	HOXC4_ENST00000303406.4_Missense_Mutation_p.Y28N|HOXC4_ENST00000609810.1_Missense_Mutation_p.Y28N	NM_153633.2	NP_705897.1	P09017	HXC4_HUMAN	homeobox C4	28					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	13						GCAAAATAGCTACATCCCTGA	0.493																																					p.Y28N		.											.	HOXC4-91	0			c.T82A						.						127.0	129.0	128.0					12																	54447788		2203	4300	6503	SO:0001583	missense	3221	exon3			AATAGCTACATCC		CCDS8873.1	12q13.13	2011-06-20	2005-12-22		ENSG00000198353	ENSG00000198353		"""Homeoboxes / ANTP class : HOXL subclass"""	5126	protein-coding gene	gene with protein product		142974	"""homeo box C4"""	HOX3, HOX3E		1973146, 1358459	Standard	NM_014620		Approved		uc001sex.3	P09017	OTTHUMG00000160036	ENST00000430889.2:c.82T>A	12.37:g.54447788T>A	ENSP00000399808:p.Tyr28Asn	Somatic	72	0		WXS	Illumina HiSeq	Phase_I	205	40	NM_014620	0	0	1	2	1		Missense_Mutation	SNP	ENST00000430889.2	37	CCDS8873.1	.	.	.	.	.	.	.	.	.	.	T	18.84	3.710126	0.68730	.	.	ENSG00000198353	ENST00000303406;ENST00000430889	D;D	0.83992	-1.79;-1.79	3.41	3.41	0.39046	.	0.152719	0.44902	D	0.000404	D	0.92014	0.7470	M	0.92317	3.295	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	D	0.93212	0.6601	10	0.72032	D	0.01	.	11.785	0.52037	0.0:0.0:0.0:1.0	.	28	P09017	HXC4_HUMAN	N	28	ENSP00000305973:Y28N;ENSP00000399808:Y28N	ENSP00000305973:Y28N	Y	+	1	0	HOXC4	52734055	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.592000	0.61027	1.775000	0.52247	0.379000	0.24179	TAC	.		0.493	HOXC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358963.1		
NAB2	4665	broad.mit.edu	37	12	57485520	57485520	+	Silent	SNP	T	T	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr12:57485520T>G	ENST00000300131.3	+	2	1074	c.696T>G	c.(694-696)ggT>ggG	p.G232G	NAB2_ENST00000357680.4_Silent_p.G232G|NAB2_ENST00000342556.6_Silent_p.G232G|NAB2_ENST00000554718.1_3'UTR	NM_005967.3	NP_005958.1	Q15742	NAB2_HUMAN	NGFI-A binding protein 2 (EGR1 binding protein 2)	232					cell proliferation (GO:0008283)|endochondral ossification (GO:0001958)|myelination (GO:0042552)|negative regulation of transcription from RNA polymerase III promoter (GO:0016480)|nervous system development (GO:0007399)|regulation of epidermis development (GO:0045682)|Schwann cell differentiation (GO:0014037)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	20						GGACTGGGGGTGGTCCAGACC	0.667																																					p.G232G													.	NAB2-92	0			c.T696G						.						53.0	61.0	58.0					12																	57485520		2203	4300	6503	SO:0001819	synonymous_variant	4665	exon2			TGGGGGTGGTCCA	BC065931	CCDS8930.1	12q13.3	2008-05-14				ENSG00000166886			7627	protein-coding gene	gene with protein product		602381				8668170, 8649813	Standard	XM_005268894		Approved	MADER	uc001smz.3	Q15742		ENST00000300131.3:c.696T>G	12.37:g.57485520T>G		Somatic	63	7		WXS	Illumina HiSeq	Phase_I	166	16	NM_005967	0	0	11	11	0	B2RAK3|O76006|Q14797	Silent	SNP	ENST00000300131.3	37	CCDS8930.1																																																																																			.		0.667	NAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412222.1	NM_005967	
TPH2	121278	broad.mit.edu	37	12	72425407	72425407	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr12:72425407G>A	ENST00000333850.3	+	11	1546	c.1405G>A	c.(1405-1407)Gac>Aac	p.D469N		NM_173353.3	NP_775489.2	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2	469					aromatic amino acid family metabolic process (GO:0009072)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to lithium ion (GO:0071285)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|response to activity (GO:0014823)|response to calcium ion (GO:0051592)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to nutrient levels (GO:0031667)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|neuron projection (GO:0043005)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|tryptophan 5-monooxygenase activity (GO:0004510)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	41					L-Tryptophan(DB00150)	TGTGGTGCAGGACCTTCGCAG	0.413																																					p.D469N													.	TPH2-93	0			c.G1405A						.						168.0	163.0	165.0					12																	72425407		2203	4300	6503	SO:0001583	missense	121278	exon11			GTGCAGGACCTTC	AY098914	CCDS31859.1	12q15	2008-02-07				ENSG00000139287	1.14.16.4		20692	protein-coding gene	gene with protein product		607478				12511643	Standard	NM_173353		Approved	NTPH, FLJ37295	uc009zrw.1	Q8IWU9		ENST00000333850.3:c.1405G>A	12.37:g.72425407G>A	ENSP00000329093:p.Asp469Asn	Somatic	86	0		WXS	Illumina HiSeq	Phase_I	244	5	NM_173353	0	0	0	0	0	A6NGA4|Q14CB0	Missense_Mutation	SNP	ENST00000333850.3	37	CCDS31859.1	.	.	.	.	.	.	.	.	.	.	G	15.44	2.835429	0.50951	.	.	ENSG00000139287	ENST00000333850	D	0.99507	-6.04	5.86	5.86	0.93980	Aromatic amino acid hydroxylase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.97114	0.9057	N	0.05510	-0.035	0.80722	D	1	B	0.19583	0.037	B	0.24006	0.05	D	0.95632	0.8690	10	0.12103	T	0.63	-30.7387	20.1858	0.98214	0.0:0.0:1.0:0.0	.	469	Q8IWU9	TPH2_HUMAN	N	469	ENSP00000329093:D469N	ENSP00000329093:D469N	D	+	1	0	TPH2	70711674	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	9.869000	0.99810	2.777000	0.95525	0.591000	0.81541	GAC	.		0.413	TPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405234.1	NM_173353	
RNF10	9921	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	120984362	120984362	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr12:120984362C>A	ENST00000325954.4	+	2	773	c.312C>A	c.(310-312)agC>agA	p.S104R	RNF10_ENST00000413266.2_Missense_Mutation_p.S104R	NM_014868.4	NP_055683.3	Q8N5U6	RNF10_HUMAN	ring finger protein 10	104	Interaction with MEOX2.|Ser-rich.				negative regulation of Schwann cell proliferation (GO:0010626)|positive regulation of myelination (GO:0031643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autoubiquitination (GO:0051865)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)	27	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GCGGCAGCAGCAAACTCTTTA	0.453																																					p.S104R													.	RNF10-227	0			c.C312A						.						60.0	62.0	61.0					12																	120984362		2203	4300	6503	SO:0001583	missense	9921	exon2			CAGCAGCAAACTC	AB027196	CCDS9201.1	12q23-q24	2013-01-09			ENSG00000022840	ENSG00000022840		"""RING-type (C3HC4) zinc fingers"""	10055	protein-coding gene	gene with protein product							Standard	NM_014868		Approved	KIAA0262, RIE2	uc001typ.4	Q8N5U6	OTTHUMG00000168999	ENST00000325954.4:c.312C>A	12.37:g.120984362C>A	ENSP00000322242:p.Ser104Arg	Somatic	46	2		WXS	Illumina HiSeq	Phase_I	165	40	NM_014868	0	0	8	10	2	Q92550|Q9NPP8|Q9ULW4	Missense_Mutation	SNP	ENST00000325954.4	37	CCDS9201.1	.	.	.	.	.	.	.	.	.	.	C	14.89	2.669800	0.47677	.	.	ENSG00000022840	ENST00000325954;ENST00000458409;ENST00000413266;ENST00000537997	D;D	0.88741	-2.42;-2.42	5.03	5.03	0.67393	.	0.200864	0.46758	D	0.000264	D	0.84483	0.5482	L	0.43152	1.355	0.36642	D	0.87688	B;B	0.26975	0.145;0.165	B;B	0.28784	0.029;0.094	T	0.82151	-0.0599	10	0.11182	T	0.66	.	16.9038	0.86120	0.0:1.0:0.0:0.0	.	104;104	Q8N5U6-2;Q8N5U6	.;RNF10_HUMAN	R	104;104;104;54	ENSP00000322242:S104R;ENSP00000415682:S104R	ENSP00000322242:S104R	S	+	3	2	RNF10	119468745	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.907000	0.48743	2.479000	0.83701	0.655000	0.94253	AGC	.		0.453	RNF10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401898.4		
HCAR1	27198	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	123214112	123214112	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr12:123214112C>T	ENST00000436083.2	-	1	1278	c.775G>A	c.(775-777)Gcc>Acc	p.A259T	HCAR1_ENST00000432564.1_Missense_Mutation_p.A259T|HCAR1_ENST00000356987.2_Missense_Mutation_p.A259T			Q9BXC0	HCAR1_HUMAN	hydroxycarboxylic acid receptor 1	259					response to estradiol (GO:0032355)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(1)|kidney(1)|lung(1)|ovary(1)|pancreas(1)|skin(1)	10						ATGTGCAGGGCCCCATGGACA	0.522																																					p.A259T		.											.	HCAR1-156	0			c.G775A						.						81.0	81.0	81.0					12																	123214112		2203	4300	6503	SO:0001583	missense	27198	exon1			GCAGGGCCCCATG	AF411110	CCDS9236.1	12q24.31	2012-08-08	2011-05-30	2011-05-30	ENSG00000196917	ENSG00000196917		"""GPCR / Class A : Hydroxy-carboxylic acid receptors"""	4532	protein-coding gene	gene with protein product	"""lactate receptor 1"""	606923	"""G protein-coupled receptor 104"", ""G protein-coupled receptor 81"""	GPR104, GPR81		11574155, 19047060, 18952058, 21454438	Standard	NM_032554		Approved	HCA1, FKSG80, TA-GPCR, LACR1	uc001ucz.3	Q9BXC0		ENST00000436083.2:c.775G>A	12.37:g.123214112C>T	ENSP00000409980:p.Ala259Thr	Somatic	78	0		WXS	Illumina HiSeq	Phase_I	213	92	NM_032554	0	0	0	0	0	B2R9X4|Q3Y5J3|Q4VBN1|Q6NXU5	Missense_Mutation	SNP	ENST00000436083.2	37	CCDS9236.1	.	.	.	.	.	.	.	.	.	.	C	15.54	2.864791	0.51482	.	.	ENSG00000196917	ENST00000356987;ENST00000432564;ENST00000436083	T;T;T	0.38401	1.14;1.14;1.14	5.62	4.72	0.59763	GPCR, rhodopsin-like superfamily (1);	0.162482	0.38272	N	0.001754	T	0.50292	0.1607	L	0.55481	1.735	0.37418	D	0.913513	D	0.61697	0.99	D	0.64877	0.93	T	0.49872	-0.8893	10	0.33141	T	0.24	-12.0983	12.8086	0.57628	0.0:0.9183:0.0:0.0817	.	259	Q9BXC0	HCAR1_HUMAN	T	259	ENSP00000349478:A259T;ENSP00000389255:A259T;ENSP00000409980:A259T	ENSP00000349478:A259T	A	-	1	0	HCAR1	121780065	0.985000	0.35326	0.946000	0.38457	0.043000	0.13939	2.721000	0.47260	2.653000	0.90120	0.655000	0.94253	GCC	.		0.522	HCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401415.1		
GPR133	283383	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	131471648	131471648	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr12:131471648T>G	ENST00000261654.5	+	6	1058	c.499T>G	c.(499-501)Tgg>Ggg	p.W167G	GPR133_ENST00000535015.1_Missense_Mutation_p.W199G	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	167					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		AGGCCCCTATTGGACTCATGT	0.493																																					p.W167G		.											.	GPR133-191	0			c.T499G						.						59.0	57.0	58.0					12																	131471648		2203	4300	6503	SO:0001583	missense	283383	exon6			CCCTATTGGACTC	AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.499T>G	12.37:g.131471648T>G	ENSP00000261654:p.Trp167Gly	Somatic	46	0		WXS	Illumina HiSeq	Phase_I	120	25	NM_198827	0	0	0	0	0	B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Missense_Mutation	SNP	ENST00000261654.5	37	CCDS9272.1	.	.	.	.	.	.	.	.	.	.	T	15.41	2.826517	0.50739	.	.	ENSG00000111452	ENST00000261654;ENST00000542091;ENST00000535015	D;D;D	0.86769	-2.17;-2.17;-2.17	4.55	4.55	0.56014	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.85682	D	0.000000	D	0.94679	0.8284	M	0.93898	3.47	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.99	D	0.95634	0.8692	10	0.72032	D	0.01	.	13.1073	0.59253	0.0:0.0:0.0:1.0	.	199;167	B7ZLF7;Q6QNK2	.;GP133_HUMAN	G	167;107;199	ENSP00000261654:W167G;ENSP00000442501:W107G;ENSP00000444425:W199G	ENSP00000261654:W167G	W	+	1	0	GPR133	130037601	1.000000	0.71417	1.000000	0.80357	0.406000	0.30931	7.078000	0.76821	1.685000	0.51034	0.533000	0.62120	TGG	.		0.493	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399356.1	NM_198827	
COG6	57511	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	40251678	40251678	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr13:40251678A>G	ENST00000455146.3	+	5	552	c.502A>G	c.(502-504)Agt>Ggt	p.S168G	COG6_ENST00000416691.1_Missense_Mutation_p.S168G	NM_020751.2	NP_065802.1	Q9Y2V7	COG6_HUMAN	component of oligomeric golgi complex 6	168					glycosylation (GO:0070085)|intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				NS(1)|kidney(2)|large_intestine(5)|lung(4)|skin(1)	13		Lung NSC(96;0.000124)|Breast(139;0.0199)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.03e-09)|Epithelial(112;7e-07)|OV - Ovarian serous cystadenocarcinoma(117;0.00015)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.0168)		TGATGAAATGAGTCTTCTCCG	0.348																																					p.S168G		.											.	COG6-227	0			c.A502G						.						87.0	81.0	83.0					13																	40251678		2203	4300	6503	SO:0001583	missense	57511	exon5			GAAATGAGTCTTC	AK026638	CCDS9370.1, CCDS45042.1	13q13.2	2011-08-01			ENSG00000133103	ENSG00000133103		"""Components of oligomeric golgi complex"""	18621	protein-coding gene	gene with protein product		606977				11980916	Standard	NM_020751		Approved	COD2, KIAA1134	uc001uxh.2	Q9Y2V7	OTTHUMG00000016768	ENST00000455146.3:c.502A>G	13.37:g.40251678A>G	ENSP00000397441:p.Ser168Gly	Somatic	53	0		WXS	Illumina HiSeq	Phase_I	113	36	NM_001145079	0	0	0	0	0	Q5T0U1|Q6AI19|Q86V49|Q9ULT5	Missense_Mutation	SNP	ENST00000455146.3	37	CCDS9370.1	.	.	.	.	.	.	.	.	.	.	A	12.40	1.927586	0.34002	.	.	ENSG00000133103	ENST00000416691;ENST00000255468;ENST00000422759;ENST00000455146	T;T;T	0.55588	0.51;0.51;0.51	5.78	-1.08	0.09936	.	0.333784	0.40640	N	0.001058	T	0.29321	0.0730	N	0.24115	0.695	0.28989	N	0.888159	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.10989	-1.0606	10	0.22109	T	0.4	-11.1167	5.8826	0.18864	0.5582:0.1302:0.3116:0.0	.	189;168	Q5T0U2;Q9Y2V7	.;COG6_HUMAN	G	168;199;168;168	ENSP00000403733:S168G;ENSP00000412877:S168G;ENSP00000397441:S168G	ENSP00000255468:S199G	S	+	1	0	COG6	39149678	1.000000	0.71417	0.941000	0.38009	0.875000	0.50365	2.795000	0.47861	-0.395000	0.07715	-0.334000	0.08254	AGT	.		0.348	COG6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044622.3		
IPO5	3843	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	98667795	98667795	+	Silent	SNP	A	A	T	rs61750357		TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr13:98667795A>T	ENST00000490680.1	+	20	2402	c.2337A>T	c.(2335-2337)gtA>gtT	p.V779V	IPO5_ENST00000539640.1_Silent_p.V654V|IPO5_ENST00000261574.5_Silent_p.V797V			O00410	IPO5_HUMAN	importin 5	779					cellular response to amino acid stimulus (GO:0071230)|negative regulation of catalytic activity (GO:0043086)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein import into nucleus (GO:0042307)|ribosomal protein import into nucleus (GO:0006610)|viral process (GO:0016032)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|Ran GTPase binding (GO:0008536)			breast(2)|endometrium(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	27						GCATTGAAGTAATGGGAGATG	0.348																																					p.V797V		.											.	IPO5-228	0			c.A2391T						.						108.0	107.0	107.0					13																	98667795		2203	4300	6503	SO:0001819	synonymous_variant	3843	exon23			TGAAGTAATGGGA	U72761	CCDS31999.1	13q32.2	2012-05-02	2008-04-15	2008-04-15	ENSG00000065150	ENSG00000065150		"""Importins"""	6402	protein-coding gene	gene with protein product		602008	"""karyopherin (importin) beta 3"", ""RAN binding protein 5"""	KPNB3, RANBP5		9114010, 9271386, 17005651	Standard	NM_002271		Approved	IMB3, MGC2068, Pse1	uc001vne.3	O00410	OTTHUMG00000017244	ENST00000490680.1:c.2337A>T	13.37:g.98667795A>T		Somatic	85	0		WXS	Illumina HiSeq	Phase_I	167	61	NM_002271	0	0	0	0	0	B4DZA0|O15257|Q5T578|Q86XC7	Silent	SNP	ENST00000490680.1	37		.	.	.	.	.	.	.	.	.	.	A	10.56	1.383369	0.25031	.	.	ENSG00000065150	ENST00000469360	.	.	.	5.72	-3.39	0.04868	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-8.1611	7.7355	0.28812	0.295:0.5469:0.06:0.0981	.	.	.	.	L	781	.	.	X	+	2	2	IPO5	97465796	0.965000	0.33210	0.966000	0.40874	0.996000	0.88848	0.136000	0.15974	-0.832000	0.04251	0.533000	0.62120	TAA	.		0.348	IPO5-006	NOVEL	alternative_5_UTR|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000354655.1	NM_002271	
Unknown	0	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	103401232	103401232	+	IGR	SNP	C	C	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr13:103401232C>G								LINC00283 (3658 upstream) : TEX30 (17107 downstream)																							ACTCCTTTTCCTTTTTAGTAA	0.353																																					p.K605N		.											.	.	0			c.G1815C						.						45.0	35.0	38.0					13																	103401232		692	1588	2280	SO:0001628	intergenic_variant	643677	exon4			CTTTTCCTTTTTA																													13.37:g.103401232C>G		Somatic	75	0		WXS	Illumina HiSeq	Phase_I	169	62	NM_001146197	0	0	0	0	0		Missense_Mutation	SNP		37																																																																																				.	0	0.353								
ATP11A	23250	hgsc.bcm.edu;broad.mit.edu	37	13	113474213	113474213	+	Splice_Site	SNP	G	G	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr13:113474213G>A	ENST00000487903.1	+	8	762		c.e8-1		ATP11A_ENST00000283558.8_Splice_Site|ATP11A_ENST00000375630.2_Splice_Site|ATP11A_ENST00000375645.3_Splice_Site			P98196	AT11A_HUMAN	ATPase, class VI, type 11A						phospholipid translocation (GO:0045332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(12)|lung(17)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	51	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				TCTGTCGCCAGGTTCGTGGGT	0.637																																					.		.											.	ATP11A-138	0			c.675-1G>A						.						125.0	89.0	101.0					13																	113474213		2203	4300	6503	SO:0001630	splice_region_variant	23250	exon8			TCGCCAGGTTCGT	AB028944	CCDS32011.1	13q34	2010-04-20	2007-09-19		ENSG00000068650	ENSG00000068650	3.6.3.1	"""ATPases / P-type"""	13552	protein-coding gene	gene with protein product	"""potential phospholipid-transporting ATPase IH"", ""phospholipid-translocating ATPase"""	605868	"""ATPase, Class VI, type 11A"""			11015572	Standard	NM_032189		Approved	ATPIH, ATPIS, KIAA1021	uc001vsj.4	P98196	OTTHUMG00000017371	ENST00000487903.1:c.675-1G>A	13.37:g.113474213G>A		Somatic	10	0		WXS	Illumina HiSeq	Phase_I	57	18	NM_015205	0	0	0	0	0	Q5VXT2	Splice_Site	SNP	ENST00000487903.1	37	CCDS32011.1	.	.	.	.	.	.	.	.	.	.	G	12.40	1.927015	0.34002	.	.	ENSG00000068650	ENST00000487903;ENST00000375630;ENST00000375645;ENST00000283558;ENST00000418678	.	.	.	4.87	4.87	0.63330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8794	0.63674	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATP11A	112522214	1.000000	0.71417	0.997000	0.53966	0.023000	0.10783	6.506000	0.73712	2.406000	0.81754	0.591000	0.81541	.	.		0.637	ATP11A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000045834.3	NM_015205	Intron
LTBP2	4053	broad.mit.edu;ucsc.edu	37	14	74970233	74970233	+	Silent	SNP	G	G	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr14:74970233G>A	ENST00000261978.4	-	32	5045	c.4659C>T	c.(4657-4659)tgC>tgT	p.C1553C	LTBP2_ENST00000556690.1_Silent_p.C1509C	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	1553	EGF-like 18; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		GCGGGGGGCTGCAGAAGCAGT	0.652																																					p.C1553C													.	LTBP2-92	0			c.C4659T						.						57.0	41.0	47.0					14																	74970233		2203	4300	6503	SO:0001819	synonymous_variant	4053	exon32			GGGGCTGCAGAAG		CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.4659C>T	14.37:g.74970233G>A		Somatic	26	0		WXS	Illumina HiSeq	Phase_I	43	4	NM_000428	0	0	0	0	0	Q99907|Q9NS51	Silent	SNP	ENST00000261978.4	37	CCDS9831.1																																																																																			.		0.652	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413595.1	NM_000428	
ZSCAN29	146050	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	43653718	43653718	+	Silent	SNP	T	T	C			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr15:43653718T>C	ENST00000396976.2	-	5	2246	c.2112A>G	c.(2110-2112)aaA>aaG	p.K704K	ZSCAN29_ENST00000396972.1_Silent_p.K315K|ZSCAN29_ENST00000568898.1_Silent_p.K314K|ZSCAN29_ENST00000562072.1_3'UTR	NM_152455.3	NP_689668.3	Q8IWY8	ZSC29_HUMAN	zinc finger and SCAN domain containing 29	704					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(7)|skin(2)	24		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.97e-07)		ATTTATAAGGTTTCTCTCCAG	0.438																																					p.K704K		.											.	ZSCAN29-91	0			c.A2112G						.						60.0	57.0	58.0					15																	43653718		2201	4299	6500	SO:0001819	synonymous_variant	146050	exon5			ATAAGGTTTCTCT	AF525399	CCDS10095.2	15q15.3	2013-01-08	2007-03-08	2007-03-08	ENSG00000140265	ENSG00000140265		"""-"", ""Zinc fingers, C2H2-type"""	26673	protein-coding gene	gene with protein product			"""zinc finger protein 690"""	ZNF690		12434312	Standard	NM_152455		Approved	FLJ35867, Zfp690	uc001zrk.1	Q8IWY8	OTTHUMG00000130767	ENST00000396976.2:c.2112A>G	15.37:g.43653718T>C		Somatic	64	0		WXS	Illumina HiSeq	Phase_I	155	43	NM_152455	0	0	2	2	0	B3KVB9|Q32M75|Q32M76|Q8NA40	Silent	SNP	ENST00000396976.2	37	CCDS10095.2																																																																																			.		0.438	ZSCAN29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253278.1	NM_152455	
IGDCC4	57722	broad.mit.edu	37	15	65678318	65678318	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr15:65678318T>G	ENST00000352385.2	-	18	3240	c.3031A>C	c.(3031-3033)Agc>Cgc	p.S1011R	IGDCC4_ENST00000558048.1_5'Flank	NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4	1011						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						GCTGGGGGGCTGGGGGGGCCA	0.667											OREG0023195	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S1011R													.	IGDCC4-93	0			c.A3031C						.						8.0	10.0	10.0					15																	65678318		2066	4111	6177	SO:0001583	missense	57722	exon18			GGGGGCTGGGGGG		CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.3031A>C	15.37:g.65678318T>G	ENSP00000319623:p.Ser1011Arg	Somatic	33	5	1086	WXS	Illumina HiSeq	Phase_I	59	10	NM_020962	0	0	0	0	0	Q9HCE4	Missense_Mutation	SNP	ENST00000352385.2	37	CCDS10206.1	.	.	.	.	.	.	.	.	.	.	T	10.25	1.297630	0.23650	.	.	ENSG00000103742	ENST00000352385;ENST00000356152	T	0.59906	0.23	4.82	3.67	0.42095	.	0.538559	0.18548	N	0.137987	T	0.43478	0.1249	L	0.40543	1.245	0.09310	N	1	P	0.49961	0.93	B	0.41571	0.36	T	0.35895	-0.9770	10	0.39692	T	0.17	-8.3717	5.5087	0.16868	0.0:0.217:0.0:0.783	.	1011	Q8TDY8	IGDC4_HUMAN	R	1011;740	ENSP00000319623:S1011R	ENSP00000319623:S1011R	S	-	1	0	IGDCC4	63465371	0.000000	0.05858	0.243000	0.24186	0.006000	0.05464	0.500000	0.22562	2.024000	0.59613	0.459000	0.35465	AGC	.		0.667	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256825.2	NM_020962	
FAM154B	283726	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	82575198	82575198	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr15:82575198C>A	ENST00000339465.5	+	3	1061	c.992C>A	c.(991-993)aCa>aAa	p.T331K	FAM154B_ENST00000427381.2_Missense_Mutation_p.T316K|FAM154B_ENST00000565501.1_3'UTR	NM_001008226.1	NP_001008227.1	Q658L1	F154B_HUMAN	family with sequence similarity 154, member B	331										autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|skin(2)	19						TTGATCCCAACAGAGAGTTGC	0.388																																					p.T331K		.											.	FAM154B-70	0			c.C992A						.						74.0	74.0	74.0					15																	82575198		2203	4300	6503	SO:0001583	missense	283726	exon3			TCCCAACAGAGAG	AL833762	CCDS32310.1	15q25.2	2008-02-21				ENSG00000188659			33727	protein-coding gene	gene with protein product							Standard	XM_005254317		Approved	DKFZp666G057	uc002bgv.3	Q658L1		ENST00000339465.5:c.992C>A	15.37:g.82575198C>A	ENSP00000340445:p.Thr331Lys	Somatic	171	0		WXS	Illumina HiSeq	Phase_I	402	132	NM_001008226	0	0	0	0	0	B4E2M2	Missense_Mutation	SNP	ENST00000339465.5	37	CCDS32310.1	.	.	.	.	.	.	.	.	.	.	C	12.76	2.034412	0.35893	.	.	ENSG00000188659	ENST00000339465;ENST00000427381	T;T	0.16743	2.32;2.32	4.22	3.28	0.37604	.	0.172782	0.36628	N	0.002496	T	0.36248	0.0960	M	0.82323	2.585	0.09310	N	0.999996	D;D	0.76494	0.999;0.984	D;P	0.68765	0.96;0.881	T	0.24693	-1.0153	10	0.14656	T	0.56	-8.4012	8.8098	0.34961	0.0:0.7627:0.1525:0.0849	.	316;331	B4E2M2;Q658L1	.;F154B_HUMAN	K	331;316	ENSP00000340445:T331K;ENSP00000403743:T316K	ENSP00000340445:T331K	T	+	2	0	FAM154B	80362253	0.114000	0.22134	0.015000	0.15790	0.341000	0.28922	0.879000	0.28146	0.867000	0.35654	0.404000	0.27445	ACA	.		0.388	FAM154B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419644.1	NM_001008226	
ALPK3	57538	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	85407685	85407685	+	Silent	SNP	G	G	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr15:85407685G>A	ENST00000258888.5	+	12	5285	c.5118G>A	c.(5116-5118)ctG>ctA	p.L1706L		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1706	Alpha-type protein kinase. {ECO:0000255|PROSITE-ProRule:PRU00501}.				heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			TCATCCCACTGTATCTGATCT	0.512																																					p.L1706L		.											.	ALPK3-337	0			c.G5118A						.						94.0	84.0	87.0					15																	85407685		2203	4299	6502	SO:0001819	synonymous_variant	57538	exon12			CCCACTGTATCTG	AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.5118G>A	15.37:g.85407685G>A		Somatic	55	0		WXS	Illumina HiSeq	Phase_I	122	47	NM_020778	0	0	0	0	0	Q9P2L6	Silent	SNP	ENST00000258888.5	37	CCDS10333.1																																																																																			.		0.512	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308997.1	NM_020778	
NDUFB10	4716	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	2011289	2011289	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr16:2011289A>T	ENST00000268668.6	+	2	383	c.266A>T	c.(265-267)gAc>gTc	p.D89V	NDUFB10_ENST00000543683.2_Missense_Mutation_p.D89V|NDUFB10_ENST00000569148.1_Intron|SNORA10_ENST00000384084.1_RNA|SNORA64_ENST00000384674.1_RNA	NM_004548.2	NP_004539.1	O96000	NDUBA_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa	89					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			lung(1)|urinary_tract(1)	2						TGGAAGAGGGACTAGTACGTG	0.567																																					p.D89V		.											.	NDUFB10-90	0			c.A266T						.						194.0	142.0	160.0					16																	2011289		2199	4300	6499	SO:0001583	missense	4716	exon2			AGAGGGACTAGTA	AF044954	CCDS10451.1	16p13.3	2011-07-04	2002-08-29		ENSG00000140990	ENSG00000140990		"""Mitochondrial respiratory chain complex / Complex I"""	7696	protein-coding gene	gene with protein product	"""complex I PDSW subunit"""	603843	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10 (22kD, PDSW)"""			9763677, 9878551	Standard	NM_004548		Approved	PDSW	uc002cni.2	O96000	OTTHUMG00000128709	ENST00000268668.6:c.266A>T	16.37:g.2011289A>T	ENSP00000268668:p.Asp89Val	Somatic	38	0		WXS	Illumina HiSeq	Phase_I	94	32	NM_004548	0	0	2	3	1	Q96II6	Missense_Mutation	SNP	ENST00000268668.6	37	CCDS10451.1	.	.	.	.	.	.	.	.	.	.	A	17.97	3.519366	0.64634	.	.	ENSG00000140990	ENST00000268668;ENST00000543683	.	.	.	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.81767	0.4892	M	0.88105	2.93	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.85631	0.1270	9	0.87932	D	0	-38.553	14.1338	0.65273	1.0:0.0:0.0:0.0	.	89;89	Q96II6;O96000	.;NDUBA_HUMAN	V	89	.	ENSP00000268668:D89V	D	+	2	0	NDUFB10	1951290	1.000000	0.71417	1.000000	0.80357	0.253000	0.25986	8.564000	0.90726	1.936000	0.56123	0.533000	0.62120	GAC	.		0.567	NDUFB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250614.2	NM_004548	
TRAP1	10131	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	16	3712967	3712967	+	Splice_Site	SNP	G	G	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr16:3712967G>A	ENST00000246957.5	-	15	1798	c.1710C>T	c.(1708-1710)gcC>gcT	p.A570A	TRAP1_ENST00000575671.1_Splice_Site_p.A361A|DNASE1_ENST00000414110.2_Intron|DNASE1_ENST00000575152.1_3'UTR|TRAP1_ENST00000538171.1_Splice_Site_p.A517A	NM_016292.2	NP_057376.2	Q12931	TRAP1_HUMAN	TNF receptor-associated protein 1	570					chaperone-mediated protein folding (GO:0061077)|negative regulation of cellular respiration (GO:1901856)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to stress (GO:0006950)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|tumor necrosis factor receptor binding (GO:0005164)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19		Ovarian(90;0.0261)				GGCACTCGGCGGCTGCGGAAG	0.642																																					p.A570A		.											.	TRAP1-226	0			c.C1710T						.						60.0	46.0	51.0					16																	3712967		2197	4300	6497	SO:0001630	splice_region_variant	10131	exon15			CTCGGCGGCTGCG	AF154108	CCDS10508.1, CCDS61824.1	16p13.3	2011-09-02			ENSG00000126602	ENSG00000126602		"""Heat shock proteins / HSPC"""	16264	protein-coding gene	gene with protein product		606219				10652318, 7876093	Standard	NM_016292		Approved	HSP75, HSP90L	uc002cvt.4	Q12931	OTTHUMG00000129427	ENST00000246957.5:c.1709-1C>T	16.37:g.3712967G>A		Somatic	12	0		WXS	Illumina HiSeq	Phase_I	27	10	NM_016292	0	0	4	4	0	B4DR68|D3DUC8|F5H897|O43642|O75235|Q9UHL5	Silent	SNP	ENST00000246957.5	37	CCDS10508.1																																																																																			.		0.642	TRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251586.2	NM_016292	Silent
PKD1L3	342372	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	72011209	72011209	+	RNA	SNP	C	C	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr16:72011209C>G	ENST00000534738.1	-	0	1684							Q7Z443	PK1L3_HUMAN	polycystic kidney disease 1-like 3						cation transport (GO:0006812)|cellular response to acidic pH (GO:0071468)|detection of chemical stimulus involved in sensory perception of sour taste (GO:0001581)|neuropeptide signaling pathway (GO:0007218)|sensory perception of sour taste (GO:0050915)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)			autonomic_ganglia(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|lung(3)|skin(2)	22						ATACTGGAACCCCAGGTAGAG	0.453																																					.													.	PKD1L3-68	0			.						.						276.0	235.0	247.0					16																	72011209		692	1591	2283			342372	.			TGGAACCCCAGGT	AY164485	CCDS73912.1	16q22.2	2008-02-05				ENSG00000277481			21716	protein-coding gene	gene with protein product		607895				12782129	Standard	NM_181536		Approved		uc010vmm.2	Q7Z443			16.37:g.72011209C>G		Somatic	51	0		WXS	Illumina HiSeq	Phase_I	90	37	.	0	0	0	0	0		Missense_Mutation	SNP	ENST00000534738.1	37																																																																																				.		0.453	PKD1L3-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000387876.1	NM_181536	
KDM6B	23135	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	17	7748926	7748926	+	Silent	SNP	C	C	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr17:7748926C>A	ENST00000448097.2	+	4	385	c.54C>A	c.(52-54)gcC>gcA	p.A18A	KDM6B_ENST00000254846.5_Silent_p.A18A			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	18					cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						AAGCCTTTGCCCTTGGGGGCC	0.642																																					p.A18A		.											.	KDM6B-205	0			c.C54A						.						56.0	59.0	58.0					17																	7748926		2203	4300	6503	SO:0001819	synonymous_variant	23135	exon4			CTTTGCCCTTGGG	AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		ENST00000448097.2:c.54C>A	17.37:g.7748926C>A		Somatic	72	0		WXS	Illumina HiSeq	Phase_I	184	40	NM_001080424	0	0	2	2	0	C9IZ40|Q96G33	Silent	SNP	ENST00000448097.2	37																																																																																				.		0.642	KDM6B-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000440248.1	XM_043272	
ELAC2	60528	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	12898190	12898190	+	Silent	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr17:12898190A>G	ENST00000338034.4	-	21	2159	c.1920T>C	c.(1918-1920)tgT>tgC	p.C640C	ELAC2_ENST00000426905.3_Silent_p.C600C|ELAC2_ENST00000395962.2_Silent_p.C621C	NM_018127.6|NM_173717.1	NP_060597.4|NP_776065.1	Q9BQ52	RNZ2_HUMAN	elaC ribonuclease Z 2	640					mitochondrial tRNA 3'-trailer cleavage, endonucleolytic (GO:0072684)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|skin(1)	23						GCCGCACCAGACAGGTCTGAA	0.622																																					p.C640C		.											.	ELAC2-90	0			c.T1920C						.						72.0	78.0	76.0					17																	12898190		2203	4300	6503	SO:0001819	synonymous_variant	60528	exon21			CACCAGACAGGTC	AF304370	CCDS11164.1, CCDS54093.1	17p11.2	2013-05-24	2013-05-24		ENSG00000006744	ENSG00000006744	3.1.26.11		14198	protein-coding gene	gene with protein product	"""tRNase Z (long form)"""	605367	"""elaC (E. coli) homolog 2"", ""elaC homolog 2 (E. coli)"""			10986046, 16636667, 21559454	Standard	NM_018127		Approved	FLJ10530, HPC2	uc010vvr.2	Q9BQ52	OTTHUMG00000058764	ENST00000338034.4:c.1920T>C	17.37:g.12898190A>G		Somatic	41	0		WXS	Illumina HiSeq	Phase_I	121	60	NM_018127	0	0	2	2	0	B4DPL9|Q6IA94|Q9HAS8|Q9HAS9|Q9NVT1	Silent	SNP	ENST00000338034.4	37	CCDS11164.1																																																																																			.		0.622	ELAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129934.5		
TBC1D28	254272	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	18541949	18541949	+	Silent	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr17:18541949A>G	ENST00000345096.4	-	6	963	c.264T>C	c.(262-264)taT>taC	p.Y88Y	TBC1D28_ENST00000405044.1_Silent_p.Y88Y			Q2M2D7	TBC28_HUMAN	TBC1 domain family, member 28	88							Rab GTPase activator activity (GO:0005097)			breast(1)|large_intestine(5)|lung(2)|ovary(1)	9						TGGTGCTCCTATATTTTGTCC	0.542																																					p.Y88Y		.											.	TBC1D28-91	0			c.T264C						.						120.0	117.0	118.0					17																	18541949		1942	4126	6068	SO:0001819	synonymous_variant	254272	exon7			GCTCCTATATTTT		CCDS42273.1	17p11.2	2008-10-27			ENSG00000189375	ENSG00000189375			26858	protein-coding gene	gene with protein product							Standard	NM_001039397		Approved	FLJ40244	uc002gud.2	Q2M2D7	OTTHUMG00000059054	ENST00000345096.4:c.264T>C	17.37:g.18541949A>G		Somatic	59	0		WXS	Illumina HiSeq	Phase_I	142	60	NM_001039397	0	0	0	0	0	Q2M2E1	Silent	SNP	ENST00000345096.4	37	CCDS42273.1																																																																																			.		0.542	TBC1D28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130672.2	NM_001039397	
MSL1	339287	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	38282491	38282491	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr17:38282491A>G	ENST00000398532.4	+	2	1139	c.824A>G	c.(823-825)aAc>aGc	p.N275S	MSL1_ENST00000578648.1_Missense_Mutation_p.N275S|MSL1_ENST00000579565.1_Missense_Mutation_p.N12S|MSL1_ENST00000577454.1_Missense_Mutation_p.N275S	NM_001012241.1	NP_001012241.1	Q68DK7	MSL1_HUMAN	male-specific lethal 1 homolog (Drosophila)	275					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)	MSL complex (GO:0072487)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|large_intestine(2)|lung(2)	7						AAGAAGGATAACGAGAAAGAA	0.428																																					p.N12S		.											.	MSL1-68	0			c.A35G						.						98.0	98.0	98.0					17																	38282491		1949	4139	6088	SO:0001583	missense	339287	exon3			AGGATAACGAGAA		CCDS45670.1	17q21.1	2011-03-21			ENSG00000188895	ENSG00000188895			27905	protein-coding gene	gene with protein product		614801				16227571, 16543150	Standard	NM_001012241		Approved	hMSL1, MSL-1, DKFZp686P24239	uc002hua.4	Q68DK7		ENST00000398532.4:c.824A>G	17.37:g.38282491A>G	ENSP00000381543:p.Asn275Ser	Somatic	92	0		WXS	Illumina HiSeq	Phase_I	231	110	NM_001012241	0	0	22	49	27	Q0VF46|Q69Z03	Missense_Mutation	SNP	ENST00000398532.4	37		.	.	.	.	.	.	.	.	.	.	A	11.43	1.637733	0.29157	.	.	ENSG00000188895	ENST00000339569;ENST00000398532	.	.	.	5.79	5.79	0.91817	.	0.270557	0.44688	D	0.000434	T	0.22820	0.0551	N	0.19112	0.55	0.26940	N	0.966276	B	0.16396	0.017	B	0.18263	0.021	T	0.28776	-1.0033	9	0.05436	T	0.98	-11.0278	8.4872	0.33078	0.8546:0.0:0.1454:0.0	.	275	Q68DK7	MSL1_HUMAN	S	12;275	.	ENSP00000341409:N12S	N	+	2	0	MSL1	35536017	0.994000	0.37717	1.000000	0.80357	0.965000	0.64279	2.451000	0.44952	2.208000	0.71279	0.533000	0.62120	AAC	.		0.428	MSL1-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000447409.2	NM_001012241	
KRTAP4-11	653240	broad.mit.edu	37	17	39274087	39274087	+	Missense_Mutation	SNP	G	G	C	rs141357429		TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr17:39274087G>C	ENST00000391413.2	-	1	519	c.481C>G	c.(481-483)Ctg>Gtg	p.L161V		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	161	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament (GO:0045095)		p.L161V(1)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			ACTGGACGCAGGcagcagcag	0.657																																					p.L161V													.	.	1	Substitution - Missense(1)	prostate(1)	c.C481G						.						17.0	21.0	20.0					17																	39274087		692	1589	2281	SO:0001583	missense	653240	exon1			GACGCAGGCAGCA	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.481C>G	17.37:g.39274087G>C	ENSP00000375232:p.Leu161Val	Somatic	46	2		WXS	Illumina HiSeq	Phase_I	136	7	NM_033059	0	0	0	0	0	A0AUY2	Missense_Mutation	SNP	ENST00000391413.2	37	CCDS45675.1	249	0.11401098901098901	67	0.13617886178861788	40	0.11049723756906077	104	0.18181818181818182	38	0.05013192612137203	.	1.347	-0.592411	0.03799	.	.	ENSG00000212721	ENST00000391413	T	0.00614	6.21	4.35	0.986	0.19784	.	.	.	.	.	T	0.00012	0.0000	L	0.31752	0.955	0.80722	P	0.0	B	0.30068	0.267	B	0.18871	0.023	T	0.19063	-1.0317	8	0.11794	T	0.64	.	5.8913	0.18915	0.1751:0.0:0.6569:0.168	.	161	Q9BYQ6	KR411_HUMAN	V	161	ENSP00000375232:L161V	ENSP00000375232:L161V	L	-	1	2	KRTAP4-11	36527613	0.671000	0.27521	0.912000	0.35992	0.970000	0.65996	0.971000	0.29396	0.348000	0.23949	0.609000	0.83330	CTG	G|0.500;C|0.500		0.657	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1		
C17orf64	124773	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	58503225	58503225	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr17:58503225G>A	ENST00000269127.4	+	2	217	c.133G>A	c.(133-135)Gat>Aat	p.D45N		NM_181707.2	NP_859058.2	Q86WR6	CQ064_HUMAN	chromosome 17 open reading frame 64	45										breast(2)|large_intestine(1)|lung(3)	6	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;5.81e-13)|all cancers(12;2.17e-11)|Colorectal(3;0.01)			CAAGGGCCTGGATCAGGACAC	0.587																																					p.D45N		.											.	C17orf64-271	0			c.G133A						.						49.0	50.0	50.0					17																	58503225		692	1591	2283	SO:0001583	missense	124773	exon2			GGCCTGGATCAGG	BC048806	CCDS32698.2	17q23.2	2005-12-16			ENSG00000141371	ENSG00000141371			26990	protein-coding gene	gene with protein product						12477932	Standard	NM_181707		Approved		uc002iyq.3	Q86WR6	OTTHUMG00000157171	ENST00000269127.4:c.133G>A	17.37:g.58503225G>A	ENSP00000269127:p.Asp45Asn	Somatic	64	0		WXS	Illumina HiSeq	Phase_I	118	62	NM_181707	0	0	0	0	0	Q8IY87	Missense_Mutation	SNP	ENST00000269127.4	37	CCDS32698.2	.	.	.	.	.	.	.	.	.	.	G	8.915	0.959686	0.18507	.	.	ENSG00000141371	ENST00000428000;ENST00000269127	.	.	.	5.8	1.57	0.23409	.	1.190680	0.06014	N	0.650076	T	0.35422	0.0931	L	0.38838	1.175	0.09310	N	0.999999	B	0.22983	0.078	B	0.25614	0.062	T	0.35475	-0.9787	9	0.51188	T	0.08	0.2409	8.0582	0.30617	0.4133:0.0:0.5867:0.0	.	45	Q86WR6	CQ064_HUMAN	N	39;45	.	ENSP00000269127:D45N	D	+	1	0	C17orf64	55858007	0.078000	0.21339	0.143000	0.22291	0.070000	0.16714	0.157000	0.16402	0.087000	0.17167	-0.136000	0.14681	GAT	.		0.587	C17orf64-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000347743.1	NM_181707	
FHOD3	80206	broad.mit.edu	37	18	34261469	34261469	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr18:34261469A>G	ENST00000359247.4	+	12	1381	c.1381A>G	c.(1381-1383)Agg>Ggg	p.R461G	FHOD3_ENST00000257209.4_Missense_Mutation_p.R461G|FHOD3_ENST00000591635.1_Intron|FHOD3_ENST00000590592.1_Missense_Mutation_p.R636G|FHOD3_ENST00000445677.1_Missense_Mutation_p.R423G	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	461					actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				AGAGAGAGAGAGGCGGCGGCA	0.443																																					p.R461G													.	FHOD3-139	0			c.A1381G						.						88.0	96.0	94.0					18																	34261469		2203	4300	6503	SO:0001583	missense	80206	exon12			AGAGAGAGGCGGC	AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.1381A>G	18.37:g.34261469A>G	ENSP00000352186:p.Arg461Gly	Somatic	148	0		WXS	Illumina HiSeq	Phase_I	301	8	NM_025135	0	0	1	1	0	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Missense_Mutation	SNP	ENST00000359247.4	37		.	.	.	.	.	.	.	.	.	.	A	19.55	3.848488	0.71603	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	T;T;T	0.39592	1.21;1.07;1.27	5.04	-0.736	0.11133	.	0.044666	0.85682	D	0.000000	T	0.54431	0.1858	M	0.66939	2.045	0.44976	D	0.997995	D;D;D;D	0.65815	0.991;0.995;0.986;0.988	P;P;P;P	0.59595	0.86;0.852;0.797;0.815	T	0.59161	-0.7506	10	0.87932	D	0	.	13.5796	0.61893	0.4531:0.5469:0.0:0.0	.	423;461;461;636	Q2V2M9-2;Q2V2M9;Q2V2M9-3;E5F5Q0	.;FHOD3_HUMAN;.;.	G	461;461;423	ENSP00000257209:R461G;ENSP00000352186:R461G;ENSP00000411430:R423G	ENSP00000257209:R461G	R	+	1	2	FHOD3	32515467	0.989000	0.36119	0.996000	0.52242	0.997000	0.91878	0.300000	0.19156	-0.274000	0.09232	0.533000	0.62120	AGG	.		0.443	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	XM_371114	
PIAS2	9063	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	44416377	44416377	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr18:44416377G>A	ENST00000585916.1	-	9	1144	c.1145C>T	c.(1144-1146)aCc>aTc	p.T382I	PIAS2_ENST00000545673.1_Missense_Mutation_p.T92I|PIAS2_ENST00000324794.7_Missense_Mutation_p.T382I	NM_004671.3	NP_004662.2	O75928	PIAS2_HUMAN	protein inhibitor of activated STAT, 2	382					androgen receptor signaling pathway (GO:0030521)|negative regulation of androgen receptor signaling pathway (GO:0060766)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein sumoylation (GO:0016925)|regulation of osteoblast differentiation (GO:0045667)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|SUMO ligase activity (GO:0019789)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	22						ACAAATCCAGGTGGGCTTTTT	0.408																																					p.T382I		.											.	PIAS2-662	0			c.C1145T						.						118.0	114.0	115.0					18																	44416377		2203	4300	6503	SO:0001583	missense	9063	exon9			ATCCAGGTGGGCT	AF077953	CCDS32824.1, CCDS32825.1	18q12.1-q12.3	2011-10-11				ENSG00000078043		"""Zinc fingers, MIZ-type"""	17311	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 4"""	603567				9724754, 9256341	Standard	NM_004671		Approved	PIASX-BETA, miz, PIASX-ALPHA, ZMIZ4	uc002lck.3	O75928		ENST00000585916.1:c.1145C>T	18.37:g.44416377G>A	ENSP00000465676:p.Thr382Ile	Somatic	153	0		WXS	Illumina HiSeq	Phase_I	329	44	NM_173206	0	0	3	3	0	O75927|Q96BT5|Q96KE3	Missense_Mutation	SNP	ENST00000585916.1	37	CCDS32824.1	.	.	.	.	.	.	.	.	.	.	G	32	5.124311	0.94429	.	.	ENSG00000078043	ENST00000398654;ENST00000262161;ENST00000398651;ENST00000545673;ENST00000324794	T;T	0.53640	0.61;1.12	5.62	5.62	0.85841	Zinc finger, MIZ-type (2);	0.000000	0.85682	D	0.000000	T	0.74876	0.3774	M	0.87038	2.855	0.80722	D	1	D;D;D;D;D	0.89917	0.998;1.0;1.0;0.999;1.0	D;D;D;D;D	0.97110	0.996;1.0;0.994;0.992;1.0	T	0.78971	-0.1993	10	0.87932	D	0	-11.3089	19.6407	0.95757	0.0:0.0:1.0:0.0	.	92;386;382;382;382	B4DGW0;O75928-3;Q2TA77;O75928-2;O75928	.;.;.;.;PIAS2_HUMAN	I	382;382;378;92;382	ENSP00000443238:T92I;ENSP00000317163:T382I	ENSP00000262161:T382I	T	-	2	0	PIAS2	42670375	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.864000	0.99589	2.640000	0.89533	0.460000	0.39030	ACC	.		0.408	PIAS2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445656.2	NM_004671	
HNRNPM	4670	ucsc.edu	37	19	8555985	8555985	+	IGR	SNP	T	T	C			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr19:8555985T>C	ENST00000325495.4	+	0	2494				PRAM1_ENST00000423345.4_Splice_Site_p.R545G|PRAM1_ENST00000255612.3_Splice_Site_p.R544G	NM_005968.4	NP_005959.2	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M						alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|RNA binding (GO:0003723)			endometrium(5)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)	25						CCATGGCACCTGAGCGCTGGG	0.662																																					p.R545G													.	.	0			c.A1633G						.						32.0	37.0	35.0					19																	8555985		1999	4163	6162	SO:0001628	intergenic_variant	84106	exon5			GGCACCTGAGCGC	L03532	CCDS12203.1, CCDS12204.1	19p13.2	2013-06-12		2008-04-18	ENSG00000099783	ENSG00000099783		"""RNA binding motif (RRM) containing"""	5046	protein-coding gene	gene with protein product	"""CEA receptor"""	160994		NAGR1, HNRPM		8441656, 7558047	Standard	NM_005968		Approved	HTGR1, HNRNPM4, HNRPM4, CEAR	uc010dwe.3	P52272	OTTHUMG00000182383		19.37:g.8555985T>C		Somatic	13	1		WXS	Illumina HiSeq		42	4	NM_032152	0	0	3	3	0	Q15584|Q8WZ44|Q96H56|Q9BWL9|Q9Y492	Missense_Mutation	SNP	ENST00000325495.4	37	CCDS12203.1	.	.	.	.	.	.	.	.	.	.	T	14.58	2.577352	0.45902	.	.	ENSG00000133246	ENST00000255612;ENST00000423345	T;T	0.16743	2.32;2.32	3.95	3.95	0.45737	.	0.000000	0.46145	D	0.000305	T	0.34366	0.0895	L	0.60455	1.87	0.34179	D	0.67073	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.48714	-0.9011	10	0.87932	D	0	.	9.5449	0.39275	0.0:0.0:0.0:1.0	.	545;593	Q96QH2-2;Q96QH2	.;PRAM_HUMAN	G	544;545	ENSP00000255612:R544G;ENSP00000408342:R545G	ENSP00000255612:R544G	R	-	1	2	PRAM1	8461985	1.000000	0.71417	0.996000	0.52242	0.151000	0.21798	2.169000	0.42434	2.027000	0.59764	0.374000	0.22700	AGG	.		0.662	HNRNPM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460894.1		
ILVBL	10994	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	15226103	15226103	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr19:15226103A>G	ENST00000263383.3	-	16	1998	c.1859T>C	c.(1858-1860)aTt>aCt	p.I620T	ILVBL_ENST00000534378.1_Missense_Mutation_p.I513T	NM_006844.3	NP_006835.2	A1L0T0	ILVBL_HUMAN	ilvB (bacterial acetolactate synthase)-like	620						integral component of membrane (GO:0016021)|membrane (GO:0016020)	magnesium ion binding (GO:0000287)|thiamine pyrophosphate binding (GO:0030976)|transferase activity (GO:0016740)			NS(3)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(1)	26						CGTCCTCCCAATGAGGATGTT	0.607																																					p.I620T		.											.	ILVBL-92	0			c.T1859C						.						138.0	103.0	115.0					19																	15226103		2203	4300	6503	SO:0001583	missense	10994	exon16			CTCCCAATGAGGA	U61263	CCDS12325.1	19p13.1	2008-07-16			ENSG00000105135	ENSG00000105135			6041	protein-coding gene	gene with protein product	"""acetolactate synthase homolog"""	605770				8954801	Standard	NM_006844		Approved	209L8, AHAS, ILV2H, MGC1269, FLJ39061, MGC19535	uc002nam.3	A1L0T0	OTTHUMG00000165630	ENST00000263383.3:c.1859T>C	19.37:g.15226103A>G	ENSP00000263383:p.Ile620Thr	Somatic	58	0		WXS	Illumina HiSeq	Phase_I	76	24	NM_006844	0	1	179	341	161	O43341|Q96F08|Q99651|Q9BWN5|Q9UEB2	Missense_Mutation	SNP	ENST00000263383.3	37	CCDS12325.1	.	.	.	.	.	.	.	.	.	.	A	19.86	3.905085	0.72868	.	.	ENSG00000105135	ENST00000263383	T	0.42900	0.96	5.37	5.37	0.77165	.	0.056671	0.64402	D	0.000002	T	0.58264	0.2110	M	0.68952	2.095	0.80722	D	1	D	0.71674	0.998	D	0.63877	0.919	T	0.59542	-0.7435	10	0.46703	T	0.11	-18.752	11.7697	0.51951	1.0:0.0:0.0:0.0	.	620	A1L0T0	ILVBL_HUMAN	T	620	ENSP00000263383:I620T	ENSP00000263383:I620T	I	-	2	0	ILVBL	15087103	1.000000	0.71417	0.998000	0.56505	0.840000	0.47671	6.822000	0.75277	2.044000	0.60594	0.533000	0.62120	ATT	.		0.607	ILVBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385439.1	NM_006844	
ZNF536	9745	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	31040126	31040126	+	Missense_Mutation	SNP	C	C	G	rs545401755		TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr19:31040126C>G	ENST00000355537.3	+	4	3747	c.3600C>G	c.(3598-3600)gaC>gaG	p.D1200E		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	1200					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					TCAGCAAAGACAGCAGCAGCG	0.592																																					p.D1200E		.											.	ZNF536-144	0			c.C3600G						.						62.0	63.0	63.0					19																	31040126		2203	4300	6503	SO:0001583	missense	9745	exon4			CAAAGACAGCAGC		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.3600C>G	19.37:g.31040126C>G	ENSP00000347730:p.Asp1200Glu	Somatic	59	0		WXS	Illumina HiSeq	Phase_I	81	30	NM_014717	0	0	0	0	0	A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	C	0.147	-1.095522	0.01858	.	.	ENSG00000198597	ENST00000355537	T	0.08546	3.08	5.59	3.11	0.35812	.	0.444542	0.25789	N	0.028284	T	0.03871	0.0109	N	0.12746	0.255	0.21675	N	0.999597	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.44298	-0.9337	10	0.13108	T	0.6	-38.7005	6.6261	0.22830	0.2337:0.5954:0.0:0.1709	.	1200;1200	A7E228;O15090	.;ZN536_HUMAN	E	1200	ENSP00000347730:D1200E	ENSP00000347730:D1200E	D	+	3	2	ZNF536	35731966	0.207000	0.23482	0.966000	0.40874	0.051000	0.14879	0.146000	0.16180	1.319000	0.45190	0.655000	0.94253	GAC	.		0.592	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717	
ZNF146	7705	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	36727612	36727612	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr19:36727612C>A	ENST00000443387.2	+	4	1262	c.270C>A	c.(268-270)caC>caA	p.H90Q	ZNF565_ENST00000355114.5_Intron|ZNF146_ENST00000456324.1_Missense_Mutation_p.H90Q	NM_007145.2	NP_009076.2	Q15072	OZF_HUMAN	zinc finger protein 146	90					regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	11	Esophageal squamous(110;0.162)					TCCTTACGCACCAGAAAATTC	0.403																																					p.H90Q		.											.	ZNF146-90	0			c.C270A						.						67.0	72.0	70.0					19																	36727612		2203	4300	6503	SO:0001583	missense	7705	exon3			TACGCACCAGAAA	X70394	CCDS12492.1	19q13.1	2013-01-08				ENSG00000167635		"""Zinc fingers, C2H2-type"""	12931	protein-coding gene	gene with protein product		601505				10449921, 8641144	Standard	NM_001099639		Approved	OZF	uc010eeu.3	Q15072		ENST00000443387.2:c.270C>A	19.37:g.36727612C>A	ENSP00000392095:p.His90Gln	Somatic	90	0		WXS	Illumina HiSeq	Phase_I	190	79	NM_001099638	0	0	6	8	2	Q2TB94	Missense_Mutation	SNP	ENST00000443387.2	37	CCDS12492.1	.	.	.	.	.	.	.	.	.	.	C	15.56	2.870414	0.51588	.	.	ENSG00000167635	ENST00000443387;ENST00000456324	D;D	0.86865	-2.18;-2.18	4.46	3.34	0.38264	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.41396	D	0.000891	D	0.94135	0.8119	H	0.95402	3.665	0.33426	D	0.580462	D	0.62365	0.991	D	0.73708	0.981	D	0.94447	0.7664	10	0.87932	D	0	-10.1539	6.9293	0.24432	0.0:0.2248:0.0:0.7752	.	90	Q15072	OZF_HUMAN	Q	90	ENSP00000392095:H90Q;ENSP00000400391:H90Q	ENSP00000392095:H90Q	H	+	3	2	ZNF146	41419452	0.874000	0.30092	1.000000	0.80357	0.991000	0.79684	-0.067000	0.11579	0.946000	0.37632	-0.355000	0.07637	CAC	.		0.403	ZNF146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451706.1	NM_007145	
GYS1	2997	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	49485593	49485593	+	Silent	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr19:49485593A>G	ENST00000323798.3	-	7	1177	c.981T>C	c.(979-981)ttT>ttC	p.F327F	GYS1_ENST00000540532.1_Missense_Mutation_p.L208S|GYS1_ENST00000263276.6_Silent_p.F263F|GYS1_ENST00000541188.1_Silent_p.F247F|GYS1_ENST00000544287.1_5'UTR	NM_002103.4	NP_002094.2	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle)	327					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|heart development (GO:0007507)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|inclusion body (GO:0016234)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)		GGCCGGCGATAAAGAAGTATA	0.542																																					p.F327F		.											.	GYS1-524	0			c.T981C						.						88.0	79.0	82.0					19																	49485593		2203	4300	6503	SO:0001819	synonymous_variant	2997	exon7			GGCGATAAAGAAG		CCDS12747.1, CCDS54292.1	19q13.3	2013-02-22			ENSG00000104812	ENSG00000104812	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4706	protein-coding gene	gene with protein product		138570		GYS			Standard	NM_002103		Approved	GSY	uc002plp.3	P13807	OTTHUMG00000150723	ENST00000323798.3:c.981T>C	19.37:g.49485593A>G		Somatic	82	0		WXS	Illumina HiSeq	Phase_I	171	62	NM_002103	0	0	1	2	1	Q9BTT9	Silent	SNP	ENST00000323798.3	37	CCDS12747.1	.	.	.	.	.	.	.	.	.	.	A	15.40	2.821993	0.50739	.	.	ENSG00000104812	ENST00000540532	T	0.27890	1.64	5.1	-3.84	0.04256	.	.	.	.	.	T	0.34366	0.0895	.	.	.	0.22754	N	0.998773	.	.	.	.	.	.	T	0.42965	-0.9420	6	0.41790	T	0.15	-14.4659	15.6467	0.77061	0.234:0.0:0.766:0.0	.	.	.	.	S	208	ENSP00000445197:L208S	ENSP00000445197:L208S	L	-	2	0	GYS1	54177405	1.000000	0.71417	0.849000	0.33467	0.997000	0.91878	1.654000	0.37334	-0.742000	0.04790	0.528000	0.53228	TTA	.		0.542	GYS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319791.1	NM_002103	
TMEM86B	255043	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	55740079	55740079	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr19:55740079T>C	ENST00000327042.4	-	1	553	c.31A>G	c.(31-33)Aag>Gag	p.K11E	AC010327.2_ENST00000598855.1_3'UTR	NM_173804.4	NP_776165.3	Q8N661	TM86B_HUMAN	transmembrane protein 86B	11					ether lipid metabolic process (GO:0046485)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	alkenylglycerophosphocholine hydrolase activity (GO:0047408)|alkenylglycerophosphoethanolamine hydrolase activity (GO:0047409)			skin(2)	2			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0443)		CAGTGAGTCTTCAGGGTCTGC	0.672																																					p.K11E		.											.	TMEM86B-90	0			c.A31G						.						25.0	26.0	26.0					19																	55740079		2203	4299	6502	SO:0001583	missense	255043	exon1			GAGTCTTCAGGGT	BC023000	CCDS12920.1	19q13.42	2011-07-12					3.3.2.2, 3.3.2.5		28448	protein-coding gene	gene with protein product						21515882	Standard	NM_173804		Approved	MGC30208	uc002qju.3	Q8N661		ENST00000327042.4:c.31A>G	19.37:g.55740079T>C	ENSP00000321038:p.Lys11Glu	Somatic	68	0		WXS	Illumina HiSeq	Phase_I	107	40	NM_173804	0	0	5	10	5		Missense_Mutation	SNP	ENST00000327042.4	37	CCDS12920.1	.	.	.	.	.	.	.	.	.	.	T	8.776	0.926998	0.18056	.	.	ENSG00000180089	ENST00000327042	T	0.22743	1.94	4.76	-1.37	0.09056	.	2.056380	0.01961	N	0.043375	T	0.12944	0.0314	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.31223	-0.9951	10	0.33940	T	0.23	.	11.2263	0.48886	0.0:0.5941:0.0:0.4059	.	11	Q8N661	TM86B_HUMAN	E	11	ENSP00000321038:K11E	ENSP00000321038:K11E	K	-	1	0	TMEM86B	60431891	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-0.228000	0.09114	-0.525000	0.06391	0.379000	0.24179	AAG	.		0.672	TMEM86B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452659.1	NM_173804	
EML6	400954	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	55191764	55191764	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr2:55191764C>A	ENST00000356458.6	+	37	5908	c.5388C>A	c.(5386-5388)ttC>ttA	p.F1796L	EML6_ENST00000490828.1_3'UTR	NM_001039753.2	NP_001034842.2	Q6ZMW3	EMAL6_HUMAN	echinoderm microtubule associated protein like 6	1796						cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|endometrium(6)	7						CAGTTGACTTCTATGACCTCA	0.463																																					p.F1796L		.											.	.	0			c.C5388A						.						158.0	127.0	136.0					2																	55191764		692	1591	2283	SO:0001583	missense	400954	exon37			TGACTTCTATGAC		CCDS46286.1	2p16.1	2013-01-10			ENSG00000214595	ENSG00000214595		"""WD repeat domain containing"""	35412	protein-coding gene	gene with protein product							Standard	NM_001039753		Approved	FLJ42562	uc002ryb.4	Q6ZMW3	OTTHUMG00000152035	ENST00000356458.6:c.5388C>A	2.37:g.55191764C>A	ENSP00000348842:p.Phe1796Leu	Somatic	104	0		WXS	Illumina HiSeq	Phase_I	183	71	NM_001039753	0	0	0	0	0	A8MUB5|B6ZDG7	Missense_Mutation	SNP	ENST00000356458.6	37	CCDS46286.1	.	.	.	.	.	.	.	.	.	.	C	16.82	3.228586	0.58777	.	.	ENSG00000214595	ENST00000356458	T	0.14022	2.54	5.58	4.69	0.59074	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.102660	0.64402	N	0.000001	T	0.08891	0.0220	N	0.25060	0.705	0.36954	D	0.893	B	0.29646	0.253	B	0.32805	0.153	T	0.32107	-0.9919	10	0.19147	T	0.46	.	7.2226	0.25997	0.0:0.7029:0.151:0.1461	.	1796	Q6ZMW3	EMAL6_HUMAN	L	1796	ENSP00000348842:F1796L	ENSP00000348842:F1796L	F	+	3	2	EML6	55045268	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.955000	0.29188	1.443000	0.47586	0.655000	0.94253	TTC	.		0.463	EML6-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324997.3	XM_001725002	
ANXA4	307	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	70039804	70039804	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr2:70039804A>T	ENST00000394295.4	+	8	745	c.497A>T	c.(496-498)aAt>aTt	p.N166I	ANXA4_ENST00000536030.1_Missense_Mutation_p.N82I|ANXA4_ENST00000409920.1_Missense_Mutation_p.N144I	NM_001153.3	NP_001144.1	P09525	ANXA4_HUMAN	annexin A4	164					epithelial cell differentiation (GO:0030855)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of interleukin-8 secretion (GO:2000483)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|phospholipase inhibitor activity (GO:0004859)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)	11						GATGAAGGAAATTATCTGGAC	0.443																																					p.N166I		.											.	ANXA4-90	0			c.A497T						.						113.0	101.0	105.0					2																	70039804		2203	4300	6503	SO:0001583	missense	307	exon8			AAGGAAATTATCT	M82809	CCDS1894.1	2p13.3	2008-02-05			ENSG00000196975	ENSG00000196975		"""Annexins"""	542	protein-coding gene	gene with protein product		106491		ANX4		1346776	Standard	NM_001153		Approved		uc002sfr.4	P09525	OTTHUMG00000129649	ENST00000394295.4:c.497A>T	2.37:g.70039804A>T	ENSP00000377833:p.Asn166Ile	Somatic	19	0		WXS	Illumina HiSeq	Phase_I	78	28	NM_001153	0	0	80	145	65	B4DDF9|Q96F33|Q9BWK1	Missense_Mutation	SNP	ENST00000394295.4	37	CCDS1894.1	.	.	.	.	.	.	.	.	.	.	A	12.92	2.083724	0.36758	.	.	ENSG00000196975	ENST00000409920;ENST00000394295;ENST00000536030	T;T;T	0.12147	2.71;2.71;2.71	5.67	3.15	0.36227	.	0.343196	0.34268	N	0.004120	T	0.13670	0.0331	M	0.64567	1.98	0.33200	D	0.551962	B;B;B	0.33135	0.155;0.399;0.155	B;B;B	0.35039	0.105;0.194;0.105	T	0.10497	-1.0627	9	.	.	.	.	5.8848	0.18876	0.635:0.2795:0.0855:0.0	.	164;144;166	P09525;Q6P452;Q6LES2	ANXA4_HUMAN;.;.	I	144;166;82	ENSP00000386756:N144I;ENSP00000377833:N166I;ENSP00000441931:N82I	.	N	+	2	0	ANXA4	69893308	0.145000	0.22656	0.915000	0.36163	0.808000	0.45660	1.316000	0.33620	0.982000	0.38575	0.533000	0.62120	AAT	.		0.443	ANXA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251848.2	NM_001153	
MPHOSPH10	10199	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	71360588	71360588	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr2:71360588T>G	ENST00000244230.2	+	2	1002	c.650T>G	c.(649-651)aTa>aGa	p.I217R	MPHOSPH10_ENST00000498451.2_Missense_Mutation_p.I217R	NM_005791.2	NP_005782.1	O00566	MPP10_HUMAN	M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)	217					negative regulation of phosphatase activity (GO:0010923)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|rRNA processing (GO:0006364)	chromosome (GO:0005694)|nucleolus (GO:0005730)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|pancreas(2)|skin(2)|stomach(1)	26						TTAGAAAACATAGAAAAAGAA	0.353																																					p.I217R		.											.	MPHOSPH10-93	0			c.T650G						.						63.0	70.0	68.0					2																	71360588		2202	4300	6502	SO:0001583	missense	10199	exon2			AAAACATAGAAAA	X98494	CCDS1916.1	2p13.3	2014-06-12			ENSG00000124383	ENSG00000124383			7213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 106"""	605503				8885239, 9450966	Standard	NM_005791		Approved	MPP10, MPP10P, CT90, PPP1R106	uc002sht.2	O00566	OTTHUMG00000129715	ENST00000244230.2:c.650T>G	2.37:g.71360588T>G	ENSP00000244230:p.Ile217Arg	Somatic	186	0		WXS	Illumina HiSeq	Phase_I	394	162	NM_005791	0	0	0	2	2	A0AVJ8	Missense_Mutation	SNP	ENST00000244230.2	37	CCDS1916.1	.	.	.	.	.	.	.	.	.	.	T	13.86	2.363316	0.41902	.	.	ENSG00000124383	ENST00000244230;ENST00000425650	T;T	0.09817	2.94;2.94	5.04	5.04	0.67666	.	0.585812	0.20103	N	0.099190	T	0.09555	0.0235	N	0.19112	0.55	0.22389	N	0.999144	P;P	0.49696	0.927;0.655	P;B	0.46419	0.516;0.305	T	0.27434	-1.0074	10	0.17369	T	0.5	.	13.0251	0.58810	0.0:0.0:0.0:1.0	.	217;217	B3KPV5;O00566	.;MPP10_HUMAN	R	217;77	ENSP00000244230:I217R;ENSP00000393034:I77R	ENSP00000244230:I217R	I	+	2	0	MPHOSPH10	71214096	0.146000	0.22672	0.072000	0.20136	0.923000	0.55619	1.710000	0.37920	2.040000	0.60383	0.397000	0.26171	ATA	.		0.353	MPHOSPH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251924.2	NM_005791	
IMMT	10989	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	86371557	86371557	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr2:86371557T>A	ENST00000410111.3	-	15	2498	c.2111A>T	c.(2110-2112)gAg>gTg	p.E704V	IMMT_ENST00000449247.2_Missense_Mutation_p.E693V|IMMT_ENST00000254636.5_Missense_Mutation_p.E605V|IMMT_ENST00000442664.2_Missense_Mutation_p.E703V|IMMT_ENST00000409051.2_Missense_Mutation_p.E657V	NM_001100169.1|NM_001100170.1|NM_006839.2	NP_001093639.1|NP_001093640.1|NP_006830.2	Q16891	MIC60_HUMAN	inner membrane protein, mitochondrial	704					mitochondrial calcium ion homeostasis (GO:0051560)|response to cold (GO:0009409)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						TGCTGCTAGCTCCAGATCACC	0.488																																					p.E704V		.											.	IMMT-91	0			c.A2111T						.						102.0	97.0	98.0					2																	86371557		1969	4166	6135	SO:0001583	missense	10989	exon15			GCTAGCTCCAGAT	D21094	CCDS46355.1, CCDS46356.1, CCDS46357.1	2p11.2	2011-10-04	2010-04-29		ENSG00000132305	ENSG00000132305			6047	protein-coding gene	gene with protein product	"""mitofilin"", ""mitochondrial inner membrane organizing system 2"""	600378	"""inner membrane protein, mitochondrial (mitofilin)"""			9168817, 8039717	Standard	NM_001100169		Approved	P87, P89, HMP, MINOS2	uc002sqz.4	Q16891	OTTHUMG00000153170	ENST00000410111.3:c.2111A>T	2.37:g.86371557T>A	ENSP00000387262:p.Glu704Val	Somatic	58	0		WXS	Illumina HiSeq	Phase_I	146	43	NM_006839	0	1	62	113	50	B1H0U5|B2R5N6|Q14539|Q15092|Q68D41|Q69HW5|Q6IBL0|Q7Z3X1|Q8TAJ5|Q9P0V2	Missense_Mutation	SNP	ENST00000410111.3	37	CCDS46355.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.501330	0.85176	.	.	ENSG00000132305	ENST00000254636;ENST00000449247;ENST00000410111;ENST00000442664;ENST00000409051;ENST00000545283;ENST00000377310;ENST00000398211;ENST00000409715	T;T;T;T;T	0.32023	1.47;1.47;1.47;1.47;1.47	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.57431	0.2053	M	0.78049	2.395	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;1.0;1.0;1.0;1.0	T	0.59820	-0.7382	10	0.51188	T	0.08	-20.9731	15.8107	0.78561	0.0:0.0:0.0:1.0	.	657;692;693;672;704	B9A067;B4DKR1;Q16891-2;Q16891-3;Q16891	.;.;.;.;IMMT_HUMAN	V	605;693;704;703;657;693;672;318;605	ENSP00000254636:E605V;ENSP00000396899:E693V;ENSP00000387262:E704V;ENSP00000407788:E703V;ENSP00000387227:E657V	ENSP00000254636:E605V	E	-	2	0	IMMT	86225068	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.868000	0.87116	2.320000	0.78422	0.529000	0.55759	GAG	.		0.488	IMMT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000329909.2	NM_006839	
SMPD4	55627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	130912744	130912744	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr2:130912744G>A	ENST00000409031.1	-	15	2643	c.1495C>T	c.(1495-1497)Ccc>Tcc	p.P499S	SMPD4_ENST00000339679.7_Missense_Mutation_p.P357S|SMPD4_ENST00000351288.6_Missense_Mutation_p.P470S|SMPD4_ENST00000431183.2_Missense_Mutation_p.P397S|SMPD4_ENST00000473720.1_5'Flank|SMPD4_ENST00000452225.2_Missense_Mutation_p.P240S|SMPD4_ENST00000453750.1_Missense_Mutation_p.P248S|SMPD4_ENST00000443958.2_Missense_Mutation_p.P163S|SMPD4_ENST00000426662.2_Missense_Mutation_p.P135S	NM_017951.4	NP_060421.2	Q9NXE4	NSMA3_HUMAN	sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3)	460					cellular response to tumor necrosis factor (GO:0071356)|ceramide biosynthetic process (GO:0046513)|glycerophospholipid catabolic process (GO:0046475)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)|sphingomyelin phosphodiesterase D activity (GO:0050290)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(17)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29	Colorectal(110;0.1)				Phosphatidylserine(DB00144)	GCGTGCTTGGGGCTGACCAGG	0.597																																					p.P499S		.											.	SMPD4-90	0			c.C1495T						.						89.0	85.0	86.0					2																	130912744		2203	4300	6503	SO:0001583	missense	55627	exon15			GCTTGGGGCTGAC	AF052134	CCDS2156.2, CCDS42751.1, CCDS54398.1	2q21.1	2009-11-06			ENSG00000136699	ENSG00000136699			32949	protein-coding gene	gene with protein product		610457				16517606	Standard	NM_001171083		Approved	FLJ20297, FLJ20756, nSMase-3, KIAA1418, NSMASE3, NET13	uc002tqr.2	Q9NXE4	OTTHUMG00000131624	ENST00000409031.1:c.1495C>T	2.37:g.130912744G>A	ENSP00000386531:p.Pro499Ser	Somatic	59	0		WXS	Illumina HiSeq	Phase_I	83	20	NM_017951	0	0	4	6	2	B4DM23|B4DQ31|B4DRB8|B4DWK7|B4E0L6|E7ESA2|E9PCE6|Q6FI76|Q6P1P7|Q6ZT43|Q9H0M2|Q9NW20|Q9NWL2|Q9P2C9	Missense_Mutation	SNP	ENST00000409031.1	37	CCDS42751.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	18.79|18.79	3.698485|3.698485	0.68386|0.68386	.|.	.|.	ENSG00000136699|ENSG00000136699	ENST00000430682|ENST00000351288;ENST00000409031;ENST00000431183;ENST00000453750;ENST00000443958;ENST00000339679;ENST00000452225;ENST00000426662;ENST00000457039;ENST00000449159;ENST00000451542	.|.	.|.	.|.	4.24|4.24	4.24|4.24	0.50183|0.50183	.|.	0.182604|0.182604	0.47852|0.47852	D|D	0.000216|0.000216	T|T	0.76449|0.76449	0.3989|0.3989	M|M	0.74881|0.74881	2.28|2.28	0.42852|0.42852	D|D	0.994089|0.994089	.|D;D;D;D;P;D;P;D;D	.|0.71674	.|0.997;0.967;0.988;0.988;0.793;0.975;0.939;0.99;0.998	.|D;P;P;P;B;P;P;P;D	.|0.80764	.|0.931;0.595;0.896;0.896;0.258;0.644;0.745;0.878;0.994	T|T	0.75895|0.75895	-0.3156|-0.3156	6|9	.|0.29301	.|T	.|0.29	.|.	14.1436|14.1436	0.65336|0.65336	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|135;240;397;357;248;431;460;499;506	.|B4E0L6;B4DQ31;E7ESA2;B4E0T5;B4DM23;Q9NXE4-2;Q9NXE4;B1PBA3;Q9NXE4-4	.|.;.;.;.;.;.;NSMA3_HUMAN;.;.	L|S	180|470;499;397;248;163;357;240;135;96;35;241	.|.	.|ENSP00000339721:P357S	P|P	-|-	2|1	0|0	SMPD4|SMPD4	130629214|130629214	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.637000|0.637000	0.38172|0.38172	5.392000|5.392000	0.66272|0.66272	1.886000|1.886000	0.54624|0.54624	0.305000|0.305000	0.20034|0.20034	CCC|CCC	.		0.597	SMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254516.3	NM_017751	
XIRP2	129446	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	168103277	168103277	+	Missense_Mutation	SNP	T	T	A	rs200235198		TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr2:168103277T>A	ENST00000409195.1	+	9	5464	c.5375T>A	c.(5374-5376)cTg>cAg	p.L1792Q	XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.L1570Q|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.L1792Q|XIRP2_ENST00000409043.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1617					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						AAACTGTTACTGAAGAAAAGG	0.408																																					p.L1792Q													.	XIRP2-104	0			c.T5375A						.						180.0	172.0	174.0					2																	168103277		1930	4132	6062	SO:0001583	missense	129446	exon9			TGTTACTGAAGAA	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.5375T>A	2.37:g.168103277T>A	ENSP00000386840:p.Leu1792Gln	Somatic	139	2		WXS	Illumina HiSeq	Phase_I	276	74	NM_152381	0	0	0	0	0	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	T	15.63	2.889248	0.52014	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.04083	3.72;3.72;3.71	5.59	5.59	0.84812	.	0.000000	0.64402	D	0.000001	T	0.21590	0.0520	M	0.77103	2.36	0.58432	D	0.999999	D;D;D	0.76494	0.998;0.999;0.999	D;D;D	0.72075	0.946;0.976;0.976	T	0.00322	-1.1818	10	0.52906	T	0.07	-10.6531	14.7546	0.69554	0.0:0.0:0.0:1.0	.	1617;1617;1570	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	Q	1792;1792;1570	ENSP00000386840:L1792Q;ENSP00000295237:L1792Q;ENSP00000387255:L1570Q	ENSP00000295237:L1792Q	L	+	2	0	XIRP2	167811523	0.911000	0.30947	1.000000	0.80357	0.585000	0.36419	5.730000	0.68546	2.134000	0.65973	0.528000	0.53228	CTG	T|0.999;C|0.000		0.408	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
DNAJC10	54431	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	183594619	183594619	+	Silent	SNP	G	G	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr2:183594619G>T	ENST00000264065.7	+	8	1093	c.678G>T	c.(676-678)gtG>gtT	p.V226V	DNAJC10_ENST00000537515.1_Silent_p.V226V	NM_018981.1	NP_061854.1	Q8IXB1	DJC10_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 10	226	Thioredoxin 1. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of ATPase activity (GO:0032781)|protein folding in endoplasmic reticulum (GO:0034975)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|chaperone binding (GO:0051087)|disulfide oxidoreductase activity (GO:0015036)|Hsp70 protein binding (GO:0030544)|misfolded protein binding (GO:0051787)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide oxidoreductase activity (GO:0015035)			breast(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(15)|ovary(1)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			AGAGTTTAGTGAGTTTTGCAA	0.323																																					p.V226V	Pancreas(56;860 1183 25669 35822 48585)	.											.	DNAJC10-273	0			c.G678T						.						148.0	159.0	155.0					2																	183594619		2203	4300	6503	SO:0001819	synonymous_variant	54431	exon8			TTTAGTGAGTTTT		CCDS33345.1, CCDS74613.1	2q32.1	2011-11-23			ENSG00000077232	ENSG00000077232		"""Heat shock proteins / DNAJ (HSP40)"", ""Protein disulfide isomerases"""	24637	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 19"""	607987				12411443, 12446677	Standard	NM_018981		Approved	ERdj5, PDIA19	uc002uow.2	Q8IXB1	OTTHUMG00000154209	ENST00000264065.7:c.678G>T	2.37:g.183594619G>T		Somatic	147	0		WXS	Illumina HiSeq	Phase_I	346	111	NM_001271581	0	0	0	0	0	Q17RJ6|Q3B7W8|Q4ZG06|Q53QT7|Q6UWZ6|Q86T61|Q8NC82|Q8TD87|Q96K38|Q96K44|Q96K54|Q9NSY6	Silent	SNP	ENST00000264065.7	37	CCDS33345.1																																																																																			.		0.323	DNAJC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334418.2	NM_018981	
SF3B1	23451	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	198285205	198285205	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr2:198285205T>A	ENST00000335508.6	-	4	453	c.362A>T	c.(361-363)aAg>aTg	p.K121M	SF3B1_ENST00000487698.1_Missense_Mutation_p.K121M|SF3B1_ENST00000409915.4_Missense_Mutation_p.K121M|SF3B1_ENST00000414963.2_Missense_Mutation_p.K121M	NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	121					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)			NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			CCGCCTATGCTTTTTGTATTC	0.373			Mis		myelodysplastic syndrome																																p.K121M				Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	.	SF3B1-140	0			c.A362T						.						179.0	176.0	177.0					2																	198285205		2203	4300	6503	SO:0001583	missense	23451	exon4			CTATGCTTTTTGT	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.362A>T	2.37:g.198285205T>A	ENSP00000335321:p.Lys121Met	Somatic	281	1		WXS	Illumina HiSeq	Phase_I	574	204	NM_012433	0	0	6	6	0	E9PCH3	Missense_Mutation	SNP	ENST00000335508.6	37	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	T	10.94	1.492662	0.26774	.	.	ENSG00000115524	ENST00000335508;ENST00000409915;ENST00000414963;ENST00000487698	.	.	.	5.93	5.93	0.95920	.	0.225047	0.45606	D	0.000347	T	0.55401	0.1918	L	0.49126	1.545	0.47407	D	0.999411	P;B;B	0.36249	0.545;0.002;0.132	B;B;B	0.36289	0.192;0.003;0.221	T	0.59857	-0.7375	9	0.72032	D	0.01	.	16.3764	0.83401	0.0:0.0:0.0:1.0	.	121;121;121	B4DGZ4;E9PCH3;O75533	.;.;SF3B1_HUMAN	M	121	.	ENSP00000335321:K121M	K	-	2	0	SF3B1	197993450	0.995000	0.38212	1.000000	0.80357	0.989000	0.77384	2.343000	0.44001	2.272000	0.75746	0.450000	0.29827	AAG	.		0.373	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		
SF3B1	23451	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	198285207	198285207	+	Silent	SNP	T	T	C			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr2:198285207T>C	ENST00000335508.6	-	4	451	c.360A>G	c.(358-360)aaA>aaG	p.K120K	SF3B1_ENST00000487698.1_Silent_p.K120K|SF3B1_ENST00000409915.4_Silent_p.K120K|SF3B1_ENST00000414963.2_Silent_p.K120K	NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	120					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)			NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			GCCTATGCTTTTTGTATTCAT	0.373			Mis		myelodysplastic syndrome																																p.K120K				Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	.	SF3B1-140	0			c.A360G						.						177.0	174.0	175.0					2																	198285207		2203	4300	6503	SO:0001819	synonymous_variant	23451	exon4			ATGCTTTTTGTAT	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.360A>G	2.37:g.198285207T>C		Somatic	281	2		WXS	Illumina HiSeq	Phase_I	566	198	NM_012433	0	0	6	6	0	E9PCH3	Silent	SNP	ENST00000335508.6	37	CCDS33356.1																																																																																			.		0.373	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		
HSPE1	3336	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	198365881	198365881	+	Silent	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr2:198365881A>G	ENST00000233893.5	+	2	530	c.87A>G	c.(85-87)ggA>ggG	p.G29G	HSPE1-MOB4_ENST00000604458.1_Silent_p.G29G|HSPE1_ENST00000465573.1_Intron|HSPD1_ENST00000544407.1_5'Flank|HSPD1_ENST00000345042.2_5'Flank|HSPD1_ENST00000388968.3_5'Flank|HSPE1_ENST00000409729.1_Intron|HSPE1_ENST00000409468.1_Silent_p.G29G	NM_002157.2	NP_002148.1	P61604	CH10_HUMAN	heat shock 10kDa protein 1	29					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|osteoblast differentiation (GO:0001649)|protein folding (GO:0006457)|response to unfolded protein (GO:0006986)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			lung(1)	1			Epithelial(96;0.225)			TAACCAAAGGAGGCATTATGC	0.438																																					p.G29G		.											.	HSPE1-226	0			c.A87G						.						59.0	60.0	60.0					2																	198365881		2203	4297	6500	SO:0001819	synonymous_variant	3336	exon2			CAAAGGAGGCATT	AF109872	CCDS2320.1	2q33.1	2013-10-17	2013-10-17		ENSG00000115541	ENSG00000115541		"""Heat Shock Proteins / Chaperonins"""	5269	protein-coding gene	gene with protein product	"""chaperonin 10"""	600141	"""heat shock 10kD protein 1 (chaperonin 10)"""			7914093, 7698325	Standard	NM_002157		Approved	CPN10, GROES		P61604	OTTHUMG00000132749	ENST00000233893.5:c.87A>G	2.37:g.198365881A>G		Somatic	187	0		WXS	Illumina HiSeq	Phase_I	367	141	NM_002157	0	0	422	825	403	O95421|Q04984|Q53X54|Q9UDH0	Silent	SNP	ENST00000233893.5	37	CCDS2320.1																																																																																			.		0.438	HSPE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256112.1	NM_002157	
NIF3L1	60491	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	201768315	201768315	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr2:201768315C>A	ENST00000409020.1	+	7	1342	c.1048C>A	c.(1048-1050)Ctt>Att	p.L350I	NIF3L1_ENST00000409357.1_Missense_Mutation_p.L350I|NIF3L1_ENST00000409588.1_3'UTR|NIF3L1_ENST00000359683.4_Missense_Mutation_p.L323I|NIF3L1_ENST00000416651.1_Missense_Mutation_p.L350I			Q9GZT8	GTPC1_HUMAN	NIF3 NGG1 interacting factor 3-like 1 (S. cerevisiae)	350					7,8-dihydroneopterin 3'-triphosphate biosynthetic process (GO:0035998)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTP cyclohydrolase I activity (GO:0003934)|metal ion binding (GO:0046872)|transcription factor binding (GO:0008134)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|skin(1)|urinary_tract(2)	13						TCTTTCTGACCTTCGAGATAT	0.423																																					p.L350I		.											.	NIF3L1-91	0			c.C1048A						.						140.0	131.0	134.0					2																	201768315		1885	4113	5998	SO:0001583	missense	60491	exon7			TCTGACCTTCGAG	AB038949	CCDS42797.1, CCDS46485.1, CCDS46486.1	2q33	2011-11-10	2011-11-10		ENSG00000196290	ENSG00000196290			13390	protein-coding gene	gene with protein product		605778	"""NIF3 (Ngg1 interacting factor 3, S.pombe homolog)-like 1"", ""NIF3 NGG1 interacting factor 3-like 1 (S. pombe)"""	ALS2CR1		11124544, 11161814, 12522100	Standard	NM_001136039		Approved	CALS-7, MDS015	uc002uwm.2	Q9GZT8	OTTHUMG00000154588	ENST00000409020.1:c.1048C>A	2.37:g.201768315C>A	ENSP00000386394:p.Leu350Ile	Somatic	106	0		WXS	Illumina HiSeq	Phase_I	241	85	NM_001136039	0	0	20	32	12	Q53TX4|Q6X735|Q9H2D2|Q9HC18	Missense_Mutation	SNP	ENST00000409020.1	37	CCDS46485.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.267008	0.80469	.	.	ENSG00000196290	ENST00000416651;ENST00000409020;ENST00000359683;ENST00000409357	T;T;T;T	0.52754	0.65;0.65;0.65;0.65	5.33	5.33	0.75918	.	0.052331	0.85682	D	0.000000	T	0.67618	0.2912	M	0.72624	2.21	0.46437	D	0.999043	D	0.69078	0.997	D	0.65573	0.936	T	0.65631	-0.6121	10	0.39692	T	0.17	-14.3245	19.3851	0.94553	0.0:1.0:0.0:0.0	.	350	Q9GZT8	NIF3L_HUMAN	I	350;350;323;350	ENSP00000400787:L350I;ENSP00000386394:L350I;ENSP00000352711:L323I;ENSP00000387315:L350I	ENSP00000352711:L323I	L	+	1	0	NIF3L1	201476560	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.771000	0.47670	2.656000	0.90262	0.557000	0.71058	CTT	.		0.423	NIF3L1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336201.1	NM_021824	
RNF25	64320	broad.mit.edu	37	2	219529245	219529245	+	Missense_Mutation	SNP	G	G	A	rs371228589		TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr2:219529245G>A	ENST00000295704.2	-	10	1255	c.815C>T	c.(814-816)gCg>gTg	p.A272V		NM_022453.2	NP_071898.2	Q96BH1	RNF25_HUMAN	ring finger protein 25	272					positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|NF-kappaB binding (GO:0051059)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24		Renal(207;0.0474)		Epithelial(149;6.99e-07)|all cancers(144;0.000129)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTCAGGTTCCGCAGGGGCAGG	0.552																																					p.A272V													.	RNF25-227	0			c.C815T						.	G	VAL/ALA	0,4406		0,0,2203	57.0	55.0	56.0		815	1.6	0.0	2		56	2,8596	2.2+/-6.3	0,2,4297	no	missense	RNF25	NM_022453.2	64	0,2,6500	AA,AG,GG		0.0233,0.0,0.0154	benign	272/460	219529245	2,13002	2203	4299	6502	SO:0001583	missense	64320	exon10			GGTTCCGCAGGGG		CCDS2420.1	2q35	2008-02-05			ENSG00000163481	ENSG00000163481		"""RING-type (C3HC4) zinc fingers"""	14662	protein-coding gene	gene with protein product						12748188	Standard	NM_022453		Approved	AO7, FLJ13906	uc002vit.3	Q96BH1	OTTHUMG00000133077	ENST00000295704.2:c.815C>T	2.37:g.219529245G>A	ENSP00000295704:p.Ala272Val	Somatic	19	0		WXS	Illumina HiSeq	Phase_I	35	3	NM_022453	0	0	30	30	0	A8K0D6|Q53HQ5|Q9H874	Missense_Mutation	SNP	ENST00000295704.2	37	CCDS2420.1	.	.	.	.	.	.	.	.	.	.	G	0.524	-0.860994	0.02610	0.0	2.33E-4	ENSG00000163481	ENST00000295704	T	0.40225	1.04	5.41	1.59	0.23543	.	1.586980	0.03323	N	0.192235	T	0.16557	0.0398	N	0.01352	-0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24476	-1.0159	10	0.09084	T	0.74	-5.7619	7.4443	0.27203	0.7535:0.0:0.2465:0.0	.	272	Q96BH1	RNF25_HUMAN	V	272	ENSP00000295704:A272V	ENSP00000295704:A272V	A	-	2	0	RNF25	219237489	0.010000	0.17322	0.038000	0.18304	0.862000	0.49288	0.329000	0.19698	0.165000	0.19558	-0.459000	0.05422	GCG	.		0.552	RNF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256721.1	NM_022453	
NYAP2	57624	broad.mit.edu	37	2	226447157	226447157	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr2:226447157G>A	ENST00000272907.6	+	4	1437	c.1024G>A	c.(1024-1026)Gcc>Acc	p.A342T	NYAP2_ENST00000409269.2_Intron	NM_020864.1	NP_065915.1	Q9P242	NYAP2_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2	342	Pro-rich.				neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												ATTTCCCCCCGCCCCCGTGCA	0.632																																					p.A342T													.	.	0			c.G1024A						.						20.0	22.0	21.0					2																	226447157		1864	4081	5945	SO:0001583	missense	57624	exon4			CCCCCCGCCCCCG	AB040919	CCDS46529.1	2q36.3	2011-11-30	2011-11-30	2011-11-30	ENSG00000144460	ENSG00000144460			29291	protein-coding gene	gene with protein product		615478	"""KIAA1486"""	KIAA1486		10819331, 21946561	Standard	NM_020864		Approved		uc002voe.2	Q9P242	OTTHUMG00000153450	ENST00000272907.6:c.1024G>A	2.37:g.226447157G>A	ENSP00000272907:p.Ala342Thr	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	135	6	NM_020864	0	0	0	0	0	A2RRN4|Q96NL2	Missense_Mutation	SNP	ENST00000272907.6	37	CCDS46529.1	.	.	.	.	.	.	.	.	.	.	G	13.01	2.109563	0.37242	.	.	ENSG00000144460	ENST00000272907	T	0.47869	0.83	5.27	5.27	0.74061	.	0.186496	0.44483	D	0.000455	T	0.58438	0.2122	L	0.43152	1.355	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.50206	-0.8855	10	0.05959	T	0.93	-28.7346	18.916	0.92506	0.0:0.0:1.0:0.0	.	342	Q9P242	K1486_HUMAN	T	342	ENSP00000272907:A342T	ENSP00000272907:A342T	A	+	1	0	KIAA1486	226155401	1.000000	0.71417	0.049000	0.19019	0.750000	0.42670	6.360000	0.73064	2.462000	0.83206	0.650000	0.86243	GCC	.		0.632	NYAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331258.1	NM_020864	
POLR3F	10621	broad.mit.edu	37	20	18448195	18448195	+	Silent	SNP	G	G	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr20:18448195G>A	ENST00000377603.4	+	1	425	c.45G>A	c.(43-45)ccG>ccA	p.P15P	DZANK1_ENST00000329494.5_5'Flank|POLR3F_ENST00000462997.1_3'UTR|DZANK1_ENST00000262547.5_5'Flank|DZANK1_ENST00000358866.6_5'Flank|DZANK1_ENST00000357236.4_5'Flank	NM_006466.2	NP_006457.2	Q9H1D9	RPC6_HUMAN	polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa	15					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			breast(2)	2						ACGCGGATCCGGTCGAAATAG	0.622																																					p.P15P	GBM(69;898 1468 19907 52011)												.	POLR3F-90	0			c.G45A						.						51.0	53.0	52.0					20																	18448195		2203	4300	6503	SO:0001819	synonymous_variant	10621	exon1			GGATCCGGTCGAA	U93869	CCDS13135.1	20p11.23	2013-01-21	2002-08-29		ENSG00000132664	ENSG00000132664		"""RNA polymerase subunits"""	15763	protein-coding gene	gene with protein product	"""RNA polymerase III C39 subunit"""		"""polymerase (RNA) III (DNA directed) polypeptide F (39 kDa)"""			9171375	Standard	NM_006466		Approved	RPC39, RPC6	uc002wqv.3	Q9H1D9	OTTHUMG00000031971	ENST00000377603.4:c.45G>A	20.37:g.18448195G>A		Somatic	120	0		WXS	Illumina HiSeq	Phase_I	242	6	NM_006466	0	0	1	1	0	A8K4C7|O15319	Silent	SNP	ENST00000377603.4	37	CCDS13135.1																																																																																			.		0.622	POLR3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078170.2	NM_006466	
CST1	1469	broad.mit.edu	37	20	23728528	23728528	+	Silent	SNP	C	C	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr20:23728528C>T	ENST00000304749.2	-	3	421	c.351G>A	c.(349-351)ttG>ttA	p.L117L	CST1_ENST00000398402.1_Silent_p.L117L	NM_001898.2	NP_001889.2	P01037	CYTN_HUMAN	cystatin SN	117					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|negative regulation of endopeptidase activity (GO:0010951)	extracellular space (GO:0005615)	cysteine-type endopeptidase inhibitor activity (GO:0004869)	p.L117L(1)		kidney(1)|large_intestine(1)|lung(8)|ovary(1)|stomach(1)|urinary_tract(1)	13	Lung NSC(19;0.0676)|all_lung(19;0.148)					CGAAAGAGCACAACTGTTTCT	0.527																																					p.L117L													.	CST1-91	1	Substitution - coding silent(1)	lung(1)	c.G351A						.						93.0	81.0	85.0					20																	23728528		2203	4300	6503	SO:0001819	synonymous_variant	1469	exon3			AGAGCACAACTGT	M19169	CCDS13160.1	20p11.2	2008-04-15			ENSG00000170373	ENSG00000170373			2473	protein-coding gene	gene with protein product		123855					Standard	NM_001898		Approved		uc002wtp.3	P01037	OTTHUMG00000032085	ENST00000304749.2:c.351G>A	20.37:g.23728528C>T		Somatic	89	2		WXS	Illumina HiSeq	Phase_I	134	8	NM_001898	0	0	0	0	0	Q96LE6|Q9UCQ6	Silent	SNP	ENST00000304749.2	37	CCDS13160.1																																																																																			.		0.527	CST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078351.2	NM_001898	
FRG1B	284802	bcgsc.ca	37	20	29628278	29628278	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr20:29628278G>A	ENST00000278882.3	+	6	660	c.280G>A	c.(280-282)Gca>Aca	p.A94T	FRG1B_ENST00000358464.4_Missense_Mutation_p.A94T|FRG1B_ENST00000439954.2_Missense_Mutation_p.A99T			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	94										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						ATGCAATGAAGCAGGGGACAT	0.373																																					.													.	FRG1B-22	0			.						.																																			SO:0001583	missense	284802	.			AATGAAGCAGGGG			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.280G>A	20.37:g.29628278G>A	ENSP00000278882:p.Ala94Thr	Somatic	593	14		WXS	Illumina HiSeq	Phase_1	1279	52	.	0	0	51	51	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	g	9.994	1.231660	0.22626	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.44083	0.93	2.08	2.08	0.27032	Actin cross-linking (1);	0.286587	0.39083	N	0.001478	T	0.22898	0.0553	.	.	.	0.21290	N	0.99973	B;B	0.12630	0.0;0.006	B;B	0.12156	0.002;0.007	T	0.15407	-1.0438	9	0.16420	T	0.52	.	10.2211	0.43198	0.0:0.0:1.0:0.0	.	99;94	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	T	94;99;94	ENSP00000408863:A99T	ENSP00000278882:A94T	A	+	1	0	FRG1B	28241939	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	4.196000	0.58407	1.475000	0.48197	0.423000	0.28283	GCA	.		0.373	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
HM13	81502	ucsc.edu;bcgsc.ca	37	20	30156952	30156952	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr20:30156952C>T	ENST00000340852.5	+	12	1188	c.1064C>T	c.(1063-1065)gCg>gTg	p.A355V	HM13_ENST00000398174.3_Missense_Mutation_p.A404V|HM13_ENST00000376127.3_Missense_Mutation_p.A313V|HM13_ENST00000492709.1_3'UTR|HM13_ENST00000335574.5_3'UTR|HM13-AS1_ENST00000412178.1_RNA	NM_030789.2	NP_110416.1	Q8TCT9	HM13_HUMAN	histocompatibility (minor) 13	355					membrane protein proteolysis (GO:0033619)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	aspartic endopeptidase activity, intramembrane cleaving (GO:0042500)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	12	all_cancers(5;3.44e-05)|Lung NSC(7;4.38e-06)|all_lung(7;7.65e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		all cancers(5;0.000479)|Colorectal(19;0.00202)|COAD - Colon adenocarcinoma(19;0.0264)			AAGGATCCAGCGGCAGTGACA	0.473											OREG0025852	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A404V													.	HM13-153	0			c.C1211T						.						33.0	34.0	33.0					20																	30156952		2202	4297	6499	SO:0001583	missense	81502	exon13			ATCCAGCGGCAGT	AL110115	CCDS13182.1, CCDS13183.1, CCDS42861.1	20q11.21	2012-02-21			ENSG00000101294	ENSG00000101294			16435	protein-coding gene	gene with protein product	"""signal peptide peptidase beta"", ""presenilin-like protein 3"", ""intramembrane protease"", ""signal peptide peptidase like 1"""	607106				12077416, 14704149	Standard	NM_030789		Approved	H13, dJ324O17.1, SPP, PSL3, IMP1, IMPAS, PSENL3, SPPL1	uc002wwc.3	Q8TCT9	OTTHUMG00000032175	ENST00000340852.5:c.1064C>T	20.37:g.30156952C>T	ENSP00000343032:p.Ala355Val	Somatic	159	3	815	WXS	Illumina HiSeq		273	82	NM_178581	0	1	242	366	123	B2RAY5|E1P5L3|Q15K36|Q540H8|Q5JWP2|Q5JWP3|Q5JWP4|Q5JWP5|Q7Z4F2|Q86Y35|Q95H87|Q9H110|Q9H111	Missense_Mutation	SNP	ENST00000340852.5	37	CCDS13182.1	.	.	.	.	.	.	.	.	.	.	C	13.91	2.379383	0.42207	.	.	ENSG00000101294	ENST00000340852;ENST00000398174;ENST00000376127	T;T;T	0.27402	1.89;1.67;1.9	4.36	3.34	0.38264	.	.	.	.	.	T	0.14527	0.0351	N	0.08118	0	0.21802	N	0.999533	B;B	0.25609	0.0;0.13	B;B	0.23018	0.001;0.043	T	0.12811	-1.0533	9	0.18710	T	0.47	.	9.0093	0.36131	0.2202:0.7798:0.0:0.0	.	355;404	Q8TCT9;Q8TCT9-2	HM13_HUMAN;.	V	355;404;313	ENSP00000343032:A355V;ENSP00000381237:A404V;ENSP00000365296:A313V	ENSP00000343032:A355V	A	+	2	0	HM13	29620613	0.851000	0.29673	0.998000	0.56505	0.990000	0.78478	0.356000	0.20181	2.420000	0.82092	0.561000	0.74099	GCG	.		0.473	HM13-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078527.2	NM_178580	
AHCY	191	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	32878681	32878681	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr20:32878681C>T	ENST00000217426.2	-	6	699	c.622G>A	c.(622-624)Gat>Aat	p.D208N	AHCY_ENST00000538132.1_Missense_Mutation_p.D180N|AHCY_ENST00000468908.1_5'Flank	NM_000687.2	NP_000678.1	P23526	SAHH_HUMAN	adenosylhomocysteinase	208					cellular nitrogen compound metabolic process (GO:0034641)|chronic inflammatory response to antigenic stimulus (GO:0002439)|circadian sleep/wake cycle (GO:0042745)|homocysteine biosynthetic process (GO:0071268)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|S-adenosylhomocysteine catabolic process (GO:0019510)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|nucleus (GO:0005634)	adenosylhomocysteinase activity (GO:0004013)|adenyl nucleotide binding (GO:0030554)|NAD binding (GO:0051287)			endometrium(6)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						ATCATCACATCTGTGGCCCGC	0.587																																					p.D208N		.											.	AHCY-91	0			c.G622A						.						50.0	47.0	48.0					20																	32878681		2203	4300	6503	SO:0001583	missense	191	exon6			TCACATCTGTGGC	M61832	CCDS13233.1, CCDS54457.1	20q11.22	2009-06-12	2009-06-12		ENSG00000101444	ENSG00000101444	3.3.1.1		343	protein-coding gene	gene with protein product		180960	"""S-adenosylhomocysteine hydrolase"""			7079734, 6580258	Standard	NM_001161766		Approved	SAHH	uc002xai.3	P23526	OTTHUMG00000140098	ENST00000217426.2:c.622G>A	20.37:g.32878681C>T	ENSP00000217426:p.Asp208Asn	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	112	42	NM_000687	0	1	44	69	24	A8K307|B3KUN3|E1P5P2|F5H737|Q96A36	Missense_Mutation	SNP	ENST00000217426.2	37	CCDS13233.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.766291	0.90020	.	.	ENSG00000101444	ENST00000217426;ENST00000538132	T;T	0.79352	-1.23;-1.26	4.74	3.78	0.43462	S-adenosyl-L-homocysteine hydrolase, NAD binding (1);	0.089011	0.85682	D	0.000000	D	0.86218	0.5880	M	0.67700	2.07	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.88144	0.2846	10	0.87932	D	0	.	15.2705	0.73696	0.0:0.859:0.141:0.0	.	208	P23526	SAHH_HUMAN	N	208;180	ENSP00000217426:D208N;ENSP00000442820:D180N	ENSP00000217426:D208N	D	-	1	0	AHCY	32342342	1.000000	0.71417	0.977000	0.42913	0.981000	0.71138	7.529000	0.81952	1.333000	0.45449	0.561000	0.74099	GAT	.		0.587	AHCY-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078773.2	NM_000687	
KIAA1755	85449	broad.mit.edu	37	20	36874404	36874404	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr20:36874404T>C	ENST00000279024.4	-	2	399	c.128A>G	c.(127-129)gAt>gGt	p.D43G		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	43										breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				GCTCAGCCCATCCCCCTGGAA	0.602																																					p.D43G													.	KIAA1755-95	0			c.A128G						.						76.0	67.0	70.0					20																	36874404		2203	4300	6503	SO:0001583	missense	85449	exon2			AGCCCATCCCCCT	AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.128A>G	20.37:g.36874404T>C	ENSP00000279024:p.Asp43Gly	Somatic	41	0		WXS	Illumina HiSeq	Phase_I	84	4	NM_001029864	0	0	0	0	0	Q9C0A8	Missense_Mutation	SNP	ENST00000279024.4	37	CCDS33467.1	.	.	.	.	.	.	.	.	.	.	T	27.6	4.846553	0.91277	.	.	ENSG00000149633	ENST00000279024	T	0.39056	1.1	5.4	5.4	0.78164	.	0.000000	0.50627	D	0.000112	T	0.66607	0.2806	M	0.81942	2.565	0.58432	D	0.999998	D	0.89917	1.0	D	0.87578	0.998	T	0.71583	-0.4549	10	0.72032	D	0.01	.	14.9112	0.70758	0.0:0.0:0.0:1.0	.	43	Q5JYT7	K1755_HUMAN	G	43	ENSP00000279024:D43G	ENSP00000279024:D43G	D	-	2	0	KIAA1755	36307818	1.000000	0.71417	0.899000	0.35326	0.867000	0.49689	7.984000	0.88150	2.172000	0.68678	0.533000	0.62120	GAT	.		0.602	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079144.3	NM_001029864	
SLC13A3	64849	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	45217868	45217868	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr20:45217868A>G	ENST00000279027.4	-	7	965	c.947T>C	c.(946-948)aTa>aCa	p.I316T	SLC13A3_ENST00000290317.5_Missense_Mutation_p.I269T|SLC13A3_ENST00000435032.1_5'UTR|SLC13A3_ENST00000396360.1_Missense_Mutation_p.I269T|SLC13A3_ENST00000413164.2_Missense_Mutation_p.I266T|SLC13A3_ENST00000495082.1_Missense_Mutation_p.I269T|SLC13A3_ENST00000472148.1_Missense_Mutation_p.I269T|SLC13A3_ENST00000372121.1_Missense_Mutation_p.I266T|SLC13A3_ENST00000464518.1_5'Flank	NM_001193342.1|NM_022829.5	NP_001180271.1|NP_073740.2	Q8WWT9	S13A3_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3	316					transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-affinity sodium:dicarboxylate symporter activity (GO:0015362)			breast(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	ATTGGTTCTTATCTCAGATTT	0.488																																					p.I316T		.											.	SLC13A3-91	0			c.T947C						.						115.0	114.0	114.0					20																	45217868		2203	4300	6503	SO:0001583	missense	64849	exon7			GTTCTTATCTCAG	AF154121	CCDS13400.1, CCDS42886.1, CCDS54469.1, CCDS54470.1	20q13.12	2013-05-22			ENSG00000158296	ENSG00000158296		"""Solute carriers"""	14430	protein-coding gene	gene with protein product		606411				10794676, 10992006	Standard	NM_001011554		Approved	NADC3, SDCT2	uc002xsf.2	Q8WWT9	OTTHUMG00000033042	ENST00000279027.4:c.947T>C	20.37:g.45217868A>G	ENSP00000279027:p.Ile316Thr	Somatic	77	0		WXS	Illumina HiSeq	Phase_I	152	35	NM_022829	0	0	0	0	0	B4DIR8|E1P5U4|F6WI18|Q5JYC9|Q5JYD0|Q5JYD1|Q5TCQ2|Q8IVB1|Q8N8K4|Q96MM5|Q9BR25|Q9H1G1|Q9H3W4|Q9NQN5|Q9NS04	Missense_Mutation	SNP	ENST00000279027.4	37	CCDS13400.1	.	.	.	.	.	.	.	.	.	.	A	0.563	-0.844580	0.02671	.	.	ENSG00000158296	ENST00000290317;ENST00000396360;ENST00000279027;ENST00000472148;ENST00000413164;ENST00000495082;ENST00000468915;ENST00000420568;ENST00000372121	T;T;T;T;T;T;T;T;T	0.10099	3.84;3.75;4.1;3.75;3.57;3.84;3.26;2.92;2.91	5.84	4.74	0.60224	.	1.055960	0.07196	N	0.856503	T	0.10981	0.0268	L	0.27053	0.805	0.28449	N	0.916409	P;B;P;P	0.42161	0.772;0.128;0.515;0.571	B;B;B;B	0.43701	0.428;0.144;0.22;0.328	T	0.15178	-1.0446	10	0.13470	T	0.59	-3.1173	10.4316	0.44411	0.9264:0.0:0.0736:0.0	.	266;269;269;316	B4DIR8;Q8WWT9-3;F6WI18;Q8WWT9	.;.;.;S13A3_HUMAN	T	269;269;316;269;266;269;269;229;266	ENSP00000290317:I269T;ENSP00000379648:I269T;ENSP00000279027:I316T;ENSP00000420177:I269T;ENSP00000415852:I266T;ENSP00000419621:I269T;ENSP00000417784:I269T;ENSP00000395095:I229T;ENSP00000361193:I266T	ENSP00000279027:I316T	I	-	2	0	SLC13A3	44651275	0.575000	0.26692	0.001000	0.08648	0.055000	0.15305	3.364000	0.52328	1.044000	0.40200	0.529000	0.55759	ATA	.		0.488	SLC13A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080329.2		
C21orf33	8209	broad.mit.edu;bcgsc.ca	37	21	45563146	45563146	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr21:45563146T>G	ENST00000291577.6	+	6	674	c.581T>G	c.(580-582)gTg>gGg	p.V194G	C21orf33_ENST00000348499.5_Missense_Mutation_p.V163G	NM_004649.6	NP_004640	P30042	ES1_HUMAN	chromosome 21 open reading frame 33	194						mitochondrion (GO:0005739)				NS(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	8				STAD - Stomach adenocarcinoma(101;0.168)|Colorectal(79;0.191)		GAGGTGACTGTGGGCCACGAG	0.617																																					p.V194G													.	C21orf33-91	0			c.T581G						.						77.0	65.0	69.0					21																	45563146		2203	4300	6503	SO:0001583	missense	8209	exon6			TGACTGTGGGCCA	Y07572	CCDS33580.1, CCDS33581.1	21q22.3	2008-07-29			ENSG00000160221	ENSG00000160221			1273	protein-coding gene	gene with protein product		601659				9150728, 8975701	Standard	NM_004649		Approved	KNP-Ia, GT335, ES1, HES1, D21S2048E, KNPI, KNPH, KNP-I	uc002zec.4	P30042	OTTHUMG00000086916	ENST00000291577.6:c.581T>G	21.37:g.45563146T>G	ENSP00000291577:p.Val194Gly	Somatic	47	1		WXS	Illumina HiSeq	Phase_I	131	51	NM_004649	0	0	87	187	100	A6NFJ6|A6NJY7|O00650|O00660|O15011|O15012|P55346|P78474|Q92505|Q92507	Missense_Mutation	SNP	ENST00000291577.6	37	CCDS33580.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	21.0|21.0|21.0	4.089390|4.089390|4.089390	0.76756|0.76756|0.76756	.|.|.	.|.|.	ENSG00000160221|ENSG00000248354;ENSG00000160221;ENSG00000160221|ENSG00000160221	ENST00000449622|ENST00000433711;ENST00000291577;ENST00000348499|ENST00000419699	.|T;T|.	.|0.78707|.	.|-1.2;1.63|.	4.69|4.69|4.69	4.69|4.69|4.69	0.59074|0.59074|0.59074	.|ThiJ/PfpI (1);|.	.|0.065935|.	.|0.64402|.	.|D|.	.|0.000006|.	T|T|T	0.62636|0.62636|0.62636	0.2444|0.2444|0.2444	L|L|L	0.49126|0.49126|0.49126	1.545|1.545|1.545	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|D;D|.	.|0.89917|.	.|1.0;1.0|.	.|D;D|.	.|0.85130|.	.|0.991;0.997|.	T|T|T	0.61033|0.61033|0.61033	-0.7144|-0.7144|-0.7144	5|10|5	.|0.87932|.	.|D|.	.|0|.	-34.2275|-34.2275|-34.2275	14.4883|14.4883|14.4883	0.67631|0.67631|0.67631	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.|.	.|163;194|.	.|P30042-2;P30042|.	.|.;ES1_HUMAN|.	W|G|G	182|173;194;163|110	.|ENSP00000291577:V194G;ENSP00000344901:V163G|.	.|ENSP00000415634:V173G|.	C|V|W	+|+|+	3|2|1	2|0|0	C21orf33|C21orf33;AP001055.7|C21orf33	44387574|44387574|44387574	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.448000|0.448000|0.448000	0.32197|0.32197|0.32197	7.555000|7.555000|7.555000	0.82223|0.82223|0.82223	1.891000|1.891000|1.891000	0.54761|0.54761|0.54761	0.533000|0.533000|0.533000	0.62120|0.62120|0.62120	TGT|GTG|TGG	.		0.617	C21orf33-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000195824.1	NM_004649	
KRTAP10-6	386674	broad.mit.edu	37	21	46011400	46011400	+	Silent	SNP	G	G	A	rs371252868		TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr21:46011400G>A	ENST00000400368.1	-	1	986	c.966C>T	c.(964-966)tcC>tcT	p.S322S	TSPEAR_ENST00000323084.4_Intron	NM_198688.2	NP_941961.2	P60371	KR106_HUMAN	keratin associated protein 10-6	322	29 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)		p.S322S(5)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(6)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23						AGGCACCACAGGAGGGGACGG	0.692																																					p.S322S													.	KRTAP10-6-90	5	Substitution - coding silent(5)	endometrium(3)|urinary_tract(1)|prostate(1)	c.C966T						.						66.0	81.0	76.0					21																	46011400		2201	4300	6501	SO:0001819	synonymous_variant	386674	exon1			ACCACAGGAGGGG	AB076353	CCDS42959.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000188155	ENSG00000188155		"""Keratin associated proteins"""	20523	protein-coding gene	gene with protein product			"""keratin associated protein 18-6"""	KRTAP18-6			Standard	NM_198688		Approved	KRTAP18.6, KAP18.6, KAP10.6	uc002zfm.3	P60371	OTTHUMG00000057634	ENST00000400368.1:c.966C>T	21.37:g.46011400G>A		Somatic	88	1		WXS	Illumina HiSeq	Phase_I	176	5	NM_198688	0	0	0	0	0		Silent	SNP	ENST00000400368.1	37	CCDS42959.1																																																																																			.		0.692	KRTAP10-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128037.1	NM_198688	
MTMR3	8897	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	30403186	30403186	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr22:30403186A>C	ENST00000401950.2	+	10	1097	c.755A>C	c.(754-756)cAt>cCt	p.H252P	MTMR3_ENST00000351488.3_Missense_Mutation_p.H252P|MTMR3_ENST00000406629.1_Missense_Mutation_p.H252P|CTA-85E5.10_ENST00000429350.1_RNA|MTMR3_ENST00000333027.3_Missense_Mutation_p.H252P|MTMR3_ENST00000323630.5_Missense_Mutation_p.H116P	NM_021090.3	NP_066576.1	Q13615	MTMR3_HUMAN	myotubularin related protein 3	252	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|large_intestine(3)|ovary(2)|skin(8)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			GATGATGAGCATCTGGTACAG	0.547																																					p.H252P		.											.	MTMR3-292	0			c.A755C						.						94.0	87.0	89.0					22																	30403186		2203	4300	6503	SO:0001583	missense	8897	exon10			ATGAGCATCTGGT	U58034	CCDS13870.1, CCDS13871.1, CCDS46682.1	22q12.2	2011-06-09			ENSG00000100330	ENSG00000100330		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7451	protein-coding gene	gene with protein product		603558				8640223, 9736772	Standard	NM_153050		Approved	KIAA0371, ZFYVE10, FYVE-DSP1	uc003agv.4	Q13615	OTTHUMG00000151278	ENST00000401950.2:c.755A>C	22.37:g.30403186A>C	ENSP00000384651:p.His252Pro	Somatic	40	0		WXS	Illumina HiSeq	Phase_I	92	28	NM_153050	0	0	0	0	0	A5PL26|A7MD32|Q9NYN5|Q9NYN6|Q9UDX6|Q9UEG3	Missense_Mutation	SNP	ENST00000401950.2	37	CCDS13870.1	.	.	.	.	.	.	.	.	.	.	A	27.9	4.872970	0.91664	.	.	ENSG00000100330	ENST00000401950;ENST00000333027;ENST00000323630;ENST00000351488;ENST00000406629	D;D;D;D;D	0.92752	-3.1;-3.1;-3.1;-3.1;-3.1	5.87	5.87	0.94306	Myotubularin phosphatase domain (1);Myotubularin-related (1);	0.087453	0.85682	D	0.000000	D	0.95310	0.8478	M	0.69823	2.125	0.80722	D	1	D;P;D	0.69078	0.997;0.931;0.997	D;P;D	0.66847	0.947;0.781;0.947	D	0.95552	0.8621	10	0.66056	D	0.02	.	15.4554	0.75308	1.0:0.0:0.0:0.0	.	252;252;252	Q13615-3;Q13615;Q13615-2	.;MTMR3_HUMAN;.	P	252;252;116;252;252	ENSP00000384651:H252P;ENSP00000331649:H252P;ENSP00000318070:H116P;ENSP00000307271:H252P;ENSP00000384077:H252P	ENSP00000318070:H116P	H	+	2	0	MTMR3	28733186	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	8.962000	0.93254	2.253000	0.74438	0.533000	0.62120	CAT	.		0.547	MTMR3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322066.1	NM_021090	
CARD10	29775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	37898635	37898635	+	Silent	SNP	C	C	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr22:37898635C>G	ENST00000403299.1	-	12	1977	c.1761G>C	c.(1759-1761)cgG>cgC	p.R587R	CARD10_ENST00000251973.5_Silent_p.R587R|CARD10_ENST00000406271.3_Silent_p.R301R			Q9BWT7	CAR10_HUMAN	caspase recruitment domain family, member 10	587					activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein complex assembly (GO:0006461)|regulation of apoptotic process (GO:0042981)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)	receptor signaling complex scaffold activity (GO:0030159)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	17	Melanoma(58;0.0574)					GGCCACAGCCCCGAGCCAGGA	0.617																																					p.R587R		.											.	CARD10-662	0			c.G1761C						.						54.0	48.0	50.0					22																	37898635		2203	4300	6503	SO:0001819	synonymous_variant	29775	exon11			ACAGCCCCGAGCC	AF086324	CCDS13948.1	22q13.1	2008-05-22			ENSG00000100065	ENSG00000100065			16422	protein-coding gene	gene with protein product		607209				11259443, 11356195	Standard	NM_014550		Approved	CARMA3, BIMP1	uc003asu.1	Q9BWT7	OTTHUMG00000150592	ENST00000403299.1:c.1761G>C	22.37:g.37898635C>G		Somatic	27	0		WXS	Illumina HiSeq	Phase_I	63	21	NM_014550	0	0	10	15	5	Q14CQ8|Q5TFG6|Q8NC81|Q9UGR5|Q9UGR6|Q9Y3H0	Silent	SNP	ENST00000403299.1	37	CCDS13948.1																																																																																			.		0.617	CARD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318997.1	NM_014550	
TMF1	7110	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	69072460	69072460	+	Silent	SNP	T	T	C			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr3:69072460T>C	ENST00000398559.2	-	17	3366	c.3150A>G	c.(3148-3150)caA>caG	p.Q1050Q	CTD-2013N24.2_ENST00000596523.1_RNA|CTD-2013N24.2_ENST00000597950.1_RNA|CTD-2013N24.2_ENST00000597366.1_RNA|TMF1_ENST00000543976.1_Silent_p.Q1053Q|CTD-2013N24.2_ENST00000601735.1_RNA|TMF1_ENST00000489370.1_5'Flank|CTD-2013N24.2_ENST00000598783.1_RNA|CTD-2013N24.2_ENST00000599467.1_RNA|CTD-2013N24.2_ENST00000601511.1_RNA|CTD-2013N24.2_ENST00000595925.1_RNA|CTD-2013N24.2_ENST00000482368.2_RNA|CTD-2013N24.2_ENST00000596732.1_RNA			P82094	TMF1_HUMAN	TATA element modulatory factor 1	1050					acrosome assembly (GO:0001675)|cellular response to organic cyclic compound (GO:0071407)|defense response to bacterium (GO:0042742)|Leydig cell differentiation (GO:0033327)|luteinizing hormone secretion (GO:0032275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|positive regulation of cytokine production (GO:0001819)|positive regulation of testosterone secretion (GO:2000845)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of transcription, DNA-templated (GO:0006355)|sperm motility (GO:0030317)|spermatid nucleus differentiation (GO:0007289)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription cofactor activity (GO:0003712)			cervix(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;4.48e-05)|Epithelial(33;0.000274)|LUSC - Lung squamous cell carcinoma(21;0.0123)|KIRC - Kidney renal clear cell carcinoma(39;0.211)|Kidney(39;0.247)		TGTTGTACCTTTGATCCAAAT	0.299																																					p.Q1050Q		.											.	TMF1-90	0			c.A3150G						.						93.0	78.0	82.0					3																	69072460		1810	4067	5877	SO:0001819	synonymous_variant	7110	exon17			GTACCTTTGATCC		CCDS43105.1	3p21-p12	2009-02-11			ENSG00000144747	ENSG00000144747			11870	protein-coding gene	gene with protein product		601126				1409643	Standard	NM_007114		Approved	ARA160, TMF	uc003dnn.3	P82094	OTTHUMG00000158771	ENST00000398559.2:c.3150A>G	3.37:g.69072460T>C		Somatic	80	0		WXS	Illumina HiSeq	Phase_I	196	61	NM_007114	0	0	0	3	3	B7ZLJ2|Q17R87|Q59GK0	Silent	SNP	ENST00000398559.2	37	CCDS43105.1																																																																																			.		0.299	TMF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352106.1	NM_007114	
BBX	56987	broad.mit.edu	37	3	107492048	107492048	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr3:107492048G>A	ENST00000325805.8	+	11	1767	c.1480G>A	c.(1480-1482)Gca>Aca	p.A494T	BBX_ENST00000416476.2_Intron|BBX_ENST00000402543.1_Missense_Mutation_p.A494T|BBX_ENST00000415149.2_Missense_Mutation_p.A494T|BBX_ENST00000406780.1_Missense_Mutation_p.A494T			Q8WY36	BBX_HUMAN	bobby sox homolog (Drosophila)	494	Lys-rich.				bone development (GO:0060348)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(18)|ovary(4)|pancreas(1)|skin(2)	49			OV - Ovarian serous cystadenocarcinoma(3;0.112)			TGAAGCCGTCGCAAAAGGAGA	0.483																																					p.A494T													.	BBX-94	0			c.G1480A						.						82.0	87.0	85.0					3																	107492048		2203	4300	6503	SO:0001583	missense	56987	exon11			GCCGTCGCAAAAG	AF168718	CCDS2950.1, CCDS46881.1, CCDS63712.1	3q13.1	2008-07-18			ENSG00000114439	ENSG00000114439			14422	protein-coding gene	gene with protein product	"""x 001 protein"""					11680820	Standard	NM_001142568		Approved	MDS001, HSPC339, HBP2	uc010hpr.4	Q8WY36	OTTHUMG00000150360	ENST00000325805.8:c.1480G>A	3.37:g.107492048G>A	ENSP00000319974:p.Ala494Thr	Somatic	195	0		WXS	Illumina HiSeq	Phase_I	409	6	NM_001142568	0	0	0	0	0	A2RRM7|Q2TAJ1|Q7L3J8|Q7LBY8|Q8NDB0|Q8WY35|Q9H0J6	Missense_Mutation	SNP	ENST00000325805.8	37	CCDS46881.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.959348	0.74016	.	.	ENSG00000114439	ENST00000415149;ENST00000402543;ENST00000325805;ENST00000406780	T;T;T;T	0.57436	0.4;0.4;0.4;0.4	5.94	5.94	0.96194	.	0.150283	0.64402	D	0.000014	T	0.65964	0.2742	L	0.32530	0.975	0.53005	D	0.999969	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79108	0.942;0.974;0.992	T	0.66917	-0.5802	10	0.87932	D	0	-12.6699	20.3523	0.98815	0.0:0.0:1.0:0.0	.	494;494;494	C9JA69;Q8WY36;Q8WY36-2	.;BBX_HUMAN;.	T	494	ENSP00000408358:A494T;ENSP00000385317:A494T;ENSP00000319974:A494T;ENSP00000385530:A494T	ENSP00000319974:A494T	A	+	1	0	BBX	108974738	1.000000	0.71417	0.974000	0.42286	0.199000	0.23934	9.107000	0.94261	2.821000	0.97095	0.484000	0.47621	GCA	.		0.483	BBX-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317820.1	NM_020235	
NDUFB4	4710	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	120320001	120320001	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr3:120320001A>G	ENST00000184266.2	+	2	275	c.224A>G	c.(223-225)aAt>aGt	p.N75S	NDUFB4_ENST00000485064.1_Missense_Mutation_p.N75S|NDUFB4_ENST00000492739.1_Intron	NM_004547.5	NP_004538.2	O95168	NDUB4_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa	75					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|large_intestine(1)|lung(3)	5				GBM - Glioblastoma multiforme(114;0.14)		AGAACAATAAATGTCTATCCT	0.363																																					p.N75S		.											.	.	0			c.A224G						.						132.0	142.0	139.0					3																	120320001		2203	4296	6499	SO:0001583	missense	4710	exon2			CAATAAATGTCTA	AF044957	CCDS2999.1, CCDS54630.1	3q13.33	2011-07-04	2002-08-29		ENSG00000065518	ENSG00000065518		"""Mitochondrial respiratory chain complex / Complex I"""	7699	protein-coding gene	gene with protein product	"""complex I B15 subunit"""	603840	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4 (15kD, B15)"""			9878551	Standard	NM_004547		Approved	B15	uc003edu.3	O95168	OTTHUMG00000159442	ENST00000184266.2:c.224A>G	3.37:g.120320001A>G	ENSP00000184266:p.Asn75Ser	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	179	71	NM_004547	0	0	128	295	167	B2RUY3|B9EJC7	Missense_Mutation	SNP	ENST00000184266.2	37	CCDS2999.1	.	.	.	.	.	.	.	.	.	.	A	11.43	1.635688	0.29068	.	.	ENSG00000065518	ENST00000184266;ENST00000485064	.	.	.	5.45	5.45	0.79879	.	0.052553	0.85682	D	0.000000	T	0.57562	0.2062	M	0.71581	2.175	0.80722	D	1	B;P	0.38129	0.103;0.619	B;B	0.38921	0.047;0.285	T	0.60929	-0.7165	9	0.45353	T	0.12	2.7254	11.8278	0.52278	1.0:0.0:0.0:0.0	.	75;75	O95168;B2RUY3	NDUB4_HUMAN;.	S	75	.	ENSP00000184266:N75S	N	+	2	0	NDUFB4	121802691	0.971000	0.33674	0.492000	0.27490	0.082000	0.17680	3.410000	0.52664	2.288000	0.76882	0.533000	0.62120	AAT	.		0.363	NDUFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355420.1	NM_004547	
NMD3	51068	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	160964158	160964158	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr3:160964158C>T	ENST00000460469.1	+	11	1507	c.1052C>T	c.(1051-1053)tCt>tTt	p.S351F	NMD3_ENST00000351193.2_Missense_Mutation_p.S351F|NMD3_ENST00000472947.1_Missense_Mutation_p.S351F			Q96D46	NMD3_HUMAN	NMD3 ribosome export adaptor	351					protein transport (GO:0015031)|ribosomal large subunit export from nucleus (GO:0000055)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|ribosomal large subunit binding (GO:0043023)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(10)|ovary(1)|skin(1)|urinary_tract(2)	25			Lung(72;0.00111)|LUSC - Lung squamous cell carcinoma(72;0.00156)			CAGAAGACATCTGAAATGAAT	0.353																																					p.S351F		.											.	NMD3-91	0			c.C1052T						.						75.0	77.0	76.0					3																	160964158		2203	4300	6503	SO:0001583	missense	51068	exon12			AGACATCTGAAAT	BC013317	CCDS3194.1	3q26.1	2013-08-06	2013-08-06		ENSG00000169251	ENSG00000169251			24250	protein-coding gene	gene with protein product		611021	"""NMD3 homolog (S. cerevisiae)"""			10810093, 23782956, 12773398	Standard	NM_015938		Approved	CGI-07	uc003feb.1	Q96D46	OTTHUMG00000159063	ENST00000460469.1:c.1052C>T	3.37:g.160964158C>T	ENSP00000419004:p.Ser351Phe	Somatic	30	0		WXS	Illumina HiSeq	Phase_I	79	33	NM_015938	0	0	0	1	1	D3DNM7|Q9Y2Z6	Missense_Mutation	SNP	ENST00000460469.1	37	CCDS3194.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.751897	0.89753	.	.	ENSG00000169251	ENST00000351193;ENST00000472947;ENST00000460469;ENST00000540137	T;T;T	0.24723	1.84;1.84;1.84	5.01	5.01	0.66863	.	0.055185	0.85682	D	0.000000	T	0.57388	0.2050	M	0.91354	3.2	0.80722	D	1	D;D;D	0.56968	0.972;0.978;0.976	P;P;P	0.59703	0.781;0.862;0.556	T	0.68213	-0.5468	10	0.87932	D	0	-30.719	18.1915	0.89808	0.0:1.0:0.0:0.0	.	351;351;351	B3KT11;C9JA08;Q96D46	.;.;NMD3_HUMAN	F	351;351;351;231	ENSP00000307525:S351F;ENSP00000417559:S351F;ENSP00000419004:S351F	ENSP00000307525:S351F	S	+	2	0	NMD3	162446852	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.963000	0.76055	2.709000	0.92574	0.655000	0.94253	TCT	.		0.353	NMD3-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353114.1	NM_015938	
PARL	55486	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	183602604	183602604	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr3:183602604A>G	ENST00000317096.4	-	1	91	c.31T>C	c.(31-33)Tgg>Cgg	p.W11R	PARL_ENST00000311101.5_Missense_Mutation_p.W11R|RP11-315J22.5_ENST00000445165.1_RNA|MIR4448_ENST00000584360.1_RNA|PARL_ENST00000435888.1_Missense_Mutation_p.W11R	NM_018622.5	NP_061092.3	Q9H300	PARL_HUMAN	presenilin associated, rhomboid-like	11					membrane protein proteolysis (GO:0033619)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|proteolysis (GO:0006508)|regulation of protein targeting to mitochondrion (GO:1903214)|regulation of reactive oxygen species metabolic process (GO:2000377)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(3)|liver(1)|lung(6)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	17	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.21e-41)|Epithelial(37;1.34e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			CCGCAGCCCCAGCCTCTCTGC	0.697											OREG0015941	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.W11R		.											.	PARL-90	0			c.T31C						.						10.0	11.0	11.0					3																	183602604		2174	4246	6420	SO:0001583	missense	55486	exon1			AGCCCCAGCCTCT	AF116692	CCDS3248.1, CCDS33897.1	3q27.3	2008-02-05		2006-02-28	ENSG00000175193	ENSG00000175193			18253	protein-coding gene	gene with protein product	"""rhomboid 7 homolog 1 (Drosophila)"""	607858		PSARL			Standard	XM_005247587		Approved	PRO2207, PSARL1, RHBDS1	uc003fmd.3	Q9H300	OTTHUMG00000156890	ENST00000317096.4:c.31T>C	3.37:g.183602604A>G	ENSP00000325421:p.Trp11Arg	Somatic	17	0	1985	WXS	Illumina HiSeq	Phase_I	37	13	NM_018622	0	0	9	11	2	Q96CQ4|Q9BTJ6|Q9P1E3	Missense_Mutation	SNP	ENST00000317096.4	37	CCDS3248.1	.	.	.	.	.	.	.	.	.	.	A	18.56	3.650621	0.67472	.	.	ENSG00000175193	ENST00000317096;ENST00000311101;ENST00000435888	T;T;T	0.58652	0.42;0.32;0.33	4.72	4.72	0.59763	.	0.104022	0.38217	N	0.001779	T	0.51770	0.1694	L	0.40543	1.245	0.37352	D	0.910834	P;P	0.40107	0.703;0.664	B;B	0.42692	0.395;0.296	T	0.62959	-0.6743	10	0.87932	D	0	-25.2787	10.7723	0.46330	1.0:0.0:0.0:0.0	.	11;11	Q9H300-2;Q9H300	.;PARL_HUMAN	R	11	ENSP00000325421:W11R;ENSP00000310676:W11R;ENSP00000402137:W11R	ENSP00000310676:W11R	W	-	1	0	PARL	185085298	0.998000	0.40836	1.000000	0.80357	0.719000	0.41307	3.655000	0.54460	2.118000	0.64928	0.533000	0.62120	TGG	.		0.697	PARL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346465.1	NM_018622	
MUC4	4585	hgsc.bcm.edu	37	3	195505787	195505787	+	Missense_Mutation	SNP	C	C	T	rs11915935		TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr3:195505787C>T	ENST00000463781.3	-	2	13123	c.12664G>A	c.(12664-12666)Gcc>Acc	p.A4222T	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A4222T|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	979					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGAGGGGTGGCGTGACCTGTG	0.587																																					p.A4222T		.											.	MUC4-90	0			c.G12664A						.						27.0	28.0	27.0					3																	195505787		2081	4173	6254	SO:0001583	missense	4585	exon2			GGGTGGCGTGACC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12664G>A	3.37:g.195505787C>T	ENSP00000417498:p.Ala4222Thr	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	119	8	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	c	9.614	1.132017	0.21041	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35048	1.37;1.33	1.25	-1.78	0.07957	.	.	.	.	.	T	0.13030	0.0316	N	0.22421	0.69	0.09310	N	1	P	0.45986	0.87	B	0.24006	0.05	T	0.19160	-1.0314	8	.	.	.	.	2.6937	0.05128	0.3974:0.3581:0.2445:0.0	rs11915935	4094	E7ESK3	.	T	4222	ENSP00000417498:A4222T;ENSP00000420243:A4222T	.	A	-	1	0	MUC4	196990566	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.565000	0.05929	-0.465000	0.06953	0.487000	0.48397	GCC	.		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	hgsc.bcm.edu	37	3	195505790	195505790	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr3:195505790G>C	ENST00000463781.3	-	2	13120	c.12661C>G	c.(12661-12663)Cac>Gac	p.H4221D	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.H4221D|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	978					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGGGTGGCGTGACCTGTGGAT	0.587																																					p.H4221D		.											.	MUC4-90	0			c.C12661G						.						24.0	25.0	25.0					3																	195505790		2080	4171	6251	SO:0001583	missense	4585	exon2			TGGCGTGACCTGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12661C>G	3.37:g.195505790G>C	ENSP00000417498:p.His4221Asp	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	120	9	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	7.658	0.684339	0.14907	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30182	1.55;1.54	1.25	1.25	0.21368	.	.	.	.	.	T	0.10508	0.0257	N	0.03608	-0.345	0.09310	N	1	B	0.30727	0.292	B	0.19391	0.025	T	0.24548	-1.0157	8	.	.	.	.	6.0271	0.19660	0.0:0.0:1.0:0.0	rs11928301	4093	E7ESK3	.	D	4221	ENSP00000417498:H4221D;ENSP00000420243:H4221D	.	H	-	1	0	MUC4	196990569	0.000000	0.05858	0.009000	0.14445	0.004000	0.04260	-0.034000	0.12225	1.015000	0.39444	0.482000	0.46254	CAC	.		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	broad.mit.edu	37	3	195515038	195515038	+	Missense_Mutation	SNP	G	G	A	rs201206859		TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr3:195515038G>A	ENST00000463781.3	-	2	3872	c.3413C>T	c.(3412-3414)cCt>cTt	p.P1138L	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P1138L|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	605					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.P1138L(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTCGGTGACAGGAAGAGAGGT	0.567																																					p.P1138L													.	MUC4-90	1	Substitution - Missense(1)	endometrium(1)	c.C3413T						.																																			SO:0001583	missense	4585	exon2			GTGACAGGAAGAG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.3413C>T	3.37:g.195515038G>A	ENSP00000417498:p.Pro1138Leu	Somatic	45	0		WXS	Illumina HiSeq	Phase_I	105	16	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	5.066	0.197826	0.09652	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.33865	1.39;1.39	0.814	0.814	0.18756	.	.	.	.	.	T	0.38108	0.1028	N	0.19112	0.55	0.09310	N	1	D	0.69078	0.997	D	0.74674	0.984	T	0.21280	-1.0250	8	.	.	.	.	7.6132	0.28142	0.0:0.0:1.0:0.0	.	1138	E7ESK3	.	L	1138	ENSP00000417498:P1138L;ENSP00000420243:P1138L	.	P	-	2	0	MUC4	196999433	0.002000	0.14202	0.001000	0.08648	0.065000	0.16274	1.050000	0.30404	0.776000	0.33473	0.064000	0.15345	CCT	.		0.567	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	broad.mit.edu	37	3	195515052	195515052	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr3:195515052G>C	ENST00000463781.3	-	2	3858	c.3399C>G	c.(3397-3399)caC>caG	p.H1133Q	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.H1133Q|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	581					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.H1133Q(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGAGGTGGCGTGACCTGTGG	0.567																																					p.H1133Q													.	MUC4-90	2	Substitution - Missense(2)	endometrium(2)	c.C3399G						.						5.0	6.0	6.0					3																	195515052		542	1260	1802	SO:0001583	missense	4585	exon2			GGTGGCGTGACCT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.3399C>G	3.37:g.195515052G>C	ENSP00000417498:p.His1133Gln	Somatic	54	1		WXS	Illumina HiSeq	Phase_I	117	17	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	1.833	-0.469252	0.04445	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.26957	1.72;1.7	0.814	-1.63	0.08345	.	.	.	.	.	T	0.20700	0.0498	N	0.08118	0	0.09310	N	1	D	0.57899	0.981	P	0.61658	0.892	T	0.18618	-1.0331	8	.	.	.	.	6.1974	0.20557	0.0:0.0:0.5044:0.4955	.	1133	E7ESK3	.	Q	1133	ENSP00000417498:H1133Q;ENSP00000420243:H1133Q	.	H	-	3	2	MUC4	196999447	0.000000	0.05858	0.000000	0.03702	0.064000	0.16182	-0.117000	0.10708	-1.056000	0.03205	0.064000	0.15345	CAC	.		0.567	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	195517971	195517971	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr3:195517971T>A	ENST00000463781.3	-	2	939	c.480A>T	c.(478-480)gaA>gaT	p.E160D	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.E160D|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	165					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGGTAGAACTTTCAGTTCCTG	0.458																																					p.E160D		.											.	MUC4-90	0			c.A480T						.						198.0	175.0	182.0					3																	195517971		2005	4193	6198	SO:0001583	missense	4585	exon2			AGAACTTTCAGTT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.480A>T	3.37:g.195517971T>A	ENSP00000417498:p.Glu160Asp	Somatic	38	0		WXS	Illumina HiSeq	Phase_I	111	45	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	8.346	0.829900	0.16749	.	.	ENSG00000145113	ENST00000463781;ENST00000475231;ENST00000392409	T;T	0.35973	1.28;1.29	3.47	-6.95	0.01628	.	11.711200	0.00166	N	0.000009	T	0.14313	0.0346	N	0.14661	0.345	0.09310	N	1	P;B	0.36354	0.549;0.016	B;B	0.30401	0.115;0.013	T	0.17561	-1.0365	10	0.15952	T	0.53	.	1.8667	0.03200	0.2254:0.1937:0.4234:0.1575	.	160;165	E7ESK3;Q99102	.;MUC4_HUMAN	D	160;160;134	ENSP00000417498:E160D;ENSP00000420243:E160D	ENSP00000376209:E134D	E	-	3	2	MUC4	197002366	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.885000	0.01620	-1.803000	0.01242	0.376000	0.23039	GAA	.		0.458	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
ZNF721	170960	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	436719	436719	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr4:436719A>G	ENST00000338977.5	-	2	1549	c.1501T>C	c.(1501-1503)Tcc>Ccc	p.S501P	ZNF721_ENST00000507078.1_Intron|ZNF721_ENST00000511833.2_Missense_Mutation_p.S513P|ZNF721_ENST00000506646.1_Intron|ABCA11P_ENST00000451020.2_RNA			Q8TF20	ZN721_HUMAN	zinc finger protein 721	501					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(15)|lung(6)|ovary(1)|skin(1)|stomach(5)|urinary_tract(1)	33						AGGGTTGTGGAACTAGTAAAC	0.398																																					p.G513R		.											.	ZNF721-47	0			c.G1537C						.						84.0	92.0	89.0					4																	436719		2098	4242	6340	SO:0001583	missense	170960	exon3			TTGTGGAACTAGT	AK092362	CCDS46991.1	4p16.3	2013-01-08			ENSG00000182903	ENSG00000182903		"""Zinc fingers, C2H2-type"", ""-"""	29425	protein-coding gene	gene with protein product						11853319	Standard	NM_133474		Approved	KIAA1982	uc003gag.4	Q8TF20		ENST00000338977.5:c.1501T>C	4.37:g.436719A>G	ENSP00000340524:p.Ser501Pro	Somatic	31	0		WXS	Illumina HiSeq	Phase_I	126	41	NM_133474	0	0	0	0	0	Q69YG7	Missense_Mutation	SNP	ENST00000338977.5	37		.	.	.	.	.	.	.	.	.	.	A	3.452	-0.111794	0.06881	.	.	ENSG00000182903	ENST00000338977;ENST00000511833	T;T	0.07908	3.15;3.15	0.419	-0.837	0.10766	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13927	0.0337	L	0.55743	1.74	0.09310	N	1	P;P;P	0.45348	0.856;0.669;0.777	P;P;P	0.55112	0.592;0.592;0.769	T	0.16217	-1.0410	9	0.42905	T	0.14	.	4.3636	0.11213	0.3506:0.0:0.6494:0.0	.	501;513;513	Q8TF20;D9N162;Q8TF20-2	ZN721_HUMAN;.;.	P	501;513	ENSP00000340524:S501P;ENSP00000428878:S513P	ENSP00000340524:S501P	S	-	1	0	ZNF721	426719	0.000000	0.05858	0.002000	0.10522	0.089000	0.18198	-1.976000	0.01497	-0.428000	0.07339	0.155000	0.16302	TCC	.		0.398	ZNF721-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000357939.1	NM_133474	
UVSSA	57654	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	1369834	1369834	+	Silent	SNP	G	G	A	rs114098503	byFrequency	TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr4:1369834G>A	ENST00000389851.4	+	10	1893	c.1446G>A	c.(1444-1446)gcG>gcA	p.A482A	UVSSA_ENST00000511563.1_Silent_p.A33A|UVSSA_ENST00000507531.1_Silent_p.A482A|UVSSA_ENST00000512728.1_Silent_p.A33A|UVSSA_ENST00000511216.1_Silent_p.A482A	NM_020894.2	NP_065945.2	Q2YD98	UVSSA_HUMAN	UV-stimulated scaffold protein A	482					protein ubiquitination (GO:0016567)|response to UV (GO:0009411)|transcription-coupled nucleotide-excision repair (GO:0006283)	chromosome (GO:0005694)	RNA polymerase II core binding (GO:0000993)										CCTCCAGAGCGTTGCCAGAGC	0.697													g|||	2	0.000399361	0.0	0.0	5008	,	,		14914	0.0		0.001	False		,,,				2504	0.001				p.A482A		.											.	.	0			c.G1446A						.						14.0	16.0	15.0					4																	1369834		2182	4297	6479	SO:0001819	synonymous_variant	57654	exon10			CAGAGCGTTGCCA	BC021930	CCDS33938.1	4p16.3	2012-04-27	2012-04-27	2012-04-27		ENSG00000163945			29304	protein-coding gene	gene with protein product		614632	"""KIAA1530"""	KIAA1530		10819331, 22466610, 22466611, 22466612	Standard	NM_020894		Approved		uc003gde.4	Q2YD98		ENST00000389851.4:c.1446G>A	4.37:g.1369834G>A		Somatic	44	0		WXS	Illumina HiSeq	Phase_I	84	33	NM_020894	0	0	0	0	0	A8K9E6|B2RU11|Q8WTX4|Q9P1Z8	Silent	SNP	ENST00000389851.4	37	CCDS33938.1																																																																																			G|0.999;A|0.001		0.697	UVSSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359480.1	NM_020894	
TRMT10A	93587	broad.mit.edu	37	4	100478514	100478514	+	Silent	SNP	C	C	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr4:100478514C>T	ENST00000273962.3	-	4	720	c.408G>A	c.(406-408)ctG>ctA	p.L136L	TRMT10A_ENST00000394876.2_Silent_p.L136L|TRMT10A_ENST00000394877.3_Silent_p.L136L	NM_152292.4	NP_689505.1	Q8TBZ6	TM10A_HUMAN	tRNA methyltransferase 10 homolog A (S. cerevisiae)	136	SAM-dependent MTase TRM10-type. {ECO:0000255|PROSITE-ProRule:PRU01012}.				magnesium ion homeostasis (GO:0010960)	extracellular vesicular exosome (GO:0070062)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)										GCACAGGATGCAGTGCCCGTC	0.343																																					p.L136L													.	.	0			c.G408A						.						103.0	97.0	99.0					4																	100478514		2203	4300	6503	SO:0001819	synonymous_variant	93587	exon4			AGGATGCAGTGCC	BC028373	CCDS3650.1	4q23	2012-06-28	2012-06-28	2012-06-28	ENSG00000145331	ENSG00000145331			28403	protein-coding gene	gene with protein product			"""RNA (guanine-9-) methyltransferase domain containing 2"""	RG9MTD2		12477932	Standard	NM_152292		Approved	MGC27034, TRM10	uc003hva.4	Q8TBZ6	OTTHUMG00000131025	ENST00000273962.3:c.408G>A	4.37:g.100478514C>T		Somatic	64	0		WXS	Illumina HiSeq	Phase_I	163	4	NM_001134666	0	0	0	0	0	B2R8X7|Q9Y2T9	Silent	SNP	ENST00000273962.3	37	CCDS3650.1																																																																																			.		0.343	TRMT10A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253668.1	NM_152292	
ALPK1	80216	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	113303701	113303701	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr4:113303701A>T	ENST00000458497.1	+	4	548	c.269A>T	c.(268-270)cAg>cTg	p.Q90L	ALPK1_ENST00000177648.9_Missense_Mutation_p.Q90L|ALPK1_ENST00000504176.2_Intron	NM_001102406.1|NM_025144.3	NP_001095876.1|NP_079420.3	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	90							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(20)|ovary(6)|prostate(2)|urinary_tract(1)	53		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		GGGTTGCAGCAGTTACTGGTA	0.483																																					p.Q90L													.	ALPK1-337	0			c.A269T						.						82.0	68.0	73.0					4																	113303701		2203	4300	6503	SO:0001583	missense	80216	exon4			TGCAGCAGTTACT	AY044164	CCDS3697.1, CCDS58923.1	4q26	2008-02-05			ENSG00000073331	ENSG00000073331			20917	protein-coding gene	gene with protein product	"""lymphocyte alpha-kinase"""	607347				10021370, 10819331	Standard	NM_025144		Approved	Lak, FLJ22670, KIAA1527	uc003ian.4	Q96QP1	OTTHUMG00000132911	ENST00000458497.1:c.269A>T	4.37:g.113303701A>T	ENSP00000398048:p.Gln90Leu	Somatic	101	1		WXS	Illumina HiSeq	Phase_I	209	81	NM_001102406	0	0	0	0	0	B4E3G1|F5H138|Q68CI9|Q6P9F9|Q6ZNK4|Q9P201	Missense_Mutation	SNP	ENST00000458497.1	37	CCDS3697.1	.	.	.	.	.	.	.	.	.	.	A	14.96	2.691426	0.48097	.	.	ENSG00000073331	ENST00000458497;ENST00000177648;ENST00000309610	T;T	0.20200	2.09;2.09	5.63	1.82	0.25136	.	0.575913	0.18643	N	0.135223	T	0.21307	0.0513	L	0.50333	1.59	0.80722	D	1	B;B;B	0.32302	0.302;0.363;0.145	B;B;B	0.32289	0.05;0.143;0.075	T	0.05321	-1.0892	10	0.66056	D	0.02	-4.5503	13.5725	0.61856	0.5727:0.4273:0.0:0.0	.	65;90;90	E7EX13;Q96QP1;B3KUH8	.;ALPK1_HUMAN;.	L	90;90;65	ENSP00000398048:Q90L;ENSP00000177648:Q90L	ENSP00000177648:Q90L	Q	+	2	0	ALPK1	113523150	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	3.632000	0.54287	0.072000	0.16694	0.533000	0.62120	CAG	.		0.483	ALPK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256421.2	NM_025144	
TMEM192	201931	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	166000935	166000935	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr4:166000935G>T	ENST00000306480.6	-	6	836	c.691C>A	c.(691-693)Cta>Ata	p.L231I	TMEM192_ENST00000506087.1_Missense_Mutation_p.L227I	NM_001100389.1	NP_001093859.1	Q8IY95	TM192_HUMAN	transmembrane protein 192	231						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)	protein homodimerization activity (GO:0042803)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	7	all_hematologic(180;0.221)	Prostate(90;0.0959)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.0926)		ATTTCTTCTAGGCTTGAAATA	0.388																																					p.L231I		.											.	TMEM192-69	0			c.C691A						.						94.0	88.0	90.0					4																	166000935		1868	4109	5977	SO:0001583	missense	201931	exon6			CTTCTAGGCTTGA	BC036301	CCDS43279.1	4q32.3	2008-04-22			ENSG00000170088	ENSG00000170088			26775	protein-coding gene	gene with protein product						12477932	Standard	NM_001100389		Approved	FLJ38482	uc003iqz.4	Q8IY95	OTTHUMG00000161254	ENST00000306480.6:c.691C>A	4.37:g.166000935G>T	ENSP00000305069:p.Leu231Ile	Somatic	36	0		WXS	Illumina HiSeq	Phase_I	76	27	NM_001100389	0	0	8	9	1	Q7Z3A1|Q8N928	Missense_Mutation	SNP	ENST00000306480.6	37	CCDS43279.1	.	.	.	.	.	.	.	.	.	.	G	11.62	1.692853	0.30052	.	.	ENSG00000170088	ENST00000306480;ENST00000506087	.	.	.	5.97	3.32	0.38043	.	0.000000	0.85682	D	0.000000	T	0.59487	0.2197	M	0.73962	2.25	0.41322	D	0.987189	B	0.27997	0.197	B	0.30716	0.119	T	0.60627	-0.7226	9	0.66056	D	0.02	-38.5919	6.9529	0.24556	0.3323:0.0:0.6677:0.0	.	231	Q8IY95	TM192_HUMAN	I	231;227	.	ENSP00000305069:L231I	L	-	1	2	TMEM192	166220385	1.000000	0.71417	0.172000	0.22920	0.509000	0.34042	2.379000	0.44318	0.868000	0.35678	0.591000	0.81541	CTA	.		0.388	TMEM192-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364310.3	NM_152681	
PPARGC1B	133522	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	149213062	149213062	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr5:149213062G>A	ENST00000309241.5	+	5	1458	c.1426G>A	c.(1426-1428)Gtg>Atg	p.V476M	PPARGC1B_ENST00000394320.3_Missense_Mutation_p.V476M|PPARGC1B_ENST00000360453.4_Missense_Mutation_p.V437M|PPARGC1B_ENST00000403750.1_Missense_Mutation_p.V412M	NM_133263.3	NP_573570.3	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 beta	476					actin filament organization (GO:0007015)|bone trabecula formation (GO:0060346)|cellular lipid metabolic process (GO:0044255)|cellular response to reactive oxygen species (GO:0034614)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone resorption (GO:0045780)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of phosphorylation (GO:0042327)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|transcription from mitochondrial promoter (GO:0006390)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-2 domain binding (GO:0050682)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|receptor activator activity (GO:0030546)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(2)|lung(15)|ovary(3)|prostate(2)|stomach(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			TGTGTGCCCCGTGCGGCGTTC	0.637																																					p.V476M		.											.	PPARGC1B-186	0			c.G1426A						.						42.0	44.0	43.0					5																	149213062		2182	4277	6459	SO:0001583	missense	133522	exon5			TGCCCCGTGCGGC	AF468496	CCDS4298.1, CCDS54933.1, CCDS54934.1	5q33.1	2013-02-12	2006-10-17		ENSG00000155846	ENSG00000155846		"""RNA binding motif (RRM) containing"""	30022	protein-coding gene	gene with protein product		608886	"""peroxisome proliferative activated receptor, gamma, coactivator 1, beta"""			11793024, 11854298	Standard	NM_133263		Approved	PERC, PGC1B	uc003lrc.3	Q86YN6	OTTHUMG00000130055	ENST00000309241.5:c.1426G>A	5.37:g.149213062G>A	ENSP00000312649:p.Val476Met	Somatic	52	0		WXS	Illumina HiSeq	Phase_I	82	27	NM_133263	0	0	0	0	0	A2RUM8|A2RUN0|B3KVW0|Q86YN3|Q86YN4|Q86YN5|Q8N1N9|Q8TDE4|Q8TDE5	Missense_Mutation	SNP	ENST00000309241.5	37	CCDS4298.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.80|18.80	3.700810|3.700810	0.68501|0.68501	.|.	.|.	ENSG00000155846|ENSG00000155846	ENST00000434684|ENST00000360453;ENST00000394320;ENST00000309241;ENST00000403750	.|T;T;T;T	.|0.14266	.|2.53;2.52;2.54;2.52	5.38|5.38	5.38|5.38	0.77491|0.77491	.|.	.|0.000000	.|0.64402	.|D	.|0.000002	T|T	0.29749|0.29749	0.0743|0.0743	L|L	0.36672|0.36672	1.1|1.1	0.43207|0.43207	D|D	0.995068|0.995068	.|D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D	.|0.91635	.|0.999;0.999;0.999;0.999;0.999	T|T	0.01294|0.01294	-1.1393|-1.1393	5|10	.|0.66056	.|D	.|0.02	-15.2485|-15.2485	17.3201|17.3201	0.87233|0.87233	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|455;455;437;476;476	.|Q86YN6-2;Q86YN6-4;Q86YN6-5;Q86YN6;Q86YN6-3	.|.;.;.;PRGC2_HUMAN;.	H|M	162|437;476;476;412	.|ENSP00000353638:V437M;ENSP00000377855:V476M;ENSP00000312649:V476M;ENSP00000384403:V412M	.|ENSP00000312649:V476M	R|V	+|+	2|1	0|0	PPARGC1B|PPARGC1B	149193255|149193255	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.758000|0.758000	0.43043|0.43043	4.727000|4.727000	0.61993|0.61993	2.521000|2.521000	0.84997|0.84997	0.462000|0.462000	0.41574|0.41574	CGT|GTG	.		0.637	PPARGC1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252334.1	NM_133263	
GALNT10	55568	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	153755929	153755929	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr5:153755929C>T	ENST00000297107.6	+	5	798	c.661C>T	c.(661-663)Cga>Tga	p.R221*	GALNT10_ENST00000425427.2_Nonsense_Mutation_p.R221*|GALNT10_ENST00000519544.1_3'UTR|GALNT10_ENST00000377661.2_Intron|SAP30L-AS1_ENST00000519727.1_RNA	NM_198321.3	NP_938080.1	Q86SR1	GLT10_HUMAN	polypeptide N-acetylgalactosaminyltransferase 10	221	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(12)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	32	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)|all_hematologic(541;0.21)	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)			GATAAGGACCCGAATGCTGGG	0.522																																					p.R221X		.											.	GALNT10-92	0			c.C661T						.						90.0	89.0	90.0					5																	153755929		2203	4300	6503	SO:0001587	stop_gained	55568	exon5			AGGACCCGAATGC	AK023782	CCDS4325.1	5q34	2014-03-13	2014-03-13		ENSG00000164574	ENSG00000164574	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19873	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 10"""	608043	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10)"""			12417297	Standard	NM_198321		Approved	GalNAc-T10	uc003lvh.3	Q86SR1	OTTHUMG00000130145	ENST00000297107.6:c.661C>T	5.37:g.153755929C>T	ENSP00000297107:p.Arg221*	Somatic	88	0		WXS	Illumina HiSeq	Phase_I	159	61	NM_198321	0	0	0	0	0	B3KXC9|Q6IN56|Q86VP8|Q8IXJ2|Q8TEJ2|Q96IV2|Q9H8E1|Q9Y4M4	Nonsense_Mutation	SNP	ENST00000297107.6	37	CCDS4325.1	.	.	.	.	.	.	.	.	.	.	C	38	7.017290	0.98006	.	.	ENSG00000164574	ENST00000425427;ENST00000297107	.	.	.	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.6439	0.99570	0.0:1.0:0.0:0.0	.	.	.	.	X	221	.	ENSP00000297107:R221X	R	+	1	2	GALNT10	153736122	0.997000	0.39634	1.000000	0.80357	0.936000	0.57629	3.644000	0.54381	2.884000	0.98904	0.655000	0.94253	CGA	.		0.522	GALNT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252453.1	NM_198321	
CPEB4	80315	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	173317154	173317154	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr5:173317154T>G	ENST00000265085.5	+	1	1872	c.418T>G	c.(418-420)Ttg>Gtg	p.L140V	CPEB4_ENST00000522336.1_5'Flank|CPEB4_ENST00000334035.5_Missense_Mutation_p.L140V|CPEB4_ENST00000520867.1_Missense_Mutation_p.L140V|CPEB4_ENST00000517880.1_5'Flank|CPEB4_ENST00000519835.1_Missense_Mutation_p.L140V	NM_030627.2	NP_085130.2	Q17RY0	CPEB4_HUMAN	cytoplasmic polyadenylation element binding protein 4	140					cellular response to amino acid stimulus (GO:0071230)|cellular response to decreased oxygen levels (GO:0036294)|cellular response to glucose starvation (GO:0042149)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|response to ischemia (GO:0002931)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	20	Renal(175;0.000159)|Lung NSC(126;0.0128)|all_lung(126;0.0202)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			ATCTCCAGTGTTGACAGGGTT	0.448																																					p.L140V		.											.	CPEB4-90	0			c.T418G						.						103.0	105.0	105.0					5																	173317154		2203	4300	6503	SO:0001583	missense	80315	exon1			CCAGTGTTGACAG	BX538213	CCDS4390.1	5q21	2013-02-12			ENSG00000113742	ENSG00000113742		"""RNA binding motif (RRM) containing"""	21747	protein-coding gene	gene with protein product		610607				11214970, 12672660	Standard	NM_030627		Approved	KIAA1673	uc003mcs.4	Q17RY0	OTTHUMG00000130541	ENST00000265085.5:c.418T>G	5.37:g.173317154T>G	ENSP00000265085:p.Leu140Val	Somatic	51	0		WXS	Illumina HiSeq	Phase_I	111	8	NM_030627	0	0	0	0	0	B7ZLQ7|Q7Z310|Q8N405|Q9C0J0	Missense_Mutation	SNP	ENST00000265085.5	37	CCDS4390.1	.	.	.	.	.	.	.	.	.	.	T	14.40	2.525591	0.44969	.	.	ENSG00000113742	ENST00000265085;ENST00000520867;ENST00000334035;ENST00000519835	T;T;T;T	0.55234	0.53;0.53;0.53;0.53	5.96	4.8	0.61643	.	0.000000	0.85682	D	0.000000	T	0.59838	0.2223	L	0.34521	1.04	0.80722	D	1	D;D;D;D	0.71674	0.997;0.998;0.997;0.997	D;D;D;D	0.87578	0.996;0.998;0.996;0.996	T	0.61686	-0.7012	10	0.72032	D	0.01	-9.5609	9.6678	0.39994	0.0:0.1383:0.0:0.8617	.	140;140;140;140	B7ZLQ8;Q17RY0-2;E5RJM0;Q17RY0	.;.;.;CPEB4_HUMAN	V	140	ENSP00000265085:L140V;ENSP00000429092:L140V;ENSP00000334533:L140V;ENSP00000429048:L140V	ENSP00000265085:L140V	L	+	1	2	CPEB4	173249760	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	1.961000	0.40432	1.089000	0.41292	0.533000	0.62120	TTG	.		0.448	CPEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252964.2	NM_030627	
CDHR2	54825	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	176018324	176018324	+	Splice_Site	SNP	G	G	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr5:176018324G>A	ENST00000510636.1	+	29	3927	c.3653G>A	c.(3652-3654)cGa>cAa	p.R1218Q	CDHR2_ENST00000506348.1_Splice_Site_p.R1218Q|CDHR2_ENST00000261944.5_Splice_Site_p.R1218Q	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	1218					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						AACACTGAGCGGTGAGCAGGG	0.597																																					p.R1218Q		.											.	CDHR2-70	0			c.G3653A						.						66.0	64.0	65.0					5																	176018324		2203	4300	6503	SO:0001630	splice_region_variant	54825	exon29			CTGAGCGGTGAGC	AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		ENST00000510636.1:c.3653+1G>A	5.37:g.176018324G>A		Somatic	52	0		WXS	Illumina HiSeq	Phase_I	122	44	NM_017675	0	0	0	1	1	A1L3U4|A6NC80|Q9NXP8	Missense_Mutation	SNP	ENST00000510636.1	37	CCDS34297.1	.	.	.	.	.	.	.	.	.	.	g	12.10	1.836140	0.32421	.	.	ENSG00000074276	ENST00000510636;ENST00000261944;ENST00000506348	T;T;T	0.56103	0.48;0.48;0.48	4.24	2.24	0.28232	.	.	.	.	.	T	0.45236	0.1332	M	0.70595	2.14	0.32458	N	0.544539	P	0.52061	0.95	B	0.38428	0.273	T	0.56378	-0.7989	9	0.25751	T	0.34	-7.212	9.1617	0.37028	0.203:0.0:0.797:0.0	.	1218	Q9BYE9	CDHR2_HUMAN	Q	1218	ENSP00000424565:R1218Q;ENSP00000261944:R1218Q;ENSP00000421078:R1218Q	ENSP00000261944:R1218Q	R	+	2	0	CDHR2	175950930	1.000000	0.71417	0.933000	0.37362	0.367000	0.29736	3.600000	0.54052	1.036000	0.39998	0.459000	0.35465	CGA	.		0.597	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372201.1	NM_017675	Missense_Mutation
DSP	1832	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	7583589	7583589	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr6:7583589G>A	ENST00000379802.3	+	24	6435	c.6094G>A	c.(6094-6096)Gta>Ata	p.V2032I	DSP_ENST00000418664.2_Missense_Mutation_p.V1433I	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	2032	4.5 X 38 AA tandem repeats (Domain A).|Globular 2.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		ATACTCTTTGGTAGAGGCCAA	0.478																																					p.V2032I		.											.	DSP-518	0			c.G6094A						.						49.0	54.0	52.0					6																	7583589		2203	4300	6503	SO:0001583	missense	1832	exon24			TCTTTGGTAGAGG	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.6094G>A	6.37:g.7583589G>A	ENSP00000369129:p.Val2032Ile	Somatic	49	0		WXS	Illumina HiSeq	Phase_I	114	32	NM_004415	0	0	2	2	0	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Missense_Mutation	SNP	ENST00000379802.3	37	CCDS4501.1	.	.	.	.	.	.	.	.	.	.	G	15.59	2.877522	0.51801	.	.	ENSG00000096696	ENST00000379802;ENST00000418664	T;T	0.67523	-0.27;-0.27	4.98	4.98	0.66077	.	0.000000	0.52532	D	0.000074	T	0.44456	0.1294	L	0.36672	1.1	0.25902	N	0.983344	P;P	0.45078	0.85;0.779	B;B	0.41236	0.278;0.351	T	0.45131	-0.9282	10	0.22109	T	0.4	.	18.6091	0.91277	0.0:0.0:1.0:0.0	.	1480;2032	Q4LE79;P15924	.;DESP_HUMAN	I	2032;1433	ENSP00000369129:V2032I;ENSP00000396591:V1433I	ENSP00000369129:V2032I	V	+	1	0	DSP	7528588	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	4.384000	0.59607	2.459000	0.83118	0.655000	0.94253	GTA	.		0.478	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415	
BMP6	654	broad.mit.edu	37	6	7727541	7727541	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr6:7727541A>T	ENST00000283147.6	+	1	512	c.353A>T	c.(352-354)cAg>cTg	p.Q118L		NM_001718.4	NP_001709.1	P22004	BMP6_HUMAN	bone morphogenetic protein 6	118					BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular response to mechanical stimulus (GO:0071260)|endochondral ossification (GO:0001958)|eye development (GO:0001654)|growth (GO:0040007)|immune response (GO:0006955)|inflammatory response (GO:0006954)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|osteoblast differentiation (GO:0001649)|positive regulation of aldosterone biosynthetic process (GO:0032349)|positive regulation of aldosterone secretion (GO:2000860)|positive regulation of bone mineralization (GO:0030501)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to activity (GO:0014823)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to retinoic acid (GO:0032526)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|type B pancreatic cell development (GO:0003323)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)|protein heterodimerization activity (GO:0046982)	p.Q118L(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(6)|ovary(1)|prostate(1)	23	Ovarian(93;0.0721)					cagcagcagcagcTGCCTCGC	0.731																																					p.Q118L													.	BMP6-578	1	Substitution - Missense(1)	lung(1)	c.A353T						.																																			SO:0001583	missense	654	exon1			AGCAGCAGCTGCC	AF083030	CCDS4503.1	6p24-p23	2014-01-30	2003-10-06		ENSG00000153162	ENSG00000153162		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1073	protein-coding gene	gene with protein product		112266	"""vegetal related growth factor (TGFB-related)"""	VGR		1427904, 1453478	Standard	NM_001718		Approved	VGR1	uc003mxu.4	P22004	OTTHUMG00000014217	ENST00000283147.6:c.353A>T	6.37:g.7727541A>T	ENSP00000283147:p.Gln118Leu	Somatic	53	1		WXS	Illumina HiSeq	Phase_I	95	5	NM_001718	0	0	0	0	0	Q5TCP3	Missense_Mutation	SNP	ENST00000283147.6	37	CCDS4503.1	.	.	.	.	.	.	.	.	.	.	A	5.648	0.304211	0.10678	.	.	ENSG00000153162	ENST00000537240;ENST00000283147;ENST00000540959	T	0.72725	-0.68	3.64	-7.28	0.01456	Transforming growth factor-beta, N-terminal (1);	0.609742	0.13235	N	0.403351	T	0.27134	0.0665	L	0.36672	1.1	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.10382	-1.0632	10	0.41790	T	0.15	.	2.9855	0.05966	0.1788:0.4954:0.0931:0.2327	.	118	P22004	BMP6_HUMAN	L	40;118;81	ENSP00000283147:Q118L	ENSP00000283147:Q118L	Q	+	2	0	BMP6	7672540	0.177000	0.23109	0.002000	0.10522	0.071000	0.16799	-0.158000	0.10070	-1.400000	0.02061	-1.802000	0.00618	CAG	.		0.731	BMP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039794.1	NM_001718	
TMEM170B	100113407	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	11575733	11575733	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr6:11575733G>T	ENST00000379426.1	+	3	338	c.338G>T	c.(337-339)gGc>gTc	p.G113V	TMEM170B_ENST00000543875.1_Missense_Mutation_p.G113V	NM_001100829.1	NP_001094299.1	Q5T4T1	T170B_HUMAN	transmembrane protein 170B	113						integral component of membrane (GO:0016021)				large_intestine(3)|lung(5)	8						CTGGTATGGGGCGTTGGACAG	0.473																																					p.G113V		.											.	TMEM170B-22	0			c.G338T						.						203.0	196.0	198.0					6																	11575733		1966	4141	6107	SO:0001583	missense	100113407	exon3			TATGGGGCGTTGG		CCDS43425.1	6p24.1	2008-08-08			ENSG00000205269	ENSG00000205269			34244	protein-coding gene	gene with protein product							Standard	NM_001100829		Approved		uc010jpa.4	Q5T4T1	OTTHUMG00000014259	ENST00000379426.1:c.338G>T	6.37:g.11575733G>T	ENSP00000368737:p.Gly113Val	Somatic	75	0		WXS	Illumina HiSeq	Phase_I	134	36	NM_001100829	0	0	0	0	0		Missense_Mutation	SNP	ENST00000379426.1	37	CCDS43425.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.373246	0.82573	.	.	ENSG00000205269	ENST00000543875;ENST00000379426	.	.	.	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.72859	0.3513	L	0.59436	1.845	0.80722	D	1	D	0.76494	0.999	D	0.75020	0.985	T	0.75645	-0.3246	9	0.87932	D	0	-20.3795	19.0673	0.93116	0.0:0.0:1.0:0.0	.	113	Q5T4T1	T170B_HUMAN	V	113	.	ENSP00000368737:G113V	G	+	2	0	TMEM170B	11683719	1.000000	0.71417	0.996000	0.52242	0.991000	0.79684	9.466000	0.97665	2.502000	0.84385	0.579000	0.79373	GGC	.		0.473	TMEM170B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000039862.1	NM_001100829	
ECT2L	345930	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	139135653	139135653	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr6:139135653T>C	ENST00000423192.1	+	3	253	c.92T>C	c.(91-93)aTa>aCa	p.I31T	ECT2L_ENST00000367682.2_Missense_Mutation_p.I31T|ECT2L_ENST00000541398.1_5'Flank			Q008S8	ECT2L_HUMAN	epithelial cell transforming 2 like	31							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(7)|lung(12)|skin(1)|upper_aerodigestive_tract(1)	30						GTGGCTCTTATAAGTCATTGG	0.368			"""N, Splice, Mis"""		ETP ALL																																p.I31T		.		Rec	yes		6	6q24.1	345930	epithelial cell transforming sequence 2 oncogene-like		L	.	ECT2L-22	0			c.T92C						.						77.0	75.0	76.0					6																	139135653		1836	4092	5928	SO:0001583	missense	345930	exon3			CTCTTATAAGTCA		CCDS43508.1	6q24.1	2014-03-11	2014-03-11		ENSG00000203734	ENSG00000203734		"""Rho guanine nucleotide exchange factors"", ""F-boxes /  ""other"""""	21118	protein-coding gene	gene with protein product	"""lung specific F-box and DH domain containing protein"", ""F-box protein 49"""		"""chromosome 6 open reading frame 91"", ""epithelial cell transforming sequence 2 oncogene-like"""	C6orf91			Standard	NM_001077706		Approved	ARHGEF32, FBXO49, LFDH	uc021zfx.1	Q008S8	OTTHUMG00000015679	ENST00000423192.1:c.92T>C	6.37:g.139135653T>C	ENSP00000387388:p.Ile31Thr	Somatic	48	0		WXS	Illumina HiSeq	Phase_I	112	45	NM_001195037	0	0	0	0	0	B2RUV6|Q5JWK2|Q5JWK3|Q5JWK4	Missense_Mutation	SNP	ENST00000423192.1	37	CCDS43508.1	.	.	.	.	.	.	.	.	.	.	T	15.36	2.809410	0.50421	.	.	ENSG00000203734	ENST00000423192;ENST00000401414;ENST00000367682	T;T;T	0.62498	0.02;0.65;0.02	5.43	5.43	0.79202	.	.	.	.	.	T	0.44477	0.1295	L	0.33485	1.01	0.80722	D	1	D	0.54047	0.964	P	0.45310	0.476	T	0.55347	-0.8155	9	0.87932	D	0	.	13.0191	0.58775	0.0:0.0:0.0:1.0	.	31	Q008S8	ECT2L_HUMAN	T	31	ENSP00000387388:I31T;ENSP00000385187:I31T;ENSP00000356655:I31T	ENSP00000356655:I31T	I	+	2	0	ECT2L	139177346	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.876000	0.63079	2.066000	0.61787	0.533000	0.62120	ATA	.		0.368	ECT2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042441.3	NM_001077706	
CITED2	10370	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	139694869	139694869	+	Silent	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr6:139694869A>G	ENST00000367651.2	-	2	428	c.213T>C	c.(211-213)caT>caC	p.H71H	CITED2_ENST00000536159.1_Silent_p.H71H|CITED2_ENST00000537332.1_Silent_p.H71H	NM_006079.4	NP_006070.2	Q99967	CITE2_HUMAN	Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2	71					adrenal cortex formation (GO:0035802)|bone morphogenesis (GO:0060349)|cardiac neural crest cell development involved in heart development (GO:0061308)|cell aging (GO:0007569)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|cranial nerve morphogenesis (GO:0021602)|decidualization (GO:0046697)|determination of left/right symmetry (GO:0007368)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|endocardial cushion development (GO:0003197)|erythrocyte development (GO:0048821)|granulocyte differentiation (GO:0030851)|heart development (GO:0007507)|heart looping (GO:0001947)|hematopoietic progenitor cell differentiation (GO:0002244)|left/right axis specification (GO:0070986)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell migration (GO:0030336)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900164)|outflow tract morphogenesis (GO:0003151)|peripheral nervous system development (GO:0007422)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of gene expression (GO:0010628)|positive regulation of male gonad development (GO:2000020)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|pulmonary artery morphogenesis (GO:0061156)|regulation of organ formation (GO:0003156)|regulation of RNA biosynthetic process (GO:2001141)|response to estrogen (GO:0043627)|response to fluid shear stress (GO:0034405)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|sex determination (GO:0007530)|skeletal muscle cell differentiation (GO:0035914)|spleen development (GO:0048536)|thymus development (GO:0048538)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|LBD domain binding (GO:0050693)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			large_intestine(1)|lung(4)	5	Breast(32;0.226)			GBM - Glioblastoma multiforme(68;0.000171)|OV - Ovarian serous cystadenocarcinoma(155;0.00134)		GCCCCATCGCATGCCTGATGC	0.672																																					p.H76H	NSCLC(98;1219 1550 33720 43229 49330)	.											.	CITED2-90	0			c.T228C						.						34.0	34.0	34.0					6																	139694869		2203	4299	6502	SO:0001819	synonymous_variant	10370	exon2			CATCGCATGCCTG	U65093	CCDS5195.1, CCDS75530.1	6q23.3	2008-08-29			ENSG00000164442	ENSG00000164442			1987	protein-coding gene	gene with protein product		602937				8901575, 10552932	Standard	NM_006079		Approved	MRG1	uc021zfz.2	Q99967	OTTHUMG00000015691	ENST00000367651.2:c.213T>C	6.37:g.139694869A>G		Somatic	20	0		WXS	Illumina HiSeq	Phase_I	33	11	NM_001168389	0	0	30	64	34	O95426|Q5VTF4	Silent	SNP	ENST00000367651.2	37	CCDS5195.1																																																																																			.		0.672	CITED2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042463.1		
RADIL	55698	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	4841357	4841357	+	Silent	SNP	G	G	A	rs369296363	byFrequency	TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr7:4841357G>A	ENST00000399583.3	-	12	2956	c.2769C>T	c.(2767-2769)ggC>ggT	p.G923G	RADIL_ENST00000538469.1_Silent_p.G683G|RADIL_ENST00000536091.1_3'UTR	NM_018059.4	NP_060529.4	Q96JH8	RADIL_HUMAN	Ras association and DIL domains	923	Pro-rich.				multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	microtubule (GO:0005874)				NS(1)|biliary_tract(2)|breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(22)|pancreas(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		CACAGGGGCCGCCGGACTCTG	0.711													G|||	2	0.000399361	0.0015	0.0	5008	,	,		14081	0.0		0.0	False		,,,				2504	0.0				p.G923G		.											.	RADIL-994	0			c.C2769T						.	G		2,3724		0,2,1861	8.0	10.0	10.0		2769	-3.9	0.0	7		10	0,8120		0,0,4060	no	coding-synonymous	RADIL	NM_018059.4		0,2,5921	AA,AG,GG		0.0,0.0537,0.0169		923/1076	4841357	2,11844	1863	4060	5923	SO:0001819	synonymous_variant	55698	exon12			GGGGCCGCCGGAC	AB058752	CCDS43544.1	7p22.1	2010-08-27			ENSG00000157927	ENSG00000157927			22226	protein-coding gene	gene with protein product		611491				16051602, 17704304	Standard	NM_018059		Approved	FLJ10324, KIAA1849, RASIP2	uc003snj.1	Q96JH8	OTTHUMG00000151753	ENST00000399583.3:c.2769C>T	7.37:g.4841357G>A		Somatic	111	0		WXS	Illumina HiSeq	Phase_I	300	118	NM_018059	0	0	4	5	1	A4D1Z5|A5YM49|B7ZL20|Q0VFZ9|Q75LH3|Q9BSP5|Q9H0M6|Q9NW43|Q9NWC4	Silent	SNP	ENST00000399583.3	37	CCDS43544.1																																																																																			.		0.711	RADIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323769.2	NM_018059	
VWDE	221806	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	12375822	12375822	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr7:12375822A>C	ENST00000275358.3	-	27	4787	c.4599T>G	c.(4597-4599)atT>atG	p.I1533M		NM_001135924.1	NP_001129396.1	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	1533	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)				breast(4)|endometrium(2)|kidney(1)|skin(1)	8						TGCTGGGCGCAATGCATTCAC	0.393																																					p.I1533M		.											.	VWDE-68	0			c.T4599G						.						129.0	120.0	123.0					7																	12375822		692	1591	2283	SO:0001583	missense	221806	exon27			GGGCGCAATGCAT		CCDS47544.1	7p21.3	2008-09-23			ENSG00000146530	ENSG00000146530			21897	protein-coding gene	gene with protein product						14702039, 16303743	Standard	NM_001135924		Approved	FLJ14712	uc003ssj.2	Q8N2E2	OTTHUMG00000152315	ENST00000275358.3:c.4599T>G	7.37:g.12375822A>C	ENSP00000275358:p.Ile1533Met	Somatic	86	0		WXS	Illumina HiSeq	Phase_I	292	128	NM_001135924	0	0	3	8	5	B7ZM77|Q96SQ3	Missense_Mutation	SNP	ENST00000275358.3	37	CCDS47544.1	.	.	.	.	.	.	.	.	.	.	A	13.50	2.255267	0.39896	.	.	ENSG00000146530	ENST00000275358	T	0.47528	0.84	4.93	-4.32	0.03688	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.522168	0.20233	N	0.096444	T	0.41789	0.1174	M	0.69358	2.11	0.22710	N	0.99882	D	0.54397	0.966	P	0.50440	0.641	T	0.33163	-0.9879	10	0.46703	T	0.11	.	1.1097	0.01701	0.3368:0.3121:0.1346:0.2165	.	1533	Q8N2E2	VWDE_HUMAN	M	1533	ENSP00000275358:I1533M	ENSP00000275358:I1533M	I	-	3	3	VWDE	12342347	0.148000	0.22702	0.759000	0.31340	0.104000	0.19210	-0.598000	0.05706	-0.445000	0.07159	0.533000	0.62120	ATT	.		0.393	VWDE-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325870.3	XM_371878	
ZAN	7455	broad.mit.edu	37	7	100349675	100349675	+	RNA	SNP	T	T	C			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr7:100349675T>C	ENST00000348028.3	+	0	2112				ZAN_ENST00000349350.6_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000427578.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			AACCCACCATTTCCACAGAAA	0.517																																					.													.	ZAN-142	0			.						.						223.0	248.0	240.0					7																	100349675		1875	4109	5984			7455	.			CACCATTTCCACA	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100349675T>C		Somatic	103	1		WXS	Illumina HiSeq	Phase_I	525	11	.	0	0	0	0	0	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Silent	SNP	ENST00000348028.3	37																																																																																				.		0.517	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386	
ZAN	7455	broad.mit.edu	37	7	100350033	100350033	+	RNA	SNP	T	T	C			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr7:100350033T>C	ENST00000348028.3	+	0	2470				ZAN_ENST00000349350.6_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000427578.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			ACCCACCATCTCCCCAGAAAA	0.522																																					.													.	ZAN-142	0			.						.						143.0	160.0	154.0					7																	100350033		1832	4071	5903			7455	.			ACCATCTCCCCAG	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100350033T>C		Somatic	176	9		WXS	Illumina HiSeq	Phase_I	659	35	.	0	0	0	0	0	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	ENST00000348028.3	37		.	.	.	.	.	.	.	.	.	.	t	4.272	0.049510	0.08243	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	T;T;T	0.62639	0.07;0.01;0.07	3.65	-0.219	0.13135	.	.	.	.	.	T	0.32376	0.0827	N	0.02315	-0.6	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.19224	-1.0312	9	0.33141	T	0.24	.	8.1166	0.30946	0.0:0.5985:0.0:0.4015	.	769;769	F5H0T8;Q9Y493	.;ZAN_HUMAN	P	769	ENSP00000445943:S769P;ENSP00000445091:S769P;ENSP00000444427:S769P	ENSP00000423579:S769P	S	+	1	0	ZAN	100187969	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.302000	0.19192	-0.057000	0.13199	-0.859000	0.03014	TCC	.		0.522	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386	
PRRT4	401399	hgsc.bcm.edu;broad.mit.edu	37	7	127991277	127991277	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr7:127991277C>G	ENST00000446477.2	-	6	2646	c.2333G>C	c.(2332-2334)gGg>gCg	p.G778A	PRRT4_ENST00000435512.1_Missense_Mutation_p.G572A|PRRT4_ENST00000535159.1_Missense_Mutation_p.G778A|PRRT4_ENST00000489835.2_3'UTR	NM_001174164.1	NP_001167635.1	C9JH25	PRRT4_HUMAN	proline-rich transmembrane protein 4	778						integral component of membrane (GO:0016021)				endometrium(4)|prostate(1)	5						AGAGGCCTCCCCTGATCTCTC	0.731																																					p.G778A		.											.	.	0			c.G2333C						.						2.0	4.0	4.0					7																	127991277		565	1396	1961	SO:0001583	missense	401399	exon6			GCCTCCCCTGATC	BC063892	CCDS47698.1, CCDS47698.2, CCDS55160.1	7q32.1	2011-10-10			ENSG00000224940	ENSG00000224940		"""Proline-rich transmembrane proteins"""	37280	protein-coding gene	gene with protein product							Standard	NM_001114726		Approved		uc022aky.1	C9JH25	OTTHUMG00000157714	ENST00000446477.2:c.2333G>C	7.37:g.127991277C>G	ENSP00000415026:p.Gly778Ala	Somatic	14	0		WXS	Illumina HiSeq	Phase_I	56	21	NM_001174164	0	0	0	0	0	A4D0Z9|C9JVW7	Missense_Mutation	SNP	ENST00000446477.2	37	CCDS55160.1	.	.	.	.	.	.	.	.	.	.	C	4.131	0.022554	0.08006	.	.	ENSG00000224940	ENST00000446477;ENST00000480290;ENST00000535159;ENST00000435512	.	.	.	4.1	-0.845	0.10737	.	.	.	.	.	T	0.16428	0.0395	N	0.08118	0	0.20703	N	0.999864	B	0.19200	0.034	B	0.25291	0.059	T	0.36553	-0.9743	8	0.12103	T	0.63	-13.93	8.1967	0.31400	0.0:0.4475:0.0:0.5525	.	778	C9JH25	PRRT4_HUMAN	A	778;307;778;572	.	ENSP00000410779:G572A	G	-	2	0	PRRT4	127778513	0.000000	0.05858	0.628000	0.29241	0.166000	0.22503	0.116000	0.15561	-0.025000	0.13918	-0.379000	0.06801	GGG	.		0.731	PRRT4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001114726	
KEL	3792	broad.mit.edu	37	7	142640923	142640923	+	Silent	SNP	C	C	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr7:142640923C>T	ENST00000355265.2	-	14	2013	c.1539G>A	c.(1537-1539)cgG>cgA	p.R513R	KEL_ENST00000479768.2_5'Flank	NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	513					vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					CTCGGAGGGACCGGACACAGC	0.562																																					p.R513R													.	KEL-93	0			c.G1539A						.						104.0	85.0	92.0					7																	142640923		2203	4300	6503	SO:0001819	synonymous_variant	3792	exon14			GAGGGACCGGACA	BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159	ENST00000355265.2:c.1539G>A	7.37:g.142640923C>T		Somatic	63	0		WXS	Illumina HiSeq	Phase_I	198	4	NM_000420	0	0	0	0	0	B2RBV4|Q96RS8|Q99885	Silent	SNP	ENST00000355265.2	37	CCDS34766.1																																																																																			.		0.562	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347671.2	NM_000420	
SPAG11B	10407	bcgsc.ca	37	8	7308688	7308688	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr8:7308688G>T	ENST00000297498.2	-	3	414	c.248C>A	c.(247-249)tCa>tAa	p.S83*	SPAG11B_ENST00000528168.1_Nonsense_Mutation_p.S30*|SPAG11B_ENST00000361111.2_Intron|SPAG11B_ENST00000359758.5_Intron|SPAG11B_ENST00000398462.2_Intron|SPAG11B_ENST00000458665.1_Intron	NM_016512.3	NP_057596.1	Q08648	SG11B_HUMAN	sperm associated antigen 11B	83					spermatogenesis (GO:0007283)	extracellular region (GO:0005576)				large_intestine(2)|lung(3)|urinary_tract(1)	6				COAD - Colon adenocarcinoma(149;0.0162)|READ - Rectum adenocarcinoma(644;0.236)		GATCCTAAATGAGGGTCCTCG	0.458																																					p.S83X													.	SPAG11B-22	0			c.C248A						.						81.0	96.0	91.0					8																	7308688		2080	4190	6270	SO:0001587	stop_gained	10407	exon3			CTAAATGAGGGTC	AF168616	CCDS5964.1, CCDS5965.1, CCDS5966.1, CCDS5967.1, CCDS47774.1	8p23.1	2014-02-21	2007-03-15	2007-03-15	ENSG00000164871	ENSG00000164871			14534	protein-coding gene	gene with protein product	"""epididymal protein 2B"""	606560				8167223, 1693137	Standard	NM_058200		Approved	HE2, EP2, EP2C, EP2D, EDDM2B	uc003wrl.3	Q08648	OTTHUMG00000129219	ENST00000297498.2:c.248C>A	8.37:g.7308688G>T	ENSP00000297498:p.Ser83*	Somatic	317	2		WXS	Illumina HiSeq	Phase_1	623	19	NM_016512	0	0	0	0	0	E9PFH0|Q546A0|Q6ZYB2|Q9H4P8|Q9H4P9|Q9H4Q0|Q9H4Q1|Q9H4Q2|Q9NRT3|Q9NRV4|Q9NRV5|Q9NRV6|Q9NRV7|Q9NRV8	Nonsense_Mutation	SNP	ENST00000297498.2	37	CCDS5966.1	.	.	.	.	.	.	.	.	.	.	G	13.30	2.195214	0.38806	.	.	ENSG00000164871	ENST00000297498;ENST00000528168	.	.	.	2.69	-0.306	0.12780	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	.	1.4268	0.02324	0.2199:0.4299:0.2162:0.134	.	.	.	.	X	83;30	.	ENSP00000297498:S83X	S	-	2	0	SPAG11B	7296098	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.109000	0.03309	-0.074000	0.12820	-1.314000	0.01303	TCA	.		0.458	SPAG11B-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251390.2	NM_058202, NM_058200, NM_058201, NM_016512, NM_058203, NM_058206, NM_058207	
TNKS	8658	broad.mit.edu	37	8	9605598	9605598	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr8:9605598C>T	ENST00000310430.6	+	18	2734	c.2708C>T	c.(2707-2709)gCg>gTg	p.A903V	TNKS_ENST00000518281.1_Missense_Mutation_p.A666V	NM_003747.2	NP_003738.2	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase	903					mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|mRNA transport (GO:0051028)|negative regulation of DNA binding (GO:0043392)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein poly-ADP-ribosylation (GO:0070212)|protein polyubiquitination (GO:0000209)|protein transport (GO:0015031)|regulation of telomere maintenance via telomerase (GO:0032210)|spindle assembly (GO:0051225)|Wnt signaling pathway (GO:0016055)	chromosome, centromeric region (GO:0000775)|chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nuclear chromosome, telomeric region (GO:0000784)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	NAD+ ADP-ribosyltransferase activity (GO:0003950)|zinc ion binding (GO:0008270)			NS(1)|endometrium(10)|kidney(6)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	49				COAD - Colon adenocarcinoma(149;0.0467)		GATAAGTGGGCGTTTACTCCC	0.468																																					p.A903V													.	TNKS-660	0			c.C2708T						.						91.0	91.0	91.0					8																	9605598		2203	4300	6503	SO:0001583	missense	8658	exon18			AGTGGGCGTTTAC	AF082556	CCDS5974.1	8p23.1	2013-01-10			ENSG00000173273	ENSG00000173273		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	11941	protein-coding gene	gene with protein product		603303				9822378, 10198177	Standard	XM_006716263		Approved	TIN1, TINF1, TNKS1, PARP-5a, PARP5A, pART5	uc003wss.3	O95271	OTTHUMG00000090481	ENST00000310430.6:c.2708C>T	8.37:g.9605598C>T	ENSP00000311579:p.Ala903Val	Somatic	137	0		WXS	Illumina HiSeq	Phase_I	263	7	NM_003747	0	0	0	0	0	O95272|Q4G0F2	Missense_Mutation	SNP	ENST00000310430.6	37	CCDS5974.1	.	.	.	.	.	.	.	.	.	.	C	36	5.863179	0.97043	.	.	ENSG00000173273	ENST00000310430;ENST00000518281	T;T	0.70749	-0.51;2.38	5.88	5.88	0.94601	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.70701	0.3254	N	0.14661	0.345	0.80722	D	1	D	0.56968	0.978	P	0.55965	0.788	T	0.74968	-0.3483	10	0.66056	D	0.02	.	20.2381	0.98363	0.0:1.0:0.0:0.0	.	903	O95271	TNKS1_HUMAN	V	903;666	ENSP00000311579:A903V;ENSP00000429890:A666V	ENSP00000311579:A903V	A	+	2	0	TNKS	9643008	1.000000	0.71417	0.982000	0.44146	0.940000	0.58332	7.629000	0.83207	2.779000	0.95612	0.650000	0.86243	GCG	.		0.468	TNKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206935.1	NM_003747	
POMK	84197	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	42977953	42977953	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr8:42977953A>G	ENST00000331373.5	+	5	1241	c.986A>G	c.(985-987)gAg>gGg	p.E329G		NM_001277971.1|NM_032237.3	NP_001264900.1|NP_115613.1	Q9H5K3	SG196_HUMAN	protein-O-mannose kinase	329	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				brain development (GO:0007420)|carbohydrate phosphorylation (GO:0046835)|learning or memory (GO:0007611)|neuromuscular process (GO:0050905)|neuron migration (GO:0001764)|protein O-linked glycosylation (GO:0006493)|sensory perception of pain (GO:0019233)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|carbohydrate kinase activity (GO:0019200)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)|protein kinase activity (GO:0004672)										GACGTTCTGGAGACCTACCAG	0.478																																					p.E329G		.											.	.	0			c.A986G						.						87.0	94.0	91.0					8																	42977953		2203	4300	6503	SO:0001583	missense	0	exon5			TTCTGGAGACCTA		CCDS6141.1	8p11.21	2013-08-22			ENSG00000185900	ENSG00000185900			26267	protein-coding gene	gene with protein product		615247				16879967, 23519211	Standard	NM_001277971		Approved	FLJ23356, SgK196		Q9H5K3	OTTHUMG00000164100	ENST00000331373.5:c.986A>G	8.37:g.42977953A>G	ENSP00000331258:p.Glu329Gly	Somatic	33	0		WXS	Illumina HiSeq	Phase_I	64	23	NM_032237	0	0	0	0	0		Missense_Mutation	SNP	ENST00000331373.5	37	CCDS6141.1	.	.	.	.	.	.	.	.	.	.	A	10.75	1.439110	0.25900	.	.	ENSG00000185900	ENST00000331373	T	0.23348	1.91	5.45	5.45	0.79879	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.258956	0.44483	D	0.000449	T	0.19446	0.0467	L	0.29908	0.895	0.26493	N	0.974911	B	0.22604	0.072	B	0.19391	0.025	T	0.12293	-1.0553	9	.	.	.	-20.8671	13.4611	0.61227	1.0:0.0:0.0:0.0	.	329	Q9H5K3	SG196_HUMAN	G	329	ENSP00000331258:E329G	.	E	+	2	0	AC113191.1	43097110	1.000000	0.71417	0.760000	0.31359	0.425000	0.31504	3.808000	0.55598	2.065000	0.61736	0.482000	0.46254	GAG	.		0.478	POMK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377291.2	NM_032237	
LRRC69	100130742	broad.mit.edu	37	8	92145338	92145338	+	Splice_Site	SNP	A	A	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr8:92145338A>T	ENST00000448384.2	+	4	384	c.384A>T	c.(382-384)agA>agT	p.R128S	LRRC69_ENST00000343709.3_Intron	NM_001129890.1	NP_001123362.1	Q6ZNQ3	LRC69_HUMAN	leucine rich repeat containing 69	128										endometrium(1)	1						TTTTTTTTAGATTAAAAAGTC	0.299																																					p.R128S													.	.	0			c.A384T						.						14.0	13.0	13.0					8																	92145338		692	1576	2268	SO:0001630	splice_region_variant	100130742	exon4			TTTTAGATTAAAA	AK130865		8q21.3	2010-07-14			ENSG00000214954	ENSG00000214954			34303	protein-coding gene	gene with protein product							Standard	NM_001129890		Approved		uc010mal.1	Q6ZNQ3	OTTHUMG00000164023	ENST00000448384.2:c.384-1A>T	8.37:g.92145338A>T		Somatic	18	1		WXS	Illumina HiSeq	Phase_I	44	8	NM_001129890	0	0	0	0	0		Missense_Mutation	SNP	ENST00000448384.2	37		.	.	.	.	.	.	.	.	.	.	A	17.78	3.474173	0.63737	.	.	ENSG00000214954	ENST00000448384	T	0.22945	1.93	5.58	0.5	0.16919	.	.	.	.	.	T	0.30070	0.0753	N	0.25380	0.74	0.26469	N	0.975319	D	0.64830	0.994	P	0.61328	0.887	T	0.22836	-1.0205	8	.	.	.	.	9.8826	0.41242	0.6915:0.0:0.3085:0.0	.	128	Q6ZNQ3	LRC69_HUMAN	S	128	ENSP00000400803:R128S	.	R	+	3	2	LRRC69	92214514	1.000000	0.71417	0.910000	0.35882	0.878000	0.50629	0.521000	0.22893	-0.127000	0.11661	0.477000	0.44152	AGA	.		0.299	LRRC69-007	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000415207.1	NM_001129890	Missense_Mutation
FER1L6	654463	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	124992806	124992806	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr8:124992806G>A	ENST00000522917.1	+	11	1371	c.1165G>A	c.(1165-1167)Gaa>Aaa	p.E389K	FER1L6_ENST00000399018.1_Missense_Mutation_p.E389K	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	389						integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			AGGCTTTGGGGAAGGTGTGTC	0.512											OREG0018964	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E389K		.											.	FER1L6-100	0			c.G1165A						.						161.0	159.0	160.0					8																	124992806		1882	4115	5997	SO:0001583	missense	654463	exon11			TTTGGGGAAGGTG	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.1165G>A	8.37:g.124992806G>A	ENSP00000428280:p.Glu389Lys	Somatic	115	0	1538	WXS	Illumina HiSeq	Phase_I	278	93	NM_001039112	0	0	0	0	0		Missense_Mutation	SNP	ENST00000522917.1	37	CCDS43767.1	.	.	.	.	.	.	.	.	.	.	G	35	5.527427	0.96431	.	.	ENSG00000214814	ENST00000522917;ENST00000399018	D;D	0.83673	-1.75;-1.75	5.53	5.53	0.82687	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.64402	U	0.000003	D	0.91882	0.7430	M	0.82323	2.585	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.90993	0.4836	10	0.40728	T	0.16	.	19.466	0.94939	0.0:0.0:1.0:0.0	.	389	Q2WGJ9	FR1L6_HUMAN	K	389	ENSP00000428280:E389K;ENSP00000381982:E389K	ENSP00000381982:E389K	E	+	1	0	FER1L6	125061987	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	9.813000	0.99286	2.607000	0.88179	0.655000	0.94253	GAA	.		0.512	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112	
ZBTB5	9925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	37441549	37441549	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr9:37441549G>T	ENST00000307750.4	-	2	1188	c.1000C>A	c.(1000-1002)Ctg>Atg	p.L334M		NM_014872.2	NP_055687.1	O15062	ZBTB5_HUMAN	zinc finger and BTB domain containing 5	334					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	8				GBM - Glioblastoma multiforme(29;0.00733)|Lung(182;0.226)		GGTGAGCTCAGGGGCTCAGAT	0.522																																					p.L334M		.											.	ZBTB5-92	0			c.C1000A						.						103.0	94.0	97.0					9																	37441549		2203	4300	6503	SO:0001583	missense	9925	exon2			AGCTCAGGGGCTC	AB002352	CCDS6610.1	9p13.1	2013-01-09			ENSG00000168795	ENSG00000168795		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	23836	protein-coding gene	gene with protein product						9205841	Standard	NM_014872		Approved	KIAA0354	uc003zzx.3	O15062	OTTHUMG00000019918	ENST00000307750.4:c.1000C>A	9.37:g.37441549G>T	ENSP00000307604:p.Leu334Met	Somatic	20	0		WXS	Illumina HiSeq	Phase_I	45	12	NM_014872	0	0	0	1	1		Missense_Mutation	SNP	ENST00000307750.4	37	CCDS6610.1	.	.	.	.	.	.	.	.	.	.	G	13.16	2.155723	0.38021	.	.	ENSG00000168795	ENST00000307750	T	0.16196	2.36	5.49	1.43	0.22495	.	0.167314	0.39985	N	0.001220	T	0.22360	0.0539	N	0.24115	0.695	0.48395	D	0.999648	D	0.71674	0.998	D	0.80764	0.994	T	0.01225	-1.1413	10	0.29301	T	0.29	.	10.2477	0.43352	0.3912:0.0:0.6088:0.0	.	334	O15062	ZBTB5_HUMAN	M	334	ENSP00000307604:L334M	ENSP00000307604:L334M	L	-	1	2	ZBTB5	37431549	0.995000	0.38212	0.998000	0.56505	0.932000	0.56968	1.979000	0.40608	0.457000	0.26962	-0.136000	0.14681	CTG	.		0.522	ZBTB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052462.1	NM_014872	
ABCA1	19	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	107578436	107578436	+	Silent	SNP	C	C	T	rs548468204	byFrequency	TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr9:107578436C>T	ENST00000374736.3	-	25	4120	c.3726G>A	c.(3724-3726)acG>acA	p.T1242T		NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	1242					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	CTTCCAGGGTCGTCTCTGAGA	0.483													C|||	4	0.000798722	0.0	0.0	5008	,	,		19115	0.0		0.0	False		,,,				2504	0.0041				p.T1242T		.											.	ABCA1-1016	0			c.G3726A						.						166.0	178.0	174.0					9																	107578436		2203	4300	6503	SO:0001819	synonymous_variant	19	exon25			CAGGGTCGTCTCT	AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.3726G>A	9.37:g.107578436C>T		Somatic	44	0		WXS	Illumina HiSeq	Phase_I	120	51	NM_005502	0	0	0	0	0	Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Silent	SNP	ENST00000374736.3	37	CCDS6762.1																																																																																			.		0.483	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	NM_005502	
PTPN3	5774	broad.mit.edu	37	9	112185015	112185015	+	Silent	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr9:112185015A>G	ENST00000374541.2	-	13	1223	c.1119T>C	c.(1117-1119)ccT>ccC	p.P373P	PTPN3_ENST00000262539.3_Intron|PTPN3_ENST00000446349.1_Intron|PTPN3_ENST00000412145.1_Silent_p.P242P	NM_001145368.1|NM_002829.3	NP_001138840.1|NP_002820.3	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type 3	373					negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of mitotic cell cycle (GO:0045930)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of membrane depolarization during action potential (GO:0098902)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	ATPase binding (GO:0051117)|phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						GAGTAATGGGAGGGGAACGAG	0.413																																					p.P373P													.	PTPN3-229	0			c.T1119C						.						160.0	146.0	151.0					9																	112185015		2203	4300	6503	SO:0001819	synonymous_variant	5774	exon13			AATGGGAGGGGAA		CCDS6776.1, CCDS48000.1, CCDS48001.1	9q31	2011-06-09			ENSG00000070159	ENSG00000070159		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9655	protein-coding gene	gene with protein product		176877				1648725	Standard	NM_002829		Approved	PTPH1	uc004bed.2	P26045	OTTHUMG00000020475	ENST00000374541.2:c.1119T>C	9.37:g.112185015A>G		Somatic	46	10		WXS	Illumina HiSeq	Phase_I	109	28	NM_002829	0	0	0	0	0	A0AUW9|E7EN99|E9PGU7	Silent	SNP	ENST00000374541.2	37	CCDS6776.1																																																																																			.		0.413	PTPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053598.4		
COQ4	51117	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	131095205	131095205	+	Silent	SNP	G	G	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr9:131095205G>A	ENST00000300452.3	+	6	932	c.609G>A	c.(607-609)ccG>ccA	p.P203P	COQ4_ENST00000461102.1_3'UTR	NM_016035.3	NP_057119			coenzyme Q4											endometrium(4)|large_intestine(1)|lung(4)	9						TCTTTGGACCGATCCGACTTG	0.557																																					p.P203P		.											.	COQ4-90	0			c.G609A						.						194.0	158.0	171.0					9																	131095205		2203	4300	6503	SO:0001819	synonymous_variant	51117	exon6			TGGACCGATCCGA	AF151850	CCDS6898.1	9q34.2	2013-10-18	2013-10-18		ENSG00000167113	ENSG00000167113			19693	protein-coding gene	gene with protein product		612898	"""coenzyme Q4 homolog (yeast)"", ""coenzyme Q4 homolog (S. cerevisiae)"""			11469793, 18474229	Standard	NM_016035		Approved	CGI-92	uc004bur.4	Q9Y3A0	OTTHUMG00000020743	ENST00000300452.3:c.609G>A	9.37:g.131095205G>A		Somatic	86	0		WXS	Illumina HiSeq	Phase_I	184	68	NM_016035	0	0	95	169	74		Silent	SNP	ENST00000300452.3	37	CCDS6898.1																																																																																			.		0.557	COQ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054427.1	NM_016035	
SURF2	6835	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	136227264	136227264	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr9:136227264G>T	ENST00000371964.4	+	5	682	c.641G>T	c.(640-642)aGg>aTg	p.R214M		NM_017503.3	NP_059973.4	Q15527	SURF2_HUMAN	surfeit 2	214						nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|large_intestine(1)|lung(4)	6				OV - Ovarian serous cystadenocarcinoma(145;4.87e-07)|Epithelial(140;4.02e-06)|all cancers(34;3.71e-05)		GATGAGAGCAGGAGAGAGACG	0.557																																					p.R214M		.											.	SURF2-226	0			c.G641T						.						131.0	111.0	118.0					9																	136227264		2203	4300	6503	SO:0001583	missense	6835	exon5			AGAGCAGGAGAGA		CCDS6967.1	9q33-q34	2008-07-21			ENSG00000148291	ENSG00000148291			11475	protein-coding gene	gene with protein product	"""surfeit locus protein 2"""	185630					Standard	NM_017503		Approved		uc004cdi.2	Q15527	OTTHUMG00000020867	ENST00000371964.4:c.641G>T	9.37:g.136227264G>T	ENSP00000361032:p.Arg214Met	Somatic	30	0		WXS	Illumina HiSeq	Phase_I	52	19	NM_017503	0	0	8	72	64	Q6IBP9|Q96CD1	Missense_Mutation	SNP	ENST00000371964.4	37	CCDS6967.1	.	.	.	.	.	.	.	.	.	.	G	13.28	2.190148	0.38707	.	.	ENSG00000148291	ENST00000371964	T	0.33216	1.42	2.84	0.71	0.18157	.	0.792035	0.11077	N	0.602308	T	0.28566	0.0707	L	0.51422	1.61	0.09310	N	1	P	0.50710	0.938	P	0.45343	0.477	T	0.14227	-1.0480	10	0.54805	T	0.06	-4.7868	5.4059	0.16320	0.1238:0.2056:0.6706:0.0	.	214	Q15527	SURF2_HUMAN	M	214	ENSP00000361032:R214M	ENSP00000361032:R214M	R	+	2	0	SURF2	135217085	0.005000	0.15991	0.000000	0.03702	0.030000	0.12068	1.572000	0.36461	0.015000	0.14971	0.462000	0.41574	AGG	.		0.557	SURF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054883.1	NM_017503	
NOTCH1	4851	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	139407915	139407915	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr9:139407915G>T	ENST00000277541.6	-	14	2357	c.2282C>A	c.(2281-2283)cCt>cAt	p.P761H		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	761	EGF-like 20. {ECO:0000255|PROSITE- ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		GTTGACACAAGGGTTGGATTC	0.587			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																											p.P761H		.		Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	.	NOTCH1-5459	0			c.C2282A						.						104.0	118.0	113.0					9																	139407915		2187	4274	6461	SO:0001583	missense	4851	exon14			ACACAAGGGTTGG	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.2282C>A	9.37:g.139407915G>T	ENSP00000277541:p.Pro761His	Somatic	30	0		WXS	Illumina HiSeq	Phase_I	68	20	NM_017617	0	0	0	0	0	Q59ED8|Q5SXM3	Missense_Mutation	SNP	ENST00000277541.6	37	CCDS43905.1	.	.	.	.	.	.	.	.	.	.	G	17.88	3.497270	0.64186	.	.	ENSG00000148400	ENST00000277541	D	0.93189	-3.18	4.76	4.76	0.60689	EGF-like calcium-binding, conserved site (1);EGF (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.97539	0.9194	M	0.93638	3.44	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98725	1.0710	10	0.72032	D	0.01	.	16.7491	0.85480	0.0:0.0:1.0:0.0	.	761	P46531	NOTC1_HUMAN	H	761	ENSP00000277541:P761H	ENSP00000277541:P761H	P	-	2	0	NOTCH1	138527736	1.000000	0.71417	1.000000	0.80357	0.223000	0.24884	9.349000	0.97066	2.199000	0.70637	0.455000	0.32223	CCT	.		0.587	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617	
PNPLA4	8228	broad.mit.edu	37	X	7868821	7868821	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chrX:7868821A>G	ENST00000381042.4	-	7	838	c.668T>C	c.(667-669)cTt>cCt	p.L223P	PNPLA4_ENST00000444736.1_Missense_Mutation_p.L223P|PNPLA4_ENST00000537427.1_Missense_Mutation_p.L136P	NM_004650.2	NP_004641.1	P41247	PLPL4_HUMAN	patatin-like phospholipase domain containing 4	223					lipid catabolic process (GO:0016042)		triglyceride lipase activity (GO:0004806)			kidney(1)|large_intestine(3)|lung(2)|prostate(1)	7		Colorectal(8;0.0329)|Medulloblastoma(8;0.232)				TGGGGGAAAAAGGGCTTGGTT	0.353																																					p.L223P													.	PNPLA4-130	0			c.T668C						.						57.0	52.0	54.0					X																	7868821		2203	4299	6502	SO:0001583	missense	8228	exon7			GGAAAAAGGGCTT	U03886	CCDS14129.1, CCDS55368.1	Xp22.3	2014-03-14			ENSG00000006757	ENSG00000006757	3.1.1.3	"""Patatin-like phospholipase domain containing"""	24887	protein-coding gene	gene with protein product		300102				7806223, 16799181, 19029121	Standard	NM_004650		Approved	DXS1283E, GS2, iPLA2eta	uc011mhr.1	P41247	OTTHUMG00000021103	ENST00000381042.4:c.668T>C	X.37:g.7868821A>G	ENSP00000370430:p.Leu223Pro	Somatic	179	0		WXS	Illumina HiSeq	Phase_I	379	5	NM_004650	0	0	46	46	0	A8K1H3|B4E362|Q8WW83	Missense_Mutation	SNP	ENST00000381042.4	37	CCDS14129.1	.	.	.	.	.	.	.	.	.	.	A	13.79	2.341460	0.41498	.	.	ENSG00000006757	ENST00000381042;ENST00000444736;ENST00000537427	T;T;T	0.81078	-1.45;-1.45;-1.45	4.38	4.38	0.52667	Acyl transferase/acyl hydrolase/lysophospholipase (1);	0.193685	0.33127	N	0.005243	D	0.89866	0.6839	M	0.89715	3.055	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	D	0.90635	0.4570	10	0.87932	D	0	-22.634	9.3053	0.37872	1.0:0.0:0.0:0.0	.	223	P41247	PLPL4_HUMAN	P	223;223;136	ENSP00000370430:L223P;ENSP00000415245:L223P;ENSP00000443157:L136P	ENSP00000370430:L223P	L	-	2	0	PNPLA4	7828821	1.000000	0.71417	0.139000	0.22197	0.388000	0.30384	5.486000	0.66856	1.452000	0.47756	0.481000	0.45027	CTT	.		0.353	PNPLA4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055687.1	NM_004650	
FAM122C	159091	broad.mit.edu	37	X	133941690	133941690	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chrX:133941690G>A	ENST00000370784.4	+	1	468	c.62G>A	c.(61-63)gGc>gAc	p.G21D	FAM122C_ENST00000475361.1_3'UTR|FAM122C_ENST00000370785.3_Missense_Mutation_p.G21D|FAM122C_ENST00000445123.1_5'UTR|FAM122C_ENST00000414371.2_Missense_Mutation_p.G57D	NM_001170779.1	NP_001164250.1	Q6P4D5	F222C_HUMAN	family with sequence similarity 122C	21										endometrium(2)|kidney(1)|lung(2)	5	Acute lymphoblastic leukemia(192;0.000127)					ACCGCAGACGGCAACATTCTG	0.542																																					p.G57D													.	FAM122C-130	0			c.G170A						.						104.0	89.0	94.0					X																	133941690		2203	4300	6503	SO:0001583	missense	159091	exon4			CAGACGGCAACAT	BC017868	CCDS14644.1, CCDS55500.1, CCDS55501.1, CCDS76028.1	Xq26.3	2008-02-05	2006-07-11		ENSG00000156500	ENSG00000156500			25202	protein-coding gene	gene with protein product						12477932	Standard	NM_138819		Approved	RP3-473B4.1	uc004exz.2	Q6P4D5	OTTHUMG00000022716	ENST00000370784.4:c.62G>A	X.37:g.133941690G>A	ENSP00000359820:p.Gly21Asp	Somatic	51	0		WXS	Illumina HiSeq	Phase_I	131	7	NM_001170780	0	0	0	0	0	F5H036|Q8WVK9	Missense_Mutation	SNP	ENST00000370784.4	37	CCDS55501.1	.	.	.	.	.	.	.	.	.	.	G	10.89	1.478893	0.26511	.	.	ENSG00000156500	ENST00000414371;ENST00000370784;ENST00000370785	T;T;T	0.56275	0.47;0.47;0.47	4.1	-0.0526	0.13821	.	0.656135	0.15470	N	0.260647	T	0.27349	0.0671	N	0.16266	0.395	0.19575	N	0.999963	B;B;B;B	0.06786	0.0;0.001;0.001;0.001	B;B;B;B	0.09377	0.004;0.002;0.004;0.003	T	0.11131	-1.0600	10	0.39692	T	0.17	.	0.6124	0.00763	0.2476:0.1865:0.3719:0.194	.	57;21;21;21	F5H036;Q6P4D5;Q6P4D5-2;Q6P187	.;F222C_HUMAN;.;.	D	57;21;21	ENSP00000402477:G57D;ENSP00000359820:G21D;ENSP00000359821:G21D	ENSP00000359820:G21D	G	+	2	0	FAM122C	133769356	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-0.005000	0.12855	-0.275000	0.09219	0.594000	0.82650	GGC	.		0.542	FAM122C-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_138819	
SLC6A8	6535	broad.mit.edu	37	X	152958793	152958793	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chrX:152958793T>C	ENST00000253122.5	+	6	1464	c.988T>C	c.(988-990)Tac>Cac	p.Y330H	SLC6A8_ENST00000430077.2_Missense_Mutation_p.Y215H|SLC6A8_ENST00000485324.1_3'UTR	NM_001142805.1|NM_005629.3	NP_001136277.1|NP_005620.1	P48029	SC6A8_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 8	330					cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|creatine transmembrane transport (GO:1902598)|creatine transport (GO:0015881)|muscle contraction (GO:0006936)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	creatine transmembrane transporter activity (GO:0005308)|creatine:sodium symporter activity (GO:0005309)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	13	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				Creatine(DB00148)	CCTGGGCAGCTACAACCGCTT	0.632																																					p.Y330H													.	SLC6A8-131	0			c.T988C						.						45.0	49.0	48.0					X																	152958793		2203	4300	6503	SO:0001583	missense	6535	exon6			GGCAGCTACAACC		CCDS14726.1, CCDS48190.1	Xq28	2013-07-19	2013-07-19		ENSG00000130821	ENSG00000130821		"""Solute carriers"""	11055	protein-coding gene	gene with protein product	"""creatine transporter"""	300036	"""solute carrier family 6 (neurotransmitter transporter, creatine), member 8"""			7774949	Standard	NM_001142805		Approved	CRTR, CT1	uc004fib.3	P48029	OTTHUMG00000024208	ENST00000253122.5:c.988T>C	X.37:g.152958793T>C	ENSP00000253122:p.Tyr330His	Somatic	79	0		WXS	Illumina HiSeq	Phase_I	114	5	NM_005629	0	0	43	43	0	B2KY47|B4DIA3|E9PFC0|Q13032|Q66I36	Missense_Mutation	SNP	ENST00000253122.5	37	CCDS14726.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	26.1|26.1	4.700265|4.700265	0.88924|0.88924	.|.	.|.	ENSG00000130821|ENSG00000130821	ENST00000413787|ENST00000253122;ENST00000430077;ENST00000328897	T|D;D	0.79653|0.84516	-1.29|-1.86;-1.86	5.16|5.16	5.16|5.16	0.70880|0.70880	.|.	.|0.000000	.|0.64402	.|U	.|0.000003	D|D	0.92980|0.92980	0.7766|0.7766	M|M	0.89214|0.89214	3.015|3.015	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.87578	.|0.998;0.993	D|D	0.94080|0.94080	0.7343|0.7343	7|10	0.87932|0.87932	D|D	0|0	.|.	12.9947|12.9947	0.58640|0.58640	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|349;330	.|Q59EV7;P48029	.|.;SC6A8_HUMAN	P|H	45|330;215;336	ENSP00000400463:L45P|ENSP00000253122:Y330H;ENSP00000403041:Y215H	ENSP00000400463:L45P|ENSP00000253122:Y330H	L|Y	+|+	2|1	0|0	SLC6A8|SLC6A8	152611987|152611987	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	7.753000|7.753000	0.85153|0.85153	1.914000|1.914000	0.55421|0.55421	0.430000|0.430000	0.28490|0.28490	CTA|TAC	.		0.632	SLC6A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061003.1		
ACOT11	26027	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	55059680	55059687	+	Frame_Shift_Del	DEL	GCCACCTT	GCCACCTT	-	rs35306628|rs370568235		TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	GCCACCTT	GCCACCTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr1:55059680_55059687delGCCACCTT	ENST00000371316.3	+	5	521_528	c.439_446delGCCACCTT	c.(439-447)gccaccttcfs	p.ATF147fs	ACOT11_ENST00000481208.1_3'UTR|ACOT11_ENST00000343744.2_Frame_Shift_Del_p.ATF147fs	NM_015547.3	NP_056362.1	Q8WXI4	ACO11_HUMAN	acyl-CoA thioesterase 11	147	Acyl coenzyme A hydrolase 1.				fatty acid metabolic process (GO:0006631)|intracellular signal transduction (GO:0035556)|response to cold (GO:0009409)|response to temperature stimulus (GO:0009266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|lipid binding (GO:0008289)			NS(1)|central_nervous_system(1)|endometrium(6)|large_intestine(3)|lung(5)|ovary(1)	17						CAAGGCCTTGGCCACCTTCGTGGCCCGC	0.625																																					p.147_149del	Ovarian(148;1440 1861 22015 32453 51933)	.											.	ACOT11-90	0			c.439_446del						.																																			SO:0001589	frameshift_variant	26027	exon5			.	AB014607	CCDS592.1, CCDS593.1	1p32.3	2011-09-13	2005-09-08	2005-09-08	ENSG00000162390	ENSG00000162390	3.1.2.-	"""Acyl CoA thioesterases"", ""StAR-related lipid transfer (START) domain containing"""	18156	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 14"""	606803	"""thioesterase, adipose associated"""	THEA		11696000, 16103133, 16940157	Standard	NM_015547		Approved	STARD14, BFIT, KIAA0707, BFIT1, THEM1	uc001cxl.2	Q8WXI4	OTTHUMG00000009891	ENST00000371316.3:c.439_446delGCCACCTT	1.37:g.55059680_55059687delGCCACCTT	ENSP00000360366:p.Ala147fs	Somatic	43	0		WXS	Illumina HiSeq	Phase_I	49	13	NM_147161	0	0	0	0	0	B1AQ22|D3DQ50|O75187|Q52LP1|Q53ER9|Q96DI1|Q9H883	Frame_Shift_Del	DEL	ENST00000371316.3	37	CCDS592.1																																																																																			.		0.625	ACOT11-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027356.1	NM_015547	
RNPEP	6051	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	201958580	201958590	+	Frame_Shift_Del	DEL	TTCCAGATGTG	TTCCAGATGTG	-			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	TTCCAGATGTG	TTCCAGATGTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr1:201958580_201958590delTTCCAGATGTG	ENST00000295640.4	+	3	701_711	c.658_668delTTCCAGATGTG	c.(658-669)ttccagatgtgtfs	p.FQMC220fs	RNPEP_ENST00000367286.3_Frame_Shift_Del_p.FQMC220fs|RNPEP_ENST00000471105.1_Intron	NM_020216.3	NP_064601.3	Q9H4A4	AMPB_HUMAN	arginyl aminopeptidase (aminopeptidase B)	220					leukotriene biosynthetic process (GO:0019370)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|epoxide hydrolase activity (GO:0004301)|metalloexopeptidase activity (GO:0008235)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|large_intestine(4)|lung(6)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21				KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|Colorectal(1306;0.005)		TAAGTTCTTCTTCCAGATGTGTCAGCCCATC	0.507																																					p.220_223del	GBM(19;39 479 7473 13131 19462)	.											.	RNPEP-91	0			c.658_668del						.																																			SO:0001589	frameshift_variant	6051	exon3			.	BC001064	CCDS1418.1	1q32	2008-02-05			ENSG00000176393	ENSG00000176393	3.4.11.6		10078	protein-coding gene	gene with protein product		602675				9533033, 10467730	Standard	NM_020216		Approved		uc001gxd.3	Q9H4A4	OTTHUMG00000035866	ENST00000295640.4:c.658_668delTTCCAGATGTG	1.37:g.201958580_201958590delTTCCAGATGTG	ENSP00000295640:p.Phe220fs	Somatic	70	0		WXS	Illumina HiSeq	Phase_I	161	36	NM_020216	0	0	0	0	0	Q9BVM9|Q9H1D4|Q9NPT7	Frame_Shift_Del	DEL	ENST00000295640.4	37	CCDS1418.1																																																																																			.		0.507	RNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087345.1	NM_020216	
ZMYM2	7750	broad.mit.edu	37	13	20638677	20638677	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr13:20638677delA	ENST00000382874.2	+	20	3314	c.3124delA	c.(3124-3126)aaafs	p.K1044fs	ZMYM2_ENST00000382869.3_Frame_Shift_Del_p.K1044fs|ZMYM2_ENST00000382871.2_Frame_Shift_Del_p.K1044fs	NM_001190964.1	NP_001177893.1	Q9UBW7	ZMYM2_HUMAN	zinc finger, MYM-type 2	1044					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|PML body (GO:0016605)	ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)	p.K1044fs*33(1)		large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		ACCTCGATCTAAAAAAAAGGT	0.368																																					p.K1042fs													.	ZMYM2-685	1	Deletion - Frameshift(1)	large_intestine(1)	c.3124delA						.						92.0	82.0	85.0					13																	20638677		1806	4073	5879	SO:0001589	frameshift_variant	7750	exon20			CGATCTAAAAAAA	AF012126	CCDS45016.1	13q11-q12	2013-01-08	2006-07-13	2006-07-13	ENSG00000121741	ENSG00000121741		"""Zinc fingers, MYM type"""	12989	protein-coding gene	gene with protein product		602221	"""zinc finger protein 198"""	ZNF198		9499416, 9425908	Standard	XM_005266517		Approved	RAMP, FIM, MYM	uc001ums.3	Q9UBW7	OTTHUMG00000016507	ENST00000382874.2:c.3124delA	13.37:g.20638677delA	ENSP00000372327:p.Lys1044fs	Somatic	32	0		WXS	Illumina HiSeq	Phase_I	92	7	NM_001190964	0	0	0	0	0	A6NDG0|A6NI02|O43212|O43434|O60898|Q5W0Q4|Q5W0T3|Q63HP0|Q8NE39|Q9H0V5|Q9H538|Q9UEU2	Frame_Shift_Del	DEL	ENST00000382874.2	37	CCDS45016.1																																																																																			.		0.368	ZMYM2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044051.2	NM_003453	
CHD3	1107	broad.mit.edu	37	17	7788146	7788148	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	GAG	GAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr17:7788146_7788148delGAG	ENST00000380358.4	+	1	23_25	c.22_24delGAG	c.(22-24)gagdel	p.E14del	LSMD1_ENST00000576861.1_Intron|LSMD1_ENST00000570555.1_Intron	NM_001005271.2	NP_001005271.2	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	0					centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				TCTGAGggacgaggaggaggagg	0.7																																					p.8_8del													.	CHD3-228	0			c.22_24del						.			165,3171		21,123,1524						0.8	1.0			6	282,6252		34,214,3019	no	coding	CHD3	NM_001005271.2		55,337,4543	A1A1,A1R,RR		4.3159,4.946,4.5289				447,9423				SO:0001651	inframe_deletion	1107	exon1			AGGGACGAGGAGG	U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000380358.4:c.22_24delGAG	17.37:g.7788155_7788157delGAG	ENSP00000369716:p.Glu14del	Somatic	9	0		WXS	Illumina HiSeq	Phase_I	6	2	NM_001005271	0	0	0	0	0	D3DTQ9|E9PG89|Q9Y4I0	In_Frame_Del	DEL	ENST00000380358.4	37	CCDS32553.2																																																																																			.		0.700	CHD3-003	NOVEL	not_organism_supported|basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000318052.1	NM_001005273	
ZC3H4	23211	hgsc.bcm.edu;broad.mit.edu	37	19	47569625	47569625	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr19:47569625delG	ENST00000253048.5	-	15	3937	c.3900delC	c.(3898-3900)cccfs	p.P1300fs	ZC3H4_ENST00000594019.1_5'UTR	NM_015168.1	NP_055983.1	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4	1300							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	41		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)		ACTGGCAAAAGGGGGAGGCCG	0.627																																					p.P1300fs		.											.	ZC3H4-74	0			c.3900delC						.						8.0	10.0	9.0					19																	47569625		1878	4043	5921	SO:0001589	frameshift_variant	23211	exon15			.	AB028987	CCDS42582.1	19q13.33	2012-07-05	2007-10-18	2007-10-18		ENSG00000130749		"""Zinc fingers, CCCH-type domain containing"""	17808	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 7"""	C19orf7			Standard	NM_015168		Approved	KIAA1064	uc002pga.4	Q9UPT8		ENST00000253048.5:c.3900delC	19.37:g.47569625delG	ENSP00000253048:p.Pro1300fs	Somatic	33	0		WXS	Illumina HiSeq	Phase_I	63	15	NM_015168	0	0	0	0	0	Q9Y420	Frame_Shift_Del	DEL	ENST00000253048.5	37	CCDS42582.1																																																																																			.		0.627	ZC3H4-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466667.1		
RTN4	57142	broad.mit.edu	37	2	55277140	55277140	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr2:55277140delG	ENST00000337526.6	-	1	540	c.297delC	c.(295-297)cccfs	p.P99fs	RTN4_ENST00000357376.3_5'Flank|RTN4_ENST00000357732.4_Frame_Shift_Del_p.P99fs|RTN4_ENST00000404909.1_Intron|RTN4_ENST00000354474.6_Intron|RTN4_ENST00000394611.2_Intron|RTN4_ENST00000317610.7_Frame_Shift_Del_p.P99fs|RTN4_ENST00000402434.2_Frame_Shift_Del_p.P71fs	NM_020532.4	NP_065393.1	Q9NQC3	RTN4_HUMAN	reticulon 4	99					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonal fasciculation (GO:0007413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cerebral cortex radial glia guided migration (GO:0021801)|endoplasmic reticulum tubular network organization (GO:0071786)|negative regulation of axon extension (GO:0030517)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell growth (GO:0030308)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of apoptotic process (GO:0042981)|regulation of axonogenesis (GO:0050770)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of cell migration (GO:0030334)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(1)|skin(1)|stomach(1)	36						ccggggcgacggggggagcgg	0.771																																					p.P99fs													.	RTN4-155	0			c.297delC						.						2.0	3.0	3.0					2																	55277140		1205	2849	4054	SO:0001589	frameshift_variant	57142	exon1			GGCGACGGGGGGA	AF087901	CCDS1851.1, CCDS1852.1, CCDS42683.1, CCDS42684.1, CCDS42685.1	2p14-p13	2008-05-23			ENSG00000115310	ENSG00000115310			14085	protein-coding gene	gene with protein product		604475				10667797, 10773680	Standard	NM_020532		Approved	NSP-CL, KIAA0886, NOGO, ASY	uc002rye.3	Q9NQC3	OTTHUMG00000129337	ENST00000337526.6:c.297delC	2.37:g.55277140delG	ENSP00000337838:p.Pro99fs	Somatic	7	0		WXS	Illumina HiSeq	Phase_I	6	2	NM_020532	0	0	0	0	0	O94962|Q7L7Q5|Q7L7Q6|Q7L7Q8|Q8IUA4|Q96B16|Q9BXG5|Q9H212|Q9H3I3|Q9UQ42|Q9Y293|Q9Y2Y7|Q9Y5U6	Frame_Shift_Del	DEL	ENST00000337526.6	37	CCDS42684.1																																																																																			.		0.771	RTN4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251484.1		
COL18A1	80781	broad.mit.edu	37	21	46911183	46911183	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr21:46911183delC	ENST00000359759.4	+	21	3378	c.3357delC	c.(3355-3357)ggcfs	p.G1119fs	COL18A1_ENST00000355480.5_Frame_Shift_Del_p.G884fs|COL18A1_ENST00000400337.2_Frame_Shift_Del_p.G704fs			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	1119	Triple-helical region 4 (COL4).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		GCCTCCCTGGCCCCCCCGGAC	0.692																																					p.G884fs													.	COL18A1-90	0			c.2652delC						.						19.0	26.0	24.0					21																	46911183		1917	4091	6008	SO:0001589	frameshift_variant	80781	exon21			CCCTGGCCCCCCC		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.3357delC	21.37:g.46911183delC	ENSP00000352798:p.Gly1119fs	Somatic	176	0		WXS	Illumina HiSeq	Phase_I	315	8	NM_030582	0	0	0	0	0	A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Frame_Shift_Del	DEL	ENST00000359759.4	37																																																																																				.		0.692	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206827.1		
FRYL	285527	broad.mit.edu	37	4	48604083	48604083	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr4:48604083delA	ENST00000503238.1	-	10	988	c.989delT	c.(988-990)ttafs	p.L330fs	FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000506685.1_Frame_Shift_Del_p.L36fs|FRYL_ENST00000507711.1_Frame_Shift_Del_p.L330fs|FRYL_ENST00000537810.1_Frame_Shift_Del_p.L330fs|FRYL_ENST00000358350.4_Frame_Shift_Del_p.L330fs			O94915	FRYL_HUMAN	FRY-like	330					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)			p.L330fs*3(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						CCAGTTATTTAAAAAAAATTG	0.308																																					p.L330X													.	FRYL-69	1	Insertion - Frameshift(1)	large_intestine(1)	c.989delT						.						55.0	55.0	55.0					4																	48604083		1793	4051	5844	SO:0001589	frameshift_variant	285527	exon13			TTATTTAAAAAAA	AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.989delT	4.37:g.48604083delA	ENSP00000426064:p.Leu330fs	Somatic	506	0		WXS	Illumina HiSeq	Phase_I	1122	8	NM_015030	0	0	0	0	0	O95640|Q8WTZ5|Q9NT40	Nonsense_Mutation	DEL	ENST00000503238.1	37	CCDS43227.1																																																																																			.		0.308	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2		
RIMS1	22999	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	73017054	73017055	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	AT	AT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr6:73017054_73017055delAT	ENST00000521978.1	+	27	3944_3945	c.3944_3945delAT	c.(3943-3945)gatfs	p.D1315fs	RIMS1_ENST00000491071.2_Frame_Shift_Del_p.D1138fs|RIMS1_ENST00000522291.1_Intron|RIMS1_ENST00000518273.1_Intron|RIMS1_ENST00000517827.1_Intron|RIMS1_ENST00000520567.1_Intron|RIMS1_ENST00000425662.2_Intron|RIMS1_ENST00000401910.3_Frame_Shift_Del_p.D635fs|RIMS1_ENST00000264839.7_Frame_Shift_Del_p.D1164fs|RIMS1_ENST00000523963.1_Intron|RIMS1_ENST00000348717.5_Frame_Shift_Del_p.D1107fs|RIMS1_ENST00000538414.1_Frame_Shift_Del_p.D121fs|RIMS1_ENST00000517960.1_Frame_Shift_Del_p.D1107fs	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1315					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				CAAGAACTTGATCGCGAGCAAT	0.401																																					p.1315_1315del		.											.	RIMS1-144	0			c.3944_3945del						.																																			SO:0001589	frameshift_variant	22999	exon27			.	AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.3944_3945delAT	6.37:g.73017054_73017055delAT	ENSP00000428417:p.Asp1315fs	Somatic	64	0		WXS	Illumina HiSeq	Phase_I	118	34	NM_014989	0	0	0	0	0	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Frame_Shift_Del	DEL	ENST00000521978.1	37	CCDS47449.1																																																																																			.		0.401	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1		
RINT1	60561	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	105189036	105189036	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr7:105189036delA	ENST00000257700.2	+	7	1106	c.875delA	c.(874-876)gaafs	p.E292fs		NM_021930.4	NP_068749.3	Q6NUQ1	RINT1_HUMAN	RAD50 interactor 1	292	RINT1/TIP20. {ECO:0000255|PROSITE- ProRule:PRU00717}.				G2 DNA damage checkpoint (GO:0031572)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						CAACTCCCAGAAAAATACTCT	0.428																																					p.E292fs		.											.	RINT1-517	0			c.875delA						.						190.0	164.0	173.0					7																	105189036		2203	4300	6503	SO:0001589	frameshift_variant	60561	exon7			.	AF317622	CCDS34726.1	7q22.2	2007-05-03			ENSG00000135249	ENSG00000135249			21876	protein-coding gene	gene with protein product		610089				11096100, 15029241	Standard	NM_021930		Approved	FLJ11785, RINT-1	uc003vda.1	Q6NUQ1	OTTHUMG00000157400	ENST00000257700.2:c.875delA	7.37:g.105189036delA	ENSP00000257700:p.Glu292fs	Somatic	53	0		WXS	Illumina HiSeq	Phase_I	197	62	NM_021930	0	0	0	0	0	Q75MG9|Q75MH0|Q96IW8|Q9H229|Q9HAD9	Frame_Shift_Del	DEL	ENST00000257700.2	37	CCDS34726.1																																																																																			.		0.428	RINT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348686.1	NM_021930	
OR2T29	343563	broad.mit.edu	37	1	248722428	248722429	+	Frame_Shift_Ins	INS	-	-	CG	rs368626489|rs546109722		TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr1:248722428_248722429insCG	ENST00000328570.3	-	1	368_369	c.364_365insCG	c.(364-366)atgfs	p.M122fs	RP11-438F14.3_ENST00000438623.1_RNA	NM_001004694.2	NP_001004694.2	Q8NH02	O2T29_HUMAN	olfactory receptor, family 2, subfamily T, member 29	122						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|lung(4)	5	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GTCATAGGCCATGGTGGCTAGA	0.54																																					p.M122fs													.	.	0			c.365_366insCG						.			12,348		6,0,174						3.0	1.0			1	52,386		25,2,192	no	frameshift	OR2T29	NM_001004694.2		31,2,366	A1A1,A1R,RR		11.8721,3.3333,8.0201				64,734				SO:0001589	frameshift_variant	343563	exon1			TAGGCCATGGTGG		CCDS55695.1	1q44	2012-08-09			ENSG00000182783	ENSG00000182783		"""GPCR / Class A : Olfactory receptors"""	31253	protein-coding gene	gene with protein product							Standard	NM_001004694		Approved		uc001ieo.2	Q8NH02	OTTHUMG00000040382	ENST00000328570.3:c.364_365insCG	1.37:g.248722428_248722429insCG	ENSP00000331774:p.Met122fs	Somatic	454	25		WXS	Illumina HiSeq	Phase_I	889	44	NM_001004694	0	0	0	0	0		Frame_Shift_Ins	INS	ENST00000328570.3	37	CCDS55695.1																																																																																			.		0.540	OR2T29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097132.1	NM_001004694	
ZZEF1	23140	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	3980188	3980189	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr17:3980188_3980189insT	ENST00000381638.2	-	20	3208_3209	c.3084_3085insA	c.(3082-3087)tcagtgfs	p.V1029fs	ZZEF1_ENST00000574474.1_5'UTR	NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	1029							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						ATTGAAAACACTGAGTTACATA	0.47																																					p.V1029fs		.											.	ZZEF1-93	0			c.3085_3086insA						.																																			SO:0001589	frameshift_variant	23140	exon20			.	BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.3085dupA	17.37:g.3980189_3980189dupT	ENSP00000371051:p.Val1029fs	Somatic	71	0		WXS	Illumina HiSeq	Phase_I	222	121	NM_015113	0	0	0	0	0	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Frame_Shift_Ins	INS	ENST00000381638.2	37	CCDS11043.1																																																																																			.		0.470	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207480.1	NM_015113	
UGT1A9	54600	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	234580827	234580828	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr2:234580827_234580828insT	ENST00000354728.4	+	1	329_330	c.247_248insT	c.(247-249)ctgfs	p.L83fs	UGT1A10_ENST00000373445.1_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A1_ENST00000609637.1_Frame_Shift_Ins_p.L83fs			O60656	UD19_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A9	83					cellular glucuronidation (GO:0052695)|cellular lipid metabolic process (GO:0044255)|drug metabolic process (GO:0017144)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|metabolic process (GO:0008152)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of fatty acid metabolic process (GO:0045922)|retinoic acid metabolic process (GO:0042573)|small molecule metabolic process (GO:0044281)|xenobiotic glucuronidation (GO:0052697)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)			breast(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	37		Breast(86;0.000766)|all_lung(227;0.00269)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0331)|Lung NSC(271;0.0459)|Lung SC(224;0.128)		Epithelial(121;1.26e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000436)|Lung(119;0.00347)|LUSC - Lung squamous cell carcinoma(224;0.00757)	Acetaminophen(DB00316)|Buprenorphine(DB00921)|Canagliflozin(DB08907)|Dabigatran etexilate(DB06695)|Dapagliflozin(DB06292)|Entacapone(DB00494)|Etodolac(DB00749)|Ezogabine(DB04953)|Flurbiprofen(DB00712)|Haloperidol(DB00502)|Human Serum Albumin(DB00062)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ketobemidone(DB06738)|Lumiracoxib(DB01283)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Nateglinide(DB00731)|Niflumic Acid(DB04552)|Oxazepam(DB00842)|Propofol(DB00818)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sulfamethoxazole(DB01015)|Tapentadol(DB06204)|Valproic Acid(DB00313)|Zileuton(DB00744)	TTCATATACCCTGGAGGATCTG	0.446																																					p.L83fs		.											.	UGT1A9-91	0			c.247_248insT						.																																			SO:0001589	frameshift_variant	54600	exon1			.	AF056188	CCDS2505.1	2q37	2010-03-05	2005-07-20		ENSG00000241119	ENSG00000241119		"""UDP glucuronosyltransferases"""	12541	other	complex locus constituent		606434	"""UDP glycosyltransferase 1 family, polypeptide A9"""			9295054, 1910331	Standard	NM_021027		Approved	HLUGP4, LUGP4, UGT1AI		O60656	OTTHUMG00000059124	ENST00000354728.4:c.248dupT	2.37:g.234580828_234580828dupT	ENSP00000346768:p.Leu83fs	Somatic	99	0		WXS	Illumina HiSeq	Phase_I	217	69	NM_021027	0	0	0	0	0	B8K285|P36509|Q9HAX0	Frame_Shift_Ins	INS	ENST00000354728.4	37	CCDS2505.1																																																																																			.		0.446	UGT1A9-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130995.1	NM_021027	
AQP3	360	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	33443353	33443354	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr9:33443353_33443354insA	ENST00000297991.4	-	3	418_419	c.338_339insT	c.(337-339)ttcfs	p.F113fs	AQP3_ENST00000493581.1_5'UTR	NM_004925.4	NP_004916.1	Q92482	AQP3_HUMAN	aquaporin 3 (Gill blood group)	113					excretion (GO:0007588)|odontogenesis (GO:0042476)|positive regulation of immune system process (GO:0002684)|regulation of keratinocyte differentiation (GO:0045616)|renal water absorption (GO:0070295)|response to calcium ion (GO:0051592)|response to retinoic acid (GO:0032526)|response to vitamin D (GO:0033280)|transmembrane transport (GO:0055085)|transport (GO:0006810)|urea transport (GO:0015840)|water transport (GO:0006833)	basolateral plasma membrane (GO:0016323)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|transporter activity (GO:0005215)|water channel activity (GO:0015250)			endometrium(2)|large_intestine(3)|lung(2)|ovary(1)	8			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.0899)		CAGCACCCAAGAAGGCTCCCAG	0.589																																					p.F113fs		.											.	AQP3-90	0			c.339_340insT						.																																			SO:0001589	frameshift_variant	360	exon3			.		CCDS6542.1	9p13	2014-07-18	2006-02-23		ENSG00000165272	ENSG00000165272		"""Ion channels / Aquaporins"", ""Blood group antigens"""	636	protein-coding gene	gene with protein product	"""Gill blood group"""	600170	"""aquaporin 3"", ""aquaporin 3 (GIL blood group)"""			7558005	Standard	NM_004925		Approved	GIL	uc003zsx.3	Q92482	OTTHUMG00000019769	ENST00000297991.4:c.339dupT	9.37:g.33443355_33443355dupA	ENSP00000297991:p.Phe113fs	Somatic	108	0		WXS	Illumina HiSeq	Phase_I	148	49	NM_004925	0	0	0	0	0	A8K843|B2RE16|D3DRL3|O00108|Q6FGT2|Q6FGW6	Frame_Shift_Ins	INS	ENST00000297991.4	37	CCDS6542.1																																																																																			.		0.589	AQP3-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052055.1	NM_004925	
VSTM2B	342865	hgsc.bcm.edu;broad.mit.edu	37	19	30018224	30018225	+	Missense_Mutation	DNP	TC	TC	AA			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr19:30018224_30018225TC>AA	ENST00000335523.7	+	2	274_275	c.189_190TC>AA	c.(187-192)atTCag>atAAag	p.Q64K	CTC-525D6.1_ENST00000582581.1_RNA|CTC-525D6.2_ENST00000579268.1_RNA	NM_001146339.1	NP_001139811.1	A6NLU5	VTM2B_HUMAN	V-set and transmembrane domain containing 2B	64	Ig-like V-type.					integral component of membrane (GO:0016021)				breast(2)	2						CGCTGGAGATTCAGTGGTGGTA	0.653																																					p.Q64K		.											.	VSTM2B-68	0			c.C190A						.																																			SO:0001583	missense	342865	exon2			GAGATTCAGTGGT		CCDS46034.1	19q12	2013-01-11			ENSG00000187135	ENSG00000187135		"""Immunoglobulin superfamily / V-set domain containing"""	33595	protein-coding gene	gene with protein product							Standard	NM_001146339		Approved		uc010xrl.1	A6NLU5		Exception_encountered	19.37:g.30018224_30018225delinsAA	ENSP00000335038:p.Gln64Lys	Somatic	15.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	16.0	NM_001146339	0	0	0	0	0		Missense_Mutation	DNP	ENST00000335523.7	37	CCDS46034.1																																																																																			.		0.653	VSTM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458601.1	NM_001146339	
CR1L	1379	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	207881585	207881586	+	Missense_Mutation	DNP	GC	GC	TG			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr1:207881585_207881586GC>TG	ENST00000508064.2	+	10	1451_1452	c.1391_1392GC>TG	c.(1390-1392)aGC>aTG	p.S464M	CR1L_ENST00000530905.1_Intron	NM_175710.1	NP_783641.1	Q2VPA4	CR1L_HUMAN	complement component (3b/4b) receptor 1-like	464	Sushi 7. {ECO:0000255|PROSITE- ProRule:PRU00302}.					cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|receptor complex (GO:0043235)				endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						GCCCATTGGAGCATGAAGCCAC	0.426																																					p.S464M		.											.	CR1L-46	0			c.C1392G						.																																			SO:0001583	missense	1379	exon10			TTGGAGCATGAAG	AY114160	CCDS44310.1	1q32.1	2008-02-05			ENSG00000197721	ENSG00000197721		"""Complement system"""	2335	protein-coding gene	gene with protein product		605886				2295627	Standard	NM_175710		Approved		uc001hga.4	Q2VPA4	OTTHUMG00000036354	Exception_encountered	1.37:g.207881585_207881586delinsTG	ENSP00000421736:p.Ser464Met	Somatic	147.0	0.0		WXS	Illumina HiSeq	Phase_I	267.0	72.0	NM_175710	0	0	0	0	0	Q32MC9|Q8NEU7	Missense_Mutation	DNP	ENST00000508064.2	37	CCDS44310.1																																																																																			.		0.426	CR1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390247.1	XM_114735	
KLHL18	23276	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	47374712	47374713	+	Missense_Mutation	DNP	GC	GC	TA			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr3:47374712_47374713GC>TA	ENST00000232766.5	+	5	686_687	c.666_667GC>TA	c.(664-669)gaGCtg>gaTAtg	p.222_223EL>DM	KLHL18_ENST00000455924.2_Missense_Mutation_p.110_111EL>DM	NM_025010.4	NP_079286.2	O94889	KLH18_HUMAN	kelch-like family member 18	222	BACK.									endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	21		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00645)|Kidney(197;0.00741)		ACCTGCCTGAGCTGCTGTCCAA	0.569																																					p.EL222DM		.											.	KLHL18-90	0			c.C667A						.																																			SO:0001583	missense	23276	exon5			CCTGAGCTGCTGT	AB018338	CCDS33749.1	3p21	2013-01-30	2013-01-30		ENSG00000114648	ENSG00000114648		"""Kelch-like"", ""BTB/POZ domain containing"""	29120	protein-coding gene	gene with protein product			"""kelch-like 18 (Drosophila)"""			9872452	Standard	NM_025010		Approved	KIAA0795, FLJ13703	uc003crd.3	O94889	OTTHUMG00000156522	Exception_encountered	3.37:g.47374712_47374713delinsTA	ENSP00000232766:p.E222_L223delinsDM	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	23.0	NM_025010	0	0	0	0	0	A8K612|Q7Z3E8|Q8N125	Missense_Mutation	DNP	ENST00000232766.5	37	CCDS33749.1																																																																																			.		0.569	KLHL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344493.1	NM_025010	
HOXB9	3219	broad.mit.edu	37	17	46703276	46703277	+	Missense_Mutation	DNP	TC	TC	CT			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr17:46703276_46703277TC>CT	ENST00000311177.5	-	1	562_563	c.355_356GA>AG	c.(355-357)GAg>AGg	p.E119R	HOXB7_ENST00000567101.2_Intron|HOXB9_ENST00000550387.1_Intron|HOXB-AS4_ENST00000480386.1_RNA	NM_024017.4	NP_076922.1	P17482	HXB9_HUMAN	homeobox B9	119					anterior/posterior pattern specification (GO:0009952)|canonical Wnt signaling pathway (GO:0060070)|cell chemotaxis (GO:0060326)|embryonic skeletal system development (GO:0048706)|mammary gland development (GO:0030879)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(2)|endometrium(1)|large_intestine(1)|liver(1)|lung(6)|prostate(1)	12						CAGCAGCGGCTCCGCCTTCACC	0.728																																					p.E119R													.	HOXB9-90	0			c.G355A						.																																			SO:0001583	missense	3219	exon1			GCGGCTCCGCCTT		CCDS11534.1	17q21.32	2011-06-20	2005-12-22		ENSG00000170689	ENSG00000170689		"""Homeoboxes / ANTP class : HOXL subclass"""	5120	protein-coding gene	gene with protein product		142964	"""homeo box B9"""	HOX2E, HOX2		1973146, 1358459	Standard	NM_024017		Approved		uc002inx.3	P17482	OTTHUMG00000159907	ENST00000311177.5:c.355_356delinsCT	17.37:g.46703276_46703277delinsCT	ENSP00000309439:p.Glu119Arg	Somatic	12	0		WXS	Illumina HiSeq	Phase_I	32	8	NM_024017	0	0	0	0	0	B2RDB7|Q9H1I1	Missense_Mutation	DNP	ENST00000311177.5	37	CCDS11534.1																																																																																			.		0.728	HOXB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358101.2		
